Effect of Disease Improvement with Self-Measurement Compliance (Measurement Frequency Level) in SmartCare Hypertension Management Service.

PubMed

Lee, Chang-Hee; Chang, Byeong-Yun

2016-03-01

This study's purpose was to analyze the effect of the SmartCare pilot project, which was conducted in 2011 in South Korea. Recent studies of telehealth mostly compare the intervention group and the control group. Therefore, it is necessary to analyze the disease improvement effect depending on the self-measurement compliance (measurement frequency level) of patients who are receiving the hypertension management services. In the SmartCare center, health managers (nurses, nutritionists, and exercise prescribers) monitored the measurement data transmitted by participants through the SmartCare system. The health managers provided the prevention, consultation, and education services remotely to patients. Of the 231 participants who were enrolled in the study, the final analysis involved 213 individuals who completed their blood pressure measurements and SmartCare services until the end of a 6-month service period. The evaluated measurement group was classified into three groups (Low, Middle, and High) by evenly dividing the monthly average frequency of measurement for 6 months. The evaluation indices were systolic blood pressure (SBP), diastolic blood pressure (DBP), weight, and body mass index (BMI); this information was transmitted through the SmartCare system. For changes in the evaluation indices after 6 months compared with the initial baseline, in the Low Group, SBP and DBP slightly decreased, and weight and BMI slightly increased (difference not statistically significant). In the Middle Group, SBP and DBP decreased slightly (difference not statistically significant); however, both weight and BMI decreased (difference statistically significant). In the High Group, SBP, DBP, weight, and BMI decreased (difference statistically significant). Patients who received the SmartCare services with higher measurement frequency levels at home showed greater effectiveness regarding the provided services compared with those patients with lower levels of BP, weight, and BMI control.

Seasonal variations of reflexibility and transmissibility of ULF waves propagating through the ionosphere of geomagnetic mid-latitudes

NASA Astrophysics Data System (ADS)

Prikner, K.

Using reference models of the daytime and night ionosphere of geomagnetic mid-latitudes in a quiescent period in summer, autumn and winter, the seasonal variation of ULF frequency characteristics of amplitude and energy correction factors of the ionosphere - vertical reflexibility, transmissibility and absorption, are studied. The existence of two frequency bands within the ULF range with different properties of ionospheric wave filtration is pointed out: (a) continuous band f of less than 0.1 to 0.2 Hz with the mirror effect of the ionosphere with respect to the incident wave, but with small ionospheric absorption of wave energy; and (b) a Hz band of greater than 0.2 Hz with resonance frequency windows and wave emissions with a sharply defined frequency structure. The seasonal variation from summer to winter indicates a decrease in wave energy absorption in the ionosphere and a slight displacement of the resonances towards higher frequencies.

Seasonal variations of reflexibility and transmissibility of ULF waves propagating through the ionosphere of geomagnetic mid-latitudes

NASA Astrophysics Data System (ADS)

Prikner, K.

Using reference models of the daytime and night ionosphere of geomagnetic mid-latitudes in a quiescent period in summer, autumn and winter, the seasonal variation of ULF frequency characteristics of amplitude and energy correction factors of the ionosphere - vertical reflexibility, transmissibility, are studied. The existence of two frequency bands within the ULF range with different properties of ionospheric wave filtration is pointed out: (1) continuous band f 0.1-0.2 Hz with the mirror effect of the ionosphere with respect to the incident wave, but with small ionospheric absorption of wave energy; (2) the f 0.2 Hz band with resonance frequency windows and wave emissions with a sharply defined frequency structure. The seasonal variation from summer to winter indicates a decrease in wave energy absorption in the ionosphere and a slight displacement of the resonances towards higher frequencies.

Rainbow-trapping absorbers: Broadband, perfect and asymmetric sound absorption by subwavelength panels for transmission problems.

PubMed

Jiménez, Noé; Romero-García, Vicent; Pagneux, Vincent; Groby, Jean-Philippe

2017-10-19

Perfect, broadband and asymmetric sound absorption is theoretically, numerically and experimentally reported by using subwavelength thickness panels in a transmission problem. The panels are composed of a periodic array of varying crosssection waveguides, each of them being loaded by Helmholtz resonators (HRs) with graded dimensions. The low cut-off frequency of the absorption band is fixed by the resonance frequency of the deepest HR, that reduces drastically the transmission. The preceding HR is designed with a slightly higher resonance frequency with a geometry that allows the impedance matching to the surrounding medium. Therefore, reflection vanishes and the structure is critically coupled. This results in perfect sound absorption at a single frequency. We report perfect absorption at 300 Hz for a structure whose thickness is 40 times smaller than the wavelength. Moreover, this process is repeated by adding HRs to the waveguide, each of them with a higher resonance frequency than the preceding one. Using this frequency cascade effect, we report quasi-perfect sound absorption over almost two frequency octaves ranging from 300 to 1000 Hz for a panel composed of 9 resonators with a total thickness of 11 cm, i.e., 10 times smaller than the wavelength at 300 Hz.

Modal Analysis of Two Bridges, Bryce Canyon National Park

NASA Astrophysics Data System (ADS)

Geimer, P. R.; Moore, J. R.; Thorne, M. S.; Quirk, B.

2016-12-01

We used ambient seismic data to identify the primary resonant frequencies of the up-canyon span of Two Bridges, a natural sandstone arch located in Bryce Canyon National Park, Utah. Two broadband seismometers placed on the span recorded continuous data for 14 hours, which were compared to measurements from a nearby reference station. Spectral peaks identified in the recordings represent resonant modes of the arch. We observed a slight drift in the fundamental frequency, which we attribute to daily changes in rock temperature and associated thermal stresses. However, no detectable vertical motion was recorded over the same time period using a laser distance meter. We applied slight impulses to the arch along its main axes to experimentally determine modal damping ratios, which describe the vibrational properties of the arch. Ground-based photogrammetry was then used to construct a new 3D model of the feature, which we imported into COMSOL Multiphysics to perform numerical modal analyses. By varying the material properties, we were able to match the fundamental resonant frequency of the arch and several higher order modes, as well as associated polarization attributes. Repeat resonant frequency measurements at Two Bridges will help us better understand how the structure changes over time in response to environment factors. The Claron Formation, which forms Two Bridges, is highly susceptible to weathering and erosion making natural hazards, such as rock falls, a frequent occurrence in Bryce Canyon.

Constancy and Change in the Prevalence and Frequency of Offending When Based on Longitudinal Self-reports or Official Records: Comparisons by Gender, Race, and Crime Type

PubMed Central

Farrington, David P.; Hipwell, Alison E.; Stepp, Stephanie D.; Pardini, Dustin; Ahonen, Lia

2015-01-01

Introduction The study examines age-crime prevalence and age-crime frequency curves based on longitudinal data from boys in the Pittsburgh Youth Study and girls in the Pittsburgh Girls Study. Results Results show that the prevalence of the age-crime curve for theft and violence (based on self-reports or police charges) followed the typical age-crime curve for males and slightly less distinctly for females, with the peak of offending occurring earlier for self-reports than for police charges. The decrease in police charges for violence and theft took place at an earlier age for females than males, but this was not distinct when self-reported delinquency was the criterion. The mean frequency of self-reported theft and violence followed the age-crime curve for males but not for females, who showed a mean frequency of offending which was more constant. In contrast, the mean frequency of police charges increased with age for males and females. Comparing African-American and Caucasian males and females shows a higher prevalence but not a higher mean frequency of self-reported offending. Conclusions The results are reviewed in the light of other studies, and the policy implications of the findings are discussed. PMID:27610337

Resonance Tube Phonation in Water-the Effect of Tube Diameter and Water Depth on Back Pressure and Bubble Characteristics at Different Airflows.

PubMed

Wistbacka, Greta; Andrade, Pedro Amarante; Simberg, Susanna; Hammarberg, Britta; Södersten, Maria; Švec, Jan G; Granqvist, Svante

2018-01-01

Resonance tube phonation with tube end in water is a voice therapy method in which the patient phonates through a glass tube, keeping the free end of the tube submerged in water, creating bubbles. The purpose of this experimental study was to determine flow-pressure relationship, flow thresholds between bubble types, and bubble frequency as a function of flow and back volume. A flow-driven vocal tract simulator was used for recording the back pressure produced by resonance tubes with inner diameters of 8 and 9 mm submerged at water depths of 0-7 cm. Visual inspection of bubble types through video recording was also performed. The static back pressure was largely determined by the water depth. The narrower tube provided a slightly higher back pressure for a given flow and depth. The amplitude of the pressure oscillations increased with flow and depth. Depending on flow, the bubbles were emitted from the tube in three distinct types with increasing flow: one by one, pairwise, and in a chaotic manner. The bubble frequency was slightly higher for the narrower tube. An increase in back volume led to a decrease in bubble frequency. This study provides data on the physical properties of resonance tube phonation with the tube end in water. This information will be useful in future research when looking into the possible effects of this type of voice training. Copyright © 2018 The Voice Foundation. Published by Elsevier Inc. All rights reserved.

Numerical investigation on pressure fluctuations in centrifugal compressor with different inlet guide vanes pre-whirl angles

NASA Astrophysics Data System (ADS)

Wang, Y. C.; Shi, M.; Cao, S. L.; Li, Z. H.

2013-12-01

The pressure fluctuations in a centrifugal compressor with different inlet guide vanes (IGV) pre-whirl angles were investigated numerically, as well as the pre-stress model and static structural of blade. The natural frequency was evaluated by pre-stress model analysis. The results show that, the aero-dynamic pressure acting on blade surface is smaller than rotation pre-stress, which wouldn't result in large deformation of blade. The natural frequencies with rotation pre-stress are slightly higher than without rotation pre-stress. The leading mechanism of pressure fluctuations for normal conditions is the rotor-stator (IGVs) interaction, while is serious flow separations for conditions that are close to surge line. A few frequency components in spectra are close to natural frequency, which possibly result in resonant vibration if amplitude is large enough, which is dangerous for compressor working, and should be avoided.

Spin-torque diode frequency tuning via soft exchange pinning of both magnetic layers

NASA Astrophysics Data System (ADS)

Khudorozhkov, A. A.; Skirdkov, P. N.; Zvezdin, K. A.; Vetoshko, P. M.; Popkov, A. F.

2017-12-01

A spin-torque diode, which is a magnetic tunnel junction with magnetic layers softly pinned at some tilt to each other, is proposed. The resonance operating frequency of such a dual exchange-pinned spin-torque diode can be significantly higher (up to 9.5 GHz) than that of a traditional free layer spin-torque diode, and, at the same time, the sensitivity remains rather high. Using micromagnetic modeling we show that the maximum microwave sensitivity of the considered diode is reached at the bias current densities slightly below the self-sustained oscillations initiating. The dependence of the resonance frequency and the sensitivity on the angle between pinning exchange fields is presented. Thus, a way of designing spin-torque diode with a given resonance response frequency in the microwave region in the absence of an external magnetic field is proposed.

Space Shuttle Redesigned Solid Rocket Motor nozzle natural frequency variations with burn time

NASA Technical Reports Server (NTRS)

Lui, C. Y.; Mason, D. R.

1991-01-01

The effects of erosion and thermal degradation on the Space Shuttle Redesigned Solid Rocket Motor (RSRM) nozzle's structural dynamic characteristics were analytically evaluated. Also considered was stiffening of the structure due to internal pressurization. A detailed NASTRAN finite element model of the nozzle was developed and used to evaluate the influence of these effects at several discrete times during motor burn. Methods were developed for treating erosion and thermal degradation, and a procedure was developed to account for internal pressure stiffening using differential stiffness matrix techniques. Results were verified using static firing test accelerometer data. Fast Fourier Transform and Maximum Entropy Method techniques were applied to the data to generate waterfall plots which track modal frequencies with burn time. Results indicate that the lower frequency nozzle 'vectoring' modes are only slightly affected by erosion, thermal effects and internal pressurization. The higher frequency shell modes of the nozzle are, however, significantly reduced.

Recent performance of and plasma outage studies with the SNS H{sup −} source

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stockli, M. P., E-mail: stockli@ornl.gov; Han, B.; Murray, S. N.

2016-02-15

Spallation Neutron Source ramps to higher power levels that can be sustained with high availability. The goal is 1.4 MW despite a compromised radio frequency quadrupole (RFQ), which requires higher radio frequency power than design levels to approach the nominal beam transmission. Unfortunately at higher power the RFQ often loses its thermal stability, a problem apparently enhanced by beam losses and high influxes of hydrogen. Delivering as much H{sup −} beam as possible with the least amount of hydrogen led to plasma outages. The root cause is the dense 1-ms long ∼55-kW 2-MHz plasma pulses reflecting ∼90% of the continuousmore » ∼300 W, 13-MHz power, which was mitigated with a 4-ms filter for the reflected power signal and an outage resistant, slightly detuned 13-MHz match. Lowering the H{sub 2} gas also increased the H{sup −} beam current to ∼55 mA and increased the RFQ transmission by ∼7% (relative)« less

HLA association in Singapore children with Grave's disease.

PubMed

Tan Siok-Hoon; Chan Soh-Ha; Lee Bee-Wah; Wee Guan-Bock; Wong Hock-Boon

1988-06-01

HLA associations in patients with Grave's disease are B8 in whites and BW35 in Japanese. This study shows the HLA association of Singapore Chinese children with Grave's disease. Forty unrelated Chinese children with Grave's disease were typed. The control population consisted of 238 consecutive unrelated normal Chinese individuals. Patients with Grave's disease showed a significantly higher frequency of BW46 than control subjects (corrected P = .0005, relative risk (RR) = 4.61). Only two patients had BW35 and none had B8. There was an increased frequency of both homozygotes and heterozygotes in thyrotoxic patients compared with controls, the RR being slightly higher in the homozygotes. Among the patients, BW46 was most frequently associated with B40, B13, and B15. The joint occurrence of BW46/B40 in thyrotoxic children had a lower relative risk than BW46 alone, whereas the joint occurrence of BW46/B13 had a higher relative risk than BW46 alone.

Modeling and Simulation of Linear and Nonlinear MEMS Scale Electromagnetic Energy Harvesters for Random Vibration Environments

PubMed Central

Sassani, Farrokh

2014-01-01

The simulation results for electromagnetic energy harvesters (EMEHs) under broad band stationary Gaussian random excitations indicate the importance of both a high transformation factor and a high mechanical quality factor to achieve favourable mean power, mean square load voltage, and output spectral density. The optimum load is different for random vibrations and for sinusoidal vibration. Reducing the total damping ratio under band-limited random excitation yields a higher mean square load voltage. Reduced bandwidth resulting from decreased mechanical damping can be compensated by increasing the electrical damping (transformation factor) leading to a higher mean square load voltage and power. Nonlinear EMEHs with a Duffing spring and with linear plus cubic damping are modeled using the method of statistical linearization. These nonlinear EMEHs exhibit approximately linear behaviour under low levels of broadband stationary Gaussian random vibration; however, at higher levels of such excitation the central (resonant) frequency of the spectral density of the output voltage shifts due to the increased nonlinear stiffness and the bandwidth broadens slightly. Nonlinear EMEHs exhibit lower maximum output voltage and central frequency of the spectral density with nonlinear damping compared to linear damping. Stronger nonlinear damping yields broader bandwidths at stable resonant frequency. PMID:24605063

Frequency of temporomandibular disorders diagnoses based on RDC/TMD in a Polish patient population.

PubMed

Osiewicz, Magdalena A; Lobbezoo, Frank; Loster, Bartłomiej W; Loster, Jolanta E; Manfredini, Daniele

2017-08-09

To assess the frequency and age distribution of Axis I and Axis II diagnoses among Polish patients with temporomandibular disorders (TMD). One hundred sixty-three (n = 163) consecutive adult patients seeking TMD treatment were assessed based on the Research Diagnostic Criteria for Temporomandibular Disorders (RDC/TMD) guidelines. Descriptive statistics on the frequency of diagnoses and mean age of the diagnostic groups was performed. Frequency of muscle disorders, disc displacements, and other joint disorders was 56.9, 48.9, and 31%, respectively. Disc displacement was the most common diagnosis in younger patients. Severe somatization and depression were shown in 11.9 and 15.8% of patients, respectively. Only 10.5% of the patients showed severe pain-related impairment. Females tended to have higher psychosocial scores than males. The frequency of Axis I TMD diagnoses in Polish patients is similar to other populations, whereas Axis II findings slightly differ from previous reports from other countries.

The population genetics of human disease: The case of recessive, lethal mutations

PubMed Central

Gao, Ziyue; Baker, Zachary; Diesel, José Francisco; Simons, Yuval B.; Haque, Imran S.; Pickrell, Joseph; Przeworski, Molly

2017-01-01

Do the frequencies of disease mutations in human populations reflect a simple balance between mutation and purifying selection? What other factors shape the prevalence of disease mutations? To begin to answer these questions, we focused on one of the simplest cases: recessive mutations that alone cause lethal diseases or complete sterility. To this end, we generated a hand-curated set of 417 Mendelian mutations in 32 genes reported to cause a recessive, lethal Mendelian disease. We then considered analytic models of mutation-selection balance in infinite and finite populations of constant sizes and simulations of purifying selection in a more realistic demographic setting, and tested how well these models fit allele frequencies estimated from 33,370 individuals of European ancestry. In doing so, we distinguished between CpG transitions, which occur at a substantially elevated rate, and three other mutation types. Intriguingly, the observed frequency for CpG transitions is slightly higher than expectation but close, whereas the frequencies observed for the three other mutation types are an order of magnitude higher than expected, with a bigger deviation from expectation seen for less mutable types. This discrepancy is even larger when subtle fitness effects in heterozygotes or lethal compound heterozygotes are taken into account. In principle, higher than expected frequencies of disease mutations could be due to widespread errors in reporting causal variants, compensation by other mutations, or balancing selection. It is unclear why these factors would have a greater impact on disease mutations that occur at lower rates, however. We argue instead that the unexpectedly high frequency of disease mutations and the relationship to the mutation rate likely reflect an ascertainment bias: of all the mutations that cause recessive lethal diseases, those that by chance have reached higher frequencies are more likely to have been identified and thus to have been included in this study. Beyond the specific application, this study highlights the parameters likely to be important in shaping the frequencies of Mendelian disease alleles. PMID:28957316

The morphology and electromagnetic properties of MnO 2 obtained in 8 T high magnetic field

NASA Astrophysics Data System (ADS)

Jia, Zhang; Yuping, Duan; Hui, Jing; Xiaogang, Li; Shunhua, Liu

2010-09-01

MnO 2 powder was synthesized in a high magnetic field (8 T) via a simple route, and the formation mechanism for the grain shape was discussed. The synthesized samples were characterized by XRD, SEM, TEM, and vector network analysis. The morphology of synthesized MnO 2 was sea urchin-like ball chain with a low density center, just like "hollow-like". Throughout the whole frequency range, the dielectric constant and the loss tangent clearly decreased in 8 T high magnetic field. Moreover, the magnetic permeability and the loss tangent increased slightly in the frequency range 2-13 GHz. Furthermore, the theoretically calculated values of reflection loss showed that when the magnetic field strength 8 T was adopted, the absorption peak became smoother and shifted to a higher frequency.

Detection of Drug Effects on Brain Activity using EEG-P300 with Similar Stimuli

NASA Astrophysics Data System (ADS)

Turnip, Arjon; Dwi Esti, K.; Faizal Amri, M.; Simbolon, Artha I.; Agung Suhendra, M.; IsKandar, Shelly; Wirakusumah, Firman F.

2017-07-01

Drug addiction poses a serious problem to our species. The worry that our significant family might be involved in drug use and are concerned to know how to detect drug use. Examinations of thirty taped EEG recordings were performed. The subjects consist of three group: addictive, methadone treatment (rehabilitation), and control (normal) which 10 subjects for each group. Statistical analysis was performed for the relative frequency of wave bands. The higher average amplitude is obtained from the addiction subjects. In the comparison with the signals source, channels P3 provide slightly higher average amplitude than other channels for all of subjects.

Rotor dynamic behaviour of a high-speed oil-free motor compressor with a rigid coupling supported on four radial magnetic bearings

NASA Technical Reports Server (NTRS)

Schmied, J.; Pradetto, J. C.

1994-01-01

The combination of a high-speed motor, dry gas seals, and magnetic bearings realized in this unit facilitates the elimination of oil. The motor is coupled with a quill shaft to the compressor. This yields higher natural frequencies of the rotor than with the use of a diaphragm coupling and helps to maintain a sufficient margin of the maximum speed to the frequency of the second compressor bending mode. However, the controller of each bearing then has to take the combined modes of both machines into account. The requirements for the controller to ensure stability and sufficient damping of all critical speeds are designed and compared with the implemented controller. The calculated closed loop behavior was confirmed experimentally, except the stability of some higher modes due to slight frequency deviations of the rotor model to the actual rotor. The influence of a mechanical damper as a device to provide additional damping to high models is demonstrated theoretically. After all, it was not necessary to install the damper, since all modes cold be stabilized by the controller.

Pulsing frequency induced change in optical constants and dispersion energy parameters of WO3 films grown by pulsed direct current magnetron sputtering

NASA Astrophysics Data System (ADS)

Punitha, K.; Sivakumar, R.; Sanjeeviraja, C.

2014-03-01

In this work, we present the pulsing frequency induced change in the structural, optical, vibrational, and luminescence properties of tungsten oxide (WO3) thin films deposited on microscopic glass and fluorine doped tin oxide (SnO2:F) coated glass substrates by pulsed dc magnetron sputtering technique. The WO3 films deposited on SnO2:F substrate belongs to monoclinic phase. The pulsing frequency has a significant influence on the preferred orientation and crystallinity of WO3 film. The maximum optical transmittance of 85% was observed for the film and the slight shift in transmission threshold towards higher wavelength region with increasing pulsing frequency revealed the systematic reduction in optical energy band gap (3.78 to 3.13 eV) of the films. The refractive index (n) of films are found to decrease (1.832 to 1.333 at 550 nm) with increasing pulsing frequency and the average value of extinction coefficient (k) is in the order of 10-3. It was observed that the dispersion data obeyed the single oscillator of the Wemple-Didomenico model, from which the dispersion energy (Ed) parameters, dielectric constants, plasma frequency, oscillator strength, and oscillator energy (Eo) of WO3 films were calculated and reported for the first time due to variation in pulsing frequency during deposition by pulsed dc magnetron sputtering. The Eo is change between 6.30 and 3.88 eV, while the Ed varies from 25.81 to 7.88 eV, with pulsing frequency. The Raman peak observed at 1095 cm-1 attributes the presence of W-O symmetric stretching vibration. The slight shift in photoluminescence band is attributed to the difference in excitons transition. We have made an attempt to discuss and correlate these results with the light of possible mechanisms underlying the phenomena.

Analysis of dental treatment performed by dental residents at General Dentistry Department of Tokyo Dental College Chiba Hospital over 6 years following introduction of mandatory dental clinical training system.

PubMed

Yamakura, Daiki; Takahashi, Toshiyuki; Kameyama, Atsushi; Noro, Akio; Sugiyama, Toshiko; Kondo, Yoshihiro; Sugiyama, Setsuko; Haruyama, Akiko; Takeda, Tomotaka; Nakajima, Kazunori

2013-01-01

Six years have passed since the introduction of legislation mandating at least 1 year of clinical training for those who have passed the national dentist examination. To determine whether clinical training has been appropriately implemented at the General Dentistry Department of Tokyo Dental College Chiba Hospital, a managed-type clinical training facility, the number of patients treated and types of dental and dental technical work performed by dental residents trained by the department were summarized and analyzed. The number of patients treated per dental resident increased from 11 in 2006 to 15 in 2011. By treatment type, periodontic treatment was the most frequently performed throughout the study period, followed by endodontic treatment. Conservation treatment, prosthodontic treatment with crowns/bridges, and prosthodontic treatment with dentures were performed at a similar moderate frequency, while oral surgical treatment was performed least frequently throughout the study period. The frequency of periodontic treatment increased slightly, whereas that of endodontic treatment decreased slightly or remained almost unchanged after introduction of the mandatory clinical training system. When the distribution of dental treatment performed at our department was compared with that of dental treatment performed by general dentists across Japan in 2011, our department showed a slightly lower frequency of periodontic treatment and higher frequency of endodontic treatment than the national total, whereas the frequency of other types of treatment was similar between the two populations. These results demonstrated that appropriate clinical training has been provided by our department to meet the purpose of offering dentists the opportunity to acquire the basic diagnostic and treatment abilities that would enable them to provide appropriate treatment for injuries and diseases frequently encountered in daily practice. The study also revealed some problems, such as a decreasing number of residents engaging in dental technical work each year. For additional improvement in the quality of dental clinical training, more analyses are needed to further identify and address potential problems in the system.

All-Optical Logic Gates and Wavelength Conversion Via the Injection-Locking of a Fabry-Perot Semiconductor Laser

DTIC Science & Technology

2013-03-21

be modified to create a non -inverting output as well. The probe beam is initially injected at a slightly higher frequency than the slave mode so...input signal(s) is (are) in the on state, injection locking, and thus the suppression of the non -injected Fabry–Perot modes, is induced, yielding a...laser diode), SLD (slave laser diode), EOM (electro-optic modulator), P (polarizer), OI (optical isolator), G (grating), L (lens), BE ( beam expander

Microwave ablation at 10.0 GHz achieves comparable ablation zones to 1.9 GHz in ex vivo bovine liver.

PubMed

Luyen, Hung; Gao, Fuqiang; Hagness, Susan C; Behdad, Nader

2014-06-01

We demonstrate the feasibility of using high-frequency microwaves for tissue ablation by comparing the performance of a 10 GHz microwave ablation system with that of a 1.9 GHz system. Two sets of floating sleeve dipole antennas operating at these frequencies were designed and fabricated for use in ex vivo experiments with bovine livers. Combined electromagnetic and transient thermal simulations were conducted to analyze the performance of these antennas. Subsequently, a total of 16 ablation experiments (eight at 1.9 GHz and eight at 10.0 GHz) were conducted at a power level of 42 W for either 5 or 10 min. In all cases, the 1.9 and 10 GHz experiments resulted in comparable ablation zone dimensions. Temperature monitoring probes revealed faster heating rates in the immediate vicinity of the 10.0 GHz antenna compared to the 1.9 GHz antenna, along with a slightly delayed onset of heating farther from the 10 GHz antenna, suggesting that heat conduction plays a greater role at higher microwave frequencies in achieving a comparably sized ablation zone. The results obtained from these experiments agree very well with the combined electromagnetic/thermal simulation results. These simulations and experiments show that using lower frequency microwaves does not offer any significant advantages, in terms of the achievable ablation zones, over using higher frequency microwaves. Indeed, it is demonstrated that high-frequency microwave antennas may be used to create reasonably large ablation zones. Higher frequencies offer the advantage of smaller antenna size, which is expected to lead to less invasive interstitial devices and may possibly lead to the development of more compact multielement arrays with heating properties not available from single-element antennas.

A research program to reduce interior noise in general aviation airplanes. Influence of depressurization and damping material on the noise reduction characteristics of flat and curved stiffened panels

NASA Technical Reports Server (NTRS)

Navaneethan, R.; Streeter, B.; Koontz, S.; Roskam, J.

1981-01-01

Some 20 x 20 aluminum panels were studied in a frequency range from 20 Hz to 5000 Hz. The noise sources used were a swept sine wave generator and a random noise generator. The effect of noise source was found to be negligible. Increasing the pressure differential across the panel gave better noise reduction below the fundamental resonance frequency due to an increase in stiffness. The largest increase occurred in the first 1 psi pressure differential. The curved, stiffened panel exhibited similar behavior, but with a lower increase of low frequency noise reduction. Depressurization on these panels resulted in decreased noise reduction at higher frequencies. The effect of damping tapes on the overall noise reduction values of the test specimens was small away from the resonance frequency. In the mass-law region, a slight and proportional improvement in noise reduction was observed by adding damping material. Adding sound absorbtion material to a panel with damping material beneficially increased noise reduction at high frequencies.

Effects of reducing the frequency and duration criteria for binge eating on lifetime prevalence of bulimia nervosa and binge eating disorder: implications for DSM-5.

PubMed

Trace, Sara E; Thornton, Laura M; Root, Tammy L; Mazzeo, Suzanne E; Lichtenstein, Paul; Pedersen, Nancy L; Bulik, Cynthia M

2012-05-01

We assessed the impact of reducing the binge eating frequency and duration thresholds on the diagnostic criteria for bulimia nervosa (BN) and binge eating disorder (BED). We estimated the lifetime population prevalence of BN and BED in 13,295 female twins from the Swedish Twin study of Adults: Genes and Environment employing a range of frequency and duration thresholds. External validation (risk to cotwin) was used to investigate empirical evidence for an optimal binge eating frequency threshold. The lifetime prevalence estimates of BN and BED increased linearly as the frequency criterion decreased. As the required duration increased, the prevalence of BED decreased slightly. Discontinuity in cotwin risk was observed in BN between at least four times per month and at least five times per month. This model could not be fit for BED. The proposed changes to the DSM-5 binge eating frequency and duration criteria would allow for better detection of binge eating pathology without resulting in a markedly higher lifetime prevalence of BN or BED. Copyright © 2011 Wiley Periodicals, Inc.

Effects of bandwidth, compression speed, and gain at high frequencies on preferences for amplified music.

PubMed

Moore, Brian C J

2012-09-01

This article reviews a series of studies on the factors influencing sound quality preferences, mostly for jazz and classical music stimuli. The data were obtained using ratings of individual stimuli or using the method of paired comparisons. For normal-hearing participants, the highest ratings of sound quality were obtained when the reproduction bandwidth was wide (55 to 16000 Hz) and ripples in the frequency response were small (less than ± 5 dB). For hearing-impaired participants listening via a simulated five-channel compression hearing aid with gains set using the CAM2 fitting method, preferences for upper cutoff frequency varied across participants: Some preferred a 7.5- or 10-kHz upper cutoff frequency over a 5-kHz cutoff frequency, and some showed the opposite preference. Preferences for a higher upper cutoff frequency were associated with a shallow high-frequency slope of the audiogram. A subsequent study comparing the CAM2 and NAL-NL2 fitting methods, with gains slightly reduced for participants who were not experienced hearing aid users, showed a consistent preference for CAM2. Since the two methods differ mainly in the gain applied for frequencies above 4 kHz (CAM2 recommending higher gain than NAL-NL2), these results suggest that extending the upper cutoff frequency is beneficial. A system for reducing "overshoot" effects produced by compression gave small but significant benefits for sound quality of a percussion instrument (xylophone). For a high-input level (80 dB SPL), slow compression was preferred over fast compression.

Response of plasma rotation to resonant magnetic perturbations in J-TEXT tokamak

NASA Astrophysics Data System (ADS)

Yan, W.; Chen, Z. Y.; Huang, D. W.; Hu, Q. M.; Shi, Y. J.; Ding, Y. H.; Cheng, Z. F.; Yang, Z. J.; Pan, X. M.; Lee, S. G.; Tong, R. H.; Wei, Y. N.; Dong, Y. B.; J-TEXT Team

2018-03-01

The response of plasma toroidal rotation to the external resonant magnetic perturbations (RMP) has been investigated in Joint Texas Experimental Tokamak (J-TEXT) ohmic heating plasmas. For the J-TEXT’s plasmas without the application of RMP, the core toroidal rotation is in the counter-current direction while the edge rotation is near zero or slightly in the co-current direction. Both static RMP experiments and rotating RMP experiments have been applied to investigate the plasma toroidal rotation. The core toroidal rotation decreases to lower level with static RMP. At the same time, the edge rotation can spin to more than 20 km s-1 in co-current direction. On the other hand, the core plasma rotation can be slowed down or be accelerated with the rotating RMP. When the rotating RMP frequency is higher than mode frequency, the plasma rotation can be accelerated to the rotating RMP frequency. The plasma confinement is improved with high frequency rotating RMP. The plasma rotation is decelerated to the rotating RMP frequency when the rotating RMP frequency is lower than the mode frequency. The plasma confinement also degrades with low frequency rotating RMP.

Iterative metal artifact reduction: evaluation and optimization of technique.

PubMed

Subhas, Naveen; Primak, Andrew N; Obuchowski, Nancy A; Gupta, Amit; Polster, Joshua M; Krauss, Andreas; Iannotti, Joseph P

2014-12-01

Iterative metal artifact reduction (IMAR) is a sinogram inpainting technique that incorporates high-frequency data from standard weighted filtered back projection (WFBP) reconstructions to reduce metal artifact on computed tomography (CT). This study was designed to compare the image quality of IMAR and WFBP in total shoulder arthroplasties (TSA); determine the optimal amount of WFBP high-frequency data needed for IMAR; and compare image quality of the standard 3D technique with that of a faster 2D technique. Eight patients with nine TSA underwent CT with standardized parameters: 140 kVp, 300 mAs, 0.6 mm collimation and slice thickness, and B30 kernel. WFBP, three 3D IMAR algorithms with different amounts of WFBP high-frequency data (IMARlo, lowest; IMARmod, moderate; IMARhi, highest), and one 2D IMAR algorithm were reconstructed. Differences in attenuation near hardware and away from hardware were measured and compared using repeated measures ANOVA. Five readers independently graded image quality; scores were compared using Friedman's test. Attenuation differences were smaller with all 3D IMAR techniques than with WFBP (p < 0.0063). With increasing high-frequency data, the attenuation difference increased slightly (differences not statistically significant). All readers ranked IMARmod and IMARhi more favorably than WFBP (p < 0.05), with IMARmod ranked highest for most structures. The attenuation difference was slightly higher with 2D than with 3D IMAR, with no significant reader preference for 3D over 2D. IMAR significantly decreases metal artifact compared to WFBP both objectively and subjectively in TSA. The incorporation of a moderate amount of WFBP high-frequency data and use of a 2D reconstruction technique optimize image quality and allow for relatively short reconstruction times.

Testing for Granger Causality in the Frequency Domain: A Phase Resampling Method.

PubMed

Liu, Siwei; Molenaar, Peter

2016-01-01

This article introduces phase resampling, an existing but rarely used surrogate data method for making statistical inferences of Granger causality in frequency domain time series analysis. Granger causality testing is essential for establishing causal relations among variables in multivariate dynamic processes. However, testing for Granger causality in the frequency domain is challenging due to the nonlinear relation between frequency domain measures (e.g., partial directed coherence, generalized partial directed coherence) and time domain data. Through a simulation study, we demonstrate that phase resampling is a general and robust method for making statistical inferences even with short time series. With Gaussian data, phase resampling yields satisfactory type I and type II error rates in all but one condition we examine: when a small effect size is combined with an insufficient number of data points. Violations of normality lead to slightly higher error rates but are mostly within acceptable ranges. We illustrate the utility of phase resampling with two empirical examples involving multivariate electroencephalography (EEG) and skin conductance data.

Plume RF interference calculations for space shuttle

NASA Technical Reports Server (NTRS)

Boynton, F. P.; Rajasekhar, P. S.

1978-01-01

During a static ground test of a full-scale SRM, measurements of attenuation of the UHF 416.5 MHz Range Safety Signal, the VHF voice link (230 MHz), and of S-band (c. 2.2. GHz) communications links were undertaken. Analyses of these results indicate that measurable attenuation did occur at all test frequencies. The measured attenuation levels are compared with a simple model in which the received signal is identified as that diffracted about the edge of the highly absorbing plume and the signal level in the shadow zone is evaluated using the formula for diffraction at a straight edge. The comparison is satisfactory at VHF and UHF frequencies, and slightly less so at S-band. Reasons for the discrepancies found at higher frequencies are discussed. A revised procedure which appears to relieve the accuracy problem was developed. This procedure is discussed along with applications to high altitude SRM plume attenuation.

Somatic cell mutations at the glycophorin A locus in erythrocytes of atomic bomb survivors: Implications for radiation carcinogenesis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kyoizumi, Seishi; Akiyama, Mitoshi; Tanabe, Kazumi

To clarify the relationship between somatic cell mutations and radiation exposure, the frequency of hemizygous mutant erythrocytes at the glycophorin A (GPA) locus was measured by flow cytometry for 1,226 heterozygous atomic bomb (A-bomb) survivors in HIroshima and Nagasaki. For statistical analysis, both GPA mutant frequency and radiation dose were log-transformed to normalize skewed distributions of these variables. The GPA mutant frequency increased slightly but significantly with age at testing and with the number of cigarettes smoked. Also, mutant frequency was significantly higher in males than in females even with adjustment for smoking and was higher to Hiroshima than inmore » Nagasaki. These characteristics of background GPA mutant frequency are qualitatively similar to those of background solid cancer incidence or mortality obtained from previous epidemiological studies of survivors. An analysis of the mutant frequency dose response using a descriptive model showed that the doubling dose is about 1.20 Sv [95% confidence interval (CI): 0.95-1.56], whereas the minimum dose for detecting a significant increase in mutant frequency is about 0.24 Sv (95% CI: 0.041-0.51). No significant effects of sex, city or age at the time of exposure on the dose response were detected. Interestingly, the doubling dose of the GPA mutant frequency was similar to that of solid cancer incidence in A-bomb survivors. This observation is in line with the hypothesis that radiation-induced somatic cell mutations are the major cause of excess cancer risk after radiation. 49 refs., 6 figs., 2 tabs.« less

Morphological correlates of echolocation frequency in the endemic Cape horseshoe bat, Rhinolophus capensis (Chiroptera: Rhinolophidae).

PubMed

Odendaal, Lizelle J; Jacobs, David S

2011-05-01

We investigated intraspecific variation in echolocation calls of the Cape horseshoe bat, Rhinolophus capensis, by comparing echolocation and associated morphological parameters among individuals from three populations of this species. The populations were situated in the center and at the western and eastern limits of the distribution of R. capensis. The latter two populations were situated in ecotones between vegetation biomes. Ecotone populations deviated slightly from the allometric relationship between body size and peak frequency for the genus, and there was no relationship between these variables within R. capensis. Nasal chamber length was the best predictor of peak frequency but not correlated with body size. The evolution of echolocation thus appears to have been uncoupled from body size in R. capensis. Furthermore, females used higher frequencies than males, which imply a potential social role for peak frequency. The differences in peak frequency may have originated from random founder effects and then compounded by genetic drift and/or natural selection. The latter may have acted directly on peak frequency altering skull parameters involved in echolocation independently of body size, resulting in the evolution of local acoustic signatures.

FoxP3+ T regulatory cells in oral lichen planus and its correlation with the distinct clinical appearance of the lesions

PubMed Central

Pereira, Joabe S; Monteiro, Bárbara V; Nonaka, Cassiano F; Silveira, Éricka J; Miguel, Márcia C

2012-01-01

The aim of this study was to evaluate the presence of FoxP3+ cells in oral lichen planus (OLP) and to correlate the findings with clinical and histopathological features of these lesions. The sample consisted of 32 cases of OLP (17 reticular and 15 erosive cases) and 10 cases of inflammatory fibrous hyperplasia (IFH). Clinical examination, histopathological and histomorphometric analysis, and immunohistochemistry (anti-FoxP3 antibody) were performed. Cells were counted in juxtaepithelial and intraepithelial regions of the lesions, and the results are expressed as the mean and range. Most erosive lesions were keratinized and exhibited epithelial atrophy, whereas most reticular lesions were hyperkeratinized. Mean epithelial thickness and mean density of the inflammatory infiltrate were higher in reticular lesions than in erosive OLP. Juxtaepithelial FoxP3+ cells were slightly more frequent in erosive lesions (mean: 1.7 and range: 0–9.4) than in reticular lesions (mean: 1.5 and range: 0–8.3). There was a significant difference in the frequency of these cells between OLP (mean: 1.6 and range: 0–9.4) and IFH (mean: 0.5 and range: 0–1.4) (P < 0.05). The number of intraepithelial FoxP3+ cells was higher in reticular OLP and IFH when compared with erosive lesions. The larger number of juxtaepithelial FoxP3+ cells in OLP compared to IFH might be related to the distinct etiopathogenesis of these lesions. High disease activity or action of the oral microbiota may explain the slightly higher frequency of FoxP3+ cells in erosive lesions. PMID:22804765

FoxP3(+) T regulatory cells in oral lichen planus and its correlation with the distinct clinical appearance of the lesions.

PubMed

Pereira, Joabe S; Monteiro, Bárbara V; Nonaka, Cassiano F; Silveira, Éricka J; Miguel, Márcia C

2012-08-01

The aim of this study was to evaluate the presence of FoxP3(+) cells in oral lichen planus (OLP) and to correlate the findings with clinical and histopathological features of these lesions. The sample consisted of 32 cases of OLP (17 reticular and 15 erosive cases) and 10 cases of inflammatory fibrous hyperplasia (IFH). Clinical examination, histopathological and histomorphometric analysis, and immunohistochemistry (anti-FoxP3 antibody) were performed. Cells were counted in juxtaepithelial and intraepithelial regions of the lesions, and the results are expressed as the mean and range. Most erosive lesions were keratinized and exhibited epithelial atrophy, whereas most reticular lesions were hyperkeratinized. Mean epithelial thickness and mean density of the inflammatory infiltrate were higher in reticular lesions than in erosive OLP. Juxtaepithelial FoxP3(+) cells were slightly more frequent in erosive lesions (mean: 1.7 and range: 0-9.4) than in reticular lesions (mean: 1.5 and range: 0-8.3). There was a significant difference in the frequency of these cells between OLP (mean: 1.6 and range: 0-9.4) and IFH (mean: 0.5 and range: 0-1.4) (P < 0.05). The number of intraepithelial FoxP3(+) cells was higher in reticular OLP and IFH when compared with erosive lesions. The larger number of juxtaepithelial FoxP3(+) cells in OLP compared to IFH might be related to the distinct etiopathogenesis of these lesions. High disease activity or action of the oral microbiota may explain the slightly higher frequency of FoxP3(+) cells in erosive lesions. © 2012 The Authors. International Journal of Experimental Pathology © 2012 International Journal of Experimental Pathology.

Demonstrating ultrafast polarization dynamics in spin-VCSELs

NASA Astrophysics Data System (ADS)

Lindemann, Markus; Pusch, Tobias; Michalzik, Rainer; Gerhardt, Nils C.; Hofmann, Martin R.

2018-02-01

Vertical-cavity surface-emitting lasers (VCSELs) are used for short-haul optical data transmission with increasing bit rates. The optimization involves both enhanced device designs and the use of higher-order modulation formats. In order to improve the modulation bandwidth substantially, the presented work employs spin-pumped VCSELs (spin-VCSELs) and their polarization dynamics instead of relying on intensity-modulated devices. In spin-VCSELs, the polarization state of the emitted light is controllable via spin injection. By optical spin pumping a single-mode VCSEL is forced to emit light composed of both orthogonal linearly polarized fundamental modes. The frequencies of these two modes differ slightly by a value determined by the cavity birefringence. As a result, the circular polarization degree oscillates with their beat frequency, i.e., with the birefringence-induced mode splitting. We used this phenomenon to show so-called polarization oscillations, which are generated by pulsed spin injection. Their frequency represents the polarization dynamics resonance frequency and can be tuned over a wide range via the birefringence, nearly independent from any other laser parameter. In previous work we demonstrated a maximum birefringence-induced mode splitting of more than 250 GHz. In this work, compared to previous publications, we show an almost doubled polarization oscillation frequency of more than 80 GHz. Furthermore, we discuss concepts to achieve even higher values far above 100 GHz.

Frequency of tooth brushing and associated factors in Mexican schoolchildren six to nine years of age.

PubMed

Casanova-Rosado, J F; Vallejos-Sánchez, A A; Minaya-Sánchez, M; Medina-Solís, C E; De La Rosa-Santillana, R; Márquez-Corona, M de L; Maupomé, G

2013-01-01

To determine the prevalence of daily tooth brushing and evaluate some variables associated. A cross-sectional study was carried out in 320 schoolchildren six to nine years old in Campeche, Mexico. Information on sociodemographic and socio-economic variables, oral hygiene practices and attitudes were collected through a questionnaire. The frequency of tooth brushing was categorized as "0" = fewer than seven times/week, "1" = at least once a day. In the analysis, nonparametric tests were used. Mean age was 6.99 +/- 1.00 years, 52.5% were boys. The prevalence of daily tooth brushing was 81.6%. In bivariate analysis, the prevalence of tooth brushing was higher (p < 0.05) among the children of mothers with higher schooling (9.80 years vs 8.47 years, p < 0.05), and in younger children (84.6% in 6-7-year olds vs 71.2% in 8-9-year olds, p < 0.05). A slight, non-significant association (p < 0.10) was noted between the current frequency of tooth brushing and an earlier age when the child first started brushing with toothpaste. There were no statistically significant differences (p > 0.05) in the frequency of tooth brushing by gender or by the mother's attitude toward the oral health of her child. The prevalence of daily tooth brushing was high compared to other studies. Mother's maximum level of schooling (as an indicator of socio-economic position) was associated with higher frequency of tooth brushing. Maternal characteristics are associated with the oral health behaviour of their children.

Mean Expected Error in Prediction of Total Body Water: A True Accuracy Comparison between Bioimpedance Spectroscopy and Single Frequency Regression Equations

PubMed Central

Abtahi, Shirin; Abtahi, Farhad; Ellegård, Lars; Johannsson, Gudmundur; Bosaeus, Ingvar

2015-01-01

For several decades electrical bioimpedance (EBI) has been used to assess body fluid distribution and body composition. Despite the development of several different approaches for assessing total body water (TBW), it remains uncertain whether bioimpedance spectroscopic (BIS) approaches are more accurate than single frequency regression equations. The main objective of this study was to answer this question by calculating the expected accuracy of a single measurement for different EBI methods. The results of this study showed that all methods produced similarly high correlation and concordance coefficients, indicating good accuracy as a method. Even the limits of agreement produced from the Bland-Altman analysis indicated that the performance of single frequency, Sun's prediction equations, at population level was close to the performance of both BIS methods; however, when comparing the Mean Absolute Percentage Error value between the single frequency prediction equations and the BIS methods, a significant difference was obtained, indicating slightly better accuracy for the BIS methods. Despite the higher accuracy of BIS methods over 50 kHz prediction equations at both population and individual level, the magnitude of the improvement was small. Such slight improvement in accuracy of BIS methods is suggested insufficient to warrant their clinical use where the most accurate predictions of TBW are required, for example, when assessing over-fluidic status on dialysis. To reach expected errors below 4-5%, novel and individualized approaches must be developed to improve the accuracy of bioimpedance-based methods for the advent of innovative personalized health monitoring applications. PMID:26137489

Dietary habits and physical activity levels in Jordanian adolescents attending private versus public schools.

PubMed

Tayyem, R F; Al-Hazzaa, H M; Abu-Mweis, S S; Bawadi, H A; Hammad, S S; Musaiger, A O

2014-07-08

The present study examined differences in dietary habits and physical activity levels between students attending private and public high schools in Jordan. A total of 386 secondary-school males and 349 females aged 14-18 years were randomly recruited using a multistage, stratified, cluster sampling technique. Dietary habits and physical activity level were self-reported in a validated questionnaire. The prevalence of obesity was significantly higher among adolescents in private (26.0%) than in public schools (16.7%). The frequency of breakfast intake was significantly higher among adolescents in private schools, whereas French fries and sweets intake was significantly higher in public schools. Television viewing showed a significant interaction with school type by sex. A higher rate of inactivity was found among students attending private schools. Despite a slightly better overall dietary profile for students in private schools, they had a higher rate of overweight and obesity compared with those in public schools.

Fluid structure interaction dynamic analysis of a mixed-flow waterjet pump

NASA Astrophysics Data System (ADS)

Pan, X. W.; Y Pan, Z.; Huang, D.; Shen, Z. H.

2013-12-01

In order to avoid resonance of a mixed-flow waterjet pump at run time and calculate the stress and deformation of the pump rotor in the flow field, a one-way fluid structure interaction method was applied to simulate the pump rotor using ANSYS CFX and ANSYS Workbench software. The natural frequencies and mode shapes of the pump rotor in the air and in the flow field were analyzed, and the stress and deformation of the impeller were obtained at different flow rates. The obtained numerical results indicated that the mode shapes were similar both in the air and in the flow field, but the pump rotor's natural frequency in the flow field was slightly smaller than that in the air; the difference of the pump rotor's natural frequency varied lightly at different flow rates, and all frequencies at different flow rates were higher than the safe frequency, the pump rotor under the effect of prestress rate did not occur resonance; The maximum stress was on the blade near the hub and the maximum deformation on the blade tip at different flow rates.

Apparatus and method for qualitative and quantitative measurements of optical properties of turbid media using frequency-domain photon migration

DOEpatents

Tromberg, B.J.; Tsay, T.T.; Berns, M.W.; Svaasand, L.O.; Haskell, R.C.

1995-06-13

Optical measurements of turbid media, that is media characterized by multiple light scattering, is provided through an apparatus and method for exposing a sample to a modulated laser beam. The light beam is modulated at a fundamental frequency and at a plurality of integer harmonics thereof. Modulated light is returned from the sample and preferentially detected at cross frequencies at frequencies slightly higher than the fundamental frequency and at integer harmonics of the same. The received radiance at the beat or cross frequencies is compared against a reference signal to provide a measure of the phase lag of the radiance and modulation ratio relative to a reference beam. The phase and modulation amplitude are then provided as a frequency spectrum by an array processor to which a computer applies a complete curve fit in the case of highly scattering samples or a linear curve fit below a predetermined frequency in the case of highly absorptive samples. The curve fit in any case is determined by the absorption and scattering coefficients together with a concentration of the active substance in the sample. Therefore, the curve fitting to the frequency spectrum can be used both for qualitative and quantitative analysis of substances in the sample even though the sample is highly turbid. 14 figs.

Apparatus and method for qualitative and quantitative measurements of optical properties of turbid media using frequency-domain photon migration

DOEpatents

Tromberg, Bruce J.; Tsay, Tsong T.; Berns, Michael W.; Svaasand, Lara O.; Haskell, Richard C.

1995-01-01

Optical measurements of turbid media, that is media characterized by multiple light scattering, is provided through an apparatus and method for exposing a sample to a modulated laser beam. The light beam is modulated at a fundamental frequency and at a plurality of integer harmonics thereof. Modulated light is returned from the sample and preferentially detected at cross frequencies at frequencies slightly higher than the fundamental frequency and at integer harmonics of the same. The received radiance at the beat or cross frequencies is compared against a reference signal to provide a measure of the phase lag of the radiance and modulation ratio relative to a reference beam. The phase and modulation amplitude are then provided as a frequency spectrum by an array processor to which a computer applies a complete curve fit in the case of highly scattering samples or a linear curve fit below a predetermined frequency in the case of highly absorptive samples. The curve fit in any case is determined by the absorption and scattering coefficients together with a concentration of the active substance in the sample. Therefore, the curve fitting to the frequency spectrum can be used both for qualitative and quantitative analysis of substances in the sample even though the sample is highly turbid.

Detection of Dental Secondary Caries Using Frequency-Domain Infrared Photothermal Radiometry (PTR) and Modulated Luminescence (LUM)

NASA Astrophysics Data System (ADS)

Kim, J.; Mandelis, A.; Matvienko, A.; Abrams, S.; Amaechi, B. T.

2012-11-01

The ability of frequency-domain photothermal radiometry (PTR) and modulated luminescence (LUM) to detect secondary caries is presented. Signal behavior upon sequential demineralization and remineralization of a spot (diameter ~1 mm) on a vertical wall of sectioned tooth samples was investigated experimentally. From these studies, it was found that PTR-LUM signals change, showing a certain pattern upon progressive demineralization and remineralization. PTR amplitudes slightly decreased upon progressive demineralization and slightly increased upon subsequent remineralization. The PTR phase increased during both demineralization and remineralization. LUM amplitudes exhibit a decreasing trend at excitation/probe distances larger than 200 μm away from the edge for both demineralization and remineralization; however, at locations close to the edge (up to ~200 μm), LUM signals slightly decrease upon demineralization and slightly increase during subsequent remineralization.

Golden Gate Bridge response: a study with low-amplitude data from three earthquakes

USGS Publications Warehouse

Çelebi, Mehmet

2012-01-01

The dynamic response of the Golden Gate Bridge, located north of San Francisco, CA, has been studied previously using ambient vibration data and finite element models. Since permanent seismic instrumentation was installed in 1993, only small earthquakes that originated at distances varying between ~11 to 122 km have been recorded. Nonetheless, these records prompted this study of the response of the bridge to low amplitude shaking caused by three earthquakes. Compared to previous ambient vibration studies, the earthquake response data reveal a slightly higher fundamental frequency (shorter-period) for vertical vibration of the bridge deck center span (~7.7–8.3 s versus 8.2–10.6 s), and a much higher fundamental frequency (shorter period) for the transverse direction of the deck (~11.24–16.3 s versus ~18.2 s). In this study, it is also shown that these two periods are dominant apparent periods representing interaction between tower, cable, and deck.

Cognitive impairment in patients with fibromyalgia syndrome as assessed by the mini-mental state examination.

PubMed

Rodríguez-Andreu, Jose; Ibáñez-Bosch, Rosario; Portero-Vázquez, Amparo; Masramon, Xavier; Rejas, Javier; Gálvez, Rafael

2009-12-21

This study evaluated the frequency of cognitive impairment in patients with Fibromyalgia syndrome (FMS) using the Mini Mental State Examination (MMSE). We analyzed baseline data from all 46 patients with FMS and 92 age- and sex-matched controls per diagnosis of neuropathic (NeP) or mixed pain (MP) selected from a larger prospective study. FMS had a slight but statistically significant lower score in the adjusted MMSE score (26.9; 95% CI 26.7-27.1) than either NeP (27.3; 95% CI 27.2-27.4) or MP (27.3; 27.2-27.5). The percentage of patients with congnitive impairment (adjusted MMSE

Effects of Reducing the Frequency and Duration Criteria for Binge Eating on Lifetime Prevalence of Bulimia Nervosa and Binge Eating Disorder: Implications for DSM-5

PubMed Central

Trace, Sara E.; Thornton, Laura M.; Root, Tammy L.; Mazzeo, Suzanne E.; Lichtenstein, Paul; Pedersen, Nancy L.; Bulik, Cynthia M.

2011-01-01

Objective We assessed the impact of reducing the binge eating frequency and duration thresholds on the diagnostic criteria for bulimia nervosa (BN) and binge eating disorder (BED). Method We estimated the lifetime population prevalence of BN and BED in 13,295 female twins from the Swedish Twin study of Adults: Genes and Environment employing a range of frequency and duration thresholds. External validation (risk to co-twin) was used to investigate empirical evidence for an optimal binge eating frequency threshold. Results The lifetime prevalence estimates of BN and BED increased linearly as the frequency criterion decreased. As the required duration increased, the prevalence of BED decreased slightly. Discontinuity in co-twin risk was observed in BN between at least four times per month and at least five times per month. This model could not be fit for BED. Discussion The proposed changes to the DSM-5 binge eating frequency and duration criteria would allow for better detection of binge eating pathology without resulting in a markedly higher lifetime prevalence of BN or BED. PMID:21882218

Parent and Child Reporting of Corporal Punishment: New Evidence from the Fragile Families and Child Wellbeing Study.

PubMed

Schneider, William; MacKenzie, Michael; Waldfogel, Jane; Brooks-Gunn, Jeanne

2015-06-01

This paper provides new evidence on parent and child reporting of corporal punishment, drawing on data from the Fragile Families and Child Wellbeing Study, a birth cohort study of families in 20 medium to large US cities. In separate interviews, 9 year olds and their mothers (N=1,180 families) were asked about the frequency of corporal punishment in the past year. Mothers and children were asked questions with slightly different response categorize which are harmonized in our analysis. Overall, children reported more high frequency corporal punishment (spanking or other physical punishment more than 10 times per year) than their mothers did; this discrepancy was seen in both African-American and Hispanic families (but not White families), and was evident for both boys and girls. These results suggest that reporting of frequency of corporal punishment is sensitive to the identity of the reporter and that in particular child reports may reveal more high frequency punishment than maternal reports do. However, predictors of high frequency punishment were similar regardless of reporter identity; in both cases, risk of high frequency punishment was higher when the child was African-American or had high previous levels of behavior problems.

Parent and Child Reporting of Corporal Punishment: New Evidence from the Fragile Families and Child Wellbeing Study

PubMed Central

Schneider, William; MacKenzie, Michael; Waldfogel, Jane; Brooks-Gunn, Jeanne

2017-01-01

This paper provides new evidence on parent and child reporting of corporal punishment, drawing on data from the Fragile Families and Child Wellbeing Study, a birth cohort study of families in 20 medium to large US cities. In separate interviews, 9 year olds and their mothers (N=1,180 families) were asked about the frequency of corporal punishment in the past year. Mothers and children were asked questions with slightly different response categorize which are harmonized in our analysis. Overall, children reported more high frequency corporal punishment (spanking or other physical punishment more than 10 times per year) than their mothers did; this discrepancy was seen in both African-American and Hispanic families (but not White families), and was evident for both boys and girls. These results suggest that reporting of frequency of corporal punishment is sensitive to the identity of the reporter and that in particular child reports may reveal more high frequency punishment than maternal reports do. However, predictors of high frequency punishment were similar regardless of reporter identity; in both cases, risk of high frequency punishment was higher when the child was African-American or had high previous levels of behavior problems. PMID:28386302

Feasibility of Real-Time Selection of Frequency Tables in an Acoustic Simulation of a Cochlear Implant

PubMed Central

Fitzgerald, Matthew; Sagi, Elad; Morbiwala, Tasnim A.; Tan, Chin-Tuan; Svirsky, Mario A.

2013-01-01

Objectives Perception of spectrally degraded speech is particularly difficult when the signal is also distorted along the frequency axis. This might be particularly important for post-lingually deafened recipients of cochlear implants (CI), who must adapt to a signal where there may be a mismatch between the frequencies of an input signal and the characteristic frequencies of the neurons stimulated by the CI. However, there is a lack of tools that can be used to identify whether an individual has adapted fully to a mismatch in the frequency-to-place relationship and if so, to find a frequency table that ameliorates any negative effects of an unadapted mismatch. The goal of the proposed investigation is to test the feasibility of whether real-time selection of frequency tables can be used to identify cases in which listeners have not fully adapted to a frequency mismatch. The assumption underlying this approach is that listeners who have not adapted to a frequency mismatch will select a frequency table that minimizes any such mismatches, even at the expense of reducing the information provided by this frequency table. Design 34 normal-hearing adults listened to a noise-vocoded acoustic simulation of a cochlear implant and adjusted the frequency table in real time until they obtained a frequency table that sounded “most intelligible” to them. The use of an acoustic simulation was essential to this study because it allowed us to explicitly control the degree of frequency mismatch present in the simulation. None of the listeners had any previous experience with vocoded speech, in order to test the hypothesis that the real-time selection procedure could be used to identify cases in which a listener has not adapted to a frequency mismatch. After obtaining a self-selected table, we measured CNC word-recognition scores with that self-selected table and two other frequency tables: a “frequency-matched” table that matched the analysis filters with the noisebands of the noise-vocoder simulation, and a “right information” table that is similar to that used in most cochlear implant speech processors, but in this simulation results in a frequency shift equivalent to 6.5 mm of cochlear space. Results Listeners tended to select a table that was very close to, but shifted slightly lower in frequency from the frequency-matched table. The real-time selection process took on average 2–3 minutes for each trial, and the between-trial variability was comparable to that previously observed with closely-related procedures. The word-recognition scores with the self-selected table were clearly higher than with the right-information table and slightly higher than with the frequency-matched table. Conclusions Real-time self-selection of frequency tables may be a viable tool for identifying listeners who have not adapted to a mismatch in the frequency-to-place relationship, and to find a frequency table that is more appropriate for them. Moreover, the small but significant improvements in word-recognition ability observed with the self-selected table suggest that these listeners based their selections on intelligibility rather than some other factor. The within-subject variability in the real-time selection procedure was comparable to that of a genetic algorithm, and the speed of the real-time procedure appeared to be faster than either a genetic algorithm or a simplex procedure. PMID:23807089

Cold-flow acoustic evaluation of a small scale, divergent, lobed nozzle for supersonic jet noise suppression

NASA Technical Reports Server (NTRS)

Huff, R. G.; Groesbeck, D. E.

1975-01-01

A supersonic jet noise suppressor was tested with cold flow for acoustic and thrust characteristics at nozzle- to atmospheric-pressure ratios of 1.5 to 4.0. Jet noise suppression and spectral characteristics of the divergent, lobed, suppressor (DLS) nozzle with and without an ejector are presented. Suppression was obtained at nozzle pressure ratios of 2.5 to 4.0. The largest, maximum-lobe, sound pressure level suppression with a hard-wall ejector was 14.6 decibels at a nozzle pressure ratio of 3.5. The thrust loss was 2 percent. In general, low-frequency jet noise was suppressed, leaving higher frequencies essentially unchanged. Without the ejector the nozzle showed a thrust loss of 11 percent together with slightly poorer noise suppression.

Molecular Electronics for Frequency Domain Optical Storage. Persistent Spectral Hole-Burning. A Review.

DTIC Science & Technology

1985-03-25

H In a real crystal, glass, or polymer, unavoidable local strains due to vacancies, dislocations, other defects, or the randomness of the host...itself cause the various molecules in the solid to have slightly different local environments. In this case (see the lower half of Figure 1), the way in...fact that the local environments of the various molecules are different that makes the various molecules absorb slightly different laser frequencies

Pulsing frequency induced change in optical constants and dispersion energy parameters of WO{sub 3} films grown by pulsed direct current magnetron sputtering

DOE Office of Scientific and Technical Information (OSTI.GOV)

Punitha, K.; Sivakumar, R., E-mail: krsivakumar1979@yahoo.com; Sanjeeviraja, C.

2014-03-21

In this work, we present the pulsing frequency induced change in the structural, optical, vibrational, and luminescence properties of tungsten oxide (WO{sub 3}) thin films deposited on microscopic glass and fluorine doped tin oxide (SnO{sub 2}:F) coated glass substrates by pulsed dc magnetron sputtering technique. The WO{sub 3} films deposited on SnO{sub 2}:F substrate belongs to monoclinic phase. The pulsing frequency has a significant influence on the preferred orientation and crystallinity of WO{sub 3} film. The maximum optical transmittance of 85% was observed for the film and the slight shift in transmission threshold towards higher wavelength region with increasing pulsingmore » frequency revealed the systematic reduction in optical energy band gap (3.78 to 3.13 eV) of the films. The refractive index (n) of films are found to decrease (1.832 to 1.333 at 550 nm) with increasing pulsing frequency and the average value of extinction coefficient (k) is in the order of 10{sup −3}. It was observed that the dispersion data obeyed the single oscillator of the Wemple-Didomenico model, from which the dispersion energy (E{sub d}) parameters, dielectric constants, plasma frequency, oscillator strength, and oscillator energy (E{sub o}) of WO{sub 3} films were calculated and reported for the first time due to variation in pulsing frequency during deposition by pulsed dc magnetron sputtering. The E{sub o} is change between 6.30 and 3.88 eV, while the E{sub d} varies from 25.81 to 7.88 eV, with pulsing frequency. The Raman peak observed at 1095 cm{sup −1} attributes the presence of W-O symmetric stretching vibration. The slight shift in photoluminescence band is attributed to the difference in excitons transition. We have made an attempt to discuss and correlate these results with the light of possible mechanisms underlying the phenomena.« less

Phase Locking of Multiple Single Neurons to the Local Field Potential in Cat V1.

PubMed

Martin, Kevan A C; Schröder, Sylvia

2016-02-24

The local field potential (LFP) is thought to reflect a temporal reference for neuronal spiking, which may facilitate information coding and orchestrate the communication between neural populations. To explore this proposed role, we recorded the LFP and simultaneously the spike activity of one to three nearby neurons in V1 of anesthetized cats during the presentation of drifting sinusoidal gratings, binary dense noise stimuli, and natural movies. In all stimulus conditions and during spontaneous activity, the average LFP power at frequencies >20 Hz was higher when neurons were spiking versus not spiking. The spikes were weakly but significantly phase locked to all frequencies of the LFP. The average spike phase of the LFP was stable across high and low levels of LFP power, but the strength of phase locking at low frequencies (≤10 Hz) increased with increasing LFP power. In a next step, we studied how strong stimulus responses of single neurons are reflected in the LFP and the LFP-spike relationship. We found that LFP power was slightly increased and phase locking was slightly stronger during strong compared with weak stimulus-locked responses. In summary, the coupling strength between high frequencies of the LFP and spikes was not strongly modulated by LFP power, which is thought to reflect spiking synchrony, nor was it strongly influenced by how strongly the neuron was driven by the stimulus. Furthermore, a comparison between neighboring neurons showed no clustering of preferred LFP phase. We argue that hypotheses on the relevance of phase locking in their current form are inconsistent with our findings. Copyright © 2016 the authors 0270-6474/16/362494-09$15.00/0.

Relationship between magnetic field strength and magnetic-resonance-related acoustic noise levels.

PubMed

Moelker, Adriaan; Wielopolski, Piotr A; Pattynama, Peter M T

2003-02-01

The need for better signal-to-noise ratios and resolution has pushed magnetic resonance imaging (MRI) towards high-field MR-scanners for which only little data on MR-related acoustic noise production have been published. The purpose of this study was to validate the theoretical relationship of sound pressure level (SPL) and static magnetic field strength. This is relevant for allowing adequate comparisons of acoustic data of MR systems at various magnetic field strengths. Acoustic data were acquired during various pulse sequences at field strengths of 0.5, 1.0, 1.5 and 2.0 Tesla using the same MRI unit by means of a Helicon rampable magnet. Continuous-equivalent, i.e. time-averaged, linear SPLs and 1/3-octave band frequencies were recorded. Ramping from 0.5 to 1.0 Tesla and from 1.0 to 2.0 Tesla resulted in an SPL increase of 5.7 and 5.2 dB(L), respectively, when averaged over the various pulse sequences. Most of the acoustic energy was in the 1-kHz frequency band, irrespective of magnetic field strength. The relation between field strength and SPL was slightly non-linear, i.e. a slightly less increase at higher field strengths, presumably caused by the elastic properties of the gradient coil encasings.

Spontaneous abortions and reproductive selection mechanisms in the rubber and leather industry in Finland

PubMed Central

Hemminki, K; Niemi, Marja-Liisa; Kyyrönen, P; Kilpikari, I; Vainio, H

1983-01-01

ABSTRACT Spontaneous abortions in hospitals were analysed from two sources—membership files of the Union of Rubber and Leather Workers (about 10 000 women) and records of the personnel of a rubber factory (about 1600 women). Two frequencies of spontaneous abortions were calculated for each population analysed: rate (No spontaneous abortions X 100/No pregnancies) and ratio (No spontaneous abortions X 100/No births). The two frequencies were increased for all union members compared with all Finnish women. The frequencies, however, did not appreciably differ when the pregnancies occurred during union membership as compared with the pregnancies before or after membership. The frequency of spontaneous abortions was higher for the short-time union members than for those employed for longer periods, but the increased frequency did not correlate with union membership. The employees of a rubber factory had slightly fewer spontaneous abortions on average than the community population. The women employed in the rubber factory for three to 23 months were found to have appreciably higher frequencies of spontaneous abortions than the women employed for longer periods. The present study showed the feasibility of using cases of spontaneous abortions in hospitals in an occupational study with longitudinal employment data. Women with short periods of employment appeared to have more spontaneous abortions than those with longer periods of employment suggesting the presence of selection mechanisms, perhaps with some analogies to the “healthy worker effect” in occupational mortality studies. The presence of such selection mechanisms deserve serious consideration in occupational reproductive epidemiology. PMID:6824605

Prevalence of human papilloma virus infection in patients with male accessory gland infection.

PubMed

La Vignera, S; Vicari, E; Condorelli, R A; Franchina, C; Scalia, G; Morgia, G; Perino, A; Schillaci, R; Calogero, A E

2015-04-01

The frequency of human papillomavirus (HPV) infection in the semen of patients with male accessory gland infection (MAGI) was evaluated. One hundred infertile patients with MAGI were classified into group A: patients with an inflammatory MAGI (n = 48) and group B: patients with a microbial form (n = 52). Healthy age-matched fertile men (34.0 ± 4.0 years) made up the control group (n = 20). Amplification of HPV DNA was carried out by HPV-HS Bio nested polymerase chain reaction for the detection of HPV DNA sequences within the L1 ORF. Ten patients in group A (20.8%) and 15 patients in group B (28.8%) had a HPV infection; two controls (10.0%) had HPV infection. Patients with MAGI had a significantly higher frequency of HPV infection compared with controls; patients with a microbial MAGI had significantly higher frequency of HPV infection compared with patients with an inflammatory form (both P < 0.05). Patients with MAGI and HPV had a slight, but significantly lower sperm progressive motility and normal morphology compared with patients with MAGI HPV-negative (P < 0.05). Elevated frequency of HPV infection occurred in patients with MAGI, suggesting that HPV should be investigated in the diagnostic work-up of these patients. Copyright © 2014 Reproductive Healthcare Ltd. Published by Elsevier Ltd. All rights reserved.

Inactivation of Enterobacter aerogenes in reconstituted skim milk by high- and low-frequency ultrasound.

PubMed

Gao, Shengpu; Hemar, Yacine; Lewis, Gillian D; Ashokkumar, Muthupandian

2014-11-01

The inactivation of Enterobacter aerogenes in skim milk using low-frequency (20kHz) and high-frequency (850kHz) ultrasonication was investigated. It was found that low-frequency acoustic cavitation resulted in lethal damage to E. aerogenes. The bacteria were more sensitive to ultrasound in water than in reconstituted skim milk having different protein concentrations. However, high-frequency ultrasound was not able to inactivate E. aerogenes in milk even when powers as high as 50W for 60min were used. This study also showed that high-frequency ultrasonication had no influence on the viscosity and particle size of skim milk, whereas low-frequency ultrasonication resulted in the decrease in viscosity and particle size of milk. The decrease in particle size is believed to be due to the breakup of the fat globules, and possibly to the cleavage of the κ-casein present at the surface of the casein micelles. Whey proteins were also found to be slightly affected by low-frequency ultrasound, with the amounts of α-lactalbumin and β-lactoglobulin slightly decreasing. Copyright © 2013. Published by Elsevier B.V.

Type III Solar Radio Burst Source Region Splitting due to a Quasi-separatrix Layer

NASA Astrophysics Data System (ADS)

McCauley, Patrick I.; Cairns, Iver H.; Morgan, John; Gibson, Sarah E.; Harding, James C.; Lonsdale, Colin; Oberoi, Divya

2017-12-01

We present low-frequency (80–240 MHz) radio imaging of type III solar radio bursts observed by the Murchison Widefield Array on 2015 September 21. The source region for each burst splits from one dominant component at higher frequencies into two increasingly separated components at lower frequencies. For channels below ∼132 MHz, the two components repetitively diverge at high speeds (0.1c–0.4c) along directions tangent to the limb, with each episode lasting just ∼2 s. We argue that both effects result from the strong magnetic field connectivity gradient that the burst-driving electron beams move into. Persistence mapping of extreme-ultraviolet jets observed by the Solar Dynamics Observatory reveals quasi-separatrix layers (QSLs) associated with coronal null points, including separatrix dome, spine, and curtain structures. Electrons are accelerated at the flare site toward an open QSL, where the beams follow diverging field lines to produce the source splitting, with larger separations at larger heights (lower frequencies). The splitting motion within individual frequency bands is interpreted as a projected time-of-flight effect, whereby electrons traveling along the outer field lines take slightly longer to excite emission at adjacent positions. Given this interpretation, we estimate an average beam speed of 0.2c. We also qualitatively describe the quiescent corona, noting in particular that a disk-center coronal hole transitions from being dark at higher frequencies to bright at lower frequencies, turning over around 120 MHz. These observations are compared to synthetic images based on the MHD algorithm outside a sphere (MAS) model, which we use to flux-calibrate the burst data.

An analysis of stepped trapezoidal-shaped microcantilever beams for MEMS-based devices

NASA Astrophysics Data System (ADS)

Ashok, Akarapu; Gangele, Aparna; Pal, Prem; Pandey, Ashok Kumar

2018-07-01

Microcantilever beams are the most widely used mechanical elements in the design and fabrication of MEMS/NEMS-based sensors and actuators. In this work, we have proposed a new microcantilever beam design based on a stepped trapezoidal-shaped microcantilever. Single-, double-, triple- and quadruple-stepped trapezoidal-shaped microcantilever beams along with conventional rectangular-shaped microcantilever beams were analysed experimentally, numerically and analytically. The microcantilever beams were fabricated from silicon dioxide material using wet bulk micromachining in 25 wt% TMAH. The length, width and thickness of the microcantilever beams were fixed at 200, 40 and 0.96 µm, respectively. A laser vibrometer was utilized to measure the resonance frequency and Q-factor of the microcantilever beams in vacuum as well as in ambient conditions. Furthermore, finite element analysis software, ANSYS, was employed to numerically analyse the resonance frequency, maximum deflection and torsional end rotation of all the microcantilever beam designs. The analytical and numerical resonance frequencies are found to be in good agreement with the experimental resonance frequencies. In the stepped trapezoidal-shaped microcantilever beams with an increasing number of steps, the Q-factor, maximum deflection and torsional end rotation were improved, whereas the resonance frequency was slightly reduced. Nevertheless, the resonance frequency is higher than the basic rectangular-shaped microcantilever beam. The observed quality factor, maximum deflection and torsional end rotation for a quadruple-stepped trapezoidal-shaped microcantilever are 38%, 41% and 52%, respectively, which are higher than those of conventional rectangular-shaped microcantilever beams. Furthermore, for an applied concentrated mass of 1 picogram on the cantilever surface, a greater shift in frequency is obtained for all the stepped trapezoidal-shaped microcantilever beam designs compared to the conventional rectangular microcantilever beam.

The effect of oblique angle of sound incidence, realistic edge conditions, curvature and in-plane panel stresses on the noise reduction characteristics of general aviation type panels

NASA Technical Reports Server (NTRS)

Grosveld, F.; Lameris, J.; Dunn, D.

1979-01-01

Experiments and a theoretical analysis were conducted to predict the noise reduction of inclined and curved panels. These predictions are compared to the experimental results with reasonable agreement between theory and experiment for panels under an oblique angle of sound incidence. Theoretical as well as experimental results indicate a big increase in noise reduction when a flat test panel is curved. Further curving the panel slightly decreases the noise reduction. Riveted flat panels are shown to give a higher noise reduction in the stiffness-controlled frequency region, while bonded panels are superior in this region when the test panel is curved. Experimentally measured noise reduction characteristics of flat aluminum panels with uniaxial in-plane stresses are presented and discussed. These test results indicate an important improvement in the noise reduction of these panels in the frequency range below the fundamental panel/cavity frequency.

Practical considerations for a second-order directional hearing aid microphone system

NASA Astrophysics Data System (ADS)

Thompson, Stephen C.

2003-04-01

First-order directional microphone systems for hearing aids have been available for several years. Such a system uses two microphones and has a theoretical maximum free-field directivity index (DI) of 6.0 dB. A second-order microphone system using three microphones could provide a theoretical increase in free-field DI to 9.5 dB. These theoretical maximum DI values assume that the microphones have exactly matched sensitivities at all frequencies of interest. In practice, the individual microphones in the hearing aid always have slightly different sensitivities. For the small microphone separation necessary to fit in a hearing aid, these sensitivity matching errors degrade the directivity from the theoretical values, especially at low frequencies. This paper shows that, for first-order systems the directivity degradation due to sensitivity errors is relatively small. However, for second-order systems with practical microphone sensitivity matching specifications, the directivity degradation below 1 kHz is not tolerable. A hybrid order directive system is proposed that uses first-order processing at low frequencies and second-order directive processing at higher frequencies. This hybrid system is suggested as an alternative that could provide improved directivity index in the frequency regions that are important to speech intelligibility.

Inter-hemispheric electroencephalography coherence analysis: assessing brain activity during monotonous driving.

PubMed

Jap, Budi Thomas; Lal, Sara; Fischer, Peter

2010-06-01

The current study investigated the effect of monotonous driving on inter-hemispheric electroencephalography (EEG) coherence. Twenty-four non-professional drivers were recruited to perform a fatigue instigating monotonous driving task while 30 channels of EEG were simultaneously recorded. The EEG recordings were then divided into 5 equal sections over the entire driving period for analysis. Inter-hemispheric coherence was computed from 5 homologous EEG electrode pairs (FP1-FP2, C3-C4, T7-T8, P7-P8, and O1-O2) for delta, theta, alpha and beta frequency bands. Results showed that frontal and occipital inter-hemispheric coherence values were significantly higher than central, parietal, and temporal sites for all four frequency bands (p<0.0001). In the alpha frequency band, significant difference was found between earlier and later driving sections (p=0.02). The coherence values in all EEG frequency bands were slightly increased at the end of the driving session, except for FP1-FP2 electrode pair, which showed no significant change in coherence in the beta frequency band at the end of the driving session. Copyright 2010 Elsevier B.V. All rights reserved.

Temperature dependence of piezoelectric properties for textured SBN ceramics.

PubMed

Kimura, Masahiko; Ogawa, Hirozumi; Kuroda, Daisuke; Sawada, Takuya; Higuchi, Yukio; Takagi, Hiroshi; Sakabe, Yukio

2007-12-01

Temperature dependences of piezoelectric properties were studied for h001i textured ceramics of bismuth layer-structured ferroelectrics, SrBi(2)Nb(2)O(9) (SBN). The textured ceramics with varied orientation degrees were fabricated by templated, grain-growth method, and the temperature dependences of resonance frequency were estimated. Excellent temperature stability of resonance frequency was obtained for the 76% textured ceramics. The resonance frequency of the 76% textured specimens varied almost linearly over a wide temperature range. Therefore, the variation was slight, even in a high temperature region above 150 degrees C. Temperature stability of a quartz crystal oscillator is generally higher than that of a ceramic resonator around room temperature. The variation of resonance frequency for the 76% textured SrBi(2)Nb(2)O(9) was larger than that of oscillation frequency for a typical quartz oscillator below 150 degrees C also in this study. However, the variation of the textured SrBi(2)Nb(2)O(9) was smaller than that of the quartz oscillator over a wide temperature range from -50 to 250 degrees C. Therefore, textured SrBi(2)Nb(2)O(9) ceramics is a major candidate material for the resonators used within a wide temperature range.

Binaural auditory beats affect long-term memory.

PubMed

Garcia-Argibay, Miguel; Santed, Miguel A; Reales, José M

2017-12-08

The presentation of two pure tones to each ear separately with a slight difference in their frequency results in the perception of a single tone that fluctuates in amplitude at a frequency that equals the difference of interaural frequencies. This perceptual phenomenon is known as binaural auditory beats, and it is thought to entrain electrocortical activity and enhance cognition functions such as attention and memory. The aim of this study was to determine the effect of binaural auditory beats on long-term memory. Participants (n = 32) were kept blind to the goal of the study and performed both the free recall and recognition tasks after being exposed to binaural auditory beats, either in the beta (20 Hz) or theta (5 Hz) frequency bands and white noise as a control condition. Exposure to beta-frequency binaural beats yielded a greater proportion of correctly recalled words and a higher sensitivity index d' in recognition tasks, while theta-frequency binaural-beat presentation lessened the number of correctly remembered words and the sensitivity index. On the other hand, we could not find differences in the conditional probability for recall given recognition between beta and theta frequencies and white noise, suggesting that the observed changes in recognition were due to the recollection component. These findings indicate that the presentation of binaural auditory beats can affect long-term memory both positively and negatively, depending on the frequency used.

X-Ray Variability Characteristics of the Seyfert 1 Galaxy NGC 3783

NASA Astrophysics Data System (ADS)

Markowitz, A.

2005-12-01

We have characterized the energy-dependent X-ray variability properties of the Seyfert 1 galaxy NGC 3783 using archival XMM-Newton and Rossi X-Ray Timing Explorer data. The high-frequency fluctuation power spectral density function (PSD) slope is consistent with flattening toward higher energies. Light-curve cross-correlation functions yield no significant lags, but peak coefficients generally decrease as energy separation of the bands increases on both short and long timescales. We have measured the coherence between various X-ray bands over the temporal frequency range of 6×10-8-1×10-4 Hz; this range includes the temporal frequency of the low-frequency PSD break tentatively detected by Markowitz et al. and includes the lowest temporal frequency over which coherence has been measured in any active galactic nucleus to date. Coherence is generally near unity at these temporal frequencies, although it decreases slightly as energy separation of the bands increases. Temporal frequency-dependent phase lags are detected on short timescales; phase lags are consistent with increasing as energy separation increases or as temporal frequency decreases. All of these results are similar to those obtained previously for several Seyfert galaxies and stellar mass black hole systems. Qualitatively, these results are consistent with the variability models of Kotov et al. and Lyubarskii, wherein the X-ray variability is due to inwardly propagating variations in the local mass accretion rate.

High-frequency sarcomeric auto-oscillations induced by heating in living neonatal cardiomyocytes of the rat

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shintani, Seine A.; Oyama, Kotaro; Fukuda, Norio, E-mail: noriof@jikei.ac.jp

2015-02-06

Highlights: • We tested the effects of infra-red laser irradiation on cardiac sarcomere dynamics. • A rise in temperature (>∼38 °C) induced high-frequency sarcomeric auto-oscillations. • These oscillations occurred with and without blockade of intracellular Ca{sup 2+} stores. • Cardiac sarcomeres can play a role as a temperature-dependent rhythm generator. - Abstract: In the present study, we investigated the effects of infra-red laser irradiation on sarcomere dynamics in living neonatal cardiomyocytes of the rat. A rapid increase in temperature to >∼38 °C induced [Ca{sup 2+}]{sub i}-independent high-frequency (∼5–10 Hz) sarcomeric auto-oscillations (Hyperthermal Sarcomeric Oscillations; HSOs). In myocytes with the intactmore » sarcoplasmic reticular functions, HSOs coexisted with [Ca{sup 2+}]{sub i}-dependent spontaneous beating in the same sarcomeres, with markedly varying frequencies (∼10 and ∼1 Hz for the former and latter, respectively). HSOs likewise occurred following blockade of the sarcoplasmic reticular functions, with the amplitude becoming larger and the frequency lower in a time-dependent manner. The present findings suggest that in the mammalian heart, sarcomeres spontaneously oscillate at higher frequencies than the sinus rhythm at temperatures slightly above the physiologically relevant levels.« less

Consumption of sweetened-beverages and poverty in Colombia: when access is not an advantage.

PubMed

Herran, Oscar F; Patiño, Gonzalo A; Gamboa, Edna M

2018-01-15

This study characterizes the intake of sweetened beverages and establishes whether economic inequalities in their consumption exists. Ecological study. Mixed methods using food frequency questionnaire and inequality indices. Based on the National Nutrition Survey, Colombia, 2010. The sweetened beverage intake of 17,514 subjects in 33 geodemographic units was estimated with a food frequency questionnaire and summarized. The calculation of inequality was based on the monetary poverty. The prevalence (yes/no) and frequency (times/day) of sweetened beverage consumption were estimated. Indices of economic inequality were calculated for both prevalence and frequency. The prevalence of sweetened beverage consumption was between 79.2% (95% CI, 75.7 to 82.8) in adults and 88.5% (95% CI, 85.8 to 91.3) in minors. The frequency of consumption in terms of times/day, was between 0.20 (95% CI, 0.16 to 0.24) in adults and 0.40 (95% CI, 0.33 to 0.46) in minors. The Gini coefficient for the prevalence was close to zero, between 0.04 and 0.08; for the frequency, it was slightly higher, between 0.12 and 0.25. It was established that there is no economic inequality in the consumption of sweetened beverages. Consumption taxes could be regressive.

Digital-Difference Processing For Collision Avoidance.

NASA Technical Reports Server (NTRS)

Shores, Paul; Lichtenberg, Chris; Kobayashi, Herbert S.; Cunningham, Allen R.

1988-01-01

Digital system for automotive crash avoidance measures and displays difference in frequency between two sinusoidal input signals of slightly different frequencies. Designed for use with Doppler radars. Characterized as digital mixer coupled to frequency counter measuring difference frequency in mixer output. Technique determines target path mathematically. Used for tracking cars, missiles, bullets, baseballs, and other fast-moving objects.

Cognitive impairment in patients with Fibromyalgia syndrome as assessed by the Mini-Mental State Examination

PubMed Central

2009-01-01

Background This study evaluated the frequency of cognitive impairment in patients with Fibromyalgia syndrome (FMS) using the Mini Mental State Examination (MMSE). Methods We analyzed baseline data from all 46 patients with FMS and 92 age- and sex-matched controls per diagnosis of neuropathic (NeP) or mixed pain (MP) selected from a larger prospective study. Results FMS had a slight but statistically significant lower score in the adjusted MMSE score (26.9; 95% CI 26.7-27.1) than either NeP (27.3; 95% CI 27.2-27.4) or MP (27.3; 27.2-27.5). The percentage of patients with congnitive impairment (adjusted MMSE ≤ 26) was numerically higher in FMS (15%; 95% CI 6.3-29) compared with NeP (5%; 95% CI 1.8-12.2) or MP (5%; 95% CI 1.8-12.2) and higher than in the same age stratum of the general population (0.05%). Conclusions Compared with the population reference value, patients with FMS showed high frequency of cognitive impairment. PMID:20025750

A high-powered siren for stable acoustic levitation of dense materials in the earth's gravity

NASA Technical Reports Server (NTRS)

Gammel, Paul M.; Croonquist, Arvid P.; Wang, Taylor G.

1988-01-01

Levitation of large dense samples (e.g., 1-cm diameter steel balls) has been performed in a 1-g environment. A siren was used to study the effects of reflector geometry and variable-frequency operation in order to attain stable acoustic positioning. The harmonic content and spatial distribution of the acoustic field have been investigated. The best stability was obtained with an open reflector system, using a flat lower reflector and a slightly concave upper reflector while operating at a frequency slightly below resonance.

Noise effect on performance of IR PVDF pyroelectric detector

NASA Astrophysics Data System (ADS)

Abdullah, K. Al; Batal, M. Anwar; Hamdan, Rawad; Khalil, Toni; Salame, Chafic

2018-05-01

The spin-casting and casting technology were used to make IR pyroelectric PVDF detectors, where the operational amplifier, TC75S63TU, is used to amplify pyroelectrical signal. The pyroelectric coefficient is measured by charge integration method, which is 23 µC/m2K. The voltage responsivity and noise equivalent power depending on the dielectric constant, specific conductivity and loss tangent, which are measured at various frequencies, is estimated where changing of detector capacitance and resistor with frequency is taken into account. Maximum voltage responsivity was for detector thickness d=116.05 µm at chopping frequency (f=0.8Hz). Influence of thermal, Johnson and amplifier noises on output voltage are studied. At frequencies (<1kHz), Johnson noise dominates whereas at frequencies (>1kHz), amplifier voltage noise dominates. The thinner detector, the lower noise affects on output voltage. The optimal signal to noise ratio (SNR) of pyroelectrical detector is for thickness d=30.1 µm at frequency f=20Hz. The reducing electrode area decreases slightly total noise at low frequency and enhances slightly SNR of pyroelectrical detector.

Clinical Effects of Formulated Food of Peucedanum japonicum Extract and Saw Palmetto Extract in Male Patients with Lower Urinary Tract Symptoms.

PubMed

Kageyama, Shinji; Beppu, Masanori; Ohnogi, Hiromu; Miyazaki, Sayaka; Haruno, Akihiro; Ito, Yoshihiko; Yamada, Shizuo

2018-05-01

To evaluate changes over time in subjective symptom scores and urination parameters before and after oral administration of formulated food containing a combination of Peucedanum japonicum (P. japonicum) extract and saw palmetto extract (SPE) in male patients with lower urinary tract symptoms (LUTS). This study was conducted in an open label manner on male patients with untreated LUTS. The urination state of patients was evaluated before and after administration of food formulated with P. japonicum extract and SPE for 4 weeks, based on urodynamic parameters and subjective symptom scores (International Prostate Symptom Score [IPSS and IPSS-QOL], Overactive Bladder Symptom Score [OABSS], Overactive Bladder Questionnaire [OAB-q], and International Index of Erectile Function [IIEF]). After the administration of food formulated with these extracts, the following results were obtained: (i) Subjective findings: The IPSS-QOL score improved significantly; both parameters related to nocturia, i.e., frequency of nighttime urination and OABSS-2, improved significantly; other ratings for subjective symptoms slightly improved. (ii) Objective findings: Residual urine volume decreased significantly, and blood prostate specific antigen (PSA) and urinary 8-OHdG levels decreased slightly after the treatment. (iii) Other findings: Blood pressure decreased slightly. No adverse drug reactions were reported. (iv) Patient impressions: 75% of patients gave a rating of "Good" or higher, with 15 out of 20 patients wanting to continue treatment after the end of 4-week administration period. Food formulated with P. japonicum extract and SPE may be useful to decrease frequency of nighttime urination and residual urine volume in male patients with LUTS. © 2017 John Wiley & Sons Australia, Ltd.

[Use of Ultrasound in the Follow-up of Professional Athletes Receiving Conservative Treatment of Patellar Tendon Enthesiopathy].

PubMed

Guo, Li-juan; Cui, Li-gang; Li, Yu-mei; Liao, Li-ping; Song, Lin

2015-10-01

To investigate the role of high-frequency ultrasound (HFUS) in evaluating in the effectiveness of conservative treatment for professional athletes with patellar tendon enthesiopathy. According to different treatment intensities, 24 professional athletes with patellar tendon enthesiopathy were randomly divided into painless group, slightly-painful group and extremely-painful group. Then changes of the HFUS findings [including ranges of two-dimensional diseases and blood conditions by Color Doppler Flow Imaging (CDFI)] of patellar tendon before and after the treatment were recorded. The results were also compared with conventional clinical treatment evaluations. After two courses of treatment,the percentage of athletes whose pain was resolved or disappeared was 37.5% in painless group, 87.5% in slightly-painful group, and 62.5% in extremely-painful group. The pain score was 4.50 ± 2.07, 4.88 ± 1.13, and 6.13 ± 1.55 in painless group,slightly-painful group,and extremely-painful group, respectively,before treatment and 4.88 ± 2.17, 3.00 ± 1.77,and 5.13 ± 2.36 after treatment. The average pain score remarkably decreased in the slightly-painful group and extremely-painful group,and such difference was statistically significant in the slightly-pain group (P<0.05). The effective rate (defined as thinner patellar,decreased hypoecho area and fewer blood distribution in the lesion) was 38%, 50%, and 62% in the painless group, slightly-painful group,and extremely-painful group, and the rates in the slightly-painful group and extremely-painful group were significantly higher than that in painless group (both P<0.05). HFUS can display the ultrasonographic changes of patellar tendon enthesiopathy after conservative treatments in an objective and quantitative manner. Compared with conventional clinical evaluations, it can more accurately reflect the disease recovery status.

Cortical evoked potentials to an auditory illusion: binaural beats.

PubMed

Pratt, Hillel; Starr, Arnold; Michalewski, Henry J; Dimitrijevic, Andrew; Bleich, Naomi; Mittelman, Nomi

2009-08-01

To define brain activity corresponding to an auditory illusion of 3 and 6Hz binaural beats in 250Hz or 1000Hz base frequencies, and compare it to the sound onset response. Event-Related Potentials (ERPs) were recorded in response to unmodulated tones of 250 or 1000Hz to one ear and 3 or 6Hz higher to the other, creating an illusion of amplitude modulations (beats) of 3Hz and 6Hz, in base frequencies of 250Hz and 1000Hz. Tones were 2000ms in duration and presented with approximately 1s intervals. Latency, amplitude and source current density estimates of ERP components to tone onset and subsequent beats-evoked oscillations were determined and compared across beat frequencies with both base frequencies. All stimuli evoked tone-onset P(50), N(100) and P(200) components followed by oscillations corresponding to the beat frequency, and a subsequent tone-offset complex. Beats-evoked oscillations were higher in amplitude with the low base frequency and to the low beat frequency. Sources of the beats-evoked oscillations across all stimulus conditions located mostly to left lateral and inferior temporal lobe areas in all stimulus conditions. Onset-evoked components were not different across stimulus conditions; P(50) had significantly different sources than the beats-evoked oscillations; and N(100) and P(200) sources located to the same temporal lobe regions as beats-evoked oscillations, but were bilateral and also included frontal and parietal contributions. Neural activity with slightly different volley frequencies from left and right ear converges and interacts in the central auditory brainstem pathways to generate beats of neural activity to modulate activities in the left temporal lobe, giving rise to the illusion of binaural beats. Cortical potentials recorded to binaural beats are distinct from onset responses. Brain activity corresponding to an auditory illusion of low frequency beats can be recorded from the scalp.

Cortical Evoked Potentials to an Auditory Illusion: Binaural Beats

PubMed Central

Pratt, Hillel; Starr, Arnold; Michalewski, Henry J.; Dimitrijevic, Andrew; Bleich, Naomi; Mittelman, Nomi

2009-01-01

Objective: To define brain activity corresponding to an auditory illusion of 3 and 6 Hz binaural beats in 250 Hz or 1,000 Hz base frequencies, and compare it to the sound onset response. Methods: Event-Related Potentials (ERPs) were recorded in response to unmodulated tones of 250 or 1000 Hz to one ear and 3 or 6 Hz higher to the other, creating an illusion of amplitude modulations (beats) of 3 Hz and 6 Hz, in base frequencies of 250 Hz and 1000 Hz. Tones were 2,000 ms in duration and presented with approximately 1 s intervals. Latency, amplitude and source current density estimates of ERP components to tone onset and subsequent beats-evoked oscillations were determined and compared across beat frequencies with both base frequencies. Results: All stimuli evoked tone-onset P50, N100 and P200 components followed by oscillations corresponding to the beat frequency, and a subsequent tone-offset complex. Beats-evoked oscillations were higher in amplitude with the low base frequency and to the low beat frequency. Sources of the beats-evoked oscillations across all stimulus conditions located mostly to left lateral and inferior temporal lobe areas in all stimulus conditions. Onset-evoked components were not different across stimulus conditions; P50 had significantly different sources than the beats-evoked oscillations; and N100 and P200 sources located to the same temporal lobe regions as beats-evoked oscillations, but were bilateral and also included frontal and parietal contributions. Conclusions: Neural activity with slightly different volley frequencies from left and right ear converges and interacts in the central auditory brainstem pathways to generate beats of neural activity to modulate activities in the left temporal lobe, giving rise to the illusion of binaural beats. Cortical potentials recorded to binaural beats are distinct from onset responses. Significance: Brain activity corresponding to an auditory illusion of low frequency beats can be recorded from the scalp. PMID:19616993

Scintigraphic detection of carotid atherosclerosis with indium-111-labeled autologous platelets

DOE Office of Scientific and Technical Information (OSTI.GOV)

Davis, H.H.; Siegel, B.A.; Sherman, L.A.

1980-05-01

Using autologous platelets labeled with indium-111-oxine, we studied the localization of platelets on arterial lesions by radionuclide scintigraphy in 34 patients with suspected cerebrovascular disease. The imaging results were compared with the findings of contrast angiography in 23 patients, 16 of whom were receiving antiplatelet and/or anticoagulant drugs during the platelet imaging study. Angiography demonstrated atherosclerotic lesions at 33 sites in the extracranial arteries of 16 of these patients. There was accumulation of /sup 111/In-platelets at 20 of these sites (61%) and at three other sites without definite angiographic abnormalities. Lesions with stenoses <50% were slightly more frequent than thosemore » with greater stenosis (68% vs 45%). The frequency of true-positive scintigraphic results was slightly higher in patients not treated with antithrombotic agents than in those on such drugs (70% vs 57%). Our results suggest that imaging with /sup 111/In-labeled autologous platelets may be useful for evaluating the pathophysiologic characteristics of atherosclerotic lesions in patients with cerebrovascular disease.« less

A meta-analysis of sex differences in cyber-bullying behavior: the moderating role of age.

PubMed

Barlett, Christopher; Coyne, Sarah M

2014-01-01

The current research used meta-analysis to determine whether (a) sex differences emerged in cyber-bullying frequency, (b) if age moderated any sex effect, and (c) if any additional moderators (e.g., publication year and status, country and continent of data collection) influenced the sex effect. Theoretically, if cyber-bullying is considered a form of traditional bullying and aggression, males are likely to cyber-bully more than females. Conversely, if cyber-bullying is considered relational/indirect aggression, females will be slightly more likely to cyber-bully than males. Results from 122 effect size estimates showed that males were slightly more likely to cyber-bully than females; however, age moderated the overall effect. Specifically, females were more likely to report cyber-bullying during early to mid-adolescence than males, while males showed higher levels of cyber-bullying during later adolescence than females. Publication status and year and continent and country of data collection also moderated the overall effect. © 2014 Wiley Periodicals, Inc.

Energy budget above a high-elevation subalpine forest in complex topography

USGS Publications Warehouse

Turnipseed, A.A.; Blanken, P.D.; Anderson, D.E.; Monson, Russell K.

2002-01-01

Components of the energy budget were measured above a subalpine coniferous forest over two complete annual cycles. Sensible and latent heat fluxes were measured by eddy covariance. Bowen ratios ranged from 0.7 to 2.5 in the summer (June-September) depending upon the availability of soil water, but were considerably higher (???3-6) during winter (December-March). Energy budget closure averaged better than 84% on a half-hourly basis in both seasons with slightly greater closure during the winter months. The energy budget showed a dependence on friction velocity (u*), approaching complete closure at u* values greater than 1 m s-1. The dependence of budget closure on u* explained why energy balance was slightly better in the winter as opposed to summer, since numerous periods of high turbulence occur in winter. It also explained the lower degree of energy closure (???10% less) during easterly upslope flow since these periods were characterized by low wind speeds (U < 4 m s-1) and friction velocities (u* < 0.5 m s-1). Co-spectral analysis suggests a shift of flux density towards higher frequencies under conditions where closure was obtained. It is suggested that low frequency contributions to the flux and advection were responsible for the lack of day-time energy budget closure. These effects were reduced at high friction velocities observed at our site. Our ability to close the energy budget at night was also highly dependent on friction velocity, approaching near closure (???90%) at u* values between 0.7 and 1.1 m s-1. Below this range, the airflow within the canopy becomes decoupled with the flow above. Above this range, insufficient temperature resolution of the sonic anemometer obscured the small temperature fluctuations, rendering measurements intractable. ?? 2002 Elsevier Science B.V. All rights reserved.

High-Fiber Orange Juice as a Nutrition Supplement in Women: A Randomized, Double-Blind, Placebo-Controlled Study of Tolerance and Effectiveness.

PubMed

Bergamasco, Christiane; Horie, Lilian Mika; Torrinhas, Raquel Susana; Waitzberg, Dan L

2015-11-01

The daily consumption of dietary fiber is frequently below suggested recommendations. Using a double-blind, controlled, randomized study, we assessed the efficiency and tolerance of a fiber-enriched orange juice to supplement fiber intake in women. After 1 week of noninterventional observation, 192 healthy adult women ingested 400 mL of orange juice for 21 days, which either was not (placebo group) or was enriched with fiber (fiber group). Orange juice ingestion was registered daily and controlled for each week during the study period. Macronutrient, fiber, and energy intake were determined using a 3-day food record, validated food chemical composition databases, and the "Pro Diet" software. Gastrointestinal symptoms were self-evaluated daily by scoring 4 grades of symptom intensity and using a visual analog scale to grade pain severity. No changes were observed for macronutrient and energy ingestion. For the placebo group (n = 97), the total fiber intake record was under the daily recommended value. In contrast, the fiber group (n = 95) displayed higher comparative values of total and soluble fiber consumption (P ≤ .001), achieving the daily recommended values of fiber intake. Both groups reported an increased frequency of slight bloating and rumbles over time (P ≤ .05). The fiber group also experienced a higher frequency of slight flatulence over time (P = .002). Consumption of fiber-enriched orange juice was efficient to achieve the daily fiber intake recommendation for women, was not accompanied by intense adverse events, and may represent a suitable method to supplement fiber intake in woman. © 2014 American Society for Parenteral and Enteral Nutrition.

Characterization of rain heights due to 0° isotherm in tropical and subtropical climates: implication on rain-induced attenuation prediction

NASA Astrophysics Data System (ADS)

Ojo, J. S.; Owolawi, P. A.

2018-01-01

In this paper, the dynamics of the structure of the rain profile as related to the zero-degree isotherm height and the implications for attenuation prediction along the Earth-space propagation links at locations in Nigeria, a tropical region, and South Africa, a subtropical region, are presented. Five-year (January 2010-December 2014) precipitation data on board the Tropical Rainfall Measuring Mission (TRMM) satellite have been analyzed over some selected locations in the two regions. The influences of the zero-degree isotherm height on some observed weather parameters are also discussed. The result on the influence of air temperature on rain height h r shows a significant increase in the tropical environment as compared with those in the subtropics. However, when h r results are compared with those obtained using rain height as recommended by the International Telecommunication Union (ITU), there is a significant difference at the 0.01% unavailability of the signal in a year particularly at higher frequencies. Further comparison with the slant path attenuation at 0.01% unavailability of the signal in a year shows a slight deviation (between 1.04 and 2.13 dB) in rain height than those acquired using the measured rain height in the tropical locations. Nevertheless, the result is slightly less than those obtained using the measured rain height in the subtropical locations with the differences in dB between - 0.49 and - 1.18. The overall results will be useful for estimating the link budgeting for digital radio satellite broadcasting. It will also be applicable for radar propagation systems at higher-frequency bands in Nigeria and South Africa.

Gamma oscillations precede interictal epileptiform spikes in the seizure onset zone

PubMed Central

Ren, Liankun; Kucewicz, Michal T.; Cimbalnik, Jan; Matsumoto, Joseph Y.; Brinkmann, Benjamin H.; Hu, Wei; Marsh, W. Richard; Meyer, Fredric B.; Stead, S. Matthew

2015-01-01

Objective: To investigate the generation, spectral characteristics, and potential clinical significance of brain activity preceding interictal epileptiform spike discharges (IEDs) recorded with intracranial EEG. Methods: Seventeen adult patients with drug-resistant temporal lobe epilepsy were implanted with intracranial electrodes as part of their evaluation for epilepsy surgery. IEDs detected on clinical macro- and research microelectrodes were analyzed using time-frequency spectral analysis. Results: Gamma frequency oscillations (30–100 Hz) often preceded IEDs in spatially confined brain areas. The gamma-IEDs were consistently observed 35 to 190 milliseconds before the epileptiform spike waveforms on individual macro- and microelectrodes. The gamma oscillations associated with IEDs had longer duration (p < 0.001) and slightly higher frequency (p = 0.045) when recorded on microelectrodes compared with clinical macroelectrodes. Although gamma-IEDs comprised only a subset of IEDs, they were strongly associated with electrodes in the seizure onset zone (SOZ) compared with the surrounding brain regions (p = 0.004), in sharp contrast to IEDs without preceding gamma oscillations that were often also detected outside of the SOZ. Similar to prior studies, isolated pathologic high-frequency oscillations in the gamma (30–100 Hz) and higher (100–600 Hz) frequency range, not associated with an IED, were also found to be associated with SOZ. Conclusions: The occurrence of locally generated gamma oscillations preceding IEDs suggests a mechanistic role for gamma in pathologic network activity generating IEDs. The results show a strong association between SOZ and gamma-IEDs. The potential clinical application of gamma-IEDs for mapping pathologic brain regions is intriguing, but will require future prospective studies. PMID:25589669

Effects of aldosterone blockade on left ventricular function and clinical status during acute myocardial infarction.

PubMed

Uzunhasan, Isil; Yildiz, Ahmet; Coskun, Ugur; Kalyoncuoglu, Muhsin; Baskurt, Murat; Cakar, Mehmet Akif; Kaya, Aysem; Pehlivanoglu, Seckin; Enar, Rasim; Okcun, Baris

2009-01-01

Heart failure is frequently a serious complication of acute myocardial infarction (AMI). ACE inhibitors, Angiotensin II receptor blockers, beta-blockers and aldosterone receptor blockers have been shown to improve outcomes in this setting. This study aimed to determine the effect of spironolactone on the frequency of clinical heart failure, mortality, rehospitalization and left ventricular functions determined by echocardiography. A total of 82 patients with STEMI hospitalized within 6-12 h of debut of symptoms were included in the study. The patients were randomly assigned into spironolactone (group A) or placebo (group B) groups after informed consent had been obtained. All patients were followed for 6 months. There were no statistically significant differences between the two groups when demographic criteria were compared. The incidence of post-MI angina pectoris, rhythm and conduction disturbance during hospitalization was significantly higher in Group B than in Group A. Although not statistically significant, the incidence of clinical heart failure was slightly lower in Group A than in Group B (5% versus 11%). Left ventricular end-diastolic volumes were slightly lower in Group A than in Group B, although statistically this was not significant. In concordance with these findings, the ejection fraction was slightly higher in Group A than in Group B, although this was not statistically significant (47% versus 44%). This trend continued during a 6-month follow-up after randomization. Our findings suggest that early administration of aldosterone blockers provides additional benefits after AMI, reducing the incidence of post-MI angina pectoris and rhythm and conduction disturbances.

Adaptive changes in echolocation sounds by Pipistrellus abramus in response to artificial jamming sounds.

PubMed

Takahashi, Eri; Hyomoto, Kiri; Riquimaroux, Hiroshi; Watanabe, Yoshiaki; Ohta, Tetsuo; Hiryu, Shizuko

2014-08-15

The echolocation behavior of Pipistrellus abramus during exposure to artificial jamming sounds during flight was investigated. Echolocation pulses emitted by the bats were recorded using a telemetry microphone mounted on the bats' backs, and their adaptation based on acoustic characteristics of emitted pulses was assessed in terms of jamming-avoidance responses (JARs). In experiment 1, frequency-modulated jamming sounds (3 ms duration) mimicking echolocation pulses of P. abramus were prepared. All bats showed significant increases in the terminal frequency of the frequency-modulated pulse by an average of 2.1-4.5 kHz when the terminal frequency of the jamming sounds was lower than the bats' own pulses. This frequency shift was not observed using jamming frequencies that overlapped with or were higher than the bats' own pulses. These findings suggest that JARs in P. abramus are sensitive to the terminal frequency of jamming pulses and that the bats' response pattern was dependent on the slight difference in stimulus frequency. In experiment 2, when bats were repeatedly exposed to a band-limited noise of 70 ms duration, the bats in flight more frequently emitted pulses during silent periods between jamming sounds, suggesting that the bats could actively change the timing of pulse emissions, even during flight, to avoid temporal overlap with jamming sounds. Our findings demonstrate that bats could adjust their vocalized frequency and emission timing during flight in response to acoustic jamming stimuli. © 2014. Published by The Company of Biologists Ltd.

VLF wave generation by beating of two HF waves in the ionosphere

NASA Astrophysics Data System (ADS)

Kuo, Spencer; Snyder, Arnold; Kossey, Paul; Chang, Chia-Lie; Labenski, John

2011-05-01

Theory of a beat-wave mechanism for very low frequency (VLF) wave generation in the ionosphere is presented. The VLF current is produced by beating two high power HF waves of slightly different frequencies through the nonlinearity and inhomogeneity of the ionospheric plasma. Theory also shows that the density irregularities can enhance the beat-wave generation. An experiment was conducted by transmitting two high power HF waves of 3.2 MHz and 3.2 MHz + f, where f = 5, 8, 13, and 2.02 kHz, from the HAARP transmitter. In the experiment, the ionosphere was underdense to the O-mode heater, i.e., the heater frequency f0 > foF2, and overdense or slightly underdense to the X-mode heater, i.e., f0 < fxF2 or f0 ≥ fxF2. The radiation intensity increased with the VLF wave frequency, was much stronger with the X-mode heaters, and was not sensitive to the electrojet. The strongest VLF radiation of 13 kHz was generated when the reflection layer of the X-mode heater was just slightly below the foF2 layer and the spread of the O-mode sounding echoes had the largest enhancement, suggesting an optimal setting for beat-wave generation of VLF waves by the HF heaters.

Accuracy of heart rate variability estimation by photoplethysmography using an smartphone: Processing optimization and fiducial point selection.

PubMed

Ferrer-Mileo, V; Guede-Fernandez, F; Fernandez-Chimeno, M; Ramos-Castro, J; Garcia-Gonzalez, M A

2015-08-01

This work compares several fiducial points to detect the arrival of a new pulse in a photoplethysmographic signal using the built-in camera of smartphones or a photoplethysmograph. Also, an optimization process for the signal preprocessing stage has been done. Finally we characterize the error produced when we use the best cutoff frequencies and fiducial point for smartphones and photopletysmograph and compare if the error of smartphones can be reasonably be explained by variations in pulse transit time. The results have revealed that the peak of the first derivative and the minimum of the second derivative of the pulse wave have the lowest error. Moreover, for these points, high pass filtering the signal between 0.1 to 0.8 Hz and low pass around 2.7 Hz or 3.5 Hz are the best cutoff frequencies. Finally, the error in smartphones is slightly higher than in a photoplethysmograph.

New Insights of High-precision Asteroseismology: Acoustic Radius and χ2-matching Method for Solar-like Oscillator KIC 6225718

NASA Astrophysics Data System (ADS)

Wu, Tao; Li, Yan

2017-10-01

Asteroseismology is a powerful tool for probing stellar interiors and determining stellar fundamental parameters. In the present work, we adopt the χ2-minimization method but only use the observed high-precision seismic observations (i.e., oscillation frequencies) to constrain theoretical models for analyzing solar-like oscillator KIC 6225718. Finally, we find the acoustic radius τ0 is the only global parameter that can be accurately measured by the χ2-matching method between observed frequencies and theoretical model calculations for a pure p-mode oscillation star. We obtain seconds for KIC 6225718. It leads that the mass and radius of the CMMs are degenerate with each other. In addition, we find that the distribution range of acoustic radius is slightly enlarged by some extreme cases, which posses both a larger mass and a higher (or lower) metal abundance, at the lower acoustic radius end.

Persistence of space radiation induced cytogenetic damage in the blood lymphocytes of astronauts.

PubMed

George, K; Chappell, L J; Cucinotta, F A

2010-08-14

Cytogenetic damage was assessed in blood lymphocytes from 16 astronauts before and after they participated in long-duration space missions of 3 months or more. The frequency of chromosome damage was measured by fluorescence in situ hybridization (FISH) chromosome painting before flight and at various intervals from a few days to many months after return from the mission. For all individuals, the frequency of chromosome exchanges measured within a month of return from space was higher than their preflight yield. However, some individuals showed a temporal decline in chromosome damage with time after flight. Statistical analysis using combined data for all astronauts indicated a significant overall decreasing trend in total chromosome exchanges with time after flight, although this trend was not seen for all astronauts and the yield of chromosome damage in some individuals actually increased with time after flight. The decreasing trend in total exchanges was slightly more significant when statistical analysis was restricted to data collected more than 220 days after return from flight. When analysis was restricted to data collected within 220 days of return from the mission there was no relationship between total exchanges and time. Translocation yields varied more between astronauts and there was only a slight non-significant decrease with time after flight that was similar for both later and earlier sampling times. Copyright (c) 2010. Published by Elsevier B.V.

Comparison of two methods in deriving a short version of oral health-related quality of life measure.

PubMed

Saub, R; Locker, D; Allison, P

2008-09-01

To compare two methods of developing short forms of the Malaysian Oral Health Impact Profile (OHIP-M) measure. Cross sectional data obtained using the long form of the OHIP-M was used to produce two types of OHIP-M short forms, derived using two different methods; namely regression and item frequency methods. The short version derived using a regression method is known as Reg-SOHIP(M) and that derived using a frequency method is known as Freq-SOHIP(M). Both short forms contained 14 items. These two forms were then compared in terms of their content, scores, reliability, validity and the ability to distinguish between groups. Out of 14 items, only four were in common. The form derived from the frequency method contained more high prevalence items and higher scores than the form derived from the regression method. Both methods produced a reliable and valid measure. However, the frequency method produced a measure, which was slightly better in terms of distinguishing between groups. Regardless of the method used to produce the measures, both forms performed equally well when tested for their cross-sectional psychometric properties.

Immunogenicity, safety and tolerability of inactivated trivalent influenza vaccine in overweight and obese children.

PubMed

Esposito, Susanna; Giavoli, Claudia; Trombetta, Claudia; Bianchini, Sonia; Montinaro, Valentina; Spada, Anna; Montomoli, Emanuele; Principi, Nicola

2016-01-02

Obesity may be a risk factor for increased hospitalization and deaths from infections due to respiratory pathogens. Additionally, obese patients appear to have impaired immunity after some vaccinations. To evaluate the immunogenicity, safety and tolerability of an inactivated trivalent influenza vaccine (TIV) in overweight and obese children, 28 overweight/obese pediatric patients and 23 healthy normal weight controls aged 3-14 years received a dose of TIV. Four weeks after vaccine administration, significantly higher seroprotection rates against the A/H1N1 strain were observed among overweight/obese children compared with normal weight controls (p<0.05). Four months after vaccination, similar or slightly higher seroconversion and seroprotection rates against the A/H1N1 and A/H3N2 strains were detected in overweight/obese than in normal weight children, whereas significantly higher rates of seroconversion and seroprotection against the B strain were found in overweight/obese patients than in normal weight controls (p<0.05 for seroconversion and seroprotection). Geometric mean titers (GMTs) and fold increase against B strains were significantly higher in overweight/obese patients than in normal weight controls 4 months after vaccine administration (p<0.01 for GMT values and p<0.05 for fold increase). The frequency of local and systemic reactions was similar between the groups, and there were no serious adverse events. The results of this study indicate that in overweight and obese children, antibody response to TIV administration is similar or slightly higher than that evidenced in normal weight subjects of similar age and this situation persists for at least 4 months after vaccine administration in the presence of a favorable safety profile. Copyright © 2015 Elsevier Ltd. All rights reserved.

Structural and electrical properties of nickel substituted cadmium ferrite

NASA Astrophysics Data System (ADS)

Chethan, B.; Raj Prakash, H. G.; Vijayakumari, S. C.; Ravikiran, Y. T.

2018-05-01

Spinal nano-sized Cadmium ferrite (CD) and Nickel substituted cadmium ferrite (NSCF) were fabricated by sol-gel auto combustion method. The formation of spinal structure of ferrite materials was confirmed by X-ray diffraction (XRD) analysis. The crystallites size of CF and NSCF as determined by Scherrer's formula were found to be 24.73 nm and 17.70 nm respectively. comparative study of Fourier transform infrared spectroscopy (FTIR) of CF and NSCF revealed tetrahedral absorption bands shifted slightly towards higher frequency where as octahedral bands shifted towards lower frequency side confirming interfacial interaction between Ni and CF. The AC conductivity (σ), loss tangent (tan δ) and complex plane impedance plots for both CF and NSCF are determined at various frequencies ranging from 50 kHz to 5 MHz and comparatively analyzed. The increase in AC conductivity of the NSCF nano particles as compared to CF was explained in the light of hopping model. The impedance measurement of NSCF show presence of a semi-circle corresponding to the grain boundary resistance and hence shows that the conductivity takes place largely through grain boundaries.

Simultaneous transmission of accurate time, stable frequency, data, and sensor system over one fiber with ITU 100 GHz grid

NASA Astrophysics Data System (ADS)

Horvath, Tomas; Munster, Petr; Vojtech, Josef; Velc, Radek; Oujezsky, Vaclav

2018-01-01

Optical fiber is the most used medium for current telecommunication networks. Besides data transmissions, special advanced applications like accurate time or stable frequency transmissions are more common, especially in research and education networks. On the other hand, new applications like distributed sensing are in ISP's interest because e.g. such sensing allows new service: protection of fiber infrastructure. Transmission of all applications in a single fiber can be very cost efficient but it is necessary to evaluate possible interaction before real application and deploying the service, especially if standard 100 GHz grid is considered. We performed laboratory measurement of simultaneous transmission of 100 G data based on DP-QPSK modulation format, accurate time, stable frequency and sensing system based on phase sensitive OTDR through two types of optical fibers, G.655 and G.653. These fibers are less common than G.652 fiber but thanks to their slightly higher nonlinear character, there are suitable for simulation of the worst case which can arise in a real network.

Impact of Uncertainty in the Drop Size Distribution on Oceanic Rainfall Retrievals From Passive Microwave Observations

NASA Technical Reports Server (NTRS)

Wilheit, Thomas T.; Chandrasekar, V.; Li, Wanyu

2007-01-01

The variability of the drop size distribution (DSD) is one of the factors that must be considered in understanding the uncertainties in the retrieval of oceanic precipitation from passive microwave observations. Here, we have used observations from the Precipitation Radar on the Tropical Rainfall Measuring Mission spacecraft to infer the relationship between the DSD and the rain rate and the variability in this relationship. The impact on passive microwave rain rate retrievals varies with the frequency and rain rate. The total uncertainty for a given pixel can be slightly larger than 10% at the low end (ca. 10 GHz) of frequencies commonly used for this purpose and smaller at higher frequencies (up to 37 GHz). Since the error is not totally random, averaging many pixels, as in a monthly rainfall total, should roughly halve this uncertainty. The uncertainty may be lower at rain rates less than about 30 mm/h, but the lack of sensitivity of the surface reference technique to low rain rates makes it impossible to tell from the present data set.

Long-range propagation of nonlinear infrasound waves through an absorbing atmosphere.

PubMed

de Groot-Hedlin, C D

2016-04-01

The Navier-Stokes equations are solved using a finite-difference, time-domain (FDTD) approach for axi-symmetric environmental models, allowing three-dimensional acoustic propagation to be simulated using a two-dimensional Cylindrical coordinate system. A method to stabilize the FDTD algorithm in a viscous medium at atmospheric densities characteristic of the lower thermosphere is described. The stabilization scheme slightly alters the governing equations but results in quantifiable dispersion characteristics. It is shown that this method leaves sound speeds and attenuation unchanged at frequencies that are well resolved by the temporal sampling rate but strongly attenuates higher frequencies. Numerical experiments are performed to assess the effect of source strength on the amplitudes and spectral content of signals recorded at ground level at a range of distances from the source. It is shown that the source amplitudes have a stronger effect on a signal's dominant frequency than on its amplitude. Applying the stabilized code to infrasound propagation through realistic atmospheric profiles shows that nonlinear propagation alters the spectral content of low amplitude thermospheric signals, demonstrating that nonlinear effects are significant for all detectable thermospheric returns.

A passive means for cancellation of structurally radiated tones.

PubMed

Zapfe, Jeffrey A; Ungar, Eric E

2003-01-01

The concept of cancellation of constant-frequency sound radiated from a vibrating surface by means of an attached mechanical oscillator is discussed. It is observed that the mass of a mechanical oscillator whose spring is attached to the vibrating surface will vibrate at comparatively large amplitudes and out of phase with that surface, provided that the surface vibrates at a frequency that is slightly higher than the oscillator's natural frequency. From this observation it is concluded that an oscillator's mass with a relatively small surface area can produce a volume velocity that is equal and opposite to that of the vibrating surface, resulting in cancellation of the sound radiated from the surface. Practical considerations in the design of such an oscillator are discussed, and the canceling performance from oscillators consisting of edge-supported circular disks is analyzed. An experimental canceling oscillator consisting of an edge-supported disk is described, and measurements made with this disk attached to a piston are shown to be in good agreement with analytical predictions. A tonal noise reduction exceeding 20 dB was demonstrated experimentally.

Quantitative Reevaluation of the Effects of Short- and Long-Term Removal of Descending Modulatory Inputs on the Pyloric Rhythm of the Crab, Cancer borealis1,2,3

PubMed Central

Hamood, Albert W.; Haddad, Sara A.; Otopalik, Adriane G.; Rosenbaum, Philipp

2015-01-01

Abstract The crustacean stomatogastric ganglion (STG) receives descending neuromodulatory inputs from three anterior ganglia: the paired commissural ganglia (CoGs), and the single esophageal ganglion (OG). In this paper, we provide the first detailed and quantitative analyses of the short- and long-term effects of removal of these descending inputs (decentralization) on the pyloric rhythm of the STG. Thirty minutes after decentralization, the mean frequency of the pyloric rhythm dropped from 1.20 Hz in control to 0.52 Hz. Whereas the relative phase of pyloric neuron activity was approximately constant across frequency in the controls, after decentralization this changed markedly. Nine control preparations kept for 5–6 d in vitro maintained pyloric rhythm frequencies close to their initial values. Nineteen decentralized preparations kept for 5–6 d dropped slightly in frequency from those seen at 30 min following decentralization, but then displayed stable activity over 6 d. Bouts of higher frequency activity were intermittently seen in both control and decentralized preparations, but the bouts began earlier and were more frequent in the decentralized preparations. Although the bouts may indicate that the removal of the modulatory inputs triggered changes in neuronal excitability, these changes did not produce obvious long-lasting changes in the frequency of the decentralized preparations. PMID:25914899

Statistically generated weighted curve fit of residual functions for modal analysis of structures

NASA Technical Reports Server (NTRS)

Bookout, P. S.

1995-01-01

A statistically generated weighting function for a second-order polynomial curve fit of residual functions has been developed. The residual flexibility test method, from which a residual function is generated, is a procedure for modal testing large structures in an external constraint-free environment to measure the effects of higher order modes and interface stiffness. This test method is applicable to structures with distinct degree-of-freedom interfaces to other system components. A theoretical residual function in the displacement/force domain has the characteristics of a relatively flat line in the lower frequencies and a slight upward curvature in the higher frequency range. In the test residual function, the above-mentioned characteristics can be seen in the data, but due to the present limitations in the modal parameter evaluation (natural frequencies and mode shapes) of test data, the residual function has regions of ragged data. A second order polynomial curve fit is required to obtain the residual flexibility term. A weighting function of the data is generated by examining the variances between neighboring data points. From a weighted second-order polynomial curve fit, an accurate residual flexibility value can be obtained. The residual flexibility value and free-free modes from testing are used to improve a mathematical model of the structure. The residual flexibility modal test method is applied to a straight beam with a trunnion appendage and a space shuttle payload pallet simulator.

Chromosome aberrations in the blood lymphocytes of astronauts after space flight

NASA Technical Reports Server (NTRS)

George, K.; Durante, M.; Wu, H.; Willingham, V.; Badhwar, G.; Cucinotta, F. A.

2001-01-01

Cytogenetic analysis of the lymphocytes of astronauts provides a direct measurement of space radiation damage in vivo, which takes into account individual radiosensitivity and considers the influence of microgravity and other stress conditions. Chromosome exchanges were measured in the blood lymphocytes of eight crew members after their respective space missions, using fluorescence in situ hybridization (FISH) with chromosome painting probes. Significant increases in aberrations were observed after the long-duration missions. The in vivo dose was derived from the frequencies of translocations and total exchanges using calibration curves determined before flight, and the RBE was estimated by comparison with individually measured physical absorbed doses. The values for average RBE were compared to the average quality factor (Q) from direct measurements of the lineal energy spectra using a tissue-equivalent proportional counter (TEPC) and radiation transport codes. The ratio of aberrations identified as complex was slightly higher after flight, which is thought to be an indication of exposure to high-LET radiation. To determine whether the frequency of complex aberrations measured in metaphase spreads after exposure to high-LET radiation was influenced by a cell cycle delay, chromosome damage was analyzed in prematurely condensed chromosome samples collected from two crew members before and after a short-duration mission. The frequency of complex exchanges after flight was higher in prematurely condensed chromosomes than in metaphase cells for one crew member.

Chromosome aberrations in the blood lymphocytes of astronauts after space flight.

PubMed

George, K; Durante, M; Wu, H; Willingham, V; Badhwar, G; Cucinotta, F A

2001-12-01

Cytogenetic analysis of the lymphocytes of astronauts provides a direct measurement of space radiation damage in vivo, which takes into account individual radiosensitivity and considers the influence of microgravity and other stress conditions. Chromosome exchanges were measured in the blood lymphocytes of eight crew members after their respective space missions, using fluorescence in situ hybridization (FISH) with chromosome painting probes. Significant increases in aberrations were observed after the long-duration missions. The in vivo dose was derived from the frequencies of translocations and total exchanges using calibration curves determined before flight, and the RBE was estimated by comparison with individually measured physical absorbed doses. The values for average RBE were compared to the average quality factor (Q) from direct measurements of the lineal energy spectra using a tissue-equivalent proportional counter (TEPC) and radiation transport codes. The ratio of aberrations identified as complex was slightly higher after flight, which is thought to be an indication of exposure to high-LET radiation. To determine whether the frequency of complex aberrations measured in metaphase spreads after exposure to high-LET radiation was influenced by a cell cycle delay, chromosome damage was analyzed in prematurely condensed chromosome samples collected from two crew members before and after a short-duration mission. The frequency of complex exchanges after flight was higher in prematurely condensed chromosomes than in metaphase cells for one crew member.

How pH, Temperature, and Time of Incubation Affect False-Positive Responses and Uncertainty of the LAL Gel-Clot Test.

PubMed

Lourenço, Felipe Rebello; Botelho, Túlia De Souza; Pinto, Terezinha De Jesus Andreoli

2012-01-01

The limulus amebocyte lysate (LAL) test is the simplest and most widely used procedure for detection of endotoxin in parenteral drugs. The LAL test demands optimal pH, ionic strength, temperature, and time of incubation. Slight changes in these parameters may increase the frequency of false-positive responses and the estimated uncertainty of the LAL test. The aim of this paper is to evaluate how changes in the pH, temperature, and time of incubation affect the occurrence of false-positive responses in the LAL test. LAL tests were performed in nominal conditions (37 °C, 60 min, and pH 7) and in different conditions of temperature (36 °C and 38 °C), time of incubation (58 and 62 min), and pH (6 and 8). Slight differences in pH increase the frequency of false-positive responses 5-fold (relative risk 5.0), resulting in an estimated of uncertainty 7.6%. Temperature and time of incubation affect the LAL test less, showing relative risks of 1.5 and 1.0, respectively. Estimated uncertainties in 36 °C or 38 °C temperatures and 58 or 62 min of incubation were found to be 2.0% and 1.0%, respectively. Simultaneous differences in these parameters significantly increase the frequency of false-positive responses. The limulus amebocyte lysate (LAL) gel-clot test is a simple test for detection of endotoxin from Gram-negative bacteria. The test is based on a gel formation when a certain amount of endotoxin is present; it is a pass/fail test. The LAL test requires optimal pH, ionic strength, temperature, and time of incubation. Slight difference in these parameters may increase the frequency of false-positive responses. The aim of this paper is to evaluate how changes in the pH, temperature, and time of incubation affect the occurrence of false-positive responses in the LAL test. We find that slight differences in pH increase the frequency of false-positive responses 5-fold. Temperature and time of incubation affect the LAL test less. Simultaneous differences in these parameters significantly increase the frequency of false-positive responses.

Influence of the excitation frequency on the density of helium metastable atoms in an atmospheric pressure dielectric barrier discharge

NASA Astrophysics Data System (ADS)

Boisvert, J.-S.; Sadeghi, N.; Margot, J.; Massines, F.

2017-01-01

Diffuse dielectric barrier discharges in atmospheric-pressure helium can be sustained over a wide range of excitation frequencies (from, but not restricted, 25 kHz to 15 MHz). The aim of the present paper is to identify the specific characteristics of the discharge modes that can be sustained in this frequency range, namely, the atmospheric-pressure Townsend-like discharge (APTD-L) mode, the atmospheric-pressure glow discharge (APGD) mode, the Ω mode, the hybrid mode, and the RF-α mode. This is achieved experimentally, by measuring the density of helium metastable atoms, which are known to play a driving role on the discharge kinetics. This density is measured by means of two absorption spectroscopy methods, one using a spectral lamp and the other one using a diode laser as a light source. The first one provides the time-averaged atom densities in the singlet He(21S) and triplet He(23S) metastable states, while with the second one we access the time-resolved density of He(23S) atoms. Time-averaged measurements indicate that the He(23S) density is relatively low in the APTD-L, the Ω and the RF-α modes ( <4 ×1016 m-3 ) slightly higher in the APGD mode ( 2 -7 ×1016 m-3 ), and still higher ( >1 ×1017 m-3 ) in the hybrid mode. The hybrid mode is exclusively observed for frequencies from 0.2 to 3 MHz. However, time-resolved density measurement shows that at 1 MHz and below, the hybrid mode is not continuously sustained. Instead, the discharge oscillates between the Ω and the hybrid mode with a switching frequency about the kilohertz. This explains the significantly lower power required to sustain the plasma as compared to above 1 MHz.

Longitudinal associations between dental caries increment and risk factors in late childhood and adolescence.

PubMed

Curtis, Alexandra M; VanBuren, John; Cavanaugh, Joseph E; Warren, John J; Marshall, Teresa A; Levy, Steven M

2018-05-12

To assess longitudinal associations between permanent tooth caries increment and both modifiable and non-modifiable risk factors, using best subsets model selection. The Iowa Fluoride Study has followed a birth cohort with standardized caries exams without radiographs of the permanent dentition conducted at about ages 9, 13, and 17 years. Questionnaires were sent semi-annually to assess fluoride exposures and intakes, select food and beverage intakes, and tooth brushing frequency. Exposure variables were averaged over ages 7-9, 11-13, and 15-17, reflecting exposure 2 years prior to the caries exam. Longitudinal models were used to relate period-specific averaged exposures and demographic variables to adjusted decayed and filled surface increments (ADJCI) (n = 392). The Akaike Information Criterion (AIC) was used to assess optimal explanatory variable combinations. From birth to age 9, 9-13, and 13-17 years, 24, 30, and 55 percent of subjects had positive permanent ADJCI, respectively. Ten models had AIC values within two units of the lowest AIC model and were deemed optimal based on AIC. Younger age, being male, higher mother's education, and higher brushing frequency were associated with lower caries increment in all 10 models, while milk intake was included in 3 of 10 models. Higher milk intakes were slightly associated with lower ADJCI. With the exception of brushing frequency, modifiable risk factors under study were not significantly associated with ADJCI. When possible, researchers should consider presenting multiple models if fit criteria cannot discern among a group of optimal models. © 2018 American Association of Public Health Dentistry.

Analysis of chromosomal aberrations, sister-chromatid exchanges and micronuclei in peripheral lymphocytes of pharmacists before and after working with cytostatic drugs.

PubMed

Roth, S; Norppa, H; Järventaus, H; Kyyrönen, P; Ahonen, M; Lehtomäki, J; Sainio, H; Sorsa, M

1994-12-01

The frequencies of chromosome aberrations, SCEs and micronuclei (cytokinesis-block method) in blood lymphocytes were compared among six nonsmoking female pharmacists before and after 1 year of working with cytostatic drugs. All possible precautions were taken to avoid exposure to cytostatics, including proper protective clothing and a monitored, negative-pressured working environment with vertical laminar flow cabinet. As referents, an age-matched group of six nonsmoking female hospital workers not dealing with cytostatics was simultaneously sampled twice with the same time interval. The pharmacists showed a marginally higher mean frequency of SCEs/cell (6.3; P = 0.049) after the working period than 1 year earlier (5.8). On the other hand, the referents, with no obvious exposure, had a higher mean number of cells with chromatid-type aberrations, gaps excluded, in the second sampling (2.0%; P = 0.048) than in the first one (0.5%). In addition, a slight (P = 0.055) trend towards a higher frequency of micronucleated binucleate cells was observed in the second sampling for both the exposed and control subjects. As such findings suggest technical variation in the cytogenetic parameters, the small difference observed in SCEs for the pharmacists between the two samplings was probably not related to the cytostatics exposure. No statistically significant differences were observed for any of the cytogenetic parameters in comparisons between the pharmacists and the referents. The findings suggest that caution should be exercised in comparing results obtained from two different samplings in prospective cytogenetic studies.

Detecting vocal fatigue in student singers using acoustic measures of mean fundamental frequency, jitter, shimmer, and harmonics-to-noise ratio

NASA Astrophysics Data System (ADS)

Sisakun, Siphan

2000-12-01

The purpose of this study is to explore the ability of four acoustic parameters, mean fundamental frequency, jitter, shimmer, and harmonics-to-noise ratio, to detect vocal fatigue in student singers. The participants are 15 voice students, who perform two distinct tasks, data collection task and vocal fatiguing task. The data collection task includes the sustained vowel /a/, reading a standard passage, and self-rate on a vocal fatigue form. The vocal fatiguing task is the vocal practice of musical scores for a total of 45 minutes. The four acoustic parameters are extracted using the software EZVoicePlus. The data analyses are performed to answer eight research questions. The first four questions relate to correlations of the self-rating scale and each of the four parameters. The next four research questions relate to differences in the parameters over time using one-factor repeated measures analysis of variance (ANOVA). The result yields a proposed acoustic profile of vocal fatigue in student singers. This profile is characterized by increased fundamental frequency; slightly decreased jitter; slightly decreased shimmer; and slightly increased harmonics-to-noise ratio. The proposed profile requires further investigation.

High-Precision Ionosphere Monitoring Using Continuous Measurements from BDS GEO Satellites

PubMed Central

Yang, Haiyan; Yang, Xuhai; Zhang, Zhe; Zhao, Kunjuan

2018-01-01

The current constellation of the BeiDou Navigation Satellite System (BDS) consists of five geostationary earth orbit (GEO) satellites, five inclined geosynchronous satellite orbit (IGSO) satellites, and four medium earth orbit (MEO) satellites. The advantage of using GEO satellites to monitor the ionosphereis the almost motionless ionospheric pierce point (IPP), which is analyzed in comparison with the MEO and IGSO satellites. The results from the analysis of the observations using eight tracking sites indicate that the ionospheric total electron content (TEC) sequence derived from each GEO satellite at their respective fixed IPPs is always continuous. The precision of calculated vertical TEC (VTEC) using BDS B1/B2, B1/B3, and B2/B3 dual-frequency combinationsis compared and analyzed. The VTEC12 precision based on the B1/B2 dual-frequency measurements using the smoothed code and the raw code combination is 0.69 and 5.54 TECU, respectively, which is slightly higher than VTEC13 and much higher than VTEC23. Furthermore, the ionospheric monitoring results of site JFNG in the northern hemisphere, and CUT0 in the southern hemisphere during the period from 1 January to 31 December 2015 are presented and discussed briefly. PMID:29495506

High-Precision Ionosphere Monitoring Using Continuous Measurements from BDS GEO Satellites.

PubMed

Yang, Haiyan; Yang, Xuhai; Zhang, Zhe; Zhao, Kunjuan

2018-02-27

The current constellation of the BeiDou Navigation Satellite System (BDS) consists of five geostationary earth orbit (GEO) satellites, five inclined geosynchronous satellite orbit (IGSO) satellites, and four medium earth orbit (MEO) satellites. The advantage of using GEO satellites to monitor the ionosphereis the almost motionless ionospheric pierce point (IPP), which is analyzed in comparison with the MEO and IGSO satellites. The results from the analysis of the observations using eight tracking sites indicate that the ionospheric total electron content (TEC) sequence derived from each GEO satellite at their respective fixed IPPs is always continuous. The precision of calculated vertical TEC (VTEC) using BDS B1/B2, B1/B3, and B2/B3 dual-frequency combinationsis compared and analyzed. The VTEC 12 precision based on the B1/B2 dual-frequency measurements using the smoothed code and the raw code combination is 0.69 and 5.54 TECU, respectively, which is slightly higher than VTEC 13 and much higher than VTEC 23 . Furthermore, the ionospheric monitoring results of site JFNG in the northern hemisphere, and CUT0 in the southern hemisphere during the period from 1 January to 31 December 2015 are presented and discussed briefly.

Is the European standard series suitable for patch testing in Riyadh, Saudi Arabia?

PubMed

el-Rab, M O; al-Sheikh, O A

1995-11-01

Due to the lack of a regional patch test series in our geographical area, the suitability of the European standard series was evaluated by patch testing dermatitis patients in Riyadh, Saudi Arabia. Of 240 consecutive patients with various forms of dermatitis, 136 (57%) showed 1 or more positive patch tests, women, 74 (54%), slightly outnumbering men, 62 (46%). Positive reactions were found to 21 of the 22 items in the test series. Sensitization was most common to nickel sulfate (51 = 37.5%), potassium dichromate (48 = 35%) and cobalt chloride (43 = 32%) The frequency of sensitization to nickel was higher in women (41 = 30%) while that to dichromate was higher in men (39 = 29%). Less reactions were found to fragrance mix (21 = 15%), formaldehyde (15 = 11%) and neomycin sulfate (15 = 11%). Sensitization to other allergens ranged between 10 and 1%. Less than 1% of patients (0.7%) reacted to benzocaine and none to primin. The frequency of occurrence of multiple sensitivities is also presented. We conclude that the European standard series is suitable for patch testing dermatitis patients in our region, with the exception of benzocaine and primin. The addition of 3 allergens that could be of local relevance is discussed.

The brain responses to different frequencies of binaural beat sounds on QEEG at cortical level.

PubMed

Jirakittayakorn, Nantawachara; Wongsawat, Yodchanan

2015-01-01

Beat phenomenon is occurred when two slightly different frequency waves interfere each other. The beat can also occur in the brain by providing two slightly different frequency waves separately each ear. This is called binaural beat. The brain responses to binaural beat are in discussion process whether the brain side and the brain area. Therefore, this study aims to figure out the brain responses to binaural beat by providing different binaural beat frequencies on 250 carrier tone continuously for 30 minutes to participants and using quantitative electroencephalography (QEEG) to interpret the data. The result shows that different responses appear in different beat frequency. Left hemisphere dominance occur in 3 Hz beat within 15 minutes and 15 Hz beat within 5 minutes. Right hemisphere dominance occurs in 10 Hz beat within 25 minute. 6 Hz beat enhances all area of the brain within 10 minutes. 8 Hz and 25 Hz beats have no clearly responses while 40 Hz beat enhances the responses in frontal lobe. These brain responses can be used for brain modulation application to induce the brain activity in further studies.

Terahertz Magnon-Polaritons in TmFeO3.

PubMed

Grishunin, Kirill; Huisman, Thomas; Li, Guanqiao; Mishina, Elena; Rasing, Theo; Kimel, Alexey V; Zhang, Kailing; Jin, Zuanming; Cao, Shixun; Ren, Wei; Ma, Guo-Hong; Mikhaylovskiy, Rostislav V

2018-04-18

Magnon-polaritons are shown to play a dominant role in the propagation of terahertz (THz) waves through TmFeO 3 orthoferrite, if the frequencies of the waves are in the vicinity of the quasi-antiferromagnetic spin resonance mode. Both time-domain THz transmission and emission spectroscopies reveal clear beatings between two modes with frequencies slightly above and slightly below this resonance, respectively. Rigorous modeling of the interaction between the spins of TmFeO 3 and the THz light shows that the frequencies correspond to the upper and lower magnon-polariton branches. Our findings reveal the previously ignored importance of propagation effects and polaritons in such heavily debated areas as THz magnonics and THz spectroscopy of electromagnons. It also shows that future progress in these areas calls for an interdisciplinary approach at the interface between magnetism and photonics.

Investigation of focused and unfocused transducer beam patterns in moderately nonlinear absorbing media

NASA Astrophysics Data System (ADS)

Kharin, Nikolay A.

2001-05-01

The novel solution of the KZK equation for acoustic pressure of the second harmonic in slightly focused beam of a circular transducer was obtained in a closed form for moderately nonlinear absorbing media (Gol'dberg numbers ~ 1). The solution is based on the method of slowly changing wave profile in combination with the method of successive approximations. Two pairs of transducers (Valpey-Fisher Corp.) Were compared to investigate the influence of focusing on the applicability of the moderate nonlinearity approach. The first pair was of 0.25' diameter and the second was of 0.5' diameter. Both pairs has one transducer with flat surface and the other geometrically focused at 4'. The central frequency for all transducers was 5 MHz. Measurements were undertaken in the blood-mimicking solution of water and glycerine. The results demonstrated that for slightly focused transducers with circular apertures, the moderate nonlinearity approach is still valid, as it was proved for flat sources with the same source level, despite the higher pressures in the focal region. The peak pressure for the weakly focused system occurs at a shorter range than focal length.

Physical characterization and performance comparison of active- and passive-pixel CMOS detectors for mammography.

PubMed

Elbakri, I A; McIntosh, B J; Rickey, D W

2009-03-21

We investigated the physical characteristics of two complementary metal oxide semiconductor (CMOS) mammography detectors. The detectors featured 14-bit image acquisition, 50 microm detector element (del) size and an active area of 5 cm x 5 cm. One detector was a passive-pixel sensor (PPS) with signal amplification performed by an array of amplifiers connected to dels via data lines. The other detector was an active-pixel sensor (APS) with signal amplification performed at each del. Passive-pixel designs have higher read noise due to data line capacitance, and the APS represents an attempt to improve the noise performance of this technology. We evaluated the detectors' resolution by measuring the modulation transfer function (MTF) using a tilted edge. We measured the noise power spectra (NPS) and detective quantum efficiencies (DQE) using mammographic beam conditions specified by the IEC 62220-1-2 standard. Our measurements showed the APS to have much higher gain, slightly higher MTF, and higher NPS. The MTF of both sensors approached 10% near the Nyquist limit. DQE values near dc frequency were in the range of 55-67%, with the APS sensor DQE lower than the PPS DQE for all frequencies. Our results show that lower read noise specifications in this case do not translate into gains in the imaging performance of the sensor. We postulate that the lower fill factor of the APS is a possible cause for this result.

[Research of dual-photoelastic-modulator-based beat frequency modulation and Fourier-Bessel transform imaging spectrometer].

PubMed

Wang, Zhi-Bin; Zhang, Rui; Wang, Yao-Li; Huang, Yan-Fei; Chen, You-Hua; Wang, Li-Fu; Yang, Qiang

2014-02-01

As the existing photoelastic-modulator(PEM) modulating frequency in the tens of kHz to hundreds of kHz between, leading to frequency of modulated interference signal is higher, so ordinary array detector cannot effectively caprure interference signal..A new beat frequency modulation method based on dual-photoelastic-modulator (Dual-PEM) and Fourier-Bessel transform is proposed as an key component of dual-photoelastic-modulator-based imaging spectrometer (Dual-PEM-IS) combined with charge coupled device (CCD). The dual-PEM are operated as an electro-optic circular retardance modulator, Operating the PEMs at slightly different resonant frequencies w1 and w2 respectively, generates a differential signal at a much lower heterodyne frequency that modulates the incident light. This method not only retains the advantages of the existing PEM, but also the frequency of modulated photocurrent decreased by 2-3 orders of magnitude (10-500 Hz) and can be detected by common array detector, and the incident light spectra can be obtained by Fourier-Bessel transform of low frequency component in the modulated signal. The method makes the PEM has the dual capability of imaging and spectral measurement. The basic principle is introduced, the basic equations is derived, and the feasibility is verified through the corresponding numerical simulation and experiment. This method has' potential applications in imaging spectrometer technology, and analysis of the effect of deviation of the optical path difference. This work provides the necessary theoretical basis for remote sensing of new Dual-PEM-IS and for engineering implementation of spectra inversion.

[The remote effects of chronic exposure to ionizing radiation and electromagnetic fields with respect to hygienic standardization].

PubMed

Grigor'ev, Iu G; Shafirkin, A V; Nikitina, V N; Vasin, A L

2003-01-01

A variety and rate of non-cancer diseases occurred in humans as a result of chronic exposure to ionizing radiation or to electromagnetic radiation (EMR) of high and superhigh frequency have been compared. The intensity of EMR was slightly higher than a sanitary standard for population. A risk of health impairments in workers having occupational exposure to EMR was assessed on the basis of Selie's concept of development of non-specific reaction of the body to chronic stress factors (general adaptation syndrome), models of changes in the body compensatory reserves and calculations of radiation risk after severe and chronic exposure to ionizing radiation.

Self-Organizing Maps-based ocean currents forecasting system.

PubMed

Vilibić, Ivica; Šepić, Jadranka; Mihanović, Hrvoje; Kalinić, Hrvoje; Cosoli, Simone; Janeković, Ivica; Žagar, Nedjeljka; Jesenko, Blaž; Tudor, Martina; Dadić, Vlado; Ivanković, Damir

2016-03-16

An ocean surface currents forecasting system, based on a Self-Organizing Maps (SOM) neural network algorithm, high-frequency (HF) ocean radar measurements and numerical weather prediction (NWP) products, has been developed for a coastal area of the northern Adriatic and compared with operational ROMS-derived surface currents. The two systems differ significantly in architecture and algorithms, being based on either unsupervised learning techniques or ocean physics. To compare performance of the two methods, their forecasting skills were tested on independent datasets. The SOM-based forecasting system has a slightly better forecasting skill, especially during strong wind conditions, with potential for further improvement when data sets of higher quality and longer duration are used for training.

Self-Organizing Maps-based ocean currents forecasting system

PubMed Central

Vilibić, Ivica; Šepić, Jadranka; Mihanović, Hrvoje; Kalinić, Hrvoje; Cosoli, Simone; Janeković, Ivica; Žagar, Nedjeljka; Jesenko, Blaž; Tudor, Martina; Dadić, Vlado; Ivanković, Damir

2016-01-01

An ocean surface currents forecasting system, based on a Self-Organizing Maps (SOM) neural network algorithm, high-frequency (HF) ocean radar measurements and numerical weather prediction (NWP) products, has been developed for a coastal area of the northern Adriatic and compared with operational ROMS-derived surface currents. The two systems differ significantly in architecture and algorithms, being based on either unsupervised learning techniques or ocean physics. To compare performance of the two methods, their forecasting skills were tested on independent datasets. The SOM-based forecasting system has a slightly better forecasting skill, especially during strong wind conditions, with potential for further improvement when data sets of higher quality and longer duration are used for training. PMID:26979129

Association between childhood leukaemia and exposure to power-frequency magnetic fields in Middle Europe.

PubMed

Jirik, Vitezslav; Pekarek, Ludek; Janout, Vladimir; Tomaskova, Hana

2012-10-01

Higher levels of exposure to extremely low-frequency magnetic fields (ELF-MF) are associated with a slightly increased risk of childhood leukaemia. Compared with more-developed Western countries, higher exposure levels are evident in the Czech Republic, probably because of the different types of housing. In light of this, we aimed to examine the association between ELF-MF exposure and childhood leukaemia in the Czech Republic. We conducted a paired case-control study. The cases (children with leukaemia) were age- sex- and permanent residence-matched to controls (children without leukaemia). Although this limited potential bias and confounding, it also limited our number of participants. The matched analyses included 79 case-control pairs. No significant association between ELF-MF exposure and childhood leukaemia was observed for exposures over 0.2 μT (odds ratio [OR]=0.93, confidence interval [CI]=0.45-1.93), 0.3 μT (OR=0.77, CI=0.34-1.75), or 0.4 μT (OR=0.9, CI=0.37-2.22). Despite higher levels of exposure in Middle and Eastern Europe, no indication of an association between ELF-MF exposure and childhood leukaemia was determined. This in contrast to the findings of previous studies conducted in different countries. Copyright © 2012 The Editorial Board of Biomedical and Environmental Sciences. Published by Elsevier B.V. All rights reserved.

Approximate first-principles anharmonic calculations of polyatomic spectra using MP2 and B3LYP potentials: comparisons with experiment.

PubMed

Roy, Tapta Kanchan; Carrington, Tucker; Gerber, R Benny

2014-08-21

Anharmonic vibrational spectroscopy calculations using MP2 and B3LYP computed potential surfaces are carried out for a series of molecules, and frequencies and intensities are compared with those from experiment. The vibrational self-consistent field with second-order perturbation correction (VSCF-PT2) is used in computing the spectra. The test calculations have been performed for the molecules HNO3, C2H4, C2H4O, H2SO4, CH3COOH, glycine, and alanine. Both MP2 and B3LYP give results in good accord with experimental frequencies, though, on the whole, MP2 gives very slightly better agreement. A statistical analysis of deviations in frequencies from experiment is carried out that gives interesting insights. The most probable percentage deviation from experimental frequencies is about -2% (to the red of the experiment) for B3LYP and +2% (to the blue of the experiment) for MP2. There is a higher probability for relatively large percentage deviations when B3LYP is used. The calculated intensities are also found to be in good accord with experiment, but the percentage deviations are much larger than those for frequencies. The results show that both MP2 and B3LYP potentials, used in VSCF-PT2 calculations, account well for anharmonic effects in the spectroscopy of molecules of the types considered.

Two-tone suppression of stimulus frequency otoacoustic emissionsa)

PubMed Central

Keefe, Douglas H.; Ellison, John C.; Fitzpatrick, Denis F.; Gorga, Michael P.

2008-01-01

Stimulus frequency otoacoustic emissions (SFOAEs) measured using a suppressor tone in human ears are analogous to two-tone suppression responses measured mechanically and neurally in mammalian cochleae. SFOAE suppression was measured in 24 normal-hearing adults at octave frequencies (fp=0.5–8.0 kHz) over a 40 dB range of probe levels (Lp). Suppressor frequencies (fs) ranged from −2.0 to 0.7 octaves re: fp, and suppressor levels ranged from just detectable suppression to full suppression. The lowest suppression thresholds occurred for “best” fs slightly higher than fp. SFOAE growth of suppression (GOS) had slopes close to one at frequencies much lower than best fs, and shallow slopes near best fs, which indicated compressive growth close to 0.3 dB/dB. Suppression tuning curves constructed from GOS functions were well defined at 1, 2, and 4 kHz, but less so at 0.5 and 8.0 kHz. Tuning was sharper at lower Lp with an equivalent rectangular bandwidth similar to that reported behaviorally for simultaneous masking. The tip-to-tail difference assessed cochlear gain, increasing with decreasing Lp and increasing fp at the lowest Lp from 32 to 45 dB for fp from 1 to 4 kHz. SFOAE suppression provides a noninvasive measure of the saturating nonlinearities associated with cochlear amplification on the basilar membrane. PMID:18345837

Noble Gas-Uranium Coordination and Intersystem Crossing for the CUO(Ne)x(Ng)n (Ng = Ar, Kr, Xe) Complexes in Solid Neon

DOE Office of Scientific and Technical Information (OSTI.GOV)

Andrews, Lester; Liang, Binyong; Li, Jun

2004-02-15

Atomic uranium excited by laser ablation reacts with CO in excess neon to produce the novel CUO molecule, which forms weak complexes CUO(Ne)m with neon and stronger complexes CUO(Ne)x(Ng)n (Ng = Ar, Kr, Xe) when the heavier noble gas atoms are present. The heavier CUO(Ne)m-1(Ng) complexes are identified through the effects of CO isotopic and Ng substitution on the neon matrix infrared spectra and by comparison to DFT frequency calculations on model complexes CUO(Ng) (Ng = Ne, Ar, Kr, Xe). The U-C and U-O stretching frequencies of CUO(Ne)m-1(Ng) complexes are slightly red shifted from 1047 and 872 cm-1 frequencies formore » the 1Sigma+ CUO ground state neon complex, which identifies singlet ground state CUO(Ne)m-1(Ng) complexes in solid neon. The next singlet CUO(Ne)x(Ng)2 complexes in excess neon follow in like manner. However, stretching modes and the isotopic shifts of the higher CUO(Ne)x(Ng)n complex approach those of the pure argon matrix CUO(Ar)n complex, which characterizes triple t ground state complexes by comparison to DFT frequency calculations.« less

G-CSF plus preemptive plerixafor vs hyperfractionated CY plus G-CSF for autologous stem cell mobilization in multiple myeloma: effectiveness, safety and cost analysis.

PubMed

Antar, A; Otrock, Z K; Kharfan-Dabaja, M A; Ghaddara, H A; Kreidieh, N; Mahfouz, R; Bazarbachi, A

2015-06-01

The optimal stem cell mobilization regimen for patients with multiple myeloma (MM) remains undefined. We retrospectively compared our experience in hematopoietic cell mobilization in 83 MM patients using fractionated high-dose CY and G-CSF with G-CSF plus preemptive plerixafor. All patients in the CY group (n=56) received fractionated high-dose CY (5 g/m(2) divided into five doses of 1 g/m(2) every 3 h) with G-CSF. All patients in the plerixafor group (n=27) received G-CSF and plerixafor preemptively based on an established algorithm. Compared with plerixafor, CY use was associated with higher total CD34+ cell yield (7.5 × 10(6) vs 15.5 × 10(6) cells/kg, P=0.005). All patients in both groups yielded ⩾4 × 10(6) CD34+ cells/kg. Conversely, CY use was associated with high frequency of febrile neutropenia, blood and platelet transfusions need and hospitalizations. The average total cost of mobilization in Lebanon was slightly higher in the plerixafor group ($7886 vs $7536; P=0.16). Our data indicate robust stem cell mobilization in MM patients with either fractionated high-dose CY and G-CSF or G-CSF alone with preemptive plerixafor. The chemo-mobilization approach was associated with twofold stem cell yield, slightly lower cost but significantly increased toxicity.

On the Horn Effect of a Tyre/road Interface, Part i: Experiment and Computation

NASA Astrophysics Data System (ADS)

Graf, R. A. G.; Kuo, C.-Y.; Dowling, A. P.; Graham, W. R.

2002-09-01

Near the tyre/road contact area, the road surface and the tyre belt form a horn-like geometry, which provides a significant amplification mechanism for sound sources. Measurements have been carried out on a stationary tyre placed on a plane surface in an otherwise anechoic chamber. Following the reciprocal theorem a microphone was placed in the road surface near the contact patch and a white noise source was used in the far field. The amplification by the horn effect can then be determined as a function of frequency for an array of microphone positions relative to the contact patch and the centre of the tyre. These experimental measurements show that the horn effect is responsible for about 10-20dB increase in noise level. The amplification function shows a distinct interference pattern for higher frequencies and is independent of the longitudinal source position for low frequencies and source positions close to the contact patch. Numerical calculations using the indirect boundary element method have been carried out. These show excellent agreement with the measurements in the frequency regime of the BEM, i.e., up to 2500 Hz. The dependence of the horn effect on primary geometrical parameters such as the effect of the radius of curvature of the shoulders, the load and the width of the tyre has been investigated experimentally and numerically. The broad features of the horn effect are given by the cylindrical geometry of the tyre. The rounded edges of the tyre tend to increase the levels of the minima and shift them to higher frequencies, while slightly decreasing the levels of the maxima. Shape variations due to load can be accounted for by correcting the source distance to the edge of the formed contact patch. The amplification at low frequencies increases with width, the results collapsing onto a single curve as a function of the dimensionless width ω / λ.

Binaural beats at high frequencies.

PubMed

McFadden, D; Pasanen, E G

1975-10-24

Binaural beats have long been believed to be audible only at low frequencies, but an interaction reminiscent of a binaural beat can sometimes be heard when different two-tone complexes of high frequency are presented to the two ears. The primary requirement is that the frequency separation in the complex at one ear be slightly different from that in the other--that is, that there be a small interaural difference in the envelope periodicities. This finding is in accord with other recent demonstrations that the auditory system is not deaf to interaural time differences at high frequencies.

Rapid detection of microorganisms based on active and passive modes of QCM.

PubMed

Farka, Zdeněk; Kovář, David; Skládal, Petr

2014-12-23

Label-free immunosensors are well suited for detection of microorganisms because of their fast response and reasonable sensitivity comparable to infection doses of common pathogens. Active (lever oscillator and frequency counter) and passive (impedance analyzer) modes of quartz crystal microbalance (QCM) were used and compared for rapid detection of three strains of E. coli. Different approaches for antibody immobilization were compared, the immobilization of reduced antibody using Sulfo-SMCC was most effective achieving the limit of detection (LOD) 8 × 104 CFU·mL-1 in 10 min. For the passive mode, software evaluating impedance characteristics in real-time was developed and used. Almost the same results were achieved using both active and passive modes confirming that the sensor properties are not limited by the frequency evaluation method but mainly by affinity of the antibody. Furthermore, reference measurements were done using surface plasmon resonance. Effect of condition of cells on signal was observed showing that cells ruptured by ultrasonication provided slightly higher signal changes than intact microbes.

Dielectric Properties of Generation 3 Pamam Dendrimer Nanocomposites

NASA Astrophysics Data System (ADS)

Ristić, Sanja; Mijović, Jovan

2008-08-01

Broadband dielectric relaxation spectroscopy (DRS) was employed to study molecular dynamics of blends composed of generation 3 poly(amidoamine) (PAMAM) dendrimers with ethylenediamine core and amino surface groups and four linear polymers: poly(propylene oxide)—PPO, two block copolymers, poly(propylene oxide)/poly(ethylene oxide)—PPO/PEO with different mol ratios (29/6 and 10/31) and poly(ethylene oxide)—PEO. The results were generated over a broad range of frequency. Dielectric spectra of dendrimers in PPO matrix reveal slight shift of normal and segmental processes to higher frequency with increasing concentration of dendrimers. In the 29PPO/6PEO matrix, no effect of concentration on the average relaxation time for normal and segmental processes was observed. In the 10PPO/31PEO matrix the relaxation time of the segmental process increases with increasing dendrimer concentration, while in the PEO matrix, local processes in dendrimers slow down. A detailed analysis of the effect of concentration of dendrimers and morphology of polymer matrix on the dielectric properties of dendrimer nanocomposites will be presented.

Rapid Detection of Microorganisms Based on Active and Passive Modes of QCM

PubMed Central

Farka, Zdeněk; Kovář, David; Skládal, Petr

2015-01-01

Label-free immunosensors are well suited for detection of microorganisms because of their fast response and reasonable sensitivity comparable to infection doses of common pathogens. Active (lever oscillator and frequency counter) and passive (impedance analyzer) modes of quartz crystal microbalance (QCM) were used and compared for rapid detection of three strains of E. coli. Different approaches for antibody immobilization were compared, the immobilization of reduced antibody using Sulfo‐SMCC was most effective achieving the limit of detection (LOD) 8 × 104 CFU·mL−1 in 10 min. For the passive mode, software evaluating impedance characteristics in real-time was developed and used. Almost the same results were achieved using both active and passive modes confirming that the sensor properties are not limited by the frequency evaluation method but mainly by affinity of the antibody. Furthermore, reference measurements were done using surface plasmon resonance. Effect of condition of cells on signal was observed showing that cells ruptured by ultrasonication provided slightly higher signal changes than intact microbes. PMID:25545267

Influence of spherical aberration, stimulus spatial frequency, and pupil apodisation on subjective refractions

PubMed Central

Bradley, Arthur; Xu, Renfeng; Thibos, Larry; Marin, Gildas; Hernandez, Martha

2014-01-01

Purpose To test competing hypotheses (Stiles Crawford pupil apodising or superior imaging of high spatial frequencies by the central pupil) for the pupil size independence of subjective refractions in the presence of primary spherical aberration. Methods Subjective refractions were obtained with a variety of test stimuli (high contrast letters, urban cityscape, high and low spatial frequency gratings) while modulating pupil diameter, levels of primary spherical aberration and pupil apodisation. Subjective refractions were also obtained with low-pass and high-pass stimuli and using “darker” and “sharper” subjective criteria. Results Subjective refractions for stimuli containing high spatial frequencies focus a near paraxial region of the pupil and are affected only slightly by level of Seidel spherical aberration, degree of pupil apodisation and pupil diameter, and generally focused a radius of about 1 to 1.5 mm from the pupil centre. Low spatial frequency refractions focus a marginal region of the pupil, and are significantly affected by level of spherical aberration, amount of pupil apodisation, and pupil size. Clinical refractions that employ the “darker” or “sharper” subjective criteria bias the patient to use lower or higher spatial frequencies respectively. Conclusions In the presence of significant levels of spherical aberration, the pupil size independence of subjective refractions occurs with or without Stiles Crawford apodisation for refractions that optimise high spatial frequency content in the image. If low spatial frequencies are optimised by a subjective refraction, spherical refractive error varies with spherical aberration, pupil size, and level of apodisation. As light levels drop from photopic to scotopic, therefore, we expect a shift from pupil size independent to pupil size dependent subjective refractions. Emphasising a “sharper” criterion during subjective refractions will improve image quality for high spatial frequencies and generate pupil size independent refractions. PMID:24397356

Comparison of Tropical and Extratropical Gust Factors Using Observed and Simulated Data

NASA Astrophysics Data System (ADS)

Edwards, R. P.; Schroeder, J. L.

2011-12-01

Questions of whether differences exist between tropical cyclone (TC) and extratropical (ET) wind have been the subject of considerable debate. This study will focus on the behavior of the gust factor (GF), the ratio of a peak wind speed of a certain duration and a mean wind speed of a certain duration, for three types of data: TC, ET, and simulated. For this project, the Universal Spectrum, a normalized, averaged spectrum for wind, was un-normalized and used to create simulated wind speed time series at a variety of wind speeds. Additional time series were created after modifying the spectrum to simulate the additional low-frequency energy observed in the TC wind spectrum as well as the reduction of high-frequency energy caused by a mechanical anemometer. The T and ET data used for this study were collected by Texas Tech University's mobile towers as part of various field efforts since 1998. Before comparisons were made, the database was divided into four roughness regimes based on the roughness length to ensure that differences observed in the turbulence statistics are not caused by differences in upstream terrain. The mean GF for the TC data set (open roughness regime), 1.49, was slightly higher than the ET value of 1.44 (Table 1). The distributions of GFs from each data type show similarities in shape between the base-simulated and ET data sets and between the TC and modified-simulated data set (Figure 1). These similarities are expected given the spectral similarities between the TC and modified-simulated data sets, namely additional low-frequency energy relative to the ET and base-simulated data. These findings suggest that the higher amount of low-frequency energy present in the tropical wind spectrum is partially responsible for the resulting higher GF for the tropical cyclone data. However, the modest increase in GF from the base to the modified simulated data suggest that there are more factors at work.

Dielectric characteristics of Mn-doped LaTiO3+δ ceramics

NASA Astrophysics Data System (ADS)

Chen, Yan; Cui, Yimin

A series of ceramic composites of Mn-doped La1- x MnxTiO3+ δ and LaMnxTi1- x O3+ δ (x = 0.1, 0.2) were synthesized by conventional solid-state reaction method. The low-frequency complex dielectric properties of the composites were investigated as functions of temperature (77 K <= T <= 360 K) and frequency (100 Hz <= f <= 1 MHz), respectively. The dielectric constant of A-site doped samples is higher than that of B-site doped samples. The loss tangent of low doped samples is much less than that of high doped samples. The A-site doped composites exhibit intrinsic dielectric response with a dielectric constant of 40 in the temperature below 250 K. Interestingly, the dielectric constants of B-site doped ceramics increase slightly in the temperature range from 77 to 360 K. And it is clearly observed that extraordinarily high dielectric loss tangent ( 6) appear at low frequency (100 Hz) in LaMn0.2Ti0.8O3+ δ , which is 8 times larger than that of LaMn0.1Ti0.9O3+ δ , which indicates that the doped content can affect the intrinsic dielectric characteristics significantly.

Investigation of the frequency response of constant voltage anemometers in turbulent flows

NASA Astrophysics Data System (ADS)

Sadeghi Hassanlouei, Atabak

A commercially available anemometer system considered as a prototype, the constant voltage anemometer (CVA), is presented and its working principle is studied and analyzed. We detail the different procedures and corrections that have to be applied to voltage signals to deduce corresponding velocity signals, including the effect of the thermal inertia of the sensor. Results are compared to another anemometer system widely used in research and industry, the constant temperature anemometer (CTA), for validation requirements. Measurements are performed in the turbulent region of a subsonic axisymmetric jet and include mean velocities, root-mean-square (rms) values of velocity fluctuations and power spectral densities. In the same range of operation, we show that the two instruments give similar results. The CVA anemometer slightly underestimates the rms velocity values given by the CTA anemometer which is attributed to a non-linear effect. We show that the cut-off frequency of the CVA system is higher than the more commonly used CTA system, and that the electronic noise level is lower. The constant voltage anemometer is thus an excellent alternative to the constant temperature anemometer for low turbulent flows with rich frequency content, such as supersonic and hypersonic flows.

Cause-effect relationship between vocal fold physiology and voice production in a three-dimensional phonation model

PubMed Central

Zhang, Zhaoyan

2016-01-01

The goal of this study is to better understand the cause-effect relation between vocal fold physiology and the resulting vibration pattern and voice acoustics. Using a three-dimensional continuum model of phonation, the effects of changes in vocal fold stiffness, medial surface thickness in the vertical direction, resting glottal opening, and subglottal pressure on vocal fold vibration and different acoustic measures are investigated. The results show that the medial surface thickness has dominant effects on the vertical phase difference between the upper and lower margins of the medial surface, closed quotient, H1-H2, and higher-order harmonics excitation. The main effects of vocal fold approximation or decreasing resting glottal opening are to lower the phonation threshold pressure, reduce noise production, and increase the fundamental frequency. Increasing subglottal pressure is primarily responsible for vocal intensity increase but also leads to significant increase in noise production and an increased fundamental frequency. Increasing AP stiffness significantly increases the fundamental frequency and slightly reduces noise production. The interaction among vocal fold thickness, stiffness, approximation, and subglottal pressure in the control of F0, vocal intensity, and voice quality is discussed. PMID:27106298

Design and Study of a LOX/GH2 Throttleable Swirl Injector for Rocket Applications

NASA Technical Reports Server (NTRS)

Greene, Christopher; Woodward, Roger; Pal, Sibtosh; Santoro, Robert; Garcia, Roberto (Technical Monitor)

2002-01-01

A LOX/GH2 swirl injector was designed for a 10:1 propellant throttling range. To accomplish this, a dual LOX (liquid oxygen) manifold was used feeding a single common vortex chamber of the swirl element. Hot-fire experiments were conducting for rocket chamber pressures from 80 to 800 psia at a mixture ratio of nominally 6.0 using steady flow, single-point-per-firing cases as well as dynamic throttling conditions. Low frequency (mean) and high frequency (fluctuating) pressure transducer data, flow meter measurements, and Raman spectroscopy images for mixing information were obtained. The injector design, experimental setup, low frequency pressure data, and injector performance analysis will be presented. C efficiency was very high (approximately 100%) at the middle of the throttle-able range with somewhat lower performance at the high and low ends. From the analysis of discreet steady state operating conditions, injector pressure drop was slightly higher than predicted with an inviscid analysis, but otherwise agreed well across the design throttling range. Analysis of the dynamic throttling data indicates that the injector may experience transient conditions that effect pressure drop and performance when compared to steady state results.

Vicia root-mirconucleus and sister chromatid exchange assays on the genotoxicity of selenium compounds.

PubMed

Yi, Huilan; Si, Liangyan

2007-06-15

Selenium (Se) is an important metalloid with industrial, environmental, biological and toxicological significance. Excessive selenium in soil and water may contribute to environmental selenium pollution, and affect plant growth and human health. By using Vicia faba micronucleus (MN) and sister chromatid exchange (SCE) tests, possible genotoxicity of sodium selenite and sodium biselenite was evaluated in this study. The results showed that sodium selenite, at concentrations from 0.01 to 10.0mg/L, induced a 1.9-3.9-fold increase in MN frequency and a 1.5-1.6-fold increase in SCE frequency, with a statistically significantly difference from the control (P<0.05 and 0.01, respectively). Sodium selenite also caused mitotic delay and a 15-80% decrease in mitotic indices (MI), but at the lowest concentration (0.005mg/L), it slightly stimulated mitotic activity. Similarly, the frequencies of MN and SCE also increased significantly in sodium biselenite treated samples, with MI decline only at relatively higher effective concentrations. Results of the present study suggest that selenite is genotoxic to V. faba root cells and may be a genotoxic risk to human health.

Induced Seismicity in Greeley, CO: The Effects of Pore Pressure on Seismic Wave Character

NASA Astrophysics Data System (ADS)

Bogolub, K. R.; Holmes, R.; Sheehan, A. F.; Brown, M. R. M.

2017-12-01

Since 2013, a series of injection-induced earthquakes has occurred near Greeley, Colorado including a Mw 3.2 event in June 2014. With induced seismicity on the rise, it is important to understand injection-induced earthquakes to improve mitigation efforts. In this research, we analyzed seismograms from a local seismic network to see if there are any notable differences in seismic waveform as a result of changes in pore pressure from wastewater injection. Catalogued earthquake events from January-June 2017 that were clearly visible on 4 or more stations in the network were used as template events in a subspace detector. Since the template events were constructed using seismograms from a single event, the subspace detector operated similarly to a matched filter and detections had very similar waveforms to the template event. Having these detections ultimately helped us identify similar earthquakes, which gave us better located events for comparison. These detections were then examined and located using a 1D local velocity model. While many of these detections were already catalogued events, we also identified >20 new events by using this detector. Any two events that were matched by the detector, collocated within the error ellipses of both events and at least a month apart temporally were classified as "event pairs". One challenge of this method is that most of the collocated earthquakes occurred in a very narrow time window, which indicates that the events have a tendency to cluster both spatially and temporally. However, we were able to examine an event pair that fit our spatial proximity criteria, and were several months apart (March 3, 2017 and May 8, 2017). We present an examination of propagation velocity and frequency content for these two events specifically to assess if transient changes in pore pressure had any observable influence on these characteristics. Our preliminary results indicate a slight difference in lag time between P wave and S wave arrivals (slightly greater in lag time for March event) and frequency content (slightly higher dominant frequencies for March event). However, more work needs to be done to refine our earthquake locations so we can determine if these observations are caused by a transient change in velocity structure, a difference in location of the two events, or some other mechanism.

Effect of ecological restoration and climate change on ecosystems: a case study in the Three-Rivers Headwater Region, China.

PubMed

Jiang, Chong; Zhang, Linbo

2016-06-01

The Three-Rivers Headwater Region (TRHR) is the headwater of the Yangtze River Basin (YARB), Yellow River Basin (YRB), and Lancang River Basin (LRB); it is known as China's 'Water Tower' owing to its important supply of freshwater. In order to assess ecosystem changes in the TRHR during 2000-2012, we systematically and comprehensively evaluated a combination of model simulation results and actual observational data. The results showed the following: (1) Ecosystem pattern was relatively stable during 2000-2010, with a slight decrease in farmland and desert areas, and a slight increase in grassland and wetland/water-body areas. (2) A warmer and wetter climate, and ecological engineering, caused the vegetation cover and productivity to significantly improve. (3) Precipitation was the main controlling factor for streamflow. A significant increase in precipitation during 2000-2012 resulted in an obvious increase in annual and seasonal streamflow. Glacier melting also contributed to the streamflow increase. (4) The total amount of soil conservation increased slightly from 2000 to 2012. The increase in precipitation caused rainfall erosivity to increase, which enhanced the intensity of soil erosion. The decrease in wind speed decreased wind erosion and the frequency of sandstorms. (5) The overall habitat quality in the TRHR was stable between 2000 and 2010, and the spatial pattern exhibited obvious heterogeneity. In some counties that included nature reserves, habitat quality was slightly higher in 2010 than in 2000, which reflected the effectiveness of the ecological restoration. Overall, the aforementioned ecosystem changes are the combined results of ecological restoration and climate change, and they are likely a local and temporary improvement, rather than a comprehensive and fundamental change. Therefore, more investments and efforts are needed to preserve natural ecosystems.

Effects of Genetic Drift and Gene Flow on the Selective Maintenance of Genetic Variation

PubMed Central

Star, Bastiaan; Spencer, Hamish G.

2013-01-01

Explanations for the genetic variation ubiquitous in natural populations are often classified by the population–genetic processes they emphasize: natural selection or mutation and genetic drift. Here we investigate models that incorporate all three processes in a spatially structured population, using what we call a construction approach, simulating finite populations under selection that are bombarded with a steady stream of novel mutations. As expected, the amount of genetic variation compared to previous models that ignored the stochastic effects of drift was reduced, especially for smaller populations and when spatial structure was most profound. By contrast, however, for higher levels of gene flow and larger population sizes, the amount of genetic variation found after many generations was greater than that in simulations without drift. This increased amount of genetic variation is due to the introduction of slightly deleterious alleles by genetic drift and this process is more efficient when migration load is higher. The incorporation of genetic drift also selects for fitness sets that exhibit allele-frequency equilibria with larger domains of attraction: they are “more stable.” Moreover, the finiteness of populations strongly influences levels of local adaptation, selection strength, and the proportion of allele-frequency vectors that can be distinguished from the neutral expectation. PMID:23457235

Rheological and tribological properties of carbon nanotube/thermoplastic nanocomposites incorporating inorganic fullerene-like WS2 nanoparticles.

PubMed

Díez-Pascual, Ana M; Naffakh, Mohammed; Marco, Carlos; Ellis, Gary

2012-07-12

The rheological and tribological properties of single-walled carbon nanotube (SWCNT)-reinforced poly(phenylene sulphide) (PPS) and poly(ether ether ketone) (PEEK) nanocomposites prepared via melt-extrusion were investigated. The effectiveness of employing a dual-nanofiller strategy combining polyetherimide (PEI)-wrapped SWCNTs with inorganic fullerene-like tungsten disulfide (IF-WS2) nanoparticles for property enhancement of the resulting hybrid composites was evaluated. Viscoelastic measurements revealed that the complex viscosity η, storage modulus G', and loss modulus G″ increased with SWCNT content. In the low-frequency region, G' and G″ became almost independent of frequency at higher SWCNT loadings, suggesting a transition from liquid-like to solid-like behavior. The incorporation of increasing IF-WS2 contents led to a progressive drop in η and G' due to a lubricant effect. PEEK nanocomposites showed lower percolation threshold than those based on PPS, ascribed to an improved SWCNT dispersion due to the higher affinity between PEI and PEEK. The SWCNTs significantly lowered the wear rate but only slightly reduced the coefficient of friction. Composites with both nanofillers exhibited improved wear behavior, attributed to the outstanding tribological properties of these nanoparticles and a synergistic reinforcement effect. The combination of SWCNTs with IF-WS2 is a promising route for improving the tribological and rheological performance of thermoplastic nanocomposites.

Reduction of a grid moiré pattern by integrating a carbon-interspaced high precision x-ray grid with a digital radiographic detector.

PubMed

Yoon, Jai-Woong; Park, Young-Guk; Park, Chun-Joo; Kim, Do-Il; Lee, Jin-Ho; Chung, Nag-Kun; Choe, Bo-Young; Suh, Tae-Suk; Lee, Hyoung-Koo

2007-11-01

The stationary grid commonly used with a digital x-ray detector causes a moiré interference pattern due to the inadequate sampling of the grid shadows by the detector pixels. There are limitations with the previous methods used to remove the moiré such as imperfect electromagnetic interference shielding and the loss of image information. A new method is proposed for removing the moiré pattern by integrating a carbon-interspaced high precision x-ray grid with high grid line uniformity with the detector for frequency matching. The grid was aligned to the detector by translating and rotating the x-ray grid with respect to the detector using microcontrolled alignment mechanism. The gap between the grid and the detector surface was adjusted with micrometer precision to precisely match the projected grid line pitch to the detector pixel pitch. Considering the magnification of the grid shadows on the detector plane, the grids were manufactured such that the grid line frequency was slightly higher than the detector sampling frequency. This study examined the factors that affect the moiré pattern, particularly the line frequency and displacement. The frequency of the moiré pattern was found to be sensitive to the angular displacement of the grid with respect to the detector while the horizontal translation alters the phase but not the moiré frequency. The frequency of the moiré pattern also decreased with decreasing difference in frequency between the grid and the detector, and a moiré-free image was produced after complete matching for a given source to detector distance. The image quality factors including the contrast, signal-to-noise ratio and uniformity in the images with and without the moiré pattern were investigated.

Accuracy of cochlear implant recipients on pitch perception, melody recognition, and speech reception in noise.

PubMed

Gfeller, Kate; Turner, Christopher; Oleson, Jacob; Zhang, Xuyang; Gantz, Bruce; Froman, Rebecca; Olszewski, Carol

2007-06-01

The purposes of this study were to (a) examine the accuracy of cochlear implant recipients who use different types of devices and signal processing strategies on pitch ranking as a function of size of interval and frequency range and (b) to examine the relations between this pitch perception measure and demographic variables, melody recognition, and speech reception in background noise. One hundred fourteen cochlear implant users and 21 normal-hearing adults were tested on a pitch discrimination task (pitch ranking) that required them to determine direction of pitch change as a function of base frequency and interval size. Three groups were tested: (a) long electrode cochlear implant users (N = 101); (b) short electrode users that received acoustic plus electrical stimulation (A+E) (N = 13); and (c) a normal-hearing (NH) comparison group (N = 21). Pitch ranking was tested at standard frequencies of 131 to 1048 Hz, and the size of the pitch-change intervals ranged from 1 to 4 semitones. A generalized linear mixed model (GLMM) was fit to predict pitch ranking and to determine if group differences exist as a function of base frequency and interval size. Overall significance effects were measured with Chi-square tests and individual effects were measured with t-tests. Pitch ranking accuracy was correlated with demographic measures (age at time of testing, length of profound deafness, months of implant use), frequency difference limens, familiar melody recognition, and two measures of speech reception in noise. The long electrode recipients performed significantly poorer on pitch discrimination than the NH and A+E group. The A+E users performed similarly to the NH listeners as a function of interval size in the lower base frequency range, but their pitch discrimination scores deteriorated slightly in the higher frequency range. The long electrode recipients, although less accurate than participants in the NH and A+E groups, tended to perform with greater accuracy within the higher frequency range. There were statistically significant correlations between pitch ranking and familiar melody recognition as well as with pure-tone frequency difference limens at 200 and 400 Hz. Low-frequency acoustic hearing improves pitch discrimination as compared with traditional, electric-only cochlear implants. These findings have implications for musical tasks such as familiar melody recognition.

Optical intensity dynamics in a five-emitter semiconductor array laser

NASA Astrophysics Data System (ADS)

Williams, Matthew O.; Kutz, J. Nathan

2009-06-01

The intensity dynamics of a five-emitter laser array subject to a linearly decreasing injection current are examined numerically. We have matched the results of the numerical model to an experimental AlGaAs quantum-dot array laser and have achieved the same robust oscillatory power output with a nearly π phase shift between emitters that was observed in experiments. Due to the linearly decreasing injection current, the output power of the waveguide decreases as a function of waveguide number. For injection currents ranging from 380 to 500 mA, the oscillatory behavior persists with only a slight change in phase difference. However, the fundamental frequency of oscillation increases with injection current, and higher harmonics as well as some fine structures are produced.

Public and private pregnancy care in Reggio Emilia Province: an observational study on appropriateness of care and delivery outcomes.

PubMed

Bonvicini, Laura; Candela, Silvia; Evangelista, Andrea; Bertani, Daniela; Casoli, Morena; Lusvardi, Annarella; Messori, Antonella; Giorgi Rossi, Paolo

2014-02-17

In industrialized countries, improvements have been made in both maternal and newborn health. While attention to antenatal care is increasing, excessive medicalization is also becoming more common.The aim of this study is to compare caesarean section (CS) frequency and ultrasound scan utilization in a public model of care involving both midwives and obstetricians with a private model in which care is provided by obstetricians only. Observational population-based study. Reggio Emilia Province. 5957 women resident in the province who delivered between October 2010 and November 2011. CS frequency and ultrasound scan utilization, stillbirths, and other negative perinatal outcomes. Women in the study were searched in the public family and reproductive health clinic medical records to identify those cared for in the public system. Outcomes of the two antenatal care models were compared through multivariate logistic regression adjusting for maternal characteristics and, for CS only, by stratifying by Robson's Group. Compared to women cared for in private services (N = 3,043), those in public service (N = 2,369) were younger, less educated, more frequently non-Italian, and multiparous. The probability of CS was slightly higher for women cared for by private obstetricians than for those cared for in the public system (31.8% vs. 27.1%; adjusted odds ratio: 1.10; 95% CI: 0.93-1.29): The probability of having more than 3 ultrasound scans was higher in private care (89.6% vs. 49.8%; adjusted odds ratio: 5.11; 95% CI: 4.30-6.08). CS frequency was higher in private care for all Robson's classes except women who underwent CS during spontaneous labour. Among negative perinatal outcomes only a higher risk of pre-term birth was observed for pregnancies cared for in private services. The public model provides less medicalized and more guidelines-oriented care than does the private model, with no increase in negative perinatal outcomes.

North Atlantic winter eddy-driven jet and atmospheric blocking variability in the Community Earth System Model version 1 Large Ensemble simulations

NASA Astrophysics Data System (ADS)

Kwon, Young-Oh; Camacho, Alicia; Martinez, Carlos; Seo, Hyodae

2018-01-01

The atmospheric jet and blocking distributions, especially in the North Atlantic sector, have been challenging features for a climate model to realistically reproduce. This study examines climatological distributions of winter (December-February) daily jet latitude and blocking in the North Atlantic from the 40-member Community Earth System Model version 1 Large Ensemble (CESM1LE) simulations. This analysis aims at examining whether a broad range of internal climate variability encompassed by a large ensemble of simulations results in an improved representation of the jet latitude distributions and blocking days in CESM1LE. In the historical runs (1951-2005), the daily zonal wind at 850 hPa exhibits three distinct preferred latitudes for the eddy-driven jet position as seen in the reanalysis datasets, which represents a significant improvement from the previous version of the same model. However, the meridional separations between the three jet latitudes are much smaller than those in the reanalyses. In particular, the jet rarely migrates to the observed southernmost position around 37°N. This leads to the bias in blocking frequency that is too low over Greenland and too high over the Azores. These features are shown to be remarkably stable across the 40 ensemble members with negligible member-to-member spread. This result implies the range of internal variability of winter jet latitude and blocking frequency within the 55-year segment from each ensemble member is comparable to that represented by the full large ensemble. Comparison with 2046-2100 from the RCP8.5 future projection runs suggests that the daily jet position is projected to maintain the same three preferred latitudes, with a slightly higher frequency of occurrence over the central latitude around 50°N, instead of shifting poleward in the future as documented in some previous studies. In addition, the daily jet speed is projected not to change significantly between 1951-2005 and 2046-2100. On the other hand, the climatological mean jet is projected to become slightly more elongated and stronger on its southern flank, and the blocking frequency over the Azores is projected to decrease.

Experimenting with a "Pipe" Whistle

ERIC Educational Resources Information Center

Stafford, Olga

2012-01-01

A simple pipe whistle can be made using pieces of PVC pipe. The whistle can be used to measure the resonant frequencies of open or closed pipes. A slightly modified version of the device can be used to also investigate the interesting dependence of the sound frequencies produced on the orifice-to-edge distance. The pipe whistle described here…

Influence of sampling frequency and load calculation methods on quantification of annual river nutrient and suspended solids loads.

PubMed

Elwan, Ahmed; Singh, Ranvir; Patterson, Maree; Roygard, Jon; Horne, Dave; Clothier, Brent; Jones, Geoffrey

2018-01-11

Better management of water quality in streams, rivers and lakes requires precise and accurate estimates of different contaminant loads. We assessed four sampling frequencies (2 days, weekly, fortnightly and monthly) and five load calculation methods (global mean (GM), rating curve (RC), ratio estimator (RE), flow-stratified (FS) and flow-weighted (FW)) to quantify loads of nitrate-nitrogen (NO 3 - -N), soluble inorganic nitrogen (SIN), total nitrogen (TN), dissolved reactive phosphorus (DRP), total phosphorus (TP) and total suspended solids (TSS), in the Manawatu River, New Zealand. The estimated annual river loads were compared to the reference 'true' loads, calculated using daily measurements of flow and water quality from May 2010 to April 2011, to quantify bias (i.e. accuracy) and root mean square error 'RMSE' (i.e. accuracy and precision). The GM method resulted into relatively higher RMSE values and a consistent negative bias (i.e. underestimation) in estimates of annual river loads across all sampling frequencies. The RC method resulted in the lowest RMSE for TN, TP and TSS at monthly sampling frequency. Yet, RC highly overestimated the loads for parameters that showed dilution effect such as NO 3 - -N and SIN. The FW and RE methods gave similar results, and there was no essential improvement in using RE over FW. In general, FW and RE performed better than FS in terms of bias, but FS performed slightly better than FW and RE in terms of RMSE for most of the water quality parameters (DRP, TP, TN and TSS) using a monthly sampling frequency. We found no significant decrease in RMSE values for estimates of NO 3 - N, SIN, TN and DRP loads when the sampling frequency was increased from monthly to fortnightly. The bias and RMSE values in estimates of TP and TSS loads (estimated by FW, RE and FS), however, showed a significant decrease in the case of weekly or 2-day sampling. This suggests potential for a higher sampling frequency during flow peaks for more precise and accurate estimates of annual river loads for TP and TSS, in the study river and other similar conditions.

Analysis of thunder and lightning frequency in the Belgrade area in Serbia in the period 1975 - 2009

NASA Astrophysics Data System (ADS)

Todorovich, N.; Vujovic, D.

2010-09-01

The analysis included observations (non-instrumental data) about the thunder and lightning (TL) on Belgrade Meteorological Observatory (latitude 44°48´N, longitude 20°28´E, h=132 m) in the period 1975-2009. The data about the duration (in minutes) by dates were analyzed. The results confirmed already known fact that the TL are most frequent in June. There is a slight increasing trend of TL duration since the mid-eighties. The results of the daily distribution confirmed the basic finding that the TL frequency is higher in the afternoon and the evening hours when two distinctive peak noticed: first of about 17 hours and second about 21 and 22 hours (UTC +1), with the minimum in the morning hours. The annual number of days with TL has the similar distribution in the reporting period as like the annual sum of the duration in minutes. There is a slight increasing trend of days with TL from the mid-eighties. The month with the extreme number of days with TL is June. The most interesting result of analysis is the distribution of the number of days with TL by calendar days. Maximum is in late June and early July, the central date is June 28. In addition to the primary maximum, there are several maximum more in the form of group of several days. Such periods we might call quasi-singularities. In addition to the main period June 27 - July 01, the most important periods and dates (quasi-singularities) are April 24, April 30 - May 2, May 16 - May 22, June 7 - June 17, July 7, July 12-July 14, August 4, August 8 - August 11 and August 28 - September 1. The most notable long period with low frequency of days with TL is second half of July. It is evident that the number of days with TL rapidly increases after April 23 and rapidly reduced after September 2.

Decision-making in healthy children, adolescents and adults explained by the use of increasingly complex proportional reasoning rules.

PubMed

Huizenga, Hilde M; Crone, Eveline A; Jansen, Brenda J

2007-11-01

In the standard Iowa Gambling Task (IGT), participants have to choose repeatedly from four options. Each option is characterized by a constant gain, and by the frequency and amount of a probabilistic loss. Crone and van der Molen (2004) reported that school-aged children and even adolescents show marked deficits in IGT performance. In this study, we have re-analyzed the data with a multivariate normal mixture analysis to show that these developmental changes can be explained by a shift from unidimensional to multidimensional proportional reasoning (Siegler, 1981; Jansen & van der Maas, 2002). More specifically, the results show a gradual shift with increasing age from (a) guessing with a slight tendency to consider frequency of loss to (b) focusing on frequency of loss, to (c) considering both frequency and amount of probabilistic loss. In the latter case, participants only considered options with low-frequency loss and then chose the option with the lowest amount of loss. Performance improved in a reversed task, in which punishment was placed up front and gain was delivered unexpectedly. In this reversed task, young children are guessing with already a slight tendency to consider both the frequency and amount of gain; this strategy becomes more pronounced with age. We argue that these findings have important implications for the interpretation of IGT performance, as well as for methods to analyze this performance.

On the Noble-Gas Induced Intersystem Crossing for the CUO Molecule: Experimental and Theoretical investigations of CUO(Ng)n (Ng = Ar, Kr, Xe; n = 1, 2, 3, 4) Complexes in Solid Neon

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liang, Binyong; Andrews, Lester S.; Li, Jun

2004-02-09

Uranium atoms excited by laser ablation react with CO in excess neon to produce the novel CUO molecule, which forms distinct Ng complexes (Ng = Ar, Kr, Xe) when the heavier noble gases are added. The CUO(Ng) complexes are identified through CO isotopic and Ng substitution on the neon matrix infrared spectra and by comparison to DFT frequency calculations. The U-C and U-O stretching frequencies of CUO(Ng) complexes are slightly red shifted from frequencies for the 1S+ CUO ground state, which identifies singlet ground state CUO(Ng) complexes. In solid neon the CUO molecule is also a complex CUO(Ne)n, and themore » CUO(Ne)n-1(Ng) complexes are likewise specified. The next singlet CUO(Ne)x(Ng)2 complexes in excess neon follow in like manner. However, the higher CUO(Ne)x(Ng)n complex (n = 3, 4) stretching modes approach pure argon matrix CUO(Ar)n values and isotopic behavior, which are characterized as triplet ground state complexes by DFT frequency calculations. This work suggests that the singlet-triplet crossing occurs with 3 Ar, 3 Kr or 4 Xe and a balance of Ne atoms coordinated to CUO in the neon matrix host.« less

Effects of chromium picolinate on micronucleus frequency and morphology of lymphocytes in calves.

PubMed

Imamoğlu, Nalan; Uyanik, Fatma; Kocaoğlu Güçlü, Berrin; Erdem, Onur; Cem Liman, Bilal; Dönmez Altuntaş, Hamiyet

2008-11-01

We report the effects of chromium picolinate (CrPic) on micronucleus frequency, morphology of lymphocytes, and lipid peroxidation in calves. Twenty-four Holstein calves were selected for the study. They were kept in a farm and were fed a commercially available calf diet and alfalfa, ad libitum. The animals were divided into three groups of eight subjects each and were treated as follows: The first group was supplemented with a daily dose of 200 microg Cr as chromium picolinate; a second group received 400 microg Cr per day and a third group that served as control received no supplemental chromium. After 12-week supplementation, blood samples were collected to determine the micronucleus frequency, the apoptotic cell percentage, and the malondialdehyde (MDA) and blood chromium levels. In both supplemented groups, the cells had irregularly shaped and segmented nuclei. Supplementation also increased the percentage of apoptotic cells (p < 0.001) and serum MDA (p < 0.01) and slightly increased the chromium levels. The animals supplemented with 400 microg showed a significant increase of micronucleus frequency (p < 0.01). The results of this study suggest that supplementation with 200 and 400 microg chromium as chromium picolinate may lead to cytotoxicity. The higher level of supplementation may also have genotoxic effects. However, further studies investigating the mechanism of the action of CrPic are required.

Computerized general practice based networks yield comparable performance with sentinel data in monitoring epidemiological time-course of influenza-like illness and acute respiratory illness.

PubMed

Truyers, Carla; Lesaffre, Emmanuel; Bartholomeeusen, Stefaan; Aertgeerts, Bert; Snacken, René; Brochier, Bernard; Yane, Fernande; Buntinx, Frank

2010-03-22

Computerized morbidity registration networks might serve as early warning systems in a time where natural epidemics such as the H1N1 flu can easily spread from one region to another. In this contribution we examine whether general practice based broad-spectrum computerized morbidity registration networks have the potential to act as a valid surveillance instrument of frequently occurring diseases. We compare general practice based computerized data assessing the frequency of influenza-like illness (ILI) and acute respiratory infections (ARI) with data from a well established case-specific sentinel network, the European Influenza Surveillance Scheme (EISS). The overall frequency and trends of weekly ILI and ARI data are compared using both networks. Detection of influenza-like illness and acute respiratory illness occurs equally fast in EISS and the computerized network. The overall frequency data for ARI are the same for both networks, the overall trends are similar, but the increases and decreases in frequency do not occur in exactly the same weeks. For ILI, the overall rate was slightly higher for the computerized network population, especially before the increase of ILI, the overall trend was almost identical and the increases and decreases occur in the same weeks for both networks. Computerized morbidity registration networks are a valid tool for monitoring frequent occurring respiratory diseases and the detection of sudden outbreaks.

Simultaneous shape repulsion and global assimilation in the perception of aspect ratio

PubMed Central

Sweeny, Timothy D.; Grabowecky, Marcia; Suzuki, Satoru

2012-01-01

Although local interactions involving orientation and spatial frequency are well understood, less is known about spatial interactions involving higher level pattern features. We examined interactive coding of aspect ratio, a prevalent two-dimensional feature. We measured perception of two simultaneously flashed ellipses by randomly post-cueing one of them and having observers indicate its aspect ratio. Aspect ratios interacted in two ways. One manifested as an aspect-ratio-repulsion effect. For example, when a slightly tall ellipse and a taller ellipse were simultaneously flashed, the less tall ellipse appeared flatter and the taller ellipse appeared even taller. This repulsive interaction was long range, occurring even when the ellipses were presented in different visual hemifields. The other interaction manifested as a global assimilation effect. An ellipse appeared taller when it was a part of a global vertical organization than when it was a part of a global horizontal organization. The repulsion and assimilation effects temporally dissociated as the former slightly strengthened, and the latter disappeared when the ellipse-to-mask stimulus onset asynchrony was increased from 40 to 140 ms. These results are consistent with the idea that shape perception emerges from rapid lateral and hierarchical neural interactions. PMID:21248223

Role of subdural electrocorticography in prediction of long-term seizure outcome in epilepsy surgery

PubMed Central

Juhász, Csaba; Shah, Aashit; Sood, Sandeep; Chugani, Harry T.

2009-01-01

Since prediction of long-term seizure outcome using preoperative diagnostic modalities remains suboptimal in epilepsy surgery, we evaluated whether interictal spike frequency measures obtained from extraoperative subdural electrocorticography (ECoG) recording could predict long-term seizure outcome. This study included 61 young patients (age 0.4–23.0 years), who underwent extraoperative ECoG recording prior to cortical resection for alleviation of uncontrolled focal seizures. Patient age, frequency of preoperative seizures, neuroimaging findings, ictal and interictal ECoG measures were preoperatively obtained. The seizure outcome was prospectively measured [follow-up period: 2.5–6.4 years (mean 4.6 years)]. Univariate and multivariate logistic regression analyses determined how well preoperative demographic and diagnostic measures predicted long-term seizure outcome. Following the initial cortical resection, Engel Class I, II, III and IV outcomes were noted in 35, 6, 12 and 7 patients, respectively. One child died due to disseminated intravascular coagulation associated with pseudomonas sepsis 2 days after surgery. Univariate regression analyses revealed that incomplete removal of seizure onset zone, higher interictal spike-frequency in the preserved cortex and incomplete removal of cortical abnormalities on neuroimaging were associated with a greater risk of failing to obtain Class I outcome. Multivariate logistic regression analysis revealed that incomplete removal of seizure onset zone was the only independent predictor of failure to obtain Class I outcome. The goodness of regression model fit and the predictive ability of regression model were greatest in the full regression model incorporating both ictal and interictal measures [R2 0.44; Area under the receiver operating characteristic (ROC) curve: 0.81], slightly smaller in the reduced model incorporating ictal but not interictal measures (R2 0.40; Area under the ROC curve: 0.79) and slightly smaller again in the reduced model incorporating interictal but not ictal measures (R2 0.27; Area under the ROC curve: 0.77). Seizure onset zone and interictal spike frequency measures on subdural ECoG recording may both be useful in predicting the long-term seizure outcome of epilepsy surgery. Yet, the additive clinical impact of interictal spike frequency measures to predict long-term surgical outcome may be modest in the presence of ictal ECoG and neuroimaging data. PMID:19286694

Evaluation of Techniques Used to Estimate Cortical Feature Maps

PubMed Central

Katta, Nalin; Chen, Thomas L.; Watkins, Paul V.; Barbour, Dennis L.

2011-01-01

Functional properties of neurons are often distributed nonrandomly within a cortical area and form topographic maps that reveal insights into neuronal organization and interconnection. Some functional maps, such as in visual cortex, are fairly straightforward to discern with a variety of techniques, while other maps, such as in auditory cortex, have resisted easy characterization. In order to determine appropriate protocols for establishing accurate functional maps in auditory cortex, artificial topographic maps were probed under various conditions, and the accuracy of estimates formed from the actual maps was quantified. Under these conditions, low-complexity maps such as sound frequency can be estimated accurately with as few as 25 total samples (e.g., electrode penetrations or imaging pixels) if neural responses are averaged together. More samples are required to achieve the highest estimation accuracy for higher complexity maps, and averaging improves map estimate accuracy even more than increasing sampling density. Undersampling without averaging can result in misleading map estimates, while undersampling with averaging can lead to the false conclusion of no map when one actually exists. Uniform sample spacing only slightly improves map estimation over nonuniform sample spacing typical of serial electrode penetrations. Tessellation plots commonly used to visualize maps estimated using nonuniform sampling are always inferior to linearly interpolated estimates, although differences are slight at higher sampling densities. Within primary auditory cortex, then, multiunit sampling with at least 100 samples would likely result in reasonable feature map estimates for all but the highest complexity maps and the highest variability that might be expected. PMID:21889537

Generalized model screening potentials for Fermi-Dirac plasmas

NASA Astrophysics Data System (ADS)

Akbari-Moghanjoughi, M.

2016-04-01

In this paper, some properties of relativistically degenerate quantum plasmas, such as static ion screening, structure factor, and Thomson scattering cross-section, are studied in the framework of linearized quantum hydrodynamic theory with the newly proposed kinetic γ-correction to Bohm term in low frequency limit. It is found that the correction has a significant effect on the properties of quantum plasmas in all density regimes, ranging from solid-density up to that of white dwarf stars. It is also found that Shukla-Eliasson attractive force exists up to a few times the density of metals, and the ionic correlations are seemingly apparent in the radial distribution function signature. Simplified statically screened attractive and repulsive potentials are presented for zero-temperature Fermi-Dirac plasmas, valid for a wide range of quantum plasma number-density and atomic number values. Moreover, it is observed that crystallization of white dwarfs beyond a critical core number-density persists with this new kinetic correction, but it is shifted to a much higher number-density value of n0 ≃ 1.94 × 1037 cm-3 (1.77 × 1010 gr cm-3), which is nearly four orders of magnitude less than the nuclear density. It is found that the maximal Thomson scattering with the γ-corrected structure factor is a remarkable property of white dwarf stars. However, with the new γ-correction, the maximal scattering shifts to the spectrum region between hard X-ray and low-energy gamma-rays. White dwarfs composed of higher atomic-number ions are observed to maximally Thomson-scatter at slightly higher wavelengths, i.e., they maximally scatter slightly low-energy photons in the presence of correction.

Exposure to an extremely low-frequency electromagnetic field only slightly modifies the proteome of Chromobacterium violaceumATCC 12472.

PubMed

Baraúna, Rafael A; Santos, Agenor V; Graças, Diego A; Santos, Daniel M; Ghilardi, Rubens; Pimenta, Adriano M C; Carepo, Marta S P; Schneider, Maria P C; Silva, Artur

2015-05-01

Several studies of the physiological responses of different organisms exposed to extremely low-frequency electromagnetic fields (ELF-EMF) have been described. In this work, we report the minimal effects of in situ exposure to ELF-EMF on the global protein expression of Chromobacterium violaceum using a gel-based proteomic approach. The protein expression profile was only slightly altered, with five differentially expressed proteins detected in the exposed cultures; two of these proteins (DNA-binding stress protein, Dps, and alcohol dehydrogenase) were identified by MS/MS. The enhanced expression of Dps possibly helped to prevent physical damage to DNA. Although small, the changes in protein expression observed here were probably beneficial in helping the bacteria to adapt to the stress generated by the electromagnetic field.

Effect of Context on the Contribution of Individual Harmonics to Residue Pitch.

PubMed

Gockel, Hedwig E; Alsindi, Sami; Hardy, Charles; Carlyon, Robert P

2017-12-01

There is evidence that the contribution of a given harmonic in a complex tone to residue pitch is influenced by the accuracy with which the frequency of that harmonic is encoded. The present study investigated whether listeners adjust the weights assigned to individual harmonics based on acquired knowledge of the reliability of the frequency estimates of those harmonics. In a two-interval forced-choice task, seven listeners indicated which of two 12-harmonic complex tones had the higher overall pitch. In context trials (60 % of all trials), the fundamental frequency (F0) was 200 Hz in one interval and 200 + ΔF0 Hz in the other. In different (blocked) conditions, either the 3rd or the 4th harmonic (plus the 7th, 9th, and 12th harmonics), were replaced by narrowband noises that were identical in the two intervals. Feedback was provided. In randomly interspersed test trials (40 % of all trials), the fundamental frequency was 200 + ΔF0/2 Hz in both intervals; in the second interval, either the third or the fourth harmonic was shifted slightly up or down in frequency with equal probability. There were no narrowband noises. Feedback was not provided. The results showed that substitution of a harmonic by noise in context trials reduced the contribution of that harmonic to pitch judgements in the test trials by a small but significant amount. This is consistent with the notion that listeners give smaller weight to a harmonic or frequency region when they have learned that this frequency region does not provide reliable information for a given task.

Non-linearity of visual evoked potentials in cerveau isolé and midpontine pretrigeminal cats.

PubMed

Shibagaki, M; Kiyono, S; Kawashima, T; Watanabe, S

1985-01-01

Characteristics of the visual evoked responses to the flickering flash stimulation were studied in the cerveau isolé and midpontine pretrigeminal cats. The flash stimulation frequency was changed stepwise between 1 and 30 Hz in increasing and decreasing order. In all cases of both preparations, with drawing of fixed sweep speed of 200 msec in whole length, P1 and N1 latencies in the successive response slightly prolonged progressively 1 to about 20 Hz and thereafter shortened about 20-30 Hz stimulus frequencies in the course of the increasing phase, and vice versa in the course of the decreasing phase. Moreover, no difference in each latency (P1, N1, P2, N2) was found at the same stimulus frequency during increasing and decreasing phases. In the amplitude taken from the P1-N1 component, the peak was found in 5-9 Hz frequency bands. This peak was higher during the decreasing phase than during the increasing phase, which indicated a hysteresis phenomenon. A peak of power for the 1st harmonics was found at 3-6 Hz driving frequency bands, and that of the 2nd harmonics at 6-10 Hz. In the state without flash stimulus, no peaks or valleys in the power spectrum were found in specific frequencies, for example 3-10 Hz. The peak in the amplitude and that in the power spectrum at 3-10 Hz stimulus frequency bands suggested an entrainment phenomenon induced by forced oscillation. The phenomena of entrainment and hysteresis suggest the existence of a non-linear structure in the oscillation generating systems of visual evoked response.

RXTE Observation of Cygnus X-1. Report 2; TIming Analysis

NASA Technical Reports Server (NTRS)

Nowak, Michael A.; Vaughan, Brian A.; Wilms, Joern; Dove, James B.; Begelman, Mitchell C.

1998-01-01

We present timing analysis for a Rossi X-ray Timing Explorer (RXTE) observation of Cygnus X-1 in its hard/low state. This was the first RXTE observation of Cyg X-1 taken after it transited back to this state from its soft/high state. RXTE's large effective area, superior timing capabilities, and ability to obtain long, uninterrupted observations have allowed us to obtain measurements of the power spectral density (PSD), coherence function, and Fourier time lags to a decade lower in frequency and half a decade higher in frequency than typically was achieved with previous instruments. Notable aspects of our observations include a weak 0.005 Hz feature in the PSD coincident with a coherence recovery; a 'hardening' of the high-frequency PSD with increasing energy; a broad frequency range measurement of the coherence function, revealing rollovers from unity coherence at both low and high frequency; and an accurate determination of the Fourier time lags over two and a half decades in frequency. As has been noted in previous similar observations, the time delay is approximately proportional to f(exp -0.7), and at a fixed Fourier frequency the time delay of the hard X-rays compared to the softest energy channel tends to increase logarithmically with energy. Curiously, the 0.01-0.2 Hz coherence between the highest and lowest energy bands is actually slightly greater than the coherence between the second highest and lowest energy bands. We carefully describe all of the analysis techniques used in this paper, and we make comparisons of the data to general theoretical expectations. In a companion paper, we make specific comparisons to a Compton corona model that we have successfully used to describe the energy spectral data from this observation.

Efficient and stable transformation of hop (Humulus lupulus L.) var. Eroica by particle bombardment.

PubMed

Batista, Dora; Fonseca, Sandra; Serrazina, Susana; Figueiredo, Andreia; Pais, Maria Salomé

2008-07-01

To the best of our knowledge, this is the first accurate and reliable protocol for hop (Humulus lupulus L.) genetic transformation using particle bombardment. Based on the highly productive regeneration system previously developed by us for hop var. Eroica, two efficient transformation protocols were established using petioles and green organogenic nodular clusters (GONCs) bombarded with gusA reporter and hpt selectable genes. A total of 36 hygromycin B-resistant (hyg(r)) plants obtained upon continuous selection were successfully transferred to the greenhouse, and a first generation group of transplanted plants was followed after spending a complete vegetative cycle. PCR analysis showed the presence of one of both transgenes in 25 plants, corresponding to an integration frequency of 69.4% and an overall transformation efficiency of 7.5%. Although all final transformants were GUS negative, the integration frequency of gusA gene was higher than that of hpt gene. Petiole-derived transgenic plants showed a higher co-integration rate of 76.9%. Real-time PCR analysis confirmed co-integration in 86% of the plants tested and its stability until the first generation, and identified positive plants amongst those previously assessed as hpt (+) only by conventional PCR. Our results suggest that the integration frequencies presented here, as well as those of others, may have been underestimated, and that PCR results should be taken with precaution not only for false positives, but also for false negatives. The protocols here described could be very useful for future introduction of metabolic or resistance traits in hop cultivars even if slight modifications for other genotypes are needed.

Rogue taxa phenomenon: a biological companion to simulation analysis

PubMed Central

Westover, Kristi M.; Rusinko, Joseph P.; Hoin, Jon; Neal, Matthew

2013-01-01

To provide a baseline biological comparison to simulation study predictions about the frequency of rogue taxa effects, we evaluated the frequency of a rogue taxa effect using viral data sets which differed in diversity. Using a quartet-tree framework, we measured the frequency of a rogue taxa effect in three data sets of increasing genetic variability (within viral serotype, between viral serotype, and between viral family) to test whether the rogue taxa was correlated with the mean sequence diversity of the respective data sets. We found a slight increase in the percentage of rogues as nucleotide diversity increased. Even though the number of rogues increased with diversity, the distribution of the types of rogues (friendly, crazy, or evil) did not depend on the diversity and in the case of the order-level data set the net rogue effect was slightly positive. This study, assessing frequency of the rogue taxa effect using biological data, indicated that simulation studies may over-predict the prevalence of the rogue taxa effect. Further investigations are necessary to understand which types of data sets are susceptible to a negative rogue effect and thus merit the removal of taxa from large phylogenetic reconstructions. PMID:23707704

Rogue taxa phenomenon: a biological companion to simulation analysis.

PubMed

Westover, Kristi M; Rusinko, Joseph P; Hoin, Jon; Neal, Matthew

2013-10-01

To provide a baseline biological comparison to simulation study predictions about the frequency of rogue taxa effects, we evaluated the frequency of a rogue taxa effect using viral data sets which differed in diversity. Using a quartet-tree framework, we measured the frequency of a rogue taxa effect in three data sets of increasing genetic variability (within viral serotype, between viral serotype, and between viral family) to test whether the rogue taxa was correlated with the mean sequence diversity of the respective data sets. We found a slight increase in the percentage of rogues as nucleotide diversity increased. Even though the number of rogues increased with diversity, the distribution of the types of rogues (friendly, crazy, or evil) did not depend on the diversity and in the case of the order-level data set the net rogue effect was slightly positive. This study, assessing frequency of the rogue taxa effect using biological data, indicated that simulation studies may over-predict the prevalence of the rogue taxa effect. Further investigations are necessary to understand which types of data sets are susceptible to a negative rogue effect and thus merit the removal of taxa from large phylogenetic reconstructions. Copyright © 2013 Elsevier Inc. All rights reserved.

Iodine-stabilized single-frequency green InGaN diode laser.

PubMed

Chen, Yi-Hsi; Lin, Wei-Chen; Shy, Jow-Tsong; Chui, Hsiang-Chen

2018-01-01

A 520-nm InGaN diode laser can emit a milliwatt-level, single-frequency laser beam when the applied current slightly exceeds the lasing threshold. The laser frequency was less sensitive to diode temperature and could be finely tuned by adjusting the applied current. Laser frequency was stabilized onto a hyperfine component in an iodine transition through the saturated absorption spectroscopy. The uncertainty of frequency stabilization was approximately 8×10 -9 at a 10-s integration time. This compact laser system can replace the conventional green diode-pumped solid-state laser and applied as a frequency reference. A single longitudinal mode operational region with diode temperature, current, and output power was investigated.

A Novel Design of Frequency Reconfigurable Antenna for UWB Application

NASA Astrophysics Data System (ADS)

Yang, Xiaolin; Yu, Ziliang; Wu, Zheng; Shen, Huajiao

2016-09-01

In this paper, we present a novel frequency reconfigurable antenna which could be easily operate in a single notched-band (WiMAX (3.3-3.6 GHz)) UWB frequency band, another single notched-band (WLAN (5-6 GHz)) UWB frequency band and the dual band-notched UWB frequency band (the stopband covers the WiMAX (3.3-3.6 GHz) and WLAN (5-6 GHz)). The reconfigurability is achieved by changing the states of PIN diodes. The simulated results are in agreement well with the measured results. And the measured patterns are slightly changed with antenna reconfiguration. The proposed antenna is a good candidate for various UWB applications.

Residues of organochlorine pesticides and polychloribiphenyls [sic] in starlings (Sturnus vulgaris), from the continental United States, 1982

USGS Publications Warehouse

Bunck, C.M.; Prouty, R.M.; Krynitsky, A.J.

1987-01-01

Starlings were collected from 129 sites throughout the contiguous United States in the fall of 1982 and analyzed for organochlorine compounds as part of a nationwide monitoring program. Residues of 14 organochlorine compounds were found. Only DDE, polychlorobiphenyls (PCB), dieldrin, and heptachlor epoxide occurred in more than 50% of the lO-starling pools. Geographical variation in the occurrence of seven organochlorine compounds was noted. Mean DDE levels were higher in the southwestern United States. Mean PCB levels were higher in the eastern United States. The occurrence frequency of most organochlorines in 1982 was similar to that which was reported in the previous nationwide study in 1979. A slight increase in occurrence was noted for trans-nonachlor. Mean DDE level I in 1982 was similar to that of 1979. Mean PCB level in 1982 was lower than the 1979 mean, but this change may not reflect a decrease in environmental PCB levels.

Rare frequency of downbeat positioning nystagmus in spinocerebellar ataxia type 31.

PubMed

Yabe, Ichiro; Matsushima, Masaaki; Yoshida, Kunihiro; Ishikawa, Kinya; Shirai, Shinichi; Takahashi, Ikuko; Sasaki, Hidenao

2015-03-15

Spinocerebellar ataxia type 31 (SCA31) and spinocerebellar ataxia type 6 (SCA6) are the most frequent types of spinocerebellar degeneration in Japan. Previous reports described that it was difficult to distinguish SCA6 and SCA31 in clinical situations. There is not much difference except that the onset age of SCA31 is slightly higher than that of SCA6. Therefore we surveyed our medical records retrospectively, and then compared clinical symptoms of SCA6 and SCA31. As previously stated, the onset age of SCA31 is higher than that of SCA6. Gaze-evoked nystagmus is more frequent in SCA6 than in SCA31. The percentage in downbeat positioning nystagmus (DPN) is as high as 63% in SCA6. In contrast, DPN in SCA31 is rare and subtle. Our study suggests that the presence of DPN is an important sign that can differentiate SCA6 from SCA31 clinically. Copyright © 2015 Elsevier B.V. All rights reserved.

Impact of dissipation on the energy spectrum of experimental turbulence of gravity surface waves

NASA Astrophysics Data System (ADS)

Campagne, Antoine; Hassaini, Roumaissa; Redor, Ivan; Sommeria, Joël; Valran, Thomas; Viboud, Samuel; Mordant, Nicolas

2018-04-01

We discuss the impact of dissipation on the development of the energy spectrum in wave turbulence of gravity surface waves with emphasis on the effect of surface contamination. We performed experiments in the Coriolis facility, which is a 13-m-diam wave tank. We took care of cleaning surface contamination as well as possible, considering that the surface of water exceeds 100 m2. We observe that for the cleanest condition the frequency energy spectrum shows a power-law decay extending up to the gravity capillary crossover (14 Hz) with a spectral exponent that is increasing with the forcing strength and decaying with surface contamination. Although slightly higher than reported previously in the literature, the exponent for the cleanest water remains significantly below the prediction from the weak turbulence theory. By discussing length and time scales, we show that weak turbulence cannot be expected at frequencies above 3 Hz. We observe with a stereoscopic reconstruction technique that the increase with the forcing strength of energy spectrum beyond 3 Hz is mostly due to the formation and strengthening of bound waves.

Femtosecond laser-induced periodic surface structure on the Ti-based nanolayered thin films

DOE Office of Scientific and Technical Information (OSTI.GOV)

Petrović, Suzana M.; Gaković, B.; Peruško, D.

2013-12-21

Laser-induced periodic surface structures (LIPSSs) and chemical composition changes of Ti-based nanolayered thin films (Al/Ti, Ni/Ti) after femtosecond (fs) laser pulses action were studied. Irradiation is performed using linearly polarized Ti:Sapphire fs laser pulses of 40 fs pulse duration and 800 nm wavelength. The low spatial frequency LIPSS (LSFL), oriented perpendicular to the laser polarization with periods slightly lower than the irradiation wavelength, was typically formed at elevated laser fluences. On the contrary, high spatial frequency LIPSS (HSFL) with uniform period of 155 nm, parallel to the laser light polarization, appeared at low laser fluences, as well as in themore » wings of the Gaussian laser beam distribution for higher used fluence. LSFL formation was associated with the material ablation process and accompanied by the intense formation of nanoparticles, especially in the Ni/Ti system. The composition changes at the surface of both multilayer systems in the LSFL area indicated the intermixing between layers and the substrate. Concentration and distribution of all constitutive elements in the irradiated area with formed HSFLs were almost unchanged.« less

Effects of near-ultraviolet light on mutations, intragenic and intergenic recombinations in Saccharomyces cerevisiae.

PubMed

Machida, I; Saeki, T; Nakai, S

1986-03-01

The effects of far (254 nm) and near (290-350 nm) ultraviolet (UV) light on mutations, intragenic and intergenic recombinations were compared in diploid strains of Saccharomyces cerevisiae. At equivalent survival levels there was not much difference in the induction of nonsense and missense mutations between far- and near-UV radiations. However, frameshift mutations were induced more frequently by near-UV than by far-UV radiation. Near-UV radiation induced intragenic recombination (gene conversion) as efficiently as far-UV radiation and the induced levels were similar in both radiations at equitoxic doses. A strikingly higher frequency was observed for the intergenic recombination induced by near-UV radiation than by far-UV radiation when compared at equivalent survival levels. Photoreactivation reduced the frequency only slightly in far-UV induced intergenic recombination and not at all in near-UV induction. These results indicate that near-UV damage involves strand breakage in addition to pyrimidine dimers and other lesions induced, whereas far-UV damage consists largely of photoreactivable lesions, pyrimidine dimers, and near-UV induced damage is more efficient for the induction of crossing-over.

Presbycusis among older Chinese people in Taipei, Taiwan: a community-based study.

PubMed

Chang, Hsin-Pin; Chou, Pesus

2007-12-01

The purpose of this study was to estimate the prevalence and severity of presbycusis in older Chinese people in Taipei, Taiwan. Pure-tone audiometry and a questionnaire were administered to a randomly-recruited cohort of people > 65 years old (n=1221) from a community in Taipei. The study cohort showed pure-tone thresholds worsening, especially at frequencies >2 kHz, with increasing age. The mean pure-tone average at speech frequencies (0.5, 1, and 2 kHz) of the better ear of subjects stratified by five-year age groups ranged from 34.9 dB hearing level (HL) to 46.4 dB HL. The pure-tone average at speech frequency in women was slightly higher than that in men in all age groups. The prevalence of presbycusis (M3 > or = 55 dBHL) was 1.6% (65-69 years), 3.2% (70-74 years), 7.5% (75-79 years), and 14.9% (> or =80 years). Persistent tinnitus was present in 13.9% of subjects, and 18.8% of subjects had a history of vertigo. Of subjects with a clinically evident hearing impairment (M3 > or = 55 dB HL), 18.4% used hearing aids. These data provide estimates of the prevalence and severity of presbycusis in community-dwelling older persons in Taiwan.

Aging of the Johari-Goldstein relaxation in the glass-forming liquids sorbitol and xylitol

NASA Astrophysics Data System (ADS)

Yardimci, Hasan; Leheny, Robert L.

2006-06-01

Employing frequency-dependent dielectric susceptibility we characterize the aging in two supercooled liquids, sorbitol and xylitol, below their calorimetric glass transition temperatures. In addition to the alpha relaxation that tracks the structural dynamics, the susceptibility of both liquids possesses a secondary Johari-Goldstein relaxation at higher frequencies. Following a quench through the glass transition, the susceptibility slowly approaches the equilibrium behavior. For both liquids, the magnitude of the Johari-Goldstein relaxation displays a dependence on the time since the quench, or aging time, that is quantitatively very similar to the age dependence of the alpha peak frequency. The Johari-Goldstein relaxation time remains constant during aging for sorbitol while it decreases slightly with age for xylitol. Hence, one cannot sensibly assign a fictive temperature to the Johari-Goldstein relaxation. This behavior contrasts with that of liquids lacking distinct Johari-Goldstein peaks for which the excess wing of the alpha peak tracks the main part of the peak during aging, enabling the assignment of a single fictive temperature to the entire spectrum. The aging behavior of the Johari-Goldstein relaxation time further calls into question the possibility that the relaxation time possesses stronger temperature dependence in equilibrium than is observed in the out-of-equilibrium state below the glass transition.

NICER Discovers mHz Oscillations and Marginally Stable Burning in GS 1826-24

NASA Astrophysics Data System (ADS)

Strohmayer, Tod E.; Gendreau, Keith C.; Keek, Laurens; Bult, Peter; Mahmoodifar, Simin; Chakrabarty, Deepto; Arzoumanian, Zaven; NICER Science Team

2018-01-01

To date, marginally stable thermonuclear burning, evidenced as mHz X-ray flux oscillations, has been observed in only five accreting neutron star binaries, 4U 1636-536, 4U 1608-52, Aql X-1, 4U 1323-619 and Terzan 5 X-2. Here we report the discovery with NASA's Neutron Star Interior Composition Explorer (NICER) of such oscillations from the well-known X-ray burster GS 1826-24. NICER observed GS 1826-24 on 9 September, 2017 for a total exposure of about 4 ksec. Timing analysis revealed highly significant oscillations at a frequency of 8.2 mHz in two successive pointings. The oscillations have a fractional modulation amplitude of approximately 3% for photon energies less than 6 keV. The observed frequency is consistent with the range observed in the other mHz QPO systems, and indeed is slightly higher than the frequency measured in 4U 1636-536 below which mHz oscillations ceased and unstable burning (X-ray bursts) resumed. We discuss the mass accretion rate dependence of the oscillations as well as the X-ray spectrum as a function of pulsation phase. We place the observations in the context of the current theory of marginally stable burning and briefly discuss the potential for constraining neutron star properties using mHz oscillations.

Design and Study of a LOX/GH2 Throttleable Swirl Injector for Rocket Applications

NASA Technical Reports Server (NTRS)

Greene, Christopher; Woodward, Roger; Pal, Sibtosh; Santoro, Robert

2002-01-01

A LOX/GH2 swirl injector was designed for a 10:1 propellant throttling range. To accomplish this, a dual LOX manifold was used feeding a single common vortex chamber of the swirl element. Hot-fire experiments were conducted for rocket chamber pressures from 80 to 800 psia at a mixture ratio of nominally 6.0 using steady flow, single-point-per-firing cases as well as dynamic throttling conditions. Low frequency (mean) and high frequency (fluctuating) pressure transducer data, flow meter measurements, and Raman spectroscopy images for mixing information were obtained. The injector design, experimental setup, low frequency pressure data, and injector performance analysis are presented. C* efficiency was very high (approx. 100%) at the middle of the throttleable range with somewhat lower performance at the high and low ends. From the analysis of discreet steady state operating conditions, injector pressure drop was slightly higher than predicted with an inviscid analysis, but otherwise agreed well across the design throttling range. Dynamic throttling of this injector was attempted with marginal success due to the immaturity of the throttling control system. Although the targeted mixture ratio of 6.0 was not maintained throughout the dynamic throttling profile, the injector behaved well over the wide range of conditions.

Vocal tract resonances in singing: The soprano voice

NASA Astrophysics Data System (ADS)

Joliveau, Elodie; Smith, John; Wolfe, Joe

2004-10-01

The vocal tract resonances of trained soprano singers were measured while they sang a range of vowels softly at different pitches. The measurements were made by broad band acoustic excitation at the mouth, which allowed the resonances of the tract to be measured simultaneously with and independently from the harmonics of the voice. At low pitch, when the lowest resonance frequency R1 exceeded f0, the values of the first two resonances R1 and R2 varied little with frequency and had values consistent with normal speech. At higher pitches, however, when f0 exceeded the value of R1 observed at low pitch, R1 increased with f0 so that R1 was approximately equal to f0. R2 also increased over this high pitch range, probably as an incidental consequence of the tuning of R1. R3 increased slightly but systematically, across the whole pitch range measured. There was no evidence that any resonances are tuned close to harmonics of the pitch frequency except for R1 at high pitch. The variations in R1 and R2 at high pitch mean that vowels move, converge, and overlap their positions on the vocal plane (R2,R1) to an extent that implies loss of intelligibility. .

High Levels of IL-10 and CD4+CD25hi+ Treg Cells in Endemic Burkitt’s Lymphoma Patients

PubMed Central

Futagbi, Godfred; Gyan, Ben; Nunoo, Harriet; Tetteh, John K.A.; Welbeck, Jennifer E.; Renner, Lorna Awo; Ofori, Michael; Dodoo, Daniel; Edoh, Dominic A.; Akanmori, Bartholomew D.

2015-01-01

Background: The interplay between Epstein-Barr virus infection, malaria, and endemic Burkitt’s Lymphoma is not well understood. Reports show diminished EBV-specific Th1 responses in children living in malaria endemic areas and deficiency of EBNA1-specific IFN-γ T cell responses in children with endemic Burkitt’s Lymphoma (eBL). This study, therefore, examined some factors involved in the loss of EBNA-1-specific T cell responses in eBL. Methods: T-cell subset frequencies, activation, and IFN-γ- or IL-4-specific responses were analyzed by flow-cytometry. Plasma cytokine levels were measured by ELISA. Results: CD4+ and CD8+ cells in age- and sex-matched healthy controls (n = 3) expressed more IFN-γ in response to all immunostimulants than in pediatric endemic BL (eBL) patients (n = 4). In healthy controls, IFN-γ expression was higher than IL-4 expression, whereas in eBL patients the expression of IL-4 by CD4+ cells to EBNA-1 was slightly higher than IFN-γ. Moreover, the blood levels of TNF-α was significantly lower (p = 0.004) while IL-10 was significantly higher (p = 0.038), in eBL patients (n = 21) compared to controls (n = 16). Additionally, the frequency of CD4+CD25hi+ T cells was higher in both age-matched acute uncomplicated malaria (n = 26) and eBL (n = 14) patients compared to healthy controls (n = 19; p = 0.000 and p = 0.027, respectively). Conclusion: The data suggest that reduced Th1 response in eBL might be due to increased levels of IL-10 and T reg cells. PMID:28536409

High Levels of IL-10 and CD4+CD25hi+ Treg Cells in Endemic Burkitt's Lymphoma Patients.

PubMed

Futagbi, Godfred; Gyan, Ben; Nunoo, Harriet; Tetteh, John K A; Welbeck, Jennifer E; Renner, Lorna Awo; Ofori, Michael; Dodoo, Daniel; Edoh, Dominic A; Akanmori, Bartholomew D

2015-08-04

The interplay between Epstein-Barr virus infection, malaria, and endemic Burkitt's Lymphoma is not well understood. Reports show diminished EBV-specific Th1 responses in children living in malaria endemic areas and deficiency of EBNA1-specific IFN-γ T cell responses in children with endemic Burkitt's Lymphoma (eBL). This study, therefore, examined some factors involved in the loss of EBNA-1-specific T cell responses in eBL. T-cell subset frequencies, activation, and IFN-γ- or IL-4-specific responses were analyzed by flow-cytometry. Plasma cytokine levels were measured by ELISA. CD4+ and CD8+ cells in age- and sex-matched healthy controls ( n = 3) expressed more IFN-γ in response to all immunostimulants than in pediatric endemic BL (eBL) patients ( n = 4). In healthy controls, IFN-γ expression was higher than IL-4 expression, whereas in eBL patients the expression of IL-4 by CD4+ cells to EBNA-1 was slightly higher than IFN-γ. Moreover, the blood levels of TNF-α was significantly lower ( p = 0.004) while IL-10 was significantly higher ( p = 0.038), in eBL patients ( n = 21) compared to controls ( n = 16). Additionally, the frequency of CD4+CD25hi+ T cells was higher in both age-matched acute uncomplicated malaria ( n = 26) and eBL ( n = 14) patients compared to healthy controls ( n = 19; p = 0.000 and p = 0.027, respectively). The data suggest that reduced Th1 response in eBL might be due to increased levels of IL-10 and T reg cells.

Frequency Diverse Array Receiver Architectures

DTIC Science & Technology

2015-06-29

completely associated with FDA, the Hybrid MIMO phased array (HMPAR) concept presented in [18] developed the basic beam patern synthesis theory for an...20], that analyzed beam paterns of chirp waveforms with slightly 6 different starting frequencies. In [21] and [11] they investigated using FDA for...forward-looking radar GMTI benefits. This research showed the ability of the range-dependent energy distribution characteristics of the FDA beam patern

Electron-Impact Excitation and Ionization in Air

DTIC Science & Technology

2009-09-01

average collision frequency, is more than 100 times larger. Even in the slightly ionized regime with only 1% electrons, the frequency of electron...information is estimated to average 1 hour per response, including the time for reviewing instructions, searching existing data sources, gathering and...physics-based model of nonequilibrium chemistry and radiation in hypersonic flow, it is timely to investigate and update the electron collision cross

Terahertz Radiation Heterodyne Detector Using Two-Dimensional Electron Gas in a GaN Heterostructure

NASA Technical Reports Server (NTRS)

Karasik, Boris S.; Gill, John J.; Mehdi, Imran; Crawford, Timothy J.; Sergeev, Andrei V.; Mitin, Vladimir V.

2012-01-01

High-resolution submillimeter/terahertz spectroscopy is important for studying atmospheric and interstellar molecular gaseous species. It typically uses heterodyne receivers where an unknown (weak) signal is mixed with a strong signal from the local oscillator (LO) operating at a slightly different frequency. The non-linear mixer devices for this frequency range are unique and are not off-the-shelf commercial products. Three types of THz mixers are commonly used: Schottky diode, superconducting hot-electron bolometer (HEB), and superconductor-insulation-superconductor (SIS) junction. A HEB mixer based on the two-dimensional electron gas (2DEG) formed at the interface of two slightly dissimilar semiconductors was developed. This mixer can operate at temperatures between 100 and 300 K, and thus can be used with just passive radiative cooling available even on small spacecraft.

Exposure to an extremely low-frequency electromagnetic field only slightly modifies the proteome of Chromobacterium violaceumATCC 12472

PubMed Central

Baraúna, Rafael A.; Santos, Agenor V.; Graças, Diego A.; Santos, Daniel M.; Ghilardi, Rubens; Pimenta, Adriano M. C.; Carepo, Marta S. P.; Schneider, Maria P.C.; Silva, Artur

2015-01-01

Several studies of the physiological responses of different organisms exposed to extremely low-frequency electromagnetic fields (ELF-EMF) have been described. In this work, we report the minimal effects of in situ exposure to ELF-EMF on the global protein expression of Chromobacterium violaceum using a gel-based proteomic approach. The protein expression profile was only slightly altered, with five differentially expressed proteins detected in the exposed cultures; two of these proteins (DNA-binding stress protein, Dps, and alcohol dehydrogenase) were identified by MS/MS. The enhanced expression of Dps possibly helped to prevent physical damage to DNA. Although small, the changes in protein expression observed here were probably beneficial in helping the bacteria to adapt to the stress generated by the electromagnetic field. PMID:26273227

Effects of Acoustic Modulation and Mixed Fuel on Flame Synthesis of Carbon Nanomaterials in an Atmospheric Environment

PubMed Central

Hu, Wei-Chieh; Sari, Shanti Kartika; Hou, Shuhn-Shyurng; Lin, Ta-Hui

2016-01-01

In this study, methane–ethylene jet diffusion flames modulated by acoustic excitation in an atmospheric environment were used to investigate the effects of acoustic excitation frequency and mixed fuel on nanomaterial formation. Acoustic output power was maintained at a constant value of 10 W, while the acoustic excitation frequency was varied (f = 0–90 Hz). The results show that the flame could not be stabilized on the port when the ethylene volume concentration (ΩE) was less than 40% at f = 10 Hz, or when ΩE = 0% (i.e., pure methane) at f = 90 Hz. The reason for this is that the flame had a low intensity and was extinguished by the entrained air due to acoustic modulation. Without acoustic excitation (f = 0 Hz), the flame was comprised of a single-layer structure for all values of ΩE, and almost no carbon nanomaterials were synthesized. However, with acoustic excitation, a double-layer flame structure was generated for frequencies close to both the natural flickering frequency and the acoustically resonant frequency. This double-layer flame structure provided a favorable flame environment for the fabrication of carbon nanomaterials. Consequently, the synthesis of carbon nano-onions was significantly enhanced by acoustic excitation near both the natural flickering frequency and the acoustically resonant frequency. At f = 20 Hz (near the natural flickering frequency) for 0% ≤ ΩE ≤ 100%, a quantity of carbon nano-onions (CNOs) piled like bunches of grapes was obtained as a result of improved mixing of the fuel with ambient air. High-density CNOs were also produced at f = 70 Hz (close to the acoustically resonant frequency) for 40% ≤ ΩE ≤ 100%. Furthermore, carbon nanotubes (CNTs) were synthesized only at 80 Hz for ΩE = 0%. The suitable temperature range for the synthesis of CNTs was slightly higher than that for the formation of CNOs (about 600 °C for CNTs; 510–600 °C for CNOs). PMID:28774059

Spectrotemporal Processing in Spectral Tuning Modules of Cat Primary Auditory Cortex

PubMed Central

Atencio, Craig A.; Schreiner, Christoph E.

2012-01-01

Spectral integration properties show topographical order in cat primary auditory cortex (AI). Along the iso-frequency domain, regions with predominantly narrowly tuned (NT) neurons are segregated from regions with more broadly tuned (BT) neurons, forming distinct processing modules. Despite their prominent spatial segregation, spectrotemporal processing has not been compared for these regions. We identified these NT and BT regions with broad-band ripple stimuli and characterized processing differences between them using both spectrotemporal receptive fields (STRFs) and nonlinear stimulus/firing rate transformations. The durations of STRF excitatory and inhibitory subfields were shorter and the best temporal modulation frequencies were higher for BT neurons than for NT neurons. For NT neurons, the bandwidth of excitatory and inhibitory subfields was matched, whereas for BT neurons it was not. Phase locking and feature selectivity were higher for NT neurons. Properties of the nonlinearities showed only slight differences across the bandwidth modules. These results indicate fundamental differences in spectrotemporal preferences - and thus distinct physiological functions - for neurons in BT and NT spectral integration modules. However, some global processing aspects, such as spectrotemporal interactions and nonlinear input/output behavior, appear to be similar for both neuronal subgroups. The findings suggest that spectral integration modules in AI differ in what specific stimulus aspects are processed, but they are similar in the manner in which stimulus information is processed. PMID:22384036

Comparison of Biodynamic Responses in Standing and Seated Human Bodies

NASA Astrophysics Data System (ADS)

MATSUMOTO, Y.; GRIFFIN, M. J.

2000-12-01

The dynamic responses of the human body in a standing position and in a sitting position have been compared. The apparent mass and transmissibilities to the head, six locations along the spine, and the pelvis were measured with eight male subjects exposed to vertical whole-body vibration. In both postures, the principal resonance in the apparent mass occurred in the range 5-6 Hz, with slightly higher frequencies and lower apparent mass in the standing posture. There was greater transmission of vertical vibration to the pelvis and the lower spine and greater relative motion within the lower spine in the standing posture than in the sitting posture at the principal resonance and at higher frequencies. Transmissibilities from the supporting surface (floor or seat) to the thoracic region had similar magnitudes for both standing and sitting subjects. The lumbar spine has less lordosis and may be more compressed and less flexible in the sitting posture than in the standing posture. This may have reduced the relative motions between lumbar vertebrae and both the supporting vibrating surface and the other vertebrae in the sitting posture. The characteristics of the vibration transmitted to the pelvis may have differed in the two postures due to different transmission paths. Increased forward rotation of the pelvis in the standing posture may have caused the differences in responses of the pelvis and the lower spine that were observed between the two postures.

Comprehensive assessment of dam impacts on flow regimes with consideration of interannual variations

NASA Astrophysics Data System (ADS)

Zhang, Yongyong; Shao, Quanxi; Zhao, Tongtiegang

2017-09-01

Assessing the impact of human intervention on flow regimes is important in policy making and resource management. Previous impact assessments of dam regulation on flow regimes have focused on long-term average patterns, but interannual variations, which are important characteristics to be considered, have been ignored. In this study, the entire signatures of hydrograph variations of Miyun Reservoir in northern China were described by forty flow regime metrics that incorporate magnitude, variability and frequency, duration, timing, and rate of change for flow events based on a long-term synchronous observation series of inflow and outflow. Principal component analysis and cluster analysis were used to reduce the multidimensionality of the metrics and time and to determine impact patterns and their interannual shifts. Statistically significant driving factors of impact pattern variations were identified. We found that dam regulation resulted in four main impact classes on the flow regimes and that the regulated capacity was interannually attenuated from 1973 to 2010. The impact patterns alternated between the highly regulated class with extremely decreasing flow magnitude, slight variability, and extreme intermittency and the slightly regulated class with extremely increasing flow magnitude, slight variability, and extreme intermittency from 1973 to 1987 and then stabilized in the latter class from 1988 to 2001. After 2001, the pattern gradually changed from the moderately regulated class with moderately decreasing flow magnitude, extreme variability, and extreme intermittency to the slightly regulated class with slightly decreasing flow magnitude, slight variability, and no intermittency. Decreasing precipitation and increasing drought were the primary drivers for the interannual variations of the impact patterns, and inflow variability was the most significant factor affecting the patterns, followed by flow event frequency and duration, magnitude, and timing. This study shows that the use of interannual characteristics can help to gain more insight into the impact of dam regulation on flow regimes and will provide important information to scientifically guide the multi-purpose regulation of dams.

Effects of Tibetan Music on Neuroendocrine and Autonomic Functions in Patients Waiting for Surgery: A Randomized, Controlled Study.

PubMed

Cotoia, Antonella; Dibello, Floriana; Moscatelli, Fiorenzo; Sciusco, Alberto; Polito, Pietro; Modolo, Alberto; Gallo, Crescenzio; Cibelli, Giuseppe; Cinnella, Gilda

2018-01-01

The aim of this study was to investigate the effects of listening to Tibetan music on anxiety and endocrine, autonomic, cognitive responses in patients waiting for urologic surgery. Sixty patients waiting for surgery were enrolled to the study. They were randomized in music (M) and control (C) groups. The M group listened to a low-frequency Tibetan music for 30 min (T 0 -T 30 ) through headphones, and the C group wore headphones with no sound. The State Trait Anxiety Inventory Questionnaire (STAI) Y-1 was administered at T 0 and T 30 . Normalized low (LFnu) and high frequencies (HFnu) of heart rate variability, LF/HF ratio, and galvanic skin response (GRS) data were analyzed at T 0 , T 10 , T 20 , T 30 , and T 35 . The salivary α -amylase (sAA) samples were collected at T 0 , T 35 , and T 45 . In the M group, the STAI Y-1 score decreased at T 30 versus baseline ( p < 0.001), sAA levels decreased at T 35 versus T 0 ( p =0.004), and GSR remained unchanged. In the C group, the STAI Y-1 score remained unchanged, sAA level increased at T 35 versus T 0 ( p < 0.001), and GSR slightly increased at T 35 versus baseline ( p =0.359). LFnu was lower, and HFnu was significantly higher (T 10 -T 30 ) in M versus C group. Mean LF/HF ratio slightly reduced in the M group. Our results suggest that preoperative listening to relaxing Tibetan music might be a useful strategy to manage preoperative anxiety.

Epidemiologic study of Kawasaki disease at a single hospital in Daejeon, Korea (1987 through 2000).

PubMed

Lee, Kyung-Yil; Han, Ji-Whan; Lee, Hyung-Shin; Hong, Ja-Hyun; Hahn, Seung-Hoon; Lee, Joon-Sung; Whang, Kyung-Tai

2004-01-01

We evaluated the epidemiology and a range of clinical characteristics in children with Kawasaki disease (KD) in one area of South Korea. We retrospectively analyzed 506 medical records of children with KD, who were admitted at Daejeon St. Mary's Hospital from January 1987 through December 2000. The mean annual frequency was 36.1 +/- 11.1 cases per year. There were 55 cases (10.9%) in 1993, 50 cases (9.9%) in 1994 and 47 cases (9.3%) in 2000. There was a slightly higher occurrence in summer with no significant difference in seasonal frequency. Age distribution ranged from 2 months to 13 years of age (mean, 2.4 +/- 1.7 years) and 485 children (95.8%) were <5 years of age. The male-to-female ratio was 1.7:1. Of the total cases 0.6% was recurrent, whereas 0.4% occurred between siblings. There were no fatalities. For treatment aspirin alone (65 cases, 12.8%), divided dose intravenous immunoglobulin (IVIG) (400 to 500 mg/day for 4 to 5 days, 231 cases, 45.7%) and one dose IVIG (2.0 g/kg, 210 cases, 41.5%) were used. Between 1996 and 2000, 143 cases were treated with only one dose IVIG, and 21 cases (14.7%) showed coronary artery lesions (CAL). Among the 143 cases 22 cases (15.4%) were retreated with IVIG and/or steroid pulse therapy. The incidence of CAL in this group was 50.0%. In Daejeon, Korea, KD showed slight annual variations without seasonal differences. The rate of CAL in acute stage with one dose IVIG therapy (2 g/kg) was 8.3% in the IVIG responders.

Characteristics of inertial currents observed in offshore wave records

NASA Astrophysics Data System (ADS)

Gemmrich, J.; Garrett, C.

2012-04-01

It is well known that ambient currents can change the amplitude, direction and frequency of ocean surface waves. Regions with persistent strong currents, such as the Agulhas current off the east coast of South Africa, are known as areas of extreme waves, and wave height modulations of up to 50% observed in the shallow North Sea have been linked to tidal currents. In the open ocean, inertial currents, while intermittent, are typically the most energetic currents with speeds up to 0.5 m/s, and can interact with the surface wave field to create wave modulation, though this has not previously been reported. We use long records of significant wave heights from buoy observations in the northeast Pacific and show evidence of significant modulation at frequencies that are slightly higher than the local inertial frequency. Quite apart from the relevance to surface waves, this result can provide a consistent and independent measurement, over a wide range of latitudes, of the frequency blue-shift, the strength and intermittency of ocean surface inertial currents. Near-inertial waves constitute the most energetic portion of the internal wave band and play a significant role in deep ocean mixing. So far, observational data on near-surface inertial currents has tended to come from short records that do not permit the reliable determination of the frequency blue-shift, though this is an important factor affecting the energy flux from the surface into deeper waters. Long records from routine wave height observations are widely available and could help to shed new light globally on the blue-shift and on the characteristics of inertial currents.

Biomechanics of the Peacock’s Display: How Feather Structure and Resonance Influence Multimodal Signaling

PubMed Central

Dakin, Roslyn; McCrossan, Owen; Hare, James F.; Montgomerie, Robert; Amador Kane, Suzanne

2016-01-01

Courtship displays may serve as signals of the quality of motor performance, but little is known about the underlying biomechanics that determines both their signal content and costs. Peacocks (Pavo cristatus) perform a complex, multimodal “train-rattling” display in which they court females by vibrating the iridescent feathers in their elaborate train ornament. Here we study how feather biomechanics influences the performance of this display using a combination of field recordings and laboratory experiments. Using high-speed video, we find that train-rattling peacocks stridulate their tail feathers against the train at 25.6 Hz, on average, generating a broadband, pulsating mechanical sound at that frequency. Laboratory measurements demonstrate that arrays of peacock tail and train feathers have a broad resonant peak in their vibrational spectra at the range of frequencies used for train-rattling during the display, and the motion of feathers is just as expected for feathers shaking near resonance. This indicates that peacocks are able to drive feather vibrations energetically efficiently over a relatively broad range of frequencies, enabling them to modulate the feather vibration frequency of their displays. Using our field data, we show that peacocks with longer trains use slightly higher vibration frequencies on average, even though longer train feathers are heavier and have lower resonant frequencies. Based on these results, we propose hypotheses for future studies of the function and energetics of this display that ask why its dynamic elements might attract and maintain female attention. Finally, we demonstrate how the mechanical structure of the train feathers affects the peacock’s visual display by allowing the colorful iridescent eyespots–which strongly influence female mate choice–to remain nearly stationary against a dynamic iridescent background. PMID:27119380

Biomechanics of the Peacock's Display: How Feather Structure and Resonance Influence Multimodal Signaling.

PubMed

Dakin, Roslyn; McCrossan, Owen; Hare, James F; Montgomerie, Robert; Amador Kane, Suzanne

2016-01-01

Courtship displays may serve as signals of the quality of motor performance, but little is known about the underlying biomechanics that determines both their signal content and costs. Peacocks (Pavo cristatus) perform a complex, multimodal "train-rattling" display in which they court females by vibrating the iridescent feathers in their elaborate train ornament. Here we study how feather biomechanics influences the performance of this display using a combination of field recordings and laboratory experiments. Using high-speed video, we find that train-rattling peacocks stridulate their tail feathers against the train at 25.6 Hz, on average, generating a broadband, pulsating mechanical sound at that frequency. Laboratory measurements demonstrate that arrays of peacock tail and train feathers have a broad resonant peak in their vibrational spectra at the range of frequencies used for train-rattling during the display, and the motion of feathers is just as expected for feathers shaking near resonance. This indicates that peacocks are able to drive feather vibrations energetically efficiently over a relatively broad range of frequencies, enabling them to modulate the feather vibration frequency of their displays. Using our field data, we show that peacocks with longer trains use slightly higher vibration frequencies on average, even though longer train feathers are heavier and have lower resonant frequencies. Based on these results, we propose hypotheses for future studies of the function and energetics of this display that ask why its dynamic elements might attract and maintain female attention. Finally, we demonstrate how the mechanical structure of the train feathers affects the peacock's visual display by allowing the colorful iridescent eyespots-which strongly influence female mate choice-to remain nearly stationary against a dynamic iridescent background.

Lateral Variations of Lg Coda Q in Southern Mexico

NASA Astrophysics Data System (ADS)

Yamamoto, J.; Quintanar, L.; Herrmann, R. B.; Fuentes, C.

Broad band digital three-component data recorded at UNM, a GEOSCOPE station, were used to estimate Lg coda Q for 34 medium size (3.9 <=mb<= 6.3) earthquakes with travel paths laying in different geological provinces of southern Mexico in an effort to establish the possible existence of geological structures acting as wave guides and/or travel paths of low attenuation between the Pacific coast and the Valley of Mexico. The stacked spectral ratio method proposed by XIE and NUTTLI (1988) was chosen for computing the coda Q. The variation range of Q0 (Q at 1Hz) and the frequency dependence parameter η estimates averaged on the frequency interval of 0.5 to 2Hz for the regions and the three components considered are: i) Guerrero region 173 <=Q0<= 182 and 0.6 <=Q0<= 0.7, ii) Oaxaca region 183 <=Q0<= 198 and 0.6 <=Q0<= 0.8, iii) Michoacan-Jalisco region 187 <=Q0<= 204 and 0.7 <=Q0<= 0.8 and iv) eastern portion of the Transmexican Volcanic Belt (TMVB) 313 <=Q0<= 335 and η = 0.9. The results show a very high coda Q for the TMVB as compared to other regions of southern Mexico. This unexpected result is difficult to reconcile with the geophysical characteristics of the TMVB, e.g., low seismicity, high volcanic activity and high heat flow typical of a highly attenuating (low Q) region. Visual inspection of seismograms indicates that for earthquakes with seismic waves traveling along the TMVB, the amplitude decay of Lg coda is anomalously slow as compared to other earthquakes in southern Mexico. Thus, it seems that the high Q value found does not entirely reflect the attenuation characteristics of the TMVB but it is probably contaminated by a wave-guide effect. This phenomenon produces an enhancement in the time duration of the Lg wave trains travelling along this geological structure. This result is important to establish the role played by the transmission medium in the extremely long duration of ground motion observed during the September 19, 1985 Michoacan earthquake. The overall spatial distribution of coda Q values indicates that events with focus in the Michoacan-Jalisco and Oaxaca regions yield slightly higher values than those from Guerrero. This feature is more pronounced for the horizontal component of coda Q. A slight dependence of average coda Q-1 on earthquake focal depth is observed in the frequency range of 0.2 to 1.0Hz approximately on the horizontal component. Deeper (h > 50km) events yield lower values of Q-1 than shallower events. For frequencies higher than 1.0Hz no clear dependence of Q-1 on focal depth is observed. However, due to the estimates uncertainties this result is not clearly established.

Ready-to-eat cereals improve nutrient, milk and fruit intake at breakfast in European adolescents.

PubMed

Michels, Nathalie; De Henauw, Stefaan; Beghin, Laurent; Cuenca-García, Magdalena; Gonzalez-Gross, Marcela; Hallstrom, Lena; Kafatos, Anthony; Kersting, Mathilde; Manios, Yannis; Marcos, Ascensión; Molnar, Denes; Roccaldo, Romana; Santaliestra-Pasías, Alba M; Sjostrom, Michael; Reye, Béatrice; Thielecke, Frank; Widhalm, Kurt; Claessens, Mandy

2016-03-01

Breakfast consumption has been recommended as part of a healthy diet. Recently, ready-to-eat cereals (RTEC) became more popular as a breakfast item. Our aim was to analyse the dietary characteristics of an RTEC breakfast in European adolescents and to compare them with other breakfast options. From the European multi-centre HELENA study, two 24-h dietary recalls of 3137 adolescents were available. Food items (RTEC or bread, milk/yoghurt, fruit) and macro- and micronutrient intakes at breakfast were calculated. Cross-sectional regression analyses were adjusted for gender, age, socio-economic status and city. Compared to bread breakfasts (39 %) and all other breakfasts (41.5 %), RTEC breakfast (19.5 %) was associated with improved nutrient intake (less fat and less sucrose; more fibre, protein and some micronutrients like vitamin B, calcium, magnesium and phosphorus) at the breakfast occasion. Exceptions were more simple sugars in RTEC breakfast consumers: more lactose and galactose due to increased milk consumption, but also higher glucose and fructose than bread consumers. RTEC consumers had a significantly higher frequency (92.5 vs. 50.4 and 60.2 %) and quantity of milk/yoghurt intake and a slightly higher frequency of fruit intake (13.4 vs. 10.9 and 8.0 %) at breakfast. Among European adolescents, RTEC consumers showed a more favourable nutrient intake than consumers of bread or other breakfasts, except for simple sugars. Therefore, RTEC may be regarded as a good breakfast option as part of a varied and balanced diet. Nevertheless, more research is warranted concerning the role of different RTEC types in nutrient intake, especially for simple sugars.

A systematic review and meta-analysis assessing adverse event profile and tolerability of nicergoline.

PubMed

Fioravanti, Mario; Nakashima, Taku; Xu, Jun; Garg, Amit

2014-07-30

To evaluate the safety profile of nicergoline compared with placebo and other active agents from published randomised controlled trials. Systematic review and meta-analysis of nicergoline compared with placebo and other active agents across various indications. MEDLINE, Medline-in-process, Cochrane, EMBASE, EMBASE alerts, Cochrane Central Register of Controlled Trials (CENTRAL), Cochrane Database of Systematic Reviews (CDSR) and Cochrane Methodology Register (CMR) for all the randomised controlled trials, open-label or blinded, in adults treated with nicergoline. Studies published until August 2013 were included. 29 studies were included for data extraction. The studies included in this review were majorly from European countries and mostly in cerebrovascular disease (n=15) and dementia (n=8). The treatment withdrawals were comparatively lower in the nicergoline group as compared with the placebo group (RR=0.92; 95% CI 0.7 to 1.21) and other active comparators (RR=0.45; 95% CI 0.10 to 1.95), but the difference was non-significant. Incidence of any adverse events (AEs) was slightly higher (RR=1.05; 95% CI 0.93 to 1.2) while incidence of serious AEs was lower (RR=0.85; 95% CI 0.50 to 1.45) in the nicergoline compared with placebo group. Frequency of anxiety was significantly lower in nicergoline as compared with placebo (p=0.01). Other AEs including diarrhoea, gastric upset, dizziness and drowsiness were less frequent in the nicergoline group when compared with placebo/active drugs, but the difference was non-significant. Frequency of hypotension and hot flushes was slightly higher in the nicergoline group but the difference was non-significant. None of the studies reported any incidence of fibrosis or ergotism with nicergoline treatment. Nicergoline is an ergot derivative, but its safety profile is better than other ergot derivatives like ergotamine and ergotoxine. This systematic review and meta-analysis suggests that nicergoline has a good safety profile. None of the studies included in this systematic review reported any incidence of fibrosis or ergotism with nicergoline. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

A systematic review and meta-analysis assessing adverse event profile and tolerability of nicergoline

PubMed Central

Fioravanti, Mario; Nakashima, Taku; Xu, Jun; Garg, Amit

2014-01-01

Objective To evaluate the safety profile of nicergoline compared with placebo and other active agents from published randomised controlled trials. Design Systematic review and meta-analysis of nicergoline compared with placebo and other active agents across various indications. Data sources MEDLINE, Medline-in-process, Cochrane, EMBASE, EMBASE alerts, Cochrane Central Register of Controlled Trials (CENTRAL), Cochrane Database of Systematic Reviews (CDSR) and Cochrane Methodology Register (CMR) for all the randomised controlled trials, open-label or blinded, in adults treated with nicergoline. Studies published until August 2013 were included. Review method 29 studies were included for data extraction. The studies included in this review were majorly from European countries and mostly in cerebrovascular disease (n=15) and dementia (n=8). Results The treatment withdrawals were comparatively lower in the nicergoline group as compared with the placebo group (RR=0.92; 95% CI 0.7 to 1.21) and other active comparators (RR=0.45; 95% CI 0.10 to 1.95), but the difference was non-significant. Incidence of any adverse events (AEs) was slightly higher (RR=1.05; 95% CI 0.93 to 1.2) while incidence of serious AEs was lower (RR=0.85; 95% CI 0.50 to 1.45) in the nicergoline compared with placebo group. Frequency of anxiety was significantly lower in nicergoline as compared with placebo (p=0.01). Other AEs including diarrhoea, gastric upset, dizziness and drowsiness were less frequent in the nicergoline group when compared with placebo/active drugs, but the difference was non-significant. Frequency of hypotension and hot flushes was slightly higher in the nicergoline group but the difference was non-significant. None of the studies reported any incidence of fibrosis or ergotism with nicergoline treatment. Conclusions Nicergoline is an ergot derivative, but its safety profile is better than other ergot derivatives like ergotamine and ergotoxine. This systematic review and meta-analysis suggests that nicergoline has a good safety profile. None of the studies included in this systematic review reported any incidence of fibrosis or ergotism with nicergoline. PMID:25079927

Effects of mistuning and matrix structure on the topology of frequency response curves

NASA Technical Reports Server (NTRS)

Afolabi, Dare

1989-01-01

The stability of a frequency response curve under mild perturbations of the system's matrix is investigated. Using recent developments in the theory of singularities of differentiable maps, it is shown that the stability of a response curve depends on the structure of the system's matrix. In particular, the frequency response curves of a cylic system are shown to be unstable. Consequently, slight parameter variations engendered by mistuning will induce a significant difference in the topology of the forced response curves, if the mistuning transformation crosses the bifurcation set.

Analysis of scattering behavior and radar penetration in AIRSAR data

NASA Technical Reports Server (NTRS)

Rignot, Eric; Van Zyl, Jakob

1992-01-01

A technique is presented to physically characterize changes in radar backscatter with frequency in multifrequency single polarization radar images that can be used as a first step in the analysis of the data and the retrieval of geophysical parameters. The technique is automatic, relatively independent of the incidence angle, and only requires a good calibration accuracy between the different frequencies. The technique reveals large areas where scattering changes significantly with frequency and whether the surface has the characteristics of a smooth, slightly rough, rough, or very rough surface.

Pulsatile pressure driven rarefied gas flow in long rectangular ducts

NASA Astrophysics Data System (ADS)

Tsimpoukis, Alexandros; Valougeorgis, Dimitris

2018-04-01

The pulsatile pressure driven fully developed flow of a rarefied gas through an orthogonal duct is investigated, based on the time-dependent linear Bhatnagar, Gross, and Krook equation, by decomposing the flow into its steady and oscillatory parts. The investigation is focused on the oscillatory part, which is characterized by the gas rarefaction and oscillation parameters, the duct aspect ratio, and the accommodation coefficient. As the oscillation frequency is increased, the amplitude of all macroscopic quantities is decreased, while their phase angle lag is increased reaching the limiting value of π/2. As the gas becomes more rarefied, higher frequencies are needed to trigger this behavior. At small and moderate frequencies, there is a critical degree of gas rarefaction, where a maximum flow rate is obtained. As the duct aspect ratio is decreased and tends to zero, the flow rate and mean wall shear stress amplitudes are increased, while their phase angle lags are slightly affected. The accommodation coefficient has a significant effect on the amplitude and a very weak one on the phase angle of the macroscopic quantities. The computation of the inertia and viscous forces clarifies when the flow consists of only one oscillating viscous region or of two regions, namely, the inviscid piston flow in the core and the oscillating Stokes layer at the wall with the velocity overshooting. Finally, the time average oscillatory pumping power is increased as the oscillation frequency is reduced and its maximum value is one half of the corresponding steady one.

Diel timing and frequency of sugar feeding in the mosquito Anopheles gambiae, depending on sex, gonotrophic state and resource availability.

PubMed

Gary, R E; Foster, W A

2006-09-01

Little is known about the sugar-feeding behaviour of equatorial Africa's principal vector of malaria, Anopheles gambiae Giles (Diptera: Culicidae). It is suspected to feed on plant sugar infrequently, but possibly the timing depends on environmental circumstances, and males may differ markedly from females. These points of uncertainty were clarified in the laboratory, by monitoring both diel and longterm sugar-feeding activity in both sexes. Males fed on sugar in a nocturnal diel rhythm closely approximating non-specific flight activity. Female diel sugar-feeding patterns resembled published rhythms and cycles of host seeking. Males sugar fed nightly at an average frequency of about twice per night, sustained over 17 days. This was substantially higher than the sugar-feeding frequency of females that were allowed both blood and oviposition sites every night: they averaged about one sugar feed in every 4 nights. These females fed on sugar between gonotrophic cycles, after eggs were mature but before the next bloodmeal. They did not sugar feed during the 2 days after blood feeding, while blood was being digested and the eggs developed. A slight delay in the availability of either the oviposition site or blood led to an increase in female sugar-feeding frequency: they averaged more than once per night until the delayed resource was made available. These observations support the conclusion that sugar feeding is a normal part of the biology of both sexes of An. gambiae.

Synthesis and thermoluminescence characterizations of Sr2B5O9Cl:Dy3+ phosphor for TL dosimetry.

PubMed

Oza, Abha H; Dhoble, N S; Park, K; Dhoble, S J

2015-09-01

The photoluminescence (PL) and thermoluminescence (TL) displayed by Dy-activated strontium haloborate (Sr2 B5 O9 Cl) were studied. A modified solid-state reaction was employed for the preparation of the phosphor. Photoluminescence spectra showed blue (484 nm) and yellow (575 nm) emissions due to incorporation of Dy(3+) into host matrix. The Dy-doped (0.5 mol%) Sr2 B5 O9 Cl was studied after exposure to γ-irradiation and revealed a prominent glow curve at 261°C with a small hump around 143°C indicating that two types of traps were generated. The glow peak at the higher temperature side (261°C) was more stable than the lower temperature glow peak. The TL intensity was 1.17 times less than that of the standard CaSO4 :Dy thermoluminescence dosimetry (TLD) phosphor, the phosphor showed a linear dose-response curve for different γ-ray irradiation doses (0.002-1.25 Gy) and fading of 5-7% was observed for higher temperature peaks upon storage. Trapping parameters and their estimated error values have been calculated by Chen's peak shape method and by the initial rise method. Values of activation energies estimated by both these techniques were comparable. The slight difference in activation energy values calculated by Chen's peak shape method indicated the formation of two kinds of traps Furthermore, slight differences in frequency values are due to various escaping and retrapping probabilities. Copyright © 2014 John Wiley & Sons, Ltd.

Continuous wave terahertz radiation from an InAs/GaAs quantum-dot photomixer device

NASA Astrophysics Data System (ADS)

Kruczek, T.; Leyman, R.; Carnegie, D.; Bazieva, N.; Erbert, G.; Schulz, S.; Reardon, C.; Reynolds, S.; Rafailov, E. U.

2012-08-01

Generation of continuous wave radiation at terahertz (THz) frequencies from a heterodyne source based on quantum-dot (QD) semiconductor materials is reported. The source comprises an active region characterised by multiple alternating photoconductive and QD carrier trapping layers and is pumped by two infrared optical signals with slightly offset wavelengths, allowing photoconductive device switching at the signals' difference frequency ˜1 THz.

Relaxations of the isolated portal vein of the rabbit induced by nicotine and electrical stimulation

PubMed Central

Hughes, J.; Vane, J. R.

1970-01-01

1. A pharmacological analysis of the inhibitory innervation of the isolated portal vein of the rabbit has been made. 2. In untreated preparations, transmural stimulation elicited a long-lasting relaxation at low frequencies (0·2-1 Hz); at higher frequencies a contraction followed by a prolonged after-relaxation occurred. Tetrodotoxin abolished the contractions but a higher dose was required to abolish the relaxations. Veratrine lowered the threshold of stimulation for producing relaxations in the untreated vein. The relaxations were unaffected by hyoscine or hexamethonium. They were reduced or altered by antagonists of α-adrenoceptors for catecholamines and by adrenergic neurone blockade. They were sometimes slightly reduced by antagonists of β-adrenoceptors. 3. In the presence of antagonists of α-adrenoceptors, electrical stimulation elicited relaxations which increased with frequency of stimulation and became maximal at 20-30 Hz. These relaxations were partially reduced by antagonists of β-adrenoceptors, or by adrenergic neurone block; the antagonisms were more pronounced at the higher frequencies of stimulation. Noradrenaline also caused relaxations which were abolished by β-adrenoceptor blocking drugs. Cocaine increased the sensitivity to noradrenaline by 7-8 fold after α-adrenoceptor blockade but had little or no effect on the relaxations induced by electrical stimulation at high frequencies. 4. In the presence of antagonists of α- and β-adrenoceptors, or adrenergic neurone blocking agents, or in veins taken from rabbits pretreated with reserpine, electrical stimulation elicited rapid relaxations which were greatest at 20-30 Hz. These relaxations were increased by veratrine and abolished by tetrodotoxin or by storing the vein for 9 days at 4° C. They were unaffected by antagonists of acetylcholine, or by dipyridamole. 5. Prostaglandins E1, E2 and F2α inhibited contractions elicited by electrical stimulation and noradrenaline, but in higher doses caused contractions themselves. 6. Nicotine (10-6-10-5 g/ml) relaxed the portal vein; higher concentrations elicited mixed inhibitory and excitatory effects. All these effects were abolished by tetrodotoxin, cocaine, hexamethonium or storage. The contractor effects were abolished by drugs or procedures that blocked adrenergic mechanisms. 7. The relaxations produced by nicotine in untreated preparations and in veins from rabbits pretreated with reserpine were mediated mainly by a non-adrenergic non-cholinergic nervous mechanism. Relaxations induced by nicotine in the presence of antagonists of a-adrenoceptors were only partially antagonized by antagonists of f3-adrenoceptors. 8. It was concluded that all the effects of nicotine and transmural stimulation were mediated by nerves. Part of the inhibitory effects was mediated by non-adrenergic, non-cholinergic nerves. PMID:4394338

Generation, Diversity Determination, and Application to Antibody Selection of a Human Naïve Fab Library

PubMed Central

Kim, Sangkyu; Park, Insoo; Park, Seung Gu; Cho, Seulki; Kim, Jin Hong; Ipper, Nagesh S.; Choi, Sun Shim; Lee, Eung Suk; Hong, Hyo Jeong

2017-01-01

We constructed a large naïve human Fab library (3 × 1010 colonies) from the lymphocytes of 809 human donors, assessed available diversities of the heavy-chain variable (VH) and κ light-chain variable (VK) domain repertoires, and validated the library by selecting Fabs against 10 therapeutically relevant antigens by phage display. We obtained a database of unique 7,373 VH and 41,804 VK sequences by 454 pyrosequencing, and analyzed the repertoires. The distribution of VH and VK subfamilies and germline genes in our antibody repertoires slightly differed from those in earlier published natural antibody libraries. The frequency of somatic hypermutations (SHMs) in heavy-chain complementarity determining region (HCDR)1 and HCDR2 are higher compared with the natural IgM repertoire. Analysis of position-specific SHMs in CDRs indicates that asparagine, threonine, arginine, aspartate and phenylalanine are the most frequent non-germline residues on the antibody-antigen interface and are converted mostly from the germline residues, which are highly represented in germline SHM hotspots. The amino acid composition and length-dependent changes in amino acid frequencies of HCDR3 are similar to those in previous reports, except that frequencies of aspartate and phenylalanine are a little higher in our repertoire. Taken together, the results show that this antibody library shares common features of natural antibody repertoires and also has unique features. The antibody library will be useful in the generation of human antibodies against diverse antigens, and the information about the diversity of natural antibody repertoires will be valuable in the future design of synthetic human antibody libraries with high functional diversity. PMID:28927259

Polybrominated diphenyl ether serum concentrations in a Californian population of children, their parents, and older adults: an exposure assessment study.

PubMed

Wu, Xiangmei May; Bennett, Deborah H; Moran, Rebecca E; Sjödin, Andreas; Jones, Richard S; Tancredi, Daniel J; Tulve, Nicolle S; Clifton, Matthew Scott; Colón, Maribel; Weathers, Walter; Hertz-Picciotto, Irva

2015-03-14

Polybrominated diphenyl ethers (PBDEs) are used as flame retardants in many household items. Given concerns over their potential adverse health effects, we identified predictors and evaluated temporal changes of PBDE serum concentrations. PBDE serum concentrations were measured in young children (2-8 years old; N = 67), parents of young children (<55 years old; N = 90), and older adults (≥55 years old; N = 59) in California, with concurrent floor wipe samples collected in participants' homes in 2008-2009. We also measured serum concentrations one year later in a subset of children (N = 19) and parents (N = 42). PBDE serum concentrations in children were significantly higher than in adults. Floor wipe concentration is a significant predictor of serum BDE-47, 99, 100 and 154. Positive associations were observed between the intake frequency of canned meat and serum concentrations of BDE-47, 99 and 154, between canned meat entrees and BDE-154 and 209, as well as between tuna and white fish and BDE-153. The model with the floor wipe concentration and food intake frequencies explained up to 40% of the mean square prediction error of some congeners. Lower home values and renting (vs. owning) a home were associated with higher serum concentrations of BDE-47, 99 and 100. Serum concentrations measured one year apart were strongly correlated as expected (r = 0.70-0.97) with a slight decreasing trend. Floor wipe concentration, food intake frequency, and housing characteristics can explain 12-40% of the prediction error of PBDE serum concentrations. Decreasing temporal trends should be considered when characterizing long-term exposure.

Generation, Diversity Determination, and Application to Antibody Selection of a Human Naïve Fab Library.

PubMed

Kim, Sangkyu; Park, Insoo; Park, Seung Gu; Cho, Seulki; Kim, Jin Hong; Ipper, Nagesh S; Choi, Sun Shim; Lee, Eung Suk; Hong, Hyo Jeong

2017-09-30

We constructed a large naïve human Fab library (3 × 10 10 colonies) from the lymphocytes of 809 human donors, assessed available diversities of the heavy-chain variable (VH) and κ light-chain variable (VK) domain repertoires, and validated the library by selecting Fabs against 10 therapeutically relevant antigens by phage display. We obtained a database of unique 7,373 VH and 41,804 VK sequences by 454 pyrosequencing, and analyzed the repertoires. The distribution of VH and VK subfamilies and germline genes in our antibody repertoires slightly differed from those in earlier published natural antibody libraries. The frequency of somatic hypermutations (SHMs) in heavy-chain complementarity determining region (HCDR)1 and HCDR2 are higher compared with the natural IgM repertoire. Analysis of position-specific SHMs in CDRs indicates that asparagine, threonine, arginine, aspartate and phenylalanine are the most frequent non-germline residues on the antibody-antigen interface and are converted mostly from the germline residues, which are highly represented in germline SHM hotspots. The amino acid composition and length-dependent changes in amino acid frequencies of HCDR3 are similar to those in previous reports, except that frequencies of aspartate and phenylalanine are a little higher in our repertoire. Taken together, the results show that this antibody library shares common features of natural antibody repertoires and also has unique features. The antibody library will be useful in the generation of human antibodies against diverse antigens, and the information about the diversity of natural antibody repertoires will be valuable in the future design of synthetic human antibody libraries with high functional diversity.

Prevalence of dental anomalies in patients with cleft lip and palate.

PubMed

Eslami, Neda; Majidi, Mohammad Reza; Aliakbarian, Majid; Hasanzadeh, Nadia

2013-09-01

The aim of the present study was to investigate the prevalence of dental anomalies in a group of patients with cleft lip and palate (CL/P) in the northeast of Iran. Ninety-one patients referring to the Cleft Lip and Palate Clinic of Mashhad Dental School were enrolled and classified into right CL/P, left CL/P, and bilateral CL/P groups. Photographs, dental casts, and panoramic and periapical radiographs were retrieved, and dental anomalies were recorded. χ test was used to analyze the frequency of dental anomalies according to type of cleft and sex. Missing maxillary lateral incisors was the most frequent dental anomaly, which was slightly higher in the bilateral group (61.1%). There were significantly more cases of missing lateral incisors outside the cleft area in right CL/P (P = 0.015). Peg lateral incisors were observed in 33.3% of bilateral CL/P compared with 28% of right and 23.3% of left unilateral cases. The sample presented rotations of central incisors in the cleft area in 33.3% of bilateral clefts. In unilateral clefts, it occurred more frequently in the right side (48%). Sexual dimorphism appeared only for maxillary central incisor rotation in the cleft area, which showed significantly greater frequency in females (P = 0.025). Transposition of maxillary canine and first premolars was found in 5.5% of bilateral, 8% of right, and 3.3% of left unilateral clefts. The prevalence of dental anomalies in the studied sample seems to be higher than that reported in the normal population. More anomalies were observed at the cleft side. The frequency of most anomalies was not significantly different between the 2 sexes.

Limited ability of DNA polymerase kappa to suppress benzo[a]pyrene-induced genotoxicity in vivo.

PubMed

Masumura, Kenichi; Toyoda-Hokaiwado, Naomi; Niimi, Naoko; Grúz, Petr; Wada, Naoko A; Takeiri, Akira; Jishage, Kou-Ichi; Mishima, Masayuki; Nohmi, Takehiko

2017-12-01

DNA polymerase kappa (Polk) is a specialized DNA polymerase involved in translesion DNA synthesis. To understand the protective roles against genotoxins in vivo, we established inactivated Polk knock-in gpt delta (inactivated Polk KI) mice that possessed reporter genes for mutations and expressed inactive Polk. In this study, we examined genotoxicity of benzo[a]pyrene (BP) to determine whether Polk actually suppressed BP-induced genotoxicity as predicted by biochemistry and in vitro cell culture studies. Seven-week-old inactivated Polk KI and wild-type (WT) mice were treated with BP at doses of 5, 15, or 50 mg/(kg·day) for three consecutive days by intragastric gavage, and mutations in the colon and micronucleus formation in the peripheral blood were examined. Surprisingly, no differences were observed in the frequencies of mutations and micronucleus formation at 5 or 50 mg/kg doses. Inactivated Polk KI mice exhibited approximately two times higher gpt mutant frequency than did WT mice only at the 15 mg/kg dose. The frequency of micronucleus formation was slightly higher in inactivated Polk KI than in WT mice at the same dose, but it was statistically insignificant. The results suggest that Polk has a limited ability to suppress BP-induced genotoxicity in the colon and bone marrow and also that the roles of specialized DNA polymerases in mutagenesis and carcinogenesis should be examined not only by in vitro assays but also by in vivo mouse studies. We also report the spontaneous mutagenesis in inactivated Polk KI mice at young and old ages. Environ. Mol. Mutagen. 58:644-653, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Study of the influence of the laterality of mobile phone use on the SAR induced in two head models

NASA Astrophysics Data System (ADS)

Ghanmi, Amal; Varsier, Nadège; Hadjem, Abdelhamid; Conil, Emmanuelle; Picon, Odile; Wiart, Joe

2013-05-01

The objective of this paper is to investigate and to analyse the influence of the laterality of mobile phone use on the exposure of the brain to radio-frequencies (RF) and electromagnetic fields (EMF) from different mobile phone models using the finite-difference time-domain (FDTD) method. The study focuses on the comparison of the specific absorption rate (SAR) induced on the right and left sides of two numerical adult and child head models. The heads are exposed by both phone models operating in GSM frequency bands for both ipsilateral and contralateral configurations. A slight SAR difference between the two sides of the heads is noted. The results show that the variation between the left and the right sides is more important at 1800 MHz for an ipsilateral use. Indeed, at this frequency, the variation can even reach 20% for the SAR10g and the SAR1g induced in the head and in the brain, respectively. Moreover, the average SAR induced by the mobile phone in the half hemisphere of the brain in ipsilateral exposure is higher than in contralateral exposure. Owing to the superficial character of energy deposition at 1800 MHz, this difference in the SAR induced for the ipsilateral and contralateral usages is more significant at 1800 MHz than at 900 MHz. The results have shown that depending on the phantom head models, the SAR distribution in the brain can vary because of differences in anatomical proportions and in the geometry of the head models. The induced SAR in child head and in sub-regions of the brain is significantly higher (up to 30%) compared to the adult head. This paper confirms also that the shape/design of the mobile and the location of the antenna can have a large influence at high frequency on the exposure of the brain, particularly on the SAR distribution and on the distinguished brain regions.

A novel fiber optic geophone with high sensitivity for geo-acoustic detection

NASA Astrophysics Data System (ADS)

Zhang, Zhenhui; Yang, Huayong; Xiong, Shuidong; Luo, Hong; Cao, Chunyan; Ma, Shuqing

2014-12-01

A novel interferometric fiber optic geophone is introduced in this paper. This geophone is mainly used for geo-acoustic signal detection. The geophone use one of the three orthogonal components of mandrel type push-pull structure in mechanically and single-mode fiber optic Michelson interferometer structure with Faraday Rotation Mirror (FRM) elements in optically. The resonance frequency of the geophone is larger than 1000Hz. The acceleration sensitivity is as high as 56.6 dB (0dB re 1rad/g) with a slight sensitivity fluctuation of +/-0. 2dB within the frequency band from 20Hz to 200Hz. The geo-acoustic signals generated by underwater blasting are detected successfully. All the channels show good uniformity in the detected wave shape and the amplitudes exhibit very slight differences. The geo-acoustic signal excitated by the engine of surface vehicles was also detected successfully.

The association of peptic ulcer and schizophrenia: a population-based study.

PubMed

Liao, Chun-Hui; Chang, Chen-Shu; Chang, Shih-Ni; Muo, Chih-Hsin; Lane, Hsien-Yuan; Sung, Fung-Chang; Kao, Chia-Hung

2014-12-01

The association of schizophrenia with peptic ulcer is not conclusive. In the last 30years, there has been little evaluation of peptic ulcer among schizophrenia patients. To explore the relation of peptic ulcer and schizophrenia during this new phase, we used the data from Taiwan insurance claims, identified 1496 schizophrenia patients (ICD-9-CM: 295) and selected 5984 non-schizophrenia controls that were frequency-matched by sex, age, and index year with schizophrenia patients during the years 1998-2001. All subjects were free of peptic ulcer at baseline. We measured incidences of peptic ulcer (ICD-9-CM: 531-534) until the end of 2009. The incidence of peptic ulcer was 1.27 times higher in schizophrenia patients than in the control group (12.1vs. 9.52 per 1000 person-years). Patients are at higher risk taking anti-depression, anxiolytic and hypnotics or non-steroidal anti-inflammatory drugs. After controlling the confounding factors, schizophrenia patients had no significant increase incidence of peptic ulcer. Schizophrenia patients have a slightly higher risk of peptic ulcer compared to the general population. This might be due to a higher rate of taking anti-depression, anxiolytic and hypnotics or non-steroidal anti-inflammatory drugs and alcoholism among this group. Copyright © 2014 Elsevier Inc. All rights reserved.

Processing Complex Sounds Passing through the Rostral Brainstem: The New Early Filter Model

PubMed Central

Marsh, John E.; Campbell, Tom A.

2016-01-01

The rostral brainstem receives both “bottom-up” input from the ascending auditory system and “top-down” descending corticofugal connections. Speech information passing through the inferior colliculus of elderly listeners reflects the periodicity envelope of a speech syllable. This information arguably also reflects a composite of temporal-fine-structure (TFS) information from the higher frequency vowel harmonics of that repeated syllable. The amplitude of those higher frequency harmonics, bearing even higher frequency TFS information, correlates positively with the word recognition ability of elderly listeners under reverberatory conditions. Also relevant is that working memory capacity (WMC), which is subject to age-related decline, constrains the processing of sounds at the level of the brainstem. Turning to the effects of a visually presented sensory or memory load on auditory processes, there is a load-dependent reduction of that processing, as manifest in the auditory brainstem responses (ABR) evoked by to-be-ignored clicks. Wave V decreases in amplitude with increases in the visually presented memory load. A visually presented sensory load also produces a load-dependent reduction of a slightly different sort: The sensory load of visually presented information limits the disruptive effects of background sound upon working memory performance. A new early filter model is thus advanced whereby systems within the frontal lobe (affected by sensory or memory load) cholinergically influence top-down corticofugal connections. Those corticofugal connections constrain the processing of complex sounds such as speech at the level of the brainstem. Selective attention thereby limits the distracting effects of background sound entering the higher auditory system via the inferior colliculus. Processing TFS in the brainstem relates to perception of speech under adverse conditions. Attentional selectivity is crucial when the signal heard is degraded or masked: e.g., speech in noise, speech in reverberatory environments. The assumptions of a new early filter model are consistent with these findings: A subcortical early filter, with a predictive selectivity based on acoustical (linguistic) context and foreknowledge, is under cholinergic top-down control. A prefrontal capacity limitation constrains this top-down control as is guided by the cholinergic processing of contextual information in working memory. PMID:27242396

Public and private pregnancy care in Reggio Emilia Province: an observational study on appropriateness of care and delivery outcomes

PubMed Central

2014-01-01

Background In industrialized countries, improvements have been made in both maternal and newborn health. While attention to antenatal care is increasing, excessive medicalization is also becoming more common. The aim of this study is to compare caesarean section (CS) frequency and ultrasound scan utilization in a public model of care involving both midwives and obstetricians with a private model in which care is provided by obstetricians only. Methods Design: Observational population-based study. Setting: Reggio Emilia Province. Population: 5957 women resident in the province who delivered between October 2010 and November 2011. Main outcome measures: CS frequency and ultrasound scan utilization, stillbirths, and other negative perinatal outcomes. Women in the study were searched in the public family and reproductive health clinic medical records to identify those cared for in the public system. Outcomes of the two antenatal care models were compared through multivariate logistic regression adjusting for maternal characteristics and, for CS only, by stratifying by Robson’s Group. Results Compared to women cared for in private services (N = 3,043), those in public service (N = 2,369) were younger, less educated, more frequently non-Italian, and multiparous. The probability of CS was slightly higher for women cared for by private obstetricians than for those cared for in the public system (31.8% vs. 27.1%; adjusted odds ratio: 1.10; 95% CI: 0.93–1.29): The probability of having more than 3 ultrasound scans was higher in private care (89.6% vs. 49.8%; adjusted odds ratio: 5.11; 95% CI: 4.30–6.08). CS frequency was higher in private care for all Robson’s classes except women who underwent CS during spontaneous labour. Among negative perinatal outcomes only a higher risk of pre-term birth was observed for pregnancies cared for in private services. Conclusions The public model provides less medicalized and more guidelines-oriented care than does the private model, with no increase in negative perinatal outcomes. PMID:24533853

Processing Complex Sounds Passing through the Rostral Brainstem: The New Early Filter Model.

PubMed

Marsh, John E; Campbell, Tom A

2016-01-01

The rostral brainstem receives both "bottom-up" input from the ascending auditory system and "top-down" descending corticofugal connections. Speech information passing through the inferior colliculus of elderly listeners reflects the periodicity envelope of a speech syllable. This information arguably also reflects a composite of temporal-fine-structure (TFS) information from the higher frequency vowel harmonics of that repeated syllable. The amplitude of those higher frequency harmonics, bearing even higher frequency TFS information, correlates positively with the word recognition ability of elderly listeners under reverberatory conditions. Also relevant is that working memory capacity (WMC), which is subject to age-related decline, constrains the processing of sounds at the level of the brainstem. Turning to the effects of a visually presented sensory or memory load on auditory processes, there is a load-dependent reduction of that processing, as manifest in the auditory brainstem responses (ABR) evoked by to-be-ignored clicks. Wave V decreases in amplitude with increases in the visually presented memory load. A visually presented sensory load also produces a load-dependent reduction of a slightly different sort: The sensory load of visually presented information limits the disruptive effects of background sound upon working memory performance. A new early filter model is thus advanced whereby systems within the frontal lobe (affected by sensory or memory load) cholinergically influence top-down corticofugal connections. Those corticofugal connections constrain the processing of complex sounds such as speech at the level of the brainstem. Selective attention thereby limits the distracting effects of background sound entering the higher auditory system via the inferior colliculus. Processing TFS in the brainstem relates to perception of speech under adverse conditions. Attentional selectivity is crucial when the signal heard is degraded or masked: e.g., speech in noise, speech in reverberatory environments. The assumptions of a new early filter model are consistent with these findings: A subcortical early filter, with a predictive selectivity based on acoustical (linguistic) context and foreknowledge, is under cholinergic top-down control. A prefrontal capacity limitation constrains this top-down control as is guided by the cholinergic processing of contextual information in working memory.

Testing the concept of a modulation filter bank: the audibility of component modulation and detection of phase change in three-component modulators.

PubMed

Sek, Aleksander; Moore, Brian C J

2003-05-01

Two experiments were performed to test the concept that the auditory system contains a "modulation filter bank" (MFB). Experiment 1 examined the ability to "hear out" the modulation frequency of the central component of a three-component modulator applied to a 4-kHz sinusoidal carrier. On each trial, three modulated stimuli were presented. The modulator of the first stimulus contained three components. Within a run the frequencies of the outer two components were fixed and the frequency of the central ("target") component was drawn randomly from one of five values. The modulators of second and third stimuli contained one component. One had a frequency equal to that of the target and the other had a frequency randomly selected from one of the other possible values. Subjects indicated whether the target corresponded to the second or third stimulus. Scores were around 80% correct when the components in the three-component modulator were widely spaced and when the frequencies of the target and comparison differed sufficiently. Experiment 2 examined the ability to hear a change in the relative phase of the components in a three-component modulator with harmonically spaced components, using a 31FC task. The frequency of the central component, f(c), was either 50 or 100 Hz. Scores were 80%-90% correct when the component spacing was < or = 0.5 f(c), but decreased markedly for greater spacings. Performance was only slightly impaired by randomizing the overall modulation depth from one stimulus to the next. The results of both experiments are broadly consistent with what would be expected from a MFB with a Q value of 1 or slightly less.

The effects of sterilisation: a comparison of sterilised women with the wives of vasectomised men.

PubMed

Alder, E; Cook, A; Gray, J; Tyrer, G; Warner, P; Bancroft, J; Loudon, N B; Loudon, J

1981-01-01

In a follow-up study, women sterilised by tubal diathermy were compared with a matched group of wives of vasectomised men. Semi-structured interviews were given to a random sample drawn from a representative population. The couples were young with small families and did not have a high proportion of unplanned pregnancies or terminations. They had previously used contraception, mainly the pill or sheath. Most couples were entirely satisfied with the operation. Both groups showed an increase in pre-menstrual symptoms but there was only slight evidence that menstrual loss was affected by female sterilisation. The vasectomy couples had a higher frequency of sexual intercourse, few sexual problems and tended to have more satisfactory marriages. They had had more discussion of their decision to have the operation and the implications of counselling are considered.

Remote plasma enhanced chemical vapor deposition of GaP with in situ generation of phosphine precursors

NASA Technical Reports Server (NTRS)

Choi, S. W.; Lucovsky, G.; Bachmann, Klaus J.

1993-01-01

Thin homoepitaxial films of gallium phosphide (GaP) were grown by remote plasma enhanced chemical vapor deposition utilizing in situ generated phosphine precursors. The GaP forming reaction is kinetically controlled with an activation energy of 0.65 eV. The increase of the growth rate with increasing radio frequency (rf) power between 20 and 100 W is due to the combined effects of increasingly complete excitation and the spatial extension of the glow discharge toward the substrate, however, the saturation of the growth rate at even higher rf power indicates the saturation of the generation rate of phosphine precursors at this condition. Slight interdiffusion of P into Si and Si into GaP is indicated from GaP/Si heterostructures grown under similar conditions as the GaP homojunctions.

Remote plasma enhanced chemical vapor deposition of GaP with in situ generation of phosphine precursors

NASA Technical Reports Server (NTRS)

Choi, S. W.; Lucovsky, G.; Bachmann, K. J.

1992-01-01

Thin homoepitaxial films of gallium phosphide (GaP) have been grown by remote plasma enhanced chemical vapor deposition utilizing in situ-generated phosphine precursors. The GaP forming reaction is kinetically controlled with an activation energy of 0.65 eV. The increase of the growth rate with increasing radio frequency (RF) power between 20 and 100 W is due to the combined effects of increasingly complete excitation and the spatial extension of the glow discharge toward the substrate; however, the saturation of the growth rate at even higher RF power indicates the saturation of the generation rate of phosphine precursors at this condition. Slight interdiffusion of P into Si and Si into GaP is indicated from GaP/Si heterostructures grown under similar conditions as the GaP homojunctions.

Voltage dependency of transmission probability of aperiodic DNA molecule

NASA Astrophysics Data System (ADS)

Wiliyanti, V.; Yudiarsah, E.

2017-07-01

Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

Method of accelerating photons by a relativistic plasma wave

DOEpatents

Dawson, John M.; Wilks, Scott C.

1990-01-01

Photons of a laser pulse have their group velocity accelerated in a plasma as they are placed on a downward density gradient of a plasma wave of which the phase velocity nearly matches the group velocity of the photons. This acceleration results in a frequency upshift. If the unperturbed plasma has a slight density gradient in the direction of propagation, the photon frequencies can be continuously upshifted to significantly greater values.

Deciphering the Long-Term Trend of Atlantic Basin Intense Hurricanes: More Active Versus Less Active During the Present Epoch

NASA Technical Reports Server (NTRS)

Wilson, Robert M.

1998-01-01

During the interval of 1944-1997, 120 intense hurricanes (i.e., those of category 3 or higher on the Saffir-Simpson hurricane damage potential scale) were observed in the Atlantic basin, having an annual frequency of 0-7 events per year, being more active prior to the mid 1960's than thereafter (hence a possible two-state division: more active versus less active), and being preferentially lower during El Nino years as compared to non-El Nino years. Because decadal averages of the frequency of intense hurricanes closely resemble those of average temperature anomalies for northern hemispheric and global standards and of the average temperature at the Armagh Observatory (Northern Ireland), a proxy for climatic change, it is inferred that the long-term trends of the annual frequency of intense hurricanes and temperature may be statistically related. Indeed, on the basis of 4- and 10-yr moving averages, one finds that there exists strong linear associations between the annual frequency of intense hurricanes in the Atlantic basin and temperature (specially, when temperature slightly leads). Because the long-term leading trends of temperature are now decidedly upward, beginning about the mid 1980's, it is inferred that the long-term consequential trends of the annual frequency of intense hurricanes should now also be upward, having begun near 1990, suggesting that a return to the more active state probably has already occurred. However, because of the anomalous El Nino activity of the early to mid 1990's, the switch from the less active to the more active state essentially went unnoticed (a marked increase in the number of intense hurricanes was not observed until the 1995 and 1996 hurricane seasons, following the end of the anomalous El Nino activity). Presuming that a return to the more active state has, indeed, occurred, one expects the number of seasonal intense hurricanes during the present epoch (continuing through about 2012) to usually be higher than average (i.e., greater than or equal to 2), except during El Nino-related seasons when the number usually will be less than average.

Identifying key climate and environmental factors affecting rates of post-fire big sagebrush (Artemisia tridentata) recovery in the northern Columbia Basin, USA

USGS Publications Warehouse

Shinneman, Douglas; McIlroy, Susan

2016-01-01

Sagebrush steppe of North America is considered highly imperilled, in part owing to increased fire frequency. Sagebrush ecosystems support numerous species, and it is important to understand those factors that affect rates of post-fire sagebrush recovery. We explored recovery of Wyoming big sagebrush (Artemisia tridentata ssp.wyomingensis) and basin big sagebrush (A. tridentata ssp. tridentata) communities following fire in the northern Columbia Basin (Washington, USA). We sampled plots across 16 fires that burned in big sagebrush communities from 5 to 28 years ago, and also sampled nearby unburned locations. Mixed-effects models demonstrated that density of large–mature big sagebrush plants and percentage cover of big sagebrush were higher with time since fire and in plots with more precipitation during the winter immediately following fire, but were lower when precipitation the next winter was higher than average, especially on soils with higher available water supply, and with greater post-fire mortality of mature big sagebrush plants. Bunchgrass cover 5 to 28 years after fire was predicted to be lower with higher cover of both shrubs and non-native herbaceous species, and only slightly higher with time. Post-fire recovery of big sagebrush in the northern Columbia Basin is a slow process that may require several decades on average, but faster recovery rates may occur under specific site and climate conditions.

Geometry effects on cooling in a standing wave cylindrical thermoacousic resonator

NASA Astrophysics Data System (ADS)

Mohd-Ghazali, Normah; Ghazali, Ahmad Dairobi; Ali, Irwan Shah; Rahman, Muhammad Aminullah A.

2012-06-01

Numerous reports have established the refrigeration applications of thermoacoustic cooling without compressors and refrigerants. Significant cooling effects can be obtained in a thermoacoustic resonator fitted with a heat exchanging stack and operated at resonance frequency. Past studies, however, have hardly referred to the fundamental relationship between resonant frequency and the resonator geometry. This paper reports the thermoacoustic cooling effects at resonance obtained by changing the diameter of the resonator while holding the length constant and vice versa. Experiments were completed at atmospheric pressure with air as the working fluid using a number of pvc tubes having parallel plate stack from Mylar. The temperature difference measured across the stack showed that a volume increase in the working fluid in general increases the temperature gradient for the quarter-and half-wavelength resonators. Doubling the diameter from 30 mm to 60 mm produced the highest temperature difference due to the greater number of stack plates resulting in a higher overall thermoacaoustic cooling. Increasing the resonator length only produced a small increase in temperature gradient since the resonant frequency at operation is only slightly changed. Investigation on the aspect ratio exhibits no influence on the temperature difference across the stack. This study have shown that the resonator length and diameter do affect the temperature difference across the thermoacoustic stack, and further research should be done to consider the contribution of the stack mass on the overall desired thermoacoustic cooling.

Mitochondrial DNA polymorphisms associated with longevity in a Finnish population.

PubMed

Niemi, Anna-Kaisa; Hervonen, Antti; Hurme, Mikko; Karhunen, Pekka J; Jylhä, Marja; Majamaa, Kari

2003-01-01

Sequence variation in mitochondrial DNA (mtDNA) may cause slight differences both in the functioning of the respiratory chain and in free radical production, and an association between certain mtDNA haplogroups and longevity has been suggested. In order to determine further the role of mtDNA in longevity, we studied the frequencies of mtDNA haplogroups and haplogroup clusters among elderly subjects and controls in a Finnish population. Samples were obtained from 225 persons aged 90-91 years (Vitality 90+) and from 400 middle-aged controls and 257 infants. MtDNA haplogroups were determined by restriction fragment length polymorphism. The haplogroup frequencies of the Vitality 90+ group differed from both those of the middle-aged controls ( P=0.01) and the infants ( P=0.00005), haplogroup H being less frequent than among the middle-aged subjects ( P=0.001) and infants ( P=0.00001), whereas haplogroups U and J were more frequent. Haplogroup clusters also differed between Vitality 90+ and both the middle-aged subjects ( P=0.002) and infants ( P=0.00001), the frequency of haplogroup cluster HV being lower in the former and that of UK and WIX being higher. These data suggest an association between certain mtDNA haplogroups or haplogroup clusters and longevity. Furthermore, our data appear to favour the presence of advantageous polymorphisms and support a role for mitochondria and mtDNA in the degenerative processes involved in ageing.

Two-Wavelength Multi-Gigahertz Frequency Comb-Based Interferometry for Full-Field Profilometry

NASA Astrophysics Data System (ADS)

Choi, Samuel; Kashiwagi, Ken; Kojima, Shuto; Kasuya, Yosuke; Kurokawa, Takashi

2013-10-01

The multi-gigahertz frequency comb-based interferometer exhibits only the interference amplitude peak without the phase fringes, which can produce a rapid axial scan for full-field profilometry and tomography. Despite huge technical advantages, there remain problems that the interference intensity undulations occurred depending on the interference phase. To avoid such problems, we propose a compensation technique of the interference signals using two frequency combs with slightly varied center wavelengths. The compensated full-field surface profile measurements of cover glass and onion skin were demonstrated experimentally to verify the advantages of the proposed method.

Effects of reversible noise exposure on the suppression tuning of rabbit distortion-product otoacoustic emissions

NASA Astrophysics Data System (ADS)

Howard, Mackenzie A.; Stagner, Barden B.; Lonsbury-Martin, Brenda L.; Martin, Glen K.

2002-01-01

Distortion-product otoacoustic emissions (DPOAEs) at 2f1-f2 can be suppressed by the introduction of a third ``suppressor'' tone. Plotting the suppression of the DPOAE level against the changing frequency and level of the suppressor produces frequency-tuning functions referred to as suppression tuning curves (STCs). The dominant features of STCs, including their shape, are similar to the features of neural tuning curves (NTCs) recorded from single auditory nerve fibers. However, recent findings using reversible diuretics suggest that STCs do not provide the same measure of cochlear frequency selectivity as provided by NTCs. To determine if STCs are also insensitive to the adverse effects of excessive sounds, the present study exposed rabbits to a moderate-level noise that produced temporary threshold shift-like (TTS) effects on DPOAEs, and examined the influence of such exposures on STCs. DPOAEs were produced using primary tones with geometric-mean frequencies centered at 2.8 or 4 kHz, and with L1 and L2 values of 45/45, 50/35, 50/50, and 55/45 dB SPL. STCs were obtained before and during recovery for a period of approximately 2 h immediately following, and at 1, 2, 3, and 7 d post-exposure to a 2 kHz octave band noise, at levels and durations sufficient to cause significant but reversible reductions in DPOAE levels. STC data included tip center frequency, tip threshold, and Q10dB measures of tuning for suppression criteria of 3, 6, 9, and 12 dB. Recovery was variable between animals, but all rabbits recovered fully by 7 d post-exposure. STC center frequencies measured during the TTS typically tuned to a slightly higher frequency, while tip thresholds tended to decrease and Q10dB increase. Together, the results indicate that, despite similarities in the general properties of STCs and NTCs, these two types of tuning curves are affected differently following reversible cochlear insult.

Gap detection threshold in the rat before and after auditory cortex ablation.

PubMed

Syka, J; Rybalko, N; Mazelová, J; Druga, R

2002-10-01

Gap detection threshold (GDT) was measured in adult female pigmented rats (strain Long-Evans) by an operant conditioning technique with food reinforcement, before and after bilateral ablation of the auditory cortex. GDT was dependent on the frequency spectrum and intensity of the continuously present noise in which the gaps were embedded. The mean values of GDT for gaps embedded in white noise or low-frequency noise (upper cutoff frequency 3 kHz) at 70 dB sound pressure level (SPL) were 1.57+/-0.07 ms and 2.9+/-0.34 ms, respectively. Decreasing noise intensity from 80 dB SPL to 20 dB SPL produced a significant increase in GDT. The increase in GDT was relatively small in the range of 80-50 dB SPL for white noise and in the range of 80-60 dB for low-frequency noise. The minimal intensity level of the noise that enabled GDT measurement was 20 dB SPL for white noise and 30 dB SPL for low-frequency noise. Mean GDT values at these intensities were 10.6+/-3.9 ms and 31.3+/-4.2 ms, respectively. Bilateral ablation of the primary auditory cortex (complete destruction of the Te1 and partial destruction of the Te2 and Te3 areas) resulted in an increase in GDT values. The fifth day after surgery, the rats were able to detect gaps in the noise. The values of GDT observed at this time were 4.2+/-1.1 ms for white noise and 7.4+/-3.1 ms for low-frequency noise at 70 dB SPL. During the first month after cortical ablation, recovery of GDT was observed. However, 1 month after cortical ablation GDT still remained slightly higher than in controls (1.8+/-0.18 for white noise, 3.22+/-0.15 for low-frequency noise, P<0.05). A decrease in GDT values during the subsequent months was not observed.

Diffusion coefficients of rare earth elements in fcc Fe: A first-principles study

NASA Astrophysics Data System (ADS)

Wang, Haiyan; Gao, Xueyun; Ren, Huiping; Chen, Shuming; Yao, Zhaofeng

2018-01-01

The diffusion data and corresponding detailed insights are particularly important for the understanding of the related kinetic processes in Fe based alloys, e.g. solute strengthening, phase transition, solution treatment etc. We present a density function theory study of the diffusivity of self and solutes (La, Ce, Y and Nb) in fcc Fe. The five-frequency model was employed to calculate the microscopic parameters in the correlation factors of the solute diffusion. The interactions of the solutes with the first nearest-neighbor vacancy (1nn) are all attractive, and can be well understood on the basis of the combination of the strain-relief effects and the electronic effects. It is found that among the investigated species, Ce is the fastest diffusing solute in fcc Fe matrix followed by Nb, and the diffusion coefficients of these two solutes are about an order of magnitude higher than that of Fe self-diffusion. And the results show that the diffusion coefficient of La is slightly higher than that of Y, and both species are comparable to that of Fe self-diffusion.

Effects of CaCO3 treatment on the morphology, crystallinity, rheology and hydrolysis of gelatinized maize starch dispersions.

PubMed

Garcia-Diaz, S; Hernandez-Jaimes, C; Escalona-Buendia, H B; Bello-Perez, L A; Vernon-Carter, E J; Alvarez-Ramirez, J

2016-09-15

Using calcium salts instead of lime allows for an ecological nixtamalization of maize grains, where the negative contamination impact of the traditional lime nixtamalization is reduced. This work assessed the effects of calcium carbonate (0.0-2.0%w/w CaCO3) on the morphology, crystallinity, rheology and hydrolysis of gelatinized maize starch dispersions (GMSD). Microscopy analysis showed that CaCO3 changed the morphology of insoluble remnants (ghosts) and decreased the degree of syneresis. Analysis of particle size distribution showed a slight shift to smaller sizes as the CaCO3 was increased. Also, X-ray patterns indicated that crystallinity achieved a minimum value at CaCO3 concentration in the range of 1%w/w. GMSD with higher CaCO3 concentrations exhibited higher thixotropy area and complex viscoelastic behavior that was frequency dependent. A possible mechanism involved in the starch chain modification by CaCO3 is that starch may act as a weak acid ion exchanger capable of exchanging alcoholic group protons for cations (Ca(+2)). Copyright © 2016 Elsevier Ltd. All rights reserved.

Why do shape aftereffects increase with eccentricity?

PubMed

Gheorghiu, Elena; Kingdom, Frederick A A; Bell, Jason; Gurnsey, Rick

2011-12-20

Studies have shown that spatial aftereffects increase with eccentricity. Here, we demonstrate that the shape-frequency and shape-amplitude aftereffects, which describe the perceived shifts in the shape of a sinusoidal-shaped contour following adaptation to a slightly different sinusoidal-shaped contour, also increase with eccentricity. Why does this happen? We first demonstrate that the perceptual shift increases with eccentricity for stimuli of fixed sizes. These shifts are not attenuated by variations in stimulus size; in fact, at each eccentricity the degree of perceptual shift is scale-independent. This scale independence is specific to the aftereffect because basic discrimination thresholds (in the absence of adaptation) decrease as size increases. Structural aspects of the displays were found to have a modest effect on the degree of perceptual shift; the degree of adaptation depends modestly on distance between stimuli during adaptation and post-adaptation testing. There were similar temporal rates of decline of adaptation across the visual field and higher post-adaptation discrimination thresholds in the periphery than in the center. The observed results are consistent with greater sensitivity reduction in adapted mechanisms following adaptation in the periphery or an eccentricity-dependent increase in the bandwidth of the shape-frequency- and shape-amplitude-selective mechanisms.

The effects of neurotoxins on web-geometry and web-building behaviour in Araneus diadematus Cl.

PubMed

Hesselberg, Thomas; Vollrath, Fritz

2004-09-15

The process of orb weaving and the resultant orb web constitute a good example of a complex behavioural pattern that is still governed by a relatively simple set of rules. We used the orb spider Araneus diadematus as a model organism to study the effect of the three neurotoxins (scopolamine, amphetamine, and caffeine) on the spider's behaviour. Scopolamine was given at two concentrations, with the lower one showing no effects but the higher one reducing web-building frequency; there also appeared to be a weak effect on web geometry. Amphetamine and caffeine, on the other hand, both resulted in significant changes in both building frequency and web geometry, compared to the controls. Amphetamine webs retained their size but showed an increase in spiral spacing and radius irregularity, as well as a decrease in building efficiency. Caffeine led to a general decrease in size and a slight increase in spiral spacing, as well as radius irregularity. Furthermore, caffeine caused webs to be rounder. Our observations suggest that these neurotoxins disturb different parts of the web-building programme presumably by affecting different actions in the spider's CNS.

Shallow doping effect of ZnO treatment using atomic layer deposition process on p-type In0.53Ga0.47As

NASA Astrophysics Data System (ADS)

Lee, Changmin; An, Youngseo; Choi, Sungho; Kim, Hyoungsub

2018-06-01

The number of atomic layer deposition (ALD) cycles for ZnO treatment was changed to study its merits and demerits as a passivation layer prior to the deposition of a HfO2 film on a p-type In0.53Ga0.47As substrate. Even a few cycles of ZnO ALD treatment was effective in improving the capacitance–voltage (C–V) characteristics by suppressing strong Fermi-level pinning, which occurred because of a high interface state density near the lower half of the In0.53Ga0.47As band gap. Increases in the number of ZnO ALD cycles induced an increase in the minimum capacitance and response of minority carriers at higher frequencies in the inversion region of the C–V characteristics. According to various temperature- and frequency-dependent C–V analyses, these changes were explained by the shallow p-type doping effect of Zn atoms in the In0.53Ga0.47As substrate. As a disadvantage, ZnO ALD treatment caused a slight increase in the dielectric leakage current.

Characteristics of phonation onset in a two-layer vocal fold model.

PubMed

Zhang, Zhaoyan

2009-02-01

Characteristics of phonation onset were investigated in a two-layer body-cover continuum model of the vocal folds as a function of the biomechanical and geometric properties of the vocal folds. The analysis showed that an increase in either the body or cover stiffness generally increased the phonation threshold pressure and phonation onset frequency, although the effectiveness of varying body or cover stiffness as a pitch control mechanism varied depending on the body-cover stiffness ratio. Increasing body-cover stiffness ratio reduced the vibration amplitude of the body layer, and the vocal fold motion was gradually restricted to the medial surface, resulting in more effective flow modulation and higher sound production efficiency. The fluid-structure interaction induced synchronization of more than one group of eigenmodes so that two or more eigenmodes may be simultaneously destabilized toward phonation onset. At certain conditions, a slight change in vocal fold stiffness or geometry may cause phonation onset to occur as eigenmode synchronization due to a different pair of eigenmodes, leading to sudden changes in phonation onset frequency, vocal fold vibration pattern, and sound production efficiency. Although observed in a linear stability analysis, a similar mechanism may also play a role in register changes at finite-amplitude oscillations.

Photolysis of low concentration H2S under UV/VUV irradiation emitted from high frequency discharge electrodeless lamps.

PubMed

Xu, Jianhui; Li, Chaolin; Liu, Peng; He, Di; Wang, Jianfeng; Zhang, Qian

2014-08-01

The photolysis of low concentration of H2S malodorous gas was studied under UV irradiation emitted by self-made high frequency discharge electrodeless lamp with atomic mercury lines at 185/253.7nm. Experiments results showed that the removal efficiency (ηH2S) of H2S was decreased with increasing initial H2S concentration and increased slightly with gas residence time. ηH2S was increased dramatically with relative humidity from<5% to 43% while the concentration of oxygen in gas environments affected the removal of H2S. The mechanisms for direct and indirect photolysis (generation of ozone) were illustrated by the experimental results on photolysis of H2S under argon environments and ozonation of H2S under air environments, respectively. The overall ηH2S by photolysis is higher than the combination of ηH2S by direct photolysis and ozonation, suggesting that hydroxyl radical-mediated indirect photolysis played an important role during photolysis processes. The main photolysis product was confirmed to be SO4(2-) with ion chromatograph. Copyright © 2014 Elsevier Ltd. All rights reserved.

On periodic solutions of an Atwood's pendulum

NASA Astrophysics Data System (ADS)

Mittleman, Donald

1987-05-01

An Atwood's pendulum is defined as an Atwood's machine in which one of two masses is allowed to swing as a pendulum while the other remains constrained to move only in the vertical direction. The pendulum motion of the one mass induces a varying tension in the connecting wire; this, in turn, produces motion in the second mass. It is shown that this motion can be made periodic if the ratio of the two masses and the dependency of this ratio on the initial conditions are chosen as prescribed in this report. If this condition is not met, the motion consists of the superposition of two motions. The first is motion in a constant gravitational field where the effective gravity is kg; the factor k is determined explicitly. The second is the periodic motion that is the central theme of this report. During the course of the analysis, the fundamental frequency of the periodic motion is determined. It is shown to be slightly higher than the frequency of a pendulum of comparable length swinging in the Earth's gravitational field; the factor is given explicitly. This work is restricted to the extent that small approximations are introduced initially for trigonometric functions.

Health-related quality of life and mental health in the medium-term aftermath of the Prestige oil spill in Galiza (Spain): a cross-sectional study

PubMed Central

Carrasco, José Miguel; Pérez-Gómez, Beatriz; García-Mendizábal, Maria José; Lope, Virginia; Aragonés, Nuria; Forjaz, Maria João; Guallar-Castillón, Pilar; López-Abente, Gonzalo; Rodríguez-Artalejo, Fernando; Pollán, Marina

2007-01-01

Background In 2002 the oil-tanker Prestige sank off the Galician coast. This study analyzes the effect of this accident on health-related quality of life (HRQoL) and mental health in the affected population. Methods Using random sampling stratified by age and sex, 2700 residents were selected from 7 coastal and 7 inland Galician towns. Two exposure criteria were considered: a) residential exposure, i.e., coast versus interior; and b) individual exposure-unaffected, slightly affected, or seriously affected-according to degree of personal affectation. SF-36, GHQ-28, HADS and GADS questionnaires were used to assess HRQoL and mental health. Association of exposure with suboptimal scores was summarized using adjusted odds ratios (OR) obtained from logistic regression. Results For residential exposure, the SF-36 showed coastal residents as having a lower likelihood of registering suboptimal HRQoL values in physical functioning (OR:0.69; 95%CI:0.54–0.89) and bodily pain (OR:0.74; 95%CI:0.62–0.91), and a higher frequency of suboptimal scores in mental health (OR:1.28; 95%CI:1.02–1.58). None of the dimensions of the other questionnaires displayed statistically significant differences. For individual exposure, no substantial differences were observed, though the SF-36 physical functioning dimension rose (showed better scores) with level of exposure (91.51 unaffected, 93.86 slightly affected, 95.28 seriously affected, p < 0.001). Conclusion Almost one and a half years after the accident, worse HRQoL and mental health levels were not in evidence among subjects exposed to the oil-spill. Nevertheless, some of the scales suggest the possibility of slight impact on the mental health of residents in the affected areas. PMID:17875207

Evaluation of Dental Status of Adolescents at Kuwait University Dental Clinic.

PubMed

Ali, Dena A

2016-01-01

This study was designed to evaluate the dental status of adolescents initially presenting at Kuwait University Dental Clinic (KUDC). The purpose of this cross-sectional study was to evaluate (a) the prevalence of unrestored caries dentin among 12- to 16-year-old Kuwaiti residents, (b) the frequency of restorations extending into the inner half of the dentin, and (c) tooth loss pattern among this age group. Twelve- to 16-year-old patients who attended KUDC during the period January 2009 to December 2012 were included in this study. The total number of patients included in the study was 486; however, only 409 panoramic radiographs were available for evaluation. The Student t-test and one-way ANOVA were used for statistical analysis. The prevalence of unrestored dentin caries among 12- to 16-year-old patients was 52%. The frequency of deep restorations extending into the inner half of the dentin was 33%. Tooth loss was found in 8.0% of the sampled population. The most common missing tooth was the mandibular first molar followed by the mandibular second premolar and the maxillary first molar. There were no statistical differences between Kuwaiti and non-Kuwaiti residents regardless of gender; however, males had a slightly higher DMFT. The DMFT and DMFS values in this study were higher than in other studies. Despite the tremendous effort by the Kuwaiti government to improve oral health, comprehensive preventive strategies, dental treatment and maintenance of oral health are still necessary and must be reinforced in this age group.

The Effect of an Extreme and Prolonged Population Bottleneck on Patterns of Deleterious Variation: Insights from the Greenlandic Inuit.

PubMed

Pedersen, Casper-Emil T; Lohmueller, Kirk E; Grarup, Niels; Bjerregaard, Peter; Hansen, Torben; Siegismund, Hans R; Moltke, Ida; Albrechtsen, Anders

2017-02-01

The genetic consequences of population bottlenecks on patterns of deleterious genetic variation in human populations are of tremendous interest. Based on exome sequencing of 18 Greenlandic Inuit we show that the Inuit have undergone a severe ∼20,000-year-long bottleneck. This has led to a markedly more extreme distribution of allele frequencies than seen for any other human population tested to date, making the Inuit the perfect population for investigating the effect of a bottleneck on patterns of deleterious variation. When comparing proxies for genetic load that assume an additive effect of deleterious alleles, the Inuit show, at most, a slight increase in load compared to European, East Asian, and African populations. Specifically, we observe <4% increase in the number of derived deleterious alleles in the Inuit. In contrast, proxies for genetic load under a recessive model suggest that the Inuit have a significantly higher load (20% increase or more) compared to other less bottlenecked human populations. Forward simulations under realistic models of demography support our empirical findings, showing up to a 6% increase in the genetic load for the Inuit population across all models of dominance. Further, the Inuit population carries fewer deleterious variants than other human populations, but those that are present tend to be at higher frequency than in other populations. Overall, our results show how recent demographic history has affected patterns of deleterious variants in human populations. Copyright © 2017 by the Genetics Society of America.

Long-term fluctuation of standard automatic perimetry, pulsar perimetry and frequency-doubling technology in early glaucoma diagnosis.

PubMed

Gonzalez-Hernandez, M; de la Rosa, M Gonzalez; de la Vega, R Rodriguez; Hernandez-Vidal, A

2007-01-01

Analyze the stability and accuracy of 3 perimetric techniques. A total of 104 stable eyes (65 subjects) with ocular hypertension and early glaucoma [group G, mean defect = 1.08 dB, SD = 2.0, in standard TOP automatic perimetry (SAP)] were examined 5 times during 18 months using: (a) SAP; (b) Pulsar temporal modulation perimetry (T30W), and (c) frequency-doubling technology (FDT N30). Ninety eyes from 90 normal controls were compared with the first set of examinations of group G. The learning effect was minimal in the 3 techniques but higher in Pulsar (1.0 src, p < 0.05) than in SAP and FDT (0.4 dB). Long-term fluctuation (F) was significantly higher in FDT (3.1 dB, SD = 1.4, p < 0.0001) than in SAP (2.3 dB, SD = 1.1) and in Pulsar (1.9 src, SD = 0.7). Pulsar and FDT reduce F when increasing the number of examinations. F seems equivalent in SAP and FDT and lower in Pulsar, considering small-scale differences of the 3 perimeters. A slight learning effect would be expected on FDT and SAP in patients with previous experience with SAP. The stability and sensitivity of Pulsar is greater than on the other 2 systems. For early diagnosis of glaucoma it is essential to prove the reproducibility and coincidence of perimetric results. (c) 2007 S. Karger AG, Basel.

Effect of simulated climate warming on the morphological and physiological traits of Elsholtzia haichowensis in copper contaminated soil.

PubMed

Guan, Ming; Jin, Zexin; Li, Junmin; Pan, Xiaocui; Wang, Suizi; Li, Yuelin

2016-01-01

The aim of this study was to investigate the effects of temperature and Cu on the morphological and physiological traits of Elsholtzia haichowensis grown in soils amended with four Cu concentrations (0, 50, 500, and 1000 mg kg(-1)) under ambient temperature and slight warming. At the same Cu concentration, the height, shoot dry weight, total plant dry weight, and root morphological parameters such as length, surface area and tip number of E. haichowensis increased due to the slight warming. The net photosynthetic rate, stomatal conductance, transpiration, light use efficiency were also higher under the slight warming than under ambient temperature. The increased Cu concentrations, total Cu uptake, bioaccumulation factors and tolerance indexes of shoots and roots were also observed at the slight warming. The shoot dry weight, root dry weight, total plant dry weight and the bioaccumulation factors of shoots and roots at 50 mg Cu kg(-1) were significantly higher than those at 500 and 1000 mg Cu kg(-1) under the slight warming. Therefore, the climate warming may improve the ability of E. haichowensis to phytoremediate Cu-contaminated soil, and the ability improvement greatly depended on the Cu concentrations in soils.

Responses of cerebral GABA-containing CBM neuron to taste stimulation with seaweed extracts in Aplysia kurodai.

PubMed

Narusuye, Kenji; Kinugawa, Aiko; Nagahama, Tatsumi

2005-11-01

Aplysia kurodai distributed along Japan feeds well on Ulva pertusa but rejects Gelidium amansii with distinctive patterned movements of the jaws and radula. On the ventral side of the cerebral M cluster, four cell bodies of higher order neurons that send axons to the buccal ganglia are distributed (CBM neurons). We have previously shown that the dopaminergic CBM1 modulates basic feeding circuits in the buccal ganglia for rejection by firing at higher frequency after application of the aversive taste of seaweed such as Gelidium amansii. In the present experiments immunohistochemical techniques showed that the CBM3 exhibited gamma-aminobutyric acid (GABA)-like immunoreactivity. The CBM3 may be equivalent to the CBI-3 involved in changing the motor programs from rejection to ingestion in Aplysia californica. The responses of the CBM3 to taste stimulation of the lips with seaweed extracts were investigated by the use of calcium imaging. The calcium-sensitive dye, Calcium Green-1, was iontophoretically introduced into a cell body of the CBM3 using a microelectrode. Application of Ulva pertusa or Gelidium amansii extract induced different changes in fluorescence in the CBM3 cell body, indicating that taste of Ulva pertusa initially induced longer-lasting continuous spike responses at slightly higher frequency compared with that of Gelidium amansii. Considering a role of the CBM3 in the pattern selection, these results suggest that elongation of the initial firing response may be a major factor for the CBM3 to switch the buccal motor programs from rejection to ingestion after application of different tastes of seaweeds in Aplysia kurodai. (c) 2005 Wiley Periodicals, Inc.

Sports participation and quality of life in adolescents and young adults with congenital heart disease.

PubMed

Dean, Peter N; Gillespie, Catherine W; Greene, Elizabeth Anne; Pearson, Gail D; Robb, Adelaide S; Berul, Charles I; Kaltman, Jonathan R

2015-01-01

Adolescents and young adults with congenital heart disease (CHD) are often restricted from physical activity and sports participation, which may have adverse effects. To determine the amount of physical activity, type of sports participation, and reasons for sports restrictions, and to evaluate the effect of sports participation on quality of life (QoL) in a cohort of patients with CHD. Individuals with CHD aged 13-30 years were recruited at outpatient visits or via mailings. They completed a questionnaire addressing physical activity, sports participation, sports restrictions, and QoL (Pediatric Quality of Life Inventory). We also reviewed the patient's medical record. Of the 177 patients who responded (mean age 20 years), 31% have mild CHD, 40% have moderate CHD, and 29% have severe CHD. In the cohort, 52% participate in competitive sports, 25% recreational sports, and 23% no sports. Among patients with severe CHD, 29% participate in competitive sports that would be restricted by published guidelines (36th Bethesda Conference). After controlling for age, sex, CHD severity, residual hemodynamic disease, and comorbidities, participation in competitive sports and increased frequency of physical activity are independently associated with a higher QoL (P = .003 and P = .001, respectively). In an identical model, competitive sports participation and frequency of physical activity are associated with higher maximum predicted oxygen consumption (VO2 ) (n = 40; P = .002 and .02) and slightly lower body mass index (BMI) (P = .02 and .01). All findings were similar when analyses were stratified by recruitment method. Patients with CHD commonly participate in competitive sports, and such participation is associated with higher QoL, improved exercise capacity, and lower BMI. © 2014 Wiley Periodicals, Inc.

English speech sound development in preschool-aged children from bilingual English-Spanish environments.

PubMed

Gildersleeve-Neumann, Christina E; Kester, Ellen S; Davis, Barbara L; Peña, Elizabeth D

2008-07-01

English speech acquisition by typically developing 3- to 4-year-old children with monolingual English was compared to English speech acquisition by typically developing 3- to 4-year-old children with bilingual English-Spanish backgrounds. We predicted that exposure to Spanish would not affect the English phonetic inventory but would increase error frequency and type in bilingual children. Single-word speech samples were collected from 33 children. Phonetically transcribed samples for the 3 groups (monolingual English children, English-Spanish bilingual children who were predominantly exposed to English, and English-Spanish bilingual children with relatively equal exposure to English and Spanish) were compared at 2 time points and for change over time for phonetic inventory, phoneme accuracy, and error pattern frequencies. Children demonstrated similar phonetic inventories. Some bilingual children produced Spanish phonemes in their English and produced few consonant cluster sequences. Bilingual children with relatively equal exposure to English and Spanish averaged more errors than did bilingual children who were predominantly exposed to English. Both bilingual groups showed higher error rates than English-only children overall, particularly for syllable-level error patterns. All language groups decreased in some error patterns, although the ones that decreased were not always the same across language groups. Some group differences of error patterns and accuracy were significant. Vowel error rates did not differ by language group. Exposure to English and Spanish may result in a higher English error rate in typically developing bilinguals, including the application of Spanish phonological properties to English. Slightly higher error rates are likely typical for bilingual preschool-aged children. Change over time at these time points for all 3 groups was similar, suggesting that all will reach an adult-like system in English with exposure and practice.

Off-equatorial current-driven instabilities ahead of approaching dipolarization fronts

NASA Astrophysics Data System (ADS)

Zhang, Xu; Angelopoulos, V.; Pritchett, P. L.; Liu, Jiang

2017-05-01

Recent kinetic simulations have revealed that electromagnetic instabilities near the ion gyrofrequency and slightly away from the equatorial plane can be driven by a current parallel to the magnetic field prior to the arrival of dipolarization fronts. Such instabilities are important because of their potential contribution to global electromagnetic energy conversion near dipolarization fronts. Of the several instabilities that may be consistent with such waves, the most notable are the current-driven electromagnetic ion cyclotron instability and the current-driven kink-like instability. To confirm the existence and characteristics of these instabilities, we used observations by two Time History of Events and Macroscale Interactions during Substorms satellites, one near the neutral sheet observing dipolarization fronts and the other at the boundary layer observing precursor waves and currents. We found that such instabilities with monochromatic signatures are rare, but one of the few cases was selected for further study. Two different instabilities, one at about 0.3 Hz and the other at a much lower frequency, 0.02 Hz, were seen in the data from the off-equatorial spacecraft. A parallel current attributed to an electron beam coexisted with the waves. Our instability analysis attributes the higher-frequency instability to a current-driven ion cyclotron instability and the lower frequency instability to a kink-like instability. The current-driven kink-like instability we observed is consistent with the instabilities observed in the simulation. We suggest that the currents needed to excite these low-frequency instabilities are so intense that the associated electron beams are easily thermalized and hence difficult to observe.

Characteristics of haze and the atmospheric boundary layer height during the periods with different category of haze over Suzhou observed by Micro-Pulse Lidar

NASA Astrophysics Data System (ADS)

Huijuan, L.

2015-12-01

Based on the observed hourly meterological data, atmospheric composition data, and the Micro-Pulse Lidar (MPL) detecting data over Suzhou during 2010 to 2014, this study concentrates on revealing the characteristics of haze weather and the atmospheric boundary layer height during the periods with different category of haze over Suzhou. The main results are shown as follows: The haze frequency over Suzhou is 30.9% with the frequency of 18% for the slight haze, 7.8% for the light haze, 3.1% for the moderate haze and 2.0% for the heavy haze. The haze frequency shows an obvious diurnal variation with a peak (valley) value at the local solar time around 08:00~09:00 am (14:00~16:00pm).The haze happens much more frequent in nighttime than in daytime. The atmospheric boundary layer height (ABLH) associated with haze also shows a clear diurnal variation. The mean ABLH over Suzhou during the period of haze is more (less) than 1000m (500m) in daytime (nighttime). Meanwhile, the ABLH during the period of haze is higher in summer than in winter. In addition, the mean ABLH during the period without (with) haze is around 700m (500m) in winter. The diurnal variation of the ABLH during the period of moderate to heavy haze in winter ranges from 350m to 500m, which is less than the winter mean ABLH by 50~150m. KEY WORDS: Micro-Pulse Lidar; haze frequency; moderate and heavy haze；atmospheric boundary layer height

The norms and variances of the Gabor, Morlet and general harmonic wavelet functions

NASA Astrophysics Data System (ADS)

Simonovski, I.; Boltežar, M.

2003-07-01

This paper deals with certain properties of the continuous wavelet transform and wavelet functions. The norms and the spreads in time and frequency of the common Gabor and Morlet wavelet functions are presented. It is shown that the norm of the Morlet wavelet function does not satisfy the normalization condition and that the normalized Morlet wavelet function is identical to the Gabor wavelet function with the parameter σ=1. The general harmonic wavelet function is developed using frequency modulation of the Hanning and Hamming window functions. Several properties of the general harmonic wavelet function are also presented and compared to the Gabor wavelet function. The time and frequency spreads of the general harmonic wavelet function are only slightly higher than the time and frequency spreads of the Gabor wavelet function. However, the general harmonic wavelet function is simpler to use than the Gabor wavelet function. In addition, the general harmonic wavelet function can be constructed in such a way that the zero average condition is truly satisfied. The average value of the Gabor wavelet function can approach a value of zero but it cannot reach it. When calculating the continuous wavelet transform, errors occur at the start- and the end-time indexes. This is called the edge effect and is caused by the fact that the wavelet transform is calculated from a signal of finite length. In this paper, we propose a method that uses signal mirroring to reduce the errors caused by the edge effect. The success of the proposed method is demonstrated by using a simulated signal.

Obesity is associated with a higher prevalence of musculoskeletal pain in middle-aged women.

PubMed

Blümel, Juan Enrique; Arteaga, Eugenio; Mezones-Holguín, Edward; Zúñiga, María Cristina; Witis, Silvina; Vallejo, María Soledad; Tserotas, Konstantino; Sánchez, Hugo; Onatra, William; Ojeda, Eliana; Mostajo, Desiree; Monterrosa, Alvaro; Lima, Selva; Martino, Mabel; Hernández-Bueno, Jose Alberto; Gómez, Gustavo; Espinoza, María Teresa; Flores, Daniel; Chedraui, Peter; Calle, Andrés; Bravo, Luz María; Benítez, Zully; Bencosme, Ascanio; Barón, Germán

2017-05-01

Musculoskeletal pain (MSP) has been recently linked with high plasma leptin levels. Our objective was to study if obese women, who have higher leptin levels, could have a higher frequency of MSP. We studied 6079 Latin-American women, 40-59 years old. Their epidemiological data were recorded and the Menopause Rating Scale (MRS), Golberg Anxiety and Depression Scale and Insomnia Scale were applied. MSP was defined as a score ≥2 on MRS11. Women with MSP were slightly older, had fewer years of schooling and were more sedentary. They also complained of more severe menopausal symptoms (29.2% versus. 4.4%, p < 0.0001). Furthermore, they had a higher abdominal perimeter (87.2 ± 12.0 cm versus 84.6 ± 11.6 cm, p < 0.0001) and a higher prevalence of obesity (23.1% versus 15.2%, p < 0.0001). Compared to normal weight women, those with low body weight (IMC <18.5) showed a lower risk of MSP (OR 0.71; 95%CI, 0.42-1.17), overweight women had a higher risk (OR 1.64; 95%CI, 1.44-1.87) and obese women the highest risk (OR 2.06; 95%CI, 1.76-2.40). Logistic regression analysis showed that obesity is independently associated to MSP (OR 1.34; 95%CI, 1.16-1.55). We conclude that obesity is one identifiable risk factor for MSP in middle-aged women.

The combined effect of hypoxia and nutritional status on metabolic and ionoregulatory responses of common carp (Cyprinus carpio).

PubMed

Moyson, Sofie; Liew, Hon Jung; Diricx, Marjan; Sinha, Amit Kumar; Blust, Ronny; De Boeck, Gudrun

2015-01-01

In the present study, the combined effects of hypoxia and nutritional status were examined in common carp (Cyprinus carpio), a relatively hypoxia tolerant cyprinid. Fish were either fed or fasted and were exposed to hypoxia (1.5-1.8mg O2L(-1)) at or slightly above their critical oxygen concentration during 1, 3 or 7days followed by a 7day recovery period. Ventilation initially increased during hypoxia, but fasted fish had lower ventilation frequencies than fed fish. In fed fish, ventilation returned to control levels during hypoxia, while in fasted fish recovery only occurred after reoxygenation. Due to this, C. carpio managed, at least in part, to maintain aerobic metabolism during hypoxia: muscle and plasma lactate levels remained relatively stable although they tended to be higher in fed fish (despite higher ventilation rates). However, during recovery, compensatory responses differed greatly between both feeding regimes: plasma lactate in fed fish increased with a simultaneous breakdown of liver glycogen indicating increased energy use, while fasted fish seemed to economize energy and recycle decreasing plasma lactate levels into increasing liver glycogen levels. Protein was used under both feeding regimes during hypoxia and subsequent recovery: protein levels reduced mainly in liver for fed fish and in muscle for fasted fish. Overall, nutritional status had a greater impact on energy reserves than the lack of oxygen with a lower hepatosomatic index and lower glycogen stores in fasted fish. Fasted fish transiently increased Na(+)/K(+)-ATPase activity under hypoxia, but in general ionoregulatory balance proved to be only slightly disturbed, showing that sufficient energy was left for ion regulation. Copyright © 2014 Elsevier Inc. All rights reserved.

Ground failure in the 2001 Mw 8.4 southern Peru earthquake

NASA Astrophysics Data System (ADS)

Rondinel-Oviedo, Efrain Alejandro

On June 23rd 2001 a moment magnitude (M W) 8.4, earthquake shook the southern portion of Peru. This rare large-magnitude event provided a unique opportunity to develop a suite of high quality case histories and also to test and calibrate existing geotechnical earthquake engineering analysis procedures and models against observations from the earthquake. The work presented in this thesis is focused on three topics pertaining to ground failure (i.e., the permanent deformation of the ground resulting from an earthquake) observed during the event: (1) surface ground damage in small basin geometries, (2) seismic compression, and (3) performance of a concrete faced rockfill dam (CFRD) dam. Surface ground strain damage patterns in small basin geometries has previously been typically studied at the large (i.e., geological) scale, but not at the scale of civil engineering infrastructure. During seismic events basin geometries containing soft material confined by stiffer material trap the seismic waves and generate surface waves that travel on the ground along the soft material. Numerical modeling shows that surface waves are generated at basin edges and travel on the ground creating higher duration, higher response (peak ground acceleration, PGA), higher energy (Arias Intensity) and higher angular distortion, especially in zones close to the edges. The impedance contrast between the stiff material and the soft material, and the dip angle play an important role in basin response. Seismic compression (i.e., the shaking induced densification of unsaturated soil) was observed in many highway embankments in the region of the earthquake. In many instances, this phenomenon was exasperated by soil-structure interaction with adjacent bridge or culvert structures. Numerical modeling conducted as part of this research showed (i) a significantly different response when the structure (culvert) is considered, (ii) impedance contrast plays a role in the system responses, and (iii) low horizontal stresses are observed when the peak of the shear strain occurs. It is believed that the effect of low confining stresses was responsible for the large amounts of settlement observed, and which was not directly captured by classical seismic compression models. The third topic of study considered evaluates the performance of a concrete faced rockfill dam (CFRD) dam in the earthquake. Analysis considered the effect of the time, PGA of rock, and change in amplification ratio with PGA. It appears that the natural frequency of the dam increases with time in the transversal direction and slightly decreases in the longitudinal direction. It is believed that the increase in the natural frequency might be associated with change in the dam stiffness (i.e. densification) with time. However, reason for the slight decrease in the longitudinal direction is not clear and requires further research.

Tilt and Translation Motion Perception during Off Vertical Axis Rotation

NASA Technical Reports Server (NTRS)

Wood, Scott J.; Reschke, Millard F.; Clement, Gilles

2006-01-01

The effect of stimulus frequency on tilt and translation motion perception was studied during constant velocity off-vertical axis rotation (OVAR), and compared to the effect of stimulus frequency on eye movements. Fourteen healthy subjects were rotated in darkness about their longitudinal axis 10deg and 20deg off-vertical at 0.125 Hz, and 20deg offvertical at 0.5 Hz. Oculomotor responses were recorded using videography, and perceived motion was evaluated using verbal reports and a joystick with four degrees of freedom (pitch and roll tilt, mediallateral and anteriorposterior translation). During the lower frequency OVAR, subjects reported the perception of progressing along the edge of a cone. During higher frequency OVAR, subjects reported the perception of progressing along the edge of an upright cylinder. The modulation of both tilt recorded from the joystick and ocular torsion significantly increased as the tilt angle increased from 10deg to 20deg at 0.125 Hz, and then decreased at 0.5 Hz. Both tilt perception and torsion slightly lagged head orientation at 0.125 Hz. The phase lag of torsion increased at 0.5 Hz, while the phase of tilt perception did not change as a function of frequency. The amplitude of both translation perception recorded from the joystick and horizontal eye movements was negligible at 0.125 Hz and increased as a function of stimulus frequency. While the phase lead of horizontal eye movements decreased at 0.5 Hz, the phase of translation perception did not vary with stimulus frequency and was similar to the phase of tilt perception during all conditions. During dynamic linear acceleration in the absence of other sensory input (canal, vision) a change in stimulus frequency alone elicits similar changes in the amplitude of both self motion perception and eye movements. However, in contrast to the eye movements, the phase of both perceived tilt and translation motion is not altered by stimulus frequency. We conclude that the neural processing to distinguish tilt and translation linear acceleration stimuli differs between eye movements and motion perception.

Impact of sampling strategy on stream load estimates in till landscape of the Midwest

USGS Publications Warehouse

Vidon, P.; Hubbard, L.E.; Soyeux, E.

2009-01-01

Accurately estimating various solute loads in streams during storms is critical to accurately determine maximum daily loads for regulatory purposes. This study investigates the impact of sampling strategy on solute load estimates in streams in the US Midwest. Three different solute types (nitrate, magnesium, and dissolved organic carbon (DOC)) and three sampling strategies are assessed. Regardless of the method, the average error on nitrate loads is higher than for magnesium or DOC loads, and all three methods generally underestimate DOC loads and overestimate magnesium loads. Increasing sampling frequency only slightly improves the accuracy of solute load estimates but generally improves the precision of load calculations. This type of investigation is critical for water management and environmental assessment so error on solute load calculations can be taken into account by landscape managers, and sampling strategies optimized as a function of monitoring objectives. ?? 2008 Springer Science+Business Media B.V.

A new quadrature annular resonator for 3 T MRI based on artificial-dielectrics.

PubMed

Mikhailovskaya, Anna A; Shchelokova, Alena V; Dobrykh, Dmitry A; Sushkov, Ivan V; Slobozhanyuk, Alexey P; Webb, Andrew

2018-06-01

Dielectric resonators have previously been constructed for ultra-high frequency magnetic resonance imaging and microscopy. However, it is challenging to design these dielectric resonators at clinical field strengths due to their intrinsically large dimensions, especially when using materials with moderate permittivity. Here we propose and characterize a novel approach using artificial-dielectrics which reduces substantially the required outer diameter of the resonator. For a resonator designed to operate in a 3 Tesla scanner using water as the dielectric, a reduction in outer diameter of 37% was achieved. When used in an inductively-coupled wireless mode, the sensitivity of the artificial-dielectric resonator was measured to be slightly higher than that of a standard dielectric resonator operating in its degenerate circularly-polarized hybrid electromagnetic modes (HEM 11 ). This study demonstrates the first application of an artificial-dielectric approach to MR volume coil design. Copyright © 2018 Elsevier Inc. All rights reserved.

Channel Measurement and Modeling for 5G Urban Microcellular Scenarios.

PubMed

Peter, Michael; Weiler, Richard J; Göktepe, Barış; Keusgen, Wilhelm; Sakaguchi, Kei

2016-08-20

In order to support the development of channel models for higher frequency bands, multiple urban microcellular measurement campaigns have been carried out in Berlin, Germany, at 60 and 10 GHz. In this paper, the collected data is uniformly analyzed with focus on the path loss (PL) and the delay spread (DS). It reveals that the ground reflection has a dominant impact on the fading behavior. For line-of-sight conditions, the PL exponents are close to free space propagation at 60 GHz, but slightly smaller (1.62) for the street canyon at 10 GHz. The DS shows a clear dependence on the scenario (median values between 16 and 38 ns) and a strong distance dependence for the open square and the wide street canyon. The dependence is less distinct for the narrow street canyon with residential buildings. This behavior is consistent with complementary ray tracing simulations, though the simplified model tends to overestimate the DS.

A new quadrature annular resonator for 3 T MRI based on artificial-dielectrics

NASA Astrophysics Data System (ADS)

Mikhailovskaya, Anna A.; Shchelokova, Alena V.; Dobrykh, Dmitry A.; Sushkov, Ivan V.; Slobozhanyuk, Alexey P.; Webb, Andrew

2018-06-01

Dielectric resonators have previously been constructed for ultra-high frequency magnetic resonance imaging and microscopy. However, it is challenging to design these dielectric resonators at clinical field strengths due to their intrinsically large dimensions, especially when using materials with moderate permittivity. Here we propose and characterize a novel approach using artificial-dielectrics which reduces substantially the required outer diameter of the resonator. For a resonator designed to operate in a 3 Tesla scanner using water as the dielectric, a reduction in outer diameter of 37% was achieved. When used in an inductively-coupled wireless mode, the sensitivity of the artificial-dielectric resonator was measured to be slightly higher than that of a standard dielectric resonator operating in its degenerate circularly-polarized hybrid electromagnetic modes (HEM11). This study demonstrates the first application of an artificial-dielectric approach to MR volume coil design.

Investigation of Al Coated Mg for Biomedical Applications

NASA Astrophysics Data System (ADS)

Elmrabet, Nabila; Roe, Martin; Neate, Nigel; Grant, David M.; Brown, Paul D.

The corrosion resistant properties of 1-2 μm thick Al coatings deposited by radio frequency magnetron sputtering on polished Mg surfaces, within Ar and Ar/H2 environments, have been appraised. The coatings were heat-treated at 300°C for 5 h to induce the formation of bioinert Al2O3, and samples were corroded within phosphate buffered saline solution at 37°C to mimic the biological environment. Both the as-deposited and heat-treated coatings were found to delay the onset of corrosion, but showed higher initial corrosion rates, once established, as compared with polished Mg surfaces. Slightly improved performance of the coatings was achieved through the addition of H2 to the system which acted to inhibit Al-Mg alloying and MgO formation. However, localized accelerated corrosion associated with substrate polishing damage emphasized the need for improved process control and coating uniformity.

An investigation of the reduction of carbon dioxide in a silent electric discharge

NASA Technical Reports Server (NTRS)

Luce, R. S.; Greenough, B. (Editor)

1978-01-01

The reduction of CO2 to O2 and CO in a silent electric discharge was studied. It was found that current alone (in the ionized plasma induced by the silent electric discharge) was reponsible for the CO2 reduction process. Voltage and frequency were important only in so far as they induced current in the plasma. Pressure and temperature were of minimum influence in the process. The large power consumption in the process was recognized as resulting from the low power factor of the reactor vessel which electrically behaved like a capacitor. The power factor was subsequently improved by adding an inductive element to make the reactor vessel capacitance part of a resonant circuit. It was found that the CO2 reduction process was most efficient in terms of power vs reduction rate when a voltage was employed that was only slightly higher than that needed to induce the plasma.

Zero energy-storage ballast for compact fluorescent lamps

DOEpatents

Schultz, W.N.; Thomas, R.J.

1999-08-31

A CFL ballast includes complementary-type switching devices connected in series with their gates connected together at a control node. The switching devices supply a resonant tank circuit which is tuned to a frequency near, but slightly lower than, the resonant frequency of a resonant control circuit. As a result, the tank circuit restarts oscillations immediately following each zero crossing of the bus voltage. Such rapid restarts avoid undesirable flickering while maintaining the operational advantages and high efficacy of the CFL ballast. 4 figs.

Zero energy-storage ballast for compact fluorescent lamps

DOEpatents

Schultz, William Newell; Thomas, Robert James

1999-01-01

A CFL ballast includes complementary-type switching devices connected in series with their gates connected together at a control node. The switching devices supply a resonant tank circuit which is tuned to a frequency near, but slightly lower than, the resonant frequency of a resonant control circuit. As a result, the tank circuit restarts oscillations immediately following each zero crossing of the bus voltage. Such rapid restarts avoid undesirable flickering while maintaining the operational advantages and high efficacy of the CFL ballast.

Intracavity brillouin scattering from passive Q-spoiling cells.

PubMed

Wick, R V; Guenther, A H

1968-01-01

Stimulated Brillouin scattering from the methanol solvent used in conjunction with cryptocyanine bleachable dye in a ruby laser cavity has been observed at low megawatt output powers. The frequency shifts of the Brillouin scattered radiation produced within the laser cavity are slightly less than frequency shifts produced in an external methanol cell. The Brillouin radiation was eliminated even at output power levels in excess of 250 MW when a 3-mm length cell was used in place of the 25.4-mm commercial cell.

Nonlinear beat excitation of low frequency wave in degenerate plasmas

NASA Astrophysics Data System (ADS)

Mir, Zahid; Shahid, M.; Jamil, M.; Rasheed, A.; Shahbaz, A.

2018-03-01

The beat phenomenon due to the coupling of two signals at slightly different frequencies that generates the low frequency signal is studied. The linear dispersive properties of the pump and sideband are analyzed. The modified nonlinear dispersion relation through the field coupling of linear modes against the beat frequency is derived in the homogeneous quantum dusty magnetoplasmas. The dispersion relation is used to derive the modified growth rate of three wave parametric instability. Moreover, significant quantum effects of electrons through the exchange-correlation potential, the Bohm potential, and the Fermi pressure evolved in macroscopic three wave interaction are presented. The analytical results are interpreted graphically describing the significance of the work. The applications of this study are pointed out at the end of introduction.

Method for ambiguity resolution in range-Doppler measurements

NASA Technical Reports Server (NTRS)

Heymsfield, Gerald M. (Inventor); Miller, Lee S. (Inventor)

1994-01-01

A method for resolving range and Doppler target ambiguities when the target has substantial range or has a high relative velocity in which a first signal is generated and a second signal is also generated which is coherent with the first signal but at a slightly different frequency such that there exists a difference in frequency between these two signals of Delta f(sub t). The first and second signals are converted into a dual-frequency pulsed signal, amplified, and the dual-frequency pulsed signal is transmitted towards a target. A reflected dual-frequency signal is received from the target, amplified, and changed to an intermediate dual-frequency signal. The intermediate dual-frequency signal is amplified, with extracting of a shifted difference frequency Delta f(sub r) from the amplified intermediate dual-frequency signal done by a nonlinear detector. The final step is generating two quadrature signals from the difference frequency Delta f(sub t) and the shifted difference frequency Delta f(sub r) and processing the two quadrature signals to determine range and Doppler information of the target.

An Observational Study of Social and Emotional Support in Smoking Cessation Twitter Accounts: Content Analysis of Tweets

PubMed Central

Rocheleau, Mary; Baquis, Kate; Stahl, Hannah; Kinney, Rebecca L; Pagoto, Sherry L; Houston, Thomas K

2015-01-01

Background Smoking continues to be the number one preventable cause of premature death in the United States. While evidence for the effectiveness of smoking cessation interventions has increased rapidly, questions remain on how to effectively disseminate these findings. Twitter, the second largest online social network, provides a natural way of disseminating information. Health communicators can use Twitter to inform smokers, provide social support, and attract them to other interventions. A key challenge for health researchers is how to frame their communications to maximize the engagement of smokers. Objective Our aim was to examine current Twitter activity for smoking cessation. Methods Active smoking cessation related Twitter accounts (N=18) were identified. Their 50 most recent tweets were content coded using a schema adapted from the Roter Interaction Analysis System (RIAS), a theory-based, validated coding method. Using negative binomial regression, the association of number of followers and frequency of individual tweet content at baseline was assessed. The difference in followership at 6 months (compared to baseline) to the frequency of tweet content was compared using linear regression. Both analyses were adjusted by account type (organizational or not organizational). Results The 18 accounts had 60,609 followers at baseline and 68,167 at 6 months. A total of 24% of tweets were socioemotional support (mean 11.8, SD 9.8), 14% (mean 7, SD 8.4) were encouraging/engagement, and 62% (mean 31.2, SD 15.2) were informational. At baseline, higher frequency of socioemotional support and encouraging/engaging tweets was significantly associated with higher number of followers (socioemotional: incident rate ratio [IRR] 1.09, 95% CI 1.02-1.20; encouraging/engaging: IRR 1.06, 95% CI 1.00-1.12). Conversely, higher frequency of informational tweets was significantly associated with lower number of followers (IRR 0.95, 95% CI 0.92-0.98). At 6 months, for every increase by 1 in socioemotional tweets, the change in followership significantly increased by 43.94 (P=.027); the association was slightly attenuated after adjusting by account type and was not significant (P=.064). Conclusions Smoking cessation activity does exist on Twitter. Preliminary findings suggest that certain content strategies can be used to encourage followership, and this needs to be further investigated. PMID:25589009

An observational study of social and emotional support in smoking cessation Twitter accounts: content analysis of tweets.

PubMed

Rocheleau, Mary; Sadasivam, Rajani Shankar; Baquis, Kate; Stahl, Hannah; Kinney, Rebecca L; Pagoto, Sherry L; Houston, Thomas K

2015-01-14

Smoking continues to be the number one preventable cause of premature death in the United States. While evidence for the effectiveness of smoking cessation interventions has increased rapidly, questions remain on how to effectively disseminate these findings. Twitter, the second largest online social network, provides a natural way of disseminating information. Health communicators can use Twitter to inform smokers, provide social support, and attract them to other interventions. A key challenge for health researchers is how to frame their communications to maximize the engagement of smokers. Our aim was to examine current Twitter activity for smoking cessation. Active smoking cessation related Twitter accounts (N=18) were identified. Their 50 most recent tweets were content coded using a schema adapted from the Roter Interaction Analysis System (RIAS), a theory-based, validated coding method. Using negative binomial regression, the association of number of followers and frequency of individual tweet content at baseline was assessed. The difference in followership at 6 months (compared to baseline) to the frequency of tweet content was compared using linear regression. Both analyses were adjusted by account type (organizational or not organizational). The 18 accounts had 60,609 followers at baseline and 68,167 at 6 months. A total of 24% of tweets were socioemotional support (mean 11.8, SD 9.8), 14% (mean 7, SD 8.4) were encouraging/engagement, and 62% (mean 31.2, SD 15.2) were informational. At baseline, higher frequency of socioemotional support and encouraging/engaging tweets was significantly associated with higher number of followers (socioemotional: incident rate ratio [IRR] 1.09, 95% CI 1.02-1.20; encouraging/engaging: IRR 1.06, 95% CI 1.00-1.12). Conversely, higher frequency of informational tweets was significantly associated with lower number of followers (IRR 0.95, 95% CI 0.92-0.98). At 6 months, for every increase by 1 in socioemotional tweets, the change in followership significantly increased by 43.94 (P=.027); the association was slightly attenuated after adjusting by account type and was not significant (P=.064). Smoking cessation activity does exist on Twitter. Preliminary findings suggest that certain content strategies can be used to encourage followership, and this needs to be further investigated.

Horizontal vestibuloocular reflex evoked by high-acceleration rotations in the squirrel monkey. II. Responses after canal plugging

NASA Technical Reports Server (NTRS)

Lasker, D. M.; Backous, D. D.; Lysakowski, A.; Davis, G. L.; Minor, L. B.

1999-01-01

The horizontal angular vestibuloocular reflex (VOR) evoked by high-frequency, high-acceleration rotations was studied in four squirrel monkeys after unilateral plugging of the three semicircular canals. During the period (1-4 days) that animals were kept in darkness after plugging, the gain during steps of acceleration (3, 000 degrees /s(2), peak velocity = 150 degrees /s) was 0.61 +/- 0.14 (mean +/- SD) for contralesional rotations and 0.33 +/- 0.03 for ipsilesional rotations. Within 18-24 h after animals were returned to light, the VOR gain for contralesional rotations increased to 0. 88 +/- 0.05, whereas there was only a slight increase in the gain for ipsilesional rotations to 0.37 +/- 0.07. A symmetrical increase in the gain measured at the plateau of head velocity was noted after animals were returned to light. The latency of the VOR was 8.2 +/- 0. 4 ms for ipsilesional and 7.1 +/- 0.3 ms for contralesional rotations. The VOR evoked by sinusoidal rotations of 0.5-15 Hz, +/-20 degrees /s had no significant half-cycle asymmetries. The recovery of gain for these responses after plugging was greater at lower than at higher frequencies. Responses to rotations at higher velocities for frequencies >/=4 Hz showed an increase in contralesional half-cycle gain, whereas ipsilesional half-cycle gain was unchanged. A residual response that appeared to be canal and not otolith mediated was noted after plugging of all six semicircular canals. This response increased with frequency to reach a gain of 0.23 +/- 0.03 at 15 Hz, resembling that predicted based on a reduction of the dominant time constant of the canal to 32 ms after plugging. A model incorporating linear and nonlinear pathways was used to simulate the data. The coefficients of this model were determined from data in animals with intact vestibular function. Selective increases in the gain for the linear and nonlinear pathways predicted the changes in recovery observed after canal plugging. An increase in gain of the linear pathway accounted for the recovery in VOR gain for both responses at the velocity plateau of the steps of acceleration and for the sinusoidal rotations at lower peak velocities. The increase in gain for contralesional responses to steps of acceleration and sinusoidal rotations at higher frequencies and velocities was due to an increase in the gain of the nonlinear pathway. This pathway was driven into inhibitory cutoff at low velocities and therefore made no contribution for rotations toward the ipsilesional side.

Free vibration of rectangular plates with a small initial curvature

NASA Technical Reports Server (NTRS)

Adeniji-Fashola, A. A.; Oyediran, A. A.

1988-01-01

The method of matched asymptotic expansions is used to solve the transverse free vibration of a slightly curved, thin rectangular plate. Analytical results for natural frequencies and mode shapes are presented in the limit when the dimensionless bending rigidity, epsilon, is small compared with in-plane forces. Results for different boundary conditions are obtained when the initial deflection is: (1) a polynomial in both directions, and (2) the product of a polynomial and a trigonometric function, and arbitrary. For the arbitrary initial deflection case, the Fourier series technique is used to define the initial deflection. The results obtained show that the natural frequencies of vibration of slightly curved plates are coincident with those of perfectly flat, prestressed rectangular plates. However, the eigenmodes are very different from those of initially flat prestressed rectangular plates. The total deflection is found to be the sum of the initial deflection, the deflection resulting from the solution of the flat plate problem, and the deflection resulting from the static problem.

Phase derivative method for reconstruction of slightly off-axis digital holograms.

PubMed

Guo, Cheng-Shan; Wang, Ben-Yi; Sha, Bei; Lu, Yu-Jie; Xu, Ming-Yuan

2014-12-15

A phase derivative (PD) method is proposed for reconstruction of off-axis holograms. In this method, a phase distribution of the tested object wave constrained within 0 to pi radian is firstly worked out by a simple analytical formula; then it is corrected to its right range from -pi to pi according to the sign characteristics of its first-order derivative. A theoretical analysis indicates that this PD method is particularly suitable for reconstruction of slightly off-axis holograms because it only requires the spatial frequency of the reference beam larger than spatial frequency of the tested object wave in principle. In addition, because the PD method belongs to a pure local method with no need of any integral operation or phase shifting algorithm in process of the phase retrieval, it could have some advantages in reducing computer load and memory requirements to the image processing system. Some experimental results are given to demonstrate the feasibility of the method.

Influence of initial sulfur content in precursor solution for the growth of molybdenum disulfide

NASA Astrophysics Data System (ADS)

Tan, A. L.; Ng, S. S.; Abu Hassan, H.

2018-04-01

This work investigated the influence of initial sulfur content in the precursor solution for the growth of molybdenum disulfide (MoS2) films by thermal vapour sulfurization (TVS) with sol-gel spin coating as pre-deposition technique. The early introduction of sulfur shows the presence of grains are uniformly distributed and homogeneous on the surface of the film. MoS2 (002) planes are detected for both films with and without initial sulfur conditions, however, the presence of initial sulfur contents gives slightly higher intensity of diffraction peak. Two phonon modes for MoS2, namely the E2g 1 (in-plane) and the A1g (out-of plane), are well detected from which the frequency difference of Raman peaks between E2g 1 and A1g suggest the grown MoS2 consisted of multi-layers. There is a slight shift of E2g 1 which is caused by the carbon impurities but no shift for A1g. Besides, MoS2 film with the presence of initial sulfur content shows better crystal as indicated by its narrower Raman peaks linewidth. Two broad absorption peaks of MoS2 are detected at 614nm and 665nm. Hence, the early introduction of sulfur content in prepared precursor solution is one way of optimizing the growth of MoS2 films.

Evaluation of DNA damage and mutagenicity induced by lead in tobacco plants.

PubMed

Gichner, Tomás; Znidar, Irena; Száková, Jirina

2008-04-30

Tobacco (Nicotiana tabacum L. var. xanthi) seedlings were treated with aqueous solutions of lead nitrate (Pb2+) at concentrations ranging from 0.4 mM to 2.4 mM for 24 h and from 25 microM to 200 microM for 7 days. The DNA damage measured by the comet assay was high in the root nuclei, but in the leaf nuclei a slight but significant increase in DNA damage could be demonstrated only after a 7-day treatment with 200 microM Pb2+. In tobacco plants growing for 6 weeks in soil polluted with Pb2+ severe toxic effects, expressed by the decrease in leaf area, and a slight but significant increase in DNA damage were observed. The tobacco plants with increased levels of DNA damage were severely injured and showed stunted growth, distorted leaves and brown root tips. The frequency of somatic mutations in tobacco plants growing in the Pb2+-polluted soil did not significantly increase. Analytical studies by inductively coupled plasma optical emission spectrometry demonstrate that after a 24-h treatment of tobacco with 2.4 mM Pb2+, the accumulation of the heavy metal is 40-fold higher in the roots than in the above-ground biomass. Low Pb2+ accumulation in the above-ground parts may explain the lower levels or the absence of Pb2+-induced DNA damage in leaves.

Differences in genotoxic activity of alpha-Ni3S2 on human lymphocytes from nickel-hypersensitized and nickel-unsensitized donors.

PubMed

Arrouijal, F Z; Marzin, D; Hildebrand, H F; Pestel, J; Haguenoer, J M

1992-05-01

The genotoxic activity of alpha-Ni3S2 was assessed on human lymphocytes from nickel-hypersensitized (SSL) and nickel-unsensitized (USL) subjects. Three genotoxicity tests were performed: the sister chromatid exchange (SCE) test, the metaphase analysis test and the micronucleus test. (i) The SCE test (3-100 micrograms/ml) showed a weak but statistically significant increase in the number of SCE in both lymphocyte types with respect to controls, USL presenting a slightly higher SCE incidence but only at one concentration. (ii) The metaphase analysis test demonstrated a high dose-dependent clastogenic activity of alpha-Ni3S2 in both lymphocyte types. The frequency of chromosomal anomalies was significantly higher in USL than in SSL for all concentrations applied. (iii) The micronucleus test confirmed the dose-dependent clastogenic activity of alpha-Ni3S2 and the differences already observed between USL and SSL, i.e. the number of cells with micronuclei was statistically higher in USL. Finally, the incorporation study with alpha-63Ni3S2 showed a higher uptake of its solubilized fraction by USL. This allows an explanation of the different genotoxic action of nickel on the two cell types. In this study we demonstrated that hypersensitivity has an influence on the incorporation of alpha-Ni3S2 and subsequently on the different induction of chromosomal aberrations in human lymphocytes.

Hydrogen bond spectroscopy in the near infrared: Out-of-plane torsion and antigeared bend combination bands in (HF)2

NASA Astrophysics Data System (ADS)

Anderson, David T.; Davis, Scott; Nesbitt, David J.

1996-09-01

High-resolution near infrared spectra of the two ``high'' frequency intermolecular modes of (HF)2 have been characterized in HF-stretch excited states using a slit jet spectrometer. In the spectral region between 4280 and 4480 cm-1, four vibration-rotation-tunneling (VRT) bands are observed and assigned to tunneling pairs of the out-of-plane torsion (ν6) and antigeared bend (ν3) intermolecular modes, in combination with the hydrogen bond donor (ν2) and acceptor (ν1) high-frequency intramolecular HF stretches, respectively. Analysis of the jet-cooled, rotationally resolved spectra provide intermolecular frequencies, rotational constants, tunneling splittings, and predissociation rates for the ν3/ν6 intermolecular excited states. The relatively small changes in the hydrogen bond interconversion tunneling splitting with either ν3 or ν6 excitation indicate that neither intermolecular mode is strongly coupled to the tunneling coordinate. The high-resolution VRT linewidths reveal mode specific predissociation broadening sensitive predominantly to intramolecular excitation, but with significant additional effects due to low-frequency intermolecular excitation as well. The intermolecular vibrational frequencies in the combination states display a systematic dependence on intramolecular redshift that allows all four intermolecular fundamental frequencies to be extrapolated from the near-ir data. Agreement between full 6-D quantum calculations and experiment for the out-of-plane torsion (ν6) vibration is remarkably good (0.5%). However, significant discrepancies (≳10%) between theory and experiment are obtained for the antigeared bend (ν3), indicating the need for further refinement of the HF dimer potential surface. Finally, the observation of all four intermolecular modes allows zero-point contributions to the binding energy to be reliably estimated. The revised value for the binding energy, De=1580(35) cm-1, is slightly higher than semiempirical estimates but now in excellent agreement with recent high level ab initio calculations.

Off-Resonance Acoustic Levitation Without Rotation

NASA Technical Reports Server (NTRS)

Barmatz, M. B.; Allen, J. L.

1984-01-01

Orthogonal acoustic-levitation modes excited at slightly different frequencies to control rotation. Rotation of object in square cross-section acoustic-levitation chamber stopped by detuning two orthogonal (x and y) excitation drivers in plane of square cross section. Detuning done using fundamental degenerate modes or odd harmonic modes.

Assessment of Maillard reaction evolution, prebiotic carbohydrates, antioxidant activity and α-amylase inhibition in pulse flours.

PubMed

Moussou, Nadia; Corzo-Martínez, Marta; Sanz, María Luz; Zaidi, Farid; Montilla, Antonia; Villamiel, Mar

2017-03-01

In this paper, the quality of bean, chickpea, fava beans, lentil and pea flours from Algeria has been evaluated. Maillard reaction (MR) indicators, modifications in the carbohydrate and protein fractions, antioxidant activity and α-amylase inhibitor of raw, toasted and stored samples were evaluated. Fava beans, beans and peas showed higher content of raffinose family oligosaccharides while chickpeas and lentils showed higher polyol content. Toasting and storage caused slightly change in pulse quality; MR showed slight losses of lysine but increased antioxidant activity. Moreover, inhibition of α-amylase was slightly augmented during processing; this could increase the undigested carbohydrates that reach the colon, modulating the glycemic response. These results point out the suitability of these flours for preparing high-quality foodstuffs intended for a wide spectrum of the population, including hyperglycemic and gluten intolerant individuals.

Michigan's forest resources in 2004

Treesearch

Mark H. Hansen; Gary J. Brand

2006-01-01

The sixth inventory of Michigan's forests was completed in 2004. The 18.7 million acres of timberland found is slightly higher than the 18.6 million acres found in the 1993 inventory. The standing timber volume has increased slightly at a rate of 0.22 percent per year. Detailed inventory results can be obtained at

Human-animal interactions and safety during dairy cattle handling--Comparing moving cows to milking and hoof trimming.

PubMed

Lindahl, C; Pinzke, S; Herlin, A; Keeling, L J

2016-03-01

Cattle handling is a dangerous activity on dairy farms, and cows are a major cause of injuries to livestock handlers. Even if dairy cows are generally tranquil and docile, when situations occur that they perceive or remember as aversive, they may become agitated and hazardous to handle. This study aimed to compare human-animal interactions, cow behavior, and handler safety when moving cows to daily milking and moving cows to more rarely occurring and possibly aversive hoof trimming. These processes were observed on 12 Swedish commercial dairy farms. The study included behavioral observations of handler and cows and cow heart rate recordings, as well as recording frequencies of situations and incidents related to an increased injury risk to the handler. At milking, cows were quite easily moved using few interactions. As expected, the cows showed no behavioral signs of stress, fear, or resistance and their heart rate only rose slightly from the baseline (i.e., the average heart rate during an undisturbed period before handling). Moving cows to hoof trimming involved more forceful and gentle interactions compared with moving cows to milking. Furthermore, the cows showed much higher frequencies of behaviors indicative of aversion and fear (e.g., freezing, balking, and resistance), as well as a higher increase in heart rate. The risk of injury to which handlers were exposed also increased when moving cows to hoof trimming rather than to routine milking. Some interactions (such as forceful tactile interactions with an object and pulling a neck strap or halter) appeared to be related to potentially dangerous incidents where the handler was being kicked, head-butted, or run over by a cow. In conclusion, moving cows to hoof trimming resulted in higher frequencies of behaviors indicating fear, more forceful interactions, and increased injury risks to the handler than moving cows to milking. Improving potentially stressful handling procedures (e.g., by better animal handling practices and preparation of cows to cope with such procedures) can increase handler safety, animal welfare, ease of handling, and efficiency. Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

The effect of increase in dielectric values on specific absorption rate (SAR) in eye and head tissues following 900, 1800 and 2450 MHz radio frequency (RF) exposure

NASA Astrophysics Data System (ADS)

Keshvari, Jafar; Keshvari, Rahim; Lang, Sakari

2006-03-01

Numerous studies have attempted to address the question of the RF energy absorption difference between children and adults using computational methods. They have assumed the same dielectric parameters for child and adult head models in SAR calculations. This has been criticized by many researchers who have stated that child organs are not fully developed, their anatomy is different and also their tissue composition is slightly different with higher water content. Higher water content would affect dielectric values, which in turn would have an effect on RF energy absorption. The objective of this study was to investigate possible variation in specific absorption rate (SAR) in the head region of children and adults by applying the finite-difference time-domain (FDTD) method and using anatomically correct child and adult head models. In the calculations, the conductivity and permittivity of all tissues were increased from 5 to 20% but using otherwise the same exposure conditions. A half-wave dipole antenna was used as an exposure source to minimize the uncertainties of the positioning of a real mobile device and making the simulations easily replicable. Common mobile telephony frequencies of 900, 1800 and 2450 MHz were used in this study. The exposures of ear and eye regions were investigated. The SARs of models with increased dielectric values were compared to the SARs of the models where dielectric values were unchanged. The analyses suggest that increasing the value of dielectric parameters does not necessarily mean that volume-averaged SAR would increase. Under many exposure conditions, specifically at higher frequencies in eye exposure, volume-averaged SAR decreases. An increase of up to 20% in dielectric conductivity or both conductivity and permittivity always caused a SAR variation of less than 20%, usually about 5%, when it was averaged over 1, 5 or 10 g of cubic mass for all models. The thickness and composition of different tissue layers in the exposed regions within the human head play a more significant role in SAR variation compared to the variations (5-20%) of the tissue dielectric parameters.

The effect of rocking stapes motions on the cochlear fluid flow and on the basilar membrane motion.

PubMed

Edom, Elisabeth; Obrist, Dominik; Henniger, Rolf; Kleiser, Leonhard; Sim, Jae Hoon; Huber, Alexander M

2013-11-01

The basilar membrane (BM) and perilymph motion in the cochlea due to rocking stapes motion (RSM) and piston-like stapes motion (PSM) is modeled by numerical simulations. The full Navier-Stokes equations are solved in a two-dimensional box geometry. The BM motion is modeled by independent oscillators using an immersed boundary technique. The traveling waves generated by both stimulation modes are studied. A comparison of the peak amplitudes of the BM motion is presented and their dependence on the frequency and on the model geometry (stapes position and cochlear channel height) is investigated. It is found that the peak amplitudes for the RSM are lower and decrease as frequency decreases whereas those for the PSM increase as frequency decreases. This scaling behavior can be explained by the different mechanisms that excite the membrane oscillation. Stimulation with both modes at the same time leads to either a slight increase or a slight decrease of the peak amplitudes compared to the pure PSM, depending on the phase shift between the two modes. While the BM motion is dominated by the PSM mode under normal conditions, the RSM may lead to hearing if no PSM is present or possible, e.g., due to round window atresia.

Dual-pulse frequency compounded superharmonic imaging.

PubMed

van Neer, Paul L M J; Danilouchkine, Mikhail G; Matte, Guillaume M; van der Steen, Anton F W; de Jong, Nico

2011-11-01

Tissue second-harmonic imaging is currently the default mode in commercial diagnostic ultrasound systems. A new modality, superharmonic imaging (SHI), combines the third through fifth harmonics originating from nonlinear wave propagation through tissue. SHI could further improve the resolution and quality of echographic images. The superharmonics have gaps between the harmonics because the transducer has a limited bandwidth of about 70% to 80%. This causes ghost reflection artifacts in the superharmonic echo image. In this work, a new dual-pulse frequency compounding (DPFC) method to eliminate these artifacts is introduced. In the DPFC SHI method, each trace is constructed by summing two firings with slightly different center frequencies. The feasibility of the method was established using a single-element transducer. Its acoustic field was modeled in KZK simulations and compared with the corresponding measurements obtained with a hydrophone apparatus. Subsequently, the method was implemented on and optimized for a setup consisting of an interleaved phased-array transducer (44 elements at 1 MHz and 44 elements at 3.7 MHz, optimized for echocardiography) and a programmable ultrasound system. DPFC SHI effectively suppresses the ghost reflection artifacts associated with imaging using multiple harmonics. Moreover, compared with the single-pulse third harmonic, DPFC SHI improved the axial resolution by 3.1 and 1.6 times at the -6-dB and -20-dB levels, respectively. Hence, DPFC offers the possibility of generating harmonic images of a higher quality at a cost of a moderate frame rate reduction.

Isolation of Helicobacter pylori in gastric mucosa and susceptibility to five antimicrobial drugs in Southern chile

PubMed Central

Otth, Laura; Wilson, Myra; Fernández, Heriberto; Otth, Carola; Toledo, Claudio; Cárcamo, Victoria; Rivera, Paula; Ruiz, Luis

2011-01-01

Helicobacter pylori colonizes more than 50% of the world population thus, it is considered an important cause of gastric cancer. The aim of this study was to determine the isolation frequency of H. pylori in Southern Chile from patients with symptomatology compatible with gastritis or gastric ulcer and to correlate these findings with demographic parameters of infected patients and the susceptibility profiles of the isolated strains to the antimicrobial drugs used in the eradication treatments. A total of 240 patients were enrolled in the study. Each gastric biopsy was homogenized and seeded onto blood agar plates containing a selective antibiotics mixture (DENT supplement). Plates were incubated at 37° C in a microaerophilic environment for five days. The susceptibility profiles to amoxicillin, ciprofloxacin, clarithromycin, tetracycline and metronidazole were determined using the E-test method. H. pylori was isolated from 99 patients (41.3%) with slightly higher frequency in female (42% positive cultures) than male (40.2% positive cultures). With regard to age and educational level, the highest isolation frequencies were obtained in patients between 21–30 (55%) and 41–50 (52.6%) years old, and patients with secondary (43.9%) and university (46.2%) educational levels. Nineteen (21.6%) strains showed resistance to at least one antimicrobial drug. Tetracycline was the most active antimicrobial in vitro, whereas metronidazole was the less active. One strain (5.3%) showed resistance to amoxicillin, clarithomycin and metronidazole, simultaneously. PMID:24031652

Liver enzymes in patients with chronic kidney disease undergoing peritoneal dialysis and hemodialysis.

PubMed

Liberato, Isabella Ramos de Oliveira; Lopes, Edmundo Pessoa de Almeida; Cavalcante, Maria Alina Gomes de Mattos; Pinto, Tiago Costa; Moura, Izolda Fernades; Loureiro Júnior, Luiz

2012-01-01

The present study was designed to analyze the serum levels of aspartate and alanine aminotransferases, gamma-glutamyl transferase, and the hematocrit in patients with chronic kidney disease who were undergoing peritoneal dialysis or hemodialysis. Twenty patients on peritoneal dialysis and 40 on hemodialysis were assessed, and the patients were matched according to the length of time that they had been on dialysis. Blood samples were collected (both before and after the session for those on hemodialysis) to measure the enzymes and the hematocrit. In the samples from the patients who were undergoing peritoneal dialysis, the aspartate and alanine aminotransferase levels were slightly higher compared with the samples collected from the patients before the hemodialysis session and slightly lower compared with the samples collected after the hemodialysis session. The levels of gamma-glutamyl transferase in the hemodialysis patients were slightly higher than the levels in the patients who were undergoing peritoneal dialysis. In addition, the levels of aminotransferases and gamma-glutamyl transferase that were collected before the hemodialysis session were significantly lower than the values collected after the session. The hematocrit levels were significantly lower in the patients who were on peritoneal dialysis compared with the patients on hemodialysis (both before and after the hemodialysis session), and the levels were also significantly lower before hemodialysis compared with after hemodialysis. The aminotransferase levels in the patients who were undergoing peritoneal dialysis were slightly higher compared with the samples collected before the hemodialysis session, whereas the aminotransferase levels were slightly lower compared with the samples collected after the session. The hematocrits and the aminotransferase and gamma-glutamyl transferase levels of the samples collected after the hemodialysis session were significantly higher than the samples collected before the session. Taken together, the present data suggest that hemodilution could alter the serum levels of liver enzymes.

Crash involvement of motor vehicles in relationship to the number and severity of traffic offenses. An exploratory analysis of Dutch traffic offenses and crash data.

PubMed

Goldenbeld, Charles; Reurings, Martine; Van Norden, Yvette; Stipdonk, Henk

2013-01-01

To establish the statistical relationship between offenses and crashes when the unit of analysis is the vehicle instead of the driver, to show the influence of the severity (e.g., minor speed offenses) on this relationship, and to research whether the form of this relationship is similar in different enforcement contexts. An exploratory analysis was conducted using Dutch traffic offense and crash data. Crash data included all police-registered crashes involving motorized and registered vehicles in 2009; offense data included all non-criminal traffic offenses registered during 2005-2009 (mostly camera detected). Together these comprise an estimated 97 percent of all traffic offenses registered in this period. The analysis was done on a level of identified vehicles rather than persons. Vehicles involved in crashes were matched to vehicles involved in traffic offenses. The offense frequency distributions of registered crash involved vehicles and a random selection of vehicles was analyzed. Two comparisons were made: (1) privately owned vehicles versus company-owned vehicles and (2) vehicles for which only minor speed offenses were registered versus vehicles for which at least one major speed offense was registered. An increase in traffic offense frequency coincides with a stronger increase in relative crash involvement. This relationship was adequately described by a power function. The slightly more than linear increase in the crash risk for vehicles with only minor speed offenses suggests that minor speed offenses (<10 km/h over the limit) contributed slightly to crashes. This relationship was unlikely to be caused by increased distance traveled only. For vehicles with at least one or more major speed violation an approximately quadratic increase of crash risk with increasing speed offense frequency was found. A comparison of Dutch and Canadian data showed a much more progressive offense-crash relationship in the Dutch data. The crash involvement of vehicles increased more than linearly with the number of minor traffic violations. Thus, automatic detection of minor offenses bears relevance to safety. The substantial increase in crash rates with speed offense frequency for vehicles with at least one major speed violation suggests that these vehicles represent a specific group with a significantly increased crash risk, especially in the case of many minor offenses. The more progressive relationship between offenses and crashes in The Netherlands when compared to Canada was hypothesized to result from the higher intensity camera enforcement levels and less severe consequences in the Dutch enforcement and adjudication system.

Two-pass-internal second-harmonic generation using a prism coupler.

NASA Technical Reports Server (NTRS)

Gonzalez, D. G.; Nieh, S. T. K.; Steier, W. H.

1973-01-01

A dispersive quartz prism is used to couple the total second harmonic generated in both directions by an internal cavity frequency doubler. The study shows that the dispersion of air and mirror reflection phase shifts can be compensated for by a slight nonphase match condition in the doubler.

Computer program to compute buckling loads of simply supported anisotropic plates

NASA Technical Reports Server (NTRS)

Chamis, C. C.

1973-01-01

Program handles several types of composites and several load conditions for each plate, both compressive or tensile membrane loads, and bending-stretching coupling via the concept of reduced bending rigidities. Vibration frequencies of homogeneous or layered anisotropic plates can be calculated by slightly modifying the program.

Social determinants of breast cancer in the Caribbean: a systematic review.

PubMed

Brown, Catherine R; Hambleton, Ian R; Hercules, Shawn M; Alvarado, Miriam; Unwin, Nigel; Murphy, Madhuvanti M; Harris, E Nigel; Wilks, Rainford; MacLeish, Marlene; Sullivan, Louis; Sobers-Grannum, Natasha

2017-04-05

Breast cancer is the leading cause of cancer deaths among women in the Caribbean and accounts for >1 million disability adjusted life years. Little is known about the social inequalities of this disease in the Caribbean. In support of the Rio Political Declaration on addressing health inequities, this article presents a systematic review of evidence on the distribution, by social determinants, of breast cancer risk factors, frequency, and adverse outcomes in Caribbean women. MEDLINE, EMBASE, SciELO, CINAHL, CUMED, LILACS, and IBECS were searched for observational studies reporting associations between social determinants and breast cancer risk factors, frequency, or outcomes. Based on the PROGRESS-plus checklist, we considered 8 social determinant groups for 14 breast cancer endpoints, which totalled to 189 possible ways ('relationship groups') to explore the role of social determinants on breast cancer. Studies with >50 participants conducted in Caribbean territories between 2004 and 2014 were eligible for inclusion. The review was conducted according to STROBE and PRISMA guidelines and results were planned as a narrative synthesis, with meta-analysis if possible. Thirty-four articles were included from 5,190 screened citations. From these included studies, 75 inequality relationships were reported examining 30 distinct relationship groups, leaving 84% of relationship groups unexplored. Most inequality relationships were reported for risk factors, particularly alcohol and overweight/obesity which generally showed a positive relationship with indicators of lower socioeconomic position. Evidence for breast cancer frequency and outcomes was scarce. Unmarried women tended to have a higher likelihood of being diagnosed with breast cancer when compared to married women. While no association was observed between breast cancer frequency and ethnicity, mortality from breast cancer was shown to be slightly higher among Asian-Indian compared to African-descent populations in Trinidad (OR 1.2, 95% CI 1.1-1.4) and Guyana (OR 1.3, 95% CI 1.0-1.6). Study quantity, quality, and variability in outcomes and reporting limited the synthesis of evidence on the role of social determinants on breast cancer in the Caribbean. This report represents important current evidence on the region, and can guide future research priorities for better describing and understanding of Caribbean breast cancer inequalities.

Open-loop frequency acquisition for suppressed-carrier biphase signals using one-pole arm filters

NASA Technical Reports Server (NTRS)

Shah, B.; Holmes, J. K.

1991-01-01

Open loop frequency acquisition performance is discussed for suppressed carrier binary phase shift keyed signals in terms of the probability of detecting the carrier frequency offset when the arms of the Costas loop detector have one pole filters. The approach, which does not require symbol timing, uses fast Fourier transforms (FFTs) to detect the carrier frequency offset. The detection probability, which depends on both the 3 dB arm filter bandwidth and the received symbol signal to noise ratio, is derived and is shown to be independent of symbol timing. It is shown that the performance of this technique is slightly better that other open loop acquisition techniques which use integrators in the arms and whose detection performance varies with symbol timing.

Varicella-Zoster Virus–Specific Immune Responses to Herpes Zoster in Elderly Participants in a Trial of a Clinically Effective Zoster Vaccine

PubMed Central

Zhang, Jane H.; Oxman, Michael N.; Johnson, Gary R.; Hayward, Anthony R.; Caulfield, Michael J.; Irwin, Michael R.; Clair, James; Smith, Jeffrey G.; Stanley, Harold; Marchese, Rocio D.; Harbecke, Ruth; Williams, Heather M.; Chan, Ivan S. F.; Arbeit, Robert D.; Gershon, Anne A.; Schödel, Florian; Morrison, Vicki A.; Kauffman, Carol A.; Straus, Steve E.; Schmader, Kenneth E.; Davis, Larry E.; Levin, Myron J.

2009-01-01

BackgroundThe objectives of this study were to evaluate the association between varicella-zoster virus (VZV)–specific humoral and cell-mediated immunity (CMI) to herpes zoster (HZ) and protection against HZ morbidity and to compare immune responses to HZ and zoster vaccine MethodsIn 981 elderly persons who developed HZ during a zoster vaccine efficacy trial (321 vaccinees and 660 placebo recipients) and 1362 without HZ (682 vaccinees and 680 placebo recipients), CMI was measured by VZV responder cell frequency and interferon-γ enzyme-linked immunospot, and antibodies were measured by VZV enzyme-linked immunosorbent assay against affinity-purified VZV glycoproteins (gpELISA) ResultsRobust VZV CMI at HZ onset correlated with reduced HZ morbidity, whereas VZV gpELISA titers did not. Three weeks after HZ onset, gpELISA titers were highest in those with more severe HZ and were slightly increased in placebo recipients (compared with zoster vaccine recipients) and in older individuals. VZV CMI responses to HZ were similar in zoster vaccine and placebo recipients and were not affected by demographic characteristics or antiviral therapy, except for responder cell frequency at HZ onset, which decreased with age. When responses to zoster vaccine and HZ could be compared, VZV CMI values were similar, but antibody titers were lower ConclusionsHigher VZV CMI at HZ onset was associated with reduced HZ severity and less postherpetic neuralgia. Higher antibody titers were associated with increased HZ severity and occurrence of postherpetic neuralgia. HZ and zoster vaccine generated comparable VZV CMI PMID:19712037

An Energy-Efficient Algorithm for Wearable Electrocardiogram Signal Processing in Ubiquitous Healthcare Applications

PubMed Central

Sodhro, Ali Hassan; Sodhro, Gul Hassan; Lohano, Sonia; Pirbhulal, Sandeep

2018-01-01

Rapid progress and emerging trends in miniaturized medical devices have enabled the un-obtrusive monitoring of physiological signals and daily activities of everyone’s life in a prominent and pervasive manner. Due to the power-constrained nature of conventional wearable sensor devices during ubiquitous sensing (US), energy-efficiency has become one of the highly demanding and debatable issues in healthcare. This paper develops a single chip-based wearable wireless electrocardiogram (ECG) monitoring system by adopting analog front end (AFE) chip model ADS1292R from Texas Instruments. The developed chip collects real-time ECG data with two adopted channels for continuous monitoring of human heart activity. Then, these two channels and the AFE are built into a right leg drive right leg drive (RLD) driver circuit with lead-off detection and medical graded test signal. Human ECG data was collected at 60 beats per minute (BPM) to 120 BPM with 60 Hz noise and considered throughout the experimental set-up. Moreover, notch filter (cutoff frequency 60 Hz), high-pass filter (cutoff frequency 0.67 Hz), and low-pass filter (cutoff frequency 100 Hz) with cut-off frequencies of 60 Hz, 0.67 Hz, and 100 Hz, respectively, were designed with bilinear transformation for rectifying the power-line noise and artifacts while extracting real-time ECG signals. Finally, a transmission power control-based energy-efficient (ETPC) algorithm is proposed, implemented on the hardware and then compared with the several conventional TPC methods. Experimental results reveal that our developed chip collects real-time ECG data efficiently, and the proposed ETPC algorithm achieves higher energy savings of 35.5% with a slightly larger packet loss ratio (PLR) as compared to conventional TPC (e.g., constant TPC, Gao’s, and Xiao’s methods). PMID:29558433

Effect of Degeneration on Fluid-Solid Interaction within Intervertebral Disk Under Cyclic Loading - A Meta-Model Analysis of Finite Element Simulations.

PubMed

Nikkhoo, Mohammad; Khalaf, Kinda; Kuo, Ya-Wen; Hsu, Yu-Chun; Haghpanahi, Mohammad; Parnianpour, Mohamad; Wang, Jaw-Lin

2015-01-01

The risk of low back pain resulted from cyclic loadings is greater than that resulted from prolonged static postures. Disk degeneration results in degradation of disk solid structures and decrease of water contents, which is caused by activation of matrix digestive enzymes. The mechanical responses resulted from internal solid-fluid interactions of degenerative disks to cyclic loadings are not well studied yet. The fluid-solid interactions in disks can be evaluated by mathematical models, especially the poroelastic finite element (FE) models. We developed a robust disk poroelastic FE model to analyze the effect of degeneration on solid-fluid interactions within disk subjected to cyclic loadings at different loading frequencies. A backward analysis combined with in vitro experiments was used to find the elastic modulus and hydraulic permeability of intact and enzyme-induced degenerated porcine disks. The results showed that the averaged peak-to-peak disk deformations during the in vitro cyclic tests were well fitted with limited FE simulations and a quadratic response surface regression for both disk groups. The results showed that higher loading frequency increased the intradiscal pressure, decreased the total fluid loss, and slightly increased the maximum axial stress within solid matrix. Enzyme-induced degeneration decreased the intradiscal pressure and total fluid loss, and barely changed the maximum axial stress within solid matrix. The increase of intradiscal pressure and total fluid loss with loading frequency was less sensitive after the frequency elevated to 0.1 Hz for the enzyme-induced degenerated disk. Based on this study, it is found that enzyme-induced degeneration decreases energy attenuation capability of disk, but less change the strength of disk.

Water reduction by constructed wetlands treating waste landfill leachate in a tropical region.

PubMed

Ogata, Yuka; Ishigaki, Tomonori; Ebie, Yoshitaka; Sutthasil, Noppharit; Chiemchaisri, Chart; Yamada, Masato

2015-10-01

One of the key challenges in landfill leachate management is the prevention of environmental pollution by the overflow of untreated leachate. To evaluate the feasibility of constructed wetlands (CWs) for the treatment of waste landfill leachate in tropical regions, water reduction and pollutant removal by a CW subjected to different flow patterns (i.e., horizontal subsurface flow (HSSF) and free water surface (FWS)) were examined in both rainy and dry seasons in Thailand. A pilot-scale CW planted with cattail was installed at a landfill site in Thailand. With HSSF, the CW substantially removed pollutants from the landfill leachate without the need to harvest plants, whereas with FWS, it only slightly removed pollutants. Under both flow patterns, the CW significantly reduced the leachate volume to a greater extent than surface evaporation, which is regarded as an effect of the storage pond. Additionally, water reduction occurred regardless of season and precipitation, within the range 0-9 mm d(-1). In the case of low feeding frequency, water reduction by the CW with HSSF was lower than that with FWS. However, high feeding frequency improved water reduction by the CW with HSSF and resulted in a similar reduction to that observed with FWS, which exhibited maximum evapotranspiration. In terms of water reduction, with both HSSF in conjunction with high frequency feeding and FWS, the CW provided a high degree of evapotranspiration. However, pollutant removal efficiencies with HSSF were higher than for FWS. The present study suggested that CWs with HSSF and high frequency feeding could be useful for the prevention of uncontrollable dispersion of polluted leachate in the tropical climate zone. Copyright © 2015 Elsevier Ltd. All rights reserved.

An Energy-Efficient Algorithm for Wearable Electrocardiogram Signal Processing in Ubiquitous Healthcare Applications.

PubMed

Sodhro, Ali Hassan; Sangaiah, Arun Kumar; Sodhro, Gul Hassan; Lohano, Sonia; Pirbhulal, Sandeep

2018-03-20

Rapid progress and emerging trends in miniaturized medical devices have enabled the un-obtrusive monitoring of physiological signals and daily activities of everyone's life in a prominent and pervasive manner. Due to the power-constrained nature of conventional wearable sensor devices during ubiquitous sensing (US), energy-efficiency has become one of the highly demanding and debatable issues in healthcare. This paper develops a single chip-based wearable wireless electrocardiogram (ECG) monitoring system by adopting analog front end (AFE) chip model ADS1292R from Texas Instruments. The developed chip collects real-time ECG data with two adopted channels for continuous monitoring of human heart activity. Then, these two channels and the AFE are built into a right leg drive right leg drive (RLD) driver circuit with lead-off detection and medical graded test signal. Human ECG data was collected at 60 beats per minute (BPM) to 120 BPM with 60 Hz noise and considered throughout the experimental set-up. Moreover, notch filter (cutoff frequency 60 Hz), high-pass filter (cutoff frequency 0.67 Hz), and low-pass filter (cutoff frequency 100 Hz) with cut-off frequencies of 60 Hz, 0.67 Hz, and 100 Hz, respectively, were designed with bilinear transformation for rectifying the power-line noise and artifacts while extracting real-time ECG signals. Finally, a transmission power control-based energy-efficient (ETPC) algorithm is proposed, implemented on the hardware and then compared with the several conventional TPC methods. Experimental results reveal that our developed chip collects real-time ECG data efficiently, and the proposed ETPC algorithm achieves higher energy savings of 35.5% with a slightly larger packet loss ratio (PLR) as compared to conventional TPC (e.g., constant TPC, Gao's, and Xiao's methods).

Sound localization in noise in hearing-impaired listeners.

PubMed

Lorenzi, C; Gatehouse, S; Lever, C

1999-06-01

The present study assesses the ability of four listeners with high-frequency, bilateral symmetrical sensorineural hearing loss to localize and detect a broadband click train in the frontal-horizontal plane, in quiet and in the presence of a white noise. The speaker array and stimuli are identical to those described by Lorenzi et al. (in press). The results show that: (1) localization performance is only slightly poorer in hearing-impaired listeners than in normal-hearing listeners when noise is at 0 deg azimuth, (2) localization performance begins to decrease at higher signal-to-noise ratios for hearing-impaired listeners than for normal-hearing listeners when noise is at +/- 90 deg azimuth, and (3) the performance of hearing-impaired listeners is less consistent when noise is at +/- 90 deg azimuth than at 0 deg azimuth. The effects of a high-frequency hearing loss were also studied by measuring the ability of normal-hearing listeners to localize the low-pass filtered version of the clicks. The data reproduce the effects of noise on three out of the four hearing-impaired listeners when noise is at 0 deg azimuth. They reproduce the effects of noise on only two out of the four hearing-impaired listeners when noise is at +/- 90 deg azimuth. The additional effects of a low-frequency hearing loss were investigated by attenuating the low-pass filtered clicks and the noise by 20 dB. The results show that attenuation does not strongly affect localization accuracy for normal-hearing listeners. Measurements of the clicks' detectability indicate that the hearing-impaired listeners who show the poorest localization accuracy also show the poorest ability to detect the clicks. The inaudibility of high frequencies, "distortions," and reduced detectability of the signal are assumed to have caused the poorer-than-normal localization accuracy for hearing-impaired listeners.

Effect of Degeneration on Fluid–Solid Interaction within Intervertebral Disk Under Cyclic Loading – A Meta-Model Analysis of Finite Element Simulations

PubMed Central

Nikkhoo, Mohammad; Khalaf, Kinda; Kuo, Ya-Wen; Hsu, Yu-Chun; Haghpanahi, Mohammad; Parnianpour, Mohamad; Wang, Jaw-Lin

2015-01-01

The risk of low back pain resulted from cyclic loadings is greater than that resulted from prolonged static postures. Disk degeneration results in degradation of disk solid structures and decrease of water contents, which is caused by activation of matrix digestive enzymes. The mechanical responses resulted from internal solid–fluid interactions of degenerative disks to cyclic loadings are not well studied yet. The fluid–solid interactions in disks can be evaluated by mathematical models, especially the poroelastic finite element (FE) models. We developed a robust disk poroelastic FE model to analyze the effect of degeneration on solid–fluid interactions within disk subjected to cyclic loadings at different loading frequencies. A backward analysis combined with in vitro experiments was used to find the elastic modulus and hydraulic permeability of intact and enzyme-induced degenerated porcine disks. The results showed that the averaged peak-to-peak disk deformations during the in vitro cyclic tests were well fitted with limited FE simulations and a quadratic response surface regression for both disk groups. The results showed that higher loading frequency increased the intradiscal pressure, decreased the total fluid loss, and slightly increased the maximum axial stress within solid matrix. Enzyme-induced degeneration decreased the intradiscal pressure and total fluid loss, and barely changed the maximum axial stress within solid matrix. The increase of intradiscal pressure and total fluid loss with loading frequency was less sensitive after the frequency elevated to 0.1 Hz for the enzyme-induced degenerated disk. Based on this study, it is found that enzyme-induced degeneration decreases energy attenuation capability of disk, but less change the strength of disk. PMID:25674562

Responses of sap flow, leaf gas exchange and growth of hybrid aspen to elevated atmospheric humidity under field conditions

PubMed Central

Niglas, Aigar; Kupper, Priit; Tullus, Arvo; Sellin, Arne

2014-01-01

An increase in average air temperature and frequency of rain events is predicted for higher latitudes by the end of the 21st century, accompanied by a probable rise in air humidity. We currently lack knowledge on how forest trees acclimate to rising air humidity in temperate climates. We analysed the leaf gas exchange, sap flow and growth characteristics of hybrid aspen (Populus tremula × P. tremuloides) trees growing at ambient and artificially elevated air humidity in an experimental forest plantation situated in the hemiboreal vegetation zone. Humidification manipulation did not affect the photosynthetic capacity of plants, but did affect stomatal responses: trees growing at elevated air humidity had higher stomatal conductance at saturating photosynthetically active radiation (gs sat) and lower intrinsic water-use efficiency (IWUE). Reduced stomatal limitation of photosynthesis in trees grown at elevated air humidity allowed slightly higher net photosynthesis and relative current-year height increments than in trees at ambient air humidity. Tree responses suggest a mitigating effect of higher air humidity on trees under mild water stress. At the same time, trees at higher air humidity demonstrated a reduced sensitivity of IWUE to factors inducing stomatal closure and a steeper decline in canopy conductance in response to water deficit, implying higher dehydration risk. Despite the mitigating impact of increased air humidity under moderate drought, a future rise in atmospheric humidity at high latitudes may be disadvantageous for trees during weather extremes and represents a potential threat in hemiboreal forest ecosystems. PMID:24887000

Densitometric evaluation of Soludent and GBX developers.

PubMed

Patel, J R

1985-01-01

A quick-developing solution (Soludent) and a new developer (Kodak GBX) were compared with a standard x-ray liquid developer. Of the three solutions evaluated, Kodak GBX solution produced slightly greater useful densities in the radiograph at all temperatures evaluated. The rapid-developing solution produced acceptable radiographs in 80% less time, with only slightly higher film fog.

Midlevel Administrators' Pay Increases Slightly but Doesn't Match Inflation

ERIC Educational Resources Information Center

Fuller, Andrea

2012-01-01

Salaries for midlevel administrators rose by a median of 2 percent this year over last year, matching the median pay increase for senior administrators and coming in slightly higher than the 1.9-percent median increase for faculty members, says an annual report released by the College and University Professional Association for Human Resources.…

Waves and instabilities in an anisotropic universe

NASA Astrophysics Data System (ADS)

Papadopoulos, D.; Vlahos, L.; Esposito, F. P.

2002-01-01

The excitation of low frequency plasma waves in an expanding anisotropic cosmological model that contains a magnetic field frozen into the matter and pointing in the longitudinal direction is discussed. Using the exact equations governing finite-amplitude wave propagation in hydromagnetic media within the framework of the general theory of relativity, we show that a spectrum of magnetized sound waves will be excited and form large-scale ``damped oscillations'' in the expanding universe. The characteristic frequency of the excited waves is slightly shifted away from the sound frequency and the shift depends on the strength of the primordial magnetic field. This magnetic field dependent shift may have an effect on the acoustic peaks of the CMB.

Dependence of the Startle Response on Temporal and Spectral Characteristics of Acoustic Modulatory Influences in Rats and Gerbils

PubMed Central

Steube, Natalie; Nowotny, Manuela; Pilz, Peter K. D.; Gaese, Bernhard H.

2016-01-01

The acoustic startle response (ASR) and its modulation by non-startling prepulses, presented shortly before the startle-eliciting stimulus, is a broadly applied test paradigm to determine changes in neural processing related to auditory or psychiatric disorders. Modulation by a gap in background noise as a prepulse is especially used for tinnitus assessment. However, the timing and frequency-related aspects of prepulses are not fully understood. The present study aims to investigate temporal and spectral characteristics of acoustic stimuli that modulate the ASR in rats and gerbils. For noise-burst prepulses, inhibition was frequency-independent in gerbils in the test range between 4 and 18 kHz. Prepulse inhibition (PPI) by noise-bursts in rats was constant in a comparable range (8–22 kHz), but lower outside this range. Purely temporal aspects of prepulse–startle-interactions were investigated for gap-prepulses focusing mainly on gap duration. While very short gaps had no (rats) or slightly facilitatory (gerbils) influence on the ASR, longer gaps always had a strong inhibitory effect. Inhibition increased with durations up to 75 ms and remained at a high level of inhibition for durations up to 1000 ms for both, rats and gerbils. Determining spectral influences on gap-prepulse inhibition (gap-PPI) revealed that gerbils were unaffected in the limited frequency range tested (4–18 kHz). The more detailed analysis in rats revealed a variety of frequency-dependent effects. Gaps in pure-tone background elicited constant and high inhibition (around 75%) over a broad frequency range (4–32 kHz). For gaps in noise-bands, on the other hand, a clear frequency-dependency was found: inhibition was around 50% at lower frequencies (6–14 kHz) and around 70% at high frequencies (16–20 kHz). This pattern of frequency-dependency in rats was specifically resulting from the inhibitory effect by the gaps, as revealed by detailed analysis of the underlying startle amplitudes. An interaction of temporal and spectral influences, finally, resulted in higher inhibition for 500 ms gaps than for 75 ms gaps at all frequencies tested. Improved prepulse paradigms based on these results are well suited to quantify the consequences of central processing disorders. PMID:27445728

Experimental Investigation of a Preloaded Spring-tab Flutter Model

NASA Technical Reports Server (NTRS)

Smith, N H; Clevenson, S A; Barmby, J G

1947-01-01

An experimental investigation was made of a preloaded spring-tab flutter model to determine the effects on flutter speed of aspect ratio, tab frequency, and preloaded spring constant. The rudder was mass-balanced, and the flutter mode studied was essentially one of three degrees of freedom (fin bending coupled with rudder and tab oscillations). Inasmuch as the spring was preloaded, the tab-spring system was a nonlinear one. Frequency of the tab was the most significant parameter in this study, and an increase in flutter speed with increasing frequency is indicated. At a given frequency, the tab of high aspect ratio is shown to have a slightly lower flutter speed than the one of low aspect ratio. Because the frequency of the preloaded spring tab was found to vary radically with amplitude, the flutter speed decreased with increase in initial displacement of the tab.

Nonradial oscillation modes of compact stars with a crust

NASA Astrophysics Data System (ADS)

Flores, Cesar Vásquez; Hall, Zack B.; Jaikumar, Prashanth

2017-12-01

Oscillation modes of isolated compact stars can, in principle, be a fingerprint of the equation of state (EoS) of dense matter. We study the non-radial high-frequency l =2 spheroidal modes of neutron stars and strange quark stars, adopting a two-component model (core and crust) for these two types of stars. Using perturbed fluid equations in the relativistic Cowling approximation, we explore the effect of a strangelet or hadronic crust on the oscillation modes of strange stars. The results differ from the case of neutron stars with a crust. In comparison to fluid-only configurations, we find that a solid crust on top of a neutron star increases the p -mode frequency slightly with little effect on the f -mode frequency, whereas for strange stars, a strangelet crust on top of a quark core significantly increases the f -mode frequency with little effect on the p -mode frequency.

Masking in three pinnipeds: underwater, low-frequency critical ratios.

PubMed

Southall, B L; Schusterman, R J; Kastak, D

2000-09-01

Behavioral techniques were used to determine underwater masked hearing thresholds for a northern elephant seal (Mirounga angustirostris), a harbor seal (Phoca vitulina), and a California sea lion (Zalophus californianus). Octave-band white noise maskers were centered at five test frequencies ranging from 200 to 2500 Hz; a slightly wider noise band was used for testing at 100 Hz. Critical ratios were calculated at one masking noise level for each test frequency. Above 200 Hz, critical ratios increased with frequency. This pattern is similar to that observed in most animals tested, and indicates that these pinnipeds lack specializations for detecting low-frequency tonal sounds in noise. However, the individual pinnipeds in this study, particularly the northern elephant seal, detected signals at relatively low signal-to-noise ratios. These results provide a means of estimating zones of auditory masking for pinnipeds exposed to anthropogenic noise sources.

Missing pulse detector for a variable frequency source

DOEpatents

Ingram, Charles B.; Lawhorn, John H.

1979-01-01

A missing pulse detector is provided which has the capability of monitoring a varying frequency pulse source to detect the loss of a single pulse or total loss of signal from the source. A frequency-to-current converter is used to program the output pulse width of a variable period retriggerable one-shot to maintain a pulse width slightly longer than one-half the present monitored pulse period. The retriggerable one-shot is triggered at twice the input pulse rate by employing a frequency doubler circuit connected between the one-shot input and the variable frequency source being monitored. The one-shot remains in the triggered or unstable state under normal conditions even though the source period is varying. A loss of an input pulse or single period of a fluctuating signal input will cause the one-shot to revert to its stable state, changing the output signal level to indicate a missing pulse or signal.

Longitudinal studies of Aedes aegypti (Diptera: Culicidae) in Thailand and Puerto Rico: blood feeding frequency.

PubMed

Scott, T W; Amerasinghe, P H; Morrison, A C; Lorenz, L H; Clark, G G; Strickman, D; Kittayapong, P; Edman, J D

2000-01-01

We used a histologic technique to study multiple blood feeding in a single gonotrophic cycle by engorged Aedes aegypti (L.) that were collected weekly for 2 yr from houses in a rural village in Thailand (n = 1,891) and a residential section of San Juan, Puerto Rico (n = 1,675). Overall, mosquitoes from Thailand contained significantly more multiple meals (n = 1,300, 42% double meals, 5% triple meals) than mosquitoes collected in Puerto Rico (n = 1,156, 32% double meals, 2% triple meals). The portion of specimens for which frequency of feeding could not be determined was 31% at both sites. We estimated that on average Ae. aegypti take 0.76 and 0.63 human blood meals per day in Thailand and Puerto Rico, respectively. However, frequency of multiple feeding varied among houses and, in Puerto Rico, the neighborhoods from which mosquitoes were collected. In Thailand 65% of the mosquitoes fed twice on the same day, whereas in Puerto Rico 57% took multiple meals separated by > or = 1 d. At both sites, the majority of engorged specimens were collected inside houses (Thailand 86%, Puerto Rico 95%). The number of blood meals detected was independent of where mosquitoes were collected (inside versus outside of the house) at both sites and the time of day collections were made in Puerto Rico. Feeding rates were slightly higher for mosquitoes collected in the afternoon in Thailand. Temperatures were significantly higher and mosquitoes significantly smaller in Thailand than in Puerto Rico. At both sites female size was negatively associated with temperature. Rates of multiple feeding were associated positively with temperature and negatively with mosquito size in Thailand, but not in Puerto Rico. Multiple feeding during a single gonotrophic cycle is a regular part of Ae. aegypti biology, can vary geographically and under different climate conditions, and may be associated with variation in patterns of dengue virus transmission.

Planck early results. IV. First assessment of the High Frequency Instrument in-flight performance

NASA Astrophysics Data System (ADS)

Planck HFI Core Team; Ade, P. A. R.; Aghanim, N.; Ansari, R.; Arnaud, M.; Ashdown, M.; Aumont, J.; Banday, A. J.; Bartelmann, M.; Bartlett, J. G.; Battaner, E.; Benabed, K.; Benoît, A.; Bernard, J.-P.; Bersanelli, M.; Bhatia, R.; Bock, J. J.; Bond, J. R.; Borrill, J.; Bouchet, F. R.; Boulanger, F.; Bradshaw, T.; Bréelle, E.; Bucher, M.; Camus, P.; Cardoso, J.-F.; Catalano, A.; Challinor, A.; Chamballu, A.; Charra, J.; Charra, M.; Chary, R.-R.; Chiang, C.; Church, S.; Clements, D. L.; Colombi, S.; Couchot, F.; Coulais, A.; Cressiot, C.; Crill, B. P.; Crook, M.; de Bernardis, P.; Delabrouille, J.; Delouis, J.-M.; Désert, F.-X.; Dolag, K.; Dole, H.; Doré, O.; Douspis, M.; Efstathiou, G.; Eng, P.; Filliard, C.; Forni, O.; Fosalba, P.; Fourmond, J.-J.; Ganga, K.; Giard, M.; Girard, D.; Giraud-Héraud, Y.; Gispert, R.; Górski, K. M.; Gratton, S.; Griffin, M.; Guyot, G.; Haissinski, J.; Harrison, D.; Helou, G.; Henrot-Versillé, S.; Hernández-Monteagudo, C.; Hildebrandt, S. R.; Hills, R.; Hivon, E.; Hobson, M.; Holmes, W. A.; Huffenberger, K. M.; Jaffe, A. H.; Jones, W. C.; Kaplan, J.; Kneissl, R.; Knox, L.; Lagache, G.; Lamarre, J.-M.; Lami, P.; Lange, A. E.; Lasenby, A.; Lavabre, A.; Lawrence, C. R.; Leriche, B.; Leroy, C.; Longval, Y.; Macías-Pérez, J. F.; Maciaszek, T.; MacTavish, C. J.; Maffei, B.; Mandolesi, N.; Mann, R.; Mansoux, B.; Masi, S.; Matsumura, T.; McGehee, P.; Melin, J.-B.; Mercier, C.; Miville-Deschênes, M.-A.; Moneti, A.; Montier, L.; Mortlock, D.; Murphy, A.; Nati, F.; Netterfield, C. B.; Nørgaard-Nielsen, H. U.; North, C.; Noviello, F.; Novikov, D.; Osborne, S.; Paine, C.; Pajot, F.; Patanchon, G.; Peacocke, T.; Pearson, T. J.; Perdereau, O.; Perotto, L.; Piacentini, F.; Piat, M.; Plaszczynski, S.; Pointecouteau, E.; Pons, R.; Ponthieu, N.; Prézeau, G.; Prunet, S.; Puget, J.-L.; Reach, W. T.; Renault, C.; Ristorcelli, I.; Rocha, G.; Rosset, C.; Roudier, G.; Rowan-Robinson, M.; Rusholme, B.; Santos, D.; Savini, G.; Schaefer, B. M.; Shellard, P.; Spencer, L.; Starck, J.-L.; Stassi, P.; Stolyarov, V.; Stompor, R.; Sudiwala, R.; Sunyaev, R.; Sygnet, J.-F.; Tauber, J. A.; Thum, C.; Torre, J.-P.; Touze, F.; Tristram, M.; van Leeuwen, F.; Vibert, L.; Vibert, D.; Wade, L. A.; Wandelt, B. D.; White, S. D. M.; Wiesemeyer, H.; Woodcraft, A.; Yurchenko, V.; Yvon, D.; Zacchei, A.

2011-12-01

The Planck High Frequency Instrument (HFI) is designed to measure the temperature and polarization anisotropies of the cosmic microwave background and Galactic foregrounds in six ~30% bands centered at 100, 143, 217, 353, 545, and 857 GHz at an angular resolution of 10' (100 GHz), 7' (143 GHz), and 5' (217 GHz and higher). HFI has been operating flawlessly since launch on 14 May 2009, with the bolometers reaching 100 mK the first week of July. The settings of the readout electronics, including bolometer bias currents, that optimize HFI's noise performance on orbit are nearly the same as the ones chosen during ground testing. Observations of Mars, Jupiter, and Saturn have confirmed that the optical beams and the time responses of the detection chains are in good agreement with the predictions of physical optics modeling and pre-launch measurements. The Detectors suffer from a high flux of cosmic rays due to historically low levels of solar activity. As a result of the redundancy of Planck's observation strategy, theremoval of a few percent of data contaminated by glitches does not significantly affect the instrumental sensitivity. The cosmic ray flux represents a significant and variable heat load on the sub-Kelvin stage. Temporal variation and the inhomogeneous distribution of the flux results in thermal fluctuations that are a probable source of low frequency noise. The removal of systematic effects in the time ordered data provides a signal with an average noise equivalent power that is 70% of the goal in the 0.6-2.5 Hz range. This is slightly higher than was achieved during the pre-launch characterization but better than predicted in the early phases of the project. The improvement over the goal is a result of the low level of instrumental background loading achieved by the optical and thermal design of the HFI. Corresponding author: J.-M. Lamarre, jean-michel.lamarre@obspm.fr

Method and apparatus for Doppler frequency modulation of radiation

NASA Technical Reports Server (NTRS)

Margolis, J. S.; Mccleese, D. J.; Shumate, M. S.; Seaman, C. H. (Inventor)

1980-01-01

A method and apparatus are described for frequency modulating radiation, such as from a laser, for optoacoustic detectors, interferometers, heterodyne spectrometers, and similar devices. Two oppositely reciprocating cats-eye retroreflectors are used to Doppler modulate the radiation. By reciprocally moving both retroreflectors, the center of mass is maintained constant to permit smooth operation at many Hertz. By slightly offsetting the axis of one retroreflector relative to the other, multiple passes of a light beam may be achieved for greater Doppler shifts with the same reciprocating motion of the retroreflectors.

Distribution of the HLA class I allele in chronic hepatitis C and its association with serum ALT level in chronic hepatitis C.

PubMed

Kondo, Yasuteru; Kobayashi, Koju; Kobayashi, Tomoo; Shiina, Masaaki; Ueno, Yoshiyuki; Satoh, Takaomi; Shimosegawa, Tooru

2003-10-01

An essential process for resolution of viral infections is the efficient recognition and elimination of intracellular virus. Recognition of viral antigens in the form of short peptides associated with HLA class I molecule is a major task of CD8+ cytotoxic T lymphocytes. In this study, we have evaluated the frequency of the HLA class I alleles in patients with chronic hepatitis C. HLA-B51, -B52, -B55, -B56, -B61, B70, -Cw1, -Cw3, and -Cw4 are less frequent in patients with chronic hepatitis C than in Japanese individuals. The frequency of HLA-A2 is slightly lower in the patients but tends to be higher in patients with normal alanine aminotransferase (ALT) level than in those with elevated ALT level (p = 0.07). Other HLA alleles are not significantly different between two groups. Comparison of HLA homozygosity at HLA-A and -B or -C or at two or three loci did not show a significant association with levels of serum ALT or with the clinical outcome of interferon therapy in patients with hepatitis C. These results suggest a possibility that the alterations of host response, which depends on genetic background, influence disease activities of HCV infection.

Humans with chronic granulomatous disease maintain humoral immunologic memory despite low frequencies of circulating memory B cells

PubMed Central

Santich, Brian H.; Kim, Jin Young; Posada, Jacqueline G.; Ho, Jason; Buckner, Clarisa M.; Wang, Wei; Kardava, Lela; Garofalo, Mary; Marciano, Beatriz E.; Manischewitz, Jody; King, Lisa R.; Khurana, Surender; Chun, Tae-Wook; Golding, Hana; Fauci, Anthony S.; Malech, Harry L.

2012-01-01

CD27+ memory B cells are reduced in the blood of patients with chronic granulomatous disease (CGD) for reasons and consequences that remain unclear. Here we confirm not only decreased CD27+ but also IgG+ B cells in the blood of CGD patients compared with healthy donors (HDs). However, among IgG+ B cells, the ratio of CD27− to CD27+ was significantly higher in CGD patients compared with HDs. Similar to conventional memory B cells, CD27−IgG+ B cells of CGD patients expressed activation markers and had undergone somatic hypermutation, albeit at levels lower than their CD27+ counterparts. Functional analyses revealed slight reductions in frequencies of total IgG but not influenza-specific memory B-cell responses, as measured by Elispot in CGD patients compared with HDs. Serum IgG levels and influenza-specific antibodies were also normal in these CGD patients. Finally, we provide evidence that influenza-specific memory B cells can be present within the CD27−IgG+ B-cell compartment. Together, these findings show that, despite reduced circulating CD27+ memory B cells, CGD patients maintain an intact humoral immunologic memory, with potential contribution from CD27− B cells. PMID:23074274

Humans with chronic granulomatous disease maintain humoral immunologic memory despite low frequencies of circulating memory B cells.

PubMed

Moir, Susan; De Ravin, Suk See; Santich, Brian H; Kim, Jin Young; Posada, Jacqueline G; Ho, Jason; Buckner, Clarisa M; Wang, Wei; Kardava, Lela; Garofalo, Mary; Marciano, Beatriz E; Manischewitz, Jody; King, Lisa R; Khurana, Surender; Chun, Tae-Wook; Golding, Hana; Fauci, Anthony S; Malech, Harry L

2012-12-06

CD27(+) memory B cells are reduced in the blood of patients with chronic granulomatous disease (CGD) for reasons and consequences that remain unclear. Here we confirm not only decreased CD27(+) but also IgG(+) B cells in the blood of CGD patients compared with healthy donors (HDs). However, among IgG(+) B cells, the ratio of CD27(-) to CD27(+) was significantly higher in CGD patients compared with HDs. Similar to conventional memory B cells, CD27(-)IgG(+) B cells of CGD patients expressed activation markers and had undergone somatic hypermutation, albeit at levels lower than their CD27(+) counterparts. Functional analyses revealed slight reductions in frequencies of total IgG but not influenza-specific memory B-cell responses, as measured by Elispot in CGD patients compared with HDs. Serum IgG levels and influenza-specific antibodies were also normal in these CGD patients. Finally, we provide evidence that influenza-specific memory B cells can be present within the CD27(-)IgG(+) B-cell compartment. Together, these findings show that, despite reduced circulating CD27(+) memory B cells, CGD patients maintain an intact humoral immunologic memory, with potential contribution from CD27(-) B cells.

High frequency electromagnetism, heat transfer and fluid flow coupling in ANSYS multiphysics.

PubMed

Sabliov, Cristina M; Salvi, Deepti A; Boldor, Dorin

2007-01-01

The goal of this study was to numerically predict the temperature of a liquid product heated in a continuous-flow focused microwave system by coupling high frequency electromagnetism, heat transfer, and fluid flow in ANSYS Multiphysics. The developed model was used to determine the temperature change in water processed in a 915 MHz microwave unit, under steady-state conditions. The influence of the flow rates on the temperature distribution in the liquid was assessed. Results showed that the average temperature of water increased from 25 degrees C to 34 degrees C at 2 l/min, and to 42 degrees C at 1 l/min. The highest temperature regions were found in the liquid near the center of the tube, followed by progressively lower temperature regions as the radial distance from the center increased, and finally followed by a slightly higher temperature region near the tube's wall corresponding to the energy distribution given by the Mathieu function. The energy distribution resulted in a similar temperature pattern, with the highest temperatures close to the center of the tube and lower at the walls. The presented ANSYS Multiphysics model can be easily improved to account for complex boundary conditions, phase change, temperature dependent properties, and non-Newtonian flows, which makes for an objective of future studies.

Effect of Zn doping on structural and dielectric properties of tetragonal Ni{sub 1-x}Zn{sub x}Fe{sub 2}O{sub 4} (0.0 ≤ x ≤ 0.5)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lone, S. A.; Dar, M. A.; Kumar, A.

2015-06-24

A series of Ni-Zn ferrite with compositional formula Ni{sub 1-x}Zn{sub x}Fe{sub 2}O{sub 4} (0.0 ≤ x ≤ 0.5) were prepared by solid-state reaction route. The influence of the Zn content on the structural and dielectric properties of NiFe{sub 2}O{sub 4} was investigated using X-ray powder diffraction (XRD), Raman spectroscopy and dielectric measurements. XRD analysis reveals that the samples are polycrystalline single-phase cubic spinel in structure excluding the presence of any secondary phase corresponding to any structure. Slight variation in the lattice parameter of Zn doped NiFe{sub 2}O{sub 4} has been observed due to difference in ionic radii of cations. Ramanmore » analysis reveals the doublet like nature of A{sub 1g} mode for all synthesized samples. Small shift in Raman modes and increment in the line width has been observed with the doping ions. Furthermore, room temperature dielectric properties of all the prepared samples have been reported. It is observed that for each sample the dielectric constant decreases with an increase of frequency and becomes constant at higher frequencies.« less

Cleaning efficiency enhancement by ultrasounds for membranes used in dairy industries.

PubMed

Luján-Facundo, M J; Mendoza-Roca, J A; Cuartas-Uribe, B; Álvarez-Blanco, S

2016-11-01

Membrane cleaning is a key point for the implementation of membrane technologies in the dairy industry for proteins concentration. In this study, four ultrafiltration (UF) membranes with different molecular weight cut-offs (MWCOs) (5, 15, 30 and 50kDa) and materials (polyethersulfone and ceramics) were fouled with three different whey model solutions: bovine serum albumin (BSA), BSA plus CaCl2 and whey protein concentrate solution (Renylat 45). The purpose of the study was to evaluate the effect of ultrasounds (US) on the membrane cleaning efficiency. The influence of ultrasonic frequency and the US application modes (submerging the membrane module inside the US bath or applying US to the cleaning solution) were also evaluated. The experiments were performed in a laboratory plant which included the US equipment and the possibility of using two membrane modules (flat sheet and tubular). The fouling solution that caused the highest fouling degree for all the membranes was Renylat 45. Results demonstrated that membrane cleaning with US was effective and this effectiveness increased at lower frequencies. Although no significant differences were observed between the two different US applications modes tested, slightly higher cleaning efficiencies values placing the membrane module at the bottom of the tank were achieved. Copyright © 2016 Elsevier B.V. All rights reserved.

Structural Alterations of Lignins in Transgenic Poplars with Depressed Cinnamyl Alcohol Dehydrogenase or Caffeic Acid O-Methyltransferase Activity Have an Opposite Impact on the Efficiency of Industrial Kraft Pulping1

PubMed Central

Lapierre, Catherine; Pollet, Brigitte; Petit-Conil, Michel; Toval, Gabriel; Romero, Javier; Pilate, Gilles; Leplé, Jean-Charles; Boerjan, Wout; Ferret, Valérie; De Nadai, Véronique; Jouanin, Lise

1999-01-01

We evaluated lignin profiles and pulping performances of 2-year-old transgenic poplar (Populus tremula × Populus alba) lines severely altered in the expression of caffeic acid/5-hydroxyferulic acid O-methyltransferase (COMT) or cinnamyl alcohol dehydrogenase (CAD). Transgenic poplars with CAD or COMT antisense constructs showed growth similar to control trees. CAD down-regulated poplars displayed a red coloration mainly in the outer xylem. A 90% lower COMT activity did not change lignin content but dramatically increased the frequency of guaiacyl units and resistant biphenyl linkages in lignin. This alteration severely lowered the efficiency of kraft pulping. The Klason lignin level of CAD-transformed poplars was slightly lower than that of the control. Whereas CAD down-regulation did not change the frequency of labile ether bonds or guaiacyl units in lignin, it increased the proportion of syringaldehyde and diarylpropane structures and, more importantly with regard to kraft pulping, of free phenolic groups in lignin. In the most depressed line, ASCAD21, a substantially higher content in free phenolic units facilitated lignin solubilization and fragmentation during kraft pulping. These results point the way to genetic modification of lignin structure to improve wood quality for the pulp industry. PMID:9880356

Alternating activation is related to fatigue in lumbar muscles during sustained sitting.

PubMed

Ringheim, Inge; Indahl, Aage; Roeleveld, Karin

2014-06-01

The aim of this study was to investigate the relation between variability in muscle activity and fatigue during a sustained low level contraction in the lumbar muscles. Twenty-five healthy participants (13 men 12 women) performed a 30min sitting task with 5 degrees inclination of the trunk. Surface electromyographic (EMG) signals were recorded bilaterally from the lumbar muscles with 2 high density surface EMG grids of 9×14 electrodes. Median frequency (MDF) decrease, amplitude (RMS) increase and the rating of perceived exertion (RPE) were used as fatigue indices. Alternating activation and spatial and temporal variability were computed and relations with the fatigue indices were explored. During sitting, the mono- and bipolar RMS slightly increased while the MDF remained unchanged indicating no systematic muscle fatigue, although the average RPE increased from 6 to 13 on a scale ranging between 6 and 20. Higher frequency of alternating activation between the left and right side was associated with increased RPE (p=0.03) and decreased MDF (p=0.05). A tendency in the same direction was seen between increased spatial and temporal variation within the grids and increased RPE and decreased MDF. Present findings provide evidence for a relationship between variability in muscle activity and fatigue. Copyright © 2014 Elsevier Ltd. All rights reserved.

Non-auditory health effects among air force crew chiefs exposed to high level sound.

PubMed

Jensen, Anker; Lund, Søren Peter; Lücke, Thorsten Høgh; Clausen, Ole Voldum; Svendsen, Jørgen Torp

2009-01-01

The possibility of non-auditory health effects in connection with occupational exposure to high level sound is supposed by some researchers, but is still debated. Crew chiefs on airfields are exposed to high-level aircraft sound when working close to aircraft with running engines. We compared their health status with a similar control group who were not subject to this specific sound exposure. Health records of 42 crew chiefs were compared to health records of 42 aircraft mechanics and 17 former crew chiefs. The specific sound exposure of crew chiefs was assessed. The number of reported disease cases was generally small, but generally slightly higher among mechanics than among crew chiefs. Diseases of the ear were more frequent among crew chiefs (not significant). Former crew chiefs reported fewer diseases of the ear and more airways infections (both significant). The sound exposure during launch was up to 144 dB (peak) and 124 dB (L(eq) ), but for limited time. The study did not reveal a higher disease frequency in general among crew chiefs. However, it did reveal a tendency to ear diseases, possibly due to their exposure to high-level sound.

Health status, stress and life satisfaction in a community population with MS.

PubMed

Patten, Scott B; Williams, Jeanne V A; Lavorato, Dina H; Berzins, Sandy; Metz, Luanne M; Bulloch, Andrew G M

2012-03-01

Community-based studies can describe health status and related variables in people with Multiple Sclerosis (MS) while avoiding biases introduced by help-seeking in specific clinical settings. To describe general health status, stress perceptions and life satisfaction in people with MS, in comparison to those with other types of disabilities. The Participation and Activity Limitation Survey (PALS) was a post-censual survey conducted by Statistics Canada in association with the 2006 Canadian Census. PALS collected data from a random sample of n = 22,513 respondents identified as having health-related impairments. Frequencies and quartiles as well as mean values, along with associated 95% confidence intervals, were calculated in the analysis. PALS identified 245 individuals with MS. Health status, both perceived and when weighted for societal preference, was markedly lower than that of other disabled groups. No differences in self-perceived stress were seen. People with MS reported lower levels of satisfaction with their health but slightly higher levels of satisfaction with their family and friends. People with MS report lower levels of general health status and more impairment than those with other disabling conditions. Higher levels of satisfaction with friends and family may reflect psychological adaptation to the illness.

Understanding the science of climate change: Talking Points - Impacts to arid lands

Treesearch

Rachel Loehman

2010-01-01

Arid ecosystems are particularly sensitive to climate change and climate variability because organisms in these regions live near their physiological limits for water and temperature stress. Slight changes in temperature or precipitation regimes, or in magnitude and frequency of extreme climatic events, can significantly alter the composition, abundance, and...

Multi-Source Generation Mechanisms for Low Frequency Noise Induced by Flood Discharge and Energy Dissipation from a High Dam with a Ski-Jump Type Spillway

PubMed Central

Lian, Jijian; Zhang, Wenjiao; Ma, Bin; Liu, Dongming

2017-01-01

As excess water is discharged from a high dam, low frequency noise (air pulsation lower than 10 Hz, LFN) is generated and propagated in the surrounding areas, causing environmental hazards such as the vibration of windows and doors and the discomfort of local residents. To study the generation mechanisms and key influencing factors of LFN induced by flood discharge and energy dissipation from a high dam with a ski-jump type spillway, detailed prototype observations and analyses of LFN are carried out. The discharge flow field is simulated and analyzed using a gas-liquid turbulent flow model. The acoustic response characteristics of the air cavity, which is formed between the discharge nappe and dam body, are analyzed using an acoustic numerical model. The multi-sources generation mechanisms are first proposed basing on the prototype observation results, vortex sound model, turbulent flow model and acoustic numerical model. Two kinds of sources of LFN are studied. One comes from the energy dissipation of submerged jets in the plunge pool, the other comes from nappe-cavity coupled vibration. The results of the analyses reveal that the submerged jets in the plunge pool only contribute to an on-site LFN energy of 0–1.0 Hz, and the strong shear layers around the high-velocity submerged jets and wall jet development areas are the main acoustic source regions of LFN in the plunge pool. In addition, the nappe-cavity coupled vibration, which is induced when the discharge nappe vibrates with close frequency to the model frequency of the cavity, can induce on-site LFN energy with wider frequency spectrum energy within 0–4.0 Hz. By contrast, the contribution degrees to LFN energy from two acoustic sources are almost same, while the contribution degree from nappe-cavity coupled vibration is slightly higher. PMID:29189750

Mid-Infrared Vibrational Spectra of Discrete Acetone-Ligated Cerium Hydroxide Cations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Groenewold, G. S.; Gianotto, Anita K.; Cossel, Kevin C.

2007-02-15

Cerium (III) hydroxy reactive sites are responsible for several important heterogeneous catalysis processes, and understanding the reaction chemistry of substrate molecules like CO, H2O, and CH3OH as they occur in heterogeneous media is a challenging task. We report here the first infrared spectra of model gas-phase cerium complexes and use the results as a benchmark to assist evaluation of the accuracy of ab initio calculations. Complexes containing [CeOH]2+ ligated by three- and four-acetone molecules were generated by electrospray ionization and characterized using wavelength-selective infrared multiple photon dissociation (IRMPD). The C=O stretching frequency for the [CeOH(acetone)4]2+ species appeared at 1650 cm-1more » and was red-shifted by 90 cm-1 compared to unligated acetone. The magnitude of this shift for the carbonyl frequency was even greater for the [CeOH(acetone)3]2+ complex: the IRMPD peak consisted of two dissociation channels, an initial elimination of acetone at 1635 cm-1, and elimination of acetone accompanied by a serial charge separation producing [CeO(acetone)]+ at 1599 cm-1, with the overall frequency centered at 1616 cm-1. The increasing red shift observed as the number of acetone ligands decreases from four to three is consistent with transfer of more electron density per ligand in the less coordinated complexes. The lower frequency measured for the elimination/charge separation process is likely due to anharmonicity resulting from population of higher vibrational states. The C-C stretching frequency in the complexes is also influenced by coordination to the metal: it is blue-shifted compared to bare acetone, indicating a slight strengthening of the C-C bond in the complex, with the intensity of the absorption decreasing with decreasing ligation. Density functional theory (DFT) calculations using three different functionals (LDA, B3LYP, and PBE0) are used to predict the infrared spectra of the complexes. Calculated frequencies for the carbonyl stretch are within 40 cm-1 of the IRMPD of the three-acetone complex measured using the single acetone loss, and within 60 cm-1 of the measurement for the four-acetone complexes. The B3LYP and LDA functionals provided the best agreement with the measured spectra. The C-C stretching frequencies calculated using B3LYP are higher in energy than the measured values by ~ 30 cm-1, and reproduce the observed trend which shows that the C-C stretching frequency decreases with increasing ligation. Agreement between C-C frequency and calculation was not as good using the LDA functional, but still within 70 cm-1. The results provide an evaluation of changes in the acceptor properties of the metal center as ligands are added, and of the utility of DFT for modeling f-block coordination complexes.« less

Test-retest reliability of pure-tone thresholds from 0.5 to 16 kHz using Sennheiser HDA 200 and Etymotic Research ER-2 earphones.

PubMed

Schmuziger, Nicolas; Probst, Rudolf; Smurzynski, Jacek

2004-04-01

The purposes of the study were: (1) To evaluate the intrasession test-retest reliability of pure-tone thresholds measured in the 0.5-16 kHz frequency range for a group of otologically healthy subjects using Sennheiser HDA 200 circumaural and Etymotic Research ER-2 insert earphones and (2) to compare the data with existing criteria of significant threshold shifts related to ototoxicity and noise-induced hearing loss. Auditory thresholds in the frequency range from 0.5 to 6 kHz and in the extended high-frequency range from 8 to 16 kHz were measured in one ear of 138 otologically healthy subjects (77 women, 61 men; mean age, 24.4 yr; range, 12-51 yr) using HDA 200 and ER-2 earphones. For each subject, measurements of thresholds were obtained twice for both transducers during the same test session. For analysis, the extended high-frequency range from 8 to 16 kHz was subdivided into 8 to 12.5 and 14 to 16 kHz ranges. Data for each frequency and frequency range were analyzed separately. There were no significant differences in repeatability for the two transducer types for all frequency ranges. The intrasession variability increased slightly, but significantly, as frequency increased with the greatest amount of variability in the 14 to 16 kHz range. Analyzing each individual frequency, variability was increased particularly at 16 kHz. At each individual frequency and for both transducer types, intrasession test-retest repeatability from 0.5 to 6 kHz and 8 to 16 kHz was within 10 dB for >99% and >94% of measurements, respectively. The results indicated a false-positive rate of <3% in reference to the criteria for cochleotoxicity for both transducer types. In reference to the Occupational Safety and Health Administration Standard Threshold Shift criteria for noise-induced hazards, the results showed a minor false-positive rate of <1% for the HDA 200. Repeatability was similar for both transducer types. Intrasession test-retest repeatability from 0.5 to 12.5 kHz at each individual frequency including the frequency range susceptible to noise-induced hearing loss was excellent for both transducers. Repeatability was slightly, but significantly poorer in the frequency range from 14 to 16 kHz compared with the frequency ranges from 0.5 to 6 or 8 to 12.5 kHz. Measurements in the extended high-frequency range from 8 to 14 kHz, but not up to 16 kHz, may be recommended for monitoring purposes.

Temporal trends in United States dew point temperatures

NASA Astrophysics Data System (ADS)

Robinson, Peter J.

2000-07-01

In this study, hourly data for the 1951-1990 period for 178 stations in the coterminous United States were used to establish temporal trends in dew point temperature. Although the data had been quality controlled previously (Robinson, 1998. Monthly variations of dew point temperatures in the coterminous United States. International Journal of Climatology 18: 1539-1556), comparisons of values between nearby stations suggested that instrumental changes, combined with locational changes, may have modified the results by as much as 1°C during the 40-year period. Nevertheless, seasonally averaged results indicated an increase over much of the area, of slightly over 1°C/100 years in spring and autumn, slightly less than this in summer. Winter displayed a drying of over 1°C/100 years. When only the 1961-1990 period was considered, the patterns were similar and trends increased by approximately 1-2°C/100 years, except in autumn, which displayed a slight drying. Analyses for specific stations indicated periods of both increasing and decreasing Td, the change between them varying with observation hour. No single change point was common over a wide area, although January commonly indicated maximum values early in the period in the east and west, and much later in the north-central portion. Rates of increase were generally higher in daytime than at night, especially in summer. Investigation of the inter-decadal differences in dew point, as a function of wind conditions, indicated that changes during calm conditions were commonly similar in magnitude to that of the overall average changes, suggesting an important role for the local hydrologic cycle in driving changes. Other inter-decadal changes could be attributed to the changes in the frequency and moisture content of invading air-streams. This was particularly clear for the changes in north-south flow in the interior.

Propagation of high amplitude higher order sounds in slightly soft rectangular ducts, carrying mean flow

NASA Technical Reports Server (NTRS)

Wang, K. S.; Vaidya, P. G.

1975-01-01

The resonance expansion method, developed to study the propagation of sound in rigid rectangular ducts is applied to the case of slightly soft ducts. Expressions for the generation and decay of various harmonics are obtained. The effect of wall admittance is seen through a dissipation function in the system of nonlinear differential equations, governing the generation of harmonics. As the wall admittance increases, the resonance is reduced. For a given wall admittance this phenomenon is stronger at higher input intensities. Both the first and second order solutions are obtained and the results are extended to the case of ducts having mean flow.

Visual stimulus eccentricity affects human gamma peak frequency.

PubMed

van Pelt, Stan; Fries, Pascal

2013-09-01

The peak frequency of neuronal gamma-band synchronization has received much attention in recent years. Gamma peak frequency shifts to higher frequency values for higher contrast, faster moving, and attended stimuli. In monkey V1, gamma peak frequency for a drifting grating is higher for a parafoveal as compared to an eccentric stimulus (Lima et al., 2010). This effect might be due to the cortical magnification factor: the higher cortical magnification for parafoveal stimuli increases the velocity with which the cortical representations of the moving grating stripes move across the cortical surface. Since faster moving stimuli lead to higher gamma frequency, a faster moving cortical representation might do the same. This explanation predicts that the eccentricity effect on gamma peak frequency is absent for stationary stimuli. To test this, we investigated the effect of eccentricity on gamma peak frequency by recording magnetoencephalography in human subjects while they viewed moving or stationary gratings. We found that both the moving and the stationary stimuli induced lower peak frequencies for larger eccentricities, arguing against an explanation based on the cortical magnification factor. We further investigated whether this eccentricity effect was explained by differences in the size or the spatial frequency of the expected cortical activation. Neither of those explained the eccentricity effect. We propose that the different stimulus and top-down factors leading to higher gamma peak frequency all result in higher stimulus salience, that salience is translated into gamma peak frequency, and that gamma peak frequency might subserve the preferential processing of neuronal activity induced by salient stimuli. Copyright © 2013 Elsevier Inc. All rights reserved.

Hematology of healthy Florida manatees (Trichechus manatus).

PubMed

Harvey, John W; Harr, Kendal E; Murphy, David; Walsh, Michael T; Nolan, Elizabeth C; Bonde, Robert K; Pate, Melanie G; Deutsch, Charles J; Edwards, Holly H; Clapp, William L

2009-06-01

Hematologic analysis is an important tool in evaluating the general health status of free-ranging manatees and in the diagnosis and monitoring of rehabilitating animals. The purpose of this study was to evaluate diagnostically important hematologic analytes in healthy manatees (Trichechus manatus) and to assess variations with respect to location (free ranging vs captive), age class (small calves, large calves, subadults, and adults), and gender. Blood was collected from 55 free-ranging and 63 captive healthy manatees. Most analytes were measured using a CELL-DYN 3500R; automated reticulocytes were measured with an ADVIA 120. Standard manual methods were used for differential leukocyte counts, reticulocyte and Heinz body counts, and plasma protein and fibrinogen concentrations. Rouleaux, slight polychromasia, stomatocytosis, and low numbers of schistocytes and nucleated RBCs (NRBCs) were seen often in stained blood films. Manual reticulocyte counts were higher than automated reticulocyte counts. Heinz bodies were present in erythrocytes of most manatees. Compared with free-ranging manatees, captive animals had slightly lower MCV, MCH, and eosinophil counts and slightly higher heterophil and NRBC counts, and fibrinogen concentration. Total leukocyte, heterophil, and monocyte counts tended to be lower in adults than in younger animals. Small calves tended to have higher reticulocyte counts and NRBC counts than older animals. Hematologic findings were generally similar between captive and free-ranging manatees. Higher manual reticulocyte counts suggest the ADVIA detects only reticulocytes containing large amounts of RNA. Higher reticulocyte and NRBC counts in young calves probably reflect an increased rate of erythropoiesis compared with older animals.

Increased spring freezing vulnerability for alpine shrubs under early snowmelt.

PubMed

Wheeler, J A; Hoch, G; Cortés, A J; Sedlacek, J; Wipf, S; Rixen, C

2014-05-01

Alpine dwarf shrub communities are phenologically linked with snowmelt timing, so early spring exposure may increase risk of freezing damage during early development, and consequently reduce seasonal growth. We examined whether environmental factors (duration of snow cover, elevation) influenced size and the vulnerability of shrubs to spring freezing along elevational gradients and snow microhabitats by modelling the past frequency of spring freezing events. We sampled biomass and measured the size of Salix herbacea, Vaccinium myrtillus, Vaccinium uliginosum and Loiseleuria procumbens in late spring. Leaves were exposed to freezing temperatures to determine the temperature at which 50% of specimens are killed for each species and sampling site. By linking site snowmelt and temperatures to long-term climate measurements, we extrapolated the frequency of spring freezing events at each elevation, snow microhabitat and per species over 37 years. Snowmelt timing was significantly driven by microhabitat effects, but was independent of elevation. Shrub growth was neither enhanced nor reduced by earlier snowmelt, but decreased with elevation. Freezing resistance was strongly species dependent, and did not differ along the elevation or snowmelt gradient. Microclimate extrapolation suggested that potentially lethal freezing events (in May and June) occurred for three of the four species examined. Freezing events never occurred on late snow beds, and increased in frequency with earlier snowmelt and higher elevation. Extrapolated freezing events showed a slight, non-significant increase over the 37-year record. We suggest that earlier snowmelt does not enhance growth in four dominant alpine shrubs, but increases the risk of lethal spring freezing exposure for less freezing-resistant species.

Aeroacoustic prediction of turbulent free shear flows

NASA Astrophysics Data System (ADS)

Bodony, Daniel Joseph

2005-12-01

For many people living in the immediate vicinity of an active airport the noise of jet aircraft flying overhead can be a nuisance, if not worse. Airports, which are held accountable for the noise they produce, and upcoming international noise limits are pressuring the major airframe and jet engine manufacturers to bring quieter aircraft into service. However, component designers need a predictive tool that can estimate the sound generated by a new configuration. Current noise prediction techniques are almost entirely based on previously collected experimental data and are applicable only to evolutionary, not revolutionary, changes in the basic design. Physical models of final candidate designs must still be built and tested before a single design is selected. By focusing on the noise produced in the jet engine exhaust at take-off conditions, the prediction of sound generated by turbulent flows is addressed. The technique of large-eddy simulation is used to calculate directly the radiated sound produced by jets at different operating conditions. Predicted noise spectra agree with measurements for frequencies up to, and slightly beyond, the peak frequency. Higher frequencies are missed, however, due to the limited resolution of the simulations. Two methods of estimating the 'missing' noise are discussed. In the first a subgrid scale noise model, analogous to a subgrid scale closure model, is proposed. In the second method the governing equations are expressed in a wavelet basis from which simplified time-dependent equations for the subgrid scale fluctuations can be derived. These equations are inexpensively integrated to yield estimates of the subgrid scale fluctuations with proper space-time dynamics.

Distribution of HLA-A, -B and -DRB1 alleles in patients with sudden sensorineural hearing loss.

PubMed

Yeo, S W; Chang, K H; Suh, B D; Kim, T G; Han, H

2000-09-01

This study was performed to investigate the association between human leukocyte antigen (HLA) and susceptibility to sudden sensorineural hearing loss in the Korean population. HLA-A and HLA-B typing using a standard microlymphocytotoxicity technique and HLA-DRB1 genotyping were performed in 35 patients with sudden sensorineural hearing loss and in 206 healthy controls. Prednisone (usual dose 60 mg/day) was administered for 6 days and tapered for an additional 4-6 days. Both initial hearing levels at the onset of deafness and final hearing levels after treatment were examined and evaluated for association with HLA alleles. The frequency of HLA-DRB1*14 was increased in patients with sudden sensorineural hearing loss compared with controls (relative risk [RR] = 2.7, p = 0.016). The frequencies of HLA-A2, -A31, -B52, -B61, -DRB1*04, -DRB1*11 and -DRB1*12 were slightly higher than in the controls, but did not reach statistical significance. When an association between the treatment results and HLA alleles was also evaluated, the frequency of HLA-DRB1*04 was found to be increased in the patients who did not respond to steroid treatment compared with both patients who responded well to steroid (50%, vs 16%, p = 0.034) and controls (RR = 3.0, p = 0.046). These results suggest that there is an association between HLA-DRB1*14 and disease susceptibility and that the presence of HLA-DRB1*04 may be an useful marker for predicting a poor prognosis in Korean patients with sudden sensorineural hearing loss.

Temporal Tuning of Word- and Face-selective Cortex.

PubMed

Yeatman, Jason D; Norcia, Anthony M

2016-11-01

Sensitivity to temporal change places fundamental limits on object processing in the visual system. An emerging consensus from the behavioral and neuroimaging literature suggests that temporal resolution differs substantially for stimuli of different complexity and for brain areas at different levels of the cortical hierarchy. Here, we used steady-state visually evoked potentials to directly measure three fundamental parameters that characterize the underlying neural response to text and face images: temporal resolution, peak temporal frequency, and response latency. We presented full-screen images of text or a human face, alternated with a scrambled image, at temporal frequencies between 1 and 12 Hz. These images elicited a robust response at the first harmonic that showed differential tuning, scalp topography, and delay for the text and face images. Face-selective responses were maximal at 4 Hz, but text-selective responses, by contrast, were maximal at 1 Hz. The topography of the text image response was strongly left-lateralized at higher stimulation rates, whereas the response to the face image was slightly right-lateralized but nearly bilateral at all frequencies. Both text and face images elicited steady-state activity at more than one apparent latency; we observed early (141-160 msec) and late (>250 msec) text- and face-selective responses. These differences in temporal tuning profiles are likely to reflect differences in the nature of the computations performed by word- and face-selective cortex. Despite the close proximity of word- and face-selective regions on the cortical surface, our measurements demonstrate substantial differences in the temporal dynamics of word- versus face-selective responses.

A comparison of G2 phase radiation-induced chromatid break kinetics using calyculin-PCC with those obtained using colcemid block.

PubMed

Bryant, Peter E; Mozdarani, Hossein

2007-09-01

To study the possible influence of cell-cycle delay on cells reaching mitosis during conventional radiation-induced chromatid break experiments using colcemid as a blocking agent, we have compared the chromatid break kinetics following a single dose of gamma rays (0.75 Gy) in metaphase CHO cells using calyculin-induced premature chromosome condensation (PCC), with those using colcemid block. Calyculin-induced PCC causes very rapid condensation of G2 cell chromosomes without the need for a cell to progress to mitosis, hence eliminating any effect of cell-cycle checkpoint on chromatid break frequency. We found that the kinetics of the exponential first-order decrease in chromatid breaks with time after irradiation was similar (not significantly different) between the two methods of chromosome condensation. However, use of the calyculin-PCC technique resulted in a slightly increased rate of disappearance of chromatid breaks and thus higher frequencies of breaks at 1.5 and 2.5 h following irradiation. We also report on the effect of the nucleoside analogue ara A on chromatid break kinetics using the two chromosome condensation techniques. Ara A treatment of cells abrogated the decrease in chromatid breaks with time, both using the calyculin-PCC and colcemid methods. We conclude that cell-cycle delay may be a factor determining the absolute frequency of chromatid breaks at various times following irradiation of cells in G2 phase but that the first-order disappearance of chromatid breaks with time and its abrogation by ara A are not significantly influenced by the G2 checkpoint.

Ophthalmic Malpractice and Physician Gender: A Claims Data Analysis (An American Ophthalmological Society Thesis)

PubMed Central

Fountain, Tamara R.

2014-01-01

Purpose: To analyze and compare malpractice claims rates between male and female ophthalmologists and test the hypothesis that claims rates are equal between the two sexes. Methods: A retrospective, cohort study review was made of all claims reported to the Ophthalmic Mutual Insurance Company from January 1990 through December 2008 in which an expense (including indemnity and/or legal defense costs) was paid or reserved. A total of 2,251 claims were examined. Frequency (claims per physician) and severity (indemnity payment, associated expenses and reserves per claim) were analyzed for both male and female ophthalmologists. Frequency and severity data were further stratified by allegation, type of treatment, and injury severity category. Results: Men were sued 54% more often than females over the period studied (P<.001). Women had lower claims frequencies across all allegations and within the treatment areas of cataract, cornea, and retinal procedures (P<.7). Men had more claims associated with severe injury, including permanent major injury and death (P<.001). The average amount paid in indemnity and expenses was 7% higher for claims against women ($115,303 compared to $107,354 against men). Conclusions: Nearly 20 years of closed claim data reveal male ophthalmologists are significantly more likely than women to have reported malpractice activity. Claims against men were associated with more severe injury to the patient but were slightly less costly overall compared to claims against women. Further study is necessary to understand the reasons underlying gender disparities in malpractice claims rates and whether the observed past differences are predictive of future results. PMID:25411514

The Complex Nature of Parental Substance Use: Examining Past Year and Prior Use Behaviors as Correlates of Child Maltreatment Frequency.

PubMed

Kepple, Nancy Jo

2017-05-12

Child maltreatment studies predominantly have operationalized parental substance use as dichotomous variables for any use, any harmful/risky use, or any substance use disorder (SUD). This limits our understanding about how a range of use behaviors may contribute to child maltreatment. Build upon prior studies by incorporating a multi-faceted approach to operationalizing parental substance use. Cross-sectional, secondary data analyses were conducted using the National Survey of Child and Adolescent Well-being (NSCAW I). The study used weighted negative binomial regression to examine relationships between annual child maltreatment frequency and different ways of operationalizing substance use among 2,100 parents. Several, inter-related behaviors (i.e., heavy drinking, illicit drug use, polysubstance use, SUD, and prior SUD < 4 years) appeared to be relevant for understanding differences in child maltreatment frequencies. A gradient effect was detected across five substance use behavior patterns: (1) lowest estimated counts were observed for nonusers, light-to-moderate drinkers, and parents with a prior (but not past year) SUD (ӯ < 7.0), (2) slightly higher estimated count was observed for heavy drinkers and/or illicit drug users (ӯ = 9.3), and (3) highest estimated count was observed for parents with past year SUD (ӯ = 17.6). Conclusions/Importance: SUD is a critical screening criteria for potential child harm. Parents reporting risky substance use behaviors may benefit from prevention or brief intervention services related to both their substance use and parenting behaviors. Administrative systems also could benefit from detailed tracking of substance use behaviors for future program evaluation and development.

Epidemiology of central nervous system tumors at the Instituto Nacional de Neurología y Neurocirugía in Mexico City.

PubMed

Velásquez-Pérez, L; Jiménez-Marcial, M E; Martínez-Martínez, J E

2004-10-01

The purpose of this study was to determine the frequency of different Central Nervous System Tumors (CNST) diagnosed at the Instituto Nacional de Neurología y Neurocirugía (National Institute of Neurology and Neurosurgery) from Mexico City over a 10-year period (1990 to 1999) by means of a hospital survey. This institute is a reference hospital that provides medical attention to a very high number of adult neurological patients every year (approximately 6,000 new patients per year besides emergency cases). From a total number of 2,041 CNST cases, we found that the most frequent tumors were those affecting the neuroepithelial tissue (32.8 %), followed by tumors of the anterior pituitary gland (26.2 %) and tumors of the meninges and similar tissues (24.1 %). In both, male and female patients the higher frequency of CNST was found in patients whose age ranged from 25 to 44 years, and CNST were slightly more frequent in women than in men. Most of the CNST patients lived in the southern districts of Mexico City, it could be because of the great number of people living in the southern districts of the city, or perhaps due to the presence of certain yet unidentified environmental carcinogenic substance in this area. Since CNST are among the more frequent malignant neoplasms, it is necessary to improve the registration system to include frequency, prevalence, incidence and mortality of these diseases in Mexico, in order to plan health policies like in developed countries.

Multiple harmonic frequencies resonant cavity design and half-scale prototype measurements for a fast kicker

DOE PAGES

Huang, Yulu; Wang, Haipeng; Wang, Shaoheng; ...

2016-12-09

Quarter wavelength resonator (QWR) based deflecting cavities with the capability of supporting multiple odd-harmonic modes have been developed for an ultrafast periodic kicker system in the proposed Jefferson Lab Electron Ion Collider (JLEIC, formerly MEIC). Previous work on the kicking pulse synthesis and the transverse beam dynamics tracking simulations show that a flat-top kicking pulse can be generated with minimal emittance growth during injection and circulation of the cooling electron bunches. This flat-top kicking pulse can be obtained when a DC component and 10 harmonic modes with appropriate amplitude and phase are combined together. To support 10 such harmonic modes,more » four QWR cavities are used with 5, 3, 1, and 1 modes, respectively. In the multiple-mode cavities, several slightly tapered segments of the inner conductor are introduced to tune the higher order deflecting modes to be harmonic, and stub tuners are used to fine tune each frequency to compensate for potential errors. In this paper, we summarize the electromagnetic design of the five-mode cavity, including the geometry optimization to get high transverse shunt impedance, the frequency tuning and sensitivity analysis, and the single loop coupler design for coupling to all of the harmonic modes. In particular we report on the design and fabrication of a half-scale copper prototype of this proof-of-principle five-odd-mode cavity, as well as the rf bench measurements. Lastly, we demonstrate mode superposition in this cavity experimentally, which illustrates the kicking pulse generation concept.« less

Experimental Characterization of Secular Frequency Scanning in Ion Trap Mass Spectrometers

NASA Astrophysics Data System (ADS)

Snyder, Dalton T.; Pulliam, Christopher J.; Wiley, Joshua S.; Duncan, Jason; Cooks, R. Graham

2016-07-01

Secular frequency scanning is implemented and characterized using both a benchtop linear ion trap and a miniature rectilinear ion trap mass spectrometer. Separation of tetraalkylammonium ions and those from a mass calibration mixture and from a pesticide mixture is demonstrated with peak widths approaching unit resolution for optimized conditions using the benchtop ion trap. The effects on the spectra of ion trap operating parameters, including waveform amplitude, scan direction, scan rate, and pressure are explored, and peaks at black holes corresponding to nonlinear (higher-order field) resonance points are investigated. Reverse frequency sweeps (increasing mass) on the Mini 12 are shown to result in significantly higher ion ejection efficiency and superior resolution than forward frequency sweeps that decrement mass. This result is accounted for by the asymmetry in ion energy absorption profiles as a function of AC frequency and the shift in ion secular frequency at higher amplitudes in the trap due to higher order fields. We also found that use of higher AC amplitudes in forward frequency sweeps biases ions toward ejection at points of higher order parametric resonance, despite using only dipolar excitation. Higher AC amplitudes also increase peak width and decrease sensitivity in both forward and reverse frequency sweeps. Higher sensitivity and resolution were obtained at higher trap pressures in the secular frequency scan, in contrast to conventional resonance ejection scans, which showed the opposite trend in resolution on the Mini 12. Mass range is shown to be naturally extended in secular frequency scanning when ejecting ions by sweeping the AC waveform through low frequencies, a method which is similar, but arguably superior, to the more usual method of mass range extension using low q resonance ejection.

Experimental Characterization of Secular Frequency Scanning in Ion Trap Mass Spectrometers.

PubMed

Snyder, Dalton T; Pulliam, Christopher J; Wiley, Joshua S; Duncan, Jason; Cooks, R Graham

2016-07-01

Secular frequency scanning is implemented and characterized using both a benchtop linear ion trap and a miniature rectilinear ion trap mass spectrometer. Separation of tetraalkylammonium ions and those from a mass calibration mixture and from a pesticide mixture is demonstrated with peak widths approaching unit resolution for optimized conditions using the benchtop ion trap. The effects on the spectra of ion trap operating parameters, including waveform amplitude, scan direction, scan rate, and pressure are explored, and peaks at black holes corresponding to nonlinear (higher-order field) resonance points are investigated. Reverse frequency sweeps (increasing mass) on the Mini 12 are shown to result in significantly higher ion ejection efficiency and superior resolution than forward frequency sweeps that decrement mass. This result is accounted for by the asymmetry in ion energy absorption profiles as a function of AC frequency and the shift in ion secular frequency at higher amplitudes in the trap due to higher order fields. We also found that use of higher AC amplitudes in forward frequency sweeps biases ions toward ejection at points of higher order parametric resonance, despite using only dipolar excitation. Higher AC amplitudes also increase peak width and decrease sensitivity in both forward and reverse frequency sweeps. Higher sensitivity and resolution were obtained at higher trap pressures in the secular frequency scan, in contrast to conventional resonance ejection scans, which showed the opposite trend in resolution on the Mini 12. Mass range is shown to be naturally extended in secular frequency scanning when ejecting ions by sweeping the AC waveform through low frequencies, a method which is similar, but arguably superior, to the more usual method of mass range extension using low q resonance ejection. Graphical Abstract ᅟ.

Early-life predictors of leisure-time physical inactivity in midadulthood: findings from a prospective British birth cohort.

PubMed

Pinto Pereira, Snehal M; Li, Leah; Power, Chris

2014-12-01

Much adult physical inactivity research ignores early-life factors from which later influences may originate. In the 1958 British birth cohort (followed from 1958 to 2008), leisure-time inactivity, defined as activity frequency of less than once a week, was assessed at ages 33, 42, and 50 years (n = 12,776). Early-life factors (at ages 0-16 years) were categorized into 3 domains (i.e., physical, social, and behavioral). We assessed associations of adult inactivity 1) with factors within domains, 2) with the 3 domains combined, and 3) allowing for adult factors. At each age, approximately 32% of subjects were inactive. When domains were combined, factors associated with inactivity (e.g., at age 50 years) were prepubertal stature (5% lower odds per 1-standard deviation higher height), hand control/coordination problems (14% higher odds per 1-point increase on a 4-point scale), cognition (10% lower odds per 1-standard deviation greater ability), parental divorce (21% higher odds), institutional care (29% higher odds), parental social class at child's birth (9% higher odds per 1-point reduction on a 4-point scale), minimal parental education (13% higher odds), household amenities (2% higher odds per increase (representing poorer amenities) on a 19-point scale), inactivity (8% higher odds per 1-point reduction in activity on a 4-point scale), low sports aptitude (13% higher odds), and externalizing behaviors (i.e., conduct problems) (5% higher odds per 1-standard deviation higher score). Adjustment for adult covariates weakened associations slightly. Factors from early life were associated with adult leisure-time inactivity, allowing for early identification of groups vulnerable to inactivity. © The Author 2014. Published by Oxford University Press on behalf of the Johns Hopkins Bloomberg School of Public Health. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Effect of higher frequency on the classification of steady-state visual evoked potentials

NASA Astrophysics Data System (ADS)

Won, Dong-Ok; Hwang, Han-Jeong; Dähne, Sven; Müller, Klaus-Robert; Lee, Seong-Whan

2016-02-01

Objective. Most existing brain-computer interface (BCI) designs based on steady-state visual evoked potentials (SSVEPs) primarily use low frequency visual stimuli (e.g., <20 Hz) to elicit relatively high SSVEP amplitudes. While low frequency stimuli could evoke photosensitivity-based epileptic seizures, high frequency stimuli generally show less visual fatigue and no stimulus-related seizures. The fundamental objective of this study was to investigate the effect of stimulation frequency and duty-cycle on the usability of an SSVEP-based BCI system. Approach. We developed an SSVEP-based BCI speller using multiple LEDs flickering with low frequencies (6-14.9 Hz) with a duty-cycle of 50%, or higher frequencies (26-34.7 Hz) with duty-cycles of 50%, 60%, and 70%. The four different experimental conditions were tested with 26 subjects in order to investigate the impact of stimulation frequency and duty-cycle on performance and visual fatigue, and evaluated with a questionnaire survey. Resting state alpha powers were utilized to interpret our results from the neurophysiological point of view. Main results. The stimulation method employing higher frequencies not only showed less visual fatigue, but it also showed higher and more stable classification performance compared to that employing relatively lower frequencies. Different duty-cycles in the higher frequency stimulation conditions did not significantly affect visual fatigue, but a duty-cycle of 50% was a better choice with respect to performance. The performance of the higher frequency stimulation method was also less susceptible to resting state alpha powers, while that of the lower frequency stimulation method was negatively correlated with alpha powers. Significance. These results suggest that the use of higher frequency visual stimuli is more beneficial for performance improvement and stability as time passes when developing practical SSVEP-based BCI applications.

Effect of higher frequency on the classification of steady-state visual evoked potentials.

PubMed

Won, Dong-Ok; Hwang, Han-Jeong; Dähne, Sven; Müller, Klaus-Robert; Lee, Seong-Whan

2016-02-01

Most existing brain-computer interface (BCI) designs based on steady-state visual evoked potentials (SSVEPs) primarily use low frequency visual stimuli (e.g., <20 Hz) to elicit relatively high SSVEP amplitudes. While low frequency stimuli could evoke photosensitivity-based epileptic seizures, high frequency stimuli generally show less visual fatigue and no stimulus-related seizures. The fundamental objective of this study was to investigate the effect of stimulation frequency and duty-cycle on the usability of an SSVEP-based BCI system. We developed an SSVEP-based BCI speller using multiple LEDs flickering with low frequencies (6-14.9 Hz) with a duty-cycle of 50%, or higher frequencies (26-34.7 Hz) with duty-cycles of 50%, 60%, and 70%. The four different experimental conditions were tested with 26 subjects in order to investigate the impact of stimulation frequency and duty-cycle on performance and visual fatigue, and evaluated with a questionnaire survey. Resting state alpha powers were utilized to interpret our results from the neurophysiological point of view. The stimulation method employing higher frequencies not only showed less visual fatigue, but it also showed higher and more stable classification performance compared to that employing relatively lower frequencies. Different duty-cycles in the higher frequency stimulation conditions did not significantly affect visual fatigue, but a duty-cycle of 50% was a better choice with respect to performance. The performance of the higher frequency stimulation method was also less susceptible to resting state alpha powers, while that of the lower frequency stimulation method was negatively correlated with alpha powers. These results suggest that the use of higher frequency visual stimuli is more beneficial for performance improvement and stability as time passes when developing practical SSVEP-based BCI applications.

Auditory evoked responses to binaural beat illusion: stimulus generation and the derivation of the Binaural Interaction Component (BIC).

PubMed

Ozdamar, Ozcan; Bohorquez, Jorge; Mihajloski, Todor; Yavuz, Erdem; Lachowska, Magdalena

2011-01-01

Electrophysiological indices of auditory binaural beats illusions are studied using late latency evoked responses. Binaural beats are generated by continuous monaural FM tones with slightly different ascending and descending frequencies lasting about 25 ms presented at 1 sec intervals. Frequency changes are carefully adjusted to avoid any creation of abrupt waveform changes. Binaural Interaction Component (BIC) analysis is used to separate the neural responses due to binaural involvement. The results show that the transient auditory evoked responses can be obtained from the auditory illusion of binaural beats.

An analysis of life expectancy of airplane wings in normal cruising flight

NASA Technical Reports Server (NTRS)

Putnam, Abbott A

1945-01-01

In order to provide a basis for judging the relative importance of wing failure by fatigue and by single intense gusts, an analysis of wing life for normal cruising flight was made based on data on the frequency of atmospheric gusts. The independent variables considered in the analysis included stress-concentration factor, stress-load relation, wing loading, design and cruising speeds, design gust velocity, and airplane size. Several methods for estimating fatigue life from gust frequencies are discussed. The procedure selected for the analysis is believed to be simple and reasonably accurate, though slightly conservative.

On vibrational imperfection sensitivity of Augusti's model structure in the vicinity of a non-linear static state

NASA Technical Reports Server (NTRS)

Elishakoff, Isaac; Marcus, S.; Starnes, J. H., JR.

1998-01-01

In this paper we present a closed-form solution for vibrational imperfection sensitivity the effect of small imperfections on the vibrational frequencies of perturbed motion around the static equilibrium state of Augusti's model Structure (a rigid link, pinned at one end to a rigid foundation and supported at the other by a linear extensional spring that retains its horizontality, as the system deflects). We also treat a modified version of that model with attendant slightly different dynamics. It is demonstrated that the vibrational frequencies decreases as the initial imperfections increase.

Atlantic hurricane response to geoengineering

NASA Astrophysics Data System (ADS)

Moore, John; Grinsted, Aslak; Ji, Duoying; Yu, Xiaoyong; Guo, Xiaoran

2015-04-01

Devastating Atlantic hurricanes are relatively rare events. However their intensity and frequency in a warming world may rapidly increase - perhaps by a factor of 5 for a 2°C mean global warming. Geoengineering by sulphate aerosol injection preferentially cools the tropics relative to the polar regions, including the hurricane main development region in the Atlantic, suggesting that geoengineering may be an effective method of controlling hurricanes. We examine this hypothesis using 6 Earth System Model simulations of climate under the GeoMIP G3 and G4 schemes that use aerosols to reduce the radiative forcing under the RCP4.5 scenario. We find that although temperatures are ameliorated by geoengineering, the numbers of storm surge events as big as that caused the 2005 Katrina hurricane are only slightly reduced compared with no geoengineering. As higher levels of sulphate aerosol injection produce diminishing returns in terms of cooling, but cause undesirable effects in various regions, it seems that stratospheric aerosol geoengineering is not an effective method of controlling hurricane damage.

Response of endometrioid ovarian carcinoma in nude mice to the combination of vincristine sulphate and cyclophosphamide.

PubMed

Bjondahl, K; Grönroos, M; Klemi, P; Möttönen, M

1980-01-01

The effect of a combination treatment with vincristine sulphate and cyclophosphamide to endometrioid ovarian carcinoma grown in nude mice hosts was studied by histopathological, ultrastructural and biochemical methods. The first course of treatment had little or no effect. After the second and third courses, however, the growth of the tumors was suppressed as evidenced by increased necrosis and decreased weight of tumors. The total volume of the mitochondria decreased but there was no change in the nucleo-cytoplasmic ratio and other ultrastructural features. In the DNA and RNA contents a decreasing trend was found. No complete remission was observed during the treatment. However, in two treated animals, kept for a longer observation period, the tumors regressed completely and no new tumor growths were found. In the control animals, the tumors grew progressively and the histology was identical to that in the patient. However, the frequency of mitoses was slightly higher in the transplanted tumor than in the primary tumor.

Electrofluid hydrolysis enhances the production of fermentable sugars from corncob via in/reverse-phase induced voltage.

PubMed

Wu, Fengfeng; Jin, Yamei; Li, Dandan; Zhou, Yuyi; Guo, Lunan; Zhang, Mengyue; Xu, Xueming; Yang, Na

2017-06-01

To improve the economic value of lignocellulosic biomasses, an innovative electrofluidic technology has been applied to the efficient hydrolysis of corncob. The system combines fluidic reactors and induced voltages via magnetoelectric coupling effect. The excitation voltage had a positive impact on reducing sugar content (RSC). But, the increase of voltage frequency at 400-700Hz caused a slight decline of the RSC. Higher temperature limits the electrical effect on the hydrolysis at 70-80°C. The energy efficiency increased under the addition of metallic ions and series of in-phase induced voltage to promote hydrolysis. In addition, the 4-series system with in-phase and reverse-phase induced voltages under the synchronous magnetic flux, exhibited a significant influence on the RSC with a maximum increase of 56%. High throughput could be achieved by increasing series in a compact system. Electrofluid hydrolysis avoids electrochemical reaction, electrode corrosion, and sample contamination. Copyright © 2017 Elsevier Ltd. All rights reserved.

Application of adaptive filters in denoising magnetocardiogram signals

NASA Astrophysics Data System (ADS)

Khan, Pathan Fayaz; Patel, Rajesh; Sengottuvel, S.; Saipriya, S.; Swain, Pragyna Parimita; Gireesan, K.

2017-05-01

Magnetocardiography (MCG) is the measurement of weak magnetic fields from the heart using Superconducting QUantum Interference Devices (SQUID). Though the measurements are performed inside magnetically shielded rooms (MSR) to reduce external electromagnetic disturbances, interferences which are caused by sources inside the shielded room could not be attenuated. The work presented here reports the application of adaptive filters to denoise MCG signals. Two adaptive noise cancellation approaches namely least mean squared (LMS) algorithm and recursive least squared (RLS) algorithm are applied to denoise MCG signals and the results are compared. It is found that both the algorithms effectively remove noisy wiggles from MCG traces; significantly improving the quality of the cardiac features in MCG traces. The calculated signal-to-noise ratio (SNR) for the denoised MCG traces is found to be slightly higher in the LMS algorithm as compared to the RLS algorithm. The results encourage the use of adaptive techniques to suppress noise due to power line frequency and its harmonics which occur frequently in biomedical measurements.

Centrifugal distortion and the ring puckering vibration in the microwave spectrum of 2,3-dihydrofuran

NASA Astrophysics Data System (ADS)

Cervellati, R.; Degli Esposti, A.; Lister, D. G.; Lopez, J. C.; Alonso, J. L.

1986-10-01

The microwave spectrum of 2,3-dihydrofuran has been reinvestigated and measurements for the ground and first five excited states of the ring puckering vibration have been extended to higher frequencies and rotational quantum numbers in order to study the vibrational dependence of the rotational and centrifugal distortion constants. The ring puckering potential function derived by Green from the far infrared spectrum does not reproduce the vibrational dependence of the rotational constants well. A slightly different potential function is derived which gives a reasonable fit both to the far infrared spectrum and the rotational constants. This changes the barrier to ring inversion from 1.00 kJ mol -1 to 1.12 kJ mol -1. The vibrational dependence of the centrifugal distortion constants is accounted for satisfactorily by the theory developed by Creswell and Mills. An attempt to reproduce the vibrational dependence of the rotational and centrifugal distortion constants using the ring puckering potential function and a simple model for this vibration has very limited success.

In-flight acoustic measurements on a light twin-engined turboprop airplane

NASA Technical Reports Server (NTRS)

Wilby, J. F.; Mcdaniel, C. D.; Wilby, E. G.

1985-01-01

Four series of flight tests were conducted to measure sound pressure levels inside and outside the cabin of a twin-engined turboprop airplane. Particular emphasis was placed on harmonics of the propeller blade passage frequency. The cabin was unfurnished for the first three flights, when the main objective was to investigate the repeatability of the data. For the fourth flight, the cabin was treated with fiberglass batts. Typically, the exterior sound pressure levels were found to vary 3 to 5 dB for a given harmonic, but variations as high as 8 dB were observed. The variability of harmonic levels within the cabin was slightly higher but depended on control of the relative phase between the propellers; when phase was not controlled the average variability was about 10 dB. Noise reductions provided by the fuselage structure were in the range of 20 to 40 dB, when an exterior microphone in the plane of rotation of the propeller was used as reference.

Intensity dynamics in a waveguide array laser

NASA Astrophysics Data System (ADS)

Feng, Mingming; Williams, Matthew O.; Kutz, J. Nathan; Silverman, Kevin L.; Mirin, Richard P.; Cundiff, Steven T.

2011-02-01

We consider experimentally and theoretically the optical field dynamics of a five-emitter laser array subject to a ramped injection current. We have achieved experimentally an array that produces a robust oscillatory power output with a nearly constant π phase shift between the oscillations from each waveguide. The output power also decreases linearly as a function of waveguide number. Those behaviors persisted for pump currents varying between 380 and 500 mA with only a slight change in phase. Of note is the fact that the fundamental frequency of oscillation increases with injection current, and higher harmonics are produced above a threshold current of approximately 380 mA. Experimental observations and theoretical predictions are in agreement. A low dimensional model was also developed and the impact of the nonuniform injection current studied. A nonuniform injection current is capable of shifting the bifurcations of the waveguide array providing a valuable method of array tuning without additional gain or structural alterations to the array.

Knowledge of Millennium Development Goals among University Faculty in Uganda and Kenya

ERIC Educational Resources Information Center

Wamala, Robert; Nabachwa, Mary Sonko; Chamberlain, Jean; Nakalembe, Eva

2012-01-01

This article examines the level of knowledge of the Millennium Development Goals (MDGs) among university faculty. The assessment is based on data from 197 academic unit or faculty heads randomly selected from universities in Uganda and Kenya. Frequency distributions and logistic regression were used for analysis. Slightly more than one in three…

"That Was Me!": Applications of the Soundbeam MIDI Controller as a Key to Creative Communication, Learning, Independence and Joy.

ERIC Educational Resources Information Center

Swingler, Tim

This paper describes the "Soundbeam MIDI (Musical Instrument Digital Interface) Controller," which allows even those students who have severe physical disabilities to create interesting aural and musical effects. Soundbeam works by emitting an invisible beam of high frequency sound inaudible to human ears. Even very slight interruptions…

Characterization of commercial supercapacitors for low temperature applications

NASA Astrophysics Data System (ADS)

Iwama, E.; Taberna, P. L.; Azais, P.; Brégeon, L.; Simon, P.

2012-12-01

Electrochemical characterizations at low temperature and floating tests have been performed on 600F commercial supercapacitor (SC) for acetonitrile (AN)-based and AN + methyl acetate (MA) mixed electrolytes. From -40 to +20 °C, AN electrolyte showed slightly higher capacitance than those of AN + MA mixed electrolytes (25 and 33 vol.% of MA). At -55 °C, however, AN electrolyte did not cycle at all, while MA mixed electrolyte normally cycled with a slight decrease in their capacitance. From electrochemical impedance spectroscopy measurements, the whole resistance for AN-based cells at -55 °C was found to be about 10,000 times higher than that of +20 °C, while a 40-fold increase in the cell resistance was obtained for the MA mixture between 20 and -55 °C. From the results of floating tests at 2.7 V and 60 °C for 1 month, the 25 vol.% MA mixture showed no change and slight decreased but stable capacitance.

Spatial Variability of Surface Irradiance Measurements at the Manus ARM Site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Riihimaki, Laura D.; Long, Charles N.

2014-05-16

The location of the Atmospheric Radiation Measurement (ARM) site on Manus island in Papua New Guinea was chosen because it is very close the coast, in a geographically at, near-sea level area of the island, minimizing the impact of local island effects on the meteorology of the measurements [Ackerman et al., 1999]. In this study, we confirm that the Manus site is in deed less impacted by the island meteorology than slightly inland by comparing over a year of broadband surface irradiance and ceilometer measurements and derived quantities at the standard Manus site and a second location 7 km awaymore » as part of the AMIE-Manus campaign. The two sites show statistically similar distributions of irradiance and other derived quantities for all wind directions except easterly winds, when the inland site is down wind from the standard Manus site. Under easterly wind conditions, which occur 17% of the time, there is a higher occurrence of cloudiness at the down wind site likely do to land heating and orographic effects. This increased cloudiness is caused by shallow, broken clouds often with bases around 700 m in altitude. While the central Manus site consistently measures a frequency of occurrence of low clouds (cloud base height less than 1200 m) about 25+4% regardless of wind direction, the AMIE site has higher frequencies of low clouds (38%) when winds are from the east. This increase in low, locally produced clouds causes an additional -20 W/m2 shortwave surface cloud radiative effect at the AMIE site in easterly conditions than in other meteorological conditions that exhibit better agreement between the two sites.« less

Association of Notch3 single-nucleotide polymorphisms and lacunar infarctions in patients.

PubMed

Li, Ying; Liu, Nan; Chen, Hui; Huang, Yonghua; Zhang, Weiwei

2016-01-01

Cerebrovascular disease is a leading cause of morbidity and mortality worldwide, which is influenced by genetic and environmental factors. The aim of the present study was to examine the association between single-nucleotide polymorphisms (SNPs) in Notch3 exons 3-6 and lacunar infarction by comparing SNPs between control subjects and those with lacunar infarction. A single-center case-control study was conducted to investigate the association between Notch3 SNPs and risk of stroke. A total of 140 patients were included in the study, 30 of whom had no infarction (control) and 110 had lacunar infarction. Lacunar patients were divided into the 'pure lacunar' and 'lacunar + leukoarasis' groups based on brain imaging. All the patients were of Chinese Han ethnicity, and the male to female ratio was 84:56. Patient clinical histories included hypertension, diabetes mellitus (DM), hyperlipidemia, and heart disease were recorded. The Notch3 sequence was obtained from the National Centser for Biotechnology Information database. Notch3 was amplified by polymerase chain reaction from whole blood samples, and exons 3-6 were sequenced to identify SNPs. The result showed that there was no significant difference in the prevalence of hypertension, DM, hyperlipidemia, and heart disease between the control and lacunar infarction patients. Notabley, the age of the lacunar + leukoarasis patients was significantly higher than that of the control and pure lacunar patients (P<0.05). Eight SNPs were detected at low frequencies, and only rs3815388 and rs1043994 exhibited slightly higher frequencies. A χ 2 test indicated that Notch3 SNPs, particularly rs1043994, were associated with lacunar infarction (P<0.05). In conclusion, the result of the present study have shown that Notch3 SNPs, particularly rs1043994, are associated with lacunar infarction.

Ventilatory Responses During Submaximal Exercise in Children With Prader-Willi Syndrome.

PubMed

Hyde, Adam M; McMurray, Robert G; Chavoya, Frank A; Rubin, Daniela A

2018-02-27

Prader-Willi syndrome (PWS) is a genetic neurobehavioral disorder presenting hypothalamic dysfunction and adiposity. At rest, PWS exhibits hypoventilation with hypercapnia. We characterized ventilatory responses in children with PWS during exercise. Participants were children aged 7-12 years with PWS (n = 8) and without PWS with normal weight (NW; n = 9, body mass index ≤ 85th percentile) or obesity (n = 9, body mass index ≥ 95th percentile). Participants completed three 5-minute ambulatory bouts at 3.2, 4.0, and 4.8 km/h. Oxygen uptake, carbon dioxide output, ventilation, breathing frequency, and tidal volume were recorded. PWS had slightly higher oxygen uptake (L/min) at 3.2 km/h [0.65 (0.46-1.01) vs 0.49 (0.34-0.83)] and at 4.8 km/h [0.89 (0.62-1.20) vs 0.63 (0.45-0.97)] than NW. PWS had higher ventilation (L/min) at 3.2 km/h [16.2 (13.0-26.5) vs 11.5 (8.4-17.5)], at 4.0 km/h [16.4 (13.9-27.9) vs 12.7 (10.3-19.5)], and at 4.8 km/h [19.7 (17.4-31.8) vs 15.2 (9.5-21.6)] than NW. PWS had greater breathing frequency (breaths/min) at 3.2 km/h [38 (29-53) vs 29 (22-35)], at 4.0 km/h [39 (29-58) vs 29 (23-39)], and at 4.8 km/h [39 (33-58) vs 32 (23-42)], but similar tidal volume and ventilation/carbon dioxide output to NW. PWS did not show impaired ventilatory responses to exercise. Hyperventilation in PWS may relate to excessive neural stimulation and metabolic cost.

Lung and chest wall impedances in the dog: effects of frequency and tidal volume.

PubMed

Barnas, G M; Stamenović, D; Lutchen, K R; Mackenzie, C F

1992-01-01

Dependences of the mechanical properties of the respiratory system on frequency (f) and tidal volume (VT) in the normal ranges of breathing are not clear. We measured, simultaneously and in vivo, resistance and elastance of the total respiratory system (Rrs and Ers), lungs (RL and EL), and chest wall (Rcw and Ecw) of five healthy anesthetized paralyzed dogs during sinusoidal volume oscillations at the trachea (50-300 ml, 0.2-2 Hz) delivered at a constant mean lung volume. Each dog showed the same f and VT dependences. The Ers and Ecw increased with increasing f to 1 Hz and decreased with increasing VT up to 200 ml. Although EL increased slightly with increasing f, it was independent of VT. The Rcw decreased from 0.2 to 2 Hz at all VT and decreased with increasing VT. Although the RL decreased from 0.2 to 0.6 Hz and was independent of VT, at higher f RL tended to increase with increasing f and VT (i.e., as peak flow increased). Finally, the f and VT dependences of Rrs were similar to those of Rcw below 0.6 Hz but mirrored RL at higher f. These data capture the competing influences of airflow nonlinearities vs. tissue nonlinearities on f and VT dependence of the lung, chest wall, and total respiratory system. More specifically, we conclude that 1) VT dependences in Ers and Rrs below 0.6 Hz are due to nonlinearities in chest wall properties, 2) above 0.6 Hz, the flow dependence of airways resistance dominates RL and Rrs, and 3) lung tissue behavior is linear in the normal range of breathing.

The role of height in the sex difference in intelligence.

PubMed

Kanazawa, Satoshi; Reyniers, Diane J

2009-01-01

Recent studies conclude that men on average have higher intelligence than women by 3-5 IQ points. However, the ultimate evolutionary question of why men should have evolved to have higher intelligence than women remains. We suggest that men may have slightly higher intelligence than women through 4 mechanisms: (1) assortative mating of intelligent men and beautiful women, (2) assortative mating of tall men and beautiful women, (3) an extrinsic correlation between height and intelligence produced by Mechanisms 1 and 2, and (4) a higher-than-expected offspring sex ratio (more sons) among tall (and hence intelligent) parents. Consistent with our suggestion, we show that men may have higher IQs than women because they are taller, and once we control for height women have slightly higher IQs than men.The correlation between height and IQ and the female advantage in intelligence persist even after we control for health as a measure of genetic quality, as well as physical attractiveness, age, race, education, and earnings. Height is also strongly associated with intelligence within each sex.

Welding characteristics of 27, 40 and 67 kHz ultrasonic plastic welding systems using fundamental- and higher-resonance frequencies.

PubMed

Tsujino, Jiromaru; Hongoh, Misugi; Yoshikuni, Masafumi; Hashii, Hidekazu; Ueoka, Tetsugi

2004-04-01

The welding characteristics of 27, 40 and 67 kHz ultrasonic plastic welding systems that are driven at only the fundamental-resonance frequency vibration were compared, and also those of the welding systems that were driven at the fundamental and several higher resonance frequencies simultaneously were studied. At high frequency, welding characteristics can be improved due to the larger vibration loss of plastic materials. For welding of rather thin or small specimens, as the fundamental frequency of these welding systems is higher and the numbers of driven higher frequencies are driven simultaneously, larger welded area and weld strength were obtained.

The effects of extra-low-frequency atmospheric pressure oscillations on human mental activity

NASA Astrophysics Data System (ADS)

Delyukov, A. A.; Didyk, L.

Slight atmospheric pressure oscillations (APO) in the extra-low-frequency range below 0.1 Hz, which frequently occur naturally, can influence human mental activity. This phenomenon has been observed in experiments with a group of 12 healthy volunteers exposed to experimentally created APO with amplitudes 30-50 Pa in the frequency band 0.011-0.17 Hz. Exposure of the subjects to APO for 15-30 min caused significant changes in attention and short-term memory functions, performance rate, and mental processing flexibility. The character of the response depended on the APO frequency and coherence. Periodic APO promoted purposeful mental activity, accompanied by an increase in breath-holding duration and a slower heart rate. On the other hand, quasi-chaotic APO, similar to the natural perturbations of atmospheric pressure, disrupted mental activity. These observations suggest that APO could be partly responsible for meteorosensitivity in humans.

Magnetospheric electron density measurements from upper hybrid resonance noise observed by IMP-6

NASA Technical Reports Server (NTRS)

Shaw, R. R.; Gurnett, D. A.

1972-01-01

A band of natural radio noise between the local electron plasma frequency and the upper hybrid resonance frequency is observed by the IMP-6 satellite. The band exists over a large range of geocentric radial distances extending from inside the plasmapause boundary to greater than 10 earth radii in the outer magnetosphere. The center frequency of the noise band decreases with increasing radial distance, and changes abruptly at the plasmapause boundary. The broadband electric field strength of this noise is very small, seldom exceeding 10 microvolts/meter, and probably could not be detected without using long electric antennas of IMP-6. It is believed that this noise is produced by incoherent Cerenkov emission from super-thermal electrons. In some cases a second very narrow noise band was observed at a frequency slightly above the second harmonic of the electron gyrofrequency.

Effect of Bryophyllum pinnatum versus fenoterol on uterine contractility.

PubMed

Gwehenberger, Birgit; Rist, Lukas; Huch, Renate; von Mandach, Ursula

2004-04-15

To characterise the phytotherapeutic tocolytic Bryophyllum pinnatum in vitro versus the conventional betamimetic, fenoterol, in human myometrium. Contractility (endpoints: area under the curve (AUC), amplitude and frequency of isometric force development) was measured in strips of term myometrium biopsied at caesarean section in 14 women and exposed to increasing concentrations of B. pinnatum versus +/- oxytocin 1 U/l. Inhibition of spontaneous contraction by B. pinnatum was concentration-dependent: 16% at maximum concentration (10(4) mg/l), or 53% that with fenoterol 5 x 10(-8)mol/l. B. pinnatum increased contraction frequency by 91% at constant amplitude and inhibited oxytocin-stimulated contractions by 20% (AUC) at constant amplitude with slightly decreased frequency. Fenoterol decreased contraction AUC by 50% with a significant decrease in frequency. Our in vitro data confirm the tocolytic activity of B. pinnatum observed in alternative medicine centres and may justify further clinical studies.

Parametric Testing of Chevrons on Single Flow Hot Jets

NASA Technical Reports Server (NTRS)

Bridges, James; Brown, Clifford A.

2004-01-01

A parametric family of chevron nozzles have been studied, looking for relationships between chevron geometric parameters, flow characteristics, and far-field noise. Both cold and hot conditions have been run at acoustic Mach number 0.9. Ten models have been tested, varying chevron count, penetration, length, and chevron symmetry. Four comparative studies were defined from these datasets which show: that chevron length is not a major impact on either flow or sound; that chevron penetration increases noise at high frequency and lowers it at low frequency, especially for low chevron counts; that chevron count is a strong player with good low frequency reductions being achieved with high chevron count without strong high frequency penalty; and that chevron asymmetry slightly reduces the impact of the chevron. Finally, it is shown that although the hot jets differ systematically from the cold one, the overall trends with chevron parameters is the same.

Frequency modulation of high-order harmonic generation in an orthogonally polarized two-color laser field.

PubMed

Li, Guicun; Zheng, Yinghui; Ge, Xiaochun; Zeng, Zhinan; Li, Ruxin

2016-08-08

We have experimentally investigated the frequency modulation of high-order harmonics in an orthogonally polarized two-color laser field consisting of a mid-infrared 1800nm fundamental pulse and its second harmonic pulse. It is demonstrated that the high harmonic spectra can be fine-tuned as we slightly change the relative delay of the two-color laser pulses. By analyzing the relative frequency shift of each harmonic at different two-color delays, the nonadiabatic spectral shift induced by the rapid variation of the intensity-dependent intrinsic dipole phase can be distinguished from the blueshift induced by the change of the refractive index during self-phase modulation (SPM). Our comprehensive analysis shows that the frequency modulation pattern is a reflection of the average emission time of high-order harmonic generation (HHG), thus offering a simple method to fine-tune the spectra of the harmonics on a sub-cycle time scale.

Effect of stress on ultrasonic pulses in fiber reinforced composites

NASA Technical Reports Server (NTRS)

Hemann, J. H.; Baaklini, G. Y.

1986-01-01

An acoustical-ultrasonic technique was used to demonstrate relationships existing between changes in attenuation of stress waves and tensile stress on an eight ply 0 degree graphite-epoxy fiber reinforced composite. All tests were conducted in the linear range of the material for which no mechanical or macroscopic damage was evident. Changes in attenuation were measured as a function of tensile stress in the frequency domain and in the time domain. Stress wave propagation in these specimens was dispersive, i.e., the wave speed depends on frequency. Wave speeds varied from 267,400 cm/sec to 680,000 cm/sec as the frequency of the signal was varied from 150 kHz to 1.9 MHz which strongly suggests that flexural/lamb wave modes of propagation exist. The magnitude of the attenuation changes depended strongly on tensile stress. It was further observed that the wave speeds increased slightly for all tested frequencies as the stress was increased.

How to Distinguish Neutron Star and Black Hole X-ray Binaries? Spectral Index and Quasi-Periodic Oscillation Frequency Correlation

NASA Technical Reports Server (NTRS)

Titarchuk, Lev; Shaposhnikov, Nickolai

2005-01-01

Recent studies have revealed strong correlations between 1-10 Hz frequencies of quasiperiodic oscillations (QPOs) and the spectral power law index of several Black Hole (BH) candidate sources when seen in the low/hard state, the steep power-law (soft) state, and in transition between these states. In the soft state these index-QPO frequency correlations show a saturation of the photon index GAMMA approximately equal to 2.7 at high values of the low frequency nu(sub L). This saturation effect was previously identified as a black hole signature. In this paper we argue that this saturation does not occur, at least for one neutron star (NS) source 4U 1728-34, for which the index GAMMA monotonically increases with nu(sub L) to the values of 6 and higher. We base this conclusion on our analysis of approximately 1.5 Msec of RXTE archival data for 4U 1728-34. We reveal the spectral evolution of the Comptonized blackbody spectra when the source transitions from the hard to soft states. The hard state spectrum is a typical thermal Comptonization spectrum of the soft photons which originate in the disk and the NS outer photospheric layers. The hard state photon index is GAMMA approximately 2. The soft state spectrum consists of two blackbody components which are only slightly Comptonized. Thus we can claim (as expected from theory) that in NS sources thermal equilibrium is established for the soft state. To the contrary in BH sources, the equilibrium is never established due to the presence of the BH horizon. The emergent BH spectrum, even in the high/soft state, has a power law component. We also identify the low QPO frequency nu(sub L) as a fundamental frequency of the quasi-spherical component of the transition layer (presumably related to the corona and the NS and disk magnetic closed field lines). The lower frequency nu(sub SL) is identified as the frequency of oscillations of a quasi-cylindrical configuration of the TL (presumably related to the NS and disk magnetic open field lines). We also show that the presence of Fe K(sub alpha), emission-line strengths, QPOs, and the link between them does not depend on radio flux in 4U 1728-34.

Linear and nonlinear frequency- and time-domain spectroscopy with multiple frequency combs.

PubMed

Bennett, Kochise; Rouxel, Jeremy R; Mukamel, Shaul

2017-09-07

Two techniques that employ equally spaced trains of optical pulses to map an optical high frequency into a low frequency modulation of the signal that can be detected in real time are compared. The development of phase-stable optical frequency combs has opened up new avenues to metrology and spectroscopy. The ability to generate a series of frequency spikes with precisely controlled separation permits a fast, highly accurate sampling of the material response. Recently, pairs of frequency combs with slightly different repetition rates have been utilized to down-convert material susceptibilities from the optical to microwave regime where they can be recorded in real time. We show how this one-dimensional dual comb technique can be extended to multiple dimensions by using several combs. We demonstrate how nonlinear susceptibilities can be quickly acquired using this technique. In a second class of techniques, sequences of ultrafast mode locked laser pulses are used to recover pathways of interactions contributing to nonlinear susceptibilities by using a photo-acoustic modulation varying along the sequences. We show that these techniques can be viewed as a time-domain analog of the multiple frequency comb scheme.

A novel approach for the fine tuning of resonance frequency of patch antenna

NASA Astrophysics Data System (ADS)

Mathur, Monika; Singh, Ghanshyam; Bhatnagar, S. K.

2013-01-01

When a patch antenna is fabricated, dimensions of the patch may be slightly different from the designed values due to tolerances in the fabrication process. This alters the resonance frequency of the antenna. To overcome this problem this paper presents a new design approach for fine tuning the resonance frequency by dielectric constant engineering. This approach is especially suited to low temperature co-fired ceramic (LTCC) and similar processes where the antenna dielectric is composed of several layers. Composite dielectric constant of this multilayer structure is altered in such a way that the resonant frequency is set back to the designed value. It has been verified that for proposed micro strip antenna (MSA) design, the frequency-area curve follows a quadratic relation with a variable R (Ratio of cavity area to the patch area). This mathematical model is true up to R 1.27. After this saturation effects set in and the curve follows a straight line behavior.≡

Frequency-agile dual-comb spectroscopy

NASA Astrophysics Data System (ADS)

Millot, Guy; Pitois, Stéphane; Yan, Ming; Hovhannisyan, Tatevik; Bendahmane, Abdelkrim; Hänsch, Theodor W.; Picqué, Nathalie

2016-01-01

Spectroscopic gas sensing and its applications to, for example, trace detection or chemical kinetics, require ever more demanding measurement times, acquisition rates, sensitivities, precisions and broad tuning ranges. Here, we propose a new approach to near-infrared molecular spectroscopy, utilizing advanced concepts of optical telecommunications and supercontinuum photonics. We generate, without mode-locked lasers, two frequency combs of slightly different repetition frequencies and moderate, but rapidly tunable, spectral span. The output of a frequency-agile continuous-wave laser is split and sent into two electro-optic intensity modulators. Flat-top low-noise frequency combs are produced by wave-breaking in a nonlinear optical fibre of normal dispersion. With a dual-comb spectrometer, we record Doppler-limited spectra spanning 60 GHz within 13 μs and an 80 kHz refresh rate, at a tuning speed of 10 nm s-1. The sensitivity for weak absorption is enhanced by a long gas-filled hollow-core fibre. New opportunities for real-time diagnostics may be opened up, even outside the laboratory.

Influence of season and frequency of ejaculation on production of stallion semen for freezing.

PubMed

Magistrini, M; Chanteloube, P; Palmer, E

1987-01-01

In an attempt to define optimal season and ejaculation frequency for frozen semen, semen was collected from 6 stallions (3 horses and 3 ponies) 3 times per week or every day, alternating every week, for 1 year. The semen was evaluated and frozen. All the samples were thawed at the end of the experiment. At collection, fresh semen evaluations showed that winter (as opposed to spring and summer) was associated with low sexual behaviour, small volumes of spermatozoa and gel, high sperm concentration and lower motility. The high ejaculation frequency yielded a decreased volume, concentration of spermatozoa in the ejaculate and slightly improved motility. The quality of thawed semen was analysed by video and microscope estimations for motility and by two staining methods for vitality. No variation was observed according to the ejaculation frequency; the best freezability was obtained in winter but the difference was small compared to between-stallion variability and optimization of frequency and season did not change a 'bad freezer' into a good one.

High resolution observations with Artemis-IV and the NRH. I. Type IV associated narrow-band bursts

NASA Astrophysics Data System (ADS)

Bouratzis, C.; Hillaris, A.; Alissandrakis, C. E.; Preka-Papadema, P.; Moussas, X.; Caroubalos, C.; Tsitsipis, P.; Kontogeorgos, A.

2016-02-01

Context. Narrow-band bursts appear on dynamic spectra from microwave to decametric frequencies as fine structures with very small duration and bandwidth. They are believed to be manifestations of small scale energy release through magnetic reconnection. Aims: We analyzed 27 metric type IV events with embedded narrow-band bursts, which were observed by the ARTEMIS-IV radio spectrograph from 30 June 1999 to 1 August 2010. We examined the morphological characteristics of isolated narrow-band structures (mostly spikes) and groups or chains of structures. Methods: The events were recorded with the SAO high resolution (10 ms cadence) receiver of ARTEMIS-IV in the 270-450 MHz range. We measured the duration, spectral width, and frequency drift of ~12 000 individual narrow-band bursts, groups, and chains. Spike sources were imaged with the Nançay radioheliograph (NRH) for the event of 21 April 2003. Results: The mean duration of individual bursts at fixed frequency was ~100 ms, while the instantaneous relative bandwidth was ~2%. Some bursts had measurable frequency drift, either positive or negative. Quite often spikes appeared in chains, which were closely spaced in time (column chains) or in frequency (row chains). Column chains had frequency drifts similar to type-IIId bursts, while most of the row chains exhibited negative frequently drifts with a rate close to that of fiber bursts. From the analysis of NRH data, we found that spikes were superimposed on a larger, slowly varying, background component. They were polarized in the same sense as the background source, with a slightly higher degree of polarization of ~65%, and their size was about 60% of their size in total intensity. Conclusions: The duration and bandwidth distributions did not show any clear separation in groups. Some chains tended to assume the form of zebra, lace stripes, fiber bursts, or bursts of the type-III family, suggesting that such bursts might be resolved in spikes when viewed with high resolution. The NRH data indicate that the spikes are not fluctuations of the background, but represent additional emission such as what would be expected from small-scale reconnection.

Lexical frequency effects on articulation: a comparison of picture naming and reading aloud

PubMed Central

Mousikou, Petroula; Rastle, Kathleen

2015-01-01

The present study investigated whether lexical frequency, a variable that is known to affect the time taken to utter a verbal response, may also influence articulation. Pairs of words that differed in terms of their relative frequency, but were matched on their onset, vowel, and number of phonemes (e.g., map vs. mat, where the former is more frequent than the latter) were used in a picture naming and a reading aloud task. Low-frequency items yielded slower response latencies than high-frequency items in both tasks, with the frequency effect being significantly larger in picture naming compared to reading aloud. Also, initial-phoneme durations were longer for low-frequency items than for high-frequency items. The frequency effect on initial-phoneme durations was slightly more prominent in picture naming than in reading aloud, yet its size was very small, thus preventing us from concluding that lexical frequency exerts an influence on articulation. Additionally, initial-phoneme and whole-word durations were significantly longer in reading aloud compared to picture naming. We discuss our findings in the context of current theories of reading aloud and speech production, and the approaches they adopt in relation to the nature of information flow (staged vs. cascaded) between cognitive and articulatory levels of processing. PMID:26528223

CT scan exposure in Spanish children and young adults by socioeconomic status: Cross-sectional analysis of cohort data.

PubMed

Bosch de Basea, Magda; Espinosa, Ana; Gil, Mariona; Figuerola, Jordi; Pardina, Marina; Vilar, José; Cardis, Elisabeth

2018-01-01

Recent publications reported that children in disadvantaged areas undergo more CT scanning than others. The present study is aimed to assess the potential differences in CT imaging by socioeconomic status (SES) in Spanish young scanned subjects and if such differences vary with different indicators or different time point SES measurements. The associations between CT scanning and SES, and between the CT scan rate per patient and SES were investigated in the Spanish EPI-CT subcohort. Various SES indicators were studied to determine whether particular SES dimensions were more closely related to the probability of undergoing one or multiple CTs. Comparisons were made with indices based on 2001 and 2011 censuses. We found evidence of socio-economic variation among young people, mainly related to autonomous communities of residence. A slightly higher rate of scans per patient of multiple body parts in the less affluent categories was observed, possibly reflecting a higher rate of accidents and violence in these groups. The number of CT scans per patient was higher both in the most affluent and the most deprived categories and somewhat lower in the intermediate groups. This relation varied with the SES indicator used, with lower CT scans per patients in categories of high unemployment and temporary work, but not depending on categories of unskilled work or illiteracy. The relationship between these indicators and number of CTs in 2011 was different than that seen with the 2001 census, with the number of CTs increasing with higher unemployment. Overall we observed some differences in the SES distribution of scanned patients by Autonomous Community in Spain. There was, however, no major differences in the frequency of CT scans per patient by SES overall, based on the 2001 census. The use of different indicators and of SES data collected at different time points led to different relations between SES and frequency of CT scans, outlining the difficulty of adequately capturing the social and economic dimensions which may affect health and health service utilisation.

CT scan exposure in Spanish children and young adults by socioeconomic status: Cross-sectional analysis of cohort data

PubMed Central

Espinosa, Ana; Gil, Mariona; Figuerola, Jordi; Pardina, Marina; Vilar, José; Cardis, Elisabeth

2018-01-01

Recent publications reported that children in disadvantaged areas undergo more CT scanning than others. The present study is aimed to assess the potential differences in CT imaging by socioeconomic status (SES) in Spanish young scanned subjects and if such differences vary with different indicators or different time point SES measurements. The associations between CT scanning and SES, and between the CT scan rate per patient and SES were investigated in the Spanish EPI-CT subcohort. Various SES indicators were studied to determine whether particular SES dimensions were more closely related to the probability of undergoing one or multiple CTs. Comparisons were made with indices based on 2001 and 2011 censuses. We found evidence of socio-economic variation among young people, mainly related to autonomous communities of residence. A slightly higher rate of scans per patient of multiple body parts in the less affluent categories was observed, possibly reflecting a higher rate of accidents and violence in these groups. The number of CT scans per patient was higher both in the most affluent and the most deprived categories and somewhat lower in the intermediate groups. This relation varied with the SES indicator used, with lower CT scans per patients in categories of high unemployment and temporary work, but not depending on categories of unskilled work or illiteracy. The relationship between these indicators and number of CTs in 2011 was different than that seen with the 2001 census, with the number of CTs increasing with higher unemployment. Overall we observed some differences in the SES distribution of scanned patients by Autonomous Community in Spain. There was, however, no major differences in the frequency of CT scans per patient by SES overall, based on the 2001 census. The use of different indicators and of SES data collected at different time points led to different relations between SES and frequency of CT scans, outlining the difficulty of adequately capturing the social and economic dimensions which may affect health and health service utilisation. PMID:29723272

Transcranial cavitation-mediated ultrasound therapy at sub-MHz frequency via temporal interference modulation

NASA Astrophysics Data System (ADS)

Sun, Tao; Sutton, Jonathan T.; Power, Chanikarn; Zhang, Yongzhi; Miller, Eric L.; McDannold, Nathan J.

2017-10-01

Sub-megahertz transmission is not usually adopted in pre-clinical small animal experiments for focused ultrasound (FUS) brain therapy due to the large focal size. However, low frequency FUS is vital for preclinical evaluations due to the frequency-dependence of cavitation behavior. To maximize clinical relevance, a dual-aperture FUS system was designed for low-frequency (274.3 kHz) cavitation-mediated FUS therapy. Combining two spherically curved transducers provides significantly improved focusing in the axial direction while yielding an interference pattern with strong side lobes, leading to inhomogeneously distributed cavitation activities. By operating the two transducers at slightly offset frequencies to modulate this interference pattern over the period of sonication, the acoustic energy was redistributed and resulted in a spatially homogenous treatment profile. Simulation and pressure field measurements in water were performed to assess the beam profiles. In addition, the system performance was demonstrated in vivo in rats via drug delivery through microbubble-mediated blood-brain barrier disruption. This design resulted in a homogenous treatment profile that was fully contained within the rat brain at a clinically relevant acoustic frequency.

Mid-Infrared Frequency-Agile Dual-Comb Spectroscopy

NASA Astrophysics Data System (ADS)

Luo, Pei-Ling; Yan, Ming; Iwakuni, Kana; Millot, Guy; Hänsch, Theodor W.; Picqué, Nathalie

2016-06-01

We demonstrate a new approach to mid-infrared dual-comb spectroscopy. It opens up new opportunities for accurate real-time spectroscopic diagnostics and it significantly simplifies the technique of dual-comb spectroscopy. Two mid-infrared frequency combs of slightly different repetition frequencies and moderate, but rapidly tunable, spectral span are generated in the 2800-3200 cm-1 region. The generators rely on electro-optic modulators, nonlinear fibers for spectral broadening and difference frequency generation and do not involve mode-locked lasers. Flat-top frequency combs span up to 10 cm-1 with a comb line spacing of 100 MHz (3×10-3 cm-1). The performance of the spectrometer without any phase-lock electronics or correction scheme is illustrated with spectra showing resolved comb lines and Doppler-limited spectra of methane. High precision on the spectroscopic parameter (line positions and intensities) determination is demonstrated for spectra measured on a millisecond time scale and it is validated with comparison with literature data. G. Millot, S. Pitois, M. Yan, T. Hovannysyan, A. Bendahmane, T.W. Hänsch, N. Picqué, Frequency-agile dual-comb spectroscopy, Nature Photonics 10, 27-30 (2016).

Masking of thresholds for the perception of fore-and-aft vibration of seat backrests.

PubMed

Morioka, Miyuki; Griffin, Michael J

2015-09-01

The detection of a vibration may be reduced by the presence of another vibration: a phenomenon known as 'masking'. This study investigated how the detection of one frequency of vibration is influenced by vibration at another frequency. With nine subjects, thresholds for detecting fore-and-aft backrest vibration were determined (for 4, 8, 16, and 31.5-Hz sinusoidal vibration) in the presence of a masker vibration (4-Hz random vibration, 1/3-octave bandwidth at six intensities). The masker vibration increased thresholds for perceiving vibration at each frequency by an amount that reduced with increasing difference between the frequency of the sinusoidal vibration and the frequency of the masker vibration. The 4-Hz random vibration almost completely masked 4-Hz sinusoidal vibration, partially masked 8- and 16-Hz vibration, and only slightly masked 31.5-Hz vibration. The findings might be explained by the involvement of different sensory systems and different body locations in the detection of different frequencies of vibration. Copyright © 2015 Elsevier Ltd and The Ergonomics Society. All rights reserved.

The impact of frequency on the performance of microwave ablation.

PubMed

Sawicki, James F; Shea, Jacob D; Behdad, Nader; Hagness, Susan C

2017-02-01

The use of higher frequencies in percutaneous microwave ablation (MWA) may offer compelling interstitial antenna design advantages over the 915 MHz and 2.45 GHz frequencies typically employed in current systems. To evaluate the impact of higher frequencies on ablation performance, we conducted a comprehensive computational and experimental study of microwave absorption and tissue heating as a function of frequency. We performed electromagnetic and thermal simulations of MWA in ex vivo and in vivo porcine muscle at discrete frequencies in the 1.9-26 GHz range. Ex vivo ablation experiments were performed in the 1.9-18 GHz range. We tracked the size of the ablation zone across frequency for constant input power and ablation duration. Further, we conducted simulations to investigate antenna feed line heating as a function of frequency, input power, and cable diameter. As the frequency was increased from 1.9 to 26 GHz the resulting ablation zone dimensions decreased in the longitudinal direction while remaining relatively constant in the radial direction; thus at higher frequencies the overall ablation zone was more spherical. However, cable heating at higher frequencies became more problematic for smaller diameter cables at constant input power. Comparably sized ablation zones are achievable well above 1.9 GHz, despite increasingly localised power absorption. Specific absorption rate alone does not accurately predict ablation performance, particularly at higher frequencies where thermal diffusion plays an important role. Cable heating due to ohmic losses at higher frequencies may be controlled through judicious choices of input power and cable diameter.

Frequency and voltage dependent electrical responses of poly(triarylamine) thin film-based organic Schottky diode

NASA Astrophysics Data System (ADS)

Anuar Mohamad, Khairul; Tak Hoh, Hang; Alias, Afishah; Ghosh, Bablu Kumar; Fukuda, Hisashi

2017-11-01

A metal-organic-metal (MOM) type Schottky diode based on poly (triarylamine) (PTAA) thin films has been fabricated by using the spin coating method. Investigation of the frequency dependent conductance-voltage (G-V-f) and capacitance-voltage (C-V-f) characteristics of the ITO/PTAA/Al MOM type diode were carried out in the frequency range from 12 Hz to 100 kHz using an LCR meter at room temperature. The frequency and bias voltage dependent electrical response were determined by admittance-based measured method in terms of an equivalent circuit model of the parallel combination of resistance and capacitance (RC circuit). Investigation revealed that the conductance is frequency and a bias voltage dependent in which conductance continuous increase as the increasing frequency, respectively. Meanwhile, the capacitance is dependent on frequency up to a certain value of frequency (100 Hz) but decreases at high frequency (1 - 10 kHz). The interface state density in the Schottky diode was determined from G-V and C-V characteristics. The interface state density has values almost constant of 2.8 x 1012 eV-1cm-2 with slightly decrease by increasing frequencies. Consequently, both series resistance and interface trap density were found to decrease with increasing frequency. The frequency dependence of the electrical responses is attributed the distribution density of interface states that could follow the alternating current (AC) signal.

Recurrence plot analysis of nonstationary data: the understanding of curved patterns.

PubMed

Facchini, A; Kantz, H; Tiezzi, E

2005-08-01

Recurrence plots of the calls of the Nomascus concolor (Western black crested gibbon) and Hylobates lar (White-handed gibbon) show characteristic circular, curved, and hyperbolic patterns superimposed to the main temporal scale of the signal. It is shown that these patterns are related to particular nonstationarities in the signal. Some of them can be reproduced by artificial signals like frequency modulated sinusoids and sinusoids with time divergent frequency. These modulations are too faint to be resolved by conventional time-frequency analysis with similar precision. Therefore, recurrence plots act as a magnifying glass for the detection of multiple temporal scales in slightly modulated signals. The detected phenomena in these acoustic signals can be explained in the biomechanical context by taking in account the role of the muscles controlling the vocal folds.

Detecting SNPs and estimating allele frequencies in clonal bacterial populations by sequencing pooled DNA.

PubMed

Holt, Kathryn E; Teo, Yik Y; Li, Heng; Nair, Satheesh; Dougan, Gordon; Wain, John; Parkhill, Julian

2009-08-15

Here, we present a method for estimating the frequencies of SNP alleles present within pooled samples of DNA using high-throughput short-read sequencing. The method was tested on real data from six strains of the highly monomorphic pathogen Salmonella Paratyphi A, sequenced individually and in a pool. A variety of read mapping and quality-weighting procedures were tested to determine the optimal parameters, which afforded > or =80% sensitivity of SNP detection and strong correlation with true SNP frequency at poolwide read depth of 40x, declining only slightly at read depths 20-40x. The method was implemented in Perl and relies on the opensource software Maq for read mapping and SNP calling. The Perl script is freely available from ftp://ftp.sanger.ac.uk/pub/pathogens/pools/.

Space Radiation Induced Cytogenetic Damage in the Blood Lymphocytes of Astronauts: Persistence of Damage After Flight and the Effects of Repeat Long Duration Missions

NASA Technical Reports Server (NTRS)

George, Kerry; Rhone, Jordan; Chappell, L. J.; Cucinotta, F. A.

2010-01-01

Cytogenetic damage was assessed in blood lymphocytes from astronauts before and after they participated in long-duration space missions of three months or more. The frequency of chromosome damage was measured by fluorescence in situ hybridization (FISH) chromosome painting before flight and at various intervals from a few days to many months after return from the mission. For all individuals, the frequency of chromosome exchanges measured within a month of return from space was higher than their prefight yield. However, some individuals showed a temporal decline in chromosome damage with time after flight. Statistical analysis using combined data for all astronauts indicated a significant overall decreasing trend in total chromosome exchanges with time after flight, although this trend was not seen for all astronauts and the yield of chromosome damage in some individuals actually increased with time after flight. The decreasing trend in total exchanges was slightly more significant when statistical analysis was restricted to data collected more than 220 days after return from flight. In addition, limited data on multiple flights show a lack of correlation between time in space and translocation yields. Data from three crewmembers who has participated in two separate long-duration space missions provide limited information on the effect of repeat flights and show a possible adaptive response to space radiation exposure.

QEEG characteristics and spectrum weighted frequency for children diagnosed as autistic spectrum disorder.

PubMed

Pop-Jordanova, Nada; Zorcec, Tatjana; Demerdzieva, Aneta; Gucev, Zoran

2010-09-30

Autistic spectrum disorders are a group of neurological and developmental disorders associated with social, communication, sensory, behavioral and cognitive impairments, as well as restricted, repetitive patterns of behavior, activities, or interests.The aim of this study was a) to analyze QEEG findings of autistic patients and to compare the results with data base; and b) to introduce the calculation of spectrum weighted frequency (brain rate) as an indicator of general mental arousal in these patients. Results for Q-EEG shows generally increased delta-theta activity in frontal region of the brain. Changes in QEEG pattern appeared to be in a non-linear correlation with maturational processes.Brain rate measured in CZ shows slow brain activity (5. 86) which is significantly lower than normal and corresponds to low general mental arousal.Recent research has shown that autistic disorders have as their basis disturbances of neural connectivity. Neurofeedback seems capable of remediating such disturbances when these data are considered as part of treatment planning. Prognosis of this pervasive disorder depends on the intellectual abilities: the better intellectual functioning, the possibilities for life adaptation are higherQEEG shows generally increased delta-theta activity in frontal region of the brain which is related to poor cognitive abilities.Brain rate measured in CZ shows slow brain activity related to under arousal.Pharmacotherapy combined with behavior therapy, social support and especially neurofeedback technique promise slight improvements.

[Simulation of effect of irrigation with reclaimed water on soil water-salt movement by ENVIRO-GRO model].

PubMed

Lü, Si-Dan; Chen, Wei-Ping; Wang, Mei-E

2012-12-01

As the conflict between water supply and demand, wastewater reuse has become an important measure, which can relieve the water shortage in Beijing. In order to promote safe irrigation with reclaimed water and prevent soil salinisation, the dynamic transport of salts in urban soils of Beijing, a city of water shortage, under irrigation of reclaimed water was simulated by ENVIRO-GRO model in this research. The accumulation trends of soil salinity were predicted. Simultaneously, it investigated the effects of different irrigation practices on soil water-salt movement and salt accumulation. Results indicated that annual averages of soil salinity (EC(e)) increased 29.5%, 97.2%, 197.8% respectively, with the higher irrigation, normal irrigation, and low irrigation under equilibrium conditions. Irrigation frequency had little effect on soil salt-water movement, and soil salt accumulation was in a downward trend with low frequency of irrigation. Under equilibrium conditions, annual averages of EC(e) increased 23.7%, 97.2%, 208.5% respectively, with irrigation water salinity (EC(w)) 0.6, 1.2, 2.4 dS x m(-1). Soil salinity increased slightly with EC(w) = 0.6 dS x m(-1), while soil salinization did not appear. Totally, the growth of Blue grass was not influenced by soil salinity under equilibrium conditions with the regular irrigation in Beijing, but mild soil salinization appeared.

Epidermal growth factor receptor mutations in 510 Finnish non--small-cell lung cancer patients.

PubMed

Mäki-Nevala, Satu; Rönty, Mikko; Morel, Mike; Gomez, Maria; Dawson, Zoe; Sarhadi, Virinder Kaur; Telaranta-Keerie, Aino; Knuuttila, Aija; Knuutila, Sakari

2014-06-01

Among the driver gene mutations in non-small-cell lung cancer, mutations in epidermal growth factor receptor (EGFR) are the most important because of their predictive role in selecting patients eligible for targeted therapy. Our aim was to study EGFR mutations in a Finnish non-small-cell lung cancer cohort of 528 patients. Mutation testing was conducted on DNA extracted from paraffin-embedded, formalin-fixed tumor material using the following real-time polymerase chain reaction-based kits: Therascreen EGFR PCR Kit and cobas EGFR Mutation Test. EGFR mutation frequency was 11.4% and all positive cases were adenocarcinomas, of which a majority had an acinar predominant pattern. Mutations were seen significantly more often in females and never-smokers than in males and smokers. The most frequent mutations were L858R in exon 21 and deletions in exon 19. Overall survival of the patients, not treated with EGFR inhibitor, did not differ between EGFR mutation-positive and EGFR mutation-negative patients. EGFR mutation profile in this Finnish non-small-cell lung cancer cohort resembles in many respect with that of other Western European cohorts, even though the overall frequency of mutations is slightly higher. We show the occurrence of EGFR mutations in patients with occupational asbestos exposure and also in those diagnosed with chronic obstructive pulmonary disease who have not been often investigated before.

Reply to Rhines and Huybers: Changes in the Frequency of Extreme Summer Heat

NASA Technical Reports Server (NTRS)

Hansen, James; Sato, Makiko; Ruedy, Reto

2013-01-01

Rhines and Huybers are correct that the decreasing number of measurement stations in recent years contributed slightly to our calculated increase of extreme summer mean temperature anomalies. However, the increased frequency of extreme heat anomalies is accounted for mainly by (i) higher mean temperature of recent decades relative to the base period 1951-1980, and (ii) the continuing upward temperature trend during recent decades. The effect of decreasing stations is shown by comparing our prior analysis with results using only stations with data records in both the base period and recent years (Fig. 1). The distribution is noisier, and the area with temperature anomaly exceeding three SDs during 2001-2011 decreases from 9.6 to 9.3% for the reduced number of stations (1,886 rather than 6,147), but our conclusions are not changed qualitatively. The temperature anomaly distribution shifts to the right and broadens because it is defined relative to a fixed (1951-1980) base period, during which global temperatures were within the Holocene range. We argue on the basis of accelerating ice loss from Greenland and Antarctica and rapidly rising sea level (now exceeding 3 mm/y or 3 m per millennium) that temperatures in the early 21st century are already above the Holocene range, and thus use of a base period preceding the rapid warming of the past three decades has merit.

Evolution of insecticide resistance in non-target black flies (Diptera: Simuliidae) from Argentina.

PubMed

Montagna, Cristina Mónica; Gauna, Lidia Ester; D'Angelo, Ana Pechen de; Anguiano, Olga Liliana

2012-06-01

Black flies, a non-target species of the insecticides used in fruit production, represent a severe medical and veterinary problem. Large increases in the level of resistance to the pyrethroids fenvalerate (more than 355-fold) and deltamethrin (162-fold) and a small increase in resistance to the organophosphate azinphos methyl (2-fold) were observed between 1996-2008 in black fly larvae under insecticide pressure. Eventually, no change or a slight variation in insecticide resistance was followed by a subsequent increase in resistance. The evolution of pesticide resistance in a field population is a complex and stepwise process that is influenced by several factors, the most significant of which is the insecticide selection pressure, such as the dose and frequency of application. The variation in insecticide susceptibility within a black fly population in the productive area may be related to changes in fruit-pest control. The frequency of individuals with esterase activities higher than the maximum value determined in the susceptible population increased consistently over the sampling period. However, the insecticide resistance was not attributed to glutathione S-transferase activity. In conclusion, esterase activity in black flies from the productive area is one mechanism underlying the high levels of resistance to pyrethroids, which have been recently used infrequently. These enzymes may be reselected by currently used pesticides and enhance the resistance to these insecticides.

Characteristics of the turbulence in the flow at a tidal stream power site.

PubMed

Milne, I A; Sharma, R N; Flay, R G J; Bickerton, S

2013-02-28

This paper analyses a set of velocity time histories which were obtained at a fixed point in the bottom boundary layer of a tidal stream, 5 m from the seabed, and where the mean flow reached 2.5 m s(-1). Considering two complete tidal cycles near spring tide, the streamwise turbulence intensity during non-slack flow was found to be approximately 12-13%, varying slightly between flood and ebb tides. The ratio of the streamwise turbulence intensity to that of the transverse and vertical intensities is typically 1 : 0.75 : 0.56, respectively. Velocity autospectra computed near maximum flood tidal flow conditions exhibit an f(-2/3) inertial subrange and conform reasonably well to atmospheric turbulence spectral models. Local isotropy is observed between the streamwise and transverse spectra at reduced frequencies of f>0.5. The streamwise integral time scales and length scales of turbulence at maximum flow are approximately 6 s and 11-14 m, respectively, and exhibit a relatively large degree of scatter. They are also typically much greater in magnitude than the transverse and vertical components. The findings are intended to increase the levels of confidence within the tidal energy industry of the characteristics of the higher frequency components of the onset flow, and subsequently lead to more realistic performance and loading predictions.

Behavioral manifestations of audiometrically-defined "slight" or "hidden" hearing loss revealed by measures of binaural detection.

PubMed

Bernstein, Leslie R; Trahiotis, Constantine

2016-11-01

This study assessed whether audiometrically-defined "slight" or "hidden" hearing losses might be associated with degradations in binaural processing as measured in binaural detection experiments employing interaurally delayed signals and maskers. Thirty-one listeners participated, all having no greater than slight hearing losses (i.e., no thresholds greater than 25 dB HL). Across the 31 listeners and consistent with the findings of Bernstein and Trahiotis [(2015). J. Acoust. Soc. Am. 138, EL474-EL479] binaural detection thresholds at 500 Hz and 4 kHz increased with increasing magnitude of interaural delay, suggesting a loss of precision of coding with magnitude of interaural delay. Binaural detection thresholds were consistently found to be elevated for listeners whose absolute thresholds at 4 kHz exceeded 7.5 dB HL. No such elevations were observed in conditions having no binaural cues available to aid detection (i.e., "monaural" conditions). Partitioning and analyses of the data revealed that those elevated thresholds (1) were more attributable to hearing level than to age and (2) result from increased levels of internal noise. The data suggest that listeners whose high-frequency monaural hearing status would be classified audiometrically as being normal or "slight loss" may exhibit substantial and perceptually meaningful losses of binaural processing.

Is There a Neighborhood Frequency Effect in English?: Evidence from Reading and Lexical Decision

ERIC Educational Resources Information Center

Sears, Christopher R.; Campbell, Crystal R.; Lupker, Stephen J.

2006-01-01

What is the effect of a word's higher frequency neighbors on its identification time? According to activation-based models of word identification (J. Grainger & A. M. Jacobs, 1996; J. L. McClelland & D. E. Rumelhart, 1981), words with higher frequency neighbors will be processed more slowly than words without higher frequency neighbors because of…

Hematology of healthy Florida manatees (Trichechus manatus)

USGS Publications Warehouse

Harvey, J.W.; Harr, K.E.; Murphy, D.; Walsh, M.T.; Nolan, E.C.; Bonde, R.K.; Pate, M.G.; Deutsch, C.J.; Edwards, H.H.; Clapp, W.L.

2009-01-01

Background: Hematologic analysis is an important tool in evaluating the general health status of free-ranging manatees and in the diagnosis and monitoring of rehabilitating animals. Objectives: The purpose of this study was to evaluate diagnostically important hematologic analytes in healthy manatees (Trichechus manatus) and to assess variations with respect to location (free ranging vs captive), age class (small calves, large calves, subadults, and adults), and gender. Methods: Blood was collected from 55 free-ranging and 63 captive healthy manatees. Most analytes were measured using a CELL-DYN 3500R; automated reticulocytes were measured with an ADVIA 120. Standard manual methods were used for differential leukocyte counts, reticulocyte and Heinz body counts, and plasma protein and fibrinogen concentrations. Results: Rouleaux, slight polychromasia, stomatocytosis, and low numbers of schistocytes and nucleated RBCs (NRBCs) were seen often in stained blood films. Manual reticulocyte counts were higher than automated reticulocyte counts. Heinz bodies were present in erythrocytes of most manatees. Compared with free-ranging manatees, captive animals had slightly lower MCV, MCH, and eosinophil counts and slightly higher heterophil and NRBC counts, and fibrinogen concentration. Total leukocyte, heterophil, and monocyte counts tended to be lower in adults than in younger animals. Small calves tended to have higher reticulocyte counts and NRBC counts than older animals. Conclusions: Hematologic findings were generally similar between captive and free-ranging manatees. Higher manual reticulocyte counts suggest the ADVIA detects only reticulocytes containing large amounts of RNA. Higher reticulocyte and NRBC counts in young calves probably reflect an increased rate of erythropoiesis compared with older animals. ?? 2009 American Society for Veterinary Clinical Pathology.

Start-Up of a Pulsed Beam Free Electron Laser (FEL) Oscillator

DTIC Science & Technology

1983-04-01

By slightly increasing the frequency of the R.F. accelerating field, Wacc during the start-up period, i.e., decreasing the beam pulse separation, the...levels. The required fractional increase in Wacc is 16L 1- 6L2 1/Lbow 10 - 6 for the parameters of ref. (3,4). The same 6 effect may also be realized

Bone implant sockets made using three different procedures: a stability study in dogs

PubMed Central

Campo, Julián

2012-01-01

Objective: This study compared the effects of three different methods of preparing bone implant sockets (drilling, osteotomes, and piezoelectric device) on osseointegration using resonance frequency analysis (RFA). Study Design: An experimental prospective study was designed. Material and Methods: Ten adult beagle dogs were studied. After 5 weeks, 23 out of 28 initially placed implants in the iliac crest were evaluated, comparing these three different procedures of bone implant socket. Student’s t-test (paired, two-tailed) was used to reveal differences among the three groups at each time point (SPSS 16.0, IL, USA). Results: After a 5-week healing period, the implants placed in sockets that were made using an osteotome or piezoelectric device were slightly more stable than those made by drilling. Reduced mechanical and heat injury to the bone is beneficial for maintaining and improving stability during the critical early healing period. Conclusion: Using RFA, there was evidence of a slight increase in implant stability in the iliac crest after 5 weeks of healing when the implant socket was made using a piezoelectric device or expansion procedure as compare with the drilling method. Key words:Bone implant sockets, drilling, osteotomes, piezoelectric, resonance frequency analysis, stability. PMID:24558558

Fast effects of glucocorticoids on memory-related network oscillations in the mouse hippocampus.

PubMed

Weiss, E K; Krupka, N; Bähner, F; Both, M; Draguhn, A

2008-05-01

Transient or lasting increases in glucocorticoids accompany deficits in hippocampus-dependent memory formation. Recent data indicate that the formation and consolidation of declarative and spatial memory are mechanistically related to different patterns of hippocampal network oscillations. These include gamma oscillations during memory acquisition and the faster ripple oscillations (approximately 200 Hz) during subsequent memory consolidation. We therefore analysed the effects of acutely applied glucocorticoids on network activity in mouse hippocampal slices. Evoked field population spikes and paired-pulse responses were largely unaltered by corticosterone or cortisol, respectively, despite a slight increase in maximal population spike amplitude by 10 microm corticosterone. Several characteristics of sharp waves and superimposed ripple oscillations were affected by glucocorticoids, most prominently the frequency of spontaneously occurring sharp waves. At 0.1 microm, corticosterone increased this frequency, whereas maximal (10 microm) concentrations led to a reduction. In addition, gamma oscillations became slightly faster and less regular in the presence of high doses of corticosteroids. The present study describes acute effects of glucocorticoids on sharp wave-ripple complexes and gamma oscillations in mouse hippocampal slices, revealing a potential background for memory deficits in the presence of elevated levels of these hormones.

Digital frequency offset-locked He–Ne laser system with high beat frequency stability, narrow optical linewidth and optical fibre output

NASA Astrophysics Data System (ADS)

Sternkopf, Christian; Manske, Eberhard

2018-06-01

We report on the enhancement of a previously-presented heterodyne laser source on the basis of two phase-locked loop (PLL) frequency coupled internal-mirror He–Ne lasers. Our new system consists of two digitally controlled He–Ne lasers with slightly different wavelengths, and offers high-frequency stability and very narrow optical linewidth. The digitally controlled system has been realized by using a FPGA controller and transconductance amplifiers. The light of both lasers was coupled into separate fibres for heterodyne interferometer applications. To enhance the laser performance we observed the sensitivity of both laser tubes to electromagnetic noise from various laser power supplies and frequency control systems. Furthermore, we describe how the linewidth of a frequency-controlled He–Ne laser can be reduced during precise frequency stabilisation. The digitally controlled laser source reaches a standard beat frequency deviation of less than 20 Hz (with 1 s gate time) and a spectral full width at half maximum (FWHM) of the beat signal less than 3 kHz. The laser source has enough optical output power to serve a fibre-coupled multi axis heterodyne interferometer. The system can be adjusted to output beat frequencies in the range of 0.1 MHz–20 MHz.

The influence of music and stress on musicians' hearing

NASA Astrophysics Data System (ADS)

Kähäri, Kim; Zachau, Gunilla; Eklöf, Mats; Möller, Claes

2004-10-01

Hearing and hearing disorders among classical and rock/jazz musicians was investigated. Pure tone audiometry was done in 140 classical and 139 rock/jazz musicians. The rock/jazz musicians answered a questionnaire concerning hearing disorders and psychosocial exposure. All results were compared to age appropriate reference materials. Hearing thresholds showed a notch configuration in both classical and rock/jazz musicians indicating the inclusion of high sound levels but an overall well-preserved hearing thresholds. Female musicians had significantly better hearing thresholds in the high-frequency area than males. Rock/jazz musicians showed slight worse hearing thresholds as compared to classical musicians. When assessing hearing disorders, a large number of rock/jazz musicians suffered from different hearing disorders (74%). Hearing loss, tinnitus and hyperacusis were the most common disorders and were significantly more frequent in comparison with different reference populations. Among classical musicians, no extended negative progress of the pure tone hearing threshold values was found in spite of the continued 16 years of musical noise exposure. In rock/jazz musicians, there was no relationships between psychosocial factors at work and hearing disorders. The rock/jazz musicians reported low stress and high degree of energy. On the average, the rock/jazz musicians reported higher control, lower stress and higher energy than a reference material of white-collar workers.

Application of chaotic attractor analysis in crack assessment of plates

NASA Astrophysics Data System (ADS)

Jalili, Sina; Daneshmehr, A. R.

2018-03-01

Part-through crack presence with limited length is one of the prevalent defects in plate structures. However, this type of damage has only a slight effect on the dynamic response of the structures. In this paper the modified line spring method (MLSM) is used to develop a nonlinear multi-degree of freedom model of part through cracked rectangular plate and chaotic interrogation is implemented to assess crack-induced degradation in the nonlinear model. After a convergence study of the proposed model in time series domain in which the plate subjected to Lorenz-type chaotic excitation, the tuning of interrogation is conducted by crossing the Lyapunov exponents' spectrums of the nonlinear model of the plate and chaotic signal. In this research nonlinear prediction error (NPE) is proposed as a damage sensitive feature which deals with the chaotic attractor of the excited system response. It is found that there are ranges of tuning parameter that result in higher damage sensitivity of the NPE. Damage characteristics such as: length, angle, location and depth of crack are considered as parameters to be varied to scrutinize the response of the plates. Results show that NPE generally has significantly higher sensitivity in comparison with conventional frequency-based methods; however this property has different levels for various boundary conditions.

Antibody to hepatitis B surface antigen among employees in the National Hospital, Oslo, Norway: a prevalence study.

PubMed

Hovig, B; Rollag, H; Dahl, O

1985-07-01

During the last decade, several studies of serologic markers of hepatitis B virus infections in hospital personnel have demonstrated an increased prevalence of antibodies to hepatitis B virus (anti-HB) compared with the general population. Norway has a very low incidence rate of hepatitis B as seen on a global scale, and this study was performed to evaluate the infection risk by hospital workers in such environments. The employees, 2,546 (94.7% of the population), in the 800-bed National Hospital in Oslo were tested for antibody to hepatitis B surface antigen (anti-HBs) in serum. Five per cent (128 persons) were anti-HBs-positive; this was only slightly higher than that in the general Norwegian population. Male employees were more often positive than females (7.0% vs. 4.4%). Staff more than 50 years of age or with 16 or more years of employment in the health services had a rate twice as high as the rest of the employees. Staff in the porter services (mostly men) had a higher rate than others, whereas the rates in the different professional groups showed no statistical differences. Contrary to many other studies, significant differences in prevalence according to frequency of patient contact or blood handling were not found.

Innu food consumption patterns: traditional food and body mass index.

PubMed

Atikessé, Laura; de Grosbois, Sylvie Boucher; St-Jean, Mélissa; Penashue, Basile Mashen; Benuen, Manipia

2010-01-01

Food consumption patterns of an Innu community were described and the benefits of traditional food (TF) were investigated in relation to body mass index (BMI). A cross-sectional study was conducted using food frequency and 24-hour recall questionnaires to evaluate consumption patterns (n=118) and to assess energy and nutrient intakes from TF and store-bought food (SBF) (n=161). Body mass index was calculated with a sub-sample of 45 participants. Mean yearly TF meal consumption was significantly related to age (p=0.05). Participants reporting high TF and low SBF consumption presented with a normal body weight (BMI=24.1) at the lower quartile and a slightly overweight status (BMI=25.8) at the median. Mean values for protein and carbohydrate intake were higher than the Dietary Reference Intakes, whereas dietary fibre intake was below these guidelines for both genders. Store-bought food provided higher levels of energy and nutrients, except for protein. Although Innu consume high amounts of TF and SBF, a lack of some essential nutrients was observed. Because TF intake was related to a tendency toward a lower BMI, a combined, targeted diet could be proposed. Health services could reinforce the importance of TF consumption and promote traditional dietary practices that offer advantages at many levels.

Hearing sensitivity during target presence and absence while a whale echolocates.

PubMed

Supin, Alexander Ya; Nachtigall, Paul E; Breese, Marlee

2008-01-01

Hearing sensitivity was measured in a false killer whale during echolocation. Sensitivity was measured using probe stimuli as sinusoidally amplitude modulated signals with a 22.5-kHz carrier frequency and recording auditory evoked potentials as envelope-following responses. The probes were presented and responses were recorded during short 2-s periods when the animal echolocated to detect the presence or absence of a target in a go/no-go paradigm. In the target-absent trials, a hearing threshold of 90.4 dB re 1 muPa was found; in the target-present trials, the threshold was 109.8 dB. Thus, a 19.4-dB difference was found between thresholds in the target-present and target-absent trials. To check the possibility that this difference was the result of different masking degree of the probe by the emitted sonar clicks, click statistics were investigated in similar trials. No indication was found that the energy of the emitted clicks was higher in the target-present than in target-absent trials; on the contrary, mean click level, mean number of clicks per train, and overall train energy was slightly higher in the target-absent trials. Thus the data indicate that the hearing sensitivity of the whale varied depending on target presence or absence.

Optical band gap determination of calcium doped lanthanum manganite nano particle tailored with polypyrrole

NASA Astrophysics Data System (ADS)

Gopalakrishna, Smitha Mysore; Murugendrappa, Malalkere Veerappa

2018-05-01

In this paper we bring forth the effect of La0.7Ca0.3MnO3 (LCM) perovskite nano particle on the optical band gap in composition with conducting Polypyrrole (PPy) prepared by chemical oxidation method. The morphology and crystalline phase were determined by SEM, TEM and X-Ray diffraction studies. The Optical band gap studies were analyzed using the UV-VIS spectrometer scanned in the range 200 nm to 600 nm for pure PPy and PPy/LCM composites. There is a characteristic peak observed for the composites situated around 315 nm for pure PPy, PPy/LCM10 and PPy/LCM50. But for higher compositions of LCM weight percentage like 30%, 40% and 50% the peak shift slightly to higher wavelength side. The peak shifts to 320 nm, 325 nm and 335 nm respectively. The optical band gap increased for Pure PPy, PPy/LCM10 and PPy/LCM20 and found to decrease gradually for PPy/LCM30, PPy/LCM40 and PPy/LCM50. The studies suggest that LCM composition in the PPy chain has a role in modifying the wavelength and in turn its band gap. The study may find application in organic devices working at high frequency and voltage.

Climate simulations and projections with a super-parameterized climate model

DOE PAGES

Stan, Cristiana; Xu, Li

2014-07-01

The mean climate and its variability are analyzed in a suite of numerical experiments with a fully coupled general circulation model in which subgrid-scale moist convection is explicitly represented through embedded 2D cloud-system resolving models. Control simulations forced by the present day, fixed atmospheric carbon dioxide concentration are conducted using two horizontal resolutions and validated against observations and reanalyses. The mean state simulated by the higher resolution configuration has smaller biases. Climate variability also shows some sensitivity to resolution but not as uniform as in the case of mean state. The interannual and seasonal variability are better represented in themore » simulation at lower resolution whereas the subseasonal variability is more accurate in the higher resolution simulation. The equilibrium climate sensitivity of the model is estimated from a simulation forced by an abrupt quadrupling of the atmospheric carbon dioxide concentration. The equilibrium climate sensitivity temperature of the model is 2.77 °C, and this value is slightly smaller than the mean value (3.37 °C) of contemporary models using conventional representation of cloud processes. As a result, the climate change simulation forced by the representative concentration pathway 8.5 scenario projects an increase in the frequency of severe droughts over most of the North America.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Feibel, C.E.

This study uses multiple data collection and research methods including in depth interviews, 271 surveys of shared taxi and minibus operators, participant observation, secondary sources, and the literature on public transport from low, medium, and high-income countries. Extensive use is also made of a survey administered in Istanbul in 1976 to 1935 paratransit operators. Primary findings are that private buses are more efficient than public buses on a cost per passenger-km basis, and that private minibuses are as efficient as public buses. In terms of energy efficiency, minibuses are almost as efficient as public and private buses using actual-occupancy levels.more » Large shared taxis are twice as cost and energy efficient as cars, and small shared taxis 50% more efficient. In terms of investment cost per seat, large shared taxis have the lowest cost followed by smaller shared taxis, minibuses, and buses. Considering actual occupancy levels, minibuses are only slightly less effective in terms of congestion than buses, and large and small shared taxis are twice as effective as cars. It is also shown that minibuses and shared taxis have better service quality than buses because of higher frequencies and speeds, and because they provide a much higher probability of getting a seat than buses. Analysis of regulation and policy suggests that there are many unintended cost of public-transport regulations.« less

Dynamics of acoustically levitated disk samples.

PubMed

Xie, W J; Wei, B

2004-10-01

The acoustic levitation force on disk samples and the dynamics of large water drops in a planar standing wave are studied by solving the acoustic scattering problem through incorporating the boundary element method. The dependence of levitation force amplitude on the equivalent radius R of disks deviates seriously from the R3 law predicted by King's theory, and a larger force can be obtained for thin disks. When the disk aspect ratio gamma is larger than a critical value gamma(*) ( approximately 1.9 ) and the disk radius a is smaller than the critical value a(*) (gamma) , the levitation force per unit volume of the sample will increase with the enlargement of the disk. The acoustic levitation force on thin-disk samples ( gamma

Dynamics of acoustically levitated disk samples

NASA Astrophysics Data System (ADS)

Xie, W. J.; Wei, B.

2004-10-01

The acoustic levitation force on disk samples and the dynamics of large water drops in a planar standing wave are studied by solving the acoustic scattering problem through incorporating the boundary element method. The dependence of levitation force amplitude on the equivalent radius R of disks deviates seriously from the R3 law predicted by King’s theory, and a larger force can be obtained for thin disks. When the disk aspect ratio γ is larger than a critical value γ*(≈1.9) and the disk radius a is smaller than the critical value a*(γ) , the levitation force per unit volume of the sample will increase with the enlargement of the disk. The acoustic levitation force on thin-disk samples (γ⩽γ*) can be formulated by the shape factor f(γ,a) when a⩽a*(γ) . It is found experimentally that a necessary condition of the acoustic field for stable levitation of a large water drop is to adjust the reflector-emitter interval H slightly above the resonant interval Hn . The simulation shows that the drop is flattened and the central parts of its top and bottom surface become concave with the increase of sound pressure level, which agrees with the experimental observation. The main frequencies of the shape oscillation under different sound pressures are slightly larger than the Rayleigh frequency because of the large shape deformation. The simulated translational frequencies of the vertical vibration under normal gravity condition agree with the theoretical analysis.

Role of entrainment in convectively-coupled equatorial waves in an aquaplanet model

NASA Astrophysics Data System (ADS)

Peatman, Simon; Methven, John; Woolnough, Steve

2016-04-01

Equatorially-trapped waves are known to be one of the key phenomena in determining the distribution of convective precipitation in the tropics as well as being crucial to the dynamics of the Madden-Julian Oscillation. However, numerical weather prediction models struggle to sustain such waves for a realistic length of time, which has a significant impact on forecasting precipitation for regions such as equatorial Africa. It has been found in the past that enhancing the rate of moisture entrainment can improve certain aspects of parametrized tropical convection in climate models. A parameter F controls the rate of entrainment into the convective plume for deep- and mid-level convection, with F = 1 denoting the control case. Here it is found in an aquaplanet simulation that F > 1 produces more convective precipitation at all zonal wavenumbers. Furthermore, Kelvin wave activity increases for waves with low frequency and zonal wavenumber but is slightly suppressed for shorter, higher-frequency waves, and vice versa for westward-propagating waves. A change in entrainment rate also brings about a change in the basic state wind and humidity fields. Therefore, the question arises as to whether changes in wave activity are due directly to changes in the coupling to the humidity in the waves by entrainment or due to changes in the basic state. An experiment was devised in which the convective parametrization scheme is allowed to entrain a weighted sum of the environmental humidity and a prescribed zonally-symmetric climatology, with a parameter α controlling the extent of the decoupling from the environment. Experiments with this new mechanism in the parametrization scheme reveal a complex relationship. For long waves at low frequency (period > ˜13 days), removing zonal asymmetry in the humidity seen by the entrainment scheme has very little influence on the ratio of eastward- to westward-propagating power. At higher frequencies and zonal wavenumbers, removing this zonal asymmetry acts to suppress wave activity. Enhanced entrainment rate relative to the control case is also shown to slow the phase speed of Kelvin waves by around 20%. The phase speed depends also on the decoupling parameter α, with the minimum speed occurring around the special case α = 1 - 1/F , when the basic state humidity is entrained at the enhanced rate and perturbations from it are entrained at the control rate.

The use of language to express thermal sensation suggests heat acclimatization by Indonesian people

NASA Astrophysics Data System (ADS)

Tochihara, Yutaka; Lee, Joo-Young; Wakabayashi, Hitoshi; Wijayanto, Titis; Bakri, Ilham; Parsons, Ken

2012-11-01

The purpose of this study was to explore whether there is evidence of heat acclimatization in the words used to express thermal sensation. A total of 458 urban Japanese and 601 Indonesians participated in a questionnaire. In addition, in a preliminary survey, 39 native English speakers in the UK participated. Our results showed that (1) for Indonesians, the closest thermal descriptor of a feeling of thermal comfort was `cool' (75%) followed by `slightly cool' (7%), `slightly cold' (5%) and `cold' (5%), while Japanese responses were distributed uniformly among descriptors `cool', `slightly cool', `neither', `slightly warm', and `warm'; (2) the closest thermal descriptors of a feeling of discomfort for Indonesians were less affected by individual thermal susceptibility (vulnerability) than those for Japanese; (3) in the cases where `cool' and `slightly cold' were imagined in the mind, the descriptors were cognized as a thermal comfortable feeling by 97% and 57% of Indonesians, respectively; (4) the most frequently voted choice endorsing hot weather was `higher than 32°C' for Indonesians and `higher than 29°C' for Japanese respondents; for cold weather, `lower than 15°C' for Japanese and `lower than 20°C' for Indonesians. In summary, the descriptor `cool' in Indonesians connotes a thermally comfortable feeling, but the inter-zone between hot and cold weather that was judged in the mind showed a upward shift when compared to that of Japanese. It is suggested that linguistic heat acclimatization exists on a cognitive level for Indonesians and is preserved in the words of thermal descriptors.

Solar power satellite system definition study. Volume 4: Solid State SPS Analysis, Phase 3

NASA Technical Reports Server (NTRS)

1980-01-01

A 2500 megawatt solid ground output Solar Power Satellite (SPS) of conventional configuration was designed and analyzed. Because the power per receiving antenna is halved, as compared with the klystron reference, twice the number of receiving antennas are needed to deliver the same total power. The solid state approach appears feasible with a slightly greater specific mass and slightly higher cost than the klystron SPS design.

Did the DSM-5 Improve the Traumatic Stressor Criterion?: Association of DSM-IV and DSM-5 Criterion A with Posttraumatic Stress Disorder Symptoms.

PubMed

Larsen, Sadie E; Berenbaum, Howard

2017-01-01

A recent meta-analysis found that DSM-III- and DSM-IV-defined traumas were associated with only slightly higher posttraumatic stress disorder (PTSD) symptoms than nontraumatic stressors. The current study is the first to examine whether DSM-5-defined traumas were associated with higher levels of PTSD than DSM-IV-defined traumas. Further, we examined theoretically relevant event characteristics to determine whether characteristics other than those outlined in the DSM could predict PTSD symptoms. One hundred six women who had experienced a trauma or significant stressor completed questionnaires assessing PTSD, depression, impairment, and event characteristics. Events were rated for whether they qualified as DSM-IV and DSM-5 trauma. There were no significant differences between DSM-IV-defined traumas and stressors. For DSM-5, effect sizes were slightly larger but still nonsignificant (except for significantly higher hyperarousal following traumas vs. stressors). Self-reported fear for one's life significantly predicted PTSD symptoms. Our results indicate that the current DSM-5 definition of trauma, although a slight improvement from DSM-IV, is not highly predictive of who develops PTSD symptoms. Our study also indicates the importance of individual perception of life threat in the prediction of PTSD. © 2017 S. Karger AG, Basel.

Investigation of an Ultrafast Harmonic Resonant RF Kicker

DOE Office of Scientific and Technical Information (OSTI.GOV)

Huang, Yulu

An Energy Recovery Linac (ERL) based multi-turn electron Circulator Cooler Ring (CCR) is envisaged in the proposed Jefferson Lab Electron Ion Collider (JLEIC) to cool the ion bunches with high energy (55 MeV), high current (1.5 A), high repetition frequency (476.3 MHz), high quality magnetized electron bunches. A critical component in this scheme is a pair of ultrafast kickers for the exchange of electron bunches between the ERL and the CCR. The ultrafast kicker should operate with the rise and fall time in less than 2.1 ns, at the repetition rate of ~10s MHz, and should be able to runmore » continuously during the whole period of cooling. These -and-fall time being combined together, are well beyond the state-of-art of traditional pulsed power supplies and magnet kickers. To solve this technical challenge, an alternative method is to generate this high repetition rate, fast rise-and-fall time short pulse continuous waveform by summing several finite number of (co)sine waves at harmonic frequencies of the kicking repetition frequency, and these harmonic modes can be generated by the Quarter Wave Resonater (QWR) based multifrequency cavities. Assuming the recirculator factor is 10, 10 harmonic modes (from 47.63 MHz to 476.3 MHz) with proper amplitudes and phases, plus a DC offset are combined together, a continuous short pulse waveform with the rise-and-fall time in less than 2.1 ns, repetition rate of 47.63 MHz waveform can be generated. With the compact and matured technology of QWR cavities, the total cost of both hardware development and operation can be reduced to a modest level. Focuse on the technical scheme, three main topics will be discussed in this thesis: the synthetization of the kicking pulse, the design and optimization of the deflecting QWR multi-integer harmonic frequency resonator and the fabrication and bench measurements of a half scale copper prototype. In the kicking pulse synthetization part, we begin with the Fourier Series expansion of an ideal square pulse, and get a Flat-Top waveform which will give a uniform kick over the bunch length of the kicked electron bunches, thus the transverse emittance of these kicked electron bunches can be maintained. By using two identical kickers with the betatron phase advance of 180 degree or its odd multiples, the residual kick voltage wave slopes at the unkicked bunch position will be totally cancelled out. Flat-Top waveform combined with two kicker scheme, the transverse emittance of the cooling electron bunches will be conserved during the whole injection, recirculation, and ejection processes. In the cavity design part, firstly, the cavity geometry is optimized to get high transverse shunt impedance thus less than 100 W of RF losses on the cavity wall can be achieved for all these 10 harmonic modes. To support all these 10 harmonic modes, group of four QWRs are adopted with the mode distribution of 5:3:1:1. In the multi-frequency cavities such as the five-mode-cavity and the three-mode-cavity, tunings are required to achieve the design frequencies for each mode. Slight segments of taper design on the inner conductor help to get the frequencies to be exactly on the odd harmonic modes. Stub tuners equal to the number of resonant modes are inserted to the outer conductor wall to compensate the frequency shifts due manufacturing errors and other perturbations during the operation such as the change of the cavity temperature. Single loop couple is designed for all harmonic modes in each cavity. By adjusting its loop size, position and rotation, it is possible to get the fundamental mode critical coupled and other higher harmonic modes slightly over coupled. A broadband circulator will be considered for absorbing the reflected power. Finally in this part, multipole field components due to the asymmetric cylindrical structure around the beam axis of the cavity as well as the beam-induced higher order mode (HOM) issues will be analyzed and discussed in this thesis. A half-scale copper prototype cavity (resonant frequencies from 95.26 MHz to 857.34 MHz) was fabricated to validate the electromagnetic characteristics. With this half scale prototype, the tuning processes of multiple harmonic frequencies, unloaded quality factor measurements of each mode, and bead-pull measurements are performed. The bench measurement results matched well with the simulation results, which have validated our cavity design and construction methods. Finally, a simple mode combining experiment with five separate signal generators was performed on this prototype cavity and the desired fast rise/fall time (1.2 ns), high repetition rate (95.26 MHz) waveform was captured, which finally proved our design of this ultrafast harmonic kicker.« less

Effects of single cycle binaural beat duration on auditory evoked potentials.

PubMed

Mihajloski, Todor; Bohorquez, Jorge; Özdamar, Özcan

2014-01-01

Binaural beat (BB) illusions are experienced as continuous central pulsations when two sounds with slightly different frequencies are delivered to each ear. It has been shown that steady-state auditory evoked potentials (AEPs) to BBs can be captured and investigated. The authors recently developed a new method of evoking transient AEPs to binaural beats using frequency modulated stimuli. This methodology was able to create single BBs in predetermined intervals with varying carrier frequencies. This study examines the effects of the BB duration and the frequency modulating component of the stimulus on the binaural beats and their evoked potentials. Normal hearing subjects were tested with a set of four durations (25, 50, 100, and 200 ms) with two stimulation configurations, binaural dichotic (binaural beats) and diotic (frequency modulation). The results obtained from the study showed that out of the given durations, the 100 ms beat, was capable of evoking the largest amplitude responses. The frequency modulation effect showed a decrease in peak amplitudes with increasing beat duration until their complete disappearance at 200 ms. Even though, at 200 ms, the frequency modulation effects were not present, the binaural beats were still perceived and captured as evoked potentials.

Direct Visualization of Mechanical Beats by Means of an Oscillating Smartphone

NASA Astrophysics Data System (ADS)

Giménez, Marcos H.; Salinas, Isabel; Monsoriu, Juan A.; Castro-Palacio, Juan C.

2017-10-01

The resonance phenomenon is widely known in physics courses. Qualitatively speaking, resonance takes place in a driven oscillating system whenever the frequency approaches the natural frequency, resulting in maximal oscillatory amplitude. Very closely related to resonance is the phenomenon of mechanical beating, which occurs when the driving and natural frequencies of the system are slightly different. The frequency of the beat is just the difference of the natural and driving frequencies. Beats are very familiar in acoustic systems. There are several works in this journal on visualizing the beats in acoustic systems. For instance, the microphone and the speaker of two mobile devices were used in previous work to analyze the acoustic beats produced by two signals of close frequencies. The formation of beats can also be visualized in mechanical systems, such as a mass-spring system or a double-driven string. Here, the mechanical beats in a smartphone-spring system are directly visualized in a simple way. The frequency of the beats is measured by means of the acceleration sensor of a smartphone, which hangs from a spring attached to a mechanical driver. This laboratory experiment is suitable for both high school and first-year university physics courses.

Physiological and morphological responses of pine and willow saplings to post-fire salvage logging

NASA Astrophysics Data System (ADS)

Millions, E. L.; Letts, M. G.; Harvey, T.; Rood, S. B.

2015-12-01

With global warming, forest fires may be increasing in frequency, and post-fire salvage logging may become more common. The ecophysiological impacts of this practice on tree saplings remain poorly understood. In this study, we examined the physiological and morphological impacts of increased light intensity, due to post-fire salvage logging, on the conifer Pinus contorta (pine) and deciduous broadleaf Salix lucida (willow) tree and shrub species in the Crowsnest Pass region of southern Alberta. Photosynthetic gas-exchange and plant morphological measurements were taken throughout the summer of 2013 on approximately ten year-old saplings of both species. Neither species exhibited photoinhibition, but different strategies were observed to acclimate to increased light availability. Willow saplings were able to slightly elevate their light-saturated rate of net photosynthesis (Amax) when exposed to higher photosynthetic photon flux density (PPFD), thus increasing their growth rate. Willow also exhibited increased leaf inclination angles and leaf mass per unit area (LMA), to decrease light interception in the salvage-logged plot. By contrast, pine, which exhibited lower Amax and transpiration (E), but higher water-use efficiency (WUE = Amax/E) than willow, increased the rate at which electrons were moved through and away from the photosynthetic apparatus in order to avoid photoinhibition. Acclimation indices were higher in willow saplings, consistent with the hypothesis that species with short-lived foliage exhibit greater acclimation. LMA was higher in pine saplings growing in the logged plot, but whole-plant and branch-level morphological acclimation was limited and more consistent with a response to decreased competition in the logged plot, which had much lower stand density.

Plasma inhomogeneities near the electrodes of a capacitively-coupled radio-frequency discharge containing dust particles

NASA Astrophysics Data System (ADS)

Tawidian, H.; Mikikian, M.; Couëdel, L.; Lecas, T.

2011-11-01

Small plasma spheroids are evidenced and analyzed in front of the electrodes of a capacitively-coupled radio-frequency discharge in which dust particles are growing. These regions are characterized by a spherical shape, a slightly enhanced luminosity and are related to instabilities induced by the presence of dust particles. Several types of behaviors are identified and particularly their chaotic appearance or disappearance and their rotational motion along the electrode periphery. Correlations with the unstable behavior of the global plasma glow are performed. These analyses are obtained thanks to high-speed imaging which is the only diagnostics able to evidence these plasma spheroids.

Non-destructive tests for railway evaluation: Detection of fouling and joint interpretation of GPR and track geometric parameters - COST Action TU1208

NASA Astrophysics Data System (ADS)

Solla, Mercedes; Fontul, Simona; Marecos, Vânia; Loizos, Andreas

2016-04-01

During the last years high-performance railway lines have increased both their number and capabilities. As all types of infrastructures, railways have to maintain a proper behaviour during the entire life cycle. This work is focused on the analysis of the GPR method and its capabilities to detect defects in both infra and superstructure in railways. Different GPR systems and frequency antennas (air-coupled with antennas of 1.0 and 1.8 GHz, and ground-coupled with antennas of 1.0 and 2.3 GHz) were compared to establish the best procedures. For the assessment of the ground conditions, both GPR systems were used in combination with Falling Weight Deflectometer (FWD) load tests, in order to evaluate the bearing capacity of the subgrade. Moreover, Light Falling Weight Deflectometer (LFWD) measures were performed for the validation of the interpretation of the damaged areas identified from GPR and FWD tests. Finally, to corroborate the joint interpretation of GPR and FWD-LFWD, drill cores were extracted in the damaged areas identified based on the field data. Comparing all the data, a good agreement was obtained between the methods, when identifying both anomalous deflections and reflections. It was also demonstrated that ground-coupled systems have clear advantages compared to air-coupled systems since these antennas provide both better signal penetration and vertical resolution to detect fine details like cracking. Regarding the assessment of the thickness, three different high-speed track infrastructure solutions were constructed in a physical model, using asphalt as subballast layer. Four different antennas were used, two ground- and two air-coupled systems. Two different methodologies were assumed to calibrate the velocity of wave propagation: coring and metal plate. Comparing the results obtained, it was observed that the ground-coupled system provided higher values of wave velocity than the air-coupled system. The velocity values were also obtained by the amplitude or metal plate method with the air-coupled system. These velocities values were similar to those values obtained with the ground-coupled system, when using the coring method. Some laboratory tests were also developed in this work aiming to evaluate the dielectric constants for different levels of ballast fouling (0, 7.5 and 15%). The effect of the water presence on the dielectric constant was also evaluated by simulating different water contents: 5.5, 10 and 14%. Different GPR systems and configuration were used. The results have demonstrated that dielectric values increase with the increasing of fouling conditions. The dielectric constants also increase with the increasing of water content. However, the analysis of all the results obtained has revealed that values are more sensitive to the fouling level rather than to the water content variation. The dielectric constants obtained with a frequency of 1.0 GHz were slightly lower than those obtained with higher frequencies of 1.8 and 2.3 GHz. Additionally, the dielectric constants obtained for all the measurements, increasing fouling conditions and water contents, with a frequency of 1.0 GHz, were also different. Thus, the dielectric constant values obtained with the ground-coupled antenna were slightly lower than those obtained with the air-coupled antenna.

EVIDENCE FOR POLAR X-RAY JETS AS SOURCES OF MICROSTREAM PEAKS IN THE SOLAR WIND

DOE Office of Scientific and Technical Information (OSTI.GOV)

Neugebauer, Marcia, E-mail: mneugeb@lpl.arizona.edu

2012-05-01

It is proposed that the interplanetary manifestations of X-ray jets observed in solar polar coronal holes during periods of low solar activity are the peaks of the so-called microstreams observed in the fast polar solar wind. These microstreams exhibit velocity fluctuations of {+-}35 km s{sup -1}, higher kinetic temperatures, slightly higher proton fluxes, and slightly higher abundances of the low-first-ionization-potential element iron relative to oxygen ions than the average polar wind. Those properties can all be explained if the fast microstreams result from the magnetic reconnection of bright-point loops, which leads to X-ray jets which, in turn, result in solarmore » polar plumes. Because most of the microstream peaks are bounded by discontinuities of solar origin, jets are favored over plumes for the majority of the microstream peaks.« less

Effect of VA and MWNT contents on the rheological and physical properties of EVA

NASA Astrophysics Data System (ADS)

Kim, Jong-Ho; Lee, Seungwon; Kim, Byoung Chul; Shin, Bong-Seob; Jeon, Jong-Young; Chae, Dong Wook

2016-02-01

Ethylene vinyl acetate (EVA) copolymers with two different VA contents (15 and 33 wt.%, denoted by EVA15 and EVA33, respectively) were melt compounded with multi-walled carbon nanotubes (MWNTs) and the effect of VA and nanotube contents on the rheological, thermal and morphological properties was investigated. The addition of nanotubes into both EVAs increased the onset temperature of crystallization and broadened the peak, but further addition from 3 wt.% slightly decreased the temperature with increasing nanotube contents. In the wide angle X-ray diffraction patterns the peak of EVA15 was little affected by the presence of nanotubes but that of EVA33 slightly shifted to higher degree and became sharper with increasing nanotube contents. Dynamic viscosity (η') increased with nanotube contents giving abrupt increase at 2 wt.% nanotubes. Loss tangent decreased with increasing nanotube contents exhibiting the plateau-like behavior over most of the frequency range from 2 wt.% nanotubes. In the Casson plot, yield stress increased with nanotube content and its increasing extent was more notable for more VA content. In the Cole-Cole plot, the presence of nanotubes from 2 wt.% gave rise to the deviation from the single master curve by decreasing the slope. The deviated extent of EVA33 became more remarkable with increasing nanotube contents than that of EVA15. The stress-strain curve showed that more improved tensile modulus and yield stress were achieved by the introduction of MWNTs for EVA 33 than for EVA15. Tensile strength of EVA33 increased with increasing nanotube contents, while that of EVA15 decreased.

Thermally actuated resonant silicon crystal nanobalances

NASA Astrophysics Data System (ADS)

Hajjam, Arash

As the potential emerging technology for next generation integrated resonant sensors and frequency references as well as electronic filters, micro-electro-mechanical resonators have attracted a lot of attention over the past decade. As a result, a wide variety of high frequency micro/nanoscale electromechanical resonators have recently been presented. MEMS resonators, as low-cost highly integrated and ultra-sensitive mass sensors, can potentially provide new opportunities and unprecedented capabilities in the area of mass sensing. Such devices can provide orders of magnitude higher mass sensitivity and resolution compared to Film Bulk Acoustic resonators (FBAR) or the conventional quartz and Surface Acoustic Wave (SAW) resonators due to their much smaller sizes and can be batch-fabricated and utilized in highly integrated large arrays at a very low cost. In this research, comprehensive experimental studies on the performance and durability of thermally actuated micromechanical resonant sensors with frequencies up to tens of MHz have been performed. The suitability and robustness of the devices have been demonstrated for mass sensing applications related to air-borne particles and organic gases. In addition, due to the internal thermo-electro-mechanical interactions, the active resonators can turn some of the consumed electronic power back into the mechanical structure and compensate for the mechanical losses. Therefore, such resonators can provide self-sustained-oscillation without the need for any electronic circuitry. This unique property has been deployed to demonstrate a prototype self-sustained sensor for air-borne particle monitoring. I have managed to overcome one of the obstacles for MEMS resonators, which is their relatively poor temperature stability. This is a major drawback when compared with the conventional quartz crystals. A significant decrease of the large negative TCF for the resonators has been attained by doping the devices with a high concentration of phosphorous, resulting in even slightly positive TCF for some of the devices. This is also expected to improve the phase noise characteristics of oscillators implemented utilizing such frequency references by eliminating the sharp dependence to electronic noise in the resonator bias current. Finally it is well known that non-uniformities in fabrication of MEMS resonators lead to variations in their frequency. I have proposed both active (non-permanent) and permanent frequency modification to compensate for variations in frequency of the MEMS resonators.

Constraining Earthquake Source Parameters in Rupture Patches and Rupture Barriers on Gofar Transform Fault, East Pacific Rise from Ocean Bottom Seismic Data

NASA Astrophysics Data System (ADS)

Moyer, P. A.; Boettcher, M. S.; McGuire, J. J.; Collins, J. A.

2015-12-01

On Gofar transform fault on the East Pacific Rise (EPR), Mw ~6.0 earthquakes occur every ~5 years and repeatedly rupture the same asperity (rupture patch), while the intervening fault segments (rupture barriers to the largest events) only produce small earthquakes. In 2008, an ocean bottom seismometer (OBS) deployment successfully captured the end of a seismic cycle, including an extensive foreshock sequence localized within a 10 km rupture barrier, the Mw 6.0 mainshock and its aftershocks that occurred in a ~10 km rupture patch, and an earthquake swarm located in a second rupture barrier. Here we investigate whether the inferred variations in frictional behavior along strike affect the rupture processes of 3.0 < M < 4.5 earthquakes by determining source parameters for 100 earthquakes recorded during the OBS deployment.Using waveforms with a 50 Hz sample rate from OBS accelerometers, we calculate stress drop using an omega-squared source model, where the weighted average corner frequency is derived from an empirical Green's function (EGF) method. We obtain seismic moment by fitting the omega-squared source model to the low frequency amplitude of individual spectra and account for attenuation using Q obtained from a velocity model through the foreshock zone. To ensure well-constrained corner frequencies, we require that the Brune [1970] model provides a statistically better fit to each spectral ratio than a linear model and that the variance is low between the data and model. To further ensure that the fit to the corner frequency is not influenced by resonance of the OBSs, we require a low variance close to the modeled corner frequency. Error bars on corner frequency were obtained through a grid search method where variance is within 10% of the best-fit value. Without imposing restrictive selection criteria, slight variations in corner frequencies from rupture patches and rupture barriers are not discernable. Using well-constrained source parameters, we find an average stress drop of 5.7 MPa in the aftershock zone compared to values of 2.4 and 2.9 MPa in the foreshock and swarm zones respectively. The higher stress drops in the rupture patch compared to the rupture barriers reflect systematic differences in along strike fault zone properties on Gofar transform fault.

A directed search for extraterrestrial laser signals

NASA Technical Reports Server (NTRS)

Betz, A.

1991-01-01

The focus of NASA's Search for Extraterrestrial Intelligence (SETI) Program is on microwave frequencies, where receivers have the best sensitivities for the detection of narrowband signals. Such receivers, when coupled to existing radio telescopes, form an optimal system for broad area searches over the sky. For a directed search, however, such as toward specific stars, calculations show that infrared wavelengths can be equally as effective as radio wavelengths for establishing an interstellar communication link. This is true because infrared telescopes have higher directivities (gains) that effectively compensate for the lower sensitivities of infrared receivers. The result is that, for a given level of transmitted power, the signal to noise ratio for communications is equally as good at infrared and radio wavelengths. It should also be noted that the overall sensitivities of both receiver systems are quite close to their respective fundamental limits: background thermal noise for the radio frequency system and quantum noise for the infrared receiver. Consequently, the choice of an optimum communication frequency may well be determined more by the achievable power levels of transmitters rather than the ultimate sensitivities of receivers at any specific frequency. In the infrared, CO2 laser transmitters with power levels greater than 1 MW can already be built on Earth. For a slightly more advanced civilization, a similar but enormously more powerful laser may be possible using a planetary atmosphere rich in CO2. Because of these possibilities and our own ignorance of what is really the optimum search frequency, a search for narrowband signals at infrared frequencies should be a part of a balanced SETI Program. Detection of narrowband infrared signals is best done with a heterodyne receiver functionally identical to a microwave spectral line receiver. We have built such a receiver for the detection of CO2 laser radiation at wavelengths near 10 microns. The spectrometer uses a high-speed HgCdTe diode as the photomixer and a small CO2 laser as the local oscillator. Output signals in the intermediate frequency range 0.1-2.6 GHz are processed by a 1000-channel acousto-optic signal processor. The receiver is being used on a 1.5-m telescope on Mt. Wilson to survey a selected sample of 150 nearby stars. The current status of the work is discussed along with future project plans.

The MICORE review of historical changes in storminess in Europe

NASA Astrophysics Data System (ADS)

Ciavola, P.

2009-12-01

The main objective of the European-funded MICORE project is to develop and demonstrate on-line tools for the reliable prediction of storm impacts on coastlines and to develop and enhance existing civil protection strategies. The magnitude and frequency of storms was analyzed at 9 diverse Europe sites in order to determine storm trends over a period spanning between 30 and 100 years. Meteorological and marine data available at national and European level were included in the analysis. Here the aim was to improve understanding of coastal responses to changes in storminess and only event above a locally defined storm threshold were considered. This overcame the problems associated with the integration and comparison of information from widely dispersed geographical locations in Europe. The storm duration analysis performed for France (Aquitaine and Mediterranean), Italy (Northern Adriatic), Portugal (West Coast), Spain (Catalonia) and UK (Eastern Irish Sea) did not find any statistically significant change during the studied period. Similarly, no significant trends were observed for the Bulgarian and southern Portugal sites. The Polish site was the exception, showing a slight increase in storminess over the period studied. No clear trends in storm intensity were found for Italy-Northern Adriatic (waves and winds), Portugal-West Coast, and UK - Eastern Irish Sea. Similarly, Belgium, the Netherlands and Spain-Atlantic Andalusia (waves) did not detect any statistically significant trends. However, data from the Bulgarian and southern Portuguese coastlines indicated a slightly decreasing storminess trend. In contrast, a slight increase in storm frequency was observed in France-Aquitaine and Mediterranean (from the 1970s till 1990s), Italy-Northern Adriatic (only surges), Poland (significant both for surges and waves) and Spain-Andalusia (significant for wind). Results from the coastal regions in this study therefore support the conclusion that there are no significant trends detected in the magnitude or frequency of storms in Europe during the study period. The study provided some evidence that storminess variability is much higher than the observed trends at the time-scales used in this work (i.e. more than 3 decades). It was, however, not possible to observe any clear association between storminess changes and changes in the global climate. This does not imply that global climate change consequences will not have an influence on European storminess and on storminess impacts in the future. However, for the existing and available data sets at a European level, those impacts have not been detected in this study It is important to note also that although no clear trends in storminess emerge from the present study, this result does not necessarily imply that longer-term trends are absent. The study so far did not considered changes in the occurrence of “clusters” of events, i.e. the occurrence of several medium-energy events over a short time-scale. With respect to coastal evolution such storm ‘sequencing’ can have a major role in depleting beach sediments and decreasing resilience of dune ridges. Understanding and predicting this impact using innovative approaches will form the next area of work in the MICORE project and will provide a basis for the development of future coastal storm warning systems.

Influence of excitation frequency on the metastable atoms and electron energy distribution function in a capacitively coupled argon discharge

NASA Astrophysics Data System (ADS)

Sharma, S.; Sirse, N.; Turner, M. M.; Ellingboe, A. R.

2018-06-01

One-dimensional particle-in-cell simulation is used to simulate the capacitively coupled argon plasma for a range of excitation frequency from 13.56 MHz to 100 MHz. The argon chemistry set can, selectively, include two metastable levels enabling multi-step ionization and metastable pooling. The results show that the plasma density decreases when metastable atoms are included with higher discrepancy at a higher excitation frequency. The contribution of multistep ionization to the overall density increases with the excitation frequency. The electron temperature increases with the inclusion of metastable atoms and decreases with the excitation frequency. At a lower excitation frequency, the density of Ar** (3p5 4p, 13.1 eV) is higher than that of Ar* (3p5 4s, 11.6 eV), whereas at higher excitation frequencies, the Ar* (3p5 4s, 11.6 eV) is the dominant metastable atom. The metastable and electron temperature profile evolve from a parabolic profile at a lower excitation frequency to a saddle type profile at a higher excitation frequency. With metastable, the electron energy distribution function (EEDF) changes its shape from Druyvesteyn type, at a low excitation frequency, to bi-Maxwellian, at a high frequency plasma excitation; however, a three-temperature EEDF is observed without metastable atoms.

Auditory cortical neurons are sensitive to static and continuously changing interaural phase cues.

PubMed

Reale, R A; Brugge, J F

1990-10-01

1. The interaural-phase-difference (IPD) sensitivity of single neurons in the primary auditory (AI) cortex of the anesthetized cat was studied at stimulus frequencies ranging from 120 to 2,500 Hz. Best frequencies of the 43 AI cells sensitive to IPD ranged from 190 to 2,400 Hz. 2. A static IPD was produced when a pair of low-frequency tone bursts, differing from one another only in starting phase, were presented dichotically. The resulting IPD-sensitivity curves, which plot the number of discharges evoked by the binaural signal as a function of IPD, were deeply modulated circular functions. IPD functions were analyzed for their mean vector length (r) and mean interaural phase (phi). Phase sensitivity was relatively independent of best frequency (BF) but highly dependent on stimulus frequency. Regardless of BF or stimulus frequency within the excitatory response area the majority of cells fired maximally when the ipsilateral tone lagged the contralateral signal and fired least when this interaural-phase relationship was reversed. 3. Sensitivity to continuously changing IPD was studied by delivering to the two ears 3-s tones that differed slightly in frequency, resulting in a binaural beat. Approximately 26% of the cells that showed a sensitivity to static changes in IPD also showed a sensitivity to dynamically changing IPD created by this binaural tonal combination. The discharges were highly periodic and tightly synchronized to a particular phase of the binaural beat cycle. High synchrony can be attributed to the fact that cortical neurons typically respond to an excitatory stimulus with but a single spike that is often precisely timed to stimulus onset. A period histogram, binned on the binaural beat frequency (fb), produced an equivalent IPD-sensitivity function for dynamically changing interaural phase. For neurons sensitive to both static and continuously changing interaural phase there was good correspondence between their static (phi s) and dynamic (phi d) mean interaural phases. 4. All cells responding to a dynamically changing stimulus exhibited a linear relationship between mean interaural phase and beat frequency. Most cells responded equally well to binaural beats regardless of the initial direction of phase change. For a fixed duration stimulus, and at relatively low fb, the number of spikes evoked increased with increasing fb, reflecting the increasing number of effective stimulus cycles. At higher fb, AI neurons were unable to follow the rate at which the most effective phase repeated itself during the 3 s of stimulation.(ABSTRACT TRUNCATED AT 400 WORDS)

The Impact of Satellite Time Group Delay and Inter-Frequency Differential Code Bias Corrections on Multi-GNSS Combined Positioning

PubMed Central

Ge, Yulong; Zhou, Feng; Sun, Baoqi; Wang, Shengli; Shi, Bo

2017-01-01

We present quad-constellation (namely, GPS, GLONASS, BeiDou and Galileo) time group delay (TGD) and differential code bias (DCB) correction models to fully exploit the code observations of all the four global navigation satellite systems (GNSSs) for navigation and positioning. The relationship between TGDs and DCBs for multi-GNSS is clearly figured out, and the equivalence of TGD and DCB correction models combining theory with practice is demonstrated. Meanwhile, the TGD/DCB correction models have been extended to various standard point positioning (SPP) and precise point positioning (PPP) scenarios in a multi-GNSS and multi-frequency context. To evaluate the effectiveness and practicability of broadcast TGDs in the navigation message and DCBs provided by the Multi-GNSS Experiment (MGEX), both single-frequency GNSS ionosphere-corrected SPP and dual-frequency GNSS ionosphere-free SPP/PPP tests are carried out with quad-constellation signals. Furthermore, the author investigates the influence of differential code biases on GNSS positioning estimates. The experiments show that multi-constellation combination SPP performs better after DCB/TGD correction, for example, for GPS-only b1-based SPP, the positioning accuracies can be improved by 25.0%, 30.6% and 26.7%, respectively, in the N, E, and U components, after the differential code biases correction, while GPS/GLONASS/BDS b1-based SPP can be improved by 16.1%, 26.1% and 9.9%. For GPS/BDS/Galileo the 3rd frequency based SPP, the positioning accuracies are improved by 2.0%, 2.0% and 0.4%, respectively, in the N, E, and U components, after Galileo satellites DCB correction. The accuracy of Galileo-only b1-based SPP are improved about 48.6%, 34.7% and 40.6% with DCB correction, respectively, in the N, E, and U components. The estimates of multi-constellation PPP are subject to different degrees of influence. For multi-constellation combination SPP, the accuracy of single-frequency is slightly better than that of dual-frequency combinations. Dual-frequency combinations are more sensitive to the differential code biases, especially for the 2nd and 3rd frequency combination, such as for GPS/BDS SPP, accuracy improvements of 60.9%, 26.5% and 58.8% in the three coordinate components is achieved after DCB parameters correction. For multi-constellation PPP, the convergence time can be reduced significantly with differential code biases correction. And the accuracy of positioning is slightly better with TGD/DCB correction. PMID:28300787

The Impact of Satellite Time Group Delay and Inter-Frequency Differential Code Bias Corrections on Multi-GNSS Combined Positioning.

PubMed

Ge, Yulong; Zhou, Feng; Sun, Baoqi; Wang, Shengli; Shi, Bo

2017-03-16

We present quad-constellation (namely, GPS, GLONASS, BeiDou and Galileo) time group delay (TGD) and differential code bias (DCB) correction models to fully exploit the code observations of all the four global navigation satellite systems (GNSSs) for navigation and positioning. The relationship between TGDs and DCBs for multi-GNSS is clearly figured out, and the equivalence of TGD and DCB correction models combining theory with practice is demonstrated. Meanwhile, the TGD/DCB correction models have been extended to various standard point positioning (SPP) and precise point positioning (PPP) scenarios in a multi-GNSS and multi-frequency context. To evaluate the effectiveness and practicability of broadcast TGDs in the navigation message and DCBs provided by the Multi-GNSS Experiment (MGEX), both single-frequency GNSS ionosphere-corrected SPP and dual-frequency GNSS ionosphere-free SPP/PPP tests are carried out with quad-constellation signals. Furthermore, the author investigates the influence of differential code biases on GNSS positioning estimates. The experiments show that multi-constellation combination SPP performs better after DCB/TGD correction, for example, for GPS-only b1-based SPP, the positioning accuracies can be improved by 25.0%, 30.6% and 26.7%, respectively, in the N, E, and U components, after the differential code biases correction, while GPS/GLONASS/BDS b1-based SPP can be improved by 16.1%, 26.1% and 9.9%. For GPS/BDS/Galileo the 3rd frequency based SPP, the positioning accuracies are improved by 2.0%, 2.0% and 0.4%, respectively, in the N, E, and U components, after Galileo satellites DCB correction. The accuracy of Galileo-only b1-based SPP are improved about 48.6%, 34.7% and 40.6% with DCB correction, respectively, in the N, E, and U components. The estimates of multi-constellation PPP are subject to different degrees of influence. For multi-constellation combination SPP, the accuracy of single-frequency is slightly better than that of dual-frequency combinations. Dual-frequency combinations are more sensitive to the differential code biases, especially for the 2nd and 3rd frequency combination, such as for GPS/BDS SPP, accuracy improvements of 60.9%, 26.5% and 58.8% in the three coordinate components is achieved after DCB parameters correction. For multi-constellation PPP, the convergence time can be reduced significantly with differential code biases correction. And the accuracy of positioning is slightly better with TGD/DCB correction.

Determinants of the use of dietary supplements among secondary and high school students

PubMed

Gajda, Karolina; Zielińska, Monika; Ciecierska, Anna; Hamułka, Jadwiga

All over the world, including Poland, the sale of dietary supplements is increasing. More and more often, people including children and youths, use dietary supplements on their own initiative and without any medical indications or knowledge in this field. Analysis of the conditions of using the dietary supplements with vitamins and minerals among secondary school and high school students in Poland. The study included 396 students aged 13-18 years (249 girls and 147 boys). Authors’ questionnaire was used to evaluate the intake of dietary supplements. The use of cluster analysis allowed to distinguish groups of students with similar socio-demographic characteristics and the frequency of use of dietary supplements. In the studied population of students three clusters were created that significantly differed in socio-demographic characteristics. In cluster 1 and 2, were mostly students who used dietary supplements (respectively, 56% of respondents and 100%). In cluster 1 there were mostly students coming from rural areas and small city, with a worse financial situation, mainly boys (56%), while cluster 2 was dominated by girls (81%) living in a big city, coming from families with a good financial situation and who were more likely to be underweight (28.8%). In cluster 3 there were mostly older students (62%), not taking dietary supplements. In comparison to cluster 2, they had lower frequency of breakfast consumption (55% vs. 69%), but higher frequency of the consumption of soft drinks, fast-food, coffee as well as salt use at the table. The results show that the use of dietary supplements in adolescence is a common phenomenon and slightly conditioned by eating behaviors. This unfavorable habit of common dietary supplements intake observed among students indicates the need for education on the benefits and risks of the supplements usage.

Symptoms and Mucosal Changes Stable During Rapid Increase of Pediatric Celiac Disease in Norway.

PubMed

Beitnes, Ann-Christin R; Vikskjold, Florin B; Jóhannesdóttir, Gróa B; Perminow, Gøri; Olbjørn, Christine; Andersen, Solveig N; Bentsen, Beint S; Rugtveit, Jarle; Størdal, Ketil

2017-04-01

We aimed to study whether the incidence of pediatric celiac disease (CD) in South-Eastern Norway changed from 2000 to 2010. We also examined whether there was a change in symptoms and histopathological morphology in the duodenal biopsies during the same period. In 3 hospitals in South-Eastern Norway, records from pediatric patients (0-14.9 years) diagnosed with CD during two 3-year periods (2000-2002 and 2008-2010) were reviewed. Only cases with a duodenal biopsy diagnosis of CD classified as Marsh grade 2 and 3a-c were included. Frequencies of symptoms, anthropometric data, and laboratory results were compared, in addition to re-examinations of histological sections from one of the hospitals. A total of 400 cases were diagnosed with a female to male ratio of 1.5:1. The incidence rate for 2000 to 2002 was 15.9 cases per 100,000 person-years (95% confidence interval 12.8-19.4), compared with 45.5 cases per 100,000 person-years during 2008 to 2010 (95% confidence interval 40.5-50.9), P < 0.001. The relative frequencies of symptoms and the distribution of histopathological changes were similar in the 2 periods, whereas weight z scores and hemoglobin levels were significantly lower in the first period. We found a 3-fold increase in the incidence rate for CD in the Norwegian pediatric population during the decade 2000 to 2010. Slightly higher weight and hemoglobin levels at diagnosis in the latter period may be due to improved CD awareness. Unaltered relative frequencies of symptoms and histopathological changes in the gut, however, suggest a true increase of CD in Norwegian children.

Hearing and loud music exposure in 14-15 years old adolescents.

PubMed

Serra, Mario R; Biassoni, Ester C; Hinalaf, María; Abraham, Mónica; Pavlik, Marta; Villalobo, Jorge Pérez; Curet, Carlos; Joekes, Silvia; Yacci, María R; Righetti, Andrea

2014-01-01

Adolescent exposure to loud music has become a social and health problem whose study demands a holistic approach. The aims of the current study are: (1) To detect early noise-induced hearing loss among adolescents and establish its relationship with their participation in musical recreational activities and (2) to determine sound immission levels in nightclubs and personal music players (PMPs). The participants consisted in 172 14-15 years old adolescents from a technical high school. Conventional and extended high frequency audiometry, transient evoked otoacoustic emissions and questionnaire on recreational habits were administered. Hearing threshold levels (HTLs) were classified as: normal (Group 1), slightly shifted (Group 2), and significantly shifted (Group 3). The musical general exposure (MGE), from participation in recreational musical activities, was categorized in low, moderate, and high exposure. The results revealed an increase of HTL in Group 2 compared with Group 1 (P < 0.01), in Group 3 compared with Group 2 (P < 0.05) only in extended high frequency range, in Group 3 compared with Group 1 (P < 0.01). Besides, a decrease in mean global amplitude, reproducibility and in frequencies amplitude in Group 2 compared with Group 1 (P < 0.05) and in Group 3 compared with Group 1 (P < 0.05). A significant difference (P < 0.05) was found in Group 1's HTL between low and high exposure, showing higher HTL in high exposure. The sound immission measured in nightclubs (107.8-112.2) dBA and PMPs (82.9-104.6) dBA revealed sound levels risky for hearing health according to exposure times. It demonstrates the need to implement preventive and hearing health promoting actions in adolescents.

ANOMALOUS MICROWAVE EMISSION IN H ii REGIONS: IS IT REALLY ANOMALOUS? THE CASE OF RCW 49

DOE Office of Scientific and Technical Information (OSTI.GOV)

Paladini, Roberta; Ingallinera, Adriano; Agliozzo, Claudia

2015-11-01

The detection of an excess of emission at microwave frequencies with respect to the predicted free–free emission has been reported for several Galactic H ii regions. Here, we investigate the case of RCW 49, for which the Cosmic Background Imager tentatively (∼3σ) detected Anomalous Microwave Emission (AME) at 31 GHz on angular scales of 7′. Using the Australia Telescope Compact Array, we carried out a multi-frequency (5, 19, and 34 GHz) continuum study of the region, complemented by observations of the H109α radio recombination line. The analysis shows that: (1) the spatial correlation between the microwave and IR emission persistsmore » on angular scales from 3.′4 to 0.″4, although the degree of the correlation slightly decreases at higher frequencies and on smaller angular scales; (2) the spectral indices between 1.4 and 5 GHz are globally in agreement with optically thin free–free emission, however, ∼30% of these are positive and much greater than −0.1, consistent with a stellar wind scenario; and (3) no major evidence for inverted free–free radiation is found, indicating that this is likely not the cause of the Anomalous Emission in RCW 49. Although our results cannot rule out the spinning dust hypothesis to explain the tentative detection of AME in RCW 49, they emphasize the complexity of astronomical sources that are very well known and studied, such as H ii regions, and suggest that, at least in these objects, the reported excess of emission might be ascribed to alternative mechanisms such as stellar winds and shocks.« less

Steady and dynamic shear rheological behavior of semi dilute Alyssum homolocarpum seed gum solutions: influence of concentration, temperature and heating-cooling rate.

PubMed

Alaeddini, Behzad; Koocheki, Arash; Mohammadzadeh Milani, Jafar; Razavi, Seyed Mohammad Ali; Ghanbarzadeh, Babak

2018-05-01

Alyssum homolocarpum seed gum (AHSG) solution exhibits high viscosity at low shear rates and has anionic features. However there is no information regarding the flow and dynamic properties of this gum in semi-dilute solutions. The present study aimed to investigate the dynamic and steady shear behavior of AHSG in the semi-dilute region. The viscosity profile demonestrated a shear thinning behavior at all temperatures and concentrations. An increase in the AHSG concentration was acompanied by an increase in the pseudoplasticity degree, whereas, by increasing the temperature, the pseudoplasticity of AHSG decreased. At low gum concentration, solutions had more viscosity dependence on temperature. The mechanical spectra obtained from the frequency sweep experiment demonstrated viscoelastic properties for gum solutions. AHSG solutions showed typical weak gel-like behavior, revealing G' greater than G' within the experimental range of frequency (Hz), with slight frequency dependency. The influence of temperature on viscoelastic properties of AHSG solutions was studied during both heating (5-85 °C) and cooling (85-5 °C) processes. The complex viscosity of AHSG was greater compared to the apparent viscosity, indicating the disruption of AHSG network structure under continuous shear rates and deviation from the Cox-Merz rule. During the initial heating, the storage modulus showed a decreasing trend and, with a further increase in temperature, the magnitude of storage modulus increased. The influence of temperature on the storage modulus was considerable when a higher heating rate was applied. AHSG can be applied as a thickening and stabilizing agents in food products that require good stability against temperature. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

Association of the DD genotype and development of Japanese type 2 diabetic nephropathy.

PubMed

Gohda, T; Makita, Y; Shike, T; Kobayashi, M; Funabiki, K; Haneda, M; Kikkawa, R; Watanabe, T; Baba, T; Yoshida, H; Tomino, Y

2001-12-01

We determined the insertion/deletion (I/D) polymorphism of the angiotensin-coverting enzyme (ACE) gene in a multicenter trial of ethnically homogeneous Japanese type 2 diabetes mellitus (DM) patients. All patients (n = 748) were divided into 5 groups as follows: group I (normoalbuminuric patients), group II (microalbuminuric patients), group III (overt albuminuric patients with serum creatinine (s-Cr) levels of less than 1.2 mg/dl), group IV (overt albuminuric patients with s-Cr levels of more than 1.3 mg/dl but excluding hemodialysis patients), and group V (hemodialysis patients). We selected patients with a diabetic duration of more than 15 years in the mild stage (groups I and II), but placed no limits on those in the advanced and end-stages (groups III, IV and V). The frequency of the DD genotype was slightly higher in the advanced and end stages. The frequency of the DD genotype in the mild stage differed from that in the end stage (II/ID/DD 47.8%/41.0%/11.2% vs. 37.0 %/43.3%/19.7% p = 0.07, II + ID/DD 88.8%/11.2% vs. 80.3%/19.7%, p < 0.05). D allele frequency in the mild stage also differed from that in the end stage (I/D 68.3%/31.7% vs. 58.7%/41.3%, p < 0.02). The presence of the DD genotype increased the risk of end-stage renal disease (ESRD) more than that of the other genotypes (odds ratio ID/II = 1.37, 95% CI 0.82-2.27; DD/II = 2.27, 95% CI 1.12-4.61). It appears that the DD genotype is associated with progression of Japanese type 2 diabetic nephropathy.

Development of a two photon/laser induced fluorescence technique for the detection of atmospheric OH radicals

NASA Technical Reports Server (NTRS)

Bradshaw, John

1990-01-01

The development of a new mid-IR laser source was the primary goal. Backward propagating stimulated D2 Raman frequency down conversion of a commercially available 1.06 micron Nd:YAG laser was shown to generate an efficient source of 1.56 micron radiation with near diffraction limited beam quality. The efficient generation of a 2.9 micron laser source was also achieved using backward propagating CH4 Raman frequency down conversion of the 1.56 micron pump. Slightly higher efficiencies were obtained for frequency down conversion of the 1.06 micron Nd:YAG using the H2 Raman shift yielding a near diffraction limited source in the 200 mJ range at 1.9 micron. Similar conversion efficiencies are anticipated as a result of extending the wavelength coverage of recently available Ti:sapphire pulse laser to not only cover the 740 to 860 nm fundamental wavelength range but also the .95 to 1.15 and 1.06 to 1.33 micron range using D2 and H2, respectively. The anticipated sensitivity of a TP-LIF OH sensor using this mid-IR source would give signal limited detection of 1.4 x 10(exp 5) OH/cu cm under boundary layer conditions and 5.5 x 10(exp 4) OH/cu cm under free troposphere sampling conditions for a five minute signal integration period. This level of performance coupled with the techniques non-perturbing nature and freedom from both interferences and background would allow reliable tropospheric OH measurement to be obtained under virtually any ambient condition of current interest, including interstitial and sampling.

Nucleotide excision repair and recombination are engaged in repair of trans-4-hydroxy-2-nonenal adducts to DNA bases in Escherichia coli.

PubMed

Janowska, Beata; Komisarski, Marek; Prorok, Paulina; Sokołowska, Beata; Kuśmierek, Jarosław; Janion, Celina; Tudek, Barbara

2009-09-23

One of the major products of lipid peroxidation is trans-4-hydroxy-2-nonenal (HNE). HNE forms highly mutagenic and genotoxic adducts to all DNA bases. Using M13 phage lacZ system, we studied the mutagenesis and repair of HNE treated phage DNA in E. coli wild-type or uvrA, recA, and mutL mutants. These studies revealed that: (i) nucleotide excision and recombination, but not mismatch repair, are engaged in repair of HNE adducts when present in phage DNA replicating in E. coli strains; (ii) in the single uvrA mutant, phage survival was drastically decreased while mutation frequency increased, and recombination events constituted 48% of all mutations; (iii) in the single recA mutant, the survival and mutation frequency of HNE-modified M13 phage was slightly elevated in comparison to that in the wild-type bacteria. The majority of mutations in recA(-) strain were G:C --> T:A transversions, occurring within the sequence which in recA(+) strains underwent RecA-mediated recombination, and the entire sequence was deleted; (iv) in the double uvrA recA mutant, phage survival was the same as in the wild-type although the mutation frequency was higher than in the wild-type and recA single mutant, but lower than in the single uvrA mutant. The majority of mutations found in the latter strain were base substitutions, with G:C --> A:T transitions prevailing. These transitions could have resulted from high reactivity of HNE with G and C, and induction of SOS-independent mutations.

Nucleotide excision repair and recombination are engaged in repair of trans-4-hydroxy-2-nonenal adducts to DNA bases in Escherichia coli

PubMed Central

Janowska, Beata; Komisarski, Marek; Prorok, Paulina; Sokołowska, Beata; Kuśmierek, Jarosław; Janion, Celina; Tudek, Barbara

2009-01-01

One of the major products of lipid peroxidation is trans-4-hydroxy-2-nonenal (HNE). HNE forms highly mutagenic and genotoxic adducts to all DNA bases. Using M13 phage lacZ system, we studied the mutagenesis and repair of HNE treated phage DNA in E. coli wild-type or uvrA, recA, and mutL mutants. These studies revealed that: (i) nucleotide excision and recombination, but not mismatch repair, are engaged in repair of HNE adducts when present in phage DNA replicating in E. coli strains; (ii) in the single uvrA mutant, phage survival was drastically decreased while mutation frequency increased, and recombination events constituted 48 % of all mutations; (iii) in the single recA mutant, the survival and mutation frequency of HNE-modified M13 phage was slightly elevated in comparison to that in the wild-type bacteria. The majority of mutations in recA- strain were G:C → T:A transversions, occurring within the sequence which in recA+ strains underwent RecA-mediated recombination, and the entire sequence was deleted; (iv) in the double uvrA recA mutant, phage survival was the same as in the wild-type although the mutation frequency was higher than in the wild-type and recA single mutant, but lower than in the single uvrA mutant. The majority of mutations found in the latter strain were base substitutions, with G:C → A:T transitions prevailing. These transitions could have resulted from high reactivity of HNE with G and C, and induction of SOS-independent mutations. PMID:19834545

Radar sensitivity to human heartbeats and respiration

NASA Astrophysics Data System (ADS)

Aardal, Øyvind; Brovoll, Sverre; Paichard, Yoann; Berger, Tor; Lande, Tor Sverre; Hamran, Svein-Erik

2015-05-01

Human heartbeats and respiration can be detected from a distance using radar. This can be used for medical applications and human being detection. It is useful to have a system independent measure of how detectable the vital signs are. In radar applications, the Radar Cross Section (RCS) is normally used to characterize the detectability of an object. Since the human vital signs are seen by the radar as movements of the torso, the modulations in the person RCS can be used as a system independent measure of the vital signs detectability. In this paper, measurements of persons seated in an anechoic chamber are presented. The measurements were calibrated using empty room and a metallic calibration sphere. A narrowband radar operating at frequencies from 500 MHz to 18 GHz in discrete steps was used. A turntable provided measurements at precise aspect angles all around the person under test. In an I & Q receiver, the heartbeat and respiration modulation is a combination of amplitude and phase mod- modulations. The measurements were filtered, leaving the modulations from the vital signs in the radar recordings. The procedure for RCS computation was applied to these filtered data, capturing the complex signatures. It was found that both the heartbeat and respiration detectability increase with increasing frequency. The heartbeat signatures are almost equal from the front and the back, while being almost undetectable from the sides of the person. The respiration signatures are slightly higher from the front than from the back, and smaller from the sides. The signature measurements presented in this paper provide an objective system independent measure of the detectability of human vital signs as a function of frequency and aspect angle. These measures are useful for example in system design and in assessing real measurement scenarios.

Hawkmoth flight stability in turbulent vortex streets.

PubMed

Ortega-Jimenez, Victor Manuel; Greeter, Jeremy S M; Mittal, Rajat; Hedrick, Tyson L

2013-12-15

Shedding of vortices is a common phenomenon in the atmosphere over a wide range of spatial and temporal scales. However, it is unclear how these vortices of varying scales affect the flight performance of flying animals. In order to examine these interactions, we trained seven hawkmoths (Manduca sexta) (wingspan ~9 cm) to fly and feed in a wind tunnel under steady flow (controls) and in the von Kármán vortex street of vertically oriented cylinders (two different cylinders with diameters of 10 and 5 cm) at speeds of 0.5, 1 and 2 m s(-1). Cylinders were placed at distances of 5, 25 and 100 cm upstream of the moths. Moths exhibited large amplitude yaw oscillations coupled with modest oscillations in roll and pitch, and slight increases in wingbeat frequency when flying in both the near (recirculating) and middle (vortex dominated) wake regions. Wingbeat amplitude did not vary among treatments, except at 1 m s(-1) for the large cylinder. Yaw and roll oscillations were synchronized with the vortex shedding frequencies in moths flying in the wake of the large cylinder at all speeds. In contrast, yaw and pitch were synchronized with the shedding frequency of small vortices at speeds ≤1 m s(-1). Oscillations in body orientation were also substantially smaller in the small cylinder treatment when compared with the large cylinder, regardless of temporal or non-dimensional spatial scale. Moths flying in steady conditions reached a higher air speed than those flying into cylinder wakes. In general, flight effects produced by the cylinder wakes were qualitatively similar among the recirculating and vortex-dominated wake regions; the magnitude of those effects, however, declined gradually with downstream distance.

The effects of slight pressure oscillations in the far infrasound frequency range on the pars flaccida in gerbil and rabbit ears.

PubMed

Didyk, L A; Bogdanov, V B; Lysenko, V A; Didyk, N P; Gorgo, Yu P; Dirckx, J J J

2007-01-01

This study was designed to clarify whether the pars flaccida (PF) as a flexible part of the tympanic membrane is capable of reacting to pressure oscillations (PO) with amplitudes and frequencies typical for natural atmospheric pressure fluctuations in the far infrasound frequency range (APF). If so, the PF mechanical reactions to APF might be involved in the overall physiologic regulation processes, which make organisms susceptible to APF. The displacements of the PF in response to PO were measured in vitro in ears of gerbils and rabbits by means of laser Doppler vibrometry. The index of the PF reactivity (R(a)) was determined as the ratio of the amplitude of the PF oscillations (PFO) to the amplitude of the PO. All kinds of PO applied caused PFO. The amplitude of the PFO increased when the amplitude of the PO was increased. In gerbils, a decrease in R(a) with the increase in amplitude of the PO was observed. In the range of PO lowest amplitudes (4-20 Pa) R(a) proved to be 1.4 times higher than in the range of highest amplitudes (90-105 Pa). Considering that the natural APF are usually within the range of +/-20 Pa, this fact points to an important contribution of the PF to the pressure dynamics in the middle ear (ME) of gerbils. In rabbit ears, R(a) was lower and recovery from plastic deformation was slower than in gerbils. Our findings are in line with the suggestion that the PF might play an important role in respect of adaptation to natural APF.

Dental Caries Level and Sugar Consumption in 12-Year-Old Children from Poland.

PubMed

Olczak-Kowalczyk, Dorota; Turska, Anna; Gozdowski, Dariusz; Kaczmarek, Urszula

2016-01-01

The frequent and high consumption of sugar products, particularly sucrose, is one of the causative factors of dental caries. Meta-analyses assessing the relationship between sugar intake and dental caries revealed that a restricted sugar intake to less than 10% of the daily energy intake results in substantial health benefits. Sugar consumption in Poland is 2-fold higher than recommended by the WHO. As change in dietary habits is slow, knowledge of whether a gradual reduction of sugar consumption influences beneficially the dental condition is important. Assessment of the relationship between caries experience and sugar consumption in 12-year-old children. The data obtained from the Statistical Agricultural Yearbooks of the Central Statistical Office in Poland regarding the average yearly sugar intake by a person in the years 1995-2013, and caries prevalence (frequency and DMFT) resulting from the national epidemiological studies of the 12-year-old children conducted by the Ministry of Health in those years were analyzed. The data was analyzed by linear regression. Regression function parameters and coefficients of determination were assessed for a possible link between sugar consumption and dental caries frequency and severity was expressed as DMFT value. The mean yearly sugar intake by a statistical Pole ranged from 43.6 kg (2002) to 35.3 kg (2006). Despite a slight trend to lower the sugar consumption, its mean intake in 1995 and 2013 was the same (41.9 kg). Caries frequency and DMFT decreased in 2012 compared to 1995 from 90.5% to 79.6% and from 4.3 to 3.53 kg in 2012, respectively. The increased sugar intake by 1 kg/year caused the increase of caries frequency by 1% and DMFT value by 0.2. Even a relatively low decrease in sugar consumption can exert some beneficial influence on the dental condition in adolescents, particularly upon the severity of caries.

Extended PCR conditions to reduce drop-out frequencies in low template STR typing including unequal mixtures.

PubMed

Weiler, Natalie E C; Matai, Anuska S; Sijen, Titia

2012-01-01

Forensic laboratories employ various approaches to obtain short tandem repeat (STR) profiles from minimal traces (<100 pg DNA input). Most approaches aim to sensitize DNA profiling by increasing the amplification level by a higher cycle number or enlarging the amount of PCR products analyzed during capillary electrophoresis. These methods have limitations when unequal mixtures are genotyped, since the major component will be over-amplified or over-loaded. This study explores an alternative strategy for improved detection of the minor components in low template (LT) DNA typing that may be better suited for the detection of the minor component in mixtures. The strategy increases the PCR amplification efficiency by extending the primer annealing time several folds. When the AmpFℓSTR(®) Identifiler(®) amplification parameters are changed to an annealing time of 20 min during all 28 cycles, the drop-out frequency is reduced for both pristine DNA and single or multiple donor mock case work samples. In addition, increased peak heights and slightly more drop-ins are observed while the heterozygous peak balance remains similar as with the conventional Identifiler protocol. By this extended protocol, full DNA profiles were obtained from only 12 sperm heads (which corresponds to 36 pg of DNA) that were collected by laser micro dissection. Notwithstanding the improved detection, allele drop-outs do persist, albeit in lower frequencies. Thus a LT interpretation strategy such as deducing consensus profiles from multiple independent amplifications is appropriate. The use of extended PCR conditions represents a general approach to improve detection of unequal mixtures as shown using four commercially available kits (AmpFℓSTR(®) Identifiler, SEfiler Plus, NGM and Yfiler). The extended PCR protocol seems to amplify more of the molecules in LT samples during PCR, which results in a lower drop-out frequency. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

A Study of Subseasonal Predictability of the Atmospheric Circulation Low-frequency Modes based on SL-AV forecasts

NASA Astrophysics Data System (ADS)

Kruglova, Ekaterina; Kulikova, Irina; Khan, Valentina; Tischenko, Vladimir

2017-04-01

The subseasonal predictability of low-frequency modes and the atmospheric circulation regimes is investigated based on the using of outputs from global Semi-Lagrangian (SL-AV) model of the Hydrometcentre of Russia and Institute of Numerical Mathematics of Russian Academy of Science. Teleconnection indices (AO, WA, EA, NAO, EU, WP, PNA) are used as the quantitative characteristics of low-frequency variability to identify zonal and meridional flow regimes with focus on control distribution of high impact weather patterns in the Northern Eurasia. The predictability of weekly and monthly averaged indices is estimated by the methods of diagnostic verification of forecast and reanalysis data covering the hindcast period, and also with the use of the recommended WMO quantitative criteria. Characteristics of the low frequency variability have been discussed. Particularly, it is revealed that the meridional flow regimes are reproduced by SL-AV for summer season better comparing to winter period. It is shown that the model's deterministic forecast (ensemble mean) skill at week 1 (days 1-7) is noticeably better than that of climatic forecasts. The decrease of skill scores at week 2 (days 8-14) and week 3( days 15-21) is explained by deficiencies in the modeling system and inaccurate initial conditions. It was noticed the slightly improvement of the skill of model at week 4 (days 22-28), when the condition of atmosphere is more determined by the flow of energy from the outside. The reliability of forecasts of monthly (days 1-30) averaged indices is comparable to that at week 1 (days 1-7). Numerical experiments demonstrated that the forecast accuracy can be improved (thus the limit of practical predictability can be extended) through the using of probabilistic approach based on ensemble forecasts. It is shown that the quality of forecasts of the regimes of circulation like blocking is higher, than that of zonal flow.

Hierarchical structure of the energy landscape of proteins revisited by time series analysis. II. Investigation of explicit solvent effects

NASA Astrophysics Data System (ADS)

Alakent, Burak; Camurdan, Mehmet C.; Doruker, Pemra

2005-10-01

Time series analysis tools are employed on the principal modes obtained from the Cα trajectories from two independent molecular-dynamics simulations of α-amylase inhibitor (tendamistat). Fluctuations inside an energy minimum (intraminimum motions), transitions between minima (interminimum motions), and relaxations in different hierarchical energy levels are investigated and compared with those encountered in vacuum by using different sampling window sizes and intervals. The low-frequency low-indexed mode relationship, established in vacuum, is also encountered in water, which shows the reliability of the important dynamics information offered by principal components analysis in water. It has been shown that examining a short data collection period (100ps) may result in a high population of overdamped modes, while some of the low-frequency oscillations (<10cm-1) can be captured in water by using a longer data collection period (1200ps). Simultaneous analysis of short and long sampling window sizes gives the following picture of the effect of water on protein dynamics. Water makes the protein lose its memory: future conformations are less dependent on previous conformations due to the lowering of energy barriers in hierarchical levels of the energy landscape. In short-time dynamics (<10ps), damping factors extracted from time series model parameters are lowered. For tendamistat, the friction coefficient in the Langevin equation is found to be around 40-60cm-1 for the low-indexed modes, compatible with literature. The fact that water has increased the friction and that on the other hand has lubrication effect at first sight contradicts. However, this comes about because water enhances the transitions between minima and forces the protein to reduce its already inherent inability to maintain oscillations observed in vacuum. Some of the frequencies lower than 10cm-1 are found to be overdamped, while those higher than 20cm-1 are slightly increased. As for the long-time dynamics in water, it is found that random-walk motion is maintained for approximately 200ps (about five times of that in vacuum) in the low-indexed modes, showing the lowering of energy barriers between the higher-level minima.

Species and rotation frequency influence soil nitrogen in simplified tropical plant communities.

PubMed

Ewel, John J

2006-04-01

Among the many factors that potentially influence the rate at which nitrogen (N) becomes available to plants in terrestrial ecosystems are the identity and diversity of species composition, frequency of disturbance or stand turnover, and time. Replicated suites of investigator-designed communities afforded an opportunity to examine the effects of those factors on net N mineralization over a 12-year period. The communities consisted of large-stature perennial plants, comprising three tree species (Hyeronima alchorneoides, Cedrela odorata, and Cordia alliodora), a palm (Euterpe oleracea), and a large, perennial herb (Heliconia imbricata). Trees were grown in monoculture and in combination with the other two life-forms; tree monocultures were subjected to rotations of one or four years, or like the three-life-form systems, left uncut. The work was conducted on fertile soil in the humid lowlands of Costa Rica, a site with few abiotic constraints to plant growth. Rates of net N mineralization and nitrification were high, typically in the range of 0.2-0.8 microg x g(1) x d(-1), with net nitrification slightly higher than net mineralization, indicating preferential uptake of ammonium (NH4+) by plants and microbes. Net rates of N mineralization were about 30% lower in stands of one of the three tree species, Hyeronima, than in stands of the other two. Contrary to expectations, short-rotation management (one or four years) resulted in higher net rates of N mineralization than in uncut stands, whether the latter were composed of a single tree species or a combination of life-forms. Neither additional species richness nor replenishment of leached N augmented mineralization rates. The net rate at which N was supplied tended to be lowest in stands where demand for N was highest. Careful choice of species, coupled with low frequency of disturbance, can lead to maintenance of N within biomass and steady rates of within-system circulation, whereas pulses, whether caused by cutting and replanting or by the phenological traits of the species selected or combined, subject N supplies to leaching loss.

Mammography screening in six diverse communities in Chicago--a population study.

PubMed

Whitman, Steve; Shah, Ami M; Silva, Abigail; Ansell, David

2007-01-01

Despite the fact that recent studies suggest a narrowing in access to mammography, Black women are much more likely to die from breast cancer than White women. Data at the community level regarding mammography screening can help explain health disparities and inform plans for improved screening efforts. In 2002-2003, a comprehensive household health survey in English or Spanish was conducted in six community areas with 1700 households. The module on mammography was based on a state-based nationwide health survey and included questions on frequency of mammography, repeat screenings, and several demographic variables. The proportion of women >or=40 years (n=482) who received a mammogram in the past 2 years ranged from 74% to 90% across the six communities. The community with the highest screening proportion was predominantly Mexican and included recent immigrants. The screening proportion in the poorest community area, which was all Black, was 77%. Women with health insurance, higher income, and more education were more likely to receive a mammogram. Proportions for women >or=50 years (n=286) were slightly higher but similar. Repeat screening, which is recommended, occurred at lower levels. Access to and utilization of mammography have grown in recent years so that even these vulnerable communities had screening proportions at or even higher than the national average and the Healthy People Year 2010 objective. Nonetheless, repeat screening sequences were lower and may require attention if mammography screening efforts are to have a greater impact on female breast cancer mortality.

Geographic variations in epidemiology of two autoimmune bullous diseases: pemphigus and bullous pemphigoid.

PubMed

Alpsoy, Erkan; Akman-Karakas, Ayse; Uzun, Soner

2015-05-01

Autoimmune bullous diseases are rare, organ-specific, a group of blistering disease of skin and mucous membranes. Recent studies suggest that the frequency of the autoimmune bullous diseases has been increasing. Pemphigus vulgaris and bullous pemphigoid are the most frequently reported autoimmune bullous diseases. High incidence of autoimmune bullous diseases in some ethnic groups such as pemphigus in Ashkenazi Jewish, or in some regions such as pemphigus foliaceus in Brazil has been shown to be related to genetic and environmental factors, respectively. Pemphigus has been reported more frequently in the female gender. Although it is most frequently diagnosed between the ages 50 and 60 in European countries, in the remaining countries in the world, it is seen between the ages of 30 and 50. Bullous pemphigoid is generally seen above 70 years of age. Although overall incidence is slightly higher in females, after the age of 80 years it is more frequent in males. Both pemphigus vulgaris and bullous pemphigoid has a chronic course with recurrences. Mortality risk of the patients with bullous pemphigoid was found at least 2 times higher and the mortality risk of the patients with pemphigus was found approximately 3 times higher than that of the general population. In this review, the results obtained from the epidemiological studies were analyzed according to geographic regions, and especially epidemiologic features of two prevalent autoimmune bullous diseases, pemphigus and bullous pemphigoid have been discussed.

Vitamin D receptor genotypes are not associated with rheumatoid arthritis or biochemical parameters of bone turnover in German RA patients.

PubMed

Goertz, B; Fassbender, W J; Williams, J C; Marzeion, A M; Bretzel, R G; Stracke, H; Berliner, M N

2003-01-01

Vitamin D is known to exert immunomodulatory effects. An overrepresentation of the b allele of the vitamin D receptor (VDR) has been detected in autoimmune diseases as type-1-diabetes and multiple sclerosis. VDR polymorphisms have been shown to influence bone metabolism and bone density. The aim of the present study was to examine the distribution of VDR alleles in German rheumatoid arthritis (RA) patients and their relation to bone turnover parameters. 62 German RA patients were included and compared to 40 controls. Three VDR alleles were examined (Bsm I, Taq I and Fok I). In addition, serum intact osteocalcin (OC), parathyroid hormone, bone specific alkaline phosphatase (B-ALP), the carboxyterminal extension peptide of type I procollagen, 25-OH-vitamin D and urinary deoxypyridinoline (DPD) excretion were measured. Furthermore, C-reactive protein, erythrocyte sedimentation rate and rheumatoid factor were measured. We found a slightly higher frequency of the bB and tT-genotype in RA patients compared to controls, which was not statistically significant. OC and B-ALP were found to be significantly higher in RA patients with positive correlations between bone formation and resorption parameters indicating higher bone turnover in RA patients with maintained coupling. CRP in RA patients correlated with DPD and inversely with PTH. VDR genotype showed no association with bone turnover, family history or the presence of rheumatoid factor. Our results suggest that VDR polymorphisms do not play a major role in RA predisposition in Germans.

Calculation and characteristic analysis on synergistic effect of CF3I gas mixtures

NASA Astrophysics Data System (ADS)

Su, ZHAO; Yunkun, DENG; Yuhao, GAO; Dengming, XIAO

2018-06-01

CF3I is a potential SF6 alternative gas. In order to study the insulation properties and synergistic effects of CF3I/N2 and CF3I/CO2 gas mixtures, two-term approximate Boltzmann equations were used to obtain the ionization coefficient α, attachment coefficient η and the critical equivalent electrical field strength (E/N)cr. The results show that the (E/N)cr of CF3I gas at 300 K is 1.2 times that of SF6 gas, and CF3I/N2 and CF3I/CO2 gas mixtures both have synergistic effect occurred. The synergistic effect coefficient of CF3I/CO2 gas mixture was higher than that of CF3I/N2 gas mixture. But the (E/N)cr of CF3I/N2 is higher than that of CF3I/CO2 under the same conditions. When the content of CF3I exceeds 20%, the (E/N)cr of CF3I/N2 and CF3I/CO2 gas mixture increase linearly with the increasing of CF3I gas content. The breakdown voltage of CF3I/N2 gas mixture is also higher than that of CF3I/CO2 gas mixture in slightly non-uniform electrical field under power frequency voltage, but the synergistic effect coefficients of the two gas mixtures are basically the same.

Patterns of contraceptive use among Mexican-origin women.

PubMed

White, Kari L; Potter, Joseph E

Mexican women in the United States (US) have higher rates of fertility compared to other ethnic groups and women in Mexico. Whether variation in women's access to family planning services or patterns of contraceptive use contributes to this higher fertility has received little attention. We explore Mexican women's contraceptive use, taking into account women's place in the reproductive life course. Using nationally representative samples from the US (National Survey of Family Growth) and Mexico (Encuesta National de la Dinámica Demográfica), we compared the parity-specific frequency of contraceptive use and fertility intentions for non-migrant women, foreign-born Mexicans in the US, US-born Mexicans, and whites. Mexican women in the US were less likely to use IUDs and more likely to use hormonal contraception than women in Mexico. Female sterilization was the most common method among higher parity women in both the US and Mexico, however, foreign-born Mexicans were less likely to be sterilized, and the least likely to use any permanent contraceptive method. Although foreign-born Mexicans were slightly less likely to report that they did not want more children, differences in method use remained after controlling for women's fertility intentions. At all parities, foreign-born Mexicans used less effective methods. These findings suggest that varying access to family planning services may contribute to variation in women's contraceptive use. Future studies are needed to clarify the extent to which disparities in fertility result from differences in contraceptive access.

Servo-controlled intravital microscope system

NASA Technical Reports Server (NTRS)

Mansour, M. N.; Wayland, H. J.; Chapman, C. P. (Inventor)

1975-01-01

A microscope system is described for viewing an area of a living body tissue that is rapidly moving, by maintaining the same area in the field-of-view and in focus. A focus sensing portion of the system includes two video cameras at which the viewed image is projected, one camera being slightly in front of the image plane and the other slightly behind it. A focus sensing circuit for each camera differentiates certain high frequency components of the video signal and then detects them and passes them through a low pass filter, to provide dc focus signal whose magnitudes represent the degree of focus. An error signal equal to the difference between the focus signals, drives a servo that moves the microscope objective so that an in-focus view is delivered to an image viewing/recording camera.

Frequency selection rule for high definition and high frame rate Lissajous scanning.

PubMed

Hwang, Kyungmin; Seo, Yeong-Hyeon; Ahn, Jinhyo; Kim, Pilhan; Jeong, Ki-Hun

2017-10-26

Lissajous microscanners are very attractive in compact laser scanning applications such as endomicroscopy or pro-projection display owing to high mechanical stability and low operating voltages. The scanning frequency serves as a critical factor for determining the scanning imaging quality. Here we report the selection rule of scanning frequencies that can realize high definition and high frame-rate (HDHF) full-repeated Lissajous scanning imaging. The fill factor (FF) monotonically increases with the total lobe number of a Lissajous curve, i.e., the sum of scanning frequencies divided by the great common divisor (GCD) of bi-axial scanning frequencies. The frames per second (FPS), called the pattern repeated rate or the frame rate, linearly increases with GCD. HDHF Lissajous scanning is achieved at the bi-axial scanning frequencies, where the GCD has the maximum value among various sets of the scanning frequencies satisfying the total lobe number for a target FF. Based on this selection rule, the experimental results clearly demonstrate that conventional Lissajous scanners substantially increase both FF and FPS by slightly modulating the scanning frequencies at near the resonance within the resonance bandwidth of a Lissajous scanner. This selection rule provides a new guideline for HDHF Lissajous scanning in compact laser scanning systems.

Adolescent Self-Esteem: Differences by Race/Ethnicity, Gender, and Age

PubMed Central

Bachman, Jerald G.; O’Malley, Patrick M.; Freedman-Doan, Peter; Trzesniewski, Kali H.; Donnellan, M. Brent

2012-01-01

Large-scale representative surveys of 8th-, 10th-, and 12th-grade students in the United States show high self-esteem scores for all groups. African-American students score highest, Whites score slightly higher than Hispanics, and Asian Americans score lowest. Males score slightly higher than females. Multivariate controls for grades and college plans actually heighten these race/ethnic/gender differences. A truncated scoring method, designed to counter race/ethnic differences in extreme response style, reduced but did not eliminate the subgroup differences. Age differences in self-esteem are modest, with 12th graders reporting the highest scores. The findings are highly consistent across 18 annual surveys from 1991 through 2008, and self-esteem scores show little overall change during that period. PMID:22279425

Broadband Venetian Blind polarizer with dual vanes

NASA Technical Reports Server (NTRS)

Conroy, Bruce L.; Hoppe, Daniel J.; Imbriale, William A.

1993-01-01

During development of a Venetian Blind polarizer, high reflections and substantial pattern deformation were noted. Analysis showed that when the polarizer was illuminated slightly off axis, a degenerate mode was excited. This mode is resonant at the design center frequency, and was the cause of the problems. A design developed using dual vanes has been shown to be free of the problem. It also has greater bandwidth.

Scattering of Light and Surface Plasmon Polaritons from Rough Surfaces

DTIC Science & Technology

2013-06-14

Scattering of an electromagnetic wave from a slightly random dielectric surface: Yoneda peak and Brewster angle in incoherent scattering.” Waves...device applications. Thus, the negative refraction of a surface plasmon polariton was studied in two papers. In the first [1], all- angle negative... angle of incidence, measured counterclockwise from the negative x1 axis, is . The surface plasmon polariton of frequency transmitted through the

Error field penetration and locking to the backward propagating wave

DOE PAGES

Finn, John M.; Cole, Andrew J.; Brennan, Dylan P.

2015-12-30

In this letter we investigate error field penetration, or locking, behavior in plasmas having stable tearing modes with finite real frequencies w r in the plasma frame. In particular, we address the fact that locking can drive a significant equilibrium flow. We show that this occurs at a velocity slightly above v = w r/k, corresponding to the interaction with a backward propagating tearing mode in the plasma frame. Results are discussed for a few typical tearing mode regimes, including a new derivation showing that the existence of real frequencies occurs for viscoresistive tearing modes, in an analysis including themore » effects of pressure gradient, curvature and parallel dynamics. The general result of locking to a finite velocity flow is applicable to a wide range of tearing mode regimes, indeed any regime where real frequencies occur.« less

High-speed three-dimensional shape measurement for dynamic scenes using bi-frequency tripolar pulse-width-modulation fringe projection

NASA Astrophysics Data System (ADS)

Zuo, Chao; Chen, Qian; Gu, Guohua; Feng, Shijie; Feng, Fangxiaoyu; Li, Rubin; Shen, Guochen

2013-08-01

This paper introduces a high-speed three-dimensional (3-D) shape measurement technique for dynamic scenes by using bi-frequency tripolar pulse-width-modulation (TPWM) fringe projection. Two wrapped phase maps with different wavelengths can be obtained simultaneously by our bi-frequency phase-shifting algorithm. Then the two phase maps are unwrapped using a simple look-up-table based number-theoretical approach. To guarantee the robustness of phase unwrapping as well as the high sinusoidality of projected patterns, TPWM technique is employed to generate ideal fringe patterns with slight defocus. We detailed our technique, including its principle, pattern design, and system setup. Several experiments on dynamic scenes were performed, verifying that our method can achieve a speed of 1250 frames per second for fast, dense, and accurate 3-D measurements.

Probing the solar core with low-degree p modes

NASA Astrophysics Data System (ADS)

Roxburgh, I. W.; Vorontsov, S. V.

2002-01-01

We address the question of what could be learned about the solar core structure if the seismic data were limited to low-degree modes only. The results of three different experiments are described. The first is the linearized structural inversion of the p-mode frequencies of a solar model modified slightly in the energy-generating core, using the original (unmodified) model as an initial guess. In the second experiment, we invert the solar p-mode frequencies measured in the 32-month subset of BiSON data (Chaplin et al. 1998), degraded with additional 0.1 μHz random errors, using a model of 2.6 Gyr age from the solar evolutionary sequence as an initial approximation. This second inversion is non-linear. In the third experiment, we compare the same set of BiSON frequencies with current reference solar model.

Burnout in Hospital Social Workers Who Work with AIDS Patients.

ERIC Educational Resources Information Center

Oktay, Julianne S.

1992-01-01

Surveyed 128 hospital social workers who worked with Acquired Immune Deficiency Syndrome (AIDS) patients. Found that hospital AIDS social workers had slightly higher rates of emotional exhaustion and depersonalization on Maslach Burnout Inventory but also felt substantially higher level of personal accomplishment. Age, autonomy, and belonging to…

Documentation of Criteria for Promotion in a Higher Education Broadcast Journalism Discipline.

ERIC Educational Resources Information Center

Reppert, James E.

All institutions of higher learning have slightly different techniques of promoting and tenuring their faculty. The author compiled this document to provide resourceful pointers to future Broadcast Journalism and Mass Communication professors in the writing and organization of their applications. This collection of materials traces one tenured…

Heart rate variability and increased risk for developing type 2 diabetes mellitus.

PubMed

Penčić-Popović, Biljana; Ćelić, Vera; Ćosić, Zoran; Pavlović-Kleut, Milena; Čaparević, Zorica; Kostić, Nada; Milovanović, Branislav; Šljivić, Aleksandra; Stojčevski, Biljana

2014-12-01

To our knowledge there are no data about the relationship between elevated risk for developing type 2 diabetes mellitus (DM2) and altered cardiac autonomic function. The aim of this study was to evaluate the association between heart rate variability (HRV) and slightly increased risk for DM2. We evaluated 69 subjects (50.0 ± 14.4 years; 30 male) without DM2, coronary artery disease and arrhythmias. The subjects were divided into two groups according to the Finnish Diabetes Risk Score (FINDRISC): group I (n = 39) included subjects with 12 > FINDRISC ≥ 7; group II (n = 30) subjects with FINDRISC < 7. HRV was derived from 24-h electrocardiogram. We used time domain variables and frequency domain analysis performed over the entire 24-h period, during the day (06-22 h) and overnight (22-06 h). Standard deviation of the average normal RR intervals was significantly lower in the group with increased risk for DM2 compared to the group II (127.1 ± 26.6 ms vs 149.6 ± 57.6 ms; p = 0.035). Other time domain measures were similar in both groups. The group I demonstrated significantly reduced frequency domain measures, total power--TP (7.2 ± 0.3 ln/ms2 vs 7.3 ± 0.3 ln/ms2; p = 0.029), and low frequency--LF (5.9 ± 0.4 ln/ms2 vs 6.3 ± 0.6 In/ms2; p = 0.006), over entire 24 h, as well as TP (7.1 ± 0.3 In/ms2 vs 7.3 ± 0.3 In/ms2; p = 0.004), very low frequency (6.2 ± 0.2 In/ms2 vs 6.3 ± 0.2 In/ms2; p = 0.030), LF (5.9 ± 0.4 In/ms2 vs 6.2 ± 0.3 In/ms2; p = 0.000) and high frequency (5.7 ± 0.4 In/ms2 vs 5.9 ± 0.4 In/ms2; p = 0.011) during the daytime compared to the group II. Nocturnal frequency domain analysis was similar between the groups. The low diurnal frequency was independently related to elevated risk for diabetes mellitus (beta = -0,331; p = 0.006). The obtained results suggest that even slightly elevated risk for developing diabetes mellitus may be related to impaired HRV.

Coagulation processes of kaolinite and montmorillonite in calm, saline water

NASA Astrophysics Data System (ADS)

Zhang, Jin-Feng; Zhang, Qing-He; Maa, Jerome P.-Y.

2018-03-01

A three dimensional numerical model for simulating the coagulation processes of colloids has been performed by monitoring the time evolution of particle number concentration, the size distribution of aggregates, the averaged settling velocity, the collision frequency, and the collision efficiency in quiescent water with selected salinities. This model directly simulates all interaction forces between particles based on the lattice Boltzmann method (LBM) and the extended Derjaguin-Landau-Verwey-Overbeek (XDLVO) theory, and thus, can reveal the collision and coagulation processes of colloidal suspensions. Although using perfect spherical particles in the modeling, the results were compared with those for kaolinite and montmorillonite suspensions to demonstrate the capability of simulating the responses of these particles with highly irregular shape. The averaged settling velocity of kaolinite aggregates in quiescent saline water reached a maximum of 0.16 mm/s when the salinity increasing to about 3, and then, exhibited little dependence on salinity thereafter. Model simulations results (by choosing specific values that represent kaolinite's characteristics) indicate a similar trend: rapid decrease of the particle number concentration (i.e., rapidly flocculated, and thus, settling velocity also increases rapidly) when salinity increases from 0 to 2, and then, only increased slightly when salinity was further increased from 5 to 20. The collision frequency for kaolinite only decreases slightly with increasing salinity because that the fluid density and viscosity increase slightly in sea water. It suggests that the collision efficiency for kaolinite rises rapidly at low salinities and levels off at high salinity. For montmorillonite, the settling velocity of aggregates in quiescent saline water continuedly increases to 0.022 mm/s over the whole salinity range 0-20, and the collision efficiency for montmorillonite rises with increasing salinities.

Stimulus Load and Oscillatory Activity in Higher Cortex

PubMed Central

Kornblith, Simon; Buschman, Timothy J.; Miller, Earl K.

2016-01-01

Exploring and exploiting a rich visual environment requires perceiving, attending, and remembering multiple objects simultaneously. Recent studies have suggested that this mental “juggling” of multiple objects may depend on oscillatory neural dynamics. We recorded local field potentials from the lateral intraparietal area, frontal eye fields, and lateral prefrontal cortex while monkeys maintained variable numbers of visual stimuli in working memory. Behavior suggested independent processing of stimuli in each hemifield. During stimulus presentation, higher-frequency power (50–100 Hz) increased with the number of stimuli (load) in the contralateral hemifield, whereas lower-frequency power (8–50 Hz) decreased with the total number of stimuli in both hemifields. During the memory delay, lower-frequency power increased with contralateral load. Load effects on higher frequencies during stimulus encoding and lower frequencies during the memory delay were stronger when neural activity also signaled the location of the stimuli. Like power, higher-frequency synchrony increased with load, but beta synchrony (16–30 Hz) showed the opposite effect, increasing when power decreased (stimulus presentation) and decreasing when power increased (memory delay). Our results suggest roles for lower-frequency oscillations in top-down processing and higher-frequency oscillations in bottom-up processing. PMID:26286916

Effect of vibration on microstructures and mechanical properties of 304 stainless steel GTA welds

NASA Astrophysics Data System (ADS)

Hsieh, Chih-Chun; Lai, Chien-Hong; Wu, Weite

2013-07-01

This study investigates the microstructures and mechanical properties of 304 stainless steel at various vibration frequencies during simultaneous vibration welding. The experimental results demonstrated that simultaneous vibration welding could accelerate the nucleation and grain refinement of the microstructures. The effect of the grain refinement was more evident at the resonant frequency (375 Hz) and a minimum content of residual δ-ferrite (4.0%). The γ phase grew in the preferential orientation of the (111) direction with and without vibration. The full width at half maximum of the diffraction peak widened after the vibration, which was attributed to the grain refinement. The residual stress could be efficiently removed through simultaneous vibration welding when the amplitude of the vibration was increased. Furthermore, the lowest residual stress (139 MPa) was found when the vibration frequency was 375 Hz. The hardness and Young's modulus exhibited slight increases with low and medium frequencies. The hardness values were increased by 7.6% and Young's modulus was increased by 15% when the vibration frequency was resonant (375 Hz).

Suspension osteopenia in mice: Whole body electromagnetic field effects

DOE Office of Scientific and Technical Information (OSTI.GOV)

Simske, S.J.; Luttges, M.W.

1995-08-01

Whole-body fields were tested for their efficacy in preventing the osteopenia caused by tail suspension in mice. The fields had fundamental frequencies corresponding to the upper range of predicted endogenous impact-generated frequencies (0.25--2.0 kHz) in the long bones. Three distinct whole-body EMFs were applied for 2 weeks on growing mice. Structural, geometric, and material properties of the femora, tibiae, and humeri of suspended mice were altered compared to controls. Comparison of suspended mice and mice subjected to caloric restriction indicates that the changes in caloric intake do not explain either the suspension or the field-induced effects. In agreement with pastmore » studies, rather, unloading appears to cause the suspension effects and to be addressed by the EMFs. The EMF effects on bone properties were apparently frequency dependent, with the lower two fundamental frequencies (260 and 910 Hz) altering, albeit slightly, the suspension-induced bone effects. The fields are not apparently optimized for frequency, etc., with respect to therapeutic potential; however, suspension provides a model system for further study of the in vivo effects of EMFs.« less

Origin of the OH vibrational blue shift in the LiOH crystal.

PubMed

Hermansson, Kersti; Gajewski, Grzegorz; Mitev, Pavlin D

2008-12-25

The O-H vibrational frequency in crystalline hydroxides is either upshifted or downshifted by its crystalline surroundings. In the LiOH crystal, the experimental gas-to-solid O-H frequency upshift ("blue shift") is approximately +115 cm(-1). Here plane-wave DFT calculations for the isotope-isolated LiOH crystal have been performed and we discuss the origin of the OH frequency upshift, and the nature of the OH group and the interlayer interactions. We find that (1) the vibrational frequency upshift originates from interactions within the LiOH layer; this OH upshift is slightly lessened by the interlayer interactions; (2) the interlayer O-H - - - H-O interaction is largely electrostatic in character (but there is no hydrogen bonding); (3) the gas-to-solid vibrational shift for OH in LiOH(s) and its subsystems qualitatively adheres to a parabola-like "frequency vs electric field strength" correlation curve, which has a maximum for a positive electric field, akin to the correlation curve earlier found in the literature for an isolated OH(-) ion in an electric field.

Suspension osteopenia in mice: whole body electromagnetic field effects.

PubMed

Simske, S J; Luttges, M W

1995-01-01

Whole-body fields were tested for their efficacy in preventing the osteopenia caused by tail suspension in mice. The fields had fundamental frequencies corresponding to the upper range of predicted endogenous impact-generated frequencies (0.25-2.0 kHz) in the long bones. Three distinct whole-body EMFs were applied for 2 weeks on growing mice. Structural, geometric, and material properties of the femora, tibiae, and humeri of suspended mice were altered compared to controls. Comparison of suspended mice and mice subjected to caloric restriction indicates that the changes in caloric intake do not explain either the suspension or the field-induced effects. In agreement with past studies, rather, unloading appears to cause the suspension effects and to be addressed by the EMFs. The EMF effects on bone properties were apparently frequency dependent, with the lower two fundamental frequencies (260 and 910 Hz) altering, albeit slightly, the suspension-induced bone effects. The fields are not apparently optimized for frequency, etc., with respect to therapeutic potential; however, suspension provides a model system for further study of the in vivo effects of EMFs.

Morphology and Molecular Mechanisms of Hepatic Injury in Rats under Simulated Weightlessness and the Protective Effects of Resistance Training.

PubMed

Du, Fang; Ding, Ye; Zou, Jun; Li, Zhili; Tian, Jijing; She, Ruiping; Wang, Desheng; Wang, Huijuan; Lv, Dongqiang; Chang, Lingling

2015-01-01

This study investigated the effects of long-term simulated weightlessness on liver morphology, enzymes, glycogen, and apoptosis related proteins by using two-month rat-tail suspension model (TS), and liver injury improvement by rat-tail suspension with resistance training model (TS&RT). Microscopically the livers of TS rats showed massive granular degeneration, chronic inflammation, and portal fibrosis. Mitochondrial and endoplasmic reticulum swelling and loss of membrane integrity were observed by transmission electron microscopy (TEM). The similar, but milder, morphological changes were observed in the livers of TS&RT rats. Serum biochemistry analysis revealed that the levels of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) were significantly higher (p<0.05) in TS rats than in controls. The levels of ALT and AST in TS&RT rats were slightly lower than in RT rats, but they were insignificantly higher than in controls. However, both TS and TS&RT rats had significantly lower levels (p<0.05) of serum glucose and hepatic glycogen than in controls. Immunohistochemistry demonstrated that the expressions of Bax, Bcl-2, and active caspase-3 were higher in TS rats than in TS&RT and control rats. Real-time polymerase chain reaction (real-time PCR) showed that TS rats had higher mRNA levels (P < 0.05) of glucose-regulated protein 78 (GRP78) and caspase-12 transcription than in control rats; whereas mRNA expressions of C/EBP homologous protein (CHOP) and c-Jun N-terminal kinase (JNK) were slightly higher in TS rats. TS&RT rats showed no significant differences of above 4 mRNAs compared with the control group. Our results demonstrated that long-term weightlessness caused hepatic injury, and may trigger hepatic apoptosis. Resistance training slightly improved hepatic damage.

Morphology and Molecular Mechanisms of Hepatic Injury in Rats under Simulated Weightlessness and the Protective Effects of Resistance Training

PubMed Central

Zou, Jun; Li, Zhili; Tian, Jijing; She, Ruiping; Wang, Desheng; Wang, Huijuan; Lv, Dongqiang; Chang, Lingling

2015-01-01

This study investigated the effects of long-term simulated weightlessness on liver morphology, enzymes, glycogen, and apoptosis related proteins by using two-month rat-tail suspension model (TS), and liver injury improvement by rat-tail suspension with resistance training model (TS&RT). Microscopically the livers of TS rats showed massive granular degeneration, chronic inflammation, and portal fibrosis. Mitochondrial and endoplasmic reticulum swelling and loss of membrane integrity were observed by transmission electron microscopy (TEM). The similar, but milder, morphological changes were observed in the livers of TS&RT rats. Serum biochemistry analysis revealed that the levels of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) were significantly higher (p<0.05) in TS rats than in controls. The levels of ALT and AST in TS&RT rats were slightly lower than in RT rats, but they were insignificantly higher than in controls. However, both TS and TS&RT rats had significantly lower levels (p<0.05) of serum glucose and hepatic glycogen than in controls. Immunohistochemistry demonstrated that the expressions of Bax, Bcl-2, and active caspase-3 were higher in TS rats than in TS&RT and control rats. Real-time polymerase chain reaction (real-time PCR) showed that TS rats had higher mRNA levels (P < 0.05) of glucose-regulated protein 78 (GRP78) and caspase-12 transcription than in control rats; whereas mRNA expressions of C/EBP homologous protein (CHOP) and c-Jun N-terminal kinase (JNK) were slightly higher in TS rats. TS&RT rats showed no significant differences of above 4 mRNAs compared with the control group. Our results demonstrated that long-term weightlessness caused hepatic injury, and may trigger hepatic apoptosis. Resistance training slightly improved hepatic damage. PMID:26000905

Asymmetries of solar oscillation line profiles

NASA Technical Reports Server (NTRS)

Duvall, T. L., Jr.; Jefferies, S. M.; Harvey, J. W.; Osaki, Y.; Pomerantz, M. A.

1993-01-01

Asymmetries of the power spectral line profiles of solar global p-modes are detected in full-disk intensity observations of the Ca II K Fraunhofer line. The asymmetry is a strong function of temporal frequency being strongest at the lowest frequencies observed and vanishing near the peak of the power distribution. The variation with spherical harmonic degree is small. The asymmetry is interpreted in terms of a model in which the solar oscillation cavity is compared to a Fabry-Perot interferometer with the source slightly outside the cavity. A phase difference between an outward direct wave and a corresponding inward wave that passes through the cavity gives rise to the asymmetry. The asymmetry is different in velocity and intensity observations. Neglecting the asymmetry when modeling the power spectrum can lead to systematic errors in the measurement of mode frequencies of as much as 10 exp -4 of the mode frequency. The present observations and interpretation locate the source of the oscillations to be approximately 60 km beneath the photosphere, the shallowest position suggested to date.

Full band all-sky search for periodic gravitational waves in the O1 LIGO data

NASA Astrophysics Data System (ADS)

Abbott, B. P.; Abbott, R.; Abbott, T. D.; Acernese, F.; Ackley, K.; Adams, C.; Adams, T.; Addesso, P.; Adhikari, R. X.; Adya, V. B.; Affeldt, C.; Afrough, M.; Agarwal, B.; Agathos, M.; Agatsuma, K.; Aggarwal, N.; Aguiar, O. D.; Aiello, L.; Ain, A.; Allen, B.; Allen, G.; Allocca, A.; Altin, P. A.; Amato, A.; Ananyeva, A.; Anderson, S. B.; Anderson, W. G.; Angelova, S. V.; Antier, S.; Appert, S.; Arai, K.; Araya, M. C.; Areeda, J. S.; Arnaud, N.; Ascenzi, S.; Ashton, G.; Ast, M.; Aston, S. M.; Astone, P.; Atallah, D. V.; Aufmuth, P.; Aulbert, C.; AultONeal, K.; Austin, C.; Avila-Alvarez, A.; Babak, S.; Bacon, P.; Bader, M. K. M.; Bae, S.; Baker, P. T.; Baldaccini, F.; Ballardin, G.; Ballmer, S. W.; Banagiri, S.; Barayoga, J. C.; Barclay, S. E.; Barish, B. C.; Barker, D.; Barkett, K.; Barone, F.; Barr, B.; Barsotti, L.; Barsuglia, M.; Barta, D.; Bartlett, J.; Bartos, I.; Bassiri, R.; Basti, A.; Batch, J. C.; Bawaj, M.; Bayley, J. C.; Bazzan, M.; Bécsy, B.; Beer, C.; Bejger, M.; Belahcene, I.; Bell, A. S.; Berger, B. K.; Bergmann, G.; Bero, J. J.; Berry, C. P. L.; Bersanetti, D.; Bertolini, A.; Betzwieser, J.; Bhagwat, S.; Bhandare, R.; Bilenko, I. A.; Billingsley, G.; Billman, C. R.; Birch, J.; Birney, R.; Birnholtz, O.; Biscans, S.; Biscoveanu, S.; Bisht, A.; Bitossi, M.; Biwer, C.; Bizouard, M. A.; Blackburn, J. K.; Blackman, J.; Blair, C. D.; Blair, D. G.; Blair, R. M.; Bloemen, S.; Bock, O.; Bode, N.; Boer, M.; Bogaert, G.; Bohe, A.; Bondu, F.; Bonilla, E.; Bonnand, R.; Boom, B. A.; Bork, R.; Boschi, V.; Bose, S.; Bossie, K.; Bouffanais, Y.; Bozzi, A.; Bradaschia, C.; Brady, P. R.; Branchesi, M.; Brau, J. E.; Briant, T.; Brillet, A.; Brinkmann, M.; Brisson, V.; Brockill, P.; Broida, J. E.; Brooks, A. F.; Brown, D. A.; Brown, D. D.; Brunett, S.; Buchanan, C. C.; Buikema, A.; Bulik, T.; Bulten, H. J.; Buonanno, A.; Buskulic, D.; Buy, C.; Byer, R. L.; Cabero, M.; Cadonati, L.; Cagnoli, G.; Cahillane, C.; Bustillo, J. Calderón; Callister, T. A.; Calloni, E.; Camp, J. B.; Canepa, M.; Canizares, P.; Cannon, K. C.; Cao, H.; Cao, J.; Capano, C. D.; Capocasa, E.; Carbognani, F.; Caride, S.; Carney, M. F.; Casanueva Diaz, J.; Casentini, C.; Caudill, S.; Cavaglià, M.; Cavalier, F.; Cavalieri, R.; Cella, G.; Cepeda, C. B.; Cerdá-Durán, P.; Cerretani, G.; Cesarini, E.; Chamberlin, S. J.; Chan, M.; Chao, S.; Charlton, P.; Chase, E.; Chassande-Mottin, E.; Chatterjee, D.; Cheeseboro, B. D.; Chen, H. Y.; Chen, X.; Chen, Y.; Cheng, H.-P.; Chia, H. Y.; Chincarini, A.; Chiummo, A.; Chmiel, T.; Cho, H. S.; Cho, M.; Chow, J. H.; Christensen, N.; Chu, Q.; Chua, A. J. K.; Chua, S.; Chung, A. K. W.; Chung, S.; Ciani, G.; Ciecielag, P.; Ciolfi, R.; Cirelli, C. E.; Cirone, A.; Clara, F.; Clark, J. A.; Clearwater, P.; Cleva, F.; Cocchieri, C.; Coccia, E.; Cohadon, P.-F.; Cohen, D.; Colla, A.; Collette, C. G.; Cominsky, L. R.; Constancio, M.; Conti, L.; Cooper, S. J.; Corban, P.; Corbitt, T. R.; Cordero-Carrión, I.; Corley, K. R.; Cornish, N.; Corsi, A.; Cortese, S.; Costa, C. A.; Coughlin, E. T.; Coughlin, M. W.; Coughlin, S. B.; Coulon, J.-P.; Countryman, S. T.; Couvares, P.; Covas, P. B.; Cowan, E. E.; Coward, D. M.; Cowart, M. J.; Coyne, D. C.; Coyne, R.; Creighton, J. D. E.; Creighton, T. D.; Cripe, J.; Crowder, S. G.; Cullen, T. J.; Cumming, A.; Cunningham, L.; Cuoco, E.; Dal Canton, T.; Dálya, G.; Danilishin, S. L.; D'Antonio, S.; Danzmann, K.; Dasgupta, A.; Da Silva Costa, C. F.; Dattilo, V.; Dave, I.; Davier, M.; Davis, D.; Daw, E. J.; Day, B.; De, S.; DeBra, D.; Degallaix, J.; De Laurentis, M.; Deléglise, S.; Del Pozzo, W.; Demos, N.; Denker, T.; Dent, T.; De Pietri, R.; Dergachev, V.; De Rosa, R.; DeRosa, R. T.; De Rossi, C.; DeSalvo, R.; de Varona, O.; Devenson, J.; Dhurandhar, S.; Díaz, M. C.; Di Fiore, L.; Di Giovanni, M.; Di Girolamo, T.; Di Lieto, A.; Di Pace, S.; Di Palma, I.; Di Renzo, F.; Doctor, Z.; Dolique, V.; Donovan, F.; Dooley, K. L.; Doravari, S.; Dorosh, O.; Dorrington, I.; Douglas, R.; Dovale Álvarez, M.; Downes, T. P.; Drago, M.; Dreissigacker, C.; Driggers, J. C.; Du, Z.; Ducrot, M.; Dupej, P.; Dwyer, S. E.; Edo, T. B.; Edwards, M. C.; Effler, A.; Eggenstein, H.-B.; Ehrens, P.; Eichholz, J.; Eikenberry, S. S.; Eisenstein, R. A.; Essick, R. C.; Estevez, D.; Etienne, Z. B.; Etzel, T.; Evans, M.; Evans, T. M.; Factourovich, M.; Fafone, V.; Fair, H.; Fairhurst, S.; Fan, X.; Farinon, S.; Farr, B.; Farr, W. M.; Fauchon-Jones, E. J.; Favata, M.; Fays, M.; Fee, C.; Fehrmann, H.; Feicht, J.; Fejer, M. M.; Fernandez-Galiana, A.; Ferrante, I.; Ferreira, E. C.; Ferrini, F.; Fidecaro, F.; Finstad, D.; Fiori, I.; Fiorucci, D.; Fishbach, M.; Fisher, R. P.; Fitz-Axen, M.; Flaminio, R.; Fletcher, M.; Fong, H.; Font, J. A.; Forsyth, P. W. F.; Forsyth, S. S.; Fournier, J.-D.; Frasca, S.; Frasconi, F.; Frei, Z.; Freise, A.; Frey, R.; Frey, V.; Fries, E. M.; Fritschel, P.; Frolov, V. V.; Fulda, P.; Fyffe, M.; Gabbard, H.; Gadre, B. U.; Gaebel, S. M.; Gair, J. R.; Gammaitoni, L.; Ganija, M. R.; Gaonkar, S. G.; Garcia-Quiros, C.; Garufi, F.; Gateley, B.; Gaudio, S.; Gaur, G.; Gayathri, V.; Gehrels, N.; Gemme, G.; Genin, E.; Gennai, A.; George, D.; George, J.; Gergely, L.; Germain, V.; Ghonge, S.; Ghosh, Abhirup; Ghosh, Archisman; Ghosh, S.; Giaime, J. A.; Giardina, K. D.; Giazotto, A.; Gill, K.; Glover, L.; Goetz, E.; Goetz, R.; Gomes, S.; Goncharov, B.; González, G.; Gonzalez Castro, J. M.; Gopakumar, A.; Gorodetsky, M. L.; Gossan, S. E.; Gosselin, M.; Gouaty, R.; Grado, A.; Graef, C.; Granata, M.; Grant, A.; Gras, S.; Gray, C.; Greco, G.; Green, A. C.; Gretarsson, E. M.; Groot, P.; Grote, H.; Grunewald, S.; Gruning, P.; Guidi, G. M.; Guo, X.; Gupta, A.; Gupta, M. K.; Gushwa, K. E.; Gustafson, E. K.; Gustafson, R.; Halim, O.; Hall, B. R.; Hall, E. D.; Hamilton, E. Z.; Hammond, G.; Haney, M.; Hanke, M. M.; Hanks, J.; Hanna, C.; Hannam, M. D.; Hannuksela, O. A.; Hanson, J.; Hardwick, T.; Harms, J.; Harry, G. M.; Harry, I. W.; Hart, M. J.; Haster, C.-J.; Haughian, K.; Healy, J.; Heidmann, A.; Heintze, M. C.; Heitmann, H.; Hello, P.; Hemming, G.; Hendry, M.; Heng, I. S.; Hennig, J.; Heptonstall, A. W.; Heurs, M.; Hild, S.; Hinderer, T.; Hoak, D.; Hofman, D.; Holt, K.; Holz, D. E.; Hopkins, P.; Horst, C.; Hough, J.; Houston, E. A.; Howell, E. J.; Hreibi, A.; Hu, Y. M.; Huerta, E. A.; Huet, D.; Hughey, B.; Husa, S.; Huttner, S. H.; Huynh-Dinh, T.; Indik, N.; Inta, R.; Intini, G.; Isa, H. N.; Isac, J.-M.; Isi, M.; Iyer, B. R.; Izumi, K.; Jacqmin, T.; Jani, K.; Jaranowski, P.; Jawahar, S.; Jiménez-Forteza, F.; Johnson, W. W.; Jones, D. I.; Jones, R.; Jonker, R. J. G.; Ju, L.; Junker, J.; Kalaghatgi, C. V.; Kalogera, V.; Kamai, B.; Kandhasamy, S.; Kang, G.; Kanner, J. B.; Kapadia, S. J.; Karki, S.; Karvinen, K. S.; Kasprzack, M.; Katolik, M.; Katsavounidis, E.; Katzman, W.; Kaufer, S.; Kawabe, K.; Kéfélian, F.; Keitel, D.; Kemball, A. J.; Kennedy, R.; Kent, C.; Key, J. S.; Khalili, F. Y.; Khan, I.; Khan, S.; Khan, Z.; Khazanov, E. A.; Kijbunchoo, N.; Kim, Chunglee; Kim, J. C.; Kim, K.; Kim, W.; Kim, W. S.; Kim, Y.-M.; Kimbrell, S. J.; King, E. J.; King, P. J.; Kinley-Hanlon, M.; Kirchhoff, R.; Kissel, J. S.; Kleybolte, L.; Klimenko, S.; Knowles, T. D.; Koch, P.; Koehlenbeck, S. M.; Koley, S.; Kondrashov, V.; Kontos, A.; Korobko, M.; Korth, W. Z.; Kowalska, I.; Kozak, D. B.; Krämer, C.; Kringel, V.; Krishnan, B.; Królak, A.; Kuehn, G.; Kumar, P.; Kumar, R.; Kumar, S.; Kuo, L.; Kutynia, A.; Kwang, S.; Lackey, B. D.; Lai, K. H.; Landry, M.; Lang, R. N.; Lange, J.; Lantz, B.; Lanza, R. K.; Lartaux-Vollard, A.; Lasky, P. D.; Laxen, M.; Lazzarini, A.; Lazzaro, C.; Leaci, P.; Leavey, S.; Lee, C. H.; Lee, H. K.; Lee, H. M.; Lee, H. W.; Lee, K.; Lehmann, J.; Lenon, A.; Leonardi, M.; Leroy, N.; Letendre, N.; Levin, Y.; Li, T. G. F.; Linker, S. D.; Littenberg, T. B.; Liu, J.; Lo, R. K. L.; Lockerbie, N. A.; London, L. T.; Lord, J. E.; Lorenzini, M.; Loriette, V.; Lormand, M.; Losurdo, G.; Lough, J. D.; Lovelace, G.; Lück, H.; Lumaca, D.; Lundgren, A. P.; Lynch, R.; Ma, Y.; Macas, R.; Macfoy, S.; Machenschalk, B.; MacInnis, M.; Macleod, D. M.; Magaña Hernandez, I.; Magaña-Sandoval, F.; Magaña Zertuche, L.; Magee, R. M.; Majorana, E.; Maksimovic, I.; Man, N.; Mandic, V.; Mangano, V.; Mansell, G. L.; Manske, M.; Mantovani, M.; Marchesoni, F.; Marion, F.; Márka, S.; Márka, Z.; Markakis, C.; Markosyan, A. S.; Markowitz, A.; Maros, E.; Marquina, A.; Martelli, F.; Martellini, L.; Martin, I. W.; Martin, R. M.; Martynov, D. V.; Mason, K.; Massera, E.; Masserot, A.; Massinger, T. J.; Masso-Reid, M.; Mastrogiovanni, S.; Matas, A.; Matichard, F.; Matone, L.; Mavalvala, N.; Mazumder, N.; McCarthy, R.; McClelland, D. E.; McCormick, S.; McCuller, L.; McGuire, S. C.; McIntyre, G.; McIver, J.; McManus, D. J.; McNeill, L.; McRae, T.; McWilliams, S. T.; Meacher, D.; Meadors, G. D.; Mehmet, M.; Meidam, J.; Mejuto-Villa, E.; Melatos, A.; Mendell, G.; Mercer, R. A.; Merilh, E. L.; Merzougui, M.; Meshkov, S.; Messenger, C.; Messick, C.; Metzdorff, R.; Meyers, P. M.; Miao, H.; Michel, C.; Middleton, H.; Mikhailov, E. E.; Milano, L.; Miller, A. L.; Miller, B. B.; Miller, J.; Millhouse, M.; Milovich-Goff, M. C.; Minazzoli, O.; Minenkov, Y.; Ming, J.; Mishra, C.; Mitra, S.; Mitrofanov, V. P.; Mitselmakher, G.; Mittleman, R.; Moffa, D.; Moggi, A.; Mogushi, K.; Mohan, M.; Mohapatra, S. R. P.; Montani, M.; Moore, C. J.; Moraru, D.; Moreno, G.; Morriss, S. R.; Mours, B.; Mow-Lowry, C. M.; Mueller, G.; Muir, A. W.; Mukherjee, Arunava; Mukherjee, D.; Mukherjee, S.; Mukund, N.; Mullavey, A.; Munch, J.; Muñiz, E. A.; Muratore, M.; Murray, P. G.; Napier, K.; Nardecchia, I.; Naticchioni, L.; Nayak, R. K.; Neilson, J.; Nelemans, G.; Nelson, T. J. N.; Nery, M.; Neunzert, A.; Nevin, L.; Newport, J. M.; Newton, G.; Ng, K. Y.; Nguyen, T. T.; Nichols, D.; Nielsen, A. B.; Nissanke, S.; Nitz, A.; Noack, A.; Nocera, F.; Nolting, D.; North, C.; Nuttall, L. K.; Oberling, J.; O'Dea, G. D.; Ogin, G. H.; Oh, J. J.; Oh, S. H.; Ohme, F.; Okada, M. A.; Oliver, M.; Oppermann, P.; Oram, Richard J.; O'Reilly, B.; Ormiston, R.; Ortega, L. F.; O'Shaughnessy, R.; Ossokine, S.; Ottaway, D. J.; Overmier, H.; Owen, B. J.; Pace, A. E.; Page, J.; Page, M. A.; Pai, A.; Pai, S. A.; Palamos, J. R.; Palashov, O.; Palomba, C.; Pal-Singh, A.; Pan, Howard; Pan, Huang-Wei; Pang, B.; Pang, P. T. H.; Pankow, C.; Pannarale, F.; Pant, B. C.; Paoletti, F.; Paoli, A.; Papa, M. A.; Parida, A.; Parker, W.; Pascucci, D.; Pasqualetti, A.; Passaquieti, R.; Passuello, D.; Patil, M.; Patricelli, B.; Pearlstone, B. L.; Pedraza, M.; Pedurand, R.; Pekowsky, L.; Pele, A.; Penn, S.; Perez, C. J.; Perreca, A.; Perri, L. M.; Pfeiffer, H. P.; Phelps, M.; Piccinni, O. J.; Pichot, M.; Piergiovanni, F.; Pierro, V.; Pillant, G.; Pinard, L.; Pinto, I. M.; Pirello, M.; Pisarski, A.; Pitkin, M.; Poe, M.; Poggiani, R.; Popolizio, P.; Porter, E. K.; Post, A.; Powell, J.; Prasad, J.; Pratt, J. W. W.; Pratten, G.; Predoi, V.; Prestegard, T.; Prijatelj, M.; Principe, M.; Privitera, S.; Prodi, G. A.; Prokhorov, L. G.; Puncken, O.; Punturo, M.; Puppo, P.; Pürrer, M.; Qi, H.; Quetschke, V.; Quintero, E. A.; Quitzow-James, R.; Raab, F. J.; Rabeling, D. S.; Radkins, H.; Raffai, P.; Raja, S.; Rajan, C.; Rajbhandari, B.; Rakhmanov, M.; Ramirez, K. E.; Ramos-Buades, A.; Rapagnani, P.; Raymond, V.; Razzano, M.; Read, J.; Regimbau, T.; Rei, L.; Reid, S.; Reitze, D. H.; Ren, W.; Reyes, S. D.; Ricci, F.; Ricker, P. M.; Rieger, S.; Riles, K.; Rizzo, M.; Robertson, N. A.; Robie, R.; Robinet, F.; Rocchi, A.; Rolland, L.; Rollins, J. G.; Roma, V. J.; Romano, R.; Romel, C. L.; Romie, J. H.; Rosińska, D.; Ross, M. P.; Rowan, S.; Rüdiger, A.; Ruggi, P.; Rutins, G.; Ryan, K.; Sachdev, S.; Sadecki, T.; Sadeghian, L.; Sakellariadou, M.; Salconi, L.; Saleem, M.; Salemi, F.; Samajdar, A.; Sammut, L.; Sampson, L. M.; Sanchez, E. J.; Sanchez, L. E.; Sanchis-Gual, N.; Sandberg, V.; Sanders, J. R.; Sassolas, B.; Saulson, P. R.; Sauter, O.; Savage, R. L.; Sawadsky, A.; Schale, P.; Scheel, M.; Scheuer, J.; Schmidt, J.; Schmidt, P.; Schnabel, R.; Schofield, R. M. S.; Schönbeck, A.; Schreiber, E.; Schuette, D.; Schulte, B. W.; Schutz, B. F.; Schwalbe, S. G.; Scott, J.; Scott, S. M.; Seidel, E.; Sellers, D.; Sengupta, A. S.; Sentenac, D.; Sequino, V.; Sergeev, A.; Shaddock, D. A.; Shaffer, T. J.; Shah, A. A.; Shahriar, M. S.; Shaner, M. B.; Shao, L.; Shapiro, B.; Shawhan, P.; Sheperd, A.; Shoemaker, D. H.; Shoemaker, D. M.; Siellez, K.; Siemens, X.; Sieniawska, M.; Sigg, D.; Silva, A. D.; Singer, L. P.; Singh, A.; Singhal, A.; Sintes, A. M.; Slagmolen, B. J. J.; Smith, B.; Smith, J. R.; Smith, R. J. E.; Somala, S.; Son, E. J.; Sonnenberg, J. A.; Sorazu, B.; Sorrentino, F.; Souradeep, T.; Spencer, A. P.; Srivastava, A. K.; Staats, K.; Staley, A.; Steinke, M.; Steinlechner, J.; Steinlechner, S.; Steinmeyer, D.; Stevenson, S. P.; Stone, R.; Stops, D. J.; Strain, K. A.; Stratta, G.; Strigin, S. E.; Strunk, A.; Sturani, R.; Stuver, A. L.; Summerscales, T. Z.; Sun, L.; Sunil, S.; Suresh, J.; Sutton, P. J.; Swinkels, B. L.; Szczepańczyk, M. J.; Tacca, M.; Tait, S. C.; Talbot, C.; Talukder, D.; Tanner, D. B.; Tao, D.; Tápai, M.; Taracchini, A.; Tasson, J. D.; Taylor, J. A.; Taylor, R.; Tewari, S. V.; Theeg, T.; Thies, F.; Thomas, E. G.; Thomas, M.; Thomas, P.; Thorne, K. A.; Thrane, E.; Tiwari, S.; Tiwari, V.; Tokmakov, K. V.; Toland, K.; Tonelli, M.; Tornasi, Z.; Torres-Forné, A.; Torrie, C. I.; Töyrä, D.; Travasso, F.; Traylor, G.; Trinastic, J.; Tringali, M. C.; Trozzo, L.; Tsang, K. W.; Tse, M.; Tso, R.; Tsukada, L.; Tsuna, D.; Tuyenbayev, D.; Ueno, K.; Ugolini, D.; Unnikrishnan, C. S.; Urban, A. L.; Usman, S. A.; Vahlbruch, H.; Vajente, G.; Valdes, G.; van Bakel, N.; van Beuzekom, M.; van den Brand, J. F. J.; Van Den Broeck, C.; Vander-Hyde, D. C.; van der Schaaf, L.; van Heijningen, J. V.; van Veggel, A. A.; Vardaro, M.; Varma, V.; Vass, S.; Vasúth, M.; Vecchio, A.; Vedovato, G.; Veitch, J.; Veitch, P. J.; Venkateswara, K.; Venugopalan, G.; Verkindt, D.; Vetrano, F.; Viceré, A.; Viets, A. D.; Vinciguerra, S.; Vine, D. J.; Vinet, J.-Y.; Vitale, S.; Vo, T.; Vocca, H.; Vorvick, C.; Vyatchanin, S. P.; Wade, A. R.; Wade, L. E.; Wade, M.; Walet, R.; Walker, M.; Wallace, L.; Walsh, S.; Wang, G.; Wang, H.; Wang, J. Z.; Wang, W. H.; Wang, Y. F.; Ward, R. L.; Warner, J.; Was, M.; Watchi, J.; Weaver, B.; Wei, L.-W.; Weinert, M.; Weinstein, A. J.; Weiss, R.; Wen, L.; Wessel, E. K.; Weßels, P.; Westerweck, J.; Westphal, T.; Wette, K.; Whelan, J. T.; Whiting, B. F.; Whittle, C.; Wilken, D.; Williams, D.; Williams, R. D.; Williamson, A. R.; Willis, J. L.; Willke, B.; Wimmer, M. H.; Winkler, W.; Wipf, C. C.; Wittel, H.; Woan, G.; Woehler, J.; Wofford, J.; Wong, W. K.; Worden, J.; Wright, J. L.; Wu, D. S.; Wysocki, D. M.; Xiao, S.; Yamamoto, H.; Yancey, C. C.; Yang, L.; Yap, M. J.; Yazback, M.; Yu, Hang; Yu, Haocun; Yvert, M.; Zadroźny, A.; Zanolin, M.; Zelenova, T.; Zendri, J.-P.; Zevin, M.; Zhang, L.; Zhang, M.; Zhang, T.; Zhang, Y.-H.; Zhao, C.; Zhou, M.; Zhou, Z.; Zhu, S. J.; Zhu, X. J.; Zucker, M. E.; Zweizig, J.; LIGO Scientific Collaboration; Virgo Collaboration

2018-05-01

We report on a new all-sky search for periodic gravitational waves in the frequency band 475-2000 Hz and with a frequency time derivative in the range of [-1.0 ,+0.1 ] ×1 0-8 Hz /s . Potential signals could be produced by a nearby spinning and slightly nonaxisymmetric isolated neutron star in our Galaxy. This search uses the data from Advanced LIGO's first observational run O1. No gravitational-wave signals were observed, and upper limits were placed on their strengths. For completeness, results from the separately published low-frequency search 20-475 Hz are included as well. Our lowest upper limit on worst-case (linearly polarized) strain amplitude h0 is ˜4 ×1 0-25 near 170 Hz, while at the high end of our frequency range, we achieve a worst-case upper limit of 1.3 ×1 0-24. For a circularly polarized source (most favorable orientation), the smallest upper limit obtained is ˜1.5 ×1 0-25.

Mutation frequencies of the cytochrome CYP2D6 gene in Parkinson disease patients and in families

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lucotte, G.; Turpin, J.C.; Gerard, N.

1996-07-26

The frequencies of five mutations of the debrisoquine 4-hydroxylase (CYP2D6) gene (mutations D6-A, B, C, D, and T), corresponding to poor metabolizer (PM) phenotypes, were determined by restriction fragment length polymorphism (RFLP) and polymerase chain reaction (PCR) in 47 patients with Parkinson disease, and compared with the findings in 47 healthy controls. These mutant alleles were about twice as frequent among patients as in controls, with an approximate relative risk ratio of 2.12 (95% confidence interval, 1.41-2.62). There seem to be no significant differences in frequencies of mutant genotypes in patients among gender and modalities of response with levodopa therapy;more » but frequency of the mutations was slightly enhanced after age-at-onset of 60 years. Mutations D6-B, D, and T were detected in 7 patients belonging to 10 Parkinson pedigrees. 25 refs., 1 fig., 2 tabs.« less

Low Density ITB Studies Using the Upgraded C-Mod Reflectometry System

NASA Astrophysics Data System (ADS)

Dominguez, A.; Edlund, E.; Fiore, C. L.; Lin, L.; Marmar, E. S.; Snipes, J. A.; Porkolab, M.; Kramer, G. J.; Rowan, W. L.

2007-11-01

The Alcator C-Mod reflectometry system was recently upgraded in two ways: The low frequency channels were changed from amplitude modulation - in which two microwave signals, slightly separated in frequency, are injected into the plasma - to baseband, where a single frequency is used, in order to improve density fluctuation measurements. The second change, a variable frequency channel operating over the range from 122GHz to 140GHz (with corresponding density cutoffs of 1.84-2.43x10^20m-3) has been installed in collaboration with PPPL. Initial results from the upgraded system are presented, including the study of low density Internal Transport Barriers. Using O-mode waves, the reflectometry system is able to radially localize density fluctuations on the low field side along the tokamak midplane. It can, therefore, be used to probe the foot of low density ITBs. The corresponding reflectometry data will be compared to those of other fluctuation diagnostics, including Phase Contrast Imaging and magnetic pick-up coils.

The effect of stress on ultrasonic pulses in fiber reinforced composites

NASA Technical Reports Server (NTRS)

Hemann, J. H.; Baaklini, G. Y.

1983-01-01

An acoustical-ultrasonic technique was used to demonstrate relationships existing between changes in attenuation of stress waves and tensile stress for an eight ply 0 degree graphite-epoxy fiber reinforced composite. All tests were conducted in the linear range of the material for which no mechanical or macroscopic damage was evident. Changes in attenuation were measured as a function of tensile stress in the frequency domain and in the time domain. Stress wave propagation in these specimens was dispersive, i.e., the wave speed depends on frequency. Wave speeds varied from 267 400 cm/sec to 680 000 cm/sec as the frequency of the signal was varied from 150 kHz to 1.9 MHz which strongly suggests that flexural/lamb wave modes of propagation exist. The magnitude of the attenuation changes depended strongly on tensile stress. It was further observed that the wave speeds increased slightly for all tested frequencies as the stress was increased.

Development of miniature, high frequency pulse tube cryocoolers

NASA Astrophysics Data System (ADS)

Radebaugh, Ray; Garaway, Isaac; Veprik, Alexander M.

2010-04-01

Because acoustic power density is proportional to frequency, the size of pulse tube cryocoolers for a given refrigeration power can be reduced by operating them at higher frequencies. A frequency of about 60 Hz had been considered the maximum frequency that could be used while maintaining high efficiency. Recently, we have shown through modeling that by decreasing the volume and hydraulic diameter of the regenerator and increasing the average pressure, it is possible to maintain high efficiency even for frequencies of several hundred hertz. Subsequent experimental results have demonstrated high efficiencies for frequencies of 100 to 140 Hz. The very high power density achieved at higher pressures and higher frequencies leads to very short cooldown times and very compact devices. The use of even higher frequencies requires the development of special compressors designed for such conditions and the development of regenerator matrices with hydraulic diameters less than about 30 Μm. To demonstrate the advantages of higher frequency operation, we discuss here the development of a miniature pulse tube cryocooler designed to operate at 80 K with a frequency of 150 Hz and an average pressure of 5.0 MPa. The regenerator diameter and length are 4.4 mm and 27 mm, respectively. The lowest temperature achieved to date has been 97 K, but a net refrigeration power of 530 mW was achieved at 120 K. Acoustic mismatches with existing compressors significantly limit the efficiency, but necessary modifications to improve the acoustic impedance match between the compressor and the cold head are discussed briefly.

Intakes of culinary herbs and spices from a food frequency questionnaire evaluated against 28-days estimated records

PubMed Central

2011-01-01

Background Worldwide, herbs and spices are much used food flavourings. However, little data exist regarding actual dietary intake of culinary herbs and spices. We developed a food frequency questionnaire (FFQ) for the assessment of habitual diet the preceding year, with focus on phytochemical rich food, including herbs and spices. The aim of the present study was to evaluate the intakes of herbs and spices from the FFQ with estimates of intake from another dietary assessment method. Thus we compared the intake estimates from the FFQ with 28 days of estimated records of herb and spice consumption as a reference method. Methods The evaluation study was conducted among 146 free living adults, who filled in the FFQ and 2-4 weeks later carried out 28 days recording of herb and spice consumption. The FFQ included a section with questions about 27 individual culinary herbs and spices, while the records were open ended records for recording of herbs and spice consumption exclusively. Results Our study showed that the FFQ obtained slightly higher estimates of total intake of herbs and spices than the total intake assessed by the Herbs and Spice Records (HSR). The correlation between the two assessment methods with regard to total intake was good (r = 0.5), and the cross-classification suggests that the FFQ may be used to classify subjects according to total herb and spice intake. For the 8 most frequently consumed individual herbs and spices, the FFQ obtained good estimates of median frequency of intake for 2 herbs/spices, while good estimates of portion sizes were obtained for 4 out of 8 herbs/spices. Conclusions Our results suggested that the FFQ was able to give good estimates of frequency of intake and portion sizes on group level for several of the most frequently used herbs and spices. The FFQ was only able to fairly rank subjects according to frequency of intake of the 8 most frequently consumed herbs and spices. Other studies are warranted to further explore the intakes of culinary spices and herbs. PMID:21575177

Intakes of culinary herbs and spices from a food frequency questionnaire evaluated against 28-days estimated records.

PubMed

Carlsen, Monica H; Blomhoff, Rune; Andersen, Lene F

2011-05-16

Worldwide, herbs and spices are much used food flavourings. However, little data exist regarding actual dietary intake of culinary herbs and spices. We developed a food frequency questionnaire (FFQ) for the assessment of habitual diet the preceding year, with focus on phytochemical rich food, including herbs and spices. The aim of the present study was to evaluate the intakes of herbs and spices from the FFQ with estimates of intake from another dietary assessment method. Thus we compared the intake estimates from the FFQ with 28 days of estimated records of herb and spice consumption as a reference method. The evaluation study was conducted among 146 free living adults, who filled in the FFQ and 2-4 weeks later carried out 28 days recording of herb and spice consumption. The FFQ included a section with questions about 27 individual culinary herbs and spices, while the records were open ended records for recording of herbs and spice consumption exclusively. Our study showed that the FFQ obtained slightly higher estimates of total intake of herbs and spices than the total intake assessed by the Herbs and Spice Records (HSR). The correlation between the two assessment methods with regard to total intake was good (r = 0.5), and the cross-classification suggests that the FFQ may be used to classify subjects according to total herb and spice intake. For the 8 most frequently consumed individual herbs and spices, the FFQ obtained good estimates of median frequency of intake for 2 herbs/spices, while good estimates of portion sizes were obtained for 4 out of 8 herbs/spices. Our results suggested that the FFQ was able to give good estimates of frequency of intake and portion sizes on group level for several of the most frequently used herbs and spices. The FFQ was only able to fairly rank subjects according to frequency of intake of the 8 most frequently consumed herbs and spices. Other studies are warranted to further explore the intakes of culinary spices and herbs.

Effect of port-care frequency on venous port catheter-related complications in cancer patients.

PubMed

Odabas, Hatice; Ozdemir, Nuriye Yıldırım; Ziraman, Ipek; Aksoy, Sercan; Abali, Huseyin; Oksuzoglu, Berna; Isik, Metin; Civelek, Burak; Dede, Dogan; Zengin, Nurullah

2014-08-01

Subcutaneous central venous port catheters (SCVPC) are of great importance in the treatment of patients with malignancies since they provide secure vascular access. Our aim was to assess the impact of long-term catheter care frequency on the frequency of port-related complications. Two hundred and seven patients who had not been on active chemotherapy through their SCVPC for at least 3 months were enrolled into the study. Those who received catheter care every 3 months or more frequently were assigned to the frequent care group, and the others to the infrequent care group. The patients were examined for port-related complications and thrombosis including port occlusion. Routinely in our clinic, catheter care was done by using 300 IU of heparin. According to the frequency of SCVPC care, 49 (23.7 %) patients were in the frequent care group and 158 (76.3 %) were in the infrequent care group. Median follow-up of all patients was 671 days (range 133-1712). Median frequency of port care in the frequent care group was 90 days (range 30-90), but 441.5 days in the infrequent care group (range 91-1630). None of the patients experienced port-related severe complications during the follow-up time. None of them presented with port occlusion. When the groups were analysed for thrombus (symptomatic and asymptomatic), there was no statistically significant difference (6.4 vs 13.8 %, p = 0.17). Those patients who had received more than first-line chemotherapy were found to have more thrombi than the patients who were treated with only one type of chemotherapy protocol (28.6 vs 10.2 %, p = 0.01), and the patients who had metastatic disease at the last control were found out to have thrombi more frequently than the non-metastatic patients (24.3 vs 9.3 %) (p = 0.01). In the present study, there was no difference in port-related severe complications between frequent and infrequent care groups during follow-up. However, the rate of thrombosis was slightly higher in the infrequent port care group.

Frequency characteristics of vibration generated by dual acoustic radiation force for estimating viscoelastic properties of biological tissues

NASA Astrophysics Data System (ADS)

Watanabe, Ryoichi; Arakawa, Mototaka; Kanai, Hiroshi

2018-07-01

We proposed a new method for estimating the viscoelastic property of the local region of a sample. The viscoelastic parameters of the phantoms simulating the biological tissues were quantitatively estimated by analyzing the frequency characteristics of displacement generated by acoustic excitation. The samples were locally strained by irradiating them with the ultrasound simultaneously generated from two point-focusing transducers by applying the sum of two signals with slightly different frequencies of approximately 1 MHz. The surface of a phantom was excited in the frequency range of 20–2,000 Hz, and its displacement was measured. The frequency dependence of the acceleration provided by the acoustic radiation force was also measured. From these results, we determined the frequency characteristics of the transfer function from the stress to the strain and estimated the ratio of the elastic modulus to the viscosity modulus (K/η) by fitting the data to the Maxwell model. Moreover, the elastic modulus K was separately estimated from the measured sound velocity and density of the phantom, and the viscosity modulus η was evaluated by substituting the estimated elastic modulus into the obtained K/η ratio.

Measurement of a free spectral range of a Fabry-Perot cavity using frequency modulation and null method under off-resonance conditions

NASA Astrophysics Data System (ADS)

Aketagawa, Masato; Kimura, Shohei; Yashiki, Takuya; Iwata, Hiroshi; Banh, Tuan Quoc; Hirata, Kenji

2011-02-01

In this paper, we discuss a method to measure the free spectral range (FSR) of a Fabry-Perot cavity (FP-cavity) using frequency modulation with one electric optical modulator (EOM) and the null method. A laser beam modulated by the EOM, to which a sine wave signal is supplied from a radio frequency (RF) oscillator, is incident on the FP-cavity. The transmitted or reflected light from the FP-cavity is observed and converted to an RF signal by a high-speed photodetector, and the RF signal is synchronously demodulated with a lock-in amplifier by referring to a cosine wave signal from the oscillator. We theoretically and experimentally demonstrate that the lock-in amplifier signal for the transmitted or reflected light becomes null with a steep slope when the modulation frequency is equal to the FSR under the condition that the carrier frequency of the laser is slightly detuned from the resonance of the FP-cavity. To reduce the measurement uncertainty for the FSR, we also discuss a selection method for laser power, a modulation index and the detuning shift of the carrier frequency, respectively.

Integrated optoelectronic oscillator.

PubMed

Tang, Jian; Hao, Tengfei; Li, Wei; Domenech, David; Baños, Rocio; Muñoz, Pascual; Zhu, Ninghua; Capmany, José; Li, Ming

2018-04-30

With the rapid development of the modern communication systems, radar and wireless services, microwave signal with high-frequency, high-spectral-purity and frequency tunability as well as microwave generator with light weight, compact size, power-efficient and low cost are increasingly demanded. Integrated microwave photonics (IMWP) is regarded as a prospective way to meet these demands by hybridizing the microwave circuits and the photonics circuits on chip. In this article, we propose and experimentally demonstrate an integrated optoelectronic oscillator (IOEO). All of the devices needed in the optoelectronic oscillation loop circuit are monolithically integrated on chip within size of 5×6cm 2 . By tuning the injection current to 44 mA, the output frequency of the proposed IOEO is located at 7.30 GHz with phase noise value of -91 dBc/Hz@1MHz. When the injection current is increased to 65 mA, the output frequency can be changed to 8.87 GHz with phase noise value of -92 dBc/Hz@1MHz. Both of the oscillation frequency can be slightly tuned within 20 MHz around the center oscillation frequency by tuning the injection current. The method about improving the performance of IOEO is carefully discussed at the end of in this article.

Multifaceted roles for low-frequency oscillations in bottom-up and top-down processing during navigation and memory.

PubMed

Ekstrom, Arne D; Watrous, Andrew J

2014-01-15

A prominent and replicated finding is the correlation between running speed and increases in low-frequency oscillatory activity in the hippocampal local field potential. A more recent finding concerns low-frequency oscillations that increase in coherence between the hippocampus and neocortical brain areas such as prefrontal cortex during memory-related behaviors (i.e., remembering the correct location to visit). In this review, we tie together movement-related and memory-related low-frequency oscillations in the rodent with similar findings in humans. We argue that although movement-related low-frequency oscillations, in particular, may have slightly different characteristics in humans than rodents, placing important constraints on our thinking about this issue, both phenomena have similar functional foundations. We review four prominent theoretical models that provide partially conflicting accounts of movement-related low-frequency oscillations. We attempt to tie together these theoretical proposals, and existing data in rodents and humans, with memory-related low-frequency oscillations. We propose that movement-related low-frequency oscillations and memory-related low-frequency oscillatory activity, both of which show significant coherence with oscillations in other brain regions, represent different facets of "spectral fingerprints," or different resonant frequencies within the same brain networks underlying different cognitive processes. Together, movement-related and memory-related low-frequency oscillatory coupling may be linked by their distinct contributions to bottom-up, sensorimotor driven processing and top-down, controlled processing characterizing aspects of memory encoding and retrieval. Copyright © 2013. Published by Elsevier Inc.

Multifaceted roles for low-frequency oscillations in bottom-up and top-down processing during navigation and memory

PubMed Central

Ekstrom, Arne D.; Watrous, Andrew J.

2014-01-01

A prominent and replicated finding is the correlation between running speed and increases in low-frequency oscillatory activity in the hippocampal local field potential. A more recent finding concerns low-frequency oscillations that increase in coherence between the hippocampus and neocortical brain areas such as prefrontal cortex during memory-related behaviors (i.e., remembering the correct arm to explore). In this review, we tie together movement-related and memory-related low-frequency oscillations in the rodent with similar findings in humans. We argue that although movement-related low-frequency oscillations, in particular, may have slightly different characteristics in humans than rodents, placing important constraints on our thinking about this issue, both phenomena have similar functional foundations. We review four prominent theoretical models that provide partially conflicting accounts of movement-related low-frequency oscillations. We attempt to tie together these theoretical proposals, and existing data in rodents and humans, with memory-related low-frequency oscillations. We propose that movement-related low-frequency oscillations and memory-related low-frequency oscillatory activity, both of which show significant coherence with oscillations in other brain regions, represent different facets of “spectral fingerprints,” or different resonant frequencies within the same brain networks underlying different cognitive processes. Together, movement-related and memory-related low-frequency oscillatory coupling may be linked by their distinct contributions to bottom-up, sensorimotor driven processing and top-down, controlled processing characterizing aspects of memory encoding and retrieval. PMID:23792985

Pulsed laser illumination of photovoltaic cells

NASA Technical Reports Server (NTRS)

Yater, Jane A.; Lowe, Roland A.; Jenkins, Phillip P.; Landis, Geoffrey A.

1995-01-01

In future space missions, free electron lasers (FEL) may be used to illuminate photovoltaic receivers to provide remote power. Both the radio-frequency (RF) and induction FEL produce pulsed rather than continuous output. In this work we investigate cell response to pulsed laser light which simulates the RF FEL format. The results indicate that if the pulse repetition is high, cell efficiencies are only slightly reduced compared to constant illumination at the same wavelength. The frequency response of the cells is weak, with both voltage and current outputs essentially dc in nature. Comparison with previous experiments indicates that the RF FEL pulse format yields more efficient photovoltaic conversion than does an induction FEL format.

Pulsed laser illumination of photovoltaic cells

NASA Technical Reports Server (NTRS)

Yater, Jane A.; Lowe, Roland A.; Jenkins, Phillip P.; Landis, Geoffrey A.

1994-01-01

In future space missions, free electron lasers (FEL) may be used to illuminate photovoltaic array receivers to provide remote power. Both the radio-frequency (RF) and induction FEL provide FEL produce pulsed rather than continuous output. In this work we investigate cell response to pulsed laser light which simulates the RF FEL format. The results indicate that if the pulse repetition is high, cell efficiencies are only slightly reduced compared to constant illumination at the same wavelength. The frequency response of the cells is weak, with both voltage and current outputs essentially dc in nature. Comparison with previous experiments indicates that the RF FEL pulse format yields more efficient photovoltaic conversion than does an induction FEL pulse format.

Influence of nonlinear detuning at plasma wavebreaking threshold on backward Raman compression of non-relativistic laser pulses

NASA Astrophysics Data System (ADS)

Balakin, A. A.; Fraiman, G. M.; Jia, Q.; Fisch, N. J.

2018-06-01

Taking into account the nonlinear dispersion of the plasma wave, the fluid equations for the three-wave (Raman) interaction in plasmas are derived. It is found that, in some parameter regimes, the nonlinear detuning resulting from the plasma wave dispersion during Raman compression limits the plasma wave amplitude to noticeably below the generally recognized wavebreaking threshold. Particle-in-cell simulations confirm the theoretical estimates. For weakly nonlinear dispersion, the detuning effect can be counteracted by pump chirping or, equivalently, by upshifting slightly the pump frequency, so that the frequency-upshifted pump interacts with the seed at the point where the plasma wave enters the nonlinear stage.

A polyphonic acoustic vortex and its complementary chords

NASA Astrophysics Data System (ADS)

Wilson, C.; Padgett, M. J.

2010-02-01

Using an annular phased array of eight loudspeakers, we generate sound beams that simultaneously contain phase singularities at a number of different frequencies. These frequencies correspond to different musical notes and the singularities can be set to overlap along the beam axis, creating a polyphonic acoustic vortex. Perturbing the drive amplitudes of the speakers means that the singularities no longer overlap, each note being nulled at a slightly different lateral position, where the volume of the other notes is now nonzero. The remaining notes form a tri-note chord. We contrast this acoustic phenomenon to the optical case where the perturbation of a white light vortex leads to a spectral spatial distribution.

Hematological analyses of some fish species in the Gulf of Riga

NASA Astrophysics Data System (ADS)

Medne, R.; Balode, M.

2012-11-01

The objective of this work was to detect and compare blood parameters of European flounder ( Platichthys flesus), herring ( Clupea harertgus membras), eelpout ( Zoarces viviparous) and perch ( Perca fluviatilis) at the Eastern and Western coast of the Gulf of Riga. The number of erythrocytes in herring of the Gulf of Riga ranges from 1.45 to 2.57 × 1012/L. At the same time no statistically significant difference in red blood cells (RBC) count between herring of both coasts was detected. The most common white blood cells in GoR herring blood smear were lymphocytes ranging from 73 to 94%. The number of lymphoblasts was very small (0-4%), indicating that herring of the GoR is not exposed to chronic stress. The number of erythrocytes in flounder ranged from 0.8 to 2.65 × 1012/L, but hemoglobin—from 4.7 to 16.5 g/dL. RBC count and hemoglobin level in European flounder did not differ between coasts however hematocrit was significantly higher at the Eastern coast. White blood cell count in flounder near the Western and Eastern coast was almost equal. Blood indices in eelpouts were slightly higher at the Eastern cost. Slightly higher number of red blood cells and significantly higher hemoglobin level has been observed in perch feeding near the Eastern coast, indicating physiological disturbances of fish. Although hematological analysis pointed at slightly worse living conditions of fish at the Eastern coast, in general hematological picture did not give evidence of fish welfare decline in the Gulf of Riga.

The effect of epigallocatechin-3-gallate (EGCG) on human alveolar bone cells both in vitro and in vivo.

PubMed

Mah, Yon-Joo; Song, Je Seon; Kim, Seong-Oh; Lee, Jae-Ho; Jeon, Mijeong; Jung, Ui-Won; Moon, Seok Jun; Kim, Jeong-Hee; Choi, Hyung-Jun

2014-05-01

The effects of epigallocatechin-3-gallate (EGCG), a major catechin in green tea, on human and mouse osteoblasts remain controversial. This study investigated the direct effects of EGCG on human alveolar bone-derived cells (hABCs) both in vitro and in vivo. hABCs which were collected from eight children (aged 7-9 years, seven males and one female) were treated with EGCG at various concentrations (1, 5, 10, 25, and 50μM), and a proliferation assay, flow cytometric analysis for apoptosis evaluation, migration assay, and in vitro osteogenic differentiation were performed. hABCs that were pretreated with 10μM EGCG and mixed with calcium phosphate carrier combined with EGCG (0.1, 0.5, or 1.5mg) in vivo were transplanted into immunodeficient mouse. Histological staining, quantitative gene expressions, and alkaline phosphatase activity were evaluated in the retrieved transplants. The proliferation and migration were decreased when EGCG was present at over 25μM. The osteogenic differentiation increased slightly when EGCG was present at up to 10μM, and clearly decreased for higher concentrations of EGCG. In vivo, the potential for hard-tissue formation was slightly higher for the group with 0.1mg of EGCG than for the control group, and decreased sharply for higher concentrations of EGCG. The present observations suggest that EGCG at a low concentration can slightly enhance the osteogenic effect in vivo, whereas at a higher concentration it can prevent the osteogenic differentiation of hABCs both in vitro and in vivo. Copyright © 2014 Elsevier Ltd. All rights reserved.

Minnesota Higher Education Facilities Authority: 1999 Annual Report.

ERIC Educational Resources Information Center

Minnesota Higher Education Facilities Authority, Saint Paul.

This annual report reviews fiscal year 1999 for institutions serviced by the Minnesota Higher Education Facilities Authority. The report notes a slight decline in new financing activity, although the $87.7 million financed during the 1999 fiscal year was the second highest annual total for the Authority. Following some introductory material, the…

Comparative study of reproductive skew and pair-bond stability using genealogies from 80 small-scale human societies.

PubMed

Ellsworth, Ryan M; Shenk, Mary K; Bailey, Drew H; Walker, Robert S

2016-05-01

Genealogies contain information on the prevalence of different sibling types that result from past reproductive behavior. Full sibling sets stem from stable monogamy, paternal half siblings primarily indicate male reproductive skew, and maternal half siblings reflect unstable pair bonds. Full and half sibling types are calculated for a total of 61,181 siblings from published genealogies for 80 small-scale societies, including foragers, horticulturalists, agriculturalists, and pastoralists from around the world. Most siblings are full (61%) followed by paternal half siblings (27%) and maternal half siblings (13%). Paternal half siblings are positively correlated with more polygynous marriages, higher at low latitudes, and slightly higher in nonforagers, Maternal half sibling fractions are slightly higher at low latitudes but do not vary with subsistence. Partible paternity societies in Amazonia have more paternal half siblings indicating higher male reproductive skew. Sibling counts from genealogies provide a convenient method to simultaneously investigate the reproductive skew and pair-bond stability dimensions of human mating systems cross-culturally. Am. J. Hum. Biol. 28:335-342, 2016. © 2015 Wiley Periodicals, Inc. © 2015 Wiley Periodicals, Inc.

Resonant circuit which provides dual-frequency excitation for rapid cycling of an electromagnet

DOEpatents

Praeg, W.F.

1982-03-09

Disclosed is a novel ring-magnet control circuit that permits synchrotron repetition rates much higher than the frequency of the sinusoidal guide field of the ring magnet during particle acceleration. The control circuit generates sinusoidal excitation currents of different frequencies in the half waves. During radio-frequency acceleration of the synchrotron, the control circuit operates with a lower frequency sine wave and, thereafter, the electromagnets are reset with a higher-frequency half sine wave.

Evaluation of the incidence and risk factors associated with persistent frequency in interstitial cystitis/bladder pain syndrome and the efficacy of antimuscarinic treatment.

PubMed

Kim, Aram; Hoe, Kyeong-Ok; Shin, Jung Hyun; Choo, Myung-Soo

2017-09-01

To investigate the incidence and risk factors associated with persistent urinary frequency, and to evaluate the efficacy of antimuscarinic treatment. Interstitial cystitis/bladder pain syndrome (IC/BPS) patients complaining of persistent urinary frequency despite improved pain were evaluated. Before initial conventional treatment, each patient completed a voiding diary and symptom questionnaires. After conventional treatment, patients were divided according to the presence of pain and frequency. Improved pain was defined as lesser than 3 points in visual analogue scale, and persistent urinary frequency as >10 times/d. Risk factors for persistent frequency were identified through multivariate analysis. The efficacy of antimuscarinic treatment was assessed by the mean change of frequency. Of 171 IC/BPS patients treated with conventional therapy, 132 had improved pain after 3 months, but 72 had persistent frequency (72 of 132, 54.5%). Patients with persistent frequency had lower voided volume (p=0.008), lower maximal flow rate (p<0.001), lower maximal bladder capacity (p=0.003), and more frequent micturition (p<0.001) at baseline compared to those with improved frequency. Patients who took antimuscarinic agents showed slightly decreased urinary frequency, from 14.6 times/d to 13.5 times/d (p=0.438) after 3 months of medication. No patients showed more than a 20% decrease in frequency with antimuscarinics. About half of the patients with IC/BPS showed persistent frequency, with poor voiding function identified as a risk factor; antimuscarinic treatment was not effective in these patients.

Health literacy, source of information and impact on adherence to therapy in people living with HIV

PubMed Central

Ernst Dorner, Thomas; Schulte-Hermann, Kathrin; Zanini, Matteo; Leichsenring, Birgit; Stefanek, Wiltrut

2014-01-01

Introduction Adequate information and health literacy (HL) has a high impact on patients understanding on the causes and consequences of many chronic diseases, including HIV, and is a crucial prerequisite to ensure adherence to therapy regimens. Several Austrian patient organizations developed an online survey together with MSD (the so-called “PAB-test”) aimed to evaluate how people living with HIV perceive the level of care in Austria. Materials and Methods An online survey has been developed to assess HL in people living with HIV and to evaluate the impact of HL on therapy adherence. HL was assessed with seven items regarding the self-rated comprehension of HIV related information, which showed a high reliability (Cronbach's alpha=0.876). A low health literacy was defined by reaching a score below the median of 20 points in the related indicator. Results A total of 303 subjects completed the questionnaire. Women slightly had more often a low HL than men (57.1% vs 44.7%, p=0.335). Heterosexual subjects had more often a low HL compared to homosexual ones (58.3% vs 38.1%, p=0.007). Health literacy slightly increased with age (not significant). An increasing education level correlated with higher HL, (66.7%, 46.2%, and 38.9% of persons showed low HL with primary, secondary and tertiary education, respectively, p=0.037). The number of missed appointments with the HIV physician was significantly higher in the low HL population (30.0% vs 14.4%, p=0.002), which also showed to be more prone to interrupt the therapy without consulting a physician (22.4% vs 9.8%, p=0.006). The low HL population, however, did not report of having forgotten the medication intake more often than the one with high HL (33.1% vs 39.1%, p=0.305). The most important source of information is the treating physician, followed by NGOs/patient organizations and the internet (Figure 1). Conclusions There are significant differences in HL between different sub-groups in the HIV community. Low HL is significantly associated with a higher frequency of missed doctor appointments and interruptions of treatment, but does not impact adherence to therapy (self-reported). The identified information providers (medical doctors, NGOs/patient organizations) should be encouraged to contribute towards increased HL in HIV patients. PMID:25394103

Measurement of optical-beat frequency in a photoconductive terahertz-wave generator using microwave higher harmonics.

PubMed

Murasawa, Kengo; Sato, Koki; Hidaka, Takehiko

2011-05-01

A new method for measuring optical-beat frequencies in the terahertz (THz) region using microwave higher harmonics is presented. A microwave signal was applied to the antenna gap of a photoconductive (PC) device emitting a continuous electromagnetic wave at about 1 THz by the photomixing technique. The microwave higher harmonics with THz frequencies are generated in the PC device owing to the nonlinearity of the biased photoconductance, which is briefly described in this article. Thirteen nearly periodic peaks in the photocurrent were observed when the microwave was swept from 16 to 20 GHz at a power of -48 dBm. The nearly periodic peaks are generated by the homodyne detection of the optical beat with the microwave higher harmonics when the frequency of the harmonics coincides with the optical-beat frequency. Each peak frequency and its peak width were determined by fitting a Gaussian function, and the order of microwave harmonics was determined using a coarse (i.e., lower resolution) measurement of the optical-beat frequency. By applying the Kalman algorithm to the peak frequencies of the higher harmonics and their standard deviations, the optical-beat frequency near 1 THz was estimated to be 1029.81 GHz with the standard deviation of 0.82 GHz. The proposed method is applicable to a conventional THz-wave generator with a photomixer.

Blood Injury and Injection Phobia: The Neglected One

PubMed Central

2014-01-01

Blood injury and injection (BII) phobia is a unique phobia associated with a diphasic cardiovascular response. The aim of this survey was to report the prevalence of BII phobia, its heritability, and clinical characteristics among the males and females in the Indian subcontinent. An interview and a survey were conducted using a developed BII phobia 21-item questionnaire among 3261 participant males (n = 1648) and females (n = 1613). Cronbach' alpha (α) of 0.972 of internal consistency was reported. The prevalence of BII phobia and associated fainting in females was slightly more than double in the males with a significant gender related effect. Similar avoidance behaviours involving hospital visits were reported for both males and females. The relative frequency of BII phobia among first and third degree relatives was found to be higher than among second degree relatives. Depression was found highly comorbid with BII phobia while a low rate of obsessive compulsion disorder (OCD) and social anxiety disorder (SAD) was reported. Morbidity associated with BII phobia may increase dramatically when other medical problems coincide with it. PMID:25049451

Blood injury and injection phobia: the neglected one.

PubMed

Wani, Ab Latif; Ara, Anjum; Bhat, Sajad Ahmad

2014-01-01

Blood injury and injection (BII) phobia is a unique phobia associated with a diphasic cardiovascular response. The aim of this survey was to report the prevalence of BII phobia, its heritability, and clinical characteristics among the males and females in the Indian subcontinent. An interview and a survey were conducted using a developed BII phobia 21-item questionnaire among 3261 participant males (n = 1648) and females (n = 1613). Cronbach' alpha (α) of 0.972 of internal consistency was reported. The prevalence of BII phobia and associated fainting in females was slightly more than double in the males with a significant gender related effect. Similar avoidance behaviours involving hospital visits were reported for both males and females. The relative frequency of BII phobia among first and third degree relatives was found to be higher than among second degree relatives. Depression was found highly comorbid with BII phobia while a low rate of obsessive compulsion disorder (OCD) and social anxiety disorder (SAD) was reported. Morbidity associated with BII phobia may increase dramatically when other medical problems coincide with it.