RSK2 represses HSF1 activation during heat shock
Wang, Xiaozhe; Asea, Alexzander; Xie, Yue; Kabingu, Edith; Stevenson, Mary Ann; Calderwood, Stuart K.
2000-01-01
Heat shock transcription factor 1(HSF1) activation is a multistep process. The conversion of a latent cytoplasmic form to a nuclear, DNA binding state appears to be activated by nonsteroidal anti-inflammatory drugs. In previous studies, we showed that HSF 1 is phosphorylated by the protein kinase RSK2 in vitro and that this effect is inhibited by nonsteroidal anti-inflammatory drugs at the concentration that leads to the activation of HSF1 in vivo (Stevenson et al 1999). In the present study, using cells from a patient with Coffin-Lowry syndrome (deficient in RSK2), we demonstrate that RSK2 slightly represses activation of HSF1 in vivo at 37°C. In Coffin-Lowry syndrome cells, HSF1-HSE DNA binding activity after treatment with sodium salicylate was slightly higher than that in untreated cells, indicating that although RSK2 is involved in HSF1 regulation, it is not the unique protein kinase that suppresses HSF1-HSE binding activity at 37°C. However, heat shock treatment resulted in significantly higher HSF1-HSE binding activity in Coffin-Lowry syndrome cells as compared with normal controls, suggesting that RSK2 represses HSF1-HSE binding activity during heat shock. PMID:11189448
RSK2 represses HSF1 activation during heat shock.
Wang, X; Asea, A; Xie, Y; Kabingu, E; Stevenson, M A; Calderwood, S K
2000-11-01
Heat shock transcription factor 1(HSF1) activation is a multistep process. The conversion of a latent cytoplasmic form to a nuclear, DNA binding state appears to be activated by nonsteroidal anti-inflammatory drugs. In previous studies, we showed that HSF 1 is phosphorylated by the protein kinase RSK2 in vitro and that this effect is inhibited by nonsteroidal anti-inflammatory drugs at the concentration that leads to the activation of HSF1 in vivo (Stevenson et al 1999). In the present study, using cells from a patient with Coffin-Lowry syndrome (deficient in RSK2), we demonstrate that RSK2 slightly represses activation of HSF1 in vivo at 37 degrees C. In Coffin-Lowry syndrome cells, HSF1-HSE DNA binding activity after treatment with sodium salicylate was slightly higher than that in untreated cells, indicating that although RSK2 is involved in HSF1 regulation, it is not the unique protein kinase that suppresses HSF1-HSE binding activity at 37 degrees C. However, heat shock treatment resulted in significantly higher HSF1-HSE binding activity in Coffin-Lowry syndrome cells as compared with normal controls, suggesting that RSK2 represses HSF1-HSE binding activity during heat shock.
Otto, Robert B.D.; Burkin, Karena; Amir, Saba Erum; Crane, Dennis T.; Bolgiano, Barbara
2015-01-01
The basis of Haemophilus influenzae type b (Hib) and Neisseria meningitidis serogroup C (MenC) glycoconjugates binding to aluminum-containing adjuvants was studied. By measuring the amount of polysaccharide and protein in the non-adsorbed supernatant, the adjuvant, aluminum phosphate, AlPO4, was found to be less efficient than aluminum hydroxide, Al(OH)3 at binding to the conjugates, at concentrations relevant to licensed vaccine formulations and when equimolar. At neutral pH, binding of TT conjugates to AlPO4 was facilitated through the carrier protein, with only weak binding of AlPO4 to CRM197 being observed. There was slightly higher binding of either adjuvant to tetanus toxoid conjugates, than to CRM197 conjugates. This was verified in AlPO4 formulations containing DTwP–Hib, where the adsorption of TT-conjugated Hib was higher than CRM197-conjugated Hib. At neutral pH, the anionic Hib and MenC polysaccharides did not appreciably bind to AlPO4, but did bind to Al(OH)3, due to electrostatic interactions. Phosphate ions reduced the binding of the conjugates to the adjuvants. These patterns of adjuvant adsorption can form the basis for future formulation studies with individual and combination vaccines containing saccharide-protein conjugates. PMID:26194164
Phenanthrene binding by humic acid-protein complexes as studied by passive dosing technique.
Zhao, Jian; Wang, Zhenyu; Ghosh, Saikat; Xing, Baoshan
2014-01-01
This work investigated the binding behavior of phenanthrene by humic acids (HA-2 and HA-5), proteins (bovine serum albumin (BSA)), lysozyme and pepsin), and their complexes using a passive dosing technique. All sorption isotherms were fitted well with Freundlich model and the binding capability followed an order of HA-5 > HA-2 > BSA > pepsin > lysozyme. In NaCl solution, phenanthrene binding to HA-BSA complexes was much higher than the sum of binding to individual HA and BSA, while there was no enhancement for HA-pepsin. Positively charged lysozyme slightly lowered phenanthrene binding on both HAs due to strong aggregation of HA-lysozyme complexes, leading to reduction in the number of binding sites. The binding enhancement by HA-BSA was observed under all tested ion species and ionic strengths. This enhancement can be explained by unfolding of protein, reduction of aggregate size and formation of HA-BSA complexes with favorable conformations for binding phenanthrene. Copyright © 2013 Elsevier Ltd. All rights reserved.
Wen, Cheng; Ye, Anpei
2013-01-01
BRaf (B- Rapid Accelerated Fibrosarcoma) protein is an important serine/threonine-protein kinase. Two domains on BRaf can independently bind its upstream kinase, Ras (Rat Sarcoma) protein. These are the Ras binding domain (RBD) and cysteine-rich-domain (CRD). Herein we use customized optical tweezers to compare the Ras binding process in two pathological mutants of BRaf responsible for CFC syndrome, abbreviated BRaf (A246P) and BRaf (Q257R). The two mutants differ in their kinetics of Ras-binding, though both bind Ras with similar increased overall affinity. BRaf (A246P) exhibits a slightly higher Ras/CRD unbinding force and a significantly higher Ras/RBD unbinding force versus the wild type. The contrary phenomenon is observed in the Q257R mutation. Simulations of the unstressed-off rate, koff(0), yield results in accordance with the changes revealed by the mean unbinding force. Our approach can be applied to rapidly assess other mutated proteins to deduce the effects of mutation on their kinetics compared to wild type proteins and to each other. PMID:24409384
DOE Office of Scientific and Technical Information (OSTI.GOV)
Alam, S.Q.; Ren, Y.F.; Alam, B.S.
1987-05-01
The purpose of the present investigation was to determine if dietary lipids can induce changes in the adenylate cyclase system in rat heart. Three groups of male young Sprague-Dawley rats were fed for 6 weeks diets containing 10% corn oil (I), 8% coconut oil + 2% corn oil (II) or 10% menhaden oil (III). Adenylate cyclase activity (basal, fluoride-, isoproterenol-, and forskolin-stimulated) was higher in heart homogenates of rats in group III than in the other two groups. Concentration of the (/sup 3/H)-forskolin binding sites in the cardiac membranes were significantly higher in rats fed menhaden oil. The values (pmol/mgmore » protein) were 4.8 +/- 0.2 (I), 4.5 +/- 0.7 (II) and 8.4 +/- 0.5 (III). There was no significant difference in the affinity of the forskolin binding sites among the 3 dietary groups. When measured at different concentrations of forskolin, the adenylate cyclase activity in cardiac membranes of rats fed menhaden oil was higher than in the other 2 groups. Concentrations of the (/sup 3/H)DHA binding sites were slightly higher but their affinity was lower in cardiac membranes of rats fed menhaden oil. The results suggest that diets containing fish oil increase the concentration of the forskolin binding sites and may also affect the characteristics of the ..beta..-adrenergic receptor in rat heart.« less
Otto, Robert B D; Burkin, Karena; Amir, Saba Erum; Crane, Dennis T; Bolgiano, Barbara
2015-09-01
The basis of Haemophilus influenzae type b (Hib) and Neisseria meningitidis serogroup C (MenC) glycoconjugates binding to aluminum-containing adjuvants was studied. By measuring the amount of polysaccharide and protein in the non-adsorbed supernatant, the adjuvant, aluminum phosphate, AlPO4, was found to be less efficient than aluminum hydroxide, Al(OH)3 at binding to the conjugates, at concentrations relevant to licensed vaccine formulations and when equimolar. At neutral pH, binding of TT conjugates to AlPO4 was facilitated through the carrier protein, with only weak binding of AlPO4 to CRM197 being observed. There was slightly higher binding of either adjuvant to tetanus toxoid conjugates, than to CRM197 conjugates. This was verified in AlPO4 formulations containing DTwP-Hib, where the adsorption of TT-conjugated Hib was higher than CRM197-conjugated Hib. At neutral pH, the anionic Hib and MenC polysaccharides did not appreciably bind to AlPO4, but did bind to Al(OH)3, due to electrostatic interactions. Phosphate ions reduced the binding of the conjugates to the adjuvants. These patterns of adjuvant adsorption can form the basis for future formulation studies with individual and combination vaccines containing saccharide-protein conjugates. Crown Copyright © 2015. Published by Elsevier Ltd. All rights reserved.
Anema, Skelte G; de Kruif, C G Kees
2013-07-24
Casein micelles with bound lactoferrin or lysozyme were fractionated into sizes ranging in radius from ∼50 to 100 nm. The κ-casein content decreased markedly and the αS-casein/β-casein content increased slightly as micelle size increased. For lactoferrin, higher levels were bound to smaller micelles. The lactoferrin/κ-casein ratio was constant for all micelle sizes, whereas the lactoferrin/αS-casein and lactoferrin/β-casein ratio decreased with increasing micelle size. This indicates that the lactoferrin was binding to the surface of the casein micelles. For lysozyme, higher levels bound to larger casein micelles. The lysozyme/αS-casein and lysozyme/β-casein ratios were nearly constant, whereas the lysozyme/κ-casein ratio increased with increasing micelle size, indicating that lysozyme bound to αS-casein and β-casein in the micelle core. Lactoferrin is a large protein that cannot enter the casein protein mesh; therefore, it binds to the micelle surface. The smaller lysozyme can enter the protein mesh and therefore binds to the more charged αS-casein and β-casein.
[Determination of plasma protein binding rate of arctiin and arctigenin with ultrafiltration].
Han, Xue-Ying; Wang, Wei; Tan, Ri-Qiu; Dou, De-Qiang
2013-02-01
To determine the plasma protein binding rate of arctiin and arctigenin. The ultrafiltration combined with HPLC was employed to determine the plasma protein binding rate of arctiin and arctigenin as well as rat plasma and healthy human plasma proteins. The plasma protein binding rate of arctiin with rat plasma at the concentrations of 64. 29, 32.14, 16.07 mg x L(-1) were (71.2 +/- 2.0)%, (73.4 +/- 0.61)%, (78.2 +/- 1.9)%, respectively; while the plasma protein binding rate of arctiin with healthy human plasma at the above concentrations were (64.8 +/- 3.1)%, (64.5 +/- 2.5)%, (77.5 +/- 1.7)%, respectively. The plasma protein binding rate of arctigenin with rat plasma at the concentrations of 77.42, 38.71, 19.36 mg x L(-1) were (96.7 +/- 0.41)%, (96.8 +/- 1.6)%, (97.3 +/- 0.46)%, respectively; while the plasma protein binding rate of arctigenin with normal human plasma at the above concentrations were (94.7 +/- 3.1)%, (96.8 +/- 1.6)%, (97.9 +/- 1.3)%, respectively. The binding rate of arctiin with rat plasma protein was moderate, which is slightly higher than the binding rate of arctiin with healthy human plasma protein. The plasma protein binding rates of arctigenin with both rat plasma and healthy human plasma are very high.
Fu, Heyun; Wei, Chenhui; Qu, Xiaolei; Li, Hui; Zhu, Dongqiang
2018-01-01
Dissolved black carbon (DBC), the soluble fraction of black carbon (BC), is an important constituent of dissolved organic matter pool. However, little is known about the binding interactions between hydrophobic organic contaminants (HOCs) and DBC and their significance in the fate process. This study determined the binding ability of DBC released from rice-derived BC for a series of apolar HOCs, including four polycyclic aromatic hydrocarbons and four chlorinated benzenes, using batch sorption and solubility enhancement techniques. Bulk BC and a dissolved soil humic acid (DSHA) were included as benchmark sorbents. The organic carbon-normalized sorption coefficient of phenanthrene to DBC was slightly lower than bulk BC, but was over ten folds higher than DSHA. Consistently, DBC was more effective than DSHA in enhancing the apparent water solubility of the tested HOCs, and the enhancement positively correlated with solute n-octanol-water partition coefficient, indicating the predominance of hydrophobic partition. The much higher binding ability of DBC relative to DSHA was mainly attributed to its higher tendency to form pseudomicellar structures as supported by the fluorescence quenching and the pH-edge data. Our findings suggest that DBC might play a significant role in the environmental fate and transport of HOCs as both sorbent and carrier. Copyright © 2017 Elsevier Ltd. All rights reserved.
Zgliczyński, J M; Stelmaszyńska, T; Olszowska, E; Krawczyk, A; Kwasnowska, E; Wróbel, J T
1983-01-01
It was found that all halides can compete with cyanide for binding with myeloperoxidase. The lower is the pH, the higher is the affinity of halides. The apparent dissociation constants (Kd) of myeloperoxidase-cyanide complex were determined in the presence of F-, Cl-, Br- and I- in the pH range of 4 to 7. In slightly acidic pH (4 - 6) fluoride and chloride exhibit a higher affinity towards the enzyme than bromide and iodide. Taking into account competition between cyanide and halides for binding with myeloperoxidase the dissociation constants of halide-myeloperoxidase complexes were calculated. All halides except fluoride can be oxidized by H2O2 in the presence of myeloperoxidase. However, since fluoride can bind with myeloperoxidase, it can competitively inhibit the oxidation of other halides. Fluoride was a competitive inhibitor with respect to other halides as well as to H2O2. Inhibition constants (Ki) for fluoride as a competitive inhibitor with respect to H2O2 increased from iodide oxidation through bromide to chloride oxidation.
Serradeil-Le Gal, C; Raufaste, D; Marty, E; Garcia, C; Maffrand, J P; Le Fur, G
1994-02-28
The new potent and selective nonpeptide vasopressin V1a antagonist, SR 49059, was tritiated and used for the characterization of rat and human liver AVP V1a receptors. Binding of [3H] SR 49059 was time-dependent, reversible and saturable. A single class of high affinity binding sites was identified with Kd values of 0.63 +/- 0.13 and 2.95 +/- 0.64 nM, in rat and human liver membranes, respectively. The maximal binding capacity (Bmax) was about 7 times higher in rat than in human liver preparations. The relative potencies of several AVP/oxytocin agonists or antagonists to inhibit [3H] SR 49059 binding confirmed that this ligand labeled a homogeneous population of sites with the expected AVP V1a profile. Furthermore, [3H] SR 49059 or unlabeled SR 49059 displayed only slight species differences between rat and human V1a receptors, whereas OPC-21268, another nonpeptide V1a antagonist, exhibited a high species-related potency with more than 500 fold higher affinity for rat than for human liver V1a receptors. Thus, [3H] SR 49059 is the first nonpeptide AVP V1a ligand reported having highly specific activity, stability, specificity and affinity. This makes it a suitable probe for labeling AVP V1a receptors in rat and also in human tissues.
Tsuchiya, N; Endo, T; Matsuta, K; Yoshinoya, S; Takeuchi, F; Nagano, Y; Shiota, M; Furukawa, K; Kochibe, N; Ito, K
1993-07-15
Although the galactose deficiency in the Asn297-linked sugar chains of serum IgG from patients with rheumatoid arthritis (RA) has been established, structural analysis of sugar chains has not been readily available. Psathyrella velutina lectin (PVL) preferentially interacts with the N-acetylglucosamine beta 1-->2Man group, exposed at the termini of sugar chains in agalacto IgG. Biotinylated PVL reacted strongly in Western blotting with H chains of IgG derived from patients with RA. An ELISA-based assay for the detection of agalacto IgG was developed using recombinant protein G and biotinylated PVL in combination, and the screening of patients' sera was performed. PVL binding of serum IgG significantly correlated with percentage of galactose-deficient IgG determined by the structural analysis. Age-related slight increase in PVL binding was observed among normal controls. Patients with RA showed significantly higher PVL binding (37.90 +/- 42.25 U/ml, n = 93) as compared with normal controls (5.75 +/- 2.92 U/ml, n = 112) (p = 0.0001). Patients with SLE showed lower but still significant PVL binding (17.86 +/- 5.18 U/ml, n = 10, p = 0.0001). PVL binding correlated with C-reactive protein level in serial analysis of individual RA patients, and was significantly higher in the synovial fluid compared with paired serum samples. PVL binding assay may provide an ideal tool for the simple and sensitive detection of agalacto IgG.
Assessment of the nickel-albumin binding assay for diagnosis of acute coronary syndrome.
da Silva, Sandra Huber; Pereira, Renata da Silva; Hausen, Bruna dos Santos; Signor, Cristiane; Gomes, Patrícia; de Campos, Marli Matiko Anraku; Moresco, Rafael Noal
2011-03-01
Myocardial ischemia may alter the metal binding capacity of circulating serum albumin. Thus, the aim of this study was to describe an automated method to measure ischemia-induced alterations in the binding capacity of serum albumin for exogenous nickel, and to evaluate the diagnostic characteristics of this assay for the assessment of acute coronary syndrome (ACS) in patients presenting to the emergency room (ER) with acute chest pain. We assessed the concentrations of cardiac troponin I (cTnI), serum albumin, ischemia-modified albumin (IMA) measured by the cobalt-albumin binding assay (CABA), and by an automated nickel-albumin binding assay (NABA) in the following groups: ACS (n=63) and non-ischemic chest pain (NICP, n=26). Biochemical markers were determined in blood samples obtained from patients within 3 h of ER admission. cTnI, CABA and NABA concentrations were higher in ACS group in comparison to the NICP group. A significant correlation between NABA and CABA was observed (r=0.5387, p<0.001). Areas under the curve for CABA and NABA were 0.7289 and 0.7582, respectively. Both CABA and NABA have the ability to discriminate patients with ACS. However, NABA has a slightly higher ability to discriminate ACS compared with CABA. Patients with ACS have reduced nickel binding to human serum albumin, and NABA may have an important role as an early marker of myocardial ischemia, particularly in patients presenting to the ER with acute chest pain.
Sun, Xiangjie; Cao, Weiping; Pappas, Claudia; Liu, Feng; Katz, Jacqueline M.; Tumpey, Terrence M.
2018-01-01
The biological basis for the poor immunogenicity of unadjuvanted avian influenza A virus vaccines in mammals is not well understood. Here, we mutated the hemagglutinin (HA) of two H1N1 virus vaccines to determine whether virus receptor binding specificity contributes to the low immunogenicity of avian influenza virus vaccines. Mutations were introduced into the HA of an avian influenza virus, A/Duck/New York/15024–21/96 (Dk/96) which switched the binding preference from α2,3- to α2,6-linked sialic acid (SA). A switch in receptor specificity of the human A/South Carolina/1/18 (SC/18) virus generated a mutant virus with α2,3 SA (avian) binding preference. Inactivated vaccines were generated and administered to mice and ferrets intramuscularly. We found that the vaccines with human receptor binding preference induced slightly higher antibody titers and cell-mediated immune responses compared to their isogenic viruses with avian receptor binding specificity. Upon challenge with DK/96 or SC18 virus, differences in lung virus titers between the vaccine groups with different receptor-binding specificities were minimal. Overall, our data suggest that receptor binding specificity contributes only marginally to the immunogenicity of avian influenza vaccines and that other factors may also be involved. PMID:25078114
NASA Astrophysics Data System (ADS)
Bhakat, Soumendranath; Söderhjelm, Pär
2017-01-01
The funnel metadynamics method enables rigorous calculation of the potential of mean force along an arbitrary binding path and thereby evaluation of the absolute binding free energy. A problem of such physical paths is that the mechanism characterizing the binding process is not always obvious. In particular, it might involve reorganization of the solvent in the binding site, which is not easily captured with a few geometrically defined collective variables that can be used for biasing. In this paper, we propose and test a simple method to resolve this trapped-water problem by dividing the process into an artificial host-desolvation step and an actual binding step. We show that, under certain circumstances, the contribution from the desolvation step can be calculated without introducing further statistical errors. We apply the method to the problem of predicting host-guest binding free energies in the SAMPL5 blind challenge, using two octa-acid hosts and six guest molecules. For one of the hosts, well-converged results are obtained and the prediction of relative binding free energies is the best among all the SAMPL5 submissions. For the other host, which has a narrower binding pocket, the statistical uncertainties are slightly higher; longer simulations would therefore be needed to obtain conclusive results.
Takahashi, Kenji; Ohta, Masaru; Shoji, Yoshimichi; Kasai, Masayasu; Kunishiro, Kazuyoshi; Miike, Tomohiro; Kanda, Mamoru; Shirahase, Hiroaki
2010-08-01
To find a novel acyl-CoA: cholesterol acyltransferase inhibitor, a series of sulfamide derivatives were synthesized and evaluated. Compound 1d, in which carboxymethyl moiety at the 5-position of Pactimibe was replaced by a sulfamoylamino group, showed 150-fold more potent anti-foam cell formation activity (IC(50): 0.02 microM), 1.6-fold higher log D(7.0) (4.63), and a slightly lower protein binding ratio (93.2%) than Pactimibe. Compound 1i, in which the octyl chain at the 1-position in 1d was replaced by an ethoxyethyl, showed markedly low log D(7.0) (1.73) and maintained 3-fold higher anti-foam cell formation activity (IC(50): 1.0 microM), than Pactimibe. The plasma protein binding ratio (PBR) of 1i was much lower than that of Pactimibe (62.5% vs. 98.1%), and its partition ratio to the rabbit atherosclerotic aorta after oral administration was higher than that of Pactimibe. Compound 1i at 10 microM markedly inhibited cholesterol esterification in atherosclerotic rabbit aortas even when incubated with serum, while Pactimibe had little effect probably due to its high PBR. In conclusion, compound 1i is expected to more efficiently inhibit the progression of atherosclerosis than Pactimibe.
Study Of The Specificity Of Xanthene Dye Binding To Mitochondria
NASA Astrophysics Data System (ADS)
Bunting, James R.; Kamali, Eleanor; Phan, Trung V.; Dowben, Robert M.; Matthews, J. Lester
1989-03-01
The binding of Rhodamine 123 (Rh123), Rhodamine 6G (R6G), and Rhodamine B (RhB) (from the cationic xanthene series) to isolated rat liver mitochondria maintained in State IV respiration in the presence of rotenone (NADH oxidase inhibitor) was monitored by following changes in the fluorescence signal of the dyes. Rh123 and Rh6G bind strongly with quenching, to 0.25 and 0.20, respectively, and red shift of emission maxima by 10 nm. RhB binds much less potently with slight emission enhancement of 1.2. For Rh123 added to 0.5 mg/ml mitochondria' protein, a sigmoidal relationship is obtained between percentage fluorescence quenching and log of Rh123 concentration with a 50% inflection point of 3.5x10-6M, estimating an apparent association constant of 2.9x 105M-1 for Rh123 binding. Addition of 7 uM RhB during Rh123 titration moves the sigmoidal inflection point to higher Rh123 concentrations, suggesting either RhB enhancement of binding of Rh123 fluorescence quenching by energy transfer to RhB bound. These results suggest that, to a great degree, the binding of the xanthene dyes to mitochondrial sites is specific, competitive, and probably cooperative.
Hanovice-Ziony, Michal; Gollop, Nathan; Landau, Serge Yan; Ungar, Eugene David; Muklada, Hussein; Glasser, Tzach Aharon; Perevolotsky, Avi; Walker, John Withers
2010-07-01
We investigated whether Mediterranean goats use salivary tannin-binding proteins to cope with tannin-rich forages by determining the affinity of salivary or parotid gland proteins for tannic acid or quebracho tannin. Mixed saliva, sampled from the oral cavity, or parotid gland contents were compared to the intermediate affinity protein bovine serum albumin with a competitive binding assay. Goats that consume tannin-rich browse (Damascus) and goats that tend to avoid tannins (Mamber) were sequentially fed high (Pistacia lentiscus L.), low (vetch hay), or zero (wheat hay) tannin forages. Affinity of salivary proteins for tannins did not differ between goat breeds and did not respond to presence or absence of tannins in the diet. Proteins in mixed saliva had slightly higher affinity for tannins than those in parotid saliva, but neither source contained proteins with higher affinity for tannins than bovine serum albumin. Similarly, 3 months of browsing in a tannin-rich environment had little effect on the affinity of salivary proteins for tannin in adult goats of either breed. We sampled mixed saliva from young kids before they consumed forage and after 3 months of foraging in a tannin-rich environment. Before foraging, the saliva of Mamber kids had higher affinity for tannic acid (but not quebracho tannin) than the saliva of Damascus kids, but there was no difference after 3 months of exposure to tannin-rich browse, and the affinity of the proteins was always similar to the affinity of bovine serum albumin. Our results suggest there is not a major role for salivary tannin-binding proteins in goats. Different tendencies of goat breeds to consume tannin-rich browse does not appear be related to differences in salivary tannin-binding proteins.
NASA Astrophysics Data System (ADS)
Yuan, Jiang-Lan; Liu, Hui; Kang, Xu; Lv, Zhong; Zou, Guo-Lin
2008-11-01
Apigenin (Ap) and genistein (Ge), a couple of isomeric flavonoids with extensive bioactivities, are the most common dietary ingredients. They have been widely investigated due to their potential therapeutic actions for some diseases. In our work, binding characteristics of Ap and Ge to hemoglobin (Hb) were analyzed with fluorescence spectroscopy, circular dichroism (CD) and UV-vis absorption spectroscopy. The results indicated that Ap and Ge caused strong fluorescence quenching of Hb by static quenching mechanism, but their quenching efficiency and mechanisms were different. The binding site n suggested that there was a single binding site in Hb for Ap and Ge. The results of synchronous fluorescence showed that the microenvironment around Tyr residues of Hb had a slight trend of polarity decreasing, but the polarity around Trp residues increased by adding Ap. Results of CD indicated that the Ap and Ge did not changed the secondary structure of Hb. According to the theory of Förster resonance energy transfer, the binding distance r between Trp 37 and Ap/Ge was predicted to be 3.4 nm and 3.32 nm, respectively. The affinity of Ge toward Hb was higher than that of Ap.
Catalytic oxidation of o-aminophenols and aromatic amines by mushroom tyrosinase.
Muñoz-Muñoz, Jose Luis; Garcia-Molina, Francisco; Garcia-Ruiz, Pedro Antonio; Varon, Ramon; Tudela, Jose; Rodriguez-Lopez, Jose N; Garcia-Canovas, Francisco
2011-12-01
The kinetics of tyrosinase acting on o-aminophenols and aromatic amines as substrates was studied. The catalytic constants of aromatic monoamines and o-diamines were both low, these results are consistent with our previous mechanism in which the slow step is the transfer of a proton by a hydroxyl to the peroxide in oxy-tyrosinase (Fenoll et al., Biochem. J. 380 (2004) 643-650). In the case of o-aminophenols, the hydroxyl group indirectly cooperates in the transfer of the proton and consequently the catalytic constants in the action of tyrosinase on these compounds are higher. In the case of aromatic monoamines, the Michaelis constants are of the same order of magnitude than for monophenols, which suggests that the monophenols bind better (higher binding constant) to the enzyme to facilitate the π-π interactions between the aromatic ring and a possible histidine of the active site. In the case of aromatic o-diamines, both the catalytic and Michaelis constants are low, the values of the catalytic constants being lower than those of the corresponding o-diphenols. The values of the Michaelis constants of the aromatic o-diamines are slightly lower than those of their corresponding o-diphenols, confirming that the aromatic o-diamines bind less well (lower binding constant) to the enzyme. Copyright © 2011 Elsevier B.V. All rights reserved.
Binding and degradation of 125I-gastrin by plasma membranes from homogenized rat gastric mucosa.
Kleveland, P M; Waldum, H L
1986-06-01
Binding of 125I-gastrin to the 270-30,000 g fraction from homogenized rat oxyntic mucosa was studied. 'Specific' binding was calculated by subtracting the binding at excess cold gastrin from the binding with labelled gastrin (250 pM) only. At 30 degrees C specific binding rose rapidly to a short-lived maximum before falling gradually, whereas at 15 degrees C and 0 degree C specific binding rose gradually to a higher plateau level. The reduced binding at 30 degrees C could be caused by degradation of either the tracer or the binding site or by a combination of these two events. Degradation of 125I-gastrin was evaluated by trichloroacetic acid (TCA) precipitation, fast protein liquid chromatography, and binding to a gastrin antibody (immunoreactivity). The effect of incubation on the binding site was evaluated by preincubation of the homogenate fraction before adding gastrin. In separate studies, the proteolytic activity of the homogenate fraction was studied by TCA precipitation of radioactive casein. Different enzyme inhibitors tested were virtually ineffective in preventing gastrin and casein degradation. Only lowering the incubation temperature to 15 degrees C or lower could prevent this degradation. The reduced and transient binding of 125I-gastrin at 30 degrees C most probably reflects tracer degradation. Accordingly, the gastrin binding experiments were performed at 15 degrees C. Only homogenates from the oxyntic area of the stomach bound 125I-gastrin specifically and with a Kd of 0.8 nM (Scatchard analysis). However, micromolar concentrations of unlabelled gastrin were required to inhibit half maximal binding of the tracer. The tracer binding was unaffected by secretin, slightly reduced by a CCK-9 analogue, and more markedly reduced by pentagastrin.
Boileau, Isabelle; Payer, Doris; Houle, Sylvain; Behzadi, Arian; Rusjan, Pablo M; Tong, Junchao; Wilkins, Diana; Selby, Peter; George, Tony P; Zack, Martin; Furukawa, Yoshiaki; McCluskey, Tina; Wilson, Alan A; Kish, Stephen J
2012-01-25
Positron emission tomography (PET) findings suggesting lower D2-type dopamine receptors and dopamine concentration in brains of stimulant users have prompted speculation that increasing dopamine signaling might help in drug treatment. However, this strategy needs to consider the possibility, based on animal and postmortem human data, that dopaminergic activity at the related D3 receptor might, in contrast, be elevated and thereby contribute to drug-taking behavior. We tested the hypothesis that D3 receptor binding is above normal in methamphetamine (MA) polydrug users, using PET and the D3-preferring ligand [11C]-(+)-propyl-hexahydro-naphtho-oxazin ([11C]-(+)-PHNO). Sixteen control subjects and 16 polydrug users reporting MA as their primary drug of abuse underwent PET scanning after [11C]-(+)-PHNO. Compared with control subjects, drug users had higher [11C]-(+)-PHNO binding in the D3-rich midbrain substantia nigra (SN; +46%; p<0.02) and in the globus pallidus (+9%; p=0.06) and ventral pallidum (+11%; p=0.1), whereas binding was slightly lower in the D2-rich dorsal striatum (approximately -4%, NS; -12% in heavy users, p=0.01) and related to drug-use severity. The [11C]-(+)-PHNO binding ratio in D3-rich SN versus D2-rich dorsal striatum was 55% higher in MA users (p=0.004), with heavy but not moderate users having ratios significantly different from controls. [11C]-(+)-PHNO binding in SN was related to self-reported "drug wanting." We conclude that the dopamine D3 receptor, unlike the D2 receptor, might be upregulated in brains of MA polydrug users, although lower dopamine levels in MA users could have contributed to the finding. Pharmacological studies are needed to establish whether normalization of D3 receptor function could reduce vulnerability to relapse in stimulant abuse.
Boileau, Isabelle; Payer, Doris; Houle, Sylvain; Behzadi, Arian; Rusjan, Pablo M.; Tong, Junchao; Wilkins, Diana; Selby, Peter; George, Tony P.; Zack, Martin; Furukawa, Yoshiaki; McCluskey, Tina; Wilson, Alan A.; Kish, Stephen J.
2012-01-01
Positron emission tomography (PET) findings suggesting lower D2-type dopamine receptors and dopamine concentration in brains of stimulant users have prompted speculation that increasing dopamine signaling might help in drug-treatment. However, this strategy needs to consider the possibility, based on animal and postmortem human data, that dopaminergic activity at the related D3 receptor might, in contrast, be elevated, and thereby contribute to drug-taking behavior. We tested the hypothesis that D3 receptor binding is above-normal in methamphetamine (MA) polydrug users, using PET and the D3-preferring ligand [11C]-(+)-PHNO. Sixteen control subjects and 16 polydrug users reporting MA as their primary drug of abuse underwent PET scanning following [11C]-(+)-PHNO. Compared to control subjects, drug users had higher [11C]-(+)-PHNO binding in the D3-rich midbrain substantia nigra (SN, +46%, p<0.02) and in the globus pallidus (+9%, p=0.06) and ventral pallidum (+11%, p=0.1), whereas binding was slightly lower in the D2-rich dorsal striatum (~−4%, NS; −12% in heavy users, p=0.01) and related to drug-use severity. [11C]-(+)-PHNO binding ratio in D3-rich SN vs. D2-rich dorsal striatum was 55% higher in MA users (p=0.004), with heavy but not moderate users having ratios significantly different from controls. [11C]-(+)-PHNO binding in SN was related to self-reported “drug-wanting.” We conclude that the dopamine D3 receptor, unlike the D2 receptor, might be upregulated in brains of MA polydrug users although lower dopamine levels in MA users could have contributed to the finding. Pharmacological studies are needed to establish whether normalization of D3 receptor function could reduce vulnerability to relapse in stimulant abuse. PMID:22279219
Gifford, Stacey M; Liu, Weizhi; Mader, Christopher C; Halo, Tiffany L; Machida, Kazuya; Boggon, Titus J; Koleske, Anthony J
2014-07-11
The closely related Abl family kinases, Arg and Abl, play important non-redundant roles in the regulation of cell morphogenesis and motility. Despite similar N-terminal sequences, Arg and Abl interact with different substrates and binding partners with varying affinities. This selectivity may be due to slight differences in amino acid sequence leading to differential interactions with target proteins. We report that the Arg Src homology (SH) 2 domain binds two specific phosphotyrosines on cortactin, a known Abl/Arg substrate, with over 10-fold higher affinity than the Abl SH2 domain. We show that this significant affinity difference is due to the substitution of arginine 161 and serine 187 in Abl to leucine 207 and threonine 233 in Arg, respectively. We constructed Abl SH2 domains with R161L and S187T mutations alone and in combination and find that these substitutions are sufficient to convert the low affinity Abl SH2 domain to a higher affinity "Arg-like" SH2 domain in binding to a phospho-cortactin peptide. We crystallized the Arg SH2 domain for structural comparison to existing crystal structures of the Abl SH2 domain. We show that these two residues are important determinants of Arg and Abl SH2 domain binding specificity. Finally, we expressed Arg containing an "Abl-like" low affinity mutant Arg SH2 domain (L207R/T233S) and find that this mutant, although properly localized to the cell periphery, does not support wild type levels of cell edge protrusion. Together, these observations indicate that these two amino acid positions confer different binding affinities and cellular functions on the distinct Abl family kinases. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
Arias, Hugo R.; Rosenberg, Avraham; Targowska-Duda, Katarzyna M.; Feuerbach, Dominik; Yuan, Xiao Juan; Jozwiak, Krzysztof; Moaddel, Ruin; Wainer, Irving W.
2015-01-01
The interaction of ibogaine and phencyclidine (PCP) with human (h) α3β4-nicotinic acetylcholine receptors (AChRs) in different conformational states was determined by functional and structural approaches including, radioligand binding assays, Ca2+ influx detections, and thermodynamic and kinetics measurements. The results established that (a) ibogaine inhibits (±)-epibatidine-induced Ca2+ influx in hα3β4 AChRs with ~9-fold higher potency than that for PCP, (b) [3H]ibogaine binds to a single site in the hα3β4 AChR ion channel with relatively high affinity (Kd = 0.46 ± 0.06 µM), and ibogaine inhibits [3H]ibogaine binding to the desensitized hα3β4 AChR with slightly higher affinity compared to the resting AChR. This is explained by a slower dissociation rate from the desensitized ion channel compared to the resting ion channel, and (c) PCP inhibits [3H]ibogaine binding to the hα3β4 AChR, suggesting overlapping sites. The experimental results correlate with the docking simulations suggesting that ibogaine and PCP interact with a binding domain located between the serine (position 6′) and valine/phenylalanine (position 13′) rings. This interaction is mediated mainly by van der Waals contacts, which is in agreement with the observed enthalpic contribution determined by non-linear chromatography. However, the calculated entropic contribution also indicates local conformational changes. Collectively our data suggest that ibogaine and PCP bind to overlapping sites located between the serine and valine/phenylalanine rings, to finally block the AChR ion channel, and in the case of ibogaine, to probably maintain the AChR in the desensitized state for longer time. PMID:20684041
Arias, Hugo R; Rosenberg, Avraham; Targowska-Duda, Katarzyna M; Feuerbach, Dominik; Yuan, Xiao Juan; Jozwiak, Krzysztof; Moaddel, Ruin; Wainer, Irving W
2010-09-01
The interaction of ibogaine and phencyclidine (PCP) with human (h) alpha3beta4-nicotinic acetylcholine receptors (AChRs) in different conformational states was determined by functional and structural approaches including, radioligand binding assays, Ca2+ influx detections, and thermodynamic and kinetics measurements. The results established that (a) ibogaine inhibits (+/-)-epibatidine-induced Ca2+ influx in h(alpha)3beta4 AChRs with approximately 9-fold higher potency than that for PCP, (b) [3H]ibogaine binds to a single site in the h(alpha)3beta4 AChR ion channel with relatively high affinity (Kd = 0.46 +/- 0.06 microM), and ibogaine inhibits [3H]ibogaine binding to the desensitized h(alpha)3beta4 AChR with slightly higher affinity compared to the resting AChR. This is explained by a slower dissociation rate from the desensitized ion channel compared to the resting ion channel, and (c) PCP inhibits [3H]ibogaine binding to the h(alpha)3beta4 AChR, suggesting overlapping sites. The experimental results correlate with the docking simulations suggesting that ibogaine and PCP interact with a binding domain located between the serine (position 6') and valine/phenylalanine (position 13') rings. This interaction is mediated mainly by van der Waals contacts, which is in agreement with the observed enthalpic contribution determined by non-linear chromatography. However, the calculated entropic contribution also indicates local conformational changes. Collectively our data suggest that ibogaine and PCP bind to overlapping sites located between the serine and valine/phenylalanine rings, to finally block the AChR ion channel, and in the case of ibogaine, to probably maintain the AChR in the desensitized state for longer time.
Biochemistry of the tale transcription factors PREP, MEIS, and PBX in vertebrates.
Longobardi, E; Penkov, D; Mateos, D; De Florian, G; Torres, M; Blasi, Francesco
2014-01-01
TALE (three amino acids loop extension) homeodomain transcription factors are required in various steps of embryo development, in many adult physiological functions, and are involved in important pathologies. This review focuses on the PREP, MEIS, and PBX sub-families of TALE factors and aims at giving information on their biochemical properties, i.e., structure, interactors, and interaction surfaces. Members of the three sets of protein form dimers in which the common partner is PBX but they can also directly interact with other proteins forming higher-order complexes, in particular HOX. Finally, recent advances in determining the genome-wide DNA-binding sites of PREP1, MEIS1, and PBX1, and their partial correspondence with the binding sites of some HOX proteins, are reviewed. These studies have generated a few general rules that can be applied to all members of the three gene families. PREP and MEIS recognize slightly different consensus sequences: PREP prefers to bind to promoters and to have PBX as a DNA-binding partner; MEIS prefers HOX as partner, and both PREP and MEIS drive PBX to their own binding sites. This outlines the clear individuality of the PREP and MEIS proteins, the former mostly devoted to basic cellular functions, the latter more to developmental functions. Copyright © 2013 Wiley Periodicals, Inc.
Rodriguez Sanoja, R.; Morlon-Guyot, J.; Jore, J.; Pintado, J.; Juge, N.; Guyot, J. P.
2000-01-01
Two constructs derived from the α-amylase gene (amyA) of Lactobacillus amylovorus were expressed in Lactobacillus plantarum, and their expression products were purified, characterized, and compared. These products correspond to the complete (AmyA) and truncated (AmyAΔ) forms of α-amylase; AmyAΔ lacks the 66-kDa carboxyl-terminal direct-repeating-unit region. AmyA and AmyAΔ exhibit similar amylase activities towards a range of soluble substrates (amylose, amylopectin and α-cyclodextrin, and soluble starch). The specific activities of the enzymes towards soluble starch are similar, but the KM and Vmax values of AmyAΔ were slightly higher than those of AmyA, whereas the thermal stability of AmyAΔ was lower than that of AmyA. In contrast to AmyA, AmyAΔ is unable to bind to β-cyclodextrin and is only weakly active towards glycogen. More striking is the fact that AmyAΔ cannot bind or hydrolyze raw starch, demonstrating that the carboxyl-terminal repeating-unit domain of AmyA is required for raw-starch binding activity. PMID:10919790
First-principles study on stability, and growth strategies of small AlnZr (n=1-9) clusters
NASA Astrophysics Data System (ADS)
Li, Zhi; Zhou, Zhonghao; Wang, Hongbin; Li, Shengli; Zhao, Zhen
2016-09-01
The geometries, relative stability as well as growth strategies of the AlnZr (n=1-9) clusters are investigated with spin polarized density functional theory: BLYP. The results reveal that the AlnZr clusters are more likely to form the dense accumulation structures than the AlN (N=1-10) clusters. The average binding energies of AlnZr are higher than those of AlN clusters. The AlnZr (n=3, 5, and 7) clusters are more stable than others by the differences of the total binding energies. Mülliken population analysis for the AlnZr clusters shows that the electron's adsorption ability of Zr is slightly lower than that of Al except for AlZr cluster. Local peaks of the HOMO-LUMO gap curve are found at n=3, 5, and 7. The reaction energies of AlnZr are higher, which means that AlnZr clusters are easier to react with Al clusters. Zr atom preferential reacts with Al2 cluster. Local peaks of the magnetic dipole moments are found at n=2, 5, and 8.
Lorentzen, Marit Sjo; Moe, Elin; Jouve, Hélène Marie; Willassen, Nils Peder
2006-10-01
The gene encoding catalase from the psychrophilic marine bacterium Vibrio salmonicida LFI1238 was identified, cloned and expressed in the catalase-deficient Escherichia coli UM2. Recombinant catalase from V. salmonicida (VSC) was purified to apparent homogeneity as a tetramer with a molecular mass of 235 kDa. VSC contained 67% heme b and 25% protoporphyrin IX. VSC was able to bind NADPH, react with cyanide and form compounds I and II as other monofunctional small subunit heme catalases. Amino acid sequence alignment of VSC and catalase from the mesophilic Proteus mirabilis (PMC) revealed 71% identity. As for cold adapted enzymes in general, VSC possessed a lower temperature optimum and higher catalytic efficiency (k (cat)/K (m)) compared to PMC. VSC have higher affinity for hydrogen peroxide (apparent K (m)) at all temperatures. For VSC the turnover rate (k (cat)) is slightly lower while the catalytic efficiency is slightly higher compared to PMC over the temperature range measured, except at 4 degrees C. Moreover, the catalytic efficiency of VSC and PMC is almost temperature independent, except at 4 degrees C where PMC has a twofold lower efficiency compared to VSC. This may indicate that VSC has evolved to maintain a high efficiency at low temperatures.
NASA Astrophysics Data System (ADS)
Wilde, Ellis J.; Hughes, Adam; Blagova, Elena V.; Moroz, Olga V.; Thomas, Ross P.; Turkenburg, Johan P.; Raines, Daniel J.; Duhme-Klair, Anne-Kathrin; Wilson, Keith S.
2017-04-01
Bacteria use siderophores to mediate the transport of essential Fe(III) into the cell. In Campylobacter jejuni the periplasmic binding protein CeuE, an integral part of the Fe(III) transport system, has adapted to bind tetradentate siderophores using a His and a Tyr side chain to complete the Fe(III) coordination. A series of tetradentate siderophore mimics was synthesized in which the length of the linker between the two iron-binding catecholamide units was increased from four carbon atoms (4-LICAM4-) to five, six and eight (5-, 6-, 8-LICAM4-, respectively). Co-crystal structures with CeuE showed that the inter-planar angles between the iron-binding catecholamide units in the 5-, 6- and 8-LICAM4- structures are very similar (111°, 110° and 110°) and allow for an optimum fit into the binding pocket of CeuE, the inter-planar angle in the structure of 4-LICAM4- is significantly smaller (97°) due to restrictions imposed by the shorter linker. Accordingly, the protein-binding affinity was found to be slightly higher for 5- compared to 4-LICAM4- but decreases for 6- and 8-LICAM4-. The optimum linker length of five matches that present in natural siderophores such as enterobactin and azotochelin. Site-directed mutagenesis was used to investigate the relative importance of the Fe(III)-coordinating residues H227 and Y288.
Yu, H; Mistry, J; Nicar, M J; Khosravi, M J; Diamandis, A; van Doorn, J; Juul, A
1999-01-01
Insulin-like growth factors (IGFs) and IGF binding proteins (IGFBPs) play an important role in cell growth and differentiation. Clinical and epidemiological studies have indicated that measuring IGFs and IGFBPs in blood has potential implications in assessing growth-related abnormalities and risks of certain types of cancer. To facilitate the application, we reported a large collection of reference ranges of IGFs and IGFBPs in normal population and evaluations of these molecules in serum and plasma as well as the impact of freeze-thaw cycles on the measurement. IGF-I, IGFBP-3 andALS showed a similar pattern of change associated with age. Levels of these molecules were low at birth and increased with age through puberty. After puberty the levels declined slowly with age. Overall, IGF-I, IGFBP-3 and ALS were slightly higher in females than in males. Free IGF-I accounted for about 1% of the total IGF-I and its variation with age was similar to total IGF-I. IGF-II levels were also increased with age from birth to puberty, but became stable after puberty. There was little difference in IGF-II levels between genders. IGFBP-2 levels declined with age from birth to puberty. Levels of IGFBP-6 in contrast were increased with age. These IGF binding proteins were higher in males than in females. IGFs, IGFBP-3 and ALS were 5-10% higher in serum than in plasma. IGFBP-2 and IGFBP-6 differed substantially between serum and plasma. Freeze-thaw treatment up to five cycles had little impact on plasma levels of IGFs and IGFBP-3. Our observations suggest that levels of IGFs and their binding proteins are varied with age, gender, and types of specimen and that these variations need to be taken into consideration when IGFs and their binding proteins are utilized in clinic and research.
Kimoto, Michiko; Nakamura, Mana; Hirao, Ichiro
2016-09-06
A new technology, genetic alphabet expansion using artificial bases (unnatural bases), has created high-affinity DNA ligands (aptamers) that specifically bind to target proteins by ExSELEX (genetic alphabet Expansion for Systematic Evolution of Ligands by EXponential enrichment). We recently found that the unnatural-base DNA aptamers can be stabilized against nucleases, by introducing an extraordinarily stable, unique hairpin DNA (mini-hairpin DNA) and by reinforcing the stem region with G-C pairs. Here, to establish this aptamer generation method, we examined the stabilization of a high-affinity anti-VEGF165 unnatural-base DNA aptamer. The stabilized aptamers displayed significantly increased thermal and nuclease stabilities, and furthermore, exhibited higher affinity to the target. As compared to the well-known anti-VEGF165 RNA aptamer, pegaptanib (Macugen), our aptamers did not require calcium ions for binding to VEGF165 Biological experiments using cultured cells revealed that our stabilized aptamers efficiently inhibited the interaction between VEGF165 and its receptor, with the same or slightly higher efficiency than that of the pegaptanib RNA aptamer. The development of cost-effective and calcium ion-independent high-affinity anti-VEGF165 DNA aptamers encourages further progress in diagnostic and therapeutic applications. In addition, the stabilization process provided additional information about the key elements required for aptamer binding to VEGF165. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Pharmacokinetics and dromotropic activity of ajmaline in rats with hyperthyroidism.
Hashimoto, Y.; Yasuhara, M.; Kamiya, A.; Okumura, K.; Hori, R.
1989-01-01
1. The pharmacokinetics and the dromotropic action (increased PQ interval) of intravenously administered ajmaline (2 mg kg-1) were studied in hyperthyroid rats with sinus tachycardia. The hyperthyroidism was induced by intraperitoneal injection of 3,5,3'-triiodo-L-thyronine (0.5 mg kg-1) for 4 days. 2. The change in the ajmaline concentration in whole blood could be described by a biexponential equation. The steady state distribution volume of ajmaline decreased from 4.81 l kg-1 in control rats to 3.80 l kg-1 in hyperthyroid rats and the total body blood clearance was slightly higher in hyperthyroid rats than in control rats. 3. Ajmaline exhibited a saturable binding to rat plasma proteins, and one kind of binding site was found in the observed range of concentrations. The binding capacity was 2 fold higher in hyperthyroid rats than in control rats. 4. On the basis of the plasma unbound concentration, ajmaline exhibited an increased negative dromotropic activity in hyperthyroid rats compared with control rats. 5. A positive correlation was found between the pacing rate and the dromotropic action of ajmaline on atrioventricular conduction in isolated perfused hearts. There was no significant difference in the rate-dependence of the effect of ajmaline on the heart between control and hyperthyroid rats. 6. Our findings suggest that the increased dromotropic activity of ajmaline is mainly due to the increased heart rate in hyperthyroid rats. PMID:2924068
Wang, Qingqing; Hu, Tao; Sun, Lijing; Ji, Shaoyang; Zhao, Dawei; Liu, Jiaxin; Ma, Guanghui; Su, Zhiguo
2015-02-01
PEGylated hemoglobin (Hb) is a promising oxygen therapeutic agent for clinical application. However, it suffered from structural perturbation, functional instability and methemoglobin (metHb) formation. To improve the structural, functional, physical and anti-oxidation properties of the PEGylated Hb. PEGylation of Hb with CO binding (HbCO) was conducted using maleimide and acylation chemistry, respectively. Physical and chemical parameters were measured for Hb samples. The circular dichroism spectra, dynamic light scattering and analytical ultracentrifugation were used to investigate the structure and conformation of PEGylated HbCO. CO binding can inhibit the autoxidation of the PEGylated Hb, structurally stabilize its tetramer and improve its thermal and pH stability. Importantly, the circular dichroism spectra showed that CO binding can decrease the structural perturbation of Hb induced by PEGylation. The PEGylated HbCO with CO release showed slightly higher oxygen-delivery capacity than the PEGylated Hb. The PEGylated HbCO did not show metHb formation after 30-day storage at 4°C. CO binding structurally stabilized the PEGylated Hb, abolished its metHb formation, and significantly increased its physical stability. In particular, it also avoided the perturbation of PEG chains on the heme microenvironment. The functional property of the PEGylated HbCO can be maintained during its long-term storage, which is of great significance for field transfusion.
NASA Astrophysics Data System (ADS)
Shu, Chang; Ding, Li; Zhong, Wenying
2014-10-01
In the current work, using ZnSe ZnS quantum dots (QDs) as representative nanoparticles, the affinities of seven anticancer drugs for bovine serum albumin (BSA) were studied using fluorescence resonance energy transfer (FRET). The FRET efficiency of BSA-QD conjugates can reach as high as 24.87% by electrostatic interaction. The higher binding constant (3.63 × 107 L mol-1) and number of binding sites (1.75) between ZnSe ZnS QDs and BSA demonstrated that the QDs could easily associate to plasma proteins and enhance the transport efficacy of drugs. The magnitude of binding constants (103-106 L mol-1), in the presence of QDs, was between drugs-BSA and drugs-QDs in agreement with common affinities of drugs for serum albumins (104-106 L mol-1) in vivo. ZnSe ZnS QDs significantly increased the affinities for BSA of Vorinostat (SAHA), Docetaxel (DOC), Carmustine (BCNU), Doxorubicin (Dox) and 10-Hydroxycamptothecin (HCPT). However, they slightly reduced the affinities of Vincristine (VCR) and Methotrexate (MTX) for BSA. The recent work will not only provide useful information for appropriately understanding the binding affinity and binding mechanism at the molecular level, but also illustrate the ZnSe ZnS QDs are perfect candidates for nanoscal drug delivery system (DDS).
Okamoto, A; Lovett, M; Payan, D G; Bunnett, N W
1994-05-01
Interactions between neutral endopeptidase-24.11 (NEP) and the substance P receptor (SPR; NK1) were investigated by examining substance P (SP) degradation, SP binding and SP-induced Ca2+ mobilization in epithelial cells transfected with cDNA encoding the rat SPR and rat NEP. Expression of NEP accelerated the degradation of SP by intact epithelial cells and by membrane preparations, and degradation was reduced by the NEP inhibitor thiorphan. In cells expressing SPR alone, specific 125I-SP binding after 20 min incubation at 37 degrees C was 92.2 +/- 3.1% of maximal binding and was unaffected by thiorphan. Coexpression of NEP in the same cells as the SPR markedly reduced SP binding to 13.9 +/- 0.5% of maximal, and binding was increased to 82.7 +/- 2.4% of maximal with thiorphan. Coexpression of NEP in the same cells as the SPR also reduced to undetectable the increase in intracellular Ca2+ in response to low concentrations of SP (0.3 and 0.5 nM), and significantly reduced the response to higher concentrations (1 and 3 nM). The Ca2+ response was restored to control values by inhibition of NEP with thiorphan. In contrast, SP binding and SP-induced Ca2+ mobilization were only slightly reduced when cells expressing SPR alone were mixed with a 3- to 24-fold excess of cells expressing NEP alone. Therefore, in this system, NEP markedly down-regulates SP binding and SP-induced Ca2+ mobilization only when coexpressed in the same cells as the SPR.
Chen, Jun; Bai, Lian-Yang; Liu, Kun-Feng; Liu, Run-Qiang; Zhang, Yu-Ping
2014-01-01
Atrazine molecular imprinted polymers (MIPs) were comparatively synthesized using identical polymer formulation by far-infrared (FIR) radiation and ultraviolet (UV)-induced polymerization, respectively. Equilibrium binding experiments were carried out with the prepared MIPs; the results showed that MIPuv possessed specific binding to atrazine compared with their MIPFIR radiation counterparts. Scatchard plot’s of both MIPs indicated that the affinities of the binding sites in MIPs are heterogeneous and can be approximated by two dissociation-constants corresponding to the high-and low-affinity binding sites. Moreover, several common pesticides including atrazine, cyromazine, metamitron, simazine, ametryn, terbutryn were tested to determine their specificity, similar imprinting factor (IF) and different selectivity index (SI) for both MIPs. Physical characterization of the polymers revealed that the different polymerization methods led to slight differences in polymer structures and performance by scanning electron microscope (SEM), Fourier transform infrared absorption (FT-IR), and mercury analyzer (MA). Finally, both MIPs were used as selective sorbents for solid phase extraction (SPE) of atrazine from lake water, followed by high performance liquid chromatography (HPLC) analysis. Compared with commercial C18 SPE sorbent (86.4%–94.8%), higher recoveries of atrazine in spiked lake water were obtained in the range of 90.1%–97.1% and 94.4%–101.9%, for both MIPs, respectively. PMID:24398982
NASA Astrophysics Data System (ADS)
Kaur, Amandeep; Khan, Imran Ahmd; Banipal, Parampaul Kaur; Banipal, Tarlok Singh
2018-02-01
The current work aims to explore the thermodynamic and conformational aspects for the binding of fluoroquinolone antibacterial drug, levofloxacin (LFC), with bovine serum albumin (BSA) using calorimetric, spectroscopic (UV-visible, fluorescence, circular dichroism, and 1H NMR), dynamic light scattering (DLS) and computational methods (molecular docking). The binding of LFC with BSA at two sequential sites with higher affinity ( 103 M- 1) at the first site has been explored by calorimetry whereas the binding at a single site with affinity of the order of 104 M- 1 has been observed from fluorescence spectroscopy. The calorimetric study in the presence of additives along with docking analysis reveals the significant role of electrostatic, hydrogen bonding, and hydrophobic interactions in the association process. The slight conformational changes in protein as well as the changes in the water network structure around the binding cavity of protein have been observed from spectroscopic and DLS measurements. The LFC induced quenching of BSA fluorescence was observed to be initiated mainly through the static quenching process and this suggests the formation of ground state LFC-BSA association complex. The stronger interactions of LFC in the cavity of Sudlow site I (subdomain IIA) of protein have been explored from site marker calorimetric and molecular docking study.
Cheng, Y; Lin, H; Xue, D; Li, R; Wang, K
2001-02-14
The changes in structure and function of 2,3-diphosphoglycerate-hemoglobin (2,3-DPG-Hb) induced by Ln(3+) binding were studied by spectroscopic methods. The binding of lanthanide cations to 2,3-DPG is prior to that to Hb. Ln(3+) binding causes the hydrolysis of either one from the two phosphomonoester bonds in 2,3-DPG non-specifically. The results using the ultrafiltration method indicate that Ln(3+) binding sites for Hb can be classified into three categories: i.e. positive cooperative sites (N(I)), non-cooperative strong sites (N(S)) and non-cooperative weak sites (N(W)) with binding constants in decreasing order: K(I)>K(S)>K(W). The total number of binding sites amounts to about 65 per Hb tetramer. Information on reaction kinetics was obtained from the change of intrinsic fluorescence in Hb monitored by stopped-flow fluorometry. Fluctuation of fluorescence dependent on Ln(3+) concentration and temperature was observed and can be attributed to the successive conformational changes induced by Ln(3+) binding. The results also reveal the bidirectional changes of the oxygen affinity of Hb in the dependence on Ln(3+) concentration. At the range of [Ln(3+)]/[Hb]<2, the marked increase of oxygen affinity (P(50) decrease) with the Ln(3+) concentration can be attributed to the hydrolysis of 2,3-DPG, while the slight rebound of oxygen affinity in higher Ln(3+) concentration can be interpreted by the transition to the T-state of the Hb tetramer induced by Ln(3+) binding. This was indicated by the changes in secondary structure characterized by the decrease of alpha-helix content.
Reassessment of the Unique Mode of Binding between Angiotensin II Type 1 Receptor and Their Blockers
Matsuo, Yoshino; Saku, Keijiro; Karnik, Sadashiva S.
2013-01-01
While the molecular structures of angiotensin II (Ang II) type 1 (AT1) receptor blockers (ARBs) are very similar, they are also slightly different. Although each ARB has been shown to exhibit a unique mode of binding to AT1 receptor, different positions of the AT1 receptor have been analyzed and computational modeling has been performed using different crystal structures for the receptor as a template and different kinds of software. Therefore, we systematically analyzed the critical positions of the AT1 receptor, Tyr113, Tyr184, Lys199, His256 and Gln257 using a mutagenesis study, and subsequently performed computational modeling of the binding of ARBs to AT1 receptor using CXCR4 receptor as a new template and a single version of software. The interactions between Tyr113 in the AT1 receptor and the hydroxyl group of olmesartan, between Lys199 and carboxyl or tetrazole groups, and between His256 or Gln257 and the tetrazole group were studied. The common structure, a tetrazole group, of most ARBs similarly bind to Lys199, His256 and Gln257 of AT1 receptor. Lys199 in the AT1 receptor binds to the carboxyl group of EXP3174, candesartan and azilsartan, whereas oxygen in the amidecarbonyl group of valsartan may bind to Lys199. The benzimidazole portion of telmisartan may bind to a lipophilic pocket that includes Tyr113. On the other hand, the n-butyl group of irbesartan may bind to Tyr113. In conclusion, we confirmed that the slightly different structures of ARBs may be critical for binding to AT1 receptor and for the formation of unique modes of binding. PMID:24260317
Carbohydrate binding properties of the stinging nettle (Urtica dioica) rhizome lectin.
Shibuya, N; Goldstein, I J; Shafer, J A; Peumans, W J; Broekaert, W F
1986-08-15
The interaction of the stinging nettle rhizome lectin (UDA) with carbohydrates was studied by using the techniques of quantitative precipitation, hapten inhibition, equilibrium dialysis, and uv difference spectroscopy. The Carbohydrate binding site of UDA was determined to be complementary to an N,N',N"-triacetylchitotriose unit and proposed to consist of three subsites, each of which has a slightly different binding specificity. UDA also has a hydrophobic interacting region adjacent to the carbohydrate binding site. Equilibrium dialysis and uv difference spectroscopy revealed that UDA has two carbohydrate binding sites per molecule consisting of a single polypeptide chain. These binding sites either have intrinsically different affinities for ligand molecules, or they may display negative cooperativity toward ligand binding.
Tomić, Mirko; Vasković, Djurdjica; Tovilović, Gordana; Andrić, Deana; Penjišević, Jelena; Kostić-Rajačić, Sladjana
2011-05-01
Five groups of previously synthesized and initially screened non-substituted and 4-halogenated arylpiperazin-1-yl-ethyl-benzimidazoles were estimated for their in-vitro binding affinities at the rat D(2) , 5-HT(2A) , and α(1) -adrenergic receptors. Among all these compounds, 2-methoxyphenyl and 2-chlorophenyl piperazines demonstrate the highest affinities for the tested receptors. The effects of 4-halogenation of benzimidazoles reveal that substitution with bromine may greatly increase the affinity of the compounds for the studied receptors, while the effect of substitution with chlorine is less remarkable. Most of the tested components show 5-HT(2A)/D(2) pK(i) binding ratios slightly above or less than 1, while only 4-chloro-6-(2-{4-[3-(trifluoromethyl)phenyl]piperazin-1-yl}ethyl)-1H-benzimidazole expresses an appropriate higher binding ratio (1.14), which was indicated for atypical neuroleptics. This compound exhibits a non-cataleptic action in rats and prevents d-amphetamine-induced hyperlocomotion in mice, which suggest its atypical antipsychotic potency. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Propensity of a single-walled carbon nanotube-peptide to mimic a KK10 peptide in an HLA-TCR complex
NASA Astrophysics Data System (ADS)
Feng, Mei; Bell, David R.; Zhou, Ruhong
2017-12-01
The application of nanotechnology to improve disease diagnosis, treatment, monitoring, and prevention is the goal of nanomedicine. We report here a theoretical study of a functionalized single-walled carbon nanotube (CNT) mimic binding to a human leukocyte antigen-T cell receptor (HLA-TCR) immune complex as a first attempt of a potential nanomedicine for human immunodeficiency virus (HIV) vaccine development. The carbon nanotube was coated with three arginine residues to imitate the HIV type 1 immunodominant viral peptide KK10 (gag 263-272: KRWIILGLNK), named CNT-peptide hereafter. Through molecular dynamics simulations, we explore the CNT-peptide and KK10 binding to an important HLA-TCR complex. Our results suggest that the CNT-peptide and KK10 bind comparably to the HLA-TCR complex, but the CNT-peptide forms stronger interactions with the TCR. Desorption simulations highlight the innate flexibility of KK10 over the CNT-peptide, resulting in a slightly higher desorption energy required for KK10 over the CNT-peptide. Our findings indicate that the designed CNT-peptide mimic has favorable propensity to activate TCR pathways and should be further explored to understand therapeutic potential.
Ge, Ruiguang; Watt, Rory M.; Sun, Xuesong; Tanner, Julian A.; He, Qing-Yu; Huang, Jian-Dong; Sun, Hongzhe
2005-01-01
Hpn is a small cytoplasmic protein found in Helicobacter pylori, which binds Ni2+ ions with moderate affinity. Consisting of 60 amino acids, the protein is rich in histidine (28 residues, 46.7%), as well as glutamate, glycine and serine residues (in total 31.7%), and contains short repeating motifs. In the present study, we report the detailed biophysical characterization of the multimeric status and Ni2+-binding properties of purified recombinant Hpn under physiologically relevant conditions. The protein exists as an equilibration of multimeric forms in solution, with 20-mers (approx. 136 kDa) being the predominant species. Using equilibrium dialysis, ICP-MS (inductively coupled plasma MS) and UV/visible spectroscopy, Hpn was found to bind five Ni2+ ions per monomer at pH 7.4, with a dissociation constant (Kd) of 7.1 μM. Importantly, Ni2+ binding to Hpn is reversible: metal is released either in the presence of a chelating ligand such as EDTA, or at a slightly acidic pH (pH for half dissociation, pH1/2 ∼6.3). Ni2+ binding induces conformational changes within the protein, increasing β-sheet and reducing α-helical content, from 22% to 37%, and 20% to 10% respectively. Growth curves of Escherichia coli BL21(DE3) both with and without the hpn gene performed under Ni2+ pressure clearly implied a role for Hpn to protect the cells from higher concentrations of external metal ions. Similarly, the accumulation of Ni2+ in these cells expressing Hpn from a plasmid was approx. 4-fold higher than in uninduced controls or control cultures that lacked the plasmid. Similarly, levels of Ni2+ in wild-type H. pylori 26695 cells were higher than those in H. pylori hpn-deletion mutant strains. Hpn may potentially serve multiple roles inside the bacterium: storage of Ni2+ ions in a ‘reservoir’; donation of Ni2+ to other proteins; and detoxification via sequestration of excess Ni2+. PMID:16164421
Xu, Chun-Ping; Boks, Niels P.; de Vries, Joop; Kaper, Hans J.; Norde, Willem; Busscher, Henk J.; van der Mei, Henny C.
2008-01-01
Adhesion and residence-time-dependent desorption of two Staphylococcus aureus strains with and without fibronectin (Fn) binding proteins (FnBPs) on Fn-coated glass were compared under flow conditions. To obtain a better understanding of the role of Fn-FnBP binding, the adsorption enthalpies of Fn with staphylococcal cell surfaces were determined using isothermal titration calorimetry (ITC). Interaction forces between staphylococci and Fn coatings were measured using atomic force microscopy (AFM). The strain with FnBPs adhered faster and initially stronger to an Fn coating than the strain without FnBPs, and its Fn adsorption enthalpies were higher. The initial desorption was high for both strains but decreased substantially within 2 s. These time scales of staphylococcal bond ageing were confirmed by AFM adhesion force measurement. After exposure of either Fn coating or staphylococcal cell surfaces to bovine serum albumin (BSA), the adhesion of both strains to Fn coatings was reduced, suggesting that BSA suppresses not only nonspecific but also specific Fn-FnBP interactions. Adhesion forces and adsorption enthalpies were only slightly affected by BSA adsorption. This implies that under the mild contact conditions of convective diffusion in a flow chamber, adsorbed BSA prevents specific interactions but does allow forced Fn-FnBP binding during AFM or stirring in ITC. The bond strength energies calculated from retraction force-distance curves from AFM were orders of magnitude higher than those calculated from desorption data, confirming that a penetrating Fn-coated AFM tip probes multiple adhesins in the outermost cell surface that remain hidden during mild landing of an organism on an Fn-coated substratum, like that during convective diffusional flow. PMID:18952882
Lee, Donald W.; Hsu, Hung-Lun; Bacon, Kaitlyn B.; Daniel, Susan
2016-01-01
With the development of single-particle tracking (SPT) microscopy and host membrane mimics called supported lipid bilayers (SLBs), stochastic virus-membrane binding interactions can be studied in depth while maintaining control over host receptor type and concentration. However, several experimental design challenges and quantitative image analysis limitations prevent the widespread use of this approach. One main challenge of SPT studies is the low signal-to-noise ratio of SPT videos, which is sometimes inevitable due to small particle sizes, low quantum yield of fluorescent dyes, and photobleaching. These situations could render current particle tracking software to yield biased binding kinetic data caused by intermittent tracking error. Hence, we developed an effective image restoration algorithm for SPT applications called STAWASP that reveals particles with a signal-to-noise ratio of 2.2 while preserving particle features. We tested our improvements to the SPT binding assay experiment and imaging procedures by monitoring X31 influenza virus binding to α2,3 sialic acid glycolipids. Our interests lie in how slight changes to the peripheral oligosaccharide structures can affect the binding rate and residence times of viruses. We were able to detect viruses binding weakly to a glycolipid called GM3, which was undetected via assays such as surface plasmon resonance. The binding rate was around 28 folds higher when the virus bound to a different glycolipid called GD1a, which has a sialic acid group extending further away from the bilayer surface than GM3. The improved imaging allowed us to obtain binding residence time distributions that reflect an adhesion-strengthening mechanism via multivalent bonds. We empirically fitted these distributions using a time-dependent unbinding rate parameter, koff, which diverges from standard treatment of koff as a constant. We further explain how to convert these models to fit ensemble-averaged binding data obtained by assays such as surface plasmon resonance. PMID:27695072
Kochibe, N; Matta, K L
1989-01-05
A lectin in the fruiting bodies of Psathyrella velutina was purified by affinity chromatography on a chitin column and subsequent ion-exchange chromatography. P. velutina lectin (PVL) tends to aggregate irreversibly in buffered saline, but the addition of glycerol (10%, v/v) to lectin solutions was found to prevent aggregate formation. PVL is assumed to occur as a monomer of a polypeptide of Mr = 40,000 as determined by gel filtration and by gel electrophoresis in the presence of sodium dodecyl sulfate. PVL is specific for N-acetylglucosamine (GlcNAc). It was determined by equilibrium dialysis to have four binding sites/polypeptide molecule showing an average intrinsic association constant of K0 = 6.4 x 10(3) M-1 toward this sugar. The binding specificity of the lectin was studied by hemagglutination inhibition assays and by avidin-biotin-mediated enzyme immunoassays using various GlcNAc-containing saccharides. The results indicate that methyl N-acetyl beta-glucosaminide was a slightly better inhibitor than the corresponding alpha-anomer. PVL binds well to oligosaccharides bearing nonreducing terminal beta-GlcNAc linked 1----6 or 1----3 but poorly to those having a 1----4 linkage, such as N-acetylated chito-oligosaccharides. It also binds to the subterminal GlcNAc moiety when it is substituted at the C-6 position but does not interact with the moiety when substituted either at C-3 or C-4. Thus, these results show that PVL is quite different in its binding specificity from other GlcNAc-binding lectins of higher plants since they bind preferentially to beta-GlcNAc in 1----4 linkage and they have a high affinity for chitin oligosaccharides.
Okamoto, A; Lovett, M; Payan, D G; Bunnett, N W
1994-01-01
Interactions between neutral endopeptidase-24.11 (NEP) and the substance P receptor (SPR; NK1) were investigated by examining substance P (SP) degradation, SP binding and SP-induced Ca2+ mobilization in epithelial cells transfected with cDNA encoding the rat SPR and rat NEP. Expression of NEP accelerated the degradation of SP by intact epithelial cells and by membrane preparations, and degradation was reduced by the NEP inhibitor thiorphan. In cells expressing SPR alone, specific 125I-SP binding after 20 min incubation at 37 degrees C was 92.2 +/- 3.1% of maximal binding and was unaffected by thiorphan. Coexpression of NEP in the same cells as the SPR markedly reduced SP binding to 13.9 +/- 0.5% of maximal, and binding was increased to 82.7 +/- 2.4% of maximal with thiorphan. Coexpression of NEP in the same cells as the SPR also reduced to undetectable the increase in intracellular Ca2+ in response to low concentrations of SP (0.3 and 0.5 nM), and significantly reduced the response to higher concentrations (1 and 3 nM). The Ca2+ response was restored to control values by inhibition of NEP with thiorphan. In contrast, SP binding and SP-induced Ca2+ mobilization were only slightly reduced when cells expressing SPR alone were mixed with a 3- to 24-fold excess of cells expressing NEP alone. Therefore, in this system, NEP markedly down-regulates SP binding and SP-induced Ca2+ mobilization only when coexpressed in the same cells as the SPR. Images Figure 1 Figure 2 PMID:7514869
Simmering, Vanessa R; Wood, Chelsey M
2017-08-01
Working memory is a basic cognitive process that predicts higher-level skills. A central question in theories of working memory development is the generality of the mechanisms proposed to explain improvements in performance. Prior theories have been closely tied to particular tasks and/or age groups, limiting their generalizability. The cognitive dynamics theory of visual working memory development has been proposed to overcome this limitation. From this perspective, developmental improvements arise through the coordination of cognitive processes to meet demands of different behavioral tasks. This notion is described as real-time stability, and can be probed through experiments that assess how changing task demands impact children's performance. The current studies test this account by probing visual working memory for colors and shapes in a change detection task that compares detection of changes to new features versus swaps in color-shape binding. In Experiment 1, 3- to 4-year-old children showed impairments specific to binding swaps, as predicted by decreased real-time stability early in development; 5- to 6-year-old children showed a slight advantage on binding swaps, but 7- to 8-year-old children and adults showed no difference across trial types. Experiment 2 tested the proposed explanation of young children's binding impairment through added perceptual structure, which supported the stability and precision of feature localization in memory-a process key to detecting binding swaps. This additional structure improved young children's binding swap detection, but not new-feature detection or adults' performance. These results provide further evidence for the cognitive dynamics and real-time stability explanation of visual working memory development. (PsycINFO Database Record (c) 2017 APA, all rights reserved).
Shi, Jie-Hua; Pan, Dong-Qi; Wang, Xiou-Xiou; Liu, Ting-Ting; Jiang, Min; Wang, Qi
2016-09-01
Artemether (AMT), a peroxide sesquiterpenoides, has been widely used as an antimalarial for the treatment of multiple drug-resistant strains of plasmodium falciparum malaria. In this work, the binding interaction of AMT with bovine serum albumin (BSA) under the imitated physiological conditions (pH7.4) was investigated by UV spectroscopy, fluorescence emission spectroscopy, synchronous fluorescence spectroscopy, Fourier transform infrared spectroscopy (FT-IR), circular dichroism (CD), three-dimensional fluorescence spectroscopy and molecular docking methods. The experimental results indicated that there was a change in UV absorption of BSA along with a slight red shift of absorption wavelength, indicating that the interaction of AMT with BSA occurred. The intrinsic fluorescence of BSA was quenched by AMT due to the formation of AMT-BSA complex. The number of binding sites (n) and binding constant of AMT-BSA complex were about 1 and 2.63×10(3)M(-1) at 298K, respectively, suggesting that there was stronger binding interaction of AMT with BSA. Based on the analysis of the signs and magnitudes of the free energy change (ΔG(0)), enthalpic change (ΔH(0)) and entropic change (ΔS(0)) in the binding process, it can be concluded that the binding of AMT with BSA was enthalpy-driven process due to |ΔH°|>|TΔS°|. The results of experiment and molecular docking confirmed the main interaction forces between AMT and BSA were van der Waals force. And, there was a slight change in the BSA conformation after binding AMT but BSA still retains its secondary structure α-helicity. However, it had been confirmed that AMT binds on the interface between sub-domain IIA and IIB of BSA. Copyright © 2016 Elsevier B.V. All rights reserved.
Structural Basis of Immune Evasion at the Site of CD4 Attachment on HIV-1 gp120
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chen, Lei; Kwon, Young Do; Zhou, Tongqing
2010-01-13
The site on HIV-1 gp120 that binds to the CD4 receptor is vulnerable to antibodies. However, most antibodies that interact with this site cannot neutralize HIV-1. To understand the basis of this resistance, we determined co-crystal structures for two poorly neutralizing, CD4-binding site (CD4BS) antibodies, F105 and b13, in complexes with gp120. Both antibodies exhibited approach angles to gp120 similar to those of CD4 and a rare, broadly neutralizing CD4BS antibody, b12. Slight differences in recognition, however, resulted in substantial differences in F105- and b13-bound conformations relative to b12-bound gp120. Modeling and binding experiments revealed these conformations to be poorlymore » compatible with the viral spike. This incompatibility, the consequence of slight differences in CD4BS recognition, renders HIV-1 resistant to all but the most accurately targeted antibodies.« less
Melanin-Based Coatings as Lead-Binding Agents
Sono, Karin; Lye, Diane; Moore, Christine A.; Boyd, W. Christopher; Gorlin, Thomas A.; Belitsky, Jason M.
2012-01-01
Interactions between metal ions and different forms of melanin play significant roles in melanin biochemistry. The binding properties of natural melanin and related synthetic materials can be exploited for nonbiological applications, potentially including water purification. A method for investigating metal ion-melanin interactions on solid support is described, with lead as the initial target. 2.5 cm discs of the hydrophobic polymer PVDF were coated with synthetic eumelanin from the tyrosinase-catalyzed polymerization of L-dopa, and with melanin extracted from human hair. Lead (Pb2+) binding was quantified by atomic absorption spectroscopy (flame mode), and the data was well fit by the Langmuir model. Langmuir affinities ranged from 3.4 · 103 to 2.2 · 104 M−1. At the maximum capacity observed, the synthetic eumelanin coating bound ~9% of its mass in lead. Binding of copper (Cu2+), zinc (Zn2+), and cadmium (Cd2+) to the synthetic-eumelanin-coated discs was also investigated. Under the conditions tested, the Langmuir affinities for Zn2+, Cd2+, and Cu2+ were 35%, 53%, and 77%, respectively, of the Langmuir affinity for Pb2+. The synthetic-eumelanin-coated discs have a slightly higher capacity for Cu2+ on a per mole basis than for Pb2+, and lower capacities for Cd2+ and Zn2+. The system described can be used to address biological questions and potentially be applied toward melanin-based water purification. PMID:22611345
The dynamics of interleukin-8 and its interaction with human CXC receptor I peptide
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kendrick, Agnieszka; Holliday, Michael; Isern, Nancy G.
2014-01-20
Interleukin-8 (CXCL8, IL-8) is a pro-inflammatory chemokine important for the regulation of inflammatory and immune responses via its interaction with G-protein coupled receptors, including CXC receptor 1 (CXCR1). CXCL8 exists as both a monomer and as a dimer at physiological concentrations, yet the molecular basis of CXCL8 interaction with its receptor as well as the importance of CXCL8 dimer formation remain poorly characterized. Although several biological studies have indicated that both the CXCL8 monomer and dimer are active, biophysical studies have reported conflicting results regarding the binding of CXCL8 to CXCR1. To clarify this problem, we expressed and purified amore » peptide (hCXCR1pep) corresponding to the N-terminal region of human CXCR1 (hCXCR1) and utilized nuclear magnetic resonance (NMR) spectroscopy to interrogate the binding of wild-type CXCL8 and a previously reported mutant (CXCL8M) that stabilizes the monomeric form. Our data reveal that CXCL8M engages hCXCR1pep with a slightly higher affinity than CXCL8, and that CXCL8 does not dissociate upon binding hCXCR1pep. These investigations also indicate that CXCL8 exhibits inherent flexibility within its receptor-binding site on multiple timescales, which may help explain the versatility in this interleukin for engaging its target receptors.« less
Samkoe, Kimberley S; Sexton, Kristian; Tichauer, Kenneth M; Hextrum, Shannon K; Pardesi, Omar; Davis, Scott C; O'Hara, Julia A; Hoopes, P Jack; Hasan, Tayyaba; Pogue, Brian W
2012-08-01
Cellular receptor targeted imaging agents present the potential to target extracellular molecular expression in cancerous lesions; however, the image contrast in vivo does not reflect the magnitude of overexpression expected from in vitro data. Here, the in vivo delivery and binding kinetics of epidermal growth factor receptor (EGFR) was determined for normal pancreas and AsPC-1 orthotopic pancreatic tumors known to overexpress EGFR. EGFR in orthotopic xenograft AsPC-1 tumors was targeted with epidermal growth factor (EGF) conjugated with IRDye800CW. The transfer rate constants (k(e), K₁₂, k₂₁, k₂₃, and k₃₂) associated with a three-compartment model describing the vascular delivery, leakage rate and binding of targeted agents were determined experimentally. The plasma excretion rate, k (e), was determined from extracted blood plasma samples. K₁₂, k₂₁, and k₃₂ were determined from ex vivo tissue washing studies at time points ≥ 24 h. The measured in vivo uptake of IRDye800CW-EGF and a non-targeted tracer dye, IRDye700DX-carboxylate, injected simultaneously was used to determined k₂₃. The vascular exchange of IRDye800CW-EGF in the orthotopic tumor (K₁₂ and k₂₁) was higher than in the AsPC-1 tumor as compared to normal pancreas, suggesting that more targeted agent can be taken up in tumor tissue. However, the cellular associated (binding) rate constant (k₂₃) was slightly lower for AsPC-1 pancreatic tumor (4.1 × 10(-4) s(-1)) than the normal pancreas (5.5 × 10(-4) s(-1)), implying that less binding is occurring. Higher vascular delivery but low cellular association in the AsPC-1 tumor compared to the normal pancreas may be indicative of low receptor density due to low cellular content. This attribute of the AsPC-1 tumor may indicate one contributing cause of the difficulty in treating pancreatic tumors with cellular targeted agents.
Moghadam, Neda Hosseinpour; Salehzadeh, Sadegh; Shahabadi, Nahid
2017-09-02
The interaction of calf thymus DNA with nevirapine at physiological pH was studied by using absorption, circular dichroism, viscosity, differential pulse voltammetry, fluorescence techniques, salt effect studies and computational methods. The drug binds to ct-DNA in a groove binding mode, as shown by slight variation in the viscosity of ct-DNA. Furthermore, competitive fluorimetric studies with Hoechst 33258 indicate that nevirapine binds to DNA via groove binding. Moreover, the structure of nevirapine was optimized by DFT calculations and was used for the molecular docking calculations. The molecular docking results suggested that nevirapine prefers to bind on the minor groove of ct-DNA.
Tsujikawa, Tetsuya; Zoghbi, Sami S.; Hong, Jinsoo; Donohue, Sean R.; Jenko, Kimberly J.; Gladding, Robert L.; Halldin, Christer; Pike, Victor W.; Innis, Robert B.; Fujita, Masahiro
2013-01-01
We recently developed a novel cannabinoid subtype-1 (CB1) receptor radioligand 11C-SD5024 for brain imaging. This study aimed to evaluate 11C-SD5024 both in vitro and in vivo and compare it with the other CB1 receptor ligands previously used in humans, i.e., 11C-MePPEP, 11C-OMAR, 18F-MK-9470, and 18F-FMPEP-d2. In vitro experiments were performed to measure dissociation constant (Ki) in human brain and to measure the lipophilicity of five CB1 receptor ligands listed above. In vivo specific binding in monkeys was measured by comparing total distribution volume (VT) at baseline and after full receptor blockade. The kinetics of 11C-SD5024 in humans were evaluated in seven healthy subjects with compartmental modeling. SD5024 showed Ki=0.47 nM, which was at an intermediate level among the five CB1 receptor ligands. Lipophilicity (LogD7.4) was 3.79, which is appropriate for brain imaging. Monkey scans showed high proportion of specific binding: ~80% of VT. In humans, 11C-SD5024 showed peak brain uptake of 1.5–3 standardized uptake value, which was slightly higher than those of 11C-OMAR and 18F-MK-9470. One-compartment model showed good fitting, consistent with the vast majority of brain uptake being specific binding found in the monkey. Regional VT values were consistent with known distribution of CB1 receptors. VT calculated from 80 and 120 min of scan data were strongly correlated (R2=0.97), indicating that 80 min provided adequate information for quantitation and that the influence of radiometabolites was low. Intersubject variability for VT of 11C-SD5024 was 22%, which was low among the five radioligands and indicated precise measurement. In conclusion, 11C-SD5024 has appropriate affinity and lipophilicity, high specific binding, moderate brain uptake, and provides good precision to measure the binding. The results suggest that 11C-SD5024 is slightly better than or equivalent to 11C-OMAR and that both are suitable for clinical studies, especially those that involve two scans in one day. PMID:24076222
Effects of weak/non-complement-binding HLA antibodies on C1q-binding.
Hönger, G; Amico, P; Arnold, M-L; Spriewald, B M; Schaub, S
2017-08-01
It is unknown under what conditions and to what extent weak/non-complement (C)-binding IgG subclasses (IgG2/IgG4) can block C1q-binding triggered by C-binding IgG subclasses (IgG1/IgG3). Therefore, we investigated in vitro C1q-binding induced by IgG subclass mixtures targeting the same HLA epitope. Various mixtures of HLA class II specific monoclonal antibodies of different IgG subclasses but identical V-region were incubated with HLA DRB1*07:01 beads and monitored for C1q-binding. The lowest concentration to achieve maximum C1q-binding was measured for IgG3, followed by IgG1, while IgG2 and IgG4 did not show appreciable C1q-binding. C1q-binding occurred only after a critical amount of IgG1/3 has bound and sharply increased thereafter. When both, C-binding and weak/non-C-binding IgG subclasses were mixed, C1q-binding was diminished proportionally to the fraction of IgG2/4. A 2- to 4-fold excess of IgG2/4 inhibited C1q-binding by 50%. Very high levels (10-fold excess) almost completely abrogated C1q-binding even in the presence of significant IgG1/3 levels that would usually lead to strong C1q-binding. In sensitized renal allograft recipients, IgG subclass constellations with ≥ 2-fold excess of IgG2/4 over IgG1/3 were present in 23/66 patients (34.8%) and overall revealed slightly decreased C1q signals. However, spiking of patient sera with IgG2 targeting a different epitope than the patient's IgG1/3 synergistically increased C1q-binding. In conclusion, if targeting the same epitope, an excess of IgG2/4 is repressing the extent of IgG1/3 triggered C1q-binding in vitro. Such IgG subclass constellations are present in about a third of sensitized patients and their net effect on C1q-binding is slightly inhibitory. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Camel and bovine chymosin: the relationship between their structures and cheese-making properties
DOE Office of Scientific and Technical Information (OSTI.GOV)
Langholm Jensen, Jesper; Chr. Hansen A/S, Bøge Allé 10-12, DK-2970 Hørsholm; Mølgaard, Anne
Analysis of the crystal structures of the two milk-clotting enzymes bovine and camel chymosin has revealed that the better milk-clotting activity towards bovine milk of camel chymosin compared with bovine chymosin is related to variations in their surface charges and their substrate-binding clefts. Bovine and camel chymosin are aspartic peptidases that are used industrially in cheese production. They cleave the Phe105-Met106 bond of the milk protein κ-casein, releasing its predominantly negatively charged C-terminus, which leads to the separation of the milk into curds and whey. Despite having 85% sequence identity, camel chymosin shows a 70% higher milk-clotting activity than bovinemore » chymosin towards bovine milk. The activities, structures, thermal stabilities and glycosylation patterns of bovine and camel chymosin obtained by fermentation in Aspergillus niger have been examined. Different variants of the enzymes were isolated by hydrophobic interaction chromatography and showed variations in their glycosylation, N-terminal sequences and activities. Glycosylation at Asn291 and the loss of the first three residues of camel chymosin significantly decreased its activity. Thermal differential scanning calorimetry revealed a slightly higher thermal stability of camel chymosin compared with bovine chymosin. The crystal structure of a doubly glycosylated variant of camel chymosin was determined at a resolution of 1.6 Å and the crystal structure of unglycosylated bovine chymosin was redetermined at a slightly higher resolution (1.8 Å) than previously determined structures. Camel and bovine chymosin share the same overall fold, except for the antiparallel central β-sheet that connects the N-terminal and C-terminal domains. In bovine chymosin the N-terminus forms one of the strands which is lacking in camel chymosin. This difference leads to an increase in the flexibility of the relative orientation of the two domains in the camel enzyme. Variations in the amino acids delineating the substrate-binding cleft suggest a greater flexibility in the ability to accommodate the substrate in camel chymosin. Both enzymes possess local positively charged patches on their surface that can play a role in interactions with the overall negatively charged C-terminus of κ-casein. Camel chymosin contains two additional positive patches that favour interaction with the substrate. The improved electrostatic interactions arising from variation in the surface charges and the greater malleability both in domain movements and substrate binding contribute to the better milk-clotting activity of camel chymosin towards bovine milk.« less
Camel and bovine chymosin: the relationship between their structures and cheese-making properties.
Langholm Jensen, Jesper; Mølgaard, Anne; Navarro Poulsen, Jens Christian; Harboe, Marianne Kirsten; Simonsen, Jens Bæk; Lorentzen, Andrea Maria; Hjernø, Karin; van den Brink, Johannes M; Qvist, Karsten Bruun; Larsen, Sine
2013-05-01
Bovine and camel chymosin are aspartic peptidases that are used industrially in cheese production. They cleave the Phe105-Met106 bond of the milk protein κ-casein, releasing its predominantly negatively charged C-terminus, which leads to the separation of the milk into curds and whey. Despite having 85% sequence identity, camel chymosin shows a 70% higher milk-clotting activity than bovine chymosin towards bovine milk. The activities, structures, thermal stabilities and glycosylation patterns of bovine and camel chymosin obtained by fermentation in Aspergillus niger have been examined. Different variants of the enzymes were isolated by hydrophobic interaction chromatography and showed variations in their glycosylation, N-terminal sequences and activities. Glycosylation at Asn291 and the loss of the first three residues of camel chymosin significantly decreased its activity. Thermal differential scanning calorimetry revealed a slightly higher thermal stability of camel chymosin compared with bovine chymosin. The crystal structure of a doubly glycosylated variant of camel chymosin was determined at a resolution of 1.6 Å and the crystal structure of unglycosylated bovine chymosin was redetermined at a slightly higher resolution (1.8 Å) than previously determined structures. Camel and bovine chymosin share the same overall fold, except for the antiparallel central β-sheet that connects the N-terminal and C-terminal domains. In bovine chymosin the N-terminus forms one of the strands which is lacking in camel chymosin. This difference leads to an increase in the flexibility of the relative orientation of the two domains in the camel enzyme. Variations in the amino acids delineating the substrate-binding cleft suggest a greater flexibility in the ability to accommodate the substrate in camel chymosin. Both enzymes possess local positively charged patches on their surface that can play a role in interactions with the overall negatively charged C-terminus of κ-casein. Camel chymosin contains two additional positive patches that favour interaction with the substrate. The improved electrostatic interactions arising from variation in the surface charges and the greater malleability both in domain movements and substrate binding contribute to the better milk-clotting activity of camel chymosin towards bovine milk.
Electronic and structural properties at the interface between CuPc and graphene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tao, Yongsheng; College of Modern Science and Technology, China Jiliang University, Hangzhou 310018; Mao, Hongying
2015-01-07
The electronic and structural properties at Copper phthalocyanine (CuPc)/graphene have been studied using ultraviolet photoemission spectroscopy and first-principles density function theory calculation. The five emission features α, β, γ, δ, and ε originating from the CuPc molecules locate at 1.48, 3.66, 4.98, 6.90, and 9.04 eV, respectively. These features shift in binding energy with the increasing CuPc coverage. The feature α is mostly deriving from Cu 3d orbital with some contributions from C 2p orbital. Further theoretical calculation indicates that the adsorption of CuPc on a top site is the most favorable configuration, and the separation between the adsorbate and graphenemore » is about 3.47 Å. According to the density of states before and after CuPc adsorption, the LUMO of CuPc is slightly occupied, while the Dirac point of graphene slightly shift towards higher energy, suggesting that a small amount of electron transfer from graphene to CuPc upon contact.« less
Binding of /sup 125/I alpha-bungarotoxin to the thymus of mice
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ohshima, F.; Kondo, K.; Tsubaki, T.
1978-01-01
Alpha-bungarotoxin is known to bind with nicotinic acetylcholine receptors of skeletal muscle. Binding of iodine 125-labeled alpha bungarotoxin to the murine thymus, muscle, and liver was estimated. The toxin was bound to the muscle. The thymus was also capable of binding a considerable amount of the toxin, and the binding was obviously blocked by tubocurarine chloride. Binding to the liver, an organ containing no nicotinic acetylcholine receptor, was very slight. These results may indicate the presence of nicotinic acetylcholine receptors in the thymus, which could have implications in the pathogenesis of myasthenia gravis. Degenerating myoid cells and their receptors maymore » represent autoantigens that induce an immunological cross-reaction with the receptors of skeletal muscles, giving rise to myasthenia gravis.« less
Caillon, Lucie; Killian, J. Antoinette; Lequin, Olivier; Khemtémourian, Lucie
2013-01-01
Dermaseptin S9 (Drs S9) is an atypical cationic antimicrobial peptide with a long hydrophobic core and with a propensity to form amyloid-like fibrils. Here we investigated its membrane interaction using a variety of biophysical techniques. Rather surprisingly, we found that Drs S9 induces efficient permeabilisation in zwitterionic phosphatidylcholine (PC) vesicles, but not in anionic phosphatidylglycerol (PG) vesicles. We also found that the peptide inserts more efficiently in PC than in PG monolayers. Therefore, electrostatic interactions between the cationic Drs S9 and anionic membranes cannot explain the selectivity of the peptide towards bacterial membranes. CD spectroscopy, electron microscopy and ThT fluorescence experiments showed that the peptide adopts slightly more β-sheet and has a higher tendency to form amyloid-like fibrils in the presence of PC membranes as compared to PG membranes. Thus, induction of leakage may be related to peptide aggregation. The use of a pre-incorporation protocol to reduce peptide/peptide interactions characteristic of aggregates in solution resulted in more α-helix formation and a more pronounced effect on the cooperativity of the gel-fluid lipid phase transition in all lipid systems tested. Calorimetric data together with 2H- and 31P-NMR experiments indicated that the peptide has a significant impact on the dynamic organization of lipid bilayers, albeit slightly less for zwitterionic than for anionic membranes. Taken together, our data suggest that in particular in membranes of zwitterionic lipids the peptide binds in an aggregated state resulting in membrane leakage. We propose that also the antimicrobial activity of Drs S9 may be a result of binding of the peptide in an aggregated state, but that specific binding and aggregation to bacterial membranes is regulated not by anionic lipids but by as yet unknown factors. PMID:24146759
The binding of analogs of porphyrins and chlorins with elongated side chains to albumin
Ben Dror, Shimshon; Bronshtein, Irena; Weitman, Hana; Smith, Kevin M.; O’Neal, William G.; Jacobi, Peter A.; Ehrenberg, Benjamin
2012-01-01
In previous studies, we demonstrated that elongation of side chains of several sensitizers endowed them with higher affinity for artificial and natural membranes and caused their deeper localization in membranes. In the present study, we employed eight hematoporphyrin and protoporphyrin analogs and four groups containing three chlorin analogs each, all synthesized with variable numbers of methylenes in their alkyl carboxylic chains. We show that these tetrapyrroles’ affinity for bovine serum albumin (BSA) and their localization in the binding site are also modulated by chain lengths. The binding constants of the hematoporphyrins and protoporphyrins to BSA increased as the number of methylenes was increased. The binding of the chlorins depended on the substitution at the meso position opposite to the chains. The quenching of the sensitizers’ florescence by external iodide ions decreased as the side chains became longer, indicating to deeper insertion of the molecules into the BSA binding pocket. To corroborate this conclusion, we studied the efficiency of photodamage caused to tryptophan in BSA upon illumination of the bound sensitizers. The efficiency was found to depend on the side-chain lengths of the photosensitizer. We conclude that the protein site that hosts these sensitizers accommodates different analogs at positions that differ slightly from each other. These differences are manifested in the ease of access of iodide from the external aqueous phase, and in the proximity of the photosensitizers to the tryptophan. In the course of this study, we developed the kinetic equations that have to be employed when the sensitizer itself is being destroyed. PMID:19330323
Shin, Y; Moni, R W; Lueders, J E; Daly, J W
1994-04-01
1. The amphiphilic peptide mastoparan is known to affect phosphoinositide breakdown, calcium influx, and exocytosis of hormones and neurotransmitters and to stimulate the GTPase activity of guanine nucleotide-binding regulatory proteins. Another amphiphilic peptide, adenoregulin was recently identified based on stimulation of agonist binding to A1-adenosine receptors. 2. A comparison of the effects of mastoparan and adenoregulin reveals that these peptides share many properties. Both stimulate binding of agonists to receptors and binding of GTP gamma S to G proteins in brain membranes. The enhanced guanyl nucleotide exchange may be responsible for the complete conversion of receptors to a high-affinity state, complexed with guanyl nucleotide-free G proteins. 3. Both peptides increase phosphoinositide breakdown in NIH 3T3 fibroblasts. Pertussis toxin partially inhibits the phosphoinositide breakdown elicited by mastoparan but has no effect on the response to adenoregulin. N-Ethylmaleimide inhibits the response to both peptides. 4. In permeabilized 3T3 cells, both adenoregulin and mastoparan inhibit GTP gamma S-stimulated phosphoinositide breakdown. Mastoparan slightly increases basal cyclic AMP levels in cultured cells, followed at higher concentrations by an inhibition, while adenoregulin has minimal effects. 5. Both peptides increase calcium influx in cultured cells and release of norepinephrine in pheochromocytoma PC12 cells. The calcium influx elicited by the peptides in 3T3 cells is not markedly altered by N-ethylmaleimide. 6. Multiple sites of action appear likely to underlie the effects of mastoparan/adenoregulin on receptors, G proteins, phospholipase C, and calcium.
Effect of counterion binding efficiency on structure and dynamics of wormlike micelles.
Oelschlaeger, C; Suwita, P; Willenbacher, N
2010-05-18
We have studied the effect of counterion binding efficiency on the linear viscoelastic properties of wormlike micelles formed from hexadecyltrimethylammonium bromide (CTAB) in the presence of different nonpenetrating inorganic salts: potassium bromide (KBr), sodium nitrate (NaNO(3)), and sodium chlorate (NaClO(3)). We have varied the salt/surfactant ratio R at fixed surfactant concentration of 350 mM. Results are compared to data for the system cetylpyridinium chloride (CPyCl) and the penetrating counterion sodium salicylate (NaSal) (Oelschlaeger, C.; Schopferer, M.; Scheffold, F.; Willenbacher, N. Langmuir 2009, 25, 716-723). Mechanical high-frequency rheology and diffusing wave spectroscopy (DWS) based tracer microrheology are used to determine the shear moduli G' and G'' in the frequency range from 0.1 Hz up to 1 MHz (Willenbacher, N.; Oelschlaeger, C.; Schopferer, M.; Fischer, P.; Cardinaux, F.; Scheffold, F. Phys. Rev. Lett. 2007, 99, 068302, 1-4). This enables us to determine the plateau modulus G(0), which is related to the cross-link density or mesh size of the entanglement network, the bending stiffness kappa (also expressed as persistence length l(p) = kappa/k(B)T) corresponding to the semiflexible nature of the micelles, and the scission energy E(sciss), which is related to their contour length. The viscosity maximum shifts to higher R values, and the variation of viscosity with R is less pronounced as the binding strength decreases. The plateau modulus increases with R at low ionic strength and is constant around the viscosity maximum; the increase in G(0) at high R, which is presumably due to branching, is weak compared to the system with penetrating counterion. The scission energy E(sciss) approximately = 20 k(B)T is independent of counterion binding efficiency irrespective of R and is slightly higher compared to the system CPyCl/NaSal, indicating that branching may be significant already at the viscosity maximum in this latter case. The micellar flexibility increases with increasing binding efficiency of counterions according to the Hofmeister series. The persistence length values for systems CTAB/KBr, CTAB/NaNO(3), and CTAB/NaClO(3) are 40, 34, and 29 nm, respectively, independent of R, and are significantly higher than in the case of CPyCl/NaSal.
Rooijakkers, Bart J. M.
2018-01-01
Six fungal-type cellulose binding domains were found in the genome of the coccolithophore Emiliania huxleyi and cloned and expressed in Escherichia coli. Sequence comparison indicate high similarity to fungal cellulose binding domains, raising the question of why these domains exist in coccolithophores. The proteins were tested for binding with cellulose and chitin as ligands, which resulted in the identification of two functional carbohydrate binding modules: EHUX2 and EHUX4. Compared to benchmark fungal cellulose binding domain Cel7A-CBM1 from Trichoderma reesei, these proteins showed slightly lower binding to birch and bacterial cellulose, but were more efficient chitin binders. Finally, a set of cellulose binding domains was created based on the shuffling of one well-functioning and one non-functional domain. These were characterized in order to get more information of the binding domain’s sequence–function relationship, indicating characteristic differences between the molecular basis of cellulose versus chitin recognition. As previous reports have showed the presence of cellulose in coccoliths and here we find functional cellulose binding modules, a possible connection is discussed. PMID:29782536
Rooijakkers, Bart J M; Ikonen, Martina S; Linder, Markus B
2018-01-01
Six fungal-type cellulose binding domains were found in the genome of the coccolithophore Emiliania huxleyi and cloned and expressed in Escherichia coli. Sequence comparison indicate high similarity to fungal cellulose binding domains, raising the question of why these domains exist in coccolithophores. The proteins were tested for binding with cellulose and chitin as ligands, which resulted in the identification of two functional carbohydrate binding modules: EHUX2 and EHUX4. Compared to benchmark fungal cellulose binding domain Cel7A-CBM1 from Trichoderma reesei, these proteins showed slightly lower binding to birch and bacterial cellulose, but were more efficient chitin binders. Finally, a set of cellulose binding domains was created based on the shuffling of one well-functioning and one non-functional domain. These were characterized in order to get more information of the binding domain's sequence-function relationship, indicating characteristic differences between the molecular basis of cellulose versus chitin recognition. As previous reports have showed the presence of cellulose in coccoliths and here we find functional cellulose binding modules, a possible connection is discussed.
Rohs, Remo; Sklenar, Heinz
2004-04-01
The results presented in this paper on methylene blue (MB) binding to DNA with AT alternating base sequence complement the data obtained in two former modeling studies of MB binding to GC alternating DNA. In the light of the large amount of experimental data for both systems, this theoretical study is focused on a detailed energetic analysis and comparison in order to understand their different behavior. Since experimental high-resolution structures of the complexes are not available, the analysis is based on energy minimized structural models of the complexes in different binding modes. For both sequences, four different intercalation structures and two models for MB binding in the minor and major groove have been proposed. Solvent electrostatic effects were included in the energetic analysis by using electrostatic continuum theory, and the dependence of MB binding on salt concentration was investigated by solving the non-linear Poisson-Boltzmann equation. We find that the relative stability of the different complexes is similar for the two sequences, in agreement with the interpretation of spectroscopic data. Subtle differences, however, are seen in energy decompositions and can be attributed to the change from symmetric 5'-YpR-3' intercalation to minor groove binding with increasing salt concentration, which is experimentally observed for the AT sequence at lower salt concentration than for the GC sequence. According to our results, this difference is due to the significantly lower non-electrostatic energy for the minor groove complex with AT alternating DNA, whereas the slightly lower binding energy to this sequence is caused by a higher deformation energy of DNA. The energetic data are in agreement with the conclusions derived from different spectroscopic studies and can also be structurally interpreted on the basis of the modeled complexes. The simple static modeling technique and the neglect of entropy terms and of non-electrostatic solute-solvent interactions, which are assumed to be nearly constant for the compared complexes of MB with DNA, seem to be justified by the results.
Rey-Castro, Carlos; Lodeiro, Pablo; Herrero, Roberto; Sastre de Vicente, Manuel E
2003-11-15
Brown seaweeds are interesting materials to be used as biosorbents for heavy metals due to their high binding ability and low cost. The study of the passive biosorption of protons on this kind of materials and its dependency on pH, ionic strength, and medium composition is essential for the practical application of brown algae in wastewater treatment. This work reports the results of the study of the proton binding equilibria of dead biomass from the seaweeds Sargassum muticum, Cystoseira baccata, and Saccorhiza polyschides by potentiometric titration with a glass electrode in the pH range between 2 and 8. Two different salts, NaCl and KNO3, in concentrations ranging from 0.05 to 2 mol x L(-1), were used as background electrolytes. The influence of the ionic strength was accounted for by means of the Donnan model in combination with the master curve approach. Different empirical expressions to describe the swelling behavior of the biosorbent were tested. On the basis of the intrinsic affinity distribution analysis a unimodal Langmuir-Freundlich isotherm was selected to describe the proton binding properties. The results show very little influence of the type of salt. The ionic strength dependency of the proton binding is very similar for the three species, and average empirical expressions of the Donnan volume are proposed. The maximum proton binding capacities obtained ranged between 2.4 and 2.9 mol x kg(-1), with average intrinsic proton affinity constants between 3.1 and 3.3, and heterogeneity parameters of ca. 0.5 for S. muticum and C. baccata, and slightly higher (ca. 0.7) for S. polyschides. The combined Langmuir-Freundlich equation and Donnan model allowed a good description of the experimental charge vs pH curves obtained.
Souza, Tatiana A C B; Trindade, Daniel M; Tonoli, Celisa C C; Santos, Camila R; Ward, Richard J; Arni, Raghuvir K; Oliveira, Arthur H C; Murakami, Mário T
2011-07-01
Nucleoside diphosphate kinases play a crucial role in the purine-salvage pathway of trypanosomatid protozoa and have been found in the secretome of Leishmania sp., suggesting a function related to host-cell integrity for the benefit of the parasite. Due to their importance for housekeeping functions in the parasite and by prolonging the life of host cells in infection, they become an attractive target for drug discovery and design. In this work, we describe the first structural characterization of nucleoside diphosphate kinases b from trypanosomatid parasites (tNDKbs) providing insights into their oligomerization, stability and structural determinants for nucleotide binding. Crystallographic studies of LmNDKb when complexed with phosphate, AMP and ADP showed that the crucial hydrogen-bonding residues involved in the nucleotide interaction are fully conserved in tNDKbs. Depending on the nature of the ligand, the nucleotide-binding pocket undergoes conformational changes, which leads to different cavity volumes. SAXS experiments showed that tNDKbs, like other eukaryotic NDKs, form a hexamer in solution and their oligomeric state does not rely on the presence of nucleotides or mimetics. Fluorescence-based thermal-shift assays demonstrated slightly higher stability of tNDKbs compared to human NDKb (HsNDKb), which is in agreement with the fact that tNDKbs are secreted and subjected to variations of temperature in the host cells during infection and disease development. Moreover, tNDKbs were stabilized upon nucleotide binding, whereas HsNDKb was not influenced. Contrasts on the surface electrostatic potential around the nucleotide-binding pocket might be a determinant for nucleotide affinity and protein stability differentiation. All these together demonstrated the molecular adaptation of parasite NDKbs in order to exert their biological functions intra-parasite and when secreted by regulating ATP levels of host cells.
Schoepe, K B; Friesel, H; Schurdak, M E; Randerath, K; Hecker, E
1986-04-01
The binding of some mouse skin metabolites and related derivatives of the tumor initiator 7,12-dimethylbenz[a]anthracene (DMBA) was investigated by 32P-postlabeling analysis after its topical administration. DMBA and trans-3,4-dihydro-3,4-dihydroxy-DMBA (DMBA-3,4-dihydrodiol) both led to the formation of four DNA adducts, which showed a very similar pattern of spots on thin-layer chromatograms. With trans-8,9-dihydro-8,9-dihydroxy-7,12-dimethylbenz[a]anthracene (DMBA-8,9-dihydrodiol) one major adduct was obtained which was chromatographically indistinguishable from one of the DMBA adducts. In contrast, 7-hydroxymethyl-12-methylbenz[a]anthracene (7-OHM-12-MBA) gave rise to two major adducts which were separable from DMBA adducts. 3-hydroxy-7,12-dimethylbenz[a]anthracene (3-OH-DMBA) and 7,12-dimethylbenz[a]anthracene-7,12-epoxide (DMBA-O2) did not lead to detectable amounts of adducts. Quantitative determination of DNA binding showed that an initiating dose (i = 100 nmol) of DMBA yielded approximately 12 adducts/10(7) normal nucleotides. Adduct formation with the same dose of DMBA-3,4-dihydrodiol was 7-8 times higher. At a 4-fold higher dose level, DMBA-8,9-dihydrodiol exhibited a 3- to 6-times weaker binding and 7-OHM-12-MBA a slightly stronger binding than DMBA. Chromatography of the DMBA and DMBA-3,4-dihydrodiol adducts with a solvent containing borate showed a decreased mobility of two out of four adducts in each case. These adducts were also sensitive to oxidation by periodate. The results suggest that two DMBA adducts carried vicinal cis-hydroxyl groups and thus were probably derived from the anti-3,4-dihydrodiol-1,2-oxide(s) of DMBA. The other two adducts were probably derived from the syn-stereoisomer(s). When the DNA-modifying capabilities and initiating activities of the more prominent mouse-skin metabolites are considered in relation to DMBA, DMBA-3,4-dihydrodiol is postulated to be a proximate and DMBA-3,4-dihydrodiol-1,2-oxide(s) to be ultimate initiators.
Cruz-Gallardo, Isabel; Aroca, Ángeles; Persson, Cecilia; Karlsson, B. Göran; Díaz-Moreno, Irene
2013-01-01
T-cell intracellular antigen-1 (TIA-1) is a DNA/RNA-binding protein that regulates critical events in cell physiology by the regulation of pre-mRNA splicing and mRNA translation. TIA-1 is composed of three RNA recognition motifs (RRMs) and a glutamine-rich domain and binds to uridine-rich RNA sequences through its C-terminal RRM2 and RRM3 domains. Here, we show that RNA binding mediated by either isolated RRM3 or the RRM23 construct is controlled by slight environmental pH changes due to the protonation/deprotonation of TIA-1 RRM3 histidine residues. The auxiliary role of the C-terminal RRM3 domain in TIA-1 RNA recognition is poorly understood, and this work provides insight into its binding mechanisms. PMID:23902765
Expanding the potential of G-quadruplex structures: formation of a heterochiral TBA analogue.
Virgilio, Antonella; Varra, Michela; Scuotto, Maria; Capuozzo, Antonella; Irace, Carlo; Mayol, Luciano; Esposito, Veronica; Galeone, Aldo
2014-03-21
In order to expand the potential applications of G-quadruplex structures, we explored the ability of heterochiral oligodeoxynucleotides based on the thrombin-binding aptamer (TBA) sequence to fold into similar complexes, with particular focus on their resistance in biological environments. A combination of CD and NMR techniques was used. Similarly to TBA, the ODN ggTTggtgtggTTgg (lower case letters indicate L residues) is able to fold into a chair-like antiparallel G-quadruplex structure, but has a slightly higher thermal stability. The discovery that heterochiral ODNs are able to form stable G-quadruplex structures opens up new possibilities for their development in several fields, as aptamers, sensors and, as recently shown, as catalysts for enantioselective reactions. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Effects of non-enzymatic glycation in human serum albumin. Spectroscopic analysis
NASA Astrophysics Data System (ADS)
Szkudlarek, A.; Sułkowska, A.; Maciążek-Jurczyk, M.; Chudzik, M.; Równicka-Zubik, J.
2016-01-01
Human serum albumin (HSA), transporting protein, is exposed during its life to numerous factors that cause its functions become impaired. One of the basic factors - glycation of HSA - occurs in diabetes and may affect HSA-drug binding. Accumulation of advanced glycation end-products (AGEs) leads to diseases e.g. diabetic and non-diabetic cardiovascular diseases, Alzheimer disease, renal disfunction and in normal aging. The aim of the present work was to estimate how non-enzymatic glycation of human serum albumin altered its tertiary structure using fluorescence technique. We compared glycated human serum albumin by glucose (gHSAGLC) with HSA glycated by fructose (gHSAFRC). We focused on presenting the differences between gHSAFRC and nonglycated (HSA) albumin used acrylamide (Ac), potassium iodide (KI) and 2-(p-toluidino)naphthalene-6-sulfonic acid (TNS). Changes of the microenvironment around the tryptophan residue (Trp-214) of non-glycated and glycated proteins was investigated by the red-edge excitation shift method. Effect of glycation on ligand binding was examined by the binding of phenylbutazone (PHB) and ketoprofen (KP), which a primary high affinity binding site in serum albumin is subdomain IIA and IIIA, respectively. At an excitation and an emission wavelength of λex 335 nm and λem 420 nm, respectively the increase of fluorescence intensity and the blue-shift of maximum fluorescence was observed. It indicates that the glycation products decreases the polarity microenvironment around the fluorophores. Analysis of red-edge excitation shift method showed that the red-shift for gHSAFRC is higher than for HSA. Non-enzymatic glycation also caused, that the Trp residue of gHSAFRC becomes less accessible for the negatively charged quencher (I-), KSV value is smaller for gHSAFRC than for HSA. TNS fluorescent measurement demonstrated the decrease of hydrophobicity in the glycated albumin. KSV constants for gHSA-PHB systems are higher than for the unmodified serum albumin, while KSV values for gHSA-KP systems are only slightly lower than that obtained for HSA-KP. The affinity of PHB to the glycated HSA is stronger than to the non-glycated in the first class binding sites within subdomain IIA, in the vicinity of Trp-214. Ketoprofen bound to unmodified human serum albumin stronger than for glycated albumin and one class of binding sites is observed (Scatchard linear plots).
Armour, Kathryn L; Smith, Cheryl S; Clark, Michael R
2010-03-31
The efficacy of a therapeutic IgG molecule may be as dependent on the optimisation of the constant region to suit its intended indication as on the selection of its variable regions. A crucial effector function to be maximised or minimised is antibody-dependent cell-mediated cytotoxicity by natural killer cells. Traditional assays of ADCC activity suffer from considerable inter-donor and intra-donor variability, which makes the measurement of antibody binding to human FcgammaRIIIa, the key receptor for ADCC, an attractive alternative method of assessment. Here, we describe the development of cell lines and assays for this purpose. The transmembrane receptor, FcgammaRIIIa, requires co-expression with signal transducing subunits to prevent its degradation, unlike the homologous receptor FcgammaRIIIb that is expressed as a GPI-anchored molecule. Therefore, to simplify the production of cell lines as reliable assay components, we expressed FcgammaRIIIa as a GPI-anchored molecule. Separate, stable CHO cell lines that express either the 158F or the higher-affinity 158V allotype of FcgammaRIIIa were isolated using fluorescence-activated cell sorting. The identities of the expressed receptors were confirmed using a panel of monoclonal antibodies that distinguish between subclasses and allotypes of FcgammaRIII and the cell lines were shown to have slightly higher levels of receptor than FcgammaRIII-positive peripheral blood mononuclear cells. Because the affinity of FcgammaRIIIa for IgG is intermediate amongst the receptors that bind IgG, we were able to use these cell lines to develop flow cytometric assays to measure the binding of both complexed and monomeric immunoglobulin. Thus, by choosing the appropriate method, weakly- or strongly-binding IgG can be efficiently compared. We have quantified the difference in the binding of wildtype IgG1 and IgG3 molecules to the two functional allotypes of the receptor and report that the FcgammaRIIIa-158V-antibody interaction is 3- to 4-fold stronger that the interaction with FcgammaRIIIa-158F. Overall, these robust assays should be valuable for batch-testing clinical material as well as providing tools for improving the design of therapeutic IgG. 2010 Elsevier B.V. All rights reserved.
Mössbauer spectroscopy and the understanding of the role of iron in neurodegeneration
NASA Astrophysics Data System (ADS)
Friedman, A.; Galazka-Friedman, J.
2017-11-01
The possible role of iron in neurodegeneration may be related to the oxidative stress, triggered by Fenton reaction. In this reaction hydroxyl free radical production is generated by divalent iron. Motor symptoms of Parkinson's disease depend on the destruction of substantia nigra (SN). As the substantive questions were: 1/ what is the concentration of iron in the samples, 2/ what is the proportion of divalent vs. trivalent iron in the samples, and 3/ what is the iron-binding compound, it seemed appropriate to use Mössbauer spectroscopy to answer those questions. We found no difference in the concentration of total iron between PD and control, with the ratio of iron in PD vs. control being 1.00 ± 0.13. The divalent iron could not exceed 5% of the total iron. The main iron-binding compound in SN, both in PD and control is ferritin. Our further studies of ferritin in parkinsonian SN demonstrated a decrease, compared to control, of L-ferritin involved in the storage of iron within ferritin. This could allow an efflux of iron from the ferritin shell and an increase of non-ferritin iron in PD SN, which was confirmed by us. Mössbauer studies in Alzheimer showed slightly higher concentration of iron in hippocampal cortex with significantly higher concentrations of L and H ferritins compared to control. In atypical parkinsonism, progressive supranuclear palsy, higher concentration of iron was found in globus pallidus and SN compared to control. Mössbauer spectroscopy may play crucial role in further studies of human neurodegeneration.
Thrombopoietin contributes to enhanced platelet activation in cigarette smokers.
Lupia, Enrico; Bosco, Ornella; Goffi, Alberto; Poletto, Cesare; Locatelli, Stefania; Spatola, Tiziana; Cuccurullo, Alessandra; Montrucchio, Giuseppe
2010-05-01
Thrombopoietin (TPO) is a humoral growth factor that primes platelet activation in response to several agonists. We recently showed that TPO enhances platelet activation in unstable angina and sepsis. Aim of this study was to investigate the role of TPO in platelet function abnormalities described in cigarette smokers. In a case-control study we enrolled 20 healthy cigarette smokers and 20 nonsmokers, and measured TPO and C-reactive protein (CRP), as well as platelet-leukocyte binding and P-selectin expression. In vitro we evaluated the priming activity of smoker or control plasma on platelet activation, and the role of TPO in this effect. We then studied the effects of acute smoking and smoking cessation on TPO levels and platelet activation indices. Chronic cigarette smokers had higher circulating TPO levels than nonsmoking controls, as well as increased platelet-leukocyte binding, P-selectin expression, and CRP levels. Serum cotinine concentrations correlated with TPO concentrations, platelet-monocyte aggregates and P-selectin expression. In addition, TPO levels significantly correlated with ex vivo platelet-monocyte aggregation and P-selectin expression. In vitro, the plasma from cigarette smokers, but not from nonsmoking controls, primed platelet-monocyte binding, which was reduced when an inhibitor of TPO was used. We also found that acute smoking slightly increased TPO levels, but did not affect platelet-leukocyte binding, whereas smoking cessation induced a significant decrease in both circulating TPO and platelet-leukocyte aggregation. Elevated TPO contributes to enhance platelet activation and platelet-monocyte cross-talk in cigarette smokers. Copyright 2009 Elsevier Ireland Ltd. All rights reserved.
Ali, Manjoor; Kumar, Amit; Kumar, Mukesh; Pandey, Badri N
2016-04-01
Human serum albumin (HSA), the most abundant soluble protein in blood plays critical roles in transportation of biomolecules and maintenance of osmotic pressure. In view of increasing applications of lanthanides- and actinides-based materials in nuclear energy, space, industries and medical applications, the risk of exposure with these metal ions is a growing concern for human health. In present study, binding interaction of actinides/lanthanides [thorium: Th(IV), uranium: U(VI), lanthanum: La(III), cerium: Ce(III) and (IV)] with HSA and its structural consequences have been investigated. Ultraviolet-visible, Fourier transform-infrared, Raman, Fluorescence and Circular dichroism spectroscopic techniques were applied to study the site of metal ions interaction, binding affinity determination and the effect of metal ions on protein unfolding and HSA conformation. Results showed that these metal ions interacted with carbonyl (CO..:)/amide(N..-H) groups and induced exposure of aromatic residues of HSA. The fluorescence analysis indicated that the actinide binding altered the microenvironment around Trp214 in the subdomain IIA. Binding affinity of U(VI) to HSA was slightly higher than that of Th(IV). Actinides and Ce(IV) altered the secondary conformation of HSA with a significant decrease of α-helix and an increase of β-sheet, turn and random coil structures, indicating a partial unfolding of HSA. A correlation was observed between metal ion's ability to alter HSA conformation and protein unfolding. Both cationic effects and coordination ability of metal ions seemed to determine the consequences of their interaction with HSA. Present study improves our understanding about the protein interaction of these heavy ions and their impact on its secondary structure. In addition, binding characteristics may have important implications for the development of rational antidote for the medical management of health effects of actinides and lanthanides. Copyright © 2016 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.
Chung, C N; Hamaguchi, Y; Honjo, T; Kawaichi, M
1994-01-01
To map regions important for DNA binding of the mouse homologue of Suppressor of Hairless or RBP-J kappa protein, mutated mouse RBP-J kappa cDNAs were made by insertion of oligonucleotide linkers or base replacement. DNA binding assays using the mutated proteins expressed in COS cells showed that various mutations between 218 Arg and 227 Arg decreased the DNA binding activity drastically. The DNA binding activity was not affected by amino acid replacements within the integrase motif of the RBP-J kappa protein (230His-269His). Replacements between 291Arg and 323Tyr affected the DNA binding activity slightly but reproducibly. These results indicate that the region encompassing 218Arg-227Arg is critical for the DNA binding activity of RBP-J kappa. This region did not show any significant homology to motifs or domains of the previously described DNA binding proteins. Using a truncation mutant protein RBP-J kappa was shown to associate with DNA as a monomer. Images PMID:8065905
Six independent fucose-binding sites in the crystal structure of Aspergillus oryzae lectin
DOE Office of Scientific and Technical Information (OSTI.GOV)
Makyio, Hisayoshi; Shimabukuro, Junpei; Suzuki, Tatsuya
The crystal structure of AOL (a fucose-specific lectin of Aspergillus oryzae) has been solved by SAD (single-wavelength anomalous diffraction) and MAD (multi-wavelength anomalous diffraction) phasing of seleno-fucosides. The overall structure is a six-bladed β-propeller similar to that of other fucose-specific lectins. The fucose moieties of the seleno-fucosides are located in six fucose-binding sites. Although the Arg and Glu/Gln residues bound to the fucose moiety are common to all fucose-binding sites, the amino-acid residues involved in fucose binding at each site are not identical. The varying peak heights of the seleniums in the electron density map suggest that each fucose-binding sitemore » has a different carbohydrate binding affinity. - Highlights: • The six-bladed β-propeller structure of AOL was solved by seleno-sugar phasing. • The mode of fucose binding is essentially conserved at all six binding sites. • The seleno-fucosides exhibit slightly different interactions and electron densities. • These findings suggest that the affinity for fucose is not identical at each site.« less
Reaction of hydrogen with Ag(111): binding states, minimum energy paths, and kinetics.
Montoya, Alejandro; Schlunke, Anna; Haynes, Brian S
2006-08-31
The interaction of atomic and molecular hydrogen with the Ag(111) surface is studied using periodic density functional total-energy calculations. This paper focuses on the site preference for adsorption, ordered structures, and energy barriers for H diffusion and H recombination. Chemisorbed H atoms are unstable with respect to the H(2) molecule in all adsorption sites below monolayer coverage. The three-hollow sites are energetically the most favorable for H chemisorption. The binding energy of H to the surface decreases slightly up to one monolayer, suggesting a small repulsive H-H interaction on nonadjacent sites. Subsurface and vacancy sites are energetically less favorable for H adsorption than on-top sites. Recombination of chemisorbed H atoms leads to the formation of gas-phase H(2) with no molecular chemisorbed state. Recombination is an exothermic process and occurs on the bridge site with a pronounced energy barrier. This energy barrier is significantly higher than that inferred from experimental temperature-programmed desorption (TPD) studies. However, there is significant permeability of H atoms through the recombination energy barrier at low temperatures, thus increasing the rate constant for H(2) desorption due to quantum tunneling effects, and improving the agreement between experiment and theory.
Effect of Sb in thick InGaAsSbN layers grown by liquid phase epitaxy
NASA Astrophysics Data System (ADS)
Donchev, V.; Milanova, M.; Asenova, I.; Shtinkov, N.; Alonso-Álvarez, D.; Mellor, A.; Karmakov, Y.; Georgiev, S.; Ekins-Daukes, N.
2018-02-01
Dilute nitride InGaAsSbN layers grown by low-temperature liquid phase epitaxy are studied in comparison with quaternary InGaAsN layers grown at the same growth conditions to understand the effect of Sb in the alloy. The lattice mismatch to the GaAs substrate is found to be slightly larger for the InGaAsSbN layers, which is explained by the large atomic radius of Sb. A reduction of the band gap energy with respect to InGaAsN is demonstrated by means of photoluminescence (PL), surface photovoltage (SPV) spectroscopy and tight-binding calculations. The band-gap energies determined from PL and ellipsometry measurements are in good agreement, while the SPV spectroscopy and the tight-binding calculations provide lower values. Possible reasons for these discrepancies are discussed. The PL spectra reveal localized electronic states in the band gap near the conduction band edge, which is confirmed by SPV spectroscopy. The analysis of the power dependence of the integrated PL has allowed determining the dominant radiative recombination mechanisms in the layers. The values of the refraction index in a wide spectral region are found to be higher for the Sb containing layers.
NASA Astrophysics Data System (ADS)
Sharma, Deepti; Ojha, Himanshu; Pathak, Mallika; Singh, Bhawna; Sharma, Navneet; Singh, Anju; Kakkar, Rita; Sharma, Rakesh K.
2016-08-01
Metformin is a biguanide class of drug used for the treatment of diabetes mellitus. It is well known that serum protein-ligand binding interaction significantly influence the biodistribution of a drug. Current study was performed to characterize the binding mechanism of metformin with serum albumin. The binding interaction of the metformin with bovine serum albumin (BSA) was examined using UV-Vis absorption spectroscopy, fluorescence, circular dichroism, density functional theory and molecular docking studies. Absorption spectra and fluorescence emission spectra pointed out the weak binding of metformin with BSA as was apparent from the slight change in absorbance and fluorescence intensity of BSA in presence of metformin. Circular dichroism study implied the significant change in the conformation of BSA upon binding with metformin. Density functional theory calculations showed that metformin has non-planar geometry and has two energy states. The docking studies evidently signified that metformin could bind significantly to the three binding sites in BSA via hydrophobic, hydrogen bonding and electrostatic interactions. The data suggested the existence of non-covalent specific binding interaction in the complexation of metformin with BSA. The present study will certainly contribute to the development of metformin as a therapeutic molecule.
Repeated seizures induce long-term increase in hippocampal benzodiazepine receptors.
McNamara, J O; Peper, A M; Patrone, V
1980-01-01
Repeated seizures, whether induced by kindling or electroshock, caused a long-lasting (at least 24 hr) increase of [3H]diazepam binding in hippocampal membranes of Sprague-Dawley rats. Scatchard analyses demonstrated that increased numbers of binding sites accounted for the increase. Neither repeated hypoxia nor repeated administration of electrical current without inducing seizures caused an increase of [3H]diazepam binding. Regardless of the method used for seizure induction, the response was graded in that large numbers of seizures were required to induce significant increases, whereas fewer seizures induced only slight increases. We suggest that the receptor increases imply a heightened response to benzodiazepines and more powerful hippocampal recurrent inhibition. PMID:6930682
Correa; Durantini; Silber
1998-12-01
The absorption spectra of N-[2-(trifluoromethyl)-4-nitrophenyl]-4-nitroaniline (1), N-[4-nitrophenyl]-4-nitroaniline (2), and N-[2-nitrophenyl]-4-nitroaniline (3) were analyzed in reversed micelles of AOT (sodium 1,4-bis (2-ethylhexyl sulfosuccinate) in n-hexane and carbon tetrachloride. For 1 and 2 the intensity of the band characteristic for the pure solvent decreases as the AOT concentration increases and a new band develops. This new band is attributed to the solute bound to the micelle. These changes allowed us to determine the binding constant (Kb) between these compounds and AOT. Kb at W0 = [H2O]/[AOT] = 0 in n-hexane varies from 81 for 1 to 5092 for 2. Although similar trends are observed for carbon tetrachloride, the values of Kb are smaller than those for n-hexane. The possible solute-solvent interactions of these compounds were analyzed by means of Taft and Kamlet's solvatochromic comparison method. The strength of binding is interpreted considering their hydrogen-bond donor ability as well as their solubility in the pure solvents. For 1 Kb decreases as W0 is increased, while for 2 no variation was observed. These effects are discussed in terms of nitrodiphenylamine-water competition for interfacial binding sites. Moreover, the effect of the solute size and the presence of the trifluoromethyl group in 1 are important factors to consider in explaining its binding behavior. The spectra of 3 change very little with AOT concentration and only a slight bathochromic shift is observed. Thus, 3 acts as nonhydrogen bond donor solute, merely sensing a slight change in the polarity of its microenvironment. Copyright 1998 Academic Press.
Voltage dependency of transmission probability of aperiodic DNA molecule
NASA Astrophysics Data System (ADS)
Wiliyanti, V.; Yudiarsah, E.
2017-07-01
Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.
The impact of sulphate and magnesium on chloride binding in Portland cement paste
DOE Office of Scientific and Technical Information (OSTI.GOV)
De Weerdt, K., E-mail: klaartje.d.weerdt@ntnu.no; SINTEF Building and Infrastructure, Trondheim; Orsáková, D.
2014-11-15
The effect of magnesium and sulphate present in sea water on chloride binding in Portland cement paste was investigated. Ground well hydrated cement paste was exposed to MgCl{sub 2}, NaCl, NaCl + MgCl{sub 2}, MgSO{sub 4} + MgCl{sub 2} and artificial sea water solutions with a range of concentrations at 20 °C. Chloride binding isotherms are determined and pH of the solutions were measured. A selection of samples was examined by SEM-EDS to identify phase changes upon exposure. The experimental data were compared with calculations of a thermodynamic model. Chloride binding from sea water was similar to chloride binding formore » NaCl solutions. The magnesium content in the sea water lead to a slight decrease in pH, but this did not result in a notable increase in chloride binding. The sulphate present in sea water reduces both chloride binding in C–S–H and AFm phases, as the C–S–H incorporates more sulphates instead of chlorides, and part of the AFm phases converts to ettringite.« less
Complexes of polyadenylic acid and the methyl esters of amino acids
NASA Technical Reports Server (NTRS)
Khaled, M. A.; Mulins, D. W., Jr.; Swindle, M.; Lacey, J. C., Jr.
1983-01-01
A study of amino acid methyl esters binding to polyadenylic acid supports the theory that the genetic code originated through weak but selective affinities between amino acids and nucleotides. NMR, insoluble complex analysis, and ultraviolet spectroscopy are used to illustrate a correlation between the hydrophybicities of A amino acids and their binding constants, which, beginning with the largest, are in the order of Phe (having nominally a hydrophobic AAA anticodon), Ile, Leu, Val and Gly (having a hydrophilic anticodon with no A). In general, the binding constants are twice the values by Reuben and Polk (1980) for monomeric AMP, which suggests that polymer amino acids are interacting with only one base. No real differences are found betwen poly A binding for free Phe, Phe methyl ester or Phe amide, except that the amide value is slightly lower.
Lima, Filipe S; Cuccovia, Iolanda M; Buchner, Richard; Antunes, Filipe E; Lindman, Björn; Miguel, Maria G; Horinek, Dominik; Chaimovich, Hernan
2015-03-10
Dodecyltrimethylammonium triflate (DTATf) micelles possess lower degree of counterion dissociation (α), lower hydration, and higher packing of monomers than other micelles of similar structure. Addition of sodium triflate ([NaTf] > 0.05 M) to DTATf solutions promotes phase separation. This phenomenon is commonly observed in oppositely charged surfactant mixtures, but it is rare for ionic surfactants and relatively simple counterions. While the properties of DTATf have already been reported, the driving forces for the observed phase separation with added salt remain unclear. Thus, we propose an interpretation for the observed phase separation in cationic surfactant solutions. Addition of up to 0.03 M NaTf to micellar DTATf solutions led to a limited increase of the aggregation number, to interface dehydration, and to a progressive decrease in α. The viscosity of DTATf solutions of higher concentration ([DTATf] ≥ 0.06 M) reached a maximum with increasing [NaTf], though the aggregation number slightly increased, and no shape change occurred. We hypothesize that this maximum results from a decrease in interaggregate repulsion, as a consequence of increased ion binding. This reduction in micellar repulsion without simultaneous infinite micellar growth is, probably, the major driving force for phase separation at higher [NaTf].
Henesey, C M; Kellner-Weibel, G L; Tarloff, J B; Harvison, P J
1999-06-01
Disposition of the nephrotoxicant N-(3,5-dichlorophenyl)succinimide (NDPS) was compared with that of a nontoxic analog, N-(3, 5-difluorophenyl)succinimide (DFPS). Male Fischer 344 rats were administered 0.2 or 0.6 mmol/kg [14C]NDPS or [14C]DFPS (i.p. in corn oil). Plasma concentrations were determined from blood samples obtained through the carotid artery. Urine samples were analyzed for metabolite content by HPLC. Rats were sacrificed at 3 h (DFPS) or 6 h (NDPS) and tissue radiolabel content and covalent binding were determined. [14C]NDPS-derived plasma radioactivity levels were 6- to 21-fold higher and peaked later than those from [14C]DFPS. Six hours after dosing, NDPS was 40% eliminated in the urine compared with approximately 90% for DFPS. By 48 h, only 67% of the NDPS dose was eliminated in urine. In contrast, DFPS excretion was virtually complete within 24 h. NDPS underwent oxidative metabolism to a slightly greater extent than DFPS. Distribution of [14C]NDPS-derived radioactivity into the kidneys was 3- to 6-fold higher than that into the liver or heart, and was more extensive than with [14C]DFPS. NDPS also covalently bound to plasma, renal, and hepatic proteins to a greater extent than DFPS. In summary, NDPS achieves higher tissue and plasma concentrations, covalently binds to a greater extent, and is eliminated more slowly than DFPS. Differences in the lipid solubility of NDPS metabolites and DFPS metabolites may help explain these results. The overall greater tissue exposure of NDPS and its metabolites may contribute to differential toxicity of these analogs.
De, Debojyoti; Dutta, Debajyoti; Kundu, Moloy; Mahato, Sourav; Schiavone, Marc T; Chaudhuri, Surabhi; Giri, Ashok; Gupta, Vidya; Bhattacharya, Sanjoy K
2005-01-01
Background Carbon dioxide fixation bioprocess in reactors necessitates recycling of D-ribulose1,5-bisphosphate (RuBP) for continuous operation. A radically new close loop of RuBP regenerating reactor design has been proposed that will harbor enzyme-complexes instead of purified enzymes. These reactors will need binders enabling selective capture and release of sugar and intermediate metabolites enabling specific conversions during regeneration. In the current manuscript we describe properties of proteins that will act as potential binders in RuBP regeneration reactors. Results We demonstrate specific binding of 3-phosphoglycerate (3PGA) and 3-phosphoglyceraldehyde (3PGAL) from sugar mixtures by inactive mutant of yeast enzymes phosphoglycerate mutase and enolase. The reversibility in binding with respect to pH and EDTA has also been shown. No chemical conversion of incubated sugars or sugar intermediate metabolites were found by the inactive enzymatic proteins. The dissociation constants for sugar metabolites are in the micromolar range, both proteins showed lower dissociation constant (Kd) for 3-phosphoglycerate (655–796 μM) compared to 3-phosphoglyceraldehyde (822–966 μM) indicating higher affinity for 3PGA. The proteins did not show binding to glucose, sucrose or fructose within the sensitivity limits of detection. Phosphoglycerate mutase showed slightly lower stability on repeated use than enolase mutants. Conclusions The sugar and their intermediate metabolite binders may have a useful role in RuBP regeneration reactors. The reversibility of binding with respect to changes in physicochemical factors and stability when subjected to repeated changes in these conditions are expected to make the mutant proteins candidates for in-situ removal of sugar intermediate metabolites for forward driving of specific reactions in enzyme-complex reactors. PMID:15689239
Iovescu, Alina; Băran, Adriana; Stîngă, Gabriela; Cantemir-Leontieş, Anca Ruxandra; Maxim, Monica Elisabeta; Anghel, Dan Florin
2015-12-01
The study systematically investigates aqueous mixtures of fixed bovine serum albumin (BSA) and various ethoxylated nonionic surfactants belonging to a homologous series or not. Mono-disperse tetra-(C12E4), hexa-(C12E6) and octa-ethyleneglycol mono-n-dodecyl ether (C12E8), and poly-disperse eicosa-ethyleneglycol mono-n-tetradecyl ether (C14EO20) are respectively employed. Fluorescence and circular dichroism measurements are performed at surfactant/protein molar ratios (rm)s lower and higher than one. We aim to get new insights into the binding mechanism of these species and to differentiate among the interaction abilities of these surfactants. The relative magnitude of the binding thermodynamic parameters by fluorescence, and the increase of α-helix prove that hydrogen bonding drives the interaction next to the hydrophobic attraction. C12En (n=4,6,8) develop more H bonds with the albumin than C14EO20 owing to a zigzag conformation of their short ethyleneoxide chains. Among the homologous surfactants, C12E6 has a slightly stronger interaction with BSA due to a maximal number of H bonds at a minimal hindering. Static fluorescence and dynamic fluorescence indicate an inter-conversion between the tryptophan (Trp) rotamers which happens around the surfactants critical micellar concentration. For C14EO20, the meander conformation of the polar group determines a less evident conversion of the Trp rotamers and smaller α-helix rise. Binding isotherms of the homologous surfactants and the fluorescence quenching mechanism by C12E6 are also provided. Copyright © 2015 Elsevier B.V. All rights reserved.
Cichocki, Michal; Paluszczak, Jaroslaw; Szaefer, Hanna; Piechowiak, Adriana; Rimando, Agnes M; Baer-Dubowska, Wanda
2008-06-01
Resveratrol, a phytoalexin present in grapes, has been reported to inhibit multistage mouse skin carcinogenesis. Recent studies showed that topically applied resveratrol significantly inhibited cyclooxygenase-2 (COX-2) expression and activation of nuclear factor-kappaB (NF-kappaB) induced by tumor promoter 12-O-tetradecanoylphorbol-13-acetate (TPA) in mouse epidermis. The aim of the present study was to further explore the effect of resveratrol on TPA-induced signaling pathways in mouse epidermis and to compare with its dimethylether, pterostilbene. Resveratrol and pterostilbene significantly reduced activator protein 1 (AP-1) and NF-kappaB activation. In the case of AP-1, the binding of c-Jun subunit was particularly affected, while only slight effect on c-Fos binding to TPA-responsive element (AP-1 binding consensus sequence) (TRE) site was observed. Both stilbenes inhibited the activation of NF-kappaB by blocking the translocation of p65 to the nucleus and increasing the retention of IkappaBa in the cytosol. The latter might be related to decreased activity of IkappaB kinase and/or proteasome 20S. Reduced activation of transcription factors decreased the expression and activity of COX-2 and inducible nitric oxide synthase (iNOS). In most assays, pterostilbene was either equally or significantly more potent than resveratrol. Pterostilbene might show higher biological activity due to its possible better bioavailability, since substitution of hydroxy with methoxy group increases lipophilicity.
NASA Astrophysics Data System (ADS)
Resende, Stella M.; De Almeida, Wagner B.; van Duijneveldt-van de Rijdt, Jeanne G. C. M.; van Duijneveldt, Frans B.
2001-08-01
Geometrical parameters for the equilibrium (MIN) and lowest saddle-point (TS) geometries of the C2H4⋯SO2 dimer, and the corresponding binding energies, were calculated using the Hartree-Fock and correlated levels of ab initio theory, in basis sets ranging from the D95(d,p) double-zeta basis set to the aug-cc-pVQZ correlation consistent basis set. An assessment of the effect of the basis set superposition error (BSSE) on these results was made. The dissociation energy from the lowest vibrational state was estimated to be 705±100 cm-1 at the basis set limit, which is well within the range expected from experiment. The barrier to internal rotation was found to be 53±5 cm-1, slightly higher than the (revised) experimental result of 43 cm-1, probably due to zero-point vibrational effects. Our results clearly show that, in direct contrast with recent ideas, the BSSE correction affects differentially the MIN and TS binding energies and so has to be included in the calculation of small energy barriers such as that in the C2H4⋯SO2 dimer. Previous reports of positive MP2 frozen-core binding energies for this complex in basis D95(d,p) are confirmed. The anomalies are shown to be an artifact arising from an incorrect removal of virtual orbitals by the default frozen-core option in the GAUSSIAN program.
NASA Astrophysics Data System (ADS)
Basyuni, M.; Sulistiyono, N.; Wati, R.; Sumardi; Oku, H.; Baba, S.; Sagami, H.
2018-03-01
Cloning of Kandelia obovata KcCAS gene (previously known as Kandelia candel) and Rhizophora stylosa RsCAS have already have been reported and encoded cycloartenol synthases. In this study, the predicted KcCAS and RsCAS protein were analyzed using online software of Phyre2 and Swiss-model. The protein modelling for KcCAS and RsCAS cycloartenol synthases was determined using Pyre2 had similar results with slightly different in sequence identity. By contrast, the Swiss-model for KcCAS slightly had higher sequence identity (47.31%) and Qmean (0.70) compared to RsCAS. No difference of ligands binding site which is considered as modulators for both cycloartenol synthases. The range of predicted protein derived from 91-757 amino acid residues with coverage sequence similarities 0.86, respectively from template model of lanosterol synthase from the human. Homology modelling revealed that 706 residues (93% of the amino acid sequence) had been modelled with 100.0% confidence by the single highest scoring template for both KcCAS and RsCAS using Phyre2. This coverage was more elevated than swiss-model predicted (86%). The present study suggested that both genes are responsible for the genesis of cycloartenol in these mangrove plants.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Palacios, J.M.; Chinaglia, G.; Rigo, M.
1991-02-01
Autoradiographic techniques were used to examine the distribution and levels of neurotensin receptor binding sites in the basal ganglia and related regions of the human brain. Monoiodo ({sup 125}I-Tyr3)neurotensin was used as a ligand. High amounts of neurotensin receptor binding sites were found in the substantia nigra pars compacta. Lower but significant quantities of neurotensin receptor binding sites characterized the caudate, putamen, and nucleus accumbens, while very low quantities were seen in both medial and lateral segments of the globus pallidus. In Huntington's chorea, the levels of neurotensin receptor binding sites were found to be comparable to those of controlmore » cases. Only slight but not statistically significant decreases in amounts of receptor binding sites were detected in the dorsal part of the head and in the body of caudate nucleus. No alterations in the levels of neurotensin receptor binding sites were observed in the substantia nigra pars compacta and reticulata. These results suggest that a large proportion of neurotensin receptor binding sites in the basal ganglia are located on intrinsic neurons and on extrinsic afferent fibers that do not degenerate in Huntington's disease.« less
Ligand binding and dynamics of the monomeric epidermal growth factor receptor ectodomain
Loeffler, Hannes H; Winn, Martyn D
2013-01-01
The ectodomain of the human epidermal growth factor receptor (hEGFR) controls input to several cell signalling networks via binding with extracellular growth factors. To gain insight into the dynamics and ligand binding of the ectodomain, the hEGFR monomer was subjected to molecular dynamics simulation. The monomer was found to be substantially more flexible than the ectodomain dimer studied previously. Simulations where the endogeneous ligand EGF binds to either Subdomain I or Subdomain III, or where hEGFR is unbound, show significant differences in dynamics. The molecular mechanics Poisson–Boltzmann surface area method has been used to derive relative free energies of ligand binding, and we find that the ligand is capable of binding either subdomain with a slight preference for III. Alanine-scanning calculations for the effect of selected ligand mutants on binding reproduce the trends of affinity measurements. Taken together, these results emphasize the possible role of the ectodomain monomer in the initial step of ligand binding, and add details to the static picture obtained from crystal structures. Proteins 2013; 81:1931–1943. © 2013 The Authors. Proteins published by Wiley Periodicals, Inc. PMID:23760854
Kaniowski, Damian; Ebenryter-Olbińska, Katarzyna; Sobczak, Milena; Wojtczak, Błażej; Janczak, Sławomir; Leśnikowski, Zbigniew J; Nawrot, Barbara
2017-08-23
Boron cluster-modified therapeutic nucleic acids with improved properties are of interest in gene therapy and in cancer boron neutron capture therapy (BNCT). High metallacarborane-loaded antisense oligonucleotides (ASOs) targeting epidermal growth factor receptor (EGFR) were synthesized through post-synthetic Cu (I)-assisted "click" conjugation of alkyne-modified DNA-oligonucleotides with a boron cluster alkyl azide component. The obtained oligomers exhibited increased lipophilicity compared to their non-modified precursors, while their binding affinity to complementary DNA and RNA strands was slightly decreased. Multiple metallacarborane residues present in the oligonucleotide chain, each containing 18 B-H groups, enabled the use of IR spectroscopy as a convenient analytical method for these oligomers based on the diagnostic B-H signal at 2400-2650 cm -1 . The silencing activity of boron cluster-modified ASOs used at higher concentrations was similar to that of unmodified oligonucleotides. The screened ASOs, when used in low concentrations (up to 50 μM), exhibited pro-oxidative properties by inducing ROS production and an increase in mitochondrial activities in HeLa cells. In contrast, when used at higher concentrations, the ASOs exhibited anti-oxidative properties by lowering ROS species levels. In the HeLa cells (tested in the MTT assay) treated (without lipofectamine) or transfected with the screened compounds, the mitochondrial activity remained equal to the control level or only slightly changed (±30%). These findings may be useful in the design of dual-action boron cluster-modified therapeutic nucleic acids with combined antisense and anti-oxidant properties.
Molecular Dynamics Investigation of the Substrate Binding Mechanism in Carboxylesterase
Chen, Qi; Luan, Zheng-Jiao; Cheng, Xiaolin; ...
2015-02-25
A recombinant carboxylesterase, cloned from Pseudomonas putida and designated as rPPE, is capable of catalyzing the bioresolution of racemic 2-acetoxy-2-(2 -chlorophenyl)acetate (rac-AcO-CPA) with excellent (S)-enantioselectivity. Semi-rational design of the enzyme showed that the W187H variant could increase the activity by ~100-fold compared to the wild type (WT) enzyme. In this study, we performed all-atom molecular dynamics (MD) simulations of both apo-rPPE and rPPE in complex with (S)-AcO-CPA to gain insights into the origin of the increased catalysis in the W187H mutant. Moreover, our results show differential binding of (S)-AcO-CPA in the WT and W187H enzymes, especially the interactions of themore » substrate with the two active site residues Ser159 and His286. The replacement of Trp187 by His leads to considerable structural rearrangement in the active site of W187H. Unlike in the WT rPPE, the cap domain in the W187 mutant shows an open conformation in the simulations of both apo and substrate-bound enzymes. This open conformation exposes the catalytic triad to the solvent through a water accessible channel, which may facilitate the entry of the substrate and/or the exit of the product. Binding free energy calculations confirmed that the substrate binds more strongly in W187H than in WT. Based on these computational results, furthermore, we predicted that the mutations W187Y and D287G might also be able to increase the substrate binding, thus improve the enzyme s catalytic efficiency. Experimental binding and kinetic assays on W187Y and D287G show improved catalytic efficiency over WT, but not W187H. Contrary to our prediction, W187Y shows slightly decreased substrate binding coupled with a 100 fold increase in turn-over rate, while in D287G the substrate binding is 8 times stronger but with a slightly reduced turn-over rate. Finally, our work provides important molecular-level insights into the binding of the (S)-AcO-CPA substrate to carboxylesterase rPPEs, which will help guide future development of more efficient rPPE variants.« less
Molecular Dynamics Investigation of the Substrate Binding Mechanism in Carboxylesterase
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chen, Qi; Luan, Zheng-Jiao; Cheng, Xiaolin
A recombinant carboxylesterase, cloned from Pseudomonas putida and designated as rPPE, is capable of catalyzing the bioresolution of racemic 2-acetoxy-2-(2 -chlorophenyl)acetate (rac-AcO-CPA) with excellent (S)-enantioselectivity. Semi-rational design of the enzyme showed that the W187H variant could increase the activity by ~100-fold compared to the wild type (WT) enzyme. In this study, we performed all-atom molecular dynamics (MD) simulations of both apo-rPPE and rPPE in complex with (S)-AcO-CPA to gain insights into the origin of the increased catalysis in the W187H mutant. Moreover, our results show differential binding of (S)-AcO-CPA in the WT and W187H enzymes, especially the interactions of themore » substrate with the two active site residues Ser159 and His286. The replacement of Trp187 by His leads to considerable structural rearrangement in the active site of W187H. Unlike in the WT rPPE, the cap domain in the W187 mutant shows an open conformation in the simulations of both apo and substrate-bound enzymes. This open conformation exposes the catalytic triad to the solvent through a water accessible channel, which may facilitate the entry of the substrate and/or the exit of the product. Binding free energy calculations confirmed that the substrate binds more strongly in W187H than in WT. Based on these computational results, furthermore, we predicted that the mutations W187Y and D287G might also be able to increase the substrate binding, thus improve the enzyme s catalytic efficiency. Experimental binding and kinetic assays on W187Y and D287G show improved catalytic efficiency over WT, but not W187H. Contrary to our prediction, W187Y shows slightly decreased substrate binding coupled with a 100 fold increase in turn-over rate, while in D287G the substrate binding is 8 times stronger but with a slightly reduced turn-over rate. Finally, our work provides important molecular-level insights into the binding of the (S)-AcO-CPA substrate to carboxylesterase rPPEs, which will help guide future development of more efficient rPPE variants.« less
Ni, Wen; Liu, Xiaohua; Tan, Lifeng
2018-05-24
Two chiral ruthenium(II) complexes containing ligand dppz-CO 2 Me (dppz-11-CO 2 Me = dipyrido[3,2-a,2',3'-c]phenazine-11-carboxylic acid methyl ester), Δ-[Ru(bpy) 2 dppz-11-CO 2 Me] 2+ (bpy = 2,2'-bipyridine; Δ-1) and Λ-[Ru(bpy) 2 dppz-11-CO 2 Me] 2+ (Λ-1), were synthesized and characterized. The binding of the two enantiomers with the triplex RNA poly(U)•poly(A)*poly(U) was carried out by various biophysical techniques. Analysis of the absorption and fluorescence features indicates that the binding strengths of the two enantiomers toward the triplex RNA differ only slightly from each other. The total increase in viscosity and shape of the curves for the triplex RNA with Λ-1 is similar to that with Δ-1, suggesting the binding modes of two enantiomers with the triplex RNA are intercalation. Thermal melting measurements indicate that the stabilization effects clearly depended on the concentrations of Λ-1 and Δ-1. However, the third-strand stabilizing effect of Δ-1 dramatically differs from that of Λ-1 when they interact with the chiral environment of the RNA triple at pH = 7.0 and [Na + ] = 35 mM. Combined with the CD (CD = circular dichroism) variations of the triplex RNA with either Λ-1 or Δ-1, the reason for their different triplex stabilization effects may originate from the two enantiomers through different orientations intercalating into nucleobases of the triplex. In addition, effects of higher ionic strengths on the triplex stabilization in the absence and presence of the two enantiomers have also been studied. The results presented here may be useful for understanding the binding properties of the triplex RNA with small molecule, particularly chiral ruthenium(II) complexes. Copyright © 2018 Elsevier Inc. All rights reserved.
Structure and Dynamics Analysis on Plexin-B1 Rho GTPase Binding Domain as a Monomer and Dimer
2015-01-01
Plexin-B1 is a single-pass transmembrane receptor. Its Rho GTPase binding domain (RBD) can associate with small Rho GTPases and can also self-bind to form a dimer. In total, more than 400 ns of NAMD molecular dynamics simulations were performed on RBD monomer and dimer. Different analysis methods, such as root mean squared fluctuation (RMSF), order parameters (S2), dihedral angle correlation, transfer entropy, principal component analysis, and dynamical network analysis, were carried out to characterize the motions seen in the trajectories. RMSF results show that after binding, the L4 loop becomes more rigid, but the L2 loop and a number of residues in other regions become slightly more flexible. Calculating order parameters (S2) for CH, NH, and CO bonds on both backbone and side chain shows that the L4 loop becomes essentially rigid after binding, but part of the L1 loop becomes slightly more flexible. Backbone dihedral angle cross-correlation results show that loop regions such as the L1 loop including residues Q25 and G26, the L2 loop including residue R61, and the L4 loop including residues L89–R91, are highly correlated compared to other regions in the monomer form. Analysis of the correlated motions at these residues, such as Q25 and R61, indicate two signal pathways. Transfer entropy calculations on the RBD monomer and dimer forms suggest that the binding process should be driven by the L4 loop and C-terminal. However, after binding, the L4 loop functions as the motion responder. The signal pathways in RBD were predicted based on a dynamical network analysis method using the pathways predicted from the dihedral angle cross-correlation calculations as input. It is found that the shortest pathways predicted from both inputs can overlap, but signal pathway 2 (from F90 to R61) is more dominant and overlaps all of the routes of pathway 1 (from F90 to P111). This project confirms the allosteric mechanism in signal transmission inside the RBD network, which was in part proposed in the previous experimental study. PMID:24901636
Structural analysis of binding functionality of folic acid-PEG dendrimers against folate receptor.
Sampogna-Mireles, Diana; Araya-Durán, Ingrid D; Márquez-Miranda, Valeria; Valencia-Gallegos, Jesús A; González-Nilo, Fernando D
2017-03-01
Dendrimers functionalized with folic acid (FA) are drug delivery systems that can selectively target cancer cells with folate receptors (FR-α) overexpression. Incorporation of polyethylene glycol (PEG) can enhance dendrimers solubility and pharmacokinetics, but ligand-receptor binding must not be affected. In this work we characterized, at atomic level, the binding functionality of conventional site-specific dendrimers conjugated with FA with PEG 750 or PEG 3350 as a linker. After Molecular Dynamics simulation, we observed that both PEG's did not interfere over ligand-receptor binding functionality. Although binding kinetics could be notably affected, the folate fragment from both dendrimers remained exposed to the solvent before approaching selectively to FR-α. PEG 3350 provided better solubility and protection from enzymatic degradation to the dendrimer than PEG 750. Also, FA-PEG3350 dendrimer showed a slightly better interaction with FR-α than FA-PEG750 dendrimer. Therefore, theoretical evidence supports that both dendrimers are suitable as drug delivery systems for cancer therapies. Copyright © 2017 Elsevier Inc. All rights reserved.
Fang, Chong; Nagy-Staroń, Anna; Grafe, Martin; Heermann, Ralf; Jung, Kirsten; Gebhard, Susanne; Mascher, Thorsten
2017-04-01
BceRS and PsdRS are paralogous two-component systems in Bacillus subtilis controlling the response to antimicrobial peptides. In the presence of extracellular bacitracin and nisin, respectively, the two response regulators (RRs) bind their target promoters, P bceA or P psdA , resulting in a strong up-regulation of target gene expression and ultimately antibiotic resistance. Despite high sequence similarity between the RRs BceR and PsdR and their known binding sites, no cross-regulation has been observed between them. We therefore investigated the specificity determinants of P bceA and P psdA that ensure the insulation of these two paralogous pathways at the RR-promoter interface. In vivo and in vitro analyses demonstrate that the regulatory regions within these two promoters contain three important elements: in addition to the known (main) binding site, we identified a linker region and a secondary binding site that are crucial for functionality. Initial binding to the high-affinity, low-specificity main binding site is a prerequisite for the subsequent highly specific binding of a second RR dimer to the low-affinity secondary binding site. In addition to this hierarchical cooperative binding, discrimination requires a competition of the two RRs for their respective binding site mediated by only slight differences in binding affinities. © 2016 John Wiley & Sons Ltd.
Capture of Pb2+ and Cu2+ Metal Cations by Neisseria meningitidis-type Capsular Polysaccharides.
Ghimire, Sujan; McCarthy, Pumtiwitt C
2018-05-05
Heavy metal pollution of water is a significant environmental and public health concern. Current biological strategies for heavy metal removal from water are performed using microbial biopolymers, including polysaccharides, that are already fully formed. This creates limitations in adapting polysaccharides to increase binding affinity for specific metals. We propose that altering the specificity of polysaccharide-producing enzymes could be beneficial to improving metal capture by modified polysaccharides. We assess binding of Cu 2+ and Pb 2+ metal cations to Neisseria meningitidis -type polysaccharides. All concentrations of metal cations tested were able to completely bind to colominic acid. This polymer is equivalent to the capsular polysaccharide of N. meningitidis serogroup B comprised of a homopolymer of negatively charged sialic acid. There was slightly less binding observed with N. meningitidis serogroup W, which contains repeating units of the neutral sugar galactose and sialic acid. Our work represents the first assessment of the metal-binding properties of these capsular polysaccharides. Future work will seek to optimize metal-binding with Neisseria meningitidis serogroup W polysaccharide.
Inhibition of ferric ion to oxalate oxidase shed light on the substrate binding site.
Pang, Yu; Lan, Wanjun; Huang, Xuelei; Zuo, Guanke; Liu, Hui; Zhang, Jingyan
2015-10-01
Oxalate oxidase (OxOx), a well known enzyme catalyzes the cleavage of oxalate to carbon dioxide with reduction of dioxygen to hydrogen peroxide, however its catalytic process is not well understood. To define the substrate binding site, interaction of Fe(3+) ions with OxOx was systemically investigated using biochemical method, circular dichrosim spectroscopy, microscale thermophoresis, and computer modeling. We demonstrated that Fe(3+) is a non-competitive inhibitor with a milder binding affinity to OxOx, and the secondary structure of the OxOx was slightly altered upon its binding. On the basis of the structural properties of the OxOx and its interaction with Fe(3+) ions, two residue clusters of OxOx were assigned as potential Fe(3+) binding sites, the mechanism of the inhibition of Fe(3+) was delineated. Importantly, the residues that interact with Fe(3+) ions are involved in the substrate orienting based on computer docking. Consequently, the interaction of OxOx with Fe(3+) highlights insight into substrate binding site in OxOx.
Šukalović, V; Roglić, G; Husinec, S; Kostić-Rajaćić, S; Andrić, D; Šoškić, Vukić
2003-11-01
Several tertiary 2-phenylethyl, 2-(1-naphthyl)ethyl and 2-(2-naphthyl)ethyl amines were synthesized and their binding affinities for dopamine D(1), D(2) and serotonin 5-HT(1A) receptors evaluated in radioligand binding assays. All compounds were inactive in D(1) dopamine radioligand binding assay. The 2-(1-naphthyl)ethyl analogues expressed a low but significant binding affinity for the D(2) and moderate one for the 5-HT(1A) receptor subtypes. Most of the remaining compounds expressed binding affinity at the 5-HT(1A) receptor subtype but were inactive in D(2) receptor binding assay. Based on these results and considering the chemical characteristics of the compounds synthesized and evaluated for dopaminergic and serotonergic activity throughout the present study it can be concluded that hydrophobic type of interaction (stacking or edge-to-face) plays a significant role in the formation of receptor-ligand complexes of 2-(1-naphthyl)ethyl amines. This structural motive can be applied to design and synthesize new, more potent dopaminergic/serotonergic ligands by slight chemical modifications.
RNA aptamers that functionally interact with green fluorescent protein and its derivatives
Shui, Bo; Ozer, Abdullah; Zipfel, Warren; Sahu, Nevedita; Singh, Avtar; Lis, John T.; Shi, Hua; Kotlikoff, Michael I.
2012-01-01
Green Fluorescent Protein (GFP) and related fluorescent proteins (FPs) have been widely used to tag proteins, allowing their expression and subcellular localization to be examined in real time in living cells and animals. Similar fluorescent methods are highly desirable to detect and track RNA and other biological molecules in living cells. For this purpose, we have developed a group of RNA aptamers that bind GFP and related proteins, which we term Fluorescent Protein-Binding Aptamers (FPBA). These aptamers bind GFP, YFP and CFP with low nanomolar affinity and binding decreases GFP fluorescence, whereas slightly augmenting YFP and CFP brightness. Aptamer binding results in an increase in the pKa of EGFP, decreasing the 475 nm excited green fluorescence at a given pH. We report the secondary structure of FPBA and the ability to synthesize functional multivalent dendrimers. FPBA expressed in live cells decreased GFP fluorescence in a valency-dependent manner, indicating that the RNA aptamers function within cells. The development of aptamers that bind fluorescent proteins with high affinity and alter their function, markedly expands their use in the study of biological pathways. PMID:22189104
Li, Richard Y.; Di Felice, Rosa; Rohs, Remo; Lidar, Daniel A.
2018-01-01
Transcription factors regulate gene expression, but how these proteins recognize and specifically bind to their DNA targets is still debated. Machine learning models are effective means to reveal interaction mechanisms. Here we studied the ability of a quantum machine learning approach to predict binding specificity. Using simplified datasets of a small number of DNA sequences derived from actual binding affinity experiments, we trained a commercially available quantum annealer to classify and rank transcription factor binding. The results were compared to state-of-the-art classical approaches for the same simplified datasets, including simulated annealing, simulated quantum annealing, multiple linear regression, LASSO, and extreme gradient boosting. Despite technological limitations, we find a slight advantage in classification performance and nearly equal ranking performance using the quantum annealer for these fairly small training data sets. Thus, we propose that quantum annealing might be an effective method to implement machine learning for certain computational biology problems. PMID:29652405
Yoo, Chang Geun; Li, Mi; Meng, Xianzhi; ...
2017-04-05
Lignin offers structural support and protection for plant cell walls; but, it also contributes to biomass recalcitrance and the costs of biofuel production via the biological pathway. Organosolv and ammonia pretreatments have been developed to reduce biomass recalcitrance and improve sugar release performance during enzymatic hydrolysis. It is believed that lignin properties are related to its inhibition on enzymatic hydrolysis; therefore, understanding the characteristics of lignin is a key for effective biomass conversion to biofuels. In this study, an organosolv pretreatment using 60% ethanol with 1.25% H 2SO 4 significantly deconstructed poplar lignin and reduced its molecular weights due tomore » the cleavage of lignin inter-unit linkages. The organosolv pretreatment increased the contents of phenolic OH units and the lignin residue showed a high cellulase maximum adsorption capacity. Ammonia pretreatment with 5% ammonium hydroxide was not as effective as organosolv pretreatment on lignin deconstruction. Organosolv lignin residue had lower lignin S/G ratio than the untreated one. Furthermore, when compared to the organosolv lignin residue and untreated lignin, ammonia lignin residue had a higher cellulase adsorption affinity. In addition, the effects of lignin on cellulose hydrolysis was investigated and the results suggested that the presence of lignin with cellulose substrates reduced cellulose hydrolysis, and its inhibitory effect was primarily determined by the lignin properties after each pretreatment. The organosolv pretreatment resulted in a slightly lower cellulase binding strength (249.7 mL g -1) on poplar lignin than that on untreated samples (261.1 mL g -1), while ammonia lignin residue showed a higher cellulase binding strength (402.8 mL g -1) and had more significant inhibition effect on cellulose hydrolysis. Our results demonstrated that the binding strength significantly affected the lignin-derived inhibition on enzymatic hydrolysis of cellulose in the cellulose-lignin mixtures.« less
Georis, J.; de Lemos Esteves, F.; Lamotte-Brasseur, J.; Bougnet, V.; Devreese, B.; Giannotta, F.; Granier, B.; Frère, J. M.
2000-01-01
In a general approach to the understanding of protein adaptation to high temperature, molecular models of the closely related mesophilic Streptomyces sp. S38 Xyl1 and thermophilic Thermomonospora fusca TfxA family 11 xylanases were built and compared with the three-dimensional (3D) structures of homologous enzymes. Some of the structural features identified as potential contributors to the higher thermostability of TfxA were introduced in Xyl1 by site-directed mutagenesis in an attempt to improve its thermostability and thermophilicity. A new Y11-Y16 aromatic interaction, similar to that present in TfxA and created in Xyl1 by the T11Y mutation, improved both the thermophilicity and thermostability. Indeed, the optimum activity temperature (70 vs. 60 degrees C) and the apparent Tm were increased by about 9 degrees C, and the mutant was sixfold more stable at 57 degrees C. The combined mutations A82R/F168H/N169D/delta170 potentially creating a R82-D169 salt bridge homologous to that present in TfxA improved the thermostability but not the thermophilicity. Mutations R82/D170 and S33P seemed to be slightly destabilizing and devoid of influence on the optimal activity temperature of Xyl1. Structural analysis revealed that residues Y11 and Y16 were located on beta-strands B1 and B2, respectively. This interaction should increase the stability of the N-terminal part of Xyl1. Moreover, Y11 and Y16 seem to form an aromatic continuum with five other residues forming putative subsites involved in the binding of xylan (+3, +2, +1, -1, -2). Y11 and Y16 might represent two additional binding subsites (-3, -4) and the T11Y mutation could thus improve substrate binding to the enzyme at higher temperature and thus the thermophilicity of Xyl1. PMID:10752608
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yoo, Chang Geun; Li, Mi; Meng, Xianzhi
Lignin offers structural support and protection for plant cell walls; but, it also contributes to biomass recalcitrance and the costs of biofuel production via the biological pathway. Organosolv and ammonia pretreatments have been developed to reduce biomass recalcitrance and improve sugar release performance during enzymatic hydrolysis. It is believed that lignin properties are related to its inhibition on enzymatic hydrolysis; therefore, understanding the characteristics of lignin is a key for effective biomass conversion to biofuels. In this study, an organosolv pretreatment using 60% ethanol with 1.25% H 2SO 4 significantly deconstructed poplar lignin and reduced its molecular weights due tomore » the cleavage of lignin inter-unit linkages. The organosolv pretreatment increased the contents of phenolic OH units and the lignin residue showed a high cellulase maximum adsorption capacity. Ammonia pretreatment with 5% ammonium hydroxide was not as effective as organosolv pretreatment on lignin deconstruction. Organosolv lignin residue had lower lignin S/G ratio than the untreated one. Furthermore, when compared to the organosolv lignin residue and untreated lignin, ammonia lignin residue had a higher cellulase adsorption affinity. In addition, the effects of lignin on cellulose hydrolysis was investigated and the results suggested that the presence of lignin with cellulose substrates reduced cellulose hydrolysis, and its inhibitory effect was primarily determined by the lignin properties after each pretreatment. The organosolv pretreatment resulted in a slightly lower cellulase binding strength (249.7 mL g -1) on poplar lignin than that on untreated samples (261.1 mL g -1), while ammonia lignin residue showed a higher cellulase binding strength (402.8 mL g -1) and had more significant inhibition effect on cellulose hydrolysis. Our results demonstrated that the binding strength significantly affected the lignin-derived inhibition on enzymatic hydrolysis of cellulose in the cellulose-lignin mixtures.« less
14-O-Methylmorphine: A Novel Selective Mu-Opioid Receptor Agonist with High Efficacy and Affinity.
Zádor, Ferenc; Balogh, Mihály; Váradi, András; Zádori, Zoltán S; Király, Kornél; Szűcs, Edina; Varga, Bence; Lázár, Bernadette; Hosztafi, Sándor; Riba, Pál; Benyhe, Sándor; Fürst, Susanna; Al-Khrasani, Mahmoud
2017-11-05
14-O-methyl (14-O-Me) group in morphine-6-O-sulfate (M6SU) or oxymorphone has been reported to be essential for enhanced affinity, potency and antinociceptive effect of these opioids. Herein we report on the pharmacological properties (potency, affinity and efficacy) of the new compound, 14-O-methylmorphine (14-O-MeM) in in vitro. Additionally, we also investigated the antinociceptive effect of the novel compound, as well as its inhibitory action on gastrointestinal transit in in vivo. The potency and efficacy of test compound were measured by [ 35 S]GTPγS binding, isolated mouse vas deferens (MVD) and rat vas deferens (RVD) assays. The affinity of 14-O-MeM for opioid receptors was assessed by radioligand binding and MVD assays. The antinociceptive and gastrointestinal effects of the novel compound were evaluated in the rat tail-flick test and charcoal meal test, respectively. Morphine, DAMGO, Ile 5,6 deltorphin II, deltorphin II and U-69593 were used as reference compounds. 14-O-MeM showed higher efficacy (E max ) and potency (EC 50 ) than morphine in MVD, RVD or [ 35 S]GTPγS binding. In addition, 14-O-MeM compared to morphine showed higher affinity for μ-opioid receptor (MOR). In vivo, in rat tail-flick test 14-O-MeM proved to be stronger antinociceptive agent than morphine after peripheral or central administration. Additionally, both compounds inhibited the gastrointestinal peristalsis. However, when the antinociceptive and antitransit doses for each test compound are compared, 14-O-MeM proved to have slightly more favorable pharmacological profile. Our results affirm that 14-O-MeM, an opioid of high efficacy and affinity for MOR can be considered as a novel analgesic agent of potential clinical value. Copyright © 2017 Elsevier B.V. All rights reserved.
Singh, Naveen Kumar; DSouza, Roy N; Bibi, Noor Shad; Fernández-Lahore, Marcelo
2015-01-01
Immobilized metal-ion affinity chromatography (IMAC) has been developed for the rapid isolation and purification of recombinant proteins. In this chapter, megaporous cryogels were synthesized having metal-ion affinity functionality, and their adsorptive properties were investigated. These cryogels have large pore sizes ranging from 10 to 100 μm with corresponding porosities between 80 and 90%. The synthesized IMAC-cryogel had a total ligand density of 770 μmol/g. Twelve milligram of a His6-tagged protein (NAD(P)H-dependent 2-cyclohexen-1-one-reductase) can be purified from a crude cell extract per gram of IMAC-cryogels. The protein binding capacity is increased with higher degrees of grafting, although a slight decrease in column efficiency may result. This chapter provides methodologies for a rapid single-step purification of recombinant His6-tagged proteins from crude cell extracts using IMAC-cryogels.
Niedermoser, Sabrina; Chin, Joshua; Wängler, Carmen; Kostikov, Alexey; Bernard-Gauthier, Vadim; Vogler, Nils; Soucy, Jean-Paul; McEwan, Alexander J; Schirrmacher, Ralf; Wängler, Björn
2015-07-01
Radiolabeled peptides for tumor imaging with PET that can be produced with kits are currently in the spotlight of radiopharmacy and nuclear medicine. The diagnosis of neuroendocrine tumors in particular has been a prime example for the usefulness of peptides labeled with a variety of different radionuclides. Among those, (68)Ga and (18)F stand out because of the ease of radionuclide introduction (e.g., (68)Ga isotope) or optimal nuclide properties for PET imaging (slightly favoring the (18)F isotope). The in vivo properties of good manufacturing practice-compliant, newly developed kitlike-producible (18)F-SiFA- and (18)F-SiFAlin- (SiFA = silicon-fluoride acceptor) modified TATE derivatives were compared with the current clinical gold standard (68)Ga-DOTATATE for high-quality imaging of somatostatin receptor-bearing tumors. SiFA- and SiFAlin-derivatized somatostatin analogs were synthesized and radiolabeled using cartridge-based dried (18)F and purified via a C18 cartridge (radiochemical yield 49.8% ± 5.9% within 20-25 min) without high-performance liquid chromatography purification. Tracer lipophilicity and stability in human serum were tested in vitro. Competitive receptor binding affinity studies were performed using AR42J cells. The most promising tracers were evaluated in vivo in an AR42J xenograft mouse model by ex vivo biodistribution and in vivo PET/CT imaging studies for evaluation of their pharmacokinetic profiles, and the results were compared with those of the current clinical gold standard (68)Ga-DOTATATE. Synthetically easily accessible (18)F-labeled silicon-fluoride acceptor-modified somatostatin analogs were developed. They exhibited high binding affinities to somatostatin receptor-positive tumor cells (1.88-14.82 nM). The most potent compound demonstrated comparable pharmacokinetics and an even slightly higher absolute tumor accumulation level in ex vivo biodistribution studies as well as higher tumor standardized uptake values in PET/CT imaging than (68)Ga-DOTATATE in vivo. The radioactivity uptake in nontumor tissue was higher than for (68)Ga-DOTATATE. The introduction of the novel SiFA building block SiFAlin and of hydrophilic auxiliaries enables a favorable in vivo biodistribution profile of the modified TATE peptides, resulting in high tumor-to-background ratios although lower than those observed with (68)Ga-DOTATATE. As further advantage, the SiFA methodology enables a kitlike labeling procedure for (18)F-labeled peptides advantageous for routine clinical application. © 2015 by the Society of Nuclear Medicine and Molecular Imaging, Inc.
Accurate Evaluation Method of Molecular Binding Affinity from Fluctuation Frequency
NASA Astrophysics Data System (ADS)
Hoshino, Tyuji; Iwamoto, Koji; Ode, Hirotaka; Ohdomari, Iwao
2008-05-01
Exact estimation of the molecular binding affinity is significantly important for drug discovery. The energy calculation is a direct method to compute the strength of the interaction between two molecules. This energetic approach is, however, not accurate enough to evaluate a slight difference in binding affinity when distinguishing a prospective substance from dozens of candidates for medicine. Hence more accurate estimation of drug efficacy in a computer is currently demanded. Previously we proposed a concept of estimating molecular binding affinity, focusing on the fluctuation at an interface between two molecules. The aim of this paper is to demonstrate the compatibility between the proposed computational technique and experimental measurements, through several examples for computer simulations of an association of human immunodeficiency virus type-1 (HIV-1) protease and its inhibitor (an example for a drug-enzyme binding), a complexation of an antigen and its antibody (an example for a protein-protein binding), and a combination of estrogen receptor and its ligand chemicals (an example for a ligand-receptor binding). The proposed affinity estimation has proven to be a promising technique in the advanced stage of the discovery and the design of drugs.
High Affinity Binding of Indium and Ruthenium Ions by Gastrins
Baldwin, Graham S.; George, Graham N.; Pushie, M. Jake
2015-01-01
The peptide hormone gastrin binds two ferric ions with high affinity, and iron binding is essential for the biological activity of non-amidated forms of the hormone. Since gastrins act as growth factors in gastrointestinal cancers, and as peptides labelled with Ga and In isotopes are increasingly used for cancer diagnosis, the ability of gastrins to bind other metal ions was investigated systematically by absorption spectroscopy. The coordination structures of the complexes were characterized by extended X-ray absorption fine structure (EXAFS) spectroscopy. Changes in the absorption of gastrin in the presence of increasing concentrations of Ga3+ were fitted by a 2 site model with dissociation constants (Kd) of 3.3 x 10−7 and 1.1 x 10−6 M. Although the absorption of gastrin did not change upon the addition of In3+ ions, the changes in absorbance on Fe3+ ion binding in the presence of indium ions were fitted by a 2 site model with Kd values for In3+ of 6.5 x 10−15 and 1.7 x 10−7 M. Similar results were obtained with Ru3+ ions, although the Kd values for Ru3+ of 2.6 x 10−13 and 1.2 x 10−5 M were slightly larger than observed for In3+. The structures determined by EXAFS all had metal:gastrin stoichiometries of 2:1 but, while the metal ions in the Fe, Ga and In complexes were bridged by a carboxylate and an oxygen with a metal-metal separation of 3.0–3.3 Å, the Ru complex clearly demonstrated a short range Ru—Ru separation, which was significantly shorter, at 2.4 Å, indicative of a metal-metal bond. We conclude that gastrin selectively binds two In3+ or Ru3+ ions, and that the affinity of the first site for In3+ or Ru3+ ions is higher than for ferric ions. Some of the metal ion-gastrin complexes may be useful for cancer diagnosis and therapy. PMID:26457677
Brady, Pamlea N; Macnaughtan, Megan A
2015-12-15
Colorimetric protein assays, such as the Coomassie blue G-250 dye-binding (Bradford) and bicinchoninic acid (BCA) assays, are commonly used to quantify protein concentration. The accuracy of these assays depends on the amino acid composition. Because of the extensive use of reductive methylation in the study of proteins and the importance of biological methylation, it is necessary to evaluate the impact of lysyl methylation on the Bradford and BCA assays. Unmodified and reductively methylated proteins were analyzed using the absorbance at 280 nm to standardize the concentrations. Using model compounds, we demonstrate that the dimethylation of lysyl ε-amines does not affect the proteins' molar extinction coefficients at 280 nm. For the Bradford assay, the responses (absorbance per unit concentration) of the unmodified and reductively methylated proteins were similar, with a slight decrease in the response upon methylation. For the BCA assay, the responses of the reductively methylated proteins were consistently higher, overestimating the concentrations of the methylated proteins. The enhanced color formation in the BCA assay may be due to the lower acid dissociation constants of the lysyl ε-dimethylamines compared with the unmodified ε-amine, favoring Cu(II) binding in biuret-like complexes. The implications for the analysis of biologically methylated samples are discussed. Copyright © 2015 Elsevier Inc. All rights reserved.
Brady, Pamlea N.; Macnaughtan, Megan A.
2015-01-01
Colorimetric protein assays, such as the Coomassie blue G-250 dye-binding (Bradford) and bicinchoninic acid (BCA) assays, are commonly used to quantify protein concentration. The accuracy of these assays depends on the amino acid composition. Because of the extensive use of reductive methylation in the study of proteins and the importance of biological methylation, it is necessary to evaluate the impact of lysyl methylation on the Bradford and BCA assays. Unmodified and reductively methylated proteins were analyzed using the absorbance at 280 nm to standardize the concentrations. Using model compounds, we demonstrate that the dimethylation of lysyl ε-amines does not affect the proteins’ molar extinction coefficients at 280 nm. For the Bradford assay, the response (absorbance per unit concentration) of the unmodified and reductively methylated proteins were similar with a slight decrease in the response upon methylation. For the BCA assay, the responses of the reductively methylated proteins were consistently higher, overestimating the concentrations of the methylated proteins. The enhanced color-formation in the BCA assay may be due to the lower acid dissociation constants of the lysyl ε-dimethylamines, compared to the unmodified ε-amine, favoring Cu(II) binding in biuret-like complexes. The implications for the analysis of biologically methylated samples are discussed. PMID:26342307
Bicho, Diana; Sousa, Ângela; Sousa, Fani; Queiroz, João; Tomaz, Cãndida
2014-09-01
DNA therapies are becoming recognized alternatives for the treatment and prevention of severe pathologies. Although most current trials have used plasmids <10 kbp, in the future larger plasmids would be required. The purpose of this work was to study the chromatographic behavior of nongrafted carbonyldiimidazole monolithic disks using plasmids with different sizes under hydrophobic conditions. Thereunto, the purification of several plasmids was performed. Higher size plasmids needed lower ammonium sulfate concentration, due to the greater number of interactions between the plasmids and monolith. The dynamic binding capacity experiments for the different plasmids revealed a lower capacity for bigger plasmids. It was also verified that the increase of salt concentration from 2.5 to 3 M of ammonium sulfate increased the capacity. At the highest salt concentration, a slight improvement in the capacity using lower flow rate was observed, possibly due to compaction of plasmid molecules and its better organization on the monolith channels. Finally, a low pH also had a positive effect on the capacity. So, this monolithic support proved to be appropriate to purify the supercoiled isoform of different plasmids with different sizes, providing a valuable instrument as a purification technique. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Interaction of Human Hemoglobin with Methotrexate
NASA Astrophysics Data System (ADS)
Zaharia, M.; Gradinaru, R.
2015-05-01
This study focuses on the interaction between methotrexate and human hemoglobin using steady-state ultraviolet-visible and fluorescence quenching methods. Fluorescence quenching was found to be valuable in assessing drug binding to hemoglobin. The quenching of methotrexate is slightly smaller than the quenching observed with related analogs (dihydrofolate and tetrahydrofolate). The quenching studies were performed at four different temperatures and various pH values. The number of binding sites for tryptophan is ~1. Parameter-dependent assays revealed that electrostatic forces play an essential role in the methotrexate-hemoglobin interaction. Furthermore, the complex was easily eluted using gel filtration chromatography.
Effect of Detergents on Galactoside Binding by Melibiose Permeases.
Amin, Anowarul; Hariharan, Parameswaran; Chae, Pil Seok; Guan, Lan
2015-09-29
The effect of various detergents on the stability and function of the melibiose permeases of Escherichia coli (MelBEc) and Salmonella typhimurium (MelBSt) was studied. In n-dodecyl-β-d-maltoside (DDM) or n-undecyl-β-d-maltoside (UDM), WT MelBSt binds melibiose with an affinity similar to that in the membrane. However, with WT MelBEc or MelBSt mutants (Arg141 → Cys, Arg295 → Cys, or Arg363 → Cys), galactoside binding is not detected in these detergents, but binding to the phosphotransferase protein IIA(Glc) is maintained. In the amphiphiles lauryl maltose neopentyl glycol (MNG-3) or glyco-diosgenin (GDN), galactoside binding with all of the MelB proteins is observed, with slightly reduced affinities. MelBSt is more thermostable than MelBEc, and the thermostability of either MelB is largely increased in MNG-3 or GDN. Therefore, the functional defect with DDM or UDM likely results from the relative instability of the sensitive MelB proteins, and stability, as well as galactoside binding, is retained in MNG-3 or GDN. Furthermore, isothermal titration calorimetry of melibiose binding with MelBSt shows that the favorable entropic contribution to the binding free energy is decreased in MNG-3, indicating that the conformational dynamics of MelB is restricted in this detergent.
Effect of detergents on galactoside binding by melibiose permeases
Amin, Anowarul; Hariharan, Parameswaran; Chae, Pil Seok; Guan, Lan
2015-01-01
The effect of various detergents on the stability and function of melibiose permeases of Escherichia coli (MelBEc) or Salmonella typhimurium (MelBSt) were studied. In n-dodecyl-β-d-maltoside (DDM) or n-undecyl-β-d-maltoside (UDM), WT MelBSt binds melibiose with an affinity similar to that in the membrane. However, with WT MelBEc or MelBSt mutants (Arg141→Cys, Arg295→Cys or Arg363→Cys), galactoside binding is not detected in these detergents, but binding to the phosphotransferase protein IIAGlc is maintained. In the amphiphiles lauryl maltose neopentyl glycol (MNG-3) or glyco-diosgenin (GDN), galactoside binding with all the MelB proteins is observed, with slightly reduced affinities. MelBSt is more thermostable than MelBEc, and the thermostability of either MelB is largely increased in MNG-3 or GDN. Therefore, the functional defect with DDM or UDM likely results from relative instability of the sensitive MelB proteins, and stability, as well as galactoside binding, is retained in MNG-3 or GDN. Furthermore, isothermal titration calorimetry of melibiose binding with MelBSt shows that the favorable entropic contribution to the binding free energy is decreased in MNG-3, indicating that the conformational dynamics of MelB is restricted in this detergent. PMID:26352464
The Strength of Hydrogen Bonds between Fluoro-Organics and Alcohols, a Theoretical Study.
Rosenberg, Robert E
2018-05-10
Fluorinated organic compounds are ubiquitous in the pharmaceutical and agricultural industries. To better discern the mode of action of these compounds, it is critical to understand the strengths of hydrogen bonds involving fluorine. There are only a few published examples of the strengths of these bonds. This study provides a high level ab initio study of inter- and intramolecular hydrogen bonds between RF and R'OH, where R and R' are aryl, vinyl, alkyl, and cycloalkyl. Intermolecular binding energies average near 5 kcal/mol, while intramolecular binding energies average about 3 kcal/mol. Inclusion of zero-point energies and applying a counterpoise correction lessen the difference. In both series, modest increases in binding energies are seen with increased acidity of R'OH and increased electron donation of R in RF. In the intramolecular compounds, binding energy increases with the rigidity of the F-(C) n -OH ring. Inclusion of free energy corrections at 298 K results in exoergic binding energies for the intramolecular compounds and endoergic binding energies for the intermolecular compounds. Parameters such as bond lengths, vibrational frequencies, and atomic populations are consistent with formation of a hydrogen bond and with slightly stronger binding in the intermolecular cases over the intramolecular cases. However, these parameters correlated poorly with binding energies.
Simon, Ted W.; Budinsky, Robert A.; Rowlands, J. Craig
2015-01-01
A stochastic model of nuclear receptor-mediated transcription was developed based on activation of the aryl hydrocarbon receptor (AHR) by 2,3,7,8-tetrachlorodibenzodioxin (TCDD) and subsequent binding the activated AHR to xenobiotic response elements (XREs) on DNA. The model was based on effects observed in cells lines commonly used as in vitro experimental systems. Following ligand binding, the AHR moves into the cell nucleus and forms a heterodimer with the aryl hydrocarbon nuclear translocator (ARNT). In the model, a requirement for binding to DNA is that a generic coregulatory protein is subsequently bound to the AHR-ARNT dimer. Varying the amount of coregulator available within the nucleus altered both the potency and efficacy of TCDD for inducing for transcription of CYP1A1 mRNA, a commonly used marker for activation of the AHR. Lowering the amount of available cofactor slightly increased the EC50 for the transcriptional response without changing the efficacy or maximal response. Further reduction in the amount of cofactor reduced the efficacy and produced non-monotonic dose-response curves (NMDRCs) at higher ligand concentrations. The shapes of these NMDRCs were reminiscent of the phenomenon of squelching. Resource limitations for transcriptional machinery are becoming apparent in eukaryotic cells. Within single cells, nuclear receptor-mediated gene expression appears to be a stochastic process; however, intercellular communication and other aspects of tissue coordination may represent a compensatory process to maintain an organism’s ability to respond on a phenotypic level to various stimuli within an inconstant environment. PMID:26039703
Hyrc, Krzysztof L; Minta, Akwasi; Escamilla, P Rogelio; Chan, Patrick P L; Meshik, Xenia A; Goldberg, Mark P
2013-10-01
Although many synthetic calcium indicators are available, a search for compounds with improved characteristics continues. Here, we describe the synthesis and properties of Asante Calcium Red-1 (ACR-1) and its low affinity derivative (ACR-1-LA) created by linking BAPTA to seminaphthofluorescein. The indicators combine a visible light (450-540 nm) excitation with deep-red fluorescence (640 nm). Upon Ca2+ binding, the indicators raise their fluorescence with longer excitation wavelengths producing higher responses. Although the changes occur without any spectral shifts, it is possible to ratio Ca(2+)-dependent (640 nm) and quasi-independent (530 nm) emission when using visible (< 490 nm) or multiphoton (∼780 nm) excitation. Therefore, both probes can be used as single wavelength or, less dynamic, ratiometric indicators. Long indicator emission might allow easy [Ca2+]i measurement in GFP expressing cells. The indicators bind Ca2+ with either high (Kd = 0.49 ± 0.07 μM; ACR-1) or low affinity (Kd = 6.65 ± 0.13 μM; ACR-1-LA). Chelating Zn2+ (Kd = 0.38 ± 0.02 nM) or Mg2+ (Kd∼5mM) slightly raises and binding Co2+ quenches dye fluorescence. New indicators are somewhat pH-sensitive (pKa = 6.31 ± 0.07), but fairly resistant to bleaching. The probes are rather dim, which combined with low AM ester loading efficiency, might complicate in situ imaging. Despite potential drawbacks, ACR-1 and ACR-1-LA are promising new calcium indicators. Copyright © 2013 Elsevier Ltd. All rights reserved.
Hyrc, Krzysztof L.; Minta, Akwasi; Escamilla, P. Rogelio; Chan, Patrick P.L.; Meshik, Xenia A.; Goldberg, Mark P.
2013-01-01
Although many synthetic calcium indicators are available, a search for compounds with improved characteristics continues. Here, we describe the synthesis and properties of Asante Calcium Red-1 (ACR-1) and its low affinity derivative (ACR-1-LA) created by linking BAPTA to seminaphthofluorescein. The indicators combine a visible light (450–540 nm) excitation with deep-red fluorescence (640 nm). Upon Ca2+ binding, the indicators raise their fluorescence with longer excitation wavelengths producing higher responses. Although the changes occur without any spectral shifts, it is possible to ratio Ca2+-dependent (640 nm) and quasi-independent (530 nm) emission when using visible (<490 nm) or multiphoton (~780 nm) excitation. Therefore, both probes can be used as single wavelength or, less dynamic, ratiometric indicators. Long indicator emission might allow easy [Ca2+]i measurement in GFP expressing cells. The indicators bind Ca2+ with either high (Kd=0.49±0.07 μM; ACR-1) or low affinity (Kd=6.65±0.13 μM; ACR-1-LA). Chelating Zn2+ (Kd =0.38±0.02 nM) or Mg2+ (Kd ~5 mM) slightly raises and binding Co2+ quenches dye fluorescence. New indicators are somewhat pH-sensitive (pKa=6.31±0.07), but fairly resistant to bleaching. The probes are rather dim, which combined with low AM ester loading efficiency, might complicate in situ imaging. Despite potential drawbacks, ACR-1 and ACR-1-LA are promising new calcium indicators. PMID:24017967
Shin, In Soo; Maeng, Jin Soo; Jang, Beom-Su; You, Eric; Cheng, Kenneth; Li, King C P; Wood, Bradford; Carrasquillo, Jorge A; Danthi, S Narasimhan; Paik, Chang H
2010-01-01
OBJECTIVES: The aim of this research was to synthesize radiolabeled peptidomimetic integrin alpha(v)beta(3) antagonist with (99m)Tc for rapid targeting of integrin alpha(v)beta(3) receptors in tumor to produce a high tumor to background ratio. METHODS: The amino terminus of 4-[2-(3,4,5,6-tetra-hydropyrimidin-2-ylamino)-ethyloxy]benzoyl-2-(S)-[N-(3-amino-neopenta-1-carbamyl)]-aminoethylsulfonyl-amino-beta-alanine hydrochloride (IAC) was conjugated with N-hydroxysuccinimide ester of HYNIC and labeled with (99m)Tc using tricine with either 1,5-pyridinedicarboxylic acid (PDA) or ethylenediamine-N,N'-diacetic acid (EDDA) as the co-ligand. The products, (99m)Tc EDDA(2)/HYNIC-IAC (P1) and (99m)Tc PDA (tricin)/HYNIC-IAC (P2) were subjected to in vitro serum stability, receptor-binding, biodistribution and imaging studies. RESULTS: P1 and P2 were synthesized with an overall yield of >80%. P1 was slightly more stable than P2 when incubated in serum at 37 degrees C for 18 hrs (84 vs 77% intact). The In vitro receptor-binding of P1 was higher than that of P2 (78.02 +/- 13.48 vs 51.05 +/- 14.05%) when incubated with alpha(v)beta(3) at a molar excess (0.8 muM). This receptor binding was completely blocked by a molar excess of an unlabeled peptidomimetic antagonist. Their differences shown in serum stability and the receptor-binding appeared to be related to their biological behaviors in tumor uptake and retention; the 1 h tumor uptakes of P1 and P2 were 3.17+/-0.52 and 2.13+/-0.17 % ID/g, respectively. P1 was retained in the tumor longer than P2. P1 was excreted primarily through the renal system whereas P2 complex was excreted equally via both renal and hepatobiliary systems. Thus, P1 was retained in the whole-body with 27.25 +/- 3.67% ID at 4 h whereas 54.04 +/- 3.57% ID of P2 remained in the whole-body at 4 h. This higher whole-body retention of P2 appeared to be resulted from a higher amount of radioactivity retained in liver and intestine. These findings were supported by imaging studies showing higher tumor-to-abdominal contrast for P1 than for P2 at 3 h postinjection. CONCLUSIONS: P1 showed good tumor targeting properties with a rapid tumor uptake, prolonged tumor retention and fast whole-body clearance kinetics. These findings warrant further investigation of the HYNIC method of (99m)Tc labeling of other peptidomimetic antagonists using EDDA as a coligand.
Zhang, Lijing; Cao, Hua; Zhang, Jiaxin; Yang, Chengli; Hu, Tingting; Li, Huili; Yang, Wu; He, Gu; Song, Xiangrong; Tong, Aiping; Guo, Gang; Li, Rui; Jiang, Yu; Liu, Jiyan; Cai, Lulu; Zheng, Yu
2017-02-01
Specific delivery of drugs to bone tissue is very challenging due to the architecture and structure of bone tissue. A seven-repeat sequence of aspartate, a representative bone-targeting oligopeptide, is preferentially used for targeted therapy for bone diseases. In this study, Asp7-cholesterol((Asp)7-CHOL) was synthesized and (Asp)7-CHOL-modified liposome loaded with doxorubicin (DOX) was successfully prepared using both pre-insertion (pre-L) and post-insertion (post-L) methods. The formulation was optimized according to particle size, zeta potential and the drug-loading efficiency of the liposome. In addition, the bone affinity of the (Asp)7-CHOL-modified liposome was evaluated using a hydroxyapatite (HA) absorption method. The results suggested that (Asp)7-CHOL-modified liposome show excellent HA absorption; pre-L showed slightly higher HA binding than post-L. However, post-L had a higher DOX entrapment efficiency than pre-L. In vivo imaging further demonstrated that pre-L showed a higher bone-targeting efficiency than post-L, which was consistent with in vitro results. In all, (Asp)7-CHOL-modified liposome showed excellent bone-targeting activity, suggesting their potential for use as a drug delivery system for bone disease-targeted therapies.
Davaatseren, Munkhtugs
2016-01-01
This study investigated the effect of soy protein hydrolysates (SPH) prepared by varying subcritical media on the physicochemical properties of pork patties. For resource of SPH, two different soybean species (Glycine max Merr.) of Daewonkong (DWK) and Saedanbaek (SDB) were selected. SPH was prepared by subcritical processing at 190℃ and 25 MPa under three different of media (water, 20% ethanol and 50% ethanol). Solubility and free amino group content revealed that water was better to yield larger amount of SPH than ethanol/water mixtures, regardless of species. Molecular weight (Mw) distribution of SPH was also similar between two species, while slightly different Mw distribution was obtained by subcritical media. For pork patty application, 50% ethanol treatment showed clear red color comparing to control after 14 d of storage. In addition, ethanol treatment had better oxidative stability than control and water treatment based on thiobarbituric acid-reactive substances (TBARS) analysis. For eating quality, although 20% ethanol treatment in SDB showed slightly higher cooking loss than control, generally addition of SPH did not affect the water-binding properties and hardness of pork patties. Consequently, the present study indicated that 50% ethanol was the best subcritical media to produce SPH possessing antioxidant activity, and the SPH produced from DWK exhibited better antioxidant activity than that produced SDB. PMID:27499657
Lee, Yun-Kyung; Ko, Bo-Bae; Davaatseren, Munkhtugs; Hong, Geun-Pyo
2016-01-01
This study investigated the effect of soy protein hydrolysates (SPH) prepared by varying subcritical media on the physicochemical properties of pork patties. For resource of SPH, two different soybean species (Glycine max Merr.) of Daewonkong (DWK) and Saedanbaek (SDB) were selected. SPH was prepared by subcritical processing at 190℃ and 25 MPa under three different of media (water, 20% ethanol and 50% ethanol). Solubility and free amino group content revealed that water was better to yield larger amount of SPH than ethanol/water mixtures, regardless of species. Molecular weight (Mw) distribution of SPH was also similar between two species, while slightly different Mw distribution was obtained by subcritical media. For pork patty application, 50% ethanol treatment showed clear red color comparing to control after 14 d of storage. In addition, ethanol treatment had better oxidative stability than control and water treatment based on thiobarbituric acid-reactive substances (TBARS) analysis. For eating quality, although 20% ethanol treatment in SDB showed slightly higher cooking loss than control, generally addition of SPH did not affect the water-binding properties and hardness of pork patties. Consequently, the present study indicated that 50% ethanol was the best subcritical media to produce SPH possessing antioxidant activity, and the SPH produced from DWK exhibited better antioxidant activity than that produced SDB.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Lianying; College of Life Science, Dezhou University, Dezhou 253023; Ren, Xiao-Min
2014-09-15
Perfluorinated compounds (PFCs) have been shown to disrupt lipid metabolism and even induce cancer in rodents through activation of peroxisome proliferator-activated receptors (PPARs). Lines of evidence showed that PPARα was activated by PFCs. However, the information on the binding interactions between PPARγ and PFCs and subsequent alteration of PPARγ activity is still limited and sometimes inconsistent. In the present study, in vitro binding of 16 PFCs to human PPARγ ligand binding domain (hPPARγ-LBD) and their activity on the receptor in cells were investigated. The results showed that the binding affinity was strongly dependent on their carbon number and functional group.more » For the eleven perfluorinated carboxylic acids (PFCAs), the binding affinity increased with their carbon number from 4 to 11, and then decreased slightly. The binding affinity of the three perfluorinated sulfonic acids (PFSAs) was stronger than their PFCA counterparts. No binding was detected for the two fluorotelomer alcohols (FTOHs). Circular dichroim spectroscopy showed that PFC binding induced distinctive structural change of the receptor. In dual luciferase reporter assays using transiently transfected Hep G2 cells, PFCs acted as hPPARγ agonists, and their potency correlated with their binding affinity with hPPARγ-LBD. Molecular docking showed that PFCs with different chain length bind with the receptor in different geometry, which may contribute to their differences in binding affinity and transcriptional activity. - Highlights: • Binding affinity between PFCs and PPARγ was evaluated for the first time. • The binding strength was dependent on fluorinated carbon chain and functional group. • PFC binding induced distinctive structural change of the receptor. • PFCs could act as hPPARγ agonists in Hep G2 cells.« less
Interaction of the dietary pigment curcumin with hemoglobin: energetics of the complexation.
Basu, Anirban; Kumar, Gopinatha Suresh
2014-08-01
Thermodynamics of the interaction of the chemotherapeutic and chemopreventive dietary pigment, curcumin, with hemoglobin was studied by isothermal titration calorimetry. The binding was characterized to be exothermic. At 293.15 K, the equilibrium constant for curcumin-Hb complexation was found to be (4.88 ± 0.06) × 10(5) M(-1). The binding stoichiometry was calculated to be 1.08 ± 0.05, confirming a 1:1 complexation. The binding was driven by a large negative standard molar enthalpy change (ΔH(0) = -118.45 ± 0.05 kJ mol(-1)) and an unfavorable standard molar entropy change (TΔS(0) = -86.53 ± 0.01 kJ mol(-1)) at 293.15 K. Increasing the temperature favoured the binding, and the magnitude of the negative standard molar heat capacity change suggested the involvement of significant hydrophobic forces in the binding process. With increasing salt concentration, the magnitude of the equilibrium constant decreased slightly; and the complexation mostly involved non-polyelectrolytic forces contributing about 92-94% of the standard molar Gibbs energy change. DSC studies revealed that curcumin binding caused a partial unfolding of the protein.
The structure of transcription termination factor Nrd1 reveals an original mode for GUAA recognition
Franco-Echevarría, Elsa; González-Polo, Noelia; Zorrilla, Silvia; Martínez-Lumbreras, Santiago; Santiveri, Clara M.; Campos-Olivas, Ramón; Sánchez, Mar; Calvo, Olga
2017-01-01
Abstract Transcription termination of non-coding RNAs is regulated in yeast by a complex of three RNA binding proteins: Nrd1, Nab3 and Sen1. Nrd1 is central in this process by interacting with Rbp1 of RNA polymerase II, Trf4 of TRAMP and GUAA/G terminator sequences. We lack structural data for the last of these binding events. We determined the structures of Nrd1 RNA binding domain and its complexes with three GUAA-containing RNAs, characterized RNA binding energetics and tested rationally designed mutants in vivo. The Nrd1 structure shows an RRM domain fused with a second α/β domain that we name split domain (SD), because it is formed by two non-consecutive segments at each side of the RRM. The GUAA interacts with both domains and with a pocket of water molecules, trapped between the two stacking adenines and the SD. Comprehensive binding studies demonstrate for the first time that Nrd1 has a slight preference for GUAA over GUAG and genetic and functional studies suggest that Nrd1 RNA binding domain might play further roles in non-coding RNAs transcription termination. PMID:28973465
Jurasekova, Zuzana; Marconi, Giancarlo; Sanchez-Cortes, Santiago; Torreggiani, Armida
2009-11-01
Luteolin (LUT) is a polyphenolic compound, found in a variety of fruits, vegetables, and seeds, which has a variety of pharmacological properties. In the present contribution, binding of LUT to human serum albumin (HSA), the most abundant carrier protein in the blood, was investigated with the aim of describing the binding mode and parameters of the interaction. The application of circular dichroism, UV-Vis absorption, fluorescence, Raman and surface-enhanced Raman scattering spectroscopy combined with molecular modeling afforded a clear picture of the association mode of LUT to HSA. Specific interactions with protein amino acids were evidenced. LUT was found to be associated in subdomain IIA where an interaction with Trp-214 is established. Hydrophobic and electrostatic interactions are the major acting forces in the binding of LUT to HSA. The HSA conformations were slightly altered by the drug complexation with reduction of alpha-helix and increase of beta-turns structures, suggesting a partial protein unfolding. Also the configuration of at least two disulfide bridges were altered. Furthermore, the study of molecular modeling afforded the binding geometry. 2009 Wiley Periodicals, Inc.
Norberg, Oscar; Wu, Bin; Thota, Niranjan; Ge, Jian-Tao; Fauquet, Germain; Saur, Ann-Kathrin; Aastrup, Teodor; Dong, Hai; Yan, Mingdi; Ramström, Olof
2017-11-27
The role of sulfur in glycosidic bonds has been evaluated using quartz crystal microbalance methodology. Synthetic routes towards α1-2- and α1-6-linked dimannosides with S- or O-glycosidic bonds have been developed, and the recognition properties assessed in competition binding assays with the cognate lectin concanavalin A. Mannose-presenting QCM sensors were produced using photoinitiated, nitrene-mediated immobilization methods, and the subsequent binding study was performed in an automated flow-through instrumentation, and correlated with data from isothermal titration calorimetry. The recorded K d -values corresponded well with reported binding affinities for the O-linked dimannosides with affinities for the α1-2-linked dimannosides in the lower micromolar range. The S-linked analogs showed slightly disparate effects, where the α1-6-linked analog showed weaker affinity than the O-linked dimannoside, as well as positive apparent cooperativity, whereas the α1-2-analog displayed very similar binding compared to the O-linked structure. Copyright © 2017 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Wang, Qi; Huang, Chuan-ren; Jiang, Min; Zhu, Ying-yao; Wang, Jing; Chen, Jun; Shi, Jie-hua
2016-03-01
The interaction of atorvastatin with bovine serum albumin (BSA) was investigated using multi-spectroscopic methods and molecular docking technique for providing important insight into further elucidating the store and transport process of atorvastatin in the body and the mechanism of action and pharmacokinetics. The experimental results revealed that the fluorescence quenching mechanism of BSA induced atorvastatin was a combined dynamic and static quenching. The binding constant and number of binding site of atorvastatin with BSA under simulated physiological conditions (pH = 7.4) were 1.41 × 105 M- 1 and about 1 at 310 K, respectively. The values of the enthalpic change (ΔH0), entropic change (ΔS0) and Gibbs free energy (ΔG0) in the binding process of atorvastatin with BSA at 310 K were negative, suggesting that the binding process of atorvastatin and BSA was spontaneous and the main interaction forces were van der Waals force and hydrogen bonding interaction. Moreover, atorvastatin was bound into the subdomain IIA (site I) of BSA, resulting in a slight change of the conformation of BSA.
Modification of Herbicide Binding to Photosystem II in Two Biotypes of Senecio vulgaris L
Pfister, Klaus; Radosevich, Steven R.; Arntzen, Charles J.
1979-01-01
The present study compares the binding and inhibitory activity of two photosystem II inhibitors: 3-(3,4-dichlorophenyl)-1,1-dimethylurea (diuron [DCMU]) and 2-chloro-4-(ethylamine)-6-(isopropyl amine)-S-triazene (atrazine). Chloroplasts isolated from naturally occurring triazine-susceptible and triazine-resistant biotypes of common groundsel (Senecio vulgaris L.) showed the following characteristics. (a) Diuron strongly inhibited photosynthetic electron transport from H2O to 2,6-dichlorophenolindophenol in both biotypes. Strong inhibition by atrazine was observed only with the susceptible chloroplasts. (b) Hill plots of electron transport inhibition data indicate a noncooperative binding of one inhibitor molecule at the site of action for both diuron and atrazine. (c) Susceptible chloroplasts show a strong diuron and atrazine binding (14C-radiolabel assays) with binding constants (K) of 1.4 × 10−8 molar and 4 × 10−8 molar, respectively. In the resistant chloroplasts the diuron binding was slightly decreased (K = 5 × 10−8 molar), whereas no specific atrazine binding was detected. (d) In susceptible chloroplasts, competitive binding between radioactively labeled diuron and non-labeled atrazine was observed. This competition was absent in the resistant chloroplasts. We conclude that triazine resistance of both intact plants and isolated chloroplasts of Senecio vulgaris L. is based upon a minor modification of the protein in the photosystem II complex which is responsible for herbicide binding. This change results in a specific loss of atrazine (triazine)-binding capacity. PMID:16661120
Turan, S; Bereket, A; Furman, A; Omar, A; Berber, M; Ozen, A; Akbenlioglu, C; Haklar, G
2007-06-01
The effect of economic status (ES) on growth, insulin-like growth factor (IGF)-I and IGF-binding protein (IGFBP)-3 in healthy children is not well characterized. We aimed to study the interrelationship between height, weight, IGF-I, IGFBP-3, mid-parental height (MPH) and ES. Eight hundred and fourteen healthy children (428 boys, 386 girls; age 3-18 years) were classified according to income of the families as low, middle and high. Standard deviation scores (SDSs) of height, weight, MPH, IGF-I and IGFBP-3 were compared between the groups. The combined effect of these parameters and ES on height SDS was investigated with complex statistical models. There was a significant trend for height and weight SDSs to increase with higher income levels in boys, but not in girls. Body mass index (BMI) SDSs were similar in three groups. There was a general trend for MPH SDS to increase with income levels in both sexes. In boys, IGF-I SDS was significantly higher in high ES group than low ES. In girls, IGFBP-3 SDSs were significantly higher in high ES group than in middle ES group. For both genders, height SDS was highly correlated with weight SDS and moderately correlated with BMI SDS, MPH SDS and IGF-1 SDS. All correlations were significant and positive. Complex models showed that MPH (19%), IGF-I (13%) and ES (3%) in boys, and MPH (16%) and IGF-I (7%) in girls have significant contribution to height SDSs. ES per se, independent of overt malnutrition, affects height, weight, IGF-I and IGFBP-3 with some gender differences in healthy children. Influence of income on height and weight show sexual dimorphism, a slight but significant effect is observed only in boys. MPH is the most prominent variable effecting height in healthy children. Higher height and MPH SDSs observed in higher income groups suggest that secular trend in growth still exists, at least in boys, in a country of favorable economic development.
Effects of glycation on meloxicam binding to human serum albumin
NASA Astrophysics Data System (ADS)
Trynda-Lemiesz, Lilianna; Wiglusz, Katarzyna
2011-05-01
The current study reports a binding of meloxicam a pharmacologically important new generation, non-steroidal anti-inflammatory drug to glycated form of the human serum albumin (HSA). The interaction of the meloxicam with nonglycated and glycated albumin has been studied at pH 7.4 in 0.05 M sodium phosphate buffer with 0.1 M NaCl, using fluorescence quenching technique and circular dichroism spectroscopy. Results of the present study have shown that the meloxicam could bind both forms of albumin glycated and nonglycated at a site, which was close to the tryptophan residues. Similarly, how for native albumin glycated form has had one high affinity site for the drug with association constants of the order of 10 5 M -1. The glycation process of the HSA significantly has affected the impact of the meloxicam on the binding of other ligands such as warfarin and bilirubin. The affinity of the glycated albumin for bilirubin as for native albumin has been reduced by meloxicam but observed effect was weaker by half (about 20%) compared with nonglycated albumin. In contrast to the native albumin meloxicam binding to glycated form of the protein only slightly affected the binding of warfarin. It seemed possible that the effects on warfarin binding might be entirely attributable to the Lys 199 modification which was in site I.
Albanyan, Buthaina; Laurini, Erik; Posocco, Paola; Pricl, Sabrina; Smith, David K
2017-05-05
This paper reports a small family of cationic surfactants designed to bind polyanions such as DNA and heparin. Each molecule has the same hydrophilic cationic ligand and a hydrophobic aliphatic group with eighteen carbon atoms with one, two, or three alkene groups within the hydrophobic chain (C18-1, C18-2 and C18-3). Dynamic light scattering indicates that more alkenes lead to geometric distortion, giving rise to larger self-assembled multivalent (SAMul) nanostructures. Mallard Blue and Ethidium Bromide dye displacement assays demonstrate that heparin and DNA have markedly different binding preferences, with heparin binding most effectively to C18-1, and DNA to C18-3, even though the molecular structural differences of these SAMul systems are buried in the hydrophobic core. Multiscale modelling suggests that adaptive heparin maximises enthalpically favourable interactions with C18-1, while shape-persistent DNA forms a similar number of interactions with each ligand display, but with slightly less entropic cost for binding to C18-3-fundamental thermodynamic differences in SAMul binding of heparin or DNA. This study therefore provides unique insight into electrostatic molecular recognition between highly charged nanoscale surfaces in biologically relevant systems. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Fang, Fang; Pan, Dong-Qi; Qiu, Min-Jie; Liu, Ting-Ting; Jiang, Min; Wang, Qi; Shi, Jie-Hua
2016-09-01
To further understand the mechanism of action and pharmacokinetics of medroxyprogesterone acetate (MPA), the binding interaction of MPA with bovine serum albumin (BSA) under simulated physiological conditions (pH 7.4) was studied using fluorescence emission spectroscopy, synchronous fluorescence spectroscopy, circular dichroism and molecular docking methods. The experimental results reveal that the fluorescence of BSA quenches due to the formation of MPA-BSA complex. The number of binding sites (n) and the binding constant for MPA-BSA complex are ~1 and 4.6 × 10(3) M(-1) at 310 K, respectively. However, it can be concluded that the binding process of MPA with BSA is spontaneous and the main interaction forces between MPA and BSA are van der Waals force and hydrogen bonding interaction due to the negative values of ΔG(0) , ΔH(0) and ΔS(0) in the binding process of MPA with BSA. MPA prefers binding on the hydrophobic cavity in subdomain IIIA (site II'') of BSA resulting in a slight change in the conformation of BSA, but BSA retaining the α-helix structure. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.
Jiang, Tuo-Ying; Zhou, Kai-Li; Lou, Yan-Yue; Pan, Dong-Qi; Shi, Jie-Hua
2018-04-01
Molecular interaction of atenolol, a selective β 1 receptor antagonist with the major carrier protein, bovine serum albumin (BSA), was investigated under imitated physiological conditions (pH 7.4) by means of fluorescence spectroscopy, UV absorption spectroscopy, Fourier transform infrared spectroscopy (FT-IR), and molecular modeling studies. The steady-state fluorescence spectra manifested that static type, due to formation of the atenolol-BSA complex, was the dominant mechanism for fluorescence quenching. The characteristic information about the binding interaction of atenolol with BSA in terms of binding constant (K b ) were determined by the UV-vis absorption titration, and were found to be in the order of 10 3 M -1 at different temperatures, indicating the existence of a weak binding in this system. Thermodynamic analysis revealed that the binding process was primarily mediated by van der Waals force and hydrogen bonds due to the negative sign for enthalpy change (ΔH 0 ), entropy change (ΔS 0 ). The molecular docking results elucidated that atenolol preferred binding on the site II of BSA according to the findings observed in competitive binding experiments. Moreover, via alterations in synchronous fluorescence, three-dimensional fluorescence and FT-IR spectral properties, it was concluded that atenolol could arouse slight configurational and micro-environmental changes of BSA.
Hernández-Pichardo, J E; Ducolomb, Y; Romo, S; Kjelland, M E; Fierro, R; Casillas, F; Betancourt, M
2016-01-01
In order to improve ICSI, appropiate sperm selection and oocyte activation is necessary. The objective of the present study was to determine the efficiency of fertilization using ICSI with chemically activated ovine oocytes and sperm selected by swim up (SU) or swim up + zona pellucida (SU + ZP) binding. Experiment 1, 4-20 replicates with total 821 in vitro matured oocytes were chemically activated with ethanol, calcium ionophore or ionomycin, to determine oocyte activation (precense of one PN). Treatments showed similar results (54, 47, 42 %, respectively) but statistically differents ( P < 0.05) than mechanical activated oocytes in sham, ICSI and sham injection (13, 25, 32 %, respectively) (10-17 replicates; n = 429). Experiment 2: Twelve ejaculates and 28 straws of semen were used (11-19 replicates). Sperm were selected by SU in BSA-TCM 199-H medium. A total of 2,294 fresh sperm and 2,760 from frozen-thawed semen were analyzed after SU or SU + ZP binding. Fresh sperm selected by SU showed acrosome reaction (AR) of 59 %, the sperm selected by SU + ZP binding increased AR to 91 %. In comparison, the AR of frozen-thawed sperm using SU or SU + ZP binding was 77 and 86 %, respectively ( P < 0.05). Experiment 3: fertilization in 200 mechanical activativated oocytes (17 replicates) was 4 %, but fertilization increased in ethanol activated oocytes after ICSI (12-28 %) (5-6 replicates). When fresh sperm only selected by SU were injected to 123 oocytes, a fertilization rate (28 %) was achieved; in sperm selected by SU + ZP was 25 % (73 oocytes). In comparison, in frozen-thawed sperm selected by SU, fertilization was 13 % (70 oocytes), whereas sperm from SU + ZP binding displayed 12 % (51 oocytes) ( P > 0.05). Chemical activation induces higher ovine oocyte activation than mechanical activation. Ethanol slightly displays higher oocyte activation than calcium ionophore and ionomicine. Sperm selection with SU + ZP increased AR/A and AR/D rates in comparison with SU in fresh and frozen-thawed sperm. According to this, in terms of fertilization rates, chemical activation after ICSI increased oocyte PN formation compared to mechanical activation. Also, fresh sperm treated with SU and SU + ZP were significantly different than frozen-thawed sperm, but between sperm treatments no significant differences were obtained.
NASA Astrophysics Data System (ADS)
Liu, Shih-Hsien
Density-functional theory (DFT) and molecular dynamics (MD) were used to resolve the origins of shape-selective syntheses of {111}-faceted Au nanostructures mediated by polyvinylpyrrolidone (PVP) as well as {100}-faceted Cu nanostructures mediated by hex- adecylamine(HDA) seen in experiment. For the work in PVP on Au surfaces, the hexagonal reconstruction of Au(100) was considered. DFT results indicate that the Au(111) surface covered by the PVP segment, 2-pyrrolidone (2P), has a lower surface energy than the 2P- covered (5 x 1) Au(100)-hex surface, and that PVP may exhibit a binding affinity for Au(111) comparable to or greater than (5 x 1) Au(100)-hex. With MD, it is shown that the PVP-covered Au(111) surface has a lower surface energy than the PVP-covered (5 x 1) Au(100)-hex surface, and that the atactic PVP isosamer chains have a binding affinity for Au(111) comparable to (5 x 1) Au(100)-hex. Also, the (5 x 1) Au(100)-hex surface may have a higher flux of Au atoms than the Au(111) surface. Therefore, the Au(111) surface would be thermodynamically and kinetically favored in PVP-mediated syntheses, leading to {111}-faceted Au nanostructures. For the work in HDA on Cu surfaces, DFT results show that the HDA-covered Cu(100) surface has a slightly higher surface energy than the HDA- covered Cu(111) surface. However, HDA has a significant binding preference on Cu(100) over Cu(111). Therefore, the Cu(100) surface would be kinetically favored in HDA-mediated syn- theses, leading to {100}-faceted Cu nanostructures. Further, a metal-organic many-body (MOMB) force field for HDA-Cu interactions was developed based on the DFT work, and the force field was used to resolve the HDA binding patterns on Cu(100) at molecular level. With MD, it is found that decylamine (DA) may be used as an effective capping agent in the synthesis of {100}-faceted Cu nanostructures since DA as well as HDA are organized on Cu surfaces and have the same binding preference on Cu(100) over Cu(111). It is also found that the HDA structures on Cu surfaces remain intact in aqueous solution due to hydrophobicity of alkyl tails and long alkyl chains in the HDA molecules, which could prevent Cu oxidation during the synthesis.
NASA Astrophysics Data System (ADS)
Li, Richard Y.; Di Felice, Rosa; Rohs, Remo; Lidar, Daniel A.
2018-03-01
Transcription factors regulate gene expression, but how these proteins recognize and specifically bind to their DNA targets is still debated. Machine learning models are effective means to reveal interaction mechanisms. Here we studied the ability of a quantum machine learning approach to classify and rank binding affinities. Using simplified data sets of a small number of DNA sequences derived from actual binding affinity experiments, we trained a commercially available quantum annealer to classify and rank transcription factor binding. The results were compared to state-of-the-art classical approaches for the same simplified data sets, including simulated annealing, simulated quantum annealing, multiple linear regression, LASSO, and extreme gradient boosting. Despite technological limitations, we find a slight advantage in classification performance and nearly equal ranking performance using the quantum annealer for these fairly small training data sets. Thus, we propose that quantum annealing might be an effective method to implement machine learning for certain computational biology problems.
Wang, J; Froeyen, M; Hendrix, C; Andrei, G; Snoeck, R; De Clercq, E; Herdewijn, P
2000-02-24
Both enantiomers of cyclohexenylguanine were synthesized in a stereospecific way starting from the same starting material: R-(-)-carvone. Both compounds showed potent and selective anti-herpesvirus activity (HSV-1, HSV-2, VZV, CMV). The binding of both cyclohexene nucleosides in the active site of HSV-1 thymidine kinase was investigated, and a model for the binding of both enantiomers is proposed. The amino acids involved in binding of the optical antipodes are the same, but the interaction energy of both enantiomers is slightly different. This may be attributed to the interaction of the secondary hydroxyl function of the nucleoside analogues with Glu-225. Structural analysis has demonstrated the flexibility of the cyclohexenyl system, and this may be considered as an important conformational characteristic explaining the potent antiviral activity.
De novo isolation of antibodies with pH-dependent binding properties.
Bonvin, Pauline; Venet, Sophie; Fontaine, Gaëlle; Ravn, Ulla; Gueneau, Franck; Kosco-Vilbois, Marie; Proudfoot, Amanda Ei; Fischer, Nicolas
2015-01-01
pH-dependent antibodies are engineered to release their target at a slightly acidic pH, a property making them suitable for clinical as well as biotechnological applications. Such antibodies were previously obtained by histidine scanning of pre-existing antibodies, a labor-intensive strategy resulting in antibodies that displayed residual binding to their target at pH 6.0. We report here the de novo isolation of pH-dependent antibodies selected by phage display from libraries enriched in histidines. Strongly pH-dependent clones with various affinity profiles against CXCL10 were isolated by this method. Our best candidate has nanomolar affinity for CXCL10 at pH 7.2, but no residual binding was detected at pH 6.0. We therefore propose that this new process is an efficient strategy to generate pH-dependent antibodies.
Shi, Jie-Hua; Pan, Dong-Qi; Jiang, Min; Liu, Ting-Ting; Wang, Qi
2017-08-01
The binding interaction between quinapril (QNPL) and bovine serum albumin (BSA) in vitro has been investigated using UV absorption spectroscopy, steady-state fluorescence spectroscopic, synchronous fluorescence spectroscopy, 3D fluorescence spectroscopy, Fourier transform infrared spectroscopy, circular dichroism, and molecular docking methods for obtaining the binding information of QNPL with BSA. The experimental results confirm that the quenching mechanism of the intrinsic fluorescence of BSA induced by QNPL is static quenching based on the decrease in the quenching constants of BSA in the presence of QNPL with the increase in temperature and the quenching rates of BSA larger than 10 10 L mol -1 s -1 , indicating forming QNPL-BSA complex through the intermolecular binding interaction. The binding constant for the QNPL-BSA complex is in the order of 10 5 M -1 , indicating there is stronger binding interaction of QNPL with BSA. The analysis of thermodynamic parameters together with molecular docking study reveal that the main binding forces in the binding process of QNPL with BSA are van der Waal's forces and hydrogen bonding interaction. And, the binding interaction of BSA with QNPL is an enthalpy-driven process. Based on Förster resonance energy transfer, the binding distance between QNPL and BSA is calculated to be 2.76 nm. The results of the competitive binding experiments and molecular docking confirm that QNPL binds to sub-domain IIA (site I) of BSA. It is confirmed there is a slight change in the conformation of BSA after binding QNPL, but BSA still retains its secondary structure α-helicity.
Maduell, Francisco; Arias, Marta; Vera, Manel; Fontseré, Néstor; Blasco, Miquel; Barros, Xoana; Garro, Julia; Elena, Montserrat; Bergadá, Eduardo; Cases, Aleix; Bedini, Jose Luis; Campistol, Josep M
2009-01-01
As a change from Diapes to polyphenylene membrane in the mid-dilution filter has recently been developed, the aim of this study was to compare mid-dilution using this new dialyzer versus pre- and postdilution. The prospective study included 20 patients who underwent 4 hemodiafiltration (HDF) sessions: 1.7 m(2) polyphenylene and predilution infusion flow (Qi) 200 ml/min, 1.7 m(2) and postdilution Qi 100 ml/min, 1.9 and 2.2 m(2) mid-dilution both with Qi 200 ml/ min. The urea and creatinine reduction ratios were slightly higher in postdilution. The beta(2)-microglobulin (85.8%), myoglobin (73.6%), prolactin (67.8%) and retinol-binding protein (29.2%) reduction ratios with 1.9 m(2) mid-dilution, which was similar to 2.2 m(2) mid-dilution, were significantly higher than with the post- and predilution modes. Mid-dilution appears to be a good HDF alternative that allows a better removal of larger molecules than postdilution and, mainly, predilution. Mid-dilution using 1.9 or 2.2 m(2) dialyzers, at the same convective volume, showed a similar removal. Copyright 2009 S. Karger AG, Basel.
Saikia, Jiban; Saha, Bedabrata; Das, Gopal
2011-02-15
Malachite nanoparticles of 100-150 nm have been efficiently and for the first time used as an adsorbent for the removal of toxic arsenate and chromate. We report a high adsorption capacity for chromate and arsenate on malachite nanoparticle from both individual and mixed solution in pH ∼4-5. However, the adsorption efficiency decreases with the increase of solution pH. Batch studies revealed that initial pH, temperature, malachite nanoparticles dose and initial concentration of chromate and arsenate were important parameters for the adsorption process. Thermodynamic analysis showed that adsorption of chromate and arsenate on malachite nanoparticles is endothermic and spontaneous. The adsorption of these anions has also been investigated quantitatively with the help of adsorption kinetics, isotherm, and selectivity coefficient (K) analysis. The adsorption data for both chromate and arsenate were fitted well in Langmuir isotherm and preferentially followed the second order kinetics. The binding affinity of chromate is found to be slightly higher than arsenate in a competitive adsorption process which leads to the comparatively higher adsorption of chromate on malachite nanoparticles surface. Copyright © 2010 Elsevier B.V. All rights reserved.
Speciation studies of nickel and chromium in wastewater from an electroplating plant.
Kiptoo, Jackson K; Ngila, J Catherine; Sawula, Gerald M
2004-09-08
A speciation scheme involving the use of flame atomic absorption spectrometry (FAAS) and differential pulse adsorptive cathodic stripping voltammetry (DPAdCSV) techniques was applied to studies of nickel and chromium in wastewater from a nickel-chrome electroplating plant. Dimethylglyoxime (DMG) and diethylenetriaminepentaacetic acid (DTPA) were employed as complexing agents for adsorptive voltammetric determination of Ni and Cr, respectively. Cr(III) and Cr(VI) were determined by exploiting differences in their reactivity towards DTPA at HMDE. Total dissolved metal content was in the range 2906-3141 and 30.7-31.2mgl(-1) for Ni and Cr, respectively. A higher percentage of the metal was present as labile species (mean value of 67.9% for Ni and 79.8% for Cr) suggesting that strongly binding ligands are not ubiquitous in the sample. About 77.8% of Cr was found to exist in the higher oxidization state, Cr(IV). Results on effect of dilution on lability of the metal forms in the sample using DPAdCSV showed slight peak shifts to a more negative (cathodic) value by -0.036V for Ni and -0.180V for Cr with a dilution factor of 100, while peak intensity (cathodic current) remained fairly constant.
Venter, P A; Naudé, R J; Oelofsen, W; Swan, G E
1997-01-01
The inhibition of cardiac Na,K-ATPase by 1 alpha,2 alpha-epoxyscillirosidin is the principal cause of poisoning of cattle by the tulip, Homeria pallida. The ultimate goals of this study were to study the interaction between 1 alpha,2 alpha-epoxyscillirosidin and ovine Na,K-ATPase by means of inhibition and displacement binding studies. Ovine cardiac Na,K-ATPase was isolated in membrane-bound form by means of deoxycholate treatment, high-speed ultracentrifugation, NaI treatment and selective solubilization in Lubrol. The inhibition of ovine cardiac and commercial porcine cerebral cortex Na,K-ATPase by 1 alpha,2 alpha-epoxyscilirosidin and ouabain was studied using a discontinuous Na,K-ATPase assay. The binding of 1 alpha,2 alpha-epoxyscillirosidin, ouabain and digoxin to the above enzymes was compared using a displacement binding assay with [3H] oubain. The Lubrol-solubilized ovine cardiac Na,K-ATPase showed a specific activity of 0.3 U/mg with no ouabain insensitive activity. I50 values of 2.1 x 10(-8) and 2.7 x 10(-8) were obtained for the inhibition of this enzyme by 1 alpha,2 alpha-epoxyscillirosidin and ouabain, respectively. 1 alpha,2 alpha-Epoxyscillirosidin has a much higher KD value (1.5 x 10(-7) M), however, than ouabain (9.5 x 10(-9) M) and digoxin (1.7 x 10(-8) M) in displacement binding studies with [3H]ouabain. 1 alpha,2 alpha-Epoxyscillirosidin is a potent inhibitor of ovine cardiac Na,K-ATPase and is a slightly stronger inhibitor of the enzyme than ouabain. The anomalous result for the displacement of 1 alpha,2 alpha-epoxyscillirosidin from its receptor is either a result of different affinities that K+ has for the enzyme ouabain and enzyme-1 alpha,2 alpha-epoxyscillirosidin complexes or because of different complex stabilities of these complexes.
Salian, Vishal D; Vaughan, Asa D; Byrne, Mark E
2012-06-01
In this work, living/controlled radical polymerization (LRP) is compared with conventional free radical polymerization in the creation of highly and weakly cross-linked imprinted poly(methacrylic acid-co-ethylene glycol dimethacrylate) networks. It elucidates, for the first time, the effect of LRP on the chain level and begins to explain why the efficiency of the imprinting process is improved using LRP. Imprinted polymers produced via LRP exhibited significantly higher template affinity and capacity compared with polymers prepared using conventional methods. The use of LRP in the creation of highly cross-linked imprinted polymers resulted in a fourfold increase in binding capacity without a decrease in affinity; whereas weakly cross-linked gels demonstrated a nearly threefold increase in binding capacity at equivalent affinity when LRP was used. In addition, by adjusting the double bond conversion, we can choose to increase either the capacity or the affinity in highly cross-linked imprinted polymers, thus allowing the creation of imprinted polymers with tailorable binding parameters. Using free radical polymerization in the creation of polymer chains, as the template-monomer ratio increased, the average molecular weight of the polymer chains decreased despite a slight increase in the double bond conversion. Thus, the polymer chains formed were shorter but greater in number. Using LRP neutralized the effect of the template. The addition of chain transfer agent resulted in slow, uniform, simultaneous chain growth, resulting in the formation of longer more monodisperse chains. Reaction analysis revealed that propagation time was extended threefold in the formation of highly cross-linked polymers when LRP techniques were used. This delayed the transition to the diffusion-controlled stage of the reaction, which in turn led to the observed enhanced binding properties, decreased polydispersity in the chains, and a more homogeneous macromolecular architecture. Copyright © 2012 John Wiley & Sons, Ltd.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Quennet, Marcel, E-mail: marcel.quennet@fu-berlin.de; Institut für Chemie und Biochemie, Freie Universität Berlin, Takustraße 3, 14195 Berlin; Ritscher, Anna
In this work the Cu/Zn order-disorder transition in Cu{sub 2}ZnSnS{sub 4} kesterites on Wyckoff positions 2c and 2d was investigated by a structural and electronic analysis in theory and experiment. For experimental investigations stoichiometric samples with different Cu/Zn order, annealed in the temperature range of 473–623 K and afterwards quenched, were used. The optical gaps were determined using the Derivation of Absorption Spectrum Fitting (DASF) method. Furthermore, the order-disorder transition was examined by DFT calculations for a closer analysis of the origins of the reduced band gap, showing a good agreement with experimental data with respect to structural and electronicmore » properties. Our studies show a slight increase of lattice parameter c in the kesterite lattice with increasing disorder. Additionally, a reduced band gap was observed with increasing disorder, which is an effect of newly occurring binding motifs in the disordered kesterite structure. - Highlights: • Experimental and theoretical investigation on the order-disorder transition in kesterites. • Slight enlargements of lattice constants due to disorder in experiment and theory. • Strong band gap fluctuations with decreasing order. • Electronic structure deviations due to changing binding motifs. • Disorder as possible main source of low open-circuit voltages.« less
NASA Astrophysics Data System (ADS)
Liu, Xiao-Qiang; Xue, Ying; Tian, Zhi-Yue; Mo, Jing-Jing; Qiu, Nian-Xiang; Chu, Wei; Xie, He-Ping
2013-11-01
Graphene doped by nitrogen (N) and/or boron (B) is used to represent the surface models of coal with the structural heterogeneity. Through the density functional theory (DFT) calculations, the interactions between coalbed methane (CBM) and coal surfaces have been investigated. Several adsorption sites and orientations of methane (CH4) on graphenes were systematically considered. Our calculations predicted adsorption energies of CH4 on graphenes of up to -0.179 eV, with the strongest binding mode in which three hydrogen atoms of CH4 direct to graphene surface, observed for N-doped graphene, compared to the perfect (-0.154 eV), B-doped (-0.150 eV), and NB-doped graphenes (-0.170 eV). Doping N in graphene increases the adsorption energies of CH4, but slightly reduced binding is found when graphene is doped by B. Our results indicate that all of graphenes act as the role of a weak electron acceptor with respect to CH4. The interactions between CH4 and graphenes are the physical adsorption and slightly depend upon the adsorption sites on graphenes and the orientations of methane as well as the electronegativity of dopant atoms in graphene.
Thornalley, Kiri; Laurini, Erik; Pricl, Sabrina; Smith, David K
2018-05-15
A family of four self-assembling lipopeptides containing Ala-Lys peptides attached to a C16 aliphatic chain was synthesised. These compounds form two enantiomeric pairs that bear a diastereomeric relationship to one another (C16-L-Ala-L-Lys/C16-D-Ala-D-Lys) and (C16-D-Ala-L-Lys/C16-L-Ala-D-Lys). These diastereomeric pairs have very different critical micelle concentrations (CMCs), with LL/DD < DL/LD suggesting more effective assembly of the former. The self-assembled multivalent (SAMul) systems bind biological polyanions as result of the cationic lysine groups on their surfaces. Polyanion binding was investigated using dye displacement assays and isothermal calorimetry (ITC). On heparin binding, there was no significant enantioselectivity, but there was a binding preference for the diastereomeric assemblies with lower CMCs. Conversely, on binding DNA, there was a significant enantioselective preference for systems displaying D-lysine ligands, with a further slight preference for attachment to L-alanine, with the CMC being irrelevant. Binding to adaptive, ill-defined heparin has a large favourable entropic term, suggesting it depends primarily on the cationic SAMul nanostructure maximising surface contact with heparin, which can adapt, displacing solvent and other ions. Conversely, binding to well-defined, shape-persistent DNA has a larger favourable enthalpic term, and combined with the enantioselectivity, this allows us to suggest that its SAMul binding is based on optimised individual electrostatic interactions at the molecular level, with a preference for binding to D-lysine. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
In silico pharmacogenetic approach: The natalizumab case study.
Cavaliere, Francesca; Montanari, Enrico; Emerson, Andrew; Buschini, Annamaria; Cozzini, Pietro
2017-09-01
Natalizumab is a humanized monoclonal antibody to α 4 β 1 integrin and is approved for the treatment of Multiple Sclerosis. In patients there is a great variation in drug response and there is much evidence that genetic contributors play an important role in defining an individual's susceptibility. Natalizumab binds to α 4 -residues Gln-152, Lys-201, Lys256, and these seem to be essential for its activity. Studies on a range of species in disease model have showed a loss of reactivity when any one of those three residues were different to human. Based on these animal studies, we thought that the single nucleotide polymorphism in the ITGA4 human gene causing a lysine to arginine transversion at amino acid position 256 require further investigations in the context of individual drug susceptibility. So, the aim of our study was to investigate the association between this genetic polymorphism and the resistance to natalizumab. We had applied molecular dynamics simulation to study the possible conformational changes induced by Lys256Arg transversion on the overall structure of integrin and we have analyzed the binding affinities of natalizumab in the non-mutated and mutated structures through HINT score. We found that this SNP does not affect the VLA4-natalizumab interaction. Instead, the binding affinities are slightly higher in the mutated complex than in the wild-type. We reported one of the first work in which MD simulation was applied in the pharmacogenetic context, and this approach is rapid and cost effective, since a population survey is carried out only after the positive prediction of simulation. Copyright © 2017 Elsevier Inc. All rights reserved.
Biocompatible inorganic nanoparticles for [18F]-fluoride binding with applications in PET imaging
Jauregui-Osoro, Maite; Williamson, Peter A.; Glaria, Arnaud; Sunassee, Kavitha; Charoenphun, Putthiporn; Green, Mark A.; Mullen, Gregory E. D.; Blower, Philip J.
2014-01-01
A wide selection of insoluble nanoparticulate metal salts was screened for avid binding of [18F]-fluoride. Hydroxyapatite and aluminium hydroxide nanoparticles showed particularly avid and stable binding of [18F]-fluoride in various biological media. The in vivo behaviour of the [18F]-labelled hydroxyapatite and aluminium hydroxide particles was determined by PET-CT imaging in mice. [18F]-labelled hydroxyapatite was stable in circulation and when trapped in various tissues (lung embolisation, subcutaneous and intramuscular), but accumulation in liver via reticuloendothelial clearance was followed by gradual degradation and release of [18F]-fluoride (over a period of 4 h) which accumulated in bone. [18F]-labelled aluminium hydroxide was also cleared to liver and spleen but degraded slightly even without liver uptake (subcutanenous and intramuscular). Both materials have properties that are an attractive basis for the design of molecular targeted PET imaging agents labelled with 18F. PMID:21394352
Typography and layout of technical reports - Survey of current practices
NASA Technical Reports Server (NTRS)
Pinelli, T. E.; Cordle, V. M.; Mccullough, R.
1985-01-01
As part of a review of the NASA Langley Research Center scientific and technical information program, 50 technical reports from industry, research institutions, and government agencies were systematically examined and analyzed to determine current usage and practice in regard to (1) typography, including composition method, type style, type size, and margin treatment; (2) graphic design, including layout and imposition of material on the page; and (3) physical media, including paper, ink, and binding methods. The results indicate that approximately 50 percent of the reports were typeset, 70 percent used Roman (serif) type, 80 percent used 10- or 11-point type for text, 60 percent used a ragged right-hand margin, slightly more than half used paragraph indentation, 75 percent used a single-column layout, 65 percent had one or more figures or tables placed perpendicular to (not aligned with) the text, and perfect binding was the most frequently used binding method.
Lectins in fish skin: do they play a role in host-monogenean interactions?
Buchmann, K
2001-09-01
Mucus samples from rainbow trout skin with or without infections by Gyrodactylus derjavini were tested for the presence of lectins reacting with mannose, galactose and lactose. The samples inhibited the binding of biotinylated lectins (from Canavalia ensiformis, Artocarpus integrifolia and Erythrina corallodendron, respectively) to microtitre plates with covalently bound carbohydrates (mannopyranoside, galactopyranoside and lactose, respectively). However, the inhibition of C. ensiformis and A. integrifolia lectins was slightly greater when mucus from infected (but recovering) fish was used, suggesting an increase of mannose and galactose binding lectins in fish skin exposed to parasites. As mannose, galactose and lactose are present on the glycocalyx of Gyrodactylus derjavini, it is suggested that lectins could play a dual role in interactions between fish hosts and their monogenean parasites. Thus, recognition between parasite and host and also host responses towards parasite infections could both, at least partly, involve carbohydrate-lectin binding.
Buku, Angeliki; Mendlowitz, Milton; Condie, Barry A; Price, Joseph A
2004-06-01
The influence of the two histidine and two arginine residues of mast cell degranulating peptide (MCD) in activity and binding was studied by replacing these amino acids in the MCD sequence with L-alanine. Their histamine releasing activity was determined on rat peritoneal mast cells. Their binding affinity to the FcepsilonRIalpha binding subunit of the human mast cell receptor protein, was carried out using fluorescence polarization. The histamine assay showed that replacement of His13 by Ala o ccurred without loss of activity compared with the activity of MCD. Alanine substitutions for Arg7 and His8 resulted in an approximately 40 fold increase, and for Arg16 in a 14-fold increase in histamine-releasing activity of MCD. The binding affinities of the analogs were tested by competitive displacement of bound fluorescent MCD peptide from the FcepsilonRIalpha binding protein of the mast cell receptor by the Ala analogs using fluorescence polarization. The analogs Ala8 (for His) and Ala16 (for Arg) showed the same binding affinities as MCD, whereas analog Ala7 (for Arg) and analog Ala13 (for His) showed slightly better binding affinity than the parent compound. This study showed that the introduction of alanine residues in these positions resulted in MCD agonists of diverse potency. These findings will be useful in further MCD structure-activity studies.
Kibbe, M R; Murdock, A; Wickham, T; Lizonova, A; Kovesdi, I; Nie, S; Shears, L; Billiar, T R; Tzeng, E
2000-02-01
Adenovirus is widely used as a vector for gene transfer to the vasculature. However, the efficiency of these vectors can be limited by ineffective viral-target cell interactions. Viral attachment, which largely determines adenoviral tropism, is mediated through binding of the adenoviral fiber coat protein to the Coxsackievirus and adenovirus receptor, while internalization follows binding of the adenoviral RGD motif to alpha(v)-integrin receptors. Modifications of the fiber coat protein sequence have been successful for targeting the adenovirus to more prevalent receptors in the vasculature, including heparan sulfate-containing receptors and alpha(v)-integrin receptors. Modified adenoviral vectors targeted to receptors more prevalent in the vasculature result in an increased transfer efficiency of the virus in vitro and in vivo even in the presence of clinically relevant doses of heparin. We tested 2 modified E1- and E3-deleted Ad5 type adenoviral vectors containing the beta-galactosidase gene. AdZ.F(pK7) contains multiple positively charged lysines in the fiber coat protein that target the adenovirus to heparan sulfate receptors, while AdZ.F(RGD) contains an RGD integrin-binding sequence in the fiber coat protein that allows binding to alpha(v)-integrin receptors. The gene transfer efficiency of these modified viruses was compared in rat aortic smooth muscle cells in vitro and in an in vivo porcine model of balloon-induced arterial injury. Because of the use of heparin during most vascular surgical procedures and the concern that heparin might interfere with the binding of AdZ.F(pK7) to heparan sulfate receptors, the effect of heparin on the in vitro and in vivo transfer efficiency of these 2 modified adenoviruses was evaluated. In vitro infection of rat aortic smooth muscle cells with AdZ.F(pK7) and AdZ.F(RGD) resulted in significantly higher levels of beta-galactosidase expression compared with the unmodified adenovirus (mean +/- SEM, 1766.3 +/- 89.1 and 44.8 +/- 3.4 vs 10.1 +/- 0.7 mU per milligram of protein; P<.001). Following heparin administration, the gene transfer efficiency achieved with AdZ.F(pK7) diminished slightly in a concentration-dependent manner. However, the transfer efficiency was still greater than with the unmodified virus (mean +/- SEM, 1342.3 +/- 101.8 vs 4.8 +/- 0.4 mU per milligram of protein; P<.001). In vivo, following injury to the pig iliac artery with a 4F Fogarty balloon catheter, we found that AdZ.F(pK7) transduced the artery approximately 35-fold more efficiently than AdZ.F and 3-fold more efficiently than AdZ.F(RGD) following the administration of intravenous heparin, 100 U/kg body weight, and heparinized saline irrigation. Modifications of the adenovirus that lead to receptor targeting resulted in significantly improved gene transfer efficiencies. These improvements in transfer efficiencies observed with the modified vectors decreased slightly in the presence of heparin. However, AdZ.F(pK7) was still superior to AdZ.F(RGD) and AdZ.F despite heparin administration. These data demonstrate that modifications of adenoviral vectors that enhance binding to heparan sulfate receptors significantly improve gene transfer efficiency even in the presence of heparin and suggest an approach to optimize gene transfer into blood vessels.
Structural Basis for a Switch in Receptor Binding Specificity of Two H5N1 Hemagglutinin Mutants
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhu, Xueyong; Viswanathan, Karthik; Raman, Rahul
Avian H5N1 influenza viruses continue to spread in wild birds and domestic poultry with sporadic infection in humans. Receptor binding specificity changes are a prerequisite for H5N1 viruses and other zoonotic viruses to be transmitted among humans. Previous reported hemagglutinin (HA) mutants from ferret-transmissible H5N1 viruses of A/Viet Nam/1203/04 and A/Indonesia/5/05 showed slightly increased, but still very weak, binding to human receptors. From mutagenesis and glycan array studies, we previously identified two H5N1 HA mutants that could more effectively switch receptor specificity to human-like α2-6 linked sialosides with avidity comparable to wild-type H5 HA binding to avian-like α2-3 linked sialosides.more » Here, crystal structures of these two H5 HA mutants free and in complex with human and avian glycan receptor analogues reveal the structural basis for their preferential binding to human receptors. These findings suggest continuous surveillance should be maintained to monitor and assess human-to-human transmission potential of H5N1 viruses.« less
Structural Basis for a Switch in Receptor Binding Specificity of Two H5N1 Hemagglutinin Mutants
Zhu, Xueyong; Viswanathan, Karthik; Raman, Rahul; ...
2015-11-01
Avian H5N1 influenza viruses continue to spread in wild birds and domestic poultry with sporadic infection in humans. Receptor binding specificity changes are a prerequisite for H5N1 viruses and other zoonotic viruses to be transmitted among humans. Previous reported hemagglutinin (HA) mutants from ferret-transmissible H5N1 viruses of A/Viet Nam/1203/04 and A/Indonesia/5/05 showed slightly increased, but still very weak, binding to human receptors. From mutagenesis and glycan array studies, we previously identified two H5N1 HA mutants that could more effectively switch receptor specificity to human-like α2-6 linked sialosides with avidity comparable to wild-type H5 HA binding to avian-like α2-3 linked sialosides.more » Here, crystal structures of these two H5 HA mutants free and in complex with human and avian glycan receptor analogues reveal the structural basis for their preferential binding to human receptors. These findings suggest continuous surveillance should be maintained to monitor and assess human-to-human transmission potential of H5N1 viruses.« less
Schoch, Angela; Larraillet, Vincent; Hilger, Maximiliane; Schlothauer, Tilman; Emrich, Thomas
2017-01-01
The success of recombinant monoclonal immunoglobulins (IgG) is rooted in their ability to target distinct antigens with high affinity combined with an extraordinarily long serum half-life, typically around 3 weeks. The pharmacokinetics of IgGs is intimately linked to the recycling mechanism of the neonatal Fc receptor (FcRn). For long serum half-life of therapeutic IgGs, the highly pH-dependent interaction with FcRn needs to be balanced to allow efficient FcRn binding and release at slightly acidic pH and physiological pH, respectively. Some IgGs, like the antibody briakinumab has an unusually short half-life of ∼8 days. Here we dissect the molecular origins of excessive FcRn binding in therapeutic IgGs using a combination of hydrogen/deuterium exchange mass spectrometry and FcRn affinity chromatography. We provide experimental evidence for a two-pronged IgG-FcRn binding mechanism involving direct FcRn interactions with both the Fc region and the Fab regions of briakinumab, and correlate the occurrence of excessive FcRn binding to an unusually strong Fab-FcRn interaction. PMID:28062799
Nonami, Kayo; Saitoh, Shohei; Nishimura-Danjobara, Yumiko; Ishida, Shiro; Oyama, Yasuo
2016-12-01
Chlorhexidine (CHX) is an antibacterial agent used in various types of pharmaceutical products. Therefore, CHX is easily found around us. Owing to its positive charge, the electrochemical property of cell membranes was assumed to be a key point of cytotoxic action of CHX. Depolarization of membranes attenuated the cytotoxic action of CHX in rat thymic lymphocytes. CHX interfered with annexin V binding to membranes. Manipulations to induce exposure of phosphatidylserine on the outer membrane surface augmented the cytotoxic action of CHX, indicating that changes in the electrochemical property of membranes affected the cytotoxic action of CHX. Hence, CHX might kill cells physiologically undergoing apoptosis, resulting instead in necrotic cell death. However, the threshold CHX concentration in this in vitro study was slightly higher than blood CHX concentrations observed clinically. Therefore, these results may support the safety of CHX use although CHX possesses unique cytotoxic actions described in this study. Copyright © 2016 Elsevier B.V. All rights reserved.
Ralet, M C; Bonnin, E; Thibault, J F
2001-03-25
The inter-molecular distribution of free carboxyl groups of two highly methoxylated pectins enzymatically deesterified by plant and fungus pectin methyl-esterases were investigated by size-exclusion (SEC) and ion-exchange chromatography (IEC). "Homogeneous" populations with respect to molar mass or charge density were thereby obtained and their chemical composition and physico-chemical properties (transport parameter for monovalent cations and calcium, calcium activity coefficient) were studied. Chemical analysis showed that the composition varies from one SEC fraction to another, the highest molar mass fraction being richer in rhamnose and galactose and exhibiting a slightly higher degree of methylation. Separation of pectins by IEC revealed a quite homogeneous charge density distribution for F58 contrary to P60 which exhibited a large distribution of methoxyl groups. The free carboxyl groups distributions and calcium binding behaviours of SEC and IEC fractions were shown to differ widely for highly methoxylated pectins deesterified by plant and fungus pectin methyl-esterases.
Martins, Danubia Batista; Nasário, Fábio Domingues; Silva-Gonçalves, Laiz Costa; de Oliveira Tiera, Vera Aparecida; Arcisio-Miranda, Manoel; Tiera, Marcio José; Dos Santos Cabrera, Marcia Perez
2018-02-01
The antimicrobial activity of chitosan and derivatives to human and plant pathogens represents a high-valued prospective market. Presently, two low molecular weight derivatives, endowed with hydrophobic and cationic character at different ratios were synthesized and characterized. They exhibit antimicrobial activity and increased performance in relation to the intermediate and starting compounds. However, just the derivative with higher cationic character showed cytotoxicity towards human cervical carcinoma cells. Considering cell membranes as targets, the mode of action was investigated through the interaction with model lipid vesicles mimicking bacterial, tumoral and erythrocyte membranes. Intense lytic activity and binding are demonstrated for both derivatives in anionic bilayers. The less charged compound exhibits slightly improved selectivity towards bacterial model membranes, suggesting that balancing its hydrophobic/hydrophilic character may improve efficiency. Observing the aggregation of vesicles, we hypothesize that the "charge cluster mechanism", ascribed to some antimicrobial peptides, could be applied to these chitosan derivatives. Copyright © 2017 Elsevier Ltd. All rights reserved.
Boileau, Isabelle; Rusjan, Pablo; Houle, Sylvain; Wilkins, Diana; Tong, Junchao; Selby, Peter; Guttman, Mark; Saint-Cyr, Jean A; Wilson, Alan A; Kish, Stephen J
2008-09-24
Animal data indicate that methamphetamine can damage striatal dopamine terminals. Efforts to document dopamine neuron damage in living brain of methamphetamine users have focused on the binding of [(11)C]dihydrotetrabenazine (DTBZ), a vesicular monoamine transporter (VMAT2) positron emission tomography (PET) radioligand, as a stable dopamine neuron biomarker. Previous PET data report a slight decrease in striatal [(11)C]DTBZ binding in human methamphetamine users after prolonged (mean, 3 years) abstinence, suggesting that the reduction would likely be substantial in early abstinence. We measured striatal VMAT2 binding in 16 recently withdrawn (mean, 19 d; range, 1-90 d) methamphetamine users and in 14 healthy matched-control subjects during a PET scan with (+)[(11)C]DTBZ. Unexpectedly, striatal (+)[(11)C]DTBZ binding was increased in methamphetamine users relative to controls (+22%, caudate; +12%, putamen; +11%, ventral striatum). Increased (+)[(11)C]DTBZ binding in caudate was most marked in methamphetamine users abstinent for 1-3 d (+41%), relative to the 7-21 d (+15%) and >21 d (+9%) groups. Above-normal VMAT2 binding in some drug users suggests that any toxic effect of methamphetamine on dopamine neurons might be masked by an increased (+)[(11)C]DTBZ binding and that VMAT2 radioligand binding might not be, as is generally assumed, a "stable" index of dopamine neuron integrity in vivo. One potential explanation for increased (+)[(11)C]DTBZ binding is that VMAT2 binding is sensitive to changes in vesicular dopamine storage levels, presumably low in drug users. If correct, (+)[(11)C]DTBZ might be a useful imaging probe to correlate changes in brain dopamine stores and behavior in users of methamphetamine.
Beckford, Garfield; Owens, Eric; Henary, Maged; Patonay, Gabor
2012-04-15
The effects of solvatochromism on protein-ligand interactions have been studied by absorbance and near-infrared laser induced fluorescence (NIR-LIF) spectroscopy. The utility of three novel classes of cyanine dyes designed for this purpose illustrates that the affinity interactions of ligands at the hydrophobic binding pockets of Human Serum Albumin (HSA) are not only dependent on the overall hydrophobic characteristics of the molecules but are highly influenced by the size of the ligands as well. Whereas changes to the chromophore moiety exhibited slight to moderate changes to the hydrophobic nature of these molecules, substitution at the alkyl indolium side chain has enabled us to vary the binding affinity towards serum albumin. Substitution at the indolium side chain among an ethyl to butyl group results in improved binding characteristics and an almost three-fold increase in affinity constant. In addition, replacement of the ethyl side chain with a phenylpropyl group also yielded unique solvotachromic patterns such as increased hydrophobicity and subsequent biocompatibility with the HSA binding regions. Ligand interaction was however inhibited by steric hindrance associated with the bulky phenyl ring system thus affecting the increased binding that could be realized from the improved hydrophobic nature of the molecules. This characteristic change in binding affinity is of potential interest to developing a methodology which reveals information on the hydrophobic character and steric specificity of the binding cavities. Copyright © 2012 Elsevier B.V. All rights reserved.
Matsunaga, James; Schlax, Paula J; Haake, David A
2013-11-01
The spirochete Leptospira interrogans causes a systemic infection that provokes a febrile illness. The putative lipoproteins LigA and LigB promote adhesion of Leptospira to host proteins, interfere with coagulation, and capture complement regulators. In this study, we demonstrate that the expression level of the LigA and LigB proteins was substantially higher when L. interrogans proliferated at 37°C instead of the standard culture temperature of 30°C. The RNA comprising the 175-nucleotide 5' untranslated region (UTR) and first six lig codons, whose sequence is identical in ligA and ligB, is predicted to fold into two distinct stem-loop structures separated by a single-stranded region. The ribosome-binding site is partially sequestered in double-stranded RNA within the second structure. Toeprint analysis revealed that in vitro formation of a 30S-tRNA(fMet)-mRNA ternary complex was inhibited unless a 5' deletion mutation disrupted the second stem-loop structure. To determine whether the lig sequence could mediate temperature-regulated gene expression in vivo, the 5' UTR and the first six codons were inserted between the Escherichia coli l-arabinose promoter and bgaB (β-galactosidase from Bacillus stearothermophilus) to create a translational fusion. The lig fragment successfully conferred thermoregulation upon the β-galactosidase reporter in E. coli. The second stem-loop structure was sufficient to confer thermoregulation on the reporter, while sequences further upstream in the 5' UTR slightly diminished expression at each temperature tested. Finally, the expression level of β-galactosidase was significantly higher when point mutations predicted to disrupt base pairs in the second structure were introduced into the stem. Compensatory mutations that maintained base pairing of the stem without restoring the wild-type sequence reinstated the inhibitory effect of the 5' UTR on expression. These results indicate that ligA and ligB expression is limited by double-stranded RNA that occludes the ribosome-binding site. At elevated temperatures, the ribosome-binding site is exposed to promote translation initiation.
Yu, Jiamei; Ma, Yuguang; Balbuena, Perla B
2012-05-29
Molecular modeling methods are used to estimate the influence of impurity species: water, O(2), and SO(2) in flue gas mixtures present in postcombustion CO(2) capture using a metal organic framework, HKUST-1, as a model sorbent material. Coordinated and uncoordinated water effects on CO(2) capture are analyzed. Increase of CO(2) adsorption is observed for both cases, which can be attributed to the enhanced binding energy between CO(2) and HKUST-1 due to the introduction of a small amount of water. Density functional theory calculations indicate that the binding energy between CO(2) and HKUST-1 with coordinated water is ~1 kcal/mol higher than that without coordinated water. It is found that the improvement of CO(2)/N(2) selectivity induced by coordinated water may mainly be attributed to the increased CO(2) adsorption on the hydrated HKUST-1. On the other hand, the enhanced selectivity induced by uncoordinated water in the flue gas mixture can be explained on the basis of the competition of adsorption sites between water and CO(2) (N(2)). At low pressures, a significant CO(2)/N(2) selectivity increase is due to the increase of CO(2) adsorption and decrease of N(2) adsorption as a consequence of competition of adsorption sites between water and N(2). However, with more water molecules adsorbed at higher pressures, the competition between water and CO(2) leads to the decrease of CO(2) adsorption capacity. Therefore, high pressure operation should be avoided in HKUST-1 sorbents for CO(2) capture. In addition, the effects of O(2) and SO(2) on CO(2) capture in HKUST-1 are investigated: The CO(2)/N(2) selectivity does not change much even with relatively high concentrations of O(2) in the flue gas (up to 8%). A slightly lower CO(2)/N(2) selectivity of a CO(2)/N(2)/H(2)O/SO(2) mixture is observed compared with that in a CO(2)/N(2)/H(2)O mixture, especially at high pressures, due to the strong SO(2) binding with HKUST-1.
Shin, In Soo; Maeng, Jin Soo; Jang, Beom-Su; You, Eric; Cheng, Kenneth; Li, King C.P; Wood, Bradford; Carrasquillo, Jorge A.; Danthi, S. Narasimhan; Paik, Chang H.
2010-01-01
Objectives The aim of this research was to synthesize radiolabeled peptidomimetic integrin αvβ3 antagonist with 99mTc for rapid targeting of integrin αvβ3 receptors in tumor to produce a high tumor to background ratio. Methods The amino terminus of 4-[2-(3,4,5,6-tetra-hydropyrimidin-2-ylamino)-ethyloxy]benzoyl-2-(S)-[N-(3-amino-neopenta-1-carbamyl)]-aminoethylsulfonyl-amino-β-alanine hydrochloride (IAC) was conjugated with N-hydroxysuccinimide ester of HYNIC and labeled with 99mTc using tricine with either 1,5-pyridinedicarboxylic acid (PDA) or ethylenediamine-N,N′-diacetic acid (EDDA) as the co-ligand. The products, 99mTc EDDA2/HYNIC-IAC (P1) and 99mTc PDA (tricin)/HYNIC-IAC (P2) were subjected to in vitro serum stability, receptor-binding, biodistribution and imaging studies. Results P1 and P2 were synthesized with an overall yield of >80%. P1 was slightly more stable than P2 when incubated in serum at 37 °C for 18 hrs (84 vs 77% intact). The In vitro receptor-binding of P1 was higher than that of P2 (78.02 ± 13.48 vs 51.05 ± 14.05%) when incubated with αvβ3 at a molar excess (0.8 μM). This receptor binding was completely blocked by a molar excess of an unlabeled peptidomimetic antagonist. Their differences shown in serum stability and the receptor-binding appeared to be related to their biological behaviors in tumor uptake and retention; the 1 h tumor uptakes of P1 and P2 were 3.17±0.52 and 2.13±0.17 % ID/g, respectively. P1 was retained in the tumor longer than P2. P1 was excreted primarily through the renal system whereas P2 complex was excreted equally via both renal and hepatobiliary systems. Thus, P1 was retained in the whole-body with 27.25 ± 3.67% ID at 4 h whereas 54.04 ± 3.57% ID of P2 remained in the whole-body at 4 h. This higher whole-body retention of P2 appeared to be resulted from a higher amount of radioactivity retained in liver and intestine. These findings were supported by imaging studies showing higher tumor-to-abdominal contrast for P1 than for P2 at 3 h postinjection. Conclusions P1 showed good tumor targeting properties with a rapid tumor uptake, prolonged tumor retention and fast whole-body clearance kinetics. These findings warrant further investigation of the HYNIC method of 99mTc labeling of other peptidomimetic antagonists using EDDA as a coligand. PMID:20556233
Effect of specific activity on organ uptake of iodine-123-meta-iodobenzylguanidine in humans.
Farahati, J; Lassmann, M; Scheubeck, M; Bier, D; Hanscheid, H; Schelper, L; Grelle, I; Biko, J; Werner, E; Graefe, K; Reiners, C
1997-04-01
Radioiodinated meta-iodobenzylguanidine (MIBG), an analogue of norepinephrine, has been used in management of neuroendocrine tumors. Recent studies reveal that distribution of radioiodinated MIBG in animals depends on the specific activity of this radiopharmaceutical. In order to clarify the effect of specific activity on organ uptake of radioiodinated MIBG. the kinetics of no-carrier-added (n.c.a.) [I-123]MIBG (greater than or equal to 7.4 TBq/mu mol) were compared with those of commercial (com.) [I-123]MIBG (similar to 74 MBq/mu mol) in 3 healthy volunteers by serial imaging and blood sampling. The organ uptake of radioiodinated MIBG did not remarkably differ between the two specific activities. Due to rapid degradation a more pronounced accumulation of radioactivity was present in plasma alter n.c.a. than after com. [I-123]MIBG resulting in a higher background and thyroid activity. In addition due to a prolonged residence time of the radioactivity, the radiation exposure to organs was in general slightly higher with n.c.a. [I-123]MIBG as compared to com. [I-123]MIBG. This finding highlights the higher in vivo deiodination of n.c.a. [I-123]MIBG than of com. [I-123]MIBG in humans. In the treatment of children suffering from neuroblastoma, therefore, degradation of n.c.a. [I-123]MIBG may decrease the concentration of radioiodinated MIBG available for binding at tumor sites and result in higher radiation exposure of non-tumor tissue.
Tan, Songwen; Wang, Donglin; Chi, Zhenxing; Li, Weiguo; Shan, Ye
2017-07-01
This work has evaluated the binding force between hHb and typcial PAEs (DMP, DEP, DPRP, DBP, DIBP, DHP and DPHP) using molecule docking technique. The DPHP with 3 aromatic rings has the strongest binding (-ΔG binding : 6.0kcalmol -1 ) than other PAEs (-ΔG binding : 2.91∼4.48kcalmol -1 ). The DMP with the lowest molecular weight has a high binding force (-ΔG binding : 4.48kcalmol -1 ), while the DHP with the highest molecular weight has the lowest binding force (-ΔG binding : 2.91kcalmol -1 ). When the length of side chain increases, the binding force trend to decrease, regarding the VDW forces and H-bonding. The lgK ow -ΔG binding plotting figure shows that a higher K ow value is accompanied by a lower binding force. The aromatic ring existed in PAEs largely increases the binding force between the hHb and the PAEs. On the other hand, the PAEs with higher number of carbon, meaning a higher hydrophobicity, can enter into the hydrophobic space of hHb centre deeper and bond to different position. The aromatic ring decreases the depth of binding position in the hydrophobic space. This work provides basic data and a theoretical method to assess the transport and accumulation of PAEs in human body, and the cytotoxicity of PAEs to hBRCs. Copyright © 2017 Elsevier B.V. All rights reserved.
Odoux, Anne; Jindal, Darren; Tamas, Tamara C; Lim, Benjamin W H; Pollard, Drake; Xu, Wu
2016-06-01
The coactivators CBP (CREBBP) and its paralog p300 (EP300), two conserved multi-domain proteins in eukaryotic organisms, regulate gene expression in part by binding DNA-binding transcription factors. It was previously reported that the CBP/p300 KIX domain mutant (Y650A, A654Q, and Y658A) altered both c-Myb-dependent gene activation and repression, and that mice with these three point mutations had reduced numbers of platelets, B cells, T cells, and red blood cells. Here, our transient transfection assays demonstrated that mouse embryonic fibroblast cells containing the same mutations in the KIX domain and without a wild-type allele of either CBP or p300, showed decreased c-Myb-mediated transcription. Dr. Wright's group solved a 3-D structure of the mouse CBP:c-Myb complex using NMR. To take advantage of the experimental structure and function data and improved theoretical calculation methods, we performed MD simulations of CBP KIX, CBP KIX with the mutations, and c-Myb, as well as binding energy analysis for both the wild-type and mutant complexes. The binding between CBP and c-Myb is mainly mediated by a shallow hydrophobic groove in the center where the side-chain of Leu302 of c-Myb plays an essential role and two salt bridges at the two ends. We found that the KIX mutations slightly decreased stability of the CBP:c-Myb complex as demonstrated by higher binding energy calculated using either MM/PBSA or MM/GBSA methods. More specifically, the KIX mutations affected the two salt bridges between CBP and c-Myb (CBP-R646 and c-Myb-E306; CBP-E665 and c-Myb-R294). Our studies also revealed differing dynamics of the hydrogen bonds between CBP-R646 and c-Myb-E306 and between CBP-E665 and c-Myb-R294 caused by the CBP KIX mutations. In the wild-type CBP:c-Myb complex, both of the hydrogen bonds stayed relatively stable. In contrast, in the mutant CBP:c-Myb complex, hydrogen bonds between R646 and E306 showed an increasing trend followed by a decreasing trend, and hydrogen bonds of the E665:R294 pair exhibited a fast decreasing trend over time during MD simulations. In addition, our data showed that the KIX mutations attenuate CBP's hydrophobic interaction with Leu302 of c-Myb. Furthermore, our 500-ns MD simulations showed that CBP KIX with the mutations has a slightly lower potential energy than wild-type CBP. The CBP KIX structures with or without its interacting protein c-Myb are different for both wild-type and mutant CBP KIX, and this is likewise the case for c-Myb with or without CBP, suggesting that the presence of an interacting protein influences the structure of a protein. Taken together, these analyses will improve our understanding of the exact functions of CBP and its interaction with c-Myb. Published by Elsevier Ltd.
Architecture of a Fur Binding Site: a Comparative Analysis
Lavrrar, Jennifer L.; McIntosh, Mark A.
2003-01-01
Fur is an iron-binding transcriptional repressor that recognizes a 19-bp consensus site of the sequence 5′-GATAATGATAATCATTATC-3′. This site can be defined as three adjacent hexamers of the sequence 5′-GATAAT-3′, with the third being slightly imperfect (an F-F-F configuration), or as two hexamers in the forward orientation separated by one base pair from a third hexamer in the reverse orientation (an F-F-x-R configuration). Although Fur can bind synthetic DNA sequences containing the F-F-F arrangement, most natural binding sites are variations of the F-F-x-R arrangement. The studies presented here compared the ability of Fur to recognize synthetic DNA sequences containing two to four adjacent hexamers with binding to sequences containing variations of the F-F-x-R arrangement (including natural operator sequences from the entS and fepB promoter regions of Escherichia coli). Gel retardation assays showed that the F-F-x-R architecture was necessary for high-affinity Fur-DNA interactions and that contiguous hexamers were not recognized as effectively. In addition, the stoichiometry of Fur at each binding site was determined, showing that Fur interacted with its minimal 19-bp binding site as two overlapping dimers. These data confirm the proposed overlapping-dimer binding model, where the unit of interaction with a single Fur dimer is two inverted hexamers separated by a C:G base pair, with two overlapping units comprising the 19-bp consensus binding site required for the high-affinity interaction with two Fur dimers. PMID:12644489
Kimura, Yasuyuki; Siméon, Fabrice G; Zoghbi, Sami S; Zhang, Yi; Hatazawa, Jun; Pike, Victor W; Innis, Robert B; Fujita, Masahiro
2012-02-01
A new PET ligand, 3-fluoro-5-(2-(2-(18)F-(fluoromethyl)-thiazol-4-yl)ethynyl)benzonitrile (18F-SP203) can quantify metabotropic glutamate subtype 5 receptors (mGluR5) in human brain by a bolus injection and kinetic modeling. As an alternative approach to a bolus injection, binding can simply be measured as a ratio of tissue to metabolite-corrected plasma at a single time point under equilibrium conditions achieved by administering the radioligand with a bolus injection followed by a constant infusion. The purpose of this study was to validate the equilibrium method as an alternative to the standard kinetic method for measuring 18F-SP203 binding in the brain. Nine healthy subjects were injected with 18F-SP203 using a bolus plus constant infusion for 300 min. A single ratio of bolus-to-constant infusion (the activity of bolus equaled to that of infusion over 219 min) was applied to all subjects to achieve equilibrium in approximately 120 min. As a measure of ligand binding, we compared total distribution volume (VT) calculated by the equilibrium and kinetic methods in each scan. The equilibrium method calculated VT by the ratio of radioactivity in the brain to the concentration of 18F-SP203 in arterial plasma at 120 min, and the kinetic method calculated VT by a two-tissue compartment model using brain and plasma dynamic data from 0 to 120 min. VT obtained via the equilibrium method was highly correlated with VT obtained via kinetic modeling. Inter-subject variability of VT obtained via the equilibrium method was slightly smaller than VT obtained via the kinetic method. VT obtained via the equilibrium method was ~10% higher than VT obtained via the kinetic method, indicating a small difference between the measurements. Taken together, the results of this study show that using the equilibrium method is an acceptable alternative to the standard kinetic method when using 18F-SP203 to measure mGluR5. Although small differences in the measurements obtained via the equilibrium and kinetic methods exist, both methods consistently measured mGluR5 as indicated by the highly correlated VT values; the equilibrium method was slightly more precise, as indirectly measured by the smaller coefficient of variability across subjects. In addition, when using 18F-SP203, the equilibrium method is more efficient because it requires much less data. Copyright © 2011. Published by Elsevier Inc.
Impact of autoclave sterilization on the activity and structure of formulated heparin.
Beaudet, Julie M; Weyers, Amanda; Solakyildirim, Kemal; Yang, Bo; Takieddin, Majde; Mousa, Shaker; Zhang, Fuming; Linhardt, Robert J
2011-08-01
The stability of a formulated heparin was examined during its sterilization by autoclaving. A new method to follow loss in heparin binding to the serine protease inhibitor, antithrombin III, and the serine protease, thrombin, was developed using a surface plasmon resonance competitive binding assay. This loss in binding affinity correlated well with loss in antifactor IIa (thrombin) activity as well as antifactor Xa activity as measured using conventional amidolytic assays. Autoclaving also resulted in a modest breakdown of the heparin backbone as confirmed by a slight reduction in number-averaged and weight-averaged molecular weight and an increase in polydispersity. Although no clear changes were observed by nuclear magnetic resonance spectroscopy, disaccharide composition analysis using high-performance liquid chromatography-electrospray ionization-mass spectrometry suggested that loss of selected sulfo groups had taken place. It is this sulfo group loss that probably accounts for a decrease in the binding of autoclaved heparin to antithrombin III and thrombin as well as the observed decrease in its amidolytic activity. Copyright © 2011 Wiley-Liss, Inc.
Rapid screening and species identification of E. coli, Listeria, and Salmonella by SERS technique
NASA Astrophysics Data System (ADS)
Liu, Yongliang; Chao, Kuanglin; Kim, Moon S.; Nou, Xiangwu
2008-04-01
Techniques for routine and rapid screening of the presence of foodborne bacteria are needed, and this study reports the feasibility of citrate-reduced silver colloidal SERS for identifying E. coli, Listeria, and Salmonella. Relative standard deviation (RSD) of SERS spectra from silver colloidal suspensions and ratios of P-O SERS peaks from small molecule (K3PO4) were used to assess the reproducibility, stability, and binding effectiveness of citrate-reduced silver colloids over batch and storage process. The results suggested the reproducibility of silver colloids over batch process and also stability and consistent binding effectiveness over 60-day storage period. Notably, although silver colloidal nanoparticles were stable for at least 90 days, their binding effectiveness began to decrease slightly after 60-day storage, with a binding reduction of about 12% at 90th day. Colloidal silver SERS, as demonstrated here, could be an important alternative technique in the rapid and simultaneous screening of the presence of three most outbreak bacteria due to the exclusive biomarkers, label-free and easy sampling attribute.
NASA Astrophysics Data System (ADS)
Murugesan, Arul; Gengan, Robert Moonsamy; Rajamanikandan, Ramar; Ilanchelian, Malaichamy
2017-12-01
A series of novel dispiro piperazinyl-quinolinyl-thioxothiazolidin-2, 4-dione derivatives were synthesised and characterised by FT-IR 1H, 13C, 2D NMR and HRMS spectroscopic techniques. A representative compound 1'-(2-(4-methylpiperazin-1-yl)quinolin-3-yl)-2″-thioxo-5‧,6‧,7‧,7a'-tetrahydro-1‧H,2H-dispiro[acenaphthylene-1,3‧-pyrrolizine-2‧,5″-thiazolidine]-2,4″-dione was studied for its binding ability with human serum albumin (HSA) using the fluorescence quench titration method. Addition of the compound to HSA produced slight fluorescence quenching and red shift. The free energy change for the complexation process was evaluated as -29.98 kJ mol-1 thereby indicating a spontaneous and highly favourable reaction. Molecular docking analyses revealed the binding as -20.79 kJ mol-1 which was analogous with the experimental value obtained from emission data. It was concluded that TYR-263 is the moiety responsible for the binding in the complex.
Ahmed, Ishfaq; Lv, Liangtao; Lin, Hong; Li, Zhenxing; Ma, Jiaju; Guanzhi, Chen; Sun, Lirui; Xu, Lili
2018-05-15
The present study was performed to determine crosslinking and oxidative reactions catalyzed by tyrosinase (Tyr), caffeic acid (CA) and their combination with respect to IgE binding potential and conformational structure of shrimp tropomyosin (TM). Cross-links and IgE binding potentials were analyzed by SDS-PAGE, western blot and indirect ELISA. While structural changes were characterized using surface hydrophobicity, ultraviolet (UV), fluorescence and circular dichroism (CD) spectroscopies. Maximum reduction in the IgG (37.19%) and IgE binding potentials (49.41%) were observed when treated with 2000 nkat/g Tyr + CA, as indicated by ELISA analyses. These findings correlated well with the denaturation of protein, as evident by slight blue shift and alterations in the ellipticities observed via structural analyses. The results demonstrated that addition of CA mediator with Tyr pronouncedly enhanced crosslinking, and altered the conformational structure, thereby mitigated allergenicity of TM, thus showing promise in developing novel food structures with reduced allergenic potential. Copyright © 2017 Elsevier Ltd. All rights reserved.
Solomentsev, Gleb; Diehl, Carl; Akke, Mikael
2018-03-06
FKBP12 (FK506 binding protein 12 kDa) is an important drug target. Nuclear magnetic resonance (NMR) order parameters, describing amplitudes of motion on the pico- to nanosecond time scale, can provide estimates of changes in conformational entropy upon ligand binding. Here we report backbone and methyl-axis order parameters of the apo and FK506-bound forms of FKBP12, based on 15 N and 2 H NMR relaxation. Binding of FK506 to FKBP12 results in localized changes in order parameters, notably for the backbone of residues E54 and I56 and the side chains of I56, I90, and I91, all positioned in the binding site. The order parameters increase slightly upon FK506 binding, indicating an unfavorable entropic contribution to binding of TΔ S = -18 ± 2 kJ/mol at 293 K. Molecular dynamics simulations indicate a change in conformational entropy, associated with all dihedral angles, of TΔ S = -26 ± 9 kJ/mol. Both these values are significant compared to the total entropy of binding determined by isothermal titration calorimetry and referenced to a reactant concentration of 1 mM ( TΔ S = -29 ± 1 kJ/mol). Our results reveal subtle differences in the response to ligand binding compared to that of the previously studied rapamycin-FKBP12 complex, despite the high degree of structural homology between the two complexes and their nearly identical ligand-FKBP12 interactions. These results highlight the delicate dependence of protein dynamics on drug interactions, which goes beyond the view provided by static structures, and reinforce the notion that protein conformational entropy can make important contributions to the free energy of ligand binding.
Iversen, L F; Brzozowski, M; Hastrup, S; Hubbard, R; Kastrup, J S; Larsen, I K; Naerum, L; Nørskov-Lauridsen, L; Rasmussen, P B; Thim, L; Wiberg, F C; Lundgren, K
1997-05-01
The structures of three complexes of human fructose-1,6-bisphosphatase (FB) with the allosteric inhibitor AMP and two AMP analogues have been determined and all fully refined. The data used for structure determination were collected at cryogenic temperature (110 K), and with the use of synchrotron radiation. The structures reveal a common mode of binding for AMP and formycine monophosphate (FMP). 5-Amino-4-carboxamido-1 beta-D-5-phosphate-ribofuranosyl-1H-imidazole (AICAR-P) shows an unexpected mode of binding to FB, different from that of the other two ligands. The imidazole ring of AICAR-P is rotated 180 degrees compared to the AMP and FMP bases. This rotation results in a slightly different hydrogen bonding pattern and minor changes in the water structure in the binding pocket. Common features of binding are seen for the ribose and phosphate moieties of all three compounds. Although binding in a different mode, AICAR-P is still capable of making all the important interactions with the residues building the allosteric binding pocket. The IC50 values of AMP, FMP, and AICAR-P were determined to be 1.7, 1.4, and 20.9 microM, respectively. Thus, the approximately 10 times lower potency of AICAR-P is difficult to explain solely from the variations observed in the binding pocket. Only one water molecule in the allosteric binding pocket was found to be conserved in all four subunits in all three structures. This water molecule coordinates to a phosphate oxygen atom and the N7 atom of the AMP molecule, and to similarly situated atoms in the FMP and AICAR-P complexes. This implies an important role of the conserved water molecule in binding of the ligand.
Iversen, L. F.; Brzozowski, M.; Hastrup, S.; Hubbard, R.; Kastrup, J. S.; Larsen, I. K.; Naerum, L.; Nørskov-Lauridsen, L.; Rasmussen, P. B.; Thim, L.; Wiberg, F. C.; Lundgren, K.
1997-01-01
The structures of three complexes of human fructose-1,6-bisphosphatase (FB) with the allosteric inhibitor AMP and two AMP analogues have been determined and all fully refined. The data used for structure determination were collected at cryogenic temperature (110 K), and with the use of synchrotron radiation. The structures reveal a common mode of binding for AMP and formycine monophosphate (FMP). 5-Amino-4-carboxamido-1 beta-D-5-phosphate-ribofuranosyl-1H-imidazole (AICAR-P) shows an unexpected mode of binding to FB, different from that of the other two ligands. The imidazole ring of AICAR-P is rotated 180 degrees compared to the AMP and FMP bases. This rotation results in a slightly different hydrogen bonding pattern and minor changes in the water structure in the binding pocket. Common features of binding are seen for the ribose and phosphate moieties of all three compounds. Although binding in a different mode, AICAR-P is still capable of making all the important interactions with the residues building the allosteric binding pocket. The IC50 values of AMP, FMP, and AICAR-P were determined to be 1.7, 1.4, and 20.9 microM, respectively. Thus, the approximately 10 times lower potency of AICAR-P is difficult to explain solely from the variations observed in the binding pocket. Only one water molecule in the allosteric binding pocket was found to be conserved in all four subunits in all three structures. This water molecule coordinates to a phosphate oxygen atom and the N7 atom of the AMP molecule, and to similarly situated atoms in the FMP and AICAR-P complexes. This implies an important role of the conserved water molecule in binding of the ligand. PMID:9144768
Das, Pratyusa; Chaudhari, Sunil Kumar; Das, Asmita; Kundu, Somashree; Saha, Chabita
2018-04-24
Binding affinities of flavonols namely quercetin, myricetin, and kaempferol to human serum albumin (HSA) were determined fluorimetrically and the order was observed to be myricetin > quercetin > kaempferol demonstrating structure-activity relationship. Quercetin-coated silver nanoparticles (AgNPs) show higher binding affinity to HSA compared to free quercetin with binding constants 6.04 × 10 7 M -1 and 4.2 × 10 6 M -1 , respectively. Using site-specific markers it is concluded that free quercetin and that coated on AgNPs bind at different sites. Significant structural changes in circular dichroism (CD) spectra of HSA were recorded with quercetin-coated AgNPs compared to free quercetin. These results were further substantiated by time-resolved fluorescence spectroscopy where fluorescence life time of the tryptophan residue in HSA-quercetin-coated AgNPs complex decreased to 3.63 ns from 4.22 ns in HSA-quercetin complex. Isothermal calorimetric studies reveal two binding modes for quercetin-coated AgNPs and also higher binding constants compared to free quercetin. These higher binding affinities are attributed to altered properties of quercetin when coated on AgNPs enabling it to reach the binding sites other than site II where free quercetin mainly binds.
Effect of Vibrio parahaemolyticus haemolysin on human erythrocytes.
Lang, Philipp A; Kaiser, Stephanie; Myssina, Swetlana; Birka, Christina; Weinstock, Christof; Northoff, Hinnak; Wieder, Thomas; Lang, Florian; Huber, Stephan M
2004-04-01
Haemolysin Kanagawa, a toxin from Vibrio parahaemolyticus, is known to trigger haemolysis. Flux studies indicated that haemolysin forms a cation channel. In the present study, channel properties were elucidated by patch clamp and functional significance of ion fluxes by fluorescence-activated cell sorting (FACS) analysis. Treatment of human erythrocytes with 1 U ml-1 haemolysin within minutes induces a non-selective cation permeability. Moreover, haemolysin activates clotrimazole-sensitive K+ channels, pointing to stimulation of Ca2+-sensitive Gardos channels. Haemolysin (1 U ml-1) leads within 5 min to slight cell shrinkage, which is reversed in Ca2+-free saline. Erythrocytes treated with haemolysin (0.1 U ml-1) do not undergo significant haemolysis within the first 60 min. Replacement of extracellular Na+ with NMDG+ leads to slight cell shrinkage, which is potentiated by 0.1 U ml-1 haemolysin. According to annexin binding, treatment of erythrocytes with 0.1 U ml-1 haemolysin leads within 30 min to breakdown of phosphatidylserine asymmetry of the cell membrane, a typical feature of erythrocyte apoptosis. The annexin binding is significantly blunted at increased extracellular K+ concentrations and by K+ channel blocker clotrimazole. In conclusion, haemolysin Kanagawa induces cation permeability and activates endogenous Gardos K+ channels. Consequences include breakdown of phosphatidylserine asymmetry, which depends at least partially on cellular loss of K+.
Coletta, M; Brittain, T; Brunori, M
1986-01-01
Thermodynamic and kinetic properties of O2 and CO binding to haemoglobin (Hb) Kempsey [Asp-G1(99) beta----Asn] were investigated and the activation parameters for the two ligands were determined. At every temperature the O2-binding isotherms display a weak co-operativity, n ranging between 1.1 and 1.2, and dissociation kinetics show a single-exponential behaviour. O2-binding kinetics were studied at 25 degrees C by temperature jump and are characterized at each saturation (from Y = 0.31 to Y = 1.0) by two processes, a fast bimolecular one and a slow monomolecular one (tau -1 = 20 s-1), which contributes to approx. 30% of the whole relaxation amplitude at every Y. CO-binding kinetics to Hb Kempsey were followed at several temperatures by flash photolysis and stopped flow. The process is biphasic, as reported elsewhere [Bunn, Wohl, Bradley, Cooley & Gibson (1974) J. Biol. Chem. 249, 7402-7409], and the relative contributions of the two bimolecular rates to the whole process are only slightly affected by temperature. On taking account for the fraction of dimers at every protein concentration, the slow phase corresponds to approx. 50% of the ligand binding to tetramers. Correlation of these results with previous spectroscopic data leads to the hypothesis that the biphasic time course of CO binding may be attributed to alpha/beta heterogeneity of the R-state of tetrameric Hb Kempsey. PMID:3800943
NASA Astrophysics Data System (ADS)
Xu, Liang; Hu, Yan-Xi; Li, Yan-Cheng; Zhang, Li; Ai, Hai-Xin; Liu, Yu-Feng; Liu, Hong-Sheng
2018-02-01
In the present work, the binding interaction between lenalidomide (LEN) and calf thymus DNA (ct-DNA) was systematically studied by using fluorescence, ultraviolet-visible (UV-vis) absorption, circular dichroism (CD) spectroscopies under imitated physiological conditions (pH = 7.4) coupled with molecular docking. It was found that LEN was bound to ct-DNA with high binding affinity (Ka = 2.308 × 105 M-1 at 283 K) through groove binding as evidenced by a slight decrease in the absorption intensity in combination with CD spectra. Thermodynamic parameters (ΔG < 0, ΔH > 0 and ΔS < 0) of the LEN-DNA system obtained at three different temperatures suggested that the binding process was spontaneous and was primarily driven by hydrogen bonds and hydrophobic interaction. Furthermore, competitive binding experiments with ethidium bromide and 4‧, 6-dia-midino-2-phenylindoleas probes showed that LEN could preferentially bind in the minor groove of double-stranded DNA. The average lifetime of LEN was calculated to be 7.645 ns. The φ of LEN was measured as 0.09 and non-radiation energy transfer between LEN and DNA had occurred. The results of the molecular docking were consistent with the experimental results. This study explored the potential applicability of the spectroscopic properties of LEN and also investigated its interactions with relevant biological targets. In addition, it will provide some theoretical references for the deep research of simultaneous administration of LEN with other drugs.
Baraúna, Rafael A; Santos, Agenor V; Graças, Diego A; Santos, Daniel M; Ghilardi, Rubens; Pimenta, Adriano M C; Carepo, Marta S P; Schneider, Maria P C; Silva, Artur
2015-05-01
Several studies of the physiological responses of different organisms exposed to extremely low-frequency electromagnetic fields (ELF-EMF) have been described. In this work, we report the minimal effects of in situ exposure to ELF-EMF on the global protein expression of Chromobacterium violaceum using a gel-based proteomic approach. The protein expression profile was only slightly altered, with five differentially expressed proteins detected in the exposed cultures; two of these proteins (DNA-binding stress protein, Dps, and alcohol dehydrogenase) were identified by MS/MS. The enhanced expression of Dps possibly helped to prevent physical damage to DNA. Although small, the changes in protein expression observed here were probably beneficial in helping the bacteria to adapt to the stress generated by the electromagnetic field.
Functional analysis of the EspR binding sites upstream of espR in Mycobacterium tuberculosis.
Cao, Guangxiang; Howard, Susan T; Zhang, Peipei; Hou, Guihua; Pang, Xiuhua
2013-11-01
The ESX-1 secretion system exports substrate proteins into host cells and is crucial for the pathogenesis of Mycobacterium tuberculosis. EspR is one of the characterized transcriptional regulators that modulates the ESX-1 system by binding the conserved EspR binding sites in the promoter of espA, the encoding gene of EspA, which is also a substrate protein of the ESX-1 system and is required for the ESX-1 activity. EspR is autoregulatory and conserved EspR binding sites are present upstream of espR. In this study, we showed that these EspR sites had varying affinities for EspR, with site B being the strongest one. Point mutations of the DNA sequence at site B abolished binding of EspR to oligonucleotides containing site B alone or with other sites, further suggesting that site B is a major binding site for EspR. Complementation studies showed that constructs containing espR, and the upstream intergenic region fully restored espR expression in a ΔespR mutant strain. Although recombinant strains with mutations at more than one EspR site showed minimal differences in espR expression, reduced expression of other EspR target genes was observed, suggesting that slight changes in EspR levels can have downstream regulatory effects. These findings contribute to our understanding of the regulation of the ESX-1 system.
NASA Astrophysics Data System (ADS)
Li, Xiangrong; Chen, Dejun; Wang, Gongke; Lu, Yan
2015-02-01
Albumin represents a very abundant and important circulating antioxidant in plasma. DPPH radical is also called 2,2-diphenyl-1-picrylhydrazyl. It has been widely used for measuring the efficiency of antioxidants. In this paper, the ability of human serum albumin (HSA) to scavenge DPPH radical was investigated using UV-vis absorption spectra. The interaction between HSA and DPPH was investigated in the absence and presence of eight popular antioxidants using fluorescence spectroscopy. These results indicate the antioxidant activity of HSA against DPPH radical is similar to glutathione and the value of IC50 is 5.200 × 10-5 mol L-1. In addition, the fluorescence experiments indicate the quenching mechanism of HSA, by DPPH, is a static process. The quenching process of DPPH with HSA is easily affected by the eight antioxidants, however, they cannot change the quenching mechanism of DPPH with HSA. The binding of DPPH to HSA primarily takes place in subdomain IIA and exists two classes of binding sites with two different interaction behaviors. The decreased binding constants and the number of binding sites of DPPH with HSA by the introduction of the eight antioxidants may result from the competition of the eight antioxidants and DPPH binding to HSA. The binding of DPPH to HSA may induce the micro-environment of the lone Trp-214 from polar to slightly nonpolar.
Modulation of mouse Leydig cell steroidogenesis through a specific arginine-vasopressin receptor
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tahri-Joutei, A.; Pointis, G.
1988-01-01
Characterization of specific vasopressin binding sites was investigated in purified mouse Leydig cells using tritiated arginine-vasopressin. Binding of radioligand was saturable, time- and temperature-dependent and reversible. (/sup 3/H)-AVP was found to bind to a single class of sites with high affinity and low capacity. Binding displacements with specific selection analogs of AVP indicated the presence of V/sub 1/ subtype receptors on Leydig cells. The ability of AVP to displace (/sup 3/H)-AVP binding was greater than LVP and oxytocin. The unrelated peptides, somatostatin and substance P, were less potent, while neurotensin and LHRH did not displace (/sup 3/H)-AVP binding. The time-coursemore » effects of AVP-pretreatment on basal and hCG-stimulated testosterone and cAMP accumulations were studied in primary culture of Leydig cells. Basal testosterone accumulation was significantly increased by a 24 h AVP-pretreatment of Leydig cells. This effect was potentiated by the phosphodiesterase inhibitor (MIX) and was concomitantly accompanied by a slight but significant increase in cAMP accumulation. AVP-pretreatment of the cells for 72 h had no effect on basal testosterone accumulation, but exerted a marked inhibitory effect on the hCG-stimulated testosterone accumulation. This reduction of testosterone accumulation occurred even in the presence of MIX and was not accompanied by any significant change of cAMP levels.« less
Matysiak-Brynda, Edyta; Bujak, Piotr; Augustin, Ewa; Kowalczyk, Agata; Mazerska, Zofia; Pron, Adam; Nowicka, Anna M
2018-01-18
One way to limit the negative effects of anti-tumor drugs on healthy cells is targeted therapy employing functionalized drug carriers. Here we present a biocompatible and stable nanoconjugate of transferrin anchored to Ag-In-Zn-S quantum dots modified with 11-mercaptoundecanoic acid (Tf-QD) as a drug carrier versus typical anticancer drug, doxorubicin. Detailed investigations of Tf-QD nanoconjugates without and with doxorubicin by fluorescence studies and cytotoxic measurements showed that the biological activity of both the transferrin and doxorubicin was fully retained in the nanoconjugate. In particular, the intercalation capabilities of free doxorubicin versus ctDNA remained essentially intact upon its binding to the nanoconjugate. In order to evaluate these capabilities, we studied the binding constant of doxorubicin attached to Tf-QDs with ctDNA as well as the binding site size on the ctDNA molecule. The binding constant slightly decreased compared to that of free doxorubicin while the binding site size, describing the number of consecutive DNA lattice residues involved in the binding, increased. It was also demonstrated that the QDs alone and in the form of a nanoconjugate with Tf were not cytotoxic towards human non-small cell lung carcinoma (H460 cell line) and the tumor cell sensitivity of the DOX-Tf-QD nanoconjugate was comparable to that of doxorubicin alone.
NASA Technical Reports Server (NTRS)
Robinson, B. A.; Foster, C. L.
1986-01-01
A series of torque tests were performed on four flight-type hex ball universal joints in order to characterize and determine the actual load-carrying capability of this device. The universal joint is a part of manual actuation rods for scientific instruments within the Hubble Space Telescope. It was found that the hex ball will bind slightly during the initial load application. This binding did not affect the function of the universal joint, and the units would wear-in after a few additional loading cycles. The torsional yield load was approximately 50 ft-lb, and was consistent among the four test specimens. Also, the torque required to cause complete failure exceeded 80 ft-lb. It is concluded that the hex ball universal joint is suitable for its intended applications.
Murciano-Calles, Javier; McLaughlin, Megan E; Erijman, Ariel; Hooda, Yogesh; Chakravorty, Nishant; Martinez, Jose C; Shifman, Julia M; Sidhu, Sachdev S
2014-10-23
Modulation of protein binding specificity is important for basic biology and for applied science. Here we explore how binding specificity is conveyed in PDZ (postsynaptic density protein-95/discs large/zonula occludens-1) domains, small interaction modules that recognize various proteins by binding to an extended C terminus. Our goal was to engineer variants of the Erbin PDZ domain with altered specificity for the most C-terminal position (position 0) where a Val is strongly preferred by the wild-type domain. We constructed a library of PDZ domains by randomizing residues in direct contact with position 0 and in a loop that is close to but does not contact position 0. We used phage display to select for PDZ variants that bind to 19 peptide ligands differing only at position 0. To verify that each obtained PDZ domain exhibited the correct binding specificity, we selected peptide ligands for each domain. Despite intensive efforts, we were only able to evolve Erbin PDZ domain variants with selectivity for the aliphatic C-terminal side chains Val, Ile and Leu. Interestingly, many PDZ domains with these three distinct specificities contained identical amino acids at positions that directly contact position 0 but differed in the loop that does not contact position 0. Computational modeling of the selected PDZ domains shows how slight conformational changes in the loop region propagate to the binding site and result in different binding specificities. Our results demonstrate that second-sphere residues could be crucial in determining protein binding specificity. Copyright © 2014 Elsevier Ltd. All rights reserved.
Wang, Jian; Evangelou, Bill P.; Nielsen, Mark T.
1992-01-01
Surface chemical characteristics of root cell walls extracted from two tobacco genotypes exhibiting differential tolerance to Mn toxicity were studied using potentiometric pH titration and Fourier transform infrared spectroscopy. The Mn-sensitive genotype KY 14 showed a stronger interaction of its cell wall surface with metal ions than did the Mn-tolerant genotype Tobacco Introduction (T.I.) 1112. This observation may be attributed to the relatively higher ratio of COO− to COOH in KY 14 cell walls than that found in the cell walls of T.I. 1112 in the pH range of 4 to 10. For both genotypes, the strength of binding between metal ions and cell wall surface was in the order of Cu > Ca > Mn > Mg > Na. However, a slightly higher preference of Ca over Mn was observed with the T.I. 1112 cell wall. This may explain the high accumulation of Mn in the leaves of Mn-tolerant genotype T.I. 1112 rather than the high accumulation of Mn in roots, as occurred in Mn-sensitive KY 14. It is concluded that surface chemical characteristics of cell walls may play an important role in plant metal ion uptake and tolerance. PMID:16652989
Screening of biologically important Zn2 + by a chemosensor with fluorescent turn on-off mechanism
NASA Astrophysics Data System (ADS)
Khan, Tanveer A.; Sheoran, Monika; Nikhil Raj M., Venkata; Jain, Surbhi; Gupta, Diksha; Naik, Sunil G.
2018-01-01
Reported herein the synthesis, characterization and biologically important zinc ion binding propensity of a weakly fluorescent chemosensor, 4-methyl-2,6-bis((E)-(2-(4-phenylthiazol-2-yl)hydrazono)methyl)phenol (1). 1H NMR spectroscopic titration experiment reveals the binding knack of 1 to the essential Zn2 +. The photo-physical studies of 1 exhibit an enhancement in the fluorescence by several folds upon binding with the zinc ions attributed to PET-off process, with a binding constant value of 5.22 × 103 M- 1. 1 exhibits an excellent detection range for Zn2 + with lower detection limit value of 2.31 × 10- 8 M. The selectivity of 1 was studied with various mono and divalent metal cations and it was observed that most cations either quenches the fluorescence or remains unchanged except for Cd2 +, which shows a slight enhancement in fluorescence intensity of 1. The ratiometric displacement of Cd2 + ions by Zn2 + ions shows an excellent selectivity towards in-situ detection of Zn2 + ions. Photo-physical studies also support the reversible binding of 1 to Zn2 + ions having on and off mechanism in presence of EDTA. Such recognition of the biologically important zinc ions finds potential application in live cell imaging.
Ma, Rui; Pan, Hong; Shen, Tao; Li, Peng; Chen, Yanan; Li, Zhenyu; Di, Xiaxia; Wang, Shuqi
2017-08-09
Phytochemical investigation on the methanol extract of Woodwardia unigemmata resulted in the isolation of seven flavonoids, including one new flavonol acylglycoside ( 1 ). The structures of these compounds were elucidated on the basis of extensive spectroscopic analysis and comparison of literature data. The multidrug resistance (MDR) reversing activity was evaluated for the isolated compounds using doxorubicin-resistant K562/A02 cells model. Compound 6 showed comparable MDR reversing effect to verapamil. Furthermore, the interaction between compounds and bovine serum albumin (BSA) was investigated by spectroscopic methods, including steady-state fluorescence, synchronous fluorescence, circular dichroism (CD) spectroscopies, and molecular docking approach. The experimental results indicated that the seven flavonoids bind to BSA by static quenching mechanisms. The negative ΔH and ΔS values indicated that van der Waals interactions and hydrogen bonds contributed in the binding of compounds 2 - 6 to BSA. In the case of compounds 1 and 7 systems, the hydrophobic interactions play a major role. The binding of compounds to BSA causes slight changes in the secondary structure of BSA. There are two binding sites of compound 6 on BSA and site I is the main site according to the molecular docking studies and the site marker competitive binding assay.
Sydor, Andrew M; Liu, Jenny; Zamble, Deborah B
2011-03-01
The biosyntheses of the [NiFe]-hydrogenase and urease enzymes in Helicobacter pylori require several accessory proteins for proper construction of the nickel-containing metallocenters. The hydrogenase accessory proteins HypA and HypB, a GTPase, have been implicated in the nickel delivery steps of both enzymes. In this study, the metal-binding properties of H. pylori HypB were characterized, and the effects of metal binding on the biochemical behavior of the protein were examined. The protein can bind stoichiometric amounts of Zn(II) or Ni(II), each with nanomolar affinity. Mutation of Cys106 and His107, which are located between two major GTPase motifs, results in undetectable Ni(II) binding, and the Zn(II) affinity is weakened by 2 orders of magnitude. These two residues are also required for the metal-dependent dimerization observed in the presence of Ni(II) but not Zn(II). The addition of metals to the protein has distinct impacts on GTPase activity, with zinc significantly reducing GTP hydrolysis to below detectable levels and nickel only slightly altering the k(cat) and K(m) of the reaction. The regulation of HypB activities by metal binding may contribute to the maturation of the nickel-containing enzymes.
Comparative studies of human and chicken retinol-binding proteins and prealbumins.
Kopelman, M; Mokady, S; Cogan, U
1976-08-09
Microheterogeneity of retinol-binding proteins of human plasma and urine, and of chicken plasma was studied by polyacrylamide gel electrophoresis. All three protein systems were found microheterogenous. Incorporation of retinol into the protein preparations on the one hand, and depletion of these proteins from retinol on the other hand, enabled us to clarify the extent to which the presence or absence of the ligand affects the apparent heterogeneity. Upon electrophoresis, each of the native proteins displayed two pairs of protein zones. It appeared that within each pair the fast moving band corresponded to aporetinol-binding protein which upon binding of retinol was converted to a holoprotein with a slightly lower mobility. However, it did not seem that proteins of one pair were converted to proteins of the second pair upon binding of retinol, substantiating ghe microheterogenous character of this protein system. A rapid, two step procedure for isolation of prealbumins from plasma is described. The method which consists of DEAE-cellulose chromatography follwed by preparative electrophoresis was utilized to separate human and chicken prealbumins. Routine dodecyl sulphate electrophoresis resulted in partial dissociation of human prealbumin but in no dissociation of the chicken protein. More drastic treatments prior to electrophoresis were needed to effect complete disruption of both proteins into subunits.
Wilbur, Jeremy D; Chen, Chih-Ying; Manalo, Venus; Hwang, Peter K; Fletterick, Robert J; Brodsky, Frances M
2008-11-21
The huntingtin-interacting protein family members (Hip1 and Hip1R in mammals and Sla2p in yeast) link clathrin-mediated membrane traffic to actin cytoskeleton dynamics. Genetic data in yeast have implicated the light chain subunit of clathrin in regulating this link. To test this hypothesis, the biophysical properties of mammalian Hip1 and Hip1R and their interaction with clathrin light chain and actin were analyzed. The coiled-coil domains (clathrin light chain-binding) of Hip1 and Hip1R were found to be stable homodimers with no propensity to heterodimerize in vitro. Homodimers were also predominant in vivo, accounting for cellular segregation of Hip1 and Hip1R functions. Coiled-coil domains of Hip1 and Hip1R differed in their stability and flexibility, correlating with slightly different affinities for clathrin light chain and more markedly with effects of clathrin light chain binding on Hip protein-actin interactions. Clathrin light chain binding induced a compact conformation of both Hip1 and Hip1R and significantly reduced actin binding by their THATCH domains. Thus, clathrin is a negative regulator of Hip-actin interactions. These observations necessarily change models proposed for Hip protein function.
Wilbur, Jeremy D.; Chen, Chih-Ying; Manalo, Venus; Hwang, Peter K.; Fletterick, Robert J.; Brodsky, Frances M.
2008-01-01
The huntingtin-interacting protein family members (Hip1 and Hip1R in mammals and Sla2p in yeast) link clathrin-mediated membrane traffic to actin cytoskeleton dynamics. Genetic data in yeast have implicated the light chain subunit of clathrin in regulating this link. To test this hypothesis, the biophysical properties of mammalian Hip1 and Hip1R and their interaction with clathrin light chain and actin were analyzed. The coiled-coil domains (clathrin light chain-binding) of Hip1 and Hip1R were found to be stable homodimers with no propensity to heterodimerize in vitro. Homodimers were also predominant in vivo, accounting for cellular segregation of Hip1 and Hip1R functions. Coiled-coil domains of Hip1 and Hip1R differed in their stability and flexibility, correlating with slightly different affinities for clathrin light chain and more markedly with effects of clathrin light chain binding on Hip protein-actin interactions. Clathrin light chain binding induced a compact conformation of both Hip1 and Hip1R and significantly reduced actin binding by their THATCH domains. Thus, clathrin is a negative regulator of Hip-actin interactions. These observations necessarily change models proposed for Hip protein function. PMID:18790740
Hota, Prasanta K; Buck, Matthias
2009-01-01
Plexin receptors function in response to semaphorin guidance cues in a variety of developmental processes involving cell motility. Interactions with Rho, as well as Ras family small GTPases are critical events in the cell signaling mechanism. We have recently determined the structure of a cytoplasmic domain (RBD) of plexin-B1 and mapped its binding interface with several Rho-GTPases, Rac1, Rnd1, and RhoD. All three GTPases associate with a similar region of this plexin domain, but show different functional behavior in cells. To understand whether thermodynamic properties of the GTPase–RBD interaction contribute to such different behavior, we have examined the interaction at different temperatures, buffer, and pH conditions. Although the binding affinity of both Rnd1 and Rac1 with the plexin-B1 RBD is similar, the detailed thermodynamic properties of the interactions are considerably different. These data suggest that on Rac1 binding to the plexin-B1 RBD, the proteins become more rigid in the complex. By contrast, Rnd1 binding is consistent with unchanged or slightly increased flexibility in one or both proteins. Both GTPases show an appreciable reduction in affinity for the dimeric plexin-B1 RBD indicating that GTPase binding is not cooperative with dimer formation, but that a partial steric hindrance destabilizes the dimer. However, a reduced affinity binding mode to a disulphide stabilized model for the dimeric RBD is also possible. Consistent with cellular studies, the interaction thermodynamics imply that further levels of regulation involving additional binding partners and/or regions outside of the RhoGTPase binding domain are required for receptor activation. PMID:19388051
Spectrophotometric study on binding of 2-thioxanthone acetic acid with ct-DNA.
Ataci, Nese; Ozcelik, Elif; Arsu, Nergis
2018-06-02
Thioxanthone and its derivatives are the most remarkable molecules due to their vast variety of application such as radiation curing that is, until using them as a therapeutic drug. Therefore, in this study it was intended to use 2-Thioxanthone acetic acid with and without NaCl in Tris HCl buffer solution (pH:7.0) to represent the interaction with ct-DNA. The UV-vis absorption spectra of TXCH 2 COOH in the presence of ct-DNA showed hypochromism and the intrinstic binding constant (K b ) was determined as 6 × 10 3 L mol -1 . The fluoresence intensity of TXCH 2 COOH with ct-DNA clearly increased up to 101% which indicated that the fluorescence intensity was very sensitive to ct-DNA concentration. The binding constant (K) and the values of number of binding sites (n) and were calculated as 1.8 × 10 3 L mol -1 and 0.69, respectively. When the quenching constants (K sv ) of free TXCH 2 COOH and TXCH 2 COOH, which were bonded with ct-DNA were compared, slightly changed values of Ksv were seen. Moreover, displacement assay with Hoechst 33,258 and viscosity measurements in the presence and absence of NaCl salt also confirmed the binding mode which noted the electrostatic interaction following groove binding between TXCH 2 COOH and ct-DNA. Last but not least, the salt effect was examined on ct-DNA binding with TXCH 2 COOH. The results of the experiments indicated that the groove binding was strengthened by NaCl whereas in the high NaCl concentration, the binding ability of TXCH 2 COOH to ct-DNA was inversely affected. Copyright © 2018 Elsevier B.V. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gehlert, D.R.; Gackenheimer, S.L.; Mais, D.E.
1991-05-01
We have developed a high specific activity ligand for localization of ATP-sensitive potassium channels in the brain. When brain sections were incubated with ({sup 125}I)iodoglyburide (N-(2-((((cyclohexylamino)carbonyl)amino)sulfonyl)ethyl)-5-{sup 125}I-2- methoxybenzamide), the ligand bound to a single site with a KD of 495 pM and a maximum binding site density of 176 fmol/mg of tissue. Glyburide was the most potent inhibitor of specific ({sup 125}I)iodoglyburide binding to rat forebrain sections whereas iodoglyburide and glipizide were slightly less potent. The binding was also sensitive to ATP which completely inhibited binding at concentrations of 10 mM. Autoradiographic localization of ({sup 125}I)iodoglyburide binding indicated a broadmore » distribution of the ATP-sensitive potassium channel in the brain. The highest levels of binding were seen in the globus pallidus and ventral pallidum followed by the septohippocampal nucleus, anterior pituitary, the CA2 and CA3 region of the hippocampus, ventral pallidum, the molecular layer of the cerebellum and substantia nigra zona reticulata. The hilus and dorsal subiculum of the hippocampus, molecular layer of the dentate gyrus, cerebral cortex, lateral olfactory tract nucleus, olfactory tubercle and the zona incerta contained relatively high levels of binding. A lower level of binding (approximately 3- to 4-fold) was found throughout the remainder of the brain. These results indicate that the ATP-sensitive potassium channel has a broad presence in the rat brain and that a few select brain regions are enriched in this subtype of neuronal potassium channels.« less
Analytical similarity assessment of rituximab biosimilar CT-P10 to reference medicinal product
Lee, Kyoung Hoon; Kim, Yeon Jung; Kang, Hyun Ah; Kim, Sung Hwan; Lee, So Jung; Lim, Ki Jung; Jung, Soon Kwan; Chang, Shin Jae
2018-01-01
ABSTRACT CT-P10 (Truxima™) was recently approved as the world's first rituximab biosimilar product in the European Union (EU) and South Korea. To demonstrate biosimilarity of CT-P10 with the reference medicinal product (RMP), extensive 3-way similarity assessment has been conducted between CT-P10, EU-Rituximab and US-Rituximab, focusing on the physicochemical and biological quality attributes. A multitude of state-of-the-art analyses revealed that CT-P10 has identical primary and higher order structures compared to the original product. Purity/impurity profiles of CT-P10 measured by the levels of aggregates, fragments, non-glycosylated form and process-related impurities were also found to be comparable with those of RMPs. In terms of the post-translational modification, CT-P10 contains slightly less N-terminal pyro-glutamate variant, which has been known not to affect product efficacy or safety. Oligosaccharide profiling has revealed that, although CT-P10 contains the same conserved glycan species and relative proportion with the RMPs, the content of total afucosylated glycan in CT-P10 was slightly higher than in EU- or US-Rituximab. Nevertheless, the effect of the observed level of afucosylation in CT-P10 drug product on Fc receptor binding affinity or antibody-dependent cell-mediated cytotoxicity was found to be negligible based on the spiking study with highly afucosylated sample. Arrays of biological assays representative of known and putative mechanisms of action for rituximab have shown that biological activities of CT-P10 are within the quality range of RMPs. Recent results of clinical studies have further confirmed that the CT-P10 exhibits equivalent clinical efficacy and safety profiles compared to EU- and US-Rituximab. The current 3-way similarity assessment together with clinical study results confidently demonstrate that CT-P10 is highly similar with EU- and US-Rituximab in terms of physicochemical properties, biological activities, efficacy, and safety for its final approval as a biosimilar product. PMID:29469653
DOE Office of Scientific and Technical Information (OSTI.GOV)
Högberg, Hans, E-mail: hans.hogberg@liu.se; Tengdelius, Lina; Eriksson, Fredrik
2014-07-01
Reactive sputtering by high power impulse magnetron sputtering (HiPIMS) and direct current magnetron sputtering (DCMS) of a Zr target in Ar/H{sub 2} plasmas was employed to deposit Zr-H films on Si(100) substrates, and with H content up to 61 at. % and O contents typically below 0.2 at. % as determined by elastic recoil detection analysis. X-ray photoelectron spectroscopy reveals a chemical shift of ∼0.7 eV to higher binding energies for the Zr-H films compared to pure Zr films, consistent with a charge transfer from Zr to H in a zirconium hydride. X-ray diffraction shows that the films are single-phase δ-ZrH{sub 2} (CaF{submore » 2} type structure) at H content >∼55 at. % and pole figure measurements give a 111 preferred orientation for these films. Scanning electron microscopy cross-section images show a glasslike microstructure for the HiPIMS films, while the DCMS films are columnar. Nanoindentation yield hardness values of 5.5–7 GPa for the δ-ZrH{sub 2} films that is slightly harder than the ∼5 GPa determined for Zr films and with coefficients of friction in the range of 0.12–0.18 to compare with the range of 0.4–0.6 obtained for Zr films. Wear resistance testing show that phase-pure δ-ZrH{sub 2} films deposited by HiPIMS exhibit up to 50 times lower wear rate compared to those containing a secondary Zr phase. Four-point probe measurements give resistivity values in the range of ∼100–120 μΩ cm for the δ-ZrH{sub 2} films, which is slightly higher compared to Zr films with values in the range 70–80 μΩ cm.« less
Analytical similarity assessment of rituximab biosimilar CT-P10 to reference medicinal product.
Lee, Kyoung Hoon; Lee, Jihun; Bae, Jin Soo; Kim, Yeon Jung; Kang, Hyun Ah; Kim, Sung Hwan; Lee, So Jung; Lim, Ki Jung; Lee, Jung Woo; Jung, Soon Kwan; Chang, Shin Jae
2018-04-01
CT-P10 (Truxima™) was recently approved as the world's first rituximab biosimilar product in the European Union (EU) and South Korea. To demonstrate biosimilarity of CT-P10 with the reference medicinal product (RMP), extensive 3-way similarity assessment has been conducted between CT-P10, EU-Rituximab and US-Rituximab, focusing on the physicochemical and biological quality attributes. A multitude of state-of-the-art analyses revealed that CT-P10 has identical primary and higher order structures compared to the original product. Purity/impurity profiles of CT-P10 measured by the levels of aggregates, fragments, non-glycosylated form and process-related impurities were also found to be comparable with those of RMPs. In terms of the post-translational modification, CT-P10 contains slightly less N-terminal pyro-glutamate variant, which has been known not to affect product efficacy or safety. Oligosaccharide profiling has revealed that, although CT-P10 contains the same conserved glycan species and relative proportion with the RMPs, the content of total afucosylated glycan in CT-P10 was slightly higher than in EU- or US-Rituximab. Nevertheless, the effect of the observed level of afucosylation in CT-P10 drug product on Fc receptor binding affinity or antibody-dependent cell-mediated cytotoxicity was found to be negligible based on the spiking study with highly afucosylated sample. Arrays of biological assays representative of known and putative mechanisms of action for rituximab have shown that biological activities of CT-P10 are within the quality range of RMPs. Recent results of clinical studies have further confirmed that the CT-P10 exhibits equivalent clinical efficacy and safety profiles compared to EU- and US-Rituximab. The current 3-way similarity assessment together with clinical study results confidently demonstrate that CT-P10 is highly similar with EU- and US-Rituximab in terms of physicochemical properties, biological activities, efficacy, and safety for its final approval as a biosimilar product.
Yin, Hui; Feng, Xionghan; Tan, Wenfeng; Koopal, Luuk K; Hu, Tiandou; Zhu, Mengqiang; Liu, Fan
2015-05-15
Vanadium(V)-doped hexagonal turbostratic birnessites were synthesized and characterized by multiple techniques and were used to remove Pb(2+) from aqueous solutions. With increasing V content, the V(V)-doped birnessites have significantly decreased crystallinity, i.e., the thickness of crystals in the c axis decreases from 9.8 nm to ∼0.7 nm, and the amount of vacancies slightly increases from 0.063 to 0.089. The specific surface areas of these samples increase after doping while the Mn average oxidation sates are almost constant. V has a valence of +5 and tetrahedral symmetry, and exists as oxyanions, including V₆O₁₆(2-), and VO4(3-) on birnessite edge sites by forming monodentate corning-sharing complexes. Pb LIII-edge extended X-ray absorption fine structure (EXAFS) spectra analysis shows that, at low V contents (V/Mn≤0.07) Pb(2+) mainly binds with birnessite on octahedral vacancy and especially edge sites whereas at higher V contents (V/Mn>0.07) more Pb(2+) associates with V oxyanions and form vanadinite [Pb₅(VO₄)₃Cl]-like precipitates. With increasing V(V) content, the Pb(2+) binding affinity on the V-doped birnessites significantly increases, ascribing to both the formation of the vanadinite precipitates and decreased particle sizes of birnessite. These results are useful to design environmentally benign materials for treatment of metal-polluted water. Copyright © 2015 Elsevier B.V. All rights reserved.
Molecular dynamic simulations for FOX-7 and FOX-7 based PBXs.
Wang, Junying; Jin, Shaohua; Chen, Shusen; Li, Lijie; Wang, Dongxu; Lu, Zhiyan; Wang, Na; Wang, Junfeng
2018-06-01
Molecular dynamic (MD) simulations were applied to investigate the binding energies and mechanical properties of 1,1-diamino-2,2-dinitroethene (FOX-7) based polymer bonded explosives (PBXs) with ethylenevinylacetate copolymer (EVA), fluorine (F2641), hydroxyl-terminated polybutadiene (HTPB), and styrene butadiene styrene block copolymer (SBS). The binding energies between FOX-7 and the four polymer binders are different, of which the descending order is FOX-7/HTPB ≈ FOX-7/SBS > FOX-7/EVA > FOX-7/F2641. Furthermore, the (002) surface of FOX-7 has the strongest interaction with the four polymers. The mechanical properties (elastic moduli and Poisson's ratio) of pure FOX-7 and FOX-7 based PBXs were obtained. The results show that the descending order of the ability of polymer binders to improve plasticity of PBXs is SBS > F2641 > EVA > HTPB. The formability of FOX-7 based PBXs is better than that of pure FOX-7, as the order of FOX-7/SBS > FOX-7/EVA > FOX-7/F2641 > FOX-7/HTPB > FOX-7 shows. Poisson's ratio of SBS is the highest. The calculated detonation performances for pure FOX-7 and FOX-7 based PBXs show that the detonation properties of explosives slightly decreases when the mass ratio of binder is about 5%. All the theoretical detonation velocities of FOX-7 based PBXs are higher than 8500 m/s.
NASA Astrophysics Data System (ADS)
Bauer, William Joseph, Jr.
The fate of an individual cell, or even an entire organism, is often determined by minute, yet very specific differences in the conformation of a single protein species. Very often, proteins take on alternate folds or even side chain conformations to deal with different situations present within the cell. These differences can be as large as a whole domain or as subtle as the alteration of a single amino acid side chain. Yet, even these seemingly minor side chain conformational differences can determine the development of a cell type during differentiation or even dictate whether a cell will live or die. Two examples of situations where minor conformational differences within a specific protein could lead to major differences in the life cycle of a cell are described herein. The first example describes the variations seen in DNA conformations which can lead to slightly different Hox protein binding conformations responsible for recognizing biologically relevant regulatory sites. These specific differences occur in the minor groove of the bound DNA and are limited to the conformation of only two side chains. The conformation of the bound DNA, however, is not solely determined by the sequence of the DNA, as multiple sequences can result in the same DNA conformation. The second example takes place in the context of a yeast prion protein which contains a mutation that decreases the frequency at which fibrils form. While the specific interactions leading to this physiological change were not directly detected, it can be ascertained from the crystal structure that the structural changes are subtle and most likely involve another binding partner. In both cases, these conformational changes are very slight but have a profound effect on the downstream processes.
Guan, Ming; Jin, Zexin; Li, Junmin; Pan, Xiaocui; Wang, Suizi; Li, Yuelin
2016-01-01
The aim of this study was to investigate the effects of temperature and Cu on the morphological and physiological traits of Elsholtzia haichowensis grown in soils amended with four Cu concentrations (0, 50, 500, and 1000 mg kg(-1)) under ambient temperature and slight warming. At the same Cu concentration, the height, shoot dry weight, total plant dry weight, and root morphological parameters such as length, surface area and tip number of E. haichowensis increased due to the slight warming. The net photosynthetic rate, stomatal conductance, transpiration, light use efficiency were also higher under the slight warming than under ambient temperature. The increased Cu concentrations, total Cu uptake, bioaccumulation factors and tolerance indexes of shoots and roots were also observed at the slight warming. The shoot dry weight, root dry weight, total plant dry weight and the bioaccumulation factors of shoots and roots at 50 mg Cu kg(-1) were significantly higher than those at 500 and 1000 mg Cu kg(-1) under the slight warming. Therefore, the climate warming may improve the ability of E. haichowensis to phytoremediate Cu-contaminated soil, and the ability improvement greatly depended on the Cu concentrations in soils.
Structural analysis of a putative SAM-dependent methyltransferase, YtqB, from Bacillus subtilis.
Park, Sun Cheol; Song, Wan Seok; Yoon, Sung-il
2014-04-18
S-adenosyl-L-methionine (SAM)-dependent methyltransferases (MTases) methylate diverse biological molecules using a SAM cofactor. The ytqB gene of Bacillus subtilis encodes a putative MTase and its biological function has never been characterized. To reveal the structural features and the cofactor binding mode of YtqB, we have determined the crystal structures of YtqB alone and in complex with its cofactor, SAM, at 1.9 Å and 2.2 Å resolutions, respectively. YtqB folds into a β-sheet sandwiched by two α-helical layers, and assembles into a dimeric form. Each YtqB monomer contains one SAM binding site, which shapes SAM into a slightly curved conformation and exposes the reactive methyl group of SAM potentially to a substrate. Our comparative structural analysis of YtqB and its homologues indicates that YtqB is a SAM-dependent class I MTase, and provides insights into the substrate binding site of YtqB. Copyright © 2014 Elsevier Inc. All rights reserved.
Ma, Xiangling; Wang, Qing; Wang, Lili; Huang, Yanmei; Liao, Xiaoxiang; Li, Hui
2016-06-01
The interaction of norgestrel with human serum albumin (HSA) was investigated by spectroscopy and molecular-docking methods. Results of spectroscopy methods suggested that the quenching mechanism of norgestrel on HSA was static quenching and that the quenching process was spontaneous. Negative values of thermodynamic parameters (ΔG, ΔH, and ΔS) indicated that hydrogen bonding and van der Waals forces dominated the binding between norgestrel and HSA. Three-dimensional fluorescence spectrum and circular dichroism spectrum showed that the HSA structure was slightly changed by norgestrel. Norgestrel mainly bound with Sudlow site I based on a probe study, as confirmed by molecular-docking results. Competition among similar structures indicated that ethisterone and norethisterone affected the binding of norgestrel with HSA. CH3 in R1 had little effect on norgestrel binding with HSA. The surface hydrophobicity properties of HSA, investigated using 8-anilino-1-naphthalenesulfonic acid, was changed with norgestrel addition. © 2016 Wiley Periodicals, Inc.
Cueva, J.P.; Chemel, B.R.; Juncosa, J.I.; Lill, M.A.; Watts, V.J.; Nichols, D.E.
2012-01-01
Efforts to develop selective agonists for dopamine D 1-like receptors led to the discovery of dihydrexidine and doxanthrine, two bioisosteric ??-phenyldopamine-type full agonist ligands that display selectivity and potency at D 1-like receptors. We report herein an improved methodology for the synthesis of substituted chromanoisoquinolines (doxanthrine derivatives) and the evaluation of several new compounds for their ability to bind to D 1- and D 2-like receptors. Identical pendant phenyl ring substitutions on the dihydrexidine and doxanthrine templates surprisingly led to different effects on D 1-like receptor binding, suggesting important differences between the interactions of these ligands with the D 1 receptor. We propose, based on the biological results and molecular modeling studies, that slight conformational differences between the tetralin and chroman-based compounds lead to a shift in the location of the pendant ring substituents within the receptor. ?? 2011 Elsevier Ltd. All rights reserved.
Domain Evolution and Functional Diversification of Sulfite Reductases
NASA Astrophysics Data System (ADS)
Dhillon, Ashita; Goswami, Sulip; Riley, Monica; Teske, Andreas; Sogin, Mitchell
2005-02-01
Sulfite reductases are key enzymes of assimilatory and dissimilatory sulfur metabolism, which occur in diverse bacterial and archaeal lineages. They share a highly conserved domain "C-X5-C-n-C-X3-C" for binding siroheme and iron-sulfur clusters that facilitate electron transfer to the substrate. For each sulfite reductase cluster, the siroheme-binding domain is positioned slightly differently at the N-terminus of dsrA and dsrB, while in the assimilatory proteins the siroheme domain is located at the C-terminus. Our sequence and phylogenetic analysis of the siroheme-binding domain shows that sulfite reductase sequences diverged from a common ancestor into four separate clusters (aSir, alSir, dsr, and asrC) that are biochemically distinct; each serves a different assimilatory or dissimilatory role in sulfur metabolism. The phylogenetic distribution and functional grouping in sulfite reductase clusters (dsrA and dsrB vs. aSiR, asrC, and alSir) suggest that their functional diversification during evolution may have preceded the bacterial/archaeal divergence.
Different modes of interaction by TIAR and HuR with target RNA and DNA
Kim, Henry S.; Wilce, Matthew C. J.; Yoga, Yano M. K.; Pendini, Nicole R.; Gunzburg, Menachem J.; Cowieson, Nathan P.; Wilson, Gerald M.; Williams, Bryan R. G.; Gorospe, Myriam; Wilce, Jacqueline A.
2011-01-01
TIAR and HuR are mRNA-binding proteins that play important roles in the regulation of translation. They both possess three RNA recognition motifs (RRMs) and bind to AU-rich elements (AREs), with seemingly overlapping specificity. Here we show using SPR that TIAR and HuR bind to both U-rich and AU-rich RNA in the nanomolar range, with higher overall affinity for U-rich RNA. However, the higher affinity for U–rich sequences is mainly due to faster association with U-rich RNA, which we propose is a reflection of the higher probability of association. Differences between TIAR and HuR are observed in their modes of binding to RNA. TIAR is able to bind deoxy-oligonucleotides with nanomolar affinity, whereas HuR affinity is reduced to a micromolar level. Studies with U-rich DNA reveal that TIAR binding depends less on the 2′-hydroxyl group of RNA than HuR binding. Finally we show that SAXS data, recorded for the first two domains of TIAR in complex with RNA, are more consistent with a flexible, elongated shape and not the compact shape that the first two domains of Hu proteins adopt upon binding to RNA. We thus propose that these triple-RRM proteins, which compete for the same binding sites in cells, interact with their targets in fundamentally different ways. PMID:21233170
Different modes of interaction by TIAR and HuR with target RNA and DNA.
Kim, Henry S; Wilce, Matthew C J; Yoga, Yano M K; Pendini, Nicole R; Gunzburg, Menachem J; Cowieson, Nathan P; Wilson, Gerald M; Williams, Bryan R G; Gorospe, Myriam; Wilce, Jacqueline A
2011-02-01
TIAR and HuR are mRNA-binding proteins that play important roles in the regulation of translation. They both possess three RNA recognition motifs (RRMs) and bind to AU-rich elements (AREs), with seemingly overlapping specificity. Here we show using SPR that TIAR and HuR bind to both U-rich and AU-rich RNA in the nanomolar range, with higher overall affinity for U-rich RNA. However, the higher affinity for U-rich sequences is mainly due to faster association with U-rich RNA, which we propose is a reflection of the higher probability of association. Differences between TIAR and HuR are observed in their modes of binding to RNA. TIAR is able to bind deoxy-oligonucleotides with nanomolar affinity, whereas HuR affinity is reduced to a micromolar level. Studies with U-rich DNA reveal that TIAR binding depends less on the 2'-hydroxyl group of RNA than HuR binding. Finally we show that SAXS data, recorded for the first two domains of TIAR in complex with RNA, are more consistent with a flexible, elongated shape and not the compact shape that the first two domains of Hu proteins adopt upon binding to RNA. We thus propose that these triple-RRM proteins, which compete for the same binding sites in cells, interact with their targets in fundamentally different ways.
Gene-Gene and Gene-Environment Interactions in the Etiology of Breast Cancer
2007-06-01
When you eat fried or baked pork or beef , you normally prefer that: Entire surface is brown with a slight burnt flavor 1...Uridine diphospho-glucuronosyltransferase 1A1 (UGT1A1) is involved in catalyzing estrogen, the hormone that plays a central role in the etiology of...relationship of UGT1A1 genotypes with plasma levels of estrone, estrone sulfate, estradiol, testosterone, and sex hormone binding globulins (SHBG
Thermochemistry of the specific binding of C12 surfactants to bovine serum albumin.
Nielsen, A D; Borch, K; Westh, P
2000-06-15
The specific binding to bovine serum albumin (BSA) of anionic and non-ionic surfactants with C12 acyl chains has been studied by high sensitivity isothermal titration calorimetry. This method proved particularly effective in resolving the binding of anionic surfactants into separate classes of sites with different affinity. For sodium dodecylsulfate (SDS) the measured binding curves could be rationalized as association to two classes (high affinity/low affinity) of sites comprising, respectively, three and six similar (i.e. thermodynamically equivalent), independent sites. Changes in the thermodynamic functions enthalpy, standard free energy, standard entropy and heat capacity could be discerned for each class of binding site, as well as for micelle formation. These data suggest that binding to low affinity sites (in analogy with micelle formation) exhibits energetic parameters; in particular, a large negative change in heat capacity, which is characteristic of hydrophobic interactions. The thermodynamics of high affinity binding, on the other hand, is indicative of other dominant forces; most likely electrostatic interactions. Other anionic ligands investigated (laurate and dodecyl benzylsulfonate) showed a behavior similar to SDS, the most significant difference being the high affinity binding of the alkylbenzyl sulfonate. For this ligand, the thermodynamic data is indicative of a more loosely associated complex than for SDS and laurate. BSA was found to bind one or two of the non-ionic surfactants (NIS) hepta- or penta(ethylene glycol) monododecyl ether (C12EO7 and C12EO5) with binding constants about three orders of magnitude lower than for SDS. Hence, the free energy of the surfactant in the weakly bound BSA-NIS complex is only slightly favored over the micellar state. The binding process is characterized by very large exothermic enthalpy changes (larger than for the charged surfactants) and a large, positive increment in heat capacity. These observations cannot be reconciled with a molecular picture based on simple hydrophobic condensation onto non-polar patches on the protein surface.
RNA Seeds Higher Order Assembly of FUS Protein
Schwartz, Jacob C.; Wang, Xueyin; Podell, Elaine R.; Cech, Thomas R.
2014-01-01
SUMMARY The abundant nuclear RNA-binding protein FUS binds the CTD of RNA polymerase II in an RNA-dependent manner, affecting Ser2 phosphorylation and transcription. Here we examine the mechanism of this process and find that RNA binding nucleates the formation of higher order FUS RNP assemblies that bind the CTD. Both the low-complexity domain and the RGG domain of FUS contribute to assembly. The assemblies appear fibrous by electron microscopy and have characteristics of beta-zipper structures. These results support the emerging view that the pathologic protein aggregation seen in neurodegenerative diseases such as ALS may occur by exaggeration of functionally important assemblies of RNA-binding proteins. PMID:24268778
Zhou, Yihua; Xu, Bixiong C.; Maheshwari, Hiralal G.; He, Li; Reed, Michael; Lozykowski, Maria; Okada, Shigeru; Cataldo, Lori; Coschigamo, Karen; Wagner, Thomas E.; Baumann, Gerhard; Kopchick, John J.
1997-01-01
Laron syndrome [growth hormone (GH) insensitivity syndrome] is a hereditary dwarfism resulting from defects in the GH receptor (GHR) gene. GHR deficiency has not been reported in mammals other than humans. Many aspects of GHR dysfunction remain unknown because of ethical and practical limitations in studying humans. To create a mammalian model for this disease, we generated mice bearing a disrupted GHR/binding protein (GHR/BP) gene through a homologous gene targeting approach. Homozygous GHR/BP knockout mice showed severe postnatal growth retardation, proportionate dwarfism, absence of the GHR and GH binding protein, greatly decreased serum insulin-like growth factor I and elevated serum GH concentrations. These characteristics represent the phenotype typical of individuals with Laron syndrome. Animals heterozygous for the GHR/BP defect show only minimal growth impairment but have an intermediate biochemical phenotype, with decreased GHR and GH binding protein expression and slightly diminished insulin-like growth factor I levels. These findings indicate that the GHR/BP-deficient mouse (Laron mouse) is a suitable model for human Laron syndrome that will prove useful for the elucidation of many aspects of GHR/BP function that cannot be obtained in humans. PMID:9371826
Zhou, Y; Xu, B C; Maheshwari, H G; He, L; Reed, M; Lozykowski, M; Okada, S; Cataldo, L; Coschigamo, K; Wagner, T E; Baumann, G; Kopchick, J J
1997-11-25
Laron syndrome [growth hormone (GH) insensitivity syndrome] is a hereditary dwarfism resulting from defects in the GH receptor (GHR) gene. GHR deficiency has not been reported in mammals other than humans. Many aspects of GHR dysfunction remain unknown because of ethical and practical limitations in studying humans. To create a mammalian model for this disease, we generated mice bearing a disrupted GHR/binding protein (GHR/BP) gene through a homologous gene targeting approach. Homozygous GHR/BP knockout mice showed severe postnatal growth retardation, proportionate dwarfism, absence of the GHR and GH binding protein, greatly decreased serum insulin-like growth factor I and elevated serum GH concentrations. These characteristics represent the phenotype typical of individuals with Laron syndrome. Animals heterozygous for the GHR/BP defect show only minimal growth impairment but have an intermediate biochemical phenotype, with decreased GHR and GH binding protein expression and slightly diminished insulin-like growth factor I levels. These findings indicate that the GHR/BP-deficient mouse (Laron mouse) is a suitable model for human Laron syndrome that will prove useful for the elucidation of many aspects of GHR/BP function that cannot be obtained in humans.
Induction of hyaluronan cables and monocyte adherence in epidermal keratinocytes.
Jokela, Tiina A; Lindgren, Antti; Rilla, Kirsi; Maytin, Edward; Hascall, Vincent C; Tammi, Raija H; Tammi, Markku I
2008-01-01
Hyaluronan attached to cell surface can form at least two very different structures; a pericellular coat close to plasma membrane and hyaluronan chains coalesced into "cables" that can span several cell lengths. The hyaluronan in cables, induced by many inflammatory agents, can bind leukocytes, whereas that in the pericellular coat does not contribute to leukocyte binding. Therefore, this structural change seems to have a major role in inflammation. In the present study we checked whether cells of squamous epithelium, like epidermal keratinocytes, can form hyaluronan cables and bind leukocytes. In addition, we checked whether hyaluronan synthesis is affected during the induction of cables. Control keratinocytes expressed pericellular hyaluronan as small patches on plasma membrane. But when treated with inflammatory agents or stressful conditions (tunicamycin, interleukin-1beta, tumor necrosis factor-alpha, and high glucose concentration), hyaluronan organization changed into cable-like structures that avidly bound monocytes. Simultaneously, the total amount of secreted hyaluronan was slightly decreased, and the expression levels of hyaluronan synthases (Has1-3) and CD44 were not significantly changed. The results show that epidermal keratinocytes can form cables and bind leukocytes under inflammatory provocation and that these effects are not dependent on stimulation of hyaluronan secretion.
Ajmal, Mohammad Rehan; Zaidi, Nida; Alam, Parvez; Nusrat, Saima; Siddiqi, Mohd Khursheed; Badr, Gamal; Mahmoud, Mohamed H; Khan, Rizwan Hasan
2017-01-01
The binding of clofazimine to human serum albumin (HSA) was investigated by applying optical spectroscopy and molecular docking methods. Fluorescence quenching data revealed that clofazimine binds to protein with binding constant in the order of 10 4 M -1 , and with the increase in temperature, Stern-Volmer quenching constants gradually decreased indicating quenching mode to be static. The UV-visible spectra showed increase in absorbance upon interaction of HSA with clofazimine which further reveals formation of the drug-albumin complex. Thermodynamic parameters obtained from fluorescence data indicate that the process is exothermic and spontaneous. Forster distance (R o ) obtained from fluorescence resonance energy transfer is found to be 2.05 nm. Clofazimine impelled rise in α-helical structure in HSA as observed from far-UV CD spectra while there are minor alterations in tertiary structure of the protein. Clofazimine interacts strongly with HSA inducing secondary structure in the protein and slight alterations in protein topology as suggested by dynamic light scattering results. Moreover, docking results indicate that clofazimine binds to hydrophobic pocket near to the drug site II in HSA.
He, Zhiyong; Xu, Mingzhu; Zeng, Maomao; Qin, Fang; Chen, Jie
2016-05-15
The interactions of α- and β-casein with malvidin-3-O-glucoside (MG), the major anthocyanin in grape skin anthocyanin extracts (GSAE), were examined at pH 6.3 by fluorescence, fourier transform infrared (FTIR) and circular dichroism (CD) spectroscopy. The binding constant (KS), binding force and effects of the interactions on the caseins conformation and GSAE stability were investigated. The results showed that α- and β-casein bound with MG via hydrophilic (van der Waals forces or hydrogen bonding) and hydrophobic interactions, respectively. α-Casein had a slightly stronger binding affinity toward MG than β-casein, with respective KS values of 0.51×10(3)M(-1) and 0.46×10(3)M(-1) at 297K. The secondary structures of α- and β-casein were changed by MG binding, with a decrease in α-helix and an increase in turn for α-casein and no change in α-helix and a decrease in turn for β-casein. The casein-anthocyanin interaction appeared to have a positive effect on the thermal, oxidation and photo stability of GSAE. Copyright © 2015 Elsevier Ltd. All rights reserved.
Beyond the benzene dimer: an investigation of the additivity of pi-pi interactions.
Tauer, Tony P; Sherrill, C David
2005-11-24
The benzene dimer is the simplest prototype of pi-pi interactions and has been used to understand the fundamental physics of these interactions as they are observed in more complex systems. In biological systems, however, aromatic rings are rarely found in isolated pairs; thus, it is important to understand whether aromatic pairs remain a good model of pi-pi interactions in clusters. In this study, ab initio methods are used to compute the binding energies of several benzene trimers and tetramers, most of them in 1D stacked configurations. The two-body terms change only slightly relative to the dimer, and except for the cyclic trimer, the three- and four-body terms are negligible. This indicates that aromatic clusters do not feature any large nonadditive effects in their binding energies, and polarization effects in benzene clusters do not greatly change the binding that would be anticipated from unperturbed benzene-benzene interactions, at least for the 1D stacked systems considered. Three-body effects are larger for the cyclic trimer, but for all systems considered, the computed binding energies are within 10% of what would be estimated from benzene dimer energies at the same geometries.
Pfeifer, A; Neumann, H G
1986-09-01
trans-4-Acetylaminostilbene (trans-AAS) is acutely toxic in rats and lesions are produced specifically in the glandular stomach. Toxicity is slightly increased by pretreating the animals with phenobarbital (PB) and is completely prevented by pretreatment with methylcholanthrene (MC). The prostaglandin inhibitors, indomethacin and acetyl salicylic acid, do not reduce toxicity. The high efficiency of MC suggested that toxicity is caused by reactive metabolites. trans-[3H]-AAS was administered orally to untreated and to PB- or MC-pretreated female Wistar rats and target doses in different tissues were measured by means of covalent binding to proteins, RNA and DNA. Macromolecular binding in the target tissue of poisoned animals was significantly lower than in liver and kidney and comparable to other non-target tissues. Pretreatment with MC lowered macromolecular binding in all extrahepatic tissues but not in liver. These findings are not in line with tissue specific metabolic activation. The only unique property of the target tissue, glandular stomach, that we observed was a particular affinity for the systemically available parent compound. In the early phase of poisoning, tissue concentrations were exceedingly high and the stomach function was impaired.
Qiu, Ling; Xiao, Heming
2009-05-15
To investigate the effect of polymer binders on the monoexplosive, molecular dynamics simulations were performed to study the binding energies, mechanical properties, and detonation performances of the bicyclo-HMX-based polymer-bonded explosives (PBXs). The results show that the binding energies on different crystalline surfaces of bicyclo-HMX decrease in the order of (010)>(100)>(001). On each crystalline surface, binding properties of different polymers with the same chain segment are different from each other, while those of the polymers in the same content decrease in the sequence of PVDF>F(2311)>F(2314) approximately PCTFE. The mechanical properties of a dozen of model systems (elastic coefficients, various moduli, Cauchy pressure, and Poisson's ratio) have been obtained. It is found that mechanical properties are effectively improved by adding small amounts of fluorine polymers, and the overall effect of fluorine polymers on three crystalline surfaces of bicyclo-HMX changes in the order of (010)>(001) approximately (100). In comparison with the base explosive, detonation performances of the PBXs decrease slightly, but they are still superior to TNT. These suggestions may be useful for the formulation design of bicyclo-HMX-based PBXs.
Huszar, Gabor; Ozenci, Ciler Celik; Cayli, Sevil; Zavaczki, Zoltan; Hansch, Eleonora; Vigue, Lynne
2003-06-01
To test, both in semen and washed-sperm fractions, whether hyaluronic acid (HA) binding is restricted to sperm that have completed cellular maturation. Comparisons of sperm in semen and in HA-bound sperm fractions. University-based diagnostic and research andrology laboratory. Semen samples originated in men being tested for infertility. The attributes of sperm maturity were tested by immunocytochemistry with creatine kinase and HspA2 antisera (highlights cytoplasmic retention in diminished-maturity sperm), aniline blue chromatin staining (detects persistent histones), pisum sativum lectin staining (reveals acrosomal integrity), and the FertiLight viability kit (highlights viable and nonviable sperm). All markers of sperm maturity and immaturity supported the hypothesis that HA-bound sperm are mature. Nonbinding sperm exhibited cytoplasmic and nuclear properties of diminished maturity. The acrosomal status of HA-bound sperm was either unreacted or slightly capacitated, but not acrosome reacted. Only viable sperm exhibited HA binding. Sperm that are able to bind to HA are mature and have completed the spermiogenetic processes of sperm plasma membrane remodeling, cytoplasmic extrusion, and nuclear histone-protamine replacement. Hyaluronic acid-bound sperm show unreacted acrosomes. These studies provide further insights into the relationship between spermiogenesis and sperm function.
Baraúna, Rafael A.; Santos, Agenor V.; Graças, Diego A.; Santos, Daniel M.; Ghilardi, Rubens; Pimenta, Adriano M. C.; Carepo, Marta S. P.; Schneider, Maria P.C.; Silva, Artur
2015-01-01
Several studies of the physiological responses of different organisms exposed to extremely low-frequency electromagnetic fields (ELF-EMF) have been described. In this work, we report the minimal effects of in situ exposure to ELF-EMF on the global protein expression of Chromobacterium violaceum using a gel-based proteomic approach. The protein expression profile was only slightly altered, with five differentially expressed proteins detected in the exposed cultures; two of these proteins (DNA-binding stress protein, Dps, and alcohol dehydrogenase) were identified by MS/MS. The enhanced expression of Dps possibly helped to prevent physical damage to DNA. Although small, the changes in protein expression observed here were probably beneficial in helping the bacteria to adapt to the stress generated by the electromagnetic field. PMID:26273227
Cao, Lin-Ying; Ren, Xiao-Min; Li, Chuan-Hai; Zhang, Jing; Qin, Wei-Ping; Yang, Yu; Wan, Bin; Guo, Liang-Hong
2017-10-03
Numerous studies have indicated estrogenic disruption effects of bisphenol A (BPA) analogues. Previous mechanistic studies were mainly focused on their genomic activities on nuclear estrogen receptor pathway. However, their nongenomic effects through G protein-coupled estrogen receptor (GPER) pathway remain poorly understood. Here, using a SKBR3 cell-based fluorescence competitive binding assay, we found six BPA analogues bound to GPER directly, with bisphenol AF (BPAF) and bisphenol B (BPB) displaying much higher (∼9-fold) binding affinity than BPA. Molecular docking also demonstrated the binding of these BPA analogues to GPER. By measuring calcium mobilization and cAMP production in SKBR3 cells, we found the binding of these BPA analogues to GPER lead to the activation of subsequent signaling pathways. Consistent with the binding results, BPAF and BPB presented higher agonistic activity than BPA with the lowest effective concentration (LOEC) of 10 nM. Moreover, based on the results of Boyden chamber and wound-healing assays, BPAF and BPB displayed higher activity in promoting GPER mediated SKBR3 cell migration than BPA with the LOEC of 100 nM. Overall, we found two BPA analogues BPAF and BPB could exert higher estrogenic effects than BPA via GPER pathway at nanomolar concentrations.
Jensen, Kaj Frank; Hansen, Michael Riis; Jensen, Kristine Steen; Christoffersen, Stig; Poulsen, Jens-Christian Navarro; Mølgaard, Anne; Kadziola, Anders
2015-04-14
The adenine phosphoribosyltransferase (APRTase) encoded by the open reading frame SSO2342 of Sulfolobus solfataricus P2 was subjected to crystallographic, kinetic, and ligand binding analyses. The enzyme forms dimers in solution and in the crystals, and binds one molecule of the reactants 5-phosphoribosyl-α-1-pyrophosphate (PRPP) and adenine or the product adenosine monophosphate (AMP) or the inhibitor adenosine diphosphate (ADP) in each active site. The individual subunit adopts an overall structure that resembles a 6-oxopurine phosphoribosyltransferase (PRTase) more than known APRTases implying that APRT functionality in Crenarchaeotae has its evolutionary origin in this family of PRTases. Only the N-terminal two-thirds of the polypeptide chain folds as a traditional type I PRTase with a five-stranded β-sheet surrounded by helices. The C-terminal third adopts an unusual three-helix bundle structure that together with the nucleobase-binding loop undergoes a conformational change upon binding of adenine and phosphate resulting in a slight contraction of the active site. The inhibitor ADP binds like the product AMP with both the α- and β-phosphates occupying the 5'-phosphoribosyl binding site. The enzyme shows activity over a wide pH range, and the kinetic and ligand binding properties depend on both pH and the presence/absence of phosphate in the buffers. A slow hydrolysis of PRPP to ribose 5-phosphate and pyrophosphate, catalyzed by the enzyme, may be facilitated by elements in the C-terminal three-helix bundle part of the protein.
NASA Astrophysics Data System (ADS)
Das, Sourav; Ghosh, Pooja; Koley, Sudipta; Singha Roy, Atanu
2018-03-01
The interactions of naringenin (NG) and naringin (NR) with Hen Egg White Lysozyme (HEWL) in aqueous medium have been investigated using UV-vis spectroscopy, steady-state fluorescence, circular dichroism (CD), Fourier Transform infrared spectroscopy (FT-IR) and molecular docking analyses. Both NG and NR can quench the intrinsic fluorescence of HEWL via static quenching mechanism. At 300 K, the value of binding constant (Kb) of HEWL-NG complex (5.596 ± 0.063 × 104 M- 1) was found to be greater than that of HEWL-NR complex (3.404 ± 0.407 × 104 M- 1). The negative ΔG° values in cases of both the complexes specify the spontaneous binding. The binding distance between the donor (HEWL) and acceptor (NG/NR) was estimated using the Försters theory and the possibility of non-radiative energy transfer from HEWL to NG/NR was observed. The presence of metal ions (Ca2 +, Cu2 + and Fe2 +) decreased the binding affinity of NG/NR towards HEWL. Synchronous fluorescence studies indicate the change in Trp micro-environment due to the incorporation of NG/NR into HEWL. CD and FT-IR studies indicated that the α-helicity of the HEWL was slightly enhanced due to ligand binding. NG and NR inhibited the enzymatic activity of HEWL and exhibited their affinity for the active site of HEWL. Molecular docking studies revealed that both NG and NR bind in the close vicinity of Trp 62 and Trp 63 residues which is vital for the catalytic activity.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lever, J.R.; Scheffel, U.A.; Stathis, M.
1990-01-01
Apparent affinities (K{sub i}) of (E)- and (Z)-N-(iodoallyl)spiperone ((E)- and (Z)- NIASP) for dopamine D{sub 2} and serotonin 5-HT{sub 2} receptors were determined in competition binding assays. (Z)-NIASP (K{sub i} 0.35 nM, D{sub 2}; K{sub i} 1.75 nM, 5-HT{sub 2}) proved slightly more potent and selective for D{sub 2} sites in vitro than (E)-NIASP (K{sub i} 0.72 nM, D{sub 2}; K{sub i} 1.14 nM, 5-HT{sub 2}). In vivo, radioiodinated (E)- and (Z)-({sup 125}I)-NIASP showed regional distributions in mouse brain which are consonant with prolonged binding to dopamine D{sub 2} receptors accompanied by a minor serotonergic component of shorter duration. Stereoselective,more » dose-dependent blockade of (E)-({sup 125}I)-NIASP uptake was found for drugs binding to dopamine D{sub 2} sites, while drugs selective for serotonin 5-HT{sub 2}, {alpha}{sub 1}-adrenergic and dopamine D{sub 1} receptors did not inhibit radioligand binding 2 hr postinjection. Specific binding in striatal tissue was essentially irreversible over the time course of the study, and (E)-({sup 125}I)-NIASP gave a striatal to cerebellar tissue radioactivity concentration of 16.9 to 1 at 6 hr postinjection. Thus, (E)-({sup 125}I)-NIASP binds with high selectivity and specificity to dopamine D{sub 2} sites in vivo.« less
Tugaeva, Kristina V; Faletrov, Yaroslav V; Allakhverdiev, Elvin S; Shkumatov, Vladimir M; Maksimov, Eugene G; Sluchanko, Nikolai N
2018-02-26
Steroidogenic acute regulatory protein (StAR, STARD1) is a key factor of intracellular cholesterol transfer to mitochondria, necessary for adrenal and gonadal steroidogenesis, and is an archetypal member of the START protein family. Despite the common overall structural fold, START members differ in their binding selectivity toward various lipid ligands, but the lack of direct structural information hinders complete understanding of the binding process and cholesterol orientation in the STARD1 complex in particular. Cholesterol binding has been widely studied by commercially available fluorescent steroids, but the effect of the fluorescent group position on binding remained underexplored. Here, we dissect STARD1 interaction with cholesterol-like steroids bearing 7-nitrobenz-2-oxa-1,3-diazol-4-yl (NBD) group in different positions, namely, with 22-NBD-cholesterol (22NC), 25-NBD-cholesterol (25NC), 20-((NBDamino)-pregn-5-en-3-ol (20NP) and 3-(NBDamino)-cholestane (3NC). While being able to stoichiometrically bind 22NC and 20NP with high fluorescence yield and quantitative exhaustion of fluorescence of some protein tryptophans, STARD1 binds 25NC and 3NC with much lower affinity and poor fluorescence response. In contrast to 3NC, binding of 20NP leads to STARD1 stabilization and substantially increases the NBD fluorescence lifetime. Remarkably, in terms of fluorescence response, 20NP slightly outperforms commonly used 22NC and can thus be used for screening of various potential ligands by a competition mechanism in the future. Copyright © 2018 Elsevier Inc. All rights reserved.
Liu, Gang; Ding, Ming; Chiuve, Stephanie E; Rimm, Eric B; Franks, Paul W; Meigs, James B; Hu, Frank B; Sun, Qi
2016-11-01
To examine select adipokines, including fatty acid-binding protein 4, retinol-binding protein 4, and high-molecular-weight (HMW) adiponectin in relation to cardiovascular disease (CVD) mortality among patients with type 2 diabetes mellitus. Plasma levels of fatty acid-binding protein 4, retinol-binding protein 4, and HMW adiponectin were measured in 950 men with type 2 diabetes mellitus in the Health Professionals Follow-up Study. After an average of 22 years of follow-up (1993-2015), 580 deaths occurred, of whom 220 died of CVD. After multivariate adjustment for covariates, higher levels of fatty acid-binding protein 4 were significantly associated with a higher CVD mortality: comparing extreme tertiles, the hazard ratio and 95% confidence interval of CVD mortality was 1.78 (1.22-2.59; P trend=0.001). A positive association was also observed for HMW adiponectin: the hazard ratio (95% confidence interval) was 2.07 (1.42-3.06; P trend=0.0002), comparing extreme tertiles, whereas higher retinol-binding protein 4 levels were nonsignificantly associated with a decreased CVD mortality with an hazard ratio (95% confidence interval) of 0.73 (0.50-1.07; P trend=0.09). A Mendelian randomization analysis suggested that the causal relationships of HMW adiponectin and retinol-binding protein 4 would be directionally opposite to those observed based on the biomarkers, although none of the Mendelian randomization associations achieved statistical significance. These data suggest that higher levels of fatty acid-binding protein 4 and HMW adiponectin are associated with elevated CVD mortality among men with type 2 diabetes mellitus. Biological mechanisms underlying these observations deserve elucidation, but the associations of HMW adiponectin may partially reflect altered adipose tissue functionality among patients with type 2 diabetes mellitus. © 2016 American Heart Association, Inc.
The oxygen-binding properties of hemocyanin from the mollusk Concholepas concholepas.
González, Andrea; Nova, Esteban; Del Campo, Miguel; Manubens, Augusto; De Ioannes, Alfredo; Ferreira, Jorge; Becker, María Inés
2017-12-01
Hemocyanins have highly conserved copper-containing active sites that bind oxygen. However, structural differences among the hemocyanins of various mollusks may affect their physicochemical properties. Here, we studied the oxygen-binding cooperativity and affinity of Concholepas concholepas hemocyanin (CCH) and its two isolated subunits over a wide range of temperatures and pH values. Considering the differences in the quaternary structures of CCH and keyhole limpet hemocyanin (KLH), we hypothesized that the heterodidecameric CCH has different oxygen-binding parameters than the homodidecameric KLH. A novel modification of the polarographic method was applied in which rat liver submitochondrial particles containing cytochrome c oxidase were introduced to totally deplete oxygen of the test solution using ascorbate as the electron donor. This method was both sensitive and reproducible. The results showed that CCH, like other hemocyanins, exhibits cooperativity, showing an inverse relationship between the oxygen-binding parameters and temperature. According to their Hill coefficients, KLH has greater cooperativity than CCH at physiological pH; however, CCH is less sensitive to pH changes than KLH. Appreciable differences in binding behavior were found between the CCH subunits: the cooperativity of CCH-A was not only almost double that of CCH-B, but it was also slightly superior to that of CCH, thus suggesting that the oxygen-binding domains of the CCH subunits are different in their primary structure. Collectively, these data suggest that CCH-A is the main oxygen-binding domain in CCH; CCH-B may play a more structural role, perhaps utilizing its surprising predisposition to form tubular polymers, unlike CCH-A, as demonstrated here using electron microscopy. Copyright © 2017 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Aminzadeh, Mohammad; Eslami, Abbas; Kia, Reza; Aleeshah, Roghayeh
2017-10-01
Diquaternarization of dipyrido-[2,3-a:2‧,3‧-c]-phenazine,(dppz) and its analogous dipyrido-[2,3-a:2‧,3‧-c]-dimethylphenazine,(dppx) using 1,3-dibromopropane afford new water-soluble derivatives of phenazine, propylene-bipyridyldiylium-phenazine (1) and propylene-bipyridyldiylium-dimethylphenazine (2). The compounds have been characterized by means of FT-IR, NMR, elemental analysis and conductometric measurements and their structure were determined by X-ray crystallography. The experimental studies on the compounds have been accompanied computationally by Density Functional Theory (DFT) calculations. The DNA binding properties of both compounds to calf thymus DNA (ctDNA) were investigated by UV-Vis absorption and emission methods. The expanded UV-Vis spectral data matrix was analyzed by multivariate curve resolution-alternating least squares (MCR-ALS) technique to obtain the concentration profile and pure spectra of all reaction species which existed in the interaction procedure. Multivariate curve resolution may help us to give a better understanding of the 1(Cl)2-ctDNA and 2(Cl)2-ctDNA interaction mechanism. The results suggest that both compounds bind tightly to DNA through intercalation mechanism and the DNA binding affinity of 2 is slightly lower than that of 1 due to steric hindrance of the methyl group. Also, thermal denaturation studies reveal that these compounds show strong affinity for binding with calf thymus DNA. The thermodynamic parameters of the DNA binding process were obtained from the temperature dependence of the binding constants and the results showed that binding of both compounds to DNA is an enthalpically driven process that is in agreement with proposed DNA intercalation capability of these compounds.
Ayhan, Mehmet Menaf; Casano, Gilles; Karoui, Hakim; Rockenbauer, Antal; Monnier, Valérie; Hardy, Micaël; Tordo, Paul; Bardelang, David; Ouari, Olivier
2015-11-09
Nitroxide free radicals have been used to study the inner space of one of Rebek's water-soluble capsules. EPR and (1) H NMR spectroscopy, ESI-MS, and DFT calculations showed a preference for the formation of 1:2 complexes. EPR titrations allowed us to determine binding constants (Ka ) in the order of 10(7) M(-2) . EPR spectral-shape analysis provided information on the guest rotational dynamics within the capsule. The interplay between optimum hydrogen bonding upon capsule formation and steric strain for guest accommodation highlights some degree of flexibility for guest inclusion, particularly at the center of the capsule where the hydrogen bond seam can be barely distorted or slightly disturbed. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Osthoff, Michael; Walder, Bernhard; Delhumeau, Cécile; Trendelenburg, Marten; Turck, Natacha
2017-09-01
The lectin pathway of the complement system has been implicated in secondary ischemic/inflammatory injury after traumatic brain injury (TBI). However, previous experimental studies have yielded conflicting results, and human studies are scarce. In this exploratory study, we investigated associations of several lectin pathway proteins early after injury and single-nucleotide polymorphisms (SNP) with outcomes after severe TBI (mortality at 14 days [primary outcome] and consciousness assessed with the Glasgow Coma Scale [GCS] at 14 days, disability assessed with the Glasgow Outcome Scale Extended [GOSE] at 90 days). Forty-four patients with severe TBI were included. Plasma levels of lectin pathway proteins were sampled at 6, 12, 24, and 48 h after injury and eight mannose-binding lectin (MBL) and ficolin (FCN)2 SNPs were analyzed by enzyme-linked immunosorbent assay (ELISA) and genotyping, respectively. Plasma protein levels were stable with only a slight increase in mannose-binding protein-associated serine protease (MASP)-2 and FCN2 levels after 48 h (p < 0.05), respectively. Neither lectin protein plasma levels (6 h or mean levels) nor MBL2 genotypes or FCN2 variant alleles were associated with 14 day mortality or 14 day consciousness. However, FCN2, FCN3, and MASP-2 levels were higher in patients with an unfavorable outcome (GOSE 1-4) at 90 days (p < 0.05), whereas there was no difference in MBL2 genotypes or FCN2 variant alleles. In particular, higher mean MASP-2 levels over 48 h were independently associated with a GOSE score < 4 at 90 days after adjustment (odds ratio 3.46 [95% confidence interval 1.12-10.68] per 100 ng/mL increase, p = 0.03). No association was observed between the lectin pathway of the complement system and 14 day mortality or 14 day consciousness. However, higher plasma FCN2, FCN3, and, in particular, MASP-2 levels early after injury were associated with an unfavorable outcome at 90 days (death, vegetative state, and severe disability) which may be related to an increased activation of the lectin pathway.
Expanding RNA binding specificity and affinity of engineered PUF domains.
Zhao, Yang-Yang; Mao, Miao-Wei; Zhang, Wen-Jing; Wang, Jue; Li, Hai-Tao; Yang, Yi; Wang, Zefeng; Wu, Jia-Wei
2018-05-18
Specific manipulation of RNA is necessary for the research in biotechnology and medicine. The RNA-binding domains of Pumilio/fem-3 mRNA binding factors (PUF domains) are programmable RNA binding scaffolds used to engineer artificial proteins that specifically modulate RNAs. However, the native PUF domains generally recognize 8-nt RNAs, limiting their applications. Here, we modify the PUF domain of human Pumilio1 to engineer PUFs that recognize RNA targets of different length. The engineered PUFs bind to their RNA targets specifically and PUFs with more repeats have higher binding affinity than the canonical eight-repeat domains; however, the binding affinity reaches the peak at those with 9 and 10 repeats. Structural analysis on PUF with nine repeats reveals a higher degree of curvature, and the RNA binding unexpectedly and dramatically opens the curved structure. Investigation of the residues positioned in between two RNA bases demonstrates that tyrosine and arginine have favored stacking interactions. Further tests on the availability of the engineered PUFs in vitro and in splicing function assays indicate that our engineered PUFs bind RNA targets with high affinity in a programmable way.
Expanding RNA binding specificity and affinity of engineered PUF domains
Zhao, Yang-Yang; Zhang, Wen-Jing; Wang, Jue; Li, Hai-Tao; Yang, Yi; Wang, Zefeng; Wu, Jia-Wei
2018-01-01
Abstract Specific manipulation of RNA is necessary for the research in biotechnology and medicine. The RNA-binding domains of Pumilio/fem-3 mRNA binding factors (PUF domains) are programmable RNA binding scaffolds used to engineer artificial proteins that specifically modulate RNAs. However, the native PUF domains generally recognize 8-nt RNAs, limiting their applications. Here, we modify the PUF domain of human Pumilio1 to engineer PUFs that recognize RNA targets of different length. The engineered PUFs bind to their RNA targets specifically and PUFs with more repeats have higher binding affinity than the canonical eight-repeat domains; however, the binding affinity reaches the peak at those with 9 and 10 repeats. Structural analysis on PUF with nine repeats reveals a higher degree of curvature, and the RNA binding unexpectedly and dramatically opens the curved structure. Investigation of the residues positioned in between two RNA bases demonstrates that tyrosine and arginine have favored stacking interactions. Further tests on the availability of the engineered PUFs in vitro and in splicing function assays indicate that our engineered PUFs bind RNA targets with high affinity in a programmable way. PMID:29490074
Silva, Daniel-Adriano; Domínguez-Ramírez, Lenin; Rojo-Domínguez, Arturo; Sosa-Peinado, Alejandro
2011-07-01
The molecular basis of multiple ligand binding affinity for amino acids in periplasmic binding proteins (PBPs) and in the homologous domain for class C G-protein coupled receptors is an unsolved question. Here, using unrestrained molecular dynamic simulations, we studied the ligand binding mechanism present in the L-lysine, L-arginine, L-ornithine binding protein. We developed an analysis based on dihedral angles for the description of the conformational changes upon ligand binding. This analysis has an excellent correlation with each of the two main movements described by principal component analysis (PCA) and it's more convenient than RMSD measurements to describe the differences in the conformational ensembles observed. Furthermore, an analysis of hydrogen bonds showed specific interactions for each ligand studied as well as the ligand interaction with the aromatic residues Tyr-14 and Phe-52. Using uncharged histidine tautomers, these interactions are not observed. On the basis of these results, we propose a model in which hydrogen bond interactions place the ligand in the correct orientation to induce a cation-π interaction with Tyr-14 and Phe-52 thereby stabilizing the closed state. Our results also show that this protein adopts slightly different closed conformations to make available specific hydrogen bond interactions for each ligand thus, allowing a single mechanism to attain multiple ligand specificity. These results shed light on the experimental evidence for ligand-dependent conformational plasticity not explained by the previous crystallographic data. Copyright © 2011 Wiley-Liss, Inc.
Lyabin, D N; Ovchinnikov, L P
2016-03-02
The Y-box binding protein 1 (YB-1) is a key regulator of gene expression at the level of both translation and transcription. The mode of its action on cellular events depends on its subcellular distribution and the amount in the cell. So far, the regulatory mechanisms of YB-1 synthesis have not been adequately studied. Our previous finding was that selective inhibition of YB-1 mRNA translation was caused by suppression of activity of the mTOR signaling pathway. It was suggested that this event may be mediated by phosphorylation of the 4E-binding protein (4E-BP). Here, we report that 4E-BP alone can only slightly inhibit YB-1 synthesis both in the cell and in vitro, although it essentially decreases binding of the 4F-group translation initiation factors to mRNA. With inhibited mTOR kinase, the level of mRNA binding to the eIF4F-group factors was decreased, while that to 4E-BP1 was increased, as was observed for both mTOR kinase-sensitive mRNAs and those showing low sensitivity. This suggests that selective inhibition of translation of YB-1 mRNA, and probably some other mRNAs as well, by mTOR kinase inhibitors is not mediated by the action of the 4E-binding protein upon functions of the 4F-group translation initiation factors.
Li, Xiangrong; Chen, Dejun; Wang, Gongke; Lu, Yan
2015-02-25
Albumin represents a very abundant and important circulating antioxidant in plasma. DPPH radical is also called 2,2-diphenyl-1-picrylhydrazyl. It has been widely used for measuring the efficiency of antioxidants. In this paper, the ability of human serum albumin (HSA) to scavenge DPPH radical was investigated using UV-vis absorption spectra. The interaction between HSA and DPPH was investigated in the absence and presence of eight popular antioxidants using fluorescence spectroscopy. These results indicate the antioxidant activity of HSA against DPPH radical is similar to glutathione and the value of IC50 is 5.200×10(-5) mol L(-1). In addition, the fluorescence experiments indicate the quenching mechanism of HSA, by DPPH, is a static process. The quenching process of DPPH with HSA is easily affected by the eight antioxidants, however, they cannot change the quenching mechanism of DPPH with HSA. The binding of DPPH to HSA primarily takes place in subdomain IIA and exists two classes of binding sites with two different interaction behaviors. The decreased binding constants and the number of binding sites of DPPH with HSA by the introduction of the eight antioxidants may result from the competition of the eight antioxidants and DPPH binding to HSA. The binding of DPPH to HSA may induce the micro-environment of the lone Trp-214 from polar to slightly nonpolar. Copyright © 2014 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Abdullah, Saleh M. S.; Fatma, Sana; Rabbani, Gulam; Ashraf, Jalaluddin M.
2017-01-01
Protein bound toxins are poorly removed by conventional extracorporeal therapies. Venous thromboembolism (VTE) is a major cause of morbidity and mortality in patients with cancer. The interaction between tinzaparin, an inhibitor of angiotensin converting enzyme and human serum albumin, a principal plasma protein in the liver has been investigated in vitro under a simulated physiological condition by UV-vis spectrophotometry and fluorescence spectrometry. The intrinsic fluorescence intensity of human serum albumin was strongly quenched by tinzaparin (TP). The binding constants and binding stoichiometry can be calculated from the data obtained from fluorescence quenching experiments. The negative value of ΔG° reveals that the binding process is a spontaneous process. Thermodynamic analysis shows that the HSA-TP complex formation occurs via hydrogen bonds, hydrophobic interactions and undergoes slight structural changes as evident by far-UV CD. It indicated that the hydrophobic interactions play a main role in the binding of TP to human serum albumin. In addition, the distance between TP (acceptor) and tryptophan residues of human serum albumin (donor) was estimated to be 2.21 nm according to the Förster's resonance energy transfer theory. For the deeper understanding of the interaction, thermodynamic, and molecular docking studies were performed as well. Our docking results suggest that TP forms stable complex with HSA (Kb ∼ 104) and its primary binding site is located in subdomain IIA (Sudlow Site I). The results obtained herein will be of biological significance in pharmacology and clinical medicine.
Pan, Dong-Qi; Jiang, Min; Liu, Ting-Ting; Wang, Qi; Shi, Jie-Hua
2017-06-01
The binding interaction between bovine serum albumin (BSA) and enalapril (ENPL) at the imitated physiological conditions (pH = 7.4) was investigated using UV-vis absorption spectroscopy (UV-vis), fluorescence emission spectroscopy (FES), synchronous fluorescence spectroscopy (SFS), Fourier transform infrared spectroscopy (FT-IR), circular dichroism (CD) and molecular docking methods. It can be deduced from the experimental results from the steady-state fluorescence spectroscopic titration that the intrinsic BSA fluorescence quenching mechanism induced by ENPL is static quenching, based on the decrease in the BSA quenching constants in the presence of ENPL with increase in temperature and BSA quenching rates >10 10 L mol -1 sec -1 . This result indicates that the ENPL-BSA complex is formed through an intermolecular interaction of ENPL with BSA. The main bonding forces for interaction of BSA and ENPL are van der Waal's forces and hydrogen bonding interaction based on negative values of Gibbs free energy change (ΔG 0 ), enthalpic change (ΔH 0 ) and entropic change (ΔS 0 ). The binding of ENPL with BSA is an enthalpy-driven process due to |ΔH°| > |TΔS°| in the binding process. The results of competitive binding experiments and molecular docking confirm that ENPL binds in BSA sub-domain IIA (site I) and results in a slight change in BSA conformation, but BSA still retains its α-helical secondary structure. Copyright © 2016 John Wiley & Sons, Ltd.
Lou, Yan-Yue; Zhou, Kai-Li; Pan, Dong-Qi; Shen, Jia-Le; Shi, Jie-Hua
2017-02-01
Clonazepam, a type of benzodiazepine, is a classical drug used to prevent and treat seizures, panic disorder, movement disorder, among others. For further clarifying the distribution of clonazepam in vivo and the pharmacodynamic and pharmacokinetic mechanisms, the binding interaction between clonazepam and bovine serum albumin (BSA) was investigated using ultraviolet spectroscopy (UV), steady-state fluorescence spectroscopy, synchronous fluorescence spectroscopy, three-dimensional (3D) fluorescence spectroscopy, Fourier transform infrared spectroscopy (FT-IR) and molecular docking methods. The results well confirmed that clonazepam bound on the subdomain III A (Site II) of BSA through van der Waals force and hydrogen bonding interaction, and quenched the intrinsic fluorescence of BSA through a static quenching process. The number of binding sites (n) and binding constant (K b ) of clonazepam-BSA complex were about 1 and 7.94×10 4 M -1 at 308K, respectively. The binding process of clonazepam with BSA was spontaneous and enthalpy-driven process due to ΔG 0 <0 and|ΔH 0 |>T|ΔS 0 | over the studied temperature range. Meanwhile, the binding interaction of clonazepam with BSA resulted in the slight change in the conformation of BSA and the obvious change in the conformation of clonazepam, implying that the flexibility of clonazepam also played an important role in increasing the stability of the clonazepam-BSA complex. Copyright © 2016 Elsevier B.V. All rights reserved.
Salmon, D; Hanocq-Quertier, J; Paturiaux-Hanocq, F; Pays, A; Tebabi, P; Nolan, D P; Michel, A; Pays, E
1997-12-15
The Trypanosoma brucei transferrin (Tf) receptor is a heterodimer encoded by ESAG7 and ESAG6, two genes contained in the different polycistronic transcription units of the variant surface glycoprotein (VSG) gene. The sequence of ESAG7/6 differs slightly between different units, so that receptors with different affinities for Tf are expressed alternatively following transcriptional switching of VSG expression sites during antigenic variation of the parasite. Based on the sequence homology between pESAG7/6 and the N-terminal domain of VSGs, it can be predicted that the four blocks containing the major sequence differences between pESAG7 and pESAG6 form surface-exposed loops and generate the ligand-binding site. The exchange of a few amino acids in this region between pESAG6s encoded by different VSG units greatly increased the affinity for bovine Tf. Similar changes in other regions were ineffective, while mutations predicted to alter the VSG-like structure abolished the binding. Chimeric proteins containing the N-terminal dimerization domain of VSG and the C-terminal half of either pESAG7 or pESAG6, which contains the ligand-binding domain, can form heterodimers that bind Tf. Taken together, these data provided evidence that the T.brucei Tf receptor is structurally related to the N-terminal domain of the VSG and that the ligand-binding site corresponds to the exposed surface loops of the protein.
Hassan, Ayorinde; Dinadayalane, Tandabany C; Grabowski, Sławomir J; Leszczynski, Jerzy
2013-12-28
The effect of increasing the number of monocyclic six-membered rings or bicyclic rings of bicyclo[2.1.1]hexenyl fused to benzene on cation-π interactions involving alkali metal ions (Li(+), Na(+), and K(+)) has been investigated. The binding energy data at the B3LYP/6-311+G(2d,2p) level clearly indicate that the binding affinity of the metal ion with benzene is enhanced by increasing the number of rings fused irrespective of a monocyclic or a bicyclic ring. Calculated binding energies are in good agreement with the available experimental results. The binding strength of cations with ligands decreases in the order Li(+) > Na(+) > K(+). Our study establishes that trisannelation of bicyclo[2.1.1]hexene to benzene facilitates a very strong interaction between benzene and cations. Infrared (IR) frequencies and nuclear magnetic resonance (NMR) chemical shifts are shown to be valuable in characterizing cation-π interactions. The C-C bonds of the central six-membered rings are weakened due to metal ion binding. Based on the Quantum Theory of Atoms in Molecules (QTAIM), we have observed the presence of stabilizing H∙∙∙H interactions in two of the considered systems as opposed to the frequent description of these interactions as non-bonded repulsive interactions. Alkali metal ion binding with those two ligands slightly reduces the strength of such H∙∙∙H interactions.
Poureshghi, Fatemeh; Ghandforoushan, Parisa; Safarnejad, Azam; Soltani, Somaieh
2017-01-01
Lamotrigine (an epileptic drug) interaction with human serum albumin (HSA) was investigated by fluorescence, UV-Vis, FTIR, CD spectroscopic techniques, and molecular modeling methods. Binding constant (K b ) of 5.74×10 3 and number of binding site of 0.97 showed that there is a slight interaction between lamotrigine and HSA. Thermodynamic studies was constructed using the flourimetric titrations in three different temperatures and the resulted data used to calculate the parameters using Vant Hoff equation. Decreased Stern Volmer quenching constant by enhanced temperature revealed the static quenching mechanism. Negative standard enthalpy (ΔH) and standard entropy (ΔS) changes indicated that van der Waals interactions and hydrogen bonds were dominant forces which facilitate the binding of Lamotrigine to HSA, the results were confirmed by molecular docking studies which showed no hydrogen binding. The FRET studies showed that there is a possibility of energy transfer between Trp214 and lamotrigine. Also the binding of lamotrigine to HSA in the studied concentrations was not as much as many other drugs, but the secondary structure of the HSA was significantly changed following the interaction in a way that α-helix percentage was reduced from 67% to 57% after the addition of lamotrigine in the molar ratio of 4:1 to HSA. According to the docking studies, lamotrigine binds to IB site preferably. Copyright © 2016. Published by Elsevier B.V.
Parrott, Andrew C
2013-09-01
Serotonergic neurotoxicity following MDMA is well-established in laboratory animals, and neuroimaging studies have found lower serotonin transporter (SERT) binding in abstinent Ecstasy/MDMA users. Serotonin is a modulator for many different psychobiological functions, and this review will summarize the evidence for equivalent functional deficits in recreational users. Declarative memory, prospective memory, and higher cognitive skills are often impaired. Neurocognitive deficits are associated with reduced SERT in the hippocampus, parietal cortex, and prefrontal cortex. EEG and ERP studies have shown localised reductions in brain activity during neurocognitive performance. Deficits in sleep, mood, vision, pain, psychomotor skill, tremor, neurohormonal activity, and psychiatric status, have also been demonstrated. The children of mothers who take Ecstasy/MDMA during pregnancy have developmental problems. These psychobiological deficits are wide-ranging, and occur in functions known to be modulated by serotonin. They are often related to lifetime dosage, with light users showing slight changes, and heavy users displaying more pronounced problems. In summary, abstinent Ecstasy/MDMA users can show deficits in a wide range of biobehavioral functions with a serotonergic component. Copyright © 2013 Elsevier Ltd. All rights reserved.
NO and CO binding profiles of hemoglobin vesicles as artificial oxygen carriers.
Sakai, Hiromi; Sato, Atsushi; Sobolewski, Peter; Takeoka, Shinji; Frangos, John A; Kobayashi, Koichi; Intaglietta, Marcos; Tsuchida, Eishun
2008-10-01
Hemoglobin vesicles (HbVs) are artificial oxygen carriers encapsulating purified and concentrated Hb solution in phospholipid vesicles (liposomes). We examined in-vitro reaction profiles of a formulation of HbV with NO and CO in anaerobic and aerobic conditions using stopped-flow spectrophotometry and a NO electrode. Reaction rate constants of NO to deoxygenated and oxygenated HbV were considerably smaller than those of cell-free Hb because of the intracellular NO-diffusion barrier. The reaction of CO with deoxygenated HbV was slightly slower than that of cell-free Hb solely because of the co-encapsulated allosteric effector, pyridoxal 5'-phosphate. The NO depletion in an aerobic condition in the presence of empty vesicles was monitored using a NO electrode, showing that the hydrophobic bilayer membrane of HbV, which might have higher gas solubility, does not markedly facilitate the O(2) and NO reaction, and that the intracellular Hb is the major component of NO depletion. In conclusion, HbV shows retarded gas reactions, providing some useful information to explain the absence of vasoconstriction and hypertension when they are intravenously injected.
Gulzar, Muhammad; Taylor, John Rn; Minnaar, Amanda
2017-11-01
Marama bean protein, as extracted previously at pH 8, forms a viscous, adhesive and extensible dough. To obtain a protein isolate with optimum functional properties, protein extraction under slightly acidic conditions (pH 6) was investigated. Two-dimensional electrophoresis showed that pH 6 extracted marama protein lacked some basic 11S legumin polypeptides, present in pH 8 extracted protein. However, it additionally contained acidic high molecular weight polypeptides (∼180 kDa), which were disulfide crosslinked into larger proteins. pH 6 extracted marama proteins had similar emulsification properties to soy protein isolate and several times higher foaming capacity than pH 8 extracted protein, egg white and soy protein isolate. pH 6 extracted protein dough was more elastic than pH 8 extracted protein, approaching the elasticity of wheat gluten. Marama protein extracted at pH 6 has excellent food-type functional properties, probably because it lacks some 11S polypeptides but has additional high molecular weight proteins. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.
An ELISA method detecting the active form of suPAR.
Zhou, Xiaolei; Xu, Mingming; Huang, Hailong; Mazar, Andrew; Iqbal, Zafar; Yuan, Cai; Huang, Mingdong
2016-11-01
Urokinase plasminogen activator receptor (uPAR) exists in a number of formats in human plasma, including soluble uPAR (suPAR) and uPAR fragments. We developed an ELISA method to detect specifically the active form suPAR, which binds to its natural ligand uPA. The intra CV and inter CV of this ELISA assay is 8.5% and 9.6% respectively, and the assay can recover 99.74% of added recombinant suPAR from 10% plasma. This assay is quite sensitive, capable of detecting down to 15pg/ml of suPAR, and can measure suPAR concentrations in the range of 0.031-8ng/ml with high linear relationship. Plasma samples from pregnant women were also measured for the active form of suPAR with this assay, giving an averaged level of 1.39ng/ml, slightly higher than the level of pooled plasma from healthy donors (0.96ng/ml). This study demonstrates the feasibility to measure the active form of suPAR, which will likely have value in clinical applications. Copyright © 2016. Published by Elsevier B.V.
Molecular mechanism of hydrocarbons binding to the metal–organic framework
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sun, Xiuquan; Wick, Collin D.; Thallapally, Praveen K.
The adsorption and diffusivity of methane, ethane, n-butane, n-hexane and cyclohexane in a metal organic framework (MOF) with the organic linker tetrakis[4-(carboxyphenyl)oxamethyl]methane, the metal salt, Zn2+, and organic pillar, 4,4’-bipyridin was studied using molecular dynamics simulations. For the n-alkanes, the longer the chain, the lower the free energy of adsorption, which was attributed to a greater number of contacts between the alkane and MOF. Cyclohexane had a slightly higher adsorption free energy than n-hexane. Furthermore, for cyclo- and n-hexane, there were no significant differences in adsorption free energies between systems with low to moderate loadings. The diffusivity of the n-alkanesmore » was found to strongly depend on chain length with slower diffusion for longer chains. Cyclohexane had no effective diffusion, suggesting that the selectivity the MOF has towards n-hexane over cyclohexane is the result of kinetics instead of energetics. This work was supported by the U.S. Department of Energy's (DOE) Office of Basic Energy Sciences, Chemical Sciences program. The Pacific Northwest National Laboratory is operated by Battelle for DOE.« less
Binding of carbonyl flavours to canola, pea and wheat proteins using GC/MS approach.
Wang, Kun; Arntfield, Susan D
2014-08-15
Interactions of homologous aldehydes (hexanal, heptanal, and octanal) and ketones (2-hexanone, 2-heptanone, and 2-octanone) to salt and alkaline-extracted canola and pea proteins and commercial wheat gluten were studied using GC/MS. Long-chain aldehyde flavours exhibited higher binding affinity, regardless of protein type and isolation method. Salt-extracted canola protein isolates (CPIs) revealed the highest binding capacity to all aldehydes followed by wheat gluten and salt-extracted pea protein isolates (PPIs), while binding of ketone flavours decreased in the order: PPIs>wheat gluten>CPIs. Two aldolisation products, 2-butyl-2-octenal and 2-pentyl-2-nonenal, were detected from the interactions between CPIs with hexanal and heptanal, respectively. Protein thermal behaviour in the presence of these compounds was analysed by differential scanning calorimeter, where decreased ΔH inferred potential conformational changes due to partial denaturation of PPIs. Compared to ketones, aldehyde flavours possessed much higher "unfolding capacity" (lower ΔH), which accounted for their higher binding affinities. Copyright © 2014 Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gundlach, A.L.; Largent, B.L.; Snyder, S.H.
1986-06-01
(+)3H-3-PPP ((+)3H-3-(3-Hydroxyphenyl)-N-(1-propyl)-piperidine) binds with high affinity to brain membranes with a pharmacological profile consistent with that of sigma receptors. The distribution of (+)3H-3-PPP binding sites in brain and spinal cord of both guinea pig and rat has been determined by in vitro autoradiography with binding densities quantitated by computer-assisted densitometry. (+)3H-3-PPP binding to slide-mounted brain sections is saturable and displays high affinity and a pharmacological specificity very similar to sites labeled in homogenates. (+)3H-3-PPP binding sites are heterogeneously distributed. Highest concentrations of binding sites occur in spinal cord, particularly the ventral horn and dorsal root ganglia; the pons-medulla, associated withmore » the cranial nerve and pontine nuclei and throughout the brain stem reticular formation; the cerebellum, over the Purkinje cell layer; the midbrain, particularly the central gray and red nucleus; and hippocampus, over the pyramidal cell layer. Lowest levels are seen in the basal ganglia and parts of the thalamus, while all other areas, including hypothalamus and cerebral cortex, exhibit moderate grain densities. Quinolinic acid-induced lesions of the hippocampus indicate that (+)3H-3-PPP labels hippocampal pyramidal cells and granule cells in the dentate gyrus. Intrastriatal injection of ibotenic acid dramatically reduces (+)3H-3-PPP binding in this area, while injection of 6-hydroxydopamine produces a relatively slight decrease. The distribution of (+)3H-3-PPP binding sites does not correlate with the receptor distribution of any recognized neurotransmitter or neuropeptide, including dopamine. However, there is a notable similarity between the distribution of (+)3H-3-PPP sites and high-affinity binding sites for psychotomimetic opioids, such as the benzomorphan (+)SKF 10,047.« less
The mechanism of antimalarial action of the ruthenium(II)-chloroquine complex [RuCl(2)(CQ)] (2).
Martínez, Alberto; Rajapakse, Chandima S K; Naoulou, Becky; Kopkalli, Yasemin; Davenport, Lesley; Sánchez-Delgado, Roberto A
2008-06-01
The mechanism of antimalarial action of the ruthenium-chloroquine complex [RuCl(2)(CQ)](2) (1), previously shown by us to be active in vitro against CQ-resistant strains of Plasmodium falciparum and in vivo against P. berghei, has been investigated. The complex is rapidly hydrolyzed in aqueous solution to [RuCl(OH(2))(3)(CQ)](2)[Cl](2), which is probably the active species. This compound binds to hematin in solution and inhibits aggregation to beta-hematin at pH approximately 5 to a slightly lower extent than chloroquine diphosphate; more importantly, the heme aggregation inhibition activity of complex 1 is significantly higher than that of CQ when measured at the interface of n-octanol-aqueous acetate buffer mixtures under acidic conditions modeling the food vacuole of the parasite. Partition coefficient measurements confirmed that complex 1 is considerably more lipophilic than CQ in n-octanol-water mixtures at pH approximately 5. This suggests that the principal target of complex 1 is the heme aggregation process, which has recently been reported to be fast and spontaneous at or near water-lipid interfaces. The enhanced antimalarial activity of complex 1 is thus probably due to a higher effective concentration of the drug at or near the interface compared with that of CQ, which accumulates strongly in the aqueous regions of the vacuole under those conditions. Furthermore, the activity of complex 1 against CQ-resistant strains of P. falciparum is probably related to its greater lipophilicity, in line with previous reports indicating a lowered ability of the mutated transmembrane transporter PfCRT to promote the efflux of highly lipophilic drugs. The metal complex also interacts with DNA by intercalation, to a comparable extent and in a similar manner to uncomplexed CQ and therefore DNA binding does not appear to be an important part of the mechanism of antimalarial action in this case.
The mechanism of antimalarial action of the ruthenium (II)-chloroquine complex [RuCl2(CQ)]2
Martínez, Alberto; Rajapakse, Chandima S. K.; Naoulou, Becky; Kopkalli, Yasemin; Davenport, Lesley; Sánchez-Delgado, Roberto A.
2008-01-01
The mechanism of antimalarial action of the ruthenium-chloroquine complex [RuCl2(CQ)]2 (1), previously shown by us to be active in vitro against CQ-resistant strains of Plasmodium falciparum and in vivo against P. berghei, has been investigated. The complex is rapidly hydrolyzed in aqueous solution to [RuCl(OH2)3(CQ)]2 [Cl]2, which is probably the active species. This compound binds to hematin in solution and inhibits aggregation to β-hematin at pH ∼ 5 to a slightly lower extent than chloroquine diphosphate; more importantly, the heme aggregation inhibition activity of complex 1 is significantly higher than that of CQ when measured at the interface of n-octanol-aqueous acetate buffer mixtures under acidic conditions modeling the food vacuole of the parasite. Partition coefficient measurements confirmed that complex 1 is considerably more lipophilic than CQ in n-octanol-water mixtures at pH ∼ 5. This suggests that the principal target of complex 1 is the heme aggregation process, which has recently been reported to be fast and spontaneous at or near water-lipid interfaces. The enhanced antimalarial activity of complex 1 is thus probably due to a higher effective concentration of the drug at or near the interface compared with that of CQ, which accumulates strongly in the aqueous regions of the vacuole under those conditions. Furthermore, the activity of complex 1 against CQ-resistant strains of P. falciparum is probably related to its greater lipophilicity, in line with previous reports indicating a lowered ability of the mutated transmembrane transporter PfCRT to promote the efflux of highly lipophilic drugs. The metal complex also interacts with DNA by intercalation, to a comparable extent and in a similar manner to uncomplexed CQ and therefore DNA binding does not appear to be an important part of the mechanism of antimalarial action in this case. PMID:18305967
Hormonal regulation of hepatic glycogenolysis in the carp, Cyprinus carpio
DOE Office of Scientific and Technical Information (OSTI.GOV)
Janssens, P.A.; Lowrey, P.
1987-04-01
Carp (Cyprinus carpio) liver maintained normal glycogen content and enzyme complement for several days in organ culture. Epinephrine-stimulated glycogenolysis, phosphorylase activation, and cyclic AMP (cAMP) accumulation in a concentration-dependent manner with EC/sub 50/s of 100, 100, and 500 nM, respectively. These actions were blocked by the ..beta..-adrenergic antagonist, propranolol, but not by the ..cap alpha..-adrenergic antagonist phentolamine. Glycogenolysis and tissue cAMP were uninfluenced by 10/sup -6/ M arginine vasotocin, arginine vasopressin, lysine vasotocin, lysine vasopressin, mesotocin, or oxytocin, but were slightly increased by 10/sup -5/ M isotocin and slightly decreased by 10/sup -6/ M angiotensin II. (/sup 125/I)-iodocyanopindolol (ICP), amore » ..beta..-adrenergic ligand, bound to isolated carp liver membranes with a K/sub D/ of 83 pM. Maximum binding of 45 fmol/mg protein was at 600 pM. Propranolol, isoprenaline, epinephrine, phenylephrine, norepinephrine, and phenoxybenzamine displaced ICP with K/sub D/s of 100 nM, 2, 20, 20, 60, and 200 ..mu..M, respectively. The ..cap alpha..-adrenergic antagonists, yohimbine and prazosin, showed no specific binding. These data provide evidence that catecholamines act via ..beta..-adrenergic receptors in carp liver and that ..cap alpha..-adrenergic receptors are not present. Vasoactive peptides play no significant role in regulation of carp liver glycogenolysis.« less
Seredenin, S B; Nadorova, A V; Kolik, L G; Yarkova, M A
2013-07-01
We studied the effects of phenazepam (0.075 mg/kg) after pretreatment (5 minutes before) with naloxone (10 mg/kg) on open-field behavior of C57Bl/6 and BALB/c mice. In ex vivo experiments, we studied the effects of naloxone (1 and 10 mg/kg) on receptor binding of [(3)H]-flunitrazepam by membranes of brain fraction (P1+P2) of C57Bl/6 and BALB/c mice. It was shown that naloxone increased motor activity in the open field in BALB/c mice and decreased this parameter in C57Bl/6 mice. During combined treatment, naloxone potentiated the activating effects of phenazepam on the open-field behavior of BALB/c mice and slightly increased the sedative effect of this drug in C57Bl/6 mice. Naloxone stimulated reception of [(3)H]-flunitrazepam in BALB/c mice and slightly increased radioligand binding in C57Bl/6 mice. These data attest to enhanced reception in benzodiazepine site of GABAA-receptor under conditions of opioid receptor blockade, the presence of anxiolytic or sedative (depending on the phenotype of the response to emotional stress) effect of naloxone, and co-directed effects of naloxone and benzodiazepine tranquilizer on open-field behavior of C57Bl/6 and BALB/c mice.
Moussou, Nadia; Corzo-Martínez, Marta; Sanz, María Luz; Zaidi, Farid; Montilla, Antonia; Villamiel, Mar
2017-03-01
In this paper, the quality of bean, chickpea, fava beans, lentil and pea flours from Algeria has been evaluated. Maillard reaction (MR) indicators, modifications in the carbohydrate and protein fractions, antioxidant activity and α-amylase inhibitor of raw, toasted and stored samples were evaluated. Fava beans, beans and peas showed higher content of raffinose family oligosaccharides while chickpeas and lentils showed higher polyol content. Toasting and storage caused slightly change in pulse quality; MR showed slight losses of lysine but increased antioxidant activity. Moreover, inhibition of α-amylase was slightly augmented during processing; this could increase the undigested carbohydrates that reach the colon, modulating the glycemic response. These results point out the suitability of these flours for preparing high-quality foodstuffs intended for a wide spectrum of the population, including hyperglycemic and gluten intolerant individuals.
Sayer, Jane M; Agniswamy, Johnson; Weber, Irene T; Louis, John M
2010-11-01
The mature protease from Group N human immunodeficiency virus Type 1 (HIV-1) (PR1(N)) differs in 20 amino acids from the extensively studied Group M protease (PR1(M)) at positions corresponding to minor drug-resistance mutations (DRMs). The first crystal structure (1.09 Å resolution) of PR1(N) with the clinical inhibitor darunavir (DRV) reveals the same overall structure as PR1(M), but with a slightly larger inhibitor-binding cavity. Changes in the 10s loop and the flap hinge propagate to shift one flap away from the inhibitor, whereas L89F and substitutions in the 60s loop perturb inhibitor-binding residues 29-32. However, kinetic parameters of PR1(N) closely resemble those of PR1(M), and calorimetric results are consistent with similar binding affinities for DRV and two other clinical PIs, suggesting that minor DRMs coevolve to compensate for the detrimental effects of drug-specific major DRMs. A miniprecursor (TFR 1-61-PR1(N)) comprising the transframe region (TFR) fused to the N-terminus of PR1(N) undergoes autocatalytic cleavage at the TFR/PR1(N) site concomitant with the appearance of catalytic activity characteristic of the dimeric, mature enzyme. This cleavage is inhibited at an equimolar ratio of precursor to DRV (∼6 μM), which partially stabilizes the precursor dimer from a monomer. However, cleavage at L34/W35 within the TFR, which precedes the TFR 1-61/PR1(N) cleavage at pH ≤ 5, is only partially inhibited. Favorable properties of PR1(N) relative to PR1(M) include its suitability for column fractionation by size under native conditions and >10-fold higher dimer dissociation constant (150 nM). Exploiting these properties may facilitate testing of potential dimerization inhibitors that perturb early precursor processing steps.
te Riet, Joost; Reinieren-Beeren, Inge; Figdor, Carl G; Cambi, Alessandra
2015-11-01
The fungus Candida albicans is the most common cause of mycotic infections in immunocompromised hosts. Little is known about the initial interactions between Candida and immune cell receptors, such as the C-type lectin dendritic cell-specific intracellular cell adhesion molecule-3 (ICAM-3)-grabbing non-integrin (DC-SIGN), because a detailed characterization at the structural level is lacking. DC-SIGN recognizes specific Candida-associated molecular patterns, that is, mannan structures present in the cell wall of Candida. The molecular recognition mechanism is however poorly understood. We postulated that small differences in mannan-branching may result in considerable differences in the binding affinity. Here, we exploit atomic force microscope-based dynamic force spectroscopy with single Candida cells to gain better insight in the carbohydrate recognition capacity of DC-SIGN. We demonstrate that slight differences in the N-mannan structure of Candida, that is, the absence or presence of a phosphomannan side chain, results in differences in the recognition by DC-SIGN as follows: (i) it contributes to the compliance of the outer cell wall of Candida, and (ii) its presence results in a higher binding energy of 1.6 kB T. The single-bond affinity of tetrameric DC-SIGN for wild-type C. albicans is ~10.7 kB T and a dissociation constant kD of 23 μM, which is relatively strong compared with other carbohydrate-protein interactions described in the literature. In conclusion, this study shows that DC-SIGN specifically recognizes mannan patterns on C. albicans with high affinity. Knowledge on the binding pocket of DC-SIGN and its pathogenic ligands will lead to a better understanding of how fungal-associated carbohydrate structures are recognized by receptors of the immune system and can ultimately contribute to the development of new anti-fungal drugs. Copyright © 2015 John Wiley & Sons, Ltd.
Kashyap, Prakriti; Deswal, Renu
2017-06-01
Plant chitinases are the members of PR (Pathogenesis related) proteins family and protect plants from biotic and abiotic stress. A novel chitinase HrCHI1 (Accession number JQ289153) of 954bp ORF encoding 317 amino acids protein was cloned, expressed and characterized from seabuckthorn, a cold/freeze tolerant shrub. The 3D structure (predicted with I-TASSER server) showed highest homology with Oryza sativa class I chitinase (PDB 2dkvA). Putative promoter region (obtained by genome walking) showed GCC box, E-boxes, the binding site for bHLH proteins and DRE elements, the CBF (C-repeat binding factor) binding site besides TATA and CAAT boxes. The gel shift assay with the nuclear extract indicated that the HrCHI1 might be participating in CBF/ERF dependent cold stress signaling pathway. The quantitative transcript profiling supported this observation as cold induced expression of HrCBF peaked earlier (at 1h) while HrCHI1 peaked latter (after 3h) indicating HrCHI1 expression might be induced by HrCBF. Further, HrCHI1 expression was methyl jasmonate (MeJa) dependent and salicylic acid (SA) independent. HrCHI1 was expressed in E. coli and purified using chitin affinity chromatography. It showed 512U/mg chitinase hydrolytic activity and resolved as a 34kDa spot with a slightly basic pI (8.5) on a 2-D gel. The E. coli cells containing recombinant chitinase showed higher rate of growth in cold in comparison with the cells containing the empty vector. In conclusion, we have isolated and characterized a cold responsive basic class I chitinase which is regulated by MeJa and seems to be functioning via CBF/ERF dependent cold stress signaling pathway. Copyright © 2017 Elsevier B.V. All rights reserved.
Aasa-Chapman, Marlèn; Gorlani, Andrea; Forsman Quigley, Anna; Hulsik, David Lutje; Chen, Lei; Weiss, Robin; de Haard, Hans; Verrips, Theo
2012-01-01
Many of the neutralising antibodies, isolated to date, display limited activities against the globally most prevalent HIV-1 subtypes A and C. Therefore, those subtypes are considered to be an important target for antibody-based therapy. Variable domains of llama heavy chain antibodies (VHH) have some superior properties compared with classical antibodies. Therefore we describe the application of trimeric forms of envelope proteins (Env), derived from HIV-1 of subtype A and B/C, for a prolonged immunization of two llamas. A panel of VHH, which interfere with CD4 binding to HIV-1 Env were selected with use of panning. The results of binding and competition assays to various Env, including a variant with a stabilized CD4-binding state (gp120Ds2), cross-competition experiments, maturation analysis and neutralisation assays, enabled us to classify the selected VHH into three groups. The VHH of group I were efficient mainly against viruses of subtype A, C and B′/C. The VHH of group II resemble the broadly neutralising antibody (bnmAb) b12, neutralizing mainly subtype B and C viruses, however some had a broader neutralisation profile. A representative of the third group, 2E7, had an even higher neutralization breadth, neutralizing 21 out of the 26 tested strains belonging to the A, A/G, B, B/C and C subtypes. To evaluate the contribution of certain amino acids to the potency of the VHH a small set of the mutants were constructed. Surprisingly this yielded one mutant with slightly improved neutralisation potency against 92UG37.A9 (subtype A) and 96ZM651.02 (subtype C). These findings and the well-known stability of VHH indicate the potential application of these VHH as anti-HIV-1 microbicides. PMID:22438910
Michigan's forest resources in 2004
Mark H. Hansen; Gary J. Brand
2006-01-01
The sixth inventory of Michigan's forests was completed in 2004. The 18.7 million acres of timberland found is slightly higher than the 18.6 million acres found in the 1993 inventory. The standing timber volume has increased slightly at a rate of 0.22 percent per year. Detailed inventory results can be obtained at
Liberato, Isabella Ramos de Oliveira; Lopes, Edmundo Pessoa de Almeida; Cavalcante, Maria Alina Gomes de Mattos; Pinto, Tiago Costa; Moura, Izolda Fernades; Loureiro Júnior, Luiz
2012-01-01
The present study was designed to analyze the serum levels of aspartate and alanine aminotransferases, gamma-glutamyl transferase, and the hematocrit in patients with chronic kidney disease who were undergoing peritoneal dialysis or hemodialysis. Twenty patients on peritoneal dialysis and 40 on hemodialysis were assessed, and the patients were matched according to the length of time that they had been on dialysis. Blood samples were collected (both before and after the session for those on hemodialysis) to measure the enzymes and the hematocrit. In the samples from the patients who were undergoing peritoneal dialysis, the aspartate and alanine aminotransferase levels were slightly higher compared with the samples collected from the patients before the hemodialysis session and slightly lower compared with the samples collected after the hemodialysis session. The levels of gamma-glutamyl transferase in the hemodialysis patients were slightly higher than the levels in the patients who were undergoing peritoneal dialysis. In addition, the levels of aminotransferases and gamma-glutamyl transferase that were collected before the hemodialysis session were significantly lower than the values collected after the session. The hematocrit levels were significantly lower in the patients who were on peritoneal dialysis compared with the patients on hemodialysis (both before and after the hemodialysis session), and the levels were also significantly lower before hemodialysis compared with after hemodialysis. The aminotransferase levels in the patients who were undergoing peritoneal dialysis were slightly higher compared with the samples collected before the hemodialysis session, whereas the aminotransferase levels were slightly lower compared with the samples collected after the session. The hematocrits and the aminotransferase and gamma-glutamyl transferase levels of the samples collected after the hemodialysis session were significantly higher than the samples collected before the session. Taken together, the present data suggest that hemodilution could alter the serum levels of liver enzymes.
Benzodiazepine and kainate receptor binding sites in the RCS rat retina.
Stasi, Kalliopi; Naskar, Rita; Thanos, Solon; Kouvelas, Elias D; Mitsacos, Ada
2003-02-01
The effect of age and photoreceptor degeneration on the kainate subtype of glutamate receptors and on the benzodiazepine-sensitive gamma-aminobutyric acid-A receptors (GABA(A)) in normal and RCS (Royal College of Surgeons) rats were investigated. [(3)H]Kainate and [(3)H]flunitrazepam were used as radioligands for kainate and GABA(A)/benzodiazepine()receptors, respectively, using the quantitative receptor autoradiography technique. In both normal and RCS rat retina we observed that [(3)Eta]flunitrazepam and [(3)Eta]kainate binding levels were several times higher in inner plexiform layer (IPL) than in outer plexiform layer (OPL) at all four ages studied (P17, P35, P60 and P180). Age-related changes in receptor binding were observed in normal rat retina: [(3)Eta]flunitrazepam binding showed a significant decrease of 25% between P17 and P60 in IPL,and [(3)Eta]kainate binding showed significant decreases between P17 and P35 in both synaptic layers (71% in IPL and 63% in OPL). Degeneration-related changes in benzodiazepine and kainate receptor binding were observed in RCS rat retina. In IPL, [(3)Eta]flunitrazepam and [(3)Eta]kainate binding levels were higher than in normal retina at P35 (by 24% and 86%, respectively). In OPL, [(3)Eta]flunitrazepam binding was higher in RCS than in normal retina on P35 (74%) and also on P60 (62%). The results indicate that postnatal changes occur in kainate and benzodiazepine receptor binding sites in OPL and IPL of the rat retina up to 6 months of age. The data also suggest that the receptor binding changes observed in the RCS retina could be a consequence of the primary photoreceptor degeneration.
Derewenda, Urszula; Artamonov, Mykhaylo; Szukalska, Gabriela; Utepbergenov, Darkhan; Olekhnovich, Natalya; Parikh, Hardik I.; Kellogg, Glen E.; Somlyo, Avril V.; Derewenda, Zygmunt S.
2013-01-01
Members of the RSK family of kinases constitute attractive targets for drug design, but a lack of structural information regarding the mechanism of selective inhibitors impedes progress in this field. The crystal structure of the N-terminal kinase domain (residues 45–346) of mouse RSK2, or RSK2NTKD, has recently been described in complex with one of only two known selective inhibitors, a rare naturally occurring flavonol glycoside, kaempferol 3-O-(3′′,4′′-di-O-acetyl-α-l-rhamnopyranoside), known as SL0101. Based on this structure, it was hypothesized that quercitrin (quercetin 3-O-α-l-rhamnopyranoside), a related but ubiquitous and inexpensive compound, might also act as an RSK inhibitor. Here, it is demonstrated that quercitrin binds to RSK2NTKD with a dissociation constant (K d) of 5.8 µM as determined by isothermal titration calorimetry, and a crystal structure of the binary complex at 1.8 Å resolution is reported. The crystal structure reveals a very similar mode of binding to that recently reported for SL0101. Closer inspection shows a number of small but significant differences that explain the slightly higher K d for quercitrin compared with SL0101. It is also shown that quercitrin can effectively substitute for SL0101 in a biological assay, in which it significantly suppresses the contractile force in rabbit pulmonary artery smooth muscle in response to Ca2+. PMID:23385462
Hu, Jianping; Wang, Yingqing; Li, Yanlian; Xu, Lin; Cao, Danyan; Song, ShanShan; Damaneh, Mohammadali Soleimani; Wang, Xin; Meng, Tao; Chen, Yue-Lei; Shen, Jingkang; Miao, Zehong; Xiong, Bing
2017-09-08
Recent years have seen much effort to discover new chemotypes of BRD4 inhibitors. Interestingly, some kinase inhibitors have been demonstrated to be potent bromodomain inhibitors, especially the PLK1 inhibitor BI-2536 and the JAK2 inhibitor TG101209, which can bind to BRD4 with IC 50 values of 0.025 μM and 0.13 μM, respectively. Although the concept of dual inhibition is intriguing, selective BRD4 inhibitors are preferred as they may diminish off-target effects and provide more flexibility in anticancer drug combination therapy. Inspired by BI-2536, we designed and prepared a series of dihydroquinoxalin-2(1H)-one derivatives as selective bromodomain inhibitors. We found compound 54 had slightly higher activity than (+)-JQ1 in the fluorescence anisotropy assay and potent antiproliferative cellular activity in the MM.1S cell line. We have successfully solved the cocrystal structure of 52 in complex with BRD4-BD1, providing a solid structural basis for the binding mode of compounds of this series. Compound 54 exhibited high selectivity over most non-BET subfamily members and did not show bioactivity towards the PLK1 kinase at 10 or 1 μM. From in vivo studies, compound 54 demonstrated a good PK profile, and the results from in vivo pharmacological studies clearly showed the efficacy of 54 in the mouse MM.1S xenograft model. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Lutfi, Esmail; Riera-Heredia, Natàlia; Córdoba, Marlon; Porte, Cinta; Gutiérrez, Joaquim; Capilla, Encarnación; Navarro, Isabel
2017-07-01
Numerous environmental pollutants have been identified as potential obesogenic compounds affecting endocrine signaling and lipid homeostasis. Among them, well-known organotins such as tributyltin (TBT) and triphenyltin (TPT), can be found in significant concentrations in aquatic environments. The aim of the present study was to investigate in vitro the effects of TBT and TPT on the development and lipid metabolism of rainbow trout (Onchorynchus mykiss) primary cultured adipocytes. Results showed that TBT and TPT induced lipid accumulation and slightly enhanced peroxisome proliferator-activated receptor gamma (PPARγ) and CCAAT enhancer binding protein alpha (C/EBPα) protein expression when compared to a control, both in the presence or absence of lipid mixture. However, the effects were higher when combined with lipid, and in the absence of it, the organotins did not cause complete mature adipocyte morphology. Regarding gene expression analyses, exposure to TBT and TPT caused an increase in fatty acid synthase (fasn) mRNA levels confirming the pro-adipogenic properties of these compounds. In addition, when added together with lipid, TBT and TPT significantly increased cebpa, tumor necrosis factor alpha (tnfa) and ATP-binding cassette transporter 1 (abca1) mRNA levels suggesting a synergistic effect. Overall, our data highlighted that TBT and TPT activate adipocyte differentiation in rainbow trout supporting an obesogenic role for these compounds, although by themselves they are not able to induce complete adipocyte development and maturation suggesting that these adipocytes might not be properly functional. Copyright © 2017 Elsevier B.V. All rights reserved.
Rostamian, Mosayeb; Mousavy, Seyed Jafar; Ebrahimi, Firouz; Ghadami, Seyyed Abolghasem; Sheibani, Nader; Minaei, Mohammad Ebrahim; Arefpour Torabi, Mohammad Ali
2012-01-01
Recently, botulinum neurotoxin (BoNT)-derived recombinant proteins have been suggested as potential botulism vaccines. Here, with concentrating on BoNT type E (BoNT/E), we studied two of these binding domain-based recombinant proteins: a multivalent chimer protein, which is composed of BoNT serotypes A, B and E binding subdomains, and a monovalent recombinant protein, which contains 93 amino acid residues from recombinant C-terminal heavy chain of BoNT/E (rBoNT/E-HCC). Both proteins have an identical region (48 aa) that contains one of the most important BoNT/E epitopes (YLTHMRD sequence). The recombinant protein efficiency in antibody production, their structural differences, and their BoNT/E-epitope location were compared by using ELISA, circular dichroism, computational modeling, and hydrophobicity predictions. Immunological studies indicated that the antibody yield against rBoNT/E-HCC was higher than chimer protein. Cross ELISA confirmed that the antibodies against the chimer protein recognized rBoNT/E-HCC more efficiently. However, both antibody groups (anti-chimer and anti-rBoNT/E-HCC antibodies) were able to recognize other proteins. Structural studies with circular dichroism showed that chimer proteins have slightly more secondary structures than rBoNT/E-HCC. The immunological results suggested that the above-mentioned identical region in rBoNT/E-HCC is more exposed. Circular dichroism, computational protein modeling and hydrophobicity predictions indicated a more exposed location for the identical region in rBoNT/E-HCC than the chimer protein, which is strongly in agreement with immunological results.
Twisting a β-Carotene, an Adaptive Trick from Nature for Dissipating Energy during Photoprotection*
Sobotka, Roman; Kish, Elizabeth; Shukla, Mahendra Kumar; Pascal, Andrew A.; Polívka, Tomáš; Robert, Bruno
2017-01-01
Cyanobacteria possess a family of one-helix high light-inducible proteins (Hlips) that are homologous to light-harvesting antenna of plants and algae. An Hlip protein, high light-inducible protein D (HliD) purified as a small complex with the Ycf39 protein is evaluated using resonance Raman spectroscopy. We show that the HliD binds two different β-carotenes, each present in two non-equivalent binding pockets with different conformations, having their (0,0) absorption maxima at 489 and 522 nm, respectively. Both populations of β-carotene molecules were in all-trans configuration and the absorption position of the farthest blue-shifted β-carotene was attributed entirely to the polarizability of the environment in its binding pocket. In contrast, the absorption maximum of the red-shifted β-carotene was attributed to two different factors: the polarizability of the environment in its binding pocket and, more importantly, to the conformation of its β-rings. This second β-carotene has highly twisted β-rings adopting a flat conformation, which implies that the effective conjugation length N is extended up to 10.5 modifying the energetic levels. This increase in N will also result in a lower S1 energy state, which may provide a permanent energy dissipation channel. Analysis of the carbonyl stretching region for chlorophyll a excitations indicates that the HliD binds six chlorophyll a molecules in five non-equivalent binding sites, with at least one chlorophyll a presenting a slight distortion to its macrocycle. The binding modes and conformations of HliD-bound pigments are discussed with respect to the known structures of LHCII and CP29. PMID:27994060
BRADRICK, THOMAS D.; MARINO, JOHN P.
2004-01-01
Replication of human immunodeficiency virus type 1 (HIV-1) is regulated in part through an interaction between the virally encoded trans-activator protein Tat and the trans-activator responsive region (TAR) of the viral RNA genome. Because TAR is highly conserved and its interaction with Tat is required for efficient viral replication, it has received much attention as an antiviral drug target. Here, we report a 2-aminopurine (2-AP) fluorescence-based assay for evaluating potential TAR inhibitors. Through selective incorporation of 2-AP within the bulge (C23 or U24) of a truncated form of the TAR sequence (Δ TAR-ap23 and Δ TAR-ap24), binding of argininamide, a 24-residue arginine-rich peptide derived from Tat, and Neomycin has been characterized using steady-state fluorescence. Binding of argininamide to the 2-AP ΔTAR constructs results in a four- to 11-fold increase in fluorescence intensity, thus providing a sensitive reporter of that interaction (KD ~ 1 mM). Similarly, binding of the Tat peptide results in an initial 14-fold increase in fluorescence (KD ~ 25 nM), but is then followed by a slight decrease that is attributed to an additional, lower-affinity association(s). Using the ΔTAR-ap23 and TAR-ap24 constructs, two classes of Neomycin binding sites are detected; the first molecule of antibiotic binds as a noncompetitive inhibitor of Tat/argininamide (KD ~ 200 nM), whereas the second, more weakly bound molecule(s) becomes associated in a presumably nonspecific manner (KD ~ 4 μM). Taken together, the results demonstrate that the 2-AP fluorescence-detected binding assays provide accurate and general methods for quantitatively assessing TAR interactions. PMID:15273324
Engineered Single-Chain, Antiparallel, Coiled Coil Mimics the MerR Metal Binding Site
Song, Lingyun; Caguiat, Jonathan; Li, Zhongrui; Shokes, Jacob; Scott, Robert A.; Olliff, Lynda; Summers, Anne O.
2004-01-01
The repressor-activator MerR that controls transcription of the mercury resistance (mer) operon is unusual for its high sensitivity and specificity for Hg(II) in in vivo and in vitro transcriptional assays. The metal-recognition domain of MerR resides at the homodimer interface in a novel antiparallel arrangement of α-helix 5 that forms a coiled-coil motif. To facilitate the study of this novel metal binding motif, we assembled this antiparallel coiled coil into a single chain by directly fusing two copies of the 48-residue α-helix 5 of MerR. The resulting 107-residue polypeptide, called the metal binding domain (MBD), and wild-type MerR were overproduced and purified, and their metal-binding properties were determined in vivo and in vitro. In vitro MBD bound ca. 1.0 equivalent of Hg(II) per pair of binding sites, just as MerR does, and it showed only a slightly lower affinity for Hg(II) than did MerR. Extended X-ray absorption fine structure data showed that MBD has essentially the same Hg(II) coordination environment as MerR. In vivo, cells overexpressing MBD accumulated 70 to 100% more 203Hg(II) than cells bearing the vector alone, without deleterious effects on cell growth. Both MerR and MBD variously bound other thiophilic metal ions, including Cd(II), Zn(II), Pb(II), and As(III), in vitro and in vivo. We conclude that (i) it is possible to simulate in a single polypeptide chain the in vitro and in vivo metal-binding ability of dimeric, full-length MerR and (ii) MerR's specificity in transcriptional activation does not reside solely in the metal-binding step. PMID:14996817
Xu, Huacheng; Guan, Dong-Xing; Zou, Li; Lin, Hui; Guo, Laodong
2018-08-01
Effects of photochemical and microbial degradation on variations in composition and molecular-size of dissolved organic matter (DOM) from different sources (algal and soil) and the subsequent influence on Cu(II) binding were investigated using UV-Vis, fluorescence excitation-emission matrices coupled with parallel factor analysis, flow field-flow fractionation (FlFFF), and metal titration. The degradation processes resulted in an initial rapid decline in the bulk dissolved organic carbon and chromophoric and fluorescent DOM components, followed by a small or little decrease. Specifically, photochemical reaction decreased the aromaticity, humification and apparent molecular weights of all DOM samples, whereas a reverse trend was observed during microbial degradation. The FlFFF fractograms revealed that coagulation of both protein- and humic-like DOM induced an increase in molecular weights for algal-DOM, while the molecular weight enhancement for allochthonous soil samples was mainly attributed to the self-assembly of humic-like components. The Cu(II) binding capacity of algal-derived humic-like and fulvic-like DOM consistently increased during photo- and bio-degradation, while the soil-derived DOM exhibited a slight decline in Cu(II) binding capacity during photo-degradation but a substantial increase during microbial degradation, indicating source- and degradation-dependent metal binding heterogeneities. Pearson correlation analysis demonstrated that the Cu(II) binding potential was mostly related with aromaticity and molecular size for allochthonous soil-derived DOM, but was regulated by both DOM properties and specific degradation processes for autochthonous algal-derived DOM. This study highlighted the coupling role of inherent DOM properties and external environmental processes in regulating metal binding, and provided new insights into metal-DOM interactions and the behavior and fate of DOM-bound metals in aquatic environments. Copyright © 2018 Elsevier Ltd. All rights reserved.
Effect of DNA Binding on Geminate CO Recombination Kinetics in CO-sensing Transcription Factor CooA*
Benabbas, Abdelkrim; Karunakaran, Venugopal; Youn, Hwan; Poulos, Thomas L.; Champion, Paul M.
2012-01-01
Carbon monoxide oxidation activator (CooA) proteins are heme-based CO-sensing transcription factors. Here we study the ultrafast dynamics of geminate CO rebinding in two CooA homologues, Rhodospirillum rubrum (RrCooA) and Carboxydothermus hydrogenoformans (ChCooA). The effects of DNA binding and the truncation of the DNA-binding domain on the CO geminate recombination kinetics were specifically investigated. The CO rebinding kinetics in these CooA complexes take place on ultrafast time scales but remain non-exponential over many decades in time. We show that this non-exponential kinetic response is due to a quenched enthalpic barrier distribution resulting from a distribution of heme geometries that is frozen or slowly evolving on the time scale of CO rebinding. We also show that, upon CO binding, the distal pocket of the heme in the CooA proteins relaxes to form a very efficient hydrophobic trap for CO. DNA binding further tightens the narrow distal pocket and slightly weakens the iron-proximal histidine bond. Comparison of the CO rebinding kinetics of RrCooA, truncated RrCooA, and DNA-bound RrCooA proteins reveals that the uncomplexed and inherently flexible DNA-binding domain adds additional structural heterogeneity to the heme doming coordinate. When CooA forms a complex with DNA, the flexibility of the DNA-binding domain decreases, and the distribution of the conformations available in the heme domain becomes restricted. The kinetic studies also offer insights into how the architecture of the heme environment can tune entropic barriers in order to control the geminate recombination of CO in heme proteins, whereas spin selection rules play a minor or non-existent role. PMID:22544803
Effect of DNA binding on geminate CO recombination kinetics in CO-sensing transcription factor CooA.
Benabbas, Abdelkrim; Karunakaran, Venugopal; Youn, Hwan; Poulos, Thomas L; Champion, Paul M
2012-06-22
Carbon monoxide oxidation activator (CooA) proteins are heme-based CO-sensing transcription factors. Here we study the ultrafast dynamics of geminate CO rebinding in two CooA homologues, Rhodospirillum rubrum (RrCooA) and Carboxydothermus hydrogenoformans (ChCooA). The effects of DNA binding and the truncation of the DNA-binding domain on the CO geminate recombination kinetics were specifically investigated. The CO rebinding kinetics in these CooA complexes take place on ultrafast time scales but remain non-exponential over many decades in time. We show that this non-exponential kinetic response is due to a quenched enthalpic barrier distribution resulting from a distribution of heme geometries that is frozen or slowly evolving on the time scale of CO rebinding. We also show that, upon CO binding, the distal pocket of the heme in the CooA proteins relaxes to form a very efficient hydrophobic trap for CO. DNA binding further tightens the narrow distal pocket and slightly weakens the iron-proximal histidine bond. Comparison of the CO rebinding kinetics of RrCooA, truncated RrCooA, and DNA-bound RrCooA proteins reveals that the uncomplexed and inherently flexible DNA-binding domain adds additional structural heterogeneity to the heme doming coordinate. When CooA forms a complex with DNA, the flexibility of the DNA-binding domain decreases, and the distribution of the conformations available in the heme domain becomes restricted. The kinetic studies also offer insights into how the architecture of the heme environment can tune entropic barriers in order to control the geminate recombination of CO in heme proteins, whereas spin selection rules play a minor or non-existent role.
Weisemann, Jasmin; Stern, Daniel; Mahrhold, Stefan; Dorner, Brigitte G.; Rummel, Andreas
2016-01-01
Botulinum neurotoxins (BoNTs) exhibit extraordinary potency due to their exquisite neurospecificity, which is achieved by dual binding to complex polysialo-gangliosides and synaptic vesicle proteins. The luminal domain 4 (LD4) of the three synaptic vesicle glycoprotein 2 isoforms, SV2A‐C, identified as protein receptors for the most relevant serotype BoNT/A, binds within the 50 kDa cell binding domain HC of BoNT/A. Here, we deciphered the BoNT/A‐SV2 interactions in more detail. In pull down assays, the binding of HCA to SV2-LD4 isoforms decreases from SV2C >> SV2A > SV2B. A binding constant of 200 nM was determined for BoNT/A to rat SV2C-LD4 in GST pull down assay. A similar binding constant was determined by surface plasmon resonance for HCA to rat SV2C and to human SV2C, the latter being slightly lower due to the substitution L563F in LD4. At pH 5, as measured in acidic synaptic vesicles, the binding constant of HCA to hSV2C is increased more than 10-fold. Circular dichroism spectroscopy reveals that the quadrilateral helix of SV2C-LD4 already exists in solution prior to BoNT/A binding. Hence, the BoNT/A‐SV2C interaction is of different nature compared to BoNT/B‐Syt-II. In particular, the preexistence of the quadrilateral β-sheet helix of SV2 and its pH-dependent binding to BoNT/A via backbone–backbone interactions constitute major differences. Knowledge of the molecular details of BoNT/A‐SV2 interactions drives the development of high affinity peptides to counteract BoNT/A intoxications or to capture functional BoNT/A variants in innovative detection systems for botulism diagnostic. PMID:27196927
Couture, Jean-François; Pereira De Jésus-Tran, Karine; Roy, Anne-Marie; Cantin, Line; Côté, Pierre-Luc; Legrand, Pierre; Luu-The, Van; Labrie, Fernand; Breton, Rock
2005-01-01
The aldo-keto reductase (AKR) human type 3 3α-hydroxysteroid dehydrogenase (h3α–HSD3, AKR1C2) plays a crucial role in the regulation of the intracellular concentrations of testosterone and 5α-dihydrotestosterone (5α-DHT), two steroids directly linked to the etiology and the progression of many prostate diseases and cancer. This enzyme also binds many structurally different molecules such as 4-hydroxynonenal, polycyclic aromatic hydrocarbons, and indanone. To understand the mechanism underlying the plasticity of its substrate-binding site, we solved the binary complex structure of h3α–HSD3-NADP(H) at 1.9 Å resolution. During the refinement process, we found acetate and citrate molecules deeply engulfed in the steroid-binding cavity. Superimposition of this structure with the h3α–HSD3-NADP(H)-testosterone/acetate ternary complex structure reveals that one of themobile loops forming the binding cavity operates a slight contraction movement against the citrate molecule while the side chains of many residues undergo numerous conformational changes, probably to create an optimal binding site for the citrate. These structural changes, which altogether cause a reduction of the substrate-binding cavity volume (from 776 Å3 in the presence of testosterone/acetate to 704 Å3 in the acetate/citratecomplex), are reminiscent of the “induced-fit” mechanism previously proposed for the aldose reductase, another member of the AKR superfamily. We also found that the replacement of residues Arg301 and Arg304, localized near the steroid-binding cavity, significantly affects the 3α–HSD activity of this enzyme toward 5α-DHT and completely abolishes its 17β–HSD activity on 4-dione. All these results have thus been used to reevaluate the binding mode of this enzyme for androgens. PMID:15929998
Jin, Jun-Yan; Li, Zhao-Qun; Zhang, Ya-Nan; Liu, Nai-Yong; Dong, Shuang-Lin
2014-07-01
Pheromone binding proteins (PBPs) are thought to bind and transport hydrophobic sex pheromone molecules across the aqueous sensillar lymph to specific pheromone receptors on the dendritic membrane of olfactory neurons. A maximum of 3 PBP genes have been consistently identified in noctuid species, and each of them shares high identity with its counterparts in other species within the family. The functionality differences of the 3 proteins are poorly understood. In the present study, 3 PBP cDNAs (SinfPBP1, 2, 3) were identified from the pink rice borer, Sesamia inferens, for the first time. The quantitative real-time PCR indicated that the 3 PBPs displayed similar temporal but very different sex related expression profiles. Expression of SinfPBP1 and SinfPBP2 were highly and moderately male biased, respectively, while SinfPBP3 was slightly female biased, as SinfPBPs were expressed at very different levels (PBP1>PBP2≫PBP3) in male antennae, but at similar levels in female antennae. Furthermore, the 3 SinfPBPs displayed different ligand binding profiles in fluorescence competitive binding assays. SinfPBP1 exhibited high and similar binding affinities to all 3 sex pheromone components (Ki=0.72-1.60 μM), while SinfPBP2 showed selective binding to the alcohol and aldehyde components (Ki=0.78-1.71 μM), and SinfPBP3 showed no obvious binding to the 3 sex pheromone components. The results suggest that SinfPBP1 plays a major role in the reception of female sex pheromones in S. inferens, while SinfPBP3 plays a least role (if any) and SinfPBP2 functions as a recognizer of alcohol and aldehyde components. Copyright © 2014 Elsevier Ltd. All rights reserved.
[Bacteriophage λ: electrostatic properties of the genome and its elements].
Krutinina, G G; Krutinin, E A; Kamzolova, S G; Osypov, A A
2015-01-01
Bacteriophage λ is a classical model object in molecular biology, but little is still known on the physical properties of its DNA and regulatory elements. A study was made of the electrostatic properties of phage λ DNA and regulatory elements. A global electrostatic potential distribution along the phage genome was found to be nonuniform with main regulatory elements being located in a limited region with a high potential. The RNA polymerase binding frequency on the linearized phage chromosome directly correlates with its local potential. Strong promoters of the phage and its host Escherichia coli have distinct electrostatic upstream elements, which differ in nucleotide sequence. Attachment and recombination sites of phage λ and its host have a higher potential, which possibly facilitates their recognition by integrase. Phage λ and host Rho-independent terminators have a symmetrical M-shaped potential profile, which only slightly depends on the annotated terminator palindrome length, and occur in a region with a substantially higher potential, which may cause polymerase retention, facilitating the formation of a terminator hairpin in RNA. It was concluded that virtually all elements of phage λ genome have potential distribution specifics, which are related to their structural properties and may play a role in their biological function. The global potential distribution along the phage genome reflects the architecture of the regulation of its transcription and integration in the host genome.
Antiallergic effect of ZCR-2060: antihistaminic action.
Abe, T; Omata, T; Yoshida, K; Matsumura, T; Ikeda, Y; Segawa, Y; Matsuda, K; Nagai, H
1994-09-01
The antihistaminic effect of 2-[2-[4-(diphenylmethyl)-1-piperadinyl]ethoxy] benzoic acid maleate (ZCR-2060), a newly synthesized antiallergic agent, was investigated in both in vitro and in vivo studies. ZCR-2060 clearly antagonized histamine-induced contraction of isolated guinea pig ileum and trachea. In contrast, carbachol-, BaCl2- and 5-hydroxytryptamine-induced contractions of isolated guinea pig ileum were slightly inhibited by higher concentrations of ZCR-2060. 3H-Mepyramine specific binding to membranes from guinea pig lung and brain were markedly inhibited by ZCR-2060 in a concentration-dependent fashion. In the in vitro studies, the antihistaminic effect of ZCR-2060 was greater than those of cetirizine and terfenadine, but was less than that of ketotifen. In the in vivo studies, ZCR-2060 significantly inhibited the histamine-induced cutaneous reaction in rats, when administered orally 1 hr before the histamine injection. Moreover, ZCR-2060 has a long-lasting antihistaminic effect. In the in vivo studies, the antihistaminic effect of ZCR-2060 was found to be greater than that of cetirizine and terfenadine, and it was the same as that of ketotifen. Thiopental-induced sleep and spontaneous ambulatory activity in mice, however, were unaffected by ZCR-2060 at higher doses. These results indicate that ZCR-2060 has a potent, selective and long acting histamine H1-receptor antagonistic action without causing any unwanted CNS side effect.
Yang, Chunfa; Ma, Ruishuang; Jiang, Tao; Cao, Muhua; Zhao, Liangliang; Bi, Yayan; Kou, Junjie; Shi, Jialan; Zou, Xiaoming
2016-06-01
Hypercoagulability in gastric cancer is a common complication and a major contributor to poor prognosis. This study aimed to determine procoagulant activity of blood cells and microparticles (MPs) in gastric cancer patients. Phosphatidylserine-positive blood cells and MPs, and their procoagulant properties in particular, were assessed in 48 gastric cancer patients and 35 healthy controls. Phosphatidylserine-positive platelets, leukocytes, and MPs in patients with tumor-node-metastasis stage III/IV gastric cancer were significantly higher than those in stage I/II patients or healthy controls. Moreover, procoagulant activity of platelets, leukocytes, and MPs in stage III/IV patients was significantly increased compared to the controls, as indicated by shorter clotting time, higher intrinsic and extrinsic factor tenase, and prothrombinase complex activity. Interestingly, lactadherin, which competes with factors V and VIII to bind phosphatidylserine, dramatically prolonged clotting time of the cells and MPs by inhibiting factor tenase and prothrombinase complex activity. Although anti-tissue factor antibody significantly attenuated extrinsic tenase complex activity of leukocytes and MPs, it only slightly prolonged clotting times. Meanwhile, treatment with radical resection reduced phosphatidylserine-positive platelets, leukocytes, and MPs, and prolonged the clotting times of the remaining cells and MPs. Our results suggest that phosphatidylserine-positive platelets, leukocytes, and MPs contribute to hypercoagulability and represent a potential therapeutic target to prevent coagulation in patients with stage III/IV gastric cancer.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kendall, Amy; Bian, Wen; Maris, Alexander
We have used fiber diffraction, cryo-electron microscopy, and scanning transmission electron microscopy to confirm the symmetry of three potexviruses, potato virus X, papaya mosaic virus, and narcissus mosaic virus, and to determine their low-resolution structures. All three viruses have slightly less than nine subunits per turn of the viral helix. Our data strongly support the view that all potexviruses have approximately the same symmetry. The structures are dominated by a large domain at high radius in the virion, with a smaller domain, which includes the putative RNA-binding site, extending to low radius.
2006-05-01
Mutations in the human androgen receptor gene as a learning tool for molecular endocrinology’ III. Poster presentations at international meetings...nonconsensus half-site, the cognate half-complex buries slightly more surface area from solvent (1,230 Å2) than the noncognate one (960 Å2). AR Mutations ...energetic penalty in- Fig. 4. (A) The AR DBD dimer interface. The molecular surfaces of the AR subunits are shown in red and blue. Dashed black lines
Densitometric evaluation of Soludent and GBX developers.
Patel, J R
1985-01-01
A quick-developing solution (Soludent) and a new developer (Kodak GBX) were compared with a standard x-ray liquid developer. Of the three solutions evaluated, Kodak GBX solution produced slightly greater useful densities in the radiograph at all temperatures evaluated. The rapid-developing solution produced acceptable radiographs in 80% less time, with only slightly higher film fog.
Midlevel Administrators' Pay Increases Slightly but Doesn't Match Inflation
ERIC Educational Resources Information Center
Fuller, Andrea
2012-01-01
Salaries for midlevel administrators rose by a median of 2 percent this year over last year, matching the median pay increase for senior administrators and coming in slightly higher than the 1.9-percent median increase for faculty members, says an annual report released by the College and University Professional Association for Human Resources.…
Sickle Cell Hemoglobin with Mutation at αHis-50 Has Improved Solubility.
Tam, Ming F; Tam, Tsuey Chyi S; Simplaceanu, Virgil; Ho, Nancy T; Zou, Ming; Ho, Chien
2015-08-28
The unliganded tetrameric Hb S has axial and lateral contacts with neighbors and can polymerize in solution. Novel recombinants of Hb S with single amino acid substitutions at the putative axial (recombinant Hb (rHb) (βE6V/αH20R) and rHb (βE6V/αH20Q)) or lateral (rHb (βE6V/αH50Q)) or double amino acid substitutions at both the putative axial and lateral (rHb (βE6V/αH20R/αH50Q) and rHb (βE6V/αH20Q/αH50Q)) contact sites were expressed in Escherichia coli and purified for structural and functional studies. The (1)H NMR spectra of the CO and deoxy forms of these mutants indicate that substitutions at either αHis-20 or αHis-50 do not change the subunit interfaces or the heme pockets of the proteins. The double mutants show only slight structural alteration in the β-heme pockets. All mutants have similar cooperativity (n50), alkaline Bohr effect, and autoxidation rate as Hb S. The oxygen binding affinity (P50) of the single mutants is comparable with that of Hb S. The double mutants bind oxygen with slightly higher affinity than Hb S under the acidic conditions. In high salt, rHb (βE6V/αH20R) is the only mutant that has a shorter delay time of polymerization and forms polymers more readily than Hb S with a dextran-Csat value of 1.86 ± 0.20 g/dl. Hb S, rHb (βE6V/αH20Q), rHb (βE6V/αH50Q), rHb (βE6V/αH20R/αH50Q), and rHb (βE6V/αH20Q/αH50Q) have dextran-Csat values of 2.95 ± 0.10, 3.04 ± 0.17, 11.78 ± 0.59, 7.11 ± 0.66, and 10.89 ± 0.83 g/dl, respectively. rHb (βE6V/αH20Q/αH50Q) is even more stable than Hb S under elevated temperature (60 °C). © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
La Regina, Giuseppe; Silvestri, Romano; Artico, Marino; Lavecchia, Antonio; Novellino, Ettore; Befani, Olivia; Turini, Paola; Agostinelli, Enzo
2007-03-08
A series of new pyrrole derivatives have been synthesized and evaluated for their monoamine oxidase (MAO) A and B inhibitory activity and selectivity. N-Methyl,N-(benzyl),N-(pyrrol-2-ylmethyl)amine (7) and N-(2-benzyl),N-(1-methylpyrrol-2-ylmethyl)amine (18) were the most selective MAO-B (7, SI = 0.0057) and MAO-A (18, SI = 12500) inhibitors, respectively. Docking and molecular dynamics simulations gave structural insights into the MAO-A and MAO-B selectivity. Compound 18 forms an H-bond with Gln215 through its protonated amino group into the MAO-A binding site. This H-bond is absent in the 7/MAO-A complex. In contrast, compound 7 places its phenyl ring into an aromatic cage of the MAO-B binding pocket, where it forms charge-transfer interactions. The slightly different binding pose of 18 into the MAO-B active site seems to be forced by a bulkier Tyr residue, which replaces a smaller Ile residue present in MAO-A.
Aptamer Recognition of Multiplexed Small-Molecule-Functionalized Substrates.
Nakatsuka, Nako; Cao, Huan H; Deshayes, Stephanie; Melkonian, Arin Lucy; Kasko, Andrea M; Weiss, Paul S; Andrews, Anne M
2018-05-31
Aptamers are chemically synthesized oligonucleotides or peptides with molecular recognition capabilities. We investigated recognition of substrate-tethered small-molecule targets, using neurotransmitters as examples, and fluorescently labeled DNA aptamers. Substrate regions patterned via microfluidic channels with dopamine or L-tryptophan were selectively recognized by previously identified dopamine or L-tryptophan aptamers, respectively. The on-substrate dissociation constant determined for the dopamine aptamer was comparable to, though slightly greater than the previously determined solution dissociation constant. Using pre-functionalized neurotransmitter-conjugated oligo(ethylene glycol) alkanethiols and microfluidics patterning, we produced multiplexed substrates to capture and to sort aptamers. Substrates patterned with L-DOPA, L-DOPS, and L-5-HTP enabled comparison of the selectivity of the dopamine aptamer for different targets via simultaneous determination of in situ binding constants. Thus, beyond our previous demonstrations of recognition by protein binding partners (i.e., antibodies and G-protein-coupled receptors), strategically optimized small-molecule-functionalized substrates show selective recognition of nucleic acid binding partners. These substrates are useful for side-by-side target comparisons, and future identification and characterization of novel aptamers targeting neurotransmitters or other important small-molecules.
Molecular cloning and functional expression of the guinea pig alpha(1a)-adrenoceptor.
González-Espinosa, C; Romero-Avila, M T; Mora-Rodríguez, D M; González-Espinosa, D; García-Sáinz, J A
2001-08-31
In the present paper, the cloning and expression of the guinea pig alpha(1A)-adrenoceptor is presented. The nucleotide sequence had an open reading frame of 1401 bp that encoded a 466 amino-acid protein with an estimated molecular mass of approximately 51.5 kDa. When the clone was expressed in Cos-1 cells, specific high-affinity binding of [(3)H]prazosin and [(3)H]tamsulosin was observed. Chloroethylclonidine treatment of membranes slightly decreased the total binding with both radioligands. Binding competition experiments using [(3)H]tamsulosin showed the following potency order: (a) for agonists: oxymetazoline >epinephrine>norepinephrine>methoxamine, and (b) for antagonists: prazosin> or 5-methyl-urapidil=benoxathian>phentolamine>BMY 7378 (8-[2-[4-(2-methoxyphenyl)-1-piperazinyl]ethyl]-8-azaspiro[4,5]decane-7,9-dione). Photoaffinity labeling using [(125)I-aryl]azido-prazosin revealed a major broad band with a molecular mass between 70 and 80 kDa. The receptor was functional, as evidenced by an epinephrine-increased production of [(3)H]inositol phosphates that was blocked by prazosin.
NASA Astrophysics Data System (ADS)
Song, Wei; Yu, Zehua; Hu, Xinxin; Liu, Rutao
2015-02-01
Studies on the effects of environmental pollutants to protein in vitro has become a global attention. Hydrogen peroxide (H2O2) is used as an effective food preservative and bleacher in industrial production. The toxicity of H2O2 to trypsin was investigated by multiple spectroscopic techniques and the molecular docking method at the molecular level. The intrinsic fluorescence of trypsin was proved to be quenched in a static process based on the results of fluorescence lifetime experiment. Hydrogen bonds interaction and van der Waals forces were the main force to generate the trypsin-H2O2 complex on account of the negative ΔH0 and ΔS0. The binding of H2O2 changed the conformational structures and internal microenvironment of trypsin illustrated by UV-vis absorption, fluorescence, synchronous fluorescence, three-dimensional (3D) fluorescence and circular dichroism (CD) results. However, the binding site was far away from the active site of trypsin and the trypsin activity was only slightly affected by H2O2, which was further explained by molecular docking investigations.
NASA Astrophysics Data System (ADS)
Mu, Hongtao; Xu, Zhenlin; Liu, Yingju; Sun, Yuanming; Wang, Baoling; Sun, Xiulan; Wang, Zhanhui; Eremin, Sergei; Zherdev, Anatoly V.; Dzantiev, Boris B.; Lei, Hongtao
2018-04-01
Although stereoselective antibody has immense potential in chiral compounds detection and separation, the interaction traits between stereoselective antibody and the corresponding antigenic enantiomers are not yet fully exploited. In this study, the stereospecific interactions between ofloxacin isomers and corresponding monoclonal antibodies (McAb-WR1 and McAb-MS1) were investigated using time-resolved fluorescence, steady-state fluorescence, and circular dichroism (CD) spectroscopic methods. The chiral recognition discrepancies of antibodies with ofloxacin isomers were reflected through binding constant, number of binding sites, driving forces and conformational changes. The major interacting forces of McAb-WR1 and McAb-MS1 chiral interaction systems were hydrophobic force and van der Waals forces joined up with hydrogen bonds, respectively. Synchronous fluorescence spectra and CD spectra results showed that the disturbing of tyrosine and tryptophan micro-environments were so slightly that no obvious secondary structure changes were found during the chiral hapten binding. Clarification of stereospecific interaction of antibody will facilitate the application of immunoassay to analyze chiral contaminants in food and other areas.
Kikkawa, Yamato; Ogawa, Takaho; Sudo, Ryo; Yamada, Yuji; Katagiri, Fumihiko; Hozumi, Kentaro; Nomizu, Motoyoshi; Miner, Jeffrey H
2013-10-25
Cell-matrix interactions are critical for tumor cell migration. Lutheran (Lu), also known as basal cell adhesion molecule (B-CAM), competes with integrins for binding to laminin α5, a subunit of LM-511, a major component of basement membranes. Here we show that the preferential binding of Lu/B-CAM to laminin α5 promotes tumor cell migration. The attachment of Lu/B-CAM transfectants to LM-511 was slightly weaker than that of control cells, and this was because Lu/B-CAM disturbed integrin binding to laminin α5. Lu/B-CAM induced a spindle cell shape with pseudopods and promoted cell migration on LM-511. In addition, blocking with an anti-Lu/B-CAM antibody led to a flat cell shape and inhibited migration on LM-511, similar to the effects of an activating integrin β1 antibody. We conclude that tumor cell migration on LM-511 requires that Lu/B-CAM competitively modulates cell attachment through integrins. We suggest that this competitive interaction is involved in a balance between static and migratory cell behaviors.
Brown, Jessica A.; Zhang, Likui; Sherrer, Shanen M.; Taylor, John-Stephen; Burgers, Peter M. J.; Suo, Zucai
2010-01-01
Understanding polymerase fidelity is an important objective towards ascertaining the overall stability of an organism's genome. Saccharomyces cerevisiae DNA polymerase η (yPolη), a Y-family DNA polymerase, is known to efficiently bypass DNA lesions (e.g., pyrimidine dimers) in vivo. Using pre-steady-state kinetic methods, we examined both full-length and a truncated version of yPolη which contains only the polymerase domain. In the absence of yPolη's C-terminal residues 514–632, the DNA binding affinity was weakened by 2-fold and the base substitution fidelity dropped by 3-fold. Thus, the C-terminus of yPolη may interact with DNA and slightly alter the conformation of the polymerase domain during catalysis. In general, yPolη discriminated between a correct and incorrect nucleotide more during the incorporation step (50-fold on average) than the ground-state binding step (18-fold on average). Blunt-end additions of dATP or pyrene nucleotide 5′-triphosphate revealed the importance of base stacking during the binding of incorrect incoming nucleotides. PMID:20798853
NASA Astrophysics Data System (ADS)
Ptak, Tomasz; Młynarz, Piotr; Dobosz, Agnieszka; Rydzewska, Agata; Prokopowicz, Monika
2013-05-01
Boronic acids are a class of intensively explored compounds, which according to their specific properties have been intensively explored in last decades. Among them phenylboronic acids and their derivatives are most frequently examined as receptors for diverse carbohydrates. In turn, there is a large gap in basic research concerning complexation of catecholamines by these compounds. Therefore, we decided to undertake studies on interaction of chosen catecholamines, namely: noradrenaline (norephinephrine), dopamine, L-DOPA, DOPA-P (phosphonic analog of L-DOPA) and catechol, with simple phenyl boronic acid PBA by means of potentiometry and NMR spectroscopy. For comparison, the binding properties of recently synthesized phenylboronic receptor 1 bearing aminophosphonate function in meta-position were investigated and showed promising ability to bind catecholamines. The protonation and stability constants of PBA and receptor 1 complexes were examined by potentiometry. The obtained results demonstrated that PBA binds the catecholamines with the following affinity order: noradrenaline ⩾ dopamine ≈ L-DOPA > catechol > DOPA-P, while its modified analog 1 reveals slightly different preferences: dopamine > noradrenaline > catechol > L-DOPA > DOPA-P.
Zn2+ selectively stabilizes FdU-substituted DNA through a unique major groove binding motif
Ghosh, Supratim; Salsbury, Freddie R.; Horita, David A.; Gmeiner, William H.
2011-01-01
We report, based on semi-empirical calculations, that Zn2+ binds duplex DNA containing consecutive FdU–dA base pairs in the major groove with distorted trigonal bipyramidal geometry. In this previously uncharacterized binding motif, O4 and F5 on consecutive FdU are axial ligands while three water molecules complete the coordination sphere. NMR spectroscopy confirmed Zn2+ complexation occurred with maintenance of base pairing while a slight hypsochromic shift in circular dichroism (CD) spectra indicated moderate structural distortion relative to B-form DNA. Zn2+ complexation inhibited ethidium bromide (EtBr) intercalation and stabilized FdU-substituted duplex DNA (ΔTm > 15°C). Mg2+ neither inhibited EtBr complexation nor had as strong of a stabilizing effect. DNA sequences that did not contain consecutive FdU were not stabilized by Zn2+. A lipofectamine preparation of the Zn2+–DNA complex displayed enhanced cytotoxicity toward prostate cancer cells relative to the individual components prepared as lipofectamine complexes indicating the potential utility of Zn2+–DNA complexes for cancer treatment. PMID:21296761
Tang, Ning; Skibsted, Leif H
2017-10-04
Aqueous solubility of zinc phytate (K sp = (2.6 ± 0.2) × 10 -47 mol 7 /L 7 ), essential for zinc bioavailability from plant foods, was found to decrease with increasing temperature corresponding to ΔH dis of -301 ± 22 kJ/mol and ΔS dis of -1901 ± 72 J/(mol K). Binding of zinc to phytate was found to be exothermic for the stronger binding site and endothermic for the weaker binding site. The solubility of the slightly soluble zinc citrate and insoluble zinc phytate was found to be considerably enhanced by the food components with oxygen donor, nitrogen donor, and sulfur donor ligands. The driving force for the enhanced solubility is mainly due to the complex formation between zinc and the investigated food components rather than ligand exchange and ternary complex formation as revealed by quantum mechanical calculations and isothermal titration calorimetry. Histidine and citrate are promising ligands for improving zinc absorption from phytate-rich foods.
Appleby, Paul N.; Albanes, Demetrius; Black, Amanda; Chan, June M.; Chen, Chu; Cirillo, Piera M.; Cohn, Barbara A.; Cook, Michael B.; Donovan, Jenny L.; Ferrucci, Luigi; Garland, Cedric F.; Giles, Graham G.; Goodman, Phyllis J.; Habel, Laurel A.; Haiman, Christopher A.; Holly, Jeff M. P.; Hoover, Robert N.; Kaaks, Rudolf; Knekt, Paul; Kolonel, Laurence N.; Kubo, Tatsuhiko; Le Marchand, Loïc; Luostarinen, Tapio; MacInnis, Robert J.; Mäenpää, Hanna O.; Männistö, Satu; Metter, E. Jeffrey; Milne, Roger L.; Nomura, Abraham M. Y.; Oliver, Steven E.; Parsons, J. Kellogg; Peeters, Petra H.; Platz, Elizabeth A.; Riboli, Elio; Ricceri, Fulvio; Rinaldi, Sabina; Rissanen, Harri; Sawada, Norie; Schaefer, Catherine A.; Schenk, Jeannette M.; Stanczyk, Frank Z.; Stampfer, Meir; Stattin, Pär; Stenman, Ulf-Håkan; Tjønneland, Anne; Trichopoulou, Antonia; Thompson, Ian M.; Tsugane, Shoichiro; Vatten, Lars; Whittemore, Alice S.; Ziegler, Regina G.
2017-01-01
Introduction Sex hormones have been implicated in the etiology of a number of diseases. To better understand disease etiology and the mechanisms of disease-risk factor associations, this analysis aimed to investigate the associations of anthropometric, sociodemographic and behavioural factors with a range of circulating sex hormones and sex hormone-binding globulin. Methods Statistical analyses of individual participant data from 12,330 male controls aged 25–85 years from 25 studies involved in the Endogenous Hormones Nutritional Biomarkers and Prostate Cancer Collaborative Group. Analysis of variance was used to estimate geometric means adjusted for study and relevant covariates. Results Older age was associated with higher concentrations of sex hormone-binding globulin and dihydrotestosterone and lower concentrations of dehydroepiandrosterone sulfate, free testosterone, androstenedione, androstanediol glucuronide and free estradiol. Higher body mass index was associated with higher concentrations of free estradiol, androstanediol glucuronide, estradiol and estrone and lower concentrations of dihydrotestosterone, testosterone, sex hormone-binding globulin, free testosterone, androstenedione and dehydroepiandrosterone sulfate. Taller height was associated with lower concentrations of androstenedione, testosterone, free testosterone and sex hormone-binding globulin and higher concentrations of androstanediol glucuronide. Current smoking was associated with higher concentrations of androstenedione, sex hormone-binding globulin and testosterone. Alcohol consumption was associated with higher concentrations of dehydroepiandrosterone sulfate, androstenedione and androstanediol glucuronide. East Asians had lower concentrations of androstanediol glucuronide and African Americans had higher concentrations of estrogens. Education and marital status were modestly associated with a small number of hormones. Conclusion Circulating sex hormones in men are strongly associated with age and body mass index, and to a lesser extent with smoking status and alcohol consumption. PMID:29281666
Watts, Eleanor L; Appleby, Paul N; Albanes, Demetrius; Black, Amanda; Chan, June M; Chen, Chu; Cirillo, Piera M; Cohn, Barbara A; Cook, Michael B; Donovan, Jenny L; Ferrucci, Luigi; Garland, Cedric F; Giles, Graham G; Goodman, Phyllis J; Habel, Laurel A; Haiman, Christopher A; Holly, Jeff M P; Hoover, Robert N; Kaaks, Rudolf; Knekt, Paul; Kolonel, Laurence N; Kubo, Tatsuhiko; Le Marchand, Loïc; Luostarinen, Tapio; MacInnis, Robert J; Mäenpää, Hanna O; Männistö, Satu; Metter, E Jeffrey; Milne, Roger L; Nomura, Abraham M Y; Oliver, Steven E; Parsons, J Kellogg; Peeters, Petra H; Platz, Elizabeth A; Riboli, Elio; Ricceri, Fulvio; Rinaldi, Sabina; Rissanen, Harri; Sawada, Norie; Schaefer, Catherine A; Schenk, Jeannette M; Stanczyk, Frank Z; Stampfer, Meir; Stattin, Pär; Stenman, Ulf-Håkan; Tjønneland, Anne; Trichopoulou, Antonia; Thompson, Ian M; Tsugane, Shoichiro; Vatten, Lars; Whittemore, Alice S; Ziegler, Regina G; Allen, Naomi E; Key, Timothy J; Travis, Ruth C
2017-01-01
Sex hormones have been implicated in the etiology of a number of diseases. To better understand disease etiology and the mechanisms of disease-risk factor associations, this analysis aimed to investigate the associations of anthropometric, sociodemographic and behavioural factors with a range of circulating sex hormones and sex hormone-binding globulin. Statistical analyses of individual participant data from 12,330 male controls aged 25-85 years from 25 studies involved in the Endogenous Hormones Nutritional Biomarkers and Prostate Cancer Collaborative Group. Analysis of variance was used to estimate geometric means adjusted for study and relevant covariates. Older age was associated with higher concentrations of sex hormone-binding globulin and dihydrotestosterone and lower concentrations of dehydroepiandrosterone sulfate, free testosterone, androstenedione, androstanediol glucuronide and free estradiol. Higher body mass index was associated with higher concentrations of free estradiol, androstanediol glucuronide, estradiol and estrone and lower concentrations of dihydrotestosterone, testosterone, sex hormone-binding globulin, free testosterone, androstenedione and dehydroepiandrosterone sulfate. Taller height was associated with lower concentrations of androstenedione, testosterone, free testosterone and sex hormone-binding globulin and higher concentrations of androstanediol glucuronide. Current smoking was associated with higher concentrations of androstenedione, sex hormone-binding globulin and testosterone. Alcohol consumption was associated with higher concentrations of dehydroepiandrosterone sulfate, androstenedione and androstanediol glucuronide. East Asians had lower concentrations of androstanediol glucuronide and African Americans had higher concentrations of estrogens. Education and marital status were modestly associated with a small number of hormones. Circulating sex hormones in men are strongly associated with age and body mass index, and to a lesser extent with smoking status and alcohol consumption.
NASA Astrophysics Data System (ADS)
Zhang, Yuanzhao; Jimenez-Cruz, Camilo A.; Wang, Jian; Zhou, Bo; Yang, Zaixing; Zhou, Ruhong
2014-11-01
Here, we report computational studies of the SH3 protein domain interacting with various single-walled carbon nanotubes (SWCNT) either bare or functionalized by mimicking the proline-rich motif (PRM) ligand (PPPVPPRR) and compare it to the SH3-PRM complex binding. With prolines or a single arginine attached, the SWCNT gained slightly on specificity when compared with the bare control, whereas with multi-arginine systems the specificity dropped dramatically to our surprise. Although the electrostatic interaction provided by arginines is crucial in the recognition between PRM and SH3 domain, our results suggest that attaching multiple arginines to the SWCNT has a detrimental effect on the binding affinity. Detailed analysis of the MD trajectories found two main factors that modulate the specificity of the binding: the existence of competing acidic patches at the surface of SH3 that leads to ``trapping and clamping'' by the arginines, and the rigidity of the SWCNT introducing entropic penalties in the proper binding. Further investigation revealed that the same ``clamping'' phenomenon exits in the PRM-SH3 system, which has not been reported in previous literature. The competing effects between nanoparticle and its functionalization components revealed by our model system should be of value to current and future nanomedicine designs.
Exploration of multiple Sortase A protein conformations in virtual screening
NASA Astrophysics Data System (ADS)
Gao, Chunxia; Uzelac, Ivana; Gottfries, Johan; Eriksson, Leif A.
2016-02-01
Methicillin resistant Staphylococcus aureus (MRSA) has become a major health concern which has brought about an urgent need for new therapeutic agents. As the S. aureus Sortase A (SrtA) enzyme contributes to the adherence of the bacteria to the host cells, inhibition thereof by small molecules could be employed as potential antivirulence agents, also towards resistant strains. Albeit several virtual docking SrtA campaigns have been reported, no strongly inhibitatory non-covalent binders have as yet emerged therefrom. In order to better understand the binding modes of small molecules, and the effect of different receptor structures employed in the screening, we herein report on an exploratory study employing 10 known binders and 500 decoys on 100 SrtA structures generated from regular or steered molecular dynamics simulations on four different SrtA crystal/NMR structures. The results suggest a correlation between the protein structural flexibility and the virtual screening performance, and confirm the noted immobilization of the β6/β7 loop upon substrate binding. The NMR structures reported appear to perform slightly better than the Xray-crystal structures, but the binding modes fluctuate tremendously, and it might be suspected that the catalytic site is not necessarily the preferred site of binding for some of the reported active compounds.
Exploration of multiple Sortase A protein conformations in virtual screening
Gao, Chunxia; Uzelac, Ivana; Gottfries, Johan; Eriksson, Leif A.
2016-01-01
Methicillin resistant Staphylococcus aureus (MRSA) has become a major health concern which has brought about an urgent need for new therapeutic agents. As the S. aureus Sortase A (SrtA) enzyme contributes to the adherence of the bacteria to the host cells, inhibition thereof by small molecules could be employed as potential antivirulence agents, also towards resistant strains. Albeit several virtual docking SrtA campaigns have been reported, no strongly inhibitatory non-covalent binders have as yet emerged therefrom. In order to better understand the binding modes of small molecules, and the effect of different receptor structures employed in the screening, we herein report on an exploratory study employing 10 known binders and 500 decoys on 100 SrtA structures generated from regular or steered molecular dynamics simulations on four different SrtA crystal/NMR structures. The results suggest a correlation between the protein structural flexibility and the virtual screening performance, and confirm the noted immobilization of the β6/β7 loop upon substrate binding. The NMR structures reported appear to perform slightly better than the Xray-crystal structures, but the binding modes fluctuate tremendously, and it might be suspected that the catalytic site is not necessarily the preferred site of binding for some of the reported active compounds. PMID:26846342
Zhang, Yuanzhao; Jimenez-Cruz, Camilo A.; Wang, Jian; Zhou, Bo; Yang, Zaixing; Zhou, Ruhong
2014-01-01
Here, we report computational studies of the SH3 protein domain interacting with various single-walled carbon nanotubes (SWCNT) either bare or functionalized by mimicking the proline-rich motif (PRM) ligand (PPPVPPRR) and compare it to the SH3-PRM complex binding. With prolines or a single arginine attached, the SWCNT gained slightly on specificity when compared with the bare control, whereas with multi-arginine systems the specificity dropped dramatically to our surprise. Although the electrostatic interaction provided by arginines is crucial in the recognition between PRM and SH3 domain, our results suggest that attaching multiple arginines to the SWCNT has a detrimental effect on the binding affinity. Detailed analysis of the MD trajectories found two main factors that modulate the specificity of the binding: the existence of competing acidic patches at the surface of SH3 that leads to “trapping and clamping” by the arginines, and the rigidity of the SWCNT introducing entropic penalties in the proper binding. Further investigation revealed that the same “clamping” phenomenon exits in the PRM-SH3 system, which has not been reported in previous literature. The competing effects between nanoparticle and its functionalization components revealed by our model system should be of value to current and future nanomedicine designs. PMID:25427563
Cofilin and DNase I affect the conformation of the small domain of actin.
Dedova, Irina V; Dedov, Vadim N; Nosworthy, Neil J; Hambly, Brett D; dos Remedios, Cris G
2002-01-01
Cofilin binding induces an allosteric conformational change in subdomain 2 of actin, reducing the distance between probes attached to Gln-41 (subdomain 2) and Cys-374 (subdomain 1) from 34.4 to 31.4 A (pH 6.8) as demonstrated by fluorescence energy transfer spectroscopy. This effect was slightly less pronounced at pH 8.0. In contrast, binding of DNase I increased this distance (35.5 A), a change that was not pH-sensitive. Although DNase I-induced changes in the distance along the small domain of actin were modest, a significantly larger change (38.2 A) was observed when the ternary complex of cofilin-actin-DNase I was formed. Saturation binding of cofilin prevents pyrene fluorescence enhancement normally associated with actin polymerization. Changes in the emission and excitation spectra of pyrene-F actin in the presence of cofilin indicate that subdomain 1 (near Cys-374) assumes a G-like conformation. Thus, the enhancement of pyrene fluorescence does not correspond to the extent of actin polymerization in the presence of cofilin. The structural changes in G and F actin induced by these actin-binding proteins may be important for understanding the mechanism regulating the G-actin pool in cells. PMID:12023237
Prchal, Jan; Srb, Pavel; Hunter, Eric; Ruml, Tomáš; Hrabal, Richard
2012-10-26
We determined the solution structure of myristoylated Mason-Pfizer monkey virus matrix protein by NMR spectroscopy. The myristoyl group is buried inside the protein and causes a slight reorientation of the helices. This reorientation leads to the creation of a binding site for phosphatidylinositols. The interaction between the matrix protein and phosphatidylinositols carrying C(8) fatty acid chains was monitored by observation of concentration-dependent chemical shift changes of the affected amino acid residues, a saturation transfer difference experiment and changes in (31)P chemical shifts. No differences in the binding mode or affinity were observed with differently phosphorylated phosphatidylinositols. The structure of the matrix protein-phosphatidylinositol-(4,5)-bisphosphate [PI(4,5)P(2)] complex was then calculated with HADDOCK software based on the intermolecular nuclear Overhauser enhancement contacts between the ligand and the matrix protein obtained from a (13)C-filtered/(13)C-edited nuclear Overhauser enhancement spectroscopy experiment. PI(4,5)P(2) binding was not strong enough for triggering of the myristoyl-switch. The structural changes of the myristoylated matrix protein were also found to result in a drop in the oligomerization capacity of the protein. Copyright © 2012. Published by Elsevier Ltd.
Xu, Ximing; Li de la Sierra-Gallay, Inés; Kubiak, Xavier; Duval, Romain; Chaffotte, Alain F; Dupret, Jean Marie; Haouz, Ahmed; Rodrigues-Lima, Fernando
2015-02-01
Arylamine N-acetyltransferases (NATs) are xenobiotic metabolizing enzymes that catalyze the acetyl-CoA-dependent acetylation of arylamines. To better understand the mode of binding of the cofactor by this family of enzymes, the structure of Mesorhizobium loti NAT1 [(RHILO)NAT1] was determined in complex with CoA. The F42W mutant of (RHILO)NAT1 was used as it is well expressed in Escherichia coli and displays enzymatic properties similar to those of the wild type. The apo and holo structures of (RHILO)NAT1 F42W were solved at 1.8 and 2 Å resolution, respectively. As observed in the Mycobacterium marinum NAT1-CoA complex, in (RHILO)NAT1 CoA binding induces slight structural rearrangements that are mostly confined to certain residues of its `P-loop'. Importantly, it was found that the mode of binding of CoA is highly similar to that of M. marinum NAT1 but different from the modes reported for Bacillus anthracis NAT1 and Homo sapiens NAT2. Therefore, in contrast to previous data, this study shows that different orthologous NATs can bind their cofactors in a similar way, suggesting that the mode of binding CoA in this family of enzymes is less diverse than previously thought. Moreover, it supports the notion that the presence of the `mammalian/eukaryotic insertion loop' in certain NAT enzymes impacts the mode of binding CoA by imposing structural constraints.
Wong, Ka-Hing; Cheung, Peter C K
2005-11-30
The in vitro mineral binding capacity of three novel dietary fibers (DFs) prepared from mushroom sclerotia, namely, Pleurotus tuber-regium, Polyporous rhinocerus, and Wolfiporia cocos, to Ca, Mg, Cu, Fe, and Zn under sequential simulated physiological conditions of the human stomach, small intestine, and colon was investigated and compared. Apart from releasing most of their endogenous Ca (ranged from 96.9 to 97.9% removal) and Mg (ranged from 95.9 to 96.7% removal), simulated physiological conditions of the stomach also attenuated the possible adverse binding effect of the three sclerotial DFs to the exogenous minerals by lowering their cation-exchange capacity (ranged from 20.8 to 32.3%) and removing a substantial amount of their potential mineral chelators including protein (ranged from 16.2 to 37.8%) and phytate (ranged from 58.5 to 64.2%). The in vitro mineral binding capacity of the three sclerotial DF under simulated physiological conditions of small intestine was found to be low, especially for Ca (ranged from 4.79 to 5.91% binding) and Mg (ranged from 3.16 to 4.18% binding), and was highly correlated (r > 0.97) with their residual protein contents. Under simulated physiological conditions of the colon with slightly acidic pH (5.80), only bound Ca was readily released (ranged from 34.2 to 72.3% releasing) from the three sclerotial DFs, and their potential enhancing effect on passive Ca absorption in the human large intestine was also discussed.
Shi, Jie-Hua; Pan, Dong-Qi; Jiang, Min; Liu, Ting-Ting; Wang, Qi
2016-11-01
The binding interaction between a typical angiotensin-converting enzyme inhibitor (ACEI), ramipril, and a transport protein, bovine serum albumin (BSA), was studied in vitro using UV-vis absorption spectroscopy, steady-state fluorescence spectroscopic titration, synchronous fluorescence spectroscopy, three dimensional fluorescence spectroscopy, circular dichroism and molecular docking under the imitated physiological conditions (pH=7.4). The experimental results suggested that the intrinsic fluorescence of BSA was quenched by ramipril thought a static quenching mechanism, indicating that the stable ramipril-BSA complex was formed by the intermolecular interaction. The number of binding sites (n) and binding constant of ramipril-BSA complex were about 1 and 3.50×10 4 M -1 at 298K, respectively, suggesting that there was stronger binding interaction of ramipril with BSA. The thermodynamic parameters together with molecular docking study revealed that both van der Waal's forces and hydrogen bonding interaction dominated the formation of the ramipril-BSA complex and the binding interaction of BSA with ramipril is enthalpy-driven processes due to |ΔH°|>|TΔS°| and ΔG°<0. The spatial distance between ramipril and BSA was calculated to be 3.56nm based on Förster's non-radiative energy transfer theory. The results of the competitive displacement experiments and molecular docking confirmed that ramipril inserted into the subdomain IIA (site I) of BSA, resulting in a slight change in the conformation of BSA but BSA still retained its secondary structure α-helicity. Copyright © 2016 Elsevier B.V. All rights reserved.
Shi, Jie-Hua; Wang, Qi; Pan, Dong-Qi; Liu, Ting-Ting; Jiang, Min
2017-05-01
The binding interactions of simvastatin (SIM), pravastatin (PRA), fluvastatin (FLU), and pitavastatin (PIT) with bovine serum albumin (BSA) were investigated for determining the affinity of four statins with BSA through multiple spectroscopic and molecular docking methods. The experimental results showed that SIM, PRA, FLU, and PIT statins quenched the intrinsic fluorescence of BSA through a static quenching process and the stable stains-BSA complexes with the binding constants in the order of 10 4 M -1 at 298 K were formed through intermolecular nonbond interaction. The values of ΔH 0 , ΔS 0 and ΔG 0 in the binding process of SIM, PRA, FLU, and PIT with BSA were negative at the studied temperature range, suggesting that the binding process of four statins and BSA was spontaneous and the main interaction forces were van der Waals force and hydrogen-bonding interactions. Moreover, the binding of four statins with BSA was enthalpy-driven process due to |ΔH°|>|TΔS°| under the studied temperature range. From the results of site marker competitive experiments and molecular docking, subdomain IIIA (site II) was the primary binding site for SIM, PRA, FLU, and PIT on BSA. The results of UV-vis absorption, synchronous fluorescence, 3D fluorescence and FT-IR spectra proved that the slight change in the conformation of BSA, while the significant changes in the conformation of SIM, PRA, FLU, and PIT drug in statin-BSA complexes, indicating that the flexibility of statin molecules plays an important role in increasing the stability of statin-BSA complexes.
Baldus, S E; Thiele, J; Park, Y O; Hanisch, F G; Bara, J; Fischer, R
1996-08-01
Using immunochemical and immunohistochemical methods, the binding site of Anguilla anguilla agglutinin (AAA) was characterized and compared with the related fucose-specific lectin from Ulex europaeus (UEA-I). In solid-phase enzyme-linked immunoassays, the two lectins recognized Fuc alpha 1-2Gal beta-HSA. AAA additionally cross-reacted with neoglycolipids bearing lacto-N-fucopentaose (LNFP) I [H type 1] and II [Le(a)] and lactodifucotetraose (LDFT) as glycan moieties. UEA-I, on the other hand, bound to a LDFT-derived neoglycolipid but not to the other neoglycolipids tested. Binding of AAA to gastric mucin was competitively neutralized by Le(a)-specific monoclonal antibodies. UEA-I binding, on the other hand, was reduced after co-incubation with H type 2- and Le(y)-specific monoclonal antibodies. According to our results, AAA reacts with fucosylated type 1 chain antigens, whereas UEA-I binds only to the alpha 1-2-fucosylated LDFT-derived neoglycolipid. In immunohistochemical studies, the reactivity of AAA and UEA-I in normal pyloric mucosa from individuals with known Lewis and secretor status was analysed. AAA showed a broad reaction in the superficial pyloric mucosa from secretors and non-secretors, but AAA reactivity was more pronounced in Le(a+b-) individuals. On the other hand, UEA-I stained the superficial pyloric mucosa only from secretor individuals. A staining of deep mucous glands by the lectins was found in all specimens. Both reacted with most human carcinomas of different origin. Slight differences in their binding pattern were observed and may be explained by the different fine-specificities of the lectins.
Zara, J; Pomato, N; McCabe, R P; Bredehorst, R; Vogel, C W
1995-01-01
Human IgM monoclonal antibody 16-88, derived from patients immunized with autologous colon carcinoma cells, was derivatized with two different cross-linkers, S-(2-thiopyridyl)-L-cysteine hydrazide (TPCH), which is carbohydrate-directed, and N-succinimidyl-3-(2- pyridyldithio)propionate (SPDP), which is amino group-directed. Two antibody functions, antigen binding and complement activation, were assayed upon derivatization with TPCH and SPDP. TPCH allowed for extensive modification (up to 17 TPCH molecules per antibody) without impairment of antigen binding activity, while this function was significantly compromised upon derivatization with SPDP. Antibody molecules derivatized with 16 SPDP residues showed almost complete loss of their antigen binding function. The complement activating ability of antibody 16-88 was significantly decreased after derivatization with TPCH or SPDP. In the case of SPDP derivatization, this decrease of the complement activating ability is predominantly a consequence of the impaired binding function. Upon conjugation of cobra venom factor (CVF), a nontoxic 137-kDa glycoprotein which is capable of activating the alternative pathway of complement, the antigen binding activity of SPDP-derivatized antibody was further compromised, whereas that of TPCH-derivatized antibody remained unaffected even after attachment of three or four CVF molecules per antibody. In both conjugates CVF retained good functional activity. CVF was slightly more active when attached to SPDP-derivatized antibody, suggesting a better accessibility of amino group-coupled CVF for its interaction with other complement proteins. These results indicate that carbohydrate-directed conjugation compromises the antibody function of complement activation, but allows for the generation of immunoconjugates with unimpaired antigen binding capability.(ABSTRACT TRUNCATED AT 250 WORDS)
Predicting protein-binding regions in RNA using nucleotide profiles and compositions.
Choi, Daesik; Park, Byungkyu; Chae, Hanju; Lee, Wook; Han, Kyungsook
2017-03-14
Motivated by the increased amount of data on protein-RNA interactions and the availability of complete genome sequences of several organisms, many computational methods have been proposed to predict binding sites in protein-RNA interactions. However, most computational methods are limited to finding RNA-binding sites in proteins instead of protein-binding sites in RNAs. Predicting protein-binding sites in RNA is more challenging than predicting RNA-binding sites in proteins. Recent computational methods for finding protein-binding sites in RNAs have several drawbacks for practical use. We developed a new support vector machine (SVM) model for predicting protein-binding regions in mRNA sequences. The model uses sequence profiles constructed from log-odds scores of mono- and di-nucleotides and nucleotide compositions. The model was evaluated by standard 10-fold cross validation, leave-one-protein-out (LOPO) cross validation and independent testing. Since actual mRNA sequences have more non-binding regions than protein-binding regions, we tested the model on several datasets with different ratios of protein-binding regions to non-binding regions. The best performance of the model was obtained in a balanced dataset of positive and negative instances. 10-fold cross validation with a balanced dataset achieved a sensitivity of 91.6%, a specificity of 92.4%, an accuracy of 92.0%, a positive predictive value (PPV) of 91.7%, a negative predictive value (NPV) of 92.3% and a Matthews correlation coefficient (MCC) of 0.840. LOPO cross validation showed a lower performance than the 10-fold cross validation, but the performance remains high (87.6% accuracy and 0.752 MCC). In testing the model on independent datasets, it achieved an accuracy of 82.2% and an MCC of 0.656. Testing of our model and other state-of-the-art methods on a same dataset showed that our model is better than the others. Sequence profiles of log-odds scores of mono- and di-nucleotides were much more powerful features than nucleotide compositions in finding protein-binding regions in RNA sequences. But, a slight performance gain was obtained when using the sequence profiles along with nucleotide compositions. These are preliminary results of ongoing research, but demonstrate the potential of our approach as a powerful predictor of protein-binding regions in RNA. The program and supporting data are available at http://bclab.inha.ac.kr/RBPbinding .
Human milk galectin-3 binding protein and breast-feeding-associated HIV transmission.
Chan, Christina S; Kim, Hae-Young; Autran, Chloe; Kim, Jae H; Sinkala, Moses; Kankasa, Chipepo; Mwiya, Mwiya; Thea, Donald M; Aldrovandi, Grace M; Kuhn, Louise; Bode, Lars
2013-12-01
Analysis of milk from 247 HIV-infected Zambian mothers showed that galectin-3 binding protein concentrations were significantly higher among HIV-infected mothers who transmitted HIV through breast-feeding (6.51 ± 2.12 μg/mL) than among nontransmitters but were also correlated with higher milk and plasma HIV RNA copies/mL and lower CD4+ cell counts. The association between galectin-3 binding protein and postnatal transmission was attenuated after adjustment for milk and plasma HIV load and CD4+ cell counts. This suggests that although milk galectin-3 binding protein is a marker of advanced maternal disease, it does not independently modify transmission risk.
Uhle, M.E.; Chin, Y.-P.; Aiken, G.R.; McKnight, Diane M.
1999-01-01
Two ortho- (2,2',5 and 2,2',5,6') and a non-ortho- (3,3',4,4') substituted polychlorinated biphenyl (PCB) congeners were used to study the effects of sorbate structure in binding processes to two lacustrine fulvic acids. Binding constants were determined by solubility enhancement of the solutes by the fulvic acids. The binding of the ortho-trichlorobiphenyl was significantly less than the non-ortho-substituted tetrachlorobiphenyl to both fulvic acids. Surprisingly, the measured ortho-trichlorobiphenyl binding constant to both fulvic acids was approximately the same as the ortho- substituted tetrachlorobiphenyl. The effect of the chlorines in the ortho position inhibits free rotation around the 1,1' carbon bond, thereby making the molecule less able to interact effectively with the fulvic acid substrate relative to its non-ortho-substituted congeners. Finally, binding of all three PCBs to the Great Dismal Swamp fulvic acid was significantly higher than for the Pony Lake sample. This observation is attributable to the former substrate's higher degree of aromaticity and polarizability, which can potentially interact more favorably with the PCBs through an increase in van der Waals type interactions.Two ortho- (2,2???,5 and 2,2???,5,6???) and a non-ortho- (3,3???,4,4???) substituted polychlorinated biphenyl (PCB) congeners were used to study the effects of sorbate structure in binding processes to two lacustrine fulvic acids. Binding constants were determined by solubility enhancement of the solutes by the fulvic acids. The binding of the ortho-trichlorobiphenyl was significantly less than the non-ortho-substituted tetrachlorobiphenyl to both fulvic acids. Surprisingly, the measured ortho-trichlorobiphenyl binding constant to both fulvic acids was approximately the same as the ortho-substituted tetrachlorobiphenyl. The effect of the chlorines in the ortho position inhibits free rotation around the 1,1??? carbon bond, thereby making the molecule less able to interact effectively with the fulvic acid substrate relative to its non-ortho-substituted congeners. Finally, binding of all three PCBs to the Great Dismal Swamp fulvic acid was significantly higher than for the Pony Lake sample. This observation is attributable to the former substrate's higher degree of aromaticity and polarizability, which can potentially interact more favorably with the PCBs through an increase in van der Waals type interactions.
Characterization of particulate matter binding peptides screened from phage display.
Liang Alvin, Aw Wei; Tanaka, Masayoshi; Okochi, Mina
2017-05-01
Particulate matter (PM), especially particulates with diameters of less than 2.5 μm, can penetrate the alveolar region and increase the risk of respiratory diseases. This has stimulated research efforts to develop detection methods so that counter measures can be taken. In this study, four PM binding peptides were obtained by phage display and binding characteristics of these peptides were investigated using the peptide array. The strongest binding peptide, WQDFGAVRSTRS, displayed a binding property, measured in terms of spot intensity, 11.4 times higher than that of the negative control, AAAAA. Inductively coupled plasma mass spectrometry (ICPMS) analysis of the transition metal compounds in the PM bound to the peptide spots was performed, and two peptides showed higher binding towards Cu and Zn compounds in PM. These results suggest that the screened peptides could serve as an indicator of transition metal compounds, which are related to adverse health effects, contained in PM. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Is there a link between selectivity and binding thermodynamics profiles?
Tarcsay, Ákos; Keserű, György M
2015-01-01
Thermodynamics of ligand binding is influenced by the interplay between enthalpy and entropy contributions of the binding event. The impact of these binding free energy components, however, is not limited to the primary target only. Here, we investigate the relationship between binding thermodynamics and selectivity profiles by combining publicly available data from broad off-target assay profiling and the corresponding thermodynamics measurements. Our analysis indicates that compounds binding their primary targets with higher entropy contributions tend to hit more off-targets compared with those ligands that demonstrated enthalpy-driven binding. Copyright © 2014 Elsevier Ltd. All rights reserved.
Van Beeren, H C; Jong, W M C; Kaptein, E; Visser, T J; Bakker, O; Wiersinga, W M
2003-02-01
Dronedarone (Dron), without iodine, was developed as an alternative to the iodine-containing antiarrhythmic drug amiodarone (AM). AM acts, via its major metabolite desethylamiodarone, in vitro and in vivo as a thyroid hormone receptor alpha(1) (TRalpha(1)) and TRbeta(1) antagonist. Here we investigate whether Dron and/or its metabolite debutyldronedarone inhibit T(3) binding to TRalpha(1) and TRbeta(1) in vitro and whether dronedarone behaves similarly to amiodarone in vivo. In vitro, Dron had a inhibitory effect of 14% on the binding of T(3) to TRalpha(1), but not on TRbeta(1). Desethylamiodarone inhibited T(3) binding to TRalpha(1) and TRbeta(1) equally. Debutyldronedarone inhibited T(3) binding to TRalpha(1) by 77%, but to TRbeta(1) by only 25%. In vivo, AM increased plasma TSH and rT(3), and decreased T(3). Dron decreased T(4) and T(3), rT(3) did not change, and TSH fell slightly. Plasma total cholesterol was increased by AM, but remained unchanged in Dron-treated animals. TRbeta(1)-dependent liver low density lipoprotein receptor protein and type 1 deiodinase activities decreased in AM-treated, but not in Dron-treated, animals. TRalpha(1)-mediated lengthening of the QTc interval was present in both AM- and Dron-treated animals. The in vitro and in vivo findings suggest that dronedarone via its metabolite debutyldronedarone acts as a TRalpha(1)-selective inhibitor.
Martin, Lewis J; Corry, Ben
2014-07-01
Sodium channel blockers are used to control electrical excitability in cells as a treatment for epileptic seizures and cardiac arrhythmia, and to provide short term control of pain. Development of the next generation of drugs that can selectively target one of the nine types of voltage-gated sodium channel expressed in the body requires a much better understanding of how current channel blockers work. Here we make use of the recently determined crystal structure of the bacterial voltage gated sodium channel NavAb in molecular dynamics simulations to elucidate the position at which the sodium channel blocking drugs benzocaine and phenytoin bind to the protein as well as to understand how these drugs find their way into resting channels. We show that both drugs have two likely binding sites in the pore characterised by nonspecific, hydrophobic interactions: one just above the activation gate, and one at the entrance to the the lateral lipid filled fenestrations. Three independent methods find the same sites and all suggest that binding to the activation gate is slightly more favourable than at the fenestration. Both drugs are found to be able to pass through the fenestrations into the lipid with only small energy barriers, suggesting that this can represent the long posited hydrophobic entrance route for neutral drugs. Our simulations highlight the importance of a number of residues in directing drugs into and through the fenestration, and in forming the drug binding sites.
Lou, Yan-Yue; Zhou, Kai-Li; Shi, Jie-Hua; Pan, Dong-Qi
2017-08-01
Boscalid, a carboxamide fungicide, is used in the treatment of grey mould and powdery mildew, widely applied to a variety of crops and fruits such as rice, wheat, grapes and pears. It will become a potential risk for health due to its widely application and residue in crops and fruits. In this study, the binding interaction between boscalid and bovine serum albumin (BSA) was characterized using steady-state fluorescence spectroscopy, ultraviolet spectroscopy (UV), synchronous fluorescence spectroscopy, 3D fluorescence spectroscopy, Fourier transform infrared spectroscopy (FT-IR) and molecular docking to ascertain the store, transport and distribution of boscalid in vivo. The experimental results indicated that the fluorescence of BSA was quenched due to the forming the static boscalid-BSA complex with the binding constant of 4.57×10 3 M -1 at 298 K and boscalid bound on the subdomain III A (site II) of BSA through van der Waals force and hydrogen bonding interaction. The binding process of boscalid with BSA was spontaneous and enthalpy-driven process based on ΔG 0 <0 and |ΔH 0 |>T|ΔS 0 | over the studied temperature range. Meanwhile, the obvious change in the conformation of boscalid was observed while the slight change in the conformation of BSA when binding boscalid to the BSA, implying that the flexibility of boscalid contributes to increasing the stability of the boscalid-BSA complex. Copyright © 2017 Elsevier B.V. All rights reserved.
Martin, Lewis J.; Corry, Ben
2014-01-01
Sodium channel blockers are used to control electrical excitability in cells as a treatment for epileptic seizures and cardiac arrhythmia, and to provide short term control of pain. Development of the next generation of drugs that can selectively target one of the nine types of voltage-gated sodium channel expressed in the body requires a much better understanding of how current channel blockers work. Here we make use of the recently determined crystal structure of the bacterial voltage gated sodium channel NavAb in molecular dynamics simulations to elucidate the position at which the sodium channel blocking drugs benzocaine and phenytoin bind to the protein as well as to understand how these drugs find their way into resting channels. We show that both drugs have two likely binding sites in the pore characterised by nonspecific, hydrophobic interactions: one just above the activation gate, and one at the entrance to the the lateral lipid filled fenestrations. Three independent methods find the same sites and all suggest that binding to the activation gate is slightly more favourable than at the fenestration. Both drugs are found to be able to pass through the fenestrations into the lipid with only small energy barriers, suggesting that this can represent the long posited hydrophobic entrance route for neutral drugs. Our simulations highlight the importance of a number of residues in directing drugs into and through the fenestration, and in forming the drug binding sites. PMID:24992293
Mechanism of pKID/KIX Association Studied by Molecular Dynamics Free Energy Simulations.
Bomblies, Rainer; Luitz, Manuel P; Zacharias, Martin
2016-08-25
The phosphorylated kinase-inducible domain (pKID) associates with the kinase interacting domain (KIX) via a coupled folding and binding mechanism. The pKID domain is intrinsically disordered when unbound and upon phosphorylation at Ser133 binds to the KIX domain adopting a well-defined kinked two-helix structure. In order to identify putative hot spot residues of binding that could serve as an initial stable anchor, we performed in silico alanine scanning free energy simulations. The simulations indicate that charged residues including the phosphorylated central Ser133 of pKID make significant contributions to binding. However, these are of slightly smaller magnitude compared to several hydrophobic side chains not defining a single dominant binding hot spot. Both continuous molecular dynamics (MD) simulations and free energy analysis demonstrate that phosphorylation significantly stabilizes the central kinked motif around Ser133 of pKID and shifts the conformational equilibrium toward the bound conformation already in the absence of KIX. This result supports a view that pKID/KIX association follows in part a conformational selection process. During a 1.5 μs explicit solvent MD simulation, folding of pKID on the surface of KIX was observed after an initial contact at the bound position of the phosphorylation site was enforced following a sequential process of αA helix association and a stepwise association and folding of the second αB helix compatible with available experimental results.
Granoff, Dan M.; Giuntini, Serena; Gowans, Flor A.; Lujan, Eduardo; Sharkey, Kelsey; Beernink, Peter T.
2016-01-01
Meningococcal factor H-binding protein (FHbp) is an antigen in 2 serogroup B meningococcal vaccines. FHbp specifically binds human and some nonhuman primate complement FH. To investigate the effect of binding of FH to FHbp on protective antibody responses, we immunized infant rhesus macaques with either a control recombinant FHbp antigen that bound macaque FH or a mutant antigen with 2 amino acid substitutions and >250-fold lower affinity for FH. The mutant antigen elicited 3-fold higher serum IgG anti-FHbp titers and up to 15-fold higher serum bactericidal titers than the control FHbp vaccine. When comparing sera with similar IgG anti-FHbp titers, the antibodies elicited by the mutant antigen gave greater deposition of complement component C4b on live meningococci (classical complement pathway) and inhibited binding of FH, while the anti-FHbp antibodies elicited by the control vaccine enhanced FH binding. Thus, the mutant FHbp vaccine elicited an anti-FHbp antibody repertoire directed at FHbp epitopes within the FH binding site, which resulted in greater protective activity than the antibodies elicited by the control vaccine, which targeted FHbp epitopes outside of the FH combining site. Binding of a host protein to a vaccine antigen impairs protective antibody responses, which can be overcome with low-binding mutant antigens. PMID:27668287
Wang, Yu; Fan, Kai; Wang, Jing; Ding, Zhao-Tang; Wang, Hui; Bi, Cai-Hong; Zhang, Yun-Wei; Sun, Hai-Wei
2017-12-01
Drought is a crucial limiting factor for tea yield and quality. To systematically characterize the molecular response of tea plants to drought stress and its capacity to recover, we used iTRAQ-based comparative proteomic approach to investigate the effects of drought on protein expression profiles in tea seedlings subjected to different drought treatments. A total of 3274 proteins were identified, of which 2169 and 2300 showed differential expressions during drought and recovery, respectively. Functional annotation showed that multiple biological processes were regulated, suggesting that tea plants probably employed multiple and synergistic resistance mechanisms in dealing with drought stress. Hierarchical clustering showed that chlorophyll a/b-binding proteins were up-regulated in DB and RE, suggesting that tea plants might regulate expression of chlorophyll a/b-binding proteins to maintain the photosystem II function during drought stress. Abundant proteins involved in sulfur-containing metabolite pathways, such as glutathione, taurine, hypotaurine, methionine, and cysteine, changed significantly during drought stress. Among them, TL29 interacted with LHCb6 to connect S-containing metabolites with chlorophyll a/b-binding proteins. This suggests that sulfur-containing compounds play important roles in the response to drought stress in tea plants. In addition, the expression of PAL was up-regulated in DA and down-regulated in DB. Cinnamyl alcohol dehydrogenase, caffeic acid O-methyltransferase, and 4-coumarate-CoA ligase also showed significant changes in expression levels, which regulated the biosynthesis of polyphenols. The results indicate that slight drought stress might promote polyphenol biosynthesis, while serious drought stress leads to inhibition. The expression of lipoxygenase and short-chain dehydrogenase increased during slight drought stress and some volatile metabolite pathways were enriched, indicating that drought stress might affect the tea aroma. The study provides valuable information that will lay the foundation for studies investigating the functions of drought response genes in tea leaves. Copyright © 2017 Elsevier GmbH. All rights reserved.
Structural and Functional Studies of Influenza Virus A/H6 Hemagglutinin.
Ni, Fengyun; Kondrashkina, Elena; Wang, Qinghua
2015-01-01
In June 2013, the first human infection by avian influenza A(H6N1) virus was reported in Taiwan. This incident raised the concern for possible human epidemics and pandemics from H6 viruses. In this study, we performed structural and functional investigation on the hemagglutinin (HA) proteins of the human-infecting A/Taiwan/2/2013(H6N1) (TW H6) virus and an avian A/chicken/Guangdong/S1311/2010(H6N6) (GD H6) virus that transmitted efficiently in guinea pigs. Our results revealed that in the presence of HA1 Q226, the triad of HA1 S137, E190 and G228 in GD H6 HA allows the binding to both avian- and human-like receptors with a slight preference for avian receptors. Its conservation among the majority of H6 HAs provides an explanation for the broader host range of this subtype. Furthermore, the triad of N137, V190 and S228 in TW H6 HA may alleviate the requirement for a hydrophobic residue at HA1 226 of H2 and H3 HAs when binding to human-like receptors. Consequently, TW H6 HA has a slight preference for human receptors, thus may represent an intermediate towards a complete human adaptation. Importantly, the triad observed in TW H6 HA is detected in 74% H6 viruses isolated from Taiwan in the past 14 years, suggesting an elevated threat of H6 viruses from this region to human health. The novel roles of the triad at HA1 137, 190 and 228 of H6 HA in binding to receptors revealed here may also be used by other HA subtypes to achieve human adaptation, which needs to be further tested in laboratory and closely monitored in field surveillance.
Mokánszki, Attila; Molnár, Zsuzsanna; Ujfalusi, Anikó; Balogh, Erzsébet; Bazsáné, Zsuzsa Kassai; Varga, Attila; Jakab, Attila; Oláh, Éva
2012-12-01
Infertile men with low sperm concentration and/or less motile spermatozoa have an increased risk of producing aneuploid spermatozoa. Selecting spermatozoa by hyaluronic acid (HA) binding may reduce genetic risks such as chromosomal rearrangements and numerical aberrations. Fluorescence in-situ hybridization (FISH) has been used to evaluate the presence of aneuploidies. This study examined spermatozoa of 10 oligozoospermic, 9 asthenozoospermic, 9 oligoasthenozoospermic and 17 normozoospermic men by HA binding and FISH. Mean percentage of HA-bound spermatozoa in the normozoospermic group was 81%, which was significantly higher than in the oligozoospermic (P<0.001), asthenozoospermic (P<0.001) and oligoasthenozoospermic (P<0.001) groups. Disomy of sex chromosomes (P=0.014) and chromosome 17 (P=0.0019), diploidy (P=0.03) and estimated numerical chromosome aberrations (P=0.004) were significantly higher in the oligoasthenozoospermic group compared with the other groups. There were statistically significant relationships (P<0.001) between sperm concentration and HA binding (r=0.658), between sperm concentration and estimated numerical chromosome aberrations (r=-0.668) and between HA binding and estimated numerical chromosome aberrations (r=-0.682). HA binding and aneuploidy studies of spermatozoa in individual cases allow prediction of reproductive prognosis and provision of appropriate genetic counselling. Infertile men with normal karyotypes and low sperm concentrations and/or less motile spermatozoa have significantly increased risks of producing aneuploid (diminished mature) spermatozoa. Selecting spermatozoa by hyaluronic acid (HA) binding, based on a binding between sperm receptors for zona pellucida and HA, may reduce the potential genetic risks such as chromosomal rearrangements and numerical aberrations. In the present study we examined sperm samples of 45 men with different sperm parameters by HA-binding assay and fluorescence in-situ hybridization (FISH). Mean percentage of HA-bound spermatozoa in the normozoospermic group was significantly higher than the oligozoospermic, the asthenozoospermic and the oligoasthenozoospermic groups. Using FISH, disomy of sex chromosomes and chromosome 17, diploidy and estimated numerical chromosome aberration frequencies were significantly higher in the oligoasthenozoospermic group compared with the three other groups. A significant positive correlation was found between the sperm concentration and the HA-binding capacity, and significant negative correlations between the sperm concentration and the estimated numerical chromosomes aberrations as well as between the HA-binding ability and the estimated numerical chromosome aberrations were identified. We conclude that HA-binding assay and sperm aneuploidy study using FISH may help to predict the reproductive ability of selected infertile male patients and to provide appropriate genetic counselling. Crown Copyright © 2012. Published by Elsevier Ltd. All rights reserved.
Hiramatsu, Hirotsugu; Takeuchi, Katsuyuki; Takeuchi, Hideo
2013-04-02
The pH dependence of the β-galactoside binding activity of human galectin-1 (hGal-1) was investigated by fluorescence spectroscopy using lactose as a ligand. The obtained binding constant Kb was 2.94 ± 0.10 mM(-1) at pH 7.5. The Kb value decreased at acidic pH with a midpoint of transition at pH 6.0 ± 0.1. To elucidate the molecular mechanism of the pH dependence, we investigated the structures of hGal-1 and its two His mutants (H44Q and H52Q) using fluorescence, circular dichroism, UV absorption, and UV resonance Raman spectroscopy. Analysis of the spectra has shown that the pKa values of His44 and His52 are 5.7 ± 0.2 and 6.3 ± 0.1, respectively. The protonation of His52 below pH 6.3 induces a small change in secondary structure and partly reduces the galactoside binding activity. On the other hand, the protonation of His44 below pH 5.7 exerts a cation-π interaction with Trp68 and largely diminishes the galactoside binding activity. With reference to the literature X-ray structures at pH 7.0 and 5.6, protonated His52 is proposed to move slightly away from the galactoside-binding region with a partial unfolding of the β-strand containing His52. On the other hand, protonated His44 becomes unable to form a hydrogen bond with galactoside and additionally induces a reorientation and/or displacement of Trp68 through cation-π interaction, leading to a loosening of the galactoside-binding pocket. These structural changes associated with His protonation are likely to be the origin of the pH dependence of the galactoside binding activity of hGal-1.
McPartland, John M; MacDonald, Christa; Young, Michelle; Grant, Phillip S; Furkert, Daniel P; Glass, Michelle
2017-01-01
Introduction: Cannabis biosynthesizes Δ 9 -tetrahydrocannabinolic acid (THCA-A), which decarboxylates into Δ 9 -tetrahydrocannabinol (THC). There is growing interest in the therapeutic use of THCA-A, but its clinical application may be hampered by instability. THCA-A lacks cannabimimetic effects; we hypothesize that it has little binding affinity at cannabinoid receptor 1 (CB 1 ). Materials and Methods: Purity of certified reference standards were tested with high performance liquid chromatography (HPLC). Binding affinity of THCA-A and THC at human (h) CB 1 and hCB 2 was measured in competition binding assays, using transfected HEK cells and [ 3 H]CP55,940. Efficacy at hCB 1 and hCB 2 was measured in a cyclic adenosine monophosphase (cAMP) assay, using a Bioluminescence Resonance Energy Transfer (BRET) biosensor. Results: The THCA-A reagent contained 2% THC. THCA-A displayed small but measurable binding at both hCB 1 and hCB 2 , equating to approximate K i values of 3.1μM and 12.5μM, respectively. THC showed 62-fold greater affinity at hCB 1 and 125-fold greater affinity at hCB 2 . In efficacy tests, THCA-A (10μM) slightly inhibited forskolin-stimulated cAMP at hCB 1 , suggestive of weak agonist activity, and no measurable efficacy at hCB 2 . Discussion: The presence of THC in our THCA-A certified standard agrees with decarboxylation kinetics (literature reviewed herein), which indicate contamination with THC is nearly unavoidable. THCA-A binding at 10μM approximated THC binding at 200nM. We therefore suspect some of our THCA-A binding curve was artifact-from its inevitable decarboxylation into THC-and the binding affinity of THCA-A is even weaker than our estimated values. We conclude that THCA-A has little affinity or efficacy at CB 1 or CB 2 .
George, J; Gilburd, B; Hojnik, M; Levy, Y; Langevitz, P; Matsuura, E; Koike, T; Shoenfeld, Y
1998-04-15
Beta2-glycoprotein I (beta2GPI) is an absolute requirement for the binding of autoimmune anticardiolipin Abs (aCL) to cardiolipin (CL). We evaluated the target recognition of human beta2GPI by IgG derived from two patients with primary and two with secondary antiphospholipid syndrome. The total IgG serum fractions and beta2GPI affinity-purified IgGs were assessed by using various domain-deleted mutants (DM) of human beta2GPI (DMs: I-III, I-IV, II-V, III-V, IV-V, and V) and mouse mAbs against individual beta2GPI domains. The four IgGs bound slightly to CL in the absence of beta2GPI and showed increased binding in the beta2GPI presence. Following affinity purification of the IgGs on a beta2GPI column, reactivity toward CL was absent. DMs containing domain V inhibited the binding of biotinylated beta2GPI to CL. The addition to CL-coated plates of DM V, but not the other DMs, reduced the binding of all four IgGs. The anti-beta2GPI IgGs bound only to complete beta2GPI and DM I-IV coated on the plates. The binding to plate-adsorbed beta2GPI could be inhibited by complete beta2GPI and DM I-IV, the latter being a more efficient inhibitor. Further, the human anti-beta2GPI IgGs could compete with the binding to beta2GPI of Cof-21 mouse mAb (directed at domain IV), but not with the two other mouse mAbs. The results suggest that some "autoimmune:" beta2GPI-dependent anticardiolipin Abs recognize a beta2GPI target that is distinct from the CL-binding site in domain V. The target site for some antiphospholipid syndrome IgGs appear to reside in domain IV of beta2GPI.
Xu, Wei; Shao, Rong; Xiao, Jianbo
2016-07-26
The inhibitory potential of natural polyphenols for α-amylases has attracted great interests among researchers. The structure-affinity properties of natural polyphenols binding to α-amylase and the structure-activity relationship of dietary polyphenols inhibiting α-amylase were deeply investigated. There is a lack of consistency between the structure-affinity relationship and the structure-activity relationship of natural polyphenols as α-amylase inhibitors. Is it consistent between the binding affinity and inhibitory potential of natural polyphenols as with α-amylase inhibitors? It was found that the consistency between the binding affinity and inhibitory potential of natural polyphenols as with α-amylase inhibitors is not equivocal. For example, there is no consistency between the binding affinity and the inhibitory potential of quercetin and its glycosides as α-amylase inhibitors. However, catechins with higher α-amylase inhibitory potential exhibited higher affinity with α-amylase.
DNA as a Target for Anticancer Phen-Imidazole Pd(II) Complexes.
Heydari, Maryam; Moghadam, Mahboube Eslami; Tarlani, AliAkbar; Farhangian, Hossein
2017-05-01
Imidazole ring is a known structure in many natural or synthetic drug molecules and its metal complexes can interact with DNA and do the cleavage. Hence, to study the influence of the structure and size of the ligand on biological behavior of metal complexes, two water-soluble Pd(II) complexes of phen and FIP ligands (where phen is 1,10-phenanthroline and FIP is 2-(Furan-2-yl)-1H-Imidazo[4,5-f][1, 10]phenanthroline) with the formula of [Pd(phen)(FIP)](NO 3 ) 2 and [Pd(FIP) 2 ]Cl 2 , that were activated against chronic myelogenous leukemia cell line, K562, were selected. Also, the interaction of these anticancer Pd(II) complexes with highly polymerized calf thymus DNA was extensively studied by means of electronic absorption, fluorescence, and circular dichroism in Tris-buffer. The results showed that the binding was positive cooperation and [Pd(phen)(FIP)](NO 3 ) 2 (K f = 127 M -1 G = 1.2) exhibited higher binding constant and number of binding sites than [Pd(FIP) 2 ]Cl 2 (K f = 13 M -1 G = 1.03) upon binding to DNA. The fluorescence data indicates that quenching effect for [Pd(phen)(FIP)](NO 3 ) 2 (K SV = 58 mM -1 ) was higher than [Pd(FIP) 2 ]Cl 2 (K SV = 12 mM -1 ). Also, [Pd(FIP) 2 ]Cl 2 interacts with ethidium bromide-DNA, as non-competitive inhibition, and can bind to DNA via groove binding and [Pd(phen)(FIP)](NO 3 ) 2 can intercalate in DNA. These results were confirmed by circular dichroism spectra. Docking data revealed that longer complexes have higher interaction energy and bind to DNA via groove binding. Graphical Abstract Two anticancer Pd(II) complexes of imidazole derivative have been synthesized and interacted with calf thymus DNA. Modes of binding have been studied by electronic absorption, fluorescence, and CD measurements. [Pd(FIP) 2 ]Cl 2 can bind to DNA via groove binding while intercalation mode of binding is observed for [Pd(phen)(FIP)](NO 3 ) 2 .
Short peptides allowing preferential detection of Candida albicans hyphae.
Kaba, Hani E J; Pölderl, Antonia; Bilitewski, Ursula
2015-09-01
Whereas the detection of pathogens via recognition of surface structures by specific antibodies and various types of antibody mimics is frequently described, the applicability of short linear peptides as sensor molecules or diagnostic tools is less well-known. We selected peptides which were previously reported to bind to recombinant S. cerevisiae cells, expressing members of the C. albicans Agglutinin-Like-Sequence (ALS) cell wall protein family. We slightly modified amino acid sequences to evaluate peptide sequence properties influencing binding to C. albicans cells. Among the selected peptides, decamer peptides with an "AP"-N-terminus were superior to shorter peptides. The new decamer peptide FBP4 stained viable C. albicans cells more efficiently in their mature hyphal form than in their yeast form. Moreover, it allowed distinction of C. albicans from other related Candida spp. and could thus be the basis for the development of a useful tool for the diagnosis of invasive candidiasis.
Kolpakova, E; Frengen, E; Stokke, T; Olsnes, S
2000-01-01
Acidic fibroblast growth factor (aFGF) intracellular binding protein (FIBP) is a protein found mainly in the nucleus that might be involved in the intracellular function of aFGF. Here we present a comparative analysis of the deduced amino acid sequences of human, murine and Drosophila FIBP analogues and demonstrate that FIBP is an evolutionarily conserved protein. The human gene spans more than 5 kb, comprising ten exons and nine introns, and maps to chromosome 11q13.1. Two slightly different splice variants found in different tissues were isolated and characterized. Sequence analysis of the region surrounding the translation start revealed a CpG island, a classical feature of widely expressed genes. Functional studies of the promoter region with a luciferase reporter system suggested a strong transcriptional activity residing within 600 bp of the 5' flanking region. PMID:11104667
Cooperative macromolecular device revealed by meta-analysis of static and time-resolved structures
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ren, Zhong; rajer, Vukica; Knapp, James E.
2013-04-08
Here we present a meta-analysis of a large collection of static structures of a protein in the Protein Data Bank in order to extract the progression of structural events during protein function. We apply this strategy to the homodimeric hemoglobin HbI from Scapharca inaequivalvis. We derive a simple dynamic model describing how binding of the first ligand in one of the two chemically identical subunits facilitates a second binding event in the other partner subunit. The results of our ultrafast time-resolved crystallographic studies support this model. We demonstrate that HbI functions like a homodimeric mechanical device, such as pliers ormore » scissors. Ligand-induced motion originating in one subunit is transmitted to the other via conserved pivot points, where the E and F' helices from two partner subunits are 'bolted' together to form a stable dimer interface permitting slight relative rotation but preventing sliding.« less
Cuya, Teobaldo; Gonçalves, Arlan da Silva; da Silva, Jorge Alberto Valle; Ramalho, Teodorico C; Kuca, Kamil; C C França, Tanos
2017-10-27
The oximes 4-carbamoyl-1-[({2-[(E)-(hydroxyimino) methyl] pyridinium-1-yl} methoxy) methyl] pyridinium (known as HI-6) and 3-carbamoyl-1-[({2-[(E)-(hydroxyimino) methyl] pyridinium-1-yl} methoxy) methyl] pyridinium (known as HS-6) are isomers differing from each other only by the position of the carbamoyl group on the pyridine ring. However, this slight difference was verified to be responsible for big differences in the percentual of reactivation of acetylcholinesterase (AChE) inhibited by the nerve agents tabun, sarin, cyclosarin, and VX. In order to try to find out the reason for this, a computational study involving molecular docking, molecular dynamics, and binding energies calculations, was performed on the binding modes of HI-6 and HS-6 on human AChE (HssAChE) inhibited by those nerve agents.
Actin Polymerization is Stimulated by Actin Crosslinking Protein Palladin
Gurung, Ritu; Yadav, Rahul; Brungardt, Joseph G.; Orlova, Albina; Egelman, Edward H.; Beck, Moriah R.
2016-01-01
The actin scaffold protein palladin regulates both normal cell migration and invasive cell motility, processes that require the coordinated regulation of actin dynamics. However, the potential effect of palladin on actin dynamics has remained elusive. Here we show that the actin binding immunoglobulin-like domain of palladin, which is directly responsible for both actin binding and bundling, also stimulates actin polymerization in vitro. Palladin eliminated the lag phase that is characteristic of the slow nucleation step of actin polymerization. Furthermore, palladin dramatically reduced depolymerization, slightly enhanced the elongation rate, and did not alter the critical concentration. Microscopy and in vitro crosslinking assays reveal differences in actin bundle architecture when palladin is incubated with actin before or after polymerization. These results suggest a model whereby palladin stimulates a polymerization-competent form of G-actin, akin to metal ions, either through charge neutralization or conformational changes. PMID:26607837
Wiegand, C; Abel, M; Ruth, P; Hipler, U C
2011-11-01
A comprehensive in vitro approach was used to assess the effects of superabsorbent polymer (SAP) containing wound dressings in treatment of non-healing wounds. A slight negative effect on HaCaT cells was noted in vitro which is most likely due to the Ca(2+) deprivation of the medium by binding to the SAP. It could be shown that SAP wound dressings are able to bind considerable amounts of elastase reducing enzyme activity significantly. Furthermore, SAP's inhibit the formation of free radicals. The SAP-containing wound dressings tested also exhibited a significant to strong antimicrobial activity effectively impeding the growth of gram-negative and gram-positive bacteria as well as yeasts. In conclusion, in vitro data confirm the positive effect of SAP wound dressings observed in vivo and suggest that they should be specifically useful for wound cleansing.
Low, Diana H P; Motakis, Efthymios
2013-10-01
Binding free energy calculations obtained through molecular dynamics simulations reflect intermolecular interaction states through a series of independent snapshots. Typically, the free energies of multiple simulated series (each with slightly different starting conditions) need to be estimated. Previous approaches carry out this task by moving averages at certain decorrelation times, assuming that the system comes from a single conformation description of binding events. Here, we discuss a more general approach that uses statistical modeling, wavelets denoising and hierarchical clustering to estimate the significance of multiple statistically distinct subpopulations, reflecting potential macrostates of the system. We present the deltaGseg R package that performs macrostate estimation from multiple replicated series and allows molecular biologists/chemists to gain physical insight into the molecular details that are not easily accessible by experimental techniques. deltaGseg is a Bioconductor R package available at http://bioconductor.org/packages/release/bioc/html/deltaGseg.html.
Basu, Anirban; Suresh Kumar, Gopinatha
2017-02-16
Interaction of two food colorant dyes, amaranth and tartrazine, with lysozyme was studied employing multiple biophysical techniques. The dyes exhibited hypochromic changes in the presence of lysozyme. The intrinsic fluorescence of lysozyme was quenched by both dyes; amaranth was a more efficient quencher than tartrazine. The equilibrium constant of amaranth was higher than that of tartarzine. From FRET analysis, the binding distances for amaranth and tartrazine were calculated to be 4.51 and 3.93 nm, respectively. The binding was found to be dominated by non-polyelectrolytic forces. Both dyes induced alterations in the microenvironment surrounding the tryptophan and tyrosine residues of the protein, with the alterations being comparatively higher for the tryptophans than the tyrosines. The interaction caused significant loss in the helicity of lysozyme, the change being higher with amaranth. The binding of both dyes was exothermic. The binding of amaranth was enthalpy driven, while that of tartrazine was predominantly entropy driven. Amaranth delayed lysozyme fibrillation at 25 μM, while tartrazine had no effect even at 100 μM. Nevertheless, both dyes had a significant inhibitory effect on fibrillogenesis. The present study explores the potential antiamyloidogenic property of these azo dyes used as food colorants.
NASA Technical Reports Server (NTRS)
Wang, K. S.; Vaidya, P. G.
1975-01-01
The resonance expansion method, developed to study the propagation of sound in rigid rectangular ducts is applied to the case of slightly soft ducts. Expressions for the generation and decay of various harmonics are obtained. The effect of wall admittance is seen through a dissipation function in the system of nonlinear differential equations, governing the generation of harmonics. As the wall admittance increases, the resonance is reduced. For a given wall admittance this phenomenon is stronger at higher input intensities. Both the first and second order solutions are obtained and the results are extended to the case of ducts having mean flow.
Yang, Guohua; Li, Shoujun; Blackmon, Sherry; Ye, Jianqiang; Bradley, Konrad C.; Cooley, Jim; Smith, Dave; Hanson, Larry; Cardona, Carol; Steinhauer, David A.; Webby, Richard; Liao, Ming
2013-01-01
An avian-like H3N2 influenza A virus (IAV) has recently caused sporadic canine influenza outbreaks in China and Korea, but the molecular mechanisms involved in the interspecies transmission of H3N2 IAV from avian to canine species are not well understood. Sequence analysis showed that residue 222 in haemagglutinin (HA) is predominantly tryptophan (W) in the closely related avian H3N2 IAV, but was leucine (L) in canine H3N2 IAV. In this study, reassortant viruses rH3N2-222L (canine-like) and rH3N2-222W (avian-like) with HA mutation L222W were generated using reverse genetics to evaluate the significance of the L222W mutation on receptor binding and host tropism of H3N2 IAV. Compared with rH3N2-222W, rH3N2-222L grew more rapidly in MDCK cells and had significantly higher infectivity in primary canine tracheal epithelial cells. Tissue-binding assays demonstrated that rH3N2-222L had a preference for canine tracheal tissues rather avian tracheal tissues, whereas rH3N2-222W favoured slightly avian rather canine tracheal tissues. Glycan microarray analysis suggested both rH3N2-222L and rH3N2-222W bound preferentially to α2,3-linked sialic acids. However, the rH3N2-222W had more than twofold less binding affinity than rH3N2-222L to a set of glycans with Neu5Aca2–3Galb1–4(Fuca-)-like or Neu5Aca2–3Galb1–3(Fuca-)-like structures. These data suggest the W to L mutation at position 222 of the HA could facilitate infection of H3N2 IAV in dogs, possibly by increasing the binding affinities of the HA to specific receptors with Neu5Aca2–3Galb1–4(Fuca-) or Neu5Aca2–3Galb1–3(Fuca-)-like structures that are present in dogs. PMID:23994833
Hematology of healthy Florida manatees (Trichechus manatus).
Harvey, John W; Harr, Kendal E; Murphy, David; Walsh, Michael T; Nolan, Elizabeth C; Bonde, Robert K; Pate, Melanie G; Deutsch, Charles J; Edwards, Holly H; Clapp, William L
2009-06-01
Hematologic analysis is an important tool in evaluating the general health status of free-ranging manatees and in the diagnosis and monitoring of rehabilitating animals. The purpose of this study was to evaluate diagnostically important hematologic analytes in healthy manatees (Trichechus manatus) and to assess variations with respect to location (free ranging vs captive), age class (small calves, large calves, subadults, and adults), and gender. Blood was collected from 55 free-ranging and 63 captive healthy manatees. Most analytes were measured using a CELL-DYN 3500R; automated reticulocytes were measured with an ADVIA 120. Standard manual methods were used for differential leukocyte counts, reticulocyte and Heinz body counts, and plasma protein and fibrinogen concentrations. Rouleaux, slight polychromasia, stomatocytosis, and low numbers of schistocytes and nucleated RBCs (NRBCs) were seen often in stained blood films. Manual reticulocyte counts were higher than automated reticulocyte counts. Heinz bodies were present in erythrocytes of most manatees. Compared with free-ranging manatees, captive animals had slightly lower MCV, MCH, and eosinophil counts and slightly higher heterophil and NRBC counts, and fibrinogen concentration. Total leukocyte, heterophil, and monocyte counts tended to be lower in adults than in younger animals. Small calves tended to have higher reticulocyte counts and NRBC counts than older animals. Hematologic findings were generally similar between captive and free-ranging manatees. Higher manual reticulocyte counts suggest the ADVIA detects only reticulocytes containing large amounts of RNA. Higher reticulocyte and NRBC counts in young calves probably reflect an increased rate of erythropoiesis compared with older animals.
Human cyclophilin has a significantly higher affinity for HIV-1 recombinant p55 than p24.
Bristow, R; Byrne, J; Squirell, J; Trencher, H; Carter, T; Rodgers, B; Saman, E; Duncan, J
1999-04-01
The ability of cyclophilin to bind a panel of recombinant HIV-gag proteins was assessed using sensitive, quantitative, sandwich enzyme-linked immunosorbant assays (ELISAs). Significantly higher binding to cyclophilin was observed when recombinants contained at least 12 carboxy-terminal amino acids of p17 in addition to p24 sequences. These results indicate that the carboxy-terminus of p17 is important for optimal binding of cyclophilin to p24 and support the theory that cyclophilin acts on the uncleaved HIV-1 gag (p17-p24) precursor.
Color-motion feature-binding errors are mediated by a higher-order chromatic representation.
Shevell, Steven K; Wang, Wei
2016-03-01
Peripheral and central moving objects of the same color may be perceived to move in the same direction even though peripheral objects have a different true direction of motion [Nature429, 262 (2004)10.1038/429262a]. The perceived, illusory direction of peripheral motion is a color-motion feature-binding error. Recent work shows that such binding errors occur even without an exact color match between central and peripheral objects, and, moreover, the frequency of the binding errors in the periphery declines as the chromatic difference increases between the central and peripheral objects [J. Opt. Soc. Am. A31, A60 (2014)JOAOD60740-323210.1364/JOSAA.31.000A60]. This change in the frequency of binding errors with the chromatic difference raises the general question of the chromatic representation from which the difference is determined. Here, basic properties of the chromatic representation are tested to discover whether it depends on independent chromatic differences on the l and the s cardinal axes or, alternatively, on a more specific higher-order chromatic representation. Experimental tests compared the rate of feature-binding errors when the central and peripheral colors had the identical s chromaticity (so zero difference in s) and a fixed magnitude of l difference, while varying the identical s level in center and periphery (thus always keeping the s difference at zero). A chromatic representation based on independent l and s differences would result in the same frequency of color-motion binding errors at everyslevel. The results are contrary to this prediction, thus showing that the chromatic representation at the level of color-motion feature binding depends on a higher-order chromatic mechanism.
Smith, Caroline J W; Poehlmann, Max L; Li, Sara; Ratnaseelan, Aarane M; Bredewold, Remco; Veenema, Alexa H
2017-03-01
Oxytocin (OT) and vasopressin (AVP) regulate various social behaviors via activation of the OT receptor (OTR) and the AVP V1a receptor (V1aR) in the brain. Social behavior often differs across development and between the sexes, yet our understanding of age and sex differences in brain OTR and V1aR binding remains incomplete. Here, we provide an extensive analysis of OTR and V1aR binding density throughout the brain in juvenile and adult male and female rats, with a focus on regions within the social decision-making network. OTR and V1aR binding density were higher in juveniles than in adults in regions associated with reward and socio-spatial memory and higher in adults than in juveniles in key regions of the social decision-making network and in cortical regions. We discuss possible implications of these shifts in OTR and V1aR binding density for the age-specific regulation of social behavior. Furthermore, sex differences in OTR and V1aR binding density were less numerous than age differences. The direction of these sex differences was region-specific for OTR but consistently higher in females than in males for V1aR. Finally, almost all sex differences in OTR and V1aR binding density were already present in juveniles and occurred in regions with denser binding in adults compared to juveniles. Possible implications of these sex differences for the sex-specific regulation of behavior, as well potential underlying mechanisms, are discussed. Overall, these findings provide an important framework for testing age- and sex-specific roles of OTR and V1aR in the regulation of social behavior.
Equine sperm-bound antisperm antibodies are associated with poor semen quality.
Ferrer, M S; Miller, L M J
2018-06-01
Antisperm antibodies (ASAs) have been associated with infertility in stallions. The objectives of this study were to investigate the frequency of ASA-positive semen samples in satisfactory and non-satisfactory breeder stallions, the association between ASA binding and semen quality, and factors that may affect the diagnosis. Breeding soundness examinations were performed in 21 stallions and the percentage of IgG- and IgA-bound spermatozoa was evaluated using flow cytometry. Median IgG and IgA binding did not differ between the first and second ejaculates. The percentage of IgA-bound spermatozoa was higher in non-satisfactory (n = 10) than satisfactory breeder stallions (n = 11). However, IgG binding or frequency of IgG-positive ejaculates did not differ with stallion classification. The IgG-positive stallions had significantly lower total sperm motility, concentration and total numbers than IgG-negative stallions in the first ejaculate, and lower sperm concentration in the second ejaculate. The IgA-positive stallions had lower total sperm motility, normal spermatozoa and total numbers than IgA-negative stallions in the first ejaculate, and lower total sperm motility, normal spermatozoa and total numbers in the second ejaculate. While IgG binding did not differ with season, IgA binding was higher in the non-breeding season (n = 6 stallions) than the breeding season (n = 15 stallions) in the first ejaculate. Stallion age did not differ with ASA classification. In conclusion, IgG binding was highly prevalent in both groups of stallions, while IgA binding was higher and more prevalent in non-satisfactory breeders. Both isotypes were associated with poor semen quality. Season and sexual rest had an effect on IgA but not IgG binding. Copyright © 2018 Elsevier Inc. All rights reserved.
Bucci, Enrico
2013-01-01
Hill’s plots of oxygen binding isotherms reveal the presence of a transition between two different oxygen affinities at the beginning and end of the isotherm. They correspond to the two conformations anticipated by the MWC model, namely the T and R conformations at the beginning and end of oxygen binding, when the lower affinity of the T form develops into the higher affinity of the R form. The difference between the binding Gibbs free energies changes of the two affinities (ΔGL) is the free energy of binding cooperativity. Notably ΔGL is positive in favor of the T form, that moves to a higher energy level upon oxygen release. Osmotic stress reveals a higher volume/surface ratio of deoxyHb, with a positive ΔGW also in favor of the T form . Increasing protein concentration shifts the isotherms to the right indicating the formation of intermediate polymeric forms. Enthalpy of the intermediates show a strong absorption of heat at the third oxygenation step due to polymers formation with quinary, and above, structures. The disassembly of intermediate polymers releases energy with a negative ΔG that compensates and allow the positivity of ΔGL. High energy polymers are the barrier preventing the relaxation of the T and R conformations into one another. The MWC allosteric model is the best justification of oxygen binding cooperativity . PMID:23710673
NASA Astrophysics Data System (ADS)
Kuperman, Marina V.; Losytskyy, Mykhaylo Yu.; Bykov, Alexander Yu.; Yarmoluk, Sergiy M.; Zhizhin, Konstantin Yu.; Kuznetsov, Nikolay T.; Varzatskii, Oleg A.; Gumienna-Kontecka, Elzbieta; Kovalska, Vladyslava B.
2017-08-01
The interactions of boron cluster compounds closo-borates with biomolecules are widely studied due to their efficiency as agents for boron neutron capture therapy of cancer. In present work the binding abilities of anionic halogen closo-borates [B10Hal10]2- (Hal = Cl, Br, I) and [B12Hal12]2- (Hal = Cl, I) towards bovine and human serum albumins were investigated by spectroscopic and isothermal titration calorimetry (ITC) methods. The protein fluorescence quenching method and ITC studies confirmed the complex formation. The degree of protein fluorescence quenching increased from chlorine to iodine boron derivatives that is attributed to external heavy atom effect. The ITC data point on the existence in the protein structure of two types of binding sites: with higher and lower affinity to closo-borates. Albumin-closo-borate complex binding ratio, n (4-5 anions per protein molecule) is higher than for the parent hydrogen closo-borates (2 anions per protein molecule). Binding constants estimated by fluorescent and ITC methods indicate higher affinity of halogen closo-borates to albumins (K in the range of 104-106 M-1) comparing to that of the hydrogen closo-borate (K about 103 M-1). Due to their high affinity and high binding ratio to albumins halogen closo-borates are proposed for further studies as agents for boron neutron capture therapy.
The role of RNA structure in the interaction of U1A protein with U1 hairpin II RNA
Law, Michael J.; Rice, Andrew J.; Lin, Patti; Laird-Offringa, Ite A.
2006-01-01
The N-terminal RNA Recognition Motif (RRM1) of the spliceosomal protein U1A interacting with its target U1 hairpin II (U1hpII) has been used as a paradigm for RRM-containing proteins interacting with their RNA targets. U1A binds to U1hpII via direct interactions with a 7-nucleotide (nt) consensus binding sequence at the 5′ end of a 10-nt loop, and via hydrogen bonds with the closing C–G base pair at the top of the RNA stem. Using surface plasmon resonance (Biacore), we have examined the role of structural features of U1hpII in binding to U1A RRM1. Mutational analysis of the closing base pair suggests it plays a minor role in binding and mainly prevents “breathing” of the loop. Lengthening the stem and nontarget part of the loop suggests that the increased negative charge of the RNA might slightly aid association. However, this is offset by an increase in dissociation, which may be caused by attraction of the RRM to nontarget parts of the RNA. Studies of a single stranded target and RNAs with untethered loops indicate that structure is not very relevant for association but is important for complex stability. In particular, breaking the link between the stem and the 5′ side of the loop greatly increases complex dissociation, presumably by hindering simultaneous contacts between the RRM and stem and loop nucleotides. While binding of U1A to a single stranded target is much weaker than to U1hpII, it occurs with nanomolar affinity, supporting recent evidence that binding of unstructured RNA by U1A has physiological significance. PMID:16738410
The role of RNA structure in the interaction of U1A protein with U1 hairpin II RNA.
Law, Michael J; Rice, Andrew J; Lin, Patti; Laird-Offringa, Ite A
2006-07-01
The N-terminal RNA Recognition Motif (RRM1) of the spliceosomal protein U1A interacting with its target U1 hairpin II (U1hpII) has been used as a paradigm for RRM-containing proteins interacting with their RNA targets. U1A binds to U1hpII via direct interactions with a 7-nucleotide (nt) consensus binding sequence at the 5' end of a 10-nt loop, and via hydrogen bonds with the closing C-G base pair at the top of the RNA stem. Using surface plasmon resonance (Biacore), we have examined the role of structural features of U1hpII in binding to U1A RRM1. Mutational analysis of the closing base pair suggests it plays a minor role in binding and mainly prevents "breathing" of the loop. Lengthening the stem and nontarget part of the loop suggests that the increased negative charge of the RNA might slightly aid association. However, this is offset by an increase in dissociation, which may be caused by attraction of the RRM to nontarget parts of the RNA. Studies of a single stranded target and RNAs with untethered loops indicate that structure is not very relevant for association but is important for complex stability. In particular, breaking the link between the stem and the 5' side of the loop greatly increases complex dissociation, presumably by hindering simultaneous contacts between the RRM and stem and loop nucleotides. While binding of U1A to a single stranded target is much weaker than to U1hpII, it occurs with nanomolar affinity, supporting recent evidence that binding of unstructured RNA by U1A has physiological significance.
Shenoy, Siddharth S.; Nanda, Hirsh; Lösche, Mathias
2012-01-01
The phosphatidylinositolphosphate phosphatase PTEN is the second most frequently mutated protein in human tumors. Its membrane association, allosteric activation and membrane dissociation are poorly understood. We recently reported PTEN binding affinities to membranes of different compositions and a preliminary investigation of the protein-membrane complex with neutron reflectometry (NR). Here we use NR to validate molecular dynamics (MD) simulations of the protein and study conformational differences of the protein in solution and on anionic membranes. NR shows that full-length PTEN binds to such membranes roughly in the conformation and orientation suggested by the crystal structure of a truncated PTEN protein, in contrast with a recently presented model which suggested that membrane binding depends critically on the SUMOylation of the CBR3 loop of PTEN’s C2 domain. Our MD simulations confirm that PTEN is peripherally bound to the bilayer surface and show slight differences of the protein structure in solution and in the membrane-bound state, where the protein body flattens against the bilayer surface. PTEN’s C2 domain binds phosphatidylserine (PS) tightly through its CBR3 loop, and its phosphatase domain also forms electrostatic interactions with PS. NR and MD results show consistently that PTEN’s unstructured, anionic C-terminal tail is repelled from the bilayer surface. In contrast, this tail is tightly tugged against the C2 domain in solution, partially obstructing the membrane-binding interface of the protein. Arresting the C-terminal tail in this conformation by phosphorylation may provide a control mechanism for PTEN’s membrane binding and activity. PMID:23073177
Im, Young Jun; Kim, Jeong-Il; Shen, Yu; Na, Young; Han, Yun-Jeong; Kim, Seong-Hee; Song, Pill-Soon; Eom, Soo Hyun
2004-10-22
In plants, nucleoside diphosphate kinases (NDPKs) play a key role in the signaling of both stress and light. However, little is known about the structural elements involved in their function. Of the three NDPKs (NDPK1-NDPK3) expressed in Arabidopsis thaliana, NDPK2 is involved in phytochrome-mediated signal transduction. In this study, we found that the binding of dNDP or NTP to NDPK2 strengthens the interaction significantly between activated phytochrome and NDPK2. To better understand the structural basis of the phytochrome-NDPK2 interaction, we determined the X-ray structures of NDPK1, NDPK2, and dGTP-bound NDPK2 from A.thaliana at 1.8A, 2.6A, and 2.4A, respectively. The structures showed that nucleotide binding caused a slight conformational change in NDPK2 that was confined to helices alphaA and alpha2. This suggests that the presence of nucleotide in the active site and/or the evoked conformational change contributes to the recognition of NDPK2 by activated phytochrome. In vitro binding assays showed that only NDPK2 interacted specifically with the phytochrome and the C-terminal regulatory domain of phytochrome is involved in the interaction. A domain swap experiment between NDPK1 and NDPK2 showed that the variable C-terminal region of NDPK2 is important for the activation by phytochrome. The structure of Arabidopsis NDPK1 and NDPK2 showed that the isoforms share common electrostatic surfaces at the nucleotide-binding site, but the variable C-terminal regions have distinct electrostatic charge distributions. These findings suggest that the binding of nucleotide to NDPK2 plays a regulatory role in phytochrome signaling and that the C-terminal extension of NDPK2 provides a potential binding surface for the specific interaction with phytochromes.
Shenoy, Siddharth S; Nanda, Hirsh; Lösche, Mathias
2012-12-01
The phosphatidylinositolphosphate phosphatase PTEN is the second most frequently mutated protein in human tumors. Its membrane association, allosteric activation and membrane dissociation are poorly understood. We recently reported PTEN binding affinities to membranes of different compositions (Shenoy et al., 2012, PLoS ONE 7, e32591) and a preliminary investigation of the protein-membrane complex with neutron reflectometry (NR). Here we use NR to validate molecular dynamics (MD) simulations of the protein and study conformational differences of the protein in solution and on anionic membranes. NR shows that full-length PTEN binds to such membranes roughly in the conformation and orientation suggested by the crystal structure of a truncated PTEN protein, in contrast with a recently presented model which suggested that membrane binding depends critically on the SUMOylation of the CBR3 loop of PTEN's C2 domain. Our MD simulations confirm that PTEN is peripherally bound to the bilayer surface and show slight differences of the protein structure in solution and in the membrane-bound state, where the protein body flattens against the bilayer surface. PTEN's C2 domain binds phosphatidylserine (PS) tightly through its CBR3 loop, and its phosphatase domain also forms electrostatic interactions with PS. NR and MD results show consistently that PTEN's unstructured, anionic C-terminal tail is repelled from the bilayer surface. In contrast, this tail is tightly tugged against the C2 domain in solution, partially obstructing the membrane-binding interface of the protein. Arresting the C-terminal tail in this conformation by phosphorylation may provide a control mechanism for PTEN's membrane binding and activity. Copyright © 2012 Elsevier Inc. All rights reserved.
Flow Cytometric Determination of Panton-Valentine Leucocidin S Component Binding
Gauduchon, Valérie; Werner, Sandra; Prévost, Gilles; Monteil, Henri; Colin, Didier A.
2001-01-01
The binding of the S component (LukS-PV) from the bicomponent staphylococcal Panton-Valentine leucocidin to human polymorphonuclear neutrophils (PMNs) and monocytes was determined using flow cytometry and a single-cysteine substitution mutant of LukS-PV. The mutant was engineered by replacing a glycine at position 10 with a cysteine and was labeled with a fluorescein moiety. The biological activity of the mutant was identical to that of the native protein. It has been shown that LukS-PV has a high affinity for PMNs (Kd = 0.07 ± 0.02 nM, n = 5) and monocytes (Kd = 0.020 ± 0.003 nM, n = 3) with maximal binding capacities of 197,000 and 80,000 LukS-PV molecules per cell, respectively. The nonspecifically bound molecules of LukS-PV do not form pores in the presence of the F component (LukF-PV) of leucocidin. LukS-PV and HlgC share the same receptor on PMNs, but the S components of other staphylococcal leukotoxins, HlgA, LukE, and LukM, do not compete with LukS-PV for its receptor. Extracellular Ca2+ at physiological concentrations (1 to 2 nM) has only a slight influence on the LukS-PV binding, in contrast to its complete inhibition by Zn2+. The down-regulation by phorbol 12-myristate 13-acetate (PMA) of the binding of LukS-PV was blocked by staurosporine, suggesting that the regulatory effect of PMA depends on protein kinase C activation. The labeled mutant form of LukS-PV has proved very useful for detailed binding studies of circulating white cells by flow cytometry. LukS-PV possesses a high specific affinity for a unique receptor on PMNs and monocytes. PMID:11254598
Theoretical Analysis of Allosteric and Operator Binding for Cyclic-AMP Receptor Protein Mutants
NASA Astrophysics Data System (ADS)
Einav, Tal; Duque, Julia; Phillips, Rob
2018-02-01
Allosteric transcription factors undergo binding events both at their inducer binding sites as well as at distinct DNA binding domains, and it is often difficult to disentangle the structural and functional consequences of these two classes of interactions. In this work, we compare the ability of two statistical mechanical models - the Monod-Wyman-Changeux (MWC) and the Koshland-N\\'emethy-Filmer (KNF) models of protein conformational change - to characterize the multi-step activation mechanism of the broadly acting cyclic-AMP receptor protein (CRP). We first consider the allosteric transition resulting from cyclic-AMP binding to CRP, then analyze how CRP binds to its operator, and finally investigate the ability of CRP to activate gene expression. In light of these models, we examine data from a beautiful recent experiment that created a single-chain version of the CRP homodimer, thereby enabling each subunit to be mutated separately. Using this construct, six mutants were created using all possible combinations of the wild type subunit, a D53H mutant subunit, and an S62F mutant subunit. We demonstrate that both the MWC and KNF models can explain the behavior of all six mutants using a small, self-consistent set of parameters. In comparing the results, we find that the MWC model slightly outperforms the KNF model in the quality of its fits, but more importantly the parameters inferred by the MWC model are more in line with structural knowledge of CRP. In addition, we discuss how the conceptual framework developed here for CRP enables us to not merely analyze data retrospectively, but has the predictive power to determine how combinations of mutations will interact, how double mutants will behave, and how each construct would regulate gene expression.
Aminoglycosylation Can Enhance the G-Quadruplex Binding Activity of Epigallocatechin
Bai, Li-Ping; Ho, Hing-Man; Ma, Dik-Lung; Yang, Hui; Fu, Wai-Chung; Jiang, Zhi-Hong
2013-01-01
With the aim of enhancing G-quadruplex binding activity, two new glucosaminosides (16, 18) of penta-methylated epigallocatechin were synthesized by chemical glycosylation. Subsequent ESI-TOF-MS analysis demonstrated that these two glucosaminoside derivatives exhibit much stronger binding activity to human telomeric DNA and RNA G-quadruplexes than their parent structure (i.e., methylated EGC) (14) as well as natural epigallocatechin (EGC, 6). The DNA G-quadruplex binding activity of 16 and 18 is even more potent than strong G-quadruplex binder quercetin, which has a more planar structure. These two synthetic compounds also showed a higher binding strength to human telomeric RNA G-quadruplex than its DNA counterpart. Analysis of the structure-activity relationship revealed that the more basic compound, 16, has a higher binding capacity with DNA and RNA G-quadruplexes than its N-acetyl derivative, 18, suggesting the importance of the basicity of the aminoglycoside for G-quadruplex binding activity. Molecular docking simulation predicted that the aromatic ring of 16 π-stacks with the aromatic ring of guanine nucleotides, with the glucosamine moiety residing in the groove of G-quadruplex. This research indicates that glycosylation of natural products with aminosugar can significantly enhance their G-quadruplex binding activities, thus is an effective way to generate small molecules targeting G-quadruplexes in nucleic acids. In addition, this is the first report that green tea catechin can bind to nucleic acid G-quadruplex structures. PMID:23335983
Attia, Mohamed I; Güclü, Deniz; Hertlein, Barbara; Julius, Justin; Witt-Enderby, Paula A; Zlotos, Darius P
2007-07-07
A structure for the self-condensation product of 2-(1H-indol-2-yl)ethyl tosylate 2a, previously proposed as 6,7,14,15-tetrahydro-15aH-azocino[1,2-a:6,5-b]diindole 3a, was revised based on the (13)C-2D-INADEQUATE experiment, and proved to be 7,7a,13,14-tetrahydro-6H-cyclobuta[b]pyrimido[1,2-a:3,4-a']diindole 4a. A mechanism for the unexpected formation of this novel hexacyclic heterocycle was proposed and its NMR solution structure was elucidated. Five derivatives of the title ring skeleton 12-16 designed as melatonin receptor ligands were synthesized and their affinities for the human MT(1) and MT(2) receptors were determined. Both butyramides 13 and 15, as well as the non-methoxy acetamide 12 exhibited micromolar binding affinities for both receptors being slightly MT(2) selective. The methoxy acetamide 14 showed the best pharmacological profile exhibiting a five times higher affinity for MT(1) (K(i) = 49 nM) than for MT(2) (K(i) = 246 nM) receptor.
Kou, Xianjuan; Qi, Shimei; Dai, Wuxing; Luo, Lan; Yin, Zhimin
2011-08-01
Arctigenin has been demonstrated to have an anti-inflammatory function, but the precise mechanisms of its action remain to be fully defined. In the present study, we determined the effects of arctigenin on lipopolysaccharide (LPS)-induced production of proinflammatory mediators and the underlying mechanisms involved in RAW264.7 cells. Our results indicated that arctigenin exerted its anti-inflammatory effect by inhibiting ROS-dependent STAT signaling through its antioxidant activity. Arctigenin also significantly reduced the phosphorylation of STAT1 and STAT 3 as well as JAK2 in LPS-stimulated RAW264.7 cells. The inhibitions of STAT1 and STAT 3 by arctigenin prevented their translocation to the nucleus and consequently inhibited expression of iNOS, thereby suppressing the expression of inflammation-associated genes, such as IL-1β, IL-6 and MCP-1, whose promoters contain STAT-binding elements. However, COX-2 expression was slightly inhibited at higher drug concentrations (50 μM). Our data demonstrate that arctigenin inhibits iNOS expression via suppressing JAK-STAT signaling pathway in macrophages. Crown Copyright © 2011. Published by Elsevier B.V. All rights reserved.
Salar, Safoura; Mehrnejad, Faramarz; Sajedi, Reza H; Arough, Javad Mohammadnejad
2017-10-01
Herein, we investigated the effect of the chitosan nanoparticles (CsNP) on the structure, dynamics, and activity of trypsin. The enzyme activity in complex with the nanoparticles slightly increased, which represents the interactions between the nanoparticles and the enzyme. The kinetic parameters of the enzyme, K m and k cat , increased after adding the nanoparticles, resulting in a slight increase in the catalytic efficiency (k cat /K m ). However, the effect of the nanoparticles on the kinetic stability of trypsin has not exhibited significant variations. Fluorescence spectroscopy did not show remarkable changes in the trypsin conformation in the presence of the nanoparticles. The circular dichroism (CD) spectroscopy results also revealed the secondary structure of trypsin attached to the nanoparticles slightly changed. Furthermore, we used molecular dynamics (MD) simulation to find more information about the interaction mechanisms between the nanoparticles and trypsin. The root mean square deviation (RMSD) of Cα atoms results have shown that in the presence of the nanoparticles, trypsin was stable. The simulation and the calculation of the binding free energy demonstrate that the nonpolar interactions are the most important forces for the formation of stable nanoparticle-trypsin complex. This study has explicitly elucidated that the nanoparticles have not considerable effect on the trypsin. Copyright © 2017. Published by Elsevier B.V.
Detection of koala retrovirus subgroup B (KoRV-B) in animals housed at European zoos.
Fiebig, Uwe; Keller, Martina; Denner, Joachim
2016-12-01
Many koalas carry an endogenous retrovirus, KoRV-A, in their genome. Recently, a second retrovirus, KoRV-B, was detected in koalas in Japanese and U.S. zoos. However, this virus is not endogenous, differs in the receptor binding site of the surface envelope protein, and uses a receptor different from that of KoRV-A. We describe here a KoRV-B found in koalas at zoos in Germany and Belgium that differs slightly from that found in the Los Angeles zoo.
Characterization of commercial supercapacitors for low temperature applications
NASA Astrophysics Data System (ADS)
Iwama, E.; Taberna, P. L.; Azais, P.; Brégeon, L.; Simon, P.
2012-12-01
Electrochemical characterizations at low temperature and floating tests have been performed on 600F commercial supercapacitor (SC) for acetonitrile (AN)-based and AN + methyl acetate (MA) mixed electrolytes. From -40 to +20 °C, AN electrolyte showed slightly higher capacitance than those of AN + MA mixed electrolytes (25 and 33 vol.% of MA). At -55 °C, however, AN electrolyte did not cycle at all, while MA mixed electrolyte normally cycled with a slight decrease in their capacitance. From electrochemical impedance spectroscopy measurements, the whole resistance for AN-based cells at -55 °C was found to be about 10,000 times higher than that of +20 °C, while a 40-fold increase in the cell resistance was obtained for the MA mixture between 20 and -55 °C. From the results of floating tests at 2.7 V and 60 °C for 1 month, the 25 vol.% MA mixture showed no change and slight decreased but stable capacitance.
Robust labeling and comparative preclinical characterization of DOTA-TOC and DOTA-TATE.
Velikyan, Irina; Xu, Hui; Nair, Manoj; Hall, Håkan
2012-07-01
Various radionuclide-labeled somatostatin analogues are used currently for diagnosis and therapy of neuroendocrine tumors. In particular, [68Ga]Ga-DOTA-TOC is commonly used for diagnosis, while [177Lu]Lu-DOTA-TATE is used for therapy. With the development of theranostics and personalized medicine where the imaging diagnosis is tailored to the subsequent radiotherapy, it is of paramount importance to investigate the relevance of the ligand exchange. The aim of this study was to compare binding capacity of [67/68Ga]Ga-DOTA-TOC ([67/68Ga]Ga-N-(4,7,10-(tris(carboxymethyl)-1,4,7,10-tetraazacyclododecan-1-yl)acetyl-D-Phe-c[Cys-D-Tyr-Trp-Lys-Thr-Cys]-Thr(ol)) and [67/68Ga]Ga-DOTA-TATE ([67/68Ga]Ga-N-(4,7,10-(tris(carboxymethyl)-1,4,7,10-tetraazacyclododecan-1-yl)acetyl-D-Phe-c[Cys-D-Tyr-Trp-Lys-Thr-Cys]-Thr) in vitro in monkey brain cryosections and in vivo in the rat, where, in contrast to transfected cell lines, there is a heterogeneous distribution of somatostatin receptor (SSTR) subtypes. The influence of various production methods of [68Ga]Ga-DOTA-TOC and [68Ga]Ga-DOTA-TATE on the biological performance of the tracers was also studied. [67Ga]Ga-DOTA-TOC, [68Ga]Ga-DOTA-TOC, [67Ga]Ga-DOTA-TATE and [68Ga]Ga-DOTA-TATE were synthesized including preconcentration and purification of the generator eluate. The binding of the radioligands was assessed in vitro using autoradiography on cryosections of Rhesus monkey brains and in vivo/ex vivo using organ distribution studies in rats. The tracer production method was improved in terms of higher robustness, simplification and good manufacturing practice (GMP) relevance. The synthesis variation did not influence the biological performance of the tracers. There was no statistically significant difference observed in the binding of [67/68Ga]Ga-DOTA-TOC and [67/68Ga]Ga-DOTA-TATE either in brain cortex in vitro or in rat biodistribution and uptake in SSTR-positive tissues such as pancreas, adrenals and pituitary. The uptake in these organs was precluded by the excess of octreotide (Sandostatin). The 10-fold higher affinity to SSTR2 of DOTA-TATE as compared to DOTA-TOC known from studies in transfected cells was reflected in a slightly more intense binding of [67/68Ga]Ga-DOTA-TATE than of [67/68Ga]Ga-DOTA-TOC in the monkey brain sections in vitro, but not in vivo in the rat. A robust 68Ga-labeling method was introduced. The difference in the uptake of [67/68Ga]Ga-DOTA-TOC and [67/68Ga]Ga-DOTA-TATE in SSTR2-positive organs was not statistically significant either in vitro in tissue studies or in vivo/ex vivo in rat experiments. The results indicate that the more complex environment in vitro and in vivo diminishes the difference observed in transfected cell line binding. Copyright © 2012 Elsevier Inc. All rights reserved.
The role of height in the sex difference in intelligence.
Kanazawa, Satoshi; Reyniers, Diane J
2009-01-01
Recent studies conclude that men on average have higher intelligence than women by 3-5 IQ points. However, the ultimate evolutionary question of why men should have evolved to have higher intelligence than women remains. We suggest that men may have slightly higher intelligence than women through 4 mechanisms: (1) assortative mating of intelligent men and beautiful women, (2) assortative mating of tall men and beautiful women, (3) an extrinsic correlation between height and intelligence produced by Mechanisms 1 and 2, and (4) a higher-than-expected offspring sex ratio (more sons) among tall (and hence intelligent) parents. Consistent with our suggestion, we show that men may have higher IQs than women because they are taller, and once we control for height women have slightly higher IQs than men.The correlation between height and IQ and the female advantage in intelligence persist even after we control for health as a measure of genetic quality, as well as physical attractiveness, age, race, education, and earnings. Height is also strongly associated with intelligence within each sex.
Gamma Interferon-Induced Guanylate Binding Protein 1 Is a Novel Actin Cytoskeleton Remodeling Factor
Ostler, Nicole; Britzen-Laurent, Nathalie; Liebl, Andrea; Naschberger, Elisabeth; Lochnit, Günter; Ostler, Markus; Forster, Florian; Kunzelmann, Peter; Ince, Semra; Supper, Verena; Praefcke, Gerrit J. K.; Schubert, Dirk W.; Stockinger, Hannes; Herrmann, Christian
2014-01-01
Gamma interferon (IFN-γ) regulates immune defenses against viruses, intracellular pathogens, and tumors by modulating cell proliferation, migration, invasion, and vesicle trafficking processes. The large GTPase guanylate binding protein 1 (GBP-1) is among the cellular proteins that is the most abundantly induced by IFN-γ and mediates its cell biologic effects. As yet, the molecular mechanisms of action of GBP-1 remain unknown. Applying an interaction proteomics approach, we identified actin as a strong and specific binding partner of GBP-1. Furthermore, GBP-1 colocalized with actin at the subcellular level and was both necessary and sufficient for the extensive remodeling of the fibrous actin structure observed in IFN-γ-exposed cells. These effects were dependent on the oligomerization and the GTPase activity of GBP-1. Purified GBP-1 and actin bound to each other, and this interaction was sufficient to impair the formation of actin filaments in vitro, as demonstrated by atomic force microscopy, dynamic light scattering, and fluorescence-monitored polymerization. Cosedimentation and band shift analyses demonstrated that GBP-1 binds robustly to globular actin and slightly to filamentous actin. This indicated that GBP-1 may induce actin remodeling via globular actin sequestering and/or filament capping. These results establish GBP-1 as a novel member within the family of actin-remodeling proteins specifically mediating IFN-γ-dependent defense strategies. PMID:24190970
Ostler, Nicole; Britzen-Laurent, Nathalie; Liebl, Andrea; Naschberger, Elisabeth; Lochnit, Günter; Ostler, Markus; Forster, Florian; Kunzelmann, Peter; Ince, Semra; Supper, Verena; Praefcke, Gerrit J K; Schubert, Dirk W; Stockinger, Hannes; Herrmann, Christian; Stürzl, Michael
2014-01-01
Gamma interferon (IFN-γ) regulates immune defenses against viruses, intracellular pathogens, and tumors by modulating cell proliferation, migration, invasion, and vesicle trafficking processes. The large GTPase guanylate binding protein 1 (GBP-1) is among the cellular proteins that is the most abundantly induced by IFN-γ and mediates its cell biologic effects. As yet, the molecular mechanisms of action of GBP-1 remain unknown. Applying an interaction proteomics approach, we identified actin as a strong and specific binding partner of GBP-1. Furthermore, GBP-1 colocalized with actin at the subcellular level and was both necessary and sufficient for the extensive remodeling of the fibrous actin structure observed in IFN-γ-exposed cells. These effects were dependent on the oligomerization and the GTPase activity of GBP-1. Purified GBP-1 and actin bound to each other, and this interaction was sufficient to impair the formation of actin filaments in vitro, as demonstrated by atomic force microscopy, dynamic light scattering, and fluorescence-monitored polymerization. Cosedimentation and band shift analyses demonstrated that GBP-1 binds robustly to globular actin and slightly to filamentous actin. This indicated that GBP-1 may induce actin remodeling via globular actin sequestering and/or filament capping. These results establish GBP-1 as a novel member within the family of actin-remodeling proteins specifically mediating IFN-γ-dependent defense strategies.
Zhou, Kai-Li; Pan, Dong-Qi; Lou, Yan-Yue; Shi, Jie-Hua
2018-04-16
The intermolecular interaction of fosinopril, an angiotensin converting enzyme inhibitor with bovine serum albumin (BSA), has been investigated in physiological buffer (pH 7.4) by multi-spectroscopic methods and molecular docking technique. The results obtained from fluorescence and UV absorption spectroscopy revealed that the fluorescence quenching mechanism of BSA induced by fosinopril was mediated by the combined dynamic and static quenching, and the static quenching was dominant in this system. The binding constant, K b , value was found to lie between 2.69 × 10 3 and 9.55 × 10 3 M -1 at experimental temperatures (293, 298, 303, and 308 K), implying the low or intermediate binding affinity between fosinopril and BSA. Competitive binding experiments with site markers (phenylbutazone and diazepam) suggested that fosinopril preferentially bound to the site I in sub-domain IIA on BSA, as evidenced by molecular docking analysis. The negative sign for enthalpy change (ΔH 0 ) and entropy change (ΔS 0 ) indicated that van der Waals force and hydrogen bonds played important roles in the fosinopril-BSA interaction, and 8-anilino-1-naphthalenesulfonate binding assay experiments offered evidence of the involvements of hydrophobic interactions. Moreover, spectroscopic results (synchronous fluorescence, 3-dimensional fluorescence, and Fourier transform infrared spectroscopy) indicated a slight conformational change in BSA upon fosinopril interaction. Copyright © 2018 John Wiley & Sons, Ltd.
NASA Astrophysics Data System (ADS)
Wu, Hai; Chen, Miaomiao; Shang, Mengting; Li, Xiang; Mu, Kui; Fan, Suhua; Jiang, Shuanglin; Li, Wenyong
2018-07-01
Black carbon (BC) is a main component of particulate matter (PM2.5). Due to their small size (<100 nm), inhaled ultrafine BC nanoparticles may penetrate the lung alveoli, where they interact with surfactant proteins and lipids, causing more serious damage to human health. Here, BC was analyzed to investigate the binding mechanism of its interaction with protein and induction of cytotoxicity changes. The binding process and protein conformation between BC and a serum protein (bovine serum albumin, BSA) were monitored by using a fluorescence quenching technique and UV-vis absorption, Fourier transform infrared (FTIR) and circular dichroism (CD) spectroscopies. The experimental results revealed that the fluorescence quenching of BSA induced by BC was a static quenching process and the hydrophobic force played the critical role in the interaction. The native conformation of BSA on the BC surface was slightly disturbed but obvious structural unfolding of the secondary structure did not occur. In the cytotoxicity study, BC nanoparticles with low concentrations exhibited strong toxicity towards BEAS-2B cells. However, the toxicity of BC nanoparticles could be mitigated by the presence of BSA. Therefore, proteins in biological fluids likely reduce the toxic effect of BC on human health. These findings delineated the binding mechanism and the toxicity between BC and the BSA-BC system, contributing to the understanding of the biological effects of BC exposure on human health in polluted atmospheres.
Escherichia coli mutants impaired in maltodextrin transport.
Wandersman, C; Schwartz, M; Ferenci, T
1979-10-01
Wild-type Escherichia coli K-12 was found to grow equally well on maltose and on maltodextrins containing up to seven glucose residues. Three classes of mutants unable to grow on maltodextrins, but still able to grow on maltose, were investigated in detail. The first class, already known, was composed of phage lambda-resistant mutants, which lack the outer membrane protein coded by gene lamB. These mutants grow on maltose and maltotriose but not at all on maltotetraose and longer maltodextrins which cannot cross the outer membrane. A second class of mutants were affected in malE, the structural gene of the periplasmic maltose binding protein. The maltose binding proteins isolated from the new mutants were altered in their substrate binding properties, but not in a way that could account for the mutant phenotypes. Rather, the results of growth experiments and transport studies suggest that these malE mutants are impaired in their ability to transport maltodextrins across the outer membrane. This implies that the maltose binding protein (in wild-type strains) cooperates with the lambda receptor in permeation through the outer membrane. The last class of mutants described in this paper were affected in malG, or perhaps in an as yet undetected gene close to malG. They were defective in the transfer of maltodextrins from the periplasmic space to the cytoplasm but only slightly affected in the transport of maltose.
Leone, Francisco A; Bezerra, Thais M S; Garçon, Daniela P; Lucena, Malson N; Pinto, Marcelo R; Fontes, Carlos F L; McNamara, John C
2014-01-01
We investigate the synergistic stimulation by K(+) plus NH4 (+) of (Na(+), K(+))-ATPase activity in microsomal preparations of whole zoea I and decapodid III, and in juvenile and adult river shrimp gills. Modulation of (Na(+), K(+))-ATPase activity is ontogenetic stage-specific, and particularly distinct between juveniles and adults. Although both gill enzymes exhibit two different sites for K(+) and NH4 (+) binding, in the juvenile enzyme, these two sites are equivalent: binding by both ions results in slightly stimulated activity compared to that of a single ionic species. In the adult enzyme, the sites are not equivalent: when one ion occupies its specific binding site, (Na(+), K(+))-ATPase activity is stimulated synergistically by ≈ 50% on binding of the complementary ion. Immunolocalization reveals the enzyme to be distributed predominantly throughout the intralamellar septum in the gill lamellae of juveniles and adults. Western blot analyses demonstrate a single immunoreactive band, suggesting a single (Na(+), K(+))-ATPase α-subunit isoform that is distributed into different density membrane fractions, independently of ontogenetic stage. We propose a model for the modulation by K(+) and NH4 (+) of gill (Na(+), K(+))-ATPase activity. These findings suggest that the gill enzyme may be regulated by NH4 (+) during ontogenetic development in M. amazonicum.
Leone, Francisco A.; Bezerra, Thais M. S.; Garçon, Daniela P.; Lucena, Malson N.; Pinto, Marcelo R.; Fontes, Carlos F. L.; McNamara, John C.
2014-01-01
We investigate the synergistic stimulation by K+ plus NH4 + of (Na+, K+)-ATPase activity in microsomal preparations of whole zoea I and decapodid III, and in juvenile and adult river shrimp gills. Modulation of (Na+, K+)-ATPase activity is ontogenetic stage-specific, and particularly distinct between juveniles and adults. Although both gill enzymes exhibit two different sites for K+ and NH4 + binding, in the juvenile enzyme, these two sites are equivalent: binding by both ions results in slightly stimulated activity compared to that of a single ionic species. In the adult enzyme, the sites are not equivalent: when one ion occupies its specific binding site, (Na+, K+)-ATPase activity is stimulated synergistically by ≈50% on binding of the complementary ion. Immunolocalization reveals the enzyme to be distributed predominantly throughout the intralamellar septum in the gill lamellae of juveniles and adults. Western blot analyses demonstrate a single immunoreactive band, suggesting a single (Na+, K+)-ATPase α-subunit isoform that is distributed into different density membrane fractions, independently of ontogenetic stage. We propose a model for the modulation by K+ and NH4 + of gill (Na+, K+)-ATPase activity. These findings suggest that the gill enzyme may be regulated by NH4 + during ontogenetic development in M. amazonicum. PMID:24586919
Huang, Huan; McIntosh, Avery L.; Martin, Gregory G.; Landrock, Kerstin K.; Landrock, Danilo; Gupta, Shipra; Atshaves, Barbara P.; Kier, Ann B.; Schroeder, Friedhelm
2014-01-01
The human liver fatty acid binding protein (L-FABP) T94A variant, the most common in the FABP family, has been associated with elevated liver triglyceride (TG) levels. How this amino acid substitution elicits these effects is not known. This issue was addressed with human recombinant wild-type (WT, T94T) and T94A variant L-FABP proteins as well as cultured primary human hepatocytes expressing the respective proteins (genotyped as TT, TC, and CC). T94A substitution did not or only slightly alter L-FABP binding affinities for saturated, monounsaturated, or polyunsaturated long chain fatty acids (LCFA), nor did it change the affinity for intermediates in TG synthesis. Nevertheless, T94A substitution markedly altered the secondary structural response of L-FABP induced by binding LCFA or intermediates of TG synthesis. Finally, T94A substitution markedly diminished polyunsaturated fatty acid, eicosapentaenoic acid (EPA) or docosahexaenoic acid (DHA), induction of peroxisome proliferator-activated receptor alpha (PPARα) - regulated proteins such as L-FABP, fatty acid transport protein 5 (FATP5), and PPARα itself in cultured primary human hepatocytes. Thus, while T94A substitution did not alter the affinity of human L-FABP for LCFAs, it significantly altered human L-FABP structure and stability as well as conformational and functional response to these ligands. PMID:24628888
Competition for DNA binding sites using Promega DNA IQ™ paramagnetic beads.
Frégeau, Chantal J; De Moors, Anick
2012-09-01
The Promega DNA IQ™ system is easily amenable to automation and has been an integral part of standard operating procedures for many forensic laboratories including those of the Royal Canadian Mounted Police (RCMP) since 2004. Due to some failure to extract DNA from samples that should have produced DNA using our validated automated DNA IQ™-based protocol, the competition for binding sites on the DNA IQ™ magnetic beads was more closely examined. Heme from heavily blooded samples interfered slightly with DNA binding. Increasing the concentration of Proteinase K during lysis of these samples did not enhance DNA recovery. However, diluting the sample lysate following lysis prior to DNA extraction overcame the reduction in DNA yield and preserved portions of the lysates for subsequent manual or automated extraction. Dye/chemicals from black denim lysates competed for binding sites on the DNA IQ™ beads and significantly reduced DNA recovery. Increasing the size or number of black denim cuttings during lysis had a direct adverse effect on DNA yield from various blood volumes. The dilution approach was successful on these samples and permitted the extraction of high DNA yields. Alternatively, shortening the incubation time for cell lysis to 30 min instead of the usual overnight at 56 °C prevented competition from black denim dye/chemicals and increased DNA yields. Crown Copyright © 2011. Published by Elsevier Ireland Ltd. All rights reserved.
Cellular distribution of calmodulin and calmodulin-binding proteins in Vicia faba L
NASA Technical Reports Server (NTRS)
Ling, V.; Assmann, S. M.
1992-01-01
The distribution of calmodulin (CaM) and CaM-binding proteins within Vicia faba was investigated. Both CaM and CaM-binding proteins were found to be differentially distributed among organs, tissues, and protoplast types. CaM levels, on a per protein basis, were found to be the highest in leaf epidermis, containing 3-fold higher levels of CaM than in total leaf. Similarly, guard cell and epidermal cell protoplasts were also found to have higher levels of CaM than mesophyll cell protoplasts. 125I-CaM blot overlay assays were performed to qualitatively examine CaM-binding proteins in these protoplast types as well as in whole tissues and organs. CaM-binding proteins with Mr 52,000, 78,000, and 115,000 were common in all metabolically active plant parts. Unique CaM-binding protein bands were detected in guard cell protoplasts (Mr 39,000, 88,000), stems (Mr 45,000, 60,000, 64,000), and roots (Mr 62,000), suggesting the presence of specialized CaM-dependent processes in these cells and organs.
Chang, F. N.; Flaks, Joel G.
1972-01-01
The binding of dihydrostreptomycin to ribosomes and ribosomal subunits of a number of different Escherichia coli strains was studied, and the Mg2+ and pH dependence, as well as the effect of salts and polynucleotides, was determined. The only requirement for binding with ribosomes and subunits from susceptible strains was 10 mm Mg2+. Monovalent salts weakened the binding in a manner similar to the effects on ribonucleic acid secondary structure, and this was antagonized to some extent by increased amounts of Mg2+. Bound dihydrostreptomycin could be readily exchanged by streptomycin and any antibiotically active derivative, but not by fragments of the antibiotic or any other aminoglycoside. With native (run-off) 70S ribosomes from streptomycin-susceptible strains, the binding was rapid and relatively temperature independent over the range from 0 to 37 C. Polynucleotides did not stimulate the binding. With concentrations of dihydrostreptomycin up to 10−5m, greater than 95% of native 70S ribosomes bound exactly 1 molecule of the antibiotic tightly, with a Kdiss for the bound complex at 25 C of 9.4 × 10−8m. The following thermodynamic parameters were found for the binding with 70S ribosomes at 25 C:ΔG° = −9.6 kcal/mole, ΔH° = −6.2 kcal/mole, and ΔS° = +11.4 entropy units/mole. Differences in affinity for the antibiotic were found between ribosomes of K-12 strains and those of other E. coli strains. There was insignificant binding to 70S ribosomes or subunits from streptomycin-resistant or -dependent strains, and to 50S subunits from susceptible strains. The binding to 30S subunits from susceptible strains was weaker by an order of magnitude than that to the 70S particle, with a Kdiss at 25 C of 10−6m. Polyuridylic acid stimulated this binding slightly but did not influence the affinity of the bound molecule. At antibiotic concentrations above 10−5m, streptomycin-susceptible 70S and 30S particles bound additional molecules of the antibiotic, and binding also occurred to ribosomes from streptomycin-resistant and -dependent strains, as well as to 50S subunits from all strains. Kdiss for all of these binding equilibria were [Formula: see text] 10−4m. This weaker non-specific binding coincided with the beginning of aggregation phenomena involving the particles, and occurred at sites distinct from the single site which binds the antibiotic tightly. This latter site was completely lost after the one-step mutation to high-level resistance or dependence. PMID:4133236
Breves, Jason P.; Phipps-Costin, Silas K.; Fujimoto, Chelsea K.; Einarsdottir, Ingibjörg E.; Regish, Amy M.; Björnsson, Björn Thrandur; McCormick, Stephen
2016-01-01
The growth hormone (Gh)/insulin-like growth-factor (Igf) system plays a central role in the regulation of growth in fishes. However, the roles of Igf binding proteins (Igfbps) in coordinating responses to food availability are unresolved, especially in anadromous fishes preparing for seaward migration. We assayed plasma Gh, Igf1, thyroid hormones and cortisol along with igfbp mRNA levels in fasted and fed Atlantic salmon ( Salmo salar ). Fish were fasted for 3 or 10 days near the peak of smoltification (late April to early May). Fasting reduced plasma glucose by 3 days and condition factor by 10 days. Plasma Gh, cortisol, and thyroxine (T 4 ) were not altered in response to fasting, whereas Igf1 and 3,5,3′-triiodo- l -thyronine (T 3 ) were slightly higher and lower than controls, respectively. Hepatic igfbp1b1 , - 1b2 , - 2a , - 2b1 and - 2b2 mRNA levels were not responsive to fasting, but there were marked increases in igfbp1a1 following 3 and 10 days of fasting. Fasting did not alter hepatic igf1or igf2 ; however, muscle igf1 was diminished by 10 days of fasting. There were no signs that fasting compromised branchial ionoregulatory functions, as indicated by unchanged Na + /K + -ATPase activity and ion pump/transporter mRNA levels. We conclude that dynamic hepatic igfbp1a1 and muscle igf1 expression participate in the modulation of Gh/Igf signaling in smolts undergoing catabolism.
Ardestani, Masoud M; Ortiz, Maria Diez; van Gestel, Cornelis A M
2013-08-01
The present study sought to quantify the components of a biotic ligand model (BLM) for the effects of Cd on Folsomia candida (Collembola). Assuming that soil porewater is the main route of exposure and to exclude the effects of soil particles on metal availability, animals were exposed for 7 d to different Cd concentrations between 0.1 mM and 100 mM in simplified soil solutions at different Ca concentrations (0.2 mM, 0.8 mM, 3.2 mM, and 12.8 mM) or at different pH (5.0, 6.0, and 7.0). Higher Ca concentrations decreased the toxicity of Cd (adult survival) in test solutions, whereas toxicity was slightly lower at pH 7 and 6 than at pH 5, suggesting a mitigating effect of Ca and to a lesser extent pH on Cd toxicity to F. candida. Internal Cd concentrations in the animals increased with increasing exposure level but were significantly reduced by increasing Ca concentrations and were not significantly affected by pH. By using Langmuir isotherms, binding constants for Cd, Ca, and protons and the fraction of binding sites occupied by Cd were calculated and used to predict effects of Cd on survival. Predicted toxicity showed a good agreement with measured responses when Ca and pH were used as separate factors or combined together. The present study shows indications of protective effects of Ca but less of protons on the toxicity and uptake of Cd in F. candida on exposure to simplified soil solutions, which can be described using the principles of a biotic ligand model. Copyright © 2013 SETAC.
Rajasekaran, Ganesan; Kamalakannan, Radhakrishnan; Shin, Song Yub
2015-10-01
Temporin-1Tl (TL) is a 13-residue frog antimicrobial peptide (AMP) exhibiting potent antimicrobial and anti-inflammatory activity. To develop novel AMP with improved anti-inflammatory activity and antimicrobial selectivity, we designed and synthesized a series of TL analogs by substituting Trp, Arg and Lys at selected positions. Except for Escherichia coli and Staphylococcus epidermidis, all TL analogs exhibited retained or increased antimicrobial activity against seven bacterial strains including three methicillin-resistant Staphylococcus aureus strains compared with TL. TL-1 and TL-4 showed a little increase in antimicrobial selectivity, while TL-2 and TL-3 displayed slightly decreased antimicrobial selectivity because of their about twofold increased hemolytic activity. All TL analogs demonstrated greatly increased anti-inflammatory activity, evident by their higher inhibition of the production tumor necrosis factor-α (TNF-α) and nitric oxide and the mRNA expression of inducible nitric oxide synthase and TNF-α in lipopolysaccharide (LPS)-stimulated RAW264.7 macrophage cells, compared with TL. Taken together, the peptide anti-inflammatory activity is as follows: TL-2 ≈ TL-3 ≈ TL-4 > TL-1 > TL. In addition, LPS binding ability of the peptides corresponded with their anti-inflammatory activity. These results apparently suggest that the anti-inflammatory activity of TL analogs is associated with the direct binding ability between these peptides and LPS. Collectively, our designed TL analogs possess improved anti-inflammatory activity and retain antimicrobial activity without a significant increase in hemolysis. Therefore, it is evident that our TL analogs constitute promising candidates for the development of peptide therapeutics for gram-negative bacterial infection. Copyright © 2015 European Peptide Society and John Wiley & Sons, Ltd.
Tambara, Keiichi; Fujita, Masatoshi; Miyamoto, Shoichi; Doi, Kazuhiko; Nishimura, Kazunobu; Komeda, Masashi
2004-02-01
Heart-type cytoplasmic fatty acid-binding protein (H-FABP) has been reported as a sensitive and specific marker for the early diagnosis of acute myocardial infarction. Our hypothesis was that serum or pericardial fluid levels of H-FABP can reflect not only myocardial infarction but also myocardial ischemia. A total of 34 patients with unstable angina, who had anginal symptoms and/or ST-changes in ECG monitoring within 24 h before operation, were classified into group A (n=17), and those without these symptoms and changes into group B (n=17). Blood and pericardial fluid samples were obtained immediately after median sternotomy, and serum and pericardial fluid levels of creatine kinase-MB, cardiac troponin-T, and H-FABP were measured. Serum H-FABP levels were slightly elevated compared with their normal values in both groups. While they showed no difference between groups A and B (group A vs. B: 8.5+/-1.0 vs. 7.1+/-0.7 ng/ml, P=0.25), pericardial fluid levels of H-FABP were significantly higher in group A than in group B (16.3+/-2.0 vs. 9.6+/-1.0 ng/ml, P=0.0046). H-FABP showed a weak correlation between its serum levels and pericardial fluid levels (r=0.40). Pericardial fluid levels of H-FABP reflect myocardial ischemia occurring within 24 h of their measurements. H-FABP may be secreted into the interstitial space by increased permeability of the myocardial cell membrane associated with severe myocardial ischemia. Thus, pericardial fluid reflects pathophysiological conditions of cardiomyocytes more sensitively than circulating blood.
Chatterjee, Nabamita; Nagarajan, Shantha
2006-08-01
The relative binding of seed water and seed coat membrane stability were measured in two contrasting wheat (Triticum aestivum L) varieties, HDR 77 (drought-tolerant) and HD 2009 (susceptible) using seed water sorption isotherms, electrical conductivity (EC) of leachates and desorption-absorption isotherms. Analysis of sorption isotherm at 25 degrees C showed that the seeds of HDR 77 had significantly higher number of strong binding sites, with correspondingly greater amount of seed water as strongly bound water, as compared to HD 2009. Total number of binding sites was also higher in HDR 77 than HD 2009, which explained the better desiccation tolerance and higher capacity to bind water in seeds of HDR 77. EC of seed leachate in both varieties did not change with respect to change in equilibrium relative humidity (RII), indicating the general seed coat membrane stability of wheat seeds. However, absolute conductivity values were higher for HD 2009. showing its relatively porous seed coat membrane. Significantly lower area enclosed by the desorption-absorption isotherm loop in HDR 77, as compared to HD 2009 also indicated the greater membrane integrity of HDR 77. Germination and seedling vigour of HD 2009 were reduced when equilibrated over very low and very high RH. In contrast, germination and vigour in HDR 77 were maintained high, except at very high RH, indicating again its desiccation tolerance. Thus, the study demonstrated the relative drought tolerance of HDR 77, on the basis of seed water-binding characteristics and seed membrane stability. Seed membrane stability as measured by seed leachate conductivity or as area under dehydration-rehydration loop may be used as a preliminary screening test for drought tolerance in wheat.
Hu, Qin; Si, Xiuhua April
2018-01-01
Existing in vivo experiments show significantly decreased acrolein uptake in rats with increasing inhaled acrolein concentrations. Considering that high-polarity chemicals are prone to bond with each other, it is hypothesized that molecular binding between acrolein and water will contribute to the experimentally observed deposition decrease by decreasing the effective diffusivity. The objective of this study is to quantify the probability of molecular binding for acrolein, as well as its effects on acrolein deposition, using multiscale simulations. An image-based rat airway geometry was used to predict the transport and deposition of acrolein using the chemical species model. The low Reynolds number turbulence model was used to simulate the airflows. Molecular dynamic (MD) simulations were used to study the molecular binding of acrolein in different media and at different acrolein concentrations. MD results show that significant molecular binding can happen between acrolein and water molecules in human and rat airways. With 72 acrolein embedded in 800 water molecules, about 48% of acrolein compounds contain one hydrogen bond and 10% contain two hydrogen bonds, which agreed favorably with previous MD results. The percentage of hydrogen-bonded acrolein compounds is higher at higher acrolein concentrations or in a medium with higher polarity. Computational dosimetry results show that the size increase caused by the molecular binding reduces the effective diffusivity of acrolein and lowers the chemical deposition onto the airway surfaces. This result is consistent with the experimentally observed deposition decrease at higher concentrations. However, this size increase can only explain part of the concentration-dependent variation of the acrolein uptake and acts as a concurrent mechanism with the uptake-limiting tissue ration rate. Intermolecular interactions and associated variation in diffusivity should be considered in future dosimetry modeling of high-polarity chemicals such as acrolein. PMID:29584651
NASA Astrophysics Data System (ADS)
Mey, Antonia S. J. S.; Jiménez, Jordi Juárez; Michel, Julien
2018-01-01
The Drug Design Data Resource (D3R) consortium organises blinded challenges to address the latest advances in computational methods for ligand pose prediction, affinity ranking, and free energy calculations. Within the context of the second D3R Grand Challenge several blinded binding free energies predictions were made for two congeneric series of Farsenoid X Receptor (FXR) inhibitors with a semi-automated alchemical free energy calculation workflow featuring FESetup and SOMD software tools. Reasonable performance was observed in retrospective analyses of literature datasets. Nevertheless, blinded predictions on the full D3R datasets were poor due to difficulties encountered with the ranking of compounds that vary in their net-charge. Performance increased for predictions that were restricted to subsets of compounds carrying the same net-charge. Disclosure of X-ray crystallography derived binding modes maintained or improved the correlation with experiment in a subsequent rounds of predictions. The best performing protocols on D3R set1 and set2 were comparable or superior to predictions made on the basis of analysis of literature structure activity relationships (SAR)s only, and comparable or slightly inferior, to the best submissions from other groups.
1993-01-01
The use of monoclonal antibodies (mAbs) directed to lipid A for the therapy of gram-negative sepsis is controversial. In an attempt to understand their biologic basis of action, we used a fluid-phase radioimmunoassay to measure binding between bacterial lipopolysaccharide (LPS) and two IgM mAbs directed to lipid A that are being evaluated for the treatment of gram-negative bacterial sepsis. Both antibodies bound 3H-LPS prepared from multiple strains of gram- negative bacteria when large excesses of antibody were used, although binding was modest and only slightly greater than control preparations. We also studied the ability of each anti-lipid A antibody to neutralize some of the biological effects of LPS in vitro. Despite large molar excesses, neither antibody neutralized LPS as assessed by the limulus lysate test, by a mitogenic assay for murine splenocytes, or by the production of cytokines interleukin (IL)-1, IL-6, or tumor necrosis factor from human monocytes in culture medium or in whole blood. Our experiments do not support the hypothesis that either of these anti- lipid A mAbs function by neutralizing the toxic effects of LPS. PMID:8418211
NASA Astrophysics Data System (ADS)
Ling, Irene; Taha, Mohamed; Al-Sharji, Nada A.; Abou-Zied, Osama K.
2018-04-01
The ability of human serum albumin (HSA) to bind medium-sized hydrophobic molecules is important for the distribution, metabolism, and efficacy of many drugs. Herein, the interaction between pyrene, a hydrophobic fluorescent probe, and HSA was thoroughly investigated using steady-state and time-resolved fluorescence techniques, ligand docking, and molecular dynamics (MD) simulations. A slight quenching of the fluorescence signal from Trp214 (the sole tryptophan residue in the protein) in the presence of pyrene was used to determine the ligand binding site in the protein, using Förster's resonance energy transfer (FRET) theory. The estimated FRET apparent distance between pyrene and Trp214 was 27 Å, which was closely reproduced by the docking analysis (29 Å) and MD simulation (32 Å). The highest affinity site for pyrene was found to be in subdomain IB from the docking results. The calculated equilibrium structure of the complex using MD simulation shows that the ligand is largely stabilized by hydrophobic interaction with Phe165, Phe127, and the nonpolar moieties of Tyr138 and Tyr161. The fluorescence vibronic peak ratio I1/I3 of bound pyrene inside HSA indicates the presence of polar effect in the local environment of pyrene which is less than that of free pyrene in buffer. This was clarified by the MD simulation results in which an average of 5.7 water molecules were found within 0.5 nm of pyrene in the binding site. Comparing the fluorescence signals and lifetimes of pyrene inside HSA to that free in buffer, the high tendency of pyrene to form dimer was almost completely suppressed inside HSA, indicating a high selectivity of the binding pocket toward pyrene monomer. The current results emphasize the ability of HSA, as a major carrier of several drugs and ligands in blood, to bind hydrophobic molecules in cavities other than subdomain IIA which is known to bind most hydrophobic drugs. This ability stems from the nature of the amino acids forming the binding sites of the protein that can easily adapt their shape to accommodate a variety of molecular structures.
Korkmaz, Elif Nihal; Nussinov, Ruth; Haliloğlu, Türkan
2012-01-01
The KIX domain of CBP is a transcriptional coactivator. Concomitant binding to the activation domain of proto-oncogene protein c-Myb and the transactivation domain of the trithorax group protein mixed lineage leukemia (MLL) transcription factor lead to the biologically active ternary MLL∶KIX∶c-Myb complex which plays a role in Pol II-mediated transcription. The binding of the activation domain of MLL to KIX enhances c-Myb binding. Here we carried out molecular dynamics (MD) simulations for the MLL∶KIX∶c-Myb ternary complex, its binary components and KIX with the goal of providing a mechanistic explanation for the experimental observations. The dynamic behavior revealed that the MLL binding site is allosterically coupled to the c-Myb binding site. MLL binding redistributes the conformational ensemble of KIX, leading to higher populations of states which favor c-Myb binding. The key element in the allosteric communication pathways is the KIX loop, which acts as a control mechanism to enhance subsequent binding events. We tested this conclusion by in silico mutations of loop residues in the KIX∶MLL complex and by comparing wild type and mutant dynamics through MD simulations. The loop assumed MLL binding conformation similar to that observed in the KIX∶c-Myb state which disfavors the allosteric network. The coupling with c-Myb binding site faded, abolishing the positive cooperativity observed in the presence of MLL. Our major conclusion is that by eliciting a loop-mediated allosteric switch between the different states following the binding events, transcriptional activation can be regulated. The KIX system presents an example how nature makes use of conformational control in higher level regulation of transcriptional activity and thus cellular events. PMID:22438798
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yu, Chao; Long, Hai; Jin, Yinghua
2016-06-17
Cyclic porphyrin trimers were synthesized through one-step cyclooligomerization via alkyne metathesis from diyne monomers. These macrocycles show interesting host-guest binding interactions with fullerenes, selectively binding C70 (6 x 103 M-1) over C60 and C84 (no binding observed). The fullerene-encapsulated host-guest complex can undergo guest or host exchange in the presence of another guest (2,4,6-tri(4-pyridyl)-1,3,5-triazine) or host (cage COP5) molecule with higher binding affinity.
Wiest, S A; Steinberg, M I
1999-08-01
2-(2-Benzofuranyl)-2-imidazoline (BFI) is a highly selective ligand for imidazoline-type 2 (I2) binding sites that are known to be associated with monoamine oxidase (MAO). Recently we demonstrated a potentiation of 3H-BFI binding in human but not in rat brain by the nonselective MAO inhibitor tranylcypromine. In the present studies, we evaluated the effect of tranylcypromine on the binding of 3H-BFI to human platelet inner membranes. Membranes were incubated with 3H-BFI at 22 degrees C in 50 mM Tris, 1.5 mM EDTA, pH 7.5. Saturation experiments with 3H-BFI (0.5-80 nM) were analyzed using non-linear curve fitting. Addition of tranylcypromine (0.1 mM) increased the number of 3H-BFI binding sites (Bmax=0.35+/-0.06 vs. 1.87+/-0.15 pmol/mg protein for vehicle and tranylcypromine, respectively) and increased 3H-BFI affinity slightly (KD =16.0+/-4.1 vs. 6.5+/-0.3 nM for vehicle and tranylcypromine, respectively). In competitive binding experiments using the less selective I2 ligand, 3H-idazoxan, tranylcypromine only weakly inhibited binding. Preincubation of platelet membranes with tranylcypromine (1 nM-10 microM) enhanced the Bmax of 3H-BFI binding in a concentration-dependent manner peaking at 1 microM (13 x control) and returning to near baseline at 100 microM. 3H-BFI binding was displaced monophasically (in order of decreasing potency) by BFI > or = 2-(4,5-dihydroimidazol-2-yl)quinoline (BU224) > or = cirazoline >idazoxan >(1,4-benzodioxan-2-methoxy-2-yl)-2-imidazoline (RX821002)= moxonidine. Amiloride, clorgyline, guanabenz and clonidine displayed biphasic curves with nanomolar high affinity components. Tranylcypromine altered the competition curves for all ligands (except BFI) by increasing the affinities for clonidine and RX821002 and decreasing affinities for BU224, cirazoline, guanabenz, idazoxan, clorgyline, moxonidine, and amiloride. Thus, in human platelets tranylcypromine exposes a high capacity 3H-BFI binding site distinct from previously described I2 sites that retains high affintiy for BFI but not other I2 ligands. Our results suggest that 3H-BFI and 3H-idazoxan may not be considered as interchangeable probes for the I2 binding site.
Xia, Zhen; Huynh, Tien; Kang, Seung-gu; Zhou, Ruhong
2012-03-21
Antibodies binding to conserved epitopes can provide a broad range of neutralization to existing influenza subtypes and may also prevent the propagation of potential pandemic viruses by fighting against emerging strands. Here we propose a computational framework to study structural binding patterns and detailed molecular mechanisms of viral surface glycoprotein hemagglutinin (HA) binding with a broad spectrum of neutralizing monoclonal antibody fragments (Fab). We used rigorous free-energy perturbation (FEP) methods to calculate the antigen-antibody binding affinities, with an aggregate underlying molecular-dynamics simulation time of several microseconds (∼2 μs) using all-atom, explicit-solvent models. We achieved a high accuracy in the validation of our FEP protocol against a series of known binding affinities for this complex system, with <0.5 kcal/mol errors on average. We then introduced what to our knowledge are novel mutations into the interfacial region to further study the binding mechanism. We found that the stacking interaction between Trp-21 in HA2 and Phe-55 in the CDR-H2 of Fab is crucial to the antibody-antigen association. A single mutation of either W21A or F55A can cause a binding affinity decrease of ΔΔG > 4.0 kcal/mol (equivalent to an ∼1000-fold increase in the dissociation constant K(d)). Moreover, for group 1 HA subtypes (which include both the H1N1 swine flu and the H5N1 bird flu), the relative binding affinities change only slightly (< ±1 kcal/mol) when nonpolar residues at the αA helix of HA mutate to conservative amino acids of similar size, which explains the broad neutralization capability of antibodies such as F10 and CR6261. Finally, we found that the hydrogen-bonding network between His-38 (in HA1) and Ser-30/Gln-64 (in Fab) is important for preserving the strong binding of Fab against group 1 HAs, whereas the lack of such hydrogen bonds with Asn-38 in most group 2 HAs may be responsible for the escape of antibody neutralization. These large-scale simulations may provide new insight into the antigen-antibody binding mechanism at the atomic level, which could be essential for designing more-effective vaccines for influenza. Copyright © 2012 Biophysical Society. Published by Elsevier Inc. All rights reserved.
Dos Santos, Cleydson Breno Rodrigues; da Silva Ramos, Ryan; Ortiz, Brenda Lorena Sánchez; da Silva, Gabriel Monteiro; Giuliatti, Silvana; Balderas-Lopez, José Luis; Navarrete, Andrés; Carvalho, José Carlos Tavares
2018-08-10
The oil obtained from the fruits of Pterodon emarginatus Vog. (OPe) is used orally and topically, in traditional medicine for some purposes, such as acute and chronic inflammatory states as rheumatoid arthritis. In this work, the anti-inflammatory activity of the OPe was demonstrated based on several animal models and presented an in silico study based on the 6α,7β-dihydroxy-vouacapan-17β-oic acid (DHVA) majority compound of the OPe to evaluate the interaction this compound, with cyclooxygenase-2 (COX-2) in 4COX (Mus musculus) and 5KIR (Homo sapiens) and molecular dynamics simulation. The OPe (498 mg/kg, p.o) significantly inhibited (p < 0.05, Student t-test) the primary and secondary reactions of arthritis by Freund's Complete Adjuvant (FCA) and in dermatitis induced by croton oil in mice, OPe inhibited peak of edema. In vascular permeability test in rats, the treatment with OPe was able to block the response to PGE 2 , serotonin, and bradykinin (p < 0.05, Student t-test). In the writhing test in mice, the OPe at doses of 498 and 980 mg/kg (p.o) produced inhibition of 73% and 92%, respectively, and was not significantly effective in the hot plate test. In the evaluation of the potency in relation to gastric injury (gastric ulcer induced by stress) and combined assay in the assessment of anti-inflammatory potency and gastric damage, it was observed that indomethacin (10 mg/kg, p.o.) inhibited carrageenan edema by 51% and produced a higher number of gastric lesions when compared to the group treated with OPe, where only areas of hyperemia were observed, without the occurrence of ulcerative lesion, and which inhibited the edema by 47%. In the in silico study, it was found that the DHVA is capable of binding to two organisms (4COX - Mus musculus and 5KIR - Homo sapiens), however, with higher binding affinity to the organism Homo sapiens. As expected, all tested ligands were capable of forming hydrogen interactions with residues at their respective binding sites, but the DHVA ligand was capable of creating slightly more hydrogen bonds when docked to either 4COX or 5KIR than the other tested ligands, thus demonstrating the participation of this compound in the anti-inflammatory and antialgic responses observed in the in vivo assays as a COX-2 inhibitor. Therefore, the results obtained support the traditional use of OPe for inflammatory and gastric problems. Copyright © 2018 Elsevier B.V. All rights reserved.
Zhai, Xiuhong; Malakhova, Margarita L; Pike, Helen M; Benson, Linda M; Bergen, H Robert; Sugár, István P; Malinina, Lucy; Patel, Dinshaw J; Brown, Rhoderick E
2009-05-15
Glycolipid transfer proteins (GLTPs) are small, soluble proteins that selectively accelerate the intermembrane transfer of glycolipids. The GLTP fold is conformationally unique among lipid binding/transfer proteins and serves as the prototype and founding member of the new GLTP superfamily. In the present study, changes in human GLTP tryptophan fluorescence, induced by membrane vesicles containing glycolipid, are shown to reflect glycolipid binding when vesicle concentrations are low. Characterization of the glycolipid-induced "signature response," i.e. approximately 40% decrease in Trp intensity and approximately 12-nm blue shift in emission wavelength maximum, involved various modes of glycolipid presentation, i.e. microinjection/dilution of lipid-ethanol solutions or phosphatidylcholine vesicles, prepared by sonication or extrusion and containing embedded glycolipids. High resolution x-ray structures of apo- and holo-GLTP indicate that major conformational alterations are not responsible for the glycolipid-induced GLTP signature response. Instead, glycolipid binding alters the local environment of Trp-96, which accounts for approximately 70% of total emission intensity of three Trp residues in GLTP and provides a stacking platform that aids formation of a hydrogen bond network with the ceramide-linked sugar of the glycolipid headgroup. The changes in Trp signal were used to quantitatively assess human GLTP binding affinity for various lipids including glycolipids containing different sugar headgroups and homogenous acyl chains. The presence of the glycolipid acyl chain and at least one sugar were essential for achieving a low-to-submicromolar dissociation constant that was only slightly altered by increased sugar headgroup complexity.
Zhuang, Shulin; Wang, Haifei; Ding, Keke; Wang, Jiaying; Pan, Liumeng; Lu, Yanli; Liu, Qingjun; Zhang, Chunlong
2016-02-01
Benzotriazole UV stabilizers (BZTs) belong to one prominent group of ultraviolet (UV) stabilizers and are widely used in various plastics materials. Their large production volumes, frequent detections in the environment and potential toxicities have raised increasing public concern. BZTs can be transported in vivo by transport proteins in plasma and the binding association to transport proteins may serve as a significant parameter to evaluate the bioaccumulative potential. We utilized a novel HSA biosensor, circular dichroism spectroscopy, fluorescence spectroscopy to detect the dynamic interactions of six BZTs (UV-326, UV-327, UV-328, UV-329, UV-P, and BZT) with human serum albumin (HSA), and characterized the corresponding structure-activity relationships (SAR) by molecular dynamics simulations. All test BZTs potently bind at Sudlow site I of HSA with a binding constant of 10(4) L/mol at 298 K. Minor changes in the moieties of BZTs affect their interactions with HSA and differently induce conformations of HSA. Their binding reduced electrochemical impedance spectra and α-helix content of HSA, caused slight red-shifted emission, and changed fluorescence lifetime components of HSA in a concentration-dependent mode. UV-327 and UV-329 form hydrogen bonds with HSA, while UV-329, UV-P and BZT bind HSA with more favorable electrostatic interactions. Our in vitro and in silico study offered a significant framework toward the understanding of risk assessment of BZTs and provides guide for future design of environmental benign BZTs-related materials. Copyright © 2015 Elsevier Ltd. All rights reserved.
Desaiah, D
1980-08-01
The effects of chlordecone and mirex on the rat myocardial ATPases and binding of 3H-dopamine and 3H-norepinephrine to the NAK-fraction were determined both by in vitro and in vivo treatment. The in vitro data showed that chlordecone significantly inhibited mitochondrial Mg2+ ATPase and Na+--K+ ATPase in a concentration dependent manner with ID50 values of 5 x 10(-8) and 2 x 10(-6) M, respectively. Mitrex, a close structural analog of chlordecone did not inhibit mitochondrial Mg2+ ATPase but inhibited about 15% of N+--K+ ATPase activity. Rats treated with symptomatogenic doses of chlordecone showed a marked and significant decrease of myocardial Na+--K+ ATPase and the residual Mg2+ ATPase activities. The decrease in the enzyme activities was dose dependent and significant. However, mirex treated rats showed a slight decrease in the myocardial Na+--K+ ATPase. The potency of chlordecone to inhibit the ATPase system was parallel to its ability to decrease the dopamine and norepinephrine binding of the myocardial NAK-fraction. Preincubation of the NAK-fraction with various concentrations of chlordecone resulted in a decreased binding of dopamine and norepinephrine. The decrease was significant and concentration dependent. Similar findings were observed in rats pretreated with chlordecone. Mirex did not show any effect, either in vitro or in vivo treatment, on the binding of dopamine or norepinephrine to the myocardial NAK-fraction. These results suggest that chlordecone may be altering the sodium pump activity by inhibiting both ATP hydrolysis and ATP synthesis and thus reducing other cellular events such as catecholamine uptake.
van den Goorbergh, J A; de Wit, H; Tijdens, R B; Mulder, G J; Meerman, J H
1987-02-01
In order to find potentially effective compounds that could prevent the covalent binding of the carcinogen N-hydroxy-2-acetylaminofluorene (N-OH-AAF) to rat liver macromolecules in vivo, the prevention of the covalent binding to RNA of the sulfate ester of the carcinogen N-OH-AAF by a series of thioethers was investigated in vitro. The most effective thioethers, which inhibited the covalent binding by 70% or more, were studied for their protection against acute hepatotoxicity of N-OH-AAF in the rat in vivo. Three of these thioethers, thiazolidine, methyl 4-(methylthio)benzoate, and 2-(methylthio)benzimidazole significantly decreased the hepatoxicity of N-OH-AAF, by 45, 71 and 83%, respectively. The effects of these thioethers on the covalent binding of N-OH-AAF to cellular macromolecules in vivo were also studied. Methyl 4-(methylthio)benzoate and 2-(methylthio)benzimidazole decreased the adduct formation of N-OH-AAF to DNA by 54 and 44%, respectively, but had no effect on protein adduct formation. Only 2-(methylthio)benzimidazole caused a slight decrease (23%) in the AAF-- protein adduct formation. 2-Acetylaminofluorene (AAF) and methyl 4-(methyl-sulfinyl)benzoate were the main products in the incubation of methyl 4-(methylthio)benzoate with AAF-N-sulfate in vitro. This suggests that the thioether attacks the nitrenium ion which is formed by spontaneous breakdown of AAF-N-sulfate; the formation of a sulfonium--AAF conjugate is postulated which decomposes into AAF and a sulfinyl compound.
Samuel, Filsy; Flavin, William P.; Iqbal, Sobia; Pacelli, Consiglia; Sri Renganathan, Sri Dushyaanthan; Trudeau, Louis-Eric; Campbell, Edward M.; Fraser, Paul E.; Tandon, Anurag
2016-01-01
Although trace levels of phosphorylated α-synuclein (α-syn) are detectable in normal brains, nearly all α-syn accumulated within Lewy bodies in Parkinson disease brains is phosphorylated on serine 129 (Ser-129). The role of the phosphoserine residue and its effects on α-syn structure, function, and intracellular accumulation are poorly understood. Here, co-expression of α-syn and polo-like kinase 2 (PLK2), a kinase that targets Ser-129, was used to generate phosphorylated α-syn for biophysical and biological characterization. Misfolding and fibril formation of phosphorylated α-syn isoforms were detected earlier, although the fibrils remained phosphatase- and protease-sensitive. Membrane binding of α-syn monomers was differentially affected by phosphorylation depending on the Parkinson disease-linked mutation. WT α-syn binding to presynaptic membranes was not affected by phosphorylation, whereas A30P α-syn binding was greatly increased, and A53T α-syn was slightly lower, implicating distal effects of the carboxyl- on amino-terminal membrane binding. Endocytic vesicle-mediated internalization of pre-formed fibrils into non-neuronal cells and dopaminergic neurons matched the efficacy of α-syn membrane binding. Finally, the disruption of internalized vesicle membranes was enhanced by the phosphorylated α-syn isoforms, a potential means for misfolded extracellular or lumenal α-syn to access cytosolic α-syn. Our results suggest that the threshold for vesicle permeabilization is evident even at low levels of α-syn internalization and are relevant to therapeutic strategies to reduce intercellular propagation of α-syn misfolding. PMID:26719332
Shimano, H; Yamada, N; Ishibashi, S; Mokuno, H; Mori, N; Gotoda, T; Harada, K; Akanuma, Y; Murase, T; Yazaki, Y
1991-05-01
We isolated subfractions of human plasma low density lipoprotein (LDL) using ion-exchange chromatography. Plasma LDL from normolipidemic subjects were applied to a DEAE Sepharose 6B column. After elution of the bulk of LDL at 150 mM NaCl (the major fraction), the residual LDL was eluted at 500 mM NaCl and designated as the minor fraction. The minor fraction, only less than 1% of total LDL, tended to be somewhat similar in certain properties to oxidized LDL, e.g., an increased negative charge, higher protein/cholesterol ratio, and a higher flotation density than native LDL. These results were consistent with data reported by Avogaro et al. (1988. Arteriosclerosis. 8: 79-87). However, assays of 125I-labeled LDL binding activity for LDL receptors equal to that of the major fraction. Incorporation of [14C]oleate into cholesteryl ester [acyl-CoA:cholesterol acyltransferase (ACAT) activity] in mouse peritoneal macrophages incubated with the minor fraction was only slightly greater than that with the major fraction. Incubation of the minor fraction with 0.5 microM Cu2+ caused a remarkable stimulation of ACAT activity, while stimulation by the major fraction required incubation with 5 microM Cu2+, suggesting that the minor fraction was relatively labile to oxidation. The minor but definite presence of a plasma LDL subfraction more negative and susceptible to oxidation implicates the possibility of its association with atherogenesis.
Effects of humic acid on the interactions between zinc oxide nanoparticles and bacterial biofilms
Ouyang, Kai; Yu, Xiao-Ying; Zhu, Yunlin; ...
2017-08-26
The effects of humic acid (HA) on interactions between ZnO nanoparticles (ZnO NPs) and Pseudomonas putida KT2440 biofilms at different maturity stages were investigated. Three stages of biofilm development were identified according to bacterial adenosine triphosphate (ATP) activity associated with biofilm development process. In the initial biofilm stage 1, the ATP content of bacteria was reduced by more than 90% when biofilms were exposed to ZnO NPs. But, in the mature biofilm stages 2 and 3, the ATP content was only slightly decreased. Biofilms at stage 3 exhibited less susceptibility to ZnO NPs than biofilms at stage 2. These resultsmore » suggest that more mature biofilms have a significantly higher tolerance to ZnO NPs compared to young biofilms. In addition, biofilms with intact extracellular polymeric substances (EPS) showed higher tolerance to ZnO NPs than those without EPS, indicating that EPS play a key role in alleviating the toxic effects of ZnO NPs. In both pure ZnO NPs and ZnO-HA mixtures, dissolved Zn 2+ originating from the NPs significantly contributed to the overall toxicity. The presence of HA dramatically decreased the toxicity of ZnO NPs due to the binding of Zn 2+ on HA. Furthermore, the combined results from this work suggest that the biofilm maturity stages and environmental constituents (such as humic acid) are important factors to consider when evaluating potential risks of NPs to ecological systems.« less
Associations between Deceased-Donor Urine Injury Biomarkers and Kidney Transplant Outcomes
Reese, Peter P.; Hall, Isaac E.; Weng, Francis L.; Schröppel, Bernd; Doshi, Mona D.; Hasz, Rick D.; Thiessen-Philbrook, Heather; Ficek, Joseph; Rao, Veena; Murray, Patrick; Lin, Haiqun
2016-01-01
Assessment of deceased-donor organ quality is integral to transplant allocation practices, but tools to more precisely measure donor kidney injury and better predict outcomes are needed. In this study, we assessed associations between injury biomarkers in deceased-donor urine and the following outcomes: donor AKI (stage 2 or greater), recipient delayed graft function (defined as dialysis in first week post-transplant), and recipient 6-month eGFR. We measured urinary concentrations of microalbumin, neutrophil gelatinase–associated lipocalin (NGAL), kidney injury molecule-1 (KIM-1), IL-18, and liver-type fatty acid binding protein (L-FABP) from 1304 deceased donors at organ procurement, among whom 112 (9%) had AKI. Each biomarker strongly associated with AKI in adjusted analyses. Among 2441 kidney transplant recipients, 31% experienced delayed graft function, and mean±SD 6-month eGFR was 55.7±23.5 ml/min per 1.73 m2. In analyses adjusted for donor and recipient characteristics, higher donor urinary NGAL concentrations associated with recipient delayed graft function (highest versus lowest NGAL tertile relative risk, 1.21; 95% confidence interval, 1.02 to 1.43). Linear regression analyses of 6-month recipient renal function demonstrated that higher urinary NGAL and L-FABP concentrations associated with slightly lower 6-month eGFR only among recipients without delayed graft function. In summary, donor urine injury biomarkers strongly associate with donor AKI but provide limited value in predicting delayed graft function or early allograft function after transplant. PMID:26374609
The population genomics of rhesus macaques (Macaca mulatta) based on whole-genome sequences
Xue, Cheng; Raveendran, Muthuswamy; Harris, R. Alan; Fawcett, Gloria L.; Liu, Xiaoming; White, Simon; Dahdouli, Mahmoud; Rio Deiros, David; Below, Jennifer E.; Salerno, William; Cox, Laura; Fan, Guoping; Ferguson, Betsy; Horvath, Julie; Johnson, Zach; Kanthaswamy, Sree; Kubisch, H. Michael; Liu, Dahai; Platt, Michael; Smith, David G.; Sun, Binghua; Vallender, Eric J.; Wang, Feng; Wiseman, Roger W.; Chen, Rui; Muzny, Donna M.; Gibbs, Richard A.; Yu, Fuli; Rogers, Jeffrey
2016-01-01
Rhesus macaques (Macaca mulatta) are the most widely used nonhuman primate in biomedical research, have the largest natural geographic distribution of any nonhuman primate, and have been the focus of much evolutionary and behavioral investigation. Consequently, rhesus macaques are one of the most thoroughly studied nonhuman primate species. However, little is known about genome-wide genetic variation in this species. A detailed understanding of extant genomic variation among rhesus macaques has implications for the use of this species as a model for studies of human health and disease, as well as for evolutionary population genomics. Whole-genome sequencing analysis of 133 rhesus macaques revealed more than 43.7 million single-nucleotide variants, including thousands predicted to alter protein sequences, transcript splicing, and transcription factor binding sites. Rhesus macaques exhibit 2.5-fold higher overall nucleotide diversity and slightly elevated putative functional variation compared with humans. This functional variation in macaques provides opportunities for analyses of coding and noncoding variation, and its cellular consequences. Despite modestly higher levels of nonsynonymous variation in the macaques, the estimated distribution of fitness effects and the ratio of nonsynonymous to synonymous variants suggest that purifying selection has had stronger effects in rhesus macaques than in humans. Demographic reconstructions indicate this species has experienced a consistently large but fluctuating population size. Overall, the results presented here provide new insights into the population genomics of nonhuman primates and expand genomic information directly relevant to primate models of human disease. PMID:27934697
Effects of humic acid on the interactions between zinc oxide nanoparticles and bacterial biofilms
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ouyang, Kai; Yu, Xiao-Ying; Zhu, Yunlin
The effects of humic acid (HA) on interactions between ZnO nanoparticles (ZnO NPs) and Pseudomonas putida KT2440 biofilms at different maturity stages were investigated. Three stages of biofilm development were identified according to bacterial adenosine triphosphate (ATP) activity associated with biofilm development process. In the initial biofilm stage 1, the ATP content of bacteria was reduced by more than 90% when biofilms were exposed to ZnO NPs. However, in the mature biofilm stages 2 and 3, the ATP content was only slightly decreased. Biofilms at stage 3 exhibited less susceptibility to ZnO NPs than biofilms at stage 2. These resultsmore » suggest that more mature biofilms have a significantly higher tolerance to ZnO NPs compared to young biofilms. In addition, biofilms with intact extracellular poly-meric substances (EPS) showed higher tolerance to ZnO NPs than those without EPS, indicating that EPS play a key role in alleviating the toxic effects of ZnO NPs. In both pure ZnO NPs and ZnO-HA mixtures, dissolved Zn 2+ originating from the NPs significantly contributed to the overall toxicity. The presence of HA dramatically decreased the toxicity of ZnO NPs due to the binding of Zn 2+ on HA. The combined results from this work suggest that the biofilm maturity stages and environmental constituents (such as humic acid) are important factors to consider when evaluating potential risks of NPs to ecological systems.« less
Effects of humic acid on the interactions between zinc oxide nanoparticles and bacterial biofilms
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ouyang, Kai; Yu, Xiao-Ying; Zhu, Yunlin
The effects of humic acid (HA) on interactions between ZnO nanoparticles (ZnO NPs) and Pseudomonas putida KT2440 biofilms at different maturity stages were investigated. Three stages of biofilm development were identified according to bacterial adenosine triphosphate (ATP) activity associated with biofilm development process. In the initial biofilm stage 1, the ATP content of bacteria was reduced by more than 90% when biofilms were exposed to ZnO NPs. But, in the mature biofilm stages 2 and 3, the ATP content was only slightly decreased. Biofilms at stage 3 exhibited less susceptibility to ZnO NPs than biofilms at stage 2. These resultsmore » suggest that more mature biofilms have a significantly higher tolerance to ZnO NPs compared to young biofilms. In addition, biofilms with intact extracellular polymeric substances (EPS) showed higher tolerance to ZnO NPs than those without EPS, indicating that EPS play a key role in alleviating the toxic effects of ZnO NPs. In both pure ZnO NPs and ZnO-HA mixtures, dissolved Zn 2+ originating from the NPs significantly contributed to the overall toxicity. The presence of HA dramatically decreased the toxicity of ZnO NPs due to the binding of Zn 2+ on HA. Furthermore, the combined results from this work suggest that the biofilm maturity stages and environmental constituents (such as humic acid) are important factors to consider when evaluating potential risks of NPs to ecological systems.« less
von Holst, Hans; Li, Xiaogai
2013-07-01
Although the consequences of traumatic brain injury (TBI) and its treatment have been improved, there is still a substantial lack of understanding the mechanisms. Numerical simulation of the impact can throw further lights on site and mechanism of action. A finite element model of the human head and brain tissue was used to simulate TBI. The consequences of gradually increased kinetic energy transfer was analyzed by evaluating the impact intracranial pressure (ICP), strain level, and their potential influences on binding forces in folded protein structures. The gradually increased kinetic energy was found to have the potential to break apart bonds of Van der Waals in all impacts and hydrogen bonds at simulated impacts from 6 m/s and higher, thereby superseding the energy in folded protein structures. Further, impacts below 6 m/s showed none or very slight increase in impact ICP and strain levels, whereas impacts of 6 m/s or higher showed a gradual increase of the impact ICP and strain levels reaching over 1000 KPa and over 30%, respectively. The present simulation study shows that the free kinetic energy transfer, impact ICP, and strain levels all have the potential to initiate cytotoxic brain tissue edema by unfolding protein structures. The definition of mild, moderate, and severe TBI should thus be looked upon as the same condition and separated only by a gradual severity of impact.
Effects of humic acid on the interactions between zinc oxide nanoparticles and bacterial biofilms.
Ouyang, Kai; Yu, Xiao-Ying; Zhu, Yunlin; Gao, Chunhui; Huang, Qiaoyun; Cai, Peng
2017-12-01
The effects of humic acid (HA) on interactions between ZnO nanoparticles (ZnO NPs) and Pseudomonas putida KT2440 biofilms at different maturity stages were investigated. Three stages of biofilm development were identified according to bacterial adenosine triphosphate (ATP) activity associated with biofilm development process. In the initial biofilm stage 1, the ATP content of bacteria was reduced by more than 90% when biofilms were exposed to ZnO NPs. However, in the mature biofilm stages 2 and 3, the ATP content was only slightly decreased. Biofilms at stage 3 exhibited less susceptibility to ZnO NPs than biofilms at stage 2. These results suggest that more mature biofilms have a significantly higher tolerance to ZnO NPs compared to young biofilms. In addition, biofilms with intact extracellular polymeric substances (EPS) showed higher tolerance to ZnO NPs than those without EPS, indicating that EPS play a key role in alleviating the toxic effects of ZnO NPs. In both pure ZnO NPs and ZnO-HA mixtures, dissolved Zn 2+ originating from the NPs significantly contributed to the overall toxicity. The presence of HA dramatically decreased the toxicity of ZnO NPs due to the binding of Zn 2+ on HA. The combined results from this work suggest that the biofilm maturity stages and environmental constituents (such as humic acid) are important factors to consider when evaluating potential risks of NPs to ecological systems. Copyright © 2017 Elsevier Ltd. All rights reserved.
Malagrinò, Francesca; Santo, Paulo E.; Gutierres, André; Bandeiras, Tiago M.; Leandro, Paula
2017-01-01
The human disease classical homocystinuria results from mutations in the gene encoding the pyridoxal 5′-phosphate- (PLP-) dependent cystathionine β-synthase (CBS), a key enzyme in the transsulfuration pathway that controls homocysteine levels, and is a major source of the signaling molecule hydrogen sulfide (H2S). CBS activity, contributing to cellular redox homeostasis, is positively regulated by S-adenosyl-L-methionine (AdoMet) but fully inhibited upon CO or NO• binding to a noncatalytic heme moiety. Despite extensive studies, the molecular basis of several pathogenic CBS mutations is not yet fully understood. Here we found that the ferrous heme of the reportedly mild p.P49L CBS variant has altered spectral properties and markedly increased affinity for CO, making the protein much more prone than wild type (WT) CBS to inactivation at physiological CO levels. The higher CO affinity could result from the slightly higher flexibility in the heme surroundings revealed by solving at 2.80-Å resolution the crystallographic structure of a truncated p.P49L. Additionally, we report that p.P49L displays impaired H2S-generating activity, fully rescued by PLP supplementation along the purification, despite a minor responsiveness to AdoMet. Altogether, the results highlight how increased propensity to CO inactivation of an otherwise WT-like variant may represent a novel pathogenic mechanism in classical homocystinuria. PMID:28421128
Conservation of transcription factor binding events predicts gene expression across species
Hemberg, Martin; Kreiman, Gabriel
2011-01-01
Recent technological advances have made it possible to determine the genome-wide binding sites of transcription factors (TFs). Comparisons across species have suggested a relatively low degree of evolutionary conservation of experimentally defined TF binding events (TFBEs). Using binding data for six different TFs in hepatocytes and embryonic stem cells from human and mouse, we demonstrate that evolutionary conservation of TFBEs within orthologous proximal promoters is closely linked to function, defined as expression of the target genes. We show that (i) there is a significantly higher degree of conservation of TFBEs when the target gene is expressed in both species; (ii) there is increased conservation of binding events for groups of TFs compared to individual TFs; and (iii) conserved TFBEs have a greater impact on the expression of their target genes than non-conserved ones. These results link conservation of structural elements (TFBEs) to conservation of function (gene expression) and suggest a higher degree of functional conservation than implied by previous studies. PMID:21622661
[Study on the interaction of doxycycline with human serum albumin].
Hu, Tao-Ying; Chen, Lin; Liu, Ying
2014-05-01
The present study was designed to investigate the interaction of doxycycline (DC) with human serum albumin (HSA) by the inner filter effects, displacement experiments and molecular docking methods, based on classic multi-spectroscopy. With fluorescence quenching method at 298 and 310 K, the binding constants Ka, were determined to be 2. 73 X 10(5) and 0. 74X 10(5) L mol-1, respectively, and there was one binding site between DC and HSA, indicating that the binding of DC to HSA was strong, and the quenching mechanism was a static quenching. The thermodynamic parameters (enthalpy change, AH and enthropy change, delta S) were calculated to be -83. 55 kJ mol-1 and -176. 31 J mol-1 K-1 via the Vant' Hoff equation, which indicated that the interaction of DC with HSA was driven mainly by hydrogen bonding and van der Waals forces. Based on the Föster's theory of non-radiation energy transfer, the specific binding distance between Trp-214 (acceptor) and DC (donor) was 4. 98 nm, which was similar to the result confirmed by molecular docking. Through displacement experiments, sub-domain IIA of HSA was assigned to possess the high-affinity binding site of DC. Three-dimensional fluorescence spectra indicated that the binding of DC to HSA induced the conformation change of HSA and increased the disclosure of some part of hydrophobic regions that had been buried before. The results of FTIR spectroscopy showed that DC bound to HSA led to the slight unfolding of the polypeptide chain of HSA. Furthermore, the binding details between DC and HSA were further confirmed by molecular docking methods, which revealed that DC was bound at sub-domain IIA through multiple interactions, such as hydrophobic effect, polar forces and pi-pi interactions. The experimental results provide theoretical basis and reliable data for the study of the interaction between small drug molecule and human serum albumin
Analysis of Cold Neutron Spectra of Metals.
modes. The damping of lattice vibrations in metals is of the same order of magnitude as in dielectrics with ionic binding, i.e., much higher than the damping in dielectrics with covalent binding. (Author)
2015-01-01
Molecules able to bind the antigen-binding sites of antibodies are of interest in medicine and immunology. Since most antibodies are bivalent, higher affinity recognition can be achieved through avidity effects in which a construct containing two or more copies of the ligand engages both arms of the immunoglobulin simultaneously. This can be achieved routinely by immobilizing antibody ligands at high density on solid surfaces, such as ELISA plates, but there is surprisingly little literature on scaffolds that routinely support bivalent binding of antibody ligands in solution, particularly for the important case of human IgG antibodies. Here we show that the simple strategy of linking two antigens with a polyethylene glycol (PEG) spacer long enough to span the two arms of an antibody results in higher affinity binding in some, but not all, cases. However, we found that the creation of multimeric constructs in which several antibody ligands are displayed on a dextran polymer reliably provides much higher affinity binding than is observed with the monomer in all cases tested. Since these dextran conjugates are simple to construct, they provide a general and convenient strategy to transform modest affinity antibody ligands into high affinity probes. An additional advantage is that the antibody ligands occupy only a small number of the reactive sites on the dextran, so that molecular cargo can be attached easily, creating molecules capable of delivering this cargo to cells displaying antigen-specific receptors. PMID:25073654
Xu, Wenxuan; Liu, Yajuan; Ye, Yanxin; Liu, Meng; Han, Laichuang; Song, Andong; Liu, Liangwei
2016-10-01
The 9_2 carbohydrate-binding module (C2) locates natively at the C-terminus of the GH10 thermophilic xylanase from Thermotoga marimita. When fused to the C-terminus, C2 improved thermostability of a GH11 xylanase (Xyn) from Aspergillus niger. However, a question is whether the C-terminal C2 would have a thermostabilizing effect when fused to the N-terminus of a catalytic module. A chimeric enzyme, C2-Xyn, was created by step-extension PCR, cloned in pET21a(+), and expressed in E. coli BL21(DE3). The C2-Xyn exhibited a 2 °C higher optimal temperature, a 2.8-fold longer thermostability, and a 4.5-fold higher catalytic efficiency on beechwood xylan than the Xyn. The C2-Xyn exhibited a similar affinity for binding to beechwood xylan and a higher affinity for oat-spelt xylan than Xyn. C2 is a thermostabilizing carbohydrate-binding module and provides a model of fusion at an enzymatic terminus inconsistent with the modular natural terminal location.
Immobilization of Fab' fragments onto substrate surfaces: A survey of methods and applications.
Crivianu-Gaita, Victor; Thompson, Michael
2015-08-15
Antibody immobilization onto surfaces has widespread applications in many different fields. It is desirable to bind antibodies such that their fragment-antigen-binding (Fab) units are oriented away from the surface in order to maximize analyte binding. The immobilization of only Fab' fragments yields benefits over the more traditional whole antibody immobilization technique. Bound Fab' fragments display higher surface densities, yielding a higher binding capacity for the analyte. The nucleophilic sulfide of the Fab' fragments allows for specific orientations to be achieved. For biosensors, this indicates a higher sensitivity and lower detection limit for a target analyte. The last thirty years have shown tremendous progress in the immobilization of Fab' fragments onto gold, Si-based, polysaccharide-based, plastic-based, magnetic, and inorganic surfaces. This review will show the current scope of Fab' immobilization techniques available and illustrate methods employed to minimize non-specific adsorption of undesirables. Furthermore, a variety of examples will be given to show the versatility of immobilized Fab' fragments in different applications and future directions of the field will be addressed, especially regarding biosensors. Copyright © 2015 Elsevier B.V. All rights reserved.
Gauer, Jacob W.; Knutson, Kristofer J.; Jaworski, Samantha R.; Rice, Anne M.; Rannikko, Anika M.; Lentz, Barry R.; Hinderliter, Anne
2013-01-01
Isothermal titration calorimetry was used to characterize the binding of calcium ion (Ca2+) and phospholipid to the peripheral membrane-binding protein annexin a5. The phospholipid was a binary mixture of a neutral and an acidic phospholipid, specifically phosphatidylcholine and phosphatidylserine in the form of large unilamellar vesicles. To stringently define the mode of binding, a global fit of data collected in the presence and absence of membrane concentrations exceeding protein saturation was performed. A partition function defined the contribution of all heat-evolving or heat-absorbing binding states. We find that annexin a5 binds Ca2+ in solution according to a simple independent-site model (solution-state affinity). In the presence of phosphatidylserine-containing liposomes, binding of Ca2+ differentiates into two classes of sites, both of which have higher affinity compared with the solution-state affinity. As in the solution-state scenario, the sites within each class were described with an independent-site model. Transitioning from a solution state with lower Ca2+ affinity to a membrane-associated, higher Ca2+ affinity state, results in cooperative binding. We discuss how weak membrane association of annexin a5 prior to Ca2+ influx is the basis for the cooperative response of annexin a5 toward Ca2+, and the role of membrane organization in this response. PMID:23746516
Hematology of healthy Florida manatees (Trichechus manatus)
Harvey, J.W.; Harr, K.E.; Murphy, D.; Walsh, M.T.; Nolan, E.C.; Bonde, R.K.; Pate, M.G.; Deutsch, C.J.; Edwards, H.H.; Clapp, W.L.
2009-01-01
Background: Hematologic analysis is an important tool in evaluating the general health status of free-ranging manatees and in the diagnosis and monitoring of rehabilitating animals. Objectives: The purpose of this study was to evaluate diagnostically important hematologic analytes in healthy manatees (Trichechus manatus) and to assess variations with respect to location (free ranging vs captive), age class (small calves, large calves, subadults, and adults), and gender. Methods: Blood was collected from 55 free-ranging and 63 captive healthy manatees. Most analytes were measured using a CELL-DYN 3500R; automated reticulocytes were measured with an ADVIA 120. Standard manual methods were used for differential leukocyte counts, reticulocyte and Heinz body counts, and plasma protein and fibrinogen concentrations. Results: Rouleaux, slight polychromasia, stomatocytosis, and low numbers of schistocytes and nucleated RBCs (NRBCs) were seen often in stained blood films. Manual reticulocyte counts were higher than automated reticulocyte counts. Heinz bodies were present in erythrocytes of most manatees. Compared with free-ranging manatees, captive animals had slightly lower MCV, MCH, and eosinophil counts and slightly higher heterophil and NRBC counts, and fibrinogen concentration. Total leukocyte, heterophil, and monocyte counts tended to be lower in adults than in younger animals. Small calves tended to have higher reticulocyte counts and NRBC counts than older animals. Conclusions: Hematologic findings were generally similar between captive and free-ranging manatees. Higher manual reticulocyte counts suggest the ADVIA detects only reticulocytes containing large amounts of RNA. Higher reticulocyte and NRBC counts in young calves probably reflect an increased rate of erythropoiesis compared with older animals. ?? 2009 American Society for Veterinary Clinical Pathology.
Li, Q L; Yi, S C; Li, D Z; Nie, X P; Li, S Q; Wang, M-Q; Zhou, A M
2018-06-01
Odorant binding proteins (OBPs) are considered as the core molecular targets in reverse chemical ecology, which is a convenient and efficient method by which to screen potential semiochemicals. Herein, we identified a classic OBP, AbamOBP1 from Aenasius bambawalei, which showed high mRNA expression in male antennae. Fluorescence competitive binding assay (FCBA) results demonstrated that AbamOBP1 has higher binding affinity with ligands at acid pH, suggesting the physiologically inconsistent binding affinity of this protein. Amongst the four compounds with the highest binding affinities at acid pH, 2, 4, 4-trimethyl-2-pentene and 1-octen-3-one were shown to have attractant activity for male adults, whereas (-)-limonene and an analogue of 1-octen-3-ol exhibited nonbehavioural activity. Further homology modelling and fluorescence quenching experiments demonstrated that the stoichiometry of the binding of this protein to these ligands was not 1: 1, suggesting that the results of FCBA were false. In contrast, the apparent association constants (Ka) of fluorescence quenching experiments seemed to be more reliable, because 2, 4, 4-trimethyl-2-pentene and 1-octen-3-one had observably higher Ka than (-)-limonene and 1-octen-3-ol at neutral pH. Based on the characteristics of different OBPs, various approaches should be applied to study their binding affinities with ligands, which could modify and complement the results of FCBA and contribute to the application of reverse chemical ecology. © 2018 The Royal Entomological Society.
Laursen, Tea L; Sandahl, Thomas D; Støy, Sidsel; Schiødt, Frank V; Lee, William M; Vilstrup, Hendrik; Thiel, Steffen; Grønbaek, Henning
2015-03-01
The complement system is activated in liver diseases including acute liver failure (ALF); however, the role of the lectin pathway of complement has scarcely been investigated in ALF. The pathway is initiated by soluble pattern recognition molecules: mannan-binding lectin (MBL), M-, L-, and H-ficolin and collectin-liver-1 (CL-L1), which are predominantly synthesized in the liver. We aimed to study lectin levels in ALF patients and associations with clinical outcome. Serum samples from 75 patients enrolled by the US ALF Study Group were collected on days 1 and 3. We included 75 healthy blood donors and 20 cirrhosis patients as controls. Analyses were performed using sandwich-type immunoassays (ELISA, TRIFMA). At day 1, the MBL level in ALF patients was 40% lower compared with healthy controls {[median (interquartile range) 0.72 μg/ml(0.91) vs. 1.15 (1.92)(P = 0.02]}, and increased significantly by day 3 [0.83 μg/ml(0.94)(P = 0.01)]. The M-ficolin level was 60% lower [0.54 μg/ml(0.50) vs. 1.48(1.01)(P < 0.0001)]. The CL-L1 level at day 1 was slightly higher compared with healthy controls [3.20 μg/ml(2.37) vs. 2.64(0.72)(P = 0.11)]; this was significant at day 3 [3.35(1.84)(P = 0.006)]. H- and L-ficolin levels were similar to healthy controls. Spontaneous ALF survivors had higher levels of MBL at day 1 [0.96 μg/ml(1.15) vs. 0.60(0.60)(P = 0.02)] and lower levels of L-ficolin by day 3 compared with patients who died or were transplanted [1.61 μg/ml(1.19) vs. 2.17(2.19)(P = 0.02)]. We observed significant dynamics in lectin levels in ALF patients, which may suggest they play a role in ALF pathogenesis. High MBL and low L-ficolin levels are associated with survival. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
NASA Astrophysics Data System (ADS)
Dror, I.; Ringering, K.; Yecheskel, Y.; Berkowitz, B.
2017-12-01
The mobility of indium and gallium in groundwater environments was studied via laboratory experiments using quartz sand as a porous medium. Indium and gallium are metals of very low abundance in the Earth's crust and, correspondingly, the biosphere is only adapted to very small concentrations of these elements. However, in modern semiconductor industries, both elements play a central role and are incorporated in devices of mass production such as smartphones and digital cameras. The resulting considerable increase in production, use and discharge of indium and gallium throughout the last two decades, with a continuous and fast increase in the near future, raises questions regarding the fate of both elements in the environment. However, the transport behavior of these two metals in soils and groundwater systems remains poorly understood to date. Because of the low solubility of both elements in aqueous solutions, trisodium citrate was used as a complexation agent to stabilize the solutions, enabling investigation of the transport of these metals at neutral pH. Column experiments showed different binding capacities for indium and gallium, where gallium is much more mobile compared to indium and both metals are substantially retarded in the column. Different affinities were also confirmed by examining sorption isotherms of indium and gallium in equilibrium batch systems. The effect of natural organic matter on the mobility of indium and gallium was also studied, by addition of humic acid. For both metals, the presence of humic acid affects the sorption dynamics: for indium, sorption is strongly inhibited leading to much higher mobility, whereas gallium showed a slightly higher sorption affinity and very similar mobility compared to the same setup without humic acid addition. However, in all cases, the binding capacity of gallium to quartz is much weaker than that of indium. These results are consistent with the assumption that indium and gallium form different types of complexes with organic ligands. It was further observed that the complexes of gallium appear to be more stable than those of indium.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gavva, S.R.; Harris, B.G.; Cook, P.F.
A thiol group at the malate-binding site of the NAD-malic enzyme from Ascaris suum has been modified to thiocyanate. The modified enzyme generally exhibits slight increases in K{sub NAD} and K{sub i metal} and decreases in V{sub max} as the metal size increases from Mg{sup 2+} to Mn{sup 2+} to Cd{sup 2+}, indicative of crowding in the site. The K{sub malate} value increases 10- to 30-fold, suggesting that malate does not bind optimally to the modified enzyme. Deuterium isotope effects on V and V/K{sub malate} increase with all three metal ions compared to the native enzyme concomitant with a decreasemore » in the {sup 13}C isotope effect, suggesting a switch in the rate limitation of the hydride transfer and decarboxylation steps with hydride transfer becoming more rate limiting. The {sup 13}C effect decreases only slightly when obtained with deuterated malate, suggestive of the presence of a secondary {sup 13}C effect in the hydride transfer step, similar to data obtained with non-nicotinamide-containing dinucleotide substrates for the native enzyme (see the preceding paper in this issue). The native enzyme is inactivated in a time-dependent manner by Cd{sup 2+}. This inactivation occurs whether the enzyme alone is present or whether the enzyme is turning over with Cd{sup 2+} as the divalent metal activator. Upon inactivation, only Cd{sup 2+} ions are bound at high stoichiometry to the enzyme, which eventually becomes denatured. Conversion of the active-site thiol to thiocyanate makes it more difficult to inactivate the enzyme by treatment with Cd{sup 2+}.« less
Metabolic clearance and blood production rates of estradiol in hyperthyroidism.
Ridgway, E C; Longcope, C; Maloof, F
1975-09-01
The metabolic clearance rate of 17beta-estradiol (MCR2), the plasma levels of 17beta-estradiol (E2)1, sex-steroid binding globulin (SSBG), luteinizing hormone (LH) and follicle-stimulating hormone (FSH) were measured in 10 hyperthyroid subjects (7 men and 3 women). The blood production rate of 17beta-estradiol (PB2) was calculated for all subjects. Nine of the 10 hyperthyroid subjects had a decreased MCR2 which returned towards normal in 5 of the 6 subjects restudied following therapy. In all 10 subjects the levels of SSBG were increased when they were hyperthyroid and returned toward normal with therapy. It is concluded that the decrease in MCR2 is largely due to the increased binding of 17beta-estradiol to SSBG. In 7 of the 10 hyperthyroid the plasma E2 concentrations were normal whereas 3 had slightly elevated levels. In 8 of the 10 hyperthyroid the PB2 was within the normal range. Only 2 hyperthyroid subjects had slightly elevated PB2. In the 6 subjects who were restudied after therapy, there was no consistent change in PB2 which remained in the normal range in all cases. It is concluded that the MCR2 is decreased in most subjects with hyperthyroidism in association with an increase of SSBG. Despite this change in MCR2 there is no significant change in PB2. The increase in SSBG levels in hyperthyroidism appears to be a direct effect of the elevation of thyroid hormone activity and is not mediated through estrogen.
In Vivo Quantification of Human Serotonin 1A Receptor Using 11C-CUMI-101, an Agonist PET Radiotracer
Milak, Matthew S.; DeLorenzo, Christine; Zanderigo, Francesca; Prabhakaran, Jaya; Kumar, J.S. Dileep; Majo, Vattoly J.; Mann, J. John; Parsey, Ramin V.
2013-01-01
The serotonin (5-hydroxytryptamine, or 5-HT) type 1A receptor (5-HT1AR) is implicated in the pathophysiology of numerous neuropsychiatric disorders. We have published the initial evaluation and reproducibility in vivo of [O-methyl-11C]2-(4-(4-(2-methoxyphenyl)piperazin-1-yl)butyl)-4-methyl-1,2,4-triazine-3,5 (2H,4H)dione (11C-CUMI-101), a novel 5-HT1A agonist radiotracer, in Papio anubis. Here, we report the optimal modeling parameters of 11C-CUMI-101 for human PET studies. Methods PET scans were obtained for 7 adult human volunteers. 11C-CUMI-101 was injected as an intravenous bolus, and emission data were collected for 120 min in 3-dimensional mode. We evaluated 10 different models using metabolite-corrected arterial input functions or reference region approaches and several outcome measures. Results When using binding potential (BPF = Bavail/KD [total available receptor concentration divided by the equilibrium dissociation constant]) as the outcome measure, the likelihood estimation in the graphical analysis (LEGA) model performed slightly better than the other methods evaluated at full scan duration. The average test–retest percentage difference was 9.90% ± 5.60%. When using BPND (BPND = fnd × Bavail/KD; BPND equals the product of BPF and fnd [free fraction in the nondisplaceable compartment]), the simplified reference tissue method (SRTM) achieved the lowest percentage difference and smallest bias when compared with nondisplaceable binding potential obtained from LEGA using the metabolite-corrected plasma input function (r2 = 0.99; slope = 0.92). The time–stability analysis indicates that a 120-min scan is sufficient for the stable estimation of outcome measures. Voxel results were comparable to region-of-interest–based analysis, with higher spatial resolution. Conclusion On the basis of its measurable and stable free fraction, high affinity and selectivity, good blood–brain barrier permeability, and plasma and brain kinetics, 11C-CUMI-101 is suitable for the imaging of high-affinity 5-HT1A binding in humans. PMID:21098796
Development and evaluation of a reinforced polymeric biomaterial for use as an orthodontic wire
NASA Astrophysics Data System (ADS)
Zufall, Scott William
Composite archwires have the potential to provide esthetic and functional improvements over conventional wires. As part of an ongoing effort to bring these materials into general use, composite wires were fabricated using a photo-pultrusion manufacturing technique, and subsequently coated with a 10 mum layer of poly(chloro-p-xylylene). Coated and uncoated composites were subjected to several different evaluations to assess their ability to perform the functions of an orthodontic archwire. An investigation of the viscoelastic behavior of uncoated composite wires was conducted at a physiological temperature of 37°C using a bend stress relaxation test. Over 90 day testing periods, energy losses increased with decreasing reinforcement levels from to 8% of the initial wire stress. Final viscous losses were 1% for all reinforcement levels. Relaxed elastic moduli for the composite wires were comparable to the reported elastic moduli of conventional orthodontic wires that are typically used for initial and intermediate alignment procedures. Frictional characteristics were evaluated in passive and active configurations for uncoated composite wires against three contemporary orthodontic brackets. Kinetic coefficients of friction were the same for all wire-bracket combinations tested and were slightly lower than the reported coefficients of other initial and intermediate alignment wires. Wear patterns on the wires, which were largely caused by sharp leading edges of the bracket slots, were characteristic of plowing and cutting wear behaviors. This wear caused glass fibers to be released from the surface of the wires, presenting a potential irritant. Coated composite wires were subjected to the same frictional analysis as the uncoated wires. A mathematical model of the archwire-bracket system was derived using engineering mechanics, and used to define a coefficient of binding. The coating increased the frictional coefficients of the wires by 72%, yet the binding coefficient was unchanged. When frictional data for initial and intermediate alignment wires were compared, the coated composites had higher friction than all but one couple. However, binding coefficients were comparable. Glass fibers were contained for all testing conditions, although the coating was often damaged by plowing or cutting wear. Overall, the coating improved the clinical acceptability of the composite wires.
Characterization and screening of IgG binding to the neonatal Fc receptor
Neuber, Tobias; Frese, Katrin; Jaehrling, Jan; Jäger, Sebastian; Daubert, Daniela; Felderer, Karin; Linnemann, Mechthild; Höhne, Anne; Kaden, Stefan; Kölln, Johanna; Tiller, Thomas; Brocks, Bodo; Ostendorp, Ralf; Pabst, Stefan
2014-01-01
The neonatal Fc receptor (FcRn) protects immunoglobulin G (IgG) from degradation and increases the serum half-life of IgG, thereby contributing to a higher concentration of IgG in the serum. Because altered FcRn binding may result in a reduced or prolonged half-life of IgG molecules, it is advisable to characterize Fc receptor binding of therapeutic antibody lead candidates prior to the start of pre-clinical and clinical studies. In this study, we characterized the interactions between FcRn of different species (human, cynomolgus monkey, mouse and rat) and nine IgG molecules from different species and isotypes with common variable heavy (VH) and variable light chain (VL) domains. Binding was analyzed at acidic and neutral pH using surface plasmon resonance (SPR) and biolayer interferometry (BLI). Furthermore, we transferred the well-accepted, but low throughput SPR-based method for FcRn binding characterization to the BLI-based Octet platform to enable a higher sample throughput allowing the characterization of FcRn binding already during early drug discovery phase. We showed that the BLI-based approach is fit-for-purpose and capable of discriminating between IgG molecules with significant differences in FcRn binding affinities. Using this high-throughput approach we investigated FcRn binding of 36 IgG molecules that represented all VH/VL region combinations available in the fully human, recombinant antibody library Ylanthia®. Our results clearly showed normal FcRn binding profiles for all samples. Hence, the variations among the framework parts, complementarity-determining region (CDR) 1 and CDR2 of the fragment antigen binding (Fab) domain did not significantly change FcRn binding. PMID:24802048
IL-3 specifically inhibits GM-CSF binding to the higher affinity receptor
DOE Office of Scientific and Technical Information (OSTI.GOV)
Taketazu, F.; Chiba, S.; Shibuya, K.
1991-02-01
The inhibition of binding between human granulocyte-macrophage colony-stimulating factor (GM-CSF) and its receptor by human interleukin-3 (IL-3) was observed in myelogenous leukemia cell line KG-1 which bore the receptors both for GM-CSF and IL-3. In contrast, this phenomenon was not observed in histiocytic lymphoma cell line U-937 or in gastric carcinoma cell line KATO III, both of which have apparent GM-CSF receptor but an undetectable IL-3 receptor. In KG-1 cells, the cross-inhibition was preferentially observed when the binding of GM-CSF was performed under the high-affinity binding condition; i.e., a low concentration of 125I-GM-CSF was incubated. Scatchard analysis of 125I-GM-CSF bindingmore » to KG-1 cells in the absence and in the presence of unlabeled IL-3 demonstrated that IL-3 inhibited GM-CSF binding to the higher-affinity component of GM-CSF receptor on KG-1 cells. Moreover, a chemical cross-linking study has revealed that the cross-inhibition of the GM-CSF binding observed in KG-1 cells is specific for the beta-chain, Mr 135,000 binding protein which has been identified as a component forming the high-affinity GM-CSF receptor existing specifically on hemopoietic cells.« less
LI, DAN; BAERT, LEEN; XIA, MING; ZHONG, WEIMING; JIANG, XI; UYTTENDAELE, MIEKE
2014-01-01
The effects of 13 food extracts and juices, including shellfish, fruits, and vegetables, on the binding ability of human norovirus (NoV) were examined, using P particles of human NoV GII.4 as a research surrogate. The enhancements (positive values) or reductions (negative values) of NoV P particle detection (changes in optical density at 450 nm) in the presence of different food extracts and juices as compared with P particles diluted in phosphate-buffered saline were tested by saliva-binding, enzyme-linked immunosorbent assay in triplicate. In the presence of different food extracts and juices at different concentrations, an increase or decrease of the receptor-binding ability of the NoV P particles was observed. Due to a higher specific binding and thus a higher accumulation of the viral particles, oysters may be contaminated with human NoV more often than other shellfish species (mussel, hard clams, and razor clams). Cranberry and pomegranate juices were shown to reduce the specific binding ability of human NoV P particles. No such binding inhibition effects were observed for the other tested extracts of fresh produce (strawberry, blackberry, blueberry, cherry tomato, spinach, romaine lettuce) or, notably, for raspberry, which has been associated with human NoV outbreaks. PMID:22980024
Li, Dan; Baert, Leen; Xia, Ming; Zhong, Weiming; Jiang, Xi; Uyttendaele, Mieke
2012-07-01
The effects of 13 food extracts and juices, including shellfish, fruits, and vegetables, on the binding ability of human norovirus (NoV) were examined, using P particles of human NoV GII.4 as a research surrogate. The enhancements (positive values) or reductions (negative values) of NoV P particle detection (changes in optical density at 450 nm) in the presence of different food extracts and juices as compared with P particles diluted in phosphate-buffered saline were tested by saliva-binding, enzyme-linked immunosorbent assay in triplicate. In the presence of different food extracts and juices at different concentrations, an increase or decrease of the receptor-binding ability of the NoV P particles was observed. Due to a higher specific binding and thus a higher accumulation of the viral particles, oysters may be contaminated with human NoV more often than other shellfish species (mussel, hard clams, and razor clams). Cranberry and pomegranate juices were shown to reduce the specific binding ability of human NoV P particles. No such binding inhibition effects were observed for the other tested extracts of fresh produce (strawberry, blackberry, blueberry, cherry tomato, spinach, romaine lettuce) or, notably, for raspberry, which has been associated with human NoV outbreaks.
Intracellular Drug Bioavailability: Effect of Neutral Lipids and Phospholipids.
Treyer, Andrea; Mateus, André; Wiśniewski, Jacek R; Boriss, Hinnerk; Matsson, Pär; Artursson, Per
2018-06-04
Intracellular unbound drug concentrations are the pharmacologically relevant concentrations for targets inside cells. Intracellular drug concentrations are determined by multiple processes, including the extent of drug binding to intracellular structures. The aim of this study was to evaluate the effect of neutral lipid (NL) and phospholipid (PL) levels on intracellular drug disposition. The NL and/or PL content of 3T3-L1 cells were enhanced, resulting in phenotypes (in terms of morphology and proteome) reminiscent of adipocytes (high NL and PL) or mild phospholipidosis (only high PL). Intracellular bioavailability ( F ic ) was then determined for 23 drugs in these cellular models and in untreated wild-type cells. A higher PL content led to higher intracellular drug binding and a lower F ic . The induction of NL did not further increase drug binding but led to altered F ic due to increased lysosomal pH. Further, there was a good correlation between binding to beads coated with pure PL and intracellular drug binding. In conclusion, our results suggest that PL content is a major determinant of drug binding in cells and that PL beads may constitute a simple alternative to estimating this parameter. Further, the presence of massive amounts of intracellular NLs did not influence drug binding significantly.
The use of language to express thermal sensation suggests heat acclimatization by Indonesian people
NASA Astrophysics Data System (ADS)
Tochihara, Yutaka; Lee, Joo-Young; Wakabayashi, Hitoshi; Wijayanto, Titis; Bakri, Ilham; Parsons, Ken
2012-11-01
The purpose of this study was to explore whether there is evidence of heat acclimatization in the words used to express thermal sensation. A total of 458 urban Japanese and 601 Indonesians participated in a questionnaire. In addition, in a preliminary survey, 39 native English speakers in the UK participated. Our results showed that (1) for Indonesians, the closest thermal descriptor of a feeling of thermal comfort was `cool' (75%) followed by `slightly cool' (7%), `slightly cold' (5%) and `cold' (5%), while Japanese responses were distributed uniformly among descriptors `cool', `slightly cool', `neither', `slightly warm', and `warm'; (2) the closest thermal descriptors of a feeling of discomfort for Indonesians were less affected by individual thermal susceptibility (vulnerability) than those for Japanese; (3) in the cases where `cool' and `slightly cold' were imagined in the mind, the descriptors were cognized as a thermal comfortable feeling by 97% and 57% of Indonesians, respectively; (4) the most frequently voted choice endorsing hot weather was `higher than 32°C' for Indonesians and `higher than 29°C' for Japanese respondents; for cold weather, `lower than 15°C' for Japanese and `lower than 20°C' for Indonesians. In summary, the descriptor `cool' in Indonesians connotes a thermally comfortable feeling, but the inter-zone between hot and cold weather that was judged in the mind showed a upward shift when compared to that of Japanese. It is suggested that linguistic heat acclimatization exists on a cognitive level for Indonesians and is preserved in the words of thermal descriptors.
Solar power satellite system definition study. Volume 4: Solid State SPS Analysis, Phase 3
NASA Technical Reports Server (NTRS)
1980-01-01
A 2500 megawatt solid ground output Solar Power Satellite (SPS) of conventional configuration was designed and analyzed. Because the power per receiving antenna is halved, as compared with the klystron reference, twice the number of receiving antennas are needed to deliver the same total power. The solid state approach appears feasible with a slightly greater specific mass and slightly higher cost than the klystron SPS design.
Larsen, Sadie E; Berenbaum, Howard
2017-01-01
A recent meta-analysis found that DSM-III- and DSM-IV-defined traumas were associated with only slightly higher posttraumatic stress disorder (PTSD) symptoms than nontraumatic stressors. The current study is the first to examine whether DSM-5-defined traumas were associated with higher levels of PTSD than DSM-IV-defined traumas. Further, we examined theoretically relevant event characteristics to determine whether characteristics other than those outlined in the DSM could predict PTSD symptoms. One hundred six women who had experienced a trauma or significant stressor completed questionnaires assessing PTSD, depression, impairment, and event characteristics. Events were rated for whether they qualified as DSM-IV and DSM-5 trauma. There were no significant differences between DSM-IV-defined traumas and stressors. For DSM-5, effect sizes were slightly larger but still nonsignificant (except for significantly higher hyperarousal following traumas vs. stressors). Self-reported fear for one's life significantly predicted PTSD symptoms. Our results indicate that the current DSM-5 definition of trauma, although a slight improvement from DSM-IV, is not highly predictive of who develops PTSD symptoms. Our study also indicates the importance of individual perception of life threat in the prediction of PTSD. © 2017 S. Karger AG, Basel.
Sharma, Umender K; Chatterji, Dipankar
2008-05-01
Anti-sigma factors Escherichia coli Rsd and bacteriophage T4 AsiA bind to the essential housekeeping sigma factor, sigma(70), of E. coli. Though both factors are known to interact with the C-terminal region of sigma(70), the physiological consequences of these interactions are very different. This study was undertaken for the purpose of deciphering the mechanisms by which E. coli Rsd and bacteriophage T4 AsiA inhibit or modulate the activity of E. coli RNA polymerase, which leads to the inhibition of E. coli cell growth to different amounts. It was found that AsiA is the more potent inhibitor of in vivo transcription and thus causes higher inhibition of E. coli cell growth. Measurements of affinity constants by surface plasmon resonance experiments showed that Rsd and AsiA bind to sigma(70) with similar affinity. Data obtained from in vivo and in vitro binding experiments clearly demonstrated that the major difference between AsiA and Rsd is the ability of AsiA to form a stable ternary complex with RNA polymerase. The binding patterns of AsiA and Rsd with sigma(70) studied by using the yeast two-hybrid system revealed that region 4 of sigma(70) is involved in binding to both of these anti-sigma factors; however, Rsd interacts with other regions of sigma(70) as well. Taken together, these results suggest that the higher inhibition of E. coli growth by AsiA expression is probably due to the ability of the AsiA protein to trap the holoenzyme RNA polymerase rather than its higher binding affinity to sigma(70).
Sharma, Umender K.; Chatterji, Dipankar
2008-01-01
Anti-sigma factors Escherichia coli Rsd and bacteriophage T4 AsiA bind to the essential housekeeping sigma factor, σ70, of E. coli. Though both factors are known to interact with the C-terminal region of σ70, the physiological consequences of these interactions are very different. This study was undertaken for the purpose of deciphering the mechanisms by which E. coli Rsd and bacteriophage T4 AsiA inhibit or modulate the activity of E. coli RNA polymerase, which leads to the inhibition of E. coli cell growth to different amounts. It was found that AsiA is the more potent inhibitor of in vivo transcription and thus causes higher inhibition of E. coli cell growth. Measurements of affinity constants by surface plasmon resonance experiments showed that Rsd and AsiA bind to σ70 with similar affinity. Data obtained from in vivo and in vitro binding experiments clearly demonstrated that the major difference between AsiA and Rsd is the ability of AsiA to form a stable ternary complex with RNA polymerase. The binding patterns of AsiA and Rsd with σ70 studied by using the yeast two-hybrid system revealed that region 4 of σ70 is involved in binding to both of these anti-sigma factors; however, Rsd interacts with other regions of σ70 as well. Taken together, these results suggest that the higher inhibition of E. coli growth by AsiA expression is probably due to the ability of the AsiA protein to trap the holoenzyme RNA polymerase rather than its higher binding affinity to σ70. PMID:18359804
Zheng, Ming-Qiang; Lin, Shu-Fei; Holden, Daniel; Naganawa, Mika; Ropchan, Jim R; Najafzaden, Soheila; Kapinos, Michael; Tabriz, Mike; Carson, Richard E; Hamill, Terence G; Huang, Yiyun
2016-03-01
Glycine transporter type-1 (GlyT1) has been proposed as a target for drug development for schizophrenia. PET imaging with a GlyT1 specific radiotracer will allow for the measurement of target occupancy of GlyT1 inhibitors, and for in vivo investigation of GlyT1 alterations in schizophrenia. We conducted a comparative evaluation of two GlyT1 radiotracers, [(11) C]GSK931145, and [(18) F]MK-6577, in baboons. Two baboons were imaged with [(11) C]GSK931145 and [(18) F]MK-6577. Blocking studies with GSK931145 (0.3 or 0.2 mg/kg) were conducted to determine the level of tracer specific binding. [(11) C]GSK931145 and [(18) F]MK-6577 were synthesized in good yield and high specific activity. Moderately fast metabolism was observed for both tracers, with ∼ 30% of parent at 30 min post-injection. In the brain, both radiotracers showed good uptake and distribution profiles consistent with regional GlyT1 densities. [(18) F]MK-6577 displayed higher uptake and faster kinetics than [(11) C]GSK931145. Time activity curves were well described by the two-tissue compartment model. Regional volume of distribution (VT ) values were higher for [(18) F]MK-6577 than [(11) C]GSK931145. Pretreatment with GSK931145 reduced tracer uptake to a homogeneous level throughout the brain, indicating in vivo binding specificity and lack of a reference region for both radiotracers. Linear regression analysis of VT estimates between tracers indicated higher specific binding for [(18) F]MK-6577 than [(11) C]GSK931145, consistent with higher regional binding potential (BPND ) values of [(18) F]MK-6577 calculated using VT from the baseline scans and non-displaceable distribution volume (VND ) derived from blocking studies. [(18) F]MK-6577 appears to be a superior radiotracer with higher brain uptake, faster kinetics, and higher specific binding signals than [(11) C]GSK931145. © 2016 Wiley Periodicals, Inc.
RNA-binding proteins in plants: the tip of an iceberg?
NASA Technical Reports Server (NTRS)
Fedoroff, Nina V.; Federoff, N. V. (Principal Investigator)
2002-01-01
RNA-binding proteins, which are involved in the synthesis, processing, transport, translation, and degradation of RNA, are emerging as important, often multifunctional, cellular regulatory proteins. Although relatively few RNA-binding proteins have been studied in plants, they are being identified with increasing frequency, both genetically and biochemically. RNA-binding proteins that regulate chloroplast mRNA stability and translation in response to light and that have been elegantly analyzed in Clamydomonas reinhardtii have counterparts with similar functions in higher plants. Several recent reports describe mutations in genes encoding RNA-binding proteins that affect plant development and hormone signaling.
Ara h 1 structure is retained after roasting and is important for enhanced binding to IgE
USDA-ARS?s Scientific Manuscript database
Roasted peanuts bind higher levels of serum IgE than raw peanuts. The contribution of the major allergens to this observation are not well-defined. We compared IgE binding properties of Ara h 1 purified from raw and roasted peanuts, and assess the structural components that may contribute to diffe...
Fandakova, Yana; Sander, Myriam C; Werkle-Bergner, Markus; Shing, Yee Lee
2014-03-01
Memory performance increases during childhood and adolescence, and decreases in old age. Among younger adults, better ability to bind items to the context in which they were experienced is associated with higher working memory performance (Oberauer, 2005). Here, we examined the extent to which age differences in binding contribute to life span age differences in short-term memory (STM). Younger children (N = 85; 10 to 12 years), teenagers (N = 41; 13 to 15 years), younger adults (N = 84; 20 to 25 years), and older adults (N = 86; 70 to 75 years) worked on global and local short-term recognition tasks that are assumed to measure item and item-context memory, respectively. Structural equation models showed that item-context bindings are functioning less well in children and older adults compared with younger adults and teenagers. This result suggests protracted development of the ability to form and recollect detailed short-term memories, and decline of this ability in aging. Across all age groups, better item-context binding was associated with higher working memory performance, indicating that developmental differences in binding mechanisms are closely related to working memory development in childhood and old age. (c) 2014 APA, all rights reserved.
EVIDENCE FOR POLAR X-RAY JETS AS SOURCES OF MICROSTREAM PEAKS IN THE SOLAR WIND
DOE Office of Scientific and Technical Information (OSTI.GOV)
Neugebauer, Marcia, E-mail: mneugeb@lpl.arizona.edu
2012-05-01
It is proposed that the interplanetary manifestations of X-ray jets observed in solar polar coronal holes during periods of low solar activity are the peaks of the so-called microstreams observed in the fast polar solar wind. These microstreams exhibit velocity fluctuations of {+-}35 km s{sup -1}, higher kinetic temperatures, slightly higher proton fluxes, and slightly higher abundances of the low-first-ionization-potential element iron relative to oxygen ions than the average polar wind. Those properties can all be explained if the fast microstreams result from the magnetic reconnection of bright-point loops, which leads to X-ray jets which, in turn, result in solarmore » polar plumes. Because most of the microstream peaks are bounded by discontinuities of solar origin, jets are favored over plumes for the majority of the microstream peaks.« less
Gamma-aminobutyric acid-modulated benzodiazepine binding sites in bacteria
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lummis, S.C.R.; Johnston, G.A.R.; Nicoletti, G.
1991-01-01
Benzodiazepine binding sites, which were once considered to exist only in higher vertebrates, are here demonstrated in the bacteria E. coli. The bacterial ({sup 3}H)diazepam binding sites are modulated by GABA; the modulation is dose dependent and is reduced at high concentrations. The most potent competitors of E.Coli ({sup 3}H)diazepam binding are those that are active in displacing ({sup 3}H)benzodiazepines from vertebrate peripheral benzodiazepine binding sites. These vertebrate sites are not modulated by GABA, in contrast to vertebrate neuronal benzodiazepine binding sites. The E.coli benzodiazepine binding sites therefore differ from both classes of vertebrate benzodiazepine binding sites; however the ligandmore » spectrum and GABA-modulatory properties of the E.coli sites are similar to those found in insects. This intermediate type of receptor in lower species suggests a precursor for at least one class of vertebrate benzodiazepine binding sites may have existed.« less
Characterization of chlorophyll binding to LIL3.
Mork-Jansson, Astrid Elisabeth; Eichacker, Lutz Andreas
2018-01-01
The light harvesting like protein 3 (LIL 3) from higher plants, has been linked to functions in chlorophyll and tocopherol biosynthesis, photo-protection and chlorophyll transfer. However, the binding of chlorophyll to LIL3 is unclear. We present a reconstitution protocol for chlorophyll binding to LIL3 in DDM micelles. It is shown in the absence of lipids and carotenoids that reconstitution of chlorophyll binding to in vitro expressed LIL3 requires pre-incubation of reaction partners at room temperature. We show chlorophyll a but not chlorophyll b binding to LIL3 at a molar ratio of 1:1. Neither dynamic light scattering nor native PAGE, enabled a discrimination between binding of chlorophyll a and/or b to LIL3.
Ethylene binding site affinity in ripening apples
DOE Office of Scientific and Technical Information (OSTI.GOV)
Blankenship, S.M.; Sisler, E.C.
1993-09-01
Scatchard plots for ethylene binding in apples (Malus domestica Borkh.), which were harvested weekly for 5 weeks to include the ethylene climacteric rise, showed C[sub 50] values (concentration of ethylene needed to occupy 50% of the ethylene binding sites) of 0.10, 0.11, 0.34, 0.40, and 0.57 [mu]l ethylene/liter[sup [minus]1], respectively, for each of the 5 weeks. Higher ethylene concentrations were required to saturate the binding sites during the climacteric rise than at other times. Diffusion of [sup 14]C-ethylene from the binding sites was curvilinear and did not show any indication of multiple binding sites. Ethylene was not metabolized by applemore » tissue.« less
Cinar, Süleyman; Al-Ayoubi, Samy; Sternemann, Christian; Peters, Judith; Winter, Roland; Czeslik, Claus
2018-01-31
Calmodulin (CaM) is a Ca 2+ sensor and mediates Ca 2+ signaling through binding of numerous target ligands. The binding of ligands by Ca 2+ -saturated CaM (holo-CaM) is governed by attractive hydrophobic and electrostatic interactions that are weakened under high pressure in aqueous solutions. Moreover, the potential formation of void volumes upon ligand binding creates a further source of pressure sensitivity. Hence, high pressure is a suitable thermodynamic variable to probe protein-ligand interactions. In this study, we compare the binding of two different ligands to holo-CaM as a function of pressure by using X-ray and neutron scattering techniques. The two ligands are the farnesylated hypervariable region (HVR) of the K-Ras4B protein, which is a natural binding partner of holo-CaM, and the antagonist trifluoperazine (TFP), which is known to inhibit holo-CaM activity. From small-angle X-ray scattering experiments performed up to 3000 bar, we observe a pressure-induced partial unfolding of the free holo-CaM in the absence of ligands, where the two lobes of the dumbbell-shaped protein are slightly swelled. In contrast, upon binding TFP, holo-CaM forms a closed globular conformation, which is pressure stable at least up to 3000 bar. The HVR of K-Ras4B shows a different binding behavior, and the data suggest the dissociation of the holo-CaM/HVR complex under high pressure, probably due to a less dense protein contact of the HVR as compared to TFP. The elastic incoherent neutron scattering experiments corroborate these findings. Below 2000 bar, pressure induces enhanced atomic fluctuations in both holo-CaM/ligand complexes, but those of the holo-CaM/HVR complex seem to be larger. Thus, the inhibition of holo-CaM by TFP is supported by a low-volume ligand binding, albeit this is not associated with a rigidification of the complex structure on the sub-ns Å-scale.
Orcutt, Kelly D; Adams, Gregory P; Wu, Anna M; Silva, Matthew D; Harwell, Catey; Hoppin, Jack; Matsumura, Manabu; Kotsuma, Masakatsu; Greenberg, Jonathan; Scott, Andrew M; Beckman, Robert A
2017-10-01
Competitive radiolabeled antibody imaging can determine the unlabeled intact antibody dose that fully blocks target binding but may be confounded by heterogeneous tumor penetration. We evaluated the hypothesis that smaller radiolabeled constructs can be used to more accurately evaluate tumor expressed receptors. The Krogh cylinder distributed model, including bivalent binding and variable intervessel distances, simulated distribution of smaller constructs in the presence of increasing doses of labeled antibody forms. Smaller constructs <25 kDa accessed binding sites more uniformly at large distances from blood vessels compared with larger constructs and intact antibody. These observations were consistent for different affinity and internalization characteristics of constructs. As predicted, a higher dose of unlabeled intact antibody was required to block binding to these distant receptor sites. Small radiolabeled constructs provide more accurate information on total receptor expression in tumors and reveal the need for higher antibody doses for target receptor blockade.
Adolescent Self-Esteem: Differences by Race/Ethnicity, Gender, and Age
Bachman, Jerald G.; O’Malley, Patrick M.; Freedman-Doan, Peter; Trzesniewski, Kali H.; Donnellan, M. Brent
2012-01-01
Large-scale representative surveys of 8th-, 10th-, and 12th-grade students in the United States show high self-esteem scores for all groups. African-American students score highest, Whites score slightly higher than Hispanics, and Asian Americans score lowest. Males score slightly higher than females. Multivariate controls for grades and college plans actually heighten these race/ethnic/gender differences. A truncated scoring method, designed to counter race/ethnic differences in extreme response style, reduced but did not eliminate the subgroup differences. Age differences in self-esteem are modest, with 12th graders reporting the highest scores. The findings are highly consistent across 18 annual surveys from 1991 through 2008, and self-esteem scores show little overall change during that period. PMID:22279425
Gao, Rong
2015-01-01
ABSTRACT Understanding cellular responses to environmental stimuli requires not only the knowledge of specific regulatory components but also the quantitative characterization of the magnitude and timing of regulatory events. The two-component system is one of the major prokaryotic signaling schemes and is the focus of extensive interest in quantitative modeling and investigation of signaling dynamics. Here we report how the binding affinity of the PhoB two-component response regulator (RR) to target promoters impacts the level and timing of expression of PhoB-regulated genes. Information content has often been used to assess the degree of conservation for transcription factor (TF)-binding sites. We show that increasing the information content of PhoB-binding sites in designed phoA promoters increased the binding affinity and that the binding affinity and concentration of phosphorylated PhoB (PhoB~P) together dictate the level and timing of expression of phoA promoter variants. For various PhoB-regulated promoters with distinct promoter architectures, expression levels appear not to be correlated with TF-binding affinities, in contrast to the intuitive and oversimplified assumption that promoters with higher affinity for a TF tend to have higher expression levels. However, the expression timing of the core set of PhoB-regulated genes correlates well with the binding affinity of PhoB~P to individual promoters and the temporal hierarchy of gene expression appears to be related to the function of gene products during the phosphate starvation response. Modulation of the information content and binding affinity of TF-binding sites may be a common strategy for temporal programming of the expression profile of RR-regulated genes. PMID:26015501
Owczarek, C M; Layton, M J; Metcalf, D; Lock, P; Willson, T A; Gough, N M; Nicola, N A
1993-01-01
Human leukaemia inhibitory factor (hLIF) binds to both human and mouse LIF receptors (LIF-R), while mouse LIF (mLIF) binds only to mouse LIF-R. Moreover, hLIF binds with higher affinity to the mLIF-R than does mLIF. In order to define the regions of the hLIF molecule responsible for species-specific interaction with the hLIF-R and for the unusual high-affinity binding to the mLIF-R, a series of 15 mouse/human LIF hybrids has been generated. Perhaps surprisingly, both of these properties mapped to the same region of the hLIF molecule. The predominant contribution was from residues in the loop linking the third and fourth helices, with lesser contributions from residues in the third helix and the loop connecting the second and third helices in the predicted three-dimensional structure. Since all chimeras retained full biological activity and receptor-binding activity on mouse cells, and there was little variation in the specific biological activity of the purified proteins, it can be concluded that the overall secondary and tertiary structures of each chimera were intact. This observation also implied that the primary binding sites on mLIF and hLIF for the mLIF-R were unaltered by inter-species domain swapping. Consequently, the site on the hLIF molecule that confers species-specific binding to the hLIF-R and higher affinity binding to the mLIF-R, must constitute an additional interaction site to that used by both mLIF and hLIF to bind to the mLIF-R. These studies define a maximum of 15 amino acid differences between hLIF and mLIF that are responsible for the different properties of these proteins. Images PMID:8253075
DOE Office of Scientific and Technical Information (OSTI.GOV)
Demirbas, A.; Simsek, T.
In this work, the utilization of aniline (C{sub 6}H{sub 7}N) formaldehyde (HCHO) resins as a binding agent of coke briquetting was investigated. Aniline (AN) formaldehyde (F) resins are a family of thermoplastics synthesized by condensing AN and F in an acid solution exhibiting high dielectric strength. The tensile strength sharply increases as the ratio of F to AN from 0.5 to 1.6, and it reaches the highest values between 1.6 and 2.2 F/AN ratio; it then slightly decreases. The highest tensile strength of F-AN resin-coke briquette (23.66 MN/m{sup 2}) was obtained from the run with 1.5 of F/AN ratio bymore » using (NH4){sub 2}S{sub 2}O{sub 8} catalyst at 310 K briquetting temperature. The tensile strength of F-AN resin-coke briquette slightly decreased with increasing the catalyst percent to 0.10%, and then it sharply decreased to zero with increasing the catalyst percent to 0.2%. The effect of pH on the tensile strength is irregular. As the pH of the mixture increases from 9.0 to 9.2, the tensile strength shows a sharp increase, and the curve reaches a plateau value between pH 9.3 and 9.9; then the tensile strength shows a slight increase after pH = 9.9.« less
Wu, Hai; Chen, Miaomiao; Shang, Mengting; Li, Xiang; Mu, Kui; Fan, Suhua; Jiang, Shuanglin; Li, Wenyong
2018-07-05
Black carbon (BC) is a main component of particulate matter (PM 2.5 ). Due to their small size (<100nm), inhaled ultrafine BC nanoparticles may penetrate the lung alveoli, where they interact with surfactant proteins and lipids, causing more serious damage to human health. Here, BC was analyzed to investigate the binding mechanism of its interaction with protein and induction of cytotoxicity changes. The binding process and protein conformation between BC and a serum protein (bovine serum albumin, BSA) were monitored by using a fluorescence quenching technique and UV-vis absorption, Fourier transform infrared (FTIR) and circular dichroism (CD) spectroscopies. The experimental results revealed that the fluorescence quenching of BSA induced by BC was a static quenching process and the hydrophobic force played the critical role in the interaction. The native conformation of BSA on the BC surface was slightly disturbed but obvious structural unfolding of the secondary structure did not occur. In the cytotoxicity study, BC nanoparticles with low concentrations exhibited strong toxicity towards BEAS-2B cells. However, the toxicity of BC nanoparticles could be mitigated by the presence of BSA. Therefore, proteins in biological fluids likely reduce the toxic effect of BC on human health. These findings delineated the binding mechanism and the toxicity between BC and the BSA-BC system, contributing to the understanding of the biological effects of BC exposure on human health in polluted atmospheres. Copyright © 2018 Elsevier B.V. All rights reserved.
Larsen, Anett K; Kristiansen, Kurt; Sylte, Ingebrigt; Seternes, Ole-Morten; Bang, Berit E
2013-07-20
Salmon trypsin is shown to increase secretion of the pro-inflammatory cytokine interleukin (IL)-8 from human airway epithelial cells through activation of PAR-2. Secretion of IL-8 induced by king crab trypsin is observed in a different concentration range compared to salmon trypsin, and seems to be only partially related to PAR-2 activation. This report aim to identify differences in the molecular structure of king crab trypsin (Paralithodes camtschaticus) compared to salmon (Salmo salar) and bovine trypsin (Bos taurus) that might influence the ability to activate protease-activated receptor-2 (PAR-2). During purification king crab trypsin displayed stronger binding capacity to the anionic column used in fast protein liquid chromatography compared to fish trypsins, and was identified as a slightly bigger molecule. Measurements of enzymatic activity yielded no obvious differences between the trypsins tested. Molecular modelling showed that king crab trypsin has a large area with strong negative electrostatic potential compared to the smaller negative areas in bovine and salmon trypsins. Bovine and salmon trypsins also displayed areas with strong positive electrostatic potential, a feature lacking in the king crab trypsin. Furthermore we have identified 3 divergent positions (Asp196, Arg244, and Tyr247) located near the substrate binding pocket of king crab trypsin that might affect the binding and cleavage of PAR-2. These preliminary results indicate that electrostatic interactions could be of importance in binding, cleavage and subsequent activation of PAR-2.
Huang, Huan; McIntosh, Avery L; Martin, Gregory G; Landrock, Kerstin K; Landrock, Danilo; Gupta, Shipra; Atshaves, Barbara P; Kier, Ann B; Schroeder, Friedhelm
2014-05-01
The human liver fatty acid-binding protein (L-FABP) T94A variant, the most common in the FABP family, has been associated with elevated liver triglyceride levels. How this amino acid substitution elicits these effects is not known. This issue was addressed using human recombinant wild-type (WT) and T94A variant L-FABP proteins as well as cultured primary human hepatocytes expressing the respective proteins (genotyped as TT, TC and CC). The T94A substitution did not alter or only slightly altered L-FABP binding affinities for saturated, monounsaturated or polyunsaturated long chain fatty acids, nor did it change the affinity for intermediates of triglyceride synthesis. Nevertheless, the T94A substitution markedly altered the secondary structural response of L-FABP induced by binding long chain fatty acids or intermediates of triglyceride synthesis. Finally, the T94A substitution markedly decreased the levels of induction of peroxisome proliferator-activated receptor α-regulated proteins such as L-FABP, fatty acid transport protein 5 and peroxisome proliferator-activated receptor α itself meditated by the polyunsaturated fatty acids eicosapentaenoic acid and docosahexaenoic acid in cultured primary human hepatocytes. Thus, although the T94A substitution did not alter the affinity of human L-FABP for long chain fatty acids, it significantly altered human L-FABP structure and stability, as well as the conformational and functional response to these ligands. © 2014 FEBS.
Fernández, José M; Plaza, César; Senesi, Nicola; Polo, Alfredo
2007-09-01
The acid-base properties of humic acids (HAs) and fulvic acids (FAs) isolated from composted sewage sludge (CS), thermally-dried sewage sludge (TS), soils amended with either CS or TS at a rate of 80 t ha(-1)y(-1) for 3y and the corresponding unamended soil were investigated by use of potentiometric titrations. The non-ideal competitive adsorption (NICA)-Donnan model for a bimodal distribution of proton binding sites was fitted to titration data by use of a least-squares minimization method. The main fitting parameters of the NICA-Donnan model obtained for each HA and FA sample included site densities, median affinity constants and widths of affinity distributions for proton binding to low and high affinity sites, which were assumed to be, respectively, carboxylic- and phenolic-type groups. With respect to unamended soil HA and FA, the HAs and FAs from CS, and especially TS, were characterized by smaller acidic functional group contents, larger proton binding affinities of both carboxylic- and phenolic-type groups, and smaller heterogeneity of carboxylic and phenolic-type groups. Amendment with CS or TS led to a decrease of acidic functional group contents and a slight increase of proton binding affinities of carboxylic- and phenolic-type groups of soil HAs and FAs. These effects were more evident in the HA and FA fractions from CS-amended soil than in those from TS-amended soil.
Takahama, Umeo; Hirota, Sachiko
2011-06-08
During the digestion of starch in foods, starch is mixed with bile in the duodenum. Because fatty acids and some kinds of polyphenols could bind to starch, it was postulated that bile salts might also bind to starch. The purpose of this paper is to study the effects of bile and bile salts on starch/iodine complex formation and pancreatin-induced starch digestion. Bile suppressed starch/iodine complex formation and inhibited pancreatin-induced starch digestion slightly in control buckwheat starch, but did so significantly in buckwheat starch from which fatty acids and polyphenols had been extracted. Such significant suppression and inhibition by bile were also observed in a reagent soluble starch. The effects of cholate and taurocholate on the starch/iodine complex formation and the pancreatin-induced starch digestion were essentially the same as those of bile. Bile, cholate, and taurocholate suppressed amylose/iodine complex formation more significantly than amylopectin/iodine complex formation and inhibited pancreatin-induced amylose digestion more effectively than the digestion of amylopectin. It is concluded from the results that bile salts could bind to starch, especially amylose, the helical structures of which were not occupied by other molecules such as fatty acids and polyphenols, and that the binding resulted in the inhibition of starch digestion by pancreatin. The conclusion suggests that the function of bile salts can be discussed from the point of not only lipid digestion but also starch digestion.
Duan, Yuhua; Stinespring, Charter D.; Chorpening, Benjamin
2015-06-18
To better understand the effects of low-level fluorine in graphene-based sensors, first-principles density functional theory (DFT) with van der Waals dispersion interactions has been employed to investigate the structure and impact of fluorine defects on the electrical properties of single-layer graphene films. The results show that both graphite-2H and graphene have zero band gaps. When fluorine bonds to a carbon atom, the carbon atom is pulled slightly above the graphene plane, creating what is referred to as a CF defect. The lowest-binding energy state is found to correspond to two CF defects on nearest neighbor sites, with one fluorine abovemore » the carbon plane and the other below the plane. Overall this has the effect of buckling the graphene. The results further show that the addition of fluorine to graphene leads to the formation of an energy band (BF) near the Fermi level, contributed mainly from the 2p orbitals of fluorine with a small contribution from the porbitals of the carbon. Among the 11 binding configurations studied, our results show that only in two cases does the BF serve as a conduction band and open a band gap of 0.37 eV and 0.24 eV respectively. The binding energy decreases with decreasing fluorine concentration due to the interaction between neighboring fluorine atoms. The obtained results are useful for sensor development and nanoelectronics.« less
The effect of phosphorylation on arrestin-rhodopsin interaction in the squid visual system.
Robinson, Kelly A; Ou, Wei-Lin; Guan, Xinyu; Sugamori, Kim S; Bandyopadhyay, Abhishek; Ernst, Oliver P; Mitchell, Jane
2015-12-01
Invertebrate visual opsins are G protein-coupled receptors coupled to retinoid chromophores that isomerize reversibly between inactive rhodopsin and active metarhodopsin upon absorption of photons of light. The squid visual system has an arrestin protein that binds to metarhodopsin to block signaling to Gq and activation of phospholipase C. Squid rhodopsin kinase (SQRK) can phosphorylate both metarhodopsin and arrestin, a dual role that is unique among the G protein-coupled receptor kinases. The sites and role of arrestin phosphorylation by SQRK were investigated here using recombinant proteins. Arrestin was phosphorylated on serine 392 and serine 397 in the C-terminus. Unphosphorylated arrestin bound to metarhodopsin and phosphorylated metarhodopsin with similar high affinities (Kd 33 and 21 nM respectively), while phosphorylation of arrestin reduced the affinity 3- to 5-fold (Kd 104 nM). Phosphorylation of metarhodopsin slightly increased the dissociation of arrestin observed during a 1 hour incubation. Together these studies suggest a unique role for SQRK in phosphorylating both receptor and arrestin and inhibiting the binding of these two proteins in the squid visual system. Invertebrate visual systems are inactivated by arrestin binding to metarhodopsin that does not require receptor phosphorylation. Here we show that squid rhodopsin kinase phosphorylates arrestin on two serines (S392,S397) in the C-terminus and phosphorylation decreases the affinity of arrestin for squid metarhodopsin. Metarhodopsin phosphorylation has very little effect on arrestin binding but does increase arrestin dissociation. © 2015 International Society for Neurochemistry.
Functional basis for complement evasion by staphylococcal superantigen-like 7.
Bestebroer, Jovanka; Aerts, Piet C; Rooijakkers, Suzan H M; Pandey, Manoj K; Köhl, Jörg; van Strijp, Jos A G; de Haas, Carla J C
2010-10-01
The human pathogen Staphylococcus aureus has a plethora of virulence factors that promote its colonization and survival in the host. Among such immune modulators are staphylococcal superantigen-like (SSL) proteins, comprising a family of 14 small, secreted molecules that seem to interfere with the host innate immune system. SSL7 has been described to bind immunoglobulin A (IgA) and complement C5, thereby inhibiting IgA-FcαRI binding and serum killing of Escherichia coli. As C5a generation, in contrast to C5b-9-mediated lysis, is crucial for immune defence against staphylococci, we investigated the impact of SSL7 on staphylococcal-induced C5a-mediated effects. Here, we show that SSL7 inhibits C5a generation induced by staphylococcal opsonization, slightly enhanced by its IgA-binding capacity. Moreover, we demonstrate a strong protective activity of SSL7 against staphylococcal clearance in human whole blood. SSL7 strongly inhibited the C5a-induced phagocytosis of S. aureus and oxidative burst in an in vitro whole-blood inflammation model. Furthermore, we found that SSL7 affects all three pathways of complement activation and inhibits the cleavage of C5 by interference of its binding to C5 convertases. Finally, SSL7 effects were also demonstrated in vivo. In a murine model of immune complex peritonitis, SSL7 abrogated the C5a-driven influx of neutrophils in mouse peritoneum. © 2010 Blackwell Publishing Ltd.
Functional basis for complement evasion by staphylococcal superantigen-like 7
Bestebroer, Jovanka; Aerts, Piet C.; Rooijakkers, Suzan H.M.; Pandey, Manoj K.; Köhl, Jörg; van Strijp, Jos A. G.; de Haas, Carla J. C.
2010-01-01
Summary The human pathogen Staphylococcus aureus has a plethora of virulence factors that promote its colonization and survival in the host. Among such immune modulators are staphylococcal superantigen-like (SSL) proteins, comprising a family of 14 small, secreted molecules that seem to interfere with the host innate immune system. SSL7 has been described to bind immunoglobulin A (IgA) and complement C5, thereby inhibiting IgA-FcαRI binding and serum killing of E. coli. As C5a generation, in contrast to C5b-9-mediated lysis, is crucial for immune defense against staphylococci, we investigated the impact of SSL7 on staphylococcal-induced C5a-mediated effects. Here, we show that SSL7 inhibits C5a generation induced by staphylococcal opsonization, slightly enhanced by its IgA-binding capacity. Moreover, we demonstrate a strong protective activity of SSL7 against staphylococcal clearance in human whole blood. SSL7 strongly inhibited the C5a-induced phagocytosis of S. aureus and oxidative burst in an in vitro whole blood inflammation model. Furthermore, we found that SSL7 affects all three pathways of complement activation and inhibits the cleavage of C5 by interference of its binding to C5 convertases. Finally, SSL7 effects were also demonstrated in vivo. In a murine model of immune complex peritonitis, SSL7 abrogated the C5a-driven influx of neutrophils in mouse peritoneum. PMID:20545943
DOE Office of Scientific and Technical Information (OSTI.GOV)
Djurovich, P.I.; Cook, W.; Joshi, R.
1994-01-13
Luminescence lifetimes ([tau][sub m]) of the [sigma]-bond-to-ligand charge-transfer (SBLCT) excited states of two diastereomers of fac-tris[(8-quinolyl)phenylmethylsilyl]iridium(III) differ by about a factor of 2 and are strongly solvent dependent. The [tau][sub m] values of the more symmetric [Delta]RRR, [Lambda]SSS diastereomer (A) are generally longer than those of the less symmetric [Delta]RRS, [Lambda]SSR diastereomer (B); [tau][sub m]'s of both diastereomers are substantially shortened relative to their values in aliphatic hydrocarbons by exciplex formation with a variety of weakly coordinating solvents including aromatic hydrocarbons, olefins, ethers, ketones, alcohols, and nitriles. Quenching constants (k[sub q]) due to exciplex formation are found to be muchmore » larger for B than they are for A in the [sigma]-donor solvents (cyclic ethers, ketones, alcohols, and nitriles); however, k[sub q] values of B are slightly smaller than those of A in [pi]-acceptor solvents (aromatic hydrocarbons, olefins). The results suggest that [sigma]-donor solvents form exciplexes by binding at the metal center, whereas [pi]-acceptor solvents bind at a quinolyl radical anion ligand site. A and B may prove useful as luminescent environmental probes which can distinguish between [sigma]-donor and [pi]-acceptor binding sites. 19 refs., 1 fig., 1 tab.« less
Saw palmetto extracts potently and noncompetitively inhibit human alpha1-adrenoceptors in vitro.
Goepel, M; Hecker, U; Krege, S; Rübben, H; Michel, M C
1999-02-15
We wanted to test whether phytotherapeutic agents used in the treatment of lower urinary tract symptoms have alpha1-adrenoceptor antagonistic properties in vitro. Preparations of beta-sitosterol and extracts of stinging nettle, medicinal pumpkin, and saw palmetto were obtained from several pharmaceutical companies. They were tested for their ability to inhibit [3H]tamsulosin binding to human prostatic alpha1-adrenoceptors and [3H]prazosin binding to cloned human alpha1A- and alpha1B-adrenoceptors. Inhibition of phenylephrine-stimulated [3H]inositol phosphate formation by cloned receptors was also investigated. Up to the highest concentration which could be tested, preparations of beta-sitosterol, stinging nettle, and medicinal pumpkin were without consistent inhibitory effect in all assays. In contrast, all tested saw palmetto extracts inhibited radioligand binding to human alpha1-adrenoceptors and agonist-induced [3H]inositol phosphate formation. Saturation binding experiments in the presence of a single saw palmetto extract concentration indicated a noncompetitive antagonism. The relationship between active concentrations in vitro and recommended therapeutic doses for the saw palmetto extracts was slightly lower than that for several chemically defined alpha1-adrenoceptor antagonists. Saw palmetto extracts have alpha1-adrenoceptor-inhibitory properties. If bioavailability and other pharmacokinetic properties of these ingredients are similar to those of the chemically defined alpha1-adrenoceptor antagonists, alpha1-adrenoceptor antagonism might be involved in the therapeutic effects of these extracts in patients with lower urinary tract symptoms suggestive of benign prostatic obstruction.
Zubieta, J K; Huguelet, P; Ohl, L E; Koeppe, R A; Kilbourn, M R; Carr, J M; Giordani, B J; Frey, K A
2000-10-01
It has been hypothesized that anomalies in monoaminergic function underlie some of the manifestations of bipolar disorder. In this study the authors examined the possibility that trait-related abnormalities in the concentration of monoaminergic synaptic terminals may be present in patients with asymptomatic bipolar disorder type I. The concentration of a stable presynaptic marker, the vesicular monoamine transporter protein (VMAT2), was quantified with (+)[(11)C]dihydrotetrabenazine (DTBZ) and positron emission tomography. Sixteen asymptomatic patients with bipolar I disorder who had a prior history of mania with psychosis (nine men and seven women) and individually matched healthy subjects were studied. Correlational analyses were conducted to examine the relationship between regional VMAT2 binding, cognitive function, and clinical variables. VMAT2 binding in the thalamus and ventral brainstem of the bipolar patients was higher than that in the comparison subjects. VMAT2 concentrations in these regions correlated with performance on measures of frontal, executive function. In addition, sex differences in VMAT2 binding were detected in the thalamus of the bipolar patients; the male patients had higher binding than the women. No sex differences in binding were observed in the healthy comparison group. These initial results suggest that higher than normal VMAT2 expression and, by extension, concentration of monoaminergic synaptic terminals, may represent a trait-related abnormality in patients with bipolar I disorder and that male and female patients show different patterns. Also, VMAT2 concentrations may be associated with some of the cognitive deficits encountered in euthymic bipolar disorder.
Computer-aided rational design of novel EBF analogues with an aromatic ring.
Wang, Shanshan; Sun, Yufeng; Du, Shaoqing; Qin, Yaoguo; Duan, Hongxia; Yang, Xinling
2016-06-01
Odorant binding proteins (OBPs) are important in insect olfactory recognition. These proteins bind specifically to insect semiochemicals and induce their seeking, mating, and alarm behaviors. Molecular docking and molecular dynamics simulations were performed to provide computational insight into the interaction mode between AgamOBP7 and novel (E)-β-farnesene (EBF) analogues with an aromatic ring. The ligand-binding cavity in OBP7 was found to be mostly hydrophobic due to the presence of several nonpolar residues. The interactions between the EBF analogues and the hydrophobic residues in the binding cavity increased in strength as the distance between them decreased. The EBF analogues with an N-methyl formamide or ester linkage had higher docking scores than those with an amide linkage. Moreover, delocalized π-π and electrostatic interactions were found to contribute significantly to the binding between the ligand benzene ring and nearby protein residues. To design new compounds with higher activity, four EBF analogues D1-D4 with a benzene ring were synthesized and evaluated based on their docking scores and binding affinities. D2, which had an N-methyl formamide group linkage, exhibited stronger binding than D1, which had an amide linkage. D4 exhibited particularly strong binding due to multiple hydrophobic interactions with the protein. This study provides crucial foundations for designing novel EBF analogues based on the OBP structure. Graphical abstract The design strategy of new EBF analogues based on the OBP7 structure.
Burnout in Hospital Social Workers Who Work with AIDS Patients.
ERIC Educational Resources Information Center
Oktay, Julianne S.
1992-01-01
Surveyed 128 hospital social workers who worked with Acquired Immune Deficiency Syndrome (AIDS) patients. Found that hospital AIDS social workers had slightly higher rates of emotional exhaustion and depersonalization on Maslach Burnout Inventory but also felt substantially higher level of personal accomplishment. Age, autonomy, and belonging to…
Documentation of Criteria for Promotion in a Higher Education Broadcast Journalism Discipline.
ERIC Educational Resources Information Center
Reppert, James E.
All institutions of higher learning have slightly different techniques of promoting and tenuring their faculty. The author compiled this document to provide resourceful pointers to future Broadcast Journalism and Mass Communication professors in the writing and organization of their applications. This collection of materials traces one tenured…
Cheung, Kwok Fan; Yung, Susan; Chau, Mel K M; Yap, Desmond Y H; Chan, Kwok Wah; Lee, Cheuk Kwong; Tang, Colin S O; Chan, Tak Mao
2017-04-25
Annexin II on mesangial cell surface mediates the binding of anti-dsDNA antibodies and consequent downstream inflammatory and fibrotic processes. We investigated the clinical relevance of circulating annexin II-binding immunoglobulins (Igs) in patients with severe proliferative lupus nephritis, and renal annexin II expression in relation to progression of nephritis in New Zealand Black and White F1 mice (NZBWF1/J) mice. Annexin II-binding Igs in serum were measured by ELISA. Ultrastructural localization of annexin II was determined by electron microscopy. Seropositivity rates for annexin II-binding IgG and IgM in patients with active lupus nephritis were significantly higher compared with controls (8.9%, 1.3% and 0.9% for annexin II-binding IgG and 11.1%, 4.0% and 1.9% for annexin II-binding IgM for patients with active lupus nephritis, patients with non-lupus renal disease and healthy subjects respectively). In lupus patients, annexin II-binding IgM level was higher at disease flare compared with remission. Annexin II-binding IgG and IgM levels were associated with that of anti-dsDNA and disease activity. Annexin II-binding IgG and IgM levels correlated with histological activity index in lupus nephritis biopsy samples. In NZBWF1/J mice, serum annexin II-binding IgG and IgM levels and glomerular annexin II and p11 expression increased with progression of active nephritis. Annexin II expression was present on mesangial cell surface and in the mesangial matrix, and co-localized with electron-dense deposits along the glomerular basement membrane. Our results show that circulating annexin II-binding IgG and IgM levels are associated with clinical and histological disease activity in proliferative lupus nephritis. The co-localization of annexin II and p11 expression with immune deposition in the kidney suggests pathogenic relevance. © 2017 The Author(s). published by Portland Press Limited on behalf of the Biochemical Society.
Yang, Chenghu; Liu, Yangzhi; Zhu, Yaxian; Zhang, Yong
2016-03-15
The autochthonous dissolved organic matter (DOM) released by Microcystis aeruginosa (M. aeruginosa-DOM) during its growth period was characterized by spectroscopy. Furthermore, the relationships between the M. aeruginosa-DOM spectroscopic descriptors and the pyrene binding coefficient (KDOC) values were explored. The results showed that the spectroscopic characteristics of the M. aeruginosa-DOM and the binding properties of pyrene were dynamically changed along with the algae growth. Pearson correlation analysis demonstrated that a higher pyrene KDOC value was observed for the M. aeruginosa-DOM that has a higher humification index (HIX) value, a lower biological index (BIX) value and a lower absorption ratio (E2/E3). The presence of protein-like and long-wavelength-excited humic-like components may impose negative and positive effects on binding of pyrene by the M. aeruginosa-DOM, respectively. Principal component analysis (PCA) further supported that the binding affinity of pyrene may be primarily influenced by the humification degree of the M. aeruginosa-DOM. Copyright © 2016 Elsevier Ltd. All rights reserved.
Thermodynamic aspects of dicarboxylate recognition by simple artificial receptors.
Linton, B R; Goodman, M S; Fan, E; van Arman, S A; Hamilton, A D
2001-11-02
Recognition of dicarboxylates by bis-functional hydrogen-bonding receptors displays divergent thermodynamics in different solvent systems. NMR titration and isothermal titration calorimetry indicated that neutral bis-urea and bis-thiourea receptors form exothermic complexes with dicarboxylates in DMSO, with a near zero entropic contribution to binding. The increased binding strength of bis-guanidinium receptors precluded quantitative measurement of binding constants in DMSO, but titration calorimetry offered a qualitative picture of the association. Formation of these 1:1 complexes was also exothermic, but additional endothermic events occurred at both lower and higher host-guest ratios. These events indicated multiple binding equilibria but did not always occur at a discrete 2:1 or 1:2 host-guest molar ratio, suggesting higher aggregates. With increasing amounts of methanol as solvent, bis-guanidinium receptors form more endothermic complexes with dicarboxylates, with a favorable entropy of association. This switch from association driven by enthalpy to one driven by entropy may reflect a change from complexation involving the formation of hydrogen bonds to that promoted by solvent liberation from binding sites.
[Cr-Ti-Al-N complex coating on titanium to strengthen Ti/porcelain bonding].
Zhang, Hui; Guo, Tian-wen; Li, Jun-ming; Pan, Jing-guang; Dang, Yong-gang; Tong, Yu
2006-02-01
To study the feasibility of magnetron sputtering Cr-Ti-Al-N complex coating as an interlayer on titanium to enhance the titanium-ceramic binding strength. With a three-point bending test according to ISO 9693, the binding strength of Duceratin (Degussa) to titanium substrate prepared with 4 different surface treatments (polishing, polishing and megnetron sputtering Cr, Ti, Al, and N complex coating, sandblasting, sandblasting and coating) was evaluated. Ti/porcelain interface and fractured Ti surface were examined using scanning electron microscopy with energy-dispersive spectrometry (EDS). The binding strength of polished and coated titanium/Duceratin was significantly higher than polished titanium group (P<0.05). The binding strength of sandblasted and coated titanium/Duceratin did not differ significantly from that of sandblasted titanium group (P>0.05), and the strength in the two sandblasted titanium groups was significantly higher than that in polished and coated titanium group (P<0.05). Megnetron sputtering Cr-Ti-Al-N complex on polished titanium can increase the titanium/porcelain binding strength. Megnetron sputtering coating is a promising Ti/porcelain interlayer.
Active site-directed double mutants of dihydrofolate reductase.
Ercikan-Abali, E A; Mineishi, S; Tong, Y; Nakahara, S; Waltham, M C; Banerjee, D; Chen, W; Sadelain, M; Bertino, J R
1996-09-15
Variants of dihydrofolate reductase (DHFR), which confer resistance to antifolates, are used as dominant selectable markers in vitro and in vivo and may be useful in the context of gene therapy. To identify improved mutant human DHFRs with increased catalytic efficiency and decreased binding to methotrexate, we constructed by site-directed mutagenesis four variants with substitutions at both Leu22 and Phe31 (i.e., Phe22-Ser31, Tyr22-Ser31, Phe22-Gly31, and Tyr22-Gly31). Antifolate resistance has been observed previously when individual changes are made at these active-site residues. Substrate and antifolate binding properties of these "double" mutants revealed that each have greatly diminished affinity for antifolates (> 10,000-fold) yet only slightly reduced substrate affinity. Comparison of in vitro measured properties with those of single-residue variants indicates that double mutants are indeed significantly superior. This was verified for one of the double mutants that provided high-level methotrexate resistance following retrovirus-mediated gene transfer in NIH3T3 cells.
Land, B R; Harris, W V; Salpeter, E E; Salpeter, M M
1984-01-01
In previous papers we studied the rising phase of a miniature endplate current (MEPC) to derive diffusion and forward rate constants controlling acetylcholine (AcCho) in the intact neuromuscular junction. The present study derives similar values (but with smaller error ranges) for these constants by including experimental results from the falling phase of the MEPC. We find diffusion to be 4 X 10(-6) cm2 s-1, slightly slower than free diffusion, forward binding to be 3.3 X 10(7) M-1 s-1, and the distance from an average release site to the nearest exit from the cleft to be 1.6 micron. We also estimate the back reaction rates. From our values we can accurately describe the shape of MEPCs under different conditions of receptor and esterase concentration. Since we suggest that unbinding is slower than isomerization, we further predict that there should be several short "closing flickers" during the total open time for an AcCho-ligated receptor channel. PMID:6584895
Kang, In-Nee; Musa, Maslinda; Harun, Fatimah; Junit, Sarni Mat
2010-02-01
The FOXE1 gene was screened for mutations in a cohort of 34 unrelated patients with congenital hypothyroidism, 14 of whom had thyroid dysgenesis and 18 were normal (the thyroid status for 2 patients was unknown). The entire coding region of the FOXE1 gene was PCR-amplified, then analyzed using single-stranded conformational polymorphism, followed by confirmation by direct DNA sequencing. DNA sequencing analysis revealed a heterozygous A>G transition at nucleotide position 394 in one of the patients. The nucleotide transition changed asparagine to aspartate at codon 132 in the highly conserved region of the forkhead DNA binding domain of the FOXE1 gene. This mutation was not detected in a total of 104 normal healthy individuals screened. The binding ability of the mutant FOXE1 protein to the human thyroperoxidase (TPO) promoter was slightly reduced compared with the wild-type FOXE1. The mutation also caused a 5% loss of TPO transcriptional activity.
Chignen Possi, Kelvine; Mulumba, Mukandila; Omri, Samy; Garcia-Ramos, Yesica; Tahiri, Houda; Chemtob, Sylvain; Ong, Huy; Lubell, William D
2017-11-22
Azapeptide analogues of growth hormone releasing peptide-6 (GHRP-6) exhibit promising affinity, selectivity, and modulator activity on the cluster of differentiation 36 receptor (CD36). For example, [A 1 , azaF 4 ]- and [azaY 4 ]-GHRP-6 (1a and 2b) were previously shown to bind selectively to CD36 and exhibited respectively significant antiangiogenic and slight angiogenic activities in a microvascular sprouting assay using choroid explants. The influences of the 1- and 4-position residues on the affinity, anti-inflammatory, and antiangiogenic activity of these azapeptides have now been studied in detail by the synthesis and analysis of a set of 25 analogues featuring Ala 1 or His 1 and a variety of aromatic side chains at the aza-amino acid residue in the 4-position. Although their binding affinities differed only by a factor of 17, the analogues exhibited significant differences in ability to modulate production of nitric oxide (NO) in macrophages and choroidal neovascularization.
Fluorescence quenching of human orosomucoid. Accessibility to drugs and small quenching agents.
Friedman, M L; Schlueter, K T; Kirley, T L; Halsall, H B
1985-01-01
The fluorescence behaviour of human orosomucoid was investigated. The intrinsic fluorescence was more accessible to acrylamide than to the slightly larger succinimide, indicating limited accessibility to part of the tryptophan population. Although I- showed almost no quenching, that of Cs+ was enhanced, and suggested a region of negative charge proximal to an emitting tryptophan residue. Removal of more than 90% of sialic acid from the glycan chains led to no change in the Cs+, I-, succinimide or acrylamide quenching, indicating that the negatively charged region originates with the protein core. Quenching as a function of pH and temperature supported this view. The binding of chlorpromazine monitored by fluorescence quenching, in the presence and in the absence of the small quenching probes (above), led to a model of its binding domain on orosomucoid that includes two tryptophan residues relatively shielded from the bulk solvent, with the third tryptophan residue being on the periphery of the domain, or affected allotopically and near the negatively charged field. PMID:4091825
Hydrogen atom addition to the surface of graphene nanoflakes: A density functional theory study
NASA Astrophysics Data System (ADS)
Tachikawa, Hiroto
2017-02-01
Polycyclic aromatic hydrocarbons (PAHs) provide a 2-dimensional (2D) reaction surface in 3-dimensional (3D) interstellar space and have been utilized as a model of graphene surfaces. In the present study, the reaction of PAHs with atomic hydrogen was investigated by means of density functional theory (DFT) to systematically elucidate the binding nature of atomic hydrogen to graphene nanoflakes. PAHs with n = 4-37 were chosen, where n indicates the number of benzene rings. Activation energies of hydrogen addition to the graphene surface were calculated to be 5.2-7.0 kcal/mol at the CAM-B3LYP/6-311G(d,p) level, which is almost constant for all PAHs. The binding energies of hydrogen atom were slightly dependent on the size (n): 14.8-28.5 kcal/mol. The absorption spectra showed that a long tail is generated at the low-energy region after hydrogen addition to the graphene surface. The electronic states of hydrogenated graphenes were discussed on the basis of theoretical results.
Thymol nanoencapsulated by sodium caseinate: physical and antilisterial properties.
Pan, Kang; Chen, Huaiqiong; Davidson, P Michael; Zhong, Qixin
2014-02-19
In this work, thymol was encapsulated in sodium caseinate using high shear homogenization. The transparent dispersion at neutral pH was stable for 30 days at room temperature as determined by dynamic light scattering and atomic force microscopy, which agreed with high ζ potential of nanoparticles. The slightly decreased particle dimension during storage indicates the absence of Ostwald ripening. When molecular binding was studied by fluorescence spectroscopy, thymol was observed to bind with tyrosine and possibly other amino acid residues away from tryptophan of caseins. At pH 4.6 (isoelectric point of caseins), the stabilization of thymol nanoparticles against aggregation was enabled by soluble soybean polysaccharide, resulting from the combined electrostatic and steric repulsions. The encapsulated thymol showed the significantly improved antilisterial activity in milk with different fat levels when compared to thymol crystals, resulting from the quicker mixing and increased solubility in the milk serum. The transparent thymol nanodispersions have promising applications to improve microbiological safety and quality of foods.
Molecular dynamics simulations of AP/HMX composite with a modified force field.
Zhu, Wei; Wang, Xijun; Xiao, Jijun; Zhu, Weihua; Sun, Huai; Xiao, Heming
2009-08-15
An all-atom force field for ammonium perchlorate (AP) is developed with the framework of pcff force field. The structural parameters of AP obtained with the modified force field are in good agreement with experimental values. Molecular dynamics (MD) simulations have been performed to investigate AP/HMX (1,3,5,7-tetranitro-1,3,5,7-tetrazocane) composite at different temperatures. The binding energies, thermal expansion coefficient, and the trigger bond lengths of HMX in the AP/HMX composite have been obtained. The binding energies of the system increase slightly with temperature increasing, peak at 245K, and then gradually decrease. The volume thermal expansion coefficient of the AP/HMX composite has been derived from the volume variation with temperature. As the temperature rises, the maximal lengths of the trigger bond N-NO(2) of HMX increase gradually. The simulated results indicate that the maximal length of trigger bond can be used as a criterion for judging the sensitivity of energetic composite.
Giedroc, D P; Chen, X; Pennella, M A; LiWang, A C
2001-11-09
The human metalloregulatory transcription factor, metal-response element (MRE)-binding transcription factor-1 (MTF-1), contains six TFIIIA-type Cys(2)-His(2) motifs, each of which was projected to form well-structured betabetaalpha domains upon Zn(II) binding. In this report, the structure and backbone dynamics of a fragment containing the unusual C-terminal fingers F4-F6 has been investigated. (15)N heteronuclear single quantum coherence (HSQC) spectra of uniformly (15)N-labeled hMTF-zf46 show that Zn(II) induces the folding of hMTF-zf46. Analysis of the secondary structure of Zn(3) hMTF-zf46 determined by (13)Calpha chemical shift indexing and the magnitude of (3)J(Halpha-HN) clearly reveal that zinc fingers F4 and F6 adopt typical betabetaalpha structures. An analysis of the heteronuclear backbone (15)N relaxation dynamics behavior is consistent with this picture and further reveals independent tumbling of the finger domains in solution. Titration of apo-MTF-zf46 with Zn(II) reveals that the F4 domain binds Zn(II) significantly more tightly than do the other two finger domains. In contrast to fingers F4 and F6, the betabetaalpha fold of finger F5 is unstable and only partially populated at substoichiometric Zn(II); a slight molar excess of zinc results in severe conformational exchange broadening of all F5 NH cross-peaks. Finally, although Cd(II) binds to apo-hMTF-zf46 as revealed by intense S(-)-->Cd(II) absorption, a non-native structure results; addition of stoichiometric Zn(II) to the Cd(II) complex results in quantitative refolding of the betabetaalpha structure in F4 and F6. The functional implications of these results are discussed.
Bonding in the first-row diatomic molecules within the local spin-density approximation
DOE Office of Scientific and Technical Information (OSTI.GOV)
Painter, G.S.; Averill, F.W.
1982-08-15
The Hohenberg-Kohn-Sham density-functional equations in the local spin-density approximation (LSDA) have been solved with essentially no loss of accuracy for dimers of the first row of the Periodic Table with the use of a fully-self-consistent spin-polarized Gaussian-orbital approach. Spectroscopic constants (binding energies, equilibrium separations, and ground-state vibrational frequencies) have been derived from the calculated potential-energy curves. Intercomparison of results obtained using the exchange-correlation functionals of Slater (scaled exchange or X..cap alpha..), Gunnarsson and Lundqvist (GL), and Vosko, Wilk, and Nusair (VWN) permits assessment of the relative merits of each and serves to identify general shortcomings in the LSDA. Basic trendsmore » are similar for each functional, but the treatment of the spin dependence of the exchange-correlation energy in the GL and VWN functionals yields a variation of the binding energy across the series which is more systematic than that in the X..cap alpha.. approximation. Agreement between the present results and those of Dunlap, Connolly, and Sabin in the X..cap alpha.., approximation confirms the accuracy of the variational charge-density-fit procedure used in the latter work. The refinements in correlation treatment within the VWN functional are reflected in improvements in binding energies which are only slight for most dimers in the series. This behavior is attributed to the error remaining in the exchange channel within the LSDA and demonstrates the necessity for self-interaction corrections for more accurate binding-energy determinations. Within the current LSDA, absolute accuracies of the VWN functional for the first-row dimers are within 2.3 eV for binding energies, 0.07 a.u. for bond lengths, and approx.200 cm/sup -1/ for vibrational frequencies.« less
The interplay between effector binding and allostery in an engineered protein switch.
Choi, Jay H; Xiong, Tina; Ostermeier, Marc
2016-09-01
The protein design rules for engineering allosteric regulation are not well understood. A fundamental understanding of the determinants of ligand binding in an allosteric context could facilitate the design and construction of versatile protein switches and biosensors. Here, we conducted extensive in vitro and in vivo characterization of the effects of 285 unique point mutations at 15 residues in the maltose-binding pocket of the maltose-activated β-lactamase MBP317-347. MBP317-347 is an allosteric enzyme formed by the insertion of TEM-1 β-lactamase into the E. coli maltose binding protein (MBP). We find that the maltose-dependent resistance to ampicillin conferred to the cells by the MBP317-347 switch gene (the switch phenotype) is very robust to mutations, with most mutations slightly improving the switch phenotype. We identified 15 mutations that improved switch performance from twofold to 22-fold, primarily by decreasing the catalytic activity in the absence of maltose, perhaps by disrupting interactions that cause a small fraction of MBP in solution to exist in a partially closed state in the absence of maltose. Other notable mutations include K15D and K15H that increased maltose affinity 30-fold and Y155K and Y155R that compromised switching by diminishing the ability of maltose to increase catalytic activity. The data also provided insights into normal MBP physiology, as select mutations at D14, W62, and F156 retained high maltose affinity but abolished the switch's ability to substitute for MBP in the transport of maltose into the cell. The results reveal the complex relationship between ligand binding and allostery in this engineered switch. © 2016 The Protein Society.
Involvement of ectodomain Leu 214 in ATP binding and channel desensitization of the P2X4 receptor.
Zhang, Longmei; Xu, Huijuan; Jie, Yanling; Gao, Chao; Chen, Wanjuan; Yin, Shikui; Samways, Damien S K; Li, Zhiyuan
2014-05-13
P2X receptors are trimeric ATP-gated cation permeable ion channels. When ATP binds, the extracellular head and dorsal fin domains are predicted to move closer to each other. However, there are scant functional data corroborating the role of the dorsal fin in ligand binding. Here using site-directed mutagenesis and electrophysiology, we show that a dorsal fin leucine, L214, contributes to ATP binding. Mutant receptors containing a single substitution of alanine, serine, glutamic acid, or phenylalanine at L214 of the rat P2X4 receptor exhibited markedly reduced sensitivities to ATP. Mutation of other dorsal fin side chains, S216, T223, and D224, did not significantly alter ATP sensitivity. Exposure of L214C to sodium (2-sulfonatoethyl) methanethiosulfonate (MTSES(-)) or (2-aminoethyl) methanethiosulfonate hydrobromide in the absence of ATP blocked responses evoked by subsequent ATP application. In contrast, when MTSES(-) was applied in the presence of ATP, no current inhibition was observed. Furthermore, L214A also slightly reduced the inhibitory effect of the antagonist 2',3'-O-(2,4,6-trinitrophenyl)-ATP, and the blockade was more rapidly reversible after washout. Certain L214 mutants also showed effects on current desensitization in the continued presence of ATP. L214I exhibited an accelerated current decline, whereas L214M exhibited a slower rate. Taken together, these data reveal that position L214 participates in both ATP binding and conformational changes accompanying channel opening and desensitization, providing compelling evidence that the dorsal fin domain indeed has functional properties that are similar to those previously reported for the body domains.
Simulation optimization of spherical non-polar guest recognition by deep-cavity cavitands
Wanjari, Piyush P.; Gibb, Bruce C.; Ashbaugh, Henry S.
2013-01-01
Biomimetic deep-cavity cavitand hosts possess unique recognition and encapsulation properties that make them capable of selectively binding a range of non-polar guests within their hydrophobic pocket. Adamantane based derivatives which snuggly fit within the pocket of octa-acid deep cavity cavitands exhibit some of the strongest host binding. Here we explore the roles of guest size and attractiveness on optimizing guest binding to form 1:1 complexes with octa-acid cavitands in water. Specifically we simulate the water-mediated interactions of the cavitand with adamantane and a range of simple Lennard-Jones guests of varying diameter and attractive well-depth. Initial simulations performed with methane indicate hydrated methanes preferentially reside within the host pocket, although these guests frequently trade places with water and other methanes in bulk solution. The interaction strength of hydrophobic guests increases with increasing size from sizes slightly smaller than methane to Lennard-Jones guests comparable in size to adamantane. Over this guest size range the preferential guest binding location migrates from the bottom of the host pocket upwards. For guests larger than adamantane, however, binding becomes less favorable as the minimum in the potential-of-mean force shifts to the cavitand face around the portal. For a fixed guest diameter, the Lennard-Jones well-depth is found to systematically shift the guest-host potential-of-mean force to lower free energies, however, the optimal guest size is found to be insensitive to increasing well-depth. Ultimately our simulations show that adamantane lies within the optimal range of guest sizes with significant attractive interactions to match the most tightly bound Lennard-Jones guests studied. PMID:24359375
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ott, S.; Costa, T.; Herz, A.
1988-07-25
The target size for opioid receptor binding was studied after manipulations known to affect the interactions between receptor and GTP-binding regulatory proteins (G-proteins). Addition of GTP or its analogs to the binding reaction, exposure of intact cells to pertussis toxin prior to irradiation, or treatment of irradiated membranes with N-ethylmaleimide did not change the target size (approximately equal to 100 kDa) for opioid receptors in NG 108-15 cells and rat brain. These data suggest that the 100-kDa species does not include an active subunit of a G-protein or alternatively that GTP does not promote the dissociation of the receptor-G-protein complex.more » The presence of Na+ (100 mM) in the radioligand binding assay induced a biphasic decay curve for agonist binding and a flattening of the monoexponential decay curve for a partial agonist. In both cases the effect was explained by an irradiation-induced loss of the low affinity state of the opioid receptor produced by the addition of Na+. This suggests that an allosteric inhibitor that mediates the effect of sodium on the receptor is destroyed at low doses of irradiation, leaving receptors which are no longer regulated by sodium. The effect of Na+ on target size was slightly increased by the simultaneous addition of GTP but was not altered by pertussis toxin treatment. Thus, the sodium unit is distinct from G-proteins and may represent a new component of the opioid receptor complex. Assuming a simple bimolecular model of one Na+ unit/receptor, the size of this inhibitor can be measured as 168 kDa.« less
Hui, Chang-Ye; Guo, Yan; Yang, Xue-Qin; Zhang, Wen; Huang, Xian-Qing
2018-05-01
To improve the Pb 2+ biosorption capacity of the potential E. coli biosorbent, a putative Pb 2+ binding domain (PbBD) derived from PbrR was efficiently displayed on to the E. coli cell surface. The PbBD was obtained by truncating the N-terminal DNA-binding domain and C-terminal redundant amino acid residues of the Pb 2+ -sensing transcriptional factor PbrR. Whole-cell sorbents were constructed with the full-length PbrR and PbBD of PbrR genetically engineered onto the surface of E. coli cells using Lpp-OmpA as the anchor. Followed by a 1.71-fold higher display of PbBD than PbrR, the presence of PbBD on the surface of E. coli cells enabled a 1.92-fold higher Pb 2+ biosorption than that found in PbrR-displayed cells. Specific Pb 2+ binding via PbBD was the same as Pb 2+ binding via the full-length PbrR, with no observable decline even in the presence of Zn 2+ and Cd 2+ . Since surface-engineered E. coli cells with PbBD increased the Pb 2+ binding capacity and did not affect the adsorption selectivity, this suggests that surface display of the metal binding domain derived from MerR-like proteins may be used for the bioremediation of specific toxic heavy metals.
BiP clustering facilitates protein folding in the endoplasmic reticulum.
Griesemer, Marc; Young, Carissa; Robinson, Anne S; Petzold, Linda
2014-07-01
The chaperone BiP participates in several regulatory processes within the endoplasmic reticulum (ER): translocation, protein folding, and ER-associated degradation. To facilitate protein folding, a cooperative mechanism known as entropic pulling has been proposed to demonstrate the molecular-level understanding of how multiple BiP molecules bind to nascent and unfolded proteins. Recently, experimental evidence revealed the spatial heterogeneity of BiP within the nuclear and peripheral ER of S. cerevisiae (commonly referred to as 'clusters'). Here, we developed a model to evaluate the potential advantages of accounting for multiple BiP molecules binding to peptides, while proposing that BiP's spatial heterogeneity may enhance protein folding and maturation. Scenarios were simulated to gauge the effectiveness of binding multiple chaperone molecules to peptides. Using two metrics: folding efficiency and chaperone cost, we determined that the single binding site model achieves a higher efficiency than models characterized by multiple binding sites, in the absence of cooperativity. Due to entropic pulling, however, multiple chaperones perform in concert to facilitate the resolubilization and ultimate yield of folded proteins. As a result of cooperativity, multiple binding site models used fewer BiP molecules and maintained a higher folding efficiency than the single binding site model. These insilico investigations reveal that clusters of BiP molecules bound to unfolded proteins may enhance folding efficiency through cooperative action via entropic pulling.
Du, Fang; Ding, Ye; Zou, Jun; Li, Zhili; Tian, Jijing; She, Ruiping; Wang, Desheng; Wang, Huijuan; Lv, Dongqiang; Chang, Lingling
2015-01-01
This study investigated the effects of long-term simulated weightlessness on liver morphology, enzymes, glycogen, and apoptosis related proteins by using two-month rat-tail suspension model (TS), and liver injury improvement by rat-tail suspension with resistance training model (TS&RT). Microscopically the livers of TS rats showed massive granular degeneration, chronic inflammation, and portal fibrosis. Mitochondrial and endoplasmic reticulum swelling and loss of membrane integrity were observed by transmission electron microscopy (TEM). The similar, but milder, morphological changes were observed in the livers of TS&RT rats. Serum biochemistry analysis revealed that the levels of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) were significantly higher (p<0.05) in TS rats than in controls. The levels of ALT and AST in TS&RT rats were slightly lower than in RT rats, but they were insignificantly higher than in controls. However, both TS and TS&RT rats had significantly lower levels (p<0.05) of serum glucose and hepatic glycogen than in controls. Immunohistochemistry demonstrated that the expressions of Bax, Bcl-2, and active caspase-3 were higher in TS rats than in TS&RT and control rats. Real-time polymerase chain reaction (real-time PCR) showed that TS rats had higher mRNA levels (P < 0.05) of glucose-regulated protein 78 (GRP78) and caspase-12 transcription than in control rats; whereas mRNA expressions of C/EBP homologous protein (CHOP) and c-Jun N-terminal kinase (JNK) were slightly higher in TS rats. TS&RT rats showed no significant differences of above 4 mRNAs compared with the control group. Our results demonstrated that long-term weightlessness caused hepatic injury, and may trigger hepatic apoptosis. Resistance training slightly improved hepatic damage.
Zou, Jun; Li, Zhili; Tian, Jijing; She, Ruiping; Wang, Desheng; Wang, Huijuan; Lv, Dongqiang; Chang, Lingling
2015-01-01
This study investigated the effects of long-term simulated weightlessness on liver morphology, enzymes, glycogen, and apoptosis related proteins by using two-month rat-tail suspension model (TS), and liver injury improvement by rat-tail suspension with resistance training model (TS&RT). Microscopically the livers of TS rats showed massive granular degeneration, chronic inflammation, and portal fibrosis. Mitochondrial and endoplasmic reticulum swelling and loss of membrane integrity were observed by transmission electron microscopy (TEM). The similar, but milder, morphological changes were observed in the livers of TS&RT rats. Serum biochemistry analysis revealed that the levels of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) were significantly higher (p<0.05) in TS rats than in controls. The levels of ALT and AST in TS&RT rats were slightly lower than in RT rats, but they were insignificantly higher than in controls. However, both TS and TS&RT rats had significantly lower levels (p<0.05) of serum glucose and hepatic glycogen than in controls. Immunohistochemistry demonstrated that the expressions of Bax, Bcl-2, and active caspase-3 were higher in TS rats than in TS&RT and control rats. Real-time polymerase chain reaction (real-time PCR) showed that TS rats had higher mRNA levels (P < 0.05) of glucose-regulated protein 78 (GRP78) and caspase-12 transcription than in control rats; whereas mRNA expressions of C/EBP homologous protein (CHOP) and c-Jun N-terminal kinase (JNK) were slightly higher in TS rats. TS&RT rats showed no significant differences of above 4 mRNAs compared with the control group. Our results demonstrated that long-term weightlessness caused hepatic injury, and may trigger hepatic apoptosis. Resistance training slightly improved hepatic damage. PMID:26000905
Ziraksaz, Zarrintaj; Nomani, Alireza; Ruponen, Marika; Soleimani, Masoud; Tabbakhian, Majid; Haririan, Ismaeil
2013-01-23
Interaction of cell-surface glycosaminoglycans (GAGs) with non-viral vectors seems to be an important factor which modifies the intracellular destination of the gene complexes. Intracellular kinetics of polyamidoamine (PAMAM) dendrimer as a non-viral vector in cellular uptake, intranuclear delivery and transgene expression of plasmid DNA with regard to the cell-surface GAGs has not been investigated until now. The physicochemical properties of the PAMAM-pDNA complexes were characterized by photon correlation spectroscopy, atomic force microscopy, zeta measurement and agarose gel electrophoresis. The transfection efficiency and toxicity of the complexes at different nitrogen to phosphate (N:P) ratios were determined using various in vitro cell models such as human embryonic kidney cells, chinese hamster ovary cells and its mutants lacking cell-surface GAGs or heparan sulphate proteoglycans (HSPGs). Cellular uptake, nuclear uptake and transfection efficiency of the complexes were determined using flow cytometry and optimized cell-nuclei isolation with quantitative real-time PCR and luciferase assay. Physicochemical studies showed that PAMAM dendrimer binds pDNA efficiently, forms small complexes with high positive zeta potential and transfects cells properly at N:P ratios around 5 and higher. The cytotoxicity could be a problem at N:Ps higher than 10. GAGs elimination caused nearly one order of magnitude higher pDNA nuclear uptake and more than 2.6-fold higher transfection efficiency than CHO parent cells. However, neither AUC of nuclear uptake, nor AUC of transfection affected significantly by only cell-surface HSPGs elimination and interesting data related to the effect of GAGs on intranuclear pDNA using PAMAM as delivery vector have been reported in this study. Presented data shows that the rate-limiting step of PAMAM-pDNA complexes transfection is located after delivery to the cell nucleus and GAGs are regarded as an inhibitor of the intranuclear delivery step, while slightly promotes transgene expression. Copyright © 2012 Elsevier B.V. All rights reserved.
Low profile, high load vertical rolling positioning stage
Shu, Deming; Barraza, Juan
1996-01-01
A stage or support platform assembly for use in a synchrotron accurately positions equipment to be used in the beam line of the synchrotron. The support platform assembly includes an outer housing in which is disposed a lifting mechanism having a lifting platform or stage at its upper extremity on which the equipment is mounted. A worm gear assembly is located in the housing and is adapted to raise and lower a lifting shaft that is fixed to the lifting platform by an anti-binding connection. The lifting platform is moved vertically as the lifting shaft is moved vertically. The anti-binding connection prevents the shaft from rotating with respect to the platform, but does permit slight canting of the shaft with respect to the lifting platform so as to eliminate binding and wear due to possible tolerance mismatches. In order to ensure that the lifting mechanism does not move in a horizontal direction as it is moved vertically, at least three linear roller bearing assemblies are arranged around the outer-periphery of the lifting mechanism. One of the linear roller bearing assemblies can be adjusted so that the roller bearings apply a loading force against the lifting mechanism. Alternatively, a cam mechanism can be used to provide such a loading force.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nishimoto, Yoshio, E-mail: nishimoto.yoshio@fukui.kyoto-u.ac.jp
2015-09-07
We develop a formalism for the calculation of excitation energies and excited state gradients for the self-consistent-charge density-functional tight-binding method with the third-order contributions of a Taylor series of the density functional theory energy with respect to the fluctuation of electron density (time-dependent density-functional tight-binding (TD-DFTB3)). The formulation of the excitation energy is based on the existing time-dependent density functional theory and the older TD-DFTB2 formulae. The analytical gradient is computed by solving Z-vector equations, and it requires one to calculate the third-order derivative of the total energy with respect to density matrix elements due to the inclusion of themore » third-order contributions. The comparison of adiabatic excitation energies for selected small and medium-size molecules using the TD-DFTB2 and TD-DFTB3 methods shows that the inclusion of the third-order contributions does not affect excitation energies significantly. A different set of parameters, which are optimized for DFTB3, slightly improves the prediction of adiabatic excitation energies statistically. The application of TD-DFTB for the prediction of absorption and fluorescence energies of cresyl violet demonstrates that TD-DFTB3 reproduced the experimental fluorescence energy quite well.« less
Toward understanding the role of individual fluorescent components in DOM-metal binding.
Wu, Jun; Zhang, Hua; Yao, Qi-Sheng; Shao, Li-Ming; He, Pin-Jing
2012-05-15
Knowledge on the function of individual fractions in dissolved organic matter (DOM) is essential for understanding the impact of DOM on metal speciation and migration. Herein, fluorescence excitation-emission matrix quenching and parallel factor (PARAFAC) analysis were adopted for bulk DOM and chemically isolated fractions from landfill leachate, i.e., humic acids (HA), fulvic acids and hydrophilic (HyI) fraction, to elucidate the role of individual fluorescent components in metal binding (Cu(II) and Cd(II)). Three components were identified by PARAFAC model, including one humic substance (HS)-like, one protein-like and one component highly correlated with the HyI fraction. Among them, the HS-like and protein-like components were responsible for Cu(II) binding, while the protein-like component was the only fraction involved in Cd(II) complexation. It was further identified that the slight quenching effect of HA fraction by Cd(II) was induced by the presence of proteinaceous materials in HA. Fluorescent substances in the HyI fraction of landfill leachate did not play as important a role as HS did. Therefore, it was suggested that the potential risk of aged leachate (more humified) as a carrier of heavy metal should not be overlooked. Copyright © 2012 Elsevier B.V. All rights reserved.
The SAM-responsive SMK box is a reversible riboswitch
Smith, Angela M.; Fuchs, Ryan T.; Grundy, Frank J.; Henkin, Tina M.
2010-01-01
The SMK (SAM-III) box is an S-adenosylmethionine (SAM)-responsive riboswitch found in the 5′ untranslated region of metK genes, encoding SAM synthetase, in many members of the Lactobacillales. SAM binding causes a structural rearrangement in the RNA that sequesters the Shine-Dalgarno (SD) sequence by pairing with a complementary anti-SD (ASD) sequence; sequestration of the SD sequence inhibits binding of the 30S ribosomal subunit and prevents translation initiation. We observed a slight increase in the half-life of the metK transcript in vivo when Enterococcus faecalis cells were depleted for SAM, but no significant change in overall transcript abundance, consistent with the model that this riboswitch regulates at the level of translation initiation. The half-life of the SAM-SMK box RNA complex in vitro is shorter than that of the metK transcript in vivo, raising the possibility of reversible binding of SAM. We used a fluorescence assay to directly visualize reversible switching between the SAM-free and SAM-bound conformations. We propose that the SMK box riboswitch can make multiple SAM-dependent regulatory decisions during the lifetime of the transcript in vivo, acting as a reversible switch that allows the cell to respond rapidly to fluctuations in SAM pools by modulating expression of the SAM synthetase gene. PMID:21143313
Jing, Qing; Okrasa, Krzysztof; Kazlauskas, Romas J
2009-01-01
One useful synthetic reaction missing from nature's toolbox is the direct hydrogenation of substrates using hydrogen. Instead nature uses cofactors like NADH to reduce organic substrates, which adds complexity and cost to these reductions. To create an enzyme that can directly reduce organic substrates with hydrogen, researchers have combined metal hydrogenation catalysts with proteins. One approach is an indirect link where a ligand is linked to a protein and the metal binds to the ligand. Another approach is direct linking of the metal to protein, but nonspecific binding of the metal limits this approach. Herein, we report a direct hydrogenation of olefins catalyzed by rhodium(I) bound to carbonic anhydrase (CA-[Rh]). We minimized nonspecific binding of rhodium by replacing histidine residues on the protein surface using site-directed mutagenesis or by chemically modifying the histidine residues. Hydrogenation catalyzed by CA-[Rh] is slightly slower than for uncomplexed rhodium(I), but the protein environment induces stereoselectivity favoring cis- over trans-stilbene by about 20:1. This enzyme is the first cofactor-independent reductase that reduces organic molecules using hydrogen. This catalyst is a good starting point to create variants with tailored reactivity and selectivity. This strategy to insert transition metals in the active site of metalloenzymes opens opportunities to a wider range of enzyme-catalyzed reactions.
Tropomyosin modulates erythrocyte membrane stability
An, Xiuli; Salomao, Marcela; Guo, Xinhua; Gratzer, Walter; Mohandas, Narla
2007-01-01
The ternary complex of spectrin, actin, and 4.1R (human erythrocyte protein 4.1) defines the nodes of the erythrocyte membrane skeletal network and is inseparable from membrane stability under mechanical stress. These junctions also contain tropomyosin (TM) and the other actin-binding proteins, adducin, protein 4.9, tropomodulin, and a small proportion of capZ, the functions of which are poorly defined. Here, we have examined the consequences of selective elimination of TM from the membrane. We have shown that the mechanical stability of the membranes of resealed ghosts devoid of TM is grossly, but reversibly, impaired. That the decreased membrane stability of TM-depleted membranes is the result of destabilization of the ternary complex of the network junctions is demonstrated by the strongly facilitated entry into the junctions in situ of a β-spectrin peptide, containing the actin- and 4.1R-binding sites, after extraction of the TM. The stabilizing effect of TM is highly specific, in that it is only the endogenous isotype, and not the slightly longer muscle TM that can bind to the depleted membranes and restore their mechanical stability. These findings have enabled us identify a function for TM in elevating the mechanical stability of erythrocyte membranes by stabilizing the spectrin-actin-4.1R junctional complex. PMID:17008534
FLB1, a human protein of epididymal origin that is involved in the sperm-oocyte recognition process.
Boué, F; Duquenne, C; Lassalle, B; Lefèvre, A; Finaz, C
1995-02-01
CA6 antibody was selected out of a monoclonal antibody library raised against human sperm proteins primarily for its ability to recognize an epididymal antigen and to modify sperm adhesion to zona-free hamster oocytes. In the present study, CA6 was shown to decrease sperm binding to zona-free hamster and human oocytes by 40-92% and 38-48%, respectively. The corresponding protein, which was referred to as FLB1, was found to be secreted by the epididymis and to bind specifically to a human, macaque, and rodent subacrosomal sperm region. Western blotting revealed a molecular mass of 94 kDa in human epididymal extracts and of 100 kDa in human, macaque, mouse, rat, and hamster sperm, suggesting further modifications after its binding to sperm. An equivalent protein was not observed in human liver, ovary, testis, plasma, or epidermis. Two-dimensional electrophoresis showed that FLB1 is formed of two subunits with the same 47-kDa molecular mass and slightly different pI (5.8, 5.9). Microsequencing of the protein revealed a partial homology with human cytokeratins 1 and 10. These results suggest that FLB1 is an epididymis-specific cytokeratin-like protein that is involved in the sperm-oocyte recognition process.
Zhang, Hong; Liu, Xuewen; He, Xiaojun; Liu, Ying; Tan, Lifeng
2014-11-01
There is renewed interest in investigating triple helices because these novel structures have been implicated as a possible means of controlling cellular processes by endogenous or exogenous mechanisms. Due to the Hoogsteen base pairing, triple helices are, however, thermodynamically less stable than the corresponding duplexes. The poor stability of triple helices limits their practical applications under physiological conditions. In contrast to DNA triple helices, small molecules stabilizing RNA triple helices at present are less well established. Furthermore, most of these studies are limited to organic compounds and, to a far lesser extent, to metal complexes. In this work, two Ru(II) complexes, [Ru(bpy)2(btip)](2+) (Ru1) and [Ru(phen)2(btip)](2+) (Ru2), have been synthesized and characterized. The binding properties of the two metal complexes with the triple RNA poly(U)˙poly(A)*poly(U) were studied by various biophysical and density functional theory methods. The main results obtained here suggest that the slight binding difference in Ru1 and Ru2 may be attributed to the planarity of the intercalative ligand and the LUMO level of Ru(II) complexes. This study further advances our knowledge on the triplex RNA-binding by metal complexes, particularly Ru(II) complexes.
Nishimoto, Yoshio
2015-09-07
We develop a formalism for the calculation of excitation energies and excited state gradients for the self-consistent-charge density-functional tight-binding method with the third-order contributions of a Taylor series of the density functional theory energy with respect to the fluctuation of electron density (time-dependent density-functional tight-binding (TD-DFTB3)). The formulation of the excitation energy is based on the existing time-dependent density functional theory and the older TD-DFTB2 formulae. The analytical gradient is computed by solving Z-vector equations, and it requires one to calculate the third-order derivative of the total energy with respect to density matrix elements due to the inclusion of the third-order contributions. The comparison of adiabatic excitation energies for selected small and medium-size molecules using the TD-DFTB2 and TD-DFTB3 methods shows that the inclusion of the third-order contributions does not affect excitation energies significantly. A different set of parameters, which are optimized for DFTB3, slightly improves the prediction of adiabatic excitation energies statistically. The application of TD-DFTB for the prediction of absorption and fluorescence energies of cresyl violet demonstrates that TD-DFTB3 reproduced the experimental fluorescence energy quite well.
Deciphering the Binding between Nupr1 and MSL1 and Their DNA-Repairing Activity
Doménech, Rosa; Pantoja-Uceda, David; Gironella, Meritxell; Santoro, Jorge; Velázquez-Campoy, Adrián; Neira, José L.; Iovanna, Juan L.
2013-01-01
The stress protein Nupr1 is a highly basic, multifunctional, intrinsically disordered protein (IDP). MSL1 is a histone acetyl transferase-associated protein, known to intervene in the dosage compensation complex (DCC). In this work, we show that both Nupr1 and MSL1 proteins were recruited and formed a complex into the nucleus in response to DNA-damage, which was essential for cell survival in reply to cisplatin damage. We studied the interaction of Nupr1 and MSL1, and their binding affinities to DNA by spectroscopic and biophysical methods. The MSL1 bound to Nupr1, with a moderate affinity (2.8 µM) in an entropically-driven process. MSL1 did not bind to non-damaged DNA, but it bound to chemically-damaged-DNA with a moderate affinity (1.2 µM) also in an entropically-driven process. The Nupr1 protein bound to chemically-damaged-DNA with a slightly larger affinity (0.4 µM), but in an enthalpically-driven process. Nupr1 showed different interacting regions in the formed complexes with Nupr1 or DNA; however, they were always disordered (“fuzzy”), as shown by NMR. These results underline a stochastic description of the functionality of the Nupr1 and its other interacting partners. PMID:24205110
DOE Office of Scientific and Technical Information (OSTI.GOV)
Meyers, K.M.; Boehme, M.; Inbar, O.
Endotoxin from Escherichia coli O127:B8, Salmonella abortus-equi and S minnesota induced clumping of some canine platelets (PLT) at a final endotoxin concentration of 1 microgram/ml. Endotoxin-induced clumping of canine PLT was independent of PLT energy-requiring processes, because clumping was observed with canine PLT incubated with 2-deoxy-D-glucose and antimycin A. The PLT responded to adenosine diphosphate before, but not after, incubation with the metabolic inhibitors. Endotoxin induced a slight and inconsistant clumping of bovine and equine PLT at high (mg/ml) endotoxin concentration. High-affinity binding sites could not be demonstrated on canine, bovine, and equine PLT, using /sup 125/I-labeled E coli O127:B8more » endotoxin. Nonspecific binding was observed and appeared to be due primarily to an extraneous coat on the PLT surface that was removed by gel filtration. The endotoxin that was bound to PLT did not appear to modify PLT function. An attempt to identify plasma proteins that bound physiologically relevant amounts of endotoxin was not successful. The significance of the endotoxin-induced clumping or lack of it on the pathophysiology of endotoxemia is discussed.« less
Common structural features of cholesterol binding sites in crystallized soluble proteins
Bukiya, Anna N.; Dopico, Alejandro M.
2017-01-01
Cholesterol-protein interactions are essential for the architectural organization of cell membranes and for lipid metabolism. While cholesterol-sensing motifs in transmembrane proteins have been identified, little is known about cholesterol recognition by soluble proteins. We reviewed the structural characteristics of binding sites for cholesterol and cholesterol sulfate from crystallographic structures available in the Protein Data Bank. This analysis unveiled key features of cholesterol-binding sites that are present in either all or the majority of sites: i) the cholesterol molecule is generally positioned between protein domains that have an organized secondary structure; ii) the cholesterol hydroxyl/sulfo group is often partnered by Asn, Gln, and/or Tyr, while the hydrophobic part of cholesterol interacts with Leu, Ile, Val, and/or Phe; iii) cholesterol hydrogen-bonding partners are often found on α-helices, while amino acids that interact with cholesterol’s hydrophobic core have a slight preference for β-strands and secondary structure-lacking protein areas; iv) the steroid’s C21 and C26 constitute the “hot spots” most often seen for steroid-protein hydrophobic interactions; v) common “cold spots” are C8–C10, C13, and C17, at which contacts with the proteins were not detected. Several common features we identified for soluble protein-steroid interaction appear evolutionarily conserved. PMID:28420706
Linear scaffolds for multivalent targeting of melanocortin receptors.
Dehigaspitiya, Dilani Chathurika; Anglin, Bobbi L; Smith, Kara R; Weber, Craig S; Lynch, Ronald M; Mash, Eugene A
2015-12-21
Molecules bearing one, two, three, or four copies of the tetrapeptide His-dPhe-Arg-Trp were attached to scaffolds based on ethylene glycol, glycerol, and d-mannitol by means of the copper-assisted azide-alkyne cyclization. The abilities of these compounds to block binding of a probe at the melanocortin 4 receptor were evaluated using a competitive binding assay. All of the multivalent molecules studied exhibited 30- to 40-fold higher apparent affinites when compared to a monovalent control. These results are consistent with divalent binding to receptor dimers. No evidence for tri- or tetravalent binding was obtained. Differences in the interligand spacing required for divalent binding, as opposed to tri- or tetravalent binding, may be responsible for these results.