Sample records for slightly higher values

  1. Changes in soil parameters under continuous plastic mulching in strawberry cultivation

    NASA Astrophysics Data System (ADS)

    Muñoz, Katherine; Diehl, Dörte; Scopchanova, Sirma; Schaumann, Gabriele E.

    2016-04-01

    Plastic mulching (PM) is a widely used practice in modern agriculture because they generate conditions for optimal yield rates and quality. However, information about long-term effects of PC on soil quality parameters is scarce. The aim of this study is to compare the effect of three different mulching managements on soil quality parameters. Sampling and methodology: Three different managements were studied: Organic mulching (OM), 2-years PM and 4-years PM. Soil samples were collected from irrigated fields in 0-5, 5-10 and 10-30 cm depths and analyzed for water content (WC), pH, dissolved organic carbon (DOC), total soil carbon (Ctot) and cation exchange capacity (CECeff). Results and discussion: Mulching management has an influence on soil parameters. The magnitude of the effects is influenced by the type (organic agriculture practice vs. plastic mulching practice) and duration of the mulching. PM modified the water distribution through the soil column. WC values at the root zone were in average 10% higher compared to those measured at the topsoil. Under OM, the WC was lower than under PM. The pH was mainly influenced by the duration of the managements with slightly higher values after 4 than after 2-years PM. Under PM, aqueous extracts of the topsoil (0-5 cm depth) contained in average with 8.5±1.8 mg/L higher DOC than in 10-30 cm depth with 5.6±0.5 mg/L, which may indicate a mobilization of organic components in the upper layers. After 4-years PM, Ctot values were slightly higher than after 2-years PM and after OM. Surprisingly, after 4-years PM, CECeff values were with 138 - 157 mmolc/kg almost 2-fold higher than after 2-years PM and OM which had with 74 - 102 mmolc/kg comparable CECeff values. Long-term PM resulted in changes of soil pH and slightly increased Ctot which probably enhanced the CECeff of the soil. However, further investigations of the effect of PM on stability of soil organic matter and microbial community structure are needed.

  2. State summaries: Utah

    USGS Publications Warehouse

    Bon, R.L.; Krahulec, K.A.

    2006-01-01

    The value of Utah's mineral production in 2005 was estimated to be a record $3.58 billion. This was $1.26 billion higher than the revised value of $2.32 billion for 2004. All major industry segments gained in value in 2005. In the value of nonfuel mineral production, Utah ranked fourth. The outlook for 2006 is cautiously optimistic. The value of mineral production is projected to increase slightly in 2006 due to increased production of most base and precious metals, coal and most major industrial minerals.

  3. Migration of grain boundaries and triple junctions in high-purity aluminum during annealing after slight cold rolling

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yin, Wenhong; School of Mechanical Engineering, Shandong University of Technology, Zibo 255049; Wang, Weiguo, E-mail: wang_weiguo@vip.163.com

    Grain orientations and grain boundary migrations near triple junctions in a high purity aluminum were analyzed by electron back scattered diffraction. The results indicate that there are good correlations between the Schmid factors or Taylor factors and the misorientation values of point to original point in grains near the triple junctions in a slightly deformed sample. Grains with higher Schmid factors or lower Taylor factors typically correspond to higher misorientation values near the triple junctions. In a subsequent annealing at 400 °C, both grain boundaries and triple junctions migrate, but the former leave ghost lines. During such migration, a grainmore » boundary grows from the grain with lower Schmid factor (higher Taylor factor) into the grain with higher Schmid factor (lower Taylor factor). Usually, the amount of migration of a grain boundary is considerably greater than that of a triple junction, and the grain boundary becomes more curved after migration. These observations indicate that the triple junctions have drag effects on grain boundary migration. - Highlights: • Polycrystalline aluminum with fine grains about 30 μm were used. • Off-line in situ EBSD was used to identify TJs before and after annealing. • Grains with higher SFs have higher misorientation values near TJs after deformation. • Grain boundaries grow from hard grains into soft grains during annealing. • Triple junctions have drag effects on grain boundaries migration.« less

  4. Reference Values for Weight, Height, Head Circumference, and Body Mass Index in Turkish Children.

    PubMed

    Neyzi, Olcay; Bundak, Rüveyde; Gökçay, Gülbin; Günöz, Hülya; Furman, Andrzej; Darendeliler, Feyza; Baş, Firdevs

    2015-12-01

    This study aimed to integrate the existing updated reference standards for the growth of Turkish infants and children and to compare these values with World Health Organization (WHO) reference data, data from some European countries, and also with previous local data. Weight, height, and head circumference measurements were obtained on 2,391 boys and 2,102 girls who were regular attenders of a well child clinic and on 1,100 boys and 1,020 girls attending schools in relatively well-off districts in İstanbul. Mean number of measurements per child was 8.2±3.6 in the age group 0-5 years and 5.5±3.3 in the age group 6-18 years. All children were from well-to-do families and all were healthy. All measurements with the exception of measurements at birth, which were based on reported values, were done by trained personnel. The LMS method was used in the analyses and in the construction of the percentile charts. There is an increase in weight for age and body mass index values for age starting in prepubertal ages, indicating an increasing trend for obesity. Compared to WHO reference data, weight and height values in Turkish children were slightly higher in infants and in children younger than 5 years, while they showed similarity to those reported for children from Norway and Belgium. Head circumference values, which were slightly higher than the WHO references in the first 5 years, were comparable to the data on Belgian and Norwegian children in the first 9 years of life. At older ages, Turkish children showed higher values for head circumference. The relatively larger head circumference values were interpreted to reflect a genetic characteristic.

  5. Effect of synthesis methods on the Ca{sub 3}Co{sub 4}O{sub 9} thermoelectric ceramic performances

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sotelo, A.; Rasekh, Sh.; Torres, M.A.

    2015-01-15

    Three different synthesis methods producing nanometric grain sizes, coprecipitation with ammonium carbonate, oxalic acid, and by attrition milling have been studied to produce Ca{sub 3}Co{sub 4}O{sub 9} ceramics and compared with the classical solid state route. These three processes have produced high reactive precursors and all the organic material and CaCO{sub 3}·have been decomposed in a single thermal treatment. Coprecipitation leads to pure Ca{sub 3}Co{sub 4}O{sub 9} phase, while attrition milling and classical solid state produce small amounts of Ca{sub 3}Co{sub 2}O{sub 6} secondary phase. Power factor values are similar for all three samples, being slightly lower for the onesmore » produced by attrition milling. These values are much higher than the obtained in samples prepared by the classical solid state method, used as reference. The maximum power factor values determined at 800 °C (∼0.43 mW/K{sup 2} m) are slightly higher than the best reported values obtained in textured ones which also show much higher density values. - Graphical abstract: Impressive raise of PF in Ca{sub 3}Co{sub 4}O{sub 9} thermoelectric materials obtained from nanometric grains. - Highlights: • Ca{sub 3}Co{sub 4}O{sub 9} has been produced by four different methods. • Precursors particle sizes influences on the final performances. • Coprecipitation methods produce single Ca{sub 3}Co{sub 4}O{sub 9} phase. • Power factor reaches values comparable to high density textured materials.« less

  6. Modeling and Performance Estimation for Airborne Minefield Detection System

    DTIC Science & Technology

    2008-05-01

    Difference Vegetation Index ( NDVI ) NDVI is defined as: NDVI = (NIR – RED)/ (NIR + RED...to minimize the effect of variable irradiance levels. NDVI is always bounded between -1 and 1. A higher positive value of NDVI indicates the...lakes, and rivers) which has low reflectance in both NIR as well as visible bands, results in very low positive or slightly negative NDVI values

  7. Critical Elements in Fly Ash from the Combustion of Bituminous Coal in Major Polish Power Plants

    NASA Astrophysics Data System (ADS)

    Bielowicz, Barbara; Botor, Dariusz; Misiak, Jacek; Wagner, Marian

    2018-03-01

    The concentration of critical elements, including such REE as Fe, Co, W, Zn, Cr, Ni, V, Mn, Ti, Ag, Ga, Ta, Sr, Li, and Cu, in the so-called fly ash obtained from the 9 Polish power plants and 1 thermal power station has been determined. The obtained values, compared with the global average concentration in bituminous coal ash and sedimentary rocks (Clarke values), have shown that the enrichment of fly ash in the specified elements takes place in only a few bituminous coal processing sites in Poland. The enrichment factor (EF) is only slightly higher (the same order of magnitude) than the Clarke values. The enrichment factor in relation to the Clarke value in the Earth's crust reached values above 10 in all of the examined ashes for the following elements: Cr, Ni, V, W, and, in some ash samples, also Cu and Zn. The obtained values are low, only slightly higher than the global average concentrations in sedimentary rocks and bituminous coal ashes. The ferromagnetic grains (microspheres) found in bituminous coal fly ashes seem to be the most economically prospective in recovery of selected critical elements. The microanalysis has shown that iron cenospheres and plerospheres in fly ash contain, in addition to enamel and iron oxides (magnetite and hematite), iron spinels enriched in Co, Cr, Cu, Mn, Ni, W, and Zn.

  8. Lung function parameters of healthy Sri Lankan Tamil young adults.

    PubMed

    Balasubramaniam, M; Sivapalan, K; Thuvarathipan, R

    2014-06-01

    To establish reference norms of lung function parameters for healthy Sri Lankan Tamil young adults. Cross sectional study of Tamil students at the Faculty of Medicine, Jaffna. Healthy non smoking students of Sri Lankan Tamil ethnic group were enrolled. Age, height, weight, BMI and spirometric measurements (Micro Quark) were recorded in 267 participants (137 females and 130 males). Height was significantly correlated with (p<0.05) all the lung function parameters except FEV1%, PEFR and MEF75 in males. Prediction equations were derived by regression analysis based on the height as an independent variable. Predicted lung function values for a particular age and height were lower than values predicted for Pakistanis, Kelatanese Malaysians and eastern Indians. The values were comparable to south Indians in Madras. Our FVC values of males and VC of females were closer to Sri Lankan Sinhalese. FEV1 and FEF25-75 in males were slightly higher and FVC, FEV1 and FEF25-75 in females were slightly lower in Tamils. When mean values were compared, these parameters were significantly higher in Tamil males (p<0.001) and significantly lower in Tamil females (p<0.001). These values will be useful in interpreting lung function parameters of the particular age group as there are no published norms for Sri Lankan Tamils. However, our study sample was confined to medical students of 20-28 years which may explain the differences with Sinhalese.

  9. Managing and Resourcing a Program of Social Integration Initiatives for International University Students: What Are the Benefits?

    ERIC Educational Resources Information Center

    Owens, Alison R.; Loomes, Susan L.

    2010-01-01

    There has been much concern in the higher education sector recently about the well-being and the safety of slightly more than 200,000 international students studying in higher education in Australia. In recognition of the economic and socio-cultural value of the international student cohort, as well as the significant challenge and risk of…

  10. Is waist circumference a better predictor of diabetes than body mass index or waist-to-height ratio in Iranian adults?

    PubMed

    Hajian-Tilaki, Karimollah; Heidari, Bezad

    2015-01-01

    Several measures of adiposity have been used for predicting diabetes. The results of studies regarding superiority of waist circumference (WC) to body mass index (BMI) are inconsistent. This study designed to compare the ability of different anthropometric measures in predicting diabetes and to determine their optimal cut-off values. A population-based cross-sectional study was conducted with 1,000 representative sample among adults aged 20-80 years in Babol, the Northern Iran. The demographic data were collected in a household survey, and the anthropometric measures of weight, height, waist, and hip circumference were measured with a standard method. Fasting blood sugar (FBS) ≥126 mg/dl was considered as diabetes. receiver operating characteristic analysis was used to estimate the predictive ability of different anthropometric indexes and their optimal cut-off values for high FBS. The overall prevalence rate of diabetes was 14.0% (14.4% in men vs. 13.5% in women, P = 0.65). The prevalence rate was significantly higher in older age (>60 years), low educated and obese (P = 0.001). The mean of BMI, WC, waist-to-hip ratio (WHR), and waist-to-height ratio (WHtR) were significantly higher among diabetic in both sexes (P = 0.001). Among men, WC (area under the ROC curve [AUC] =0.64) and WHtR (AUC = 0.63) have slightly higher accuracy index compared with BMI (AUC = 0.62) or WHR (AUC = 0.60). In contrast, among women, WHtR (AUC = 0.69) and WC (AUC = 0.68) yielded slightly better predictive than BMI (AUC = 0.67). The optimal cut-off values obtained for BMI and WHtR were similar between two sexes (BMI = 24.95 kg/m(2) for men and BMI = 25.2 kg/m(2) for women, WHtR = 0.51 for both sexes) whereas the optimal cut-off value for WC was higher in men than women (98.5 cm men vs. 89.5 cm women). Overall WC and WHtR exhibited a slightly better discriminate performance than BMI for diabetes in both sexes, particularly in women.

  11. [Health risk assessment of soil heavy metals in residential communities built on brownfields].

    PubMed

    Chen, Xing; Ma, Jian-Hua; Li, Xin-Ning; Liu, De-Xin; Li, Yi-Meng

    2014-03-01

    Nine residential communities which were built on different brownfields in a city of Henan Province were chosen to investigate the health risks of heavy metals (As, Hg, Cd, and Pb) in surface soils. Concentrations of soil heavy metals were measured according to the methods described in the national standard. Based on the health risk models recommended by the U. S. Environmental Protection Agency (US EPA), non-carcinogenic and carcinogenic health risks of soil heavy metals were assessed. The results showed that compared with the original brownfields, the heavy metal concentrations in soils and their health risks in residential communities built on brownfields were significantly improved, and the concentrations and health risks of soil heavy metals in these communities were all higher than those in non-brownfield residential communities. The HQ and HI values of soil heavy metals in all the residential communities were lower than 1, which indicated that there was no non-carcinogenic risk in these communities. Meanwhile, the values of CR and TCR were slightly higher than the standard suggested by the US EPA, indicating that slight carcinogenic risks in the communities, but these values were lower than the lenient standard proposed by some experts. The HI value of the four metals for children was exactly seven times higher than that for adults. The contribution rate of HQ(As) to HI was about 75%, CR(AS) to TCR was about 80%, and therefore arsenic was the crucial factor for carcinogenic and non-carcinogenic risk in the residential communities of the city.

  12. Identification of sources and behavior of agricultural contaminants in groundwater using nitorgen and sulfur isootope in Haean basin, Korea

    NASA Astrophysics Data System (ADS)

    Kaown, Dugin; Kim, Heejung; Mayer, Bernard; Hyun, Yunjung; Lee, Jin-Yong; Lee, Kang-Kun

    2013-04-01

    The Haean basin shows a bowl-shaped topographic feature and the drainage system shows a dendritic pattern. The study area is consisted of forests (58.0%), vegetable fields (27.6%), rice paddy fields (11.4%) and fruit fields (0.5%). Most of residents in the study area practice agriculture and paddy rice and vegetables (Chinese radish) are the typical crops grown. The concentration of nitrate in groundwater showed 0.8 ~ 67.3 mg/L in June, 2012 and 2.0 ~ 65.7 mg/L in September, 2012. Hydrogeochemical values and stable isotope ratios of dissolved nitrate and sulfate in groundwater were used to identify contamination sources and transformation processes in shallow groundwater. The δ15N-NO3- values in the study area ranged between +5.2 and +16.9‰ in June and between +4.4 and +13.0‰ in September. The sulfate concentration in groundwater samples obtained from the study area varied from 0.8 to 16.5 mg/L in June and 0 to 19.7 mg/L in September. δ34S-SO42- values ranged from +2.9 to +11.7‰ in June and +1.6 to +8.2‰ in September. The values of δ15N-NO3- and δ34S-SO42- in September were slightly decreased than those of values in June. The chemical composition of groundwater in vegetable and fruit fields showed slightly lower values of δ34S-SO42- and δ15N-NO3- indicated that a mixture of synthetic and organic fertilizers is responsible for groundwater contamination with agro-chemicals. Most groundwater from forests and paddy fields showed slightly higher values of δ15N-NO3- suggested that organic fertilizer is introduced into subsurface.

  13. Spheres settling in an Oldroyd-B fluid

    NASA Astrophysics Data System (ADS)

    Pan, Tsorng-Whay; Glowinski, Roland

    2017-11-01

    In this talk we present a numerical study of the dynamics of balls settling in a vertical channel with a square cross-section filled with an Oldroyd-B fluid. For the case of two balls, two typical kinds of particle dynamics are obtained: (i) periodic interaction between two balls and (ii) the formation of a vertical chain of two balls. For the periodic interaction of two balls occurred at lower values of the elasticity number, two balls draft, kiss and break away periodically and the chain is not formed due to not strong enough elastic force. For slightly higher values of the elasticity number, two balls draft, kiss and break away a couple times first and then form a chain. Such chain finally becomes a vertical one after the oscillation damps out. For higher values of the elasticity number, two balls draft, kiss and form a vertical chain right away. The formation of three ball chain can be obtained at higher values of the elasticity number. This work was supported by NSF (Grant DMS-1418308).

  14. Liver enzymes in patients with chronic kidney disease undergoing peritoneal dialysis and hemodialysis.

    PubMed

    Liberato, Isabella Ramos de Oliveira; Lopes, Edmundo Pessoa de Almeida; Cavalcante, Maria Alina Gomes de Mattos; Pinto, Tiago Costa; Moura, Izolda Fernades; Loureiro Júnior, Luiz

    2012-01-01

    The present study was designed to analyze the serum levels of aspartate and alanine aminotransferases, gamma-glutamyl transferase, and the hematocrit in patients with chronic kidney disease who were undergoing peritoneal dialysis or hemodialysis. Twenty patients on peritoneal dialysis and 40 on hemodialysis were assessed, and the patients were matched according to the length of time that they had been on dialysis. Blood samples were collected (both before and after the session for those on hemodialysis) to measure the enzymes and the hematocrit. In the samples from the patients who were undergoing peritoneal dialysis, the aspartate and alanine aminotransferase levels were slightly higher compared with the samples collected from the patients before the hemodialysis session and slightly lower compared with the samples collected after the hemodialysis session. The levels of gamma-glutamyl transferase in the hemodialysis patients were slightly higher than the levels in the patients who were undergoing peritoneal dialysis. In addition, the levels of aminotransferases and gamma-glutamyl transferase that were collected before the hemodialysis session were significantly lower than the values collected after the session. The hematocrit levels were significantly lower in the patients who were on peritoneal dialysis compared with the patients on hemodialysis (both before and after the hemodialysis session), and the levels were also significantly lower before hemodialysis compared with after hemodialysis. The aminotransferase levels in the patients who were undergoing peritoneal dialysis were slightly higher compared with the samples collected before the hemodialysis session, whereas the aminotransferase levels were slightly lower compared with the samples collected after the session. The hematocrits and the aminotransferase and gamma-glutamyl transferase levels of the samples collected after the hemodialysis session were significantly higher than the samples collected before the session. Taken together, the present data suggest that hemodilution could alter the serum levels of liver enzymes.

  15. C-reactive protein reference percentiles among pre-adolescent children in Europe based on the IDEFICS study population.

    PubMed

    Schlenz, H; Intemann, T; Wolters, M; González-Gil, E M; Nappo, A; Fraterman, A; Veidebaum, T; Molnar, D; Tornaritis, M; Sioen, I; Mårild, S; Iacoviello, L; Ahrens, W

    2014-09-01

    C-reactive protein (CRP) is involved in a wide range of diseases. It is a powerful marker for inflammatory processes used for diagnostic and monitoring purposes. We aimed to establish reference values as data on the distribution of serum CRP levels in young European children are scarce. Reference values of high-sensitivity CRP concentrations were calculated for 9855 children aged 2.0-10.9 years, stratified by age and sex. The children were recruited during the population-based European IDEFICS study (Identification and prevention of Dietary- and lifestyle-induced health Effects in Children and infantS) with 18 745 participants recruited from 2007 to 2010. In 44.1% of the children, CRP values were below or equal the detection limit of 0.2 mg/l. Median CRP concentrations showed a slight negative age trend in boys and girls, whereas serum CRP values were slightly higher in girls than in boys across all age groups. Our population-based reference values of CRP may guide paediatric practice as elevated values may require further investigation or treatment. Therefore, the presented reference values represent a basis for clinical evaluation and for future research on risk assessment of diseases associated with increased CRP levels among children.

  16. Temperature dependent lattice constant of InSb above room temperature

    NASA Astrophysics Data System (ADS)

    Breivik, Magnus; Nilsen, Tron Arne; Fimland, Bjørn-Ove

    2013-10-01

    Using temperature dependent X-ray diffraction on two InSb single crystalline substrates, the bulk lattice constant of InSb was determined between 32 and 325 °C. A polynomial function was fitted to the data: a(T)=6.4791+3.28×10-5×T+1.02×10-8×T2 Å (T in °C), which gives slightly higher values than previously published (which go up to 62 °C). From the fit, the thermal expansion of InSb was calculated to be α(T)=5.062×10-6+3.15×10-9×T K-1 (T in °C). We found that the thermal expansion coefficient is higher than previously published values above 100 °C (more than 10% higher at 325 °C).

  17. The clinical value of 201Tl per rectum scintigraphy in the work-up of patients with alcoholic liver disease.

    PubMed

    Urbain, D; Reding, P; Georges, B; Thys, O; Ham, H R

    1986-01-01

    The clinical value of thallium 201 per rectum scintigraphy in the work-up of patients with alcoholic liver disease was evaluated using data obtained in 104 patients. The 25th min ratio of heart to liver activities was used as an index of portal systemic shunting. This ratio was found to be normal in alcoholic patients with normal liver biopsy and also in those presenting only steatosis. It was slightly higher in patients with liver fibrosis and significantly higher values were observed in patients with liver cirrhosis. High values of the ratio were associated with a higher risk of portal systemic encephalopathy and/or gastrointestinal bleeding. The prognostic value of the test was supported by the fact that good correlations were observed between the ratio and widely accepted prognostic scores such as the Child score or the Orrego index. Moreover, high ratios were associated with an increased mortality risk at one year. We conclude that this simple test is interesting in the screening of cirrhotics at risk of encephalopathy, gastrointestinal hemorrhage, or early death.

  18. Health risk profile for terrestrial radionuclides in soil around artisanal gold mining area at Alsopag, Sudan

    NASA Astrophysics Data System (ADS)

    Idriss, Hajo; Salih, Isam; Alaamer, Abdulaziz S.; AL-Rajhi, M. A.; Osman, Alshfia; Adreani, Tahir Elamin; Abdelgalil, M. Y.; Ali, Nagi I.

    2018-06-01

    This study shows the assessment of radiation hazard parameters due to terrestrial radionuclides in the soil around artisanal gold mining for addressing the issue of natural radioactivity in mining areas. Hence, the levels 238U, 232Th, 40K and 226Ra in soil (using gamma spectrometry), 222Rn in soil and 222Rn in air were determined. Radiation hazard parameters were then computed. These include absorbed dose D, annual effective dose E, radium equivalent activity Raeq, external hazard H ex, annual gonadal dose equivalent hazard index AGDE and excess lifetime cancer risk ELCR due to the inhalation of radon (222Rn) and consumption of radium (226Ra) in vegetation. Uranium (238U), thorium (232Th) and potassium (40K) averages were, respectively, 26, 36 and 685 Becquerel per kilogram (Bq kg-1). Soil radon (4671 Bq m-3) and radon in air (14.77 Bq m-3) were found to be less than worldwide data. Nevertheless, the average 40K concentration was 685 Bq kg-1. This is slightly higher than the United Nations Scientific Committee on the Effects of Atomic Radiation average value of 412 Bq kg-1. The obtained result indicates that some of the radiation hazard parameters seem unsavory. The mean value of absorbed dose rate (62.49 nGy h-1) was slightly higher than average value of 57 nGy h-1 ( 45% from 40K), and that of AGDE (444 μSv year-1) was higher than worldwide average reported value (300 μSv year-1). This study highlights the necessity to launch extensive nationwide radiation protection program in the mining areas for regulatory control.

  19. Assessing archetypes of organizational culture based on the Competing Values Framework: the experimental use of the framework in Japanese neonatal intensive care units

    PubMed Central

    Sasaki, Hatoko; Yonemoto, Naohiro; Mori, Rintaro; Nishida, Toshihiko; Kusuda, Satoshi; Nakayama, Takeo

    2017-01-01

    Abstract Objective To assess organizational culture in neonatal intensive care units (NICUs) in Japan. Design Cross-sectional survey of organizational culture. Setting Forty NICUs across Japan. Participants Physicians and nurses who worked in NICUs (n = 2006). Main Outcome Measures The Competing Values Framework (CVF) was used to assess the organizational culture of the study population. The 20-item CVF was divided into four culture archetypes: Group, Developmental, Hierarchical and Rational. We calculated geometric means (gmean) and 95% bootstrap confidence intervals of the individual dimensions by unit and occupation. The median number of staff, beds, physicians’ work hours and work engagement were also calculated to examine the differences by culture archetypes. Results Group (gmean = 34.6) and Hierarchical (gmean = 31.7) culture archetypes were higher than Developmental (gmean = 16.3) and Rational (gmean = 17.4) among physicians as a whole. Hierarchical (gmean = 36.3) was the highest followed by Group (gmean = 25.8), Developmental (gmean = 16.3) and Rational (gmean = 21.7) among nurses as a whole. Units with dominant Hierarchical culture had a slightly higher number of physicians (median = 7) than dominant Group culture (median = 6). Units with dominant Group culture had a higher number of beds (median = 12) than dominant Hierarchical culture (median = 9) among physicians. Nurses from units with a dominant Group culture (median = 2.8) had slightly higher work engagement compared with those in units with a dominant Hierarchical culture (median = 2.6). Conclusions Our findings revealed that organizational culture in NICUs varies depending on occupation and group size. Group and Hierarchical cultures predominated in Japanese NICUs. Assessing organizational culture will provide insights into the perceptions of unit values to improve quality of care. PMID:28371865

  20. Assessing archetypes of organizational culture based on the Competing Values Framework: the experimental use of the framework in Japanese neonatal intensive care units.

    PubMed

    Sasaki, Hatoko; Yonemoto, Naohiro; Mori, Rintaro; Nishida, Toshihiko; Kusuda, Satoshi; Nakayama, Takeo

    2017-06-01

    To assess organizational culture in neonatal intensive care units (NICUs) in Japan. Cross-sectional survey of organizational culture. Forty NICUs across Japan. Physicians and nurses who worked in NICUs (n = 2006). The Competing Values Framework (CVF) was used to assess the organizational culture of the study population. The 20-item CVF was divided into four culture archetypes: Group, Developmental, Hierarchical and Rational. We calculated geometric means (gmean) and 95% bootstrap confidence intervals of the individual dimensions by unit and occupation. The median number of staff, beds, physicians' work hours and work engagement were also calculated to examine the differences by culture archetypes. Group (gmean = 34.6) and Hierarchical (gmean = 31.7) culture archetypes were higher than Developmental (gmean = 16.3) and Rational (gmean = 17.4) among physicians as a whole. Hierarchical (gmean = 36.3) was the highest followed by Group (gmean = 25.8), Developmental (gmean = 16.3) and Rational (gmean = 21.7) among nurses as a whole. Units with dominant Hierarchical culture had a slightly higher number of physicians (median = 7) than dominant Group culture (median = 6). Units with dominant Group culture had a higher number of beds (median = 12) than dominant Hierarchical culture (median = 9) among physicians. Nurses from units with a dominant Group culture (median = 2.8) had slightly higher work engagement compared with those in units with a dominant Hierarchical culture (median = 2.6). Our findings revealed that organizational culture in NICUs varies depending on occupation and group size. Group and Hierarchical cultures predominated in Japanese NICUs. Assessing organizational culture will provide insights into the perceptions of unit values to improve quality of care. © The Author 2017. Published by Oxford University Press in association with the International Society for Quality in Health Care

  1. Higher order statistics of planetary gravities and topographies

    NASA Technical Reports Server (NTRS)

    Kaula, William M.

    1993-01-01

    The statistical properties of Earth, Venus, Mars, Moon, and a 3-D mantle convection model are compared. The higher order properties are expressed by third and fourth moments: i.e., as mean products over equilateral triangles (defined as coskewance) and equilateral quadrangles (defined as coexance). For point values, all the fields of real planets have positive skewness, ranging from slightly above zero for Lunar gravity to 2.6 sigma(exp 3) for Martian gravity (sigma is rms magnitude). Six of the eight excesses are greater than Gaussian (3 sigma(exp 4)), ranging from 2.0 sigma(exp 4) for Earth topography to 18.6 sigma(exp 4), for Martian topography. The coskewances and coexances drop off to zero within 20 deg arc in most cases. The mantle convective model has zero skewness and excess slightly less than Gaussian, probably arising from viscosity variations being only radial.

  2. Effect of wood grain and veneer side on loblolly pine veneer wettability

    Treesearch

    Todd E. Shupe; Chung Y. Hse; Elvin T. Choong; Leslie H. Groom

    1998-01-01

    Research was initiated to determine the effect of veneer side (tight or loose), and wood grain (earlywood or latewood) on the wettability of loblolly pine veneer. Contact angle measurements were performed with phenol-formaldehyde resin and distilled water. The resin and distilled water showed slightly higher contact angle mean values on the latewood portion for both...

  3. Simultaneous Exposure to Heavy Metals among Residents in the Industrial Complex: Korean National Cohort Study

    PubMed Central

    Park, Heejin; Lee, Kyoungho; Moon, Chan-Seok; Woo, Kyungsook; Kang, Tack-Shin; Chung, Eun-Kyung; Son, Bu-Soon

    2015-01-01

    A survey was conducted to evaluate the multi-exposure level and correlation among toxic metal biomarkers (Cd, Pb, and Hg). A total of 592 individuals who participated in the survey were residents near an industrial complex in Gwangyang and Yeosu (exposed group) and of Hadong and Namhae (control group) in southern Korea from May 2007 to November 2010. The Gwangyang and Yeosu area exposed groups had slightly higher blood Pb (2.21 and 1.90 µg/dL), urinary Cd observed values (2.20 and 1.46 µg/L), urinary Cd with a urinary creatinine correction (1.43 and 1.25 µg/g Cr), and urinary Hg observed values (2.26 and 0.98 µg/L) in women participants than those in the Hadong and Namhae area (control group). Blood Pb (3.18 and 2.55 µg/dL), urinary Hg observed values (1.14 and 0.92 µg/L), and urinary Hg with a urinary creatinine correction (1.06 and 0.96 µg/L) for male participants were also slightly higher than those in the Hadong and Namhae area (control group). The correlation among urinary Cd, Hg and Pb concentrations in the blood was significant. We suggest that the exposed group of residents were simultaneously exposed to Pb, Cd, and Hg from contaminated ambient air originating from the iron manufacturing industrial complex. PMID:26024361

  4. Stable C and N isotopic composition of cold-water corals from the Newfoundland and Labrador continental slope: Examination of trophic, depth and spatial effects

    NASA Astrophysics Data System (ADS)

    Sherwood, Owen A.; Jamieson, Robyn E.; Edinger, Evan N.; Wareham, Vonda E.

    2008-10-01

    With the aim of understanding of the trophic ecology of cold-water corals, this paper explores the tissue δ13C and δ15N values of 11 'coral' species (8 alcyonacean, 1 antipatharian, 1 pennatulacean, 1 scleractinian) collected along the Newfoundland and Labrador continental slope. Isotopic results delimit species along continua of trophic level and food lability. With an isotopic signature similar to macrozooplankton, Paragorgia arborea occupies the lowest trophic level and most likely feeds on fresh phytodetritus. Primnoa resedaeformis occupies a slightly higher trophic level, likely supplementing its diet with microzooplankton. Bathypathes arctica, Pennatulacea and other alcyonaceans ( Acanella arbuscula, Acanthogorgia armata, Anthomastus grandiflorus, Duva florida, Keratoisis ornata, Paramuricea sp.) had higher δ13C and δ15N values, suggesting these species feed at higher trophic levels and on a greater proportion of more degraded POM. Flabellum alabastrum had an isotopic signature similar to that of snow crab, indicating a primarily carnivorous diet. Isotopic composition did not vary significantly over a depth gradient of 50-1400 m. Coral δ13C increased slightly (<1‰) from the Hudson Strait to the southern Grand Banks, but δ15N did not. By modulating the availability and quality of suspended foods, substrate likely exerts a primary influence on the feeding habits of cold-water corals.

  5. Ecotoxicity evaluation of a liquid detergent using the automatic biotest ECOTOX.

    PubMed

    Azizullah, Azizullah; Richter, Peter; Ullah, Waheed; Ali, Imran; Häder, Donat-Peter

    2013-08-01

    Synthetic detergents are common pollutants reaching aquatic environments in different ways after usage at homes, institutions and industries. In this study a liquid detergent, used for dish washing, was evaluated for its toxicity during long- and short-term tests using the automatic biotest ECOTOX. Different parameters of Euglena gracilis like motility, swimming velocity, gravitactic orientation, cell compactness and cell growth were used as end points. In short-term experiments, the maximum adverse effects on motility, velocity, cell shape and gravitaxis were observed after 1 h of exposure. With further increase in exposure time to the detergent a slight recovery of these parameters was observed. In long-term experiments, the detergent caused severe disturbances to E. gracilis. Motility, cell growth and cell compactness (shape) with EC50 values of 0.064, 0.18 and 2.05 %, respectively, were found as the most sensitive parameters to detergent stress. There was a slight positive effect on gravitactic orientation at the lowest two concentrations; at higher concentrations of the detergent cells orientation was highly impaired giving EC50 values of 1.75 and 2.52 % for upward swimming and r-value, respectively.

  6. Exact quantum scattering calculation of transport properties for free radicals: OH(X2Π)-helium.

    PubMed

    Dagdigian, Paul J; Alexander, Millard H

    2012-09-07

    Transport properties for OH-He are computed through quantum scattering calculations using the ab initio potential energy surfaces determined by Lee et al. [J. Chem. Phys. 113, 5736 (2000)]. To gauge the importance of the open-shell character of OH and the anisotropy of the potential on the transport properties, including the collision integrals Ω((1,1)) and Ω((2,2)), as well as the diffusion coefficient, calculations were performed with the full potential, with the difference potential V(dif) set to zero, and with only the spherical average of the potential. Slight differences (3%-5%) in the computed diffusion coefficient were found between the values obtained using the full potential and the truncated potentials. The computed diffusion coefficients were compared to recent experimental measurements and those computed with a Lennard-Jones (LJ) 12-6 potential. The values obtained with the full potential were slightly higher than the experimental values. The LJ 12-6 potential was found to underestimate the variation in temperature as compared to that obtained using the full OH-He ab initio potential.

  7. An experimental measurement of galactic cosmic radiation dose in conventional aircraft between San Francisco and London compared to theoretical values for conventional and supersonic aircraft

    NASA Technical Reports Server (NTRS)

    Wallace, R.; Boyer, M. F.

    1972-01-01

    These direct measurements are in fair agreement with computations made using a program which considers both basic cosmic ray atmospheric physics and the focusing effect of the earth's magnetic field. These measurements also agree with those made at supersonic jet aircraft altitudes in Rb-57 aircraft. It is concluded that experiments and theory show that the doses received at conventional jet aircraft altitudes are slightly higher than those encountered in supersonic flights at much higher altitudes.

  8. Plasmaspheric H+, He+, O+, He++, and O++ Densities and Temperatures

    NASA Technical Reports Server (NTRS)

    Gallagher, D. L.; Craven, P. D.; Comfort H.

    2013-01-01

    Thermal plasmaspheric densities and temperatures for five ion species have recently become available, even though these quantities were derived some time ago from the Retarding Ion Mass Spectrometer onboard the Dynamics Explorer 1 satellite over the years 1981-1984. The quantitative properties will be presented. Densities are found to have one behavior with lessor statistical variation below about L=2 and another with much greater variability above that Lshell. Temperatures also have a behavior difference between low and higher L-values. The density ratio He++/H+ is the best behaved with values of about 0.2% that slightly increase with increasing L. Unlike the He+/H+ density ratio that on average decreases with increasing Lvalue, the O+/H+ and O++/H+ density ratios have decreasing values below about L=2 and increasing average ratios at higher L-values. Hydrogen ion temperatures range from about 0.2 eV to several 10s of eV for a few measurements, although the bulk of the observations are of temperatures below 3 eV, again increasing with L-value. The temperature ratios of He+/H+ are tightly ordered around 1.0 except for the middle plasmasphere between L=3.5 and 4.5 where He+ temperatures can be significantly higher. The temperatures of He++, O+, and O++ are consistently higher than H+.

  9. Plasmaspheric H+, He+, He++, O+, and O++ Densities and Temperatures

    NASA Technical Reports Server (NTRS)

    Gallagher, G. L.; Craven, P. D.; Comfort, R. H.

    2013-01-01

    Thermal plasmaspheric densities and temperatures for five ion species have recently become available, even though these quantities were derived some time ago from the Retarding Ion Mass Spectrometer onboard the Dynamics Explorer 1 satellite over the years 1981-1984. The quantitative properties will be presented. Densities are found to have one behavior with lessor statistical variation below about L=2 and another with much greater variability above that Lshell. Temperatures also have a behavior difference between low and higher L-values. The density ratio He++/H+ is the best behaved with values of about 0.2% that slightly increase with increasing L. Unlike the He+/H+ density ratio that on average decreases with increasing Lvalue, the O+/H+ and O++/H+ density ratios have decreasing values below about L=2 and increasing average ratios at higher L-values. Hydrogen ion temperatures range from about 0.2 eV to several 10s of eV for a few measurements, although the bulk of the observations are of temperatures below 3 eV, again increasing with L-value. The temperature ratios of He+/H+ are tightly ordered around 1.0 except for the middle plasmasphere between L=3.5 and 4.5 where He+ temperatures can be significantly higher. The temperatures of He++, O+, and O++ are consistently higher than H+.

  10. Synthesis and thermoluminescence characterizations of Sr2B5O9Cl:Dy3+ phosphor for TL dosimetry.

    PubMed

    Oza, Abha H; Dhoble, N S; Park, K; Dhoble, S J

    2015-09-01

    The photoluminescence (PL) and thermoluminescence (TL) displayed by Dy-activated strontium haloborate (Sr2 B5 O9 Cl) were studied. A modified solid-state reaction was employed for the preparation of the phosphor. Photoluminescence spectra showed blue (484 nm) and yellow (575 nm) emissions due to incorporation of Dy(3+) into host matrix. The Dy-doped (0.5 mol%) Sr2 B5 O9 Cl was studied after exposure to γ-irradiation and revealed a prominent glow curve at 261°C with a small hump around 143°C indicating that two types of traps were generated. The glow peak at the higher temperature side (261°C) was more stable than the lower temperature glow peak. The TL intensity was 1.17 times less than that of the standard CaSO4 :Dy thermoluminescence dosimetry (TLD) phosphor, the phosphor showed a linear dose-response curve for different γ-ray irradiation doses (0.002-1.25 Gy) and fading of 5-7% was observed for higher temperature peaks upon storage. Trapping parameters and their estimated error values have been calculated by Chen's peak shape method and by the initial rise method. Values of activation energies estimated by both these techniques were comparable. The slight difference in activation energy values calculated by Chen's peak shape method indicated the formation of two kinds of traps Furthermore, slight differences in frequency values are due to various escaping and retrapping probabilities. Copyright © 2014 John Wiley & Sons, Ltd.

  11. Behavior of ceramic particles at the solid-liquid metal interface in metal matrix composites

    NASA Technical Reports Server (NTRS)

    Stefanescu, D. M.; Dhindaw, B. K.; Kacar, S. A.; Moitra, A.

    1988-01-01

    Directional solidification results were obtained in order to investigate particle behavior at the solid-liquid interface in Al-2 pct Mg (cellular interface) and Al-6.1 pct Ni (eutectic interface) alloys. It is found that particles can be entrapped in the solid if adequate solidification rates and temperature gradients are used. Model results showed critical velocity values slightly higher than those obtained experimentally.

  12. Assessment of heavy metal pollution and human health risk in urban soils of steel industrial city (Anshan), Liaoning, Northeast China.

    PubMed

    Qing, Xiao; Yutong, Zong; Shenggao, Lu

    2015-10-01

    The purpose of this study was to determine the concentrations and health risk of heavy metals in urban soils from a steel industrial district in China. A total of 115 topsoil samples from Anshan city, Liaoning, Northeast China were collected and analyzed for Cr, Cd, Pb, Zn, Cu, and Ni. The geoaccumulation index (Igeo), pollution index (PI), and potential ecological risk index (PER) were calculated to assess the pollution level in soils. The hazard index (HI) and carcinogenic risk (RI) were used to assess human health risk of heavy metals. The average concentration of Cr, Cd, Pb, Zn, Cu, and Ni were 69.9, 0.86, 45.1, 213, 52.3, and 33.5mg/kg, respectively. The Igeo and PI values of heavy metals were in the descending order of Cd>Zn>Cu>Pb>Ni>Cr. Higher Igeo value for Cd in soil indicated that Cd pollution was moderate. Pollution index indicated that urban soils were moderate to highly polluted by Cd, Zn, Cu, and Pb. The spatial distribution maps of heavy metals revealed that steel industrial district was the contamination hotspots. Principal component analysis (PCA) and matrix cluster analysis classified heavy metals into two groups, indicating common industrial sources for Cu, Zn, Pb, and Cd. Matrix cluster analysis classified the sampling sites into four groups. Sampling sites within steel industrial district showed much higher concentrations of heavy metals compared to the rest of sampling sites, indicating significant contamination introduced by steel industry on soils. The health risk assessment indicated that non-carcinogenic values were below the threshold values. The hazard index (HI) for children and adult has a descending order of Cr>Pb>Cd>Cu>Ni>Zn. Carcinogenic risks due to Cr, Cd, and Ni in urban soils were within acceptable range for adult. Carcinogenic risk value of Cr for children is slightly higher than the threshold value, indicating that children are facing slight threat of Cr. These results provide basic information of heavy metal pollution control and environment management in steel industrial regions. Copyright © 2015 Elsevier Inc. All rights reserved.

  13. Comparison of Water Vapor Measurements from Ground-based and Space-based GPS Atmospheric Remote Sensing Techniques

    NASA Astrophysics Data System (ADS)

    Colon-Pagan, Ian; Kuo, Ying-Hwa

    2008-10-01

    In this study, we compare precipitable water vapor (PWV) values from ground-based GPS water vapor sensing and COSMIC radio occultation (RO) measurements over the Caribbean Sea, Gulf of Mexico, and United States regions as well as global analyses from NCEP and ECMWF models. The results show good overall agreement; however, the PWV values estimated by ground-based GPS receivers tend to have a slight dry bias for low PWV values and a slight wet bias for higher PWV values, when compared with GPS RO measurements and global analyses. An application of a student T-test indicates that there is a significant difference between both ground- and space-based GPS measured datasets. The dry bias associated with space-based GPS is attributed to the missing low altitude data, where the concentration of water vapor is large. The close agreements between space-based and global analyses are due to the fact that these global analyses assimilate space-based GPS RO data from COSMIC, and the retrieval of water vapor profiles from space-based technique requires the use of global analyses as the first guess. This work is supported by UCAR SOARS and a grant from the National Oceanic and Atmospheric Administration, Educational Partnership Program under the cooperative agreement NA06OAR4810187.

  14. Bioindication of human-induced soil degradation in enclosed karst depressions (dolines) using Ellenberg indicator values (Classical Karst, Slovenia).

    PubMed

    Breg Valjavec, Mateja; Zorn, Matija; Čarni, Andraž

    2018-05-29

    One of the frequently used bioindication methods is Ellenberg indicator values (EIVs), which are commonly applied in Central Europe as bioindicators of ecological characteristics. However, very few studies have tested EIVs as a bioindication of human-induced soil degradation. We tested the ability of EIVs to distinguish between localities of degraded karst depressions (dolines) and localities of semi-natural (agricultural) soils in preserved dolines on the Kras Plateau (Classical Karst, SW Slovenia). We compared the results of bioindications of soil nutrient content (N), soil reaction (R) and soil moisture (M) with measured soil parameters. Low values of organic carbon, a slightly alkaline soil reaction and low organic sulphur content are chemical indicators of soil degradation in dolines, in comparison with preserved reference dolines (high organic carbon, slightly acid reaction, higher S). EIV reaction is the most reliable plant indicator value that can distinguish between degraded and non-degraded soil plots. According to a regression tree, sulphur (S) and C/N are the most important factors for division on the basis of EIV reaction. By applying the EIV reaction of diagnostic plant species, we significantly improved bioindication of soil degradation, although in the case of EIV nutrients, bioindication was not improved. Copyright © 2018. Published by Elsevier B.V.

  15. Climate predictability and prediction skill on seasonal time scales over South America from CHFP models

    NASA Astrophysics Data System (ADS)

    Osman, Marisol; Vera, C. S.

    2017-10-01

    This work presents an assessment of the predictability and skill of climate anomalies over South America. The study was made considering a multi-model ensemble of seasonal forecasts for surface air temperature, precipitation and regional circulation, from coupled global circulation models included in the Climate Historical Forecast Project. Predictability was evaluated through the estimation of the signal-to-total variance ratio while prediction skill was assessed computing anomaly correlation coefficients. Both indicators present over the continent higher values at the tropics than at the extratropics for both, surface air temperature and precipitation. Moreover, predictability and prediction skill for temperature are slightly higher in DJF than in JJA while for precipitation they exhibit similar levels in both seasons. The largest values of predictability and skill for both variables and seasons are found over northwestern South America while modest but still significant values for extratropical precipitation at southeastern South America and the extratropical Andes. The predictability levels in ENSO years of both variables are slightly higher, although with the same spatial distribution, than that obtained considering all years. Nevertheless, predictability at the tropics for both variables and seasons diminishes in both warm and cold ENSO years respect to that in all years. The latter can be attributed to changes in signal rather than in the noise. Predictability and prediction skill for low-level winds and upper-level zonal winds over South America was also assessed. Maximum levels of predictability for low-level winds were found were maximum mean values are observed, i.e. the regions associated with the equatorial trade winds, the midlatitudes westerlies and the South American Low-Level Jet. Predictability maxima for upper-level zonal winds locate where the subtropical jet peaks. Seasonal changes in wind predictability are observed that seem to be related to those associated with the signal, especially at the extratropics.

  16. Comparative evaluation of the effect of sweet orange oil-diesel blend on performance and emissions of a multi-cylinder compression ignition engine

    NASA Astrophysics Data System (ADS)

    Rahman, S. M. Ashrafur; Hossain, F. M.; Van, Thuy Chu; Dowell, Ashley; Islam, M. A.; Rainey, Thomas J.; Ristovski, Zoran D.; Brown, Richard J.

    2017-06-01

    In 2014, global demand for essential oils was 165 kt and it is expected to grow 8.5% per annum up to 2022. Every year Australia produces approximately 1.5k tonnes of essential oils such as tea tree, orange, lavender, eucalyptus oil, etc. Usually essential oils come from non-fatty areas of plants such as the bark, roots, heartwood, leaves and the aromatic portions (flowers, fruits) of the plant. For example, orange oil is derived from orange peel using various extraction methods. Having similar properties to diesel, essential oils have become promising alternate fuels for diesel engines. The present study explores the opportunity of using sweet orange oil in a compression ignition engine. Blends of sweet orange oil-diesel (10% sweet orange oil, 90% diesel) along with neat diesel fuel were used to operate a six-cylinder diesel engine (5.9 litres, common rail, Euro-III, compression ratio 17.3:1). Some key fuel properties such as: viscosity, density, heating value, and surface tension are presented. Engine performance (brake specific fuel consumption) and emission parameters (CO, NOX, and Particulate Matter) were measured to evaluate running with the blends. The engine was operated at 1500 rpm (maximum torque condition) with different loads. The results from the property analysis showed that sweet orange oil-diesel blend exhibits lower density, viscosity and surface tension and slightly higher calorific value compared to neat diesel fuel. Also, from the engine test, the sweet orange oil-diesel blend exhibited slightly higher brake specific fuel consumption, particulate mass and particulate number; however, the blend reduced the brake specific CO emission slightly and brake specific NOX emission significantly compared to that of neat diesel.

  17. Assessment of PAH-exposure among coke oven workers.

    PubMed

    Vähäkangas, K; Pyy, L; Yrjänheikki, E

    1992-12-01

    Coke oven workers are exposed to high concentrations of polycyclic aromatic hydrocarbons. Only recently have methods been developed to try to assess the individual, biologically significant exposure. The only coke oven plant in Finland started to function in 1987, in Raahe, enabling the implementation of a cohort study among the workers to determine the usefulness of some currently available biomonitoring methods, e.g. methods of measuring PAH-DNA adducts. Urine and blood samples were taken several times from a sample of workers starting from before they worked at the plant. A questionnaire (smoking, diet, former and current occupations) was filled in by the workers at every sampling, and air samples (personal and stationary) were collected at the same time. The mean values of both benzo(a)pyrene diolepoxide (BPDE)-DNA adducts were measured by synchronous fluorescence spectrophotometry (SFS) and the antibodies to these adducts increased somewhat after the work at the plant started. However, all the adduct values were low, and no differences between the smokers and non-smokers at any time point were detected. Battery workers had slightly increased means of BPDE-DNA adducts compared to non-battery workers. Also, coke oven workers had slightly higher adduct values than age, sex and smoking matched controls.

  18. The Quality Characteristics of Salted Ground Pork Patties Containing Various Fat Levels by Microwave Cooking

    PubMed Central

    Jeong, Jong Youn; Lim, Seung Taek; Kim, Cheon Jei

    2016-01-01

    This study was carried out to evaluate the effects of fat level on the microwave cooking properties of ground pork patties with NaCl (1.5%). Ground pork patties were processed from pork hams to achieve fat levels of 10%, 15%, 20%, and 25%, respectively. Each patty was cooked from a thawed state to 75℃ in a microwave oven at full power (700 W). After microwave cooking, protein content, moisture content, fat retention, and shear force values in patties decreased as fat level increased from 10 to 25%. As fat level increased, cooking time decreased but total cooking loss and drip loss were increased, whereas slight differences in diameter reduction and thickness of patties were observed. In raw patties, 10% fat patties had lower L* values and higher a* values compared to patties with more fat, but these differences were reduced when patties were cooked. Patties with 10% fat showed a more pink color on the surface and interior than patties with a higher fat content but more air pockets were noted in higher-fat patties. Higher-fat patties were more tender, juicy, and oily than lower-fat patties. PMID:27621696

  19. Not Just Guess Work: Tips for Observation, Brainstorming, and Prototyping.

    PubMed

    Krone, Ryan

    2017-06-01

    Much has been written about brainstorming and prototyping in medical devices. These 2 topics are the crucial ingredients to innovation; which, if well seeded by organized and structured forays into each, will net much higher quality and more valuable results. Structure and process, although slightly counterintuitive as applied to brainstorming and prototyping, can greatly improve the value proposition of the innovation itself. Copyright © 2017 Elsevier Inc. All rights reserved.

  20. Comparison of stretched-Exponential and monoexponential model diffusion-Weighted imaging in prostate cancer and normal tissues.

    PubMed

    Liu, Xiaohang; Zhou, Liangping; Peng, Weijun; Wang, He; Zhang, Yong

    2015-10-01

    To compare stretched-exponential and monoexponential model diffusion-weighted imaging (DWI) in prostate cancer and normal tissues. Twenty-seven patients with prostate cancer underwent DWI exam using b-values of 0, 500, 1000, and 2000 s/mm(2) . The distributed diffusion coefficients (DDC) and α values of prostate cancer and normal tissues were obtained with stretched-exponential model and apparent diffusion coefficient (ADC) values using monoexponential model. The ADC, DDC (both in 10(-3) mm(2)/s), and α values (range, 0-1) were compared among different prostate tissues. The ADC and DDC were also compared and correlated in each tissue, and the standardized differences between DDC and ADC were compared among different tissues. Data were obtained for 31 cancers, 36 normal peripheral zone (PZ) and 26 normal central gland (CG) tissues. The ADC (0.71 ± 0.12), DDC (0.60 ± 0.18), and α value (0.64 ± 0.05) of tumor were all significantly lower than those of the normal PZ (1.41 ± 0.22, 1.47 ± 0.20, and 0.85 ± 0.09) and CG (1.25 ± 0.14, 1.32 ± 0.13, and 0.82 ± 0.06) (all P < 0.05). ADC was significantly higher than DDC in cancer, but lower than DDC in the PZ and CG (all P < 0.05). The ADC and DDC were strongly correlated (R(2)  = 0.99, 0.98, 0.99, respectively, all P < 0.05) in all the tissue, and standardized difference between ADC and DDC of cancer was slight but significantly higher than that in normal tissue. The stretched-exponential model DWI provides more parameters for distinguishing prostate cancer and normal tissue and reveals slight differences between DDC and ADC values. © 2015 Wiley Periodicals, Inc.

  1. Functional properties of protein isolates extracted from stabilized rice bran by microwave, dry heat, and parboiling.

    PubMed

    Khan, Saima Hafeez; Butt, Masood Sadiq; Sharif, Mian Kamran; Sameen, Ayesha; Mumtaz, Semee; Sultan, Muhammad Tauseef

    2011-03-23

    Protein isolates extracted from differently stabilized rice bran were analyzed to work out the food use potential. Bulk density remained higher for isolates obtained from heat stabilized bran, the treatments were found to have positive impact on the oil absorption properties, while the water absorption was slightly impaired owing to some possible configurational changes. Surface hydrophobicity and emulsion properties were improved with bran stabilization. Isolates exhibited better foaming properties owing to the flexible nature of protein molecules, with less intensive disulfide bonding, that were slightly affected by the stabilization treatment. Nitrogen solubility index followed a curved pattern with the least value near isoelectric point that showed an increasing trend toward basic pH, and parboiled protein isolates exhibited better gelling properties among the isolates.

  2. Quantitative grading of a human blastocyst: optimal inner cell mass size and shape.

    PubMed

    Richter, K S; Harris, D C; Daneshmand, S T; Shapiro, B S

    2001-12-01

    To investigate the predictive value of quantitative measurements of blastocyst morphology on subsequent implantation rates after transfer. Prospective observational study. Private assisted reproductive technology center. One hundred seventy-four IVF patients receiving transfers of expanded blastocyst-stage embryos on day 5 (n = 112) or day 6 (n = 62) after oocyte retrieval. None. Blastocyst diameter, number of trophectoderm cells, inner cell mass (ICM) size, ICM shape, and implantation and pregnancy rates. Blastocyst diameter and trophectoderm cell numbers were unrelated to implantation rates. Day 5 expanded blastocysts with ICMs of >4,500 microm(2) implanted at a higher rate than did those with smaller ICMs (55% vs. 31%). Day 5 expanded blastocysts with slightly oval ICMs implanted at a higher rate (58%) compared with those with either rounder ICMs (7%) or more elongated ICMs (33%). Implantation rates were highest (71%) for embryos with both optimal ICM size and shape. Pregnancy rates were higher for day 5 transfers of optimally shaped ICMs compared with day 5 transfers of optimally sized ICMs. Quantitative measurements of the inner cell mass are highly indicative of blastocyst implantation potential. Blastocysts with relatively large and/or slightly oval ICMs are more likely to implant than other blastocysts.

  3. Influence of air-drying temperature on drying kinetics, colour, firmness and biochemical characteristics of Atlantic salmon (Salmo salar L.) fillets.

    PubMed

    Ortiz, Jaime; Lemus-Mondaca, Roberto; Vega-Gálvez, Antonio; Ah-Hen, Kong; Puente-Diaz, Luis; Zura-Bravo, Liliana; Aubourg, Santiago

    2013-08-15

    In this work the drying kinetics of Atlantic salmon (Salmo salar L.) fillets and the influence of air drying temperature on colour, firmness and biochemical characteristics were studied. Experiments were conducted at 40, 50 and 60°C. Effective moisture diffusivity increased with temperature from 1.08×10(-10) to 1.90×10(-10) m(2) s(-1). The colour difference, determined as ΔE values (from 9.3 to 19.3), as well as firmness (from 25 to 75 N mm(-1)) of dried samples increased with dehydration temperature. The lightness value L(∗) and yellowness value b(∗) indicated formation of browning products at higher drying temperatures, while redness value a(∗) showed dependence on astaxanthin value. Compared with fresh fish samples, palmitic acid and tocopherol content decreased in a 20% and 40%, respectively, with temperature. While eicosapentaenoic acid (EPA) content remained unchanged and docosahexaenoic acid (DHA) content changed slightly. Anisidine and thiobarbituric acid values indicated the formation of secondary lipid oxidation products, which is more relevant for longer drying time than for higher drying temperatures. Copyright © 2013 Elsevier Ltd. All rights reserved.

  4. Prognostic significance of inverse spatial QRS-T angle circadian pattern in myocardial infarction survivors.

    PubMed

    Giannopoulos, Georgios; Dilaveris, Polychronis; Batchvarov, Velislav; Synetos, Andreas; Hnatkova, Katerina; Gatzoulis, Konstantinos; Malik, Marek; Stefanadis, Christodoulos

    2009-01-01

    We investigated the predictive value of the spatial QRS-T angle (QRSTA) circadian variation in myocardial infarction (MI) patients. Analyzing 24-hour recordings (SEER MC, GE Marquette) from 151 MI patients (age 63 +/- 12.7), the QRSTA was computed in derived XYZ leads. QRS-T angle values were compared between daytime and night time. The end point was cardiac death or life-threatening ventricular arrhythmia in 1 year. Overall, QRSTA was slightly higher during the day vs. the night (91 degrees vs. 87 degrees, P = .005). However, 33.8% of the patients showed an inverse diurnal QRSTA variation (higher values at night), which was correlated to the outcome (P = .001, odds ratio 6.7). In multivariate analysis, after entering all factors exhibiting univariate trend towards significance, inverse QRSTA circadian pattern remained significant (P = .036). Inverse QRSTA circadian pattern was found to be associated with adverse outcome (22.4%) in MI patients, whereas a normal pattern was associated (96%) with a favorable outcome.

  5. Pluto's atmosphere - Models based on refraction, inversion, and vapor-pressure equilibrium

    NASA Technical Reports Server (NTRS)

    Eshleman, Von R.

    1989-01-01

    Viking spacecraft radio-occultation measurements indicate that, irrespective of substantial differences, the polar ice cap regions on Mars have inversions similar to those of Pluto, and may also share vapor pressure equilibrium characteristics at the surface. This temperature-inversion phenomenon occurs in a near-surface boundary layer; surface pressure-temperature may correspond to the vapor-pressure equilibrium with CH4 ice, or the temperature may be slightly higher to match the value derived from IRAS data.

  6. The effects of MWNT on thermal conductivity and thermal mechanical properties of epoxy

    NASA Astrophysics Data System (ADS)

    Ismadi, A. I.; Othman, R. N.

    2017-12-01

    Multiwall nanotube (MWNT) was used as filler in various studies to improve thermal conductivity and mechanical properties of epoxy. Present study varied different weight loading (0, 0.1 %, 0.5 %, 1 %, 1.5 %, 3 % and 5 %) of MWNT in order to observe the effects on the epoxy. Nanocomposite was analyzed by dynamic-mechanical thermal analyser (DMTA) and KD2 pro analyzer. DMTA measured storage modulus (E') and glass transition temperature (Tg) of the nanocomposite. Result showed that Tg value of neat epoxy is higher than all MWNT epoxy nanocomposite. Tg values drop from 81.55 °C (neat epoxy) to 65.03 °C (at 0.1 wt%). This may happen due to the agglomeration of MWNT in the epoxy. However, Tg values increases with the increase of MWNT wt%. Tg values increased from 65.03 °C to 78.53 °C at 1 wt%. Increment of storage modulus (E') at 3 °C (glassy region) was observed as the MWNT loading increases. Maximum value of E' during glassy region was observed to be at 5 wt% with (7.26±0.7) E+08 Pa compared to neat epoxy. On the contrary, there is slight increased and slight decreased with E' values at 100 °C (rubbery region) for all nanocomposite. Since epoxy exhibits low thermal conductivity properties, addition of MWNT has enhanced the properties. Optimum value of thermal conductivity was observed at 3 wt%. The values increased up to 9.03 % compared to neat epoxy. As expected, the result showed decrease value in thermal conductivity at 5 wt% as a result of agglomeration of MWNT in the epoxy.

  7. Soil or Dust for Health Risk Assessment Studies in Urban Environment.

    PubMed

    Gabarrón, M; Faz, A; Acosta, J A

    2017-10-01

    To identify the best material (soil or dust) to be selected for health-risk assessment studies, road dust and urban soil from three cities with different population densities were collected, and size fractions were analysed for metal content (Pb, Zn, Cu, Cd, Cr, Co, and Ni). Results showed similar distribution of the size particles among cities, predominating fractions between 75 and 2000 μm in road dust and particles below 75 μm in soil. Metals were mainly bound to PM10 in both soil and road dust increasing the risk of adverse health effects, overall through inhalation exposure. The risk assessment showed that the most hazardous exposure pathway was the ingestion via, followed by dermal absorption and inhalation route. Values of hazard quotient showed that the risk for children due to the ingestion and dermal absorption was higher than adults, and slightly larger at PM10 comparing to <75-μm fraction for the inhalation route. Higher risk values were found for road dust, although any hazard index or cancer risk index value did not overreach the safe value of 10 -6 .

  8. Assessments of levels, potential ecological risk, and human health risk of heavy metals in the soils from a typical county in Shanxi Province, China.

    PubMed

    Pan, Libo; Ma, Jin; Hu, Yu; Su, Benying; Fang, Guangling; Wang, Yue; Wang, Zhanshan; Wang, Lei; Xiang, Bao

    2016-10-01

    A total of 128 surface soil samples were collected, and eight heavy metals, including As, Cd, Cr, Cu, Pb, Ni, Zn, and Hg, were analyzed for their concentrations, potential ecological risks, and human health risks. The mean concentrations of these eight metals were lower than the soil environmental quality standards in China, while they were slightly higher than the background values in Shanxi Province. The enrichment factor, coefficient variation, and potential ecological risk index were used to assess the pollution and eco-risk level of heavy metals, among which, Cd and Hg showed higher pollution levels and potential risks than the others in the studied area. Moreover, multivariate geostatistical analysis suggested that Hg originated mainly from point sources such as industrial emissions, while agricultural activity is the predominant factor for Cd. The human health risk assessment indicated that non-carcinogenic values were below the threshold values. The total carcinogenic risks due to As, Cr, and Ni were within the acceptable range for adults, while for children, they were higher than the threshold value (1.0E-04), indicating that children are facing higher threat to heavy metals in soils. These results provide basic information on heavy metal pollution control and human health risk assessment management in the study regions.

  9. Energy values and estimation of power generation potentials of some non-woody biomass species

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kumar, M.; Patel, S.K.

    In view of high energy potentials in non-woody biomass species and an increasing interest in their utilization for power generation, an attempt has been made in this study to assess the proximate analysis and energy content of different components of Ocimum canum and Tridax procumbens biomass species (both non-woody), and their impact on power generation and land requirement for energy plantations. The net energy content in Ocimum canum was found to be slightly higher than that in Tridax procumbens. In spite of having higher ash contents, the barks from both the plant species exhibited higher calorific values. The results havemore » shown that approximately 650 and 1,270 hectares of land are required to generate 20,000 kWh/day electricity from Ocimum canum and Tridax procumbens biomass species. Coal samples, obtained from six different local mines, were also examined for their qualities, and the results were compared with those of studied biomass materials. This comparison reveals much higher power output with negligible emission of suspended particulate matters (SPM) from biomass materials.« less

  10. The ground state tunneling splitting and the zero point energy of malonaldehyde: a quantum Monte Carlo determination.

    PubMed

    Viel, Alexandra; Coutinho-Neto, Maurício D; Manthe, Uwe

    2007-01-14

    Quantum dynamics calculations of the ground state tunneling splitting and of the zero point energy of malonaldehyde on the full dimensional potential energy surface proposed by Yagi et al. [J. Chem. Phys. 1154, 10647 (2001)] are reported. The exact diffusion Monte Carlo and the projection operator imaginary time spectral evolution methods are used to compute accurate benchmark results for this 21-dimensional ab initio potential energy surface. A tunneling splitting of 25.7+/-0.3 cm-1 is obtained, and the vibrational ground state energy is found to be 15 122+/-4 cm-1. Isotopic substitution of the tunneling hydrogen modifies the tunneling splitting down to 3.21+/-0.09 cm-1 and the vibrational ground state energy to 14 385+/-2 cm-1. The computed tunneling splittings are slightly higher than the experimental values as expected from the potential energy surface which slightly underestimates the barrier height, and they are slightly lower than the results from the instanton theory obtained using the same potential energy surface.

  11. Research on the Spatial-Temporal Distribution Pattern of the Network Attention of Fog and Haze in China

    NASA Astrophysics Data System (ADS)

    Weng, Lingyan; Han, Xugao

    2018-01-01

    Understanding the spatial-temporal distribution pattern of fog and haze is the base to deal with them by adjusting measures to local conditions. Taking 31 provinces in China mainland as the research areas, this paper collected data from Baidu index on the network attention of fog and haze in relevant areas from 2011 to 2016, and conducted an analysis of their spatial-temporal distribution pattern by using autocorrelation analysis. The results show that the network attention of fog and haze has an overall spatial distribution pattern of “higher in the eastern and central, lower in the western China”. There are regional differences in different provinces in terms of network attention. Network attention of fog and haze indicates an obvious geographical agglomeration phenomenon, which is a gradual enlargement of the agglomeration area of higher value with a slight shrinking of those lower value agglomeration areas.

  12. Influence of deformation behavior, oxydation, and temperature on the long time cyclic stress behavior of high temperature steels

    NASA Technical Reports Server (NTRS)

    Maile, K.

    1982-01-01

    The influence of different parameters on the creep-fatigue behavior of several steel alloys was investigated. The higher the temperature the lower the crack initiation value. Pauses during the cycle reduce the damage. Oxidation reduces and protective gas increases the lifetime. Prior loading and prior deformation reduce the lifetime. Short annealing slightly affects the cycle stress behavior. The test results do not satisfactorily agree with methods of extrapolation and damage accumulation.

  13. Quantitative characterization of brazing performance for Sn-plated silver alloy fillers

    NASA Astrophysics Data System (ADS)

    Wang, Xingxing; Peng, Jin; Cui, Datian

    2017-12-01

    Two types of AgCuZnSn fillers were prepared based on BAg50CuZn and BAg34CuZnSn alloy through a combinative process of electroplating and thermal diffusion. The models of wetting entropy and joint strength entropy of AgCuZnSn filler metals were established. The wetting entropy of the Sn-plated silver brazing alloys are lower than the traditional fillers, and its joint strength entropy value is slightly higher than the latter. The wetting entropy value of the Sn-plated brazing alloys and traditional filler metal are similar to the change trend of the wetting area. The trend of the joint strength entropy value with those fillers are consisted with the tensile strength of the stainless steel joints with the increase of Sn content.

  14. Initial growth, refractive index, and crystallinity of thermal and plasma-enhanced atomic layer deposition AlN films

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Van Bui, Hao, E-mail: H.VanBui@utwente.nl; Wiggers, Frank B.; Gupta, Anubha

    2015-01-01

    The authors have studied and compared the initial growth and properties of AlN films deposited on Si(111) by thermal and plasma-enhanced atomic layer deposition (ALD) using trimethylaluminum and either ammonia or a N{sub 2}-H{sub 2} mixture as precursors. In-situ spectroscopic ellipsometry was employed to monitor the growth and measure the refractive index of the films during the deposition. The authors found that an incubation stage only occurred for thermal ALD. The linear growth for plasma-enhanced ALD (PEALD) started instantly from the beginning due to the higher nuclei density provided by the presence of plasma. The authors observed the evolution ofmore » the refractive index of AlN during the growth, which showed a rapid increase up to a thickness of about 30 nm followed by a saturation. Below this thickness, higher refractive index values were obtained for AlN films grown by PEALD, whereas above that the refractive index was slightly higher for thermal ALD films. X-ray diffraction characterization showed a wurtzite crystalline structure with a (101{sup ¯}0) preferential orientation obtained for all the layers with a slightly better crystallinity for films grown by PEALD.« less

  15. The effects of ILLLI on peripheral blood T lymphocytes subpopulation & NK cells in psoriasis treatment

    NASA Astrophysics Data System (ADS)

    Zhu, Jing; Nie, Fan

    2005-07-01

    Objective: To research the effects of Intravascular low level laser irradiation (ILLLI) on the immulogic function of cells in treatment of psoriasis. Method: 49 patients suffered from psoriasis were treated by Intravascular low level laser irradiation (laser output power: 4-5mw, 1 hour per day, a course of treatment is 10 days). We checked the function of T lymphocyte subgroup and NK cell in peripheral blood between pre and post treatment. Results: 1.The mean value of CD3+ in post treatment is higher. P<0.05. Significant difference is showed between pre and post treatment 2. The mean value of CD4+ in post treatment dropped slightly while the mean value of CD4/CD8, NK cell in post treatment increased little, nearly approach the mean value of natural person. 3.The mean value of CD4+,CD8+,NK cell which is under 30% increased the percent obviously after the treatment; The mean value of CD4+,CD8+ u higher than 30% obviously drop the percent, P#0.05 and <0.01. Related statistical analysis showed significant and much significant difference between pre and post treatment. Conclusions: The low level laser irradiation (ILLLI) in treatment of psoriasis has bidirectional ajustive effect which can balance the immulogic function of cell.

  16. High serum soluble CD30 does not predict acute rejection in liver transplant patients.

    PubMed

    Matinlauri, I; Höckerstedt, K; Isoniemi, H

    2006-12-01

    Increased pre- and posttransplantation values of soluble CD30 (sCD30) have been shown to be associated with acute kidney transplant rejection. We sought to study whether high sCD30 could predict rejection early after liver transplantation. The study population included 54 consecutive liver transplant patients, whose samples were collected before liver transplantation and at discharge, which was at a mean time of 3 weeks after transplantation. During the first 6 months posttransplantation, 22 patients experienced an acute rejection episode. Serum sCD30 concentrations were measured by an enzyme-linked immunoassay; changes in serum sCD30 levels posttransplantation were also expressed as relative values compared with pretransplantation results. Liver patients before transplantation displayed higher serum sCD30 values compared with healthy controls: mean values +/- SD were 93 +/- 58 IU/mL vs 17 +/- 8 IU/mL, respectively. At 3 weeks after transplantation the mean sCD30 concentration in liver transplant patients decreased to 59 +/- 42 IU/mL (P = .005). The mean pretransplantation serum sCD30 value was slightly lower among rejecting vs nonrejecting patients: 78 +/- 43 IU/mL vs 104 +/- 65 IU/mL (P = NS). Posttransplantation values in both groups decreased significantly: 47 +/- 34 IU/mL in patients with rejection (P = .014) vs 69 +/- 45 IU/mL in patients without rejection (P = .012). The relative value at 3 weeks posttransplantation decreased slightly more among patients with vs without rejection (70% vs 88%; NS). No correlation was found between serum sCD30 and anti-HLA class I antibodies or crossmatch positivity. In conclusion, neither pre- nor posttransplantation sCD30 levels were associated with acute rejection in liver transplant patients.

  17. Analysis of tank 38H (HTF-38-17-18, -19) and tank 43H (HTF-43-17-20, -21) samples for support of the enrichment control and corrosion control programs

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hay, M. S.; Coleman, C. J.; Diprete, D. P.

    SRNL analyzed samples from Tank 38H and Tank 43H to support ECP and CCP. The total uranium in the Tank 38H samples ranged from 53.7 mg/L for the surface sample to 57.0 mg/L in the sub-surface sample. The Tank 43H samples showed uranium concentrations of 46.2 mg/L for the surface sample and 45.7 mg/L in the sub-surface sample. The U-235 percentage was 0.63% in the Tank 38H samples and 0.62% in the Tank 43H samples. The total uranium and percent U-235 results appear consistent with recent Tank 38H and Tank 43H uranium measurements. The plutonium results for the Tank 38Hmore » surface sample are slightly higher than recent sample results, while the Tank 43H plutonium results are within the range of values measured on previous samples. The Cs-137 results for the Tank 38H surface and subsurface samples are slightly higher than the concentrations measured in recent samples. The Cs-137 results for the two Tank 43H samples are within the range of values measured on previous samples. The comparison of the sum of the cations in each sample versus the sum of the anions shows a difference of 23% for the Tank 38H surface sample and 18% for the Tank 43H surface sample. The four samples show silicon concentrations somewhat lower than the previous samples with values ranging from 80.2 to 105 mg/L.« less

  18. High-Fiber Orange Juice as a Nutrition Supplement in Women: A Randomized, Double-Blind, Placebo-Controlled Study of Tolerance and Effectiveness.

    PubMed

    Bergamasco, Christiane; Horie, Lilian Mika; Torrinhas, Raquel Susana; Waitzberg, Dan L

    2015-11-01

    The daily consumption of dietary fiber is frequently below suggested recommendations. Using a double-blind, controlled, randomized study, we assessed the efficiency and tolerance of a fiber-enriched orange juice to supplement fiber intake in women. After 1 week of noninterventional observation, 192 healthy adult women ingested 400 mL of orange juice for 21 days, which either was not (placebo group) or was enriched with fiber (fiber group). Orange juice ingestion was registered daily and controlled for each week during the study period. Macronutrient, fiber, and energy intake were determined using a 3-day food record, validated food chemical composition databases, and the "Pro Diet" software. Gastrointestinal symptoms were self-evaluated daily by scoring 4 grades of symptom intensity and using a visual analog scale to grade pain severity. No changes were observed for macronutrient and energy ingestion. For the placebo group (n = 97), the total fiber intake record was under the daily recommended value. In contrast, the fiber group (n = 95) displayed higher comparative values of total and soluble fiber consumption (P ≤ .001), achieving the daily recommended values of fiber intake. Both groups reported an increased frequency of slight bloating and rumbles over time (P ≤ .05). The fiber group also experienced a higher frequency of slight flatulence over time (P = .002). Consumption of fiber-enriched orange juice was efficient to achieve the daily fiber intake recommendation for women, was not accompanied by intense adverse events, and may represent a suitable method to supplement fiber intake in woman. © 2014 American Society for Parenteral and Enteral Nutrition.

  19. Assessing the influence of chin prominence on profile esthetics: A survey study.

    PubMed

    Pişiren, Akın Buğra; Arman-Özçırpıcı, Ayça; Tunçer, Nilüfer İrem

    2018-04-01

    The aim of this survey study was to assess the influence of chin prominence on the perception of profile esthetics between genders by orthodontists, oral and maxillofacial surgeons (OMF), plastic surgeons, orthognathic patients and laypersons. A total of 731 observers participated in this study. Profile photographs of one female and one male showing ideal soft tissue values, skeletal class 1 relationship, and normodivergent facial type were modified with photo editing program (Adobe Photoshop CC software), so that the chin was moved posteriorly up to 10 mm and anteriorly up to 8 mm at 2-mm intervals. Participants were asked to rate 11 female and 11 male profile images and to assess whether surgery was needed. Within the limits of this study, ideal, slightly concave and slightly convex profiles for females, and ideal and slightly concave profiles for males were found more acceptable. Surgery was desired for 50.9% of retrusive profiles and 57.3% of protrusive profiles. Female participants had a higher rate of desire for surgery than male participants, and clinicians desired surgery significantly less than others. Desire for surgery started from 4 mm in males and females for all groups, from -6 mm in orthodontists and OMFs, from -4 mm in other groups in females, and from -6 mm in males for all groups. Clinicians tend to operate more pronounced cases when compared to laypeople. A significantly higher rate of surgery was desired for protrusive chin profiles, and female participants had a higher desire for surgery. Copyright © 2018 European Association for Cranio-Maxillo-Facial Surgery. Published by Elsevier Ltd. All rights reserved.

  20. Generalized model screening potentials for Fermi-Dirac plasmas

    NASA Astrophysics Data System (ADS)

    Akbari-Moghanjoughi, M.

    2016-04-01

    In this paper, some properties of relativistically degenerate quantum plasmas, such as static ion screening, structure factor, and Thomson scattering cross-section, are studied in the framework of linearized quantum hydrodynamic theory with the newly proposed kinetic γ-correction to Bohm term in low frequency limit. It is found that the correction has a significant effect on the properties of quantum plasmas in all density regimes, ranging from solid-density up to that of white dwarf stars. It is also found that Shukla-Eliasson attractive force exists up to a few times the density of metals, and the ionic correlations are seemingly apparent in the radial distribution function signature. Simplified statically screened attractive and repulsive potentials are presented for zero-temperature Fermi-Dirac plasmas, valid for a wide range of quantum plasma number-density and atomic number values. Moreover, it is observed that crystallization of white dwarfs beyond a critical core number-density persists with this new kinetic correction, but it is shifted to a much higher number-density value of n0 ≃ 1.94 × 1037 cm-3 (1.77 × 1010 gr cm-3), which is nearly four orders of magnitude less than the nuclear density. It is found that the maximal Thomson scattering with the γ-corrected structure factor is a remarkable property of white dwarf stars. However, with the new γ-correction, the maximal scattering shifts to the spectrum region between hard X-ray and low-energy gamma-rays. White dwarfs composed of higher atomic-number ions are observed to maximally Thomson-scatter at slightly higher wavelengths, i.e., they maximally scatter slightly low-energy photons in the presence of correction.

  1. Higher-order aberrations after wavefront-optimized photorefractive keratectomy and laser in situ keratomileusis

    PubMed Central

    Randleman, J. Bradley; Perez-Straziota, Claudia E.; Hu, Michelle H.; White, Alfred J.; Loft, Evan S.; Stulting, R. Doyle

    2013-01-01

    PURPOSE To analyze the changes in higher-order aberrations (HOAs) that occur after wavefront-optimized photorefractive keratectomy (PRK) and laser in situ keratomileusis (LASIK). SETTING Private practice, Atlanta, Georgia, USA. METHODS This retrospective analysis comprised eyes that had PRK or LASIK from June 2004 through October 2005. Postoperative outcome measures included 3-month uncorrected visual acuity (UCVA), best spectacle-corrected visual acuity (BSCVA), manifest refraction spherical equivalent (MRSE), changes in the root mean square (RMS) and grouped coefficient HOAs (microns) measured with a corneal analyzer, and subjective assessment of visual aberrations. RESULTS One hundred consecutive eyes of 54 patients had PRK, and 100 contemporaneous consecutive eyes of 71 patients had LASIK. The PRK and LASIK populations were similar in general demographics, preoperative HOAs, and postoperative UCVA and BSCVA. The mean MRSE was slightly hyperopic after PRK (mean +0.11 diopters [D]) and slightly myopic after LASIK (mean −0.19 D) (P<.0001). There were no statistically significant changes in RMS or grouped coefficient HOA values after PRK or LASIK, nor were there significant differences in postoperative RMS or grouped coefficient HOA values between PRK and LASIK. One percent of PRK and LASIK patients reported a subjective increase in postoperative visual aberrations; 5% reported a subjective improvement postoperatively. CONCLUSIONS Wavefront-optimized excimer laser surgery did not induce significant HOAs after PRK or LASIK. The 2 techniques were equally efficacious and had equivalent postoperative HOA profiles. PMID:19185240

  2. Myocardial blood flow quantification by Rb-82 cardiac PET/CT: A detailed reproducibility study between two semi-automatic analysis programs.

    PubMed

    Dunet, Vincent; Klein, Ran; Allenbach, Gilles; Renaud, Jennifer; deKemp, Robert A; Prior, John O

    2016-06-01

    Several analysis software packages for myocardial blood flow (MBF) quantification from cardiac PET studies exist, but they have not been compared using concordance analysis, which can characterize precision and bias separately. Reproducible measurements are needed for quantification to fully develop its clinical potential. Fifty-one patients underwent dynamic Rb-82 PET at rest and during adenosine stress. Data were processed with PMOD and FlowQuant (Lortie model). MBF and myocardial flow reserve (MFR) polar maps were quantified and analyzed using a 17-segment model. Comparisons used Pearson's correlation ρ (measuring precision), Bland and Altman limit-of-agreement and Lin's concordance correlation ρc = ρ·C b (C b measuring systematic bias). Lin's concordance and Pearson's correlation values were very similar, suggesting no systematic bias between software packages with an excellent precision ρ for MBF (ρ = 0.97, ρc = 0.96, C b = 0.99) and good precision for MFR (ρ = 0.83, ρc = 0.76, C b = 0.92). On a per-segment basis, no mean bias was observed on Bland-Altman plots, although PMOD provided slightly higher values than FlowQuant at higher MBF and MFR values (P < .0001). Concordance between software packages was excellent for MBF and MFR, despite higher values by PMOD at higher MBF values. Both software packages can be used interchangeably for quantification in daily practice of Rb-82 cardiac PET.

  3. Chemical composition, oxidative stability and antioxidant capacity of oil extracted from roasted seeds of Sacha-inchi (Plukenetia volubilis L.).

    PubMed

    Cisneros, Fausto H; Paredes, Daniel; Arana, Adrian; Cisneros-Zevallos, Luis

    2014-06-04

    The effect of roasting of Sacha-inchi (Plukenetia volubilis L.) seeds on the oxidative stability and composition of its oil was investigated. The seeds were subjected to light, medium and high roasting intensities. Oil samples were subjected to high-temperature storage at 60 °C for 30 days and evaluated for oxidation (peroxide value and p-anisidine), antioxidant activity (total phenols and DPPH assay), and composition (tocopherol content and fatty acid profile). Results showed that roasting partially increased oil oxidation and its antioxidant capacity, slightly decreased tocopherol content, and did not affect the fatty acid profile. During storage, oxidation increased for all oil samples, but at a slower rate for oils from roasted seeds, likely due to its higher antioxidant capacity. Also, tocopherol content decreased significantly, and a slight modification of the fatty acid profile suggested that α-linolenic acid oxidized more readily than other fatty acids present.

  4. A case report of a TPS dental implant rigidly connected to a natural tooth: 19-year follow-up.

    PubMed

    Quaranta, Alessandro; Poli, Ottavia; Vozza, Iole

    2013-01-01

    A partial edentulous area was restored with a tooth to implant fixed partial denture and a rigid connection between the two elements. Maintenance recalls were performed over a 19-year period of observation on a yearly basis. THE FOLLOWING PARAMETERS WERE COLLECTED DURING EACH EXAMINATION OVER THE ENTIRE PERIOD OF OBSERVATION: PD around the implant and natural tooth abutment, gingival index, modified gingival index, plaque index, modified plaque index, occlusal assessment, marginal bone loss. Radiographic assessment of peri-implant bone remodeling was performed in a retrospective way. The following reference points were assessed on each image: fixture-abutment junction, threads, first contact of the crestal bone with the implant on both mesial and distal side. This made possible, with the known values for implant diameter and length, to make linear measurements of remaining peri-implant bone measured from the mesial and distal marginal bone levels and the fixture-abutment junction. The amount of bone change over the baseline to a 19 years follow-up observation time was calculated for both the implant and the natural tooth. Clinical parameters showed healthy values over the entire period of observation with slight isolated positive bleeding on probing. Bone remodeling values were constant over the entire period with slight higher values around the tooth. Peri-apical radiographs did not show any intrusion of the tooth. The present case report showed the complete functionality and stability of a tooth to implant rigidly connected FPD over a period of 19 years.

  5. Estimated glomerular filtration rate is associated with both arterial stiffness and N-terminal pro-brain natriuretic peptide in newly diagnosed hypertensive patients.

    PubMed

    Gür, Mustafa; Uçar, Hakan; Kuloğlu, Osman; Kıvrak, Ali; Şeker, Taner; Türkoğlu, Caner; Özaltun, Betül; Kaypaklı, Onur; Şahin, Durmuş Yıldıray; Elbasan, Zafer; Tanboğa, Halil İbrahim; Çaylı, Murat

    2014-01-01

    Even a slight decrease in the glomerular filtration rate (GFR) is an independent risk factor for cardiovascular disease. Arterial stiffness, left ventricular hypertrophy and N-terminal pro-brain natriuretic peptide (NT-proBNP) are independent risk factors for cardiovascular disease, which are particularly common in end-stage renal disease. We aimed to evaluate the association between GFR with arterial stiffness, left ventricle mass (LVM) and NT-proBNP in hypertensive subjects with normal to mildly impaired renal function. The study population consisted of 285 newly diagnosed hypertensive patients (mean age; 49.9 ± 11.8 years). GFR was estimated (eGFR) by the Modification of Diet in Renal Disease formula. Pulse wave velocity (PWV) and augmentation index (AIx), which reflects arterial stiffness, were calculated using the single-point method via the Mobil-O-Graph® ARCsolver algorithm. LVM was obtained by echocardiography. Plasma NT-proBNP was measured by electrochemiluminescence. The patients were divided into two groups according to the median eGFR value (eGFRlow group <101 ml/min/1.73 m(2) and eGFRhigh group ≥ 101 ml/min/1.73 m(2)). LVM and NT-proBNP values were higher in eGFRlow group compared with eGFRhigh group (p<0.05). Pulse wave velocity and augmentation index values were higher in eGFRlow group compared with eGFRhigh group (p<0.05, for all). Multiple linear regression analysis showed that eGFR was independently associated with PWV (β=-0.422, p<0.001) and NT-proBNP (β=-0.404, p<0.001). Present study showed that eGFR was independently associated with PWV and NT-proBNP values. Importantly, these findings may explain, in part, the increase in cardiovascular risk in with slightly impaired renal function.

  6. Pyrite formation driven by MSW landfill leachate in the Madrid Basin, Spain

    NASA Astrophysics Data System (ADS)

    Castelló, Ricardo; Recio, Clemente; Morillas, Pilar; Vizcayno, Carmen

    2008-04-01

    The role of municipal solid waste (MSW) landfill leachate on the genesis of minor amounts of pyrite associated with gypsum in an otherwise predominantly evaporitic sequence was studied in geological and geochemical terms. The potential association between landfill leachate and the conditions required for bacterial reduction of sulfate and fixation of H2S as pyrite were examined. The lithological column was generally found to contain little or no Fe. The δ34S values for sulfates were consistent with previously reported data; however, the measured δ18O values were slightly higher. Sulfides disseminated in the marl/lutite exhibited higher δ34S values (≈-8‰) than gypsum-coating pyrite crystals (δ34S < -30‰). Dissolution of gypsum to sulfate and the supply of metabolizable organic matter and Fe required for H2S fixation as sulfides may have originated from landfill leachate. Intermittent availability of leachate, a result of the precipitation regime, can facilitate sulfur disproportionation and lead to fractionations as high as δ_{text{SO}4^{2-}-{text{S}^{2-}}}≈ - {text{50}}permille.

  7. Determination of ferrous and total iron in refractory spinels

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Amonette, James E.; Matyas, Josef

    2015-12-30

    Accurate and precise determination of the redox state of iron (Fe) in spinels presents a significant challenge due to their refractory nature. The resultant extreme conditions needed to obtain complete dissolution generally oxidize some of the Fe(II) initially present and thus prevent the use of colorimetric methods for Fe(II) measurements. To overcome this challenge we developed a hybrid oxidimetric/colorimetric approach, using Ag(I) as the oxidimetric reagent for determination of Fe(II) and 1,10-phenanthroline as the colorimetric reagent for determination of total Fe. This approach, which allows determination of Fe(II) and total Fe on the same sample, was tested on a seriesmore » of four geochemical reference materials and then applied to the analysis of Fe(Ni) spinel crystals isolated from simulated high-level-waste (HLW) glass and of several reagent magnetites. Results for the reference materials were in excellent agreement with published values, with the exception of USGS BIR-1, for which higher Fe(II) values and lower total Fe values were obtained. The Fe(Ni) spinels showed Fe(II) values at the detection limit (ca. 0.05 wt% Fe) and total Fe values slightly higher than obtained by total elemental analysis. For the magnetite samples, total Fe values were in agreement with reference results, but a wide range in Fe(II) values was obtained indicating various degrees of conversion to maghemite.« less

  8. Continuous glucose monitoring and HbA1c in the evaluation of glucose metabolism in children at high risk for type 1 diabetes mellitus.

    PubMed

    Helminen, Olli; Pokka, Tytti; Tossavainen, Päivi; Ilonen, Jorma; Knip, Mikael; Veijola, Riitta

    2016-10-01

    Continuous glucose monitoring (CGM) parameters, self-monitored blood glucose (SMBG), HbA1c and oral glucose tolerance test (OGTT) were studied during preclinical type 1 diabetes mellitus. Ten asymptomatic children with multiple (⩾2) islet autoantibodies (cases) and 10 age and sex-matched autoantibody-negative controls from the Type 1 Diabetes Prediction and Prevention (DIPP) Study were invited to 7-day CGM with Dexcom G4 Platinum Sensor. HbA1c and two daily SMBG values (morning and evening) were analyzed. Five-point OGTTs were performed and carbohydrate intake was assessed by food records. The matched pairs were compared with the paired sample t-test. The cases showed higher mean values and higher variation in glucose levels during CGM compared to the controls. The time spent ⩾7.8mmol/l was 5.8% in the cases compared to 0.4% in the controls (p=0.040). Postprandial CGM values were similar except after the dinner (6.6mmol/l in cases vs. 6.1mmol/l in controls; p=0.023). When analyzing the SMBG values higher mean level, higher evening levels, as well as higher variation were observed in the cases when compared to the controls. HbA1c was significantly higher in the cases [5.7% (39mmol/mol) vs. 5.3% (34mmol/mol); p=0.045]. No differences were observed in glucose or C-peptide levels during OGTT. Daily carbohydrate intake was slightly higher in the cases (254.2g vs. 217.7g; p=0.034). Glucose levels measured by CGM and SMBG are useful indicators of dysglycemia during preclinical type 1 diabetes mellitus. Increased evening glucose values seem to be common in children with preclinical type 1 diabetes mellitus. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  9. Jellyfish Lake, Palau: Regeneration of C, N, Si, and P in anoxic marine lake sediments

    USGS Publications Warehouse

    Lyons, W.B.; Lent, R.M.; Burnett, W.C.; Chin, P.; Landing, W.M.; Orem, W.H.; McArthur, J.M.

    1996-01-01

    Sediment cores from Jellyfish Lake were processed under an inert atmosphere and the pore waters extracted and analyzed for the following parameters: pH, titration alkalinity (TA), Cl-, H4SiO4, PO43-, NH4+, Ca2-, Mg2+, SO42-, and H2S. Additionally, in one set of pore-water samples (core 10), the ??13C of the ??CO2 was also determined. The TA, H4SiO4, PO43-, NH4+, and H2S increased with depth in the pore waters above anoxic bottom-water values. H2S values increased to 3.8 ??M. In one case, both H4SiO4 and PO43- concentrations increased to a maximum value and then decreased with depth, suggesting removal into solid phases. The H4SiO4 concentrations are equal to or greater than pore-water values observed in sediments underlying upwelling areas. PO43- concentrations are, in general, lower than pore-water values from terrigenous nearshore areas but higher than nearshore carbonate pore-water values from Florida Bay or Bermuda. The Ca2+, Cl-, and Mg2+: Cl- ratios show slight decreases in the top 15-20 cm, suggesting that authigenic carbonate may be forming. This suggestion is supported by the fact that the pore waters are saturated with respect to CaCO3 due to the very high TAs. The ??13C measurements of the pore-water ??CO2 are from a shorter core. These measurements reach their most negative concentration at 72 cm and then become slightly heavier. This change is accompanied by a decrease in TA, suggesting the onset of methanogenesis at this location in this core.

  10. An Impact Triggered Runaway Greenhouse on Mars

    NASA Technical Reports Server (NTRS)

    Segura, T. L.; McKay, C. P.; Toon, O. B.

    2004-01-01

    When a planet is in radiative equilibrium, the incoming solar flux balances the outgoing longwave flux. If something were to perturb the system slightly, say the incoming solar flux increased, the planet would respond by radiating at a higher surface temperature. Since any radiation that comes in must go out, if the incoming is increased, the outgoing must also increase, and this increase manifests itself as a warmer equilibrium temperature. The increase in solar flux would correspond to an increase in temperature, which would increase the amount of water vapor in the atmosphere due to increased evaporation. Since water vapor is a greenhouse gas, it would absorb more radiation in the atmosphere leading to a yet warmer equilibrium temperature. The planet would reach radiative equilibrium at this new temperature. There exists a point, however, past which this positive feedback leads to a "runaway" situation. In this case, the planet does not simply evaporate a little more water and eventually come to a slightly higher equilibrium temperature. Instead, the planet keeps evaporating more and more water until all of the planet's available liquid and solid water is in the atmosphere. The reason for this is generally understood. If the planet's temperature increases, evaporation of water increases, and the absorption of radiation increases. This increases the temperature and the feedback continues until all water is in the atmosphere. The resulting equilibrium temperature is very high, much higher than the equilibrium temperature of a point with slightly lower solar flux. One can picture that as solar flux increases, planetary temperature also increases until the runaway point where temperature suddenly "jumps" to a higher value, in response to all the available water now residing in the atmosphere. This new equilibrium is called a "runaway greenhouse" and it has been theorized that this is what happened to the planet Venus, where the surface temperature is more than 700 K (427 C).

  11. Polycyclic aromatic hydrocarbons in Haliotis tuberculata (Linnaeus, 1758) (Mollusca, Gastropoda): Considerations on food safety and source investigation.

    PubMed

    Conte, Francesca; Copat, Chiara; Longo, Sabrina; Conti, Gea Oliveri; Grasso, Alfina; Arena, Giovanni; Dimartino, Angela; Brundo, Maria Violetta; Ferrante, Margherita

    2016-08-01

    Polycyclic aromatic hydrocarbons were analyzed in wild specimens of Haliotis tuberculata from three sites of the Sothern Ionian Sea. The species Ht is commonly found at these sites and has significant commercial value. Main results revealed mean values of benzo(a)pyrene higher than the threshold set by Regulation No. 835/2011/EU in all sampling sites and the sum of selected PAHs, expressed as ΣPAH4 by EC Regulation, were below the limit set by the same Regulation in ME and VSG. We found generally higher concentrations than literature finding, especially for low molecular weight PAHs, and results of diagnostic ratios highlighted both pyrolytic and petrogenic sources. The potential human health risks due consumption of Ht by local inhabitants have been assessed by exposure daily intake (EDI), target hazard quotient (THQ) and lifetime cancer risk (CR). EDI values were below the intake range reviewed by EFSA for each class of contaminant. BaP daily intake was below the value of 10 ng/Kg/day, suggested by JFCFA, and CRBaP was slightly higher than the acceptable risk level (ARL) of 1×10(-5). Conversely, target hazard quotient (THQ) resulted always below 1, thus the risk to develop chronic systemic effects due naphthalene, acenaphthene, fluorene, anthracene, fluoranthene and pyrene was low. Copyright © 2016 Elsevier Ltd. All rights reserved.

  12. Dielectric behavior and transport properties of ZnO nanorods

    NASA Astrophysics Data System (ADS)

    Soosen Samuel, M.; Koshy, Jiji; Chandran, Anoop; George, K. C.

    2011-08-01

    Highly optical, good crystalline and randomly aligned ZnO nanorods were synthesized by the hydrothermal method. The dielectric properties of ZnO nanorods were attributed to the interfacial polarization at low frequencies (below 10 kHz) and orientational polarization at higher frequencies. The observed ω( n-1) dependence of dielectric loss was discussed on the basis of the Universal model of dielectric response. Dielectric loss peak was composed of the Debye like loss peak at higher frequencies and interfacial loss peak at lower frequencies. Charge transport through the grain and grain boundary region was investigated by impedance spectroscopy. At higher temperatures the conductivity of the nanorod was mainly through the grain interior and the overall impedance was contributed by the grain boundary region. The activation energy of nanorod was calculated as 0.078 eV, which is slightly higher than the reported bulk value.

  13. Effect of 400 ml blood loss on adaptation of certain functions of the organism to exercise.

    PubMed

    Markiewicz, K; Cholewa, M; Górski, L; Jaszczuk, J; Chmura, J; Bartniczak, Z

    1981-01-01

    Eighteen men aged 19-23 years, volunteer blood donors, donated 400 ml of blood. Twenty-four hours before donation, one hour and 24 hours after it they performed a 10-minute exercise on Monark cycle ergometer at workloads raising the heart rate to 170/min. During the exercise the oxygen uptake (VO2), carbon dioxide elimination (VCO2), respiratory quotient (RQ), oxygen uptake to maximal oxygen uptake ratio (VO2/VO2 max), heart rate (HR) and systolic and diastolic arterial blood pressure (Ps and Pd) were determined. The obtained results were compared with the values of haemoglobin concentration and erythrocyte count. One hour after blood donation raised values of HR and Pd were obtained (p less than 0.05) with decreased Ps (p less than 0.05) and VO2 (p less than 0.05). Twenty-four hours after blood loss these parameters were not different from the initial ones (p less than 0.05). Submaximal exercise performed 1 hour after blood loss produced a significantly greater increase of the heart rate than this exercise performed before blood loss. The values of VO2, VCO2, and VO2/VO2 max were slightly lower and those of RQ and HRXPs slightly higher than during control exercise (p less than 0.05). Exercise performed 24 hours after blood loss caused identical changes in these parameters as during control tests.

  14. Cereal sprouts: composition, nutritive value, food applications.

    PubMed

    Lorenz, K

    1980-01-01

    The practice of sprouting of cereal grains has become popular in the western world. Sprouted grains are thought of as having exceptional nutritive value. Sprouting is easy and can be done without sophisticated equipment. Untreated seeds of good quality and high germination percentage are placed in an environment of adequate water, a desirable temperature, and a certain composition of gases in the atmosphere for several days for sprouting. The sprouts can be kept for a few days to over a week under refrigeration. They can be used in many different foods including breakfast items, salads, soups, casseroles, pasta, and baked products. Sprouting of grains causes increased enzyme activity, a loss of total dry matter, an increase in total protein, a change in amino acid composition, a decrease in starch, increases in sugars, a slight increase in crude fat and crude fiber, and slightly higher amounts of certain vitamins and minerals. Most of the increases in nutrients are not true increases, however. They simply reflect the loss of dry matter, mainly in the form of carbohydrates, due to respiration during sprouting. As total carbohydrates decreases, the percentage of other nutrients increases. There are no nutritional evaluations of cereal sprouts in humans. Animal studies with cattle, pigs, chickens, and rats have failed to show a superior nutritive value of sprouted grains over ungerminated grains. Studies with humans are not likely to produce more encouraging results.

  15. Soil gas geochemistry in relation to eruptive fissures on Timanfaya volcano, Lanzarote Island (Canary Islands, Spain)

    NASA Astrophysics Data System (ADS)

    Padrón, Eleazar; Padilla, Germán; Hernández, Pedro A.; Pérez, Nemesio M.; Calvo, David; Nolasco, Dácil; Barrancos, José; Melián, Gladys V.; Dionis, Samara; Rodríguez, Fátima

    2013-01-01

    We report herein the first results of an extensive soil gas survey performed on Timanfaya volcano on May 2011. Soil gas composition at Timanfaya volcano indicates a main atmospheric source, slightly enriched in CO2 and He. Soil CO2 concentration showed a very slight deep contribution of the Timanfaya volcanic system, with no clear relation to the main eruptive fissures of the studied area. The existence of soil helium enrichments in Timanfaya indicates a shallow degassing of crustal helium and other possible deeper sources probably form cooling magma bodies at depth. The main soil helium enrichments were observed in good agreement with the main eruptive fissures of the 1730-36 eruption, with the highest values located at those areas with a higher density of recent eruptive centers, indicating an important structural control for the leakage of helium at Timanfaya volcano. Atmospheric air slightly polluted by deep-seated helium emissions, CO2 degassed from a cooling magma body, and biogenic CO2, might be the most plausible explanation for the existence of soil gas. Helium is a deep-seated gas, exhibiting important emission rates along the main eruptive fissure of the 1730-36 eruption of Timanfaya volcano.

  16. Repair, Evaluation, Maintenance, and Rehabilitation Research Program: Redevelopment of Relief Wells, Upper Wood River Drainage and Levee District, Madison County, Illinois

    DTIC Science & Technology

    1993-11-01

    indicate that the wel rnproved to nearly their original effec- tiveness as a result of the prolongf., eriod of flow during the flood. Evalua- tion of... flow data from the Flood of. )73 indicated restored yields in some of the test wells of slightly higher than 100 percent of the original values. Tests...redevelopment and flushing of bacterial residue occurred as a result of the high flows . The same studies indicated that the test wells of the Upper Wood

  17. TNT Prout-Tompkins Kinetics Calibration with PSUADE

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wemhoff, A P; Hsieh, H

    2007-04-11

    We used the code PSUADE to calibrate Prout-Tompkins kinetic parameters for pure recrystallized TNT. The calibration was based on ALE3D simulations of a series of One Dimensional Time to Explosion (ODTX) experiments. The resultant kinetic parameters differed from TNT data points with an average error of 28%, which is slightly higher than the value of 23% previously calculated using a two-point optimization. The methodology described here provides a basis for future calibration studies using PSUADE. The files used in the procedure are listed in the Appendix.

  18. The Relative Rates of Secondary Hydration in Basalt and Rhyolite, and the use of δD as a Paleoclimate Indicator: Implications for Paleoenvironmental and Volcanic Degassing Studies

    NASA Astrophysics Data System (ADS)

    Seligman, A. N.; Bindeman, I. N.

    2014-12-01

    The δD-H2O correlation is important for volcanic degassing and secondary hydration trends. We utilize the caibration of the TC/EA - MAT 253 continuous flow system, which permits us to analyze wt.% H2O and its δD extracted from 1-8 mg of glass with as little as 0.1 wt% H2O. Tephra that has been secondarily hydrated with meteoric water is widely used as a paleoenvironmental tool, but the rate of secondary hydration, the relative amounts of primary magmatic (degassed) and secondary meteoric water, and the retention of primary and secondary δD values are not well understood. To quantify these processes, we use a natural experiment involving dated Holocene tepha in Kamchatka and Oregon. Our research illustrates the drastic difference in hydration rates between silicic (hydrated after ~1.5 ka) and mafic tephra, which is not hydrated in the Holocene (similar to results for submarine volcanic glasses), and andesitic tephra with intermediate degrees of hydration. The 0.05-7.3 ka basaltic scoria from Klyuchevskoy volcano retains ≤0.45 wt.% primary magmatic H2O, with δD values from -99 to -121 ‰. Four other 0.05-7.6 ka basaltic tephra units from Kamchatka with <57 wt.% SiO2 all have wt.% H2O 0.21-0.84 and δD values ranging from -90 - -145 ‰. The 1.0-7.6 ka andesitic tephra have slightly higher water contents (0.9-3.0 %) and slightly lower δD values (-113 - -146 ‰). Seven 0.3-7.9 ka silicic samples with SiO2 >65 wt.% have higher (1.5 -3.4) wt.% H2O and δD values between -115 - -160 ‰. We interpret the lower δD values and higher water contents (opposite of the magmatic degassing trend) to be a characteristic of secondary hydration in regions of higher latitude such as Kamchatka and Oregon. We are also investigating 7.7 ka Mt. Mazama tephra in Oregon that are known to be fully hydrated and cover nearly 5000 km2 northeast of Crater Lake and range in elevation from ~1.3-1.9 km to understand the δD and δ18O details of the hydrated water's correspondence with local Holocene meteoric waters. In the future, we plan to use a combination of δD in mid-high latitude precipitation to delineate δD-H2O hydration trends to better understand the distinction between primary magmatic and secondary meteoric water in volcanic glass, and the exchange of hydrogen isotopes between OH- and H2Omol sites in volcanic glass.

  19. The red tide event in El Salvador, August 2001-January 2002.

    PubMed

    Enrique Barraza, José; Armero-Guardado, Julio; Valencia de Toledo, Zobeyda Marisol

    2004-09-01

    A red tide event occurred in El Salvador from August 2001 to January 2002. National health authorities usually measured toxin levels in Ostrea iridescens, however other species were analyzed during this microalgae bloom: Anadara similis, Anadara tuberculosa and Modiolus sp. El Salvador authorities consider 400 mouse units/100 g the highest value that is safe for human health. During this period toxin levels in 0. iridescens and Modiolus sp. increased from values under 400 to 3977 and 15,468 mouse units/100 g, respectively. Persistent and higher levels were recorded in oyster and mussel banks on the west part of the country. The Ministry of Health and Social Assistance treated 41 slight to moderate intoxications associated to bivalve mollusks consumption.

  20. The WEPP Model Application in a Small Watershed in the Loess Plateau

    PubMed Central

    Han, Fengpeng; Ren, Lulu; Zhang, Xingchang; Li, Zhanbin

    2016-01-01

    In the Loess Plateau, soil erosion has not only caused serious ecological and environmental problems but has also impacted downstream areas. Therefore, a model is needed to guide the comprehensive control of soil erosion. In this study, we introduced the WEPP model to simulate soil erosion both at the slope and watershed scales. Our analyses showed that: the simulated values at the slope scale were very close to the measured. However, both the runoff and soil erosion simulated values at the watershed scale were higher than the measured. At the slope scale, under different coverage, the simulated erosion was slightly higher than the measured. When the coverage is 40%, the simulated results of both runoff and erosion are the best. At the watershed scale, the actual annual runoff of the Liudaogou watershed is 83m3; sediment content is 0.097 t/m3, annual erosion sediment 8.057t and erosion intensity 0.288 t ha-1 yr-1. Both the simulated values of soil erosion and runoff are higher than the measured, especially the runoff. But the simulated erosion trend is relatively accurate after the farmland is returned to grassland. We concluded that the WEPP model can be used to establish a reasonable vegetation restoration model and guide the vegetation restoration of the Loess Plateau. PMID:26963704

  1. Mutual information and redundancy in spontaneous communication between cortical neurons.

    PubMed

    Szczepanski, J; Arnold, M; Wajnryb, E; Amigó, J M; Sanchez-Vives, M V

    2011-03-01

    An important question in neural information processing is how neurons cooperate to transmit information. To study this question, we resort to the concept of redundancy in the information transmitted by a group of neurons and, at the same time, we introduce a novel concept for measuring cooperation between pairs of neurons called relative mutual information (RMI). Specifically, we studied these two parameters for spike trains generated by neighboring neurons from the primary visual cortex in the awake, freely moving rat. The spike trains studied here were spontaneously generated in the cortical network, in the absence of visual stimulation. Under these conditions, our analysis revealed that while the value of RMI oscillated slightly around an average value, the redundancy exhibited a behavior characterized by a higher variability. We conjecture that this combination of approximately constant RMI and greater variable redundancy makes information transmission more resistant to noise disturbances. Furthermore, the redundancy values suggest that neurons can cooperate in a flexible way during information transmission. This mostly occurs via a leading neuron with higher transmission rate or, less frequently, through the information rate of the whole group being higher than the sum of the individual information rates-in other words in a synergetic manner. The proposed method applies not only to the stationary, but also to locally stationary neural signals.

  2. Serum lipid, uric acid and glucose levels in urban black males doing manual or clerical work.

    PubMed

    Botha, J L; Irwig, L M; Joffe, B I; Mendelsohn, D; Seftel, H C

    1981-08-15

    Serum lipid, uric acid and glucose levels were measured in four groups of Black male factory workers 1 hour after an oral glucose load. These groups comprised non-obese manual, obese manual, non-obese clerical and obese clerical workers. Obese men had significantly higher serum uric acid, total cholesterol and triglyceride levels and lower high=density lipoprotein (HDL) cholesterol levels than non-obese men. Serum glucose and low-density lipoprotein (LDL) cholesterol values were also higher in obese than in non-obese men, but the differences were not significant. Clerical workers had higher levels than manual workers for most of the biochemical variables measured, but only in the case of uric acid was the difference significant. Possible reasons for the fact that the effect of occupation on the variables was slight are briefly discussed.

  3. In vitro fermentation characteristics and effective utilisable crude protein in leaves and green pods of Moringa stenopetala and Moringa oleifera cultivated at low and mid-altitudes.

    PubMed

    Melesse, A; Steingass, H; Boguhn, J; Rodehutscord, M

    2013-06-01

    This study was conducted to assess the in vitro nutrient digestibility and utilisation of leaves and green pods of two Moringa species in supplementing the feed of ruminant animals during the dry season. Samples were analysed for proximate nutrients using official methods. The metabolisable energy (ME), organic matter digestibility (OMD) and effective utilisable crude protein (uCP) were estimated using the Hohenheim in vitro gas test method. Gas volume in Moringa stenopetala leaves and green pods was generally higher than those of Moringa oleifera. Gas volume for leaves was similar between low and mid-altitudes but was higher for green pods at mid-altitude. M. stenopetala leaves contained significantly higher ME (9.8 MJ/kg DM) and OMD (75%) than those of M. oleifera. Similarly, M. stenopetala green pods had higher ME and OMD values than those of M. oleifera. For green pods, the ME and OMD values were significantly higher at mid-altitude than those at low altitude although these values for leaves were similar between both altitudes. Moringa oleifera leaves had higher effective uCP than those of M. stenopetala. Nevertheless, the effective uCP was higher for green pods of M. stenopetala than those of M. oleifera. The effective uCP for leaves cultivated at mid-altitude was slightly higher than those at low altitude. This study suggested that leaves and green pods could be used as alternative energy and protein supplements for tropical ruminants, particularly during dry periods. It was further concluded that leaves were generally better in nutrient compositions and in vitro nutrient digestibility characteristics than green pods. © 2012 Blackwell Verlag GmbH.

  4. Personality Profiles, Values and Empathy: Differences between Lacto-Ovo-Vegetarians and Vegans.

    PubMed

    Kessler, Christian S; Holler, Sophie; Joy, Sebastian; Dhruva, Anand; Michalsen, Andreas; Dobos, Gustav; Cramer, Holger

    2016-01-01

    Vegetarian nutrition is gaining increasing public attention worldwide. While some studies have examined differences in motivations and personality traits between vegetarians and omnivores, only few studies have considered differences in motivations and personality traits between the 2 largest vegetarian subgroups: lacto-ovo-vegetarians and vegans. To examine differences between lacto-ovo-vegetarians and vegans in the distribution patterns of motives, values, empathy, and personality profiles. An anonymous online survey was performed in January 2014. Group differences between vegetarians and vegans in their initial motives for the choice of nutritional approaches, health-related quality of life (World Health Organization Quality of Life-BREF (WHOQOL-BREF)), personality traits (Big Five Inventory-SOEP (BFI-S)), values (Portraits Value Questionnaire (PVQ)), and empathy (Empathizing Scale) were analyzed by univariate analyses of covariance; P values were adjusted for multiple testing. 10,184 individuals completed the survey; 4,427 (43.5%) were vegetarians and 4,822 (47.3%) were vegans. Regarding the initial motives for the choice of nutritional approaches, vegans rated food taste, love of animals, and global/humanitarian reasons as more important, and the influence of their social environment as less important than did vegetarians. Compared to vegetarians, vegans had higher values on physical, psychological, and social quality of life on the WHOQOL-BREF, and scored lower on neuroticism and higher on openness on the BFI-S. In the PVQ, vegans scored lower than vegetarians on power/might, achievement, safety, conformity, and tradition and higher on self-determination and universalism. Vegans had higher empathy than vegetarians (all p < 0.001). This survey suggests that vegans have more open and compatible personality traits, are more universalistic, empathic, and ethically oriented, and have a slightly higher quality of life when compared to vegetarians. Given the small absolute size of these differences, further research is needed to evaluate whether these group differences are relevant in everyday life and can be confirmed in other populations. © 2016 S. Karger GmbH, Freiburg.

  5. Photoacclimation in a tropical population of Cladophora glomerata (L.) Kützing 1843 (Chlorophyta) from southeastern Brazil.

    PubMed

    Bautista, A I N; Necchi-Júnior, O

    2008-02-01

    Photoacclimation of photosynthesis was investigated in a tropical population of C. glomerata (São Paulo State, southeastern Brazil, 20 degrees 48' 24" S and 49 degrees 22' 24" W) by chlorophyll fluorescence parameters and chlorophyll a content. Plants were acclimated to two levels of irradiance: low (65 +/- 5 micromol.m(-2).s(-1)) and high (300 +/- 10 micromol.m(-2).s(-1)) and exposed short-term (4 days) and long-term (28 days) under a light-dark cycle of 12:12 hours. Photosynthesis-irradiance (PI) curves revealed distinct strategies of photoacclimation. In long-term exposure, plants acclimated by altering the photosynthetic units (PSU) number and keeping fixed the PSU size, revealed by increased rates of maximum photosynthesis (Pmax), lower photosynthetic efficiency (alpha) and higher values of the saturation parameter (Ik) under high irradiance. The short-term acclimation strategy consisted of changing the PSU size, with a fixed number of PSUs, as revealed by similar Pmax but higher alpha and lower Ik under low irradiance. Chlorophyll a contents followed the general pattern reported in green algae of higher concentrations under lower irradiance. Dark/light induction curves revealed consistently higher values of potential quantum yield under low irradiance. Initial and final values showed a higher recovery capacity in the short (84.4-90.6%) term exposure than in the long-term case (81.4-81.5%). ETR (electron transport rate) and NPQ (non-photochemical quenching) values were consistently higher under low irradiance. ETR showed a continuous and steady increase along the light exposure period in the short and long-term experiments, whereas NPQ values revealed a rapid increase after 15 seconds of light exposure, kept a slightly increasing trend and stabilized in most treatments. Lower photosynthetic performance (ETR) and recovery capacity of potential quantum yield were observed, particularly in long-term exposure, suggesting that this population is constrained by the typical high light environment of tropical regions.

  6. Oxidation in Acidic Medium of Lignins from Agricultural Residues

    NASA Astrophysics Data System (ADS)

    Labat, Gisele Aparecida Amaral; Gonçalves, Adilson Roberto

    Agricultural residues as sugarcane straw and bagasse are burned in boilers for generation of energy in sugar and alcohol industries. However, excess of those by-products could be used to obtain products with higher value. Pulping process generates cellulosic pulps and lignin. The lignin could be oxidized and applied in effluent treatments for heavy metal removal. Oxidized lignin presents very strong chelating properties. Lignins from sugarcane straw and bagasse were obtained by ethanol-water pulping. Oxidation of lignins was carried out using acetic acid and Co/Mn/Br catalytical system at 50, 80, and 115 °C for 5 h. Kinetics of the reaction was accomplished by measuring the UV-visible region. Activation energy was calculated for lignins from sugarcane straw and bagasse (34.2 and 23.4 kJ mol-1, respectively). The first value indicates higher cross-linked formation. Fourier-transformed infrared spectroscopy data of samples collected during oxidation are very similar. Principal component analysis applied to spectra shows only slight structure modifications in lignins after oxidation reaction.

  7. Storage stability and composition changes of three cold-pressed nut oils under refrigeration and room temperature conditions.

    PubMed

    Rabadán, Adrián; Álvarez-Ortí, Manuel; Pardo, José Emilio; Alvarruiz, Andrés

    2018-09-01

    Chemical composition and stability parameters of three cold-pressed nut oils (almond, walnut and pistachio) were monitored for up to 16 months of storage at 5 °C, 10 °C, 20 °C and room temperature. Freshly pressed pistachio oil had lower peroxide value than almond oil and higher induction period than almond and walnut oils, indicating a higher stability. The peroxide values increased faster at room temperature than at lower temperatures during the storage time, and the highest increase was for pistachio oil stored at room temperature exposed to daylight. The induction period decreased for all three nut oils during the storage time, regardless of the storage conditions. Pistachio oil remained the most stable oil at the end of the storage time, followed by almond oil. The percentage of polyunsaturated fatty acids decreased slightly throughout the storage. Copyright © 2018 Elsevier Ltd. All rights reserved.

  8. Quantification of myocardial fibrosis by digital image analysis and interactive stereology

    PubMed Central

    2014-01-01

    Background Cardiac fibrosis disrupts the normal myocardial structure and has a direct impact on heart function and survival. Despite already available digital methods, the pathologist’s visual score is still widely considered as ground truth and used as a primary method in histomorphometric evaluations. The aim of this study was to compare the accuracy of digital image analysis tools and the pathologist’s visual scoring for evaluating fibrosis in human myocardial biopsies, based on reference data obtained by point counting performed on the same images. Methods Endomyocardial biopsy material from 38 patients diagnosed with inflammatory dilated cardiomyopathy was used. The extent of total cardiac fibrosis was assessed by image analysis on Masson’s trichrome-stained tissue specimens using automated Colocalization and Genie software, by Stereology grid count and manually by Pathologist’s visual score. Results A total of 116 slides were analyzed. The mean results obtained by the Colocalization software (13.72 ± 12.24%) were closest to the reference value of stereology (RVS), while the Genie software and Pathologist score gave a slight underestimation. RVS values correlated strongly with values obtained using the Colocalization and Genie (r > 0.9, p < 0.001) software as well as the pathologist visual score. Differences in fibrosis quantification by Colocalization and RVS were statistically insignificant. However, significant bias was found in the results obtained by using Genie versus RVS and pathologist score versus RVS with mean difference values of: -1.61% and 2.24%. Bland-Altman plots showed a bidirectional bias dependent on the magnitude of the measurement: Colocalization software overestimated the area fraction of fibrosis in the lower end, and underestimated in the higher end of the RVS values. Meanwhile, Genie software as well as the pathologist score showed more uniform results throughout the values, with a slight underestimation in the mid-range for both. Conclusion Both applied digital image analysis methods revealed almost perfect correlation with the criterion standard obtained by stereology grid count and, in terms of accuracy, outperformed the pathologist’s visual score. Genie algorithm proved to be the method of choice with the only drawback of a slight underestimation bias, which is considered acceptable for both clinical and research evaluations. Virtual slides The virtual slide(s) for this article can be found here: http://www.diagnosticpathology.diagnomx.eu/vs/9857909611227193 PMID:24912374

  9. Quantification of myocardial fibrosis by digital image analysis and interactive stereology.

    PubMed

    Daunoravicius, Dainius; Besusparis, Justinas; Zurauskas, Edvardas; Laurinaviciene, Aida; Bironaite, Daiva; Pankuweit, Sabine; Plancoulaine, Benoit; Herlin, Paulette; Bogomolovas, Julius; Grabauskiene, Virginija; Laurinavicius, Arvydas

    2014-06-09

    Cardiac fibrosis disrupts the normal myocardial structure and has a direct impact on heart function and survival. Despite already available digital methods, the pathologist's visual score is still widely considered as ground truth and used as a primary method in histomorphometric evaluations. The aim of this study was to compare the accuracy of digital image analysis tools and the pathologist's visual scoring for evaluating fibrosis in human myocardial biopsies, based on reference data obtained by point counting performed on the same images. Endomyocardial biopsy material from 38 patients diagnosed with inflammatory dilated cardiomyopathy was used. The extent of total cardiac fibrosis was assessed by image analysis on Masson's trichrome-stained tissue specimens using automated Colocalization and Genie software, by Stereology grid count and manually by Pathologist's visual score. A total of 116 slides were analyzed. The mean results obtained by the Colocalization software (13.72 ± 12.24%) were closest to the reference value of stereology (RVS), while the Genie software and Pathologist score gave a slight underestimation. RVS values correlated strongly with values obtained using the Colocalization and Genie (r>0.9, p<0.001) software as well as the pathologist visual score. Differences in fibrosis quantification by Colocalization and RVS were statistically insignificant. However, significant bias was found in the results obtained by using Genie versus RVS and pathologist score versus RVS with mean difference values of: -1.61% and 2.24%. Bland-Altman plots showed a bidirectional bias dependent on the magnitude of the measurement: Colocalization software overestimated the area fraction of fibrosis in the lower end, and underestimated in the higher end of the RVS values. Meanwhile, Genie software as well as the pathologist score showed more uniform results throughout the values, with a slight underestimation in the mid-range for both. Both applied digital image analysis methods revealed almost perfect correlation with the criterion standard obtained by stereology grid count and, in terms of accuracy, outperformed the pathologist's visual score. Genie algorithm proved to be the method of choice with the only drawback of a slight underestimation bias, which is considered acceptable for both clinical and research evaluations. The virtual slide(s) for this article can be found here: http://www.diagnosticpathology.diagnomx.eu/vs/9857909611227193.

  10. A study on the hemocompatibility of dendronized chitosan derivatives in red blood cells

    PubMed Central

    Zhou, Yanfang; Li, Jiemei; Lu, Fang; Deng, Junjie; Zhang, Jiahua; Fang, Peijie; Peng, Xinsheng; Zhou, Shu-Feng

    2015-01-01

    Dendrimers are hyperbranched macromolecules with well-defined topological structures and multivalent functionalization sites, but they may cause cytotoxicity due to the presence of cationic charge. Recently, we have introduced alkyne-terminated poly(amidoamine) (PAMAM) dendrons of different generations (G=2,3) into chitosan to obtain dendronized chitosan derivatives [Cs-g-PAMAM (G=2,3)], which exhibited a better water solubility and enhanced plasmid DNA transfection efficiency. In this study, we attempted to examine the impact of Cs-g-PAMAM (G=2,3) at different concentrations (25 μg/mL, 50 μg/mL, and 100 μg/mL) on the morphology, surface structure, and viability of rat red blood cells (RBCs). The results showed that treatment of RBCs with Cs-g-PAMAM (G=2,3) at 50 μg/mL and 100 μg/mL induced a slightly higher hemolysis than Cs, and Cs-g-PAMAM (G=3) caused a slightly higher hemolysis than Cs-g-PAMAM (G=2), but all values were <5.0%. Optical microscopic and atomic force microscopic examinations indicated that Cs-g-PAMAM (G=2,3) caused slight RBC aggregation and lysis. Treatment of RBCs with 100 μg/mL Cs-g-PAMAM (G=3) induced echinocytic transformation, and RBCs displayed characteristic irregular contour due to the folding of the periphery. Drephanocyte-like RBCs were observed when treated with 100 μg/mL Cs-g-PAMAM (G=3). Erythrocytes underwent similar shape transition upon treatment with Cs-g-PAMAM (G=2) or Cs. The roughness values (Rms) of RBCs incubated with Cs-g-PAMAM (G=2,3) were significantly larger than those for RBCs incubated with physiological saline (P<0.01), but the Rms showed no difference for Cs and Cs-g-PAMAM (G=2,3) (P>0.05). Furthermore, Cs-g-PAMAM (G=2,3) exhibited a lower cytotoxicity in human kidney 293T cells. These results indicate that Cs-g-PAMAM (G=2,3) are hemocompatible but may disturb membrane and lipid structures at higher concentrations. Further safety and biocompatibility evaluations are warranted for Cs-g-PAMAM. Our findings prove helpful for a better understanding of the advantages of combining PAMAM dendrimers and chitosan to design and develop new, safe, and effective drug delivery vehicles. PMID:25999697

  11. An inter-comparison of surface energy flux measurement systems used during FIFE, 1987

    NASA Technical Reports Server (NTRS)

    Nie, D.; Kanemasu, E. T.; Fritschen, L. J.; Weaver, H.; Smith, E. A.; Verma, S. B.; Field, R. T.; Kustas, W.; Stewart, J. B.

    1990-01-01

    During the first International Satellite Land Surface Climatology Program Field Experiment (FIFE-87), surface energy fluxes were measured at 22 flux sites by nine groups of scientists using different measuring systems. A rover Bowen ratio station was taken to nearly all the flux stations to serve as a reference for estimating the instrument related differences. The rover system was installed within a few meters from the host instrument of a site. Net radiation, Bowen ratio, and latent heat fluxes were compared between the rover and the host for the stations visited. Linear regression analysis was used to examine the relationship between rover measurements and host measurements. These inter-comparisons are needed to examine the influence of instrumentation on measurement uncertainty. Highly significant effects of instrument type were detected from these comparisons. Instruments of the same type showed average differences of less than 5 percent for net radiation, 10 percent for Bowen ratio, and 6 percent for latent heat flux. The corresponding average differences for different types of instruments can be up to 10, 30, and 20 percent respectively. The Didcot net radiometer gave higher net radiation while the Swissteco type showed lower values, as compared to the corrected REBS model. The 4-way components methed and the Thornswaite type give similar values to the REBS. The SERBS type Bowen ratio systems exhibit slightly lower Bowen ratios and thus higher latent heat fluxes, compared to the AZET systems. Eddy correlation systems showed slightly lower latent heat flux in comparison to the Bowen ratio systems.

  12. Large Decadal Decline of the Arctic Multiyear Ice Cover

    NASA Technical Reports Server (NTRS)

    Comiso, Josefino C.

    2012-01-01

    The perennial ice area was drastically reduced to 38% of its climatological average in 2007 but recovered slightly in 2008, 2009, and 2010 with the areas being 10%, 24%, and 11% higher than in 2007, respectively. However, trends in extent and area remained strongly negative at -12.2% and -13.5% decade (sup -1), respectively. The thick component of the perennial ice, called multiyear ice, as detected by satellite data during the winters of 1979-2011 was studied, and results reveal that the multiyear ice extent and area are declining at an even more rapid rate of -15.1% and -17.2% decade(sup -1), respectively, with a record low value in 2008 followed by higher values in 2009, 2010, and 2011. Such a high rate in the decline of the thick component of the Arctic ice cover means a reduction in the average ice thickness and an even more vulnerable perennial ice cover. The decline of the multiyear ice area from 2007 to 2008 was not as strong as that of the perennial ice area from 2006 to 2007, suggesting a strong role of second-year ice melt in the latter. The sea ice cover is shown to be strongly correlated with surface temperature, which is increasing at about 3 times the global average in the Arctic but appears weakly correlated with the Arctic Oscillation (AO), which controls the atmospheric circulation in the region. An 8-9-yr cycle is apparent in the multiyear ice record, which could explain, in part, the slight recovery in the last 3 yr.

  13. [Quantification of the gnostic sensitivity via measurement of the vibration threshold and of finger tip sensation].

    PubMed

    Oosterhuis, H J; Bouwsma, C; van Halsema, B; Hollander, R A; Kros, C J; Tombroek, I

    1992-10-03

    Quantification of vibration perception and fingertip sensation in routine neurological examination. Neurological Clinic, University Hospital, Groningen, the Netherlands. Prospective, controlled investigation. Vibration perception and fingertip sensation were quantified in a large group of normal control persons of various ages and in neurological patients and compared with the usual sensory tests at routine neurological examination. The vibration perception limit was measured with a biothesiometer without accelerometer, the fingertip sensation with a device for two-point discrimination slightly modified according to Renfrew ('Renfrew meter'). Concordance of the tests was studied by calculating kappa values. The normal values of both sensory qualities had a log-normal distribution and increased with age. The values obtained with the Renfrew meter correlated well with those of the two-point discrimination and stereognosis but were systematically higher than those indicated by Renfrew. Both methods appear useful at routine neurological examination if certain measuring precautions are taken.

  14. A case report of a TPS dental implant rigidly connected to a natural tooth: 19-year follow-up

    PubMed Central

    Quaranta, Alessandro; Poli, Ottavia; Vozza, Iole

    2013-01-01

    Summary Aim A partial edentulous area was restored with a tooth to implant fixed partial denture and a rigid connection between the two elements. Maintenance recalls were performed over a 19-year period of observation on a yearly basis. Methods The following parameters were collected during each examination over the entire period of observation: PD around the implant and natural tooth abutment, gingival index, modified gingival index, plaque index, modified plaque index, occlusal assessment, marginal bone loss. Radiographic assessment of peri-implant bone remodeling was performed in a retrospective way. The following reference points were assessed on each image: fixture-abutment junction, threads, first contact of the crestal bone with the implant on both mesial and distal side. This made possible, with the known values for implant diameter and length, to make linear measurements of remaining peri-implant bone measured from the mesial and distal marginal bone levels and the fixture-abutment junction. The amount of bone change over the baseline to a 19 years follow-up observation time was calculated for both the implant and the natural tooth. Results Clinical parameters showed healthy values over the entire period of observation with slight isolated positive bleeding on probing. Bone remodeling values were constant over the entire period with slight higher values around the tooth. Peri-apical radiographs did not show any intrusion of the tooth. Conclusions The present case report showed the complete functionality and stability of a tooth to implant rigidly connected FPD over a period of 19 years. PMID:24611092

  15. [Bread from the bioactivated wheat grain with the raised nutrition value].

    PubMed

    Ponomareva, E I; Alekhina, N N; Bakaeva, I A

    2016-01-01

    Bread from the bioactivated grain of wheat differs in high content of dietary fibers, minerals and vitamins compared to traditional types of bread, but, despite this, it has low protein and lysine content. The aim of the study was the development of bread with the raised nutritional value from the bioactivated wheat grain by use of flour from cake of wheat germ (6.5%). It has been established that the flour from wheat germ has protein biological value (77.4%) and the amino acid score according to lysine (100.3%) above 12 and 40.5%, respectively, compared with those from bioactivated wheat. During calculation of nutritive, biological and energy value of products from the bioactivated wheat grain it is revealed that the biological value of bread from wheat germ flour slightly exceeded the biological value of the bread without its addition and amounted to 70.80%, due to a high protein content and a balanced amino acid composition. The protein content in the test sample of bakery products was 19.0% higher than the control, phosphorus - 13.0%, zinc - 50.0%.

  16. Evaluation of different mathematical models and different b-value ranges of diffusion-weighted imaging in peripheral zone prostate cancer detection using b-value up to 4500 s/mm2

    PubMed Central

    Feng, Zhaoyan; Min, Xiangde; Margolis, Daniel J. A.; Duan, Caohui; Chen, Yuping; Sah, Vivek Kumar; Chaudhary, Nabin; Li, Basen; Ke, Zan; Zhang, Peipei; Wang, Liang

    2017-01-01

    Objectives To evaluate the diagnostic performance of different mathematical models and different b-value ranges of diffusion-weighted imaging (DWI) in peripheral zone prostate cancer (PZ PCa) detection. Methods Fifty-six patients with histologically proven PZ PCa who underwent DWI-magnetic resonance imaging (MRI) using 21 b-values (0–4500 s/mm2) were included. The mean signal intensities of the regions of interest (ROIs) placed in benign PZs and cancerous tissues on DWI images were fitted using mono-exponential, bi-exponential, stretched-exponential, and kurtosis models. The b-values were divided into four ranges: 0–1000, 0–2000, 0–3200, and 0–4500 s/mm2, grouped as A, B, C, and D, respectively. ADC, , D*, f, DDC, α, Dapp, and Kapp were estimated for each group. The adjusted coefficient of determination (R2) was calculated to measure goodness-of-fit. Receiver operating characteristic curve analysis was performed to evaluate the diagnostic performance of the parameters. Results All parameters except D* showed significant differences between cancerous tissues and benign PZs in each group. The area under the curve values (AUCs) of ADC were comparable in groups C and D (p = 0.980) and were significantly higher than those in groups A and B (p< 0.05 for all). The AUCs of ADC and Kapp in groups B and C were similar (p = 0.07 and p = 0.954), and were significantly higher than the other parameters (p< 0.001 for all). The AUCs of ADC in group D was slightly higher than Kapp (p = 0.002), and both were significantly higher than the other parameters (p< 0.001 for all). Conclusions ADC derived from conventional mono-exponential high b-value (3200 s/mm2) models is an optimal parameter for PZ PCa detection. PMID:28199367

  17. Selected nutrient contents, fatty acid composition, including conjugated linoleic acid, and retention values in separable lean from lamb rib loins as affected by external fat and cooking method.

    PubMed

    Badiani, Anna; Montellato, Lara; Bochicchio, Davide; Anfossi, Paola; Zanardi, Emanuela; Maranesi, Magda

    2004-08-11

    Proximate composition and fatty acid profile, conjugated linoleic acid (CLA) isomers included, were determined in separable lean of raw and cooked lamb rib loins. The cooking methods compared, which were also investigated for cooking yields and true nutrient retention values, were dry heating of fat-on cuts and moist heating of fat-off cuts; the latter method was tested as a sort of dietetic approach against the more traditional former type. With significantly (P < 0.05) lower cooking losses, dry heating of fat-on rib-loins produced slightly (although only rarely significantly) higher retention values for all of the nutrients considered, including CLA isomers. On the basis of the retention values obtained, both techniques led to a minimum migration of lipids into the separable lean, which was higher (P < 0.05) in dry heating than in moist heating, and was characterized by the prevalence of saturated and monounsaturated fatty acids. On the whole, the response to cooking of the class of CLA isomers (including that of the nutritionally most important isomer cis-9,trans-11) was more similar to that of the monounsaturated than the polyunsaturated fatty acids.

  18. Chrystal and Proudman resonances simulated with three numerical models

    NASA Astrophysics Data System (ADS)

    Bubalo, Maja; Janeković, Ivica; Orlić, Mirko

    2018-05-01

    The aim of this work was to study Chrystal and Proudman resonances in a simple closed basin and to explore and compare how well the two resonant mechanisms are reproduced with different, nowadays widely used, numerical ocean models. The test case was based on air pressure disturbances of two commonly used shapes (a sinusoidal and a boxcar), having various wave lengths, and propagating at different speeds. Our test domain was a closed rectangular basin, 300 km long with a uniform depth of 50 m, with the theoretical analytical solution available for benchmark. In total, 2250 simulations were performed for each of the three different numerical models: ADCIRC, SCHISM and ROMS. During each of the simulations, we recorded water level anomalies and computed the integral of the energy density spectrum for a number of points distributed along the basin. We have successfully documented the transition from Proudman to Chrystal resonance that occurs for a sinusoidal air pressure disturbance having a wavelength between one and two basin lengths. An inter-model comparison of the results shows that different models represent the two resonant phenomena in a slightly different way. For Chrystal resonance, all the models showed similar behavior; however, ADCIRC model providing slightly higher values of the mean resonant period than the other two models. In the case of Proudman resonance, the most consistent results, closest to the analytical solution, were obtained using ROMS model, which reproduced the mean resonant speed equal to 22.00 m/s— i.e., close to the theoretical value of 22.15 m/s. ADCIRC and SCHISM models showed small deviations from that value, with the mean speed being slightly lower—21.97 m/s (ADCIRC) and 21.93 m/s (SCHISM). The findings may seem small but could play an important role when resonance is a crucial process producing enhancing effects by two orders of magnitude (i.e., meteotsunamis).

  19. Comparing multistate expected damages, option price and cumulative prospect measures for valuing flood protection

    NASA Astrophysics Data System (ADS)

    Farrow, Scott; Scott, Michael

    2013-05-01

    Floods are risky events ranging from small to catastrophic. Although expected flood damages are frequently used for economic policy analysis, alternative measures such as option price (OP) and cumulative prospect value exist. The empirical magnitude of these measures whose theoretical preference is ambiguous is investigated using case study data from Baltimore City. The outcome for the base case OP measure increases mean willingness to pay over the expected damage value by about 3%, a value which is increased with greater risk aversion, reduced by increased wealth, and only slightly altered by higher limits of integration. The base measure based on cumulative prospect theory is about 46% less than expected damages with estimates declining when alternative parameters are used. The method of aggregation is shown to be important in the cumulative prospect case which can lead to an estimate up to 41% larger than expected damages. Expected damages remain a plausible and the most easily computed measure for analysts.

  20. Peak insertion torque values of five mini-implant systems under different insertion loads.

    PubMed

    Quraishi, Erma; Sherriff, Martyn; Bister, Dirk

    2014-06-01

    To assess the effect of 1 and 3 kg insertion load on five makes of self-drilling mini-implants on peak insertion torque values to establish risk factors involved in the fracture of mini-implants. Two different loads were applied during insertion of 40 mini-implants from five different manufacturers (Dual Top(™) (1·6×8 mm), Infinitas(™) (1·5×9 mm), Ortho Easy(™) (1·7×8 mm), Spider Screw(™) (1·5×8 mm) and Vector TAS(™) (1·4×8 mm)) into acrylic blocks at 8 rev/min utilizing a Motorized Torque Measurement Stand. Peak insertion torque values for both loads were highest for Vector TAS followed by Ortho Easy and Dual Top and were nearly three times higher than Infinitas (original version) and Spider Screws(TM). The log-rank test showed statistically significant differences for both loads for Vector TAS, Ortho Easy and Spider Screws. Unlike other designs tested, both tapered mini-implant designs (Spider Screw and Infinitas) showed a tendency to buckle in the middle of the body but fractured at the tip. Non-tapered mini-implants fractured at significantly higher torque values compared to tapered designs under both loads. Increased pressure resulted in slightly higher maximum torque values at fracture for some of the mini-implant designs, although this is unlikely to be of clinical relevance. Tripling insertion pressure from 1 to 3 kg increased the risk of bending tapered mini-implants before fracture. © 2014 British Orthodontic Society.

  1. Canine and feline hematology reference values for the ADVIA 120 hematology system.

    PubMed

    Moritz, Andreas; Fickenscher, Yvonne; Meyer, Karin; Failing, Klaus; Weiss, Douglas J

    2004-01-01

    The ADVIA 120 is a laser-based hematology analyzer with software applications for animal species. Accurate reference values would be useful for the assessment of new hematologic parameters and for interlaboratory comparisons. The goal of this study was to establish reference intervals for CBC results and new parameters for RBC morphology, reticulocytes, and platelets in healthy dogs and cats using the ADVIA 120 hematology system. The ADVIA 120, with multispecies software (version 1.107-MS), was used to analyze whole blood samples from clinically healthy dogs (n=46) and cats (n=61). Data distribution was determined and reference intervals were calculated as 2.5 to 97.5 percentiles and 25 to 75 percentiles. Most data showed Gaussian or log-normal distribution. The numbers of RBCs falling outside the normocytic-normochromic range were slightly higher in cats than in dogs. Both dogs and cats had reticulocytes with low, medium, and high absorbance. Mean numbers of large platelets and platelet clumps were higher in cats compared with dogs. Reference intervals obtained on the ADVIA 120 provide valuable baseline information for assessing new hematologic parameters and for interlaboratory comparisons. Differences compared with previously published reference values can be attributed largely to differences in methodology.

  2. Low-Cost CdTe/Silicon Tandem Solar Cells

    DOE PAGES

    Tamboli, Adele C.; Bobela, David C.; Kanevce, Ana; ...

    2017-09-06

    Achieving higher photovoltaic efficiency in single-junction devices is becoming increasingly difficult, but tandem modules offer the possibility of significant efficiency improvements. By device modeling we show that four-terminal CdTe/Si tandem solar modules offer the prospect of 25%-30% module efficiency, and technoeconomic analysis predicts that these efficiency gains can be realized at costs per Watt that are competitive with CdTe and Si single junction alternatives. The cost per Watt of the modeled tandems is lower than crystalline silicon, but slightly higher than CdTe alone. But, these higher power modules reduce area-related balance of system costs, providing increased value especially in area-constrainedmore » applications. This avenue for high-efficiency photovoltaics enables improved performance on a near-term timeframe, as well as a path to further reduced levelized cost of electricity as module and cell processes continue to advance.« less

  3. Low-Cost CdTe/Silicon Tandem Solar Cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tamboli, Adele C.; Bobela, David C.; Kanevce, Ana

    Achieving higher photovoltaic efficiency in single-junction devices is becoming increasingly difficult, but tandem modules offer the possibility of significant efficiency improvements. By device modeling we show that four-terminal CdTe/Si tandem solar modules offer the prospect of 25%-30% module efficiency, and technoeconomic analysis predicts that these efficiency gains can be realized at costs per Watt that are competitive with CdTe and Si single junction alternatives. The cost per Watt of the modeled tandems is lower than crystalline silicon, but slightly higher than CdTe alone. But, these higher power modules reduce area-related balance of system costs, providing increased value especially in area-constrainedmore » applications. This avenue for high-efficiency photovoltaics enables improved performance on a near-term timeframe, as well as a path to further reduced levelized cost of electricity as module and cell processes continue to advance.« less

  4. A fast hybrid algorithm combining regularized motion tracking and predictive search for reducing the occurrence of large displacement errors.

    PubMed

    Jiang, Jingfeng; Hall, Timothy J

    2011-04-01

    A hybrid approach that inherits both the robustness of the regularized motion tracking approach and the efficiency of the predictive search approach is reported. The basic idea is to use regularized speckle tracking to obtain high-quality seeds in an explorative search that can be used in the subsequent intelligent predictive search. The performance of the hybrid speckle-tracking algorithm was compared with three published speckle-tracking methods using in vivo breast lesion data. We found that the hybrid algorithm provided higher displacement quality metric values, lower root mean squared errors compared with a locally smoothed displacement field, and higher improvement ratios compared with the classic block-matching algorithm. On the basis of these comparisons, we concluded that the hybrid method can further enhance the accuracy of speckle tracking compared with its real-time counterparts, at the expense of slightly higher computational demands. © 2011 IEEE

  5. Analysis of Tank 38H (HTF-38-17-52, -53) and Tank 43H (HTF-43-17-54, -55) Samples for Support of the Enrichment Control and Corrosion Control Programs

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hay, M.; Coleman, C.; Diprete, D.

    SRNL analyzed samples from Tank 38H and Tank 43H to support ECP and CCP. The total uranium in the Tank 38H surface sample was 41.3 mg/L while the sub-surface sample was 43.5 mg/L. The Tank 43H samples contained total uranium concentrations of 28.5 mg/L in the surface sample and 28.1 mg/L in the sub-surface sample. The U-235 percentage ranged from 0.62% to 0.63% for the Tank 38H samples and Tank 43H samples. The total uranium and percent U-235 results in the table appear slightly lower than recent Tank 38H and Tank 43H uranium measurements. The plutonium results in the tablemore » show a large difference between the surface and sub-surface sample concentrations for Tank 38H. The Tank 43H plutonium results closely match the range of values measured on previous samples. The Cs-137 results for the Tank 38H surface and sub-surface samples show similar concentrations slightly higher than the concentrations measured in recent samples. The Cs-137 results for the two Tank 43H samples also show similar concentrations within the range of values measured on previous samples. The four samples show silicon concentrations somewhat lower than the previous samples with values ranging from 124 to 168 mg/L.« less

  6. Effects of cadmium on bioaccumulation and biochemical stress response in rice (Oryza sativa L.).

    PubMed

    Xie, Pan-pan; Deng, Juan-wei; Zhang, Hui-min; Ma, You-hua; Cao, De-ju; Ma, Ru-xiao; Liu, Ren-jing; Liu, Cheng; Liang, Yue-gan

    2015-12-01

    This study investigated the effects of various Cd concentrations on the bioaccumulation, antioxidative defense, and stress responses of rice (Oryza sativa L.). The distribution characteristics of Cd in rice were in the following order: roots>stems>grains. The bioconcentration factor values of Cd increased at concentrations lower than 3.00 mg Cd/kg and approximately decreased to a constant value at concentrations higher than 3.00 mg Cd/kg. Rice showed a higher Cd accumulation potential at low Cd concentrations than at high Cd concentrations. The Freundlich isotherm model described well the adsorption isotherms of Cd in rice roots. The biosorption mechanism of rice roots was determined to be cooperative adsorption. The malondialdehyde (MDA) content increased at a concentration range of 0.00-5.00 mg/L, indicating the enhancement of lipid peroxidation. By contrast, the MDA content slightly decreased at concentrations higher than 5.00 mg/L. Peroxidase (POD) activity exhibited active response to oxidative stress at concentrations lower than 5.00 mg/L but was inhibited at concentrations higher than 5.00 mg/L. The response to Cd stress of the N-H, O-H and C-O functional groups in rice shoots was observed via Fourier transform infrared spectroscopy. Copyright © 2015 Elsevier Inc. All rights reserved.

  7. Genetic diversity of resin yielder Pinus merkusii from West Java - Indonesia revealed by microsatellites marker

    NASA Astrophysics Data System (ADS)

    Susilowati, A.; Rachmat, H. H.; Siregar, I. Z.; Supriyanto

    2018-02-01

    Phenotypic observation of resin yielder Pinus merkusii showed higher value of genetic variation and narrow sense heritability values for resin production trait. This result indicated that genetic factor played as dominant aspect. However, further observation using molecular marker would still be needed to overcome the weakness of phenotypic observation. This study was carried out in order to characterize the genetic diversity and genetic differentiation of resin yielder genotype candidate P.merkusii using microsatellite markers and to characterize the genetic structure in the resin yielder populations. Seventy needle and inner bark samples were collected from resin yielder in Cijambu Seedling Seed Orchard (SSO) Sumedang, West Java and further divided into two genotype candidates (lower and high resin yielder). Seven microsatellites loci (pm01, pm04, pm05, pm07, pm08, pm09a, pm12, pde5 and SPAC 11.6) were used for detection of genetic diversity. Results showed that genetic diversity in higher resin candidates was (0.551), slightly different compared lower candidates (0.545). However, cluster analysis determined that higher resin yielder grouped with lower one. Molecular variation was found to be low among populations (21%) and high among individuals within the populations (79%). Private alleles were detected both in higher yielder and also normal population.

  8. Microstructure and Texture Evolutions of Biomedical Ti-13Nb-13Zr Alloy Processed by Hydrostatic Extrusion

    NASA Astrophysics Data System (ADS)

    Ozaltin, K.; Panigrahi, A.; Chrominski, W.; Bulutsuz, A. G.; Kulczyk, M.; Zehetbauer, M. J.; Lewandowska, M.

    2017-11-01

    A biomedical β-type Ti-13Nb-13Zr (TNZ) (wt pct) ternary alloy was subjected to severe plastic deformation by means of hydrostatic extrusion (HE) at room temperature without intermediate annealing. Its effect on microstructure, mechanical properties, phase transformations, and texture was investigated by light and electron microscopy, mechanical tests (Vickers microhardness and tensile tests), and XRD analysis. Microstructural investigations by light microscope and transmission electron microscope showed that, after HE, significant grain refinement took place, also reaching high dislocation densities. Increases in strength up to 50 pct occurred, although the elongation to fracture left after HE was almost 9 pct. Furthermore, Young's modulus of HE-processed samples showed slightly lower values than the initial state due to texture. Such mechanical properties combined with lower Young's modulus are favorable for medical applications. Phase transformation analyses demonstrated that both initial and extruded samples consist of α' and β phases but that the phase fraction of α' was slightly higher after two stages of HE.

  9. The effect of aging on efferent nerve fibers regeneration in mice.

    PubMed

    Verdú, E; Butí, M; Navarro, X

    1995-10-23

    This study evaluates the influence of aging on nerve regeneration and reinnervation of target organs in mice aged 2, 6, 9, 12, 18 and 24 months. In animals of each age group the sciatic nerve was subjected to crush, section or section and suture. Reinnervation of plantar muscles and sweat glands (SG) was evaluated over three months after operation by functional methods. Reappearance of SG secretion and motor responses occurred slightly earlier in young than older mice. The degree of motor and sudomotor reinnervation, with respect to preoperative control values, was also significantly higher in young than old animals. The differences were more pronounced after 12 months of age. The degree of recovery progressively decreased with the severity of the lesion, differences being more marked in older mice. Neurorraphy improved recovery, comparatively more in older than in young mice. These results indicate that, after injuries of peripheral nerves, axonal regeneration and reinnervation are maintained throughout life, but tend to be more delayed and slightly less effective with aging.

  10. Antioxidant capacity, fatty acids profile, and descriptive sensory analysis of table olives as affected by deficit irrigation.

    PubMed

    Cano-Lamadrid, Marina; Hernández, Francisca; Corell, Mireia; Burló, Francisco; Legua, Pilar; Moriana, Alfonso; Carbonell-Barrachina, Ángel A

    2017-01-01

    The influence of three irrigation treatments (T0, no stress; T1, soft stress; and, T2, moderate stress) on the key functional properties [fatty acids, sugar alcohols, organic acids, minerals, total polyphenols content (TPC), and antioxidant activity (AA)], sensory quality, and consumers' acceptance of table olives, cv. 'Manzanilla', was evaluated. A soft water stress, T1, led to table olives with the highest oil and dry matter contents, with the highest intensities of key sensory attributes and slightly, although not significant, higher values of consumer satisfaction degree. Besides, RDI in general (T1 and T2) slightly increased green colour, the content of linoleic acid, but decreased the content of phytic acid and some minerals. The soft RDI conditions are a good option for the cultivation of olive trees because they are environmentally friendly and simultaneously maintain or even improve the functionality, sensory quality, and consumer acceptance of table olives. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  11. Intercalibration of Two Polar Satellite Instruments Without Simultaneous Nadir Observations

    NASA Astrophysics Data System (ADS)

    Manninen, Terhikki; Riihela, Aku; Schaaf, Crystal; Key, Jeffrey; Lattanzio, Alessio

    2016-08-01

    A new intercalibration method for two polar satellite instruments is presented. It is based on statistical fitting of two data sets covering the same area during the same period, but not simultaneously. Deming regression with iterative weights is used. The accuracy of the method was better than about 0.5 % for the MODIS vs. MODIS and AVHRR vs. AVHRR test data sets. The intercalibration of AVHRR vs. MODIS red and NIR channels is carried out and showed a difference of reflectance values of 2% (red) and 6 % (NIR). The red channel intercalibration has slightly higher accuracy for all cases studied.

  12. Energy metabolism of Macaca mulatta during spaceflight

    NASA Technical Reports Server (NTRS)

    Hoban-Higgins, T. M.; Stein, T. P.; Dotsenko, M. A.; Korolkov, V. I.; Fuller, C. A.

    2000-01-01

    The mean daily energy expenditure rates of two rhesus monkeys (Macaca mulatta) were determined during spaceflight on the joint U.S./Russian Bion 11 mission by the doubly labeled water (DLW, 2H218O) method. Control values were obtained from two studies performed under flight-like conditions (n = 4). The mean inflight energy expenditure for the two Bion 11 monkeys was 81.3 kcal/kg/day, which was higher than that seen previously. The average energy expenditure (77.6 +/- 4.4 kcal/kg/day) for the four ground control monkeys was slightly lower than had been measured previously.

  13. Summation by parts, projections, and stability

    NASA Technical Reports Server (NTRS)

    Olsson, Pelle

    1993-01-01

    We have derived stability results for high-order finite difference approximations of mixed hyperbolic-parabolic initial-boundary value problems (IBVP). The results are obtained using summation by parts and a new way of representing general linear boundary conditions as an orthogonal projection. By slightly rearranging the analytic equations, we can prove strict stability for hyperbolic-parabolic IBVP. Furthermore, we generalize our technique so as to yield strict stability on curvilinear non-smooth domains in two space dimensions. Finally, we show how to incorporate inhomogeneous boundary data while retaining strict stability. Using the same procedure one can prove strict stability in higher dimensions as well.

  14. Immunogenicity, safety and tolerability of inactivated trivalent influenza vaccine in overweight and obese children.

    PubMed

    Esposito, Susanna; Giavoli, Claudia; Trombetta, Claudia; Bianchini, Sonia; Montinaro, Valentina; Spada, Anna; Montomoli, Emanuele; Principi, Nicola

    2016-01-02

    Obesity may be a risk factor for increased hospitalization and deaths from infections due to respiratory pathogens. Additionally, obese patients appear to have impaired immunity after some vaccinations. To evaluate the immunogenicity, safety and tolerability of an inactivated trivalent influenza vaccine (TIV) in overweight and obese children, 28 overweight/obese pediatric patients and 23 healthy normal weight controls aged 3-14 years received a dose of TIV. Four weeks after vaccine administration, significantly higher seroprotection rates against the A/H1N1 strain were observed among overweight/obese children compared with normal weight controls (p<0.05). Four months after vaccination, similar or slightly higher seroconversion and seroprotection rates against the A/H1N1 and A/H3N2 strains were detected in overweight/obese than in normal weight children, whereas significantly higher rates of seroconversion and seroprotection against the B strain were found in overweight/obese patients than in normal weight controls (p<0.05 for seroconversion and seroprotection). Geometric mean titers (GMTs) and fold increase against B strains were significantly higher in overweight/obese patients than in normal weight controls 4 months after vaccine administration (p<0.01 for GMT values and p<0.05 for fold increase). The frequency of local and systemic reactions was similar between the groups, and there were no serious adverse events. The results of this study indicate that in overweight and obese children, antibody response to TIV administration is similar or slightly higher than that evidenced in normal weight subjects of similar age and this situation persists for at least 4 months after vaccine administration in the presence of a favorable safety profile. Copyright © 2015 Elsevier Ltd. All rights reserved.

  15. Reactive sputtering of δ-ZrH{sub 2} thin films by high power impulse magnetron sputtering and direct current magnetron sputtering

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Högberg, Hans, E-mail: hans.hogberg@liu.se; Tengdelius, Lina; Eriksson, Fredrik

    2014-07-01

    Reactive sputtering by high power impulse magnetron sputtering (HiPIMS) and direct current magnetron sputtering (DCMS) of a Zr target in Ar/H{sub 2} plasmas was employed to deposit Zr-H films on Si(100) substrates, and with H content up to 61 at. % and O contents typically below 0.2 at. % as determined by elastic recoil detection analysis. X-ray photoelectron spectroscopy reveals a chemical shift of ∼0.7 eV to higher binding energies for the Zr-H films compared to pure Zr films, consistent with a charge transfer from Zr to H in a zirconium hydride. X-ray diffraction shows that the films are single-phase δ-ZrH{sub 2} (CaF{submore » 2} type structure) at H content >∼55 at. % and pole figure measurements give a 111 preferred orientation for these films. Scanning electron microscopy cross-section images show a glasslike microstructure for the HiPIMS films, while the DCMS films are columnar. Nanoindentation yield hardness values of 5.5–7 GPa for the δ-ZrH{sub 2} films that is slightly harder than the ∼5 GPa determined for Zr films and with coefficients of friction in the range of 0.12–0.18 to compare with the range of 0.4–0.6 obtained for Zr films. Wear resistance testing show that phase-pure δ-ZrH{sub 2} films deposited by HiPIMS exhibit up to 50 times lower wear rate compared to those containing a secondary Zr phase. Four-point probe measurements give resistivity values in the range of ∼100–120 μΩ cm for the δ-ZrH{sub 2} films, which is slightly higher compared to Zr films with values in the range 70–80 μΩ cm.« less

  16. Age-related changes in hematology and plasma chemistry values of hybrid striped bass (Morone chrysops X Morone saxatilis).

    PubMed

    Hrubec, Terry C.; Smith, Stephen A.; Robertson, John L.

    2001-01-01

    Hybrid striped bass (Morone chrysops X Morone saxatilis ) are an important aquaculture species yet there are few diagnostic tools available to assess their health. Hematology and clinical chemistry analyses are not used extensively in fish medicine due to the lack of reference intervals for various fish species, and because factors such as age can affect blood values. There is little published information regarding age-related changes in blood values of juvenile fish. It is important to evaluate juvenile fish, as this is the time they are raised in aquaculture settings. Determining age-related changes in the blood values of fishes would further develop clinical pathology as a diagnostic tool, enhancing both fish medicine and the aquaculture industry. The results of standard hematology and clinical chemistry analysis were evaluated in juvenile hybrid striped bass at 4, 6, 9, 15, and 19 months of age. Values for PCV and RBC indices were significantly lower, and plasma protein concentration was significantly higher in younger fish. Total WBC and lymphocyte counts were significantly higher in fish at 6 and 9 months of age, while neutrophil and monocyte counts were higher at 6, 9, and 15 months. Eosinophil counts were significantly higher in 9-month-old fish. The majority of hematologic values fell within previously established reference intervals, indicating that only slight modification to the intervals is necessary for evaluating hematologic results of hybrid striped bass at different ages. The following analytes deviated sufficiently from adult reference intervals to warrant separate reference values: plasma protein concentration at 4 months, WBC and lymphocyte counts at 15 and 19 months, and thrombocyte-like-cells at 9 months of age. Values for most biochemical analytes were significantly different among age groups except for creatinine and potassium concentrations. Comparisons with reference intervals were not made for biochemical analytes, because established reference intervals were not available. Age-related changes in hematologic and biochemical values of striped bass were similar to those reported for rainbow trout and mammals.

  17. Degrees of Antioxidant Protection: A 2-Year Study of the Bioactive Properties of Organic Milk in Poland.

    PubMed

    Puppel, Kamila; Sakowski, Tomasz; Kuczyńska, Beata; Grodkowski, Grzegorz; Gołębiewski, Marcin; Barszczewski, Jerzy; Wróbel, Barbara; Budziński, Arkadiusz; Kapusta, Aleksandra; Balcerak, Marek

    2017-02-01

    The aim of this study was to determine the nutritional value of organic milk in Poland, investigate the influence of diet on antioxidant capacity and degree of antioxidant protection (DAP), and to examine the effect of season on the bioactive properties of milk from organic farms. From 2014 to 2015, 820 milk samples were collected from 6 organic farms during indoor feeding season (IDS) and pasture feeding season (PS). Pasture feeding season + corn grain (PSCG) cows' daily ration during pasture feeding season was enriched with 4 kg a day of corn to improve dietary energy balance. Milk obtained during PS was found to have a higher fat content, slight but significantly lower protein content compared with milk from IDS. The study showed that the content of monounsaturated fatty acids (MUFA) in milk fat was strongly linked to the concentration of polyunsaturated fatty acids (PUFA) and, to a lesser extent, on the supply of MUFA. The IDS data (concentration of vitamin E, A, and β-carotene) showed the lowest values compared with the PS and PSCG groups. Total antioxidant status (TAS) and DAP showed an increasing trend in organic milk. PSCG was associated with highest level of DAP (9% higher than PS and 79% higher than IDS) and TAS (37% higher than PS and 79% higher than IDS). The results obtained show that supplementation of the basic ration with corn grain improved both TAS and DAP. The higher DAP and TAS value is responsible for product stability, considering the risk factor related to levels of cholesterol-oxide intake in humans. © 2017 Institute of Food Technologists®.

  18. Willingness to pay per quality-adjusted life year for life-saving treatments in Thailand

    PubMed Central

    Nimdet, Khachapon; Ngorsuraches, Surachat

    2015-01-01

    Objective To estimate the willingness to pay (WTP) per quality-adjusted life year (QALY) value for life-saving treatments and to determine factors affecting the WTP per QALY value. Design A cross-sectional survey with multistage sampling and face-to-face interviews. Setting General population in the southern part of Thailand. Participants A total of 600 individuals were included in the study. Only 554 (92.3%) responses were usable for data analyses. Outcome measure Participants were asked for the maximum amount of WTP value for life-saving treatments by an open-ended question. EQ-5D-3L and visual analogue scale (VAS) were used to estimate additional QALY. Results The amount of WTP values varied from 0 to 720 000 Baht/year (approximately 32 Baht=US$1). The averages of additional QALY obtained from VAS and EQ-5D-3L were only slightly different (0.872 and 0.853, respectively). The averages of WTP per QALY obtained from VAS and EQ-5D-3L were 244720 and 243120 Baht/QALY, respectively. As compared to male participants, female participants were more likely to pay less for an additional QALY (p=0.007). In addition, participants with higher household incomes tended to have higher WTP per QALY values (p<0.001). Conclusions Our study added another WTP per QALY value specifically for life-saving treatments, which would complement the current cost-effectiveness threshold used in Thailand and optimise patient access to innovative treatments or technologies. PMID:26438135

  19. Population-based mammography screening: comparison of screen-film and full-field digital mammography with soft-copy reading--Oslo I study.

    PubMed

    Skaane, Per; Young, Kari; Skjennald, Arnulf

    2003-12-01

    To compare screen-film and full-field digital mammography with soft-copy reading in a population-based screening program. Full-field digital and screen-film mammography were performed in 3,683 women aged 50-69 years. Two standard views of each breast were acquired with each modality. Images underwent independent double reading with use of a five-point rating scale for probability of cancer. Recall rates and positive predictive values were calculated. Cancer detection rates determined with both modalities were compared by using the McNemar test for paired proportions. Retrospective side-by-side analysis for conspicuity of cancers was performed by an external independent radiologist group with experience in both modalities. In 3,683 cases, 31 cancers were detected. Screen-film mammography depicted 28 (0.76%) malignancies, and full-field digital mammography depicted 23 (0.62%) malignancies. The difference between cancer detection rates was not significant (P =.23). The recall rate for full-field digital mammography (4.6%; 168 of 3,683 cases) was slightly higher than that for screen-film mammography (3.5%; 128 of 3,683 cases). The positive predictive value based on needle biopsy results was 46% for screen-film mammography and 39% for full-field digital mammography. Side-by-side image comparison for cancer conspicuity led to classification of 19 cancers as equal for probability of malignancy, six cancers as slightly better demonstrated at screen-film mammography, and six cancers as slightly better demonstrated at full-field digital mammography. There was no statistically significant difference in cancer detection rate between screen-film and full-field digital mammography. Cancer conspicuity was equal with both modalities. Full-field digital mammography with soft-copy reading is comparable to screen-film mammography in population-based screening.

  20. Use of continuous glucose monitoring as an outcome measure in clinical trials.

    PubMed

    Beck, Roy W; Calhoun, Peter; Kollman, Craig

    2012-10-01

    Although developed to be a management tool for individuals with diabetes, continuous glucose monitoring (CGM) also has potential value for the assessment of outcomes in clinical studies. We evaluated using CGM as such an outcome measure. Data were analyzed from six previously completed inpatient studies in which both CGM (Freestyle Navigator™ [Abbott Diabetes Care, Alameda, CA] or Guardian(®) [Medtronic, Northridge, CA]) and reference glucose measurements were available. The analyses included 97 days of data from 93 participants with type 1 diabetes (age range, 5-57 years; mean, 18 ± 12 years). Mean glucose levels per day were similar for the CGM and reference measurements (median, 148 mg/dL vs. 143 mg/dL, respectively; P = 0.92), and the correlation of the two was high (r = 0.89). Similarly, most glycemia metrics showed no significant differences comparing CGM and reference values, except that the nadir glucose tended to be slightly lower and peak glucose slightly higher with reference measurements than CGM measurements (respective median, 59 mg/dL vs. 66 mg/dL [P = 0.05] and 262 mg/dL vs. 257 mg/dL [P = 0.003]) and glucose variability as measured with the coefficient of variation was slightly lower with CGM than reference measurements (respective median, 31% vs. 35%; P<0.001). A reasonably high degree of concordance exists when comparing outcomes based on CGM measurements with outcomes based on reference blood glucose measurements. CGM inaccuracy and underestimation of the extremes of hyperglycemia and hypoglycemia can be accounted for in a clinical trial's study design. Thus, in appropriate settings, CGM can be a very meaningful and feasible outcome measure for clinical trials.

  1. Replacing Alpha-Fetoprotein With Alpha-Fetoprotein-L3 Increases the Sensitivity of Prenatal Screening for Trisomy 21.

    PubMed

    Huai, Lei; Leng, Jianhang; Ma, Shenglin; Huang, Fang; Shen, Junya; Ding, Yu

    This study aimed to investigate the serum concentration of alpha-fetoprotein (AFP)-L3 in midterm pregnancies and its potential application in prenatal trisomy screening. The serum samples from 27 women with trisomy 21 fetuses and 800 women with normal fetuses were examined to measure the concentrations of AFP, AFP-L3, human chorionic gonadotropin (hCG), unconjugated estriol (uE3), and inhibin-A. The screening results of various tests consisting of these markers were analyzed. In normal pregnancies within 15-20 weeks of gestation, the medians of serum AFP-L3 were 4.63, 5.70, 5.78, 6.58, 7.03, and 7.25 pg/mL. The median of AFP-L3 MoM in the trisomy 21 group was 0.46, which was significantly lower than the value of 1 in the normal group (P < 0.05). When using a cutoff value of 1/270, the sensitivity of the triple marker test (AFP, hCG, uE3) was improved from 74% to 81% by replacing AFP with AFP-L3, with the false-positive rate slightly increased from 5.4% to 6.8%. Similarly, the sensitivity of the quad marker test (AFP, hCG, uE3, inhibin-A) was improved from 81% to 89% by replacing AFP with AFP-L3, with the false-positive rate slightly increased from 4.6% to 5.6%. Serum AFP-L3 concentration increases along with more weeks of gestation in the midterm pregnancies. Trisomy 21 screening tests with AFP replaced by AFP-L3 have higher sensitivities at the expense of slightly increased false-positive rates. This improvement in screening may help to better prepare the parents and caregivers for the special needs of newborns with trisomy 21.

  2. Use of Continuous Glucose Monitoring as an Outcome Measure in Clinical Trials

    PubMed Central

    Calhoun, Peter; Kollman, Craig

    2012-01-01

    Abstract Objective Although developed to be a management tool for individuals with diabetes, continuous glucose monitoring (CGM) also has potential value for the assessment of outcomes in clinical studies. We evaluated using CGM as such an outcome measure. Research Design and Methods Data were analyzed from six previously completed inpatient studies in which both CGM (Freestyle Navigator™ [Abbott Diabetes Care, Alameda, CA] or Guardian® [Medtronic, Northridge, CA]) and reference glucose measurements were available. The analyses included 97 days of data from 93 participants with type 1 diabetes (age range, 5–57 years; mean, 18±12 years). Results Mean glucose levels per day were similar for the CGM and reference measurements (median, 148 mg/dL vs. 143 mg/dL, respectively; P=0.92), and the correlation of the two was high (r=0.89). Similarly, most glycemia metrics showed no significant differences comparing CGM and reference values, except that the nadir glucose tended to be slightly lower and peak glucose slightly higher with reference measurements than CGM measurements (respective median, 59 mg/dL vs. 66 mg/dL [P=0.05] and 262 mg/dL vs. 257 mg/dL [P=0.003]) and glucose variability as measured with the coefficient of variation was slightly lower with CGM than reference measurements (respective median, 31% vs. 35%; P<0.001). Conclusions A reasonably high degree of concordance exists when comparing outcomes based on CGM measurements with outcomes based on reference blood glucose measurements. CGM inaccuracy and underestimation of the extremes of hyperglycemia and hypoglycemia can be accounted for in a clinical trial's study design. Thus, in appropriate settings, CGM can be a very meaningful and feasible outcome measure for clinical trials. PMID:23013201

  3. Broiler genetic strain and sex effects on meat characteristics.

    PubMed

    López, K P; Schilling, M W; Corzo, A

    2011-05-01

    A randomized complete block design within a factorial arrangement of treatments was used to evaluate the effect of strain and sex on carcass characteristics, meat quality, and sensory acceptability. Two broiler strains were reared: a commercially available strain (strain A) and a strain currently in the test phase (strain B) that has been genetically selected to maximize breast yield. Broilers were harvested in a pilot scale processing plant using commercial prototype equipment at 42 d of age. Carcasses were deboned at 4 h postmortem. The left half of each breast was evaluated for pH, color, cooking loss, shear force, and proximate analysis. The right side of each breast was used for consumer acceptability testing. Thigh meat was evaluated for proximate composition. No interactions were observed throughout the study. Male broilers had a higher (P < 0.05) live BW, carcass weight, and breast weight and lower (P < 0.05) dressing percentage and breast meat yield when compared with females. Broilers from strain B presented a higher (P < 0.05) breast yield and dressing percentage than those broilers corresponding to the commercially available broiler strain. At 24 h postmortem, female broilers presented a lower ultimate pH and higher Commission internationale de l'éclairage yellowness values (ventral side of the pectoralis major) when compared with male broilers. On average, no differences existed (P > 0.05) among treatments with respect to pH decline, cooking loss, shear values, and proximate composition. In addition, no differences (P > 0.05) existed among breast meat from the different strains with respect to consumer acceptability of appearance, texture, flavor, and overall acceptability, but breast meat from strain B was slightly preferred (P < 0.05) over that of strain A with respect to aroma. However, breast meat from both strains received scores in the range of "like slightly to like moderately." Overall data suggest that all treatments yielded high quality breast and thigh meat and strain cross did not present variability in terms of consumer acceptability.

  4. The Nation's top 25 construction aggregates producers

    USGS Publications Warehouse

    Willett, Jason Christopher

    2013-01-01

    U.S. production of construction aggregates in 2011 was 2.17 billion short tons, valued at $17.2 billion, free on board (f.o.b.) at plant. Construction aggregates production decreased by 37 percent, and the associated value decreased by 25 percent, compared with the record highs reported in 2006. In 2011, construction aggregates production increased for the first time since 2006, owing to a very slight increase in the production of both construction sand and gravel and crushed stone. The average unit value, which is the f.o.b. at plant price of a ton of material, increased slightly, but is still less than the average unit value of two years prior.

  5. Bone Healing and Hormonal Bioassay in Patients with Long-Bone Fractures and Concomitant Head Injury.

    PubMed

    Khallaf, Fathy G; Kehinde, Elijah O; Hussein, Sundus

    The aim of this study is to investigate healing of fractures in patients with concomitant head injuries and to measure blood hormone levels to elucidate the mechanism of a possible accelerated osteogenesis. One hundred and sixty-two patients were included in this study and divided into 3 cohorts: group A with head injuries only (n = 52); group B with head injuries as well as long-bone fractures (n = 50); group C with long-bone fractures only (n = 60). Fracture-healing parameters including time of appearance and thickness of the bridging callus, and blood hormonal assays were measured and compared using Student's t test. The mean time to healing was significantly lower in cohort B (6.9 ± 2.9 weeks) than C (22.4 ± 8.7 weeks; p = 0.001). The mean thickness of the healing callus was significantly higher in cohort B (26.3 ± 9.7 mm) than C (8.1 ± 5.9 mm; p = 0.002). The mean healing rate was also higher in cohort B (4.5 ± 2.3 mm/week) than C (0.38 ± 0.21 mm/week; p = 0.001). Blood hormonal assays in group B showed higher values of parathyroid hormone and growth hormone than in group C. However, adrenaline and noradrenaline values were lower in group B than in group C at all measured time intervals, and correspondingly leptin was lower in all groups (p = 0.001). Corticosteroid values were normal in group B compared to slightly higher values in group C, also at all measured time intervals. In this study, healing of fractures in patients with concomitant head injuries was accelerated, thereby indicating an involvement of a combined neurohormonal mechanism. © 2016 S. Karger AG, Basel.

  6. Ultrafiltration technology with a ceramic membrane for reactive dye removal: optimization of membrane performance.

    PubMed

    Alventosa-deLara, E; Barredo-Damas, S; Alcaina-Miranda, M I; Iborra-Clar, M I

    2012-03-30

    An ultrafiltration (UF) ceramic membrane was used to decolorize Reactive Black 5 (RB5) solutions at different dye concentrations (50 and 500 mg/L). Transmembrane pressure (TMP) and cross-flow velocity (CFV) were modified to study their influence on initial and steady-state permeate flux (J(p)) and dye rejection (R). Generally, J(p) increased with higher TMP and CFV and lower feed concentration, up to a maximum steady-state J(p) of 266.81 L/(m(2)h), obtained at 3 bar, 3m/s and 50mg/L. However, there was a TMP value (which changed depending on operating CFV and concentration) beyond which slight or no further increase in steady-state J(p) was observed. Similarly, the higher the CFV was, the more slightly the steady-state J(p) increased. Furthermore, the effectiveness of ultrafiltration treatment was evaluated through dye rejection coefficient. The results showed significant dye removals, regardless of the tested conditions, with steady-state R higher than 79.8% for the 50mg/L runs and around 73.2% for the 500 mg/L runs. Finally response surface methodology (RSM) was used to optimize membrane performance. At 50mg/L, a TMP of 4 bar and a CFV of 2.53 m/s were found to be the conditions giving the highest steady-state J(p), 255.86 L/(m(2)h), and the highest R, 95.2% simultaneously. Copyright © 2012 Elsevier B.V. All rights reserved.

  7. What Drives Hydrogen Isotopic Variability Recorded by Biomarkers in Sediments of Lake Karakul, Pamir?

    NASA Astrophysics Data System (ADS)

    Aichner, B.; Mischke, S.; Pausata, F. S. R.; Werner, M.; Zhang, Q.; Heinecke, L.; Feakins, S. J.; Sachse, D.; Mahmoudov, Z.; Rajabov, I.

    2017-12-01

    Central Asia is a climate sensitive region located at the boundary of large scale atmospheric circulation systems. To examine glacial to interglacial hydrological changes in the region, we analysed the hydrogen isotopic composition (δD values) of n-alkanes in a 30-ka record from Lake Karakul, eastern Pamir (altitude: 3,915m, MAT: -3.9 °C, MAP: 82 mm). δD values of both aquatic and terrestrial compounds showed distinct trends throughout the studied time interval, with generally higher values during the glacial and lower values during the Holocene, and variability of up to 60‰. In particular shifts towards higher δD values were observed for aquatic biomarkers at ca. 30, 27, and 15 ka BP. Temperature and precipitation effects alone cannot explain the higher δD values during the glacial and the large isotopic amplitudes. To explain these observations we conducted a set of experiments using atmospheric models with embedded isotope modules (CAM3iso- and ECHAM5-wiso). We assume that terrestrial n-alkanes mainly record the isotopic signature of summer precipitation within the lower elevated parts of the Karakul Basin. Based on the model output we hypothesize that shifts between local and more distant vapour sources are the reason behind the trends within isotopic data. Data derived from aquatic biomarkers are more difficult to explain due to multiple influencing factors on δD of the lake water. Assuming that the lake water integrates an annual isotopic signal from the whole lake catchment, we suggest that a change in precipitation seasonality drives the large variability of hydrogen isotopic values. This is in agreement with the models, which suggest reduced winter (more negative δD) and slightly higher summer precipitation (more positive δD) during the glacial compared to the Holocene. Consequently, a net-increase of isotopically enriched inflow into the lake could explain the three distinct shifts towards higher δD values. Expansion of terrestrial vegetation, indicated by increasing biomarker concentrations, during these periods is another indicator for wetter summers in an arid environment. We conclude that δD values of terrestrial compounds reflect major shifts of vapour sources which are driven by insolation, while aquatic biomarkers are additionally influenced by changes of precipitation seasonality.

  8. Comparison of vertical hydraulic conductivity in a streambed-point bar system of a gaining stream

    NASA Astrophysics Data System (ADS)

    Dong, Weihong; Chen, Xunhong; Wang, Zhaowei; Ou, Gengxin; Liu, Can

    2012-07-01

    SummaryVertical hydraulic conductivities (Kv) of both streambed and point bars can influence water and solute exchange between streams and surrounding groundwater systems. The sediments in point bars are relatively young compared to the older sediments in the adjacent aquifers but slightly older compared to submerged streambeds. Thus, the permeability in point bar sediments can be different not only from regional aquifer but also from modern streambed. However, there is a lack of detailed studies that document spatial variability of vertical hydraulic conductivity in point bars of meandering streams. In this study, the authors proposed an in situ permeameter test method to measure vertical hydraulic conductivity of the two point bars in Clear Creek, Nebraska, USA. We compared the Kv values in streambed and adjacent point bars through 45 test locations in the two point bars and 51 test locations in the streambed. The Kv values in the point bars were lower than those in the streambed. Kruskal-Wallis test confirmed that the Kv values from the point bars and from the channel came from two statistically different populations. Within a point bar, the Kv values were higher along the point bar edges than those from inner point bars. Grain size analysis indicated that slightly more silt and clay particles existed in sediments from inner point bars, compared to that from streambed and from locations near the point bar edges. While point bars are the deposits of the adjacent channel, the comparison of two groups of Kv values suggests that post-depositional processes had an effect on the evolution of Kv from channel to point bars in fluvial deposits. We believed that the transport of fine particles and the gas ebullition in this gaining stream had significant effects on the distribution of Kv values in a streambed-point bar system. With the ageing of deposition in a floodplain, the permeability of point bar sediments can likely decrease due to reduced effects of the upward flow and gas ebullition.

  9. Energy budget above a high-elevation subalpine forest in complex topography

    USGS Publications Warehouse

    Turnipseed, A.A.; Blanken, P.D.; Anderson, D.E.; Monson, Russell K.

    2002-01-01

    Components of the energy budget were measured above a subalpine coniferous forest over two complete annual cycles. Sensible and latent heat fluxes were measured by eddy covariance. Bowen ratios ranged from 0.7 to 2.5 in the summer (June-September) depending upon the availability of soil water, but were considerably higher (???3-6) during winter (December-March). Energy budget closure averaged better than 84% on a half-hourly basis in both seasons with slightly greater closure during the winter months. The energy budget showed a dependence on friction velocity (u*), approaching complete closure at u* values greater than 1 m s-1. The dependence of budget closure on u* explained why energy balance was slightly better in the winter as opposed to summer, since numerous periods of high turbulence occur in winter. It also explained the lower degree of energy closure (???10% less) during easterly upslope flow since these periods were characterized by low wind speeds (U < 4 m s-1) and friction velocities (u* < 0.5 m s-1). Co-spectral analysis suggests a shift of flux density towards higher frequencies under conditions where closure was obtained. It is suggested that low frequency contributions to the flux and advection were responsible for the lack of day-time energy budget closure. These effects were reduced at high friction velocities observed at our site. Our ability to close the energy budget at night was also highly dependent on friction velocity, approaching near closure (???90%) at u* values between 0.7 and 1.1 m s-1. Below this range, the airflow within the canopy becomes decoupled with the flow above. Above this range, insufficient temperature resolution of the sonic anemometer obscured the small temperature fluctuations, rendering measurements intractable. ?? 2002 Elsevier Science B.V. All rights reserved.

  10. Trainees May Add Value to Patient Care by Decreasing Addendum Utilization in Radiology Reports.

    PubMed

    Balthazar, Patricia; Konstantopoulos, Christina; Wick, Carson A; DeSimone, Ariadne K; Tridandapani, Srini; Simoneaux, Stephen; Applegate, Kimberly E

    2017-11-01

    The purpose of this study was to evaluate the impact of trainee involvement and other factors on addendum rates in radiology reports. This retrospective study was performed in a tertiary care pediatric hospital. From the institutional radiology data repository, we extracted all radiology reports from January 1 to June 30, 2016, as well as trainee (resident or fellow) involvement, imaging modality, patient setting (emergency, inpatient, or outpatient), order status (routine vs immediate), time of interpretation (regular work hours vs off-hours), radiologist's years of experience, and sex. We grouped imaging modalities as advanced (CT, MRI, and PET) or nonadvanced (any modality that was not CT, MRI, or PET) and radiologist experience level as ≤ 20 years or > 20 years. Our outcome measure was the rate of addenda in radiology reports. Statistical analysis was performed using multivariate logistic regression. From 129,033 reports finalized during the study period, 418 (0.3%) had addenda. Reports generated without trainees were 12 times more likely than reports with trainee involvement to have addenda (odds ratio [OR] = 12.2, p < 0.001). Advanced imaging studies were more likely than nonadvanced studies to be associated with addendum use (OR = 4.7, p < 0.001). Reports generated for patients in emergency or outpatient settings had a slightly higher likelihood of addendum use than those in an inpatient setting (OR = 1.5, p = 0.04; and OR = 1.3, p = 0.04, respectively). Routine orders had a slightly higher likelihood of addendum use compared with immediate orders (OR = 1.3, p = 0.01). We found no difference in addendum use by radiologist's sex, radiologist's years of experience, emergency versus outpatient setting, or time of interpretation. Trainees may add value to patient care by decreasing addendum rates in radiology reports.

  11. Experimental investigation of turbulent diffusion of slightly buoyant droplets in locally isotropic turbulence

    NASA Astrophysics Data System (ADS)

    Gopalan, Balaji; Malkiel, Edwin; Katz, Joseph

    2008-09-01

    High-speed inline digital holographic cinematography is used for studying turbulent diffusion of slightly buoyant 0.5-1.2 mm diameter diesel droplets and 50 μm diameter neutral density particles. Experiments are performed in a 50×50×70 mm3 sample volume in a controlled, nearly isotropic turbulence facility, which is characterized by two dimensional particle image velocimetry. An automated tracking program has been used for measuring velocity time history of more than 17 000 droplets and 15 000 particles. For most of the present conditions, rms values of horizontal droplet velocity exceed those of the fluid. The rms values of droplet vertical velocity are higher than those of the fluid only for the highest turbulence level. The turbulent diffusion coefficient is calculated by integration of the ensemble-averaged Lagrangian velocity autocovariance. Trends of the asymptotic droplet diffusion coefficient are examined by noting that it can be viewed as a product of a mean square velocity and a diffusion time scale. To compare the effects of turbulence and buoyancy, the turbulence intensity (ui') is scaled by the droplet quiescent rise velocity (Uq). The droplet diffusion coefficients in horizontal and vertical directions are lower than those of the fluid at low normalized turbulence intensity, but exceed it with increasing normalized turbulence intensity. For most of the present conditions the droplet horizontal diffusion coefficient is higher than the vertical diffusion coefficient, consistent with trends of the droplet velocity fluctuations and in contrast to the trends of the diffusion timescales. The droplet diffusion coefficients scaled by the product of turbulence intensity and an integral length scale are a monotonically increasing function of ui'/Uq.

  12. Higher insulin sensitivity in vegans is not associated with higher mitochondrial density.

    PubMed

    Gojda, J; Patková, J; Jaček, M; Potočková, J; Trnka, J; Kraml, P; Anděl, M

    2013-12-01

    Vegans have a lower incidence of insulin resistance (IR)-associated diseases and a higher insulin sensitivity (IS) compared with omnivores. The aim of this study was to examine whether the higher IS in vegans relates to markers of mitochondrial biogenesis and to intramyocellular lipid (IMCL) content. Eleven vegans and 10 matched (race, age, sex, body mass index, physical activity and energy intake) omnivorous controls were enrolled in a case-control study. Anthropometry, bioimpedance (BIA), ultrasound measurement of visceral and subcutaneous fat layer, parameters of glucose and lipid homeostasis, hyperinsulinemic euglycemic clamp and muscle biopsies were performed. Citrate synthase (CS) activity, mitochondrial DNA (mtDNA) and IMCL content were assessed in skeletal muscle samples. Both groups were comparable in anthropometric and BIA parameters, physical activity and protein-energy intake. Vegans had significantly higher glucose disposal (M-value, vegans 8.11±1.51 vs controls 6.31±1.57 mg/kg/min, 95% confidence interval: 0.402 to 3.212, P=0.014), slightly lower IMCL content (vegans 13.91 (7.8 to 44.0) vs controls 17.36 (12.4 to 78.5) mg/g of muscle, 95% confidence interval: -7.594 to 24.550, P=0.193) and slightly higher relative muscle mtDNA amount (vegans 1.36±0.31 vs controls 1.13±0.36, 95% confidence interval:-0.078 to 0.537, P=0.135). No significant differences were found in CS activity (vegans 18.43±5.05 vs controls 18.16±5.41 μmol/g/min, 95% confidence interval: -4.503 to 5.050, P=0.906). Vegans have a higher IS, but comparable mitochondrial density and IMCL content with omnivores. This suggests that a decrease in whole-body glucose disposal may precede muscle lipid accumulation and mitochondrial dysfunction in IR development.

  13. Measuring adolescents' HRQoL via self reports and parent proxy reports: an evaluation of the psychometric properties of both versions of the KINDL-R instrument.

    PubMed

    Erhart, Michael; Ellert, Ute; Kurth, Bärbel-Maria; Ravens-Sieberer, Ulrike

    2009-08-26

    Several instruments are available to assess children's health-related quality of life (HRQoL) based on self reports as well as proxy reports from parents. Previous studies have found only low-to-moderate agreement between self and proxy reports, but few studies have explicitly compared the psychometric qualities of both. This study compares the reliability, factorial validity and convergent and known group validity of the self-report and parent-report versions of the HRQoL KINDL-R questionnaire for children and adolescents. Within the nationally representative cross-sectional German Health Interview and Examination Survey for Children and Adolescents (KiGGS), 6,813 children and adolescents aged 11 to 17 years completed the KINDL-R generic HRQoL instrument while their parents answered the KINDL proxy version (both in paper-and-pencil versions). Cronbach's alpha and confirmatory factor-analysis models (linear structural equation model) were obtained. Convergent and discriminant validity were assessed by calculating the Pearson's correlation coefficient for the Strengths and Difficulties Questionnaire. Known-groups differences were examined (ANOVA) for obese children and children with a lower familial socio-economic status. The parent reports achieved slightly higher Cronbach's alpha values for the total score (0.86 vs. 0.83) and most sub-scores. Confirmatory factor analysis revealed an acceptable fit of the six-dimensional measurement model of the KINDL for the parent (RMSEA=0.07) and child reports (RMSEA=0.06). Factorial invariance across the two versions did not hold with regards to the pattern of loadings, the item errors and the covariation between latent concepts. However the magnitude of the differences was rather small. The parent report version achieved slightly higher convergent validity (r=0.44-0.63 vs. r=0.33-0.59) in the Strengths and Difficulties Questionnaire. No clear differences were observed for known-groups validity. Our study showed that parent proxy reports and child self reports on the child's HRQoL slightly differ with regards to how the perceptions, evaluations and possibly the affective resonance of each group are structured and internally consistent. Overall, the parent reports achieved slightly higher reliability and thus are favoured for the examination of small samples. No version was universally superior with regards to the validity of the measurements. Whenever possible, children's HRQoL should be measured via both sources of information.

  14. Determining the Value of Two Biologic Drugs for Chronic Inflammatory Skin Diseases: Results of a Multi-Criteria Decision Analysis.

    PubMed

    Zozaya, Néboa; Martínez-Galdeano, Lucía; Alcalá, Bleric; Armario-Hita, Jose Carlos; Carmona, Concepción; Carrascosa, Jose Manuel; Herranz, Pedro; Lamas, María Jesús; Trapero-Bertran, Marta; Hidalgo-Vega, Álvaro

    2018-06-01

    Multi-criteria decision analysis (MCDA) is a tool that systematically considers multiple factors relevant to health decision-making. The aim of this study was to use an MCDA to assess the value of dupilumab for severe atopic dermatitis compared with secukinumab for moderate to severe plaque psoriasis in Spain. Following the EVIDEM (Evidence and Value: Impact on DEcision Making) methodology, the estimated value of both interventions was obtained by means of an additive linear model that combined the individual weighting (between 1 and 5) of each criterion with the individual scoring of each intervention in each criterion. Dupilumab was evaluated against placebo, while secukinumab was evaluated against placebo, etanercept and ustekinumab. A retest was performed to assess the reproducibility of weights, scores and value estimates. The overall MCDA value estimate for dupilumab versus placebo was 0.51 ± 0.14. This value was higher than those obtained for secukinumab: 0.48 ± 0.15 versus placebo, 0.45 ± 0.15 versus etanercept and 0.39 ± 0.18 versus ustekinumab. The highest-value contribution was reported by the patients' group, followed by the clinical professionals and the decision makers. A fundamental element that explained the difference in the scoring between pathologies was the availability of therapeutic alternatives. The retest confirmed the consistency and replicability of the analysis. Under this methodology, and assuming similar economic costs per patient for both treatments, the results indicated that the overall value estimated of dupilumab for severe atopic dermatitis was similar to, or slightly higher than, that of secukinumab for moderate to severe plaque psoriasis.

  15. Primary biliary cirrhosis degree assessment by acoustic radiation force impulse imaging and hepatic fibrosis indicators.

    PubMed

    Zhang, Hai-Chun; Hu, Rong-Fei; Zhu, Ting; Tong, Ling; Zhang, Qiu-Qin

    2016-06-14

    To evaluate the assessment of primary biliary cirrhosis degree by acoustic radiation force impulse imaging (ARFI) and hepatic fibrosis indicators. One hundred and twenty patients who developed liver cirrhosis secondary to primary biliary cirrhosis were selected as the observation group, with the degree of patient liver cirrhosis graded by Child-Pugh (CP) score. Sixty healthy individuals were selected as the control group. The four indicators of hepatic fibrosis were detected in all research objects, including hyaluronic acid (HA), laminin (LN), type III collagen (PC III), and type IV collagen (IV-C). The liver parenchyma hardness value (LS) was then measured by ARFI technique. LS and the four indicators of liver fibrosis (HA, LN, PC III, and IV-C) were observed in different grade CP scores. The diagnostic value of LS and the four indicators of liver fibrosis in determining liver cirrhosis degree with PBC, whether used alone or in combination, were analyzed by receiver operating characteristic (ROC) curve. LS and the four indicators of liver fibrosis within the three classes (A, B, and C) of CP scores in the observation group were higher than in the control group, with C class > B class > A class; the differences were statistically significant (P < 0.01). Although AUC values of LS within the three classes of CP scores were higher than in the four indicators of liver fibrosis, sensitivity and specificity were unstable. The ROC curves of LS combined with the four indicators of liver fibrosis revealed that: AUC and sensitivity in all indicators combined in the A class of CP score were higher than in LS alone, albeit with slightly decreased specificity; AUC and specificity in all indicators combined in the B class of CP score were higher than in LS alone, with unchanged sensitivity; AUC values (0.967), sensitivity (97.4%), and specificity (90%) of all indicators combined in the C class of CP score were higher than in LS alone (0.936, 92.1%, 83.3%). The diagnostic value of PBC cirrhosis degree in liver cirrhosis degree assessment by ARFI combined with the four indicators of serum liver fibrosis is of satisfactory effectiveness and has important clinical application value.

  16. Normal and pathological serum levels of alpha2-macroglobulins in men and mice.

    PubMed Central

    Tunstall, A M; Merriman, J M; Milne, I; James, K

    1975-01-01

    The serum levels of alpha2-macroglobulin have been measured in normal men and mice and in a number of immunopathological conditions. Normal human concentrations are high in youth, reach their minimum in middle age, and gradually increase with old age. In all age groups the mean is higher in the female than in the male. Conversely, in normal mice the alpha2M level is low in youth, maximum in middle age, and shows a slight depression with old age, and the levels are frequently higher in males than in females; there are also strain variations. In human immunopathological conditions, there are some deviations from the normal alpha2M level but these are seen to be changes from the normal distribution of values around the mean, rather than significant elevation or depression of mean values. In some disease states studied there are differences between the sexes in the deviation from normal. "Abnormal" strains of mice had alpha2M levels within the range exhibited by "normal" mice but changes in the levels are seen in mice with various myelomas. Images PMID:47865

  17. Scratch Testing of Hot-Pressed Monolithic Chromium Diboride (CrB2) and CrB2 + MoSi2 Composite

    NASA Astrophysics Data System (ADS)

    Bhatt, B.; Murthy, T. S. R. Ch.; Singh, K.; Sashanka, A.; Vishwanadh, B.; Sonber, J. K.; Sairam, K.; Nageswara Rao, G. V. S.; Srinivasa Rao, T.; Kain, Vivekanand

    2017-10-01

    The tribological performance of hot-pressed monolithic CrB2 and a newly developed CrB2 + 20 vol.% MoSi2 composite was investigated by using scratch test. The test was carried out under progressive loading ranging from 0.9 to 30 N over a scratch distance of 3 mm. In situ values of coefficient of friction (COF), depth of penetration and acoustic emission were recorded. The wear volume and fracture toughness were also calculated. COF of both materials is increased with increasing the scratch length and progressive load. COF of the composite was observed to be slightly higher compared to the monolithic CrB2. The wear volume of the composite is 60% higher compared to monolithic CrB2. Fracture toughness values of 2.48 and 2.81 MPa m1/2 were calculated for monolithic CrB2 and CrB2 + 20 vol.% MoSi2 composite, respectively. Microstructural characterization indicates that the abrasive wear is the dominant wear mechanism in both the materials.

  18. The stopping rate of negative cosmic-ray muons near sea level

    NASA Technical Reports Server (NTRS)

    Spannagel, G.; Fireman, E. L.

    1971-01-01

    A production rate of 0.065 + or - 0.003 Ar-37 atom/kg min of K-39 at 2-mwe depth below sea level was measured by sweeping argon from potassium solutions. This rate is unaffected by surrounding the solution by paraffin and is attributed to negative muon captures and the electromagnetic interaction of fast muons, and not to nucleonic cosmic ray component. The Ar-37 yield from K-39 by the stopping of negative muons in a muon beam of a synchrocyclotron was measured to be 8.5 + or - 1.7%. The stopping rate of negative cosmic ray muons at 2-mwe depth below sea level from these measurements and an estimated 17% electromagnetic production is 0.63 + or - 0.13 muon(-)/kg min. Previous measurements on the muon stopping rate vary by a factor of 5. Our value is slightly higher but is consistent with two previous high values. The sensitivity of the Ar-37 radiochemical method for the detection of muons is considerably higher than that of the previous radiochemical methods and could be used to measure the negative muon capture rates at greater depths.

  19. [Distribution of Urban Soil Heavy Metal and Pollution Evaluation in Different Functional Zones of Yinchuan City].

    PubMed

    Wang, You-qi; Bai, Yi-ru; Wang, Jian-yu

    2016-02-15

    Surface soil samples (0-20 cm) from eight different functional areas in Yinchuan city were collected. There were 10 samples respectively in each functional area. The urban soil heavy metals (Zn, Cd, Pb, Mn, Cu and Cr) pollution characteristics and sources in eight different functional areas were evaluated by mathematical statistics and geostatistical analysis method. Meanwhile, the spatial distributions of heavy metals based on the geography information system (GIS) were plotted. The average values of total Zn, Cd, Pb, Mn, Cu and Cr were 74.87, 0.15, 29.02, 553.55, 40.37 and 80.79 mg x kg(-1), respectively. The results showed that the average value of soil heavy metals was higher than the soil background value of Ningxia, which indicated accumulation of the heavy metals in urban soil. The single factor pollution index of soil heavy metals was in the sequence of Cu > Pb > Zn > Cr > Cd > Mn. The average values of total Zn, Cd, Pb and Cr were higher in north east, south west and central city, while the average values of Mn and Cu were higher in north east and central city. There was moderate pollution in road and industrial area of Yinchuan, while the other functional areas showed slight pollution according to Nemoro synthesis index. The pollution degree of different functional areas was as follows: road > industrial area > business district > medical treatment area > residential area > public park > development zone > science and education area. The results indicated that the soil heavy metal pollution condition in Yinchuan City has been affected by human activities with the development of economy.

  20. Simulation Analysis of Wireless Power Transmission System for Biomedical Applications

    NASA Astrophysics Data System (ADS)

    Yang, Zhao; Wei, Zhiqiang; Chi, Haokun; Yin, Bo; Cong, Yanping

    2018-03-01

    In recent years, more and more implantable medical devices have been used in the medical field. Some of these devices, such as brain pacemakers, require long-term power support. The WPT(wireless power transmission) technology which is more convenient and economical than replacing the battery by surgery, has become the first choice of many patients. In this paper, we design a WPT system that can be used in implantable medical devices, simulate the transmission efficiency of the system in the air and in the head model, and simulate the SAR value when the system working in the head model. The results show that when implantation depth of the secondary coil is 3 mm, the efficiency of the system can reach 45%, and the maximum average SAR value is 2.19 W / kg, slightly higher than the standard of IEEE.

  1. Voltage dependency of transmission probability of aperiodic DNA molecule

    NASA Astrophysics Data System (ADS)

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  2. [Value of anti-Müllerian hormone in predicting pregnant outcomes of polycystic ovary syndrome patients undergone assisted reproductive technology].

    PubMed

    Li, Y; Tan, J Q; Mai, Z Y; Yang, D Z

    2018-01-25

    Objective: Explore the value of anti-Müllerian hormone (AMH) in predicting pregnant outcomes of polycystic ovary syndrome (PCOS) patients undergone assisted reproductive technology. Methods: The study totally recruited 1 697 patients who underwent the first in vitro fertilization (IVF) or intracytoplasmic sperm injection (ICSI) cycle in Sun Yat-sen Memorial Hospital from the January 2014 to December 2015. The patients were divided into two groups based on the age<35 ( n= 758) and ≥35 years old ( n= 939) , compare the basic data and pregnant outcomes of controlled ovarian hyerstimulation. Spearman correlation method was conducted to analyze the relations between AMH and clinical outcomes. The logistic regression method and partial correlation analysis were used to judge the main factors which determine pregnancy outcomes by controlled the confounding factors. The receiver operating characteristic curve (ROC) was used to evaluate the predictive sensitivity and specificity of AMH. Results: In the group of PCOS patient younger than 35 years, AMH were correlated with the number of antral follicles ( r= 0.388) and retrieved oocytes ( r= 0.235) . When the effect of total dosage and starting dosage of gonadotropin were controlled, AMH was still significantly associated with the number of retrieved oocytes ( P< 0.05) . AMH had no predictive value for the clinical pregnancy of PCOS patient younger than 35 years (area under ROC curve=0.481, P= 0.768) . In the group of PCOS patient≥35 years old, AMH were correlated with the number of antral follicles ( r= 0.450) , retrieved oocytes ( r= 0.399) , available embryo ( r= 0.336) and high quality embryo ( r= 0.235) . When the effect of total dosage and starting dosage of gonadotropin were controlled, the correlations were still significant between those indexes (all P< 0.05) . AMH had no predictive value for the clinical pregnancy of PCOS patient ≥35 years old (area under ROC curve=0.535, P= 0.560) . However, the clinical pregnancy rate of the group of PCOS patient ≥35 years old was slightly higher than the control group ( P= 0.062) . Conclusions: AMH has no predictive value for the pregnancy outcome of PCOS patient. The pregnancy rate of PCOS patient ≥35 years old is slightly higher than the younger group, because the PCOS patient may have better ovarian reserve.

  3. The nation’s top 25 construction aggregates producers

    USGS Publications Warehouse

    Willett, Jason C.

    2014-01-01

    U.S. production of construction aggregates in 2012 was 2.18 billion short tons valued at $17.6 billion, free on board (f.o.b.) at plant. In 2012, construction aggregates production remained virtually unchanged from the levels of the last two years because of a very slight increase compared with that of 2011 in the production of both construction sand and gravel and crushed stone. The average unit value, which is the f.o.b. at the plant price of a metric ton of material, increased slightly. Construction aggregates production was 36 percent less than and the associated value was 23 percent less than the record highs reported in 2006.

  4. Biological mechanisms of premature ovarian failure caused by psychological stress based on support vector regression

    PubMed Central

    Wang, Xiu-Feng; Zhang, Lei; Wu, Qing-Hua; Min, Jian-Xin; Ma, Na; Luo, Lai-Cheng

    2015-01-01

    Psychological stress has become a common and important cause of premature ovarian failure (POF). Therefore, it is very important to explore the mechanisms of POF resulting from psychological stress. Sixty SD rats were randomly divided into control and model groups. Biomolecules associated with POF (β-EP, IL-1, NOS, NO, GnRH, CRH, FSH, LH, E2, P, ACTH, and CORT) were measured in the control and psychologically stressed rats. The regulation relationships of the biomolecules were explored in the psychologically stressed state using support vector regression (SVR). The values of β-EP, IL-1, NOS, and GnRH in the hypothalamus decreased significantly, and the value of NO changed slightly, when the values of 3 biomolecules in the hypothalamic-pituitary-adrenal axis decreased. The values of E2 and P in the hypothalamic-pituitary-ovarian axis decreased significantly, while the values of FSH and LH changed slightly, when the values of the biomolecules in the hypothalamus decreased. The values of FSH and LH in the pituitary layer of the hypothalamic-pituitary-ovarian axis changed slightly when the values of E2 and P in the target gland layer of the hypothalamic-pituitary-ovarian axis decreased. An Imbalance in the neuroendocrine-immune bimolecular network, particularly the failure of the feedback action of the target gland layer to pituitary layer in the pituitary-ovarian axis, is possibly one of the pathogenic mechanisms of POF. PMID:26885082

  5. Biomarkers in diverticular diseases of the colon.

    PubMed

    Tursi, Antonio

    2012-01-01

    Recent data found that diverticular disease (DD) of the colon shows similarities with inflammatory bowel diseases (IBD). In particular, the detection of microscopic inflammation and the clinical response to mesalazine seem to confirm the hypothesis that inflammation may be a key point for the appearance of symptoms and development of complications. In light of this hypothesis, several studies have recently focused their attention on the role of biomarkers in predicting and monitoring the course of the disease. C-reactive protein (CRP), white blood cell count, erythrocyte sedimentation rate, and fecal calprotectin (FC) have therefore been investigated. As in IBD, CRP seems to be the most effective marker of histological and clinical severity of the disease. In particular, CRP below 50 mg/l suggests an acute uncomplicated diverticulitis (AUD), whereas CRP higher than 200 mg/l is a strong indicator of DD complicated by perforation. As in IBD, FC seems to be a noninvasive sensitive marker of DD severity. In particular, FC may show slight increased valued already in symptomatic uncomplicated DD (SUDD) (FC value ≥15 μg/ml seems to be predictive of SUDD). As expected, FC shows higher values in AUD (FC value ≥60 μg/ml seems to be predictive of AUD). Finally, FC seems to be useful also in monitoring the therapeutic response in DD. In fact, FC values decreased significantly in patients responding to therapy, whereas they persisted to increase in patients who failed to obtain remission. Copyright © 2012 S. Karger AG, Basel.

  6. Temperature-dependent surface density of alkylthiol monolayers on gold nanocrystals

    NASA Astrophysics Data System (ADS)

    Liu, Xuepeng; Lu, Pin; Zhai, Hua; Wu, Yucheng

    2018-03-01

    Atomistic molecular dynamics (MD) simulations are performed to study the surface density of passivating monolayers of alkylthiol chains on gold nanocrystals at temperatures ranging from 1 to 800 K. The results show that the surface density of alkylthiol monolayer reaches a maximum value at near room temperature (200-300 K), while significantly decreases with increasing temperature in the higher temperature region (> 300 {{K}}), and slightly decreases with decreasing temperature at low temperature (< 200 {{K}}). We find that the temperature dependence of surface ligand density in the higher temperature region is attributed to the substantial ligand desorption induced by the thermal fluctuation, while that at low temperature results from the reduction in entropy caused by the change in the ordering of passivating monolayer. These results are expected helpful to understand the temperature-dependent surface coverage of gold nanocrystals.

  7. Metabolic and Hormonal Response to a Feed-challenge Test in Lean and Overweight Dogs.

    PubMed

    Söder, J; Wernersson, S; Hagman, R; Karlsson, I; Malmlöf, K; Höglund, K

    2016-01-01

    Obese dogs risk poor life quality, creating a need for increased knowledge of metabolism in overweight dogs. Investigate postprandial metabolic and hormonal responses to a high-fat mixed-meal in dogs and responses of lean versus overweight dogs. Twenty-eight healthy intact male Labrador Retrievers were included. Prospective observational study. Twelve dogs were grouped as lean (body condition score (BCS 4-5), 10 as slightly overweight (BCS 6), and 6 as overweight (BCS 6.5-8) on a 9-point scale. After an overnight fast, urine and blood samples were collected. Dogs were then fed a high-fat mixed-meal, and blood was collected hourly for 4 hours and urine after 3 hours. Postprandial concentrations of insulin and glucagon were increased at 1 hour (both P < 0.0001), triglycerides at 2 hours (P < 0.0001), and glucose at 3 hours (P = 0.004); and all remained increased throughout the feed-challenge in all dogs. Postprandial urine cortisol/creatinine ratio was higher than fasting values (P = 0.001). Comparing between groups, there was an overall higher triglyceride response in overweight compared to lean (P = 0.001) and slightly overweight (P = 0.015) dogs. Overweight dogs also had higher fasting cortisol/creatinine ratio compared to lean dogs (P = 0.024). Postprandial responses of dogs to a high-fat mixed-meal were similar to those previously reported in people. The higher postprandial triglyceride response and fasting cortisol/creatinine ratio in the overweight dogs could be early signs of metabolic imbalance. Thus, although overweight dogs often appear healthy, metabolic alterations might be present. Copyright © 2016 The Authors. Journal of Veterinary Internal Medicine published by Wiley Periodicals, Inc. on behalf of the American College of Veterinary Internal Medicine.

  8. Relationship between respiratory quotient, nitrification, and nitrous oxide emissions in a forced aerated composting process

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tsutsui, Hirofumi, E-mail: jm-tsutsuih@kochi-u.ac.jp; Japan Science and Technology Agency, CREST; Fujiwara, Taku

    2015-08-15

    Highlights: • RQ can be an indicator of N{sub 2}O emission in forced aerated composting process. • Emission of N{sub 2}O with nitrification was observed with RQ decrease. • Mass balances demonstrated the RQ decrease was caused by nitrification. • Conversion ratio of oxidized ammonia and total N to N{sub 2}O were ∼2.7%. - Abstract: We assessed the relationship between respiratory quotient (RQ) and nitrification and nitrous oxide (N{sub 2}O) emission in forced aerated composting using lab-scale reactors. Relatively high RQ values from degradation of readily degradable organics initially occurred. RQ then stabilized at slightly lower values, then decreased. Continuousmore » emission of N{sub 2}O was observed during the RQ decrease. Correlation between nitrification and N{sub 2}O emission shows that the latter was triggered by nitrification. Mass balances demonstrated that the O{sub 2} consumption of nitrification (∼24.8 mmol) was slightly higher than that of CO{sub 2} emission (∼20.0 mmol), indicating that the RQ decrease was caused by the occurrence of nitrification. Results indicate that RQ is a useful index, which not only reflects the bioavailability of organics but also predicts the occurrence of nitrification and N{sub 2}O emission in forced aerated composting.« less

  9. The brominated flame retardants, PBDEs and HBCD, in Canadian human milk samples collected from 1992 to 2005; concentrations and trends.

    PubMed

    Ryan, John Jake; Rawn, Dorothea F K

    2014-09-01

    Human milk samples were collected from individuals residing in various regions across Canada mostly in the years 1992 to 2005. These included five large cities in southern Canada as well as samples from Nunavik in northern Quebec. Comparative samples were also collected from residents of Austin, Texas, USA in 2002 and 2004. More than 300 milk samples were analysed for the brominated flame retardants (BFRs), PBDEs and HBCD, by extraction, purification and quantification using either isotope dilution gas chromatography-mass spectrometry (GC-MS) or liquid chromatography-MS. The Canadian total PBDE values in the years 2002-2005 show median levels of about 20μg/kg on a lipid basis; a value significantly higher than in the 1980s and 1990s. Milk samples from Inuit donors in the northern region of Nunavik were slightly lower in PBDE concentrations than those from populated regions in the south of Quebec. Milk samples from Ontario contained slightly lower amounts of PBDEs in two time periods than those from Texas. HBCD levels in most milk samples were usually less than 1ppb milk lipid and dominated by the α-isomer. This large data set of BFRs in Canadian human milk demonstrates an increase in the last few decades in human exposure to BFRs which now appears to have stabilized. Crown Copyright © 2014. Published by Elsevier Ltd. All rights reserved.

  10. Magnetic field effects on electron transfer reactions involving sextet-spin ( S = 5/2) intermediates generated on photoexcitation of a Cr(III)-porphyrin complex

    NASA Astrophysics Data System (ADS)

    Mori, Yukie; Hoshino, Mikio; Hayashi, Hisaharu

    The excited trip-sextet ( 6 T 1 ) state of chloro-(3-methylimidazol)-( meso -tetraphenylporphyrinato) chromium(III) (Cr III P) is quenched by 1,1 '-dibenzyl-4,4 '-bipyridinium (BV 2+ ) in acetonitrile through electron transfer to give 5 (Cr III P .+ ) and 2 BV .+ . The intermediate is a geminate ion pair in the sextet (Sx) state 6 [ 5 (Cr III P .+ ) 2 BV .+ ], which decays through either the escape from a solvent cage to give the free ions or the spin conversion to the quartet (Qa) state followed by back electron transfer. The free ion yield ( ΦFI ) increased with increasing magnetic field from 0 to 4 T and then slightly decreased from 4 T to 10 T. These magnetic field effects are explained as follows. Under low fields where the Zeeman splitting of the spin sublevels is lower than or comparable with the electron spin dipole-dipole interaction within 5 (Cr III P .+ ), this interaction effectively induces the Sx ⇔Qa conversion of [ 5 (Cr III P .+ ) 2 BV + ] to result in low ΦFI values. Under high fields where the Zeeman splitting is larger than the dipole-dipole interaction, the Sx Qa conversion is decreased with increasing field to cause higher ΦFI values. The slight decrease in ΦFI above 4 T may be due to the Δg mechanism.

  11. Human exposure to airborne aldehydes in Chinese medicine clinics during moxibustion therapy and its impact on risks to health.

    PubMed

    Hsu, Yi-Chyun; Chao, How-Ran; Shih, Shun-I

    2015-01-01

    Many air toxicants, and especially aldehydes, are generated by moxibustion, which means burning Artemisia argyi. Our goal was to investigate indoor-air aldehyde emissions in Chinese medicine clinics (CMCs) during moxibustion to further evaluate the potential health risks, including cancer risk and non-cancer risk, to the medical staff and adult patients. First, the indoor-air-quality in 60 public sites, including 15 CMCs, was investigated. Four CMCs with frequent use of moxibustion were selected from the 15 CMCs to gather the indoor airborne aldehydes in the waiting and therapy rooms. The mean values of formaldehyde and acetaldehyde in the CMCs' indoor air were 654 and 4230 μg m(-3), respectively, in the therapy rooms, and 155 and 850 μg m(-3), respectively, in the waiting rooms. The average lifetime cancer risks (Rs) and non-cancer risks (hazard quotients: HQs) of airborne formaldehyde and acetaldehyde among the CMC medical staff exceeded the acceptable criteria (R < 1.00 × 10(-3) and HQ < 1.00) for occupational workers. The patients' Rs and HQs were also slightly higher than the critical values (R = 1.00 × 10(-6) and HQ = 1.00). Our results indicate that airborne aldehydes pose a significant threat to the health of medical staff, and slightly affected the patients' health, during moxibustion in the CMCs.

  12. Application of Multiple Imputation for Missing Values in Three-Way Three-Mode Multi-Environment Trial Data

    PubMed Central

    Tian, Ting; McLachlan, Geoffrey J.; Dieters, Mark J.; Basford, Kaye E.

    2015-01-01

    It is a common occurrence in plant breeding programs to observe missing values in three-way three-mode multi-environment trial (MET) data. We proposed modifications of models for estimating missing observations for these data arrays, and developed a novel approach in terms of hierarchical clustering. Multiple imputation (MI) was used in four ways, multiple agglomerative hierarchical clustering, normal distribution model, normal regression model, and predictive mean match. The later three models used both Bayesian analysis and non-Bayesian analysis, while the first approach used a clustering procedure with randomly selected attributes and assigned real values from the nearest neighbour to the one with missing observations. Different proportions of data entries in six complete datasets were randomly selected to be missing and the MI methods were compared based on the efficiency and accuracy of estimating those values. The results indicated that the models using Bayesian analysis had slightly higher accuracy of estimation performance than those using non-Bayesian analysis but they were more time-consuming. However, the novel approach of multiple agglomerative hierarchical clustering demonstrated the overall best performances. PMID:26689369

  13. Eyeglasses for Children - a Survey of Daily Practice.

    PubMed

    Hagander, C E; Traber, G; Landau, K; Jaggi, G P

    2016-04-01

    Glasses for children are recommended and prescribed by different groups of professionals. We set out to compare the prescription practices of ophthalmologists, orthoptists and optometrists/opticians in Switzerland. Online questionnaire on the prescription and recommendation of glasses in fictitious cases of children of different ages, refractive values and symptoms. The questionnaire was sent out to members of the Swiss Ophthalmological Society, Swiss Orthoptics and Schweizerischer Berufsverband für Augenoptik und Optometrie. 307 questionnaires were analysed. Optometrists/opticians recommended glasses with a significantly smaller cycloplegic refraction value (p < 0.005) than did orthoptists and ophthalmologists. In the example of a 14-year-old asymptomatic child, ophthalmologists recommended glasses at + 2.64 [Dpt], orthoptists at + 2.44 [Dpt] and optometrists/opticians at + 1.32 [Dpt]. Optometrists/opticians tended to recommend slightly higher correction values in glasses than did ophthalmologists and orthoptists. In Switzerland, optometrists/opticians recommend glasses with significantly smaller cycloplegic refraction values than do orthoptists and ophthalmologists, regardless of age or symptoms described in these fictitious cases. Georg Thieme Verlag KG Stuttgart · New York.

  14. Application of Multiple Imputation for Missing Values in Three-Way Three-Mode Multi-Environment Trial Data.

    PubMed

    Tian, Ting; McLachlan, Geoffrey J; Dieters, Mark J; Basford, Kaye E

    2015-01-01

    It is a common occurrence in plant breeding programs to observe missing values in three-way three-mode multi-environment trial (MET) data. We proposed modifications of models for estimating missing observations for these data arrays, and developed a novel approach in terms of hierarchical clustering. Multiple imputation (MI) was used in four ways, multiple agglomerative hierarchical clustering, normal distribution model, normal regression model, and predictive mean match. The later three models used both Bayesian analysis and non-Bayesian analysis, while the first approach used a clustering procedure with randomly selected attributes and assigned real values from the nearest neighbour to the one with missing observations. Different proportions of data entries in six complete datasets were randomly selected to be missing and the MI methods were compared based on the efficiency and accuracy of estimating those values. The results indicated that the models using Bayesian analysis had slightly higher accuracy of estimation performance than those using non-Bayesian analysis but they were more time-consuming. However, the novel approach of multiple agglomerative hierarchical clustering demonstrated the overall best performances.

  15. Evaluation of a Salutogenetic Concept for Inpatient Psychosomatic Treatment

    PubMed Central

    Loew, Thomas

    2013-01-01

    The increase of psychosomatic disorders due to cultural changes requires enhanced therapeutic models. This study investigated a salutogenetic treatment concept for inpatient psychosomatic treatment, based on data from more than 11000 patients of a psychosomatic clinic in Germany. The clinic aims at supporting patients' health improvement by fostering values such as humanity, community, and mindfulness. Most of patients found these values realized in the clinical environment. Self-assessment questionnaires addressing physical and mental health as well as symptom ratings were available for analysis of pre-post-treatment effects and long-term stability using one-year follow-up data, as well as for a comparison with other clinics. With respect to different diagnoses, symptoms improved in self-ratings with average effect sizes between 0.60 and 0.98. About 80% of positive changes could be sustained as determined in a 1-year follow-up survey. Patients with a lower concordance with the values of the clinic showed less health improvement. Compared to 14 other German psychosomatic clinics, the investigated treatment concept resulted in slightly higher decrease in symptoms (e.g., depression scale) and a higher self-rated mental and physical improvement in health. The data suggest that a successfully implemented salutogenetic clinical treatment concept not only has positive influence on treatment effects but also provides long-term stability. PMID:24159352

  16. Aerosol optical properties and radiative effect under different weather conditions in Harbin, China

    NASA Astrophysics Data System (ADS)

    Mao, Qianjun; Huang, Chunlin; Zhang, Hengxing; Chen, Qixiang; Yuan, Yuan

    2018-03-01

    The aerosol optical properties and radiative effect under different weather conditions in Harbin (126.63°E, 45.75°N) were analyzed based on ground-based Sun/Sky radiometric (CE-318) measurements during September 2016-April 2017. The means values of aerosol optical depth (AOD500) and Angstrom exponent (AE440-870) were 0.37 ± 0.27 and 1.08 ± 0.33, respectively. The mean AOD500 under four weather conditions are apparently higher in severe pollution (Se-Po) days (0.80 ± 0.31) and moderate pollution (Mo-Po) days (0.53 ± 0.25) but lower in slight pollution (Sl-Po) days (0.37 ± 0.26) and no pollution (No-Po) days (0.26 ± 0.20), while the mean values of AE440-870 maintain high, varying from 0.98 to 1.25. The higher AE440-870 indicated that the air quality in Harbin is mainly affected by aerosols originated from anthropogenic sources. The daily values of shortwave (0.25-4 μm) direct aerosol radiative forcing (DARF) at top/bottom of atmosphere (TOA/BOA) were estimated through Santa Barbara DISORT Atmosphere Radiative Transfer (SBDART) model. Further, the aerosol radiative forcing efficiency (ARFE), radiation flux (RF) and atmosphere heating rate (HR) in Harbin were also estimated by the SBDART model.

  17. Galileo photometry of asteroid 243 Ida

    USGS Publications Warehouse

    Helfenstein, P.; Veverka, J.; Thomas, P.C.; Simonelli, D.P.; Klaasen, K.; Johnson, T.V.; Fanale, F.; Granahan, J.; McEwen, A.S.; Belton, M.; Chapman, C.

    1996-01-01

    Galileo imaging observations over phase angles 19.5?? to 109.8?? are combined with near-opposition Earth-based data to derive the photometric properties of Ida. To first order these properties are uniform over the surface and well modeled at ?? = 0.55 ??m by Hapke parameters ????0 = 0.22, h = 0.020, B0 = 1.5, g = -0.33, and ?? = 18?? with corresponding geometric albedo p = 0.21??0.030.01 and Bond albedo AB = 0.081??0.0170.008. Ida's photometric properties are more similar to those of "average S-asteroids" (P. Helfenstein and J. Veverka 1989, Asteroids II, Univ. of Arizona Press, Tucson) than are those of 951 Gaspra. Two primary color units are identified on Ida: Terrain A exhibits a spectrum with relatively shallower 1-??m absorption and a relatively steeper red spectral slope than average Ida, while Terrain B has a deeper 1-??m absorption and a less steep red slope. The average photometric properties of Ida and Terrain A are similar while those of Terrain B differ mostly in having a slightly higher value of ????0 (0.22 versus 0.21), suggesting that Terrain B consists of slightly brighter, more transparent regolith particles. Galileo observations of Ida's satellite Dactyl over phase angles 19.5?? to 47.6?? suggest photometric characteristics similar to those of Ida, the major difference being Dactyl's slightly lower albedo (0.20 compared to 0.21). ?? 1990 Academic Press, Inc.

  18. Distribution and urban-suburban differences in ground-level ozone and its precursors over Shenyang, China

    NASA Astrophysics Data System (ADS)

    Liu, Ningwei; Ren, Wanhui; Li, Xiaolan; Ma, Xiaogang; Zhang, Yunhai; Li, Bingkun

    2018-03-01

    Hourly mixing ratio data of ground-level ozone and its main precursors at ambient air quality monitoring sites in Shenyang during 2013-2015 were used to survey spatiotemporal variations in ozone. Then, the transport of ozone and its precursors among urban, suburban, and rural sites was examined. The correlations between ozone and some key meteorological factors were also investigated. Ozone and O x mixing ratios in Shenyang were higher during warm seasons and lower during cold ones, while ozone precursors followed the opposite cycle. Ozone mixing ratios reached maximum and minimum values in the afternoon and morning, respectively, reflecting the significant influence of photochemical production during daytime and depletion via titration during nighttime. Compared to those in downtown Shenyang, ozone mixing ratios were higher and the occurrence of peak values were later in suburban and rural areas downwind of the prevailing wind. The differences were most significant in summer, when the ozone mixing ratios at one suburban downwind site reached a maximum value of 35.6 ppb higher than those at the downtown site. This suggests that photochemical production processes were significant during the transport of ozone precursors, particularly in warm seasons with sufficient sunlight. Temperature, total radiation, and wind speed all displayed positive correlations with ozone concentration, reflecting their important role in accelerating ozone formation. Generally, the correlations between ozone and meteorological factors were slightly stronger at suburban sites than in urban areas, indicating that ozone levels in suburban areas were more sensitive to these meteorological factors.

  19. Dental caries prevalence in the permanent teeth in Greek schoolchildren related to age, sex, urbanization and social status.

    PubMed

    Megas, B F; Athanassouli, T N

    1989-06-01

    An epidemiological study of caries experience in permanent teeth of 1739 schoolchildren aged 6-17 years was conducted in Epirus, a northwestern region of Greece. Dental caries was found to be prevalent in the population examined and to increase with age. The mean DMFT values at the ages of 6, 12 and 17 years were 0.53 +/- 1.13, 4.93 +/- 4.04 and 8.88 +/- 6.19 respectively, while the average DMFT value for the total population examined was 4.96 +/- 4.83. The percentages of the children with caries-free permanent dentitions were 80 per cent at the age of 6 years, 24 per cent at 12 years and 7 per cent at 17 years. The total percentage of caries-free children was 20 per cent. Girls were found to have a higher caries prevalence than boys in all age groups. Small differences in the caries prevalence were found between rural and urban children population. Children of lower socioeconomic levels exhibited slightly higher caries prevalence than children of higher levels. The results of this baseline study indicate that dental caries is a major problem in this region of Greece and therefore an active and effective programme of dental care is necessary for the child population.

  20. Is EMG of the lower leg dependent on weekly running mileage?

    PubMed

    Baur, H; Hirschmüller, A; Müller, S; Cassel, M; Mayer, F

    2012-01-01

    Neuromuscular activity of the lower leg is dependent on the task performed, speed of movement and gender. Whether training volume influences neuromuscular activity is not known. The EMG of physically active persons differing in running mileage was analysed to investigate this. 55 volunteers were allocated to a low (LM: < 30 km), intermediate (IM: > 30 km & < 45 km) or high mileage (HM: > 45 km) group according to their weekly running volume. Neuromuscular activity of the lower leg was measured during running (3.33 m·s - 1). Mean amplitude values for preactivation, weight acceptance and push-off were calculated and normalised to the mean activity of the entire gait cycle.Higher activity in the gastrocnemius group was observed in weight acceptance in LM compared to IM (+30%) and HM (+25%) but lower activity was present in the push-off for LM compared to IM and HM. For the peroneal muscle, differences were present in the push-off where HM showed increased activity compared to IM (+24%) and LM (+60%). The tibial muscle revealed slightly lower activity during preactivation for the high mileage runners. Neuromuscular activity differs during stance between the high and intermediate group compared to low mileage runners. Slight adaptations in neuromuscular activation indicate a more target-oriented activation strategy possibly due to repetitive training in runners with higher weekly mileage. © Georg Thieme Verlag KG Stuttgart · New York.

  1. Tensile Properties of Friction Stir Welded Joints of AA 2024-T6 Alloy at Different Welding Speeds

    NASA Astrophysics Data System (ADS)

    Avula, Dhananjayulu; Devuri, Venkateswarlu; Cheepu, Muralimohan; Dwivedi, Dheerendra Kumar

    2018-03-01

    The influence of welding speed on the friction stir welded joint properties of hardness, tensile properties, defects and microstructure characterization are studied in the present study. The friction stir welding was conducted on AA2014-T6 heat treated alloy with 5 mm thickness plate in butt joint configuration. The welding speed was varied from 8 mm/min to 120 mm/min at the fixed travel speed and load conditions. It is observed that the welding speeds at higher rate with wide range can be possible to weld this alloy at higher rates of tool revolution suggesting that the inherent capability of friction stir welding technique for aluminum 2014 alloys. The strength of the joints gradually increases with enhancing of welding speed. The micro structural observations exhibited the formation of equiaxed grains in the stir zone and slightly in the thermo-mechanically affected zone. In addition, the size of the grains decreases with increase in welding speed owing to the presence of low heat input. Hence the hardness of the joints slightly increased in the stir zones over the other zones of the weld nugget. The joint strength initially increases with the welding speed and starts to decreases after reaching to the maximum value. The relationship between the welding conditions and friction stir welded joint properties has been discussed.

  2. Acute Oral Toxicity of Trimethylolethane Trinitrate (TMETN) in Sprague- Dawley Rats

    DTIC Science & Technology

    1989-07-01

    classification scheme of Hodge and Steiner, these results indicate that TMETN is a slightly toxic compound.1 20. ON-RIBUTION /AVAILABILITY OF ABSTRACT 21. ABSTRACT...the classification scheme of Hodge and Sterner, these results indcate that TMETN is a slightly toxic compound. KEY WORDS: Acute Oral Toxicit-y...Dawley rats and 1027.4 63.7 mg/kg in female Sprague-Dawley rats. These MLD values place TMETN in the "slightly toxic" range by the system of Hodge and

  3. Effect of water hardness on the production and microbicidal efficacy of slightly acidic electrolyzed water.

    PubMed

    Forghani, Fereidoun; Park, Joong-Hyun; Oh, Deog-Hwan

    2015-06-01

    Slightly acidic electrolyzed water (SAEW) has been proved as an effective sanitizer against microorganisms attached to foods. However, its physical properties and inactivation efficacy are affected by several factors such as water hardness. Therefore, in this study the effect of water hardness on SAEW properties were studied. Pure cultures of foodborne bacteria were used in vitro and in vivo to evaluate the inactivation efficacy of the SAEWs produced. Results obtained showed water hardness to be an important factor in the production of SAEW. Low water hardness may result in the necessity of further optimization of production process. In this study the addition of 5% HCl and 2 M NaCl at 1.5 mL/min flow rate was found to be the best electrolyte concentration for the optimization of SAEW production from low hardness water (34 ± 2 mg/L). Furthermore, the results showed that pre-heating was a better approach compared to post-production heating of SAEW, resulting in higher ACC values and therefor better sanitization efficacy. Copyright © 2014 Elsevier Ltd. All rights reserved.

  4. [Uranium Concentration in Drinking Water from Small-scale Water Supplies in Schleswig-Holstein, Germany].

    PubMed

    Ostendorp, G

    2015-04-01

    In this study the drinking water of 212 small-scale water supplies, mainly situated in areas with intensive agriculture or fruit-growing, was analysed for uranium. The median uranium concentration amounted to 0.04 µg/lL, the 95(th) percentile was 2.5 µg/L. The maximum level was 14 µg/L. This sample exceeded the guideline value for uranium in drinking water. The uranium concentration in small-scale water supplies was found to be slightly higher than that in central water works in Schleswig-Holstein. Water containing more than 10 mg/L nitrate showed significantly higher uranium contents. The results indicate that the uranium burden in drinking water from small wells is mainly determined by geological factors. An additional anthropogenic effect of soil management cannot be excluded. Overall uranium concentrations were low and not causing health concerns. However, in specific cases higher concentrations may occur. © Georg Thieme Verlag KG Stuttgart · New York.

  5. Analysis of the mobile phone effect on the heart rate variability by using the largest Lyapunov exponent.

    PubMed

    Yılmaz, Derya; Yıldız, Metin

    2010-12-01

    In this study, the effects of electromagnetic fields (EMFs) emitted by GSM900 based mobile phones (MPs) on the heart rate variability (HRV) were examined by using nonlinear analysis methods. The largest Lyapunov exponent (LLE) calculation was used to evaluate the effect of MP under various real exposure conditions. Sixteen healthy young volunteers were exposed to EMFs emitted by GSM900 based MP at two levels from a very low EMF (MP at stand-by) to a higher EMF (MP at pre-ring handshaking and ringing). A blind experimental protocol was designed and utilized with consideration to the physiological and psychological factors that may affect HRV. The results showed that the LLE values increased slightly with higher EMF produced by MP (P < 0.05). This change indicates that the degree of chaos in the HRV signals increased at higher EMF compared to low level EMF. Consequently, we have concluded that high level EMF changed the complexity of cardiac system behavior, significantly.

  6. Cost-effectiveness of bazedoxifene versus raloxifene in the treatment of postmenopausal women in Spain

    PubMed Central

    Darbà, Josep; Pérez-Álvarez, Nuria; Kaskens, Lisette; Holgado-Pérez, Susana; Racketa, Jill; Rejas, Javier

    2013-01-01

    Background The purpose of this study was to assess the cost-effectiveness of bazedoxifene and raloxifene for prevention of vertebral and nonvertebral fractures among postmenopausal Spanish women aged 55–82 years with established osteoporosis and a high fracture risk. Methods A Markov model was developed to represent the transition of a cohort of postmenopausal osteoporotic women through different health states, ie, patients free of fractures, patients with vertebral or nonvertebral fractures, and patients recovered from a fracture. Efficacy data for bazedoxifene were obtained from the Osteoporosis Study. The perspective of the Spanish National Health Service was chosen with a time horizon of 27 years. Costs were reported in 2010 Euros. Deterministic results were presented as expected cost per quality-adjusted life-year (QALY), and probabilistic results were represented in cost-effectiveness planes. Results In deterministic analysis, the expected cost per patient was higher in the raloxifene cohort (€13,881) than in the bazedoxifene cohort (€13,436). QALYs gained were slightly higher in the bazedoxifene cohort (14.56 versus 14.54). Results from probabilistic sensitivity analysis showed that bazedoxifene has a slightly higher probability of being cost-effective for all threshold values independent of the maximum that the National Health Service is willing to pay per additional QALY. Conclusion Bazedoxifene was shown to be a cost-effective treatment option for the prevention of fractures in Spanish women with postmenopausal osteoporosis and a high fracture risk. When comparing bazedoxifene with raloxifene, it may be concluded that the former is the dominant strategy. PMID:23882153

  7. Relationships of consumer sensory ratings, marbling score, and shear force value to consumer acceptance of beef strip loin steaks.

    PubMed

    Platter, W J; Tatum, J D; Belk, K E; Chapman, P L; Scanga, J A; Smith, G C

    2003-11-01

    Logistic regression was used to quantify and characterize the effects of changes in marbling score, Warner-Bratzler shear force (WBSF), and consumer panel sensory ratings for tenderness, juiciness, or flavor on the probability of overall consumer acceptance of strip loin steaks from beef carcasses (n = 550). Consumers (n = 489) evaluated steaks for tenderness, juiciness, and flavor using nine-point hedonic scales (1 = like extremely and 9 = dislike extremely) and for overall steak acceptance (satisfied or not satisfied). Predicted acceptance of steaks by consumers was high (> 85%) when the mean consumer sensory rating for tenderness,juiciness, or flavor for a steak was 3 or lower on the hedonic scale. Conversely, predicted consumer acceptance of steaks was low (< or = 10%) when the mean consumer rating for tenderness, juiciness, or flavor for a steak was 5 or higher on the hedonic scale. As mean consumer sensory ratings for tenderness, juiciness, or flavor decreased from 3 to 5, the probability of acceptance of steaks by consumers diminished rapidly in a linear fashion. These results suggest that small changes in consumer sensory ratings for these sensory traits have dramatic effects on the probability of acceptance of steaks by consumers. Marbling score displayed a weak (adjusted R2 = 0.053), yet significant (P < 0.01), relationship to acceptance of steaks by consumers, and the shape of the predicted probability curve for steak acceptance was approximately linear over the entire range of marbling scores (Traces67 to Slightly Abundant97), suggesting that the likelihood of consumer acceptance of steaks increases approximately 10% for each full marbling score increase between Slight to Slightly Abundant. The predicted probability curve for consumer acceptance of steaks was sigmoidal for the WBSF model, with a steep decline in predicted probability of acceptance as WBSF values increased from 3.0 to 5.5 kg. Changes in WBSF within the high (> 5.5 kg) or low (< 3.0 kg) portions of the range of WBSF values had little effect on the probability of consumer acceptance of steaks.

  8. Detector evaluation of a prototype amorphous selenium-based full field digital mammography system

    NASA Astrophysics Data System (ADS)

    Jesneck, Jonathan L.; Saunders, Robert S.; Samei, Ehsan; Xia, Jessie Q.; Lo, Joseph Y.

    2005-04-01

    This study evaluated the physical performance of a selenium-based direct full-field digital mammography prototype detector (Siemens Mammomat NovationDR), including the pixel value vs. exposure linearity, the modulation transfer function (MTF), the normalized noise power spectrum (NNPS), and the detective quantum efficiency (DQE). The current detector is the same model which received an approvable letter from FDA for release to the US market. The results of the current prototype are compared to those of an earlier prototype. Two IEC standard beam qualities (RQA-M2: Mo/Mo, 28 kVp, 2 mm Al; RQA-M4: Mo/Mo, 35 kVp, 2 mm Al) and two additional beam qualities (MW2: W/Rh, 28 kVp, 2 mm Al; MW4: W/Rh, 35 kVp, 2 mm Al) were investigated. To calculate the modulation transfer function (MTF), a 0.1 mm Pt-Ir edge was imaged at each beam quality. Detector pixel values responded linearly against exposure values (R2 0.999). As before, above 6 cycles/mm Mo/Mo MTF was slightly higher along the chest-nipple axis compared to the left-right axis. MTF was comparable to the previously reported prototype, with slightly reduced resolution. The DQE peaks ranged from 0.71 for 3.31 μC/kg (12.83 mR) to 0.4 for 0.48 μC/kg (1.86 mR) at 1.75 cycles/mm for Mo/Mo at 28 kVp. The DQE range for W/Rh at 28 kVP was 0.81 at 2.03 μC/kg (7.87 mR) to 0.50 at 0.50 μC/kg (1.94 mR) at 1 cycle/mm. NNPS tended to increase with greater exposures, while all exposures had a significant low-frequency component. Bloom and detector edge artifacts observed previously were no longer present in this prototype. The new detector shows marked noise improvement, with slightly reduced resolution. There remain artifacts due to imperfect gain calibration, but at a reduced magnitude compared to a prototype detector.

  9. Clinical evaluation of a medical high dynamic range display

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Marchessoux, Cedric, E-mail: cedric.marchessoux@ba

    Purpose: Recent new medical displays do have higher contrast and higher luminance but do not have a High Dynamic Range (HDR). HDR implies a minimum luminance value close to zero. A medical HDR display prototype based on two Liquid Crystal layers has been developed. The goal of this study is to evaluate the potential clinical benefit of such display in comparison with a low dynamic range (LDR) display. Methods: The study evaluated the clinical performance of the displays in a search and detection task. Eight radiologists read chest x-ray images some of which contained simulated lung nodules. The study usedmore » a JAFROC (Jacknife Free Receiver Operating Characteristic) approach for analyzing FROC data. The calculated figure of merit (FoM) is the probability that a lesion is rated higher than all rated nonlesions on all images. Time per case and accuracy for locating the center of the nodules were also compared. The nodules were simulated using Samei’s model. 214 CR and DR images [half were “healthy images” (chest nodule-free) and half “diseased images”] were used resulting in a total number of nodules equal to 199 with 25 images with 1 nodule, 51 images with 2 nodules, and 24 images with 3 nodules. A dedicated software interface was designed for visualizing the images for each session. For the JAFROC1 statistical analysis, the study is done per nodule category: all nodules, difficult nodules, and very difficult nodules. Results: For all nodules, the averaged FoM{sub HDR} is slightly higher than FoM{sub LDR} with 0.09% of difference. For the difficult nodules, the averaged FoM{sub HDR} is slightly higher than FoM{sub LDR} with 1.38% of difference. The averaged FoM{sub HDR} is slightly higher than FoM{sub LDR} with 0.71% of difference. For the true positive fraction (TPF), both displays (the HDR and the LDR ones) have similar TPF for all nodules, but looking at difficult and very difficult nodules, there are more TP for the HDR display. The true positive fraction has been also computed in function of the local average luminance around the nodules. For the lowest luminance range, there is more than 30% in favor of the HDR display. For the highest luminance range, there is less than 6% in favor of the LDR display. Conclusions: This study shows the potential benefit of using a HDR display in radiology.« less

  10. Protein C

    MedlinePlus

    ... Normal Results Normal values are 60% to 150% inhibition. Normal value ranges may vary slightly among different ... Health Solutions. About MedlinePlus Site Map FAQs Customer Support Get email updates Subscribe to RSS Follow us ...

  11. Protein S

    MedlinePlus

    ... Normal Results Normal values are 60% to 150% inhibition. Normal value ranges may vary slightly among different ... Health Solutions. About MedlinePlus Site Map FAQs Customer Support Get email updates Subscribe to RSS Follow us ...

  12. [Effects of tourism disturbance on plant diversity in Qingshan Lake scenic area of Zhejiang Province].

    PubMed

    Lu, Qing-Bin; You, Wei-Yun; Zhao, Chang-Jie; Wang, Xiang-Wei; Meng-Xiang, Xiu

    2011-02-01

    From May 2007 to June 2008, an investigation was made on the changes of plant community in Qingshan Lake scenic area of Zhejiang Province under the effects of tourism disturbance. With the increase of tourism disturbance, the importance value of the plants was mainly fastened on a few species such as Pinus hwangshanensis, apt to decrease for tree and shrub species and to increase for herb species, and the individuals of the plants increased. The values of richness index (D) and diversity index (H) were in the order of medium disturbance > slight disturbance > severe disturbance, while the evenness index (J) value was in the order of medium disturbance > severe disturbance > slight disturbance. At the same vegetation layers, only a few species such as Cinnamomum camphora existed under different disturbances, and thereby, the similarity index values were smaller than 0.500. Slight disturbance affected coniferous forest most, with the average values of D, H, and J being the lowest (1.188, 1.056, and 0.697, respectively); severe disturbance affected broadleaf forest and shrub-herbage most, with the D value (2.013) of shrub-herbage and the H value (1.286) and J value (0.807) of broadleaf forest being the lowest; while medium disturbance was favorable to the increase of plant diversity and to the normal exertion of ecosystem function. The eco-safety of the structural elements of plant community in the scenic area was threatened to some extent, resulting in the reduction of indigenous species such as Sinocalycanthus chinensis and the incursion of exotic species as Setaria viridis.

  13. Assessment of natural radioactivity levels in soil samples from some areas in Assiut, Egypt.

    PubMed

    El-Gamal, Hany; Farid, M El-Azab; Abdel Mageed, A I; Hasabelnaby, M; Hassanien, Hassanien M

    2013-12-01

    The natural radioactivity of soil samples from Assiut city, Egypt, was studied. The activity concentrations of 28 samples were measured with a NaI(Tl) detector. The radioactivity concentrations of (226)Ra, (232)Th, and (40)K showed large variations, so the results were classified into two groups (A and B) to facilitate the interpretation of the results. Group A represents samples collected from different locations in Assiut and characterized by low activity concentrations with average values of 46.15 ± 9.69, 30.57 ± 4.90, and 553.14 ± 23.19 for (226)Ra, (232)Th, and (40)K, respectively. Group B represents samples mainly collected from the area around Assiut Thermal Power Plant and characterized by very high activity concentrations with average values of 3,803 ± 145, 1,782 ± 98, and 1,377 ± 78 for (226)Ra, (232)Th, and (40)K, respectively. In order to evaluate the radiological hazard of the natural radioactivity, the radium equivalent activity (Raeq), the absorbed dose rate (D), the annual effective dose rate (E), the external hazard index (H ex), and the annual gonadal dose equivalent (AGDE) have been calculated and compared with the internationally approved values. For group A, the calculated averages of these parameters are in good agreement with the international recommended values except for the absorbed dose rate and the AGDE values which are slightly higher than the international recommended values. However, for group B, all obtained averages of these parameters are much higher by several orders of magnitude than the international recommended values. The present work provides a background of radioactivity concentrations in the soil of Assiut.

  14. Reuse of imputed data in microarray analysis increases imputation efficiency

    PubMed Central

    Kim, Ki-Yeol; Kim, Byoung-Jin; Yi, Gwan-Su

    2004-01-01

    Background The imputation of missing values is necessary for the efficient use of DNA microarray data, because many clustering algorithms and some statistical analysis require a complete data set. A few imputation methods for DNA microarray data have been introduced, but the efficiency of the methods was low and the validity of imputed values in these methods had not been fully checked. Results We developed a new cluster-based imputation method called sequential K-nearest neighbor (SKNN) method. This imputes the missing values sequentially from the gene having least missing values, and uses the imputed values for the later imputation. Although it uses the imputed values, the efficiency of this new method is greatly improved in its accuracy and computational complexity over the conventional KNN-based method and other methods based on maximum likelihood estimation. The performance of SKNN was in particular higher than other imputation methods for the data with high missing rates and large number of experiments. Application of Expectation Maximization (EM) to the SKNN method improved the accuracy, but increased computational time proportional to the number of iterations. The Multiple Imputation (MI) method, which is well known but not applied previously to microarray data, showed a similarly high accuracy as the SKNN method, with slightly higher dependency on the types of data sets. Conclusions Sequential reuse of imputed data in KNN-based imputation greatly increases the efficiency of imputation. The SKNN method should be practically useful to save the data of some microarray experiments which have high amounts of missing entries. The SKNN method generates reliable imputed values which can be used for further cluster-based analysis of microarray data. PMID:15504240

  15. A study of compressibility and compactibility of directly compressible tableting materials containing tramadol hydrochloride.

    PubMed

    Mužíková, Jitka; Kubíčková, Alena

    2016-09-01

    The paper evaluates and compares the compressibility and compactibility of directly compressible tableting materials for the preparation of hydrophilic gel matrix tablets containing tramadol hydrochloride and the coprocessed dry binders Prosolv® SMCC 90 and Disintequik™ MCC 25. The selected types of hypromellose are Methocel™ Premium K4M and Methocel™ Premium K100M in 30 and 50 % concentrations, the lubricant being magnesium stearate in a 1 % concentration. Compressibility is evaluated by means of the energy profile of compression process and compactibility by the tensile strength of tablets. The values of total energy of compression and plasticity were higher in the tableting materials containing Prosolv® SMCC 90 than in those containing Disintequik™ MCC 25. Tramadol slightly decreased the values of total energy of compression and plasticity. Tableting materials containing Prosolv® SMCC 90 yielded stronger tablets. Tramadol decreased the strength of tablets from both coprocessed dry binders.

  16. Early history of the moon: Implications of U-Th-Pb and Rb-Sr systematics

    NASA Technical Reports Server (NTRS)

    Tatsumoto, M.; Nunes, P. D.; Unruh, D. M.

    1974-01-01

    Anorthosite 60015 contains the lowest initial Sr-87/Sr-86 ratio (0.69884 + or - 0.00004) yet reported for a lunar sample. The initial ratio is equal to that of the achondrite Angra dos Reis and slightly higher than the lowest measured Sr-87/Sr-86 ratio for an inclusion in the C3 carbonaceous chondrite Allende. The Pb-Pb ages of both Angra dos Reis and Allende are 4.62 x 10 to the 9th power years (4.62 billion years). Thus, the initial Sr-87/Sr-86 ratio found in lunar anorthosite 60015 strongly supports the hypothesis that the age of the moon is about 4.65 b.y. The U-238/Pb-204 value estimated for the source of the excess lead in orange soil 74220 is lower than the values estimated for the sources of KREEP (600-1000), high K (300-600) and low K (100-300) basalts.

  17. The (C III lambda 1909/Si III lambda 1892) ratio as a diagnostic for planetary nebulae and symbiotic stars

    NASA Technical Reports Server (NTRS)

    Feibelman, Walter A.; Aller, Lawrence H.

    1987-01-01

    Suitable IUE archival material on planetary nebulae has been examined to determine the log R /F(lambda 1909 C III)/F(lambda 1892 Si III)/ as a discriminant for distinguishing planetary nebulae from symbiotic stars and related objects. The mean value of log R for 73 galactic planetaries is 1.4, while that of extragalactic planetaries appears to be slightly lower, and that for symbiotics is 0.3. The lower value of log R for symbiotics is easily understood as a consequence of their higher densities. A plot of log R versus N-epsilon indicates that 80 percent of the planetaries fall into the range of log R between 1.2 and 1.8, but some of the 'peculiar' and bipolar nebulae fall below log R = 1.2. The corresponding N(C++)/N(Si++) ionic ratio varies over a large range.

  18. Factorial analysis of diesel engine performance using different types of biofuels.

    PubMed

    Tashtoush, Ghassan M; Al-Widyan, Mohamad I; Albatayneh, Aiman M

    2007-09-01

    In this study, several bio-source-fuels like fresh and waste vegetable oil and waste animal fat were tested at different injector pressures (120, 140, 190, 210 bar) in a direct-injection, naturally aspirated, single-cylinder diesel engine with a design injection pressure of 190 bar. Using 2k factorial analysis, the effect of injection pressure (Pi) and fuel type on three engine parameters, namely, combustion efficiency (etac), mass fuel consumption (mf), and engine speed (N) was examined. It was found that Pi and fuel type significantly affected both etac and mf while they had a slight effect on engine speed. Moreover, with diesel and biodiesels, the etac increased to a maximum at 190 bar but declined at the higher Pi value. In contrast, higher Pi had a favorable effect on etac over the whole Pi range with all the other more viscous fuels tested. In addition, the mass fuel consumption consistently decreased with an increase in Pi for all the fuels including the baseline diesel fuel, with which the engine consistently attained higher etac and higher rpm compared to all the other fuels tested.

  19. Behavior of flavonols and carotenoids of minimally processed kale leaves during storage in passive modified atmosphere packaging.

    PubMed

    Kobori, C N; Huber, L S; Sarantópoulos, C I G L; Rodriguez-Amaya, D B

    2011-03-01

    Minimally processed kale leaves were packed in passive modified atmosphere and stored at 3 conditions: 1 °C in the dark and 11 °C with or without light exposure. The products were evaluated during storage in terms of headspace gas composition, sensory attributes, flavonol, and carotenoid contents. The sensory quality decreased slightly during 17 d at 1 °C in the dark. At 11 °C, the vegetable shelf life was predicted to be 6 d in the dark and 3 d with light. Quercetin and kaempferol were stable during storage for 15 d at 1 °C in the absence of light. At 11 °C in the dark, quercetin was stable during 10 d, increasing slightly on the 8th day. Kaempferol decreased up to the 5th day but increased on the 8th day, decreasing again on the 10th day. After 5 d at 11 °C under light, the flavonol levels were significantly higher than those of the initial values. Neoxanthin and violaxanthin did not change significantly after 15 d at 1 °C in the dark. Lutein and β-carotene, however, decreased 7.1% and 11.3%, respectively. At 11 °C in the dark, neoxanthin, violaxanthin, lutein, and β-carotene decreased 16.1%, 13.2%, 24.1%, and 23.7% after 10 d, respectively. At 11 °C under light, neoxanthin and lutein had a slight increase while violaxanthin and β-carotene decreased 23.1% and 16.5% after 5 d. Practical Application:  Passive modified atmosphere packaging together with refrigeration can extend the shelf life of minimally processed kale, retaining the health-promoting compounds, flavonols and carotenoids. Quercetin, kaempferol, neoxanthin, and violaxanthin are stable and lutein and β-carotene slightly reduced.

  20. Lactate dehydrogenase test

    MedlinePlus

    Normal value range is 105 to 333 international units per liter (IU/L). Normal value ranges may vary slightly among different laboratories. Some labs use different measurements or test different samples. Talk to your provider about ...

  1. Theoretical estimation of 13C-D clumped isotope effects in methyl of several organic compound

    NASA Astrophysics Data System (ADS)

    LIU, Q.; Yin, X.; Liu, Y.

    2015-12-01

    Recent developments in mass spectrometry and tunable infrared laser direct absorption spectroscopy make it possible to measure 13C-D clumped isotope effects of methane. These techniques can be further applied to determine 13C-D clumped isotope effects of methyl fragments, therefore need accurate equilirbium Δi values to calibrate experimental measurements. In this study, we calculate temperature depandences of 13C-D clumped isotope signatures in methyl of several organic compounds including ethane, propane, acetic acid, etc. Our calculation are performed at CCSD/6-311+G(3df,3pd) by using Gaussian 03 program with no scale treament. Our results show that the Δi values of 13C-D clumping in methyl fragments of different organic compounds yield similar signals (~5.5‰ at 25˚C, slightly lower than Δi value of 13C-D clumping in methane). For testing the calculated accuracy, theoretical treaments beyond the harmonic level by including several higher-order corrections to the Bigeleisen-Mayer equation are used. Contributions from higher-order corrections (e.g., AnZPE, AnEXC, VrZPE, VrEXC, QmCorr and CenDist) are estimated to repire the ignorings of the Bigeleisen-Mayer equation (the anharmonic effects of vibration, vibration-rotation coupling, quantum mechanics and centrifugal distortion for rotation, etc.) for the calculation of partition function ratios. The results show that the higher-order corrections contribute ~0.05‰ at 25˚C, which is similar to the contribution for calculating 13C-D clumped isotope signature of methane. By comparing our calculated frequencies to the measured ones, the uncertainty of our calculation of Δi values 13C-D clumping in methyl fragments is considered to be within ~0.05‰ at room temperature.

  2. [School performance of former premature infants in the first four years of school].

    PubMed

    Frenzel, J; Paalhorn, U

    1992-12-01

    School achievement during the first four grades was analysed by means of subject marks in 203 prematurely born and in 140 maturely born children. In subjects referring to behaviour in the classroom, no statistically significant differences in average marks could be found between prematurely born children and the control group. The average marks in performance subjects were slightly higher in the subgroup of very prematurely born children. However, statistically significant lower marks were observed in the subject of sports only, and for formerly immature children also in the subject of manual training. The higher the educational level of the mothers, the better the average marks without sports. No relationships between school performance and manifestation of postnatal risk factor like Apgar score, blood gas values and duration of oxygen dependency could be seen. These results demonstrate that school performance of former premature infants lies within the normal variance of their grade.

  3. Thunderstorms and ground-based radio noise as observed by radio astronomy Explorer 1

    NASA Technical Reports Server (NTRS)

    Caruso, J. A.; Herman, J. R.

    1973-01-01

    Radio Astronomy Explorer (RAE) data were analyzed to determine the frequency dependence of HF terrestrial radio noise power. RAE observations of individual thunderstorms, mid-ocean areas, and specific geographic regions for which concommitant ground based measurements are available indicate that noise power is a monotonically decreasing function of frequency which conforms to expectations over the geographic locations and time periods investigated. In all cases investigated, active thunderstorm regions emit slightly higher power as contrasted to RAE observations of the region during meteorologically quiet periods. Noise levels are some 15 db higher than predicted values over mid-ocean, while in locations where ground based measurements are available a maximum deviation of 5 db occurs. Worldwide contour mapping of the noise power at 6000 km for five individual months and four observing frequencies, examples of which are given, indicate high noise levels over continental land masses with corresponding lower levels over ocean regions.

  4. Optical and mechanical properties of nanocrystalline ZrC thin films grown by pulsed laser deposition.

    DOE PAGES

    Craciun, D.; Socol, G.; Lambers, E.; ...

    2015-01-17

    Thin ZrC films (<500 nm) were grown on (100) Si substrates at a substrate temperature of 500 °C by the pulsed laser deposition (PLD) technique using a KrF excimer laser under different CH 4 pressures. Glancing incidence X-ray diffraction showed that films were nanocrystalline, while X-ray reflectivity studies found out films were very dense and exhibited a smooth surface morphology. Optical spectroscopy data shows that the films have high reflectivity (>90%) in the infrared region, characteristic of metallic behavior. Nanoindentation results indicated that films deposited under lower CH 4 pressures exhibited slightly higher nanohardness and Young modulus values than filmsmore » deposited under higher pressures. As a result, tribological characterization revealed that these films exhibited relatively high wear resistance and steady-state friction coefficients on the order of μ = 0.4.« less

  5. Effect of simulated climate warming on the morphological and physiological traits of Elsholtzia haichowensis in copper contaminated soil.

    PubMed

    Guan, Ming; Jin, Zexin; Li, Junmin; Pan, Xiaocui; Wang, Suizi; Li, Yuelin

    2016-01-01

    The aim of this study was to investigate the effects of temperature and Cu on the morphological and physiological traits of Elsholtzia haichowensis grown in soils amended with four Cu concentrations (0, 50, 500, and 1000 mg kg(-1)) under ambient temperature and slight warming. At the same Cu concentration, the height, shoot dry weight, total plant dry weight, and root morphological parameters such as length, surface area and tip number of E. haichowensis increased due to the slight warming. The net photosynthetic rate, stomatal conductance, transpiration, light use efficiency were also higher under the slight warming than under ambient temperature. The increased Cu concentrations, total Cu uptake, bioaccumulation factors and tolerance indexes of shoots and roots were also observed at the slight warming. The shoot dry weight, root dry weight, total plant dry weight and the bioaccumulation factors of shoots and roots at 50 mg Cu kg(-1) were significantly higher than those at 500 and 1000 mg Cu kg(-1) under the slight warming. Therefore, the climate warming may improve the ability of E. haichowensis to phytoremediate Cu-contaminated soil, and the ability improvement greatly depended on the Cu concentrations in soils.

  6. Origins of terrestrial organic matter in surface sediments of the East China Sea shelf

    NASA Astrophysics Data System (ADS)

    Zhang, Hailong; Xing, Lei; Zhao, Meixun

    2017-10-01

    Terrestrial organic matter (TOM) is an important component of marine sedimentary OM, and revealing the origins and transport mechanisms of TOM to the East China Sea (ECS) is important for understanding regional carbon cycle. A novel approach combining molecular proxies and compound-specific carbon isotopes is used to quantitatively constrain the origins and transport mechanisms of TOM in surface sediments from the ECS shelf. The content of terrestrial biomarkers of (C27+C29+C31) n-alkanes (52 to 580 ng g-1) revealed a seaward decreasing trend, the δ13CTOC values (-20.6‰ to -22.7‰) were more negative near the coast, and the TMBR (terrestrial and marine biomarker ratio) values (0.06 to 0.40) also revealed a seaward decreasing trend. These proxies all indicated more TOM (up to 48%) deposition in the coastal areas. The Alkane Index, the ratio of C29/(C29+C31) n-alkanes indicated a higher proportion of grass vegetation in the coastal area; While the δ13C values of C29 n-alkane (-29.3‰ to -33.8‰) indicated that terrestrial plant in the sediments of the ECS shelf were mainly derived from C3 plants. Cluster analysis afforded detailed estimates of different-sourced TOM contributions and transport mechanisms. TOM in the Zhejiang-Fujian coastal area was mostly delivered by the Changjiang River, and characterized by higher %TOM (up to 48%), higher %C3 plant OM (68%-85%) and higher grass plant OM (56%-61%); TOM in the mid-shelf area was mostly transported by aerosols, and characterized by low %TOM (less than 17%), slightly lower C3 plant OM (56%-72%) and lower grass plant OM (49%-55%).

  7. Soil properties of crocker formation and its influence on slope instability along the Ranau-Tambunan highway, Sabah

    NASA Astrophysics Data System (ADS)

    Azlan, Noran Nabilla Nor; Simon, Norbert; Hussin, Azimah; Roslee, Rodeano

    2016-11-01

    The Crocker formation on the study area consists of an inter-bedded shale and sandstone. The intense deformation and discontinuity on sandstone and shale beds of the arenaceous Crocker Formation makes them easily exposed to weathering and instability. In this study, a total of 15 selected slopes representing highly weathered material of stable and unstable conditions were studied to identify the characteristics of soil material on both conditions and how these characteristics will lead to instability. Physical properties analysis of soil material were conducted on 5 samples from stable slopes and 10 samples from failed slopes collected along the Ranau-Tambunan highway (RTM), Sabah. The analysis shows that the Crocker Formation consists mainly of poorly graded materials of sandy SILT with low plasticity (MLS) and PI value ranges from 1%-14. The failures materials are largely consist of low water content (0.94%-2.03%), higher finer texture material (11%-71%), intermediate liquid limit (21%-44%) and low plastic limit (20%-30%) while stable material consist of low water content (1.25%-1.80%), higher coarser texture material (43%-78%), low liquid limit (25%-28%) and low plastic limit (22%-25%). Specific gravity shows a ranges value of 2.24-2.60 for both slope conditions. The clay content in failed slope samples exhibit a slightly higher percentage of clay indicating a higher plasticity value compared to stable slopes. Statistical analysis was carried out to examine the association between landslide occurrences with soil physical properties in both stable and unstable slopes. The significant of both slope condition properties association to landslide occurrences was determined by mean rank differences. The study reveals that the grain size and plasticity of soil have contributed largely to slope instability in the study area.

  8. Mineralogical influences on porosity-depth trends of shelf deposits (Miocene-Pleistocene) along the northwest shelf of Australia (IODP Expedition 356)

    NASA Astrophysics Data System (ADS)

    Knierzinger, Wolfgang; Lee, Eun Young; Wagreich, Michael

    2017-04-01

    Porosity in sediments is influenced by various factors such as mineralogical composition, burial depth, connate fluids, and stratigraphic layering. This work focuses on processes underlying porosity anomalies in carbonate shelf deposits along the northwest shelf of Australia by using different techniques (polarization microscopy, electron microscopy, XRD, XRF). IODP expedition 356 recovered cored seven sites (U1458-U1464), covering a latitudinal range of 29°S-18°S on the northwest shelf. Strong negative deviations from general porosity-depth trends for these carbonate rich sediments are clear for samples with higher contents of dolomite, calcium sulfates, and non-skeletal calcite. No significant influence of aragonite on porosity values has yet been detected. However, it is likely that the occurrence of high amounts of aragonite is a crucial element with regard to porosity values in these carbonate rich deposits, since elongated aragonite needles commonly enhance interparticle porosity. Further insight might be gained through the application of electron microscopy. In general, sediments in the northern part of the study area (Sites U1462, U1463, U1464) tend to show slightly higher porosity values compared to sediments form the south (Sites U1459, U1460). This may reflect the influence of calcium sulfate, because mineralogical analyses show, calcium sulfate is relatively rare at the southern sites, whereas higher amounts of calcium sulfates occur in the north. The lack of detrital particles in calcium sulfate components indicates an evaporitic origin. Deposits at Site U 1461 differ from other analyzed sediments insofar as higher amounts of feldspars and micas are apparent. *This research is conducted within the frame of the 'International Ocean Discovery Program', funded by the Ministry of Oceans and Fisheries, Korea.

  9. Evaluation of the spline reconstruction technique for PET

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kastis, George A., E-mail: gkastis@academyofathens.gr; Kyriakopoulou, Dimitra; Gaitanis, Anastasios

    2014-04-15

    Purpose: The spline reconstruction technique (SRT), based on the analytic formula for the inverse Radon transform, has been presented earlier in the literature. In this study, the authors present an improved formulation and numerical implementation of this algorithm and evaluate it in comparison to filtered backprojection (FBP). Methods: The SRT is based on the numerical evaluation of the Hilbert transform of the sinogram via an approximation in terms of “custom made” cubic splines. By restricting reconstruction only within object pixels and by utilizing certain mathematical symmetries, the authors achieve a reconstruction time comparable to that of FBP. The authors havemore » implemented SRT in STIR and have evaluated this technique using simulated data from a clinical positron emission tomography (PET) system, as well as real data obtained from clinical and preclinical PET scanners. For the simulation studies, the authors have simulated sinograms of a point-source and three digital phantoms. Using these sinograms, the authors have created realizations of Poisson noise at five noise levels. In addition to visual comparisons of the reconstructed images, the authors have determined contrast and bias for different regions of the phantoms as a function of noise level. For the real-data studies, sinograms of an{sup 18}F-FDG injected mouse, a NEMA NU 4-2008 image quality phantom, and a Derenzo phantom have been acquired from a commercial PET system. The authors have determined: (a) coefficient of variations (COV) and contrast from the NEMA phantom, (b) contrast for the various sections of the Derenzo phantom, and (c) line profiles for the Derenzo phantom. Furthermore, the authors have acquired sinograms from a whole-body PET scan of an {sup 18}F-FDG injected cancer patient, using the GE Discovery ST PET/CT system. SRT and FBP reconstructions of the thorax have been visually evaluated. Results: The results indicate an improvement in FWHM and FWTM in both simulated and real point-source studies. In all simulated phantoms, the SRT exhibits higher contrast and lower bias than FBP at all noise levels, by increasing the COV in the reconstructed images. Finally, in real studies, whereas the contrast of the cold chambers are similar for both algorithms, the SRT reconstructed images of the NEMA phantom exhibit slightly higher COV values than those of FBP. In the Derenzo phantom, SRT resolves the 2-mm separated holes slightly better than FBP. The small-animal and human reconstructions via SRT exhibit slightly higher resolution and contrast than the FBP reconstructions. Conclusions: The SRT provides images of higher resolution, higher contrast, and lower bias than FBP, by increasing slightly the noise in the reconstructed images. Furthermore, it eliminates streak artifacts outside the object boundary. Unlike other analytic algorithms, the reconstruction time of SRT is comparable with that of FBP. The source code for SRT will become available in a future release of STIR.« less

  10. Estimated association between dwelling soil contamination and internal radiation contamination levels after the 2011 Fukushima Daiichi nuclear accident in Japan

    PubMed Central

    Tsubokura, Masaharu; Nomura, Shuhei; Sakaihara, Kikugoro; Kato, Shigeaki; Leppold, Claire; Furutani, Tomoyuki; Morita, Tomohiro; Oikawa, Tomoyoshi; Kanazawa, Yukio

    2016-01-01

    Objectives Measurement of soil contamination levels has been considered a feasible method for dose estimation of internal radiation exposure following the Chernobyl disaster by means of aggregate transfer factors; however, it is still unclear whether the estimation of internal contamination based on soil contamination levels is universally valid or incident specific. Methods To address this issue, we evaluated relationships between in vivo and soil cesium-137 (Cs-137) contamination using data on internal contamination levels among Minamisoma (10–40 km north from the Fukushima Daiichi nuclear power plant), Fukushima residents 2–3 years following the disaster, and constructed three models for statistical analysis based on continuous and categorical (equal intervals and quantiles) soil contamination levels. Results A total of 7987 people with a mean age of 55.4 years underwent screening of in vivo Cs-137 whole-body counting. A statistically significant association was noted between internal and continuous Cs-137 soil contamination levels (model 1, p value <0.001), although the association was slight (relative risk (RR): 1.03 per 10 kBq/m2 increase in soil contamination). Analysis of categorical soil contamination levels showed statistical (but not clinical) significance only in relatively higher soil contamination levels (model 2: Cs-137 levels above 100 kBq/m2 compared to those <25 kBq/m2, RR=1.75, p value <0.01; model 3: levels above 63 kBq/m2 compared to those <11 kBq/m2, RR=1.45, p value <0.05). Conclusions Low levels of internal and soil contamination were not associated, and only loose/small associations were observed in areas with slightly higher levels of soil contamination in Fukushima, representing a clear difference from the strong associations found in post-disaster Chernobyl. These results indicate that soil contamination levels generally do not contribute to the internal contamination of residents in Fukushima; thus, individual measurements are essential for the precise evaluation of chronic internal radiation contamination. PMID:27357196

  11. Radar stage uncertainty

    USGS Publications Warehouse

    Fulford, J.M.; Davies, W.J.

    2005-01-01

    The U.S. Geological Survey is investigating the performance of radars used for stage (or water-level) measurement. This paper presents a comparison of estimated uncertainties and data for radar water-level measurements with float, bubbler, and wire weight water-level measurements. The radar sensor was also temperature-tested in a laboratory. The uncertainty estimates indicate that radar measurements are more accurate than uncorrected pressure sensors at higher water stages, but are less accurate than pressure sensors at low stages. Field data at two sites indicate that radar sensors may have a small negative bias. Comparison of field radar measurements with wire weight measurements found that the radar tends to measure slightly lower values as stage increases. Copyright ASCE 2005.

  12. A MRCC study of the isomerisation of cyclopropane

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lang, Jakub; Švaňa, Matej; Demel, Ondřej

    2017-01-19

    Mukherjee’s and Brillouin-Wigner multi-reference coupled cluster methods were used to study the isomerization of cyclopropane to propene through a trimethylene/propylidene diradicals. Main aim was to obtain high quality ab-initio data using advanced methods that treat both static and dynamic correlation in the involved species. The MkCCSD(T)/cc-pVQZ activation energy of cyclopropane isomerization via trimethylene is 65.6 kcal/mol, in a good agreement with experimental values in the range 60-65 kcal/mol. The MkCCSD(T)/cc-pV5Z adiabatic singlet-triplet gap in trimethylene is 0.6 kcal/mol, slightly higher than previous CASPT2 result -0.7 kcal/mol by Skancke et al.

  13. Re-examining sleep׳s effect on motor skills: How to access performance on the finger tapping task?

    PubMed

    Ribeiro Pereira, Sofia Isabel; Beijamini, Felipe; Vincenzi, Roberta Almeida; Louzada, Fernando Mazzilli

    2015-01-01

    Here our goal was to determine the magnitude of sleep-related motor skill enhancement. Performance on the finger tapping task (FTT) was evaluated after a 90 min daytime nap (n=15) or after quiet wakefulness (n=15). By introducing a slight modification in the formula used to calculate the offline gains we were able to refine the estimated magnitude of sleep׳s effect on motor skills. The raw value of improvement after a nap decreased after this correction (from ~15% to ~5%), but remained significantly higher than the control. These results suggest that sleep does indeed play a role in motor skill consolidation.

  14. Isotopically exchangeable organic hydrogen in coal relates to thermal maturity and maceral composition

    USGS Publications Warehouse

    Mastalerz, Maria; Schimmelmann, A.

    2002-01-01

    Hydrogen isotopic exchangeability (Hex) and ??Dn values of non-exchangeable organic hydrogen were investigated in coal kerogens ranging in rank from lignite to graphite. The relative abundance of Hex is highest in lignite with about 18% of total hydrogen being exchangeable, and decreases to around 2.5% in coals with Ro of 1.7 to ca. 5.7%. At Still higher rank (Ro > 6%), Hex increases slightly, although the abundance of total hydrogen decreases. ??Dn is influenced by original biochemical D/H ratios and by thermal maturation in contact with water. Therefore, ??Dn does not show an overall consistent trend with maturity. ?? 2002 Elsevier Science Ltd. All rights reserved.

  15. [A study of Ververck index in 16 865 singleton neonates with a gestational age of 27-42 weeks in Shenzhen, China].

    PubMed

    Huang, Xiao-Yun; Liu, Hui-Long; Lei, Min; Lian, Zhao-Hui; Mai, Hui-Fen

    2018-01-01

    Ververck index (VI) reflects thoracic development, body type, and nutritional status. This study aimed to investigate the VI of singleton neonates with a gestational age (GA) of 27-42 weeks at birth, and to establish percentile curves of VI of the neonates. Cross-sectional cluster sampling was performed between April 2013 and September 2015. Body weight, body length, and chest circumference were measured for 16 865 singleton neonates with a GA of 27-42 weeks in two hospitals in Shenzhen, China. VI was calculated and the percentile curves of VI were plotted for the neonates. Mean VIs were obtained for singleton neonates with a gestational age of 27-42 weeks (in three groups of male, female, and both sexes), and related 3rd-97th percentile curves were plotted. As for the 50th percentile curve, the singleton neonates with a GA of 27 weeks had the lowest 50th percentile value of VI, which gradually increased with the increase in GA. The singleton neonates with a GA of 42 weeks had the highest 50th percentile value of VI. Girls had a slightly higher 50th percentile value of VI than boys in all GA groups. VI of neonates increases with the increase in GA. Female neonates may have a slightly better thoracic development, body type, and nutritional status than male neonates at birth. The percentile curves of VI plotted for singleton neonates with a GA of 27-42 weeks (in three groups of male, female, and both sexes) can provide a basis for evaluating thoracic development, body type, and nutritional status of neonates at birth in Shenzhen, China.

  16. Can lung function measurements be used to predict which patients will be at risk of developing interstitial pneumonitis after bone marrow transplantation?

    PubMed

    Milburn, H J; Prentice, H G; du Bois, R M

    1992-06-01

    Lung function often deteriorates after bone marrow transplantation for haematological malignancies. Whether pulmonary function measurements are useful for monitoring patients' progress after transplantation and for alerting clinicians to the development of pneumonitis is uncertain. Serial pulmonary function measurements were made in 39 patients with a haematological malignancy, and the values from 18 recipients of T cell depleted allogeneic (n = 17) or autologous (n = 1) bone marrow transplants who developed interstitial pneumonitis were compared retrospectively with values from 21 recipients of allogeneic (n = 17) or autologous (n = 4) transplants who did not develop pneumonitis. Lung function was measured at the onset of a further 18 episodes of pneumonitis. Measurements made before transplantation showed no difference in forced expiratory volume in one second (FEV1), transfer factor for carbon monoxide (TLCO), or total lung capacity between the two groups, but the forced vital capacity (FVC) was slightly higher in those who developed pneumonitis (mean (SD)% predicted 104 (12)) than in those who did not (93 (17%)). Six weeks and three months after transplantation all pulmonary function measurements had fallen slightly in both groups but TLCO had fallen considerably more in those who later developed pneumonitis, being 71% (SD 11%) and 77% (7%) of pretransplant values in patients who later developed pneumonitis compared with 109% (38%) and 96% (26%) in those who did not. All lung function measurements were significantly lower at the onset of pneumonitis than three months after transplantation, even in patients with no abnormal signs and a normal chest radiograph. Serial measurements of gas transfer before and after bone marrow transplantation may be useful for predicting which patients will be at risk of developing pneumonitis and may help to diagnose pneumonitis in breathless patients with no abnormal signs.

  17. Analysis of composite/difference field scattering properties between a slightly rough optical surface and multi-body defects.

    PubMed

    Gong, Lei; Wu, Zhensen; Gao, Ming; Qu, Tan

    2018-03-20

    The effective extraction of optical surface roughness and defect characteristic provide important realistic values to improve optical system efficiency. Based on finite difference time domain/multi-resolution time domain (FDTD/MRTD) mixed approach, composite scattering between a slightly rough optical surface and multi-body defect particles with different positions is investigated. The scattering contribution of defect particles or the slightly rough optical surface is presented. Our study provides a theoretical and technological basis for the nondestructive examination and optical performance design of nanometer structures.

  18. Genetic analyses of protein yield in dairy cows applying random regression models with time-dependent and temperature x humidity-dependent covariates.

    PubMed

    Brügemann, K; Gernand, E; von Borstel, U U; König, S

    2011-08-01

    Data used in the present study included 1,095,980 first-lactation test-day records for protein yield of 154,880 Holstein cows housed on 196 large-scale dairy farms in Germany. Data were recorded between 2002 and 2009 and merged with meteorological data from public weather stations. The maximum distance between each farm and its corresponding weather station was 50 km. Hourly temperature-humidity indexes (THI) were calculated using the mean of hourly measurements of dry bulb temperature and relative humidity. On the phenotypic scale, an increase in THI was generally associated with a decrease in daily protein yield. For genetic analyses, a random regression model was applied using time-dependent (d in milk, DIM) and THI-dependent covariates. Additive genetic and permanent environmental effects were fitted with this random regression model and Legendre polynomials of order 3 for DIM and THI. In addition, the fixed curve was modeled with Legendre polynomials of order 3. Heterogeneous residuals were fitted by dividing DIM into 5 classes, and by dividing THI into 4 classes, resulting in 20 different classes. Additive genetic variances for daily protein yield decreased with increasing degrees of heat stress and were lowest at the beginning of lactation and at extreme THI. Due to higher additive genetic variances, slightly higher permanent environment variances, and similar residual variances, heritabilities were highest for low THI in combination with DIM at the end of lactation. Genetic correlations among individual values for THI were generally >0.90. These trends from the complex random regression model were verified by applying relatively simple bivariate animal models for protein yield measured in 2 THI environments; that is, defining a THI value of 60 as a threshold. These high correlations indicate the absence of any substantial genotype × environment interaction for protein yield. However, heritabilities and additive genetic variances from the random regression model tended to be slightly higher in the THI range corresponding to cows' comfort zone. Selecting such superior environments for progeny testing can contribute to an accurate genetic differentiation among selection candidates. Copyright © 2011 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  19. Circulating parathyroid hormone and calcitonin in rats after spaceflight

    NASA Technical Reports Server (NTRS)

    Arnaud, Sara B.; Fung, Paul; Popova, Irina A.; Morey-Holton, Emily R.; Grindeland, Richard E.

    1992-01-01

    Parathyroid hormone and calcithonin, two major calcium-regulating hormones, were measured in the plasma of five experimental groups of rats to evaluate postflight calcium homeostasis after the 14-day Cosmos 2044 flight. Parathyroid hormone values were slightly higher in the flight animals (F) than in the appropriate cage and diet controls (S) (44 +/- 21 vs 21 +/- 4 pg/ml, P less than 0.05), but they were the same as in the vivarium controls (V), which had different housing and feeding schedules. The difference in F and V (22 +/- 11 vs 49 +/- 16 pg/ml, P less than 0.05) was most likely due to failure of circulating calcitonin in F to show the normal age-dependent increase which was demonstrated in age-matched controls in a separate experiment. Basal values for parathyroid hormone and calcitonin were unchanged after 2 wk of hindlimb suspension, a flight simulation model, in age-matched and younger rats. From a time course experiment serum calcium was higher and parathyroid hormone lower after 4 wk than in ambulatory controls. Postflight circulating levels of parathyroid hormone appear to reflect disturbances in calcium homeostasis from impaired renal function of undetermined cause, whereas levels of calcitonin reflect depression of a normal growth process.

  20. The Technical Efficiency of Specialised Milk Farms: A Regional View

    PubMed Central

    Špička, Jindřich; Smutka, Luboš

    2014-01-01

    The aim of the article is to evaluate production efficiency and its determinants of specialised dairy farming among the EU regions. In the most of European regions, there is a relatively high significance of small specialised farms including dairy farms. The DEAVRS method (data envelopment analysis with variable returns to scale) reveals efficient and inefficient regions including the scale efficiency. In the next step, the two-sample t-test determines differences of economic and structural indicators between efficient and inefficient regions. The research reveals that substitution of labour by capital/contract work explains the variability of the farm net value added per AWU (annual work unit) income indicator by more than 30%. The significant economic determinants of production efficiency in specialised dairy farming are farm size, herd size, crop output per hectare, productivity of energy, and capital (at α = 0.01). Specialised dairy farms in efficient regions have significantly higher farm net value added per AWU than inefficient regions. Agricultural enterprises in inefficient regions have a more extensive structure and produce more noncommodity output (public goods). Specialised dairy farms in efficient regions have a slightly higher milk yield, specific livestock costs of feed, bedding, and veterinary services per livestock unit. PMID:25050408

  1. Speciation studies of nickel and chromium in wastewater from an electroplating plant.

    PubMed

    Kiptoo, Jackson K; Ngila, J Catherine; Sawula, Gerald M

    2004-09-08

    A speciation scheme involving the use of flame atomic absorption spectrometry (FAAS) and differential pulse adsorptive cathodic stripping voltammetry (DPAdCSV) techniques was applied to studies of nickel and chromium in wastewater from a nickel-chrome electroplating plant. Dimethylglyoxime (DMG) and diethylenetriaminepentaacetic acid (DTPA) were employed as complexing agents for adsorptive voltammetric determination of Ni and Cr, respectively. Cr(III) and Cr(VI) were determined by exploiting differences in their reactivity towards DTPA at HMDE. Total dissolved metal content was in the range 2906-3141 and 30.7-31.2mgl(-1) for Ni and Cr, respectively. A higher percentage of the metal was present as labile species (mean value of 67.9% for Ni and 79.8% for Cr) suggesting that strongly binding ligands are not ubiquitous in the sample. About 77.8% of Cr was found to exist in the higher oxidization state, Cr(IV). Results on effect of dilution on lability of the metal forms in the sample using DPAdCSV showed slight peak shifts to a more negative (cathodic) value by -0.036V for Ni and -0.180V for Cr with a dilution factor of 100, while peak intensity (cathodic current) remained fairly constant.

  2. Comparison of survival of diarrhoeagenic agents in two local weaning foods (ogi and koko).

    PubMed

    Bakare, S; Smith, S I; Olukoya, D K; Akpan, E

    1998-12-01

    The pH values of both cooked and uncooked ogi and koko samples were determined and the survival rate of four diarrhoeagenic agents, enteroinvasive Escherichia coli, Salmonella typhi, Shigella flexneri, and Vibrio cholerae were studied after they were seeded into cooked ogi and koko. Analysis of the pH of the cooked inoculated samples showed that there was a slight increase in pH (decrease in acidity) during storage for 48 h and 37 degrees C (from 3.5 to 3.7 for ogi and from 3.7 to 4.1 for koko). The study also showed that ogi had a slightly lower pH value than koko both before and after cooking. In both cases, the cooked samples had a slightly lower pH value than the uncooked samples. The pH value of ogi ranged from 3.0 to 3.6 and that of koko from 3.5 to 3.9. The survival experiment showed that the inoculated enteric pathogens were inhibited in cooked ogi and koko during storage for 24-48 h. The antibacterial effect of cooked koko was more pronounced, on the four enteric pathogens studied, than that of cooked ogi. Except for Shigella flexneri and E. coli in ogi, non of the other bacteria studied was recovered after 24 h.

  3. Mapping strengths into virtues: the relation of the 24 VIA-strengths to six ubiquitous virtues

    PubMed Central

    Ruch, Willibald; Proyer, René T.

    2015-01-01

    The Values-in-Action-classification distinguishes six core virtues and 24 strengths. As the assignment of the strengths to the virtues was done on theoretical grounds it still needs empirical verification. As an alternative to factor analytic investigations the present study utilizes expert judgments. In a pilot study the conceptual overlap among five sources of knowledge (strength’s name including synonyms, short definitions, brief descriptions, longer theoretical elaborations, and item content) about a particular strength was examined. The results show that the five sources converged quite well, with the short definitions and the items being slightly different from the other. All strengths exceeded a cut-off value but the convergence was much better for some strengths (e.g., zest) than for others (e.g., perspective). In the main study 70 experts (from psychology, philosophy, theology, etc.) and 41 laypersons rated how prototypical the strengths are for each of the six virtues. The results showed that 10 were very good markers for their virtues, nine were good markers, four were acceptable markers, and only one strength failed to reach the cut-off score for its assigned virtue. However, strengths were often markers for two or even three virtues, and occasionally they marked the other virtue more strongly than the one they were assigned to. The virtue prototypicality ratings were slightly positively correlated with higher coefficients being found for justice and humanity. A factor analysis of the 24 strengths across the ratings yielded the six factors with an only slightly different composition of strengths and double loadings. It is proposed to adjust either the classification (by reassigning strengths and by allowing strengths to be subsumed under more than one virtue) or to change the definition of certain strengths so that they only exemplify one virtue. The results are discussed in the context of factor analytic attempts to verify the structural model. PMID:25954222

  4. Temporal trends in United States dew point temperatures

    NASA Astrophysics Data System (ADS)

    Robinson, Peter J.

    2000-07-01

    In this study, hourly data for the 1951-1990 period for 178 stations in the coterminous United States were used to establish temporal trends in dew point temperature. Although the data had been quality controlled previously (Robinson, 1998. Monthly variations of dew point temperatures in the coterminous United States. International Journal of Climatology 18: 1539-1556), comparisons of values between nearby stations suggested that instrumental changes, combined with locational changes, may have modified the results by as much as 1°C during the 40-year period. Nevertheless, seasonally averaged results indicated an increase over much of the area, of slightly over 1°C/100 years in spring and autumn, slightly less than this in summer. Winter displayed a drying of over 1°C/100 years. When only the 1961-1990 period was considered, the patterns were similar and trends increased by approximately 1-2°C/100 years, except in autumn, which displayed a slight drying. Analyses for specific stations indicated periods of both increasing and decreasing Td, the change between them varying with observation hour. No single change point was common over a wide area, although January commonly indicated maximum values early in the period in the east and west, and much later in the north-central portion. Rates of increase were generally higher in daytime than at night, especially in summer. Investigation of the inter-decadal differences in dew point, as a function of wind conditions, indicated that changes during calm conditions were commonly similar in magnitude to that of the overall average changes, suggesting an important role for the local hydrologic cycle in driving changes. Other inter-decadal changes could be attributed to the changes in the frequency and moisture content of invading air-streams. This was particularly clear for the changes in north-south flow in the interior.

  5. Primary biliary cirrhosis degree assessment by acoustic radiation force impulse imaging and hepatic fibrosis indicators

    PubMed Central

    Zhang, Hai-Chun; Hu, Rong-Fei; Zhu, Ting; Tong, Ling; Zhang, Qiu-Qin

    2016-01-01

    AIM: To evaluate the assessment of primary biliary cirrhosis degree by acoustic radiation force impulse imaging (ARFI) and hepatic fibrosis indicators. METHODS: One hundred and twenty patients who developed liver cirrhosis secondary to primary biliary cirrhosis were selected as the observation group, with the degree of patient liver cirrhosis graded by Child-Pugh (CP) score. Sixty healthy individuals were selected as the control group. The four indicators of hepatic fibrosis were detected in all research objects, including hyaluronic acid (HA), laminin (LN), type III collagen (PC III), and type IV collagen (IV-C). The liver parenchyma hardness value (LS) was then measured by ARFI technique. LS and the four indicators of liver fibrosis (HA, LN, PC III, and IV-C) were observed in different grade CP scores. The diagnostic value of LS and the four indicators of liver fibrosis in determining liver cirrhosis degree with PBC, whether used alone or in combination, were analyzed by receiver operating characteristic (ROC) curve. RESULTS: LS and the four indicators of liver fibrosis within the three classes (A, B, and C) of CP scores in the observation group were higher than in the control group, with C class > B class > A class; the differences were statistically significant (P < 0.01). Although AUC values of LS within the three classes of CP scores were higher than in the four indicators of liver fibrosis, sensitivity and specificity were unstable. The ROC curves of LS combined with the four indicators of liver fibrosis revealed that: AUC and sensitivity in all indicators combined in the A class of CP score were higher than in LS alone, albeit with slightly decreased specificity; AUC and specificity in all indicators combined in the B class of CP score were higher than in LS alone, with unchanged sensitivity; AUC values (0.967), sensitivity (97.4%), and specificity (90%) of all indicators combined in the C class of CP score were higher than in LS alone (0.936, 92.1%, 83.3%). CONCLUSION: The diagnostic value of PBC cirrhosis degree in liver cirrhosis degree assessment by ARFI combined with the four indicators of serum liver fibrosis is of satisfactory effectiveness and has important clinical application value. PMID:27298571

  6. Correlation dimensions of climate subsystems and their geographic variability

    NASA Astrophysics Data System (ADS)

    Gan, Thian Yew; Wang, Qiang; Seneka, Michael

    2002-12-01

    The correlation dimension D2 of precipitation (Canada and Africa), air temperature (Canada, New Zealand, and Southern Hemisphere), geo-potential height (Canada), and unregulated streamflow (Canada, USA, and Africa) were estimated using the Hill procedure of Mikosch and Wang [1995] and the bias correction of Wang and Gan [1998]. After bias correction, it seems that D2 is distinct between climate subsystems, such that for precipitation, it is between 8 and 9, for streamflow, it is between 7 and 9, for temperature, it is between 10 and 11, and for geo-potential heights, it is between 12 and 14. The results seem to suggest that climate might be viewed as a loosely coupled set of fairly high-dimensional subsystems and that different climate variables can yield different D2 values. Further, results also suggest that the D2 values of the climate subsystems studied, generally, have low geographic variability, as found between the precipitation data of Western Canada and Uganda, between the streamflow data of basins representing wide range climate and scales from Canada, USA, and Africa, and among the temperature data of Western Canada, New Zealand, and the southern hemisphere, and that the original D2 values analyzed from Canadian geo-potential heights are similar to that of Western Europe, eastern North America, and Germany. There is at most a weak relationship among basin physical characteristics, location, basin scale, and streamflow D2, while climatic influence is more obvious, as shown by drier basins having slightly higher D2 values than basins of wetter climate, basins from temperate climate having higher D2 values than those from cold or hot climates, and comparable D2 values between precipitation and streamflow data.

  7. Willingness to pay per quality-adjusted life year for life-saving treatments in Thailand.

    PubMed

    Nimdet, Khachapon; Ngorsuraches, Surachat

    2015-10-05

    To estimate the willingness to pay (WTP) per quality-adjusted life year (QALY) value for life-saving treatments and to determine factors affecting the WTP per QALY value. A cross-sectional survey with multistage sampling and face-to-face interviews. General population in the southern part of Thailand. A total of 600 individuals were included in the study. Only 554 (92.3%) responses were usable for data analyses. Participants were asked for the maximum amount of WTP value for life-saving treatments by an open-ended question. EQ-5D-3L and visual analogue scale (VAS) were used to estimate additional QALY. The amount of WTP values varied from 0 to 720,000 Baht/year (approximately 32 Baht=US$1). The averages of additional QALY obtained from VAS and EQ-5D-3L were only slightly different (0.872 and 0.853, respectively). The averages of WTP per QALY obtained from VAS and EQ-5D-3L were 244,720 and 243,120 Baht/QALY, respectively. As compared to male participants, female participants were more likely to pay less for an additional QALY (p=0.007). In addition, participants with higher household incomes tended to have higher WTP per QALY values (p<0.001). Our study added another WTP per QALY value specifically for life-saving treatments, which would complement the current cost-effectiveness threshold used in Thailand and optimise patient access to innovative treatments or technologies. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  8. Connecticut's Value-Based Insurance Plan Increased The Use Of Targeted Services And Medication Adherence.

    PubMed

    Hirth, Richard A; Cliff, Elizabeth Q; Gibson, Teresa B; McKellar, M Richard; Fendrick, A Mark

    2016-04-01

    In 2011 Connecticut implemented the Health Enhancement Program for state employees. This voluntary program followed the principles of value-based insurance design (VBID) by lowering patient costs for certain high-value primary and chronic disease preventive services, coupled with requirements that enrollees receive these services. Nonparticipants in the program, including those removed for noncompliance with its requirements, were assessed a premium surcharge. The program was intended to curb cost growth and improve health through adherence to evidence-based preventive care. To evaluate its efficacy in doing so, we compared changes in service use and spending after implementation of the program to trends among employees of six other states. Compared to employees of other states, Connecticut employees were similar in age and sex but had a slightly higher percentage of enrollees with chronic conditions and substantially higher spending at baseline. During the program's first two years, the use of targeted services and adherence to medications for chronic conditions increased, while emergency department use decreased, relative to the situation in the comparison states. The program's impact on costs was inconclusive and requires a longer follow-up period. This novel combination of VBID principles and participation requirements may be a tool that can help plan sponsors increase the use of evidence-based preventive services. Project HOPE—The People-to-People Health Foundation, Inc.

  9. Diagnostic accuracy of high-risk HPV genotyping in women with high-grade cervical lesions: evidence for improving the cervical cancer screening strategy in China.

    PubMed

    Xu, Huihui; Lin, Aifen; Shao, Xiujuan; Shi, Weiwu; Zhang, Yang; Yan, Weihua

    2016-12-13

    Currently, clinical data for primary HPV screening alone are lacking in China. Here, we evaluate cervical cancer screening with primary HPV genotyping, as well as possible future screening strategy. Overall, high-risk HPV (hrHPV) prevalence was 18.2% among hospital-based population in Taizhou area. For cervical intraepithelial neoplasia 2 or worse (CIN2+), the sensitivity of primary hrHPV genotyping strategy and current cervical cancer screening strategy were 93.5%, and 71.1%, respectively; whereas the specificity was 17.5%, and 62.4%, respectively. Current cervical screening strategy had slightly higher positive predictive values (28.4%) for CIN2+ than hrHPV genotyping strategy (21.9%), whereas primary hrHPV genotyping strategy demonstrated higher negative predictive values (94.7%) than current cervical screening strategy (91.1%). Compared to HPV35/39/45/51/56/59/66/68 genotypes, the odds ratios (OR) for CIN2+ in HPV16/18/31/33/52/58 infection women were 3.2 (95% confidence interval [CI] 2.3-4.1). Primary hrHPV genotyping strategy provides a better predictive value than HPV16/18 genotyping alone in guiding the clinical management of the current cervical cancer screening. HPV testing without adjunctive cytology may be sufficiently sensitive for primary cervical cancer screening.

  10. Strong antimicrobial activity of xanthohumol and other derivatives from hops (Humulus lupulus L.) on gut anaerobic bacteria.

    PubMed

    Cermak, Pavel; Olsovska, Jana; Mikyska, Alexandr; Dusek, Martin; Kadleckova, Zuzana; Vanicek, Jiri; Nyc, Otakar; Sigler, Karel; Bostikova, Vanda; Bostik, Pavel

    2017-11-01

    Anaerobic bacteria, such as Bacteroides fragilis or Clostridium perfringens, are part of indigenous human flora. However, Clostridium difficile represents also an important causative agent of nosocomial infectious antibiotic-associated diarrhoea. Treatment of C. difficile infection is problematic, making it imperative to search for new compounds with antimicrobial properties. Hops (Humulus lupulus L.) contain substances with antibacterial properties. We tested antimicrobial activity of purified hop constituents humulone, lupulone and xanthohumol against anaerobic bacteria. The antimicrobial activity was established against B. fragilis, C. perfringens and C. difficile strains according to standard testing protocols (CLSI, EUCAST), and the minimum inhibitory concentrations (MICs) and minimum bactericidal concentrations (MBC) were calculated. All C. difficile strains were toxigenic and clinically relevant, as they were isolated from patients with diarrhoea. Strongest antimicrobial effects were observed with xanthohumol showing MIC and MBC values of 15-107 μg/mL, which are close to those of conventional antibiotics in the strains of bacteria with increased resistance. Slightly higher MIC and MBC values were obtained with lupulone followed by higher values of humulone. Our study, thus, shows a potential of purified hop compounds, especially xanthohumol, as alternatives for treatment of infections caused by select anaerobic bacteria, namely nosocomial diarrhoea caused by resistant strains. © 2017 APMIS. Published by John Wiley & Sons Ltd.

  11. Gallium-68 DOTATOC PET/CT In Vivo Characterization of Somatostatin Receptor Expression in the Prostate

    PubMed Central

    Gajić, Milan M.; Obradović, Vladimir B.; Baum, Richard P.

    2014-01-01

    Abstract Aim: The aim was to investigate somatostatin receptor (sstr) expression in normal prostate by determining the maximum standardized uptake value (SUVmax) of 68Ga-DOTATOC PET/CT in neuroendocrine tumor (NET) patients, without NET involvement of the prostate gland, for establishing the reference standard. Methods: Sixty-four NET patients underwent 68Ga-DOTATOC PET/CT. SUVmax of the prostate gland, normal liver, testes, and gluteus muscles were evaluated. The prostate gland size was measured. Statistical analysis was performed using dedicated software (SPSS13). Results: Mean/median 68Ga-DOTATOC SUVmax values were as follows: normal prostate 2.6±0.0, slightly enlarged prostate 4.2±1.6, prostatic hypertrophy 4.9±1.6, prostatic hyperplasia 5.0±1.5, prostate cancer 9.5±2.1, normal liver 7.3±1.8, testes 1.8±0.5, and gluteus 1.0±0.2. The normal prostate gland had three times less sstr expression than normal liver tissue. Strong correlation was found between patient age and sstr expression in prostate/prostate size. No significant difference existed in sstr expression between prostatic hypertrophy and hyperplasia. Much higher sstr expression was found in prostatic cancer compared with normal prostate. Conclusion: 68Ga-DOTATOC PET/CT defines the baseline sstr uptake in prostate not affected by NET (significantly lower than in the liver). Higher values were established in prostatic hyperplasia and hypertrophy. Only concomitant prostate cancer was associated with higher SUVmax in comparison with non-neoplastic liver. PMID:24450327

  12. Natural variation in 210Po and 210Pb activity concentrations in the urine of Finnish population groups.

    PubMed

    Muikku, Maarit; Heikkinen, Tarja; Solatie, Dina; Vesterbacka, Pia

    2011-11-01

    A study to determine activity concentrations of (210)Pb and (210)Po in the urine of certain Finnish population groups was conducted, to investigate the variation in natural background level of urinary excretion. The study participants were divided into three groups mainly based on their diet. The first group comprised recreational fishermen and the second group represented people consuming more reindeer meat than an average Finn, while people using drinking water with very high activity concentrations of (210)Po were selected for the third group. The fourth group was a control group. The mean urinary excretion of (210)Po in groups 1 and 2 was 73 and 100 mBq d(-1), respectively. These values were higher than the value of the control group (20 mBq d(-1)) and the mean values reported in the literature. The mean daily urinary excretion of (210)Pb in groups 1 and 2, 70 and 52 mBq d(-1), was also slightly higher than that in the control group (32 mBq d(-1)). In contrast, the excretion rates of both (210)Po and (210)Pb for the members of group 3 were one to two orders of magnitude higher than those reported in the literature. This was clearly due to the elevated levels of natural radionuclides in their drinking water. The present study demonstrates the importance of possessing good knowledge of the background levels, in order to allow the determination of the additional exposure due, for example, to the malevolent use of radiation.

  13. Biomechanical evaluation of one-piece and two-piece small-diameter dental implants: In-vitro experimental and three-dimensional finite element analyses.

    PubMed

    Wu, Aaron Yu-Jen; Hsu, Jui-Ting; Chee, Winston; Lin, Yun-Te; Fuh, Lih-Jyh; Huang, Heng-Li

    2016-09-01

    Small-diameter dental implants are associated with a higher risk of implant failure. This study used both three-dimensional finite-element (FE) simulations and in-vitro experimental tests to analyze the stresses and strains in both the implant and the surrounding bone when using one-piece (NobelDirect) and two-piece (NobelReplace) small-diameter implants, with the aim of understanding the underlying biomechanical mechanisms. Six experimental artificial jawbone models and two FE models were prepared for one-piece and two-piece 3.5-mm diameter implants. Rosette strain gauges were used for in-vitro tests, with peak values of the principal bone strain recorded with a data acquisition system. Implant stability as quantified by Periotest values (PTV) were also recorded for both types of implants. Experimental data were analyzed statistically using Wilcoxon's rank-sum test. In FE simulations, the peak value and distribution of von-Mises stresses in the implant and bone were selected for evaluation. In in-vitro tests, the peak bone strain was 42% lower for two-piece implants than for one-piece implants. The PTV was slightly lower for one-piece implants (PTV = -6) than for two-piece implants (PTV = -5). In FE simulations, the stresses in the bone and implant were about 23% higher and 12% lower, respectively, for one-piece implants than those for two-piece implants. Due to the higher peri-implant bone stresses and strains, one-piece implants (NobelDirect) might be not suitable for use as small-diameter implants. Copyright © 2016. Published by Elsevier B.V.

  14. 16 CFR 1500.41 - Method of testing primary irritant substances.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... example: Skin reaction Exposure time (hours) Evaluation value Erythema and eschar formation: Intact skin... patches are removed and the resulting reactions are evaluated on the basis of the designated values in the following table: Skin reaction Value 1 Erythema and eschar formation: No erythema 0 Very slight erythema...

  15. Signal intensity on fluid-attenuated inversion recovery images of condylar marrow changes correspond with slight pain in patients with temporomandibular joint disorders.

    PubMed

    Kodama, Sayaka; Otonari-Yamamoto, Mika; Sano, Tsukasa; Sakamoto, Junichirou; Imoto, Kenichi; Wakoh, Mamoru

    2014-01-01

    Edema and necrosis of the temporomandibular joint (TMJ) have been described in terms of bone marrow signal abnormalities in magnetic resonance imaging (MRI). However, painful joints often show no such signaling abnormalities, making the diagnosis of TMJ disorders difficult in the clinical setting. An association has been suggested between TMJ bone marrow change and TMJ pain, but even when such change results in slight pain, it may be too slight to be visually apparent on MR images. We hypothesized that fluid-attenuated inversion recovery (FLAIR) can be used to detect such minimal changes. The purpose of this study was to determine whether there is an association between signal intensity on FLAIR images and pain in the TMJ. The study included 85 TMJs in 45 patients referred to our department for MRI. The signal intensity on FLAIR images was measured. Pain was evaluated based on the visual analog scale. An unpaired t test and Pearson's product-moment correlation coefficient were used for the statistical analysis. A p value of <0.05 was considered statistically significant. Signal intensity on the FLAIR images was significantly higher in painful than in nonpainful TMJs, although a significant correlation was not observed between the signal intensity and the pain score. The results of this study suggest an association between abnormalities in the marrow of the mandibular condyle and pain. They also indicate that FLAIR imaging is a useful tool in the clinical diagnosis of painful TMJs.

  16. Galileo Photometry of Asteroid 243 Ida

    NASA Astrophysics Data System (ADS)

    Helfenstein, P.; Veverka, J.; Thomas, P. C.; Simonelli, D. P.; Klaasen, K.; Johnson, T. V.; Fanale, F.; Granahan, J.; McEwen, A. S.; Belton, M.; Chapman, C.

    1996-03-01

    Galileo imaging observations over phase angles 19.5° to 109.8° are combined with near-opposition Earth-based data to derive the photometric properties of Ida. To first order these properties are uniform over the surface and well modeled at λ = 0.55 μm by Hapke parameters ω0= 0.22,h= 0.020,B0= 1.5,g= -0.33, and θ = 18° with corresponding geometric albedop= 0.21±0.030.01and Bond albedoAB= 0.081±0.0170.008. Ida's photometric properties are more similar to those of “average S-asteroids” (P. Helfenstein and J. Veverka 1989,Asteroids II, Univ. of Arizona Press, Tucson) than are those of 951 Gaspra. Two primary color units are identified on Ida: Terrain A exhibits a spectrum with relatively shallower 1-μm absorption and a relatively steeper red spectral slope than average Ida, while Terrain B has a deeper 1-μm absorption and a less steep red slope. The average photometric properties of Ida and Terrain A are similar while those of Terrain B differ mostly in having a slightly higher value of ω0(0.22 versus 0.21), suggesting that Terrain B consists of slightly brighter, more transparent regolith particles. Galileo observations of Ida's satellite Dactyl over phase angles 19.5° to 47.6° suggest photometric characteristics similar to those of Ida, the major difference being Dactyl's slightly lower albedo (0.20 compared to 0.21).

  17. Natural background groundwater composition in the Azores archipelago (Portugal): a hydrogeochemical study and threshold value determination.

    PubMed

    Cruz, J V; Andrade, C

    2015-07-01

    Groundwater discharges were sampled in selected springs from São Miguel (Furnas and Fogo trachytic central volcanoes) and Santa Maria islands (Azores, Portugal), in order to characterize natural background levels (NBLs) and proceed to the determination of threshold values (TVs). Besides being a key issue in order to fully assess the anthropogenic pressures, NBLs are also instrumental to derive TVs, therefore complying with requirements from the European Union Groundwater Directive. The composition of groundwater corresponds mainly to low mineralized Na-HCO3 to Na-Cl water types, the latter dominant in Santa Maria island, with a decreasing order of Na>Ca>Mg>K and Cl>HCO3>SO4>NO3 for cations and anion respectively. The majority of the samples are slightly acid to slightly alkaline (pH range of 5.45-7.43), and the electrical conductivity range between 180 and 1458 μS/cm. Groundwater composition is controlled by two major drivers, addition of sea salts and dissolution of silicate minerals. Results shown that TVs established along the present study are in general in the lower rank when compared to the range of values proposed by the several EU member states, with the main exception of NO3, reflecting the impact of agriculture activities over water quality in the Azores, and lower than the national ones. The comparison between the estimated NBL and TV with values derived with another dataset from the Azores, usually higher, depicts the effect of a larger and diverse number of groundwater sources over calculations. On the other hand, all samples which show a contribution from volcanic/hydrothermal systems were excluded from the dataset, which explains why the derived NBLs and TVs are lower comparing to other active volcanic areas, which is also a conservative approach on a subject that has regulatory implications. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. Comparing salt tolerance of beet cultivars and their halophytic ancestor: consequences of domestication and breeding programmes

    PubMed Central

    Rozema, Jelte; Cornelisse, Danny; Zhang, Yuancheng; Li, Hongxiu; Bruning, Bas; Katschnig, Diana; Broekman, Rob; Ji, Bin; van Bodegom, Peter

    2015-01-01

    Salt tolerance of higher plants is determined by a complex set of traits, the timing and rate of evolution of which are largely unknown. We compared the salt tolerance of cultivars of sugar beet and their ancestor, sea beet, in hydroponic studies and evaluated whether traditional domestication and more recent breeding have changed salt tolerance of the cultivars relative to their ancestor. Our comparison of salt tolerance of crop cultivars is based on values of the relative growth rate (RGR) of the entire plant at various salinity levels. We found considerable salt tolerance of the sea beet and slightly, but significantly, reduced salt tolerance of the sugar beet cultivars. This indicates that traditional domestication by selection for morphological traits such as leaf size, beet shape and size, enhanced productivity, sugar content and palatability slightly affected salt tolerance of sugar beet cultivars. Salt tolerance among four sugar beet cultivars, three of which have been claimed to be salt tolerant, did not differ. We analysed the components of RGR to understand the mechanism of salt tolerance at the whole-plant level. The growth rate reduction at higher salinity was linked with reduced leaf area at the whole-plant level (leaf area ratio) and at the individual leaf level (specific leaf area). The leaf weight fraction was not affected by increased salinity. On the other hand, succulence and leaf thickness and the net assimilation per unit of leaf area (unit leaf rate) increased in response to salt treatment, thus partially counteracting reduced capture of light by lower leaf area. This compensatory mechanism may form part of the salt tolerance mechanism of sea beet and the four studied sugar beet cultivars. Together, our results indicate that domestication of the halophytic ancestor sea beet slightly reduced salt tolerance and that breeding for improved salt tolerance of sugar beet cultivars has not been effective. PMID:25492122

  19. Factors associated with age at slaughter and carcass weight, price, and value of dairy cull cows.

    PubMed

    Bazzoli, I; De Marchi, M; Cecchinato, A; Berry, D P; Bittante, G

    2014-02-01

    The sale of cull cows contributes to the overall profit of dairy herds. The objective of this study was to quantify the factors associated with slaughter age (mo), cow carcass weight (kg), price (€/kg of carcass weight), and value (€/head) of dairy cull cows. Data included 20,995 slaughter records in the period from 2003 to 2011 of 5 different breeds: 2 dairy [Holstein Friesian (HF) and Brown Swiss (BS)] and 3 dual-purpose [Simmental (Si), Alpine Grey (AG), and Rendena (Re)]. Associations of breed, age of cow (except when the dependent variable was slaughter age), and year and month of slaughter with slaughter age, carcass weight, price, and value were quantified using a mixed linear model; herd was included as a random effect. The seasonal trends in cow price and value traits were inversely related to the number of cows slaughtered, whereas annual variation in external factors affected market conditions. Relative to BS cows, HF cows were younger at slaughter (73.1 vs. 80.7 mo), yielded slightly lighter carcasses (242 vs. 246 kg), and received a slightly lower price (1.69 vs. 1.73 €/kg) and total value (394 vs. 417 €/head). Dual-purpose breeds were older and heavier and received a much greater price and total value at slaughter (521, 516, and 549 €/head, respectively for Si, Re, and AG) than either dairy breed. Of the dual-purpose cows, Si carcasses were heavier (271 kg), whereas the carcasses of local breeds received a higher price (2.05 and 2.18 €/kg for Re and AG, respectively) and Alpine Grey cows were the oldest at slaughter (93.3 mo). The price per kilogram of cull cow carcasses was greatest for very young cows (i.e., <3 yr of age) and the differential in price and value between younger and older cows was greater in dual-purpose than in dairy breeds. Large differences in cull cow whole carcass value (carcass weight × unit price) among dairy breeds suggest that such a trait could be considered in the breeding objectives of the breeds. Copyright © 2014 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  20. Stable isotope ratios of marijuana. I. Carbon and nitrogen stable isotopes describe growth conditions.

    PubMed

    West, Jason B; Hurley, Janet M; Ehleringer, James R

    2009-01-01

    There remains significant uncertainty in illicit marijuana cultivation. We analyzed the delta(13)C and delta(15)N of 508 domestic samples from known U.S.A. counties, 31 seized from a single location, 5 samples grown in Mexico and Colombia, and 10 northwest border seizures. For a subset, inflorescences and leaves were analyzed separately. These data revealed a strong correspondence, with inflorescences having slightly higher delta(13)C and delta(15)N values than leaves. A framework for interpreting these results is introduced and evaluated. Samples identified as outdoor-grown by delta(13)C were generally recorded as such by the Drug Enforcement Administration (DEA). DEA-classified indoor-grown samples had the most negative delta(13)C values, consistent with indoor cultivation, although many were also in the outdoor-grown domain. Delta(15)N indicated a wide range of fertilizers across the dataset. Samples seized at the single location suggested multiple sources. Northwest border delta(13)C values suggested indoor growth, whereas for the Mexican and Colombian samples they indicated outdoor growth.

  1. Morphological responses of wheat to changes in phytochrome photoequilibrium

    NASA Technical Reports Server (NTRS)

    Barnes, C.; Bugbee, B.

    1991-01-01

    Wheat plants (Triticum aestivum L.) were grown at the same photosynthetic photon flux (PPF), 200 micromoles per square meter per second, but with phytochrome photoequilibrium (phi) values of 0.81, 0.55, and 0.33. Plants grown at phi values of 0.55 and 0.33 tillered 43 and 56%, less compared with plants grown at phi of 0.81. Main culm development (Haun stage) was slightly more advanced at lower values of phi, and leaf sheaths, but not leaf lamina, were longer at lower phi. Dry-mass accumulation was not affected by different levels of phi. Three levels of PPF (100, 200, and 400 micromoles per square meter per second) and two lamp types, metal halide and high pressure sodium, were also tested. Higher levels of PPF resulted in more dry mass, more tillering, and a more advanced Haun stage. There was no difference in plant dry mass or development under metal halide versus high pressure sodium lamps, except for total leaf length, which was greater under high pressure sodium lamps (49.5 versus 44.9 centimeters, P < 0.01).

  2. [Effects of artificial reef construction to marine ecosystem services value: a case of Yang-Meikeng artificial reef region in Shenzhen].

    PubMed

    Qin, Chuan-xin; Chem, Pi-mao; Jia, Xiao-ping

    2011-08-01

    Based on the researches and statistic data of Yangmeikeng artificial reef region in Shenzhen in 2008 and by the method of ecosystem services value, this paper analyzed the effects of artificial reef construction in the region on the marine ecosystem services. After the artificial reef construction, the tourism service value in the region decreased from 87% to 42%, food supply service value increased from 7% to 27%, and the services value of raw material supply, climatic regulation, air quality regulation, water quality regulation, harmful organism and disease regulation, and knowledge expansion had a slight increase, as compared to the surrounding coastal areas. The total services value per unit area of Yangmeikeng artificial reef region in 2008 was 1714.7 x 10(4) yuan x km(-2), far higher than the mean services value of coastal marine ecosystem in the surrounding areas of Shenzhen and in the world. Artificial reef construction affected and altered the structure of regional marine ecosystem services value, and improved the regional ecosystem services value, being of significance for the rational exploitation and utilization of marine resources and the successful recovery of damaged marine eco-environment and fish resources. Utilizing the method of ecosystem services value to evaluate artificial reef construction region could better elucidate the benefits of artificial reef construction, effectively promote the development of our artificial reef construction, and improve the management of marine ecosystem.

  3. The effect of upper gastrointestinal system endoscopy process on serum oxidative stress levels.

    PubMed

    Turan, Mehmet Nuri; Aslan, Mehmet; Bolukbas, Filiz Fusun; Bolukbas, Cengiz; Selek, Sahbettin; Sabuncu, Tevfik

    2016-12-01

    Some authors have investigated the effects of oxidative stress in some process such as undergoing laparoscopic. However, the effect of upper gastrointestinal system endoscopy process on oxidative stress is unclear. We evaluated the short-term effect of upper gastrointestinal system endoscopy process on oxidative stress. Thirty patients who underwent endoscopy process and 20 healthy controls were enrolled in the prospective study. Serum total antioxidant capacity and total oxidant status measurements were measured before and after endoscopy process. The ratio percentage of total oxidant status to total antioxidant capacity was regarded as oxidative stress index. Before endoscopy process, serum total antioxidant capacity levels were higher, while serum total oxidant status levels and oxidative stress index values were lower in patients than controls, but this difference was not statistically significant (all, p > 0.05). After endoscopy process, serum total antioxidant capacity and total oxidant status levels were significantly higher in patients than before endoscopy process (both, p < 0.05). However, oxidative stress index values were slight higher in patients but this difference was not statistically significant (p > 0.05). We observed that serum TAC and TOS levels were increased in patients who underwent endoscopy process after endoscopy process. However, short-time upper gastrointestinal system endoscopy process did not cause an important change in the oxidative stress index. Further studies enrolling a larger number of patients are required to clarify the results obtained here.

  4. Physiological and psychological factors associated with onset of high-altitude headache in Chinese men upon acute high-altitude exposure at 3700 m.

    PubMed

    Guo, Wen-Yun; Bian, Shi-Zhu; Zhang, Ji-Hang; Li, Qian-Ning; Yu, Jie; Chen, Jian-Fei; Tang, Cai-Fa; Rao, Rong-Sheng; Yu, Shi-Yong; Jin, Jun; Huang, Lan

    2017-04-01

    Aim We aimed to identify clinical characteristics and risk factors associated with onset of high-altitude headache (HAH) after acute exposure at 3700 m. Method In two hours, 163 individuals ascended by plane to 3700 m. Demographic information, physiological and psychological measurements, cognitive function, physical work capacity tests and profile of mood states within one week prior to the departure and within 24 hours after arrival were examined. Results HAH patients featured significantly higher vertebral artery diastolic velocity (V d ), heart rate (HR) and pulmonary artery diameter. HAH was also associated with a more negative mood state, including scores for tension anxiety, depression, hostility, fatigue and confusion, as well as lower vigor (all p values <0.05). Furthermore, negative emotions were positively related to HAH severity. HAH slightly decreased cognitive functioning. HR, V d , lack of vigor, confusion and self-reported anxiety (all p values <0.05) were independent risk factors for HAH. We have identified three independent baseline predictors for HAH including internal diameter of the left ventricle (LVD), Athens Insomnia Scale (AIS) and confusion score. Conclusions Higher HR, V d , confusion and self-reported anxiety and insufficient vigor were independent risk factors for HAH. Furthermore, higher baseline LVD, AIS and confusion score are independent predictors of HAH.

  5. Comparative survey of PAHs incidence in Portuguese traditional meat and blood sausages.

    PubMed

    Roseiro, L C; Gomes, A; Patarata, L; Santos, C

    2012-06-01

    Sixteen polycyclic aromatic hydrocarbons (PAHs) in representative traditional sausages produced in "Trás-os-Montes" and "Alentejo", were determined. Light PAHs represented similar overall contents in both regions and showed close decreasing order patterns (ACY, PHE, FLR and NAP), irrespective of the product type considered. Amongst the carcinogenic/mutagenic PAHs analyzed (PAH8), both regions also had greater contents associated to BaA and CHR, with slightly higher values for the former compound in "Alentejo" and, oppositely, for the later in "Trás-os-Montes". However, their quantitative comparison showed that the general mean total PAH content found in "Trás-os-Montes" was almost 3-fold higher than in similar products from "Alentejo" and this factor was about 8-fold superior when the PAH8 and PAH4 indicators were compared, expressing benzo[a]pyrene toxic equivalencies (BaPE), 15 times (total mean toxicity), 34 times (PAH8) and 9 times (PAH4) higher. In general terms, the mean BaP content of all analyzed samples from "Alentejo" was 0.41 μg kg(-1). Differently that value in "Trás-os-Montes" reached 3.57 μg kg(-1), expressing concerning average contents of 5.35, 5.87 and 4.51 μg kg(-1) in Chouriço de Carne, Moura and Salpicão sausages, respectively. Copyright © 2012 Elsevier Ltd. All rights reserved.

  6. [Spatial Distribution and Potential Ecological Risk Assessment of Heavy Metals in Soils and Sediments in Shunde Waterway, Southern China].

    PubMed

    Cai, Yi-min; Chen, Wei-ping; Peng, Chi; Wang, Tie-yu; Xiao, Rong-bo

    2016-05-15

    Environmental quality of soils and sediments around water source area can influence the safety of potable water of rivers. In order to study the pollution characteristics, the sources and ecological risks of heavy metals Zn, Cr, Pb, Cu, Ni and Cd in water source area, surface soils around the waterway and sediments in the estuary of main tributaries were collected in Shunde, and ecological risks of heavy metals were assessed by two methods of potential ecological risk assessment. The mean contents of Zn, Cr, Pb, Cu, Ni and Cd in the surface soils were 186.80, 65.88, 54.56, 32.47, 22.65 and 0.86 mg · kg⁻¹ respectively, and they were higher than their soil background values except those of Cu and Ni. The mean concentrations of Zn, Cr, Pb, Cu, Ni and Cd in the sediments were 312.11, 111.41, 97.87, 92.32, 29.89 and 1.72 mg · kg⁻¹ respectively, and they were higher than their soil background values except that of Ni. The results of principal component analysis illustrated that the main source of Cr and Ni in soils was soil parent materials, and Zn, Pb, Cu and Cd in soils mainly came from wastewater discharge of local manufacturing industry. The six heavy metals in sediments mainly originated from industry emissions around the Shunde waterway. The results of potential ecological risk assessment integrating environmental bioavailability of heavy metals showed that Zn, Cu, Pb and Ni had a slight potential ecological risk. Cd had a slight potential ecological risk in surface soils, but a moderate potential ecological risk in surfaces sediments. Because the potential ecological risk assessment integrating environmental bioavailability of heavy metals took the soil properties and heavy metal forms into account, its results of risks were lower than those of Hakanson methods, and it could avoid overestimating the potential risks of heavy metals.

  7. Validation and optimisation of an ICD-10-coded case definition for sepsis using administrative health data

    PubMed Central

    Jolley, Rachel J; Jetté, Nathalie; Sawka, Keri Jo; Diep, Lucy; Goliath, Jade; Roberts, Derek J; Yipp, Bryan G; Doig, Christopher J

    2015-01-01

    Objective Administrative health data are important for health services and outcomes research. We optimised and validated in intensive care unit (ICU) patients an International Classification of Disease (ICD)-coded case definition for sepsis, and compared this with an existing definition. We also assessed the definition's performance in non-ICU (ward) patients. Setting and participants All adults (aged ≥18 years) admitted to a multisystem ICU with general medicosurgical ICU care from one of three tertiary care centres in the Calgary region in Alberta, Canada, between 1 January 2009 and 31 December 2012 were included. Research design Patient medical records were randomly selected and linked to the discharge abstract database. In ICU patients, we validated the Canadian Institute for Health Information (CIHI) ICD-10-CA (Canadian Revision)-coded definition for sepsis and severe sepsis against a reference standard medical chart review, and optimised this algorithm through examination of other conditions apparent in sepsis. Measures Sensitivity (Sn), specificity (Sp), positive predictive value (PPV) and negative predictive value (NPV) were calculated. Results Sepsis was present in 604 of 1001 ICU patients (60.4%). The CIHI ICD-10-CA-coded definition for sepsis had Sn (46.4%), Sp (98.7%), PPV (98.2%) and NPV (54.7%); and for severe sepsis had Sn (47.2%), Sp (97.5%), PPV (95.3%) and NPV (63.2%). The optimised ICD-coded algorithm for sepsis increased Sn by 25.5% and NPV by 11.9% with slightly lowered Sp (85.4%) and PPV (88.2%). For severe sepsis both Sn (65.1%) and NPV (70.1%) increased, while Sp (88.2%) and PPV (85.6%) decreased slightly. Conclusions This study demonstrates that sepsis is highly undercoded in administrative data, thus under-ascertaining the true incidence of sepsis. The optimised ICD-coded definition has a higher validity with higher Sn and should be preferentially considered if used for surveillance purposes. PMID:26700284

  8. Organic food: nutritious food or food for thought? A review of the evidence.

    PubMed

    Magkos, Faidon; Arvaniti, Fotini; Zampelas, Antonis

    2003-09-01

    Apparently, one of the primary reasons for purchasing organic food is the perception that it is more nutritious than conventional food. Given the increasing interest towards organic food products, it is imperative to review the existing literature concerning the nutritional value of the produce, and to determine to what extent are consumer expectations met. There are only few well-controlled studies that are capable of making a valid comparison and, therefore, compilation of the results is difficult and generalisation of the conclusions should be made with caution. In spite of these limitations, however, some differences can be identified. Although there is little evidence that organic and conventional foods differ in respect to the concentrations of the various micronutrients (vitamins, minerals and trace elements), there seems to be a slight trend towards higher ascorbic acid content in organically grown leafy vegetables and potatoes. There is also a trend towards lower protein concentration but of higher quality in some organic vegetables and cereal crops. With respect to the rest of the nutrients and the other food groups, existing evidence is inadequate to allow for valid conclusions. Finally, animal feeding experiments indicate that animal health and reproductive performance are slightly improved when they are organically fed. A similar finding has not yet been identified in humans. Several important directions can be highlighted for future research; it seems, however, that despite any differences, a well-balanced diet can equally improve health regardless of its organic or conventional origin.

  9. Characterization of surface dielectric barrier discharge influenced by intermediate frequency for ozone production

    NASA Astrophysics Data System (ADS)

    Abdelaziz, Ayman A.; Ishijima, Tatsuo; Seto, Takafumi; Osawa, Naoki; Wedaa, Hassan; Otani, Yoshio

    2016-06-01

    The aim of this study is to investigate the effect of the intermediate frequency (1-10 kHz) of the sinusoidal driving voltage on the characteristics of a developed surface dielectric barrier discharge (SDBD)-based reactor having spikes on its discharge electrode. Moreover, its influence on the production of ozone and nitrogen oxide byproducts is evaluated. The results show that SDBD is operated in the filamentary mode at all the frequencies. Nevertheless, the pulses of the discharge current at high frequencies are much denser and have higher amplitudes than those at low frequencies. The analysis of the power consumed in the reactor shows that a small portion of the input power is dissipated in the dielectric material of SDBD source, whereas the major part of the power is consumed in the plasma discharge. The results of the ozone production show that higher frequencies have a slightly adverse effect on the ozone production at relatively high energy density values, where the ozone concentration is slightly decreased when the frequency is increased at the same energy density. The temperature of the discharge channels and gas is not a crucial factor for the decomposition of ozone in this reactor, while the results of the measurements of nitrogen oxides characteristics indicate that the formation of NO and NO2 has a significant adverse effect on the production efficiency of ozone due to their oxidation to another nitrogen oxides and their catalytic effect.

  10. The role of heavy metals and polychlorinated biphenyls (PCBs) in the oncogenesis of head and neck tumors and thyroid diseases: a pilot study.

    PubMed

    Petrosino, V; Motta, G; Tenore, G; Coletta, M; Guariglia, A; Testa, D

    2018-04-01

    Previous literature has highlighted the mechanisms of molecular toxicity induced by substances such as arsenic, cadmium, chromium, nickel, lead, barium and PCBs. The research was carried out on 20 volunteers, all the patients gave their consent to the research: the aim of the study was to evaluate the presence of metals and PCBs in these different matrices (blood and hair), correlating the biochemical data to pathological conditions present, and also to the area in which patients resided. Various quantitative determinations were carried out on samples of blood and hair for 14 heavy metals and on blood samples for 12 PCBs. For the 11 patients the results indicated that blood levels for half of the 14 displayed heavy metals measured considerably higher compared to the reference values, whilst the levels measured in hair evidenced some positive values significantly higher than the maximum reference. Of the 12 PCBs assayed in blood some showed higher positive values compared to the maximum tabular reference (although there is no clear reference quantified in the WHO-2005 report). In the 9 healthy patients heavy metals in the blood were within the expected target range, with those showing positive results (≤ 3 out of 14 heavy metals for each patient) having values only slightly higher than the reference maximum. The levels of 14 heavy metals measured in hair were below thresholds, and levels for the 12 PCBs measured in blood showed negativity or positivity with values close to the minimum benchmarks. The analyses carried out on biological matrices have uncovered important and significant differences between healthy and unhealthy subjects, both qualitative and quantitative differences with respect to heavy metals and PCBs. All patients with head and neck cancer enlisted for the study had heavy metal and PCB blood levels at least twice the maximum reference level. The levels of heavy metals in hair were at least double the maximum reference. In contrast, all healthy volunteers enrolled showed no significant levels for either metals or PCBs.

  11. Assessment of Maillard reaction evolution, prebiotic carbohydrates, antioxidant activity and α-amylase inhibition in pulse flours.

    PubMed

    Moussou, Nadia; Corzo-Martínez, Marta; Sanz, María Luz; Zaidi, Farid; Montilla, Antonia; Villamiel, Mar

    2017-03-01

    In this paper, the quality of bean, chickpea, fava beans, lentil and pea flours from Algeria has been evaluated. Maillard reaction (MR) indicators, modifications in the carbohydrate and protein fractions, antioxidant activity and α-amylase inhibitor of raw, toasted and stored samples were evaluated. Fava beans, beans and peas showed higher content of raffinose family oligosaccharides while chickpeas and lentils showed higher polyol content. Toasting and storage caused slightly change in pulse quality; MR showed slight losses of lysine but increased antioxidant activity. Moreover, inhibition of α-amylase was slightly augmented during processing; this could increase the undigested carbohydrates that reach the colon, modulating the glycemic response. These results point out the suitability of these flours for preparing high-quality foodstuffs intended for a wide spectrum of the population, including hyperglycemic and gluten intolerant individuals.

  12. [Value of DC and DRs in prediction of cardiovascular events in acute myocardial infarction patients].

    PubMed

    Gao, L; Chen, Y D; Shi, Y J; Xue, H; Wang, J L

    2016-05-24

    To investigate the value of deceleration capacity of rate (DC) and heart rate deceleration runs(DRs) in predicting cardiovascular events in patient with acute myocardial infarction (AMI). This study included 166 patients with AMI, who underwent ECG with sinus rhythm.These patients were followed-up for major adverse cardiac events (MACE). The receiver operating characteristic curve (ROC) was drawn to determine the best values for estimating the MACE. The mean follow-up time was (20.5±2.8) months, with 13 cases of cardiac death.There was statistically significant difference of DC, DRs and standard diviation of NN intervals(SDNN-24) between the death group and survival group.The area under the curve (AUC) of DC, DR4 and DR8 were larger than SDNN-24 (0.874, 0.804 vs 0.727). The values of DC, DR2, DR4 and root mean square of the successive differences(RMSSD) in the group of patients who underwent cardiac adverse events were smaller than the group of patients who didn't, and the AUC of DC was slightly higher than that of RMSSD. DC and DRs have important predictive value for cardiac death and MACE and can screen high-risk patients in patients with AMI.

  13. Ordovician Jeleniów Claystone Formation of the Holy Cross Mountains, Poland - Reconstruction of Redox Conditions Using Pyrite Framboid Study

    NASA Astrophysics Data System (ADS)

    Smolarek, Justyna; Marynowski, Leszek; Trela, Wiesław

    2014-09-01

    The aim of this research is to reconstruct palaeoredox conditions during sedimentation of the Jeleniów Claystone Formation deposits, using framboid pyrite diameter measurements. Analysis of pyrite framboids diameter distribution is an effective method in the palaeoenvironmental interpretation which allow for a more detailed insight into the redox conditions, and thus the distinction between euxinic, dysoxic and anoxic conditions. Most of the samples is characterized by framboid indicators typical for anoxic/euxinic conditions in the water column, with average (mean) values ranging from 5.29 to 6.02 urn and quite low standard deviation (SD) values ranging from 1.49 to 3.0. The remaining samples have shown slightly higher values of framboid diameter typical for upper dysoxic conditions, with average values (6.37 to 7.20 um) and low standard deviation (SD) values (1.88 to 2.88). From the depth of 75.5 m till the shallowest part of the Jeleniów Claystone Formation, two samples have been examined and no framboids has been detected. Because secondary weathering should be excluded, the lack of framboids possibly indicates oxic conditions in the water column. Oxic conditions continue within the Wólka Formation based on the lack of framboids in the ZB 51.6 sample.

  14. Ordovician Jeleniów Claystone Formation of the Holy Cross Mountains, Poland - Reconstruction of redox conditions using pyrite framboid study

    NASA Astrophysics Data System (ADS)

    Smolarek, Justyna; Marynowski, Leszek; Trela, Wiesław

    2014-09-01

    The aim of this research is to reconstruct palaeoredox conditions during sedimentation of the Jeleniów Claystone Formation deposits, using framboid pyrite diameter measurements. Analysis of pyrite framboids diameter distribution is an effective method in the palaeoenvironmental interpretation which allow for a more detailed insight into the redox conditions, and thus the distinction between euxinic, dysoxic and anoxic conditions. Most of the samples is characterized by framboid indicators typical for anoxic/euxinic conditions in the water column, with average (mean) values ranging from 5.29 to 6.02 μm and quite low standard deviation (SD) values ranging from 1.49 to 3.0. The remaining samples have shown slightly higher values of framboid diameter typical for upper dysoxic conditions, with average values (6.37 to 7.20 μm) and low standard deviation (SD) values (1.88 to 2.88). From the depth of 75.5 m till the shallowest part of the Jeleniów Claystone Formation, two samples have been examined and no framboids has been detected. Because secondary weathering should be excluded, the lack of framboids possibly indicates oxic conditions in the water column. Oxic conditions continue within the Wólka Formation based on the lack of framboids in the ZB 51.6 sample

  15. Michigan's forest resources in 2004

    Treesearch

    Mark H. Hansen; Gary J. Brand

    2006-01-01

    The sixth inventory of Michigan's forests was completed in 2004. The 18.7 million acres of timberland found is slightly higher than the 18.6 million acres found in the 1993 inventory. The standing timber volume has increased slightly at a rate of 0.22 percent per year. Detailed inventory results can be obtained at

  16. Geochemistry of the Neoproterozoic metabasic rocks from the Negele area, southern Ethiopia: Tectonomagmatic implications

    NASA Astrophysics Data System (ADS)

    Yihunie, Tadesse; Adachi, Mamoru; Yamamoto, Koshi

    2006-03-01

    Neoproterozoic metabasic rocks along with metasediments and ultramafic rocks constitute the Kenticha and Bulbul lithotectonic domains in the Negele area. They occur as amphibolite and amphibole schist in the Kenticha, and amphibole schist and metabasalt in the Bulbul domains. These rocks are dominantly basaltic in composition and exhibit low-K tholeiitic characteristics. They are slightly enriched in large ion lithophile (LIL) and light rare earth (LRE) elements and depleted in high field strength (HFS) and heavy rare earth (HRE) elements. They exhibit chemical characteristics similar to back-arc basin and island-arc basalts, but include a few samples with slightly higher Y, Zr and Nb contents. Initial Sr isotopic ratios and ɛNd values for the Kenticha metabasic rocks range from 0.7048 to 0.7051 and from 4.7 to 9.6 whereas for the Bulbul metabasic rocks they range from 0.7032 to 0.7055 and from -0.1 to 5.5, respectively. The trace elements and Sr-Nd isotope compositions of samples from the Kenticha and Bulbul domains suggest similar, but isotopically heterogeneous magma sources. The magma is inferred to have derived from depleted source with a contribution from an enriched mantle source component.

  17. Slight Fermentation with Lactobacillus fermentium Improves the Taste (Sugar:Acid Ratio) of Citrus (Citrus reticulata cv. chachiensis) Juice.

    PubMed

    Yu, Yuanshan; Xiao, Gengsheng; Xu, Yujuan; Wu, Jijun; Fu, Manqin; Wen, Jing

    2015-11-01

    The aim of this study was to evaluate the hypothesis that fermentation with Lactobacillus fermentium, which can metabolize citric acid, could be applied in improving the taste (sugar:acid ratio) of citrus juice. During fermentation, the strain of L. fermentium can preferentially utilize citric acid of citrus (Citrus reticulata cv. Chachiensis) juice to support the growth without the consumption of sugar. After 6 h of fermentation with L. fermentium at 30 °C, the sugar:acid ratio of citrus juice increased to 22:1 from 12:1, which resulted in that the hedonic scores of sweetness, acidity and overall acceptability of fermented-pasteurized citrus juice were higher than the unfermented-pasteurized citrus juice. Compared with unfermented-pasteurized citrus juice, the ORAC value and total amino acid showed a reduction, and no significant change (P > 0.05) in the L*, a*, b*, total soluble phenolics and ascorbic acid (Vc) content in the fermented-pasteurized citrus juice was observed as compared with unfermented-pasteurized citrus juice. Hence, slight fermentation with L. fermentium can be used for improving the taste (sugar:acid ratio) of citrus juice with the well retaining of quality. © 2015 Institute of Food Technologists®

  18. Cu-Zn isotope constraints on the provenance of air pollution in Central Europe: Using soluble and insoluble particles in snow and rime.

    PubMed

    Novak, Martin; Sipkova, Adela; Chrastny, Vladislav; Stepanova, Marketa; Voldrichova, Petra; Veselovsky, Frantisek; Prechova, Eva; Blaha, Vladimir; Curik, Jan; Farkas, Juraj; Erbanova, Lucie; Bohdalkova, Leona; Pasava, Jan; Mikova, Jitka; Komarek, Arnost; Krachler, Michael

    2016-11-01

    Copper (Cu) and zinc (Zn) isotope ratios can be used to fingerprint sources and dispersion pathways of pollutants in the environment. Little is known, however, about the potential of δ 65 Cu and δ 66 Zn values in liquid and solid forms of atmospheric deposition to distinguish between geogenic, industrial, local and remote sources of these potentially toxic base metals. Here we present Cu-Zn deposition fluxes at 10 mountain-top sites in the Czech Republic, a region affected by extremely high industrial emission rates 25 years ago. Additionally, we monitored isotope composition of Cu and Zn in vertical and horizontal atmospheric deposition at two sites. We compared δ 65 Cu and δ 66 Zn values in snow and rime, extracted by diluted HNO 3 and concentrated HF. Cu and Zn isotope signatures of industrial pollution sources were also determined. Cu and Zn deposition fluxes at all study sites were minute. The mean δ 65 Cu value of atmospheric deposition (-0.07‰) was higher than the mean δ 65 Cu value of pollution sources (-1.17‰). The variability in δ 65 Cu values of atmospheric deposition was lower, compared to the pollution sources. The mean δ 66 Zn value of atmospheric deposition (-0.09‰) was slightly higher than the mean δ 66 Zn value of pollution sources (-0.23‰). The variability in δ 66 Zn values of atmospheric deposition was indistinguishable from that of pollution sources. The largest isotope differences (0.35‰) were observed between the insoluble and soluble fractions of atmospheric deposition. These differences may result from different sources of Cu/Zn for each fraction. The difference in isotope composition of soluble and insoluble particles appears to be a promising tool for pollution provenance studies in Central Europe. Copyright © 2016 Elsevier Ltd. All rights reserved.

  19. Antioxidant (A-tocopherol acetate) effect on oxidation stability and NOx emission reduction in methyl ester of Annona oil operated diesel engine

    NASA Astrophysics Data System (ADS)

    Senthil, R.; Silambarasan, R.; Pranesh, G.

    2017-05-01

    There is a major drawback while using biodiesel as a alternate fuel for compression ignition diesel engine due to lower heating value, higher viscosity, higher density and higher oxides of nitrogen emission. To minimize these drawbacks, fuel additives can contribute towards engine performance and exhaust emission reduction either directly or indirectly. In this current work, the test was conducted to investigate the effect of antioxidant additive (A-tocopherol acetate) on oxidation stability and NOx emission in a of Annona methyl ester oil (MEAO) fueled diesel engine. The A-tocopherol acetate is mixed in different concentrations such as 0.01, 0.02, 0.03 and 0.04% with 100% by vol MEAO. It is concluded that the antioxidant additive very effective in increasing the oxidation stability and in controlling the NOx emission. Further, the addition of antioxidant additive is slight increase the HC, CO and smoke emissions. Hence, A-tocopherol acetate is very effective in controlling the NOx emission with MEAO operated diesel engine without any major modification.

  20. Thermogravimetric analysis and fast pyrolysis of Milkweed.

    PubMed

    Kim, Seung-Soo; Agblevor, Foster A

    2014-10-01

    Pyrolysis of Milkweed was carried out in a thermogravimetric analyzer and a bubbling fluidized bed reactor. Total liquid yield of Milkweed pyrolysis was between 40.74% and 44.19 wt% between 425 °C and 550 °C. The gas yield increased from 27.90 wt% to 33.33 wt% with increasing reaction temperature. The higher heating values (HHV) of the Milkweed bio-oil were relatively high (30.33-32.87 MJ/kg) and varied with reaction temperature, feeding rate and fluidization velocity. The selectivity for CO2 was highest within non-condensable gases, and the molar ratio of CO2/CO was about 3 at the different reaction conditions. The (13)C NMR analysis, of the bio-oil showed that the relative concentration carboxylic group and its derivatives was higher at 425 °C than 475 °C, which resulted in slightly higher oxygen content in bio-oil. The pH of aqueous phase obtained at 475 °C was 7.37 which is the highest reported for any lignocellulosic biomass pyrolysis oils. Copyright © 2014 Elsevier Ltd. All rights reserved.

  1. Anti-Muellerian hormone concentration in bitches with histopathologically diagnosed ovarian tumours and cysts.

    PubMed

    Walter, B; Coelfen, A; Jäger, K; Reese, S; Meyer-Lindenberg, A; Aupperle-Lellbach, H

    2018-06-01

    Increased concentrations of Anti-Muellerian hormone (AMH) can indicate a granulosa cell tumour as shown in women, mares and cows. To investigate AMH to differentiate canine granulosa cell tumour from other ovarian pathologies, we evaluated the ovaries of 63 bitches. Blood serum samples were collected before surgery for AMH analysis. Ovaries were submitted for histopathological examination. Fourteen bitches showed normal ovaries. These bitches had AMH values between 0.12 and 0.99 ng/ml. In 20 bitches ovarian cysts i.e., follicular cysts (n = 8), corpora lutea cysts (n = 7), subsurface cysts (n = 5) were diagnosed. These dogs had AMH values of 0.11-2.09 ng/ml. Bitches with small luteinized follicular cysts had slightly higher AMH values than those without ovarian alteration. In 29 cases ovarian neoplasms i.e., granulosa cell tumour (n = 9), epithelial tumours (n = 16), dysgerminomas (n = 3) and one sarcoma were identified. Anti-Muellerian hormone values of bitches with an ovarian neoplasm except granulosa cell tumour ranged from 0.18 to 1.18 ng/ml. The AMH values of bitches with granulosa cell tumour ranged from 1.12 to ≤23 ng/ml and were significantly higher (p < .05) than in all of the other bitches. The cut-off of 0.99 ng/ml gave a sensitivity of 100% and a specificity of 94.44% to diagnose granulosa cell tumour. In conclusion, markedly elevated AMH concentrations in bitches are indicative for a granulosa cell tumour. However, negative testing does not rule out the existence of small one. Differentiation of GCT from luteinized follicular cysts may especially be difficult. © 2018 Blackwell Verlag GmbH.

  2. Trends in the Prevalence of Overweight and Obesity among Chinese Preschool Children from 2006 to 2014.

    PubMed

    Xiao, Yanyu; Qiao, Yijuan; Pan, Lei; Liu, Jin; Zhang, Tao; Li, Nan; Liu, Enqing; Wang, Yue; Liu, Hongyan; Liu, Gongshu; Huang, Guowei; Hu, Gang

    2015-01-01

    To examine the trends in the prevalence of overweight and obesity among preschool children from 2006 to 2014. A total of 145,078 children aged 3-6 years from 46 kindergartens finished the annual health examination in Tianjin, China. Height, weight and other information were obtained using standardized methods. Z-scores for weight, height, and BMI were calculated based on the standards for the World Health Organization (WHO) child growth standards. From 2006 to 2014, mean values of height z-scores significantly increased from 0.34 to 0.54, mean values of weight z-scores kept constant, and mean values of BMI z-scores significantly decreased from 0.40 to 0.23. Mean values of height z-scores, weight z-scores, and BMI z-scores slightly decreased among children from 3 to 4 years old, and then increased among children from 4 to 6 years old. Between 2006 and 2014, there were no significant changes in prevalence of overweight (BMI z-scores >2 SD) and obesity (BMI z-scores >3 SD) among 3-4 years children. However, prevalence of obesity (BMI z-scores >2 SD) increased from 8.8% in 2006 to 10.1% in 2010, and then kept stable until 2014 among 5-6 years children. Boys had higher prevalence of obesity than girls. Mean values of BMI z-scores decreased from 2006 to 2014 among Chinese children aged 3-6 years old due to the significant increase of height z-scores. Prevalence of obesity increased from 2006 to 2010, and then kept stable until 2014 among children aged 5-6 years. The prevalence of obesity was higher in boys than in girls.

  3. Antioxidant, anticholinesterase and tyrosinase inhibition activities, and fatty acids of Crocus mathewii - A forgotten endemic angiosperm of Turkey.

    PubMed

    Yildiztekin, Fatma; Nadeem, Said; Erol, Ebru; Yildiztekin, Mahmut; Tuna, Atilla L; Ozturk, Mehmet

    2016-09-01

    Context We report the first ever chemical/biochemical study on Crocus mathewii Kerndorff (Iridaceae) - a Turkish endemic angiosperm. This plant has never been explored for its phytochemistry and bioactivities. Objective This study explores C. mathewii corm and aerial parts for the chemical and biological properties of hexane, ethyl acetate, methanol and water fractions of the extracts. Material and methods Plant material (20 g) was extracted by methanol (250 mL × 5, 3 days each) and fractioned into hexane, ethyl acetate, methanol and water. All fractions were subjected to β-carotene-linoleic acid, DPPH(·), ABTS(·)(+), CUPRAC, metal chelating and tyrosinase inhibition activities. Hexane fractions were submitted to GC-MS analysis. Results Ethyl acetate fractions showed excellent IC50 values in DPPH(·) (aerial 36.21 ± 0.76 and corm 33.87 ± 0.02 mg/L) and ABTS(·)(+) (aerial 33.01 ± 0.79 and bulb 27.87 ± 0.33 mg/L); higher than the IC50 of the standard α-tocopherol (DPPH 116.25 ± 1.97; ABTS 52.64 ± 0.37 mg/L), higher than BHA in DPPH (57.31 ± 0.25 mg/L), but slightly lower in ABTS (19.86 ± 2.73 mg/L). Methanol extract of aerial parts also showed higher activity than α-tocopherol in DPPH (85.56 ± 11.51 mg/L) but slightly less (72.90 ± 3.66 mg/L) than both the standards in ABTS. Linoleic (aerial 53.9%, corm 43.9%) and palmitic (aerial 22.2%, corm 18%) were found as the major fatty acids. Discussion and conclusion Some fractions of C. mathewii showed higher antioxidant activities than the standards. There is a need to explore more about this plant.

  4. Allelopathic effects of water extracts ofArtemisia princeps var.orientalis on selected plant species.

    PubMed

    Kil, B S; Yun, K W

    1992-01-01

    The allelopathic effects of wormwood plants (Artemisia princeps var.orientalis) and their possible phytotoxicity on receptor species were investigated. The aqueous extracts of mature leaf, stem, and root of wormwood plants caused significant inhibition in germination and decreased seedling elongation of receptor plants, whereas germination of some species was not inhibited by extracts of stems and roots. Dry weight growth was slightly increased at lower concentrations of the extract, whereas it was proportionally inhibited at higher concentrations. The calorie value of the organic matter in receptor plants measured by bomb calorimeter was reduced proportionally to the extract concentration. However, results with extracts of juvenile leaf did not correlate with inhibition or promotion of elongation and dry weight.

  5. Dietary intake of aluminum in a Spanish population (Canary Islands).

    PubMed

    González-Weller, Dailos; Gutiérrez, Angel José; Rubio, Carmen; Revert, Consuelo; Hardisson, Arturo

    2010-10-13

    The aim of this study was to analyze the aluminum content in foods and beverages most commonly consumed by the Canary Island population to determine the dietary intake of this metal throughout the Canary Islands as a whole and in each of the seven islands (Gran Canaria, Lanzarote, Fuerteventura, Tenerife, La Palma, La Gomera, and El Hierro). Four hundred and forty samples were analyzed by ICP-OES. Estimated total intake of aluminum for the Canary population was 10.171 mg/day, slightly higher than the provisional tolerable weekly intake (PTWI; 10 mg/day for a person weighing 70 kg). Aluminum intake by age and sex of the Canary Island population was also determined and compared values from other populations, both national and international.

  6. Metal-Insulator Transition of strained SmNiO3 Thin Films: Structural, Electrical and Optical Properties

    PubMed Central

    Torriss, B.; Margot, J.; Chaker, M.

    2017-01-01

    Samarium nickelate (SmNiO3) thin films were successfully synthesized on LaAlO3 and SrTiO3 substrates using pulsed-laser deposition. The Mott metal-insulator (MI) transition of the thin films is sensitive to epitaxial strain and strain relaxation. Once the strain changes from compressive to tensile, the transition temperature of the SmNiO3 samples shifts to slightly higher values. The optical conductivity reveals the strong dependence of the Drude spectral weight on the strain relaxation. Actually, compressive strain broadens the bandwidth. In contrast, tensile strain causes the effective number of free carriers to reduce which is consistent with the d-band narrowing. PMID:28098240

  7. An examination of the hexokinase method for serum glucose assay using external quality assessment data.

    PubMed

    Westwood, A; Bullock, D G; Whitehead, T P

    1986-01-01

    Hexokinase methods for serum glucose assay appeared to give slightly but consistently higher inter-laboratory coefficients of variation than all methods combined in the UK External Quality Assessment Scheme; their performance over a two-year period was therefore compared with that for three groups of glucose oxidase methods. This assessment showed no intrinsic inferiority in the hexokinase method. The greater variation may be due to the more heterogeneous group of instruments, particularly discrete analysers, on which the method is used. The Beckman Glucose Analyzer and Astra group (using a glucose oxidase method) showed the least inter-laboratory variability but also the lowest mean value. No comment is offered on the absolute accuracy of any of the methods.

  8. A Novel Highly Sensitive NO2 Sensor Based on Perovskite Na0.5+xBi0.5TiO3-δ Electrolyte.

    PubMed

    Xiao, Yihong; Zhang, Chufan; Zhang, Xu; Cai, Guohui; Zheng, Yong; Zheng, Ying; Zhong, Fulan; Jiang, Lilong

    2017-07-10

    NO x is one of dangerous air pollutants, and the demands for reliable sensors to detect NO x are extremely urgent recently. Conventional fluorite-phase YSZ used for NO x sensor requires higher operating temperature to obtain desirable oxygen ion conductivity. In this work, perovskite-phase Na 0.5 Bi 0.5 TiO 3 (NBT) oxygen conductor was chosen as the solid electrolyte to fabricate a novel highly sensitive NO 2 sensor with CuO as the sensing electrode and Pt as reference electrode. Na dopped Na 0.5 Bi 0.5 TiO 3 greatly improved the sensing performance of this sensor. The optimal sensor based on Na 0.51 Bi 0.50 TiO 3-δ exhibited good response-recovery characteristics to NO 2 and the response current values were almost linear to NO 2 concentrations in the range of 50-500 ppm at 400-600 °C. The response current value towards NO 2 reached maximum 11.23 μA at 575 °C and the value on NO 2 is much higher than other gases (CH 4 , C 2 H 4 , C 3 H 6 , C 3 H 8 , CO), indicating good selectivity for detecting NO 2 . The response signals of the sensor were slightly affected by coexistent O 2 varying from 2 to 21 vol% at 575 °C. The response current value decreased only 4.9% over 2 months, exhibiting the potential application in motor vehicles.

  9. Observational test of empirical magnetopause location models using geosynchronous satellite data

    NASA Astrophysics Data System (ADS)

    Park, Eunsu; Moon, Y.-J.; Lee, Kangjin

    2016-11-01

    In this study, we identify 123 geosynchronous magnetopause crossings using geosynchronous satellite observation data from 1996 to 2010 as well as make an observational test of magnetopause location models using the identified events. For this, we consider three models: Petrinec and Russell (1996), Shue et al. (1998), and Lin et al. (2010). To evaluate the models, we estimate a probability of detection (PoD) and a critical success index (CSI) as a function of year. To examine the effect of solar cycle phase, we consider three different time periods: (1) ascending phase (1996-1999), (2) maximum phase (2000-2002), and (3) descending phase (2003-2008). Major results from this study are as follows. First, the PoD values of all models range from 0.4 to 0.8 for the most of years. Second, the PoD values of Lin et al. (2010) are noticeably higher than those of the other models. Third, the CSI values of all models range from 0.1 to 0.3, and those of Shue et al. (1998) are slightly higher than those of the other models. Fourth, the predicted magnetopause radii based on Lin et al.(2010) well match the observed ones within 1 Earth radius, while those on Shue et al. (1998) overestimate the observed ones by about 2 Earth radii. Fifth, the PoD and critical success index (CSI) values of all the models are better for the solar maximum phase than those for the other phases, implying that the models are more optimized for the phase.

  10. Predicting out-of-office blood pressure level using repeated measurements in the clinic: an observational cohort study

    PubMed Central

    Sheppard, James P.; Holder, Roger; Nichols, Linda; Bray, Emma; Hobbs, F.D. Richard; Mant, Jonathan; Little, Paul; Williams, Bryan; Greenfield, Sheila; McManus, Richard J.

    2014-01-01

    Objectives: Identification of people with lower (white-coat effect) or higher (masked effect) blood pressure at home compared to the clinic usually requires ambulatory or home monitoring. This study assessed whether changes in SBP with repeated measurement at a single clinic predict subsequent differences between clinic and home measurements. Methods: This study used an observational cohort design and included 220 individuals aged 35–84 years, receiving treatment for hypertension, but whose SBP was not controlled. The characteristics of change in SBP over six clinic readings were defined as the SBP drop, the slope and the quadratic coefficient using polynomial regression modelling. The predictive abilities of these characteristics for lower or higher home SBP readings were investigated with logistic regression and repeated operating characteristic analysis. Results: The single clinic SBP drop was predictive of the white-coat effect with a sensitivity of 90%, specificity of 50%, positive predictive value of 56% and negative predictive value of 88%. Predictive values for the masked effect and those of the slope and quadratic coefficient were slightly lower, but when the slope and quadratic variables were combined, the sensitivity, specificity, positive and negative predictive values for the masked effect were improved to 91, 48, 24 and 97%, respectively. Conclusion: Characteristics obtainable from multiple SBP measurements in a single clinic in patients with treated hypertension appear to reasonably predict those unlikely to have a large white-coat or masked effect, potentially allowing better targeting of out-of-office monitoring in routine clinical practice. PMID:25144295

  11. 210-Polonium studies in some environmental and biological matrices of Domiasiat uranium deposit area, West Khasi Hills, Meghalaya, India.

    PubMed

    Marbaniang, Deswyn G; Poddar, Raj K; Nongkynrih, Phlis; Khathing, Darlando T

    2010-03-01

    The study was performed using a silicon surface barrier alpha spectrometer at Bhabha Atomic Research Centre, Mumbai, India. Through the study, the observed (210)Po activity in water sample from different locations in the Domiasiat area ranges from 0.04 to 0.69 Bq/l. The daily and annual intake of (210)Po through water was also estimated and the mean value of 0.72 and 263.61 Bq, respectively, were observed. It is observed that the effective doses through water were higher than the World Health Organization recommended dose of 0.05 mSv/year. The total annual effective doses through terrestrial ingestion for all the locations was studied and the mean annual effective dose was observed to be 0.315 mSv, which, when compared to the worldwide and the Indian values, was observed to be slightly higher. The mean activity in soil is found to be 124.8 +/-5.7 Bq/kg and in meat the activity is 0.43 +/-0.05 Bq/kg. In fishes, an activity of 0.48 +/-0.07 Bq/kg in Garra lamta, 0.29 +/-0.02 Bq/kg in Neolissocheilus hexaganolepis, and 3.3 +/-0.1 Bq/kg in Macrobrachium sp. is observed. Activity concentration in plant samples was analyzed and the activity ranges from 0.020 +/-0.002 to 9.69 +/-0.35 Bq/kg. Committed effective dose by the adult population of the Domiasiat area through intake of (210)Po through these food items was also determined and compared with the Indian average value and the worldwide average value.

  12. Sustainable energy development of bio briquettes based on rice husk blended materials: an alternative energy source

    NASA Astrophysics Data System (ADS)

    Suryaningsih, S.; Nurhilal, O.

    2018-05-01

    Rice husk as an abundant waste of biomass up to 21 million tons/year, it is unfortunate if it is not utilized. By converting it into bio briquettes, the value of rice husk bio briquettes in some studies before obtaining a relatively low value of 3,221-3,350 cal/g. The purpose of this research is to increase the calorific value of rice husk bio briquettes by mixing with coconut shell charcoal or corncob charcoal at various composition ratios of 50:50 and 80:20, to reach the optimal value that the industrial sector needed. Carbonization process was carried out at a temperature of 250-350 °C for 1.5 hours. From the results of the proximate analysis test using selected carbonization temperature at 300 °C, it can be seen that the best briquette value is made by mixing rice husk and coconut shell charcoal at composition ratio of 50:50, resulting 47.92% fixed carbon, 8.52% moisture content, 23.40% volatile matter and 20.16% ash content. The highest calorific value of 4,886 cal/g at ratio composition of 50:50, is slightly higher than the East Kalimantan coal standard of 4,828 cal/g. Hence, this bio briquettes are suitable for small scale industry application and household community use.

  13. Hardness of the subchondral bone of the patella in the normal state, in chondromalacia, and in osteoarthrosis.

    PubMed

    Björkström, S; Goldie, I F

    1982-06-01

    The hardness of bone is its property of withstanding the impact of a penetrating agent. It has been found that articular degenerative changes in, for example, the tibia (knee) are combined with a decrease in the hardness of the subchondral bone. In this investigation the hardness of subchondral bone in chondromalacia and osteoarthrosis of the patella has been analysed and compared with normal subchondral bone. Using an indentation method originally described by Brinell the hardness of the subchondral bone was evaluated in 7 normal patellae, in 20 with chondromalacia and in 33 with osteoarthrosis. A microscopic and microradiographic study of the subchondral bone was carried out simultaneously. Hardness was lowest in the normal material. The mean hardness value beneath the degenerated cartilage differed only slightly from that of the normal material, but the variation of values was increased. The hardness in bone in the chondromalacia area was lower than the hardness in bone covered by surrounding normal cartilage. The mean hardness value in bone beneath normal parts of cartilage in specimens with chondromalacia was higher than the mean hardness value of the normal material. In the microscopic and microradiographic examination it became evident that there was a relationship between trabecular structure and subchondral bone hardness; high values: coarse and solid structure; low values: slender and less regular structure.

  14. Densitometric evaluation of Soludent and GBX developers.

    PubMed

    Patel, J R

    1985-01-01

    A quick-developing solution (Soludent) and a new developer (Kodak GBX) were compared with a standard x-ray liquid developer. Of the three solutions evaluated, Kodak GBX solution produced slightly greater useful densities in the radiograph at all temperatures evaluated. The rapid-developing solution produced acceptable radiographs in 80% less time, with only slightly higher film fog.

  15. Midlevel Administrators' Pay Increases Slightly but Doesn't Match Inflation

    ERIC Educational Resources Information Center

    Fuller, Andrea

    2012-01-01

    Salaries for midlevel administrators rose by a median of 2 percent this year over last year, matching the median pay increase for senior administrators and coming in slightly higher than the 1.9-percent median increase for faculty members, says an annual report released by the College and University Professional Association for Human Resources.…

  16. A Bayesian predictive two-stage design for phase II clinical trials.

    PubMed

    Sambucini, Valeria

    2008-04-15

    In this paper, we propose a Bayesian two-stage design for phase II clinical trials, which represents a predictive version of the single threshold design (STD) recently introduced by Tan and Machin. The STD two-stage sample sizes are determined specifying a minimum threshold for the posterior probability that the true response rate exceeds a pre-specified target value and assuming that the observed response rate is slightly higher than the target. Unlike the STD, we do not refer to a fixed experimental outcome, but take into account the uncertainty about future data. In both stages, the design aims to control the probability of getting a large posterior probability that the true response rate exceeds the target value. Such a probability is expressed in terms of prior predictive distributions of the data. The performance of the design is based on the distinction between analysis and design priors, recently introduced in the literature. The properties of the method are studied when all the design parameters vary.

  17. Determination of Minor and Trace Metals in Aluminum and Aluminum Alloys by ICP-AES; Evaluation of the Uncertainty and Limit of Quantitation from Interlaboratory Testing.

    PubMed

    Uemoto, Michihisa; Makino, Masanori; Ota, Yuji; Sakaguchi, Hiromi; Shimizu, Yukari; Sato, Kazuhiro

    2018-01-01

    Minor and trace metals in aluminum and aluminum alloys have been determined by inductively coupled plasma atomic emission spectrometry (ICP-AES) as an interlaboratory testing toward standardization. The trueness of the measured data was successfully investigated to improve the analytical protocols, using certified reference materials of aluminum. Their precision could also be evaluated, feasible to estimate the uncertainties separately. The accuracy (trueness and precision) of the data were finally in good agreement with the certified values and assigned uncertainties. Repeated measurements of aluminum solutions with different concentrations of the analytes revealed the relative standard deviations of the measurements with concentrations, thus enabling their limits of quantitation. They differed separately and also showed slightly higher values with an aluminum matrix than those without one. In addition, the upper limit of the detectable concentration of silicon with simple acid digestion was estimated to be 0.03 % in the mass fraction.

  18. Relationship between sweat chloride, sodium, and age in clinically obtained samples.

    PubMed

    Traeger, Nadav; Shi, Qiuhu; Dozor, Allen J

    2014-01-01

    The relationship between sweat electrolytes and age is uncertain, as is the value of measuring sodium or the chloride:sodium ratio. 13,785 sweat tests performed over 23 years at one center through the Macroduct collection in clinically obtained samples were analyzed. Sweat chloride tended to decrease over the first year of life, slowly increase until the fourth decade, then either level off or slightly decrease. In children, sweat sodium overlapped between those with positive and negative sweat tests, but not in adults. If the sweat test was positive, there was a higher likelihood of having a chloride:sodium ratio >1, but most subjects with a ratio >1 did not have CF. Sweat chloride and sodium vary with age. Measurement of sweat sodium did not add discriminatory value. The proportion of subjects with a chloride:sodium ratio >1, with or without CF, varied greatly between age ranges. © 2013. Published by Elsevier B.V. on behalf of European Cystic Fibrosis Society. All rights reserved.

  19. System-Wide Significance of Predation on Juvenile Salmonids in the Columbia and Snake River Reservoirs : Annual Report of Research 1991.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shively, R.S.

    1991-01-01

    We indexed consumption rates of northern squawfish (Ptychoch oregonensis) preying upon juvenile salmonids in four lower Snake River reservoirs. Stomach contents were also collected from smallmouth bass (Micropterus dolomieui), channel catfish (Ictaluris gunctatus), and walleye (Stizostedion vitreum). Northern squawfish digestive tracts were analyzed and the overall diet (% weight) was dominated by fish and crustaceans. Examination of stomach contents smallmouth bass showed that crustaceans (primarily crayfish) dominated their diets. Overall, the consumption rate of juvenile salmonids by smallmouth bass was low. The northern squawfish consumption index (CI) at Snake River locations ranged from zero at all mid-reservoir locations to 1.2more » at Lower Granite forebay. In John Day Reservoir, CI values ranged from 0.5 to 1.9 in May and from 0.9 to 3.0 in July. Consumption index values were highest in forebay and tailrace areas, and were slightly higher in BRZs than in non-restricted zones.« less

  20. Meat quality attributes of Agile Wallabies.

    PubMed

    Geesink, Geert H; van den Heuvel, Aaron; Hunt, Warren

    2017-11-01

    Meat quality traits of Agile Wallaby (Macropus agilis) M. longissimus (loin) and M. semimembranosus (topside) were investigated. Both muscles exhibited a relatively high pH (>5.7) and dark colour (L*-, a*-, and b*-values). Aging the loins from 2 to 21days p.m. had a significant effect on shear force. However, the results regarding shear force, myofibrillar fragmentation index (MFI) and degradation of desmin and troponin-T suggested that the aging response largely occurred within 2days p.m. Suspension of carcasses from one leg resulted in a side effect on shear force of the loin at 2 and 7days p.m., but not on sarcomere length or MFI. Topsides from the free hanging leg exhibited lower shear force values (33 vs 42N) and greater sarcomere lengths (2.51 vs 1.84μM). Tenderness, juiciness, flavour and overall liking were higher for loins than topsides. Sensory scores for the loin and topside were slightly lower and similar, respectively, to those reported for lamb. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Seasonal Equability in Late Cretaceous Central-Eastern Iberia? Inferences from Isotopic Data on Vertebrates

    NASA Astrophysics Data System (ADS)

    Domingo, L.; Barroso-Barcenilla, F.; Cambra-Moo, O.

    2013-12-01

    After the mid-Cretaceous thermal maximum, the latest Cretaceous witnessed a long-term cooling trend (Santonian-Maastrichtian). It has been proposed that seasonal equability (low mean annual range of temperatures) accompanied the mid-Cretaceous greenhouse period, but was it also a climatic feature of the colder latest Cretaceous? Terrestrial proxies have proven useful in understanding past seasonality and in this vein, we performed oxygen isotope analyses of the phosphate (δ18OPO4) on the rich and exceptionally well preserved late Campanian-early Maastrichtian vertebrate assemblage of 'Lo Hueco' fossil site (Cuenca, Spain). We analysed theropod and crocodilian tooth enamel, turtle shell, and gar ganoine with the aim of evaluating paleoclimatic conditions existing in the western area of the Tethys realm. The 'Lo Hueco' locality was situated at a paleo-latitude of 31°N and sedimentological and paleontological studies point to a coastal environment with distributary channels and sporadic sabkhas. Samples were collected from two different levels: G1 (proximal muddy floodplain) and G2 (distal muddy floodplain), with G1 being older. δ18OH2O values were calculated from theropod, crocodilian and turtle δ18OPO4 values using established equations and in all cases they are in good agreement with precipitation water from subtropical latest Cretaceous and modern settings. Theropods recorded consistently slightly lower δ18OH2O values (G1: -4.1×1.4‰, G2: -3.5×0.5‰) than crocodilians (G1: -3.6×0.6‰, G2: -2.7×0.6‰) and turtles (G1: -3.8×0.6‰, G2: -2.9×0.5‰). This may be due to terrestrial endothermic taxa, such as theropods, recording ingested water year round, meanwhile semiaquatic ectothermic taxa, such as crocodilians and turtles, would record δ18OH2O values representing local meteoric waters over the warm season, when conditions are favorable for apatite synthesis. With these δ18OH2O values, we used gar ganoine δ18OPO4 values as an independent proxy to calculate temperature values. As expected, temperature values estimated from theropods are lower (G1: 17.5×4.4°C, G2: 21.0×3.8°C), representing mean annual temperature (MAT), whereas temperature values yielded by crocodilians (G1: 19.6×4.4°C, G2: 24.4×3.8°C) and turtles (G1: 18.8×4.4°C, G2: 23.5×3.8°C) are slightly higher, reflecting the temperature of the warmest months (TWMs). Our record shows an increase in temperature values between G1 and G2, but they remain within expected temperature estimates based on other independent proxies (palynomorphs, vertebrates) and paleoclimatic models for the Late Cretaceous and the 'Lo Hueco' paleo-latitude. Maximum differences between TWMs and MAT are 2.1°C and 3.4°C for G1 and G2, respectively. These differences are in the low end-member of those observed in modern subtropical settings (~2.8-8.1°C) pointing to a slightly lower seasonal thermal varibility in central-eastern Iberia during the late Campanian-early Maastrichtian.

  2. The association of educational attainment and SBP among older community-living adults: the Maintenance of Balance, Independent Living, Intellect and Zest in the Elderly (MOBILIZE) Boston Study.

    PubMed

    Kiely, Dan K; Gross, Alden L; Kim, Dae H; Lipsitz, Lewis A

    2012-08-01

    Educational attainment is inversely associated with SBP level in young adulthood. This association has not been studied in an older cohort, and confounding and mediating factors are not well known. The authors hypothesized that higher education is associated with lower levels of SBP independent of many risk factors for hypertension. This prospective observational study included a sample of 764 older community-living participants in the Maintenance of Balance, Independent Living, Intellect and Zest in the Elderly (MOBILIZE) Boston Study. Compared to participants with more than college education, regression analyses showed those with a high school education or less had a SBP value 6.33 mmHg higher [95% confidence interval (CI): 2.55-10.10], and those who had a college education had a SBP value 4.01 mmHg higher (95% CI: 0.77-7.25) independent of many hypothesized confounders and mediators. Results of a path analysis confirmed that higher level of education was associated with lower SBP even after adjustment for hypothesized mediators. Although slightly attenuated by multivariable adjustment for hypertension risk factors, the significant inverse association between educational attainment and SBP was not entirely mediated by these risk factors. These findings indicate that education is inversely associated with SBP in a diverse cohort of community-living older adults, independent of many known or suspected risk factors. This study is the first to report the association between education and SBP in an older sample, representing a population at the highest risk for hypertension-related morbidity and mortality.

  3. Evaluation of our prognosis of ST-phenomena made according to the solar inertial motion (SIM) and expected further development

    NASA Astrophysics Data System (ADS)

    Charvátová, Ivanka; Hejda, Pavel

    2016-04-01

    During several latest years, a behavior of the Sun is slightly unusual (hibernation stage?). Our prediction of cycle 24 height and of geomagnetic index aa (Charvátová, 2011) was confirmed in two basic points: the cycle 24 height is around 100 W (predicted value according to a close similarity between the SIMs in the years 1840-1905 and 1980-2045 was 140(100) W). (Other predictions for cycle 24 were between 40 W and 185 W.) As concerns aa-index of geomagnetic activity, predicted great depression bellow 10 nT appeared, but before the predicted year. Although the continuation of our SIMs prediction shows lower future sunspot cycles 25(65 W), 26 (80 W), 27 (60 W), the values are much higher than during the Maunder minimum. These cycles could be longer, up to 12 years. A future course of geomagnetic index aa could follow its course after 1880. In aa-index and also in sunspot numbers, the cycle of 1.6 years, dominant period in the SIM due to the inner planets (synodic period of Venus and Earth), is permanently seen, including in distances between two peaks of sunspot cycles. We can use this for prediction of higher values of these both phenomena - it can occur in the years 2016.42, 2018.02, 2019.62. During the interval 1840-1905 also higher volcanic activity occurred - up to force of Krakatoa (1883, DVI=400). Since 1980, several great volcanic events appeared again (e.g. Mt. Pinatubo (1991), DVI=350). Survey and comparison of volcanic indices DVI and AI in the two corresponding mentioned intervals will be also presented.

  4. The role of SISCOM in preoperative evaluation for patients with epilepsy surgery: A meta-analysis.

    PubMed

    Chen, Tong; Guo, Liang

    2016-10-01

    To assess the specific value of subtraction ictal and inter-ictal SPECT co-registered to MRI (SISCOM) in identifying the epileptogenic zone (EZ) and predicting postoperative outcomes in epileptic surgical patients. A meta-analysis of studies published from January 1995 to June 2015 was conducted through a comprehensive literature search, and 11 studies were included. R software was first used to calculate a pooled positive rate, concordant rate and positive predictive value (PPV) for good outcomes. Stata software was then used to explore the relationship between SISCOM localization and surgical outcomes, including a subgroup analysis for extra-temporal lobe epilepsy. The unweighted positive and concordant rates of SISCOM were 85.9% and 65.3%, respectively. In 142 MRI-negative patients, the SISCOM positive rate was 83.8%. The pooled PPV of 178 surgical patients with concordant SISCOM was 56%. In the meta-analysis of 275 surgical patients, the seizure-free odds ratio was 3.28-times higher in concordant than in non-concordant SISCOM patients [95%CI (1.90, 5.67)]. For extra-temporal lobe epilepsy, the seizure-free odds ratio was 2.44-times higher in concordant than in non-concordant SISCOM patients [95%CI (1.34, 4.43)]. Our data indicate that SISCOM has moderate sensitivity in localizing the epileptogenic zone and can provide complementary information when MRI is negative. Furthermore, SISCOM localization concordant with the gold standard demonstrates slightly higher predictive value for good surgical outcomes. Further research is required to explore the influence of SISCOM localization results in temporal lobe versus extra-temporal lobe epilepsy. Copyright © 2016 British Epilepsy Association. Published by Elsevier Ltd. All rights reserved.

  5. Soil dioxins levels at agriculture sites and natural preserve areas of Taiwan.

    PubMed

    Jou, Jin-juh; Lin, Kae-Long; Chung, Jen-Chir; Liaw, Shu-Liang

    2007-08-17

    In this study, agriculture soil in Taiwan has been sampled and analyzed to determine the background level of polychlorinated dibenzo-p-dioxins and dibenzofurans (PCDD/DF) in the agricultural and nature preserve areas. Another objective is to investigate relationship between soil characteristics and air deposition in Taiwan. The results indicate that in nature preserve areas the topsoil shows an extraordinary profile of PCDD/DF compared to that in the air deposition. The PCDD/DF levels of the low-contaminated agricultural soils are compatible with those of the nature preserves soils. However, in the highly-contaminated agricultural soils, there is an abrupt jump in their concentrations, 10-100 times higher. The overall I-TEQ values of the background topsoils range from 0.101 to 15.2 ng I-TEQ/kg. Near industrial/urban areas in Taiwan the PCDD/DF are slightly higher compared to those in the low concentration group. Typically, the PCDD/DF background values found in this survey fall in the 90% confidence interval and can thus, be deemed the background levels in Taiwan. Ninety-five percent of these data are below the European and American soil standard of 10 ng I-TEQ/kg d.w. The PCDD/DF profile with one neighborhood soil sample was shown no significant difference.

  6. Climate simulations and projections with a super-parameterized climate model

    DOE PAGES

    Stan, Cristiana; Xu, Li

    2014-07-01

    The mean climate and its variability are analyzed in a suite of numerical experiments with a fully coupled general circulation model in which subgrid-scale moist convection is explicitly represented through embedded 2D cloud-system resolving models. Control simulations forced by the present day, fixed atmospheric carbon dioxide concentration are conducted using two horizontal resolutions and validated against observations and reanalyses. The mean state simulated by the higher resolution configuration has smaller biases. Climate variability also shows some sensitivity to resolution but not as uniform as in the case of mean state. The interannual and seasonal variability are better represented in themore » simulation at lower resolution whereas the subseasonal variability is more accurate in the higher resolution simulation. The equilibrium climate sensitivity of the model is estimated from a simulation forced by an abrupt quadrupling of the atmospheric carbon dioxide concentration. The equilibrium climate sensitivity temperature of the model is 2.77 °C, and this value is slightly smaller than the mean value (3.37 °C) of contemporary models using conventional representation of cloud processes. As a result, the climate change simulation forced by the representative concentration pathway 8.5 scenario projects an increase in the frequency of severe droughts over most of the North America.« less

  7. Breast milk macronutrient composition after bariatric surgery.

    PubMed

    Jans, Goele; Matthys, Christophe; Lannoo, Matthias; Van der Schueren, Bart; Devlieger, Roland

    2015-05-01

    Breast milk samples from 12 lactating women with bariatric surgery were investigated by comparing the macronutrient and energy content with samples from 36 non-surgical controls. Samples were analyzed with the Human Milk Analyzer and the maternal diet 24 h prior to sampling with a food record. A higher fat, energy, and a slightly higher carbohydrate milk content was found in the surgical group compared to the non-surgical group (3.0 ± 0.7 versus 2.2 ± 0.9 g/100 ml, P = 0.008; 61.0 ± 7.2 versus 51.7 ± 9 kcal/100 ml, P = 0.002; and 6.6 ± 0.6 versus 6.3 ± 0.4 g/100 ml, P = 0.045, respectively). No correlations and no strong explanatory variance were found between milk macronutrient composition and corresponding maternal dietary intake. The nutritional value of breast milk after bariatric surgery appears to be at least as high as in non-surgical controls.

  8. An ex vivo rat eye model to aid development of high-resolution retina imaging devices for rodents

    NASA Astrophysics Data System (ADS)

    van Oterendorp, Christian; Martin, Keith R.; Zhong, Jiang Jian; Diaz-Santana, Luis

    2010-09-01

    High resolution in vivo retinal imaging in rodents is becoming increasingly important in eye research. Development of suitable imaging devices currently requires many lengthy animal procedures. We present an ex vivo rat model eye with fluorescently labelled retinal ganglion cells (RGC) and nerve fibre bundles that reduces the need for animal procedures while preserving key properties of the living rat eye. Optical aberrations and scattering of four model eyes and eight live rat eyes were quantified using a Shack-Hartmann sensor. Fluorescent images from RGCs were obtained using a prototype scanning laser ophthalmoscope. The wavefront aberration root mean square value without defocus did not significantly differ between model and living eyes. Higher order aberrations were slightly higher but RGC image quality was comparable to published in vivo work. Overall, the model allows a large reduction in number and duration of animal procedures required to develop new in vivo retinal imaging devices.

  9. Properties and Antioxidant Capacity of Anchovy (Engraulis encrasicholus) By-Product Protein Films Containing Thyme Essential Oil.

    PubMed

    Tural, Serpil; Turhan, Sadettin

    2017-03-01

    In this study, some properties and antioxidant capacity of anchovy ( Engraulis encrasicholus ) by-product protein films with added 0.5, 1.0 and 1.5% of thyme essential oil were investigated. The films with thyme essential oil had higher elongation at break, water vapour permeability and oxygen permeability, lower solubility and tensile strength than control film (p<0.05). The incorporation of thyme essential oil affected transparency values of the films, but only the addition of 1.5% of thyme essential oil significantly reduced the transparency (p<0.05). In the film matrix, molecular organisation and intermolecular interaction were changed by thyme essential oil addition. The films with thyme essential oil had a heterogeneous surface and a relatively smooth cross-section structure. Slightly higher phase transition and lower glass transition temperatures were observed in films with thyme essential oil. The antioxidant capacity of the films was improved by incorporating thyme essential oil depending on its volume fraction.

  10. Properties and Antioxidant Capacity of Anchovy (Engraulis encrasicholus) By-Product Protein Films Containing Thyme Essential Oil

    PubMed Central

    Tural, Serpil

    2017-01-01

    Summary In this study, some properties and antioxidant capacity of anchovy (Engraulis encrasicholus) by-product protein films with added 0.5, 1.0 and 1.5% of thyme essential oil were investigated. The films with thyme essential oil had higher elongation at break, water vapour permeability and oxygen permeability, lower solubility and tensile strength than control film (p<0.05). The incorporation of thyme essential oil affected transparency values of the films, but only the addition of 1.5% of thyme essential oil significantly reduced the transparency (p<0.05). In the film matrix, molecular organisation and intermolecular interaction were changed by thyme essential oil addition. The films with thyme essential oil had a heterogeneous surface and a relatively smooth cross-section structure. Slightly higher phase transition and lower glass transition temperatures were observed in films with thyme essential oil. The antioxidant capacity of the films was improved by incorporating thyme essential oil depending on its volume fraction. PMID:28559736

  11. Cognitive impairment in patients with fibromyalgia syndrome as assessed by the mini-mental state examination.

    PubMed

    Rodríguez-Andreu, Jose; Ibáñez-Bosch, Rosario; Portero-Vázquez, Amparo; Masramon, Xavier; Rejas, Javier; Gálvez, Rafael

    2009-12-21

    This study evaluated the frequency of cognitive impairment in patients with Fibromyalgia syndrome (FMS) using the Mini Mental State Examination (MMSE). We analyzed baseline data from all 46 patients with FMS and 92 age- and sex-matched controls per diagnosis of neuropathic (NeP) or mixed pain (MP) selected from a larger prospective study. FMS had a slight but statistically significant lower score in the adjusted MMSE score (26.9; 95% CI 26.7-27.1) than either NeP (27.3; 95% CI 27.2-27.4) or MP (27.3; 27.2-27.5). The percentage of patients with congnitive impairment (adjusted MMSE

  12. Fracture Strength of Single-Crystal Silicon Carbide Microspecimens at Room and Elevated Temperature

    NASA Technical Reports Server (NTRS)

    Nemeth, Noel N.; Sharpe, William N., Jr.; Beheim, Glenn M.; Evans, Laura J.; Jadaan, Osama M.

    2007-01-01

    Three shapes of tensile specimens were tested--curved with a very low stress concentration factor and straight with either a circular hole or an elliptical hole. The nominal thickness was 125 micron with a net section 100 micron wide; the overall length of these microspecimens was 3.1 mm. They were fabricated by an improved version of deep reactive ion etching, which produced specimens with smooth sidewalls and cross-sections having a slightly trapezoidal shape that was exaggerated inside the holes. The novel test setup used a vertical load train extending into a resistance furnace. The specimens had wedge-shaped ends which fit into ceramic grips. The fixed grip was mounted on a ceramic post, and the movable grip was connected to a load cell and actuator outside the furnace with a ceramic-encased nichrome wire. The same arrangement was used for tests at 24 and at 1000 C. The strengths of the curved specimens for two batches of material (made with slightly different processes) were 0.66+/-0.12 GPa and 0.45+/-0.20 GPa respectively at 24 C with identical values at 1000 C. The fracture strengths of the circular-hole and elliptical-hole specimens (computed from the stress concentration factors and measured loads at failure) were approximately 1.2 GPa with slight decreases at the higher temperature. Fractographic examinations showed failures initiating on the surface--primarily at corners. Weibull predictions of fracture strengths for the hole specimens based on the properties of the curved specimens were reasonably effective for the circular holes, but not for the elliptical holes.

  13. Sensitivity of tsunami evacuation modeling to direction and land cover assumptions

    USGS Publications Warehouse

    Schmidtlein, Mathew C.; Wood, Nathan J.

    2015-01-01

    Although anisotropic least-cost-distance (LCD) modeling is becoming a common tool for estimating pedestrian-evacuation travel times out of tsunami hazard zones, there has been insufficient attention paid to understanding model sensitivity behind the estimates. To support tsunami risk-reduction planning, we explore two aspects of LCD modeling as it applies to pedestrian evacuations and use the coastal community of Seward, Alaska, as our case study. First, we explore the sensitivity of modeling to the direction of movement by comparing standard safety-to-hazard evacuation times to hazard-to-safety evacuation times for a sample of 3985 points in Seward's tsunami-hazard zone. Safety-to-hazard evacuation times slightly overestimated hazard-to-safety evacuation times but the strong relationship to the hazard-to-safety evacuation times, slightly conservative bias, and shorter processing times of the safety-to-hazard approach make it the preferred approach. Second, we explore how variations in land cover speed conservation values (SCVs) influence model performance using a Monte Carlo approach with one thousand sets of land cover SCVs. The LCD model was relatively robust to changes in land cover SCVs with the magnitude of local model sensitivity greatest in areas with higher evacuation times or with wetland or shore land cover types, where model results may slightly underestimate travel times. This study demonstrates that emergency managers should be concerned not only with populations in locations with evacuation times greater than wave arrival times, but also with populations with evacuation times lower than but close to expected wave arrival times, particularly if they are required to cross wetlands or beaches.

  14. [Malignant tumor incidence in employees of the Alytus textile factory (1978-1997)].

    PubMed

    Kuzmickiene, Irena; Stukonis, Mecys; Didziapetris, Remigijus

    2002-01-01

    The purpose of this study was to evaluate cancer incidence in the large cotton-manufacturing factory in Lithuania. Altogether 10,198 workers employed at least 1 year in 1969-1997 were included in the cohort and followed during the period 1978/01/01-1997/12/31. National cancer rates were used to calculate the expected number of cancer cases. The overall cancer risk for men was slightly higher than that in the general population (standardized incidence rate (SIR) 1.15, 95% confidence interval (95% CI) 0.98-1.34). A significant increase in the incidence of esophagus (11 observed cases, SIR 3.76, 95% CI 1.88-6.67) and slightly increased of lung (42 observed cases, SIR 1.26, 95% CI 0.91-1.70) cancer became evident. None of the cancer risk showed statistically significant excess cancer incidence in the textile-processing (spinning and weaving) departments (SIR 0.98). In the women cohort the level of the general incidence was very close to expected, standardized incidence rates (SIR) being 0.99 (95% CI 0.88-1.13). However, there was a significant increase in the number of cases of gall bladder (6 observed, SIR 3.19, 95% CI 1.17-6.95). The analysis of the results among textile-processing (spinning and weaving departments) workers indicated the elevated risk of breast cancer (44 observed cases, SIR 1.49, 95% CI 1.08-2.0) and cervical cancer (24 observed cases, SIR 1.68, 95% CI 1.08-2.50). The number of lung cancer cases in this group was a higher, but statistically not significant (5 observed cases, SIR 1.53, 95% CI 0.5-3.58). Increased SIR values were observed for > or = 10 years since the first exposure for all cancers, cervix uteri, ovary and kidney. The overall cancer risk for men cohort was slightly higher than that in the general population. There was a significant increase in the number of cancer of the esophagus. The overall excess risk in women cohort was only for gall bladder, but for spinners and weavers the elevated risk was for cervix uteri and breast cancer. After 10 years of employment the excess risk was already for all cancers, cervix uteri, ovary and kidney malignant tumors.

  15. The 3D model: explaining densification and deformation mechanisms by using 3D parameter plots.

    PubMed

    Picker, Katharina M

    2004-04-01

    The aim of the study was to analyze very differently deforming materials using 3D parameter plots and consequently to gain deeper insights into the densification and deformation process described with the 3D model in order to define an ideal tableting excipient. The excipients used were dicalcium phosphate dihydrate (DCPD), sodium chloride (NaCl), microcrystalline cellulose (MCC), xylitol, mannitol, alpha-lactose monohydrate, maltose, hydroxypropyl methylcellulose (HPMC), sodium carboxymethylcellulose (NaCMC), cellulose acetate (CAC), maize starch, potato starch, pregelatinized starch, and maltodextrine. All of the materials were tableted to graded maximum relative densities (rhorel, max) using an eccentric tableting machine. The data which resulted, namely force, displacement, and time, were analyzed by the application of 3D modeling. Different particle size fractions of DCPD, CAC, and MCC were analyzed in addition. Brittle deforming materials such as DCPD exhibited a completely different 3D parameter plot, with low time plasticity, d, and low pressure plasticity, e, and a strong decrease in omega values when densification increased, in contrast to the plastically deforming MCC, which had much higher d, e, and omega values. e and omega values changed only slightly when densification increased for MCC. NaCl showed less of a decrease in omega values than DCPD did, and the d and e values were between those of MCC and DCPD. The sugar alcohols, xylitol and mannitol, behaved in a similar fashion to sodium chloride. This is also valid for the crystalline sugars, alpha-lactose monohydrate, and maltose. However, the sugars are more brittle than the sugar alcohols. The cellulose derivatives, HPMC, NaCMC, and CAC, are as plastic as MCC, however, their elasticity depends on substitution indicated by lower (more elastic) or higher (less elastic) omega values. The native starches, maize starch and potato starch, are very elastic, and pregelatinized starch and maltodextrine are less elastic and exhibited higher omega values. Deformation behavior as shown in 3D parameter plots depends on particle size for polymers such as CAC and MCC; however, it does not depend on particle size for brittle materials such as DCPD. An ideally deforming tableting excipient should exhibit high e, d, and omega values with a constant ratio of e and omega at increasing densification.

  16. Remineralization effects of two pediatric dentifrices and one regular dentifrice on artificial carious lesion in primary teeth: An in vitro study

    PubMed Central

    Advani, Shweta; Sogi, Suma; Hugar, Shivayogi; Indushekar, K. R.; Kiran, K.; Hallikerimath, Seema

    2014-01-01

    Aim: The aim of the following study is to know the efficacy of remineralization of two pediatric dentifrices and one regular dentifrice on artificial carious lesions in primary teeth. Materials and Methods: A total of 21 teeth coated with nail varnish leaving a window of 1 mm were subjected to demineralization for 72 h. These 21 teeth were then sectioned into two equal parts with a diamond disc. The 42 sections obtained were then evaluated under the stereomicroscope and the demineralization values were noted. The 42 sections were divided into three groups: Group 1: Kidodent, Group 2: Cheeriogel, Group 3: Colgate Total and subjected to remineralization respectively for 7 days. The specimens were again evaluated under the stereomicroscope for the remineralisation values. Results: All the three dentifrices showed remineralization with artificial carious lesions. Colgate Total showed higher remineralization rates compared with the other two pediatric dentifrices. Kidodent showed a slightly higher remineralisation rate compared with Cheeriogel which was not significant. Conclusion/Hypothesis: The pediatric dentifrices also showed remineralization with artificial carious lesions. Hence, we conclude that, this amount of remineralization was more or less, when compared to the regular dentifrice which showed higher remineralization rates, which could lead to adverse effects, like fluorosis if not used judiciously. On basis of which we hypothetize: Pediatric dentifrices have an appropriate fluoride content, as required by the children, and also does not minimize the cariostatic effects. PMID:25254193

  17. Elements in whole blood of Northwestern Crows (Corvus caurinus) in Alaska: No evidence for an association with beak deformities

    USGS Publications Warehouse

    Van Hemert, Caroline R.; Handel, Colleen M.

    2016-01-01

    A recent outbreak of beak deformities among resident birds in Alaska has raised concern about environmental contamination as a possible underlying factor. We measured whole blood concentrations of 30 essential and nonessential elements to determine whether any were associated with beak deformities in Northwestern Crows (Corvus caurinus). We tested for differences between 1) adults with versus those without beak deformities and 2) unaffected adults versus juveniles. Crows with beak deformities had slightly higher levels of barium, molybdenum, and vanadium (all P<0.05), but concentrations were generally low and within the range of values reported from other apparently healthy wild birds. Concentrations of several elements, including selenium, were higher in birds without versus birds with beak deformities (all P<0.05), a difference that may be explained in part by compromised foraging ability associated with the deformities. Adult crows had higher concentrations of cadmium, silicon, and zinc than juveniles (all P<0.05), although differences were relatively small and values were similar to those from other wild birds. Our results suggest that neither selenium nor other tested elements are likely to be causing beak deformities in Alaskan crows. We also provide the first data on elemental concentrations in Northwestern Crows. Levels of selenium far exceeded those typically found in passerine birds and were similar to those in marine-associated waterfowl, suggesting that background levels should be interpreted relative to a species's environment.

  18. Carbonaceous species in PM2.5 at a pair of rural/urban sites in Beijing, 2005-2008

    NASA Astrophysics Data System (ADS)

    Yang, F.; Huang, L.; Duan, F.; Zhang, W.; He, K.; Ma, Y.; Brook, J. R.; Tan, J.; Zhao, Q.; Cheng, Y.

    2011-08-01

    One-week integrated PM2.5 samples were collected over four years (2005-2008) at a pair of sites, one rural and one urban site, in the area of Beijing, China. Weekly organic and elemental carbon (OC and EC) concentrations from these samples were measured to investigate their atmospheric concentrations, temporal variation patterns and the factors influencing these aspects. A slightly systematic decrease in annual mean concentration of OC and an opposite trend for EC at both sites was observed. Since OC accounted for about 70 % of total carbon (TC, i.e. OC + EC) the total carbonaceous mass experienced a slight decline on a yearly basis over the study period. Its fraction of PM2.5 mass at the urban site in 2008 was significantly lower than observed 10 years earlier (1999), indicating that the relative importance of carbonaceous species in PM2.5 has decreased. In urban Beijing clear seasonal variations (by factors of 1.35 ~ 3.0) were shown in both OC and EC with higher weekly concentrations and fluctuations in winter and much lower values in summer and spring. The minimum seasonal urban excesses of OC (3.0 μg m-3) and EC (1.3 μg m-3) occurred in the summer of 2008, which were only one-ninth and one-seventh of their corresponding maximum values, respectively. This reduction in the urban-difference, coupled with more positive stable carbon isotope values of EC at the urban site in that summer relative to the preceding summers, supports that the special clean air campaign for the 2008 Summer Olympic Games very likely had noticeable impact on the ambient concentrations of carbonaceous aerosols in the Beijing area, particularly on the local urban scale. Less consistent seasonal patterns in OC and EC, their scattered correlation, and higher mass ratios of OC to EC (OC/EC) at the rural site indicate more complex and variable major sources regarding aerosol formation in the rural area. These emission sources include biomass burning during the harvest seasons, widely used high-polluting family stoves and small boilers for cooking and heating with high OC/EC ratios, and a greater relative quantity of secondary organic aerosols.

  19. Estimated association between dwelling soil contamination and internal radiation contamination levels after the 2011 Fukushima Daiichi nuclear accident in Japan.

    PubMed

    Tsubokura, Masaharu; Nomura, Shuhei; Sakaihara, Kikugoro; Kato, Shigeaki; Leppold, Claire; Furutani, Tomoyuki; Morita, Tomohiro; Oikawa, Tomoyoshi; Kanazawa, Yukio

    2016-06-29

    Measurement of soil contamination levels has been considered a feasible method for dose estimation of internal radiation exposure following the Chernobyl disaster by means of aggregate transfer factors; however, it is still unclear whether the estimation of internal contamination based on soil contamination levels is universally valid or incident specific. To address this issue, we evaluated relationships between in vivo and soil cesium-137 (Cs-137) contamination using data on internal contamination levels among Minamisoma (10-40 km north from the Fukushima Daiichi nuclear power plant), Fukushima residents 2-3 years following the disaster, and constructed three models for statistical analysis based on continuous and categorical (equal intervals and quantiles) soil contamination levels. A total of 7987 people with a mean age of 55.4 years underwent screening of in vivo Cs-137 whole-body counting. A statistically significant association was noted between internal and continuous Cs-137 soil contamination levels (model 1, p value <0.001), although the association was slight (relative risk (RR): 1.03 per 10 kBq/m(2) increase in soil contamination). Analysis of categorical soil contamination levels showed statistical (but not clinical) significance only in relatively higher soil contamination levels (model 2: Cs-137 levels above 100 kBq/m(2) compared to those <25 kBq/m(2), RR=1.75, p value <0.01; model 3: levels above 63 kBq/m(2) compared to those <11 kBq/m(2), RR=1.45, p value <0.05). Low levels of internal and soil contamination were not associated, and only loose/small associations were observed in areas with slightly higher levels of soil contamination in Fukushima, representing a clear difference from the strong associations found in post-disaster Chernobyl. These results indicate that soil contamination levels generally do not contribute to the internal contamination of residents in Fukushima; thus, individual measurements are essential for the precise evaluation of chronic internal radiation contamination. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  20. Radiobiological Impact of Planning Techniques for Prostate Cancer in Terms of Tumor Control Probability and Normal Tissue Complication Probability

    PubMed Central

    Rana, S; Cheng, CY

    2014-01-01

    Background: The radiobiological models describe the effects of the radiation treatment on cancer and healthy cells, and the radiobiological effects are generally characterized by the tumor control probability (TCP) and normal tissue complication probability (NTCP). Aim: The purpose of this study was to assess the radiobiological impact of RapidArc planning techniques for prostate cancer in terms of TCP and normal NTCP. Subjects and Methods: A computed tomography data set of ten cases involving low-risk prostate cancer was selected for this retrospective study. For each case, two RapidArc plans were created in Eclipse treatment planning system. The double arc (DA) plan was created using two full arcs and the single arc (SA) plan was created using one full arc. All treatment plans were calculated with anisotropic analytical algorithm. Radiobiological modeling response evaluation was performed by calculating Niemierko's equivalent uniform dose (EUD)-based Tumor TCP and NTCP values. Results: For prostate tumor, the average EUD in the SA plans was slightly higher than in the DA plans (78.10 Gy vs. 77.77 Gy; P = 0.01), but the average TCP was comparable (98.3% vs. 98.3%; P = 0.01). In comparison to the DA plans, the SA plans produced higher average EUD to bladder (40.71 Gy vs. 40.46 Gy; P = 0.03) and femoral heads (10.39 Gy vs. 9.40 Gy; P = 0.03), whereas both techniques produced NTCP well below 0.1% for bladder (P = 0.14) and femoral heads (P = 0.26). In contrast, the SA plans produced higher average NTCP compared to the DA plans (2.2% vs. 1.9%; P = 0.01). Furthermore, the EUD to rectum was slightly higher in the SA plans (62.88 Gy vs. 62.22 Gy; P = 0.01). Conclusion: The SA and DA techniques produced similar TCP for low-risk prostate cancer. The NTCP for femoral heads and bladder was comparable in the SA and DA plans; however, the SA technique resulted in higher NTCP for rectum in comparison with the DA technique. PMID:24761232

  1. Assessment of two different types of bias affecting the results of outcome-based evaluation in undergraduate medical education.

    PubMed

    Schiekirka, Sarah; Anders, Sven; Raupach, Tobias

    2014-07-21

    Estimating learning outcome from comparative student self-ratings is a reliable and valid method to identify specific strengths and shortcomings in undergraduate medical curricula. However, requiring students to complete two evaluation forms (i.e. one before and one after teaching) might adversely affect response rates. Alternatively, students could be asked to rate their initial performance level retrospectively. This approach might threaten the validity of results due to response shift or effort justification bias. Two consecutive cohorts of medical students enrolled in a six-week cardio-respiratory module were enrolled in this study. In both cohorts, performance gain was estimated for 33 specific learning objectives. In the first cohort, outcomes calculated from ratings provided before (pretest) and after (posttest) teaching were compared to outcomes derived from comparative self-ratings collected after teaching only (thentest and posttest). In the second cohort, only thentests and posttests were used to calculate outcomes, but data collection tools differed with regard to item presentation. In one group, thentest and posttest ratings were obtained sequentially on separate forms while in the other, both ratings were obtained simultaneously for each learning objective. Using thentest ratings to calculate performance gain produced slightly higher values than using true pretest ratings. Direct comparison of then- and posttest ratings also yielded slightly higher performance gain than sequential ratings, but this effect was negligibly small. Given the small effect sizes, using thentests appears to be equivalent to using true pretest ratings. Item presentation in the posttest does not significantly impact on results.

  2. Assessment of two different types of bias affecting the results of outcome-based evaluation in undergraduate medical education

    PubMed Central

    2014-01-01

    Background Estimating learning outcome from comparative student self-ratings is a reliable and valid method to identify specific strengths and shortcomings in undergraduate medical curricula. However, requiring students to complete two evaluation forms (i.e. one before and one after teaching) might adversely affect response rates. Alternatively, students could be asked to rate their initial performance level retrospectively. This approach might threaten the validity of results due to response shift or effort justification bias. Methods Two consecutive cohorts of medical students enrolled in a six-week cardio-respiratory module were enrolled in this study. In both cohorts, performance gain was estimated for 33 specific learning objectives. In the first cohort, outcomes calculated from ratings provided before (pretest) and after (posttest) teaching were compared to outcomes derived from comparative self-ratings collected after teaching only (thentest and posttest). In the second cohort, only thentests and posttests were used to calculate outcomes, but data collection tools differed with regard to item presentation. In one group, thentest and posttest ratings were obtained sequentially on separate forms while in the other, both ratings were obtained simultaneously for each learning objective. Results Using thentest ratings to calculate performance gain produced slightly higher values than using true pretest ratings. Direct comparison of then- and posttest ratings also yielded slightly higher performance gain than sequential ratings, but this effect was negligibly small. Conclusions Given the small effect sizes, using thentests appears to be equivalent to using true pretest ratings. Item presentation in the posttest does not significantly impact on results. PMID:25043503

  3. Hologic QDR 2000 whole-body scans: a comparison of three combinations of scan modes and analysis software

    NASA Technical Reports Server (NTRS)

    Spector, E.; LeBlanc, A.; Shackelford, L.

    1995-01-01

    This study reports on the short-term in vivo precision and absolute measurements of three combinations of whole-body scan modes and analysis software using a Hologic QDR 2000 dual-energy X-ray densitometer. A group of 21 normal, healthy volunteers (11 male and 10 female) were scanned six times, receiving one pencil-beam and one array whole-body scan on three occasions approximately 1 week apart. The following combinations of scan modes and analysis software were used: pencil-beam scans analyzed with Hologic's standard whole-body software (PB scans); the same pencil-beam analyzed with Hologic's newer "enhanced" software (EPB scans); and array scans analyzed with the enhanced software (EA scans). Precision values (% coefficient of variation, %CV) were calculated for whole-body and regional bone mineral content (BMC), bone mineral density (BMD), fat mass, lean mass, %fat and total mass. In general, there was no significant difference among the three scan types with respect to short-term precision of BMD and only slight differences in the precision of BMC. Precision of BMC and BMD for all three scan types was excellent: < 1% CV for whole-body values, with most regional values in the 1%-2% range. Pencil-beam scans demonstrated significantly better soft tissue precision than did array scans. Precision errors for whole-body lean mass were: 0.9% (PB), 1.1% (EPB) and 1.9% (EA). Precision errors for whole-body fat mass were: 1.7% (PB), 2.4% (EPB) and 5.6% (EA). EPB precision errors were slightly higher than PB precision errors for lean, fat and %fat measurements of all regions except the head, although these differences were significant only for the fat and % fat of the arms and legs. In addition EPB precision values exhibited greater individual variability than PB precision values. Finally, absolute values of bone and soft tissue were compared among the three combinations of scan and analysis modes. BMC, BMD, fat mass, %fat and lean mass were significantly different between PB scans and either of the EPB or EA scans. Differences were as large as 20%-25% for certain regional fat and BMD measurements. Additional work may be needed to examine the relative accuracy of the scan mode/software combinations and to identify reasons for the differences in soft tissue precision with the array whole-body scan mode.

  4. RBC count

    MedlinePlus

    ... common measurements for results of these tests. Normal value ranges may vary slightly among different laboratories. Some labs use different measurements or test different samples. Talk to your health ...

  5. A Prospective Follow-Up of Adipocytokines in Cohort Patients With Gout: Association With Metabolic Syndrome But Not With Clinical Inflammatory Findings: Strobe-Compliant Article.

    PubMed

    García-Méndez, Sergio; Rivera-Bahena, Carolina Bustos; Montiel-Hernández, José Luis; Xibillé-Friedmann, Daniel; Álvarez-Hernández, Everardo; Peláez-Ballestas, Ingris; Burgos-Vargas, Rubén; Vázquez-Mellado, Janitzia

    2015-07-01

    The aim of this study was to determine the levels of leptin (Lep) and adiponectin (AdipoQ) in patients with gout and its relationship with joint inflammatory data and/or with metabolic syndrome (MetS) variables, during 1 year follow-up.Forty-one patients (40 males) with gout diagnosis, attending for the first time to a rheumatology department, were included. Evaluations were performed baseline, at 6 and 12 months. Variables included the following: demographic, clinical and laboratory data related to gout and associated diseases. Lep and AdipoQ determinations by the ELISA method were performed in frozen serum from each visit. The pharmacological and no-pharmacological treatment for gout and associated diseases was individualized for each patient according to published guidelines. Statistical analysis included Mann-Whitney U test, Fisher test, x, ANOVA, Cochran Q, Pearson and Spearman correlation tests, as well as linear regression.In the baseline evaluation, 29.2% had MetS (hypertriglyceridemia 66%, hypertension 44% and obesity 37%); patients with MetS had higher C reactive protein (CRP) levels [34.1 ± 28.6 vs. 12.2 ± 11.2 mg/dL, P = 0.033]. Although not significant, also had higher Lep and lower AdipoQ levels (3.2 ± 3.0 vs. 1.9 ± 1.2 ng/mL, P = 0.142 and 40.5 ± 26.8 vs. 38.0 ± 24.9 ng/mL, P = 0.877, respectively). During follow-up, our patients had significant improvement in serum uric acid (sUA) levels and variables evaluating pain and joint swelling (P ≤ 0.05). Metabolic abnormalities tended to persist or even worsen during the monitoring period: significant increase in total cholesterol (P = 0.004), tendency to higher triglycerides (P = 0.883) and slight improvement in glycaemia (P = 0.052). Lep values increased significantly during follow-up (P = 0.001) while AdipoQ levels diminished slightly (P = 0.317). Neither Lep nor AdipoQ values showed important correlation (r > 0.5) with metabolic variables or joint swelling.This study suggests that in patients with gout, concentrations of Lep and AdipoQ are more in line with the metabolic state than with clinical disease activity.

  6. Chemical composition of precipitation in a Mexican Maya region

    NASA Astrophysics Data System (ADS)

    Bravo, H. A.; Saavedra, M. I. R.; Sánchez, P. A.; Torres, R. J.; Granada, L. M. M.

    The chemical characteristics of wet precipitation in Puerto Morelos, Quintana Roo State, Mexico, were measured from April 1994 to December 1995. Puerto Morelos is located in the Caribbean Mayan coastal region of the Peninsula of Yucatan, and is normally exposed to winds from the Caribbean region. Wetfall was analyzed for pH, conductivity and Cl -, NO 3-, SO 42-, Na +, NH 4+, K +, Mg 2+ and Ca 2+ ion concentrations. Volume-weighted mean pH for the whole sampling period was 5.35, although values as low as 4.6 were measured in several rain samples. Concentrations of all species correlated negatively with rain volume. Sea-salt aerosols contributed with most of the Na +, Cl -, Mg 2+, K + and SO 42- found in wet precipitation. The mean [SO 42-excess] was 9.7 μEq l -1, which agrees with the background hemispheric values of ≈10 μEq l -1 reported elsewhere. The mean [NO 3-] was 11.4 μEq l -1, almost four times higher than the background hemispheric value of ≈2.5 μEq l -1 reported elsewhere. However, a major component causing the slight acidity character of rain in Puerto Morelos seems to be H 2SO 4.

  7. Characterizing the natural radiation levels throughout the main geological units of Sabkhat al Jabboul area, northern Syria.

    PubMed

    Al-Hilal, Mohamed; Aissa, Mosa

    2015-02-01

    The concentrations of equivalent eU, eTh, and K% were determined together with soil gas radon values and carborne gamma-ray survey in order to define the natural radioactivity levels throughout main geological units of Sabkhat al Jabboul region. Forty five soil and rock samples were collected from various lithofacies in each geological unit, and analyzed by γ-ray spectrometric technique for determining the concentration values of major radioelements. Such radiometric data could be used to differentiate between various lithologies of the investigated rocks. Although no distinct radioactive anomalies were found in the area, the radiometric profiles showed some minor variations with slightly higher values than the normal level. Despite the low radioactivity and the lack of rocks diversity in the surveyed area, it was possible to classify some certain rock types based on their radiometric response. The relationships between eU, eTh and their ratios were discussed for the Quaternary, Neogene and Paleogene formations, in order to evaluate the degree of uranium distribution and remobilization. The overall results of this radiometric survey were generally low, and lying within the range of the normal background levels in Syrian. Copyright © 2014 Elsevier Ltd. All rights reserved.

  8. Ecological risks and potential sources of heavy metals in agricultural soils from Huanghuai Plain, China.

    PubMed

    Zhou, Lingli; Yang, Bing; Xue, Nandong; Li, Fasheng; Seip, Hans Martin; Cong, Xin; Yan, Yunzhong; Liu, Bo; Han, Baolu; Li, Huiying

    2014-01-01

    A total of 224 agricultural soil samples from Huanghuai Plain in China were investigated for the concentrations of seven heavy metals (As, Cd, Cr, Hg, Ni, Pb, and Zn). The mean concentrations of the metals were 12, 0.17, 79, 0.04, 35, 25, and 74 mg/kg, respectively. These values are similar or slightly higher than background values in this region, except for Cd with a mean nearly twice the background value. The estimated ecological risks based on contamination factors and potential ecological risk indexes are also mostly low, but considerable for Cd and Hg. Multivariate analysis (including Pearson's correlation analysis, hierarchical cluster analysis, and principal component analysis) clearly revealed three distinct metal groups, i.e., Cr/Ni/Zn, As/Cd/Pb, and Hg, whose concentrations were closely associated with the distribution and pollution characteristics of industries in and around the plain. The main anthropogenic sources for the three metal groups were identified as atmospheric deposition, sewage irrigation/fertilizers usage, and atmospheric deposition/irrigation water, respectively. The present results are well suited for planning, risk assessment, and decision making by environmental managers of this region.

  9. Effect of drying methods on total antioxidant capacity of bitter gourd (momordica charantia) fruit

    NASA Astrophysics Data System (ADS)

    Tan, Ee Shian; Abdullah, Aminah; Maskat, Mohammad Yusof

    2013-11-01

    The effect of thermal and non-thermal drying methods on hydrophilic and lipophilic antioxidant capacities of bitter gourd fruit was investigated in this study. The bitter gourd fruits were dried by following methods: (i) oven drying 40°C, (ii) oven drying 50°C, (iii) oven drying 60°C, (iv) microwave drying (medium low power), (v) microwave drying (medium power) and (vi) freeze drying. Pure acetone and hexane were used to extract the hydrophilic and lipophilic antioxidant compounds from dried bitter gourd fruits. Freeze dried extracts reported to have highest values in DPPH scavenging activity (hydrophilic and lipophilic fractions), FRAP (lipophilic fraction) and TPC (hydrophilic and lipophilic fraction). Thermal drying slightly increased the values of DPPH scavenging activity, FRAP and TPC assays for hydrophilic extracts. Results concluded bitter gourd fruit is a good source of natural antioxidants and its total antioxidant quality was most preserved by freeze drying. Additionally, the higher value reported in DPPH scavenging activity, FRAP and TPC assays for lipophilic extracts than the hydrophilic extracts suggested that the lipophilic antioxidant compounds of bitter gourd fruit might possess stronger antioxidant power than its counterpart.

  10. Natural radioactivity in various water samples and radiation dose estimations in Bolu province, Turkey.

    PubMed

    Gorur, F Korkmaz; Camgoz, H

    2014-10-01

    The level of natural radioactivity for Bolu province of north-western Turkey was assessed in this study. There is no information about radioactivity measurement reported in water samples in the Bolu province so far. For this reason, gross α and β activities of 55 different water samples collected from tap, spring, mineral, river and lake waters in Bolu were determined. The mean activity concentrations were 68.11 mBq L(-1), 169.44 mBq L(-1) for gross α and β in tap water. For all samples the gross β activity is always higher than the gross α activity. All value of the gross α were lower than the limit value of 500 mBq L(-1) while two spring and one mineral water samples were found to have gross β activity concentrations of greater than 1000 mBq L(-1). The associated age-dependent dose from all water ingestion in Bolu was estimated. The total dose for adults had an average value exceeds the WHO recommended limit value. The risk levels from the direct ingestion of the natural radionuclides in tap and mineral water in Bolu were determinated. The mean (210)Po and (228)Ra risk the value of tap and mineral waters slightly exceeds what some consider on acceptable risk of 10(-4) or less. Copyright © 2014 Elsevier Ltd. All rights reserved.

  11. INFLUENCE OF INTRAMUSCULAR FAT LEVEL ON ORGANOLEPTIC, PHYSICAL, AND CHEMICAL CHARACTERISTICS OF IRRADIATED PORK MUSCLE

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Whitehair, L.A.

    1962-01-01

    A study was conducted to evaluate the influence of marbling on certain organoleptic, physical, and chemical characteristics of precooked and irradiated pork loin muscle (longissimus dorsi). The study consisted of two separate phases. Loins utilized in Phase I were selected by visual appraisal and categorized into three distinct marbling level scores. A high temperature, short time blanching treatment was used for proteolytic enzyme inactivation. Phase II loins were selected and classified into three marbling levels by both visual appraisal amd ether extraction analysis of total fat. A low temperature, long time heat treatment was used for enzyme inactivation. Samples weremore » packed under vacuum in rigid containers and irradiated at a dosage level of 4.5 megarads gamma radiation. Non-irradiated samples were stored at -65 deg F. Irradiated and control samples were evaluated at periodic intervals by a panel. Physical and chemical analyses were made initially on samples representing each treatment and subsequently at the termination of each storage period. Organoleptic results indicated that degree of marbling did not influence preference ratings of plain radiosterilized longissimus dorsi muscle (pork). However, irradiated longissimus dorsi (pork) sandwich items with lower marbling scores were consistently preferred over highly marbled, irradiated sandwich items. Non-irradiated longissimus dorsi samples were preferred to irradiated longissimus dorsi samples in all tests. The short term-high temperature method of blanching used in Phase I resulted in products of slightly superior quality to those of Phase II, which possessed softer, slightly drier texture characteristics. The practical storage life of irradiated samples under the conditions was approximately 150 days. Hunter color values were increased by radiation treatment. Irradiated longissimus dorsi samples developed a characteristic pink-red color. Mechanical tenderness values in both irradiated and non-irradiated samples were lowered significantly by higher levels of marbling. Expressible moisture values of irradiated samples were lower than those of control samples. The values increased with advancing storage time. Iodine numbers of lower marbling scores (both irradiated and non-irradiated samplcs) exceeded those of highly marbled samples. T.B.A. number values were lower in irradiated samples of Phase I. The values were increased with respect to increased levels of marbling in Phase II. Values increased steadily with advancing storage time in both phases. pH values were elevated by irradiation treatment, marbling level, and storage time in Phase I. The differences were not observed for Phase II samples. Bacteriological assays indicated that irradiated samples were commercially sterile. Extremely low numbers of Micrococci were found. (Dissertation Abstr., 23: No. 4)« less

  12. Propagation of high amplitude higher order sounds in slightly soft rectangular ducts, carrying mean flow

    NASA Technical Reports Server (NTRS)

    Wang, K. S.; Vaidya, P. G.

    1975-01-01

    The resonance expansion method, developed to study the propagation of sound in rigid rectangular ducts is applied to the case of slightly soft ducts. Expressions for the generation and decay of various harmonics are obtained. The effect of wall admittance is seen through a dissipation function in the system of nonlinear differential equations, governing the generation of harmonics. As the wall admittance increases, the resonance is reduced. For a given wall admittance this phenomenon is stronger at higher input intensities. Both the first and second order solutions are obtained and the results are extended to the case of ducts having mean flow.

  13. Skin temperature evaluation by infrared thermography: Comparison of two image analysis methods during the nonsteady state induced by physical exercise

    NASA Astrophysics Data System (ADS)

    Formenti, Damiano; Ludwig, Nicola; Rossi, Alessio; Trecroci, Athos; Alberti, Giampietro; Gargano, Marco; Merla, Arcangelo; Ammer, Kurt; Caumo, Andrea

    2017-03-01

    The most common method to derive a temperature value from a thermal image in humans is the calculation of the average of the temperature values of all the pixels confined within a demarcated boundary defined region of interest (ROI). Such summary measure of skin temperature is denoted as Troi in this study. Recently, an alternative method for the derivation of skin temperature from the thermal image has been developed. Such novel method (denoted as Tmax) is based on an automated (software-driven) selection of the warmest pixels within the ROI. Troi and Tmax have been compared under basal, steady-state conditions, resulting very well correlated and characterized by a bias of approximately 1 °C (Tmax > Troi). Aim of this study was to investigate the relationship between Tmax and Troi under the nonsteady-state conditions induced by physical exercise. Thermal images of quadriceps of 13 subjects performing a squat exercise were recorded for 120 s before (basal steady state) and for 480 s after the initiation of the exercise (nonsteady state). The thermal images were then analysed to extract Troi and Tmax. Troi and Tmax changed almost in parallel during the nonstead -state. At a closer inspection, it was found that during the nonsteady state the bias between the two methods slightly increased (from 0.7 to 1.1 °C) and the degree of association between them slightly decreased (from Pearson's r = 0.96 to 0.83). Troi and Tmax had different relationships with the skin temperature histogram. Whereas Tmax was the mean, which could be interpreted as the centre of gravity of the histogram, Tmax was related with the extreme upper tail of the histogram. During the nonsteady state, the histogram increased its spread and became slightly more asymmetric. As a result, Troi deviated a little from the 50th percentile, while Tmax remained constantly higher than the 95th percentile. Despite their differences, Troi and Tmax showed a substantial agreement in assessing the changes in skin temperature following physical exercise. Further studies are needed to clarify the relationship existing among Tmax, Troi and cutaneous blood flow during physical exercise.

  14. Geochemistry of Early Paleozoic boninites from the Central Qilian block, Northwest China: Constraints on petrogenesis and back-arc basin development

    NASA Astrophysics Data System (ADS)

    Gao, Zhong; Zhang, Hong-Fei; Yang, He; Luo, Bi-Ji; Guo, Liang; Xu, Wang-Chun; Pan, Fa-Bin

    2018-06-01

    Early Paleozoic boninites occur in the Central Qilian orogenic belt, Northwest China. Their petrogenesis provides insights into lithosphere process and tectonic evolution of the Qilian block. In this paper, we carry out a study of geochronological, geochemical and Sr-Nd isotopic compositions for the Early Paleozoic boninites in the Lajishan area of the Central Qilian block. The Lajishan boninites (∼483 Ma) have high Al2O3/TiO2 (36.7-64.7) and CaO/TiO2 (31.1-49.6) ratios, and high MgO (7.86-10.47 wt%), Cr (439-599 ppm) and Ni (104-130 ppm) contents, indicating that the boninites result from a refractory mantle source. They are depleted in high field-strength elements (HFSE) and enriched in large ion lithophile elements (LILE), coupled with slightly high initial 87Sr/86Sr values of 0.7059-0.7074 and low εNd(t) values of -1.05 to +2.66, indicating that the mantle source was metasomatized by subducted slab-derived components. We found that an assemblage of low-Ca group and high-Ca group boninites occurred in the Lajishan belt. The high-Ca group boninites were derived from relatively fertile mantle with slightly higher melting degree, whereas the low-Ca group boninites were generated by partial melting of more refractory mantle wedge peridotites with slightly lower melting degree. The assemblage of low-Ca group and high-Ca group boninites reveals that the low-Ca group boninites were generated by the further melting of the more refractory mantle source after the segregation of the high-Ca group boninitic magmas in response to the back-arc basin opening. In the light of reported boninites worldwide, a diagram of Zr/Y vs. CaO/Al2O3 is used to identify boninites in fore-arc and back-arc regions. We suggest that the Lajishan boninites represent the products of back-arc basin development in response to the northward subduction of the Qaidam-West Qinling ocean slab.

  15. Hematology of healthy Florida manatees (Trichechus manatus).

    PubMed

    Harvey, John W; Harr, Kendal E; Murphy, David; Walsh, Michael T; Nolan, Elizabeth C; Bonde, Robert K; Pate, Melanie G; Deutsch, Charles J; Edwards, Holly H; Clapp, William L

    2009-06-01

    Hematologic analysis is an important tool in evaluating the general health status of free-ranging manatees and in the diagnosis and monitoring of rehabilitating animals. The purpose of this study was to evaluate diagnostically important hematologic analytes in healthy manatees (Trichechus manatus) and to assess variations with respect to location (free ranging vs captive), age class (small calves, large calves, subadults, and adults), and gender. Blood was collected from 55 free-ranging and 63 captive healthy manatees. Most analytes were measured using a CELL-DYN 3500R; automated reticulocytes were measured with an ADVIA 120. Standard manual methods were used for differential leukocyte counts, reticulocyte and Heinz body counts, and plasma protein and fibrinogen concentrations. Rouleaux, slight polychromasia, stomatocytosis, and low numbers of schistocytes and nucleated RBCs (NRBCs) were seen often in stained blood films. Manual reticulocyte counts were higher than automated reticulocyte counts. Heinz bodies were present in erythrocytes of most manatees. Compared with free-ranging manatees, captive animals had slightly lower MCV, MCH, and eosinophil counts and slightly higher heterophil and NRBC counts, and fibrinogen concentration. Total leukocyte, heterophil, and monocyte counts tended to be lower in adults than in younger animals. Small calves tended to have higher reticulocyte counts and NRBC counts than older animals. Hematologic findings were generally similar between captive and free-ranging manatees. Higher manual reticulocyte counts suggest the ADVIA detects only reticulocytes containing large amounts of RNA. Higher reticulocyte and NRBC counts in young calves probably reflect an increased rate of erythropoiesis compared with older animals.

  16. The minimum mass ratio of W Ursae Majoris binaries

    NASA Technical Reports Server (NTRS)

    Rasio, Frederic A.

    1995-01-01

    The minimum mass ratio for tidal stability of a contact binary containing two unevolved main-sequence stars is calculated to be q(sub min) approximately =0.09 in the case of a mostly radiative primary, and it is higher if an appreciable fraction of the mass lies in a convective envelope. At least one observed system, AW UMa, has a mass ratio just below this value (q = 0.075), implying that, if the system is stable, the primary must be slightly evolved and must have a very shallow convective envelope. Contact binaries with mass ratios significantly below that of AW UMa should not be observed, since they are tidally unstable and quickly merge into a single, rapidly rotating object, on a timescale approximately 10(exp 3)-10(exp 4) yr.

  17. Improvement of corrosion resistance of low-alloy steels by resurfacing using multifunction cavitation in water

    NASA Astrophysics Data System (ADS)

    Ijiri, Masataka; Yoshimura, Toshihiko

    2018-02-01

    Low-alloy steels are based on carbon steel in combination with several percent or less (in many cases, 1 mass%) alloying elements, and they offer improved resistance to corrosion at a cost slightly higher than that of carbon steel. However, these materials do not exhibit the same corrosion resistance as stainless steel. The authors have previously developed a novel multifunction cavitation (MFC) technique, which combines ultrasonic cavitation with water jet cavitation. In this study, MFC was used to modify the surface of Cr-Mo steel (SCM435) and Ni-Cr-Mo steel (SNCM630). MFC was found to improve the residual stress value of the material as the result of surface modification while also imparting high strength and superior corrosion resistance.

  18. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dirian, Yves; Foffa, Stefano; Kunz, Martin

    We study the cosmological predictions of two recently proposed non-local modifications of General Relativity. Both models have the same number of parameters as ΛCDM, with a mass parameter m replacing the cosmological constant. We implement the cosmological perturbations of the non-local models into a modification of the CLASS Boltzmann code, and we make a full comparison to CMB, BAO and supernova data. We find that the non-local models fit these datasets very well, at the same level as ΛCDM. Among the vast literature on modified gravity models, this is, to our knowledge, the only example which fits data as wellmore » as ΛCDM without requiring any additional parameter. For both non-local models parameter estimation using Planck +JLA+BAO data gives a value of H{sub 0} slightly higher than in ΛCDM.« less

  19. RBC urine test

    MedlinePlus

    ... measurement for a result of this test. Normal value ranges may vary slightly among different laboratories. Some labs use different measurements or test different samples. Talk to your provider ...

  20. Contrast-enhanced time-resolved 4D MRA of congenital heart and vessel anomalies: image quality and diagnostic value compared with 3D MRA.

    PubMed

    Vogt, Florian M; Theysohn, Jens M; Michna, Dariusz; Hunold, Peter; Neudorf, Ulrich; Kinner, Sonja; Barkhausen, Jörg; Quick, Harald H

    2013-09-01

    To evaluate time-resolved interleaved stochastic trajectories (TWIST) contrast-enhanced 4D magnetic resonance angiography (MRA) and compare it with 3D FLASH MRA in patients with congenital heart and vessel anomalies. Twenty-six patients with congenital heart and vessel anomalies underwent contrast-enhanced MRA with both 3D FLASH and 4D TWIST MRA. Images were subjectively evaluated regarding total image quality, artefacts, diagnostic value and added diagnostic value of 4D dynamic imaging. Quantitative comparison included signal-to-noise ratio (SNR), contrast-to-noise ratio (CNR) and vessel sharpness measurements. Three-dimensional FLASH MRA was judged to be significantly better in terms of image quality (4.0 ± 0.6 vs 3.4 ± 0.6, P < 0.05) and artefacts (3.8 ± 0.4 vs 3.3 ± 0.5, P < 0.05); no difference in diagnostic value was found (4.2 ± 0.4 vs 4.0 ± 0.4); important additional functional information was found in 21/26 patients. SNR and CNR were higher in the pulmonary trunk in 4D TWIST, but slightly higher in the systemic arteries in 3D FLASH. No difference in vessel sharpness delineation was found. Although image quality was inferior compared with 3D FLASH MRA, 4D TWIST MRA yields robust images and added diagnostic value through dynamic acquisition was found. Thus, 4D TWIST MRA is an attractive alternative to 3D FLASH MRA. • New magnetic resonance angiography (MRA) techniques are increasingly introduced for congenital cardiovascular problems. • Time-resolved angiography with interleaved stochastic trajectories (TWIST) is an example. • Four-dimensional TWIST MRA provided inferior image quality compared to 3D FLASH MRA but without significant difference in vessel sharpness. • Four-dimensional TWIST MRA gave added diagnostic value.

  1. Training and overtraining markers in selected sport events.

    PubMed

    Hartmann, U; Mester, J

    2000-01-01

    Varieties of symptoms are supposed to detect overtraining (OT). Besides the problems of diagnosis and analysis in elite athletes, a daily monitoring of training status takes place with measurement of the parameters serum urea (SU) and serum creatine kinase (CK); therefore, their meaningfulness will be examined, with special respect inter- and intra-individually. Data were obtained from determinations during training from athletes in rowing and athletes of international level. For 6981 SU determinations (male, N = 717; female, N = 285), a slightly asymmetric normal distribution was found (male, 80%, 5-7 mmol x L(-1); female, 75%, 4-6 mmol x L(-1)). Values for women were approximately 1.5 mmol x L(-1) lower. Individual variability was enormous; there seems little point in setting fixed value as 8.3 mmol x L(-1) for men and 7.0 mmol x L(-1) for women as a critical limit for OT. CK has also been measured and evaluated in sports as an essential parameter for determination of muscular stress. Frequency distributions of CK in 2790 samples (male, N = 497; female, N = 350) presented an asymmetric normal distribution with distinct trend toward higher values being evident for the range between 100 and 250 U x L(-1). Conspicuously elevated values occurred in the ranges 250-350 U x L(-1) and 1000-2000 U x L(-1). Men's maximal values were 3000 U x L(-1) and 1150 U x L(-1) for women. Individual variability was enormous. Athletes with chronically low CK exhibited mainly low variability; those with chronically higher values exhibited considerable variability. Establishment of both parameters should be useful to determine individual baselines from a large number of samples. Determinations should be made at least every 3 d in standardized conditions. If a large increase is observed in combination with reduced exercise tolerance after a phase of exertion (2-4 d), then the possibility of a catabolic/metabolic activity or insufficient exercise tolerance becomes much more likely.

  2. [Influence of below-cloud secondary evaporation on stable isotope composition in precipitation in Northwest China.

    PubMed

    Liu, Jie Yao; Zhang, Fu Ping; Feng, Qi; Li, Zong Xing; Zhu, Yi Wen; Nie, Shuo; Li, Ling

    2018-05-01

    The precipitation isotope data and meteorological data of eight stations provided by GNIP (Global Network for Isotopes in Precipitation) and two stations from the present study, combined with HYSPLIT model and water droplet evaporation model were used to examine the spatial and temporal distribution of precipitation δ 18 O and d values in Northwest China. The secondary evaporative effect of existence was evaluated and then quantitatively discussed, with the sensitive factors of secondary evaporative effect being considered. The results showed that during the summer monsoon, the δ 18 O and d values decreased from south to north in Xinjiang, while the δ 18 O value increased but d values decreased from south to north and from east to west of Shaanxi-Gansu-Ningxia region. During the winter monsoon, the δ 18 O value decreased from east to west in whole Northwest region, while the d value increased from south to north in Xinjiang, decreased from south to north and increased slightly from east to west in Shanxi-Gansu-Ningxia. The slope and intercept (6.80, -0.07) of the atmospheric precipitation line in the summer monsoon period was significantly lower than that of annual mean (7.27, 3.37) and winter monsoon period (7.46, 6.07), indicating that the secondary evaporation was stronger during the summer monsoon. The evaporation ratio in the summer monsoon was 4.49%, which was higher than 3.65% in the winter monsoon. However, the evaporation ratio of the winter monsoon was higher than the summer monsoon around of Loess Plateau, which might closely relate to the increasing drought of the Loess Plateau in recent years. Finally, the intensity of secondary evaporation decreased with increasing relative humidity, precipitation and vapor pressure but increased with increasing temperature (greater than 0 ℃). The influences of those factors (humidity, precipitation, temperature and vapor pressure) on the secondary evaporation were dependent on the differences of ranges.

  3. Provisional hourly values of equatorial Dst for 1971

    NASA Technical Reports Server (NTRS)

    Sugiura, M.; Poros, D. J.

    1972-01-01

    Tables and plots of provisional hourly values of the equatorial Dst index for 1971 are given, a table of daily mean Dst values for 1971 is also provided. The base line values for the four observatories, Hermanus, Kakioka, Honolulu, and San Juan, were obtained from extrapolations using the coefficients for the secular variations determined for the previous years. Examining the Dst values for quiet days, the base lines so determined appear to be slightly low, so that the Dst index for quiet periods tends to be high.

  4. Ecological vulnerability: seasonal and spatial assessment of trace metals in soils and plants in the vicinity of a scrap metal recycling factory in Southwestern Nigeria.

    PubMed

    Owoade, O K; Awotoye, O O; Salami, O O

    2014-10-01

    The concentrations of selected heavy metals in the soil and vegetation in the immediate vicinity of a metal scrap recycling factory were determined in the dry and wet seasons using the Atomic Absorption Spectrophotometer. The results showed that the soil pH in all the sites indicated slight acidity (from 5.07 to 6.13), high soil organic matter content (from 2.08 to 5.60 %), and a well-drained soil of sandy loam textural composition. Soil heavy metal content in the dry season were 0.84-3.12 mg/kg for Pb, 0.26-0.46 mg/kg for Cd, 9.19-24.70 mg/kg for Zn, and 1.46-1.97 mg/kg for Cu. These values were higher than those in the wet season which ranged from 0.62-0.69 mg/kg for Pb, 0.67-0.78 mg/kg for Cd, 0.84-1.00 mg/kg for Zn, and 1.26-1.45 mg/kg for Cu. Except for cadmium in the dry season, the highest concentrations occurred in the northern side of the factory for all the elements in both seasons. An increase in the concentrations of the elements up to 350 m in most directions was also observed. There was no specific pattern in the level of the metals in the leaves of the plant used for the study. However, slightly elevated values were observed in the wet season (Pb 0.53 mg/kg, Cd 0.59 mg/kg, Cu 0.88 mg/kg) compared with the dry season values (Pb 0.50 mg/kg, Cd 0.57 mg/kg, Cu 0.83 mg/kg). This study showed that the elevated concentrations of these metals might be associated with the activities from the recycling plant, providing the basis for heavy metal pollution monitoring and control of this locality that is primarily used for agricultural purposes.

  5. Effects of pyrogallol, hydroquinone and duroquinone on responses to nitrergic nerve stimulation and NO in the rat anococcygeus muscle

    PubMed Central

    La, Mylinh; Rand, Michael J

    1999-01-01

    The hypothesis that endogenous superoxide dismutase (SOD) protects the nitrergic transmitter from inactivation by superoxide and that this explains the lack of sensitivity of the transmitter to superoxide generators was tested in the rat isolated anococcygeus muscle.Responses to nitrergic nerve stimulation or to NO were not significantly affected by exogenous SOD or by the Cu/Zn SOD inhibitor diethyldithiocarbamic acid (DETCA).Hydroquinone produced a concentration-dependent reduction of responses to NO with an IC50 of 27 μM, and higher concentrations reduced relaxant responses to nitrergic nerve stimulation with an IC50 of 612 μM. The effects of hydroquinone were only slightly reversed by SOD, so it does not appear to be acting as a superoxide generator.Pyrogallol produced a concentration-dependent reduction in responses to NO with an IC50 value of 39 μM and this effect was reversed by SOD (100–1000 u ml−1). Pyrogallol did not affect responses to nitrergic nerve stimulation. Treatment with DETCA did not alter the differentiating action of pyrogallol.Duroquinone produced a concentration-dependent reduction of relaxations to NO with an IC50 value of 240 μM and 100 μM slightly decreased nitrergic relaxations. After treatment with DETCA, duroquinone produced greater reductions of relaxant responses to NO and to nitrergic stimulation, the IC50 values being 8.5 μM for NO and 40 μM for nitrergic nerve stimulation: these reductions were reversed by SOD.The findings do not support the hypothesis that the presence of Cu/Zn SOD explains the greater susceptibility of NO than the nitrergic transmitter to the superoxide generator pyrogallol, but suggest that it may play a role in the effects of duroquinone. PMID:10051154

  6. The effect of weight, body mass index, age, sex, and race on plasma concentrations of subcutaneous sumatriptan: a pooled analysis.

    PubMed

    Munjal, Sagar; Gautam, Anirudh; Rapoport, Alan M; Fisher, Dennis M

    2016-01-01

    Factors such as body size (weight and body mass index [BMI]), age, sex, and race might influence the clinical response to sumatriptan. We evaluated the impact of these covariates on the plasma concentration (Cp) profile of sumatriptan administered subcutaneously. We conducted three pharmacokinetic studies of subcutaneous sumatriptan in 98 healthy adults. Sumatriptan was administered subcutaneously (236 administrations) as either DFN-11 3 mg, a novel 0.5 mL autoinjector being developed by Dr. Reddy's Laboratories; Imitrex(®) (Sumatriptan) injection 3 mg or 6 mg (6 mg/0.5 mL); or Imitrex STATdose 4 mg or 6 mg (0.5 mL). Blood was sampled for 12 hours to determine sumatriptan Cp. Maximum Cp (Cmax), area under the curve during the first 2 hours (AUC0-2), and total area under the curve (AUC0-∞) were determined using noncompartmental methods. Post hoc analyses were conducted to determine the relationship between these exposure metrics and each of body weight, BMI, age, sex, and race (categorized as white, black, or others). Both weight and BMI correlated negatively with each exposure metric for each treatment group. Across all treatment groups, AUC0-2 for subjects with BMI less than or equal to median value was 1.03-1.12 times the value for subjects with BMI more than median value. For subjects with BMI less than or equal to median value receiving DFN-11, median AUC0-2 was slightly less than that for subjects with BMI more than median value receiving Imitrex 4 mg and larger than that for subjects with BMI more than median value receiving Imitrex 3 mg. Results were similar for the other exposure metrics and for weight. Exposure was higher in women than in men, which can be attributed in part to differences in weight. There was no relationship between exposure and age. For DFN-11, AUC0-2 and AUC0-∞ were lower in nonwhites compared with whites; the ratio of median values was 0.84 and 0.89, respectively. A similar, nonstatistically significant, trend was observed in the other products (ratio of median values ranging from 0.84 to 0.89). Weight and BMI appear to be important covariates for sumatriptan exposure: subjects with lower values for either metric of body size have higher systemic exposure compared with subjects with higher values. Additional studies are required to determine if doses of subcutaneous sumatriptan may be adjusted based on BMI for comparable efficacy and a potentially improved tolerability profile.

  7. Nutritional assessment and antioxidant analysis of 22 date palm (Phoenix dactylifera) varieties growing in Sultanate of Oman.

    PubMed

    Al-Harrasi, Ahmad; Rehman, Najeeb Ur; Hussain, Javid; Khan, Abdul Latif; Al-Rawahi, Ahmed; Gilani, Syed Abdullah; Al-Broumi, Mohammed; Ali, Liaqat

    2014-09-01

    To assess the nutritional values and antioxidant analysis of 22 varieties of date palm (Phoenix dactylifera) fruit collected from various regions of the Sultanate of Oman. Nutritional parameters including moisture, fats, fiber, proteins, carbohydrates, and energy value were determined using standard methods of Association of Official Analytical Chemists. The antioxidant activity was screened for their free radical scavenging properties using ascorbic acid as a standard antioxidant. Free radical scavenging activity was evaluated using 1,1-diphenyl-2-picrylhydrazyl free radical. The results of the date fruits (dried/tamar stage) revealed significantly higher moisture (15%-21%), dry matter (78%-86%), ash content (1.0%-2.0%), fiber (1.0%-2.5%), fat (0.1%-0.7%), protein (1.8%-3.8%), nitrogen (0.25%-0.55%), carbohydrates (74.5%-82.4%), and energy values (307-345.5 kcal/100 g). The antioxidant activity ranged between 40% and 86% depending upon the type of date and location. Overall, Khalas, Fardh and Khasab have significantly higher nutritional attributes; however, other varieties such as Barshi, Qush LuLu, Handal, and Khunaizi also have comparable nutritional values. The cluster analysis further evidenced the correlation of proximate parameters in different locations. Moreover, the nutritional and antioxidant attributes of similar date varieties collected from different locations were slightly varied. The present finding helps in understanding the nutritional significance of different date varieties in Oman while the lesser known varieties can be improved through sustainable horticultural practices as a valuable product. The study further reveals that the consumption of these dates' fruits would exert several beneficial effects by virtue of their antioxidant activity. Copyright © 2014 Hainan Medical College. Published by Elsevier B.V. All rights reserved.

  8. High accuracy of the nine equivalents of nursing manpower use score assessed by critical care nurses.

    PubMed

    Perren, Andreas; Previsdomini, Marco; Perren, Ilaria; Merlani, Paolo

    2012-04-05

    The nine equivalents of nursing manpower use score (NEMS) is frequently used to quantify, evaluate and allocate nursing workload at intensive care unit level. In Switzerland it has also become a key component in defining the degree of ICU hospital reimbursement. The accuracy of nurse registered NEMS scores in real life was assessed and error-prone variables were identified. In this retrospective multicentre audit three reviewers (1 nurse, 2 intensivists) independently reassessed a total of 529 NEMS scores. Correlation and agreement of the sum-scores and of the different variables among reviewers, as well as between nurses and the reviewers' reference value, were assessed (ICC, % agreement and kappa). Bland & Altman (reference value - nurses) of sum-scores and regression of the difference were determined and a logistic regression model identifying risk factors for erroneous assessments was calculated. Agreement for sum-scores among reviewers was almost perfect (mean ICC = 0.99 / significant correlation p <0.0001). The nurse registered NEMS score (mean ± SD) was 24.8 ± 8.6 points versus 24.0 ± 8.6 points (p <0.13 for difference) of the reference value, with a slightly lower ICC (0.83). The lowest agreement was found in intravenous medication (0.85). Bland & Altman was 0.84 ± 10, with a significant regression between the difference and the reference value, indicating overall an overestimation of lower scores (≤29 points) and underestimation of higher scores. Accuracy of scores or variables was not associated with nurses' characteristics. In real life, nurse registered NEMS scores are highly accurate. Lower (≤29 points) NEMS sum-scores are overestimated and higher underestimated. Accuracy of scores or variables was not associated with nurses' characteristics.

  9. Serum Anti-Glycan Antibody Biomarkers for Inflammatory Bowel Disease Diagnosis and Progression: A Systematic Review and Meta-analysis

    PubMed Central

    Kaul, Amit; Hutfless, Susan; Liu, Ling; Bayless, Theodore M.; Marohn, Michael R.; Li, Xuhang

    2011-01-01

    BACKGROUND Anti-glycan antibody serologic markers may serve as useful adjunct in the diagnosis/prognosis of inflammatory bowel disease (IBD), including Crohn’s disease (CD) and ulcerative colitis (UC). This meta-analysis/systemic review was aimed to evaluate the diagnostic value, as well as the association of anti-glycan biomarkers with IBD susceptible gene variants, disease complications, and need for surgery in IBD. METHODS The diagnostic odds ratio (DOR), 95% confidence interval (CI), and sensitivity/specificity were used to compare the diagnostic value of individual and combinations of anti-glycan markers and their association with disease course (complication and/or need for surgery). RESULTS Fourteen studies were included in the systemic review and nine in the meta-analysis. Individually, ASCA had the highest DOR for differentiating IBD from healthy (DOR 21.1; 1.8-247.3; 2 studies), and CD from UC (DOR 10.2; CI 7.7-13.7; 7 studies). For combination of ≥2 markers, the DOR was 2.8 (CI 2.2-3.6; 2 studies) for CD-related surgery, higher than any individual marker, while the DOR for differentiating CD from UC was 10.2 (CI 5.6-18.5; 3 studies) and for complication was 2.8 (CI 2.2-3.7; 2 studies), similar to individual markers. CONCLUSIONS ASCA had the highest diagnostic value among individual anti-glycan markers. While ACCA had the highest association with complications, ASCA and ACCA associated equally with need for surgery. Although in most individual studies, combination of ≥2 markers had a better diagnostic value as well as higher association with complications and need for surgery, we found the combination performing slightly better than any individual marker in our meta-analysis. PMID:22294465

  10. Germination under Moderate Salinity Increases Phenolic Content and Antioxidant Activity in Rapeseed (Brassica napus var oleifera Del.) Sprouts.

    PubMed

    Falcinelli, Beatrice; Sileoni, Valeria; Marconi, Ombretta; Perretti, Giuseppe; Quinet, Muriel; Lutts, Stanley; Benincasa, Paolo

    2017-08-19

    The use of sprouts in the human diet is becoming more and more widespread because they are tasty and high in bioactive compounds and antioxidants, with related health benefits. In this work, we sprouted rapeseed under increasing salinity to investigate the effect on free and bound total phenolics (TP), non-flavonoids (NF), tannins (TAN), phenolic acids (PAs), and antioxidant activity. Seeds were incubated at 0, 25, 50, 100, 200 mM NaCl until early or late sprout stage, i.e., before or after cotyledon expansion, respectively. Sprouting and increasing salinity slightly decreased the bound fractions of TP, NF, TAN, PAs, while it increased markedly the free ones and their antioxidant activity. Further increases were observed in late sprouts. Moderate salinity (25-50 mM NaCl) caused the highest relative increase in phenolic concentration while it slightly affected sprout growth. On the contrary, at higher NaCl concentrations, sprouts grew slowly (100 mM NaCl) or even died before reaching the late sprout stage (200 mM). Overall, moderate salinity was the best compromise to increase phenolic content of rapeseed sprouts. The technique may be evaluated for transfer to other species as a cheap and feasible way to increase the nutritional value of sprouts.

  11. Do biochars influence the availability and human oral bioaccessibility of Cd, Pb, and Zn in a contaminated slightly alkaline soil?

    PubMed

    Janus, Adeline; Waterlot, Christophe; Heymans, Sophie; Deboffe, Christophe; Douay, Francis; Pelfrêne, Aurélie

    2018-03-14

    Different remediation techniques have been used to restore metal-contaminated sites, including stabilizing metals by adding amendments to the soils. This study experimented three biochars, made from wood and miscanthus, cultivated on contaminated and uncontaminated soils, used as amendments at a 2% application rate on a metal-contaminated soil for 9 months in laboratory-controlled conditions. The objective was to evaluate whether biochars were able to decrease the availability and human oral bioaccessibility of metals in an alkaline soil. To meet this goal, the modifications of the soil's physicochemical parameters, metal distribution in soil, and human bioaccessibility were evaluated at different sampling times. The results showed that biochar application to the alkaline soil did not always decrease the soil metal availability, which challenges the value of using biochars in already slightly alkaline soils at a low application rate. However, differences in efficiency between the three biochars tested were highlighted. The biochar produced with miscanthus cultivated on uncontaminated soil led to higher soil metal bioaccessibility. Moreover, because of the absence of any increase in soil metal availability with the biochar produced from biomass cultivated on contaminated soil, the use of such biochars can be recommended for the remediation of contaminated soil.

  12. All-nanotube stretchable supercapacitor with low equivalent series resistance.

    PubMed

    Gilshteyn, Evgenia P; Amanbayev, Daler; Anisimov, Anton S; Kallio, Tanja; Nasibulin, Albert G

    2017-12-12

    We report high-performance, stable, low equivalent series resistance all-nanotube stretchable supercapacitor based on single-walled carbon nanotube film electrodes and a boron nitride nanotube separator. A layer of boron nitride nanotubes, fabricated by airbrushing from isopropanol dispersion, allows avoiding problem of high internal resistance and short-circuiting of supercapacitors. The device, fabricated in a two-electrode test cell configuration, demonstrates electrochemical double layer capacitance mechanism and retains 96% of its initial capacitance after 20 000 electrochemical charging/discharging cycles with the specific capacitance value of 82 F g -1 and low equivalent series resistance of 4.6 Ω. The stretchable supercapacitor prototype withstands at least 1000 cycles of 50% strain with a slight increase in the volumetric capacitance from 0.4 to 0.5 mF cm -3 and volumetric power density from 32 mW cm -3 to 40 mW cm -3 after stretching, which is higher than reported before. Moreover, a low resistance of 250 Ω for the as-fabricated stretchable prototype was obtained, which slightly decreased with the strain applied up to 200 Ω. Simple fabrication process of such devices can be easily extended making the all-nanotube stretchable supercapacitors, presented here, promising elements in future wearable devices.

  13. The Blake geomagnetic excursion recorded in a radiometrically dated speleothem

    NASA Astrophysics Data System (ADS)

    Osete, María-Luisa; Martín-Chivelet, Javier; Rossi, Carlos; Edwards, R. Lawrence; Egli, Ramon; Muñoz-García, M. Belén; Wang, Xianfeng; Pavón-Carrasco, F. Javier; Heller, Friedrich

    2012-11-01

    One of the most important developments in geomagnetism has been the recognition of polarity excursions of the Earth's magnetic field. Accurate timing of the excursions is a key point for understanding the geodynamo process and for magnetostratigraphic correlation. One of the best-known excursions is the Blake geomagnetic episode, which occurred during marine isotope stage MIS 5, but its morphology and age remain controversial. Here we show, for the first time, the Blake excursion recorded in a stalagmite which was dated using the uranium-series disequilibrium techniques. The characteristic remanent magnetisation is carried by fine-grained magnetite. The event is documented by two reversed intervals (B1 and B2). The age of the event is estimated to be between 116.5±0.7 kyr BP and 112.0±1.9 kyr BP, slightly younger (∼3-4 kyr) than recent estimations from sedimentary records dated by astronomical tuning. Low values of relative palaeointensity during the Blake episode are estimated, but a relative maximum in the palaeofield intensity coeval with the complete reversal during the B2 interval was observed. Duration of the Blake geomagnetic excursion is 4.5 kyr, two times lower than single excursions and slightly higher than the estimated diffusion time for the inner core (∼3 kyr).

  14. Polarized single crystal neutron diffraction study of the zero-magnetization ferromagnet Sm1 -xGdxAl2 (x =0.024 )

    NASA Astrophysics Data System (ADS)

    Chatterji, T.; Stunault, A.; Brown, P. J.

    2018-02-01

    We have determined the temperature evolution of the spin and orbital moments in the zero-magnetization ferromagnet Sm1 -xGdxAl2 (x = 0.024) by combining polarized and unpolarized single crystal neutron diffraction data. The sensitivity of the polarized neutron technique has allowed the moment values to be determined with a precision of ≈0.1 μB . Our results clearly demonstrate that, when magnetized by a field of 8 T, the spin and orbital moments in Sm1 -xGdxAl2 are oppositely directed, so that the net magnetization is very small. Below 60 K the contributions from spin and orbital motions are both about 2 μB , with that due to orbital motion being slightly larger than that due to spin. Between 60 and 65 K the contributions of each to the magnetization fall rapidly and change sign at Tcomp ≈67 K , above which the aligned moments recover but with the orbital magnetization still slightly higher than the spin one. These results imply that above Tcomp the small resultant magnetization of the Sm3 + ion is oppositely directed to the magnetizing field. It is suggested that this anomaly is due to polarization of conduction electron spin associated with the doping Gd3 + ions.

  15. [Heavy metal pollution characteristics and ecological risk analysis for soil in Phyllostachys praecox stands of Lin'an].

    PubMed

    Fang, Xiao-bo; Shi, Han; Liao, Xin-feng; Lou, Zhong; Zhou, Lyu-yan; Yu, Hai-xia; Yao, Lin; Sun, Li-ping

    2015-06-01

    An investigation was carried out in an attempt to reveal the characteristics of heavy metals contamination in the soils of Phyllostachys praecox forest in Lin' an. Based on the concentrations of Hg, As, Cu, Pb, Zn, Cd, Cr, Ni, Co and Mn in 160 topsoil samples, the pollution status and ecological risks of heavy metals in the soils were assessed by single factor pollution index, Nemerow integrated pollution index and Hankanson potential ecological risk index. The spatial variability of heavy metal concentrations in the soils closely related to the distribution of traffic, industrial and livestock pollution sources. The average concentrations of Hg, As, Cu, Pb, Zn, Cd, Cr, Ni, Co and Mn in the soils were 0.16, 7.41, 34.36, 87.98, 103.98, 0.26, 59.12, 29.56, 11.44 and 350.26 mg · kg(-1), respectively. Pb, Cd, Zn and Cu concentrations were as 2.89, 1.70, 1.12 and 1.12 times as the background values of soil in Zhejiang Province, respectively. But their concentrations were all lower than the threshold values of the National Environmental Quality Standard for Soil (GB 15618-1995). The average single factor pollution index revealed that the level of heavy metal pollution in the soils was in order of Pb>Cd>Cu= Zn>Hg>As>Ni>Co>Cr>Mn. Pb pollution was of moderate level while Cd, Cu and Zn pollutions were slight. There was no soil pollution caused by the other heavy metals. However, the Nemerow integrated pollution index showed that all the 160 soil samples were contaminated by heavy metals to a certain extent. Among total 160 soil samples, slight pollution level, moderate pollution level and heavy pollution level accounted for 55.6%, 29.4% and 15.0%, respectively. The average single factor potential ecological risk index (Er(i)) implied that the potential ecological risk related to Cd reached moderate level, while the others were of slight level. Furthermore, Cd and Hg showed higher potential ecological risk indices which reached up to 256.82 and 187.33 respectively, indicating Cd and Hg had a strong ecological risk and therefore might pose the most serious ecological risk in the soils of P. praecox standsin Lin' an. In addition, the integrated factor potential ecological risk analysis suggested a slight risk to local ecosystem originated from heavy metal contamination in the soils of P. praecox stands in Lin'an.

  16. Paleohydrology and paleochemistry of Lake Manitoba, Canada: the isotope and ostracode records

    USGS Publications Warehouse

    Last, W.M.; Teller, J.T.; Forester, R.M.

    1994-01-01

    Lake Manitoba, the largest lake in the Prairie region of North America, contains a fine-grained sequence of late Pleistocene and Holocene sediment that documents a complex postglacial history. This record indicates that differential isostatic rebound and changing climate have interacted with varying drainage basin size and hydrologic budget to create significant variations in lake level and limnological conditions. During the initial depositional period in the basin, the Lake Agassiz phase (???12-9 ka), ??18O of ostracodes ranged from -16??? to -5??? (PDB), implying the lake was variously dominated by cold, dilute glacial meltwater and warm to cold, slightly saline water. Candona subtriangulata, which prefers cold, dilute water, dominates the most negative ??18O intervals, when the basin was part of proglacial Lake Agassiz. At times during this early phase, the ??18O of the lake abruptly shifted to higher values; euryhaline taxa such as C. rawsoni or Limnocythere ceriotuberosa, and halobiont taxa such as L. staplini or L. sappaensis are dominant in these intervals. This positive covariance of isotope and ostracode records implies that the lake level episodically fell, isolating the Lake Manitoba basin from the main glacial lake. ??18O values from inorganic endogenic Mg-calcite in the post-Agassiz phase of Lake Manitoba trend from -4??? at 8 ka to -11??? at 4.5 ka. We interpret that this trend indicates a gradually increasing influence of isotopically low (-20??? SMOW) Paleozoic groundwater inflow, although periods of increased evaporation during this time may account for zones of less negative isotopic values. The ??18O of this inorganic calcite abruptly shifts to higher values (-6???) after ???4.5 ka due to the combined effects of increased evaporative enrichment in a closed basin lake and the increased contribution of isotopically high surface water inflow on the hydrologic budget. After ???2 ka, the ??18O of the Mg-calcite fluctuates between -13??? and -7???, implying short-term variability in the lake's hydrologic budget, with values indicating the lake varied from outflow-dominated to evaporation-dominated. The ??13C values of Mg-calcite remain nearly constant from 8 to 4.5 ka and then trend to higher values upward in the section. This pattern suggests primary productivity in the lake was initially constant but gradually increased after 4.5 ka. ?? 1994 Kluwer Academic Publishers.

  17. Percentiles of fasting serum insulin, glucose, HbA1c and HOMA-IR in pre-pubertal normal weight European children from the IDEFICS cohort.

    PubMed

    Peplies, J; Jiménez-Pavón, D; Savva, S C; Buck, C; Günther, K; Fraterman, A; Russo, P; Iacoviello, L; Veidebaum, T; Tornaritis, M; De Henauw, S; Mårild, S; Molnár, D; Moreno, L A; Ahrens, W

    2014-09-01

    The aim of this study is to present age- and sex-specific reference values of insulin, glucose, glycosylated haemoglobin (HbA1c) and the homeostasis model assessment to quantify insulin resistance (HOMA-IR) for pre-pubertal children. The reference population consists of 7074 normal weight 3- to 10.9-year-old pre-pubertal children from eight European countries who participated in at least one wave of the IDEFICS ('identification and prevention of dietary- and lifestyle-induced health effects in children and infants') surveys (2007-2010) and for whom standardised laboratory measurements were obtained. Percentile curves of insulin (measured by an electrochemiluminescence immunoassay), glucose, HbA1c and HOMA-IR were calculated as a function of age stratified by sex using the general additive model for location scale and shape (GAMLSS) method. Levels of insulin, fasting glucose and HOMA-IR continuously show an increasing trend with age, whereas HbA1c shows an upward trend only beyond the age of 8 years. Insulin and HOMA-IR values are higher in girls of all age groups, whereas glucose values are slightly higher in boys. Median serum levels of insulin range from 17.4 and 13.2 pmol l(-1) in 3-<3.5-year-old girls and boys, respectively, to 53.5 and 43.0 pmol l(-1) in 10.5-<11-year-old girls and boys. Median values of glucose are 4.3 and 4.5 mmol l(-1) in the youngest age group and 49.3 and 50.6 mmol l(-1) in the oldest girls and boys. For HOMA-IR, median values range from 0.5 and 0.4 in 3-<3.5-year-old girls and boys to 1.7 and 1.4 in 10.5-<11-year-old girls and boys, respectively. Our study provides the first standardised reference values for an international European children's population and provides the, up to now, largest data set of healthy pre-pubertal children to model reference percentiles for markers of insulin resistance. Our cohort shows higher values of Hb1Ac as compared with a single Swedish study while our percentiles for the other glucose metabolic markers are in good accordance with previous studies.

  18. Drought until death do us part: a case study of the desiccation-tolerance of a tropical moist forest seedling-tree, Licania platypus (Hemsl.) Fritsch.

    PubMed

    Tyree, Melvin T; Vargas, Gustavo; Engelbrecht, Bettina M J; Kursar, Thomas A

    2002-11-01

    Studies of the desiccation tolerance of 15-month-old Licania platypus (Hemsl.) Fritsch seedlings were performed on potted plants. Pots were watered to field capacity and then dehydrated for 23-46 d to reach various visible wilting stages from slightly-wilted to dead. Root hydraulic conductance, k(r), was measured with a high-pressure flow meter and whole-stem hydraulic conductance, k(ws), was measured by a vacuum chamber method. Leaf punches were harvested for measurement of leaf water potential by a thermocouple psychrometer and for measurement of fresh- and dry-weight. L. platypus was surprisingly desiccation-tolerant, suggesting that most species of central Panama may be well adapted to the seasonality of rainfall in the region. The slightly-wilted stage corresponded to leaf water potentials and relative water contents of -2.7 MPa and 0.85, respectively, but plants did not die until these values fell to -7.5 MPa and 0.14, respectively. As desiccation proceeded k(r) and k(ws) declined relative to irrigated controls, but k(ws) was more sensitive to desiccation than k(r). Values of k(ws) declined by 70-85% in slightly-wilted to dead plants, respectively. By comparison, k(r) showed no significant change in slightly-wilted plants and fell by about 50% in plants having severely-wilted to dead shoots.

  19. Characterization of commercial supercapacitors for low temperature applications

    NASA Astrophysics Data System (ADS)

    Iwama, E.; Taberna, P. L.; Azais, P.; Brégeon, L.; Simon, P.

    2012-12-01

    Electrochemical characterizations at low temperature and floating tests have been performed on 600F commercial supercapacitor (SC) for acetonitrile (AN)-based and AN + methyl acetate (MA) mixed electrolytes. From -40 to +20 °C, AN electrolyte showed slightly higher capacitance than those of AN + MA mixed electrolytes (25 and 33 vol.% of MA). At -55 °C, however, AN electrolyte did not cycle at all, while MA mixed electrolyte normally cycled with a slight decrease in their capacitance. From electrochemical impedance spectroscopy measurements, the whole resistance for AN-based cells at -55 °C was found to be about 10,000 times higher than that of +20 °C, while a 40-fold increase in the cell resistance was obtained for the MA mixture between 20 and -55 °C. From the results of floating tests at 2.7 V and 60 °C for 1 month, the 25 vol.% MA mixture showed no change and slight decreased but stable capacitance.

  20. Upper arm circumference development in Chinese children and adolescents: a pooled analysis.

    PubMed

    Tong, Fang; Fu, Tong

    2015-05-30

    Upper arm development in children is different in different ethnic groups. There have been few reports on upper arm circumference (UAC) at different stages of development in children and adolescents in China. The purpose of this study was to provide a reference for growth with weighted assessment of the overall level of development. Using a pooled analysis, an authoritative journal database search and reports of UAC, we created a new database on developmental measures in children. In conducting a weighted analysis, we compared reference values for 0~60 months of development according to the World Health Organization (WHO) statistics considering gender and nationality and used Z values as interval values for the second sampling to obtain an exponential smooth curve to analyze the mean, standard deviation, and sites of attachment. Ten articles were included in the pooled analysis, and these articles included participants from different areas of China. The point of intersection with the WHO curve was 3.5 years with higher values at earlier ages and lower values at older ages. Boys curve was steeper after puberty. The curves in the studies had a merged line compatible. The Z values of exponential smoothing showed the curves were similar for body weight and had a right normal distribution. The integrated index of UAC in Chinese children and adolescents indicated slightly variations with regions. Exponential curve smoothing was suitable for assessment at different developmental stages.

  1. The effect of increase in dielectric values on specific absorption rate (SAR) in eye and head tissues following 900, 1800 and 2450 MHz radio frequency (RF) exposure

    NASA Astrophysics Data System (ADS)

    Keshvari, Jafar; Keshvari, Rahim; Lang, Sakari

    2006-03-01

    Numerous studies have attempted to address the question of the RF energy absorption difference between children and adults using computational methods. They have assumed the same dielectric parameters for child and adult head models in SAR calculations. This has been criticized by many researchers who have stated that child organs are not fully developed, their anatomy is different and also their tissue composition is slightly different with higher water content. Higher water content would affect dielectric values, which in turn would have an effect on RF energy absorption. The objective of this study was to investigate possible variation in specific absorption rate (SAR) in the head region of children and adults by applying the finite-difference time-domain (FDTD) method and using anatomically correct child and adult head models. In the calculations, the conductivity and permittivity of all tissues were increased from 5 to 20% but using otherwise the same exposure conditions. A half-wave dipole antenna was used as an exposure source to minimize the uncertainties of the positioning of a real mobile device and making the simulations easily replicable. Common mobile telephony frequencies of 900, 1800 and 2450 MHz were used in this study. The exposures of ear and eye regions were investigated. The SARs of models with increased dielectric values were compared to the SARs of the models where dielectric values were unchanged. The analyses suggest that increasing the value of dielectric parameters does not necessarily mean that volume-averaged SAR would increase. Under many exposure conditions, specifically at higher frequencies in eye exposure, volume-averaged SAR decreases. An increase of up to 20% in dielectric conductivity or both conductivity and permittivity always caused a SAR variation of less than 20%, usually about 5%, when it was averaged over 1, 5 or 10 g of cubic mass for all models. The thickness and composition of different tissue layers in the exposed regions within the human head play a more significant role in SAR variation compared to the variations (5-20%) of the tissue dielectric parameters.

  2. Concurrent Timbres in Orchestration: a Perceptual Study of Factors Determining "blend"

    NASA Astrophysics Data System (ADS)

    Sandell, Gregory John

    Orchestration often involves selecting instruments for concurrent presentation, as in melodic doubling or chords. One evaluation of the aural outcome of such choices is along the continuum of "blend": whether the instruments fuse into a single composite timbre, segregate into distinct timbral entities, or fall somewhere in between the two extremes. This study investigates, through perceptual experimentation, the acoustical correlates of blend for 15 natural-sounding orchestral instruments presented in concurrently-sounding pairs (e.g. flute-cello, trumpet -oboe, etc.). Ratings of blend showed primary effects for centroid (the location of the midpoint of the spectral energy distribution) and duration of the onset for the tones. Lower average values of both centroid and onset duration for a pair of tones led to increased blends, as did closeness in value for the two factors. Blend decreased (instruments segregated) with higher average values or increased difference in value for the two factors. The musical interval of presentation slightly affected the relative importance of these two mechanisms, with unison intervals determined more by lower average centroid, and minor thirds determined more by closeness in centroid. The contribution of onset in general was slightly more pronounced in the unison conditions than in the minor third condition. Additional factors contributing to blend were correlation of amplitude and centroid envelopes (blend increased as temporal patterns rose and fell in synchrony) and similarity in the overall amount of fundamental frequency perturbation (decreased blend with increasing jitter from both tones). To confirm the importance of centroid as an independent factor determining blend, pairs of tones including instruments with artificially changed centroids were rated for blend. Judgments for several versions of the same instrument pair showed that blend decreased as the altered instrument increased in centroid, corroborating the earlier experiments. Other factors manipulated were amplitude level and the degree of inharmonicity. A survey of orchestration manuals showed many illustrations of "blending" combinations of instruments that were consistent with the results of these experiments. This study's acoustically-based guidelines for blend augment instance-based methods of traditional orchestration teaching, providing underlying abstractions helpful for evaluating the blend of arbitrary combinations of instruments.

  3. The role of height in the sex difference in intelligence.

    PubMed

    Kanazawa, Satoshi; Reyniers, Diane J

    2009-01-01

    Recent studies conclude that men on average have higher intelligence than women by 3-5 IQ points. However, the ultimate evolutionary question of why men should have evolved to have higher intelligence than women remains. We suggest that men may have slightly higher intelligence than women through 4 mechanisms: (1) assortative mating of intelligent men and beautiful women, (2) assortative mating of tall men and beautiful women, (3) an extrinsic correlation between height and intelligence produced by Mechanisms 1 and 2, and (4) a higher-than-expected offspring sex ratio (more sons) among tall (and hence intelligent) parents. Consistent with our suggestion, we show that men may have higher IQs than women because they are taller, and once we control for height women have slightly higher IQs than men.The correlation between height and IQ and the female advantage in intelligence persist even after we control for health as a measure of genetic quality, as well as physical attractiveness, age, race, education, and earnings. Height is also strongly associated with intelligence within each sex.

  4. Curcumin liposomes prepared with milk fat globule membrane phospholipids and soybean lecithin.

    PubMed

    Jin, Hong-Hao; Lu, Qun; Jiang, Jian-Guo

    2016-03-01

    Using thin film ultrasonic dispersion method, the curcumin liposomes were prepared with milk fat globule membrane (MFGM) phospholipids and soybean lecithins, respectively, to compare the characteristics and stability of the 2 curcumin liposomes. The processing parameters of curcumin liposomes were investigated to evaluate their effects on the encapsulation efficiency. Curcumin liposomes were characterized in terms of size distribution, ζ-potential, and in vitro release behavior, and then their storage stability under various conditions was evaluated. The curcumin liposomes prepared with MFGM phospholipids had an encapsulation efficiency of about 74%, an average particle size of 212.3 nm, and a ζ-potential of -48.60 mV. The MFGM liposomes showed higher encapsulation efficiency, smaller particle size, higher absolute value of ζ-potential, and slower in vitro release than soybean liposomes. The retention rate of liposomal curcumin was significantly higher than that of free curcumin. The stability of the 2 liposomes under different pH was almost the same, but MFGM liposomes displayed a slightly higher stability than soybean liposomes under the conditions of Fe(3+), light, temperature, oxygen, and relative humidity. In conclusion, MFGM phospholipids have potential advantages in the manufacture of curcumin liposomes used in food systems. Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  5. Asbestos penetration test system for clothing materials

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bradley, O.D.; Stampfer, J.F.; Sandoval, A.N.

    1997-04-01

    For hazardous work such as asbestos abatement, there is a need to assess protective clothing fabrics and seam constructions to assure an adequate barrier against hazardous material. The penetration of aerosols through fabrics usually is measured by challenging fabric samples with an aerosol stream at a constant specified airflow. To produce the specified airflow, pressure differentials across the samples often are higher than exist in a work environment. This higher airflow results in higher aerosol velocities through the fabric and, possibly, measured penetration values not representative of those actually experienced in the field. The objective of the reported work wasmore » to develop a test method that does not require these higher airflows. The authors have designed and fabricated a new system that tests fabric samples under a low, constant, specified pressure differential across the samples. This differential is adjustable from tenths of a mm Water Gauge (hundredths of an in WG) to over 25-mm WG (1-in WG). The system operates at a pressure slightly lower than its surroundings. Although designed primarily for asbestos, the system is equally applicable to the testing of other aerosols by changing the aerosol generator and detector. Through simple modification of the sample holders, the test apparatus would be capable of evaluating seam and closure constructions.« less

  6. Epidemiological investigations into multiple sclerosis in southern Hesse. II. The distribution of cases in relation to exogenous features.

    PubMed

    Lauer, K; Firnhaber, W

    1984-10-01

    In order to discover possible exogenous variables associated with a higher multiple sclerosis risk, the distribution of cases with definite and probable multiple sclerosis ascertained in the course of a micro-epidemiologic study in Southern Hesse was evaluated and compared with some environmental factors. The prevalence in 1980, the prevalence of cases with disease-onset within the region according to locality of onset and the rate of native Southern Hesse patients according to childhood residence all showed a similar geographical distribution, with the highest values in the south-eastern, mountainous part of the region. This district has a lower annual mean temperature, more annual snow-days and a higher annual precipitation compared to the remaining area. A statistical comparison revealed no association with industrial or agricultural activities, with a particular type of land use, with cattle, pig- or horse-breeding, or with sanitary or housing standards. On the other hand, a slight association with the soil type could be demonstrated, with higher rates on loam and clay subsoils when compared to predominantly sandy regions. Whether this finding has any significance or not remains to be clarified.

  7. Altered lignin biosynthesis improves cellulosic bioethanol production in transgenic maize plants down-regulated for cinnamyl alcohol dehydrogenase.

    PubMed

    Fornalé, Silvia; Capellades, Montserrat; Encina, Antonio; Wang, Kan; Irar, Sami; Lapierre, Catherine; Ruel, Katia; Joseleau, Jean-Paul; Berenguer, Jordi; Puigdomènech, Pere; Rigau, Joan; Caparrós-Ruiz, David

    2012-07-01

    Cinnamyl alcohol dehydrogenase (CAD) is a key enzyme involved in the last step of monolignol biosynthesis. The effect of CAD down-regulation on lignin production was investigated through a transgenic approach in maize. Transgenic CAD-RNAi plants show a different degree of enzymatic reduction depending on the analyzed tissue and show alterations in cell wall composition. Cell walls of CAD-RNAi stems contain a lignin polymer with a slight reduction in the S-to-G ratio without affecting the total lignin content. In addition, these cell walls accumulate higher levels of cellulose and arabinoxylans. In contrast, cell walls of CAD-RNAi midribs present a reduction in the total lignin content and of cell wall polysaccharides. In vitro degradability assays showed that, although to a different extent, the changes induced by the repression of CAD activity produced midribs and stems more degradable than wild-type plants. CAD-RNAi plants grown in the field presented a wild-type phenotype and produced higher amounts of dry biomass. Cellulosic bioethanol assays revealed that CAD-RNAi biomass produced higher levels of ethanol compared to wild-type, making CAD a good target to improve both the nutritional and energetic values of maize lignocellulosic biomass.

  8. Willingness to engage in energy conservation and CO2 emissions reduction: An empirical investigation

    NASA Astrophysics Data System (ADS)

    Eluwa, S. E.; Siong, H. C.

    2014-02-01

    Africa's response to climate change has largely been focused on adaptation rather than mitigation. The reason for this is based on the fact that the continent contributes very little to global CO2 emission. Again, mitigation policies like carbon tax as being practised in developed countries may be costly and difficult to implement in a continent where most economies are fragile. Using behavioural change as an adaptation approach, we examined the opinion of Ibadan city residents towards energy conservation and CO2 emissions reduction. A total of 822 respondents were sampled across the three residential neighbourhoods of the city. Results from the study showed that female and male respondents differed in their opinion towards energy conservation. However, the female respondents tended to record higher mean scores on majority of the items used to capture energy conservation behaviour than their male counterparts. Also, those with higher level of education seemed to be more conscious of the environmental consequences arising from energy use at home than those with lower educational background. However, very slight variations were recorded in the mean value score across the different age groups, those respondents above 50 years scored a bit higher than other age groups.

  9. Physiological changes, sleep, and morning mood in an isolated environment

    NASA Technical Reports Server (NTRS)

    Kraft, Norbert O.; Inoue, Natsuhiko; Mizuno, Koh; Ohshima, Hiroshi; Murai, Tadashi; Sekiguchi, Chiharu; Orasanu, J. M. (Principal Investigator)

    2002-01-01

    BACKGROUND: Previous isolation studies have shown increased 24-h urine volumes and body weight gains in subjects. This project examined those and other physiological variables in relationship to sleep motor activity, subjective sleep quality, mood, and complaints during confinement. METHODS: Six male and two female subjects lived for 7 d in the National Space Development Agency of Japan's isolation chamber, which simulates the interior of the Japanese Experiment Module. Each 24-h period included 6 h of sleep, 3 meals, and 20 min of exercise. Each morning, subjects completed Sleep Sensation and Complaint Index questionnaires. Catecholamine and creatinine excretion, urine volume, and body weight were measured on the 2 d before and 2 d after confinement, and sleep motor activity was measured during confinement. RESULTS: Confinement produced no significant change in body weight, urine volume, or questionnaire results. In contrast, epinephrine, norepinephrine, and sleep motor activity exhibited significant differences during confinement (p < 0.05). Higher nocturnal norepinephrine excretion correlated with higher sleep motor activity. CONCLUSION: The 24-h epinephrine values were slightly higher than normal throughout the experiment, but lower than for subjects working under time-stress. High sympathetic activity (as indicated by norepinephrine) may have interfered with sleep.

  10. Evaluation and projected changes of precipitation statistics in convection-permitting WRF climate simulations over Central Europe

    NASA Astrophysics Data System (ADS)

    Knist, Sebastian; Goergen, Klaus; Simmer, Clemens

    2018-02-01

    We perform simulations with the WRF regional climate model at 12 and 3 km grid resolution for the current and future climates over Central Europe and evaluate their added value with a focus on the daily cycle and frequency distribution of rainfall and the relation between extreme precipitation and air temperature. First, a 9 year period of ERA-Interim driven simulations is evaluated against observations; then global climate model runs (MPI-ESM-LR RCP4.5 scenario) are downscaled and analyzed for three 12-year periods: a control, a mid-of-century and an end-of-century projection. The higher resolution simulations reproduce both the diurnal cycle and the hourly intensity distribution of precipitation more realistically compared to the 12 km simulation. Moreover, the observed increase of the temperature-extreme precipitation scaling from the Clausius-Clapeyron (C-C) scaling rate of 7% K-1 to a super-adiabatic scaling rate for temperatures above 11 °C is reproduced only by the 3 km simulation. The drop of the scaling rates at high temperatures under moisture limited conditions differs between sub-regions. For both future scenario time spans both simulations suggest a slight decrease in mean summer precipitation and an increase in hourly heavy and extreme precipitation. This increase is stronger in the 3 km runs. Temperature-extreme precipitation scaling curves in the future climate are projected to shift along the 7% K-1 trajectory to higher peak extreme precipitation values at higher temperatures. The curves keep their typical shape of C-C scaling followed by super-adiabatic scaling and a drop-off at higher temperatures due to moisture limitation.

  11. Disaggregated N2O emission factors in China based on cropping parameters create a robust approach to the IPCC Tier 2 methodology

    PubMed Central

    Shepherd, Anita; Yan, Xiaoyuan; Nayak, Dali; Newbold, Jamie; Moran, Dominic; Dhanoa, Mewa Singh; Goulding, Keith; Smith, Pete; Cardenas, Laura M.

    2015-01-01

    China accounts for a third of global nitrogen fertilizer consumption. Under an International Panel on Climate Change (IPCC) Tier 2 assessment, emission factors (EFs) are developed for the major crop types using country-specific data. IPCC advises a separate calculation for the direct nitrous oxide (N2O) emissions of rice cultivation from that of cropland and the consideration of the water regime used for irrigation. In this paper we combine these requirements in two independent analyses, using different data quality acceptance thresholds, to determine the influential parameters on emissions with which to disaggregate and create N2O EFs. Across China, the N2O EF for lowland horticulture was slightly higher (between 0.74% and 1.26% of fertilizer applied) than that for upland crops (values ranging between 0.40% and 1.54%), and significantly higher than for rice (values ranging between 0.29% and 0.66% on temporarily drained soils, and between 0.15% and 0.37% on un-drained soils). Higher EFs for rice were associated with longer periods of drained soil and the use of compound fertilizer; lower emissions were associated with the use of urea or acid soils. Higher EFs for upland crops were associated with clay soil, compound fertilizer or maize crops; lower EFs were associated with sandy soil and the use of urea. Variation in emissions for lowland vegetable crops was closely associated with crop type. The two independent analyses in this study produced consistent disaggregated N2O EFs for rice and mixed crops, showing that the use of influential cropping parameters can produce robust EFs for China. PMID:26865831

  12. The association of educational attainment and SBP among older community-living adults: the Maintenance of Balance, Independent Living, Intellect and Zest in the Elderly (MOBILIZE) Boston Study

    PubMed Central

    Kiely, Dan K.; Gross, Alden L.; Kim, Dae H.; Lipsitz, Lewis A.

    2012-01-01

    Objective Educational attainment is inversely associated with SBP level in young adulthood. This association has not been studied in an older cohort, and confounding and mediating factors are not well known. Methods The authors hypothesized that higher education is associated with lower levels of SBP independent of many risk factors for hypertension. This prospective observational study included a sample of 764 older community-living participants in the Maintenance of Balance, Independent Living, Intellect and Zest in the Elderly (MOBILIZE) Boston Study. Results Compared to participants with more than college education, regression analyses showed those with a high school education or less had a SBP value 6.33 mmHg higher [95% confidence interval (CI): 2.55–10.10], and those who had a college education had a SBP value 4.01 mmHg higher (95% CI: 0.77–7.25) independent of many hypothesized confounders and mediators. Discussion Results of a path analysis confirmed that higher level of education was associated with lower SBP even after adjustment for hypothesized mediators. Although slightly attenuated by multivariable adjustment for hypertension risk factors, the significant inverse association between educational attainment and SBP was not entirely mediated by these risk factors. These findings indicate that education is inversely associated with SBP in a diverse cohort of community-living older adults, independent of many known or suspected risk factors. Conclusion This study is the first to report the association between education and SBP in an older sample, representing a population at the highest risk for hypertension-related morbidity and mortality. PMID:22688267

  13. Disaggregated N2O emission factors in China based on cropping parameters create a robust approach to the IPCC Tier 2 methodology

    NASA Astrophysics Data System (ADS)

    Shepherd, Anita; Yan, Xiaoyuan; Nayak, Dali; Newbold, Jamie; Moran, Dominic; Dhanoa, Mewa Singh; Goulding, Keith; Smith, Pete; Cardenas, Laura M.

    2015-12-01

    China accounts for a third of global nitrogen fertilizer consumption. Under an International Panel on Climate Change (IPCC) Tier 2 assessment, emission factors (EFs) are developed for the major crop types using country-specific data. IPCC advises a separate calculation for the direct nitrous oxide (N2O) emissions of rice cultivation from that of cropland and the consideration of the water regime used for irrigation. In this paper we combine these requirements in two independent analyses, using different data quality acceptance thresholds, to determine the influential parameters on emissions with which to disaggregate and create N2O EFs. Across China, the N2O EF for lowland horticulture was slightly higher (between 0.74% and 1.26% of fertilizer applied) than that for upland crops (values ranging between 0.40% and 1.54%), and significantly higher than for rice (values ranging between 0.29% and 0.66% on temporarily drained soils, and between 0.15% and 0.37% on un-drained soils). Higher EFs for rice were associated with longer periods of drained soil and the use of compound fertilizer; lower emissions were associated with the use of urea or acid soils. Higher EFs for upland crops were associated with clay soil, compound fertilizer or maize crops; lower EFs were associated with sandy soil and the use of urea. Variation in emissions for lowland vegetable crops was closely associated with crop type. The two independent analyses in this study produced consistent disaggregated N2O EFs for rice and mixed crops, showing that the use of influential cropping parameters can produce robust EFs for China.

  14. Reducing the H0 and σ8 tensions with dark matter-neutrino interactions

    NASA Astrophysics Data System (ADS)

    Di Valentino, Eleonora; Bœhm, Céline; Hivon, Eric; Bouchet, François R.

    2018-02-01

    The introduction of dark matter-neutrino interactions modifies the cosmic microwave background (CMB) angular power spectrum at all scales, thus affecting the reconstruction of the cosmological parameters. Such interactions can lead to a slight increase of the value of H0 and a slight decrease of S8≡σ8√{Ωm/0.3 } , which can help reduce somewhat the tension between the CMB and weak lensing or Cepheids data sets. Here we show that it is impossible to solve both tensions simultaneously. While the 2015 Planck temperature and low multipole polarization data combined with the Cepheids data sets prefer large values of the Hubble rate (up to H0=72.1-1.7+1.5 km /s /Mpc , when Neff is free to vary), the σ8 parameter remains too large to reduce the σ8 tension. Adding high multipole Planck polarization data does not help since this data shows a strong preference for low values of H0, thus worsening current tensions, even though they also prefer smaller value of σ8.

  15. Structural, morphological and optical investigations on electron-beam irradiated PbF2-TeO2-B2O3-Eu2O3 glasses

    NASA Astrophysics Data System (ADS)

    Wagh, Akshatha; Petwal, Vikash; Dwivedi, Jishnu; Upadhyaya, V.; Raviprakash, Y.; Kamath, Sudha D.

    2016-09-01

    Combined structural, optical and morphological studies were carried out on Eu2O3 doped PbF2-TeO2-B2O3 glass samples, before and after being subjected to electron beam of energy 7.5 MeV. XRD confirmed the amorphous nature of the glasses even after 150 kGy electron beam irradiation. Densities of the irradiated samples showed slightly greater values when compared to their respective values before irradiation, which proved the increase in the compaction of the network. The intensities of the three prominent bands; B-O-B linkages, BO4 units and BO3 units of FT-IR spectra, of the titled glasses, showed slight decrease after electron beam irradiation. The decrement in the values of energy band gap and shift in cut-off wavelength towards red edge, proved the formation of color centers in the glass network after irradiation. The change in Hunter L values, through color measurement was a proof for the Farbe/color/absorption centers created in the glass sites after irradiation.

  16. Fluvial geochemistry in São Miguel Island (Azores, Portugal): source and fluxes of inorganic solutes in an active volcanic environment.

    PubMed

    Freire, P; Andrade, C; Coutinho, R; Cruz, J V

    2013-06-01

    River water chemistry in two of the major rivers in São Miguel Island (Azores archipelago, Portugal) has been characterized monthly between June 2010 and October 2011 in order to estimate the main geochemical processes that explain water composition and to estimate solute fluxes and the thermal water input to rivers. Both rivers (Ribeira Grande - RRG, and Ribeira Quente - RRQ) drain active trachytic central volcanoes. The number of sampling stations is seven in RRG and six in RRQ. Rivers are mainly slightly acid to basic in nature (pH in the range 5.41-8.70 in RRG and 5.90-8.10 in RRQ) and from the Na-HCO3 and Na-HCO3-Cl water types. In both cases water temperature increases towards the river mouth and median values are slightly higher in Ribeira Quente (15.5-22.4°C) comparing to Ribeira Grande river (15.2-19.7°C). Electrical conductivity suggests poorly mineralized waters (139-456 μS/cm in RRG and 209-402 μS/cm in RRQ, and values increase downstream. Higher solute fluxes are associated to HCO3 and Na, and the total CO2 flux is equal to 3647 t/yr in RRQ and 7546 t/yr in RRG. Mixture with thermal water discharges also influences river water chemistry and in RRQ the contribution to the annual average discharge rate was estimated in 2.96×10(6)m(3)/yr (12.8% of overall discharge rate in the watershed). In RRG thermal water discharges were estimated in 2.4×10(6)m(3)/yr (14.9% of the discharge rate). The minimum total CO2-consumption associated with low-temperature weathering is equal to 0.58×10(6)mol/km(2)/yr in Ribeira Quente river and equal to 0.78×10(6)mol/km(2)/yr in Ribeira Grande river. Copyright © 2013 Elsevier B.V. All rights reserved.

  17. Validation and optimisation of an ICD-10-coded case definition for sepsis using administrative health data.

    PubMed

    Jolley, Rachel J; Quan, Hude; Jetté, Nathalie; Sawka, Keri Jo; Diep, Lucy; Goliath, Jade; Roberts, Derek J; Yipp, Bryan G; Doig, Christopher J

    2015-12-23

    Administrative health data are important for health services and outcomes research. We optimised and validated in intensive care unit (ICU) patients an International Classification of Disease (ICD)-coded case definition for sepsis, and compared this with an existing definition. We also assessed the definition's performance in non-ICU (ward) patients. All adults (aged ≥ 18 years) admitted to a multisystem ICU with general medicosurgical ICU care from one of three tertiary care centres in the Calgary region in Alberta, Canada, between 1 January 2009 and 31 December 2012 were included. Patient medical records were randomly selected and linked to the discharge abstract database. In ICU patients, we validated the Canadian Institute for Health Information (CIHI) ICD-10-CA (Canadian Revision)-coded definition for sepsis and severe sepsis against a reference standard medical chart review, and optimised this algorithm through examination of other conditions apparent in sepsis. Sensitivity (Sn), specificity (Sp), positive predictive value (PPV) and negative predictive value (NPV) were calculated. Sepsis was present in 604 of 1001 ICU patients (60.4%). The CIHI ICD-10-CA-coded definition for sepsis had Sn (46.4%), Sp (98.7%), PPV (98.2%) and NPV (54.7%); and for severe sepsis had Sn (47.2%), Sp (97.5%), PPV (95.3%) and NPV (63.2%). The optimised ICD-coded algorithm for sepsis increased Sn by 25.5% and NPV by 11.9% with slightly lowered Sp (85.4%) and PPV (88.2%). For severe sepsis both Sn (65.1%) and NPV (70.1%) increased, while Sp (88.2%) and PPV (85.6%) decreased slightly. This study demonstrates that sepsis is highly undercoded in administrative data, thus under-ascertaining the true incidence of sepsis. The optimised ICD-coded definition has a higher validity with higher Sn and should be preferentially considered if used for surveillance purposes. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  18. Zinc and sulfur isotope variation in sphalerite from carbonate-hosted zinc deposits, Cantabria, Spain

    NASA Astrophysics Data System (ADS)

    Pašava, Jan; Tornos, Fernando; Chrastný, Vladislav

    2014-10-01

    We studied zinc and sulfur isotopes and the chemical composition of sphalerite samples from Picos de Europa (Aliva mine) and sphalerite and hydrozincite samples from La Florida mine, two carbonate-hosted Mississippi Valley-type (MVT) deposits located in northern Spain; despite being close, they are hosted in carbonatic rocks of different ages, Lower Carboniferous and Lower Cretaceous, respectively. The two generations of sphalerite at Picos de Europa show different δ66Zn values (stage 1 sphalerite +0.24 per mil and stage 2 sphalerite from -0.75 to +0.08 per mil). Both generations also differ in the sulfur isotope composition (stage 1 has δ34S = +6.6 and stage 2 has δ34S = -0.9 to +2.9 per mil) and the chemical composition (stage 1 sphalerite, compared to stage 2 sphalerite, is significantly enriched in Pb, As, Mn, Sb, slightly enriched in Ag, Ni, and Cu and depleted in Co, Ga, Tl, Te, Ge, and Sn). We suggest that Zn isotope fractionation was controlled predominantly by pH and T changes. High Zn isotope values reflect rapid precipitation of sphalerite from higher-temperature acidic fluids that carried Zn mostly as chloride species after interaction with carbonate rocks while lower Zn isotope values most likely resulted from a longer precipitation process from fluid at higher pH and decreasing T that carried dominantly Zn sulfide species. At La Florida, sphalerite samples show light 66Zn-depleted signatures with δ66Zn values from -0.80 to -0.01 per mil (mostly between -0.80 and -0.24 per mil) and δ34S values from +10.7 to +15.7 per mil without any relationship between the δ66Zn and δ34S values. Here, the variation in Zn isotope values is interpreted as related to mixing of fluids from two reservoirs. The Zn was carried by a single deep-seated and higher T (~250-320 °C) fluid, and precipitation took place after mixing with a connate S-rich fluid in a system with mH2S > mZn2+ as a result of change in pH, T, and Zn predominant species. The light δ66Zn accompanied by heavy δ34S values resulted from fractionation of Zn aqueous sulfides at near-neutral pH and decreasing T. Hydrozincite samples show much heavier δ66Zn values (+0.21 to +0.33 per mil), consistent with fractionation during supergene processes.

  19. Trends in the Sea Ice Cover Using Enhanced and Compatible AMSR-E, SSM/I and SMMR Data

    NASA Technical Reports Server (NTRS)

    Comiso, Josefino C.; Nishio, Fumihiko

    2007-01-01

    Arguably, the most remarkable manifestation of change in the polar regions is the rapid decline (of about -10 %/decade) in the Arctic perennial ice cover. Changes in the global sea ice cover, however, are more modest, being slightly positive in the Southern Hemisphere and slightly negative in the Northern Hemisphere, the significance of which has not been adequately assessed because of unknown errors in the satellite historical data. We take advantage of the recent and more accurate AMSR-E data to evaluate the true seasonal and interannual variability of the sea ice cover, assess the accuracy of historical data, and determine the real trend. Consistently derived ice concentrations from AMSR-E, SSM/I, and SMMR data were analyzed and a slight bias is observed between AMSR-E and SSM/I data mainly because of differences in resolution. Analysis of the combine SMMR, SSM/I and AMSR-E data set, with the bias corrected, shows that the trends in extent and area of sea ice in the Arctic region is -3.4 +/- 0.2 and -4.0 +/- 0.2 % per decade, respectively, while the corresponding values for the Antarctic region is 0.9 +/- 0.2 and 1.7 .+/- 0.3 % per decade. The higher resolution of the AMSR-E provides an improved determination of the location of the ice edge while the SSM/I data show an ice edge about 6 to 12 km further away from the ice pack. Although the current record of AMSR-E is less than 5 years, the data can be utilized in combination with historical data for more accurate determination of the variability and trends in the ice cover.

  20. The thermal comfort and its changes in the 31 provincial capital cities of mainland China in the past 30 years

    NASA Astrophysics Data System (ADS)

    Chi, Xiaoli; Li, Rui; Cubasch, Ulrich; Cao, Wenting

    2018-04-01

    The thermal comfort and its changes in the 31 provincial capital cities of mainland China in the past 30 years were comprehensively evaluated using the Physiologically Equivalent Temperature (PET) and Universal Thermal Climate Index (UTCI) indicators. The PET and UTCI values were highly correlated with each other and presented similar thermal comfort pattern, although their sensitivities might differ slightly. The results showed that these cities covered, respectively, 4-8 and 6-8 thermal comfort classes of the PET and UTCI scale. On the whole, the annual cumulative number of pleasant days was more than 160 days/year. In terms of seasonal variations in thermal comfort conditions, the 31 provincial capital cities in mainland China can be classified into 5 types, which are, respectively, characterized by pleasant summer and severe cold winter (type-I); pleasant spring, autumn, winter, and severe hot summer (type-II); pleasant spring and autumn, slightly pleasant summer, and cold winter (type-III); pleasant spring and autumn, hot stress summer, and slightly cold winter (type-IV); and pleasant spring, summer, autumn, and cool winter (type-V). Type-II cities are rare winter resorts, while type-I cities are natural summer resorts. Type-V cities are the year round pleasant resorts. In the past three decades, the cities in mainland China had experienced increasing pleasant duration in late winter and early spring and intensifying heat stress in summer. The reduction in annual cumulative number of cold stress days in higher latitude/altitude cities outweighed the increase in duration of heat stress in subtropical cities. These may provide some references for urban planning and administration in mainland China.

  1. Health-related quality of life and mental health in the medium-term aftermath of the Prestige oil spill in Galiza (Spain): a cross-sectional study

    PubMed Central

    Carrasco, José Miguel; Pérez-Gómez, Beatriz; García-Mendizábal, Maria José; Lope, Virginia; Aragonés, Nuria; Forjaz, Maria João; Guallar-Castillón, Pilar; López-Abente, Gonzalo; Rodríguez-Artalejo, Fernando; Pollán, Marina

    2007-01-01

    Background In 2002 the oil-tanker Prestige sank off the Galician coast. This study analyzes the effect of this accident on health-related quality of life (HRQoL) and mental health in the affected population. Methods Using random sampling stratified by age and sex, 2700 residents were selected from 7 coastal and 7 inland Galician towns. Two exposure criteria were considered: a) residential exposure, i.e., coast versus interior; and b) individual exposure-unaffected, slightly affected, or seriously affected-according to degree of personal affectation. SF-36, GHQ-28, HADS and GADS questionnaires were used to assess HRQoL and mental health. Association of exposure with suboptimal scores was summarized using adjusted odds ratios (OR) obtained from logistic regression. Results For residential exposure, the SF-36 showed coastal residents as having a lower likelihood of registering suboptimal HRQoL values in physical functioning (OR:0.69; 95%CI:0.54–0.89) and bodily pain (OR:0.74; 95%CI:0.62–0.91), and a higher frequency of suboptimal scores in mental health (OR:1.28; 95%CI:1.02–1.58). None of the dimensions of the other questionnaires displayed statistically significant differences. For individual exposure, no substantial differences were observed, though the SF-36 physical functioning dimension rose (showed better scores) with level of exposure (91.51 unaffected, 93.86 slightly affected, 95.28 seriously affected, p < 0.001). Conclusion Almost one and a half years after the accident, worse HRQoL and mental health levels were not in evidence among subjects exposed to the oil-spill. Nevertheless, some of the scales suggest the possibility of slight impact on the mental health of residents in the affected areas. PMID:17875207

  2. A thermal model for evaluation of the Malay Basin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Waples, D.W.; Warren, L.; Mahadir, R.

    1994-07-01

    Detailed reconstruction of the present-day thermal structure of Malay Basin using downhole temperature, and paleoheat flow using an R[sub 0] database, leads to important conclusions and observations about the thermal history of the basin: (1) a major heating event occurred within the last 100,000 yr; (2) low R[sub 0] value throughout the basin indicates heat flow prior to the heating event only slightly higher than that of stable cratons, (3) present-day heat flow is lowest in the eastern Malay Basin, where most of the erosion due to the late Miocene regional unconformity, and highest in the northwestern, where Pliocene-Pleistocene subsidencemore » have been greatest. The data are consistent with the following general models for the basin evolution: (1) slight extension of the stable craton during late Eocene resulting from the collision of India with Asia, without the high heat flow, thermal doming, or rift development; (2) maintenance of slight extension and continued downwarping until the end of the middle Miocene, when local compression uplifted the basement in the eastern portion of the basin, leading to 15 km of erosion in some areas; and (3) establishment of a much stronger extensional regime throughout the basin during the Pliocene, causing submergence and greatest subsidence in the west, accompanied by an increase in heat flow to levels never seen before in the basin. Although strong subsidence (and presumably the increase in basal heat flow) began about 5.5 Ma, the thermal effects were not noted in the upper sedimentary section until recently because of the time required for the increased basal heat flow to reach the surface.« less

  3. Cost-effectiveness analysis of oxycodone with naloxone versus oxycodone alone for the management of moderate-to-severe pain in patients with opioid-induced constipation in Canada.

    PubMed

    Goeree, Ron; Goeree, Jeff

    2016-01-01

    Approximately 20-30% of Canadians suffer from chronic pain. Guidelines for the management of chronic pain support the use of controlled-release (CR) opioids to treat chronic pain. Although effective in managing chronic pain, oxycodone is associated with high rates of opioid-induced constipation (OIC). The cost-effectiveness of a combination of oxycodone for the management of pain and naloxone for the relief of OIC has not previously been evaluated for Canada. A decision analytic model was developed to estimate the cost-utility of combination oxycodone/naloxone compared to oxycodone alone in four populations. Drug costs for managing pain and healthcare costs related to managing OIC were included in the analysis and the primary measure of effectiveness was quality adjusted life years (QALYs) derived from OIC rates observed in clinical trials. The analysis was conducted from a healthcare system perspective, used a 1-year time horizon, and results were expressed in 2015 Canadian dollars. In all four patient populations, there was a trade-off between slightly higher total expected costs for Targin treated patients compared to oxycodone treated patients, but also improved clinical benefits in terms of reduced OIC, which resulted in higher QALYs for patients. Although analgesic costs were found to be slightly higher for Targin treated patients, Targin also resulted in cost offsets to the healthcare system in terms of less rescue laxative drug use and other resources required for the management of OIC. The resulting 1-year cost-utility of Targin compared to oxycodone ranged from $2178-$7732 per QALY gained in the base case analysis, and it was found that these cost-utility results remained robust and at low values throughout a series of one-way deterministic analyses of uncertainty. The clinical effectiveness of oxycodone/naloxone in managing pain and OIC compared to CR oxycodone alone resulted in low cost-utility estimates.

  4. A new automatic blood pressure kit auscultates for accurate reading with a smartphone: A diagnostic accuracy study.

    PubMed

    Wu, Hongjun; Wang, Bingjian; Zhu, Xinpu; Chu, Guang; Zhang, Zhi

    2016-08-01

    The widely used oscillometric automated blood pressure (BP) monitor was continuously questioned on its accuracy. A novel BP kit named Accutension which adopted Korotkoff auscultation method was then devised. Accutension worked with a miniature microphone, a pressure sensor, and a smartphone. The BP values were automatically displayed on the smartphone screen through the installed App. Data recorded in the phone could be played back and reconfirmed after measurement. They could also be uploaded and saved to the iCloud. The accuracy and consistency of this novel electronic auscultatory sphygmomanometer was preliminarily verified here. Thirty-two subjects were included and 82 qualified readings were obtained. The mean differences ± SD for systolic and diastolic BP readings between Accutension and mercury sphygmomanometer were 0.87 ± 2.86 and -0.94 ± 2.93 mm Hg. Agreements between Accutension and mercury sphygmomanometer were highly significant for systolic (ICC = 0.993, 95% confidence interval (CI): 0.989-0.995) and diastolic (ICC = 0.987, 95% CI: 0.979-0.991). In conclusion, Accutension worked accurately based on our pilot study data. The difference was acceptable. ICC and Bland-Altman plot charts showed good agreements with manual measurements. Systolic readings of Accutension were slightly higher than those of manual measurement, while diastolic readings were slightly lower. One possible reason was that Accutension captured the first and the last korotkoff sound more sensitively than human ear during manual measurement and avoided sound missing, so that it might be more accurate than traditional mercury sphygmomanometer. By documenting and analyzing of variant tendency of BP values, Accutension helps management of hypertension and therefore contributes to the mobile heath service.

  5. Spinal posture and pelvic position in three hundred forty-five elementary school children: a rasterstereographic pilot study.

    PubMed

    Furian, Thimm Christoph; Rapp, Walter; Eckert, Stefanie; Wild, Michael; Betsch, Marcel

    2013-02-22

    Children's posture has been of growing concern due to observations that it seems to be impaired compared to previous generations. So far there is no reference data for spinal posture and pelvic position in healthy children available. Purpose of this pilot study was to determine rasterstereographic posture values in children during their second growth phase. Three hundred and forty-five pupils were measured with a rasterstereographic device in a neutral standing position with hanging arms. To further analyse for changes in spinal posture during growth, the children were divided into 12-month age clusters. A mean kyphotic angle of 47.1°±7.5 and a mean lordotic angle of 42.1°±9.9 were measured. Trunk imbalance in girls (5.85 mm±0.74) and boys (7.48 mm± 0.83) varied only little between the age groups, with boys showing slightly higher values than girls. The trunk inclination did not show any significant differences between the age groups in boys or girls. Girls' inclination was 2.53°±1.96 with a tendency to decreasing angles by age, therefore slightly smaller compared to boys (2.98°±2.18). Lateral deviation (4.8 mm) and pelvic position (tilt: 2.75 mm; torsion: 1.53°; inclination: 19.8°±19.8) were comparable for all age groups and genders. This study provides the first systematic rasterstereographic analysis of spinal posture in children between 6 and 11 years. With the method of rasterstereography a reliable three-dimensional analysis of spinal posture and pelvic position is possible. Spinal posture and pelvic position does not change significantly with increasing age in this collective of children during the second growth phase.

  6. Endocrine effects of adjuvant letrozole compared with tamoxifen in hormone-responsive postmenopausal patients with early breast cancer: the HOBOE trial.

    PubMed

    Rossi, Emanuela; Morabito, Alessandro; Di Rella, Francesca; Esposito, Giuseppe; Gravina, Adriano; Labonia, Vincenzo; Landi, Gabriella; Nuzzo, Francesco; Pacilio, Carmen; De Maio, Ermelinda; Di Maio, Massimo; Piccirillo, Maria Carmela; De Feo, Gianfranco; D'Aiuto, Giuseppe; Botti, Gerardo; Chiodini, Paolo; Gallo, Ciro; Perrone, Francesco; de Matteis, Andrea

    2009-07-01

    PURPOSE We compared the endocrine effects of 6 and 12 months of adjuvant letrozole versus tamoxifen in postmenopausal patients with hormone-responsive early breast cancer within an ongoing phase III trial. PATIENTS AND METHODS Patients were randomly assigned to receive tamoxifen, letrozole, or letrozole plus zoledronic acid. Serum values of estradiol, follicle-stimulating hormone (FSH), luteinizing hormone (LH), testosterone, dehydroepiandrosterone-sulphate (DHEA-S), progesterone, and cortisol were measured at baseline and after 6 and 12 months of treatment. For each hormone, changes from baseline at 6 and 12 months were compared between treatment groups, and differences over time for each group were analyzed. Results Hormonal data were available for 139 postmenopausal patients with a median age of 62 years, with 43 patients assigned to tamoxifen and 96 patients assigned to letrozole alone or combined with zoledronic acid. Baseline values were similar between the two groups for all hormones. Many significant changes were observed between drugs and for each drug over time. Namely, three hormones seemed significantly affected by one drug only: estradiol that decreased and progesterone that increased with letrozole and cortisol that increased with tamoxifen. Both drugs affected FSH (decreasing with tamoxifen and slightly increasing with letrozole), LH (decreasing more with tamoxifen than with letrozole), testosterone (slightly increasing with letrozole but not enough to differ from tamoxifen), and DHEA-S (increasing with both drugs but not differently between them). Zoledronic acid did not have significant impact on hormonal levels. CONCLUSION Adjuvant letrozole and tamoxifen result in significantly distinct endocrine effects. Such differences can explain the higher efficacy of letrozole as compared with tamoxifen.

  7. SAGE III solar ozone measurements: Initial results

    NASA Technical Reports Server (NTRS)

    Wang, Hsiang-Jui; Cunnold, Derek M.; Trepte, Chip; Thomason, Larry W.; Zawodny, Joseph M.

    2006-01-01

    Results from two retrieval algorithms, o3-aer and o3-mlr , used for SAGE III solar occultation ozone measurements in the stratosphere and upper troposphere are compared. The main differences between these two retrieved (version 3.0) ozone are found at altitudes above 40 km and below 15 km. Compared to correlative measurements, the SAGE II type ozone retrievals (o3-aer) provide better precisions above 40 km and do not induce artificial hemispheric differences in upper stratospheric ozone. The multiple linear regression technique (o3_mlr), however, can yield slightly more accurate ozone (by a few percent) in the lower stratosphere and upper troposphere. By using SAGE III (version 3.0) ozone from both algorithms and in their preferred regions, the agreement between SAGE III and correlative measurements is shown to be approx.5% down to 17 km. Below 17 km SAGE III ozone values are systematically higher, by 10% at 13 km, and a small hemispheric difference (a few percent) appears. Compared to SAGE III and HALOE, SAGE II ozone has the best accuracy in the lowest few kilometers of the stratosphere. Estimated precision in SAGE III ozone is about 5% or better between 20 and 40 km and approx.10% at 50 km. The precision below 20 km is difficult to evaluate because of limited coincidences between SAGE III and sondes. SAGE III ozone values are systematically slightly larger (2-3%) than those from SAGE II but the profile shapes are remarkably similar for altitudes above 15 km. There is no evidence of any relative drift or time dependent differences between these two instruments for altitudes above 15-20 km.

  8. Performance of dense digital surface models based on image matching in the estimation of plot-level forest variables

    NASA Astrophysics Data System (ADS)

    Nurminen, Kimmo; Karjalainen, Mika; Yu, Xiaowei; Hyyppä, Juha; Honkavaara, Eija

    2013-09-01

    Recent research results have shown that the performance of digital surface model extraction using novel high-quality photogrammetric images and image matching is a highly competitive alternative to laser scanning. In this article, we proceed to compare the performance of these two methods in the estimation of plot-level forest variables. Dense point clouds extracted from aerial frame images were used to estimate the plot-level forest variables needed in a forest inventory covering 89 plots. We analyzed images with 60% and 80% forward overlaps and used test plots with off-nadir angles of between 0° and 20°. When compared to reference ground measurements, the airborne laser scanning (ALS) data proved to be the most accurate: it yielded root mean square error (RMSE) values of 6.55% for mean height, 11.42% for mean diameter, and 20.72% for volume. When we applied a forward overlap of 80%, the corresponding results from aerial images were 6.77% for mean height, 12.00% for mean diameter, and 22.62% for volume. A forward overlap of 60% resulted in slightly deteriorated RMSE values of 7.55% for mean height, 12.20% for mean diameter, and 22.77% for volume. According to our results, the use of higher forward overlap produced only slightly better results in the estimation of these forest variables. Additionally, we found that the estimation accuracy was not significantly impacted by the increase in the off-nadir angle. Our results confirmed that digital aerial photographs were about as accurate as ALS in forest resources estimation as long as a terrain model was available.

  9. Contamination levels of mercury in the muscle of female and male spiny dogfishes (Squalus acanthias) caught off the coast of Japan.

    PubMed

    Endo, Tetsuya; Hisamichi, Yohsuke; Kimura, Osamu; Kotaki, Yuichi; Kato, Yoshihisa; Ohta, Chiho; Koga, Nobuyuki; Haraguchi, Koichi

    2009-11-01

    We analyzed the total mercury (T-Hg) and stable isotopes of (13)C and (15)N in the muscle of spiny dogfish (Squalus acanthias) caught off the coast of Japan. The average body length of the female spiny dogfish sampled (94.9+/-20.2 cm, 50.5-131.0 cm, n=40) was significantly larger than that of the males sampled (77.8+/-10.8 cm, 55.5-94.0 cm, n=35), although the ages of the samples were unknown. The T-Hg concentration in the muscle samples rapidly increased after maturity in the females (larger than about 120 cm) and males (larger than about 90 cm), followed by a continued gradual increase. Contamination level of T-Hg in female muscle samples (0.387+/-0.378 microg(wet g)(-1), n=40) was slightly higher than that in male muscle samples (0.316+/-0.202 microg(wet g)(-1), n=35), probably due to the greater longevity of females. In contrast, the contamination level of T-Hg in females smaller than 94.0 cm in length (0.204+/-0.098 microg(wet g)(-1), n=20) was slightly lower than that in the males, probably due to the faster growth rate of females. Although the partial differential(13)C and partial differential(15)N values in the muscle samples increased with an increase in body length, there were no significant differences between the females (-17.2+/-0.4 per thousand and 12.4+/-0.9 per thousand, respectively) and males (-17.3+/-0.4 per thousand and 12.4+/-0.8 per thousand, respectively). A positive correlation was found between partial differential(13)C and partial differential(15)N values, suggesting trophic enrichment due to the growth.

  10. A new automatic blood pressure kit auscultates for accurate reading with a smartphone

    PubMed Central

    Wu, Hongjun; Wang, Bingjian; Zhu, Xinpu; Chu, Guang; Zhang, Zhi

    2016-01-01

    Abstract The widely used oscillometric automated blood pressure (BP) monitor was continuously questioned on its accuracy. A novel BP kit named Accutension which adopted Korotkoff auscultation method was then devised. Accutension worked with a miniature microphone, a pressure sensor, and a smartphone. The BP values were automatically displayed on the smartphone screen through the installed App. Data recorded in the phone could be played back and reconfirmed after measurement. They could also be uploaded and saved to the iCloud. The accuracy and consistency of this novel electronic auscultatory sphygmomanometer was preliminarily verified here. Thirty-two subjects were included and 82 qualified readings were obtained. The mean differences ± SD for systolic and diastolic BP readings between Accutension and mercury sphygmomanometer were 0.87 ± 2.86 and −0.94 ± 2.93 mm Hg. Agreements between Accutension and mercury sphygmomanometer were highly significant for systolic (ICC = 0.993, 95% confidence interval (CI): 0.989–0.995) and diastolic (ICC = 0.987, 95% CI: 0.979–0.991). In conclusion, Accutension worked accurately based on our pilot study data. The difference was acceptable. ICC and Bland–Altman plot charts showed good agreements with manual measurements. Systolic readings of Accutension were slightly higher than those of manual measurement, while diastolic readings were slightly lower. One possible reason was that Accutension captured the first and the last korotkoff sound more sensitively than human ear during manual measurement and avoided sound missing, so that it might be more accurate than traditional mercury sphygmomanometer. By documenting and analyzing of variant tendency of BP values, Accutension helps management of hypertension and therefore contributes to the mobile heath service. PMID:27512876

  11. Internal Kinematics of Groups of Galaxies in the Sloan Digital Sky Survey Data Release 7

    NASA Astrophysics Data System (ADS)

    Li, Cheng; Jing, Y. P.; Mao, Shude; Han, Jiaxin; Peng, Qiuying; Yang, Xiaohu; Mo, H. J.; van den Bosch, Frank

    2012-10-01

    We present measurements of the velocity dispersion profile (VDP) for galaxy groups in the final data release of the Sloan Digital Sky Survey (SDSS). For groups of given mass, we estimate the redshift-space cross-correlation function (CCF) with respect to a reference galaxy sample, ξ(s)(rp , π), the projected CCF, wp (rp ), and the real-space CCF, ξcg(r). The VDP is then extracted from the redshift distortion in ξ(s)(rp , π), by comparing ξ(s)(rp , π) with ξcg(r). We find that the velocity dispersion (VD) within virial radius (R 200) shows a roughly flat profile, with a slight increase at radii below ~0.3R 200 for high-mass systems. The average VD within the virial radius, σ v , is a strongly increasing function of central galaxy mass. We apply the same methodology to N-body simulations with the concordance Λ cold dark matter cosmology but different values of the density fluctuation parameter σ8, and we compare the results to the SDSS results. We show that the σ v - M * relation from the data provides stringent constraints on both σ8 and σ ms , the dispersion in log M * of central galaxies at fixed halo mass. Our best-fitting model suggests σ8 = 0.86 ± 0.03 and σ ms = 0.16 ± 0.03. The slightly higher value of σ8 compared to the WMAP7 result might be due to a smaller matter density parameter assumed in our simulations. Our VD measurements also provide a direct measure of the dark matter halo mass for central galaxies of different luminosities and masses, in good agreement with the results obtained by Mandelbaum et al. from stacking the gravitational lensing signals of the SDSS galaxies.

  12. Studies on the energy content of pigeon feeds I. Determination of digestibility and metabolizable energy content.

    PubMed

    Hullar, I; Meleg, I; Fekete, S; Romvari, R

    1999-12-01

    The digestibility coefficient and metabolizable energy (ME) content of the most important pigeon feeds (corn, wheat, barley, red and white millet, sorghum, canary seed, peas, lentils, sunflower, and hemp) were determined. The experiment was carried out using 10 adult male homing pigeons. All feeds were fed alone, in a whole-grain form, ad libitum. Drinking water and grit were offered to the birds on a continuous basis. Each feedstuff was fed to five pigeons in 1-wk cycles. There was no significant difference between the values determined in pigeons and those reported in the literature for chickens among the digestibilities of the CP of the various feeds. For pigeons, the digestibility of carbohydrates (N-free extracts, NFE) was lower (e.g., 62.37 vs 83.00% for barley and 63.45 vs 77.00% for peas), whereas the ether extract (EE) was higher (e.g., 75.58 vs 61.00% for barley and 82.59 vs 80.00% for peas) in pigeons compared with chickens. As a result, the AMEn values determined in pigeons did not differ significantly from those reported for chickens but tended to be slightly higher. For feeds of high-oil content, that difference may be somewhat larger. The correlation between the CP, EE, crude fiber (CF), and NFE contents of the feeds and the ME values determined in this experiment were calculated by multivariate linear regression. It was concluded that it was more accurate to determine and tabulate the ME contents of other potential pigeon feeds directly by experimental methods rather than using an equation.

  13. Intercomparison of field measurements of nitrous acid (HONO) during the SHARP campaign

    NASA Astrophysics Data System (ADS)

    Pinto, J. P.; Dibb, J.; Lee, B. H.; Rappenglück, B.; Wood, E. C.; Levy, M.; Zhang, R.-Y.; Lefer, B.; Ren, X.-R.; Stutz, J.; Tsai, C.; Ackermann, L.; Golovko, J.; Herndon, S. C.; Oakes, M.; Meng, Q.-Y.; Munger, J. W.; Zahniser, M.; Zheng, J.

    2014-05-01

    Because of the importance of HONO as a radical reservoir, consistent and accurate measurements of its concentration are needed. As part of SHARP (Study of Houston Atmospheric Radical Precursors), time series of HONO were obtained by six different measurement techniques on the roof of the Moody Tower at the University of Houston. Techniques used were long path differential optical absorption spectroscopy (DOAS), stripping coil-visible absorption photometry (SC-AP), long path absorption photometry (LOPAP®), mist chamber/ion chromatography (MC-IC), quantum cascade-tunable infrared laser differential absorption spectroscopy (QC-TILDAS), and ion drift-chemical ionization mass spectrometry (ID-CIMS). Various combinations of techniques were in operation from 15 April through 31 May 2009. All instruments recorded a similar diurnal pattern of HONO concentrations with higher median and mean values during the night than during the day. Highest values were observed in the final 2 weeks of the campaign. Inlets for the MC-IC, SC-AP, and QC-TILDAS were collocated and agreed most closely with each other based on several measures. Largest differences between pairs of measurements were evident during the day for concentrations < 100 parts per trillion (ppt). Above 200 ppt, concentrations from the SC-AP, MC-IC, and QC-TILDAS converged to within about 20%, with slightly larger discrepancies when DOAS was considered. During the first 2 weeks, HONO measured by ID-CIMS agreed with these techniques, but ID-CIMS reported higher values during the afternoon and evening of the final 4 weeks, possibly from interference from unknown sources. A number of factors, including building related sources, likely affected measured concentrations.

  14. Tensile properties of V-Cr-Ti alloys after exposure in oxygen-containing environments

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Natesan, K.; Soppet, W.K.

    A systematic study was conducted to evaluate the oxidation kinetics of V-4Cr-4Ti (44 alloy) and V-5Cr-5Ti alloys (55 alloy) and to establish the role of oxygen ingress on the tensile behavior of the alloys at room temperature and at 500 C. The oxidation rate of the 44 alloy is slightly higher than that of the 55 alloy. The oxidation process followed parabolic kinetics. Maximum engineering stress for 55 alloy increased with an increase in oxidation time at 500 C. The maximum stress values for 55 alloy were higher at room temperature than ta 500 C for the same oxidation treatment.more » Maximum engineering stresses for 44 alloy were substantially lower than those for 55 alloy in the same oxidation {approx}500 h exposure in air at 500 C; the same values were 4.8 and 6.1%, respectively, at 500 C after {approx}2060 h oxidation in air at 500 C. Maximum engineering stress for 44 alloy at room temperature was 421.6--440.6 MPa after {approx}250 h exposure at 500 C in environments with a pO{sub 2} range of 1 {times} 10{sup {minus}6} to 760 torr. The corresponding uniform and total elongation values were 11--14.4% and 14.5--21.7%, respectively. Measurements of crack depths in various specimens showed that depth is independent of pO{sub 2} in the preexposure environment and was of 70--95 {micro}m after 250--275 h exposure at 500 C.« less

  15. Plasma osmolality reference values in African grey parrots (Psittacus erithacus erithacus), Hispaniolan Amazon parrots (Amazona ventralis), and red-fronted macaws (Ara rubrogenys).

    PubMed

    Beaufrère, Hugues; Acierno, Mark; Mitchell, Mark; Guzman, David Sanchez-Migallon; Bryant, Heather; Tully, Thomas N

    2011-06-01

    Birds are routinely presented to veterinarians for dehydration. Success with these cases ultimately depends on providing replacement fluids and re-establishing fluid homeostasis. Few studies have been done to determine reference ranges for plasma osmolality in birds. The goals of this study were to determine reference values for plasma osmolality in 3 species of parrots and to provide recommendations on fluid selection for replacement therapy in these species. Blood samples were collected from 21 adult Hispaniolan Amazon parrots (Amazona ventralis), 21 Congo African grey parrots (Psittacus erithacus erithacus), and 9 red-fronted macaws (Ara rubrogenys), and were placed into lithium heparin containers. Plasma osmolality was measured in duplicate with a freezing point depression osmometer. Summary statistics were computed from the average values. Reference ranges, calculated by using the robust method, were 288-324, 308-345, and 223-369 mOsm/kg in African grey parrots, Hispaniolan Amazon parrots, and red-fronted macaws, respectively. The mean +/- SD values were 306 +/- 7, 327 +/- 7, and 304 +/- 18 mOsm/kg in African grey parrots, Hispaniolan Amazon parrots, and red-fronted macaws, respectively. Comparisons with osmolality values in mammals and values previously reported for psittacine bird species suggest that plasma osmolality is slightly higher in parrots than in mammals, species-specific differences exist, and differences between reported values occur. Overall, fluids with an osmolarity close to 300-320 mOsm/L, such as Normosol-R, Plasmalyte-R, Plasmalyte-A, and NaCl 0.9%, can be recommended in parrots for fluid replacement therapy when isotonic fluids are required.

  16. Crack-tip-opening angle measurements and crack tunneling under stable tearing in thin sheet 2024-T3 aluminum alloy

    NASA Technical Reports Server (NTRS)

    Dawicke, D. S.; Sutton, M. A.

    1993-01-01

    The stable tearing behavior of thin sheets 2024-T3 aluminum alloy was studied for middle crack tension specimens having initial cracks that were: flat cracks (low fatigue stress) and 45 degrees through-thickness slant cracks (high fatigue stress). The critical crack-tip-opening angle (CTOA) values during stable tearing were measured by two independent methods, optical microscopy and digital image correlation. Results from the two methods agreed well. The CTOA measurements and observations of the fracture surfaces showed that the initial stable tearing behavior of low and high fatigue stress tests is significantly different. The cracks in the low fatigue stress tests underwent a transition from flat-to-slant crack growth, during which the CTOA values were high and significant crack tunneling occurred. After crack growth equal to about the thickness, CTOA reached a constant value of 6 deg and after crack growth equal to about twice the thickness, crack tunneling stabilized. The initial high CTOA values, in the low fatigue crack tests, coincided with large three-dimensional crack front shape changes due to a variation in the through-thickness crack tip constraint. The cracks in the high fatigue stress tests reach the same constant CTOA value after crack growth equal to about the thickness, but produced only a slightly higher CTOA value during initial crack growth. For crack growth on the 45 degree slant, the crack front and local field variables are still highly three-dimensional. However, the constant CTOA values and stable crack front shape may allow the process to be approximated with two-dimensional models.

  17. Reference values for airway resistance in newborns, infants and preschoolers from a Latin American population.

    PubMed

    Gochicoa, Laura G; Thomé-Ortiz, Laura P; Furuya, María E Y; Canto, Raquel; Ruiz-García, Martha E; Zúñiga-Vázquez, Guillermo; Martínez-Ramírez, Filiberto; Vargas, Mario H

    2012-05-01

    Several studies have determined reference values for airway resistance measured by the interrupter technique (Rint) in paediatric populations, but only one has been done on Latin American children, and no studies have been performed on Mexican children. Moreover, these previous studies mostly included children aged 3 years and older; therefore, information regarding Rint reference values for newborns and infants is scarce. Rint measurements were performed on preschool children attending eight kindergartens (Group 1) and also on sedated newborns, infants and preschool children admitted to a tertiary-level paediatric hospital due to non-cardiopulmonary disorders (Group 2). In both groups, Rint values were inversely associated with age, weight and height, but the strongest association was with height. The linear regression equation for Group 1 (n = 209, height 86-129 cm) was Rint = 2.153 - 0.012 × height (cm) (standard deviation of residuals 0.181 kPa/L/s). The linear regression equation for Group 2 (n = 55, height 52-113 cm) was Rint = 4.575 - 0.035 × height (cm) (standard deviation of residuals 0.567 kPa/L/s). Girls tended to have slightly higher Rint values than boys, a difference that diminished with increasing height. In this study, Rint reference values applicable to Mexican children were determined, and these values are probably also applicable to other paediatric populations with similar Spanish-Amerindian ancestries. There was an inverse relationship between Rint and height, with relatively large between-subject variability. © 2012 The Authors. Respirology © 2012 Asian Pacific Society of Respirology.

  18. Hematology of healthy Florida manatees (Trichechus manatus)

    USGS Publications Warehouse

    Harvey, J.W.; Harr, K.E.; Murphy, D.; Walsh, M.T.; Nolan, E.C.; Bonde, R.K.; Pate, M.G.; Deutsch, C.J.; Edwards, H.H.; Clapp, W.L.

    2009-01-01

    Background: Hematologic analysis is an important tool in evaluating the general health status of free-ranging manatees and in the diagnosis and monitoring of rehabilitating animals. Objectives: The purpose of this study was to evaluate diagnostically important hematologic analytes in healthy manatees (Trichechus manatus) and to assess variations with respect to location (free ranging vs captive), age class (small calves, large calves, subadults, and adults), and gender. Methods: Blood was collected from 55 free-ranging and 63 captive healthy manatees. Most analytes were measured using a CELL-DYN 3500R; automated reticulocytes were measured with an ADVIA 120. Standard manual methods were used for differential leukocyte counts, reticulocyte and Heinz body counts, and plasma protein and fibrinogen concentrations. Results: Rouleaux, slight polychromasia, stomatocytosis, and low numbers of schistocytes and nucleated RBCs (NRBCs) were seen often in stained blood films. Manual reticulocyte counts were higher than automated reticulocyte counts. Heinz bodies were present in erythrocytes of most manatees. Compared with free-ranging manatees, captive animals had slightly lower MCV, MCH, and eosinophil counts and slightly higher heterophil and NRBC counts, and fibrinogen concentration. Total leukocyte, heterophil, and monocyte counts tended to be lower in adults than in younger animals. Small calves tended to have higher reticulocyte counts and NRBC counts than older animals. Conclusions: Hematologic findings were generally similar between captive and free-ranging manatees. Higher manual reticulocyte counts suggest the ADVIA detects only reticulocytes containing large amounts of RNA. Higher reticulocyte and NRBC counts in young calves probably reflect an increased rate of erythropoiesis compared with older animals. ?? 2009 American Society for Veterinary Clinical Pathology.

  19. Statistically generated weighted curve fit of residual functions for modal analysis of structures

    NASA Technical Reports Server (NTRS)

    Bookout, P. S.

    1995-01-01

    A statistically generated weighting function for a second-order polynomial curve fit of residual functions has been developed. The residual flexibility test method, from which a residual function is generated, is a procedure for modal testing large structures in an external constraint-free environment to measure the effects of higher order modes and interface stiffness. This test method is applicable to structures with distinct degree-of-freedom interfaces to other system components. A theoretical residual function in the displacement/force domain has the characteristics of a relatively flat line in the lower frequencies and a slight upward curvature in the higher frequency range. In the test residual function, the above-mentioned characteristics can be seen in the data, but due to the present limitations in the modal parameter evaluation (natural frequencies and mode shapes) of test data, the residual function has regions of ragged data. A second order polynomial curve fit is required to obtain the residual flexibility term. A weighting function of the data is generated by examining the variances between neighboring data points. From a weighted second-order polynomial curve fit, an accurate residual flexibility value can be obtained. The residual flexibility value and free-free modes from testing are used to improve a mathematical model of the structure. The residual flexibility modal test method is applied to a straight beam with a trunnion appendage and a space shuttle payload pallet simulator.

  20. Reliability of mandibular canines as indicators for sexual dichotomy.

    PubMed

    Hosmani, Jagadish V; Nayak, Ramakant S; Kotrashetti, Vijayalakshmi S; S, Pradeep; Babji, Deepa

    2013-02-01

    Amongst the various calcified structures in the human body, teeth have gained lot of popularity in estimating the sex of an individual as they are highly resistant to destruction and decomposition. Using permanent mandibular canines many researchers have predicted a high level of accuracy in identifying the sex correctly. The purpose of our study was to gauge the effectiveness of mandibular canines in discerning sex. Fifty dental casts each of males and females were utilized for the study. Mesio-distal dimension and inter-canine distance of mandibular right and left canine was recorded using digital vernier caliper and mandibular canine index was calculated. The mean value of mesio-distal dimensions of right and left mandibular canine was slightly greater in males compared to females. The mandibular canine index was equal in both sexes. Inter-canine distance was marginally higher in males compared to females. Despite of higher values in males none of the parameters were statistically significant. The results herein bolster contemporary studies that mesio-distal dimensions of mandibular canines and mandibular canine index do not reflect sexual dimorphism and that its application should be discontinued in sex prediction among Indian populations. How to cite this article: Hosmani J V, Nayak R S, Kotrashetti V S, Pradeep S, Babji D. Reliability of Mandibular Canines as Indicators for Sexual Dichotomy. J Int Oral Health 2013; 5(1):1-7.

  1. [Nutrient contents and microbial populations of aeolian sandy soil in Sanjiangyuan region of Qinghai Province].

    PubMed

    Lin, Chao-feng; Chen, Zhan-quan; Xue, Quan-hong; Lai, Hang-xian; Chen, Lai-sheng; Zhang, Deng-shan

    2007-01-01

    Sanjiangyuan region (the headstream of three rivers) in Qinghai Province of China is the highest and largest inland alpine wetland in the world. The study on the nutrient contents and microbial populations of aeolian sandy soils in this region showed that soil organic matter content increased with the evolution of aeolian sand dunes from un-stabilized to stabilized state, being 5.9 and 3.8 times higher in stabilized sand dune than in mobile and semi-stabilized sand dunes, respectively. Soil nitrogen and phosphorus contents increased in line with the amount of organic matter, while potassium content and pH value varied slightly. The microbial populations changed markedly with the development of vegetation, fixing of mobile sand, and increase of soil nutrients. The quantities of soil bacteria, fungi and actinomycetes were 4.0 and 2.8 times, 19.6 and 6.3 times, and 12.4 and 2.6 times higher in stabilized and semi-stabilized sand dunes than in mobile sand dune, respectively, indicating that soil microbial bio-diversity was increased with the evolution of aeolian sand dunes from mobile to stabilized state. In addition, the quantities of soil microbes were closely correlated with the contents of soil organic matter, total nitrogen, and available nitrogen and phosphorus, but not correlated with soil total phosphorus, total and available potassium, or pH value.

  2. Catalytic oxidation of o-aminophenols and aromatic amines by mushroom tyrosinase.

    PubMed

    Muñoz-Muñoz, Jose Luis; Garcia-Molina, Francisco; Garcia-Ruiz, Pedro Antonio; Varon, Ramon; Tudela, Jose; Rodriguez-Lopez, Jose N; Garcia-Canovas, Francisco

    2011-12-01

    The kinetics of tyrosinase acting on o-aminophenols and aromatic amines as substrates was studied. The catalytic constants of aromatic monoamines and o-diamines were both low, these results are consistent with our previous mechanism in which the slow step is the transfer of a proton by a hydroxyl to the peroxide in oxy-tyrosinase (Fenoll et al., Biochem. J. 380 (2004) 643-650). In the case of o-aminophenols, the hydroxyl group indirectly cooperates in the transfer of the proton and consequently the catalytic constants in the action of tyrosinase on these compounds are higher. In the case of aromatic monoamines, the Michaelis constants are of the same order of magnitude than for monophenols, which suggests that the monophenols bind better (higher binding constant) to the enzyme to facilitate the π-π interactions between the aromatic ring and a possible histidine of the active site. In the case of aromatic o-diamines, both the catalytic and Michaelis constants are low, the values of the catalytic constants being lower than those of the corresponding o-diphenols. The values of the Michaelis constants of the aromatic o-diamines are slightly lower than those of their corresponding o-diphenols, confirming that the aromatic o-diamines bind less well (lower binding constant) to the enzyme. Copyright © 2011 Elsevier B.V. All rights reserved.

  3. Demonstrating ultrafast polarization dynamics in spin-VCSELs

    NASA Astrophysics Data System (ADS)

    Lindemann, Markus; Pusch, Tobias; Michalzik, Rainer; Gerhardt, Nils C.; Hofmann, Martin R.

    2018-02-01

    Vertical-cavity surface-emitting lasers (VCSELs) are used for short-haul optical data transmission with increasing bit rates. The optimization involves both enhanced device designs and the use of higher-order modulation formats. In order to improve the modulation bandwidth substantially, the presented work employs spin-pumped VCSELs (spin-VCSELs) and their polarization dynamics instead of relying on intensity-modulated devices. In spin-VCSELs, the polarization state of the emitted light is controllable via spin injection. By optical spin pumping a single-mode VCSEL is forced to emit light composed of both orthogonal linearly polarized fundamental modes. The frequencies of these two modes differ slightly by a value determined by the cavity birefringence. As a result, the circular polarization degree oscillates with their beat frequency, i.e., with the birefringence-induced mode splitting. We used this phenomenon to show so-called polarization oscillations, which are generated by pulsed spin injection. Their frequency represents the polarization dynamics resonance frequency and can be tuned over a wide range via the birefringence, nearly independent from any other laser parameter. In previous work we demonstrated a maximum birefringence-induced mode splitting of more than 250 GHz. In this work, compared to previous publications, we show an almost doubled polarization oscillation frequency of more than 80 GHz. Furthermore, we discuss concepts to achieve even higher values far above 100 GHz.

  4. Amino acid cycling in the Mississippi River Plume and effects from the passage of Hurricanes Isadore and Lili

    NASA Astrophysics Data System (ADS)

    Bianchi, Thomas S.; Grace, Bryan L.; Carman, Kevin R.; Maulana, Ivan

    2014-08-01

    We present data on the effects of Hurricanes Isadore and Lili on the spatial and temporal variations in concentrations of amino acids, and other bulk dissolved and particulate constituents in surface waters of the Mississippi River Plume (MRP) collected during 3 survey cruises (March 2002, October 2002, and April 2004). Abiotic factors (e.g., particle sorption and sediment resuspension) had the largest contribution in describing DAA and PAA dynamics in the MRP. The range of dissolved organic carbon (DOC) (88.61 to 699.90 μM) and particulate organic carbon (POC) (0.08 to 32.72 μM) values was slightly higher than the range observed for a broader region of the Louisiana shelf, but in general agreed with peak values at the mid-salinity range of the plume. The positive and negative correlations between acidic (e.g., aspartic acid and glutamic acid) and basic (e.g., histidine and arginine) DAA and salinity, respectively, in the MRP, were largely controlled by differential partitioning of amino acids with suspended sediments. Concentrations of β-alanine, γ-aminobutyric acid, and δ-aminovaleric acid were significantly higher during October 2002 compared to spring sampling events, due to resuspension of shelf sediments caused by the recent passage of Hurricane Isadore and the approach of Hurricane Lili, as it entered the Gulf of Mexico during our sampling.

  5. THE HIGH-RESOLUTION INFRARED SPECTRUM OF O$sup 18$-ENRICHED CO$sub 2$

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Berney, C.V.

    1962-01-01

    The infrared spectrum of a sample of CO/sub 2/ enriched to about 10 at.% with O/sup 18/ was examined in the region of 5400 to 1620 cm/sup -1/, using an Ebert grating spectrometer with spectral slit widths ranging from 0.4 to 0.2 cm/ sup -1/. Various bands of O/sup 18/-substituted species of CO/sub 2/ were observed, including several which were not previously reported under comparable resolution. These are given, together with the observed band centers in cm/sup - 1/. The data are compared with values calculated from vibrational constants given by Courtoy (Ann. Soc. Sci. Bruxelles 73: No. I, 1959).more » Band centers for the unsymmetrical species were found to be consistently higher than calculated, by 0.2 to 1.3 cm/sup -1/. The anomalously large Fermi resonance constant (52.5 cm/sup -1/) found by Courtoy for C/sup 12/O/sup 16/O/sup 18/ was confirmed, an d the C/sup 12/O/sup 18/ bands observed indicated that it is even higher (around 53.7 cm/sup -1/) for the doubly-substituted species. Rotational data for C/sup 12/O/sup 16/O/sup 18/ indicated that alpha /sup 3/ is abo ut 287 x 10/sup -5/ cm/ sup -1/, slightly smaller than the value suggested by Courtoy. (Dissertation Abstr.)« less

  6. Professional quality of life normative benchmarks.

    PubMed

    De La Rosa, Gabriel M; Webb-Murphy, Jennifer A; Fesperman, Susan F; Johnston, Scott L

    2018-03-01

    Those responsible for the care of trauma survivors can experience both beneficial and detrimental consequences resulting from their professional demands. Research has demonstrated that among professional caregivers, compassion satisfaction (CS), burnout (BO), and compassion fatigue (CF) are important factors contributing to professional quality of life. The current research aims to provide normative information regarding the factors contributing to professional quality of life among those who interact with survivors of trauma. The Professional Quality of Life (ProQOL) Scale is a widely used measure of CS, BO, and CF. The most recent iteration of the ProQOL manual provides normative data to assist in the interpretation of scores. However, a review of the literature reporting raw scores on the ProQOL suggests that mean scores and cutoff scores for the 25th and 75th percentiles may be misleading. A review of 30 studies (total sample size of 5,612) was conducted and normative values are presented. The mean (standard deviation) level of CS, CF, and BO were 37.7 (6.5), 16.7 (5.7), and 22.8 (5.4), respectively. Values gathered from the literature review tend to align well with one another and suggest that within a given sample, CS scores tend to be higher than BO scores, and BO scores tend to be slightly higher than CF scores. (PsycINFO Database Record (c) 2018 APA, all rights reserved).

  7. Positional-Species Composition of Diacylglycerol Acetates from Mature Euonymus Seeds.

    PubMed

    Sidorov, Roman A; Pchelkin, Vasily P; Zhukov, Anatoly V; Tsydendambaev, Vladimir D

    2016-06-01

    The positional-species composition (PSC) of 3-acetyl-1,2-diacyl-sn-glycerols (AcDAGs) from the seeds of mature fruits of 14 species of the genus Euonymus L. was established. The residues of six major fatty acids (FAs), palmitic (P), stearic (St), hexadecenoic (H), octadecenoic (O), linoleic (L), and linolenic (Ln), were present in the AcDAGs. Here, we demonstrated that the profile of PSC of AcDAGs could serve as chemotaxonomic factor to divide euonymus species studied here into groups which completely correlate with the present day systematic of the genus. In particular, the Euonymus section greatly exceeded other sections of the Euonymus subgenus as well as the Kalonymus one in the total levels of AcDAGs positional species having one and two O residues and was characterized by significantly lesser concentrations of species with one and two L residues. Moreover, in seed, AcDAGs of almost all Euonymus species EFL values were slightly higher than EFO ones, but all EFL and EFO values were higher than 1.0, and therefore, it can be concluded that both FAs mainly esterified sn-2-position of the glycerol moiety and saturated FAs residues were always virtually absent in the sn-2 position of Euonymus seed AcDAGs, as it is also the case in nearly all TAGs molecules of plant origin. © 2016 Verlag Helvetica Chimica Acta AG, Zürich.

  8. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Haryadi, E-mail: haryadi@polban.ac.id; Gunawan, Y. B.; Harjogi, D.

    The modification of Nafion 117 - TMSP (trimethoxysylilprophanthiol) composite membrane has been conducted by in-situ sol-gel method followed by characterization of structural and properties of material using spectroscopic techniques. The performance of composite membrane has then been examined in the single stack module of Fe-Cr Redox Flow Battery. It was found that the introduction of silica from TMSP through sol-gel process within the Nafion 117 membrane produced composite membrane that has slightly higher proton conductivity values as compared to the pristine of Nafion 117 membrane observed by electrochemical impedance spectroscopy. The degree of swelling of water in the composite membranemore » demonstrated greatly reduced than a pristine Nafion 117 signifying low water cross over. The SEM-EDX measurements indicated that there was no phase separation occurred suggesting that silica nanoparticles are distributed homogeneously within the composite membrane. The composite membrane used as separator in the system of Fe-Cr Redox Flow Battery revealed no cross mixing (crossover) occurred between anolyte and catholyte in the system as observed from the total voltage measurements that closed to the theoretical value. The battery efficiency generally increased as the volume of the electrolytes enlarged.« less

  9. Investigation of AWG demultiplexer based SOI for CWDM application

    NASA Astrophysics Data System (ADS)

    Juhari, Nurjuliana; Susthitha Menon, P.; Shaari, Sahbudin; Annuar Ehsan, Abang

    2017-11-01

    9-channel Arrayed Waveguide Grating (AWG) demultiplexer for conventional and tapered structure were simulated using beam propagation method (BPM) with channel spacing of 20 nm. The AWG demultiplexer was design using high refractive index (n 3.47) material namely silicon-on-insulator (SOI) with rib waveguide structure. The characteristics of insertion loss, adjacent crosstalk and output spectrum response at central wavelength of 1.55 μm for both designs were compared and analyzed. The conventional AWG produced a minimum insertion loss of 6.64 dB whereas the tapered AWG design reduced the insertion loss by 2.66 dB. The lowest adjacent crosstalk value of -16.96 dB was obtained in the conventional AWG design and this was much smaller compared to the tapered AWG design where the lowest crosstalk value is -17.23 dB. Hence, a tapered AWG design significantly reduces the insertion loss but has a slightly higher adjacent crosstalk compared to the conventional AWG design. On the other hand, the output spectrum responses that are obtained from both designs were close to the Coarse Wavelength Division Multiplexing (CWDM) wavelength grid.

  10. Intramyocardial pressure gradients in working and nonworking isolated cat hearts.

    PubMed

    Mihailescu, L S; Abel, F L

    1994-03-01

    This study presents an improved method for the measurement of intramyocardial pressure (IMP) using the servo-nulling mechanism. Glass micropipettes (20-24 microns OD) were used as transducers, coated to increase their mechanical resistance to breakage, and placed inside the left ventricular wall with a micropipette holder and manipulator. IMP was measured at the base of the left ventricle in working and nonworking isolated cat hearts that were perfused with Krebs-Henseleit buffer. In working hearts a transmural gradient of systolic IMP oriented from endocardium toward the epicardium was found; the endocardial values for systolic IMP were slightly higher than systolic left ventricular pressure (LVP), by 11-18%. Increases in afterload induced increases in IMP, without changing the systolic IMP-to-LVP ratio. In nonworking hearts with drained left ventricles, the systolic transmural gradient for IMP described for working hearts persisted, but at lower values, and was directly dependent on coronary perfusion pressure. Systolic IMP-to-LVP ratios were always > 1. The diastolic IMP of both working and nonworking hearts exhibited irregular transmural gradients. Our results support the view that generated systolic IMP is largely independent of LVP development.

  11. Preparation and properties of evaporated CdTe films compared with single crystal CdTe. Progress report No. 3, May 1-July 31, 1981

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bube, R.H.

    1981-01-01

    Preparation of the hot-wall vacuum deposition system nears completion and the first trial evaporation should take place in mid October. A UTI 100C Mass Analyzer with a 1 to 300 AMU capability has been ordered for the system. Preliminary tests indicate good temperature tracking between the furnace core and the CdTe source itself. Homojunction cells prepared by HWVE deposition of n-CdTe on p-CdTe substrates in October 1980 show no significant change in dark or light properties after open-circuit storage for the next 9 months. CdTe single crystal boules have been grown with P, As and Cs impurity. For P impuritymore » it appears from our data that the segregation coefficient is close to unity, that the value of hole density is controlled by the P and not by some unknown background acceptor, and that growth with excess Cd gives slightly higher values of hole density than growth with excess Te. CdTe:As crystals appear similar to CdTe:P crystals.« less

  12. Seven years of aerosol scattering hygroscopic growth measurements from SGP: Factors influencing water uptake: Aerosol Scattering Hygroscopic Growth

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jefferson, A.; Hageman, D.; Morrow, H.

    Long-term measurements of changes in the aerosol scattering coefficient hygroscopic growth at the U.S. Department of Energy Southern Great Plains site provide information on the seasonal as well as size and chemical dependence of aerosol hygroscopic growth. Annual average sub 10 um fRH values (the ratio of aerosol scattering at 85%/40% RH) were 1.75 and 1.87 for the gamma and kappa fit algorithms, respectively. The study found higher growth rates in the winter and spring seasons that correlated with high aerosol nitrate mass fraction. FRH, exhibited strong, but differing correlations with the scattering Ångström exponent and backscatter fraction, two opticalmore » size-dependent parameters. The aerosol organic fraction had a strong influence, with fRH decreasing with increases in the organic mass fraction and absorption Ångström exponent and increasing with the aerosol single scatter albedo. Uncertainty analysis if the fit algorithms revealed high uncertainty at low scattering coefficients and slight increases in uncertainty at high RH and fit parameters values.« less

  13. Aerodynamic Characteristics at a Mach Number of 6.8 of Two Hypersonic Missile Configurations, One with Low-Aspect-Ratio Cruciform Fins and Trailing-Edge Flaps and One with a Flared Afterbody and All-Movable Controls

    NASA Technical Reports Server (NTRS)

    Robinson, Ross B; Bernot, Peter T

    1958-01-01

    An investigation has been made to determine the aerodynamic characteristics in pitch at a Mach number of 6.8 of hypersonic missile configurations with cruciform trailing-edge flaps and with all-movable control surfaces. The flaps were tested on a configuration having low-aspect-ratio cruciform fins with an apex angle of 5 deg the all-movable controls were mounted at the 46.7-percent body station on a configuration having a 10 deg flared afterbody. The tests were made through an angle-of-attack range of -2 deg to 20 deg at zero sideslip in the Langley 11-inch hypersonic tunnel. The results indicated that the all-movable controls on the flared afterbody model should be capable of producing much larger values of trim lift and of normal acceleration than the trailing-edge -flap configuration. The flared -after body configuration had considerably higher drag than the cruciform-fin model but only slightly lower values of lift drag ratio.

  14. Aerodynamic Characteristics at a Mach Number of 6.8 of Two Hypersonic Missile Configurations, One with Low-Aspect-Ratio Cruciform Fins and Trailing-Edge Flaps and One with a Flared Afterbody and All-Movable Controls

    NASA Technical Reports Server (NTRS)

    Bernot, P. T.; Robinson, R. B.

    1958-01-01

    An investigation has been made to determine the aerodynamic characteristics in pitch at a Mach number of 6.8 of hypersonic missile configurations with cruciform trailing-edge flaps and with all-movable control surfaces. The flaps were tested on a configuration having low-aspect-ratio cruciform fins with an apex angle of 5 degrees; the all-movable controls were mounted at the 46.7-percent body station on a configuration having a 10 degrees flared afterbody. The tests were made through an angle-of-attack range of -2 degrees to 20 degrees at zero sideslip in the Langley 11-inch hypersonic tunnel. The results indicated that the all-movable controls on the flared-afterbody model should be capable of producing much larger values of trim lift and of normal acceleration than the trailing-edge-flap configuration. The flared-afterbody configuration had considerably higher drag than the cruciform-fin model but only slightly lower values of lift-drag ratio.

  15. Photoelectron and computational studies of the copper-nucleoside anionic complexes, Cu(-)(cytidine) and Cu(-)(uridine).

    PubMed

    Li, Xiang; Ko, Yeon-Jae; Wang, Haopeng; Bowen, Kit H; Guevara-García, Alfredo; Martínez, Ana

    2011-02-07

    The copper-nucleoside anions, Cu(-)(cytidine) and Cu(-)(uridine), have been generated in the gas phase and studied by both experimental (anion photoelectron spectroscopy) and theoretical (density functional calculations) methods. The photoelectron spectra of both systems are dominated by single, intense, and relatively narrow peaks. These peaks are centered at 2.63 and 2.71 eV for Cu(-)(cytidine) and Cu(-)(uridine), respectively. According to our calculations, Cu(-)(cytidine) and Cu(-)(uridine) species with these peak center [vertical detachment energy (VDE)] values correspond to structures in which copper atomic anions are bound to the sugar portions of their corresponding nucleosides largely through electrostatic interactions; the observed species are anion-molecule complexes. The combination of experiment and theory also reveal the presence of a slightly higher energy, anion-molecule complex isomer in the case of the Cu(-)(cytidine). Furthermore, our calculations found that chemically bond isomers of these species are much more stable than their anion-molecule complex counterparts, but since their calculated VDE values are larger than the photon energy used in these experiments, they were not observed.

  16. Photoelectron and computational studies of the copper-nucleoside anionic complexes, Cu-(cytidine) and Cu-(uridine)

    NASA Astrophysics Data System (ADS)

    Li, Xiang; Ko, Yeon-Jae; Wang, Haopeng; Bowen, Kit H.; Guevara-García, Alfredo; Martínez, Ana

    2011-02-01

    The copper-nucleoside anions, Cu-(cytidine) and Cu-(uridine), have been generated in the gas phase and studied by both experimental (anion photoelectron spectroscopy) and theoretical (density functional calculations) methods. The photoelectron spectra of both systems are dominated by single, intense, and relatively narrow peaks. These peaks are centered at 2.63 and 2.71 eV for Cu-(cytidine) and Cu-(uridine), respectively. According to our calculations, Cu-(cytidine) and Cu-(uridine) species with these peak center [vertical detachment energy (VDE)] values correspond to structures in which copper atomic anions are bound to the sugar portions of their corresponding nucleosides largely through electrostatic interactions; the observed species are anion-molecule complexes. The combination of experiment and theory also reveal the presence of a slightly higher energy, anion-molecule complex isomer in the case of the Cu-(cytidine). Furthermore, our calculations found that chemically bond isomers of these species are much more stable than their anion-molecule complex counterparts, but since their calculated VDE values are larger than the photon energy used in these experiments, they were not observed.

  17. Elemental Abundances of Blue Compact Dwarfs from Mid-Infrared Spectroscopy with Spitzer

    NASA Astrophysics Data System (ADS)

    Wu, Yanling; Bernard-Salas, J.; Charmandaris, V.; Lebouteiller, V.; Hao, Lei; Brandl, B. R.; Houck, J. R.

    2008-01-01

    We present a study of elemental abundances in a sample of 13 blue compact dwarf (BCD) galaxies, using the ~10-37 μm high-resolution spectra obtained with Spitzer IRS. We derive the abundances of neon and sulfur for our sample using the infrared fine-structure lines probing regions which may be obscured by dust in the optical and compare our results with similar infrared studies of starburst galaxies from ISO. We find a good correlation between the neon and sulfur abundances, although sulfur is underabundant relative to neon with respect to the solar value. A comparison of the elemental abundances (neon and sulfur) measured from the infrared data with those derived from the optical (neon, sulfur, and oxygen) studies reveals a good overall agreement for sulfur, while the infrared-derived neon abundances are slightly higher than the optical values. This indicates either that the metallicities of dust-enshrouded regions in BCDs are similar to the optically accessible regions, or that if they are different they do not contribute substantially to the total infrared emission of the host galaxy.

  18. Studies on probe measurements in presence of magnetic field in dust containing hydrogen plasma

    NASA Astrophysics Data System (ADS)

    Kalita, Deiji; Kakati, Bharat; Kausik, Siddhartha Sankar; Saikia, Bipul Kumar; Bandyopadhyay, Mainak

    2018-04-01

    The accuracy of plasma parameters measured by Langmuir probe in presence of magnetic field is studied in our present work. It is observed that the ratio of electron to ion saturation current shows almost identical behavior with that of unmagnetized hydrogen plasma when r L > 10 r p (here r L : Larmor radius and r p : probe radius). At magnetic field strength, B = 594 gauss, the electron temperature ( T e ) shows an overestimated value up to 35-40%, whereas at B ≤ 37 gauss, T e shows around ≤10% overestimated value w.r.t. unmagnetized case. A bi-Maxwellian electron energy probability function is observed for entire magnetic field range for both pristine and dust containing hydrogen plasma. The bulk (cold) electron collection by the Langmuir probe is strongly suppressed whereas the higher energetic electron collection remains unaffected in presence of magnetic field. In presence of dust grains, it is found that the low energy electron population decreases even more than the magnetized plasma and the high-energy tail slightly increases compared to the pristine plasma.

  19. The use of language to express thermal sensation suggests heat acclimatization by Indonesian people

    NASA Astrophysics Data System (ADS)

    Tochihara, Yutaka; Lee, Joo-Young; Wakabayashi, Hitoshi; Wijayanto, Titis; Bakri, Ilham; Parsons, Ken

    2012-11-01

    The purpose of this study was to explore whether there is evidence of heat acclimatization in the words used to express thermal sensation. A total of 458 urban Japanese and 601 Indonesians participated in a questionnaire. In addition, in a preliminary survey, 39 native English speakers in the UK participated. Our results showed that (1) for Indonesians, the closest thermal descriptor of a feeling of thermal comfort was `cool' (75%) followed by `slightly cool' (7%), `slightly cold' (5%) and `cold' (5%), while Japanese responses were distributed uniformly among descriptors `cool', `slightly cool', `neither', `slightly warm', and `warm'; (2) the closest thermal descriptors of a feeling of discomfort for Indonesians were less affected by individual thermal susceptibility (vulnerability) than those for Japanese; (3) in the cases where `cool' and `slightly cold' were imagined in the mind, the descriptors were cognized as a thermal comfortable feeling by 97% and 57% of Indonesians, respectively; (4) the most frequently voted choice endorsing hot weather was `higher than 32°C' for Indonesians and `higher than 29°C' for Japanese respondents; for cold weather, `lower than 15°C' for Japanese and `lower than 20°C' for Indonesians. In summary, the descriptor `cool' in Indonesians connotes a thermally comfortable feeling, but the inter-zone between hot and cold weather that was judged in the mind showed a upward shift when compared to that of Japanese. It is suggested that linguistic heat acclimatization exists on a cognitive level for Indonesians and is preserved in the words of thermal descriptors.

  20. Impact of Biomass Burning Plumes on Photolysis Rates and Ozone Formation at the Mount Bachelor Observatory

    NASA Astrophysics Data System (ADS)

    Baylon, P.; Jaffe, D. A.; Hall, S. R.; Ullmann, K.; Alvarado, M. J.; Lefer, B. L.

    2018-02-01

    In this paper, we examine biomass burning (BB) events at the Mt. Bachelor Observatory (MBO) during the summer of 2015. We explored the photochemical environment in these BB plumes, which remains poorly understood. Because we are interested in understanding the effect of aerosols only (as opposed to the combined effect of aerosols and clouds), we carefully selected three cloud-free days in August and investigate the photochemistry in these plumes. At local midday (solar zenith angle (SZA) = 35°), j(NO2) values were slightly higher (0.2-1.8%) in the smoky days compared to the smoke-free day, presumably due to enhanced scattering by the smoke aerosols. At higher SZA (70°), BB aerosols decrease j(NO2) by 14-21%. We also observe a greater decrease in the actinic flux at 310-350 nm, compared to 360-420 nm, presumably due to absorption in the UV by brown carbon. We compare our measurements with results from the Tropospheric Ultraviolet-Visible v.5.2 model. As expected, we find a good agreement (to within 6%) during cloud-free conditions. Finally, we use the extended Leighton relationship and a photochemical model (Aerosol Simulation Program v.2.1) to estimate midday HO2 and RO2 concentrations and ozone production rates (P(O3)) in the fire plumes. We observe that Leighton-derived HO2 and RO2 values (49-185 pptv) and instantaneous P(O3) (2.0-3.6 ppbv/h) are higher than the results from the photochemical model.

  1. Solar power satellite system definition study. Volume 4: Solid State SPS Analysis, Phase 3

    NASA Technical Reports Server (NTRS)

    1980-01-01

    A 2500 megawatt solid ground output Solar Power Satellite (SPS) of conventional configuration was designed and analyzed. Because the power per receiving antenna is halved, as compared with the klystron reference, twice the number of receiving antennas are needed to deliver the same total power. The solid state approach appears feasible with a slightly greater specific mass and slightly higher cost than the klystron SPS design.

  2. Did the DSM-5 Improve the Traumatic Stressor Criterion?: Association of DSM-IV and DSM-5 Criterion A with Posttraumatic Stress Disorder Symptoms.

    PubMed

    Larsen, Sadie E; Berenbaum, Howard

    2017-01-01

    A recent meta-analysis found that DSM-III- and DSM-IV-defined traumas were associated with only slightly higher posttraumatic stress disorder (PTSD) symptoms than nontraumatic stressors. The current study is the first to examine whether DSM-5-defined traumas were associated with higher levels of PTSD than DSM-IV-defined traumas. Further, we examined theoretically relevant event characteristics to determine whether characteristics other than those outlined in the DSM could predict PTSD symptoms. One hundred six women who had experienced a trauma or significant stressor completed questionnaires assessing PTSD, depression, impairment, and event characteristics. Events were rated for whether they qualified as DSM-IV and DSM-5 trauma. There were no significant differences between DSM-IV-defined traumas and stressors. For DSM-5, effect sizes were slightly larger but still nonsignificant (except for significantly higher hyperarousal following traumas vs. stressors). Self-reported fear for one's life significantly predicted PTSD symptoms. Our results indicate that the current DSM-5 definition of trauma, although a slight improvement from DSM-IV, is not highly predictive of who develops PTSD symptoms. Our study also indicates the importance of individual perception of life threat in the prediction of PTSD. © 2017 S. Karger AG, Basel.

  3. Kidney Disease Among Registered Métis Citizens of Ontario: A Population-Based Cohort Study

    PubMed Central

    Hayward, Jade S.; McArthur, Eric; Nash, Danielle M.; Sontrop, Jessica M.; Russell, Storm J.; Khan, Saba; Walker, Jennifer D.; Nesrallah, Gihad E.; Sood, Manish M.; Garg, Amit X.

    2017-01-01

    Background: Indigenous peoples in Canada have higher rates of kidney disease than non-Indigenous Canadians. However, little is known about the risk of kidney disease specifically in the Métis population in Canada. Objective: To compare the prevalence of chronic kidney disease and incidence of acute kidney injury and end-stage kidney disease among registered Métis citizens in Ontario and a matched sample from the general Ontario population. Design: Population-based, retrospective cohort study using data from the Métis Nation of Ontario’s Citizenship Registry and administrative databases. Setting: Ontario, Canada; 2003-2013. Patients: Ontario residents ≥18 years. Measurements: Prevalence of chronic kidney disease and incidence of acute kidney injury and end-stage kidney disease. Secondary outcomes among patients hospitalized with acute kidney injury included non-recovery of kidney function and mortality within 1 year of discharge. Methods: Database codes and laboratory values were used to determine study outcomes. Métis citizens were matched (1:4) to Ontario residents on age, sex, and area of residence. The analysis included 12 229 registered Métis citizens and 48 916 adults from the general population. Results: We found the prevalence of chronic kidney disease was slightly higher among Métis citizens compared with the general population (3.1% vs 2.6%, P = 0.002). The incidence of acute kidney injury was 1.2 per 1000 person-years in both Métis citizens and the general population (P = 0.54). Of those hospitalized with acute kidney injury, outcomes were similar among Métis citizens and the general population except 1-year mortality, which was higher for Métis citizens (24.5% vs 15.3%, P = 0.03). The incidence of end-stage kidney disease did not differ between groups (<3.0 per 10 000 person-years, P = 0.73). Limitations: The Métis Nation of Ontario Citizenship Registry only captures about 20% of Métis people in Ontario. Administrative health care codes used to identify kidney disease are highly specific but have low sensitivity. Conclusions: Rates of kidney disease were similar or slightly higher for Métis citizens in Ontario compared with the matched general population. PMID:28491337

  4. Comparative burial and thermal history of lower Upper Cretaceous strata, Powder River basin, Wyoming

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nuccio, V.F.

    1989-03-01

    Burial histories were reconstructed for three localities in the Powder River basin (PRB), Wyoming. Thermal maturity of lower Upper Cretaceous source rocks was determined by vitrinite reflectance (R/sub m/) and time-temperature index (TTI) modeling, producing independent estimates for timing of the oil window (0.55-1.35% R/sub m/). In the northwestern PRB, lower Upper Cretaceous rocks were buried to about 12,500 ft and achieved a thermal maturity of 0.50% to 0.56% at maximum burial, 10 Ma, based on measured R/sub m/. TTI modeling suggests a slightly higher thermal maturity, with an R/sub m/ equivalent of approximately 0.75%, placing the source rocks atmore » the beginning of the oil window 30 Ma. In the southwestern PRB, lower Upper Cretaceous rocks have been buried to about 15,000 ft and achieved thermal maturities between 0.66% and 0.75% about 10 Ma based on measured R/sub m/; therefore, petroleum generation may have begun slightly earlier. TTI modeling estimates an R/sub m/ equivalent of 1.10%, placing the beginning of the oil window at 45 Ma. In the northeastern PRB, lower Upper Cretaceous rocks have been buried only to approximately 5500 ft. Measured R/sub m/ and TTI modeling indicate a thermal maturity for lower Upper Cretaceous rocks between 0.45% and 0.50% R/sub m/, too low for petroleum generation. The higher R/sub m/ values determined by the TTI models may be due to overestimation of maximum burial depth and/or paleogeothermal gradients. The two independent maturity indicators do, however, constrain fairly narrowly the onset of petroleum generation.« less

  5. Comparison of intraocular lens power prediction using immersion ultrasound and optical biometry with and without formula optimization.

    PubMed

    Nemeth, Gabor; Nagy, Attila; Berta, Andras; Modis, Laszlo

    2012-09-01

    Comparison of postoperative refraction results using ultrasound biometry with closed immersion shell and optical biometry. Three hundred and sixty-four eyes of 306 patients (age: 70.6 ± 12.8 years) underwent cataract surgery where intraocular lenses calculated by SRK/T formula were implanted. In 159 cases immersion ultrasonic biometry, in 205 eyes optical biometry was used. Differences between predicted and actual postoperative refractions were calculated both prior to and after optimization with the SRK/T formula, after which we analysed the similar data in the case of Holladay, Haigis, and Hoffer-Q formulas. Mean absolute error (MAE) and the percentage rate of patients within ±0.5 and ±1.0 D difference in the predicted error were calculated with these four formulas. MAE was 0.5-0.7 D in cases of both methods with SRK/T, Holladay, and Hoffer-Q formula, but higher with Haigis formula. With no optimization, 60-65 % of the patients were under 0.5 D error in the immersion group (except for Haigis formula). Using the optical method, this value was slightly higher (62-67 %), however, in this case, Haigis formula also did not perform so well (45 %). Refraction results significantly improved with Holladay, Hoffer-Q, and Haigis formulas in both groups. The rate of patients under 0.5 D error increased to 65 % by the immersion technique, and up to 80 % by the optical one. According to our results, optical biometry offers only slightly better outcomes compared to those of immersion shell with no optimized formulas. However, in case of new generation formulas with both methods, the optimization of IOL-constants give significantly better results.

  6. The MRI-measured arterial input function resulting from a bolus injection of Gd-DTPA in a rat model of stroke slightly underestimates that of Gd-[14C]DTPA and marginally overestimates the blood-to-brain influx rate constant determined by Patlak plots

    PubMed Central

    Nagaraja, Tavarekere N.; Karki, Kishor; Ewing, James R.; Divine, George W.; Fenstermacher, Joseph D.; Patlak, Clifford S.; Knight, Robert A.

    2009-01-01

    The hypothesis that the arterial input function (AIF) of gadolinium-diethylenetriaminepentaacetic acid (Gd-DTPA) injected by intravenous (iv) bolus and measured by the change in the T1-relaxation rate (ΔR1; R1=1/T1) of superior sagittal sinus blood (AIF-I) approximates the AIF of 14C-labeled Gd-DTPA measured in arterial blood (AIF*) was tested in a rat stroke model (n=13). Contrary to the hypothesis, the initial part of the ΔR1-time curve was underestimated, and the area under the normalized curve for AIF-I was about 15% lower than that for AIF*, the reference AIF. Hypothetical AIF’s for Gd-DTPA (AIF-II) were derived from the AIF* values and averaged to obtain AIF-III. Influx rate constants (Ki) and proton distribution volumes at zero time (Vp+Vo) were estimated with Patlak plots of AIF-I, -II and -III and tissue ΔR1 data. For the regions of interest, the Ki’s estimated with AIF-I were slightly but not significantly higher than those obtained with AIF-II and AIF-III. In contrast, Vp+Vo was significantly higher when calculated with AIF-I. Similar estimates of Ki and Vp+Vo were obtained with AIF-II and AIF-III. In summary, AIF-I underestimated the reference AIF (AIF*); this shortcoming had little effect on the Ki calculated by Patlak plot but produced a significant overestimation of Vp+Vo. PMID:20512853

  7. [Characterization of Chromophoric dissolved organic matter (CDOM) in Zhoushan fishery using excitation-emission matrix spectroscopy (EEMs) and parallel factor analysis (PARAFAC)].

    PubMed

    Zhou, Qian-qian; Su, Rong-guo; Bai, Ying; Zhang, Chuan-song; Shi, Xiao-yong

    2015-01-01

    The composition, distribution characteristics and sources of chromophoric dissolved organic matter(CDOM) in Zhoushan Fishery in spring were evaluated by fluorescence excitation-emission matrix (EEM) combined with parallel factor analysis (EEMs-PARAFAC). Three humic-like components [C1 (330/420 nm)], C2 [(290) 365/440 nm] and C3 [(260) 370/490 nm)] and two protein-like components [C4(285/340 nm) and C5 (270/310 nm)] were identified by EEMs-PARAFAC. The horizontal distribution patterns of the five components were almost the same with only slight differences, showing decreasing trends with increasing distance from shore. In the surface and middle layers, the high value areas were located in the north of Hangzhou Bay estuary and the outlet of Xiazhimen channel, and the former's was higher in the surface layer while the latter's was higher in the middle layer. In the bottom layer, CDOM decreased gradiently from the inshore to offshore, with higher CDOM near Zhoushan Island. The distributions of fluorescence components showed an opposite trend with salinity, and no significant linear relationship with Chl-a concentration was found, which indicated that CDOM in the surface and middle layers were dominated by terrestrial input and human activities of Zhoushan Island and that of the bottom layer was attribute to human activities of Zhoushan Island. The vertical distribution of five fluorescent components along 30.5 degrees N transect showed a decreasing trend from the surface and middle layers to bottom layer with high values in inshore and offshore areas, which were correlated with the lower salinity and higher Chl-a concentration, respectively. On this transect, CDOM was mainly affected by Yangtze River input in coastal area but by bioactivities in offshore waters. Along the 30 degrees N transect, the vertical distribution patterns of CDOM were similar to those of 30.5 degrees N transect but there was a high value area in the bottom layer near the shore, attributing to the CDOM release from the marine sediment pore water to the water body because of physical force role like tidal, the underlying upwelling and so on. A strong correlation occurred between C1 and C3, C4, indicating that they had similar sources; a weak correlation was found between C1 and C2, C5, reflecting some differences among their sources. CDOM in Zhoushan Fishery in spring had low humification index (HIX) values, which reflected a low degree of humification, poor stability and a short resident time in the environment. For biological index (BIX), its higher values appeared in the offshore waters and the lower values occurred in the inshore area, reflecting a greater influence of human and biological activities, respectively.

  8. Speciation and isotopic composition of sulfur in sediments from Jellyfish Lake, Palau

    USGS Publications Warehouse

    Bates, A.L.; Spiker, E. C.; Orem, W.H.; Burnett, W.C.

    1993-01-01

    Jellyfish Lake, Palau, is a meromictic marine lake with high organic productivity, low reactive Fe content, and anoxic bottom waters. Sediment samples from Jellyfish Lake were examined for the distribution of sulfur species and their isotopic signatures in order to gain a better understanding of sedimentary sulfur incorporation in Fe-poor environments. Surface samples were taken along a transect from a near-shore site to the center of the lake, and include a sample below oxic water, a sample below the chemocline layer, and samples below anoxic waters. Three additional samples were taken from a core, 2 m long, collected near the lake center. Sulfur to organic carbon weight ratios in all samples were lower than the expected value of 0.36 for normal marine sediment, probably because the lake water is deficient in reactive Fe to form iron sulfides. Total sulfur contents in the surface sediments indicated no changes with distance from shore; however, the sulfur content of the surface sample at the chemocline layer may be slightly higher. Total sulfur content increased with depth in the core and is inversely related to organic carbon content. Organic sulfur is the major sulfur species in the samples, followed in descending order by sulfate, disulfides and monosulfides. Sulfate sulfur isotope ??34S-values are positive (from +20.56 to +12.04???), reflecting the marine source of sulfate in Jellyfish Lake. Disulfide and monosulfide ??34S-values are negative (from -25.07 to -7.60???), because of fractionation during bacterial reduction of sulfate. Monosulfide ??34S-values are somewhat higher than those of disulfides, and they are close to the ??34S-values of organic sulfur. These results indicate that most of the organic sulfur is formed by reaction of bacteriogenic monosulfides, or possibly monosulfide-derived polysulfides, with organic matter in the sediment. ?? 1993.

  9. Gene Expression Profiling of Nonhuman Primates Exposed to Aerosolized Venezuelan Equine Encephalitis Virus

    DTIC Science & Technology

    2007-12-01

    endogenous pyrogens occur slightly earlier in s.c. infections, but are more pro- longed by aerosol. Lymphopenia also seems to be more aggressive in...brain) Brain P-value (lung) Lung P-value (spleen) Spleen Antigen processing, endogenous antigen via MHC class I (BP) HLA-A 213932_x_at 8.58E-05 2.40

  10. The morphology and electromagnetic properties of MnO 2 obtained in 8 T high magnetic field

    NASA Astrophysics Data System (ADS)

    Jia, Zhang; Yuping, Duan; Hui, Jing; Xiaogang, Li; Shunhua, Liu

    2010-09-01

    MnO 2 powder was synthesized in a high magnetic field (8 T) via a simple route, and the formation mechanism for the grain shape was discussed. The synthesized samples were characterized by XRD, SEM, TEM, and vector network analysis. The morphology of synthesized MnO 2 was sea urchin-like ball chain with a low density center, just like "hollow-like". Throughout the whole frequency range, the dielectric constant and the loss tangent clearly decreased in 8 T high magnetic field. Moreover, the magnetic permeability and the loss tangent increased slightly in the frequency range 2-13 GHz. Furthermore, the theoretically calculated values of reflection loss showed that when the magnetic field strength 8 T was adopted, the absorption peak became smoother and shifted to a higher frequency.

  11. Bond strengths of Scotchbond Multi-Purpose to moist dentin and enamel.

    PubMed

    Swift, E J; Triolo, P T

    1992-12-01

    This in vitro study tested the shear bond strengths of the Scotchbond Multi-Purpose adhesive system to moist and dry enamel and dentin. After the tooth was etched, the surface was either dried with compressed air or blotted with tissue paper, leaving the surface visibly moist. Primer and adhesive were applied according to the manufacturer's directions. Resin composite posts were applied, and the specimens were thermocycled. Shear bond strengths were determined using an Instron universal testing machine. For both enamel and dentin, mean shear bond strengths were higher when the surface was left visibly moist after etching. Bond strengths to moist and dry dentin were 21.8 and 17.8 MPa, respectively. Enamel bond strengths were slightly lower, with values of 17.0 and 14.2 MPa to moist and dry enamel, respectively.

  12. Profile modification computations for LHCD experiments on PBX-M using the TSC/LSC model

    NASA Astrophysics Data System (ADS)

    Kaita, R.; Ignat, D. W.; Jardin, S. C.; Okabayashi, M.; Sun, Y. C.

    1996-02-01

    The TSC-LSC computational model of the dynamics of lower hybrid current drive has been exercised extensively in comparison with data from a Princeton Beta Experiment-Modification (PBX-M) discharge where the measured q(0) attained values slightly above unity. Several significant, but plausible, assumptions had to be introduced to keep the computation from behaving pathologically over time, producing singular profiles of plasma current density and q. Addition of a heuristic current diffusion estimate, or more exactly, a smoothing of the rf-driven current with a diffusion-like equation, greatly improved the behavior of the computation, and brought theory and measurement into reasonable agreement. The model was then extended to longer pulse lengths and higher powers to investigate performance to be expected in future PBX-M current profile modification experiments.

  13. Dynamic-mechanical and thermomechanical properties of cellulose nanofiber/polyester resin composites.

    PubMed

    Lavoratti, Alessandra; Scienza, Lisete Cristine; Zattera, Ademir José

    2016-01-20

    Composites of unsaturated polyester resin (UPR) and cellulose nanofibers (CNFs) obtained from dry cellulose waste of softwood (Pinus sp.) and hardwood (Eucalyptus sp.) were developed. The fiber properties and the influence of the CNFs in the dynamic-mechanical and thermomechanical properties of the composites were evaluated. CNFs with a diameter of 70-90 nm were obtained. Eucalyptus sp. has higher α-cellulose content than Pinus sp. fibers. The crystallinity of the cellulose pulps decreased after grinding. However, high values were still obtained. The chemical composition of the fibers was not significantly altered by the grinding process. Eucalyptus sp. CNF composites had water absorption close to the neat resin at 1 wt% filler. The dynamic-mechanical properties of Eucalyptus sp. CNFs were slightly increased and the thermal stability was improved. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. Cardiac morphology after conditions of microgravity during Cosmos 2044

    NASA Technical Reports Server (NTRS)

    Goldstein, Margaret A.; Edwards, Robert J.; Schroeter, John P.

    1992-01-01

    Light- and electron-microscopic studies were performed on cardiac muscle from rats flown on Cosmos 2044 and from four control groups. Average cross-sectional area of myofibers was measured by video analysis of the light-microscopic images of papillary and ventricular muscle samples from all animals. This cross-sectional area was significantly decreased in flight rats (P = 0.03) compared with synchronous controls. Additional findings at the electron microscopic level consistent with this atrophy were obtained by stereological analysis and optical diffraction analysis of papillary muscle samples. Slightly higher mitochondrial volume density values and mitochondria-to-myofibril ratios as well as normal A-band spacings (d1,0) and Z-band spacings of myofibrils were observed in the tail-suspension and flight groups. General morphological features similar to those in ventricular samples from the previous Cosmos 1887 flight were observed.

  15. Anthropometric and metabolic indices in assessment of type and severity of dyslipidemia.

    PubMed

    Zaid, Muhammad; Ameer, Fatima; Munir, Rimsha; Rashid, Rida; Farooq, Nimrah; Hasnain, Shahida; Zaidi, Nousheen

    2017-02-28

    It has been shown that obesity is associated with increased rates of dyslipidemia. The present work revisits the association between plasma lipid levels and classical indicators of obesity including body mass index (BMI). The significance of various anthropometric/metabolic variables in clinical assessment of type and severity of dyslipidemia was also determined. Recently described body indices, a body shape index (ABSI) and body roundness index (BRI), were also assessed in this context. For the present cross-sectional analytical study, the participants (n = 275) were recruited from the patients visiting different health camps. Participants were anthropometrically measured and interviewed, and their fasting intravenous blood was collected. Plasma lipid levels were accordingly determined. The values for different anthropometric parameters are significantly different between dyslipidemic and non-dyslipidemic participants. Receiver operating characteristics curve analyses revealed that all the tested variables gave the highest area under the curve (AUC) values for predicting hypertriglyceridemia in comparison to other plasma lipid abnormalities. BRI gave slightly higher AUC values in predicting different forms of dyslipidemia in comparison to BMI, whereas ABSI gave very low values. Several anthropometric/metabolic indices display increased predictive capabilities for detecting hypertriglyceridemia in comparison to any other form of plasma lipid disorders. The capacity of BRI to predict dyslipidemia was comparable but not superior to the classical indicators of obesity, whereas ABSI could not detect dyslipidemia.

  16. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sablock, J.

    A trace element signature, a characteristic pattern of enrichment and depletion of trace elements, was determined for a group of siliciclastic-carbonate Oxfordian and Kimmeridgian sedimentary strata, collected from outcrops in western Montana, southeastern British Columbia and southern Alberta. The average values, by petrofacies, of 10 major and 18 trace elements were measured for 40 samples. These data were normalized to Upper Continental Crust (UCC), and plotted against averaged published values of graywackes from the same facies. The rare earth elements (REEs), as well as Ti, Zr, Nb and Y are considered immobile even through diagenesis, and at least low levelmore » metamorphism. So these elements should form a reliable part of the geochemical signature. Compared to UCC and average graywacke, Jurassic samples are very depleted in Zr, Nb and Y. Oxfordian samples have slightly higher rare earth element values, i.e. La, Ce and Nd, than either other Jurassic samples or average graywacke. The most likely source of REE values are garnets and tourmaline which occur as inclusions in monocrystalline quartz grains. This pattern, and petrological study, point to a sedimentary source area, deficient in feldspar, heavy minerals and rock fragments. The consistency of the signature throughout this time may indicate slow uplift of a widespread sedimentary source area, or could be an effect of greater mixing and shorter residence time of dissolved materials in an epeiric sea.« less

  17. Fluctuating asymmetry and mentum gaps in populations of the midge Chironomus riparius (Diptera: Chironomidae) from a metal-contaminated River

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Groenendijk, D.; Zeinstra, L.W.M.; Postma, J.F.

    1998-10-01

    The developmental stability of both metal-exposed and nonexposed Chironomus riparius populations from the lowland River Dommel was investigated using fluctuating asymmetry (FA) and the incidence of mentum gaps. It was hypothesized that larval development was affected by the influx of Cd, Zn, Fe, Cu, and Pb directly by chemical stress, as well as through inbreeding of metal-adapted and nonadapted specimens. Morphological para/meters were therefore assessed in field-collected larvae and in clean, laboratory-cultured, first-generation (F1) larvae. Fluctuating asymmetry values and mentum gap incidence at contaminated field sites were significantly higher than at clean, upstream locations. Furthermore, FA values of clean, laboratory-culturedmore » F1 larvae generally fell to reference values, indicating the direct effect of metal pollution on developmental aberrations. Mentum gaps were not observed in clean F1 cultures. Slightly elevated FA values were, however, still observed in clean F1 larvae from polluted locations downstream from the metal input. This residual disturbance was thought to reflect genetic stress emerging from interbreeding between metal-adapted and nonadapted specimens. Fluctuating asymmetry and mentum gaps together serve as a useful ecotoxicological marker for metal stress and, when combined with in situ studies and F1 cultures, allow for analysis of the response of animal populations to spatial and temporal gradients in metal exposure.« less

  18. Lymph node culture

    MedlinePlus

    A normal result means there was no growth of microorganisms on the lab dish. Normal value ranges may vary slightly among different laboratories. Talk to your doctor about the meaning of your specific test results.

  19. Antithrombin III blood test

    MedlinePlus

    ... thinning medicine does not work. Normal Results Normal value ranges may vary slightly among different laboratories. Talk ... to the principles of the Health on the Net Foundation (www.hon.ch). The information provided herein ...

  20. Trypsinogen test

    MedlinePlus

    ... is also used to screen newborn babies for cystic fibrosis. Normal Results Normal value ranges may vary slightly ... to: Abnormal production of pancreatic enzymes Acute pancreatitis Cystic fibrosis Pancreatic cancer Low or normal levels may be ...

  1. EVIDENCE FOR POLAR X-RAY JETS AS SOURCES OF MICROSTREAM PEAKS IN THE SOLAR WIND

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Neugebauer, Marcia, E-mail: mneugeb@lpl.arizona.edu

    2012-05-01

    It is proposed that the interplanetary manifestations of X-ray jets observed in solar polar coronal holes during periods of low solar activity are the peaks of the so-called microstreams observed in the fast polar solar wind. These microstreams exhibit velocity fluctuations of {+-}35 km s{sup -1}, higher kinetic temperatures, slightly higher proton fluxes, and slightly higher abundances of the low-first-ionization-potential element iron relative to oxygen ions than the average polar wind. Those properties can all be explained if the fast microstreams result from the magnetic reconnection of bright-point loops, which leads to X-ray jets which, in turn, result in solarmore » polar plumes. Because most of the microstream peaks are bounded by discontinuities of solar origin, jets are favored over plumes for the majority of the microstream peaks.« less

  2. A Sr-isotopic comparison between thermal waters, rocks, and hydrothermal calcites, Long Valley caldera, California

    USGS Publications Warehouse

    Goff, F.; Wollenberg, H.A.; Brookins, D.C.; Kistler, R.W.

    1991-01-01

    The 87Sr/86Sr values of thermal waters and hydrothermal calcites of the Long Valley caldera geothermal system are more radiogenic than those of young intracaldera volcanic rocks. Five thermal waters display 87Sr/86Sr of 0.7081-0.7078 but show systematically lighter values from west to east in the direction of lateral flow. We believe the decrease in ratio from west to east signifies increased interaction of deeply circulating thermal water with relatively fresh volcanic rocks filling the caldera depression. All types of pre-, syn-, and post-caldera volcanic rocks in the west and central caldera have (87Sr/86Sr)m between about 0.7060 and 0.7072 and values for Sierra Nevada granodiorites adjacent to the caldera are similar. Sierran pre-intrusive metavolcanic and metasedimentary rocks can have considerably higher Sr-isotope ratios (0.7061-0.7246 and 0.7090-0.7250, respectively). Hydrothermally altered volcanic rocks inside the caldera have (87Sr/86Sr)m slightly heavier than their fresh volcanic equivalents and hydrothermal calcites (0.7068-0.7105) occupy a midrange of values between the volcanic/plutonic rocks and the Sierran metamorphic rocks. These data indicate that the Long Valley geothermal reservoir is first equilibrated in a basement complex that contains at least some metasedimentary rocks. Reequilibration of Sr-isotope ratios to lower values occurs in thermal waters as convecting geothermal fluids flow through the isotopically lighter volcanic rocks of the caldera fill. ?? 1991.

  3. O and C stable isotopes in cryogenic cave calcite (CCC) - possible proxy for past climate changes

    NASA Astrophysics Data System (ADS)

    -Andreea, Badaluta Carmen; Ersek, Vasile; Piotrowska, Natalia; Persoiu, Aurel

    2017-04-01

    Perennial ice deposits in caves host various proxies of past climate variability, most notable, the isotopic composition of ice, which has been shown to reflect, generally, the temperature outside the cave during the formation of ice (usually, autumn though spring). This ice forms by the freezing of water, water that contains large amounts of dissolved calcium carbonate. The freezing is accompanied by degassing of CO2, and precipitation of cryogenic cave calcite (CCC) under strong kinetic conditions. These kinetic processes could lead to the alteration of the original putative climatic signal carried by the isotopic composition of CCC. Here, we present a possibly climatic explanation of the isotopic composition of CCC from a 1000 years old cave ice deposit from Scărișoara Ice Cave (SIC) in Romania, Eastern Europe. In a 7 m core from the Great Hall of SIC we have analyzed the isotopic composition of the water (oxygen and hydrogen) and CCC (oxygen and carbon) from individual ice layers in the core, as well as that of precipitation , outside the cave. The isotopic composition of precipitation from the cave area varies between -3.6 ‰ for δˡ⁸O and -22 ‰ for δ2H in summer, and -17.8 ‰ for δˡ⁸O and -22 ‰ for δ2H in winter, with mean values of -9.1 ‰ for δˡ⁸O and -62 ‰ for δ2H. A positive correlation between air temperature and the isotopic composition of precipitation, as well as drip water in the cave has been found. The mean values in the ice core during the past 1000 years are -10.3‰ for δ18O and -71 ‰ for δ2H. The water isotopic values in the ice core show low values up to 900 AD, higher values between 900 and 1300 AD (Medieval Warm Period, MWP), and again lower values after 1300 AD (Little Ice Age, LIA), reaching their minimum after 1800 AD. The isotopic composition of CCC shows slightly higher values in the MWP and lower in LIA, possibly suggesting a climatic influence. Modern observations are too short to be able to calibrate this putative signal. Further, clumped isotope thermometry has shown that the kinetic fractionation that dominates during the freezing of water leads to unusual reconstructed formative temperature: +20°C. However, δˡ3C and δˡ⁸O values in CCC have higher values for samples from the MWP than those from the LIA. CCC results from the deposition of CaCO3 from Ca(CO3)2. The main source of CO2 to form carbonic acid is soil CO2, produced by root respiration. Previous studies have shown that δˡ⁸O of this CO2 is in equilibrium with the δˡ⁸O of water, so that the higher (lower) δˡ⁸O values of CCC could reflect warmer (colder) conditions during the MPW (LIA). The interpretation of δˡ3C values of CCC is less straightforward. Higher δˡ3C values in soil CO2 are determined by moisture limitation on plants, either due to low moisture or higher evaporative conditions. While the MWP was warmer in the study area, conflicting data exists on precipitation, with studies suggesting both drier and wetter conditions, so that is difficult to interpret our carbon isotope data. Apart from the direct climatic influence, the depth of soil could have also played a part, as deeper soils, as expected under birch forests that dominated during the MWP, would have had more enrichment in the heavy isotopes with depth, than the thiner soils of the LIA (formed under mostly spruce forests). Further, drought/higher temperatures could also influence the kinetics of the reaction, which can be large enough to overprint any soil signal in δˡ3C.

  4. Triticonazole enantiomers: Separation by supercritical fluid chromatography and the effect of the chromatographic conditions.

    PubMed

    He, Jianfeng; Fan, Jun; Yan, Yilun; Chen, Xiaodong; Wang, Tai; Zhang, Yaomou; Zhang, Weiguang

    2016-11-01

    Enantiomeric pairs of triticonazole have been successfully separated by supercritical fluid chromatography coupled with a tris(3,5-dimethylphenylcarbamoyl) cellulose-coated chiral stationary phase in this work. The effects of co-solvent, dissolution solvent, flow rate, backpressure, and column temperature have been studied in detail with respect to retention, selectivity, and resolution of triticonazole. As indicated, the co-solvents mostly affected the retention factors and resolution, due to the different molecular structure and polarity. In addition, the dissolution solvents, namely, chloromethanes and alcohols, have been also important for enantioseparation because of the different interaction with stationary phase. Higher flow rate and backpressure led to faster elution of the triticonazole molecules, and the change of column temperature showed slight effect on the resolution of triticonazole racemate. Moreover, a comparative separation experiment between supercritical fluid chromatography and high performance liquid chromatography revealed that chiral supercritical fluid chromatography gave the 3.5 times value of R s /t R2 than high performance liquid chromatography, which demonstrated that supercritical fluid chromatography had much higher separation efficiency. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Design and Performance of the Sorbent-Based Atmosphere Revitalization System for Orion

    NASA Technical Reports Server (NTRS)

    Ritter, James A.; Reynolds, Steven P.; Ebner, Armin D.; Knox, James C.; LeVan, M. Douglas

    2007-01-01

    Validation and simulations of a real-time dynamic cabin model were conducted on the sorbent-based atmosphere revitalization system for Orion. The dynamic cabin model, which updates the concentration of H2O and CO2 every second during the simulation, was able to predict the steady state model values for H2O and CO2 for long periods of steady metabolic production for a 4-person crew. It also showed similar trends for the exercise periods, where there were quick changes in production rates. Once validated, the cabin model was used to determine the effects of feed flow rate, cabin volume and column volume. A higher feed flow rate reduced the cabin concentrations only slightly over the base case, a larger cabin volume was able to reduce the cabin concentrations even further, and the lower column volume led to much higher cabin concentrations. Finally, the cabin model was used to determine the effect of the amount of silica gel in the column. As the amount increased, the cabin concentration of H2O decreased, but the cabin concentration of CO2 increased.

  6. Padres Trabajando por la Paz: a randomized trial of a parent education intervention to prevent violence among middle school children.

    PubMed

    Murray, N G; Kelder, S H; Parcel, G S; Frankowski, R; Orpinas, P

    1999-06-01

    This paper reports the results of a randomized trial to test the effectiveness of a theoretically derived intervention designed to increase parental monitoring among Hispanic parents of middle school students. Role model story newsletters developed through the process of Intervention Mapping were mailed to half of a subsample of parents whose children participated in Students for Peace, a comprehensive violence prevention program. The results indicated that parents in the experimental condition (N = 38) who had lower social norms for monitoring at baseline reported higher norms after the intervention than the parents in the control condition (N = 39) (P = 0.009). Children of parents in the experimental group reported slightly higher levels of monitoring at follow-up across baseline values, whereas control children who reported moderate to high levels of monitoring at pre-test reported lower levels at follow-up (P = 0.04). These newsletters are a population-based strategy for intervention with parents that show some promise for comprehensive school-based interventions for youth.

  7. Impact and hardness optimisation of composite materials inspired by the babassu nut (Orbignya speciosa).

    PubMed

    Staufenberg, Gerrit; Graupner, Nina; Müssig, Jörg

    2015-08-20

    The babassu nut is the fruit of the babassu palm Orbignya speciosa. The combination of hardness and impact strength is difficult to acquire for artificial materials, making the babassu nut a promising source for biomimetic inspiration. Unnotched Charpy impact tests, Shore D hardness tests and scanning electron microscopy were used for mechanical and microscopical analysis of the pericarp. Four major principles were found for a biomimetic approach: a hard core ((1); endocarp) is embedded in a soft outer layer of high impact strength ((2); epicarp) and is reinforced with fibres of variable fineness (3), some of which are oriented radial to the core (4). Biomimetic fibre-reinforced composites were produced using abstracted mechanisms of the babassu nut based on regenerated cellulose fibres (lyocell, L) with two different fineness values as reinforcement embedded in a polylactide (PLA) core matrix and polypropylene (PP) based outer layers. The biomimetic fibre composite reaches a significantly higher impact strength that is 1.6 times higher than the reference sample produced from a PLA/PP/L-blend. At the same time the hardness is slightly increased compared to PP/L.

  8. Role of the Lakes in Groundwater Recharge and Discharge in the Young Glacial Area, Northern Poland.

    PubMed

    Jaworska-Szulc, Beata

    2016-07-01

    The aim of this research was to delineate characteristic hydrogeological lake types in the Young Glacial Area (YGA). The YGA is in the central and east part of the Kashubian Lake District (KLD) in Northern Poland, an area covered by deposits of Quaternary glaciation. All the bigger lakes were investigated in the area of about 1500 km(2) (39 lakes). The role of lakes in groundwater recharge and discharge was determined from total dissolved solids (TDS) in lake waters and also from groundwater flow simulation. The general trend was that gaining lakes, as determined by flow modeling, had higher values of TDS than losing lakes. In addition to typical gaining lakes (with TDS > 250 mg/l), there were losing lakes perched on glacial till deposits with very low TDS (<100 mg/l). Two groups of losing lakes were delineated: ones with very low TDS and another group with slightly higher TDS (due to local contact with groundwater). Flow-through lakes with TDS of 170-200 mg/l were also delineated. © 2015, National Ground Water Association.

  9. Function and the patient with chronic low back pain.

    PubMed

    Strong, J; Ashton, R; Large, R G

    1994-09-01

    To undertake a comparative examination of the reliability and validity of two frequently used self-report measures of functional disability, the Pain Disability Index (PDI) and the Oswestry Low Back Pain Disability Questionnaire (OLBPDQ). A descriptive ex-post facto design was used in the study. Pain clinics and neurosurgical units at three metropolitan hospitals. One hundred patients with chronic low back pain of noncancer origin were administered the two questionnaires as part of a larger questionnaire battery. Acceptable internal consistency values of 0.76 for the PDI and 0.71 for the OLBPDQ were obtained. A correlation of r = 0.63 was found between the PDI and the OLBPDQ, supporting the concurrent validity of the two scales. Both the scales were found to be correlated to the Beck Depression Inventory scores (PDI, r = 0.42; OLBPDQ, r = 0.39), with higher disability associated with greater depression. Only the total PDI score was found to be sensitive to functional status differences within the patient sample. These findings support other recent work in favor of the PDI. The PDI had a slightly higher internal consistency and was more sensitive than the OLBPDQ.

  10. Effects of CaCO3 treatment on the morphology, crystallinity, rheology and hydrolysis of gelatinized maize starch dispersions.

    PubMed

    Garcia-Diaz, S; Hernandez-Jaimes, C; Escalona-Buendia, H B; Bello-Perez, L A; Vernon-Carter, E J; Alvarez-Ramirez, J

    2016-09-15

    Using calcium salts instead of lime allows for an ecological nixtamalization of maize grains, where the negative contamination impact of the traditional lime nixtamalization is reduced. This work assessed the effects of calcium carbonate (0.0-2.0%w/w CaCO3) on the morphology, crystallinity, rheology and hydrolysis of gelatinized maize starch dispersions (GMSD). Microscopy analysis showed that CaCO3 changed the morphology of insoluble remnants (ghosts) and decreased the degree of syneresis. Analysis of particle size distribution showed a slight shift to smaller sizes as the CaCO3 was increased. Also, X-ray patterns indicated that crystallinity achieved a minimum value at CaCO3 concentration in the range of 1%w/w. GMSD with higher CaCO3 concentrations exhibited higher thixotropy area and complex viscoelastic behavior that was frequency dependent. A possible mechanism involved in the starch chain modification by CaCO3 is that starch may act as a weak acid ion exchanger capable of exchanging alcoholic group protons for cations (Ca(+2)). Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. Plant Regeneration and Cellular Behaviour Studies in Celosia cristata Grown In Vivo and In Vitro

    PubMed Central

    Taha, Rosna Mat; Wafa, Sharifah Nurashikin

    2012-01-01

    Tissue culture studies of Celosia cristata were established from various explants and the effects of various hormones on morphogenesis of this species were examined. It was found that complete plant regeneration occurred at highest percentage on MS medium supplemented with 2.0 mg/L NAA and 1.5 mg/L BAP, with the best response showed by shoot explants. In vitro flowering was observed on MS basal medium after six weeks. The occurrence of somaclonal variation and changes in cellular behavior from in vivo and in vitro grown plants were investigated through cytological studies and image analysis. It was observed that Mitotic Index (MI), mean chromosome numbers, and mean nuclear to cell area ratio of in vitro root meristem cells were slightly higher compared to in vivo values. However, in vitro plants produced lower mean cell areas but higher nuclear areas when compared to in vivo plants. Thus, no occurrence of somaclonal variation was detected, and this was supported by morphological features of the in vitro plants. PMID:22593677

  12. Cognitive impairment in patients with Fibromyalgia syndrome as assessed by the Mini-Mental State Examination

    PubMed Central

    2009-01-01

    Background This study evaluated the frequency of cognitive impairment in patients with Fibromyalgia syndrome (FMS) using the Mini Mental State Examination (MMSE). Methods We analyzed baseline data from all 46 patients with FMS and 92 age- and sex-matched controls per diagnosis of neuropathic (NeP) or mixed pain (MP) selected from a larger prospective study. Results FMS had a slight but statistically significant lower score in the adjusted MMSE score (26.9; 95% CI 26.7-27.1) than either NeP (27.3; 95% CI 27.2-27.4) or MP (27.3; 27.2-27.5). The percentage of patients with congnitive impairment (adjusted MMSE ≤ 26) was numerically higher in FMS (15%; 95% CI 6.3-29) compared with NeP (5%; 95% CI 1.8-12.2) or MP (5%; 95% CI 1.8-12.2) and higher than in the same age stratum of the general population (0.05%). Conclusions Compared with the population reference value, patients with FMS showed high frequency of cognitive impairment. PMID:20025750

  13. CA-125 blood test

    MedlinePlus

    ... above 35 U/mL is considered abnormal. Normal value ranges may vary slightly among different laboratories. Some ... 125 usually does not mean ovarian cancer is present. Most healthy women with an elevated CA-125 ...

  14. 77 FR 217 - Medicare and Medicaid Programs: Hospital Outpatient Prospective Payment; Ambulatory Surgical...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-01-04

    ... Donald Howard, (410) 786-6764, Hospital Value-Based Purchasing (VBP) Program Issues. SUPPLEMENTARY... analyses performed by Brandeis University and Mathematica Policy Research together despite their slightly...

  15. Lateral Variations of Lg Coda Q in Southern Mexico

    NASA Astrophysics Data System (ADS)

    Yamamoto, J.; Quintanar, L.; Herrmann, R. B.; Fuentes, C.

    Broad band digital three-component data recorded at UNM, a GEOSCOPE station, were used to estimate Lg coda Q for 34 medium size (3.9 <=mb<= 6.3) earthquakes with travel paths laying in different geological provinces of southern Mexico in an effort to establish the possible existence of geological structures acting as wave guides and/or travel paths of low attenuation between the Pacific coast and the Valley of Mexico. The stacked spectral ratio method proposed by XIE and NUTTLI (1988) was chosen for computing the coda Q. The variation range of Q0 (Q at 1Hz) and the frequency dependence parameter η estimates averaged on the frequency interval of 0.5 to 2Hz for the regions and the three components considered are: i) Guerrero region 173 <=Q0<= 182 and 0.6 <=Q0<= 0.7, ii) Oaxaca region 183 <=Q0<= 198 and 0.6 <=Q0<= 0.8, iii) Michoacan-Jalisco region 187 <=Q0<= 204 and 0.7 <=Q0<= 0.8 and iv) eastern portion of the Transmexican Volcanic Belt (TMVB) 313 <=Q0<= 335 and η = 0.9. The results show a very high coda Q for the TMVB as compared to other regions of southern Mexico. This unexpected result is difficult to reconcile with the geophysical characteristics of the TMVB, e.g., low seismicity, high volcanic activity and high heat flow typical of a highly attenuating (low Q) region. Visual inspection of seismograms indicates that for earthquakes with seismic waves traveling along the TMVB, the amplitude decay of Lg coda is anomalously slow as compared to other earthquakes in southern Mexico. Thus, it seems that the high Q value found does not entirely reflect the attenuation characteristics of the TMVB but it is probably contaminated by a wave-guide effect. This phenomenon produces an enhancement in the time duration of the Lg wave trains travelling along this geological structure. This result is important to establish the role played by the transmission medium in the extremely long duration of ground motion observed during the September 19, 1985 Michoacan earthquake. The overall spatial distribution of coda Q values indicates that events with focus in the Michoacan-Jalisco and Oaxaca regions yield slightly higher values than those from Guerrero. This feature is more pronounced for the horizontal component of coda Q. A slight dependence of average coda Q-1 on earthquake focal depth is observed in the frequency range of 0.2 to 1.0Hz approximately on the horizontal component. Deeper (h > 50km) events yield lower values of Q-1 than shallower events. For frequencies higher than 1.0Hz no clear dependence of Q-1 on focal depth is observed. However, due to the estimates uncertainties this result is not clearly established.

  16. Fitness prospects: effects of age, sex and recruitment age on reproductive value in a long-lived seabird.

    PubMed

    Zhang, He; Rebke, Maren; Becker, Peter H; Bouwhuis, Sandra

    2015-01-01

    Reproductive value is an integrated measure of survival and reproduction fundamental to understanding life-history evolution and population dynamics, but little is known about intraspecific variation in reproductive value and factors explaining such variation, if any. By applying generalized additive mixed models to longitudinal individual-based data of the common tern Sterna hirundo, we estimated age-specific annual survival probability, breeding probability and reproductive performance, based on which we calculated age-specific reproductive values. We investigated effects of sex and recruitment age (RA) on each trait. We found age effects on all traits, with survival and breeding probability declining with age, while reproductive performance first improved with age before levelling off. We only found a very small, marginally significant, sex effect on survival probability, but evidence for decreasing age-specific breeding probability and reproductive performance with RA. As a result, males had slightly lower age-specific reproductive values than females, while birds of both sexes that recruited at the earliest ages of 2 and 3 years (i.e. 54% of the tern population) had somewhat higher fitness prospects than birds recruiting at later ages. While the RA effects on breeding probability and reproductive performance were statistically significant, these effects were not large enough to translate to significant effects on reproductive value. Age-specific reproductive values provided evidence for senescence, which came with fitness costs in a range of 17-21% for the sex-RA groups. Our study suggests that intraspecific variation in reproductive value may exist, but that, in the common tern, the differences are small. © 2014 The Authors. Journal of Animal Ecology © 2014 British Ecological Society.

  17. Identification of Phosphohistone H3 Cutoff Values Corresponding to Original WHO Grades but Distinguishable in Well-Differentiated Gastrointestinal Neuroendocrine Tumors.

    PubMed

    Kim, Min Jeong; Kwon, Mi Jung; Kang, Ho Suk; Choi, Kyung Chan; Nam, Eun Sook; Cho, Seong Jin; Park, Hye-Rim; Min, Soo Kee; Seo, Jinwon; Choe, Ji-Young; Park, Hyoung-Chul

    2018-01-01

    Mitotic counts in the World Health Organization (WHO) grading system have narrow cutoff values. True mitotic figures, however, are not always distinguishable from apoptotic bodies and darkly stained nuclei, complicating the ability of the WHO grading system to diagnose well-differentiated neuroendocrine tumors (NETs). The mitosis-specific marker phosphohistone H3 (PHH3) can identify true mitoses and grade tumors reliably. The aim of this study was to investigate the correspondence of tumor grades, as determined by PHH3 mitotic index (MI) and mitotic counts according to WHO criteria, and to determine the clinically relevant cutoffs of PHH3 MI in rectal and nonrectal gastrointestinal NETs. Mitotic counts correlated with both the Ki-67 labeling index and PHH3 MI, but the correlation with PHH3 MI was slightly higher. The PHH3 MI cutoff ≥4 correlated most closely with original WHO grades for both rectal NETs. A PHH3 MI cutoff ≥4, which could distinguish between G1 and G2 tumors, was associated with disease-free survival in patients with rectal NETs, whereas that cutoff value showed marginal significance for overall survival in patient with rectal NETs. In conclusion, the use of PHH3 ≥4 correlated most closely with original WHO grades.

  18. Identification of Phosphohistone H3 Cutoff Values Corresponding to Original WHO Grades but Distinguishable in Well-Differentiated Gastrointestinal Neuroendocrine Tumors

    PubMed Central

    Kim, Min Jeong; Kang, Ho Suk; Choi, Kyung Chan; Nam, Eun Sook; Cho, Seong Jin; Park, Hye-Rim; Seo, Jinwon; Choe, Ji-Young

    2018-01-01

    Mitotic counts in the World Health Organization (WHO) grading system have narrow cutoff values. True mitotic figures, however, are not always distinguishable from apoptotic bodies and darkly stained nuclei, complicating the ability of the WHO grading system to diagnose well-differentiated neuroendocrine tumors (NETs). The mitosis-specific marker phosphohistone H3 (PHH3) can identify true mitoses and grade tumors reliably. The aim of this study was to investigate the correspondence of tumor grades, as determined by PHH3 mitotic index (MI) and mitotic counts according to WHO criteria, and to determine the clinically relevant cutoffs of PHH3 MI in rectal and nonrectal gastrointestinal NETs. Mitotic counts correlated with both the Ki-67 labeling index and PHH3 MI, but the correlation with PHH3 MI was slightly higher. The PHH3 MI cutoff ≥4 correlated most closely with original WHO grades for both rectal NETs. A PHH3 MI cutoff ≥4, which could distinguish between G1 and G2 tumors, was associated with disease-free survival in patients with rectal NETs, whereas that cutoff value showed marginal significance for overall survival in patient with rectal NETs. In conclusion, the use of PHH3 ≥4 correlated most closely with original WHO grades. PMID:29780816

  19. Registered nurses' perceptions of rewarding and its significance.

    PubMed

    Seitovirta, Jaana; Lehtimäki, Aku-Ville; Vehviläinen-Julkunen, Katri; Mitronen, Lasse; Kvist, Tarja

    2017-11-07

    To examine reward type preferences and their relationships with the significance of rewarding perceived by registered nurses in Finland. Previous studies have found relationships between nurses' rewarding and their motivation at work, job satisfaction and organisational commitment. Data were collected in a cross-sectional, descriptive, questionnaire survey from 402 registered nurses using the Registered Nurses' Perceptions of Rewarding Scale in 2015, and analysed with descriptive and multivariate statistical methods. Registered nurses assigned slightly higher values to several non-financial than to financial rewards. The non-financial reward types appreciation and feedback from work community, worktime arrangements, work content, and opportunity to develop, influence and participate were highly related to the significance of rewarding. We identified various rewards that registered nurses value, and indications that providing an appropriate array of rewards, particularly non-financial rewards, is a highly beneficial element of nursing management. It is important to understand the value of rewards for nursing management. Nurse managers should offer diverse rewards to their registered nurses to promote excellent performance and to help efforts to secure and maintain high-quality, safe patient care. The use of appropriate rewards is especially crucial to improving registered nurses' reward satisfaction and job satisfaction globally in the nursing profession. © 2017 John Wiley & Sons Ltd.

  20. Core-shell structure of Miglyol/poly(D,L-lactide)/Poloxamer nanocapsules studied by small-angle neutron scattering.

    PubMed

    Rübe, Andrea; Hause, Gerd; Mäder, Karsten; Kohlbrecher, Joachim

    2005-10-03

    The contrast variation technique in small angle neutron scattering (SANS) was used to investigate the inner structure of nanocapsules on the example of poly(D,L-lactide) (PLA) nanocapsules. The determination of the PLA and Poloxamer shell thickness was the focus of this study. Highest sensitivity on the inner structure of the nanocapsules was obtained when the scattering length density of the solvent was varied between the one of the Miglyol core and the PLA shell. According to the fit data the PLA shell thickness was 9.8 nm. The z-averaged radius determined by SANS experiments correlated well with dynamic light scattering (DLS) results, although DLS values were systematically slightly higher than the ones measured by SANS. This could be explained by taking into account the influence of Poloxamer attached to the nanocapsules surface. For a refined fit model with a second shell consisting of Poloxamer, SANS values and DLS values fitted well with each other. The characterization method presented here is significant because detailed insights into the nanocapsule and the Poloxamer shell were gained for the first time. This method could be used to develop strategies for the optimization of the shell properties concerning controlled release and to study changes in the shell structure during degradation processes.

  1. Differential response of oyster shell powder on enzyme profile and nutritional value of oyster mushroom Pleurotus florida PF05.

    PubMed

    Naraian, Ram; Narayan, Om Prakash; Srivastava, Jatin

    2014-01-01

    Oyster mushroom Pleurotus florida was cultivated on different combinations of wheat straw (WS) as basal substrate and oyster shell powder (OSP) supplement. The OSP supplementation considerably responded to different cultivation phases. The mycelium grew fast and showed rapid growth rate (8.91 mmd(-1)) in WS + OSP (97 + 3) combination while WS + OSP (92 + 8) showed maximum laccase (3.133 U/g) and Mn peroxidase (MnP) activities (0.091 U/g). The climax level of laccase (5.433 U/g) and MnP (0.097 U/g) was recorded during fruit body initiation in WS + OSP (97 + 3) and WS + OSP (98 + 2) combinations, respectively. The WS + OSP (97 + 3) combination represented the best condition for mushroom cultivation and produced the highest biological efficiency (147%). In addition, protein and lipid contents in fruit bodies were slightly improved in response to OSP. The carbohydrate was significantly increased by raising concentration of OSP. The highest values of protein, carbohydrate, and lipid noted were 31.3 μg/g, 0.0639 (g/g), and 0.373 (g/g) correspondingly. Conclusively it was evident that lower concentrations of OSP acted positively and relatively to higher concentrations and improved nutritional content which may suitably be used to enhance both yield and nutritional values of mushroom.

  2. Effect of metallurgical structure and properties on adhesion and friction behavior of cobalt alloys

    NASA Technical Reports Server (NTRS)

    Keller, D. V., Jr.; Shatynski, S.; Vedamanikam, P. M.

    1972-01-01

    The metallurgical structure and some of the mechanical properties of two cobalt alloys, cobalt-50% iron and cobalt-25% molybdenum-10% chromium, were determined under various heat treated conditions. The mechanical properties of the bcc disordered Co-50Fe alloy, which was found to be very brittle, indicated an exceedingly low fracture strength, low hardness, and very weak grain boundary strength. Ordering by suitable heat treatment only produced a more brittle material with a lower fracture strength and a slightly higher hardness value. Work hardening was found to produce a finer grain structure and a greater grain boundary strength. Tensile properties were examined. It was found that the Co-25Mo-10Cr alloy was difficult to place in the alpha Co solid solution condition, which limited the ability to use precipitation as a hardening reaction. Over two hundred adhesion cycles from zero contact load, to maximum load, to fracture were conducted between couples for each of the above alloys in an ultrahigh vacuum system which would permit the sample surfaces to be cleaned of all contaminant layers. In the Co-50Fe case, the calculated fracture stress from the adhesion tests showed values in the range of 80 to 150 k.s.i., which is about ten times greater than the values from tension tests.

  3. Changes in UCP expression in tissues of Zucker rats fed diets with different protein content.

    PubMed

    Masanés, R M; Yubero, P; Rafecas, I; Remesar, X

    2002-09-01

    The effect of dietary protein content on the uncoupling proteins (UCP) 1, 2 and 3 expression in a number of tissues of Zucker lean and obese rats was studied. Thirty-day-old male Zucker lean (Fa/?) and obese (fa/fa) rats were fed on hyperproteic (HP, 30% protein), standard (RD, 17% protein) or hypoproteic (LP, 9% protein) diets ad libitum for 30 days. Although dietary protein intake affected the weights of individual muscles in lean and obese animals, these weights were similar. In contrast, huge differences were observed in brown adipose tissue (BAT) and liver weights. Lean rats fed on the LP diet generally increased UCP expression, whereas the HP group had lower values. Obese animals, HP and LP groups showed higher UCP expression in muscles, with slight differences in BAT and lower values for UCP3 in subcutaneous adipose tissue. The mean values of UCP expression in BAT of obese rats were lower than in their lean counterpart, whereas the expression in skeletal muscle was increased. Thus, expression of UCPs can be modified by dietary protein content, in lean and obese rats. A possible thermogenic function of UCP3 in muscle and WAT in obese rats must be taken into account.

  4. Comparison of lipids in organs of the starfish Asterias amurensis associated with different treatments

    NASA Astrophysics Data System (ADS)

    Wang, Qi; Ikegame, Keita; Takahashi, Koretaro; Xue, Changhu; Zhang, Weinong; Wang, Hongxun; Hou, Wenfu; Wang, Yuming

    2013-09-01

    Lipids were extracted from organs of the starfish Asterias amurensis associated with different treatments (raw-control, boiling and heating), and then analyzed for lipid content, lipid oxidation index, lipid classes and fatty acid composition. Results showed that boiling softened the hard starfish shells, thus facilitating the collection of starfish organs. As compared with raw organs, the boiled organs had lower water content and higher lipid content, possibly due to the loss of water-holding capacity caused by protein denaturation. Both boiling and heating increased the peroxide value (PV), thiobarbituric acid (TBA) value and carbon value (CV) of lipids. Despite slight increases in the content of complex lipids, associated lipid composition had no substantial variations upon boiling and heating. For simple lipids, the content of 1, 2-diglyceride decreased in boiled and heated organs, with free fatty acids observed on thin layer chromatography (TLC). However, neither boiling nor heating significantly changed the fatty acid compositions of simple or complex lipids in starfish organs, suggesting that these two treatments had no significant effects on complex lipids in starfish organs. Together, our results indicated that boiling of starfish soon after capture facilitated the handling and extraction of useful complex lipids consisting of abundant glucosylceramide and eicosapentaenoic acid (EPA)-bounded phospholipids.

  5. Vocal tract resonances in singing: The soprano voice

    NASA Astrophysics Data System (ADS)

    Joliveau, Elodie; Smith, John; Wolfe, Joe

    2004-10-01

    The vocal tract resonances of trained soprano singers were measured while they sang a range of vowels softly at different pitches. The measurements were made by broad band acoustic excitation at the mouth, which allowed the resonances of the tract to be measured simultaneously with and independently from the harmonics of the voice. At low pitch, when the lowest resonance frequency R1 exceeded f0, the values of the first two resonances R1 and R2 varied little with frequency and had values consistent with normal speech. At higher pitches, however, when f0 exceeded the value of R1 observed at low pitch, R1 increased with f0 so that R1 was approximately equal to f0. R2 also increased over this high pitch range, probably as an incidental consequence of the tuning of R1. R3 increased slightly but systematically, across the whole pitch range measured. There was no evidence that any resonances are tuned close to harmonics of the pitch frequency except for R1 at high pitch. The variations in R1 and R2 at high pitch mean that vowels move, converge, and overlap their positions on the vocal plane (R2,R1) to an extent that implies loss of intelligibility. .

  6. Porcelain surface conditioning protocols and shear bond strength of orthodontic brackets.

    PubMed

    Lestrade, Ashley M; Ballard, Richard W; Xu, Xiaoming; Yu, Qingzhao; Kee, Edwin L; Armbruster, Paul C

    2016-05-01

    The objective of the present study was to determine which of six bonding protocols yielded a clinically acceptable shear bond strength (SBS) of metal orthodontic brackets to CAD/CAM lithium disilicate porcelain restorations. A secondary aim was to determine which bonding protocol produced the least surface damage at debond. Sixty lithium disilicate samples were fabricated to replicate the facial surface of a mandibular first molar using a CEREC CAD/CAM machine. The samples were split into six test groups, each of which received different mechanical/chemical pretreatment protocols to roughen the porcelain surface prior to bonding a molar orthodontic attachment. Shear bond strength testing was conducted using an Instron machine. The mean, maximum, minimal, and standard deviation SBS values for each sample group including an enamel control were calculated. A t-test was used to evaluate the statistical significance between the groups. No significant differences were found in SBS values, with the exception of surface roughening with a green stone prior to HFA and silane treatment. This protocol yielded slightly higher bond strength which was statistically significant. Chemical treatment alone with HFA/silane yielded SBS values within an acceptable clinical range to withstand forces applied by orthodontic treatment and potentially eliminates the need to mechanically roughen the ceramic surface.

  7. Adolescent Self-Esteem: Differences by Race/Ethnicity, Gender, and Age

    PubMed Central

    Bachman, Jerald G.; O’Malley, Patrick M.; Freedman-Doan, Peter; Trzesniewski, Kali H.; Donnellan, M. Brent

    2012-01-01

    Large-scale representative surveys of 8th-, 10th-, and 12th-grade students in the United States show high self-esteem scores for all groups. African-American students score highest, Whites score slightly higher than Hispanics, and Asian Americans score lowest. Males score slightly higher than females. Multivariate controls for grades and college plans actually heighten these race/ethnic/gender differences. A truncated scoring method, designed to counter race/ethnic differences in extreme response style, reduced but did not eliminate the subgroup differences. Age differences in self-esteem are modest, with 12th graders reporting the highest scores. The findings are highly consistent across 18 annual surveys from 1991 through 2008, and self-esteem scores show little overall change during that period. PMID:22279425

  8. Nitroblue tetrazolium test

    MedlinePlus

    ... infections. Normal value ranges may vary slightly from one lab to another. Talk to your doctor about the meaning of your test results. What Abnormal Results Mean If the sample does not change color when NBT is added, ...

  9. Burnout in Hospital Social Workers Who Work with AIDS Patients.

    ERIC Educational Resources Information Center

    Oktay, Julianne S.

    1992-01-01

    Surveyed 128 hospital social workers who worked with Acquired Immune Deficiency Syndrome (AIDS) patients. Found that hospital AIDS social workers had slightly higher rates of emotional exhaustion and depersonalization on Maslach Burnout Inventory but also felt substantially higher level of personal accomplishment. Age, autonomy, and belonging to…

  10. Documentation of Criteria for Promotion in a Higher Education Broadcast Journalism Discipline.

    ERIC Educational Resources Information Center

    Reppert, James E.

    All institutions of higher learning have slightly different techniques of promoting and tenuring their faculty. The author compiled this document to provide resourceful pointers to future Broadcast Journalism and Mass Communication professors in the writing and organization of their applications. This collection of materials traces one tenured…

  11. Global Longitudinal Strain to Predict Mortality in Patients With Acute Heart Failure.

    PubMed

    Park, Jin Joo; Park, Jun-Bean; Park, Jae-Hyeong; Cho, Goo-Yeong

    2018-05-08

    Heart failure (HF) is currently classified according to left ventricular ejection fraction (LVEF); however, the prognostic value of LVEF is controversial. Myocardial strain is a prognostic factor independently of LVEF. The authors sought to evaluate the prognostic value of global longitudinal strain (GLS) in patients with HF. GLS was measured in 4,172 consecutive patients with acute HF. Patients were categorized as either HF with reduced (LVEF <40%), midrange (LVEF 40% to 49%), or preserved ejection fraction (LVEF ≥50%) and were also classified as having mildly (GLS >12.6%), moderately (8.1% < GLS <12.5%), or severely (GLS ≤8.0%) reduced strain. The primary endpoint was 5-year all-cause mortality. Mean GLS was 10.8%, and mean LVEF was 40%. Overall, 1,740 (40.4%) patients had died at 5 years. Patients with reduced ejection fraction had slightly higher mortality than those with midrange or preserved ejection fraction (41%, 38%, and 39%, respectively; log-rank p = 0.031), whereas patients with reduced strain had significantly higher mortality (severely reduced GLS, 49%; moderately reduced GLS, 38%; mildly reduced GLS, 34%; log-rank p < 0.001). In multivariable analysis, each 1% increase in GLS was associated with a 5% decreased risk for mortality (p < 0.001). Patients with moderate (hazard ratio: 1.31; 95% confidence interval: 1.13 to 1.53) and severe GLS reductions (hazard ratio: 1.61; 95% confidence interval: 1.36 to 1.91) had higher mortality, but LVEF was not associated with mortality. In patients with acute HF, GLS has greater prognostic value than LVEF. Therefore, the authors suggest that GLS should be considered as the standard measurement in all patients with HF. This new concept needs validation in further studies. Copyright © 2018 American College of Cardiology Foundation. Published by Elsevier Inc. All rights reserved.

  12. Identifying carbon sources and trophic position of coral reef fishes using diet and stable isotope (δ15N and δ13C) analyses in two contrasted bays in Moorea, French Polynesia

    NASA Astrophysics Data System (ADS)

    Letourneur, Y.; Lison de Loma, T.; Richard, P.; Harmelin-Vivien, M. L.; Cresson, P.; Banaru, D.; Fontaine, M.-F.; Gref, T.; Planes, S.

    2013-12-01

    Stable isotope ratios (δ15N and δ13C) and diet of three fish species, Stegastes nigricans, Chaetodon citrinellus and Epinephelus merra, were analyzed on the fringing coral reefs of two bays that are differentially exposed to river runoff on Moorea Island, French Polynesia. S. nigricans and C. citrinellus relied mostly on turf algae and presented similar trophic levels and δ15N values, whereas E. merra fed on large invertebrates (crabs and shrimps) and had higher trophic levels and δ15N values. Discrepancies existed between stomach content and stable isotope analyses for the relative importance of food items. Bayesian mixing models indicated that sedimented organic matter was also an important additional food for S. nigricans and C. citrinellus, and fishes for E. merra. The main sources of organic matter involved in the food webs ending with these species were algal turfs and surface sediments, while water particulate organic matter was barely used. Significant spatial differences in C and N isotopic ratios for sources and fishes were found within and between bays. Lower 13C and higher 15N values were observed for various compartments of the studied trophic network at the end of each bay than at the entrance. Differences were observed between bays, with organic sources and consumers being, on average, slightly more 13C-depleted and 15N-enriched in Cook's Bay than in Opunohu Bay, linked with a higher mean annual flow of the river at Cook's Bay. Our results suggest that rivers bring continental material into these two bays, which is partly incorporated into the food webs of fringing coral reefs at least close to river mouths. Thus, continental inputs can influence the transfer of organic matter within coral reef food webs depending on the diet of organisms.

  13. Morphology and Molecular Mechanisms of Hepatic Injury in Rats under Simulated Weightlessness and the Protective Effects of Resistance Training.

    PubMed

    Du, Fang; Ding, Ye; Zou, Jun; Li, Zhili; Tian, Jijing; She, Ruiping; Wang, Desheng; Wang, Huijuan; Lv, Dongqiang; Chang, Lingling

    2015-01-01

    This study investigated the effects of long-term simulated weightlessness on liver morphology, enzymes, glycogen, and apoptosis related proteins by using two-month rat-tail suspension model (TS), and liver injury improvement by rat-tail suspension with resistance training model (TS&RT). Microscopically the livers of TS rats showed massive granular degeneration, chronic inflammation, and portal fibrosis. Mitochondrial and endoplasmic reticulum swelling and loss of membrane integrity were observed by transmission electron microscopy (TEM). The similar, but milder, morphological changes were observed in the livers of TS&RT rats. Serum biochemistry analysis revealed that the levels of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) were significantly higher (p<0.05) in TS rats than in controls. The levels of ALT and AST in TS&RT rats were slightly lower than in RT rats, but they were insignificantly higher than in controls. However, both TS and TS&RT rats had significantly lower levels (p<0.05) of serum glucose and hepatic glycogen than in controls. Immunohistochemistry demonstrated that the expressions of Bax, Bcl-2, and active caspase-3 were higher in TS rats than in TS&RT and control rats. Real-time polymerase chain reaction (real-time PCR) showed that TS rats had higher mRNA levels (P < 0.05) of glucose-regulated protein 78 (GRP78) and caspase-12 transcription than in control rats; whereas mRNA expressions of C/EBP homologous protein (CHOP) and c-Jun N-terminal kinase (JNK) were slightly higher in TS rats. TS&RT rats showed no significant differences of above 4 mRNAs compared with the control group. Our results demonstrated that long-term weightlessness caused hepatic injury, and may trigger hepatic apoptosis. Resistance training slightly improved hepatic damage.

  14. Morphology and Molecular Mechanisms of Hepatic Injury in Rats under Simulated Weightlessness and the Protective Effects of Resistance Training

    PubMed Central

    Zou, Jun; Li, Zhili; Tian, Jijing; She, Ruiping; Wang, Desheng; Wang, Huijuan; Lv, Dongqiang; Chang, Lingling

    2015-01-01

    This study investigated the effects of long-term simulated weightlessness on liver morphology, enzymes, glycogen, and apoptosis related proteins by using two-month rat-tail suspension model (TS), and liver injury improvement by rat-tail suspension with resistance training model (TS&RT). Microscopically the livers of TS rats showed massive granular degeneration, chronic inflammation, and portal fibrosis. Mitochondrial and endoplasmic reticulum swelling and loss of membrane integrity were observed by transmission electron microscopy (TEM). The similar, but milder, morphological changes were observed in the livers of TS&RT rats. Serum biochemistry analysis revealed that the levels of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) were significantly higher (p<0.05) in TS rats than in controls. The levels of ALT and AST in TS&RT rats were slightly lower than in RT rats, but they were insignificantly higher than in controls. However, both TS and TS&RT rats had significantly lower levels (p<0.05) of serum glucose and hepatic glycogen than in controls. Immunohistochemistry demonstrated that the expressions of Bax, Bcl-2, and active caspase-3 were higher in TS rats than in TS&RT and control rats. Real-time polymerase chain reaction (real-time PCR) showed that TS rats had higher mRNA levels (P < 0.05) of glucose-regulated protein 78 (GRP78) and caspase-12 transcription than in control rats; whereas mRNA expressions of C/EBP homologous protein (CHOP) and c-Jun N-terminal kinase (JNK) were slightly higher in TS rats. TS&RT rats showed no significant differences of above 4 mRNAs compared with the control group. Our results demonstrated that long-term weightlessness caused hepatic injury, and may trigger hepatic apoptosis. Resistance training slightly improved hepatic damage. PMID:26000905

  15. Chlorophyll fluorescence lifetime imaging provides new insight into the chlorosis induced by plant virus infection.

    PubMed

    Lei, Rong; Jiang, Hongshan; Hu, Fan; Yan, Jin; Zhu, Shuifang

    2017-02-01

    Leaf chlorosis induced by plant virus infection has a short fluorescence lifetime, which reflects damaged photosynthetic complexes and degraded chloroplasts. Plant viruses often induce chlorosis and necrosis, which are intimately related to photosynthetic functions. Chlorophyll fluorescence lifetime measurement is a valuable noninvasive tool for analyzing photosynthetic processes and is a sensitive indicator of the environment surrounding the fluorescent molecules. In this study, our central goal was to explore the effect of viral infection on photosynthesis by employing chlorophyll fluorescence lifetime imaging (FLIM), steady-state fluorescence, non-photochemical quenching (NPQ), transmission electron microscopy (TEM), and pigment analysis. The data indicated that the chlorophyll fluorescence lifetime of chlorotic leaves was significantly shorter than that of healthy control leaves, and the fitted short lifetime component of chlorophyll fluorescence of chlorotic leaves was dominant. This dominant short lifetime component may result from damage to the structure of thylakoid, which was confirmed by TEM. The NPQ value of chlorotic leaves was slightly higher than that of healthy green leaves, which can be explained by increased neoxanthin, lutein and violaxanthin content relative to chlorophyll a. The difference in NPQ is slight, but FLIM can provide simple and direct characterization of PSII structure and photosynthetic function. Therefore, this technique shows great potential as a simple and rapid method for studying mechanisms of plant virus infection.

  16. Comparison of size modulation and conventional standard automated perimetry with the 24-2 test protocol in glaucoma patients

    NASA Astrophysics Data System (ADS)

    Hirasawa, Kazunori; Shoji, Nobuyuki; Kasahara, Masayuki; Matsumura, Kazuhiro; Shimizu, Kimiya

    2016-05-01

    This prospective randomized study compared test results of size modulation standard automated perimetry (SM-SAP) performed with the Octopus 600 and conventional SAP (C-SAP) performed with the Humphrey Field Analyzer (HFA) in glaucoma patients. Eighty-eight eyes of 88 glaucoma patients underwent SM-SAP and C-SAP tests with the Octopus 600 24-2 Dynamic and HFA 24-2 SITA-Standard, respectively. Fovea threshold, mean defect, and square loss variance of SM-SAP were significantly correlated with the corresponding C-SAP indices (P < 0.001). The false-positive rate was slightly lower, and false-negative rate slightly higher, with SM-SAP than C-SAP (P = 0.002). Point-wise threshold values obtained with SM-SAP were moderately to strongly correlated with those obtained with C-SAP (P < 0.001). The correlation coefficients of the central zone were significantly lower than those of the middle to peripheral zone (P = 0.031). The size and depth of the visual field (VF) defect were smaller (P = 0.039) and greater (P = 0.043), respectively, on SM-SAP than on C-SAP. Although small differences were observed in VF sensitivity in the central zone, the defect size and depth and the reliability indices between SM-SAP and C-SAP, global indices of the two testing modalities were well correlated.

  17. Diagnostic performance of dual-staining cytology for cervical cancer screening: A systematic literature review.

    PubMed

    Tjalma, Wiebren A A

    2017-03-01

    Cervical cancer screening saves lives. Secondary prevention in cervical cancer screening relies on the results of primary cytology and/or HPV testing. However, primary screening with cytology has a low sensitivity, and HPV screening has a low specificity. This means that either cancers are missed, or women are over-treated. To improve performance outcomes, the concept of dual-stain cytology (CINtec ® PLUS Cytology test) has been introduced. In this approach, additional staining with p16/Ki-67 is performed in cases where cytology results are abnormal (LSIL or ASCUS) and/or HPV-positive. Another way to describe this approach might be "diagnostic" cytology. In order to assess the value of this "diagnostic cytology", a systematic literature review was conducted of dual-stain cytology performance across multiple studies until May 2016. In a Belgian screening population (women age 25-65 years), dual-stain cytology was significantly more sensitive (66%) and slightly less specific (-1.0%) than cytology. In the population referred to colposcopy or with abnormal cytology (ASCUS, LSIL), dual-staining showed a significantly higher increase in specificity, and a slightly lower sensitivity than HPV testing. Specificity gains resulted in fewer false positives and an increase in the number of correct referrals to colposcopy. Dual-staining with p16/Ki-67 cytology is an attractive biomarker approach for triage in cervical cancer screening. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Nurses' Perspectives on the Geriatric Nursing Practice Environment and the Quality of Older People's Care in Ontario Acute Care Hospitals.

    PubMed

    Fox, Mary T; Sidani, Souraya; Butler, Jeffrey I; Tregunno, Deborah

    2017-06-01

    Background Cultivating hospital environments that support older people's care is a national priority. Evidence on geriatric nursing practice environments, obtained from studies of registered nurses (RNs) in American teaching hospitals, may have limited applicability to Canada, where RNs and registered practical nurses (RPNs) care for older people in predominantly nonteaching hospitals. Purpose This study describes nurses' perceptions of the overall quality of care for older people and the geriatric nursing practice environment (geriatric resources, interprofessional collaboration, and organizational value of older people's care) and examines if these perceptions differ by professional designation and hospital teaching status. Methods A cross-sectional survey, using Dillman's tailored design, that included Geriatric Institutional Assessment Profile subscales, was completed by 2005 Ontario RNs and registered practical nurses to assess their perceptions of the quality of care and geriatric nursing practice environment. Results Scores on the Geriatric Institutional Assessment Profile subscales averaged slightly above the midpoint except for geriatric resources which was slightly below. Registered practical nurses rated the quality of care and geriatric nursing practice environment higher than RNs; no significant differences were found by hospital teaching status. Conclusions Nurses' perceptions of older people's care and the geriatric nursing practice environment differ by professional designation but not hospital teaching status. Teaching and nonteaching hospitals should both be targeted for geriatric nursing practice environment improvement initiatives.

  19. Possibility of using waste tire rubber and fly ash with Portland cement as construction materials.

    PubMed

    Yilmaz, Arin; Degirmenci, Nurhayat

    2009-05-01

    The growing amount of waste rubber produced from used tires has resulted in an environmental problem. Recycling waste tires has been widely studied for the last 20 years in applications such as asphalt pavement, waterproofing systems and membrane liners. The aim of this study is to evaluate the feasibility of utilizing fly ash and rubber waste with Portland cement as a composite material for masonry applications. Class C fly ash and waste automobile tires in three different sizes were used with Portland cement. Compressive and flexural strength, dry unit weight and water absorption tests were performed on the composite specimens containing waste tire rubber. The compressive strength decreased by increasing the rubber content while increased by increasing the fly ash content for all curing periods. This trend is slightly influenced by particle size. For flexural strength, the specimens with waste tire rubber showed higher values than the control mix probably due to the effect of rubber fibers. The dry unit weight of all specimens decreased with increasing rubber content, which can be explained by the low specific gravity of rubber particles. Water absorption decreased slightly with the increase in rubber particles size. These composite materials containing 10% Portland cement, 70% and 60% fly ash and 20% and 30% tire rubber particles have sufficient strength for masonry applications.

  20. Chemical abundances of globular clusters in NGC 5128 (Centaurus A)

    NASA Astrophysics Data System (ADS)

    Hernandez, Svea; Larsen, Søren; Trager, Scott; Kaper, Lex; Groot, Paul

    2018-06-01

    We perform a detailed abundance analysis on integrated-light spectra of 20 globular clusters (GCs) in the early-type galaxy NGC 5128 (Centaurus A). The GCs were observed with X-Shooter on the Very Large Telescope (VLT). The cluster sample spans a metallicity range of -1.92 < [Fe/H] < -0.13 dex. Using theoretical isochrones, we compute synthetic integrated-light spectra and iterate the individual abundances until the best fit to the observations is obtained. We measured abundances of Mg, Ca, and Ti, and find a slightly higher enhancement in NGC 5128 GCs with metallicities [Fe/H] < -0.75 dex, of the order of ˜0.1 dex, than in the average values observed in the Milky Way (MW) for GCs of the same metallicity. If this α-enhancement in the metal-poor GCs in NGC 5128 is genuine, it could hint at a chemical enrichment history different than that experienced by the MW. We also measure Na abundances in 9 out of 20 GCs. We find evidence for intracluster abundance variations in six of these clusters where we see enhanced [Na/Fe] > +0.25 dex. We obtain the first abundance measurements of Cr, Mn, and Ni for a sample of the GC population in NGC 5128 and find consistency with the overall trends observed in the MW, with a slight enhancement (<0.1 dex) in the Fe-peak abundances measured in the NGC 5128.

  1. [Chemical composition and daily variation of melt water during ablation season in monsoonal temperate Glacier region: a case study of Baishui Glacier No. 1].

    PubMed

    Zhu, Guo-Feng; Pu, Tao; He, Yuan-Qing; Wang, Pei-Zhen; Kong, Jian-Long; Zhang, Ning-Ning; Xin, Hui-Juan

    2012-12-01

    Melt water samples collected continuously from 29 August to 3 September 2009 in the Baishui Glacier No. 1 at elevation of 4750 m were analyzed for pH, conductivity, delta18O and inorganic ions. The results showed that the pH had obvious diurnal variations and was increased slightly by the influence of precipitation. The dissolution of alkaline soluble salts in the dust was the main reason for the increase of melt water conductivity; the value of delta18O was relatively low in strong ablation period and high in slight ablation period. Different from other research areas, the concentrations of Na+, K+, which were influenced by lithological and marine water vapor, were higher than that of Mg2+ in the study area; HCO3- and Ca2+ accounted for more than 80% of total ions in snow and ice melt water, indicating that the ions mainly came from limestone and the melt water was a typical carbonate solution; The content of melt water had an obvious daily change with temperature change, but the response amplitudes were different; Monsoon transport, local rock lithology, human industrial and agricultural activities were the main sources of inorganic ions and the deciding factors of the ion composition in the Baishui Glacier No. 1.

  2. Toenail selenium as an indicator of environmental exposure: A cross-sectional study.

    PubMed

    Filippini, Tommaso; Ferrari, Angela; Michalke, Bernhard; Grill, Peter; Vescovi, Luciano; Salvia, Chiara; Malagoli, Carlotta; Malavolti, Marcella; Sieri, Sabina; Krogh, Vittorio; Bargellini, Annalisa; Martino, Antonio; Ferrante, Margherita; Vinceti, Marco

    2017-05-01

    The relation between toxicity and essentiality of selenium (Se) is of growing interest in human health, as the effects may widely differ depending of its different chemical species and the exposure levels. Toenail Se has been proposed as a reliable biomarker of long-term Se exposure, but few studies investigated the correlation between its toenail content and environmental determinants (i.e., dietary food intake). We aimed to determine the relation of toenail Se levels with serum Se species as well as food items. We recruited a random sample of Modena (Northern Italy) municipal residents, from whom we collected detailed personal information, dietary habits, toenail specimen for Se determination and a blood sample for serum Se speciation analysis. Toenail Se mean value was 0.96 µg/g (range, 0.47‑1.60), with slightly higher levels in females, in non-obese subjects and in Se supplements users, while it was lower in current smokers. Toenail Se positively correlated with organic Se forms, mainly selenoprotein P and selenocysteine, and inversely with the inorganic forms (selenite and selenate). Toenail Se was not associated with meat, cereals and dairy products consumption, positively correlated with fruit and slightly with vegetable intake, and negatively with fish and seafood consumption. Finally, no clear association emerged with estimated air Se exposure.

  3. Fermented pigeon pea (Cajanus cajan) ingredients in pasta products.

    PubMed

    Torres, Alexia; Frias, J; Granito, M; Vidal-Valverde, C

    2006-09-06

    Pigeon pea (Cajanus cajan var. aroíto) seeds were fermented in order to remove antinutritional factors and to obtain functional legume flour to be used as pasta ingredients. Fermentation brought about a drastic reduction of alpha-galactosides (82%), phytic acid (48%), and trypsin inhibitor activity (39%). Fermented legume flours presented a notable increase of fat and total soluble available carbohydrates, a slight decrease of protein, dietary fiber, calcium, vitamin B2, vitamin E, and total antioxidant capacity, and a decrease of soluble dietary fiber, Na, K, Mg, and Zn contents. No changes were observed in the level of starch and tannins as a consequence of fermentation. The fermented flour was used as an ingredient to make pasta products in a proportion of 5, 10, and 12%. The supplemented pasta products obtained had longer cooking times, higher cooking water absorptions, higher cooking loss, and higher protein loss in water than control pasta (100% semolina). From sensory evaluations, fortified pasta with 5 and 10% fermented pigeon pea flour had an acceptability score similar to control pasta. Pasta supplemented with 10% fermented pigeon pea flour presented higher levels of protein, fat, dietary fiber, mineral, vitamin E, and Trolox equivalent antioxidant capacity than 100% semolina pasta and similar vitamins B1 and B2 contents. Protein efficiency ratios and true protein digestibility improved (73 and 6%, respectively) after supplementation with 10% fermented pigeon pea flour; therefore, the nutritional value was enhanced.

  4. Forskolin- and dihydroalprenolol (DHA) binding sites and adenylate cyclase activity in heart of rats fed diets containing different oils

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Alam, S.Q.; Ren, Y.F.; Alam, B.S.

    1987-05-01

    The purpose of the present investigation was to determine if dietary lipids can induce changes in the adenylate cyclase system in rat heart. Three groups of male young Sprague-Dawley rats were fed for 6 weeks diets containing 10% corn oil (I), 8% coconut oil + 2% corn oil (II) or 10% menhaden oil (III). Adenylate cyclase activity (basal, fluoride-, isoproterenol-, and forskolin-stimulated) was higher in heart homogenates of rats in group III than in the other two groups. Concentration of the (/sup 3/H)-forskolin binding sites in the cardiac membranes were significantly higher in rats fed menhaden oil. The values (pmol/mgmore » protein) were 4.8 +/- 0.2 (I), 4.5 +/- 0.7 (II) and 8.4 +/- 0.5 (III). There was no significant difference in the affinity of the forskolin binding sites among the 3 dietary groups. When measured at different concentrations of forskolin, the adenylate cyclase activity in cardiac membranes of rats fed menhaden oil was higher than in the other 2 groups. Concentrations of the (/sup 3/H)DHA binding sites were slightly higher but their affinity was lower in cardiac membranes of rats fed menhaden oil. The results suggest that diets containing fish oil increase the concentration of the forskolin binding sites and may also affect the characteristics of the ..beta..-adrenergic receptor in rat heart.« less

  5. A Prospective Follow-Up of Adipocytokines in Cohort Patients With Gout: Association With Metabolic Syndrome But Not With Clinical Inflammatory Findings

    PubMed Central

    García-Méndez, Sergio; Rivera-Bahena, Carolina Bustos; Montiel-Hernández, José Luis; Xibillé-Friedmann, Daniel; Álvarez-Hernández, Everardo; Peláez-Ballestas, Ingris; Burgos-Vargas, Rubén; Vázquez-Mellado, Janitzia

    2015-01-01

    Abstract The aim of this study was to determine the levels of leptin (Lep) and adiponectin (AdipoQ) in patients with gout and its relationship with joint inflammatory data and/or with metabolic syndrome (MetS) variables, during 1 year follow-up. Forty-one patients (40 males) with gout diagnosis, attending for the first time to a rheumatology department, were included. Evaluations were performed baseline, at 6 and 12 months. Variables included the following: demographic, clinical and laboratory data related to gout and associated diseases. Lep and AdipoQ determinations by the ELISA method were performed in frozen serum from each visit. The pharmacological and no-pharmacological treatment for gout and associated diseases was individualized for each patient according to published guidelines. Statistical analysis included Mann–Whitney U test, Fisher test, x2, ANOVA, Cochran Q, Pearson and Spearman correlation tests, as well as linear regression. In the baseline evaluation, 29.2% had MetS (hypertriglyceridemia 66%, hypertension 44% and obesity 37%); patients with MetS had higher C reactive protein (CRP) levels [34.1 ± 28.6 vs. 12.2 ± 11.2 mg/dL, P = 0.033]. Although not significant, also had higher Lep and lower AdipoQ levels (3.2 ± 3.0 vs. 1.9 ± 1.2 ng/mL, P = 0.142 and 40.5 ± 26.8 vs. 38.0 ± 24.9 ng/mL, P = 0.877, respectively). During follow-up, our patients had significant improvement in serum uric acid (sUA) levels and variables evaluating pain and joint swelling (P ≤ 0.05). Metabolic abnormalities tended to persist or even worsen during the monitoring period: significant increase in total cholesterol (P = 0.004), tendency to higher triglycerides (P = 0.883) and slight improvement in glycaemia (P = 0.052). Lep values increased significantly during follow-up (P = 0.001) while AdipoQ levels diminished slightly (P = 0.317). Neither Lep nor AdipoQ values showed important correlation (r > 0.5) with metabolic variables or joint swelling. This study suggests that in patients with gout, concentrations of Lep and AdipoQ are more in line with the metabolic state than with clinical disease activity. PMID:26131838

  6. Coccidioides complement fixation

    MedlinePlus

    ... antibodies are detected in the blood sample. Normal value ranges may vary slightly among different laboratories. Some labs use different measurements or test different samples. Talk to your health care provider about the meaning of your specific test results.

  7. Albumin - blood (serum)

    MedlinePlus

    The normal range is 3.4 to 5.4 g/dL (34 to 54 g/L). Normal value ranges may vary slightly among different laboratories. Some labs use different measurements or test different samples. Talk to your provider about ...

  8. The Motivational Value Systems Questionnaire (MVSQ): Psychometric Analysis Using a Forced Choice Thurstonian IRT Model

    PubMed Central

    Merk, Josef; Schlotz, Wolff; Falter, Thomas

    2017-01-01

    This study presents a new measure of value systems, the Motivational Value Systems Questionnaire (MVSQ), which is based on a theory of value systems by psychologist Clare W. Graves. The purpose of the instrument is to help people identify their personal hierarchies of value systems and thus become more aware of what motivates and demotivates them in work-related contexts. The MVSQ is a forced-choice (FC) measure, making it quicker to complete and more difficult to intentionally distort, but also more difficult to assess its psychometric properties due to ipsativity of FC data compared to rating scales. To overcome limitations of ipsative data, a Thurstonian IRT (TIRT) model was fitted to the questionnaire data, based on a broad sample of N = 1,217 professionals and students. Comparison of normative (IRT) scale scores and ipsative scores suggested that MVSQ IRT scores are largely freed from restrictions due to ipsativity and thus allow interindividual comparison of scale scores. Empirical reliability was estimated using a sample-based simulation approach which showed acceptable and good estimates and, on average, slightly higher test-retest reliabilities. Further, validation studies provided evidence on both construct validity and criterion-related validity. Scale score correlations and associations of scores with both age and gender were largely in line with theoretically- and empirically-based expectations, and results of a multitrait-multimethod analysis supports convergent and discriminant construct validity. Criterion validity was assessed by examining the relation of value system preferences to departmental affiliation which revealed significant relations in line with prior hypothesizing. These findings demonstrate the good psychometric properties of the MVSQ and support its application in the assessment of value systems in work-related contexts. PMID:28979228

  9. The Motivational Value Systems Questionnaire (MVSQ): Psychometric Analysis Using a Forced Choice Thurstonian IRT Model.

    PubMed

    Merk, Josef; Schlotz, Wolff; Falter, Thomas

    2017-01-01

    This study presents a new measure of value systems, the Motivational Value Systems Questionnaire (MVSQ), which is based on a theory of value systems by psychologist Clare W. Graves. The purpose of the instrument is to help people identify their personal hierarchies of value systems and thus become more aware of what motivates and demotivates them in work-related contexts. The MVSQ is a forced-choice (FC) measure, making it quicker to complete and more difficult to intentionally distort, but also more difficult to assess its psychometric properties due to ipsativity of FC data compared to rating scales. To overcome limitations of ipsative data, a Thurstonian IRT (TIRT) model was fitted to the questionnaire data, based on a broad sample of N = 1,217 professionals and students. Comparison of normative (IRT) scale scores and ipsative scores suggested that MVSQ IRT scores are largely freed from restrictions due to ipsativity and thus allow interindividual comparison of scale scores. Empirical reliability was estimated using a sample-based simulation approach which showed acceptable and good estimates and, on average, slightly higher test-retest reliabilities. Further, validation studies provided evidence on both construct validity and criterion-related validity. Scale score correlations and associations of scores with both age and gender were largely in line with theoretically- and empirically-based expectations, and results of a multitrait-multimethod analysis supports convergent and discriminant construct validity. Criterion validity was assessed by examining the relation of value system preferences to departmental affiliation which revealed significant relations in line with prior hypothesizing. These findings demonstrate the good psychometric properties of the MVSQ and support its application in the assessment of value systems in work-related contexts.

  10. Influence of climate and geography on the occurrence of Legionella and amoebae in composting facilities.

    PubMed

    Conza, Lisa; Casati Pagani, Simona; Gaia, Valeria

    2014-11-24

    The incidence of Legionnaires' disease (LD) in southern Switzerland is three times higher than in northern Switzerland. Climatic and geographic factors may be potential causes for this difference.We studied the prevalence of Legionella and free-living amoebae (FLA) in compost and bioaerosol in two Swiss regions to understand the role of climate and geography in the transmission of LD. We also tried to investigate whether or not compost storage duration would influence the composition of Legionella and FLA communities. A larger proportion of compost heaps in facilities from southern Switzerland harbor more diverse Legionella compared to the north (P=0.0146). FLA were isolated from composts in northern facilities at slightly higher rates (88.2% vs. 69.2%) and at lower rates from bioaerosols (6.3% vs. 13%) than in southern Switzerland. The diversity of FLA was higher in northern than in southern Switzerland (80% vs. 65%). A general decrease in the presence and variety of species was observed with decreasing compost storage time length. A discriminant model showed that values of vapour pressure, relative humidity and temperature distinguish the two regions, which were also characterised by different contamination rates by FLA and Legionella. The duration of outdoor storage may favour contamination of the compost by Legionella, and may increase the number and isolation of Legionella naturally occurring in compost. The climate in the south seems to favour higher Legionella contamination of compost heaps: this could explain the higher incidence of LD in southern Switzerland.

  11. A novel method for preparation of high dense tetragonal Li7La3Zr2O12

    NASA Astrophysics Data System (ADS)

    Zhao, Pengcheng; Wen, Yuehua; Cheng, Jie; Cao, Gaoping; Jin, Zhaoqing; Ming, Hai; Xu, Yan; Zhu, Xiayu

    2017-03-01

    For conventional preparation methods of Li7La3Zr2O12 (LLZO) solid state electrolytes, there is a stereotype that higher density always comes from higher pressure enforced upon the LLZO pellets. In this paper, a different way with an auto-consolidation mechanism is provided and discussed. No pressing operations are employed during the whole preparation process. Due to the surface tension of liquid melted Li2O at sintering temperature, LLZO particles could aggregate together freely and automatically. The preparation process for dense LLZO is greatly simplified. A dense tetragonal LLZO with high relative density about 93% has been prepared successfully by this auto-consolidation method. And there are no voids observed in the SEM images. At 30 °C, the total conductivity is about 5.67 × 10-5 S cm-1, which is the highest one for tetragonal LLZO in the reported issues, even two times higher than that prepared by hot-pressing method. The activation energy for total conductivity is ∼0.35 eV atom-1 at 30-120 °C, slightly lower than the previous reported values. This work sheds light on the understanding of the consolidation mechanism for solid electrolytes and suggests a reliable route to syhthesize cemanic solid electrolytes.

  12. Assessment of geochemical mobility of metals in surface sediments of the Santa Rosalia mining region, Western Gulf of California.

    PubMed

    Shumilin, Evgueni; Gordeev, Vyacheslav; Figueroa, Griselda Rodríguez; Demina, Liudmila; Choumiline, Konstantin

    2011-01-01

    To asses the geomobility of cadmium, copper, iron, manganese, nickel, lead, and zinc in marine sediments near the Santa Rosalía copper smelter, which is located on the eastern coast of the Baja California Peninsula, sequential leaching was applied to sediment samples containing different levels of Cu: (1) uncontaminated or slightly contaminated (<55 mg kg⁻¹ Cu); (2) moderately contaminated (55-500 mg kg⁻¹ Cu); and (3) heavily contaminated (>500 mg kg⁻¹ Cu). Concentrations of Cd, Cu, Fe, Mn, Ni, Pb, and Zn in four fractions of the leachate (mobile fraction F1, relatively mobile fraction F2, associated with organic matter/sulphides fraction F3, and residual fraction F4) were measured by atomic absorption spectrophotometry (AAS). The sediments with Cu concentration <500 mg kg⁻¹ displayed prevalence of mobile acid-leachable fraction F1 and reducible fraction F2 for Cd, Cu, Mn, and Pb, whereas the relative contribution of fraction F3 was relatively low for all of the examined metals. Residual fraction F4 was highest (>65%) for Fe and Ni because both metals are associated with the crystalline matrix of natural sediments. The sediments heavily contaminated with Cu (>500 mg kg⁻¹) had dramatically increased percentages of Cu, Mn, Pb, and Zn, ranging on average from 63 to 81%, in the residual fraction. In the case of Cu, for example, the relative abundances of this element in the different fractions of such sediments followed this sequence: residual fraction F4 (76 ± 5%) >absorbed form and carbonates fraction F1 (15 ± 5%) >Fe and Mn oxyhydroxides fraction F2 (5 ± 2%) >fraction associated with organic matter and sulphides F3 (4.5 ± 3.9%). Copper, Pb, and Zn contents in each geochemical fraction of all samples were compared with sediment-quality guideline values ("effects range low" [ERL] and "effects range medium" [ERM]) to assess their possible negative effects on biota. Copper contents in mobile fractions F1 and F2, which were moderately contaminated with Cu, were higher than ERL but lower than ERM guideline values. For heavily contaminated sediments, Zn contents of mobile fractions F1 and F2 were higher than ERL but lower than ERM guideline values. The Cu content of fraction F1 was higher than ERM guideline values, whereas for fractions F2 and F3 copper content was higher than ERL guidelines but still lower than ERM guideline values.

  13. Current cytochrome P450 phenotyping methods applied to metabolic drug-drug interaction prediction in dogs.

    PubMed

    Mills, Beth Miskimins; Zaya, Matthew J; Walters, Rodney R; Feenstra, Kenneth L; White, Julie A; Gagne, Jason; Locuson, Charles W

    2010-03-01

    Recombinant cytochrome P450 (P450) phenotyping, different approaches for estimating fraction metabolized (f(m)), and multiple measures of in vivo inhibitor exposure were tested for their ability to predict drug interaction magnitude in dogs. In previous reports, midazolam-ketoconazole interaction studies in dogs have been attributed to inhibition of CYP3A pathways. However, in vitro phenotyping studies demonstrated higher apparent intrinsic clearances (CL(int,app)) of midazolam with canine CYP2B11 and CYP2C21. Application of activity correction factors and isoform hepatic abundance to liver microsome CL(int,app) values further implicated CYP2B11 (f(m) >or= 0.89) as the dog enzyme responsible for midazolam- and temazepam-ketoconazole interactions in vivo. Mean area under the curve (AUC) in the presence of the inhibitor/AUC ratios from intravenous and oral midazolam interaction studies were predicted well with unbound K(i) and estimates of unbound hepatic inlet inhibitor concentrations and intestinal metabolism using the AUC-competitive inhibitor relationship. No interactions were observed in vivo with bufuralol, although significant interactions with bufuralol were predicted with fluoxetine via CYP2D and CYP2C pathways (>2.45-fold) but not with clomipramine (<2-fold). The minor caffeine-fluvoxamine interaction (1.78-fold) was slightly higher than predicted values based on determination of a moderate f(m) value for CYP1A1, although CYP1A2 may also be involved in caffeine metabolism. The findings suggest promise for in vitro approaches to drug interaction assessment in dogs, but they also highlight the need to identify improved substrate and inhibitor probes for canine P450s.

  14. Total plasma clearance versus urinary plasma clearance of (51)Cr-EDTA in patients with cirrhosis with and without fluid retention.

    PubMed

    Henriksen, Ulrik L; Hansen, Hanne B; Ring-Larsen, Helmer; Bendtsen, Flemming; Henriksen, Jens H

    2015-01-01

    In patients with fluid retention, the total plasma clearance of (51)Cr-EDTA (ClP) may overestimate the glomerular filtration rate (GFR). The present study was therefore undertaken in order to compare ClP with the urinary plasma clearance of (51)Cr-EDTA (ClU) in patients with cirrhosis with and without fluid retention. A total of 136 patients with cirrhosis (24 without fluid retention, 112 with ascites) received a quantitative intravenous injection of (51)Cr-EDTA followed by plasma and quantitative urinary samples for 5 hours. ClP was determined from the injected dose relative to the plasma concentration-time area, extrapolated to infinity. ClU was determined as urinary excretion relative to the plasma concentration-time area up to voiding. In patients without fluid retention, the difference between ClP and ClU (ClP - ClU = ClΔ) was mean 4.5 mL/min/1.73 m(2). In patients with ascites, ClΔ was significantly higher (17.6 mL/min/1.73 m(2), p < 0.0001). ClΔ increased with lower values of GFR (r = - 0.458, p < 0.001). Repeated measurements of ClU in a subgroup of patients with fluid retention (n = 25) gave almost identical values. Different types of corrections of one-pool clearance were almost identical with ClP, except for higher clearance values, which were somewhat underestimated by the former. In patients with fluid retention and ascites ClP and corrected one-pool clearance overestimates GFR substantially. Although ClU may underestimate GFR slightly, patients with ascites should collect urine quantitatively in order to obtain a reliable measurement of GFR.

  15. Increasing ankle push-off work with a powered prosthesis does not necessarily reduce metabolic rate for transtibial amputees.

    PubMed

    Quesada, Roberto E; Caputo, Joshua M; Collins, Steven H

    2016-10-03

    Amputees using passive ankle-foot prostheses tend to expend more metabolic energy during walking than non-amputees, and reducing this cost has been a central motivation for the development of active ankle-foot prostheses. Increased push-off work at the end of stance has been proposed as a way to reduce metabolic energy use, but the effects of push-off work have not been tested in isolation. In this experiment, participants with unilateral transtibial amputation (N=6) walked on a treadmill at a constant speed while wearing a powered prosthesis emulator. The prosthesis delivered different levels of ankle push-off work across conditions, ranging from the value for passive prostheses to double the value for non-amputee walking, while all other prosthesis mechanics were held constant. Participants completed six acclimation sessions prior to a data collection in which metabolic rate, kinematics, kinetics, muscle activity and user satisfaction were recorded. Metabolic rate was not affected by net prosthesis work rate (p=0.5; R 2 =0.007). Metabolic rate, gait mechanics and muscle activity varied widely across participants, but no participant had lower metabolic rate with higher levels of push-off work. User satisfaction was affected by push-off work (p=0.002), with participants preferring values of ankle push-off slightly higher than in non-amputee walking, possibly indicating other benefits. Restoring or augmenting ankle push-off work is not sufficient to improve energy economy for lower-limb amputees. Additional necessary conditions might include alternate timing or control, individualized tuning, or particular subject characteristics. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. Natural synergism of acid and lactone type mixed sophorolipids in interfacial activities and cytotoxicities.

    PubMed

    Hirata, Yoshihiko; Ryu, Mizuyuki; Igarashi, Keisuke; Nagatsuka, Asami; Furuta, Taro; Kanaya, Shigenori; Sugiura, Masaki

    2009-01-01

    Sophorolipids (SLs) naturally produced from Candida bombicola are a mixture of lactonic (SL-lactone) and acidic (SL-acid) sophorosides of 17-L-hydroxydecanoic acid with an SL-lactone:SL-acid ratio of 72:28. SLs are biodegradable low-foaming surfactants with high detergency and hardness-tolerance properties. To analyze the effect of the SL-lactone:SL-acid ratio on these properties, SL-LXs containing X% SL-lactone, in which X varied from 0 to 100, were prepared and their interfacial activities and cytotoxicities examined. The minimum surface tension values for all SLs examined were comparable. The critical micelle concentration (CMC) was 680 mg/L for SL-L0 and 62-110 mg/L for the other SLs. Interestingly, natural SL (SL-L72) had the lowest surface tension and CMC among all of the SLs examined. The foaming ability and stability of the SLs were dependent on the SL-L content. SL-L0 and L17 had higher foaming values than the other SLs examined in 0-ppm hardness water. These values greatly reduced and became constant when the SL-L content increased over 55%. The detergencies of all of the SLs examined were comparable, except for those of SL-L0 and SL-L100, which were slightly lower than those of the other SLs. These results suggest that natural synergism between SLs creates a better balance for many interfacial activities. The cytotoxicity of SL-L72 was higher than that of SL-L0, but was comparable to that of surfactin, which is commercially available for cosmetic use. The low cytotoxicities and high interfacial properties of SLs increase their usefulness as biocompatible surface active agents for many applications.

  17. Low temperature measurement of the vapor pressures of planetary molecules

    NASA Technical Reports Server (NTRS)

    Kraus, George F.

    1989-01-01

    Interpretation of planetary observations and proper modeling of planetary atmospheres are critically upon accurate laboratory data for the chemical and physical properties of the constitutes of the atmospheres. It is important that these data are taken over the appropriate range of parameters such as temperature, pressure, and composition. Availability of accurate, laboratory data for vapor pressures and equilibrium constants of condensed species at low temperatures is essential for photochemical and cloud models of the atmospheres of the outer planets. In the absence of such data, modelers have no choice but to assume values based on an educated guess. In those cases where higher temperature data are available, a standard procedure is to extrapolate these points to the lower temperatures using the Clausius-Clapeyron equation. Last summer the vapor pressures of acetylene (C2H2) hydrogen cyanide (HCN), and cyanoacetylene (HC3N) was measured using two different methods. At the higher temperatures 1 torr and 10 torr capacitance manometers were used. To measure very low pressures, a technique was used which is based on the infrared absorption of thin film (TFIR). This summer the vapor pressure of acetylene was measured the TFIR method. The vapor pressure of hydrogen sulfide (H2S) was measured using capacitance manometers. Results for H2O agree with literature data over the common range of temperature. At the lower temperatures the data lie slightly below the values predicted by extrapolation of the Clausius-Clapeyron equation. Thin film infrared (TFIR) data for acetylene lie significantly below the values predicted by extrapolation. It is hoped to bridge the gap between the low end of the CM data and the upper end of the TFIR data in the future using a new spinning rotor gauge.

  18. Movement of fluids in the Nankai Trough area: Insights from 129I and halogen distributions along the IODP NanTroSEIZE transect

    NASA Astrophysics Data System (ADS)

    Tomaru, Hitoshi; Fehn, Udo

    2015-01-01

    Halogen concentrations and 129I/I ratios were determined in pore waters from the Nankai Trough subduction system, collected during IODP Expeditions 315, 316, 322, and 333 along the NanTroSEIZE transect. The transect allowed the first direct comparison of iodine results across an active subduction system, from subducting oceanic sediments to the accretionary prism, and the overlying forearc basin. In contrast to the other halogens (Cl and Br) iodine concentrations show large variations within and among the cores at all sites landward of the trough, I concentrations increase rapidly with depth and reach values several orders of magnitude higher than those in seawater, but are only slightly higher than seawater values at the seaward sites. Methane concentrations follow a similar pattern. Host sediments of the fluids are younger than 7 Ma in all the cores, but the ages of iodine in pore waters at the landward sites reach values beyond 30 Ma. In contrast, iodine seaward of the trough is in isotopic equilibrium with the host sediments, resulting in very similar iodine and sediment ages. The distribution of iodine concentrations and ages indicates that iodine at the landward sites has been transported there in aqueous fluids, probably together with methane, from old formations in the upper plate. The specific fluid pathways potentially were influenced by features such as the megasplay fault in the prism or the décollement. The results demonstrate large-scale transport of fluids carrying iodine and other compounds such as methane from old layers in the upper plate to surface locations landward of the Nankai Trough, while separate, but only local hydrologic processes occur in the marine sediments moving toward the trough.

  19. Carcass and meat quality in double-muscled Belgian Blue bulls and cows.

    PubMed

    Fiems, L O; De Campeneere, S; Van Caelenbergh, W; De Boever, J L; Vanacker, J M

    2003-03-01

    Carcass and meat quality of 37 bulls and 91 cows of the Belgian Blue breed (double-muscled type) were compared. Age at slaughter averaged 648±73 and 1820±689 days, respectively. Both groups of cattle were finished on maize silage supplemented with concentrate, and were slaughtered at about 750 kg live weight. Females had a lower (P=0.004) cold carcass weight (469.7 kg) in comparison with bulls (500.8 kg), due to a reduced dressing percentage (63.8 vs. 66.6; P <0.001). SEUROP conformation was better for bulls. SEUROP fat covering (P=0.007) and fat content in the carcass (16.4 vs. 12.9%; P <0.001) and in the M. longissimus thoracis (LT) muscle (2.3 vs. 1.1%; P <0.001) were higher for females than for males. The LT of cows was darker (lower L* and higher a*-value; P <0.001), had a better waterholding capacity (P⩽0.063) and was slightly more tender (P=0.120) than the LT of bulls. Increasing parity reduced dressing percentage and increased LT lightness (L*-value) in cows. Several carcass (SEUROP-grading, composition, LT-area) and meat quality traits (protein and fat contents, drip and cooking losses, a*-value) were better correlated with carcass weight than parity. It is concluded that meat quality of the aged LT of cows is not negatively affected by age, while some carcass quality traits decreased with advancing age. Carcass quality traits adjusted for age at slaughter were better for bulls, but LT meat quality characteristics were at least as good for females as for males.

  20. Adsorption of a reactive dye on chemically modified activated carbons--influence of pH.

    PubMed

    Orfão, J J M; Silva, A I M; Pereira, J C V; Barata, S A; Fonseca, I M; Faria, P C C; Pereira, M F R

    2006-04-15

    The surface chemistry of a commercial activated carbon with a slightly basic nature was modified by appropriate treatments in order to obtain two additional samples, respectively with acidic and basic properties, without changing its textural parameters significantly. Different techniques (N2 adsorption at 77 K, temperature programmed desorption, and determination of acidity, basicity, and pH at the point of zero charge) were used to characterize the adsorbents. Kinetic and equilibrium adsorption data of a selected textile reactive dye (Rifafix Red 3BN, C.I. reactive red 241) on the mentioned materials were obtained at the pH values of 2, 7, and 12. The kinetic curves are fitted using the second-order model. The respective rate constants seem to diminish progressively with the initial concentration for the more diluted solutions tested, reaching a constant value at higher concentrations, which depends on the experimental system under consideration (adsorbent and pH). In general, the Langmuir model provides the best fit for the equilibrium data. The different uptakes obtained are discussed in relation to the surface chemical properties of the adsorbents. It is shown that the adsorption of the reactive (anionic) dye on the basic sample (prepared by thermal treatment under H2 flow at 700 degrees C) is favored. This conclusion is explained on the basis of the dispersive and electrostatic interactions involved. Moreover, it is also shown that the optimal adsorption condition for all the activated carbons tested corresponds to solution pH values not higher than the pH(pzc) of the adsorbents, which may be interpreted by taking into account the electrostatic forces present.

  1. Pitted cones and domes on Mars: Observations in Acidalia Planitia and Cydonia Mensae using MOC, THEMIS, and TES data

    USGS Publications Warehouse

    Farrand, W. H.; Gaddis, L.R.; Keszthelyi, L.

    2005-01-01

    Domes and cones with summit pits located in Acidalia Planitia and Cydonia Mensae were studied using MOC and THEMIS images and a TES-derived thermal inertia map. North of 40.5??N latitude, the features have a dome-like morphology, and south of that latitude, the morphology is more cone-like. Layering is apparent in the summit craters of fresher looking southern cones, and asymmetric aprons were observed in some instances. Some of the northern domes also display layering in their summit craters, but asymmetric aprons were not observed. The northern domes can also display multiple summit pits or no summit pits at all and can occur in association with higher-albedo "pancake" features. The northern domes are higher in albedo but have apparent thermal inertias that are lower than the surrounding plains. The apparent thermal inertia values of the southern cones range from values comparable to the surrounding plains to slightly lower. From the TES thermal inertia map, we infer that the thermal inertia values of the pitted cones are between those of basaltic fine dust and sand, while those of the surrounding plains are closer to that of basaltic sand. While a unique interpretation of the origin of the pitted cones is not possible with the available data, we do not find compelling evidence to suggest an origin related to either basaltic volcanism or ground-ice. Instead, an origin for these features through some combination of mud volcanism and evaporite deposition around geysers and/or springs is most consistent with the observations. Copyright 2005 by the American Geophysical Union.

  2. Stable isotope ratio analysis of breastfeeding and weaning practices of children from medieval Fishergate House York, UK.

    PubMed

    Burt, Nicole M

    2013-11-01

    Rib collagen of 51 juveniles and 11 adult females from the late medieval Fishergate House cemetery site (York, UK) were analyzed using nitrogen and carbon stable isotope ratio analysis to determine the weaning age for this population and to reconstruct diet. The juveniles' ages ranged from fetal to 5-6 years, while the females were of reproductive age. Previous researchers suggested that the children from Fishergate House might have been weaned later than the medieval British norm of 2 years, based on a mortality peak at 4-6 years of age. The results show weaning was complete by 2 years of age, agreeing with previous British weaning studies. The adult female δ(15) N values have a mean of 11.4‰ ± 1.1‰ and the δ(13) C values have a mean of -19.4‰ ± 0.4‰. These findings are consistent with previous isotopic studies of female diet in York during this period, though slightly lower. The weaned juvenile nitrogen values were found to be higher than the adult females (12.4‰ ± 1.0‰ for δ(15) N and -19.7‰ ± 0.5‰ for δ(13) C), which might indicate a dependence on higher trophic level proteins such as marine fish or pork. Marine fish is considered a high status food and children are considered low-status individuals at this time, making this a particularly interesting finding. Weaning does not appear to coincide with peak mortality, suggesting environment factors may be playing a larger role in child mortality at Fishergate House. Copyright © 2013 Wiley Periodicals, Inc.

  3. Impacts of education level and employment status on health-related quality of life in multiple sclerosis patients.

    PubMed

    Šabanagić-Hajrić, Selma; Alajbegović, Azra

    2015-02-01

    To evaluate the impacts of education level and employment status on health-related quality of life (HRQoL) in multiple sclerosis patients. This study included 100 multiple sclerosis patients treated at the Department of Neurology, Clinical Center of the University of Sarajevo. Inclusion criteria were the Expanded Disability Status Scale (EDSS) score between 1.0 and 6.5, age between 18 and 65 years, stable disease on enrollment. Quality of life (QoL) was evaluated by the Multiple Sclerosis Quality of Life-54 questionnaire (MSQoL-54). Mann-Whitney and Kruskal-Wallis test were used for comparisons. Linear regression analyses were performed to evaluate prediction value of educational level and employment status in predicting MSQOL-54 physical and mental composite scores. Full employment status had positive impact on physical health (54.85 vs. 37.90; p les than 0.001) and mental health (59.55 vs. 45.90; p les than 0.001) composite scores. Employment status retained its independent predictability for both physical (r(2)=0.105) and mental (r(2)=0.076) composite scores in linear regression analysis. Patients with college degree had slightly higher median value of physical (49.36 vs. 45.30) and mental health composite score (66.74 vs. 55.62) comparing to others, without statistically significant difference. Employment proved to be an important factor in predicting quality of life in multiple sclerosis patients. Higher education level may determine better QOL but without significant predictive value. Sustained employment and development of vocational rehabilitation programs for MS patients living in the country with high unemployment level is an important factor in improving both physical and mental health outcomes in MS patients.

  4. Hematological analyses of some fish species in the Gulf of Riga

    NASA Astrophysics Data System (ADS)

    Medne, R.; Balode, M.

    2012-11-01

    The objective of this work was to detect and compare blood parameters of European flounder ( Platichthys flesus), herring ( Clupea harertgus membras), eelpout ( Zoarces viviparous) and perch ( Perca fluviatilis) at the Eastern and Western coast of the Gulf of Riga. The number of erythrocytes in herring of the Gulf of Riga ranges from 1.45 to 2.57 × 1012/L. At the same time no statistically significant difference in red blood cells (RBC) count between herring of both coasts was detected. The most common white blood cells in GoR herring blood smear were lymphocytes ranging from 73 to 94%. The number of lymphoblasts was very small (0-4%), indicating that herring of the GoR is not exposed to chronic stress. The number of erythrocytes in flounder ranged from 0.8 to 2.65 × 1012/L, but hemoglobin—from 4.7 to 16.5 g/dL. RBC count and hemoglobin level in European flounder did not differ between coasts however hematocrit was significantly higher at the Eastern coast. White blood cell count in flounder near the Western and Eastern coast was almost equal. Blood indices in eelpouts were slightly higher at the Eastern cost. Slightly higher number of red blood cells and significantly higher hemoglobin level has been observed in perch feeding near the Eastern coast, indicating physiological disturbances of fish. Although hematological analysis pointed at slightly worse living conditions of fish at the Eastern coast, in general hematological picture did not give evidence of fish welfare decline in the Gulf of Riga.

  5. The effect of epigallocatechin-3-gallate (EGCG) on human alveolar bone cells both in vitro and in vivo.

    PubMed

    Mah, Yon-Joo; Song, Je Seon; Kim, Seong-Oh; Lee, Jae-Ho; Jeon, Mijeong; Jung, Ui-Won; Moon, Seok Jun; Kim, Jeong-Hee; Choi, Hyung-Jun

    2014-05-01

    The effects of epigallocatechin-3-gallate (EGCG), a major catechin in green tea, on human and mouse osteoblasts remain controversial. This study investigated the direct effects of EGCG on human alveolar bone-derived cells (hABCs) both in vitro and in vivo. hABCs which were collected from eight children (aged 7-9 years, seven males and one female) were treated with EGCG at various concentrations (1, 5, 10, 25, and 50μM), and a proliferation assay, flow cytometric analysis for apoptosis evaluation, migration assay, and in vitro osteogenic differentiation were performed. hABCs that were pretreated with 10μM EGCG and mixed with calcium phosphate carrier combined with EGCG (0.1, 0.5, or 1.5mg) in vivo were transplanted into immunodeficient mouse. Histological staining, quantitative gene expressions, and alkaline phosphatase activity were evaluated in the retrieved transplants. The proliferation and migration were decreased when EGCG was present at over 25μM. The osteogenic differentiation increased slightly when EGCG was present at up to 10μM, and clearly decreased for higher concentrations of EGCG. In vivo, the potential for hard-tissue formation was slightly higher for the group with 0.1mg of EGCG than for the control group, and decreased sharply for higher concentrations of EGCG. The present observations suggest that EGCG at a low concentration can slightly enhance the osteogenic effect in vivo, whereas at a higher concentration it can prevent the osteogenic differentiation of hABCs both in vitro and in vivo. Copyright © 2014 Elsevier Ltd. All rights reserved.

  6. Minnesota Higher Education Facilities Authority: 1999 Annual Report.

    ERIC Educational Resources Information Center

    Minnesota Higher Education Facilities Authority, Saint Paul.

    This annual report reviews fiscal year 1999 for institutions serviced by the Minnesota Higher Education Facilities Authority. The report notes a slight decline in new financing activity, although the $87.7 million financed during the 1999 fiscal year was the second highest annual total for the Authority. Following some introductory material, the…

  7. Comparative study of reproductive skew and pair-bond stability using genealogies from 80 small-scale human societies.

    PubMed

    Ellsworth, Ryan M; Shenk, Mary K; Bailey, Drew H; Walker, Robert S

    2016-05-01

    Genealogies contain information on the prevalence of different sibling types that result from past reproductive behavior. Full sibling sets stem from stable monogamy, paternal half siblings primarily indicate male reproductive skew, and maternal half siblings reflect unstable pair bonds. Full and half sibling types are calculated for a total of 61,181 siblings from published genealogies for 80 small-scale societies, including foragers, horticulturalists, agriculturalists, and pastoralists from around the world. Most siblings are full (61%) followed by paternal half siblings (27%) and maternal half siblings (13%). Paternal half siblings are positively correlated with more polygynous marriages, higher at low latitudes, and slightly higher in nonforagers, Maternal half sibling fractions are slightly higher at low latitudes but do not vary with subsistence. Partible paternity societies in Amazonia have more paternal half siblings indicating higher male reproductive skew. Sibling counts from genealogies provide a convenient method to simultaneously investigate the reproductive skew and pair-bond stability dimensions of human mating systems cross-culturally. Am. J. Hum. Biol. 28:335-342, 2016. © 2015 Wiley Periodicals, Inc. © 2015 Wiley Periodicals, Inc.

  8. Heterogeneous chemistry of alkylamines with sulfuric acid: implications for atmospheric formation of alkylaminium sulfates.

    PubMed

    Wang, Lin; Lal, Vinita; Khalizov, Alexei F; Zhang, Renyi

    2010-04-01

    The heterogeneous interaction of alkylamines with sulfuric acid has been investigated to assess the role of amines in aerosol growth through the formation of alkylaminium sulfates. The kinetic experiments were conducted in a low-pressure fast flow reactor coupled to an ion drift-chemical ionization mass spectrometer (ID-CIMS). The measurements of heterogeneous uptake of methylamine, dimethylamine, and trimethylamine were performed in the acidity range of 59-82 wt % H(2)SO(4) and between 243 and 283 K. Irreversible reactive uptakes were observed for all three alkylamines, with comparable uptake coefficients (gamma) in the range of 2.0 x 10(-2) to 4.4 x 10(-2). The measured gamma value was slightly higher in more concentrated sulfuric acid and at lower temperatures. The results imply that the heterogeneous reactions of alkylamines contribute effectively to the growth of atmospheric acidic particles and, hence, secondary organic aerosol formation.

  9. [Atopic eczema: psychophysiological reactivity with standardized stressors].

    PubMed

    Münzel, K; Schandry, R

    1990-11-01

    In 18 atopic eczema patients with active symptomatology and 15 control subjects a comparison of reactivity to psychological stressors was made. The physiological measures were heart rate, peripheral vasomotor response, skin resistance level, spontaneous fluctuations of the skin resistance, and forearm skin temperature. In addition, self-ratings of subjective state, situational anxiety, and social anxiety were assessed. Mental arithmetic performed undisturbed and in distracting conditions, and anticipation of the latter and of having to speak in public served as stressors. The results show higher reaction values of the eczema patients for heart rate, peripheral vasomotor response, fluctuations of skin resistance and subjective tension. A subgroup of patients with extreme skin irritation (itching) reacted with an elevation of skin temperature, in contrast to control subjects and patients with less marked itching, in whom skin temperature dropped slightly. The results suggest that atopic eczema may have a psychophysiological component.

  10. AN EMPIRICISM FOR ESTABLISHING THE TRANSITION TEMPERATURES OF SUPERCONDUCTING ALLOYS AND COMPOUNDS

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gold, L.

    1964-01-01

    The preparation of superconductive alloys may be guided by a form of empiricism based upon the isotope law. For a series of alloys having a common structure, the critical temperatures of its members are presumed so interrelated. The reduced mass of a compound becomes somewhat obscure for stoichiometry other than 50 to 50 at.%. Several possible definitions of reduced mass permit setting of upper and lower bounds on the transition point in general. Theoretical calculations are presented for Nb/sub 3/In with evidence that the experimental values for this substance and Nb/sub 3/Ga may require slight revision. In line with themore » quest for alloys with higher critical temperatures than N/b/sub 3/Sn, a prediction is made that Nb/sub 3/Si (were it to exist and be of the BETA - tungsten structure) would be a promising prospect. (auth)« less

  11. The influenced of reaction time on the degradation of palm oil empty fruit bunch (EFB) in hydrothermal carbonization

    NASA Astrophysics Data System (ADS)

    Sarwono, Rakhman; Kurniawan, Hendris Hendarsyah

    2017-11-01

    Hydrothermal carbonization (HTC) of empty fruit bunch (EFB) of palm oil in different reaction times were investigated. Experiments were carried out in an autoclave at different reaction time of 3,6,9, 15, 20, 25 and 40 hours. With a fixed solid/liquid ratio of 5 gram of EFB in 50 ml water as a solvent, and temperature reaction of 250 °C. Increase the reaction time the soluble products are also increased. The liquid products were analyzed using GCMS to determine the chemical composition. The chemical composition were greatly affected by the reaction time. The main component was glycolic acid, by increasing the reaction time made the varieties of chemical compositions in liquid products, especially for the glycolic acid component, it was decreased slightly. The higher heating value (HHV) also increase slighly by increasing the reaction time both solid and liquid products.

  12. Pyroelectric response mechanism of barium strontium titanate ceramics in dielectric bolometer mode: The underlying essence of the enhancing effect of direct current bias field

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mao, Chaoliang; Cao, Sheng; Yan, Shiguang

    Pyroelectric response mechanism of Ba{sub 0.70}Sr{sub 0.30}TiO{sub 3} ceramics under dielectric bolometer (DB) mode was investigated by dielectric and pyroelectric properties measurement. The variations of total, intrinsic, and induced pyroelectric coefficients (p{sub tot}, p{sub int}, p{sub ind}) with temperatures and bias fields were analyzed. p{sub int} plays the dominant role to p{sub tot} through most of the temperature range and p{sub ind} will be slightly higher than p{sub int} above T{sub 0}. The essence of the enhancing effect of DC bias field on pyroelectric coefficient can be attributed to the high value of p{sub int}. This mechanism is useful formore » the pyroelectric materials (DB mode) applications.« less

  13. Ground and excited state dipole moments of some flavones using solvatochromic methods: An experimental and theoretical study

    NASA Astrophysics Data System (ADS)

    Kumar, Sanjay; Kapoor, Vinita; Bansal, Ritu; Tandon, H. C.

    2018-03-01

    The absorption and fluorescence characteristics of biologically active flavone derivatives 6-Hydroxy-7,3‧,4‧,5‧-tetramethoxyflavone (6HTMF) and 7-Hydroxy-6,3‧,4‧,5‧-tetramethoxyflavone (7HTMF) are studied at room temperature (298 K) in solvents of different polarities. Excited state dipole moments of these compounds have been determined using the solvatochromic shift method based on the microscopic solvent polarity parameter ETN . Dipole moments in excited state were found to be higher than those in the ground state in both the molecules. A reasonable agreement has been observed between experimental and theoretically calculated dipole moments (using AM1 method). Slightly large value of ground and excited state dipole moments of 7HTMF than 6HTMF are in conformity with predicted electrostatic potential maps. Our results would be helpful in understanding use of these compounds as tunable dye lasers, optical brighteners and biosensors.

  14. Kinetic Study of Laboratory Mutants of NDM-1 Metallo-β-Lactamase and the Importance of an Isoleucine at Position 35

    PubMed Central

    Marcoccia, Francesca; Bottoni, Carlo; Sabatini, Alessia; Colapietro, Martina; Mercuri, Paola Sandra; Galleni, Moreno; Kerff, Frédéric; Matagne, André; Celenza, Giuseppe; Amicosante, Gianfranco

    2016-01-01

    Two laboratory mutants of NDM-1 were generated by replacing the isoleucine at position 35 with threonine and serine residues: the NDM-1I35T and NDM-1I35S enzymes. These mutants were well characterized, and their kinetic parameters were compared with those of the NDM-1 wild type. The kcat, Km, and kcat/Km values calculated for the two mutants were slightly different from those of the wild-type enzyme. Interestingly, the kcat/Km of NDM-1I35S for loracarbef was about 14-fold higher than that of NDM-1. Far-UV circular dichroism (CD) spectra of NDM-1 and NDM-1I35T and NDM-1I35S enzymes suggest local structural rearrangements in the secondary structure with a marked reduction of α-helix content in the mutants. PMID:26856833

  15. Experimental Study of Hydrogasification of Lignite and Subbituminous Coal Chars

    PubMed Central

    Gil, Stanisław

    2015-01-01

    The experimental facility for pressure hydrogasification research was adapted to the pressure of 10 MPa and temperature of 1300 K, which ensured repeatability of results and hydrogen heating to the process temperature. A hydrogasification reaction of chars produced from two rank coals was investigated at temperatures up to 1173 K, pressures up to 8 MPa, and the gas flow rates of 0.5–5 dmn 3/min. Reactivity of the “Szczerców” lignite char was found to be slightly higher than that of the subbituminous “Janina” coal char produced under the same conditions. A high value of the char reactivity was observed to a certain carbon conversion degree, above which a sharp drop took place. It was shown that, to achieve proper carbon conversion, the hydrogasification reaction must proceed at a temperature above 1200 K. PMID:26065028

  16. Cancer incidence in the workers cohort of textile manufacturing factory in Alytus, Lithuania.

    PubMed

    Kuzmickiene, Irena; Didziapetris, Remigijus; Stukonis, Mecys

    2004-02-01

    Altogether 14,650 workers employed at least for 1 year a the textile factory in Alytus, Lithuania, were included in the cohort and followed during the period from 1978 to 1997. The standardized incidence ratio (SIR) for men was 1.28. The incidence of esophagus cancer was significant higher (SIR 3.42). It increased only slightly for lung (SIR 1.35). In the women cohort, SIR was 1.05. However, there was a significant increase of the incidence of gallbladder cancer (SIR 3.19). Among textile-processing (spinning and weaving departments) women workers, we found elevated total cancer incidence (SIR 1.35), incidence of breast cancer (SIR 1.49), and cervical cancer (SIR 1.82). In this cohort increased SIR values were observed for more than 10 years since first exposure for all cancer (SIR 1.70) and cervical cancer (SIR 2.44).

  17. Application of the fuzzy topsis multi-attribute decision making method to determine scholarship recipients

    NASA Astrophysics Data System (ADS)

    Irvanizam, I.

    2018-03-01

    Some scholarships have been routinely offered by Ministry of Research, Technology and Higher Education of the Republic of Indonesia for students at Syiah Kuala University. In reality, the scholarship selection process is becoming subjective and highly complex problem. Multi-Attribute Decision Making (MADM) techniques can be a solution in order to solve scholarship selection problem. In this study, we demonstrated the application of a fuzzy TOPSIS as an MADM technique by using a numerical example in order to calculate a triangular fuzzy number for the fuzzy data onto a normalized weight. We then use this normalized value to construct the normalized fuzzy decision matrix. We finally use the fuzzy TOPSIS to rank alternatives in descending order based on the relative closeness to the ideal solution. The result in terms of final ranking shows slightly different from the previous work.

  18. The Benard problem: A comparison of finite difference and spectral collocation eigen value solutions

    NASA Technical Reports Server (NTRS)

    Skarda, J. Raymond Lee; Mccaughan, Frances E.; Fitzmaurice, Nessan

    1995-01-01

    The application of spectral methods, using a Chebyshev collocation scheme, to solve hydrodynamic stability problems is demonstrated on the Benard problem. Implementation of the Chebyshev collocation formulation is described. The performance of the spectral scheme is compared with that of a 2nd order finite difference scheme. An exact solution to the Marangoni-Benard problem is used to evaluate the performance of both schemes. The error of the spectral scheme is at least seven orders of magnitude smaller than finite difference error for a grid resolution of N = 15 (number of points used). The performance of the spectral formulation far exceeded the performance of the finite difference formulation for this problem. The spectral scheme required only slightly more effort to set up than the 2nd order finite difference scheme. This suggests that the spectral scheme may actually be faster to implement than higher order finite difference schemes.

  19. The Thermoelectric Properties and Flexural Strength of Nano-TiN/Co4Sb11.3Te0.58Se0.12 Composites Affected by Annealing Treatment

    NASA Astrophysics Data System (ADS)

    Pengfei, Wen; Pengcheng, Zhai; Shijie, Ding; Bo, Duan; Yao, Li

    2017-05-01

    This paper is devoted to investigating the thermoelectric properties and flexural strength of the nano-TiN (1 vol.%) dispersed Co4Sb11.3Te0.58Se0.12 composites affected by different thermal annealing treatments at 773 K in a vacuum. After 200 h of annealing treatment, the density of the sample decreases by 4% compared with that before annealing. Moreover, the electrical conductivity and thermal conductivity decline because of the higher porosity in the annealed sample. However, the Seebeck coefficient changes little after annealing. As a result, the ZT value varies slightly after 200 h of annealing. In addition, it is noteworthy that the flexural strength decreases by 16% after 200 h of annealing treatment. Furthermore, the discrete degree of the flexural strength increases with increasing annealing time.

  20. Channel Measurement and Modeling for 5G Urban Microcellular Scenarios.

    PubMed

    Peter, Michael; Weiler, Richard J; Göktepe, Barış; Keusgen, Wilhelm; Sakaguchi, Kei

    2016-08-20

    In order to support the development of channel models for higher frequency bands, multiple urban microcellular measurement campaigns have been carried out in Berlin, Germany, at 60 and 10 GHz. In this paper, the collected data is uniformly analyzed with focus on the path loss (PL) and the delay spread (DS). It reveals that the ground reflection has a dominant impact on the fading behavior. For line-of-sight conditions, the PL exponents are close to free space propagation at 60 GHz, but slightly smaller (1.62) for the street canyon at 10 GHz. The DS shows a clear dependence on the scenario (median values between 16 and 38 ns) and a strong distance dependence for the open square and the wide street canyon. The dependence is less distinct for the narrow street canyon with residential buildings. This behavior is consistent with complementary ray tracing simulations, though the simplified model tends to overestimate the DS.

  1. Perceptions of culturally competent diabetes management in a primary care practice.

    PubMed

    Kirk, Julienne K; Hildebrandt, Carol; Davis, Stephen; Crandall, Sonia J; Siciliano, Alissa B; Marion, Gail S

    2014-01-01

    To evaluate whether clinicians consider the impact of culture on diabetes management, a survey was mailed to 300 randomly selected patients > or = 50 years with type 2 diabetes and 153 surveys were returned. Data were correlated with A1C values. African Americans (AA) and non-Hispanic whites (NHW), (91.9%, 97.0%) respectively, reported clinicians discussed benefits of controlling blood sugar but did not discuss effects of cultural issues on glucose control (< or = 50%). AAs perceived clinicians were more accommodating of their cultural preferences than did NHWs (49.2% versus 30.6%) (P < .05). Females (51.9%) (P < .01) reported that clinicians acknowledged the importance of their cultural beliefs with a slightly higher percentage for African American females (54.8%) versus non-Hispanic White females (48.6%). Understanding the patient's and clinician's views of cultural beliefs as they relate to diabetes self-management can provide perspectives to guide care.

  2. Heavy metal pollution among autoworkers. II. Cadmium, chromium, copper, manganese, and nickel.

    PubMed Central

    Clausen, J; Rastogi, S C

    1977-01-01

    Garages and auto-repair workshops may be polluted with other heavy metals besides lead. Blood of autoworkers with high lead content was analysed for cadmium, chromium, copper manganese, nickel, ALAD activity and carboxyhaemoglobin level. Cadmium and copper levels in blood of autoworkers were comparable with those of the control subjects while chroimium and nickel levels were significantly higher (P less than 0-01 for both metals), and scattered raised values of manganese were found. There was no significant mutual correlation between levels of various heavy metals determined in whole blood. High copper levels were slightly related to decreasing ALAD activity (P less than 0-1). Nineteen per cent of autoworkers were found to have an abnormally blood level of carboxyhaemoglobin. The amount of particulate heavy metal in autoworkshop air was not related to biochemical abnormalities found in the autoworkers. Various sources of pollution of these heavy metals in autoworkshops are discussed. PMID:71915

  3. Urease activity in different soils of Egypt.

    PubMed

    el-Shinnawi, M M

    1978-01-01

    Samples from two depths (0--15 and 15--30 cm) of five Egyptian soils: sandy, calcareous, fertile alluvial, saline alluvial, and alkali alluvial were tested for urease activity. Samples were treated with farmyard manure at rates of 0 and 0.5% C, and moisture at levels of 50, 65, and 80% of the water holding capacity. The studied Egyptian soils showed different activities of urease. Decreases in the values were shown by depth of sampling and varied in their intensities according to soil type, except for saline soil which revealed an opposite trend by the higher activity of its sub-surface layer. Order of activity was the following: fertile, saline, alkali, calcareous, and sandy soil. Farmyard manure slightly increased the activity of the enzyme. Incubation of moistened samples revealed that the optimum moisture content was 50% of W.H.C. for the tested soils, except for saline which showed best results at 65% of W.H.C.

  4. [Efficiency of photodecomposition of trace NDMA in water by UV irradiation].

    PubMed

    Xu, Bing-Bing; Chen, Zhong-Lin; Qi, Fei; Ma, Jun

    2008-07-01

    Efficiency of photodecomposition of trace NDMA by UV irradiation was investigated with analyzing the initial concentration of NDMA, solution pH, irradiation area, irradiation intensity and water quality effect on NDMA photolysis. NDMA could be effectively photodegraded by UV irradiation. The removal efficiency of NDMA was 97.5% after 5 min of UV irradiation. Effect of initial NDMA concentration on photodecomposition of NDMA was not remarkable. With pH value ascending, the removal rate of NDMA photodecomposition decreased. The yields of photoquantum were more under lower solution pH than that under higher pH. NDMA had fastest reaction rate at solution pH = 2.2. Removal efficiency of NDMA increased with the available irradiation area ascending. Increscent ultraviolet irradiation intensity was good for NDMA degradation. Water quality affected the removal of NDMA slightly. The removal efficiency of NDMA in tap water and Songhua River raw water were 96.7% and 94.8%, respectively.

  5. Lean mixture engine testing and evaluation program. [for automobile engine pollution and fuel performances

    NASA Technical Reports Server (NTRS)

    Dowdy, M. W.; Hoehn, F. W.; Griffin, D. C.

    1975-01-01

    Experimental results for fuel consumption and emissions are presented for a 350 CID (5.7 liter) Chevrolet V-8 engine modified for lean operation with gasoline. The lean burn engine achieved peak thermal efficiency at an equivalence ratio of 0.75 and a spark advance of 60 deg BTDC. At this condition the lean burn engine demonstrated a 10% reduction in brake specific fuel consumption compared with the stock engine; however, NOx and hydrocarbon emissions were higher. With the use of spark retard and/or slightly lower equivalence ratios, the NOx emissions performance of the stock engine was matched while showing a 6% reduction in brake specific fuel consumption. Hydrocarbon emissions exceeded the stock values in all cases. Diagnostic data indicate that lean performance in the engine configuration tested is limited by ignition delay, cycle-to-cycle pressure variations, and cylinder-to-cylinder distribution.

  6. Postnatal development of plasma amino acids in hyperphagic rats.

    PubMed

    Salvadó, M J; Segués, T; Arola, L

    1991-01-01

    The effect of feeding a highly palatable high-energy cafeteria diet on individual amino acid levels in plasma during postnatal development of the rat has been evaluated and compared to chow-fed controls. The cafeteria diet selected by the rats was hypercaloric and hyperlipidic, with practically the same amount of carbohydrate as the control diet, and slightly hyperproteic. In response to cafeteria feeding, significant decreases were observed in plasma serine and cysteine along the period studied. Significant changes with age during the growth period were shown by cafeteria-fed animals, which were not observed in control rats. Citrulline levels were lower on days 10 and 14 in cafeteria pups than in chow pups. Methionine was highest on day 30. Threonine was also higher at days 20 and 30, as was valine but with a nadir at day 10. Lysine showed maximal values on days 14 and 30.

  7. Optimal forwarding ratio on dynamical networks with heterogeneous mobility

    NASA Astrophysics Data System (ADS)

    Gan, Yu; Tang, Ming; Yang, Hanxin

    2013-05-01

    Since the discovery of non-Poisson statistics of human mobility trajectories, more attention has been paid to understand the role of these patterns in different dynamics. In this study, we first introduce the heterogeneous mobility of mobile agents into dynamical networks, and then investigate packet forwarding strategy on the heterogeneous dynamical networks. We find that the faster speed and the higher proportion of high-speed agents can enhance the network throughput and reduce the mean traveling time in random forwarding. A hierarchical structure in the dependence of high-speed is observed: the network throughput remains unchanged at small and large high-speed value. It is also interesting to find that a slightly preferential forwarding to high-speed agents can maximize the network capacity. Through theoretical analysis and numerical simulations, we show that the optimal forwarding ratio stems from the local structural heterogeneity of low-speed agents.

  8. Oxygen potentials of mixed oxide fuels for fast reactors

    NASA Astrophysics Data System (ADS)

    Kato, M.; Tamura, T.; Konashi, K.

    2009-03-01

    Oxygen potentials of homogenous (Pu0.2U0.8)O2-x and (Am0.02Pu0.30Np0.02U0.66)O2-x which have been developed as fuels for fast breeder reactors were measured at temperatures of 1473-1623 K by a gas equilibrium method using an (Ar, H2, H2O) gas mixture. The measured oxygen potentials of (Pu0.2U0.8)O2-x were about 25 kJ mol-1 lower than those of (Pu0.3U0.7)O2-x measured previously and were consistent with the values calculated by Besmann and Lindemer's model. The measured oxygen potentials of (Am0.02Pu0.30Np0.02U0.66)O2-x were slightly higher than those of MOX without minor actinides. No fuel-cladding chemical interaction is affected significantly by adding their minor actinides.

  9. Enhanced thermoelectric properties of Hg-doped Cu2Se

    NASA Astrophysics Data System (ADS)

    Li, Erying; Wang, Siqi; Zhu, Zheng; Cao, Ruijuan; Hu, Xing; Song, Hongzhang

    2018-03-01

    The Cu2-xHgxSe (x = 0, 0.05, 0.10 and 0.15) nanopowders were fabricated using the hydrothermal synthesis, and then hot-pressed into bulk alloys. The effects of Hg doping on the thermoelectric (TE) properties of Cu2Se were investigated. The electrical resistivities of all the doped samples are lower than that of the nondoped sample due to the induced cation vacancies. For the x = 0.10 and x = 0.15 samples, Seebeck coefficients increase slightly compared with the nondoped sample at higher temperature. Except for the sample of x = 0.05, the thermal conductivities of x = 0.10 and x = 0.15 samples are substantially lower than that of the x = 0.00 sample. As an overall result, the maximum value of ZT, which is the dimensionless TE figure of merit, reaches 1.50 at 600∘C for the x = 0.10 sample.

  10. Further studies on gold alloys used in fabrication of porcelain-fused-to-metal restorations.

    PubMed

    Civjan, S; Huget, E F; Dvivedi, N; Cosner, H J

    1975-03-01

    Composition, microstructure, castability, mechanical properties, and heat treatment characteristics of two gold-palladium-silver-based alloys were studied. The materials exhibited compositional as well as microstructural differences. Clinically acceptable castings could not be obtained when manufacturers' recommended casting temperatures were used. Ultimate tensile strength, yield strength, modulus of elasticity, and Brinell hardness values for the alloys were comparable. The elastic limit of Cameo, however, was significantly higher than that of vivo-star. Maximum rehardening of annealed castings occurred on reheat treatment at temperatures between 1,200 and 1,300 F. As-cast specimens, however, were not heat hardenable. The sequence of heat treatments used in the application of porcelain reduced slightly the hardness of both alloys. Hardness of the metal substructures was not increased by return of porcelain-coated specimens to a 1,250 F oven for final heat treatment.

  11. Defect structure in electrodeposited nanocrystalline Ni layers with different Mo concentrations

    NASA Astrophysics Data System (ADS)

    Kapoor, Garima; Péter, László; Fekete, Éva; Gubicza, Jenő

    2018-05-01

    The effect of molybdenum (Mo) alloying on the lattice defect structure in electrodeposited nanocrystalline nickel (Ni) films was studied. The electrodeposited layers were prepared on copper substrate at room temperature, with a constant current density and pH value. The chemical composition of these layers was determined by EDS. In addition, X-ray diffraction line profile analysis was carried out to study the microstructural parameters such as the crystallite size, the dislocation density and the stacking fault probability. It was found that the higher Mo content yielded more than one order of magnitude larger dislocation density while the crystallite size was only slightly smaller. In addition, the twin boundary formation activity during deposition increased with increasing Mo concentration. The results obtained on electrodeposited layers were compared with previous research carried out on bulk nanocrystalline Ni-Mo materials with similar compositions but processed by severe plastic deformation.

  12. Thermomechanical treatment of 2124 PM aluminum alloys with low and high dispersoid levels

    NASA Technical Reports Server (NTRS)

    Sarkar, B.; Lisagor, W. B.

    1986-01-01

    The effects of thermomechanical treatment (TMT) on the mechanical properties and metallurgical structure of 2124 powder metallurgy aluminum alloys prepared from rapidly solidified powders were investigated. The alloys were prepared by using a standard canning/vacuum degassing/hot consolidation/extrusion sequence. Two compositions, with manganese contents of 0.5 and 1.5 percent, were investigated to examine the effects of low and high dispersoid levels. The results indicate that significant improvements in strength can be accomplished through TMT for this PM alloy system with little loss in toughness. The increase in strength observed is attributed to the presence of much finer, more homogeneous S-prime precipitation than that observed without TMT. Rolling deformation at room temperature resulted in some tendency for nonuniform (planar) deformation and resulted in slightly lower notch strength values. The lower notch strengths observed in the higher manganese composition were attributed to the coarser, more dense dispersoids observed in this material.

  13. Effect of gamma irradiation on physicochemical properties of stored pigeon pea (Cajanus cajan) flour

    PubMed Central

    Bamidele, Oluwaseun P; Akanbi, Charles T

    2013-01-01

    The effect of gamma irradiation at various doses (5, 10, 15, 20 kGy) was observed on pigeon pea flour stored for 3 months on proximate composition, functional properties, and peroxide value. Sensory evaluation was also carried out on bean cake (moinmoin) made from nonirradiated and irradiated pigeon pea flour. The results showed that stored gamma-irradiated samples had significantly lower (P < 0.05) value of protein and little or no effect on moisture content. There were slight decreases in crude fiber and ash content of the irradiated samples compared with the control sample. The result of functional properties of the irradiated flours showed slight increase in water absorption capacity, swelling capacity and bulk density. The peroxide value of crude oil increased significantly with dose increases for the period of storage. The sensory evaluation of moinmoin samples prepared from irradiated pigeon pea flour showed no significant difference from the moinmoin sample prepared from nonirradiated flour. It can be concluded that gamma irradiation can extend the shelf life of pigeon pea flour. PMID:24804044

  14. Effect of gamma irradiation on physicochemical properties of stored pigeon pea (Cajanus cajan) flour.

    PubMed

    Bamidele, Oluwaseun P; Akanbi, Charles T

    2013-09-01

    The effect of gamma irradiation at various doses (5, 10, 15, 20 kGy) was observed on pigeon pea flour stored for 3 months on proximate composition, functional properties, and peroxide value. Sensory evaluation was also carried out on bean cake (moinmoin) made from nonirradiated and irradiated pigeon pea flour. The results showed that stored gamma-irradiated samples had significantly lower (P < 0.05) value of protein and little or no effect on moisture content. There were slight decreases in crude fiber and ash content of the irradiated samples compared with the control sample. The result of functional properties of the irradiated flours showed slight increase in water absorption capacity, swelling capacity and bulk density. The peroxide value of crude oil increased significantly with dose increases for the period of storage. The sensory evaluation of moinmoin samples prepared from irradiated pigeon pea flour showed no significant difference from the moinmoin sample prepared from nonirradiated flour. It can be concluded that gamma irradiation can extend the shelf life of pigeon pea flour.

  15. Value Conflicts between Civil Society and Military Institutions.

    DTIC Science & Technology

    1972-02-01

    to inaividuality and personal freedom in the military service (30 percent of the sample indi- cated they were unemployed ). Potential for Reenlistment...percent were unemployed as contrasted with 15 percent of "would not have entered" they have a lower socioeconomic background and include a larger...they .ere unemployed .) With respect to importance attached to value ouestions, some slight, statistically significant, differences appear (.3

  16. Fearing Colleges Slight "Traditional Values," Conservatives Back "Free Enterprise" Chairs.

    ERIC Educational Resources Information Center

    Evangelauf, Jean

    1987-01-01

    In the last 25 years, 80 to 100 chairs or institutes focusing on the study of capitalism have been established on college campuses, sometimes facing criticism because of potential conflict with the institution's mission. (MSE)

  17. CMV blood test

    MedlinePlus

    CMV antibody tests ... never been infected with CMV have no detectable antibodies to CMV. Normal value ranges may vary slightly ... The presence of antibodies to CMV indicates a current or past ... CMV. If the number of antibodies (called the antibody titer) ...

  18. Aspartate aminotransferase (AST) blood test

    MedlinePlus

    The normal range is 10 to 34 U/L (0.17 to 0.57 µkat/L). Normal value ranges may vary slightly among different laboratories. Some labs use different measurements or may test different samples. Talk to your health ...

  19. The effect of an atomically deposited layer of alumina on NiO in P-type dye-sensitized solar cells.

    PubMed

    Natu, Gayatri; Huang, Zhongjie; Ji, Zhiqiang; Wu, Yiying

    2012-01-10

    We present a systematic investigation of the fundamental effects of an atomically deposited alumina (AlO(x)H(y)) onto the NiO films in p-type dye-sensitized solar cells (p-DSCs). With P1 as the sensitizing dye and 0.1 M I(2) and 1.0 M LiI in 3-methoxypropionitrile as the electrolyte, one atomic layer deposition (ALD) cycle of alumina was used to achieve a 74% increase in the overall conversion efficiency of a NiO-based DSC. The open circuit voltage of the cells increased from 0.11 to 0.15 V, and the short circuit current density increased from 0.83 to 0.95 mA/cm(2). Adsorption isotherm studies were performed to show that the amount of dye adsorbed on the NiO-alumina film is slightly lower than the amount adsorbed on the nontreated NiO film. The increased J(sc) was therefore assigned to the increased efficiency of carrier collection at the semiconductor-FTO interface. Our study of the photocurrent onset potentials of NiO and NiO-alumina films with the chopped light measurement technique showed no definitive difference in the onset potential values. However, the DSCs based on NiO-alumina showed a higher recombination resistance value from the electrochemical impedance studies and a higher diode ideality factor from the V(oc) versus ln(light intensity) plots as compared to the DSCs based on untreated NiO. It has thus been established that the increase in V(oc) upon alumina treatment arises due to a higher resistance for electron-hole recombination across NiO surface locally.

  20. Contamination and health risks from heavy metals in cultivated soil in Zhangjiakou City of Hebei Province, China.

    PubMed

    Liang, Qian; Xue, Zhan-Jun; Wang, Fei; Sun, Zhi-Mei; Yang, Zhi-Xin; Liu, Shu-Qing

    2015-12-01

    A total of 79 topsoil samples (ranging from 0 to 20 cm in depth) were collected from a grape cultivation area of Zhangjiakou City, China. The total concentrations of As, Cd, Hg, Cr, Cu, Mn, Ni, Pb, and Zn in soil samples were determined to evaluate pollution levels and associated health risks in each sample. Pollution levels were calculated using enrichment factors (EF) and geoaccumulation index (I geo). Health risks for adults and children were quantified using hazard indexes (HI) and aggregate carcinogenic risks (ACR). The mean concentrations of measured heavy metals Cd, Hg, and Cu, only in the grape cultivation soil samples, were higher than the background values of heavy metals in Hebei Province. According to principal component analysis (PCA), the anthropogenic activities related to agronomic and fossil fuel combustion practices attributed to higher accumulations of Cd, Hg, and Cu, which have slightly polluted about 10-40% of the sampled soils. However, the HI for all of the heavy metals were lower than 1 (within safe limits), and the ACR of As was in the 10(-6)-10(-4) range (a tolerable level). This suggests the absence of both non-carcinogenic and carcinogenic health risks for adults and children through oral ingestion and dermal absorption exposure pathways in the studied area. It should be also noted that the heightened vulnerability of children to health risks was accounted for higher HI and ACR values. Consequently, heavy metal concentrations (e.g., Cd, Hg, Cu) should be periodically monitored in these soils and improved soil management practices are required to minimize possible impacts on children's health.

Top