Sample records for small charged molecules

  1. Systems Based Study of the Therapeutic Potential of Small Charged Molecules for the Inhibition of IL-1 Mediated Cartilage Degradation

    PubMed Central

    Kar, Saptarshi; Smith, David W.; Gardiner, Bruce S.; Grodzinsky, Alan J.

    2016-01-01

    Inflammatory cytokines are key drivers of cartilage degradation in post-traumatic osteoarthritis. Cartilage degradation mediated by these inflammatory cytokines has been extensively investigated using in vitro experimental systems. Based on one such study, we have developed a computational model to quantitatively assess the impact of charged small molecules intended to inhibit IL-1 mediated cartilage degradation. We primarily focus on the simplest possible computational model of small molecular interaction with the IL-1 system—direct binding of the small molecule to the active site on the IL-1 molecule itself. We first use the model to explore the uptake and release kinetics of the small molecule inhibitor by cartilage tissue. Our results show that negatively charged small molecules are excluded from the negatively charged cartilage tissue and have uptake kinetics in the order of hours. In contrast, the positively charged small molecules are drawn into the cartilage with uptake and release timescales ranging from hours to days. Using our calibrated computational model, we subsequently explore the effect of small molecule charge and binding constant on the rate of cartilage degradation. The results from this analysis indicate that the small molecules are most effective in inhibiting cartilage degradation if they are either positively charged and/or bind strongly to IL-1α, or both. Furthermore, our results showed that the cartilage structural homeostasis can be restored by the small molecule if administered within six days following initial tissue exposure to IL-1α. We finally extended the scope of the computational model by simulating the competitive inhibition of cartilage degradation by the small molecule. Results from this model show that small molecules are more efficient in inhibiting cartilage degradation by binding directly to IL-1α rather than binding to IL-1α receptors. The results from this study can be used as a template for the design and development of more pharmacologically effective osteoarthritis drugs, and to investigate possible therapeutic options. PMID:27977731

  2. Influence of thermocleavable functionality on organic field-effect transistor performance of small molecules

    NASA Astrophysics Data System (ADS)

    Mahale, Rajashree Y.; Dharmapurikar, Satej S.; Chini, Mrinmoy Kumar; Venugopalan, Vijay

    2017-06-01

    Diketopyrrolopyrrole based donor-acceptor-donor conjugated small molecules using ethylene dioxythiophene as a donor was synthesized. Electron deficient diketopyrrolopyrrole unit was substituted with thermocleavable (tert-butyl acetate) side chains. The thermal treatment of the molecules at 160 °C eliminated the tert-butyl ester group results in the formation of corresponding acid. Optical and theoretical studies revealed that the molecules adopted a change in molecular arrangement after thermolysis. The conjugated small molecules possessed p-channel charge transport characteristics in organic field effect transistors. The charge carrier mobility was increased after thermolysis of tert-butyl ester group to 5.07 × 10-5 cm2/V s.

  3. Interplay between efficiency and device architecture for small molecule organic solar cells.

    PubMed

    Williams, Graeme; Sutty, Sibi; Aziz, Hany

    2014-06-21

    Small molecule organic solar cells (OSCs) have experienced a resurgence of interest over their polymer solar cell counterparts, owing to their improved batch-to-batch (thus, cell-to-cell) reliability. In this systematic study on OSC device architecture, we investigate five different small molecule OSC structures, including the simple planar heterojunction (PHJ) and bulk heterojunction (BHJ), as well as several planar-mixed structures. The different OSC structures are studied over a wide range of donor:acceptor mixing concentrations to gain a comprehensive understanding of their charge transport behavior. Transient photocurrent decay measurements provide crucial information regarding the interplay between charge sweep-out and charge recombination, and ultimately hint toward space charge effects in planar-mixed structures. Results show that the BHJ/acceptor architecture, comprising a BHJ layer with high C60 acceptor content, generates OSCs with the highest performance by balancing charge generation with charge collection. The performance of other device architectures is largely limited by hole transport, with associated hole accumulation and space charge effects.

  4. Influence of charge on encapsulation and release behavior of small molecules in self-assembled layer-by-layer microcapsules.

    PubMed

    Mandapalli, Praveen K; Labala, Suman; Vanamala, Deekshith; Koranglekar, Manali P; Sakimalla, Lakshmi A; Venuganti, Venkata Vamsi K

    2014-12-01

    The objective of this study is to investigate the influence of charge of model small molecules on their encapsulation and release behavior in layer-by-layer microcapsules (LbL-MC). Poly(styrene sulfonate) and poly(ethylene imine) were sequentially adsorbed on calcium carbonate sacrificial templates to prepare LbL-MC. Model molecules with varying charge, anionic - ascorbic acid, cationic - imatinib mesylate (IM) and neutral - 5-fluorouracil were encapsulated in LbL-MC. Free and encapsulated LbL-MC were characterized using zetasizer, FTIR spectroscope and differential scanning calorimeter. The influence of IM-loaded LbL-MC on cell viability was studied in B16F10 murine melanoma cells. Furthermore, biodistribution of IM-loaded LbL-MC with and without PEGylation was studied in BALB/c mice. Results showed spherical LbL-MC of 3.0 ± 0.4 μm diameter. Encapsulation efficiency of LbL-MC increased linearly (R(2 )= 0.89-0.99) with the increase in solute concentration. Increase in pH from 2 to 6 increased the encapsulation of charged molecules in LbL-MC. Charged molecules showed greater encapsulation efficiency in LbL-MC compared with neutral molecule. In vitro release kinetics showed Fickian and non-Fickian diffusion of small molecules, depending on the nature of molecular interactions with LbL-MC. At 50 μM concentration, free IM showed significantly (p < 0.05) more cytotoxicity compared with IM-loaded LbL-MC. Biodistribution studies showed that PEGylation of LbL-MC decreased the liver and spleen uptake of IM-encapsulated LbL-MC. In conclusion, LbL-MC can be developed as a potential carrier for small molecules depending on their physical and chemical properties.

  5. Fluorination-enabled optimal morphology leads to over 11% efficiency for inverted small-molecule organic solar cells

    PubMed Central

    Deng, Dan; Zhang, Yajie; Zhang, Jianqi; Wang, Zaiyu; Zhu, Lingyun; Fang, Jin; Xia, Benzheng; Wang, Zhen; Lu, Kun; Ma, Wei; Wei, Zhixiang

    2016-01-01

    Solution-processable small molecules for organic solar cells have attracted intense attention for their advantages of definite molecular structures compared with their polymer counterparts. However, the device efficiencies based on small molecules are still lower than those of polymers, especially for inverted devices, the highest efficiency of which is <9%. Here we report three novel solution-processable small molecules, which contain π-bridges with gradient-decreased electron density and end acceptors substituted with various fluorine atoms (0F, 1F and 2F, respectively). Fluorination leads to an optimal active layer morphology, including an enhanced domain purity, the formation of hierarchical domain size and a directional vertical phase gradation. The optimal morphology balances charge separation and transfer, and facilitates charge collection. As a consequence, fluorinated molecules exhibit excellent inverted device performance, and an average power conversion efficiency of 11.08% is achieved for a two-fluorine atom substituted molecule. PMID:27991486

  6. An ultrasensitive universal detector based on neutralizer displacement

    NASA Astrophysics Data System (ADS)

    Das, Jagotamoy; Cederquist, Kristin B.; Zaragoza, Alexandre A.; Lee, Paul E.; Sargent, Edward H.; Kelley, Shana O.

    2012-08-01

    Diagnostic technologies that can provide the simultaneous detection of nucleic acids for gene expression, proteins for host response and small molecules for profiling the human metabolome will have a significant advantage in providing comprehensive patient monitoring. Molecular sensors that report changes in the electrostatics of a sensor's surface on analyte binding have shown unprecedented sensitivity in the detection of charged biomolecules, but do not lend themselves to the detection of small molecules, which do not carry significant charge. Here, we introduce the neutralizer displacement assay that allows charge-based sensing to be applied to any class of molecule irrespective of the analyte charge. The neutralizer displacement assay starts with an aptamer probe bound to a neutralizer. When analyte binding occurs the neutralizer is displaced, which results in a dramatic change in the surface charge for all types of analytes. We have tested the sensitivity, speed and specificity of this system in the detection of a panel of molecules: (deoxy)ribonucleic acid, ribonucleic acid, cocaine, adenosine triphosphate and thrombin.

  7. Free-standing few-layered graphene oxide films: selective, steady and lasting permeation of organic molecules with adjustable speeds

    NASA Astrophysics Data System (ADS)

    Huang, Tao; An, Qi; Luan, Xinglong; Zhang, Qian; Zhang, Yihe

    2016-01-01

    A variety of small molecules with diameters around 1 nm possess a range of functions, such as antibiotic, antimicrobic, anticoagulant, pesticidal and chemotherapy effects, making these molecules especially useful in various applications ranging from medical treatment to environmental microbiological control. However, the long-term steady delivery (release or permeation) of these small molecules with adjustable and controllable speeds has remained an especially challenging task. In this study, we prepared covalently cross-linked free-standing few-layered GO films using a layer-by-layer technique in combination with photochemical cross-linkages, and achieved a controlled release of positively charged, negatively charged, and zwitterionic small molecules with adjustable and controllable speeds. The steady delivery of the small molecule lasted up to 9 days. Other functionalities, such as graphene-enhanced Raman spectra and electrochemical properties that could also be integrated or employed in delivery systems, were also studied for our films. We expect the special molecular delivery properties of our films to lead to new possibilities in drug/fertilizer delivery and environmental microbiological control applications.A variety of small molecules with diameters around 1 nm possess a range of functions, such as antibiotic, antimicrobic, anticoagulant, pesticidal and chemotherapy effects, making these molecules especially useful in various applications ranging from medical treatment to environmental microbiological control. However, the long-term steady delivery (release or permeation) of these small molecules with adjustable and controllable speeds has remained an especially challenging task. In this study, we prepared covalently cross-linked free-standing few-layered GO films using a layer-by-layer technique in combination with photochemical cross-linkages, and achieved a controlled release of positively charged, negatively charged, and zwitterionic small molecules with adjustable and controllable speeds. The steady delivery of the small molecule lasted up to 9 days. Other functionalities, such as graphene-enhanced Raman spectra and electrochemical properties that could also be integrated or employed in delivery systems, were also studied for our films. We expect the special molecular delivery properties of our films to lead to new possibilities in drug/fertilizer delivery and environmental microbiological control applications. Electronic supplementary information (ESI) available: AFM images of GO and GO films, UV-vis spectra of delayed release, and permeation fidelities. See DOI: 10.1039/c5nr08129g

  8. Charge transfer and charge localization in extended radical cations: Investigation of model molecules for peptides

    NASA Astrophysics Data System (ADS)

    Weinkauf, Rainer; Lehrer, Florian

    1998-12-01

    Molecules consisting of a flexible tail and an aromatic chromophore are used as model systems to understand the situation of a single chromophore in a small peptide. Their S0-S1 resonant multiphoton ionization (REMPI) spectra show, that in neutral molecules the tail-chromophore interaction is weak and electronic excitation is localized at the chromophore. For molecules, where the ionization energy of the tail is considerable higher than that of the chromophore, by high resolution REMPI photoelectron spectroscopy we find the charge to be localized on the aromatic chromophore. This scheme also in suitable peptides allows local ionization at the aromatic chromophore. An estimate for various charge positions in peptide chains, however, shows, that for most of the amino acids electron hole positions in the nitrogen and oxygen "lone pair" orbitals of the peptide bond are nearly degenerate. REMPI photoelectron spectra of phenylethylamine, which as a model system contains such two degenerate charge positions, show small energetic shift of the ionization energy but strong geometry changes upon electron removal. This result is interpreted as direct ionization into a mixed charge delocalized state. Consequences for the charge transfer mechanism in peptides are discussed.

  9. A Nonfullerene Small Molecule Acceptor with 3D Interlocking Geometry Enabling Efficient Organic Solar Cells.

    PubMed

    Lee, Jaewon; Singh, Ranbir; Sin, Dong Hun; Kim, Heung Gyu; Song, Kyu Chan; Cho, Kilwon

    2016-01-06

    A new 3D nonfullerene small-molecule acceptor is reported. The 3D interlocking geometry of the small-molecule acceptor enables uniform molecular conformation and strong intermolecular connectivity, facilitating favorable nanoscale phase separation and electron charge transfer. By employing both a novel polymer donor and a nonfullerene small-molecule acceptor in the solution-processed organic solar cells, a high-power conversion efficiency of close to 6% is demonstrated. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Quantum Theory of Atoms in Molecules Charge-Charge Transfer-Dipolar Polarization Classification of Infrared Intensities.

    PubMed

    Duarte, Leonardo J; Richter, Wagner E; Silva, Arnaldo F; Bruns, Roy E

    2017-10-26

    Fundamental infrared vibrational transition intensities of gas-phase molecules are sensitive probes of changes in electronic structure accompanying small molecular distortions. Models containing charge, charge transfer, and dipolar polarization effects are necessary for a successful classification of the C-H, C-F, and C-Cl stretching and bending intensities. C-H stretching and in-plane bending vibrations involving sp 3 carbon atoms have small equilibrium charge contributions and are accurately modeled by the charge transfer-counterpolarization contribution and its interaction with equilibrium charge movement. Large C-F and C═O stretching intensities have dominant equilibrium charge movement contributions compared to their charge transfer-dipolar polarization ones and are accurately estimated by equilibrium charge and the interaction contribution. The C-F and C-Cl bending modes have charge and charge transfer-dipolar polarization contribution sums that are of similar size but opposite sign to their interaction values resulting in small intensities. Experimental in-plane C-H bends have small average intensities of 12.6 ± 10.4 km mol -1 owing to negligible charge contributions and charge transfer-counterpolarization cancellations, whereas their average out-of-plane experimental intensities are much larger, 65.7 ± 20.0 km mol -1 , as charge transfer is zero and only dipolar polarization takes place. The C-F bending intensities have large charge contributions but very small intensities. Their average experimental out-of-plane intensity of 9.9 ± 12.6 km mol -1 arises from the cancellation of large charge contributions by dipolar polarization contributions. The experimental average in-plane C-F bending intensity, 5.8 ± 7.3 km mol -1 , is also small owing to charge and charge transfer-counterpolarization sums being canceled by their interaction contributions. Models containing only atomic charges and their fluxes are incapable of describing electronic structure changes for simple molecular distortions that are of interest in classifying infrared intensities. One can expect dipolar polarization effects to also be important for larger distortions of chemical interest.

  11. Interfacial charge transfer absorption: Application to metal molecule assemblies

    NASA Astrophysics Data System (ADS)

    Creutz, Carol; Brunschwig, Bruce S.; Sutin, Norman

    2006-05-01

    Optically induced charge transfer between adsorbed molecules and a metal electrode was predicted by Hush to lead to new electronic absorption features, but has been only rarely observed experimentally. Interfacial charge transfer absorption (IFCTA) provides information concerning the barriers to charge transfer between molecules and the metal/semiconductor and the magnitude of the electronic coupling and could thus provide a powerful tool for understanding interfacial charge-transfer kinetics. Here, we utilize a previously published model [C. Creutz, B.S. Brunschwig, N. Sutin, J. Phys. Chem. B 109 (2005) 10251] to predict IFCTA spectra of metal-molecule assemblies and compare the literature observations to these predictions. We conclude that, in general, the electronic coupling between molecular adsorbates and the metal levels is so small that IFCTA is not detectable. However, few experiments designed to detect IFCTA have been done. We suggest approaches to optimizing the conditions for observing the process.

  12. Phase behavior and structure of stable complexes between a long polyanion and a branched polycation

    NASA Astrophysics Data System (ADS)

    Mengarelli, Valentina; Zeghal, Mehdi; Auvray, Loïc; Clemens, Daniel

    2011-08-01

    The association between oppositely charged branched polyethylenimine (BPEI) and polymethacrylic acid (PMA) in the dilute regime is investigated using turbidimetric titration and electrophoretic mobility measurements. The complexation is controlled by tuning continuously the pH-sensitive charge of the polyacid in acidic solution. The formation of soluble and stable positively charged complexes is a cooperative process characterized by the existence of two regimes of weak and strong complexation. In the regime of weak complexation, a long PMA chain overcharged by several BPEI molecules forms a binary complex. As the charge of the polyacid increases, these binary complexes condense at a well defined charge ratio of the mixture to form large positively charged aggregates. The overcharging and the existence of two regimes of complexation are analyzed in the light of recent theories. The structure of the polyelectrolytes is investigated at higher polymer concentration by small angle neutron scattering. Binary complexes of finite size present an open structure where the polyacid chains connecting a small number of BPEI molecules have shrunk slightly. In the condensed complexes, BPEI molecules, wrapped by polyacid chains, form networks of stretched necklaces.

  13. Accurate on-chip measurement of the Seebeck coefficient of high mobility small molecule organic semiconductors

    NASA Astrophysics Data System (ADS)

    Warwick, C. N.; Venkateshvaran, D.; Sirringhaus, H.

    2015-09-01

    We present measurements of the Seebeck coefficient in two high mobility organic small molecules, 2,7-dioctyl[1]benzothieno[3,2-b][1]benzothiophene (C8-BTBT) and 2,9-didecyl-dinaphtho[2,3-b:2',3'-f]thieno[3,2-b]thiophene (C10-DNTT). The measurements are performed in a field effect transistor structure with high field effect mobilities of approximately 3 cm2/V s. This allows us to observe both the charge concentration and temperature dependence of the Seebeck coefficient. We find a strong logarithmic dependence upon charge concentration and a temperature dependence within the measurement uncertainty. Despite performing the measurements on highly polycrystalline evaporated films, we see an agreement in the Seebeck coefficient with modelled values from Shi et al. [Chem. Mater. 26, 2669 (2014)] at high charge concentrations. We attribute deviations from the model at lower charge concentrations to charge trapping.

  14. Improving the Charge Carrier Transport and Suppressing Recombination of Soluble Squaraine-Based Solar Cells via Parallel-Like Structure

    PubMed Central

    Zhu, Youqin; Liu, Jingli; Zhao, Jiao; Li, Yang; Qiao, Bo; Song, Dandan; Huang, Yan; Xu, Zheng; Zhao, Suling; Xu, Xurong

    2018-01-01

    Small molecule organic solar cells (SMOSCs) have attracted extensive attention in recent years. Squaraine (SQ) is a kind of small molecule material for potential use in high-efficiency devices, because of its high extinction coefficient and low-cost synthesis. However, the charge carrier mobility of SQ-based film is much lower than other effective materials, which leads to the pretty low fill factor (FF). In this study, we improve the performance of SQ derivative-based solar cells by incorporating PCDTBT into LQ-51/PC71BM host binary blend film. The incorporation of PCDTBT can not only increase the photon harvesting, but also provide an additional hole transport pathway. Through the charge carrier mobility and transient photovoltage measurement, we find that the hole mobility and charge carrier lifetime increase in the ternary system. Also, we carefully demonstrate that the charge carrier transport follows a parallel-like behavior. PMID:29747394

  15. Rational Design of Diketopyrrolopyrrole-Based Small Molecules as Donating Materials for Organic Solar Cells

    PubMed Central

    Jin, Ruifa; Wang, Kai

    2015-01-01

    A series of diketopyrrolopyrrole-based small molecules have been designed to explore their optical, electronic, and charge transport properties as organic solar cell (OSCs) materials. The calculation results showed that the designed molecules can lower the band gap and extend the absorption spectrum towards longer wavelengths. The designed molecules own the large longest wavelength of absorption spectra, the oscillator strength, and absorption region values. The optical, electronic, and charge transport properties of the designed molecules are affected by the introduction of different π-bridges and end groups. We have also predicted the mobility of the designed molecule with the lowest total energies. Our results reveal that the designed molecules are expected to be promising candidates for OSC materials. Additionally, the designed molecules are expected to be promising candidates for electron and/or hole transport materials. On the basis of our results, we suggest that molecules under investigation are suitable donors for [6,6]-phenyl-C61-butyric acid methyl ester (PCBM) and its derivatives as acceptors of OSCs. PMID:26343640

  16. Reshaping and linking of molecules in ion-pair traps

    NASA Astrophysics Data System (ADS)

    Cochrane, Bryce; Naumkin, Fedor Y.

    2016-01-01

    A series of insertion complexes of small molecules trapped between alkali-halide counter-ions are investigated ab initio. The molecular shape is altered inside the complexes and varies in corresponding anions. Stabilities and charge distributions are investigated. Strong charge-transfer in the alkali-halide component effectively through the almost neutral molecule results in very large dipole moments. The most stable species is used to construct a dimer significantly bound via dipole-dipole interaction. Another complex with two alkali-halide diatoms trapping the molecule represents a unit of corresponding longer oligomer. This completes the array of systems with the molecule effectively in ion-pair, ion-dipole, dipole-pair electric fields.

  17. Effects of Acids, Bases, and Heteroatoms on Proximal Radial Distribution Functions for Proteins.

    PubMed

    Nguyen, Bao Linh; Pettitt, B Montgomery

    2015-04-14

    The proximal distribution of water around proteins is a convenient method of quantifying solvation. We consider the effect of charged and sulfur-containing amino acid side-chain atoms on the proximal radial distribution function (pRDF) of water molecules around proteins using side-chain analogs. The pRDF represents the relative probability of finding any solvent molecule at a distance from the closest or surface perpendicular protein atom. We consider the near-neighbor distribution. Previously, pRDFs were shown to be universal descriptors of the water molecules around C, N, and O atom types across hundreds of globular proteins. Using averaged pRDFs, a solvent density around any globular protein can be reconstructed with controllable relative error. Solvent reconstruction using the additional information from charged amino acid side-chain atom types from both small models and protein averages reveals the effects of surface charge distribution on solvent density and improves the reconstruction errors relative to simulation. Solvent density reconstructions from the small-molecule models are as effective and less computationally demanding than reconstructions from full macromolecular models in reproducing preferred hydration sites and solvent density fluctuations.

  18. Charge transfer through amino groups-small molecules interface improving the performance of electroluminescent devices

    NASA Astrophysics Data System (ADS)

    Havare, Ali Kemal; Can, Mustafa; Tozlu, Cem; Kus, Mahmut; Okur, Salih; Demic, Şerafettin; Demirak, Kadir; Kurt, Mustafa; Icli, Sıddık

    2016-05-01

    A carboxylic group functioned charge transporting was synthesized and self-assembled on an indium tin oxide (ITO) anode. A typical electroluminescent device [modified ITO/TPD (50 nm)/Alq3 (60 nm)/LiF (2 nm)/(120 nm)] was fabricated to investigate the effect of the amino groups-small molecules interface on the characteristics of the device. The increase in the surface work function of ITO is expected to facilitate the hole injection from the ITO anode to the Hole Transport Layer (HTL) in electroluminescence. The modified electroluminescent device could endure a higher current and showed a much higher luminance than the nonmodified one. For the produced electroluminescent devices, the I-V characteristics, optical characterization and quantum yields were performed. The external quantum efficiency of the modified electroluminescent device is improved as the result of the presence of the amino groups-small molecules interface.

  19. Gating capacitive field-effect sensors by the charge of nanoparticle/molecule hybrids.

    PubMed

    Poghossian, Arshak; Bäcker, Matthias; Mayer, Dirk; Schöning, Michael J

    2015-01-21

    The semiconductor field-effect platform is a powerful tool for chemical and biological sensing with direct electrical readout. In this work, the field-effect capacitive electrolyte-insulator-semiconductor (EIS) structure - the simplest field-effect (bio-)chemical sensor - modified with citrate-capped gold nanoparticles (AuNPs) has been applied for a label-free electrostatic detection of charged molecules by their intrinsic molecular charge. The EIS sensor detects the charge changes in AuNP/molecule inorganic/organic hybrids induced by the molecular adsorption or binding events. The feasibility of the proposed detection scheme has been exemplarily demonstrated by realizing capacitive EIS sensors consisting of an Al-p-Si-SiO2-silane-AuNP structure for the label-free detection of positively charged cytochrome c and poly-d-lysine molecules as well as for monitoring the layer-by-layer formation of polyelectrolyte multilayers of poly(allylamine hydrochloride)/poly(sodium 4-styrene sulfonate), representing typical model examples of detecting small proteins and macromolecules and the consecutive adsorption of positively/negatively charged polyelectrolytes, respectively. For comparison, EIS sensors without AuNPs have been investigated, too. The adsorption of molecules on the surface of AuNPs has been verified via the X-ray photoelectron spectroscopy method. In addition, a theoretical model of the functioning of the capacitive field-effect EIS sensor functionalized with AuNP/charged-molecule hybrids has been discussed.

  20. Tailoring the interface using thiophene small molecules in TiO2/P3HT hybrid solar cells.

    PubMed

    Freitas, Flavio S; Clifford, John N; Palomares, Emilio; Nogueira, Ana F

    2012-09-14

    In this paper we focus on the effect of carboxylated thiophene small molecules as interface modifiers in TiO(2)/P3HT hybrid solar cells. Our results show that small differences in the chemical structure of these molecules, for example, the presence of the -CH(2)- group in the 2-thiopheneacetic acid (TAA), can greatly increase the TiO(2) surface wettability, improving the TiO(2)/polymer contact. This effect is important to enhance exciton splitting and charge separation.

  1. Triphenylamine-Based Push–Pull Molecule for Photovoltaic Applications: From Synthesis to Ultrafast Device Photophysics

    PubMed Central

    2017-01-01

    Small push–pull molecules attract much attention as prospective donor materials for organic solar cells (OSCs). By chemical engineering, it is possible to combine a number of attractive properties such as broad absorption, efficient charge separation, and vacuum and solution processabilities in a single molecule. Here we report the synthesis and early time photophysics of such a molecule, TPA-2T-DCV-Me, based on the triphenylamine (TPA) donor core and dicyanovinyl (DCV) acceptor end group connected by a thiophene bridge. Using time-resolved photoinduced absorption and photoluminescence, we demonstrate that in blends with [70]PCBM the molecule works both as an electron donor and hole acceptor, thereby allowing for two independent channels of charge generation. The charge-generation process is followed by the recombination of interfacial charge transfer states that takes place on the subnanosecond time scale as revealed by time-resolved photoluminescence and nongeminate recombination as follows from the OSC performance. Our findings demonstrate the potential of TPA-DCV-based molecules as donor materials for both solution-processed and vacuum-deposited OSCs. PMID:28413568

  2. Enhancing SERS by Means of Supramolecular Charge Transfer

    NASA Technical Reports Server (NTRS)

    Wong, Eric; Flood, Amar; Morales, Alfredo

    2009-01-01

    In a proposed method of sensing small quantities of molecules of interest, surface enhanced Raman scattering (SERS) spectroscopy would be further enhanced by means of intermolecular or supramolecular charge transfer. There is a very large potential market for sensors based on this method for rapid detection of chemical and biological hazards. In SERS, the Raman signals (vibrational spectra) of target molecules become enhanced by factors of the order of 108 when those molecules are in the vicinities of nanostructured substrate surfaces that have been engineered to have plasmon resonances that enhance local electric fields. SERS, as reported in several prior NASA Tech Briefs articles and elsewhere, has remained a research tool and has not yet been developed into a practical technique for sensing of target molecules: this is because the short range (5 to 20 nm) of the field enhancement necessitates engineering of receptor molecules to attract target molecules to the nanostructured substrate surfaces and to enable reliable identification of the target molecules in the presence of interferants. Intermolecular charge-transfer complexes have been used in fluorescence-, photoluminescence-, and electrochemistry-based techniques for sensing target molecules, but, until now, have not been considered for use in SERS-based sensing. The basic idea of the proposed method is to engineer receptor molecules that would be attached to nanostructured SERS substrates and that would interact with the target molecules to form receptor-target supramolecular charge-transfer complexes wherein the charge transfer could be photoexcited.

  3. Electric-field controlled capture or release of phosgene molecule on graphene-based materials: First principles calculations

    NASA Astrophysics Data System (ADS)

    Zhang, Tong; Sun, Hao; Wang, Fengdi; Zhang, Wanqiao; Ma, Junmei; Tang, Shuwei; Gong, Hongwei; Zhang, Jingping

    2018-01-01

    Phosgene, one of the common chemicals in many industry areas, is extremely harmful to human and the environment. Thus, it is necessary to design the advanced materials to detect or remove phosgene effectively. In fact, detection or adsorption of some small gas molecules are not the most difficult to actualize. Whereas, one of the primary challenges is the gas molecules desorption from the adsorbent for the purpose of recycling of substrate materials since the small gas molecules interacts strongly with the substrates. In this work, the interaction between the phosgene molecule and pristine or Mn-doped graphene sheets with different electric field and charge state are investigated by using first-principles simulations. Our results show that the adsorption energy of phosgene on Mn-doped graphene is dramatically weakened by applying an external negative electric field but is obviously enhanced by introducing a positive electric field. These processes can be easily controlled by transform the direction of the electric field. Thus, introducing an external electric field or charge in the system may be an excellent method to control the phosgene molecule adsorption and desorption on Mn-doped graphene sheet. All energy needed is just a small quantity of electricity, which satisfies well the requirement of green chemistry and sustainable development. The mechanism and reason of reversible adsorption/desorption is also revealed in terms of energy, charge distribution and orbital analysis. Such spontaneous adsorption or desorption makes Mn-doped graphene to be used as an excellent reusable scavenger of phosgene.

  4. Atomic Charge Parameters for the Finite Difference Poisson-Boltzmann Method Using Electronegativity Neutralization.

    PubMed

    Yang, Qingyi; Sharp, Kim A

    2006-07-01

    An optimization of Rappe and Goddard's charge equilibration (QEq) method of assigning atomic partial charges is described. This optimization is designed for fast and accurate calculation of solvation free energies using the finite difference Poisson-Boltzmann (FDPB) method. The optimization is performed against experimental small molecule solvation free energies using the FDPB method and adjusting Rappe and Goddard's atomic electronegativity values. Using a test set of compounds for which experimental solvation energies are available and a rather small number of parameters, very good agreement was obtained with experiment, with a mean unsigned error of about 0.5 kcal/mol. The QEq atomic partial charge assignment method can reflect the effects of the conformational changes and solvent induction on charge distribution in molecules. In the second section of the paper we examined this feature with a study of the alanine dipeptide conformations in water solvent. The different contributions to the energy surface of the dipeptide were examined and compared with the results from fixed CHARMm charge potential, which is widely used for molecular dynamics studies.

  5. Self-consistent-field study of conduction through conjugated molecules

    NASA Astrophysics Data System (ADS)

    Paulsson, Magnus; Stafström, Sven

    2001-07-01

    Current-voltage (I-V) characteristics of individual molecules connected by metallic leads are studied theoretically. Using the Pariser-Parr-Pople quantum chemical method to model the molecule enables us to include electron-electron interactions in the Hartree approximation. The self-consistent-field method is used to calculate charging together with other properties for the total system under bias. Thereafter the Landauer formula is used to calculate the current from the transmission amplitudes. The most important parameter to understand charging is the position of the chemical potentials of the leads in relation to the molecular levels. At finite bias, the main part of the potential drop is located at the molecule-lead junctions. Also, the potential of the molecule is shown to partially follow the chemical potential closest to the highest occupied molecular orbital (HOMO). Therefore, the resonant tunneling steps in the I-V curves are smoothed giving a I-V resembling a ``Coulomb-gap.'' However, the charge of the molecule is not quantized since the molecule is small with quite strong interactions with the leads. The calculations predict an increase in the current at the bias corresponding to the energy gap of the molecule irrespective of the metals used in the leads. When the bias is increased further, charge is redistributed from the HOMO level to the lowest unoccupied molecular orbital of the molecule. This gives a step in the I-V curves and a corresponding change in the potential profile over the molecule. Calculations were mainly performed on polyene molecules. Molecules asymmetrically coupled to the leads model the I-V curves for molecules contacted by a scanning tunneling microscopy tip. I-V curves for pentapyrrole and another molecule that show negative differential conductance are also analyzed. The charging of these two systems depends on the shape of the molecular wave functions.

  6. Fe(+) chemical ionization of peptides.

    PubMed

    Speir, J P; Gorman, G S; Amster, I J

    1993-02-01

    Laser-desorbed peptide neutral molecules were allowed to react with Fe(+) in a Fourier transform mass spectrometer, using the technique of laser desorption/chemical ionization. The Fe(+) ions are formed by laser ablation of a steel target, as well as by dissociative charge-exchange ionization of ferrocene with Ne(+). Prior to reaction with laser-desorbed peptide molecules, Fe(+) ions undergo 20-100 thermalizin collisions with xenon to reduce the population of excited-state metal ion species. The Fe(+) ions that have not experienced thermalizing collisions undergo charge exchange with peptide molecules. Iron ions that undergo thermalizing collisions before they are allowed to react with peptides are found to undergo charge exchange and to form adduct species [M + Fe(+)] and fragment ions that result from the loss of small, stable molecules, such as H2O, CO, and CO2, from the metal ion-peptide complex.

  7. Solution-processed small molecule:fullerene bulk-heterojunction solar cells: impedance spectroscopy deduced bulk and interfacial limits to fill-factors.

    PubMed

    Guerrero, Antonio; Loser, Stephen; Garcia-Belmonte, Germà; Bruns, Carson J; Smith, Jeremy; Miyauchi, Hiroyuki; Stupp, Samuel I; Bisquert, Juan; Marks, Tobin J

    2013-10-21

    Using impedance spectroscopy, we demonstrate that the low fill factor (FF) typically observed in small molecule solar cells is due to hindered carrier transport through the active layer and hindered charge transfer through the anode interfacial layer (IFL). By carefully tuning the active layer thickness and anode IFL in BDT(TDPP)2 solar cells, the FF is increased from 33 to 55% and the PCE from 1.9 to 3.8%. These results underscore the importance of simultaneously optimizing active layer thickness and IFL in small molecule solar cells.

  8. Thermoelectric effect and its dependence on molecular length and sequence in single DNA molecules.

    PubMed

    Li, Yueqi; Xiang, Limin; Palma, Julio L; Asai, Yoshihiro; Tao, Nongjian

    2016-04-15

    Studying the thermoelectric effect in DNA is important for unravelling charge transport mechanisms and for developing relevant applications of DNA molecules. Here we report a study of the thermoelectric effect in single DNA molecules. By varying the molecular length and sequence, we tune the charge transport in DNA to either a hopping- or tunnelling-dominated regimes. The thermoelectric effect is small and insensitive to the molecular length in the hopping regime. In contrast, the thermoelectric effect is large and sensitive to the length in the tunnelling regime. These findings indicate that one may control the thermoelectric effect in DNA by varying its sequence and length. We describe the experimental results in terms of hopping and tunnelling charge transport models.

  9. Thermoelectric effect and its dependence on molecular length and sequence in single DNA molecules

    PubMed Central

    Li, Yueqi; Xiang, Limin; Palma, Julio L.; Asai, Yoshihiro; Tao, Nongjian

    2016-01-01

    Studying the thermoelectric effect in DNA is important for unravelling charge transport mechanisms and for developing relevant applications of DNA molecules. Here we report a study of the thermoelectric effect in single DNA molecules. By varying the molecular length and sequence, we tune the charge transport in DNA to either a hopping- or tunnelling-dominated regimes. The thermoelectric effect is small and insensitive to the molecular length in the hopping regime. In contrast, the thermoelectric effect is large and sensitive to the length in the tunnelling regime. These findings indicate that one may control the thermoelectric effect in DNA by varying its sequence and length. We describe the experimental results in terms of hopping and tunnelling charge transport models. PMID:27079152

  10. Numerical Study on the Partitioning of the Molecular Polarizability into Fluctuating Charge and Induced Atomic Dipole Contributions

    PubMed Central

    Mei, Ye; Simmonett, Andrew C.; Pickard, Frank C.; DiStasio, Robert A.; Brooks, Bernard R.; Shao, Yihan

    2015-01-01

    In order to carry out a detailed analysis of the molecular static polarizability, which is the response of the molecule to a uniform external electric field, the molecular polarizability was computed using the finite-difference method for 21 small molecules, using density functional theory. Within nine charge population schemes (Löwdin, Mulliken, Becke, Hirshfeld, CM5, Hirshfeld-I, NPA, CHELPG, MK-ESP) in common use, the charge fluctuation contribution is found to dominate the molecular polarizability, with its ratio ranging from 59.9% with the Hirshfeld or CM5 scheme to 96.2% with the Mulliken scheme. The Hirshfeld-I scheme is also used to compute the other contribution to the molecular polarizability coming from the induced atomic dipoles, and the atomic polarizabilities in 8 small molecules and water pentamer are found to be highly anisotropic for most atoms. Overall, the results suggest that (a) more emphasis probably should be placed on the charge fluctuation terms in future polarizable force field development; (b) an anisotropic polarizability might be more suitable than an isotropic one in polarizable force fields based entirely or partially on the induced atomic dipoles. PMID:25945749

  11. Numerical study on the partitioning of the molecular polarizability into fluctuating charge and induced atomic dipole contributions

    DOE PAGES

    Mei, Ye; Simmonett, Andrew C.; Pickard, IV, Frank C.; ...

    2015-05-06

    In order to carry out a detailed analysis of the molecular static polarizability, which is the response of the molecule to a uniform external electric field, the molecular polarizability was computed in this study using the finite-difference method for 21 small molecules, using density functional theory. Within nine charge population schemes (Lowdin, Mulliken, Becke, Hirshfeld, CM5, Hirshfeld-I, NPA, CHELPG, MK-ESP) in common use, the charge fluctuation contribution is found to dominate the molecular polarizability, with its ratio ranging from 59.9% with the Hirshfeld or CM5 scheme to 96.2% with the Mulliken scheme. The Hirshfeld-I scheme is also used to computemore » the other contribution to the molecular polarizability coming from the induced atomic dipoles, and the atomic polarizabilities in eight small molecules and water pentamer are found to be highly anisotropic for most atoms. In conclusion, the overall results suggest that (a) more emphasis probably should be placed on the charge fluctuation terms in future polarizable force field development and (b) an anisotropic polarizability might be more suitable than an isotropic one in polarizable force fields based entirely or partially on the induced atomic dipoles.« less

  12. Effects of Acids, Bases, and Heteroatoms on Proximal Radial Distribution Functions for Proteins

    PubMed Central

    Nguyen, Bao Linh; Pettitt, B. Montgomery

    2015-01-01

    The proximal distribution of water around proteins is a convenient method of quantifying solvation. We consider the effect of charged and sulfur-containing amino acid side-chain atoms on the proximal radial distribution function (pRDF) of water molecules around proteins using side-chain analogs. The pRDF represents the relative probability of finding any solvent molecule at a distance from the closest or surface perpendicular protein atom. We consider the near-neighbor distribution. Previously, pRDFs were shown to be universal descriptors of the water molecules around C, N, and O atom types across hundreds of globular proteins. Using averaged pRDFs, a solvent density around any globular protein can be reconstructed with controllable relative error. Solvent reconstruction using the additional information from charged amino acid side-chain atom types from both small models and protein averages reveals the effects of surface charge distribution on solvent density and improves the reconstruction errors relative to simulation. Solvent density reconstructions from the small-molecule models are as effective and less computationally demanding than reconstructions from full macromolecular models in reproducing preferred hydration sites and solvent density fluctuations. PMID:26388706

  13. Link between hopping models and percolation scaling laws for charge transport in mixtures of small molecules

    DOE PAGES

    Ha, Dong -Gwang; Kim, Jang -Joo; Baldo, Marc A.

    2016-04-29

    Mixed host compositions that combine charge transport materials with luminescent dyes offer superior control over exciton formation and charge transport in organic light emitting devices (OLEDs). Two approaches are typically used to optimize the fraction of charge transport materials in a mixed host composition: either an empirical percolative model, or a hopping transport model. We show that these two commonly-employed models are linked by an analytic expression which relates the localization length to the percolation threshold and critical exponent. The relation is confirmed both numerically and experimentally through measurements of the relative conductivity of Tris(4-carbazoyl-9-ylphenyl) amine (TCTA) :1,3-bis(3,5-dipyrid-3-yl-phenyl) benzene (BmPyPb)more » mixtures with different concentrations, where the TCTA plays a role as hole conductor and the BmPyPb as hole insulator. Furthermore, the analytic relation may allow the rational design of mixed layers of small molecules for high-performance OLEDs.« less

  14. Link between hopping models and percolation scaling laws for charge transport in mixtures of small molecules

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ha, Dong-Gwang; Kim, Jang-Joo; Baldo, Marc A.

    2016-04-01

    Mixed host compositions that combine charge transport materials with luminescent dyes offer superior control over exciton formation and charge transport in organic light emitting devices (OLEDs). Two approaches are typically used to optimize the fraction of charge transport materials in a mixed host composition: either an empirical percolative model, or a hopping transport model. We show that these two commonly-employed models are linked by an analytic expression which relates the localization length to the percolation threshold and critical exponent. The relation is confirmed both numerically and experimentally through measurements of the relative conductivity of Tris(4-carbazoyl-9-ylphenyl)amine (TCTA) :1,3-bis(3,5-dipyrid-3-yl-phenyl)benzene (BmPyPb) mixtures withmore » different concentrations, where the TCTA plays a role as hole conductor and the BmPyPb as hole insulator. The analytic relation may allow the rational design of mixed layers of small molecules for high-performance OLEDs.« less

  15. Spin relaxation measurements of electrostatic bias in intermolecular exploration

    NASA Astrophysics Data System (ADS)

    Teng, Ching-Ling; Bryant, Robert G.

    2006-04-01

    We utilize the paramagnetic contribution to proton spin-lattice relaxation rate constants induced by freely diffusing charged paramagnetic centers to investigate the effect of charge on the intermolecular exploration of a protein by the small molecule. The proton NMR spectrum provided 255 resolved resonances that report how the explorer molecule local concentration varies with position on the surface. The measurements integrate over local dielectric constant variations, and, in principle, provide an experimental characterization of the surface free energy sampling biases introduced by the charge distribution on the protein. The experimental results for ribonuclease A obtained using positive, neutral, and negatively charged small nitroxide radicals are qualitatively similar to those expected from electrostatic calculations. However, while systematic electrostatic trends are apparent, the three different combinations of the data sets do not yield internally consistent values for the electrostatic contribution to the intermolecular free energy. We attribute this failure to the weakness of the electrostatic sampling bias for charged nitroxides in water and local variations in effective translational diffusion constant at the water-protein interface, which enters the nuclear spin relaxation equations for the nitroxide-proton dipolar coupling.

  16. Role of intermolecular charge delocalization and its dimensionality in efficient band-like electron transport in crystalline 2,5-difluoro-7,7,8,8-tetracyanoquinodimethane (F2-TCNQ).

    PubMed

    Sosorev, Andrey Yu

    2017-09-27

    Theoretical understanding of charge transport in organic semiconductors is exclusively important for organic electronics, but still remains a subject of debate. The recently discovered record-high band-like electron mobility in single crystals of 2,5-difluoro-7,7,8,8-tetracyanoquinodimethane (F 2 -TCNQ) is challenging from the theoretical viewpoint. First, the very small size of the F 2 -TCNQ molecule implies high reorganization energy that seems incompatible with efficient charge transport. Second, it is not clear why the crystals of a similar compound, 7,7,8,8-tetracyanoquinodimethane (TCNQ), show an inefficient hopping electron transport mechanism. To address these issues, we apply DFT and QM/MM calculations to the F n -TCNQ (n = 0,2,4) crystal series. We show that multidimensional intermolecular charge delocalization is of key importance for efficient charge transport in materials consisting of small-sized molecules, and commonly used guidelines for the search for high-mobility organic semiconductors are to be corrected.

  17. Solubilization of Therapeutic Agents in Micellar Nanomedicines

    PubMed Central

    Vuković, Lela; Madriaga, Antonett; Kuzmis, Antonina; Banerjee, Amrita; Tang, Alan; Tao, Kevin; Shah, Neil; Král, Petr; Onyuksel, Hayat

    2014-01-01

    We use atomistic molecular dynamics simulations to reveal the binding mechanisms of therapeutic agents in PEG-ylated micellar nanocarriers (SSM). In our experiments, SSM in buffer solutions can solubilize either ≈ 11 small bexarotene molecules or ≈ 6 (2 in low ionic strength buffer) human vasoactive intestinal peptide (VIP) molecules. Free energy calculations reveal that molecules of the poorly water soluble drug bexarotene can reside at the micellar ionic interface of the PEG corona, with their polar ends pointing out. Alternatively, they can reside in the alkane core center, where several bexarotene molecules can self-stabilize by forming a cluster held together by a network of hydrogen bonds. We also show that highly charged molecules, such as VIP, can be stabilized at the SSM ionic interface by Coulombic coupling between their positively charged residues and the negatively charged phosphate head-groups of the lipids. The obtained results illustrate that atomistic simulations can reveal drug solubilization character in nanocarriers and be used in efficient optimization of novel nanomedicines. PMID:24283508

  18. Investigation of Various Active Layers for Their Performance on Organic Solar Cells.

    PubMed

    Huang, Pao-Hsun; Wang, Yeong-Her; Ke, Jhong-Ciao; Huang, Chien-Jung

    2016-08-09

    The theoretical mechanism of open-circuit voltages (V OC ) in OSCs based on various small molecule organic materials is studied. The structure under investigation is simple planar heterojunction (PHJ) by thermal vacuum evaporation deposition. The various wide band gaps of small molecule organic materials are used to enhance the power conversion efficiency (PCE). The donor materials used in the device include: Alpha-sexithiophene (α-6T), Copper(II) phthalocyanine (CuPc), boron subnaphthalocyanine chloride (SubNc) and boron Subphthalocyanine chloride (SubPc). It is combined with fullerene or SubPc acceptor material to obtain a comprehensive understanding of the charge transport behavior. It is found that the V OC of the device is largely limited by charge transport. This was associated with the space charge effects and hole accumulation. These results are attributed to the improvement of surface roughness and work function after molybdenum trioxide (MoO₃) is inserted as an anode buffer layer.

  19. Dissociative charge transfer of H/+/ ions with H2 and D2 molecules from 78 to 330 K

    NASA Technical Reports Server (NTRS)

    Johnsen, R.; Chen, A.; Biondi, M. A.

    1980-01-01

    The dissociative charge transfer of He(+) ions with H2 and D2 molecules has been studied using a temperature-variable drift-tube mass-spectrometer apparatus over the temperature range 78 to 330 K. The binary rate coefficients are small at 300 K, approximately 10 to the -13th to 10 to the -14th cu cm/sec, and only slightly larger at 78 K. Termolecular contributions to the binary rate coefficients are found to be small at 330 K but increase substantially with decreasing temperature. Two-body charge transfer with D2 is found to be slower than with H2 by a factor of 10, in good agreement with recent theoretical predictions, although the measured values of the rate coefficients are larger by a factor of about 4 than the predicted values.

  20. The Holographic Electron Density Theorem, de-quantization, re-quantization, and nuclear charge space extrapolations of the Universal Molecule Model

    NASA Astrophysics Data System (ADS)

    Mezey, Paul G.

    2017-11-01

    Two strongly related theorems on non-degenerate ground state electron densities serve as the basis of "Molecular Informatics". The Hohenberg-Kohn theorem is a statement on global molecular information, ensuring that the complete electron density contains the complete molecular information. However, the Holographic Electron Density Theorem states more: the local information present in each and every positive volume density fragment is already complete: the information in the fragment is equivalent to the complete molecular information. In other words, the complete molecular information provided by the Hohenberg-Kohn Theorem is already provided, in full, by any positive volume, otherwise arbitrarily small electron density fragment. In this contribution some of the consequences of the Holographic Electron Density Theorem are discussed within the framework of the "Nuclear Charge Space" and the Universal Molecule Model. In the Nuclear Charge Space" the nuclear charges are regarded as continuous variables, and in the more general Universal Molecule Model some other quantized parameteres are also allowed to become "de-quantized and then re-quantized, leading to interrelations among real molecules through abstract molecules. Here the specific role of the Holographic Electron Density Theorem is discussed within the above context.

  1. Improving Photoconductance of Fluorinated Donors with Fluorinated Acceptors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Garner, Logan E.; Larson, Bryon; Oosterhout, Stefan

    2016-11-21

    This work investigates the influence of fluorination of both donor and acceptor materials on the generation of free charge carriers in small molecule donor/fullerene acceptor BHJ OPV active layers. A fluorinated and non-fluorinated small molecule analogue were synthesized and their optoelectronic properties characterized. The intrinsic photoconductance of blends of these small molecule donors was investigated using time-resolved microwave conductivity. Blends of the two donor molecules with a traditional non-fluorinated fullerene (PC70BM) as well as a fluorinated fullerene (C60(CF3)2-1) were investigated using 5% and 50% fullerene loading. We demonstrate for the first time that photoconductance in a 50:50 donor:acceptor BHJ blendmore » using a fluorinated fullerene can actually be improved relative to a traditional non-fluorinated fullerene by fluorinating the donor molecule as well.« less

  2. Theoretical characterization and design of small molecule donor material containing naphthodithiophene central unit for efficient organic solar cells.

    PubMed

    Duan, Yu-Ai; Geng, Yun; Li, Hai-Bin; Jin, Jun-Ling; Wu, Yong; Su, Zhong-Min

    2013-07-15

    To seek for high-performance small molecule donor materials used in heterojunction solar cell, six acceptor-donor-acceptor small molecules based on naphtho[2,3-b:6,7-b']dithiophene (NDT) units with different acceptor units were designed and characterized using density functional theory and time-dependent density functional theory. Their geometries, electronic structures, photophysical, and charge transport properties have been scrutinized comparing with the reported donor material NDT(TDPP)2 (TDPP  =  thiophene-capped diketopyrrolopyrrole). The open circuit voltage (V(oc)), energetic driving force(ΔE(L-L)), and exciton binding energy (E(b)) were also provided to give an elementary understanding on their cell performance. The results reveal that the frontier molecular orbitals of 3-7 match well with the acceptor material PC61 BM, and compounds 3-5 were found to exhibit the comparable performances to 1 and show promising potential in organic solar cells. In particular, comparing with 1, system 7 with naphthobisthiadiazole acceptor unit displays broader absorption spectrum, higher V(oc), lower E(b), and similar carrier mobility. An in-depth insight into the nature of the involved excited states based on transition density matrix and charge density difference indicates that all S1 states are mainly intramolecular charge transfer states with the charge transfer from central NDT unit to bilateral acceptor units, and also imply that the exciton of 7 can be dissociated easily due to its large extent of the charge transfer. In a word, 7 maybe superior to 1 and may act as a promising donor candidate for organic solar cell. Copyright © 2013 Wiley Periodicals, Inc.

  3. An Estimation of Hybrid Quantum Mechanical Molecular Mechanical Polarization Energies for Small Molecules Using Polarizable Force-Field Approaches

    DOE PAGES

    Huang, Jing; Mei, Ye; König, Gerhard; ...

    2017-01-24

    Here in this work, we report two polarizable molecular mechanics (polMM) force field models for estimating the polarization energy in hybrid quantum mechanical molecular mechanical (QM/MM) calculations. These two models, named the potential of atomic charges (PAC) and potential of atomic dipoles (PAD), are formulated from the ab initio quantum mechanical (QM) response kernels for the prediction of the QM density response to an external molecular mechanical (MM) environment (as described by external point charges). The PAC model is similar to fluctuating charge (FQ) models because the energy depends on external electrostatic potential values at QM atomic sites; the PADmore » energy depends on external electrostatic field values at QM atomic sites, resembling induced dipole (ID) models. To demonstrate their uses, we apply the PAC and PAD models to 12 small molecules, which are solvated by TIP3P water. The PAC model reproduces the QM/MM polarization energy with a R 2 value of 0.71 for aniline (in 10,000 TIP3P water configurations) and 0.87 or higher for other eleven solute molecules, while the PAD model has a much better performance with R 2 values of 0.98 or higher. The PAC model reproduces reference QM/MM hydration free energies for 12 solute molecules with a RMSD of 0.59 kcal/mol. The PAD model is even more accurate, with a much smaller RMSD of 0.12 kcal/mol, with respect to the reference. Lastly, this suggests that polarization effects, including both local charge distortion and intramolecular charge transfer, can be well captured by induced dipole type models with proper parametrization.« less

  4. An Estimation of Hybrid Quantum Mechanical Molecular Mechanical Polarization Energies for Small Molecules Using Polarizable Force-Field Approaches.

    PubMed

    Huang, Jing; Mei, Ye; König, Gerhard; Simmonett, Andrew C; Pickard, Frank C; Wu, Qin; Wang, Lee-Ping; MacKerell, Alexander D; Brooks, Bernard R; Shao, Yihan

    2017-02-14

    In this work, we report two polarizable molecular mechanics (polMM) force field models for estimating the polarization energy in hybrid quantum mechanical molecular mechanical (QM/MM) calculations. These two models, named the potential of atomic charges (PAC) and potential of atomic dipoles (PAD), are formulated from the ab initio quantum mechanical (QM) response kernels for the prediction of the QM density response to an external molecular mechanical (MM) environment (as described by external point charges). The PAC model is similar to fluctuating charge (FQ) models because the energy depends on external electrostatic potential values at QM atomic sites; the PAD energy depends on external electrostatic field values at QM atomic sites, resembling induced dipole (ID) models. To demonstrate their uses, we apply the PAC and PAD models to 12 small molecules, which are solvated by TIP3P water. The PAC model reproduces the QM/MM polarization energy with a R 2 value of 0.71 for aniline (in 10,000 TIP3P water configurations) and 0.87 or higher for other 11 solute molecules, while the PAD model has a much better performance with R 2 values of 0.98 or higher. The PAC model reproduces reference QM/MM hydration free energies for 12 solute molecules with a RMSD of 0.59 kcal/mol. The PAD model is even more accurate, with a much smaller RMSD of 0.12 kcal/mol, with respect to the reference. This suggests that polarization effects, including both local charge distortion and intramolecular charge transfer, can be well captured by induced dipole type models with proper parametrization.

  5. An Estimation of Hybrid Quantum Mechanical Molecular Mechanical Polarization Energies for Small Molecules Using Polarizable Force-Field Approaches

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Huang, Jing; Mei, Ye; König, Gerhard

    Here in this work, we report two polarizable molecular mechanics (polMM) force field models for estimating the polarization energy in hybrid quantum mechanical molecular mechanical (QM/MM) calculations. These two models, named the potential of atomic charges (PAC) and potential of atomic dipoles (PAD), are formulated from the ab initio quantum mechanical (QM) response kernels for the prediction of the QM density response to an external molecular mechanical (MM) environment (as described by external point charges). The PAC model is similar to fluctuating charge (FQ) models because the energy depends on external electrostatic potential values at QM atomic sites; the PADmore » energy depends on external electrostatic field values at QM atomic sites, resembling induced dipole (ID) models. To demonstrate their uses, we apply the PAC and PAD models to 12 small molecules, which are solvated by TIP3P water. The PAC model reproduces the QM/MM polarization energy with a R 2 value of 0.71 for aniline (in 10,000 TIP3P water configurations) and 0.87 or higher for other eleven solute molecules, while the PAD model has a much better performance with R 2 values of 0.98 or higher. The PAC model reproduces reference QM/MM hydration free energies for 12 solute molecules with a RMSD of 0.59 kcal/mol. The PAD model is even more accurate, with a much smaller RMSD of 0.12 kcal/mol, with respect to the reference. Lastly, this suggests that polarization effects, including both local charge distortion and intramolecular charge transfer, can be well captured by induced dipole type models with proper parametrization.« less

  6. Side-chain Engineering of Benzo[1,2-b:4,5-b’]dithiophene Core-structured Small Molecules for High-Performance Organic Solar Cells

    PubMed Central

    Yin, Xinxing; An, Qiaoshi; Yu, Jiangsheng; Guo, Fengning; Geng, Yongliang; Bian, Linyi; Xu, Zhongsheng; Zhou, Baojing; Xie, Linghai; Zhang, Fujun; Tang, Weihua

    2016-01-01

    Three novel small molecules have been developed by side-chain engineering on benzo[1,2-b:4,5-b’]dithiophene (BDT) core. The typical acceptor-donor-acceptor (A-D-A) structure is adopted with 4,8-functionalized BDT moieties as core, dioctylterthiophene as π bridge and 3-ethylrhodanine as electron-withdrawing end group. Side-chain engineering on BDT core exhibits small but measurable effect on the optoelectronic properties of small molecules. Theoretical simulation and X-ray diffraction study reveal the subtle tuning of interchain distance between conjugated backbones has large effect on the charge transport and thus the photovoltaic performance of these molecules. Bulk-heterojunction solar cells fabricated with a configuration of ITO/PEDOT:PSS/SM:PC71BM/PFN/Al exhibit a highest power conversion efficiency (PCE) of 6.99% after solvent vapor annealing. PMID:27140224

  7. Side-chain Engineering of Benzo[1,2-b:4,5-b']dithiophene Core-structured Small Molecules for High-Performance Organic Solar Cells.

    PubMed

    Yin, Xinxing; An, Qiaoshi; Yu, Jiangsheng; Guo, Fengning; Geng, Yongliang; Bian, Linyi; Xu, Zhongsheng; Zhou, Baojing; Xie, Linghai; Zhang, Fujun; Tang, Weihua

    2016-05-03

    Three novel small molecules have been developed by side-chain engineering on benzo[1,2-b:4,5-b']dithiophene (BDT) core. The typical acceptor-donor-acceptor (A-D-A) structure is adopted with 4,8-functionalized BDT moieties as core, dioctylterthiophene as π bridge and 3-ethylrhodanine as electron-withdrawing end group. Side-chain engineering on BDT core exhibits small but measurable effect on the optoelectronic properties of small molecules. Theoretical simulation and X-ray diffraction study reveal the subtle tuning of interchain distance between conjugated backbones has large effect on the charge transport and thus the photovoltaic performance of these molecules. Bulk-heterojunction solar cells fabricated with a configuration of ITO/PEDOT:PSS/SM:PC71BM/PFN/Al exhibit a highest power conversion efficiency (PCE) of 6.99% after solvent vapor annealing.

  8. Mass transport through vertically aligned large diameter MWCNT embedded in parylene

    PubMed Central

    Krishnakumar, P; Tiwari, P B; Staples, S; Luo, T; Darici, Y; He, J; Lindsay, SM

    2013-01-01

    We have fabricated porous membranes using a parylene encapsulated vertically aligned forest of multi-walled carbon nanotube (MWCNT, about 7nm inner diameter). The transport of charged particles in electrolyte through these membranes was studied by applying electric field and pressure. Under an electric field in the range of 4.4×104 V/m, electrophoresis instead of electroomosis is found to be the main mechanism for ion transport. Small molecules and 5 nm gold nanoparticles can be driven through the membranes by an electric field. However, small biomolecules, like DNA oligomers, cannot. Due to the weak electric driving force, the interactions between charged particles and the hydrophobic CNT inner surface play important roles in the transport, leading to enhanced selectivity for small molecules. Simple chemical modification on the CNT ends also induces an obvious effect on the translocation of single strand DNA oligomer and gold nanoparticle under a modest pressure (<294 Pa). PMID:23064678

  9. R.E.DD.B.: A database for RESP and ESP atomic charges, and force field libraries

    PubMed Central

    Dupradeau, François-Yves; Cézard, Christine; Lelong, Rodolphe; Stanislawiak, Élodie; Pêcher, Julien; Delepine, Jean Charles; Cieplak, Piotr

    2008-01-01

    The web-based RESP ESP charge DataBase (R.E.DD.B., http://q4md-forcefieldtools.org/REDDB) is a free and new source of RESP and ESP atomic charge values and force field libraries for model systems and/or small molecules. R.E.DD.B. stores highly effective and reproducible charge values and molecular structures in the Tripos mol2 file format, information about the charge derivation procedure, scripts to integrate the charges and molecular topology in the most common molecular dynamics packages. Moreover, R.E.DD.B. allows users to freely store and distribute RESP or ESP charges and force field libraries to the scientific community, via a web interface. The first version of R.E.DD.B., released in January 2006, contains force field libraries for molecules as well as molecular fragments for standard residues and their analogs (amino acids, monosaccharides, nucleotides and ligands), hence covering a vast area of relevant biological applications. PMID:17962302

  10. Origin of Reduced Open-Circuit Voltage in Highly Efficient Small-Molecule-Based Solar Cells upon Solvent Vapor Annealing.

    PubMed

    Deng, Wanyuan; Gao, Ke; Yan, Jun; Liang, Quanbin; Xie, Yuan; He, Zhicai; Wu, Hongbin; Peng, Xiaobin; Cao, Yong

    2018-03-07

    In this study, we demonstrate that remarkably reduced open-circuit voltage in highly efficient organic solar cells (OSCs) from a blend of phenyl-C 61 -butyric acid methyl ester and a recently developed conjugated small molecule (DPPEZnP-THD) upon solvent vapor annealing (SVA) is due to two independent sources: increased radiative recombination and increased nonradiative recombination. Through the measurements of electroluminescence due to the emission of the charge-transfer state and photovoltaic external quantum efficiency measurement, we can quantify that the open-circuit voltage losses in a device with SVA due to the radiative recombination and nonradiative recombination are 0.23 and 0.31 V, respectively, which are 0.04 and 0.07 V higher than those of the as-cast device. Despite of the reduced open-circuit voltage, the device with SVA exhibited enhanced dissociation of charge-transfer excitons, leading to an improved short-circuit current density and a remarkable power conversion efficiency (PCE) of 9.41%, one of the best for solution-processed OSCs based on small-molecule donor materials. Our study also clearly shows that removing the nonradiative recombination pathways and/or suppressing energetic disorder in the active layer would result in more long-lived charge carriers and enhanced open-circuit voltage, which are prerequisites for further improving the PCE.

  11. Staying Alive: Measuring Intact Viable Microbes with Electrospray Ionization Mass Spectrometry

    NASA Astrophysics Data System (ADS)

    Forsberg, Erica; Fang, Mingliang; Siuzdak, Gary

    2017-01-01

    Mass spectrometry has traditionally been the technology of choice for small molecule analysis, making significant inroads into metabolism, clinical diagnostics, and pharmacodynamics since the 1960s. In the mid-1980s, with the discovery of electrospray ionization (ESI) for biomolecule analysis, a new door opened for applications beyond small molecules. Initially, proteins were widely examined, followed by oligonucleotides and other nonvolatile molecules. Then in 1991, three intriguing studies reported using mass spectrometry to examine noncovalent protein complexes, results that have been expanded on for the last 25 years. Those experiments also raised the questions: How soft is ESI, and can it be used to examine even more complex interactions? Our lab addressed these questions with the analyses of viruses, which were initially tested for viability following electrospray ionization and their passage through a quadrupole mass analyzer by placing them on an active medium that would allow them to propagate. This observation has been replicated on multiple different systems, including experiments on an even bigger microbe, a spore. The question of analysis was also addressed in the early 2000s with charge detection mass spectrometry. This unique technology could simultaneously measure mass-to-charge and charge, allowing for the direct determination of the mass of a virus. More recent experiments on spores and enveloped viruses have given us insight into the range of mass spectrometry's capabilities (reaching 100 trillion Da), beginning to answer fundamental questions regarding the complexity of these organisms beyond proteins and genes, and how small molecules are integral to these supramolecular living structures.

  12. Investigating the Effect of Charge Hydration Asymmetry and Incorporating it in Continuum Solvation Framework

    NASA Astrophysics Data System (ADS)

    Mukhopadhyay, Abhishek

    One of the essential requirements of biomolecular modeling is an accurate description of water as a solvent. The challenge is to make this description computationally facile - reasonably fast, simple, robust and easy to incorporate into existing software packages, yet accurate. The most rigorous procedure to model the effect of aqueous solvent is to explicitly model every water molecule in the system. For many practical applications, this approach is computationally too intense, as the number of required water atoms is on an average at least one order of magnitude larger than the number of atoms of the molecule of interest. Implicit solvent models, in which solvent molecules are replaced by a continuous dielectric, have become a popular alternative to explicit solvent methods. However, implicit solvation models often lack various microscopic details which are crucial for accuracy. One such missing effect that is currently missing from popular implicit models is the so called effect of charge hydration asymmetry (CHA). The missing effect of charge hydration asymmetry - the asymmetric response of water upon the sign of solute charge - manifests a characteristic, strong dependence of solvation free energies on the sign of solute charge. Here, we incorporate this missing effect into the continuum solvation framework via the conceptually simplest Born equation and also in the generalized Born model. We identify the key electric multipole moments of model water molecules critical for the various degrees of CHA effect observed in studies based on molecular dynamics simulations using different rigid water models. We then use this gained insight to incorporate this effect first into the Born model and then into the generalized Born model. The proposed framework significantly improves accuracy of the hydration free energy estimates tested on a comprehensive set of varied molecular solutes - monovalent and divalent ions, small drug-like molecules, charged and uncharged amino acid dipeptides, and small proteins. We finally develop a methodology to resolve the issue with unacceptably large uncertainty that stems from a variety of fundamental and technical difficulties in experimental quantification of CHA from charged solutes. Using the proposed corrections in the continuum framework, we untangle the charge-asymmetric response of water from its symmetric response, and further circumvent the difficulties by extracting accurate estimate propensity of water to cause CHA from accurate experimental hydration free energies of neutral polar molecules. We show that the asymmetry in water's response is strong, about 50% of the symmetric response.

  13. The Endoplasmic Reticulum Membrane Is Permeable to Small Molecules

    PubMed Central

    Le Gall, Sylvie; Neuhof, Andrea; Rapoport, Tom

    2004-01-01

    The lumen of the endoplasmic reticulum (ER) differs from the cytosol in its content of ions and other small molecules, but it is unclear whether the ER membrane is as impermeable as other membranes in the cell. Here, we have tested the permeability of the ER membrane to small, nonphysiological molecules. We report that isolated ER vesicles allow different chemical modification reagents to pass from the outside into the lumen with little hindrance. In permeabilized cells, the ER membrane allows the passage of a small, charged modification reagent that is unable to cross the plasma membrane or the lysosomal and trans-Golgi membranes. A larger polar reagent of ∼5 kDa is unable to pass through the ER membrane. Permeation of the small molecules is passive because it occurs at low temperature in the absence of energy. These data indicate that the ER membrane is significantly more leaky than other cellular membranes, a property that may be required for protein folding and other functions of the ER. PMID:14617815

  14. Possible influence of the Kuramoto length in a photo-catalytic water splitting reaction revealed by Poisson-Nernst-Planck equations involving ionization in a weak electrolyte

    NASA Astrophysics Data System (ADS)

    Suzuki, Yohichi; Seki, Kazuhiko

    2018-03-01

    We studied ion concentration profiles and the charge density gradient caused by electrode reactions in weak electrolytes by using the Poisson-Nernst-Planck equations without assuming charge neutrality. In weak electrolytes, only a small fraction of molecules is ionized in bulk. Ion concentration profiles depend on not only ion transport but also the ionization of molecules. We considered the ionization of molecules and ion association in weak electrolytes and obtained analytical expressions for ion densities, electrostatic potential profiles, and ion currents. We found the case that the total ion density gradient was given by the Kuramoto length which characterized the distance over which an ion diffuses before association. The charge density gradient is characterized by the Debye length for 1:1 weak electrolytes. We discuss the role of these length scales for efficient water splitting reactions using photo-electrocatalytic electrodes.

  15. Observational aspects of polycyclic aromatic hydrocarbon charging in the Interstellar Medium

    NASA Technical Reports Server (NTRS)

    Bakes, E. L. O.; Tielens, Alexander G. G. M.

    1995-01-01

    We have investigated the charging processes which affect small carbonaceous dust grains and polycyclic aromatic hydrocarbons (PAH's). Because of their high abundance, interstellar PAH molecules can dominate the charge balance of the interstellar medium (ISM), which controls the heating and cooling interstellar gas and interstellar chemistry. We present the results of our model, which compare well with observations and suggest further applications to both laboratory measurements and data obtainable from the KAO.

  16. Intermolecular interaction approach for TADF (Conference Presentation)

    NASA Astrophysics Data System (ADS)

    Wong, Ken-Tsung

    2016-09-01

    Materials with thermally activated delayed fluorescence (TADF) have recently emerged as new fluorescent emitters for highly efficient organic light-emitting diodes (OLEDs). Molecule with TADF behavior needs to have a small singlet-triplet energy difference (ΔES-T) that allows the up-conversion from nonradiative triplet state (T1) to radiative singlet state (S1) via reverse intersystem crossing (RISC) process. Generally, molecules with small ΔES-T can be obtained via carefully manipulate the degree of "intramolecular" charge transfer (ICT) between electron-donating and -accepting components, such that the electron exchange energy that contributes to ΔES-T, can be minimized. Alternatively, excited state with small ΔES-T can be feasibly realized via "intermolecular" charge transfer occurring at the interface between spatially separating donor (D) and acceptor (A) molecules. Because the exchange energy decreases as the HOMO-LUMO separation distance increases, theoretically, the intermolecular D/A charge transfer state (or exciplex) should have rather small ΔES-T, leading to efficient TADF. However, it is still a challenge to access highly efficient exciplex systems. This is mainly because exciplex formation is commonly accompanied with a large red shift of emission spectra and long radiative lifetime, which tend to diminish photoluminescence quantum yield (PLQY) as well as electroluminescence (EL) performance. Until now, exciplex-based OLEDs with external quantum efficiency (EQE) above 10% are still limited. By judicious selection of donor and acceptor, the formation of efficient exciplex can be feasibly achieved. In this conference, our recent efforts on highly efficient exciplexes using C3-symmetry triazine acceptors and various donors, and their device characteristics will be presented.

  17. The electronegativity equalization method and the split charge equilibration applied to organic systems: parametrization, validation, and comparison.

    PubMed

    Verstraelen, Toon; Van Speybroeck, Veronique; Waroquier, Michel

    2009-07-28

    An extensive benchmark of the electronegativity equalization method (EEM) and the split charge equilibration (SQE) model on a very diverse set of organic molecules is presented. These models efficiently compute atomic partial charges and are used in the development of polarizable force fields. The predicted partial charges that depend on empirical parameters are calibrated to reproduce results from quantum mechanical calculations. Recently, SQE is presented as an extension of the EEM to obtain the correct size dependence of the molecular polarizability. In this work, 12 parametrization protocols are applied to each model and the optimal parameters are benchmarked systematically. The training data for the empirical parameters comprise of MP2/Aug-CC-pVDZ calculations on 500 organic molecules containing the elements H, C, N, O, F, S, Cl, and Br. These molecules have been selected by an ingenious and autonomous protocol from an initial set of almost 500,000 small organic molecules. It is clear that the SQE model outperforms the EEM in all benchmark assessments. When using Hirshfeld-I charges for the calibration, the SQE model optimally reproduces the molecular electrostatic potential from the ab initio calculations. Applications on chain molecules, i.e., alkanes, alkenes, and alpha alanine helices, confirm that the EEM gives rise to a divergent behavior for the polarizability, while the SQE model shows the correct trends. We conclude that the SQE model is an essential component of a polarizable force field, showing several advantages over the original EEM.

  18. Charge Separation and Triplet Exciton Formation Pathways in Small-Molecule Solar Cells as Studied by Time-Resolved EPR Spectroscopy

    DOE PAGES

    Thomson, Stuart A. J.; Niklas, Jens; Mardis, Kristy L.; ...

    2017-09-13

    Organic solar cells are a promising renewable energy technology, offering the advantages of mechanical flexibility and solution processability. An understanding of the electronic excited states and charge separation pathways in these systems is crucial if efficiencies are to be further improved. Here we use light induced electron paramagnetic resonance (LEPR) spectroscopy and density functional theory calculations (DFT) to study the electronic excited states, charge transfer (CT) dynamics and triplet exciton formation pathways in blends of the small molecule donors (DTS(FBTTh 2) 2, DTS(F2BTTh 2) 2, DTS(PTTh 2) 2, DTG(FBTTh 2) 2 and DTG(F2BTTh 2) 2) with the fullerene derivative PCmore » 61BM. Using high frequency EPR the g-tensor of the positive polaron on the donor molecules was determined. The experimental results are compared with DFT calculations which reveal that the spin density of the polaron is distributed over a dimer or trimer. Time-resolved EPR (TR-EPR) spectra attributed to singlet CT states were identified and the polarization patterns revealed similar charge separation dynamics in the four fluorobenzothiadiazole donors, while charge separation in the DTS(PTTh 2) 2 blend is slower. Using TR-EPR we also investigated the triplet exciton formation pathways in the blend. The polarization patterns reveal that the excitons originate from both intersystem crossing (ISC) and back electron transfer (BET) processes. The DTS(PTTh 2) 2 blend was found to contain substantially more triplet excitons formed by BET than the fluorobenzothiadiazole blends. As a result, the higher BET triplet exciton population in the DTS(PTTh 2) 2 blend is in accordance with the slower charge separation dynamics observed in this blend.« less

  19. Charge Separation and Triplet Exciton Formation Pathways in Small Molecule Solar Cells as Studied by Time-resolved EPR Spectroscopy.

    PubMed

    Thomson, Stuart A J; Niklas, Jens; Mardis, Kristy L; Mallares, Christopher; Samuel, Ifor D W; Poluektov, Oleg G

    2017-10-19

    Organic solar cells are a promising renewable energy technology, offering the advantages of mechanical flexibility and solution processability. An understanding of the electronic excited states and charge separation pathways in these systems is crucial if efficiencies are to be further improved. Here we use light induced electron paramagnetic resonance (LEPR) spectroscopy and density functional theory calculations (DFT) to study the electronic excited states, charge transfer (CT) dynamics and triplet exciton formation pathways in blends of the small molecule donors (DTS(FBTTh 2 ) 2 , DTS(F 2 BTTh 2 ) 2 , DTS(PTTh 2 ) 2 , DTG(FBTTh 2 ) 2 and DTG(F 2 BTTh 2 ) 2 ) with the fullerene derivative PC 61 BM. Using high frequency EPR the g-tensor of the positive polaron on the donor molecules was determined. The experimental results are compared with DFT calculations which reveal that the spin density of the polaron is distributed over a dimer or trimer. Time-resolved EPR (TR-EPR) spectra attributed to singlet CT states were identified and the polarization patterns revealed similar charge separation dynamics in the four fluorobenzothiadiazole donors, while charge separation in the DTS(PTTh 2 ) 2 blend is slower. Using TR-EPR we also investigated the triplet exciton formation pathways in the blend. The polarization patterns reveal that the excitons originate from both intersystem crossing (ISC) and back electron transfer (BET) processes. The DTS(PTTh 2 ) 2 blend was found to contain substantially more triplet excitons formed by BET than the fluorobenzothiadiazole blends. The higher BET triplet exciton population in the DTS(PTTh 2 ) 2 blend is in accordance with the slower charge separation dynamics observed in this blend.

  20. Charge Separation and Triplet Exciton Formation Pathways in Small-Molecule Solar Cells as Studied by Time-Resolved EPR Spectroscopy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Thomson, Stuart A. J.; Niklas, Jens; Mardis, Kristy L.

    Organic solar cells are a promising renewable energy technology, offering the advantages of mechanical flexibility and solution processability. An understanding of the electronic excited states and charge separation pathways in these systems is crucial if efficiencies are to be further improved. Here we use light induced electron paramagnetic resonance (LEPR) spectroscopy and density functional theory calculations (DFT) to study the electronic excited states, charge transfer (CT) dynamics and triplet exciton formation pathways in blends of the small molecule donors (DTS(FBTTh 2) 2, DTS(F2BTTh 2) 2, DTS(PTTh 2) 2, DTG(FBTTh 2) 2 and DTG(F2BTTh 2) 2) with the fullerene derivative PCmore » 61BM. Using high frequency EPR the g-tensor of the positive polaron on the donor molecules was determined. The experimental results are compared with DFT calculations which reveal that the spin density of the polaron is distributed over a dimer or trimer. Time-resolved EPR (TR-EPR) spectra attributed to singlet CT states were identified and the polarization patterns revealed similar charge separation dynamics in the four fluorobenzothiadiazole donors, while charge separation in the DTS(PTTh 2) 2 blend is slower. Using TR-EPR we also investigated the triplet exciton formation pathways in the blend. The polarization patterns reveal that the excitons originate from both intersystem crossing (ISC) and back electron transfer (BET) processes. The DTS(PTTh 2) 2 blend was found to contain substantially more triplet excitons formed by BET than the fluorobenzothiadiazole blends. As a result, the higher BET triplet exciton population in the DTS(PTTh 2) 2 blend is in accordance with the slower charge separation dynamics observed in this blend.« less

  1. The dynamics of charge transfer with and without a barrier: A very simplified model of cyclic voltammetry.

    PubMed

    Ouyang, Wenjun; Subotnik, Joseph E

    2017-05-07

    Using the Anderson-Holstein model, we investigate charge transfer dynamics between a molecule and a metal surface for two extreme cases. (i) With a large barrier, we show that the dynamics follow a single exponential decay as expected; (ii) without any barrier, we show that the dynamics are more complicated. On the one hand, if the metal-molecule coupling is small, single exponential dynamics persist. On the other hand, when the coupling between the metal and the molecule is large, the dynamics follow a biexponential decay. We analyze the dynamics using the Smoluchowski equation, develop a simple model, and explore the consequences of biexponential dynamics for a hypothetical cyclic voltammetry experiment.

  2. Structure-Antibacterial Activity Relationships of Imidazolium-Type Ionic Liquid Monomers, Poly(ionic liquids) and Poly(ionic liquid) Membranes: Effect of Alkyl Chain Length and Cations.

    PubMed

    Zheng, Zhiqiang; Xu, Qiming; Guo, Jiangna; Qin, Jing; Mao, Hailei; Wang, Bin; Yan, Feng

    2016-05-25

    The structure-antibacterial activity relationship between the small molecular compounds and polymers are still elusive. Here, imidazolium-type ionic liquid (IL) monomers and their corresponding poly(ionic liquids) (PILs) and poly(ionic liquid) membranes were synthesized. The effect of chemical structure, including carbon chain length of substitution at the N3 position and charge density of cations (mono- or bis-imidazolium) on the antimicrobial activities against both Escherichia coli (E. coli) and Staphylococcus aureus (S. aureus) was investigated by determination of minimum inhibitory concentration (MIC). The antibacterial activities of both ILs and PILs were improved with the increase of the alkyl chain length and higher charge density (bis-cations) of imidazolium cations. Moreover, PILs exhibited lower MIC values relative to the IL monomers. However, the antibacterial activities of PIL membranes showed no correlation to those of their analogous small molecule IL monomers and PILs, which increased with the charge density (bis-cations) while decreasing with the increase of alkyl chain length. The results indicated that antibacterial property studies on small molecules and homopolymers may not provide a solid basis for evaluating that in corresponding polymer membranes.

  3. Towards a Pharmacophore for Amyloid

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Landau, Meytal; Sawaya, Michael R.; Faull, Kym F.

    2011-09-16

    Diagnosing and treating Alzheimer's and other diseases associated with amyloid fibers remains a great challenge despite intensive research. To aid in this effort, we present atomic structures of fiber-forming segments of proteins involved in Alzheimer's disease in complex with small molecule binders, determined by X-ray microcrystallography. The fiber-like complexes consist of pairs of {beta}-sheets, with small molecules binding between the sheets, roughly parallel to the fiber axis. The structures suggest that apolar molecules drift along the fiber, consistent with the observation of nonspecific binding to a variety of amyloid proteins. In contrast, negatively charged orange-G binds specifically to lysine sidemore » chains of adjacent sheets. These structures provide molecular frameworks for the design of diagnostics and drugs for protein aggregation diseases. The devastating and incurable dementia known as Alzheimer's disease affects the thinking, memory, and behavior of dozens of millions of people worldwide. Although amyloid fibers and oligomers of two proteins, tau and amyloid-{beta}, have been identified in association with this disease, the development of diagnostics and therapeutics has proceeded to date in a near vacuum of information about their structures. Here we report the first atomic structures of small molecules bound to amyloid. These are of the dye orange-G, the natural compound curcumin, and the Alzheimer's diagnostic compound DDNP bound to amyloid-like segments of tau and amyloid-{beta}. The structures reveal the molecular framework of small-molecule binding, within cylindrical cavities running along the {beta}-spines of the fibers. Negatively charged orange-G wedges into a specific binding site between two sheets of the fiber, combining apolar binding with electrostatic interactions, whereas uncharged compounds slide along the cavity. We observed that different amyloid polymorphs bind different small molecules, revealing that a cocktail of compounds may be required for future amyloid therapies. The structures described here start to define the amyloid pharmacophore, opening the way to structure-based design of improved diagnostics and therapeutics.« less

  4. Addition of ferrocene controls polymorphism and enhances charge mobilities in poly(3-hexylthiophene) thin-film transistors

    NASA Astrophysics Data System (ADS)

    Smith, Brandon; Clark, Michael; Grieco, Christopher; Larsen, Alec; Asbury, John; Gomez, Enrique

    2015-03-01

    Crystalline organic molecules often exhibit the ability to form multiple crystal structures depending on the processing conditions. Exploiting this polymorphism to optimize molecular orbital overlap between adjacent molecules within the unit lattice of conjugated polymers is an approach to enhance charge transport within the material. We have demonstrated the formation of tighter π- π stacking poly(3-hexylthiophene-2,5-diyl) polymorphs in films spin coated from ferrocene-containing solutions using grazing incident X-ray diffraction. As a result, we found that the addition of ferrocene to casting solutions yields thin-film transistors which exhibit significantly higher source-drain current and charge mobilities than neat polymer devices. Insights gleaned from ferrocene/poly(3-hexylthiophene) mixtures can serve as a template for selection and optimization of next generation small molecule/polymer systems possessing greater baseline charge mobilities. Ultimately, the development of such techniques to enhance the characteristics of organic transistors without imparting high costs or loss of advantageous properties will be a critical factor determining the future of organic components within the electronics market.

  5. Design of organic ternary blends and small-molecule bulk heterojunctions: photophysical considerations

    NASA Astrophysics Data System (ADS)

    Rajesh, Kallarakkal Ramakrishnan; Paudel, Keshab; Johnson, Brian; Hallani, Rawad; Anthony, John; Ostroverkhova, Oksana

    2015-01-01

    We explored relationships between photophysical processes and solar cell characteristics in solution-processable bulk heterojunctions (BHJs), in particular: (1) polymer donor:fullerene acceptor:small-molecule (SM) nonfullerene acceptor, (2) polymer donor:SM donor:SM nonfullerene acceptor, and (3) SM donor:SM nonfullerene or fullerene acceptor. Addition of a nonfullerene SM acceptor to "efficient" polymer:fullerene BHJs led to a reduction in power conversion efficiency (PCE), mostly due to decreased charge photogeneration efficiency and increased disorder. By contrast, addition of an SM donor to "inefficient" polymer:SM nonfullerene acceptor BHJs led to a factor of two to three improvement in the PCE, due to improved charge photogeneration efficiency and transport. In most blends, exciplex formation was observed and correlated with a reduced short-circuit current (Jsc) without negatively impacting the open-circuit voltage (Voc). A factor of ˜5 higher PCE was observed in SM donor:fullerene acceptor BHJs as compared to SMBHJs with the same SM donor but nonfullerene acceptor, due to enhanced charge carrier photogeneration in the blend with fullerene. Our study revealed that the HOMO and LUMO energies of molecules comprising a blend are not reliable parameters for predicting Voc of the blend, and an understanding of the photophysics is necessary for interpreting solar cell characteristics and improving the molecular design of BHJs.

  6. Penetration of analogues of H2O and CO2 in proteins studied by room temperature phosphorescence of tryptophan.

    PubMed

    Wright, W W; Owen, C S; Vanderkooi, J M

    1992-07-21

    The influence of the protein matrix on the reactivity of external molecules with a species buried within the protein interior is considered in two general ways: (1) there may be structural fluctuations that allow for the diffusive penetration of the small molecules and/or (2) the external molecule may react over a distance. As a means to study the protein matrix, a reactive species within the protein can be formed by exciting tryptophan to the triplet state, and then the reaction of the triplet-state molecule with an external molecule can be monitored by a decrease in phosphorescence. In this work, the quenching ability (i.e., reactivity) was examined for H2S, CS2, and NO2- acting on tryptophan phosphorescence in parvalbumin, azurin, horse liver alcohol dehydrogenase, and alkaline phosphatase. A comparison of charged versus uncharged quenchers (H2S vs SH- and CS2 vs NO2-) reveals that the uncharged molecules are much more effective than charged species in quenching the phosphorescence of fully buried tryptophan, whereas the quenching for exposed tryptophan is relatively independent of the charge of the quencher. This is consistent with the view that uncharged triatomic molecules can penetrate the protein matrix to some extent. The energies of activation of the quenching reaction are low for the charged quenchers and higher for the uncharged CS2. A model is presented in which the quenchability of a buried tryptophan is inversely related to the distance from the surface when diffusion through the protein is the rate-limiting step.(ABSTRACT TRUNCATED AT 250 WORDS)

  7. Electron and hole transport in the organic small molecule α-NPD

    NASA Astrophysics Data System (ADS)

    Rohloff, R.; Kotadiya, N. B.; Crǎciun, N. I.; Blom, P. W. M.; Wetzelaer, G. A. H.

    2017-02-01

    Electron and hole transport properties of the organic small molecule N,N'-Di(1-naphthyl)-N,N'-diphenyl-(1,1'-biphenyl)-4,4'-diamine are investigated by space-charge-limited current measurements. The hole transport shows trap-free behavior with a mobility of 2.3 × 10-8 m2/Vs at vanishing carrier density and electric field. The electron transport, on the other hand, shows heavily trap-limited behavior, which leads to highly unbalanced transport. A trap concentration of 1.3 × 1024 m-3 was found by modeling the electron currents, similar to the universal trap concentration found in conjugated polymers. This indicates that electron trapping is a generic property of organic semiconductors, ranging from vacuum-deposited small-molecules to solution-processed conjugated polymers.

  8. Development of a Simple Electron Transfer and Polarization Model and Its Application to Biological Systems.

    PubMed

    Diller, David J

    2017-01-10

    Here we present a new method for point charge calculation which we call Q ET (charges by electron transfer). The intent of this work is to develop a method that can be useful for studying charge transfer in large biological systems. It is based on the intuitive framework of the Q EQ method with the key difference being that the Q ET method tracks all pairwise electron transfers by augmenting the Q EQ pseudoenergy function with a distance dependent cost function for each electron transfer. This approach solves the key limitation of the Q EQ method which is its handling of formally charged groups. First, we parametrize the Q ET method by fitting to electrostatic potentials calculated using ab initio quantum mechanics on over 11,000 small molecules. On an external test set of over 2500 small molecules the Q ET method achieves a mean absolute error of 1.37 kcal/mol/electron when compared to the ab initio electrostatic potentials. Second, we examine the conformational dependence of the charges on over 2700 tripeptides. With the tripeptide data set, we show that the conformational effects account for approximately 0.4 kcal/mol/electron on the electrostatic potentials. Third, we test the Q ET method for its ability to reproduce the effects of polarization and electron transfer on 1000 water clusters. For the water clusters, we show that the Q ET method captures about 50% of the polarization and electron transfer effects. Finally, we examine the effects of electron transfer and polarizability on the electrostatic interaction between p38 and 94 small molecule ligands. When used in conjunction with the Generalized-Born continuum solvent model, polarization and electron transfer with the Q ET model lead to an average change of 17 kcal/mol on the calculated electrostatic component of ΔG.

  9. Exploring the chemical enhancement for surface-enhanced Raman scattering with Au bowtie nanoantennas

    PubMed Central

    Fromm, David P.; Kinkhabwala, Anika; Schuck, P. James; Moerner, W. E.; Sundaramurthy, Arvind; Kino, Gordon S.

    2006-01-01

    Single metallic bowtie nanoantennas provide a controllable environment for surface-enhanced Raman scattering (SERS) of adsorbed molecules. Bowties have experimentally measured electromagnetic enhancements, enabling estimation of chemical enhancement for both the bulk and the few-molecule regime. Strong fluctuations of selected Raman lines imply that a small number of p-mercaptoaniline molecules on a single bowtie show chemical enhancement >107, much larger than previously believed, likely due to charge transfer between the Au surface and the molecule. This chemical sensitivity of SERS has significant implications for ultra-sensitive detection of single molecules. PMID:16483189

  10. Zero-point fluctuations in naphthalene and their effect on charge transport parameters.

    PubMed

    Kwiatkowski, Joe J; Frost, Jarvist M; Kirkpatrick, James; Nelson, Jenny

    2008-09-25

    We calculate the effect of vibronic coupling on the charge transport parameters in crystalline naphthalene, between 0 and 400 K. We find that nuclear fluctuations can cause large changes in both the energy of a charge on a molecule and on the electronic coupling between molecules. As a result, nuclear fluctuations cause wide distributions of both energies and couplings. We show that these distributions have a small temperature dependence and that, even at high temperatures, vibronic coupling is dominated by the effect of zero-point fluctuations. Because of the importance of zero-point fluctuations, we find that the distributions of energies and couplings have substantial width, even at 0 K. Furthermore, vibronic coupling with high energy modes may be significant, even though these modes are never thermally activated. Our results have implications for the temperature dependence of charge mobilities in organic semiconductors.

  11. Method for preparing small volume reaction containers

    DOEpatents

    Retterer, Scott T.; Doktycz, Mitchel J.

    2017-04-25

    Engineered reaction containers that can be physically and chemically defined to control the flux of molecules of different sizes and charge are disclosed. Methods for constructing small volume reaction containers through a combination of etching and deposition are also disclosed. The methods allow for the fabrication of multiple devices that possess features on multiple length scales, specifically small volume containers with controlled porosity on the nanoscale.

  12. Surface functionalization of dopamine coated iron oxide nanoparticles for various surface functionalities

    NASA Astrophysics Data System (ADS)

    Sherwood, Jennifer; Xu, Yaolin; Lovas, Kira; Qin, Ying; Bao, Yuping

    2017-04-01

    We present effective conjugation of four small molecules (glutathione, cysteine, lysine, and Tris(hydroxymethyl)aminomethane) onto dopamine-coated iron oxide nanoparticles. Conjugation of these molecules could improve the surface functionality of nanoparticles for more neutral surface charge at physiological pH and potentially reduce non-specific adsorption of proteins to nanoparticles surfaces. The success of conjugation was evaluated with dynamic light scattering by measuring the surface charge changes and Fourier transform infrared spectroscopy for surface chemistry analysis. The stability of dopamine-coated nanoparticles and the ability of conjugated nanoparticles to reduce the formation of protein corona were evaluated by measuring the size and charge of the nanoparticles in biological medium. This facile conjugation method opens up possibilities for attaching various surface functionalities onto iron oxide nanoparticle surfaces for biomedical applications.

  13. Interaction Between Cyanine Dye IR-783 and Polystyrene Nanoparticles in Solution.

    PubMed

    Zhang, Yunzhi; Xu, Hui; Casabianca, Leah B

    2018-05-17

    The interactions between small molecule drugs or dyes and nanoparticles are important to the use of nanoparticles in medicine. Noncovalent adsorption of dyes on nanoparticle surfaces is also important to the development of nanoparticle dual-use imaging contrast agents. In the present work, solution-state NMR is used to examine the noncovalent interaction between a near-infrared cyanine dye and the surface of polystyrene nanoparticles in solution. Using 1D proton NMR, we can approximate the number of dye molecules that associate with each nanoparticle for different sized nanoparticles. Saturation-Transfer Difference (STD)-NMR was also used to show that protons near the positively-charged nitrogen in the dye are more strongly associated with the negatively-charged nanoparticle surface than protons near the negatively-charged sulfate groups of the dye. The methods described here can be used to study similar drug or dye molecules interacting with the surface of organic nanoparticles. This article is protected by copyright. All rights reserved.

  14. Origin of the Surface-Induced First Hyperpolarizability in the C60/SiO2 System: SCC-DFTB Insight.

    PubMed

    Nénon, Sébastien; Champagne, Benoît

    2014-01-02

    Using the self-consistent charge density functional tight binding (SCC-DFTB) method, C60 molecules physisorbed on an α-quartz slab are shown to display a first hyperpolarizability, whereas, owing to their symmetry, both the α-quartz slab and C60 molecule have no first hyperpolarizabilities. A larger first hyperpolarizability is achieved when the lowest-lying (five- or six-membered) ring is situated in between two hydroxyl rows, rather than on top, because this situation favors orbital overlaps and charge transfer. Further analysis has demonstrated that (i) the first hyperpolarizability originates from the MO overlap and field-induced charge transfers from the neighboring substrate/adsorbate moieties but not to geometric relaxation of the C60 molecules at the interface and that (ii) larger first hyperpolarizabilities are associated with low surface coverage and with small distances between C60 and the surface. This contribution is a clear illustration of the emergence of second-order nonlinear optical responses (first hyperpolarizability) as a result of breaking the centrosymmetry.

  15. Scaling laws for nanoFET sensors

    NASA Astrophysics Data System (ADS)

    Zhou, Fu-Shan; Wei, Qi-Huo

    2008-01-01

    The sensitive conductance change of semiconductor nanowires and carbon nanotubes in response to the binding of charged molecules provides a novel sensing modality which is generally denoted as nanoFET sensors. In this paper, we study the scaling laws of nanoplate FET sensors by simplifying nanoplates as random resistor networks with molecular receptors sitting on lattice sites. Nanowire/tube FETs are included as the limiting cases where the device width goes small. Computer simulations show that the field effect strength exerted by the binding molecules has significant impact on the scaling behaviors. When the field effect strength is small, nanoFETs have little size and shape dependence. In contrast, when the field effect strength becomes stronger, there exists a lower detection threshold for charge accumulation FETs and an upper detection threshold for charge depletion FET sensors. At these thresholds, the nanoFET devices undergo a transition between low and large sensitivities. These thresholds may set the detection limits of nanoFET sensors, while they could be eliminated by designing devices with very short source-drain distance and large width.

  16. Carbon nanotubes-based chemiresistive immunosensor for small molecules: detection of nitroaromatic explosives.

    PubMed

    Park, Miso; Cella, Lakshmi N; Chen, Wilfred; Myung, Nosang V; Mulchandani, Ashok

    2010-12-15

    In recent years, there has been a growing focus on use of one-dimensional (1-D) nanostructures, such as carbon nanotubes and nanowires, as transducer elements for label-free chemiresistive/field-effect transistor biosensors as they provide label-free and high sensitivity detection. While research to-date has elucidated the power of carbon nanotubes- and other 1-D nanostructure-based field effect transistors immunosensors for large charged macromolecules such as proteins and viruses, their application to small uncharged or charged molecules has not been demonstrated. In this paper we report a single-walled carbon nanotubes (SWNTs)-based chemiresistive immunosensor for label-free, rapid, sensitive and selective detection of 2,4,6-trinitrotoluene (TNT), a small molecule. The newly developed immunosensor employed a displacement mode/format in which SWNTs network forming conduction channel of the sensor was first modified with trinitrophenyl (TNP), an analog of TNT, and then ligated with the anti-TNP single chain antibody. Upon exposure to TNT or its derivatives the bound antibodies were displaced producing a large change, several folds higher than the noise, in the resistance/conductance of SWNTs giving excellent limit of detection, sensitivity and selectivity. The sensor detected between 0.5 ppb and 5000 ppb TNT with good selectivity to other nitroaromatic explosives and demonstrated good accuracy for monitoring TNT in untreated environmental water matrix. We believe this new displacement format can be easily generalized to other one-dimensional nanostructure-based chemiresistive immuno/affinity-sensors for detecting small and/or uncharged molecules of interest in environmental monitoring and health care. Copyright © 2010 Elsevier B.V. All rights reserved.

  17. Charge migration and charge transfer in molecular systems

    PubMed Central

    Wörner, Hans Jakob; Arrell, Christopher A.; Banerji, Natalie; Cannizzo, Andrea; Chergui, Majed; Das, Akshaya K.; Hamm, Peter; Keller, Ursula; Kraus, Peter M.; Liberatore, Elisa; Lopez-Tarifa, Pablo; Lucchini, Matteo; Meuwly, Markus; Milne, Chris; Moser, Jacques-E.; Rothlisberger, Ursula; Smolentsev, Grigory; Teuscher, Joël; van Bokhoven, Jeroen A.; Wenger, Oliver

    2017-01-01

    The transfer of charge at the molecular level plays a fundamental role in many areas of chemistry, physics, biology and materials science. Today, more than 60 years after the seminal work of R. A. Marcus, charge transfer is still a very active field of research. An important recent impetus comes from the ability to resolve ever faster temporal events, down to the attosecond time scale. Such a high temporal resolution now offers the possibility to unravel the most elementary quantum dynamics of both electrons and nuclei that participate in the complex process of charge transfer. This review covers recent research that addresses the following questions. Can we reconstruct the migration of charge across a molecule on the atomic length and electronic time scales? Can we use strong laser fields to control charge migration? Can we temporally resolve and understand intramolecular charge transfer in dissociative ionization of small molecules, in transition-metal complexes and in conjugated polymers? Can we tailor molecular systems towards specific charge-transfer processes? What are the time scales of the elementary steps of charge transfer in liquids and nanoparticles? Important new insights into each of these topics, obtained from state-of-the-art ultrafast spectroscopy and/or theoretical methods, are summarized in this review. PMID:29333473

  18. The synthesis and properties of linear A-π-D-π-A type organic small molecule containing diketopyrrolopyrrole terminal units.

    PubMed

    Zhang, Shanshan; Niu, Qingfen; Sun, Tao; Li, Yang; Li, Tianduo; Liu, Haixia

    2017-08-05

    A novel linear A-π-D-π-A-type organic small molecule Ph2(PDPP) 2 consisting diketopyrrolopyrrole (DPP) as acceptor unit, biphenylene as donor unit and acetylene unit as π-linkage has been successfully designed and synthesized. Its corresponding thermal, photophysical and electrochemical properties as well as the photoinduced charge-separation process were investigated. Ph2(PDPP) 2 exhibits high thermal stability and it can be soluble in common organic solvents such as chloroform and tetrahydrofuran. The photophysical properties show that DPP 2 Ph 2 harvests sunlight over the entire visible spectrum range in the thin-film state (300-800nm). DPP 2 Ph 2 has lower band gaps and appropriate energy levels to satisfy the requirement of solution-processable organic solar cells. The efficient photoinduced charge separation process was clearly observed between DPP 2 Ph 2 with PC 61 BM and the K sv value was found to be as high as 2.13×10 4 M -1 . Therefore, these excellent properties demonstrate that the designed A-π-D-π-A-type small molecule Ph2(PDPP) 2 is the prospective candidate as donor material for organic photovoltaic material. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Sensing small molecule interactions with lipid membranes by local pH modulation.

    PubMed

    Huang, Da; Zhao, Tao; Xu, Wei; Yang, Tinglu; Cremer, Paul S

    2013-11-05

    Herein, we utilized a label-free sensing platform based on pH modulation to detect the interactions between tetracaine, a positively charged small molecule used as a local anesthetic, and planar supported lipid bilayers (SLBs). The SLBs were patterned inside a flow cell, allowing for various concentrations of tetracaine to be introduced over the surface in a buffer solution. Studies with membranes containing POPC (1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine) yielded an equilibrium dissociation constant value of Kd = 180 ± 47 μm for this small molecule-membrane interaction. Adding cholesterol to the SLBs decreased the affinity between tetracaine and the bilayers, while this interaction tightened when POPE (1-hexadecanoyl-2-(9-Z-octadecenoyl)-sn-glycero-3-phosphoethanolamine) was added. Studies were also conducted with three negatively charged membrane lipids, POPG (1-palmitoyl-2-oleoyl-sn-glycero-3-phospho-(1'-rac-glycerol) (sodium salt)), POPS (1-palmitoyl-2-oleoyl-sn-glycero-3-phospho-l-serine (sodium salt)), and ganglioside GM1. All three measurements gave rise to a similar tightening of the apparent Kd value compared with pure POPC membranes. The lack of chemical specificity with the identity of the negatively charged lipid indicated that the tightening was largely electrostatic. Through a direct comparison with ITC measurements, it was found that the pH modulation sensor platform offers a facile, inexpensive, highly sensitive, and rapid method for the detection of interactions between putative drug candidates and lipid bilayers. As such, this technique may potentially be exploited as a screen for drug development and analysis.

  20. Natural Non-Mulberry Silk Nanoparticles for Potential-Controlled Drug Release

    PubMed Central

    Wang, Juan; Yin, Zhuping; Xue, Xiang; Kundu, Subhas C.; Mo, Xiumei; Lu, Shenzhou

    2016-01-01

    Natural silk protein nanoparticles are a promising biomaterial for drug delivery due to their pleiotropic properties, including biocompatibility, high bioavailability, and biodegradability. Chinese oak tasar Antheraea pernyi silk fibroin (ApF) nanoparticles are easily obtained using cations as reagents under mild conditions. The mild conditions are potentially advantageous for the encapsulation of sensitive drugs and therapeutic molecules. In the present study, silk fibroin protein nanoparticles are loaded with differently-charged small-molecule drugs, such as doxorubicin hydrochloride, ibuprofen, and ibuprofen-Na, by simple absorption based on electrostatic interactions. The structure, morphology and biocompatibility of the silk nanoparticles in vitro are investigated. In vitro release of the drugs from the nanoparticles depends on charge-charge interactions between the drugs and the nanoparticles. The release behavior of the compounds from the nanoparticles demonstrates that positively-charged molecules are released in a more prolonged or sustained manner. Cell viability studies with L929 demonstrated that the ApF nanoparticles significantly promoted cell growth. The results suggest that Chinese oak tasar Antheraea pernyi silk fibroin nanoparticles can be used as an alternative matrix for drug carrying and controlled release in diverse biomedical applications. PMID:27916946

  1. A theoretical-electron-density databank using a model of real and virtual spherical atoms.

    PubMed

    Nassour, Ayoub; Domagala, Slawomir; Guillot, Benoit; Leduc, Theo; Lecomte, Claude; Jelsch, Christian

    2017-08-01

    A database describing the electron density of common chemical groups using combinations of real and virtual spherical atoms is proposed, as an alternative to the multipolar atom modelling of the molecular charge density. Theoretical structure factors were computed from periodic density functional theory calculations on 38 crystal structures of small molecules and the charge density was subsequently refined using a density model based on real spherical atoms and additional dummy charges on the covalent bonds and on electron lone-pair sites. The electron-density parameters of real and dummy atoms present in a similar chemical environment were averaged on all the molecules studied to build a database of transferable spherical atoms. Compared with the now-popular databases of transferable multipolar parameters, the spherical charge modelling needs fewer parameters to describe the molecular electron density and can be more easily incorporated in molecular modelling software for the computation of electrostatic properties. The construction method of the database is described. In order to analyse to what extent this modelling method can be used to derive meaningful molecular properties, it has been applied to the urea molecule and to biotin/streptavidin, a protein/ligand complex.

  2. Ultrahigh-efficiency solution-processed simplified small-molecule organic light-emitting diodes using universal host materials

    PubMed Central

    Han, Tae-Hee; Choi, Mi-Ri; Jeon, Chan-Woo; Kim, Yun-Hi; Kwon, Soon-Ki; Lee, Tae-Woo

    2016-01-01

    Although solution processing of small-molecule organic light-emitting diodes (OLEDs) has been considered as a promising alternative to standard vacuum deposition requiring high material and processing cost, the devices have suffered from low luminous efficiency and difficulty of multilayer solution processing. Therefore, high efficiency should be achieved in simple-structured small-molecule OLEDs fabricated using a solution process. We report very efficient solution-processed simple-structured small-molecule OLEDs that use novel universal electron-transporting host materials based on tetraphenylsilane with pyridine moieties. These materials have wide band gaps, high triplet energy levels, and good solution processabilities; they provide balanced charge transport in a mixed-host emitting layer. Orange-red (~97.5 cd/A, ~35.5% photons per electron), green (~101.5 cd/A, ~29.0% photons per electron), and white (~74.2 cd/A, ~28.5% photons per electron) phosphorescent OLEDs exhibited the highest recorded electroluminescent efficiencies of solution-processed OLEDs reported to date. We also demonstrate a solution-processed flexible solid-state lighting device as a potential application of our devices. PMID:27819053

  3. A Solution-Processable Molecule using Thieno[3,2-b]thiophene as Building Block for Efficient Organic Solar Cells.

    PubMed

    Wei, Huan; Chen, Weichao; Han, Liangliang; Wang, Ting; Bao, Xichang; Li, Xiaoyun; Liu, Jie; Zhou, Yuanhang; Yang, Renqiang

    2015-08-01

    A solution-processed acceptor-π-donor-π-acceptor (A-π-D-π-A) type small molecule, namely DCATT, has been designed and synthesized for the application as donor material in organic solar cells. The fused aromatic unit thieno[3,2-b]thiophene (TT) flanked with thiophene is applied as π bridge, while 4,8-bisthienyl substituted benzodithiophene (BDT) and 2-ethylhexyl cyanoacetate are chosen as the central building block and end group, respectively. Introduction of fused ring to the small molecule enhances the conjugation length of the main chain, and gives a strong tendency to form π-π stacking with a large overlapping area which favors to high charge carrier transport. Small-molecule organic solar cells based on blends of DCATT and fullerene acceptor exhibit power conversion efficiencies as high as 5.20 % under the illumination of AM 1.5G, 100 mW cm(-2) . © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Nuclear Dynamics at Molecule–Metal Interfaces: A Pseudoparticle Perspective

    DOE PAGES

    Galperin, Michael; Nitzan, Abraham

    2015-11-20

    We discuss nuclear dynamics at molecule-metal interfaces including nonequilibrium molecular junctions. Starting from the many-body states (pseudoparticle) formulation of the molecule-metal system in the molecular vibronic basis, we introduce gradient expansion to reduce the adiabatic nuclear dynamics (that is, nuclear dynamics on a single molecular potential surface) into its semiclassical form while maintaining the effect of the nonadiabatic electronic transitions between different molecular charge states. Finally, this yields a set of equations for the nuclear dynamics in the presence of these nonadiabatic transitions, which reproduce the surface-hopping formulation in the limit of small metal-molecule coupling (where broadening of the molecularmore » energy levels can be disregarded) and Ehrenfest dynamics (motion on the potential of mean force) when information on the different charging states is traced out.« less

  5. Femtosecond response of polyatomic molecules to ultra-intense hard X-rays.

    PubMed

    Rudenko, A; Inhester, L; Hanasaki, K; Li, X; Robatjazi, S J; Erk, B; Boll, R; Toyota, K; Hao, Y; Vendrell, O; Bomme, C; Savelyev, E; Rudek, B; Foucar, L; Southworth, S H; Lehmann, C S; Kraessig, B; Marchenko, T; Simon, M; Ueda, K; Ferguson, K R; Bucher, M; Gorkhover, T; Carron, S; Alonso-Mori, R; Koglin, J E; Correa, J; Williams, G J; Boutet, S; Young, L; Bostedt, C; Son, S-K; Santra, R; Rolles, D

    2017-06-01

    X-ray free-electron lasers enable the investigation of the structure and dynamics of diverse systems, including atoms, molecules, nanocrystals and single bioparticles, under extreme conditions. Many imaging applications that target biological systems and complex materials use hard X-ray pulses with extremely high peak intensities (exceeding 10 20 watts per square centimetre). However, fundamental investigations have focused mainly on the individual response of atoms and small molecules using soft X-rays with much lower intensities. Studies with intense X-ray pulses have shown that irradiated atoms reach a very high degree of ionization, owing to multiphoton absorption, which in a heteronuclear molecular system occurs predominantly locally on a heavy atom (provided that the absorption cross-section of the heavy atom is considerably larger than those of its neighbours) and is followed by efficient redistribution of the induced charge. In serial femtosecond crystallography of biological objects-an application of X-ray free-electron lasers that greatly enhances our ability to determine protein structure-the ionization of heavy atoms increases the local radiation damage that is seen in the diffraction patterns of these objects and has been suggested as a way of phasing the diffraction data. On the basis of experiments using either soft or less-intense hard X-rays, it is thought that the induced charge and associated radiation damage of atoms in polyatomic molecules can be inferred from the charge that is induced in an isolated atom under otherwise comparable irradiation conditions. Here we show that the femtosecond response of small polyatomic molecules that contain one heavy atom to ultra-intense (with intensities approaching 10 20 watts per square centimetre), hard (with photon energies of 8.3 kiloelectronvolts) X-ray pulses is qualitatively different: our experimental and modelling results establish that, under these conditions, the ionization of a molecule is considerably enhanced compared to that of an individual heavy atom with the same absorption cross-section. This enhancement is driven by ultrafast charge transfer within the molecule, which refills the core holes that are created in the heavy atom, providing further targets for inner-shell ionization and resulting in the emission of more than 50 electrons during the X-ray pulse. Our results demonstrate that efficient modelling of X-ray-driven processes in complex systems at ultrahigh intensities is feasible.

  6. Femtosecond response of polyatomic molecules to ultra-intense hard X-rays

    DOE PAGES

    Rudenko, A.; Inhester, L.; Hanasaki, K.; ...

    2017-05-31

    We report x-ray free-electron lasers enable the investigation of the structure and dynamics of diverse systems, including atoms, molecules, nanocrystals and single bioparticles, under extreme conditions. Many imaging applications that target biological systems and complex materials use hard X-ray pulses with extremely high peak intensities (exceeding 10 20 watts per square centimetre). However, fundamental investigations have focused mainly on the individual response of atoms and small molecules using soft X-rays with much lower intensities. Studies with intense X-ray pulses have shown that irradiated atoms reach a very high degree of ionization, owing to multiphoton absorption, which in a heteronuclear molecularmore » system occurs predominantly locally on a heavy atom (provided that the absorption cross-section of the heavy atom is considerably larger than those of its neighbours) and is followed by efficient redistribution of the induced charge. In serial femtosecond crystallography of biological objects—an application of X-ray free-electron lasers that greatly enhances our ability to determine protein structure—the ionization of heavy atoms increases the local radiation damage that is seen in the diffraction patterns of these objects and has been suggested as a way of phasing the diffraction data. On the basis of experiments using either soft or less-intense hard X-rays, it is thought that the induced charge and associated radiation damage of atoms in polyatomic molecules can be inferred from the charge that is induced in an isolated atom under otherwise comparable irradiation conditions. Here we show that the femtosecond response of small polyatomic molecules that contain one heavy atom to ultra-intense (with intensities approaching 10 20 watts per square centimetre), hard (with photon energies of 8.3 kiloelectronvolts) X-ray pulses is qualitatively different: our experimental and modelling results establish that, under these conditions, the ionization of a molecule is considerably enhanced compared to that of an individual heavy atom with the same absorption cross-section. This enhancement is driven by ultrafast charge transfer within the molecule, which refills the core holes that are created in the heavy atom, providing further targets for inner-shell ionization and resulting in the emission of more than 50 electrons during the X-ray pulse. Fnally, our results demonstrate that efficient modelling of X-ray-driven processes in complex systems at ultrahigh intensities is feasible.« less

  7. Femtosecond response of polyatomic molecules to ultra-intense hard X-rays

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rudenko, A.; Inhester, L.; Hanasaki, K.

    We report x-ray free-electron lasers enable the investigation of the structure and dynamics of diverse systems, including atoms, molecules, nanocrystals and single bioparticles, under extreme conditions. Many imaging applications that target biological systems and complex materials use hard X-ray pulses with extremely high peak intensities (exceeding 10 20 watts per square centimetre). However, fundamental investigations have focused mainly on the individual response of atoms and small molecules using soft X-rays with much lower intensities. Studies with intense X-ray pulses have shown that irradiated atoms reach a very high degree of ionization, owing to multiphoton absorption, which in a heteronuclear molecularmore » system occurs predominantly locally on a heavy atom (provided that the absorption cross-section of the heavy atom is considerably larger than those of its neighbours) and is followed by efficient redistribution of the induced charge. In serial femtosecond crystallography of biological objects—an application of X-ray free-electron lasers that greatly enhances our ability to determine protein structure—the ionization of heavy atoms increases the local radiation damage that is seen in the diffraction patterns of these objects and has been suggested as a way of phasing the diffraction data. On the basis of experiments using either soft or less-intense hard X-rays, it is thought that the induced charge and associated radiation damage of atoms in polyatomic molecules can be inferred from the charge that is induced in an isolated atom under otherwise comparable irradiation conditions. Here we show that the femtosecond response of small polyatomic molecules that contain one heavy atom to ultra-intense (with intensities approaching 10 20 watts per square centimetre), hard (with photon energies of 8.3 kiloelectronvolts) X-ray pulses is qualitatively different: our experimental and modelling results establish that, under these conditions, the ionization of a molecule is considerably enhanced compared to that of an individual heavy atom with the same absorption cross-section. This enhancement is driven by ultrafast charge transfer within the molecule, which refills the core holes that are created in the heavy atom, providing further targets for inner-shell ionization and resulting in the emission of more than 50 electrons during the X-ray pulse. Fnally, our results demonstrate that efficient modelling of X-ray-driven processes in complex systems at ultrahigh intensities is feasible.« less

  8. Influence of Electrostatics on Small Molecule Flux through a Protein Nanoreactor.

    PubMed

    Glasgow, Jeff E; Asensio, Michael A; Jakobson, Christopher M; Francis, Matthew B; Tullman-Ercek, Danielle

    2015-09-18

    Nature uses protein compartmentalization to great effect for control over enzymatic pathways, and the strategy has great promise for synthetic biology. In particular, encapsulation in nanometer-sized containers to create nanoreactors has the potential to elicit interesting, unexplored effects resulting from deviations from well-understood bulk processes. Self-assembled protein shells for encapsulation are especially desirable for their uniform structures and ease of perturbation through genetic mutation. Here, we use the MS2 capsid, a well-defined porous 27 nm protein shell, as an enzymatic nanoreactor to explore pore-structure effects on substrate and product flux during the catalyzed reaction. Our results suggest that the shell can influence the enzymatic reaction based on charge repulsion between small molecules and point mutations around the pore structure. These findings also lend support to the hypothesis that protein compartments modulate the transport of small molecules and thus influence metabolic reactions and catalysis in vitro.

  9. Pursuing High-Mobility n-Type Organic Semiconductors by Combination of "Molecule-Framework" and "Side-Chain" Engineering.

    PubMed

    Zhang, Cheng; Zang, Yaping; Zhang, Fengjiao; Diao, Ying; McNeill, Christopher R; Di, Chong-An; Zhu, Xiaozhang; Zhu, Daoben

    2016-10-01

    "Molecule-framework" and "side-chain" engineering is powerful for the design of high-performance organic semiconductors. Based on 2DQTTs, the relationship between molecular structure, film microstructure, and charge-transport property in organic thin-film transistors (OTFTs) is studied. 2DQTT-o-B exhibits outstanding electron mobilities of 5.2 cm 2 V -1 s -1 , which is a record for air-stable solution-processable n-channel small-molecule OTFTs to date. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Effect of Cosmological Neutrinos on Discrimination Between the Two Enantiomers of a Chiral Molecule

    NASA Astrophysics Data System (ADS)

    Bargueño, Pedro; Gonzalo, Isabel

    2006-04-01

    In the framework of an extraterrestrial origin of biological homochirality, universal mechanisms are of particular interest. In this sense we consider the weak parity-violating neutrino-electron interaction through weak charged currents W ± between the relic flux of cosmological neutrinos and the electrons of a chiral molecule. We use the known theoretical result of the split in energy of the two helicity sates of an electron in the cosmic neutrino bath, due to weak charged currents. In the case that electrons of a chiral molecule are submitted to a helicoidal potential due to the nuclear conformation, these electrons have opposite helicities for the two enantiomers of the molecule and consequently the mentioned neutrino-electron interaction would produce a splitting in energy between the two enantiomers. An estimation of this energy for the case of a single electron yields a small value of the order of 10-26 eV. This value results amplified by the contribution of all the molecular electrons having helicity and other possible mechanisms.

  11. Unconventional Current Scaling and Edge Effects for Charge Transport through Molecular Clusters

    PubMed Central

    2017-01-01

    Metal–molecule–metal junctions are the key components of molecular electronics circuits. Gaining a microscopic understanding of their conducting properties is central to advancing the field. In the present contribution, we highlight the fundamental differences between single-molecule and ensemble junctions focusing on the fundamentals of transport through molecular clusters. In this way, we elucidate the collective behavior of parallel molecular wires, bridging the gap between single molecule and large-area monolayer electronics, where even in the latter case transport is usually dominated by finite-size islands. On the basis of first-principles charge-transport simulations, we explain why the scaling of the conductivity of a junction has to be distinctly nonlinear in the number of molecules it contains. Moreover, transport through molecular clusters is found to be highly inhomogeneous with pronounced edge effects determined by molecules in locally different electrostatic environments. These effects are most pronounced for comparably small clusters, but electrostatic considerations show that they prevail also for more extended systems. PMID:29043825

  12. Biomolecular Force Field Parameterization via Atoms-in-Molecule Electron Density Partitioning.

    PubMed

    Cole, Daniel J; Vilseck, Jonah Z; Tirado-Rives, Julian; Payne, Mike C; Jorgensen, William L

    2016-05-10

    Molecular mechanics force fields, which are commonly used in biomolecular modeling and computer-aided drug design, typically treat nonbonded interactions using a limited library of empirical parameters that are developed for small molecules. This approach does not account for polarization in larger molecules or proteins, and the parametrization process is labor-intensive. Using linear-scaling density functional theory and atoms-in-molecule electron density partitioning, environment-specific charges and Lennard-Jones parameters are derived directly from quantum mechanical calculations for use in biomolecular modeling of organic and biomolecular systems. The proposed methods significantly reduce the number of empirical parameters needed to construct molecular mechanics force fields, naturally include polarization effects in charge and Lennard-Jones parameters, and scale well to systems comprised of thousands of atoms, including proteins. The feasibility and benefits of this approach are demonstrated by computing free energies of hydration, properties of pure liquids, and the relative binding free energies of indole and benzofuran to the L99A mutant of T4 lysozyme.

  13. Spontaneous Charge Separation and Sublimation Processes are Ubiquitous in Nature and in Ionization Processes in Mass Spectrometry

    NASA Astrophysics Data System (ADS)

    Trimpin, Sarah; Lu, I.-Chung; Rauschenbach, Stephan; Hoang, Khoa; Wang, Beixi; Chubatyi, Nicholas D.; Zhang, Wen-Jing; Inutan, Ellen D.; Pophristic, Milan; Sidorenko, Alexander; McEwen, Charles N.

    2018-02-01

    Ionization processes have been discovered by which small and large as well as volatile and nonvolatile compounds are converted to gas-phase ions when associated with a matrix and exposed to sub-atmospheric pressure. Here, we discuss experiments further defining these simple and unexpected processes. Charge separation is found to be a common process for small molecule chemicals, solids and liquids, passed through an inlet tube from a higher to a lower pressure region, with and without heat applied. This charge separation process produces positively- and negatively-charged particles with widely different efficiencies depending on the compound and its physical state. Circumstantial evidence is presented suggesting that in the new ionization process, charged particles carry analyte into the gas phase, and desolvation of these particles produce the bare ions similar to electrospray ionization, except that solid particles appear likely to be involved. This mechanistic proposition is in agreement with previous theoretical work related to ion emission from ice.

  14. Spectrally resolved single-molecule electrometry

    NASA Astrophysics Data System (ADS)

    Ruggeri, F.; Krishnan, M.

    2018-03-01

    Escape-time electrometry is a recently developed experimental technique that offers the ability to measure the effective electrical charge of a single biomolecule in solution with sub-elementary charge precision. The approach relies on measuring the average escape-time of a single charged macromolecule or molecular species transiently confined in an electrostatic fluidic trap. Comparing the experiments with the predictions of a mean-field model of molecular electrostatics, we have found that the measured effective charge even reports on molecular conformation, e.g., folded or disordered state, and non-uniform charge distribution in disordered proteins or polyelectrolytes. Here we demonstrate the ability to use the spectral dimension to distinguish minute differences in electrical charge between individual molecules or molecular species in a single simultaneous measurement, under identical experimental conditions. Using one spectral channel for referenced measurement, this kind of photophysical distinguishability essentially eliminates the need for accurate knowledge of key experimental parameters, otherwise obtained through intensive characterization of the experimental setup. As examples, we demonstrate the ability to detect small differences (˜5%) in the length of double-stranded DNA fragments as well as single amino acid exchange in an intrinsically disordered protein, prothymosin α.

  15. A general intermolecular force field based on tight-binding quantum chemical calculations

    NASA Astrophysics Data System (ADS)

    Grimme, Stefan; Bannwarth, Christoph; Caldeweyher, Eike; Pisarek, Jana; Hansen, Andreas

    2017-10-01

    A black-box type procedure is presented for the generation of a molecule-specific, intermolecular potential energy function. The method uses quantum chemical (QC) information from our recently published extended tight-binding semi-empirical scheme (GFN-xTB) and can treat non-covalently bound complexes and aggregates with almost arbitrary chemical structure. The necessary QC information consists of the equilibrium structure, Mulliken atomic charges, charge centers of localized molecular orbitals, and also of frontier orbitals and orbital energies. The molecular pair potential includes model density dependent Pauli repulsion, penetration, as well as point charge electrostatics, the newly developed D4 dispersion energy model, Drude oscillators for polarization, and a charge-transfer term. Only one element-specific and about 20 global empirical parameters are needed to cover systems with nuclear charges up to radon (Z = 86). The method is tested for standard small molecule interaction energy benchmark sets where it provides accurate intermolecular energies and equilibrium distances. Examples for structures with a few hundred atoms including charged systems demonstrate the versatility of the approach. The method is implemented in a stand-alone computer code which enables rigid-body, global minimum energy searches for molecular aggregation or alignment.

  16. Fabrication and characterization of controllable grain boundary arrays in solution-processed small molecule organic semiconductor films

    NASA Astrophysics Data System (ADS)

    Wo, Songtao; Headrick, Randall L.; Anthony, John E.

    2012-04-01

    We have produced solution-processed thin films of 6,13-bis(tri-isopropyl-silylethynyl) pentacene with grain sizes from a few micrometers up to millimeter scale by lateral crystallization from a rectangular stylus. Grains are oriented along the crystallization direction, and the grain size transverse to the crystallization direction depends inversely on the writing speed, hence forming a regular array of oriented grain boundaries with controllable spacing. We utilize these controllable arrays to systematically study the role of large-angle grain boundaries in carrier transport and charge trapping in thin film transistors. The effective mobility scales with the grain size, leading to an estimate of the potential drop at individual large-angle grain boundaries of more than 1 volt. This result indicates that the structure of grain boundaries is not molecularly abrupt, which may be a general feature of solution-processed small molecule organic semiconductor thin films, where relatively high energy grain boundaries are typically formed. Transient measurements after switching from positive to negative gate bias or between large and small negative gate bias reveal reversible charge trapping, with time constants on the order of 10 s and trap densities that are correlated with grain boundary density. We suggest that charge diffusion along grain boundaries and other defects is the rate-determining mechanism of the reversible trapping.

  17. Experimental validation of calculated atomic charges in ionic liquids

    NASA Astrophysics Data System (ADS)

    Fogarty, Richard M.; Matthews, Richard P.; Ashworth, Claire R.; Brandt-Talbot, Agnieszka; Palgrave, Robert G.; Bourne, Richard A.; Vander Hoogerstraete, Tom; Hunt, Patricia A.; Lovelock, Kevin R. J.

    2018-05-01

    A combination of X-ray photoelectron spectroscopy and near edge X-ray absorption fine structure spectroscopy has been used to provide an experimental measure of nitrogen atomic charges in nine ionic liquids (ILs). These experimental results are used to validate charges calculated with three computational methods: charges from electrostatic potentials using a grid-based method (ChelpG), natural bond orbital population analysis, and the atoms in molecules approach. By combining these results with those from a previous study on sulfur, we find that ChelpG charges provide the best description of the charge distribution in ILs. However, we find that ChelpG charges can lead to significant conformational dependence and therefore advise that small differences in ChelpG charges (<0.3 e) should be interpreted with care. We use these validated charges to provide physical insight into nitrogen atomic charges for the ILs probed.

  18. How mobile are dye adsorbates and acetonitrile molecules on the surface of TiO2 nanoparticles? A quasi-elastic neutron scattering study

    PubMed Central

    Vaissier, Valerie; Sakai, Victoria Garcia; Li, Xiaoe; Cabral, João T.; Nelson, Jenny; Barnes, Piers R. F.

    2016-01-01

    Motions of molecules adsorbed to surfaces may control the rate of charge transport within monolayers in systems such as dye sensitized solar cells. We used quasi-elastic neutron scattering (QENS) to evaluate the possible dynamics of two small dye moieties, isonicotinic acid (INA) and bis-isonicotinic acid (BINA), attached to TiO2 nanoparticles via carboxylate groups. The scattering data indicate that moieties are immobile and do not rotate around the anchoring groups on timescales between around 10 ps and a few ns (corresponding to the instrumental range). This gives an upper limit for the rate at which conformational fluctuations can assist charge transport between anchored molecules. Our observations suggest that if the conformation of larger dye molecules varies with time, it does so on longer timescales and/or in parts of the molecule which are not directly connected to the anchoring group. The QENS measurements also indicate that several layers of acetonitrile solvent molecules are immobilized at the interface with the TiO2 on the measurement time scale, in reasonable agreement with recent classical molecular dynamics results. PMID:27991538

  19. How mobile are dye adsorbates and acetonitrile molecules on the surface of TiO2 nanoparticles? A quasi-elastic neutron scattering study

    NASA Astrophysics Data System (ADS)

    Vaissier, Valerie; Sakai, Victoria Garcia; Li, Xiaoe; Cabral, João T.; Nelson, Jenny; Barnes, Piers R. F.

    2016-12-01

    Motions of molecules adsorbed to surfaces may control the rate of charge transport within monolayers in systems such as dye sensitized solar cells. We used quasi-elastic neutron scattering (QENS) to evaluate the possible dynamics of two small dye moieties, isonicotinic acid (INA) and bis-isonicotinic acid (BINA), attached to TiO2 nanoparticles via carboxylate groups. The scattering data indicate that moieties are immobile and do not rotate around the anchoring groups on timescales between around 10 ps and a few ns (corresponding to the instrumental range). This gives an upper limit for the rate at which conformational fluctuations can assist charge transport between anchored molecules. Our observations suggest that if the conformation of larger dye molecules varies with time, it does so on longer timescales and/or in parts of the molecule which are not directly connected to the anchoring group. The QENS measurements also indicate that several layers of acetonitrile solvent molecules are immobilized at the interface with the TiO2 on the measurement time scale, in reasonable agreement with recent classical molecular dynamics results.

  20. Direct analysis of samples under ambient condition by high-voltage-assisted laser desorption ionization mass spectrometry in both positive and negative ion mode.

    PubMed

    Ren, Xinxin; Liu, Jia; Zhang, Chengsen; Luo, Hai

    2013-03-15

    With the rapid development of ambient mass spectrometry, the hybrid laser-based ambient ionization methods which can generate multiply charged ions of large biomolecules and also characterize small molecules with good signal-to-noise in both positive and negative ion modes are of particular interest. An ambient ionization method termed high-voltage-assisted laser desorption ionization (HALDI) is developed, in which a 1064 nm laser is used to desorb various liquid samples from the sample target biased at a high potential without the need for an organic matrix. The pre-charged liquid samples are desorbed by the laser to form small charged droplets which may undergo an electrospray-like ionization process to produce multiply charged ions of large biomolecules. Various samples including proteins, oligonucleotides (ODNs), drugs, whole milk and chicken eggs have been analyzed by HALDI-MS in both positive and negative ion mode with little or no sample preparation. In addition, HALDI can generate intense signals with better signal-to-noise in negative ion mode than laser desorption spay post-ionization (LDSPI) from the same samples, such as ODNs and some carboxylic-group-containing small drug molecules. HALDI-MS can directly analyze a variety of liquid samples including proteins, ODNs, pharmaceuticals and biological fluids in both positive and negative ion mode without the use of an organic matrix. This technique may be further developed into a useful tool for rapid analysis in many different fields such as pharmaceutical, food, and biological sciences. Copyright © 2013 John Wiley & Sons, Ltd.

  1. Geoengineering with Charged Droplets

    NASA Astrophysics Data System (ADS)

    Gokturk, H.

    2011-12-01

    Water molecules in a droplet are held together by intermolecular forces generated by hydrogen bonding which has a bonding energy of only about 0.2 eV. One can create a more rugged droplet by using an ion as a condensation nucleus. In that case, water molecules are held together by the interaction between the ion and the dipole moments of the water molecules surrounding the ion, in addition to any hydrogen bonding. In this research, properties of such charged droplets were investigated using first principle quantum mechanical calculations. A molecule which exhibits positive electron affinity is a good candidate to serve as the ionic condensation nucleus, because addition of an electron to such a molecule creates an energetically more stable state than the neutral molecule. A good example is the oxygen molecule (O2) where energy of O2 negative (O2-) ion is lower than that of the neutral O2 by about 0.5 eV. Examples of other molecules which have positive electron affinity include ozone (O3), nitrogen dioxide (NO2) and sulfur oxides (SOx, x=1-3). Atomic models used in the calculations consisted of a negative ion of one of the molecules mentioned above surrounded by water molecules. Calculations were performed using the DFT method with B3LYP hybrid functional and Pople type basis sets with polarization and diffuse functions. Energy of interaction between O2- ion and the water molecule was found to be ~0.7 eV. This energy is an order of magnitude greater than the thermal energy of even the highest temperatures encountered in the atmosphere. Once created, charged rugged droplets can survive in hot and dry climates where they can be utilized to create humidity and precipitation. The ion which serves as the nucleus of the droplet can attract not only water molecules but also other dipolar gases in the atmosphere. Such dipolar gases include industrial pollutants, for example nitrogen dioxide (NO2) or sulfur dioxide (SO2). Energy of interaction between O2- ion and pollutant molecules was calculated to be ~0.5 eV for NO2 and ~0.9 eV for SO2. These values are comparable to that of water, hence charged droplets have the potential to serve as scavengers of pollutants in the atmosphere. The charged droplet can also interact with quadrupolar gases depending on the charge distribution of the gas. A quadrupole of interest is carbon dioxide (CO2) where oxygens are slightly negative and carbon is slightly positive in a neutral molecule. When CO2 is in the vicinity of a negative ion, the carbon atom gets attracted to the ion, whereas oxygens are repelled from it. This interaction distorts the linear geometry of CO2, turning it into a small dipole. Energy of interaction between O2- ion and CO2 was calculated to be ~0.3 eV which is smaller than those of the above mentioned dipoles, but still significantly greater than the typical thermal energy at 25 C (~0.03 eV). One can expect the diffusion of atmospheric CO2 into the droplets to be enhanced due to the charge. Hence such droplets can help capture the CO2 in the atmosphere and sequester it simply as rain. Charged droplets can be created using electrical,optical, thermal or other means. A method which utilizes solar energy will be described in the presentation.

  2. Noise analysis of antibiotic permeation through bacterial channels

    NASA Astrophysics Data System (ADS)

    Nestorovich, Ekaterina M.; Danelon, Christophe; Winterhalter, Mathias; Bezrukov, Sergey M.

    2003-05-01

    Statistical analysis of high-resolution current recordings from a single ion channel reconstituted into a planar lipid membrane allows us to study transport of antibiotics at the molecular detail. Working with the general bacterial porin, OmpF, we demonstrate that addition of zwitterionic β-lactam antibiotics to the membrane-bathing solution introduces transient interruptions in the small-ion current through the channel. Time-resolved measurements reveal that one antibiotic molecule blocks one of the monomers in the OmpF trimer for characteristic times from microseconds to hundreds of microseconds. Spectral noise analysis enables us to perform measurements over a wide range of changing parameters. In all cases studied, the residence time of an antibiotic molecule in the channel exceeds the estimated time for free diffusion by orders of magnitude. This demonstrates that, in analogy to substrate-specific channels that evolved to bind specific metabolite molecules, antibiotics have 'evolved' to be channel-specific. The charge distribution of an efficient antibiotic complements the charge distribution at the narrowest part of the bacterial porin. Interaction of these charges creates a zone of attraction inside the channel and compensates the penetrating molecule's entropy loss and desolvation energy. This facilitates antibiotic translocation through the narrowest part of the channel and accounts for higher antibiotic permeability rates.

  3. Tunable drug loading and release from polypeptide multilayer nanofilms

    PubMed Central

    Jiang, Bingbing; Li, Bingyun

    2009-01-01

    Polypeptide multilayer nanofilms were prepared using electrostatic layer-by-layer self-assembly nanotechnology. Small charged drug molecules (eg, cefazolin, gentamicin, and methylene blue) were loaded in polypeptide multilayer nanofilms. Their loading and release were found to be pH-dependent and could also be controlled by changing the number of film layers and drug incubation time, and applying heat-treatment after film formation. Antibioticloaded polypeptide multilayer nanofilms showed controllable antibacterial properties against Staphylococcus aureus. The developed biodegradable polypeptide multilayer nanofilms are capable of loading both positively- and negatively-charged drug molecules and promise to serve as drug delivery systems on biomedical devices for preventing biomedical device-associated infection, which is a significant clinical complication for both civilian and military patients. PMID:19421369

  4. ForceGen 3D structure and conformer generation: from small lead-like molecules to macrocyclic drugs

    NASA Astrophysics Data System (ADS)

    Cleves, Ann E.; Jain, Ajay N.

    2017-05-01

    We introduce the ForceGen method for 3D structure generation and conformer elaboration of drug-like small molecules. ForceGen is novel, avoiding use of distance geometry, molecular templates, or simulation-oriented stochastic sampling. The method is primarily driven by the molecular force field, implemented using an extension of MMFF94s and a partial charge estimator based on electronegativity-equalization. The force field is coupled to algorithms for direct sampling of realistic physical movements made by small molecules. Results are presented on a standard benchmark from the Cambridge Crystallographic Database of 480 drug-like small molecules, including full structure generation from SMILES strings. Reproduction of protein-bound crystallographic ligand poses is demonstrated on four carefully curated data sets: the ConfGen Set (667 ligands), the PINC cross-docking benchmark (1062 ligands), a large set of macrocyclic ligands (182 total with typical ring sizes of 12-23 atoms), and a commonly used benchmark for evaluating macrocycle conformer generation (30 ligands total). Results compare favorably to alternative methods, and performance on macrocyclic compounds approaches that observed on non-macrocycles while yielding a roughly 100-fold speed improvement over alternative MD-based methods with comparable performance.

  5. Dynamics of ions in a water drop using the AMOEBA polarizable force field

    NASA Astrophysics Data System (ADS)

    Thaunay, Florian; Ohanessian, Gilles; Clavaguéra, Carine

    2017-03-01

    Various ions carrying a charge from -2 to +3 were confined in a drop of 100 water molecules as a way to model coordination properties inside the cluster and at the interface. The behavior of the ions has been followed by molecular dynamics with the AMOEBA polarizable force field. Multiply charged ions and small singly charged ions are found to lie inside the droplet, while bigger monovalent ions sit near the surface. The results provide a coherent picture of average structural properties as well as residence times for which a general trend is proposed, especially for the anions.

  6. FreeSolv: A database of experimental and calculated hydration free energies, with input files

    PubMed Central

    Mobley, David L.; Guthrie, J. Peter

    2014-01-01

    This work provides a curated database of experimental and calculated hydration free energies for small neutral molecules in water, along with molecular structures, input files, references, and annotations. We call this the Free Solvation Database, or FreeSolv. Experimental values were taken from prior literature and will continue to be curated, with updated experimental references and data added as they become available. Calculated values are based on alchemical free energy calculations using molecular dynamics simulations. These used the GAFF small molecule force field in TIP3P water with AM1-BCC charges. Values were calculated with the GROMACS simulation package, with full details given in references cited within the database itself. This database builds in part on a previous, 504-molecule database containing similar information. However, additional curation of both experimental data and calculated values has been done here, and the total number of molecules is now up to 643. Additional information is now included in the database, such as SMILES strings, PubChem compound IDs, accurate reference DOIs, and others. One version of the database is provided in the Supporting Information of this article, but as ongoing updates are envisioned, the database is now versioned and hosted online. In addition to providing the database, this work describes its construction process. The database is available free-of-charge via http://www.escholarship.org/uc/item/6sd403pz. PMID:24928188

  7. Rational design of tetraphenylethylene-based luminescent down-shifting molecules: photophysical studies and photovoltaic applications in a CdTe solar cell from small to large units.

    PubMed

    Li, Yilin; Li, Zhipeng; Ablekim, Tursunjan; Ren, Tianhui; Dong, Wen-Ji

    2014-12-21

    A rational design strategy of novel fluorophores for luminescent down-shifting (LDS) application was proposed and tested in this paper. Three new fluorophores (1a-c) with specific intramolecular charge transfer (ICT) and aggregation-induced emission (AIE) characteristics were synthesized as LDS molecules for increasing the output short circuit current density (Jsc) of a CdTe solar cell. Photophysical studies of their solution and solid states, and photovoltaic measurements of their PMMA solid films applied on a CdTe solar cell suggested that the specific spectroscopic properties and Jsc enhancement effects of these molecules were highly related to their chemical structures. The Jsc enhancement effects of these fluorophores were measured on both a CdTe small cell and a large panel. An increase in the output Jsc by as high as 5.69% for a small cell and 8.88% for a large panel was observed. Compared to a traditional LDS molecule, Y083, these fluorophores exhibited more superior capabilities of LDS.

  8. LigandRNA: computational predictor of RNA–ligand interactions

    PubMed Central

    Philips, Anna; Milanowska, Kaja; Łach, Grzegorz; Bujnicki, Janusz M.

    2013-01-01

    RNA molecules have recently become attractive as potential drug targets due to the increased awareness of their importance in key biological processes. The increase of the number of experimentally determined RNA 3D structures enabled structure-based searches for small molecules that can specifically bind to defined sites in RNA molecules, thereby blocking or otherwise modulating their function. However, as of yet, computational methods for structure-based docking of small molecule ligands to RNA molecules are not as well established as analogous methods for protein-ligand docking. This motivated us to create LigandRNA, a scoring function for the prediction of RNA–small molecule interactions. Our method employs a grid-based algorithm and a knowledge-based potential derived from ligand-binding sites in the experimentally solved RNA–ligand complexes. As an input, LigandRNA takes an RNA receptor file and a file with ligand poses. As an output, it returns a ranking of the poses according to their score. The predictive power of LigandRNA favorably compares to five other publicly available methods. We found that the combination of LigandRNA and Dock6 into a “meta-predictor” leads to further improvement in the identification of near-native ligand poses. The LigandRNA program is available free of charge as a web server at http://ligandrna.genesilico.pl. PMID:24145824

  9. A second generation distributed point polarizable water model.

    PubMed

    Kumar, Revati; Wang, Fang-Fang; Jenness, Glen R; Jordan, Kenneth D

    2010-01-07

    A distributed point polarizable model (DPP2) for water, with explicit terms for charge penetration, induction, and charge transfer, is introduced. The DPP2 model accurately describes the interaction energies in small and large water clusters and also gives an average internal energy per molecule and radial distribution functions of liquid water in good agreement with experiment. A key to the success of the model is its accurate description of the individual terms in the n-body expansion of the interaction energies.

  10. Electroluminescence Properties of IrQ(ppy)2 Dual-Emitter Organometallic Compound in Organic Light-Emitting Devices

    NASA Astrophysics Data System (ADS)

    Ciobotaru, Constantin Claudiu; Polosan, Silviu; Ciobotaru, Iulia Corina

    2018-02-01

    This paper reports the influence of the charge carrier mobility on the electroluminescent properties of a dual-emitter organometallic compound dispersed in two conjugated organic small-molecule host materials and embedded in organic light-emitting devices (OLEDs). The electroluminescent processes in OLEDs are strongly influenced by the host-guest interaction. The charge carrier mobility in the host material plays an important role in the electroluminescent processes but also depends on the triplet-triplet interaction with the organometallic compound. The low charge carrier mobility in 4,4'-bis( N-carbazolyl)-1,1'-biphenyl (CBP) host material reduces the electroluminescent processes, but they are slightly enhanced by the triplet-triplet exothermic charge transfer. The higher charge carrier mobility in the case of N, N'-bis(3-methylphenyl)- N, N'-diphenylbenzidine (TPD) host material influences the electroluminescent processes by the endothermic energy transfer at room temperature, which facilitates the triplet-triplet harvesting in the host-guest system. The excitation is transferred to the guest molecules by triplet-triplet interaction as a Dexter transfer, which occurs by endothermic transfer from the triplet exciton in the host to the triplet exciton in the guest.

  11. Charge and Spin Currents in Open-Shell Molecules:  A Unified Description of NMR and EPR Observables.

    PubMed

    Soncini, Alessandro

    2007-11-01

    The theory of EPR hyperfine coupling tensors and NMR nuclear magnetic shielding tensors of open-shell molecules in the limit of vanishing spin-orbit coupling (e.g., for organic radicals) is analyzed in terms of spin and charge current density vector fields. The ab initio calculation of the spin and charge current density response has been implemented at the Restricted Open-Shell Hartree-Fock, Unrestricted Hartree-Fock, and unrestricted GGA-DFT level of theory. On the basis of this formalism, we introduce the definition of nuclear hyperfine coupling density, a scalar function of position providing a partition of the EPR observable over the molecular domain. Ab initio maps of spin and charge current density and hyperfine coupling density for small radicals are presented and discussed in order to illustrate the interpretative advantages of the newly introduced approach. Recent NMR experiments providing evidence for the existence of diatropic ring currents in the open-shell singlet pancake-bonded dimer of the neutral phenalenyl radical are directly assessed via the visualization of the induced current density.

  12. How ions affect the structure of water.

    PubMed

    Hribar, Barbara; Southall, Noel T; Vlachy, Vojko; Dill, Ken A

    2002-10-16

    We model ion solvation in water. We use the MB model of water, a simple two-dimensional statistical mechanical model in which waters are represented as Lennard-Jones disks having Gaussian hydrogen-bonding arms. We introduce a charge dipole into MB waters. We perform (NPT) Monte Carlo simulations to explore how water molecules are organized around ions and around nonpolar solutes in salt solutions. The model gives good qualitative agreement with experiments, including Jones-Dole viscosity B coefficients, Samoilov and Hirata ion hydration activation energies, ion solvation thermodynamics, and Setschenow coefficients for Hofmeister series ions, which describe the salt concentration dependence of the solubilities of hydrophobic solutes. The two main ideas captured here are (1) that charge densities govern the interactions of ions with water, and (2) that a balance of forces determines water structure: electrostatics (water's dipole interacting with ions) and hydrogen bonding (water interacting with neighboring waters). Small ions (kosmotropes) have high charge densities so they cause strong electrostatic ordering of nearby waters, breaking hydrogen bonds. In contrast, large ions (chaotropes) have low charge densities, and surrounding water molecules are largely hydrogen bonded.

  13. DNA Immobilization and Hybridization Detection by the Intrinsic Molecular Charge Using Capacitive Field-Effect Sensors Modified with a Charged Weak Polyelectrolyte Layer.

    PubMed

    Bronder, Thomas S; Poghossian, Arshak; Scheja, Sabrina; Wu, Chunsheng; Keusgen, Michael; Mewes, Dieter; Schöning, Michael J

    2015-09-16

    Miniaturized setup, compatibility with advanced micro- and nanotechnologies, and ability to detect biomolecules by their intrinsic molecular charge favor the semiconductor field-effect platform as one of the most attractive approaches for the development of label-free DNA chips. In this work, a capacitive field-effect EIS (electrolyte-insulator-semiconductor) sensor covered with a layer-by-layer prepared, positively charged weak polyelectrolyte layer of PAH (poly(allylamine hydrochloride)) was used for the label-free electrical detection of DNA (deoxyribonucleic acid) immobilization and hybridization. The negatively charged probe single-stranded DNA (ssDNA) molecules were electrostatically adsorbed onto the positively charged PAH layer, resulting in a preferentially flat orientation of the ssDNA molecules within the Debye length, thus yielding a reduced charge-screening effect and a higher sensor signal. Each sensor-surface modification step (PAH adsorption, probe ssDNA immobilization, hybridization with complementary target DNA (cDNA), reducing an unspecific adsorption by a blocking agent, incubation with noncomplementary DNA (ncDNA) solution) was monitored by means of capacitance-voltage and constant-capacitance measurements. In addition, the surface morphology of the PAH layer was studied by atomic force microscopy and contact-angle measurements. High hybridization signals of 34 and 43 mV were recorded in low-ionic strength solutions of 10 and 1 mM, respectively. In contrast, a small signal of 4 mV was recorded in the case of unspecific adsorption of fully mismatched ncDNA. The density of probe ssDNA and dsDNA molecules as well as the hybridization efficiency was estimated using the experimentally measured DNA immobilization and hybridization signals and a simplified double-layer capacitor model. The results of field-effect experiments were supported by fluorescence measurements, verifying the DNA-immobilization and hybridization event.

  14. Small Molecule Inhibition of Ligand-Stimulated RAGE-DIAPH1 Signal Transduction

    PubMed Central

    Manigrasso, Michaele B.; Pan, Jinhong; Rai, Vivek; Zhang, Jinghua; Reverdatto, Sergey; Quadri, Nosirudeen; DeVita, Robert J.; Ramasamy, Ravichandran; Shekhtman, Alexander; Schmidt, Ann Marie

    2016-01-01

    The receptor for advanced glycation endproducts (RAGE) binds diverse ligands linked to chronic inflammation and disease. NMR spectroscopy and x-ray crystallization studies of the extracellular domains of RAGE indicate that RAGE ligands bind by distinct charge- and hydrophobicity-dependent mechanisms. The cytoplasmic tail (ct) of RAGE is essential for RAGE ligand-mediated signal transduction and consequent modulation of gene expression and cellular properties. RAGE signaling requires interaction of ctRAGE with the intracellular effector, mammalian diaphanous 1 or DIAPH1. We screened a library of 58,000 small molecules and identified 13 small molecule competitive inhibitors of ctRAGE interaction with DIAPH1. These compounds, which exhibit in vitro and in vivo inhibition of RAGE-dependent molecular processes, present attractive molecular scaffolds for the development of therapeutics against RAGE-mediated diseases, such as those linked to diabetic complications, Alzheimer’s disease, and chronic inflammation, and provide support for the feasibility of inhibition of protein-protein interaction (PPI). PMID:26936329

  15. Small-Molecule-Based Self-Assembled Ligands for G-Quadruplex DNA Surface Recognition.

    PubMed

    Rivera-Sánchez, María Del C; García-Arriaga, Marilyn; Hobley, Gerard; Morales-de-Echegaray, Ana V; Rivera, José M

    2017-10-31

    Most drugs are small molecules because of their attractive pharmacokinetics, manageable development and manufacturing, and effective binding into the concave crevices of bio-macromolecules. Despite these features, they often fall short when it comes to effectively recognizing the surfaces of bio-macromolecules. One way to overcome the challenge of biomolecular surface recognition is to develop small molecules that become self-assembled ligands (SALs) prior to binding. Herein, we report SALs made from 8-aryl-2'-deoxyguanosine derivatives forming precise hydrophilic supramolecular G-quadruplexes (SGQs) with excellent size, shape, and charge complementarity to G-quadruplex DNA (QDNA). We show that only those compounds forming SGQs act as SALs, which in turn differentially stabilize QDNAs from selected oncogene promoters and the human telomeric regions. Fluorescence resonance energy-transfer melting assays are consistent with spectroscopic, calorimetric, and light scattering studies, showing the formation of a "sandwichlike" complex QDNA·SGQ·QDNA. These results open the door for the advent of SALs that recognize QDNAs and potentially the surfaces of other bio-macromolecules such as proteins.

  16. Transport of the highly charged myo-inositol hexakisphosphate molecule across the red blood cell membrane: a phase transfer and biological study.

    PubMed

    Vincent, Stéphane P; Lehn, Jean-Marie; Lazarte, Jaime; Nicolau, Claude

    2002-09-01

    To address the problem of delivering highly charged small molecules, such as phytic acid (InsP(6) or IHP), across biological membranes, we investigated an approach based on a non-covalent interaction between transport molecule(s) and IHP. Thus, we synthesized a collection of compounds containing IHP ionically bound to lipophilic (but non-lipidic) ammonium or poly-ammonium cations. First, we assessed the ability of these water-soluble salts to cross a biological membrane by measuring the partition coefficients between human serum and 1-octanol. In view of the ability of IHP to act as potent effector for oxygen release, the O(2)-hemoglobin dissociation curves were then measured for the most efficient salts on whole blood. From both the biological and the physical properties of IHP-ammonium salts we determined that cycloalkylamines (or poly-amines) were the best transport molecules, especially cycloheptyl- and cyclooctylamine. Indeed, the octanol/serum partition coefficient of IHP undecacyclooctylammonium salt, is superior to 1, which is very favorable for potential uptake into the red blood cell membrane. A qualitative correlation was found between the partitioning experiments and the biological evaluations performed on whole blood.

  17. Charge transport in single photochromic molecular junctions

    NASA Astrophysics Data System (ADS)

    Kim, Youngsang; Pietsch, T.; Scheer, Elke; Hellmuth, T.; Pauly, F.; Sysoiev, D.; Huhn, T.; Exner, T.; Groth, U.; Steiner, U.; Erbe, A.

    2012-02-01

    Recently, photoswitchable molecules, i.e. diarylethene, gained significant interest due to their applicability in data storage media, as optical switches, and in novel logic circuits [1]. Diarylethene-derivative molecules are the most promising candidates to design electronic functional elements, because of their excellent thermal stability, high fatigue resistance, and negligible change upon switching [1]. Here, we present the preferential conductance of specifically designed sulfur-free diarylethene molecules [2] bridging the mechanically controlled break-junctions at low temperatures [3]. The molecular energy levels and electrode couplings are obtained by evaluating the current-voltage characteristics using the single-level model [4]. The charge transport mechanism of different types of diarylethene molecules is investigated, and the results are discussed within the framework of novel theoretical predictions. [4pt] [1] M. Del Valle etal., Nat Nanotechnol 2, 176 (2007) S. J. van der Molen etal., Nano. Lett. 9, 76 (2009).[0pt] [2] D. Sysoiev etal., Chem. Eur. J. 17, 6663 (2011).[0pt] [3] Y. Kim etal., Phys. Rev. Lett. 106, 196804 (2011).[0pt] [4] Y. Kim etal., Nano Lett. 11, 3734 (2011). L. Zotti etal., Small 6, 1529 (2010).

  18. Biology's built-in Faraday cages

    NASA Astrophysics Data System (ADS)

    Klee, Maurice M.

    2014-05-01

    Biological fluids are water-based, ionic conductors. As such, they have both high relative dielectric constants and substantial conductivities, meaning they are lossy dielectrics. These fluids contain charged molecules (free charges), whose movements play roles in essentially all cellular processes from metabolism to communication with other cells. Using the problem of a point source in air above a biological fluid of semi-infinite extent, the bound charges in the fluid are shown to perform the function of a fast-acting Faraday cage, which protects the interior of the fluid from external electric fields. Free charges replace bound charges in accordance with the fluid's relaxation time, thereby providing a smooth transition between the initial protection provided by the bound charges and the steady state protection provided by the free charges. The electric fields within the biological fluid are thus small for all times just as they would be inside a classical Faraday cage.

  19. Carbon Mineralization Using Phosphate and Silicate Ions

    NASA Astrophysics Data System (ADS)

    Gokturk, H.

    2013-12-01

    Carbon dioxide (CO2) reduction from combustion of fossil fuels has become an urgent concern for the society due to marked increase in weather related natural disasters and other negative consequences of global warming. CO2 is a highly stable molecule which does not readily interact with other neutral molecules. However it is more responsive to ions due to charge versus quadrupole interaction [1-2]. Ions can be created by dissolving a salt in water and then aerosolizing the solution. This approach gives CO2 molecules a chance to interact with the hydrated salt ions over the large surface area of the aerosol. Ion containing aerosols exist in nature, an example being sea spray particles generated by breaking waves. Such particles contain singly and doubly charged salt ions including Na+, Cl-, Mg++ and SO4--. Depending on the proximity of CO2 to the ion, interaction energy can be significantly higher than the thermal energy of the aerosol. For example, an interaction energy of 0.6 eV is obtained with the sulfate (SO4--) ion when CO2 is the nearest neighbor [2]. In this research interaction between CO2 and ions which carry higher charges are investigated. The molecules selected for the study are triply charged phosphate (PO4---) ions and quadruply charged silicate (SiO4----) ions. Examples of salts which contain such molecules are potassium phosphate (K3PO4) and sodium orthosilicate (Na4SiO4). The research has been carried out with first principle quantum mechanical calculations using the Density Functional Theory method with B3LYP functional and Pople type basis sets augmented with polarization and diffuse functions. Atomic models consist of the selected ions surrounded by water and CO2 molecules. Similar to the results obtained with singly and doubly charged ions [1-2], phosphate and silicate ions attract CO2 molecules. Energy of interaction between the ion and CO2 is 1.6 eV for the phosphate ion and 3.3 eV for the silicate ion. Hence one can expect that the selected ions would enhance the absorption of CO2 into the aerosol even more than the singly or doubly charged ions. Ion containing aerosols also help to catalyze reactions between water and CO2. Hydrated phosphate and silicate ions tend to attract hydrogen atoms from neighboring water molecules to reduce the charged state. When there is CO2 in the vicinity of the ion, the remainder of the water molecule which loses the hydrogen(s) reacts with CO2 to form carbonates. (PO4---) + H2O + CO2 -> (HPO3--) + (HCO3-) (SiO4----) + H2O + CO2 -> (HSiO4---) + (HCO3-) (SiO4----) + H2O + CO2 -> (H2SiO4--) + (CO3--) In conclusion, highly charged phosphate and silicate ions dissolved in water and aerosolized into small droplets can facilitate both the capture and the mineralization of CO2. This method would be especially effective in a CO2 rich environment such as the exhaust gas of a combustion process. [1] H. Gokturk, "Geoengineering with Charged Droplets," AGU Fall Meeting, San Francisco 2011 [2] H. Gokturk, "Atomistic Simulation of Sea Spray Particles," AGU Fall Meeting, San Francisco 2012

  20. T-Shaped Indan-1,3-dione derivatives as promising electron donors for bulk heterojunction small molecule solar cell

    NASA Astrophysics Data System (ADS)

    Adhikari, Tham; Solanke, Parmeshwar; Pathak, Dinesh; Wagner, Tomas; Bureš, Filip; Reed, Tyler; Nunzi, Jean-Michel

    2017-07-01

    We report on the photovoltaic performance of novel T-Shaped Indan-1,3-dione derivatives as donors in a solution processed bulk heterojunction solar cells. Small molecule bulk heterojunction solar cells of these molecules with [6,6]-phenyl-C61-butyric acid methyl ester (PC61BM) were fabricated and characterized. The preliminary characterization of these devices yielded a PCE of 0.24% and 0.33% for two separate derivatives. These low power conversion efficiencies were attributed to a high surface roughness with a large number of dewetting spots. Doping with 10% Polystyrene in the Indan-1,3-dione derivatives decreases surface roughness and dewetting spots thereby improving the efficiency of the devices. Efficiency of the devices was found as 0.39% and 0.51% for two derivatives after doping with polystyrene. The charge transfer mechanism was studied with photoluminescence quenching. The morphology and packing behavior of molecules were further studied using Atomic Force Microscopy (AFM) and X-ray diffraction (XRD).

  1. Photogenerated Intrinsic Free Carriers in Small-molecule Organic Semiconductors Visualized by Ultrafast Spectroscopy

    PubMed Central

    He, Xiaochuan; Zhu, Gangbei; Yang, Jianbing; Chang, Hao; Meng, Qingyu; Zhao, Hongwu; Zhou, Xin; Yue, Shuai; Wang, Zhuan; Shi, Jinan; Gu, Lin; Yan, Donghang; Weng, Yuxiang

    2015-01-01

    Confirmation of direct photogeneration of intrinsic delocalized free carriers in small-molecule organic semiconductors has been a long-sought but unsolved issue, which is of fundamental significance to its application in photo-electric devices. Although the excitonic description of photoexcitation in these materials has been widely accepted, this concept is challenged by recently reported phenomena. Here we report observation of direct delocalized free carrier generation upon interband photoexcitation in highly crystalline zinc phthalocyanine films prepared by the weak epitaxy growth method using ultrafast spectroscopy. Transient absorption spectra spanning the visible to mid-infrared region revealed the existence of short-lived free electrons and holes with a diffusion length estimated to cross at least 11 molecules along the π−π stacking direction that subsequently localize to form charge transfer excitons. The interband transition was evidenced by ultraviolet-visible absorption, photoluminescence and electroluminescence spectroscopy. Our results suggest that delocalized free carriers photogeneration can also be achieved in organic semiconductors when the molecules are packed properly. PMID:26611323

  2. Prodrugs of phosphonates and phosphates: crossing the membrane barrier

    PubMed Central

    Wiemer, Andrew J.; Wiemer, David F.

    2016-01-01

    A substantial portion of metabolism involves transformation of phosphate esters, including pathways leading to nucleotides and oligonucleotides, carbohydrates, isoprenoids and steroids, and phosphorylated proteins. Because the natural substrates bear one or more negative charges, drugs that target these enzymes generally must be charged as well but small charged molecules can have difficulty traversing the cell membrane other than by endocytosis. The resulting dichotomy has stimulated abundant effort to develop effective prodrugs, compounds that carry little or no charge to enable them to transit biological membranes but then able to release the parent drug once inside the target cell. This chapter will present recent studies on advances in prodrug forms, along with representative examples of their application to marketed and developmental drugs. PMID:25391982

  3. Graphane versus graphene: a computational investigation of the interaction of nucleobases, aminoacids, heterocycles, small molecules (CO2, H2O, NH3, CH4, H2), metal ions and onium ions.

    PubMed

    Umadevi, Deivasigamani; Narahari Sastry, G

    2015-11-11

    Graphane has emerged as a two-dimensional hydrocarbon with interesting physical properties and potential applications. Understanding the interaction of graphane with various molecules and ions is crucial to appreciate its potential applications. We investigated the interaction of nucleobases, aminoacids, saturated and unsaturated heterocycles, small molecules, metal ions and onium ions with graphane by using density functional theory calculations. The preferred orientations of these molecules and ions on the graphane surface have been analysed. The binding energies of graphane with these molecules have been compared with the corresponding binding energies of graphene. Our results reveal that graphane forms stable complexes with all the molecules and ions yet showing lesser binding affinity when compared to graphene. As an exemption, the preferential strong binding of H2O with graphane than graphene reveals the fact that graphane is more hydrophilic than graphene. Charge transfer between graphane and the molecules and ions have been found to be an important factor in determining the binding strength of the complexes. The effect of the interaction of these molecules and ions on the HOMO-LUMO energy gap of graphane has also been investigated.

  4. Free energy of RNA-counterion interactions in a tight-binding model computed by a discrete space mapping

    NASA Astrophysics Data System (ADS)

    Henke, Paul S.; Mak, Chi H.

    2014-08-01

    The thermodynamic stability of a folded RNA is intricately tied to the counterions and the free energy of this interaction must be accounted for in any realistic RNA simulations. Extending a tight-binding model published previously, in this paper we investigate the fundamental structure of charges arising from the interaction between small functional RNA molecules and divalent ions such as Mg2+ that are especially conducive to stabilizing folded conformations. The characteristic nature of these charges is utilized to construct a discretely connected energy landscape that is then traversed via a novel application of a deterministic graph search technique. This search method can be incorporated into larger simulations of small RNA molecules and provides a fast and accurate way to calculate the free energy arising from the interactions between an RNA and divalent counterions. The utility of this algorithm is demonstrated within a fully atomistic Monte Carlo simulation of the P4-P6 domain of the Tetrahymena group I intron, in which it is shown that the counterion-mediated free energy conclusively directs folding into a compact structure.

  5. The effects of electric fields on charged molecules and particles in individual microenvironments

    NASA Astrophysics Data System (ADS)

    Jamieson, K. S.; ApSimon, H. M.; Jamieson, S. S.; Bell, J. N. B.; Yost, M. G.

    Measurements of small air ion concentrations, electrostatic potential and AC electric field strengths were taken in an office setting to investigate the link between electric fields and charged molecule and particle concentrations in individual microenvironments. The results obtained indicate that the electromagnetic environments individuals can be exposed to whilst indoors can often bear little resemblance to those experienced outdoors in nature, and that many individuals may spend large periods of their time in "Faraday cage"-like conditions exposed to inappropriate levels and types of electric fields that can reduce localised concentrations of biologically essential and microbiocidal small air ions. Such conditions may escalate their risk of infection from airborne contaminants, including microbes, whilst increasing localised surface contamination. The degree of "electro-pollution" that individuals are exposed to was shown to be influenced by the type of microenvironment they occupy, with it being possible for very different types of microenvironment to exist within the same room. It is suggested that adopting suitable electromagnetic hygiene/productivity guidelines that seek to replicate the beneficial effects created by natural environments may greatly mitigate such problems.

  6. Free energy of RNA-counterion interactions in a tight-binding model computed by a discrete space mapping.

    PubMed

    Henke, Paul S; Mak, Chi H

    2014-08-14

    The thermodynamic stability of a folded RNA is intricately tied to the counterions and the free energy of this interaction must be accounted for in any realistic RNA simulations. Extending a tight-binding model published previously, in this paper we investigate the fundamental structure of charges arising from the interaction between small functional RNA molecules and divalent ions such as Mg(2+) that are especially conducive to stabilizing folded conformations. The characteristic nature of these charges is utilized to construct a discretely connected energy landscape that is then traversed via a novel application of a deterministic graph search technique. This search method can be incorporated into larger simulations of small RNA molecules and provides a fast and accurate way to calculate the free energy arising from the interactions between an RNA and divalent counterions. The utility of this algorithm is demonstrated within a fully atomistic Monte Carlo simulation of the P4-P6 domain of the Tetrahymena group I intron, in which it is shown that the counterion-mediated free energy conclusively directs folding into a compact structure.

  7. Fragmentation of neutral amino acids and small peptides by intense, femtosecond laser pulses.

    PubMed

    Duffy, Martin J; Kelly, Orla; Calvert, Christopher R; King, Raymond B; Belshaw, Louise; Kelly, Thomas J; Costello, John T; Timson, David J; Bryan, William A; Kierspel, Thomas; Turcu, I C Edmond; Cacho, Cephise M; Springate, Emma; Williams, Ian D; Greenwood, Jason B

    2013-09-01

    High power femtosecond laser pulses have unique properties that could lead to their application as ionization or activation sources in mass spectrometry. By concentrating many photons into pulse lengths approaching the timescales associated with atomic motion, very strong electric field strengths are generated, which can efficiently ionize and fragment molecules without the need for resonant absorption. However, the complex interaction between these pulses and biomolecular species is not well understood. To address this issue, we have studied the interaction of intense, femtosecond pulses with a number of amino acids and small peptides. Unlike previous studies, we have used neutral forms of these molecular targets, which allowed us to investigate dissociation of radical cations without the spectra being complicated by the action of mobile protons. We found fragmentation was dominated by fast, radical-initiated dissociation close to the charge site generated by the initial ionization or from subsequent ultrafast migration of this charge. Fragments with lower yields, which are useful for structural determinations, were also observed and attributed to radical migration caused by hydrogen atom transfer within the molecule.

  8. Heparin-based hydrogels with tunable sulfation & degradation for anti-inflammatory small molecule delivery.

    PubMed

    Peng, Yifeng; Tellier, Liane E; Temenoff, Johnna S

    2016-08-16

    Sustained release of anti-inflammatory agents remains challenging for small molecule drugs due to their low molecular weight and hydrophobicity. Therefore, the goal of this study was to control the release of a small molecule anti-inflammatory agent, crystal violet (CV), from hydrogels fabricated with heparin, a highly sulfated glycosaminoglycan capable of binding positively-charged molecules such as CV. In this system, both electrostatic interactions between heparin and CV and hydrogel degradation were tuned simultaneously by varying the level of heparin sulfation and varying the amount of dithiothreitol within hydrogels, respectively. It was found that heparin sulfation significantly affected CV release, whereby more sulfated heparin hydrogels (Hep and Hep(-N)) released CV with near zero-order release kinetics (R-squared values between 0.96-0.99). Furthermore, CV was released more quickly from fast-degrading hydrogels than slow-degrading hydrogels, providing a method to tune total CV release between 5-15 days while maintaining linear release kinetics. In particular, N-desulfated heparin hydrogels exhibited efficient CV loading (∼90% of originally included CV), near zero-order CV release kinetics, and maintenance of CV bioactivity after release, making this hydrogel formulation a promising CV delivery vehicle for a wide range of inflammatory diseases.

  9. “Roller-Wheel”-Type Pt-Containing Small Molecules and the Impact of “Rollers” on Material Crystallinity, Electronic Properties, and Solar Cell Performance

    DOE PAGES

    He, Wenhan; Livshits, Maksim Y.; Dickie, Diane A.; ...

    2017-07-21

    We report the synthesis, characterization, and detailed comparison of a series of novel Pt-bisacetylide containing conjugated small molecules possessing an unconventional “roller-wheel” shaped structure that is distinctly different from the “dumbbell” designs in traditional Pt-bisacetylide containing conjugated polymers and small molecules. The relationships between the chemical nature and length of the “rollers” and the electronic and physical properties of the materials are carefully studied by steady-state spectroscopy, cyclic voltammetry, differential scanning calorimetry, single-crystal X-ray diffraction, transient absorption spectroscopy, theoretical calculation, and device application. It was revealed that if the roller are long enough, these molecules can “slip-stack” in the solidmore » state, leading to high crystallinity and charge mobility. Organic solar cells were fabricated and showed power conversion efficiencies up to 5.9%, out-performing all existing Pt-containing materials. The device performance was also found to be sensitive to optimization conditions and blend morphologies, which are a result of the intricate interplay among materials crystallinity, phase separation, and the relative positions of the lowest singlet and triplet excited states.« less

  10. “Roller-Wheel”-Type Pt-Containing Small Molecules and the Impact of “Rollers” on Material Crystallinity, Electronic Properties, and Solar Cell Performance

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    He, Wenhan; Livshits, Maksim Y.; Dickie, Diane A.

    We report the synthesis, characterization, and detailed comparison of a series of novel Pt-bisacetylide containing conjugated small molecules possessing an unconventional “roller-wheel” shaped structure that is distinctly different from the “dumbbell” designs in traditional Pt-bisacetylide containing conjugated polymers and small molecules. The relationships between the chemical nature and length of the “rollers” and the electronic and physical properties of the materials are carefully studied by steady-state spectroscopy, cyclic voltammetry, differential scanning calorimetry, single-crystal X-ray diffraction, transient absorption spectroscopy, theoretical calculation, and device application. It was revealed that if the roller are long enough, these molecules can “slip-stack” in the solidmore » state, leading to high crystallinity and charge mobility. Organic solar cells were fabricated and showed power conversion efficiencies up to 5.9%, out-performing all existing Pt-containing materials. The device performance was also found to be sensitive to optimization conditions and blend morphologies, which are a result of the intricate interplay among materials crystallinity, phase separation, and the relative positions of the lowest singlet and triplet excited states.« less

  11. Thermal-energy reactions of O2(2+) ions with O2, N2, CO2, NO, and Ne

    NASA Technical Reports Server (NTRS)

    Chatterjee, B. K.; Johnson, R.

    1989-01-01

    The paper presents results of drift-tube mass-spectrometer studies of the reactivity of doubly charged molecular oxygen ions with several molecules and neon atoms. Thermal-energ rate coefficients for the reactions with the molecular reactants were found to be large, close to the limiting Langevin rates. Charge transfer with neon atoms was observed, but the measured rate coefficient was only a small fraction of the Langevin rate. It is concluded that the measured rate constants for the reactions considereed refer to vibrationally excited ions.

  12. Energy and charge transfer dynamics between Alq3 and CdSeS nanocrystals.

    PubMed

    Zhang, Shuping; Liu, Yuqiang; Yang, Yanqiang

    2010-03-01

    The photoluminescence properties of the blend films consisting of organic small molecules and nanocrystals (NCs)--Alq3 and CdSeS NCs--were studied by steady-state and time-resolved photoluminescence (PL) spectroscopy with different excited wavelengths. Both the fluorescence intensity and lifetime are intensively dependent on the NC concentration. The detailed analysis of experiment data proves that Forster energy transfer from the Alq3 to the NCs exists simultaneously with the charge transfer and both compete with each other in the blend films.

  13. Targeting of small molecule anticancer drugs to the tumour and its vasculature using cationic liposomes: lessons from gene therapy

    PubMed Central

    Dass, Crispin R; Choong, Peter FM

    2006-01-01

    Cationic (positively charged) liposomes have been tested in various gene therapy clinical trials for neoplastic and other diseases. They have demonstrated selectivity for tumour vascular endothelial cells raising hopes for both antiangiogenic and antivascular therapies. They are also capable of being selectively delivered to the lungs and liver when administered intravenously. These vesicles are being targeted to the tumour in various parts of the body by using advanced liposomal systems such as ligand-receptor and antibody-antigen combinations. At present, the transferrin receptor is commonly used for cancer-targeted drug delivery systems including cationic liposomes. This review looks at the growing utility of these vesicles for delivery of small molecule anticancer drugs. PMID:16792817

  14. High open-circuit voltage small-molecule p-DTS(FBTTh 2 ) 2.ICBA bulk heterojunction solar cells – morphology, excited-state dynamics, and photovoltaic performance

    DOE PAGES

    Ko Kyaw, Aung Ko; Gehrig, Dominik; Zhang, Jie; ...

    2014-11-27

    The photovoltaic performance of bulk heterojunction solar cells using the solution-processable small molecule donor 7,7'-(4,4-bis(2-ethylhexyl)-4H-silolo[3,2-b:4,5-b']dithiophene-2,6-diyl)bis(6-fluoro-4-(5'-hexyl-[2,2'-bithiophene]-5-yl)benzo[c][1,2,5]thiadiazole) (p-DTS(FBTTh 2) 2 in combination with indene-C60 bis-adduct (ICBA) as an acceptor is systematically optimized by altering the processing conditions. A high open-circuit voltage of 1 V, more than 0.2 V higher than that of a p-DTS(FBTTh 2) 2:PC 70BM blend, is achieved. However, the power conversion efficiency remains around 5% and thus is lower than ~8% previously reported for p-DTS(FBTTh 2) 2:PC 70BM. Transient absorption (TA) pump–probe spectroscopy over a wide spectral (Vis-NIR) and dynamic (fs to μs) range in combination with multivariate curvemore » resolution analysis of the TA data reveals that generation of free charges is more efficient in the blend with PC 70BM as an acceptor. In contrast, blends with ICBA create more coulombically bound interfacial charge transfer (CT) states, which recombine on the sub-nanosecond timescale by geminate recombination. Furthermore, the ns to μs charge carrier dynamics in p-DTS(FBTTh 2) 2:ICBA blends are only weakly intensity dependent implying a significant contribution of recombination from long-lived CT states and trapped charges, while those in p-DTS(FBTTh 2) 2:PC 70BM decay via an intensity-dependent recombination mechanism indicating that spatially separated (free) charge carriers are observed, which can be extracted as photocurrent from the device.« less

  15. Cell and Particle Interactions and Aggregation During Electrophoretic Motion

    NASA Technical Reports Server (NTRS)

    Davis, Robert H.

    2000-01-01

    The objectives of this research were (i) to perform experiments for observing and quantifying electrophoretic aggregation, (ii) to develop a theoretical description to appropriately analyze and compare with the experimental results, (iii) to study the combined effects of electrophoretic and gravitational aggregation of large particles, and the combined effects of electrophoretic and Brownian aggregation of small particles, and (iv) to perform a preliminary design of a potential future flight experiment involving electrophoretic aggregation. Electrophoresis refers to the motion of charged particles, droplets or molecules in response to an applied electric field. Electrophoresis is commonly used for analysis and separation of biological particles or molecules. When particles have different surface charge densities or potentials, they will migrate at different velocities in an electric field. This differential migration leads to the possibility that they will collide and aggregate, thereby preventing separation.

  16. Co-existence of monomers and clusters in concentrated protein solutions

    NASA Astrophysics Data System (ADS)

    Chinchalikar, Akshay J.; Kumar, Sugam; Aswal, V. K.; Callow, P.; Wagh, A. G.

    2012-06-01

    Small-angle neutron scattering (SANS) measurements have been performed on concentrated protein solutions in order to study aggregation of lysozyme molecules at different pH. The variation of correlation peak in concentration (C) dependent SANS data shows deviation from C1/3 behavior suggesting the aggregation phenomena in these systems. The aggregates or clusters coexist along with monomers with cluster fraction proportional to protein concentration. The clustering is also favored at higher pH approaching isoelectric point (pI) because of decrease in charge on the protein molecule.

  17. Toward an alternative hardness kernel matrix structure in the Electronegativity Equalization Method (EEM).

    PubMed

    Chaves, J; Barroso, J M; Bultinck, P; Carbó-Dorca, R

    2006-01-01

    This study presents an alternative of the Electronegativity Equalization Method (EEM), where the usual Coulomb kernel has been transformed into a smooth function. The new framework, as the classical EEM, permits fast calculations of atomic charges in a given molecule for a small computational cost. The original EEM procedure needs to previously calibrate the different implied atomic hardness and electronegativity, using a chosen set of molecules. In the new EEM algorithm half the number of parameters needs to be calibrated, since a relationship between electronegativities and hardnesses has been found.

  18. Extracting Aggregation Free Energies of Mixed Clusters from Simulations of Small Systems: Application to Ionic Surfactant Micelles.

    PubMed

    Zhang, X; Patel, L A; Beckwith, O; Schneider, R; Weeden, C J; Kindt, J T

    2017-11-14

    Micelle cluster distributions from molecular dynamics simulations of a solvent-free coarse-grained model of sodium octyl sulfate (SOS) were analyzed using an improved method to extract equilibrium association constants from small-system simulations containing one or two micelle clusters at equilibrium with free surfactants and counterions. The statistical-thermodynamic and mathematical foundations of this partition-enabled analysis of cluster histograms (PEACH) approach are presented. A dramatic reduction in computational time for analysis was achieved through a strategy similar to the selector variable method to circumvent the need for exhaustive enumeration of the possible partitions of surfactants and counterions into clusters. Using statistics from a set of small-system (up to 60 SOS molecules) simulations as input, equilibrium association constants for micelle clusters were obtained as a function of both number of surfactants and number of associated counterions through a global fitting procedure. The resulting free energies were able to accurately predict micelle size and charge distributions in a large (560 molecule) system. The evolution of micelle size and charge with SOS concentration as predicted by the PEACH-derived free energies and by a phenomenological four-parameter model fit, along with the sensitivity of these predictions to variations in cluster definitions, are analyzed and discussed.

  19. Molecules Without Atoms

    NASA Astrophysics Data System (ADS)

    Ruth, Anthony; Collins, Laura; Gomes, Kenjiro; Janko, Boldizsar

    We present a real-space representation of molecules which results in the normal bonding rules and electronic structure of chemistry without atom-centered coulomb potentials. Using a simple mapping, we can generate atomless molecules from the structure of real molecules. Additionally, molecules without atoms show similar covalent bonding energies and transfer of charge in ionic bonds as real molecules. The atomless molecules contain only the valence and conduction electronic structure of the real molecule. Using the framework of the Atoms in Molecules (AIM) theory of Bader, we prove that the topological features of the valence charge distribution of molecules without atoms are identical to that of real molecules. In particular, the charge basins of atomless molecules show identical location and quantities of representative charge. We compare the accuracy, computational cost, and intuition gained from electronic structure calculations of molecules without atoms with the use of pseudopotentials to represent atomic cores in density functional theory. A. R. acknowledges support from a NASA Space Technology Research Fellowship.

  20. Micro injector sample delivery system for charged molecules

    DOEpatents

    Davidson, James C.; Balch, Joseph W.

    1999-11-09

    A micro injector sample delivery system for charged molecules. The injector is used for collecting and delivering controlled amounts of charged molecule samples for subsequent analysis. The injector delivery system can be scaled to large numbers (>96) for sample delivery to massively parallel high throughput analysis systems. The essence of the injector system is an electric field controllable loading tip including a section of porous material. By applying the appropriate polarity bias potential to the injector tip, charged molecules will migrate into porous material, and by reversing the polarity bias potential the molecules are ejected or forced away from the tip. The invention has application for uptake of charged biological molecules (e.g. proteins, nucleic acids, polymers, etc.) for delivery to analytical systems, and can be used in automated sample delivery systems.

  1. Coulomb Fission in Multiply-Charged Ammonia Clusters: Accurate Measurements of the Rayleigh Instability Limit from Fragmentation Patterns.

    PubMed

    Harris, Christopher; Stace, Anthony J

    2018-03-15

    A series of experiments have been undertaken on the fragmentation of multiply charged ammonia clusters, (NH 3 ) n z+ , where z ≤ 8 and n ≤ 850, to establish Rayleigh instability limits, whereby clusters at certain critical sizes become unstable due to Coulomb repulsion between the resident charges. Experimental results on size-selected clusters are found to be in excellent agreement with theoretical predictions of Rayleigh instability limits at all values of the charge. Electrostatic theory has been used to help identify fragmentation patterns on the assumption that the clusters separate into two dielectric spheres, and the predicted Coulomb repulsion energies used to establish pathways and the sizes of cluster fragments. The results show that fragmentation is very asymmetric in terms of both the numbers of molecules involved and the amount of charge each fragment accommodates. For clusters carrying a charge ≤+4, the results show that fragmentation proceeds via the loss of small, singly charged clusters. When clusters carry a charge of +5 or more, the experimental observations suggest a marked switch in behavior. Although the laboratory measurements equate to fragmentation via the loss of a large dication cluster, electrostatic theory supports an interpretation that involves the sequential loss of two smaller, singly charged clusters possibly accompanied by the extensive evaporation of neutral molecules. It is suggested that this change in fragmentation pattern is driven by the channelling of Coulomb repulsion energy into intermolecular modes within these larger clusters. Overall, the results appear to support the ion evaporation model that is frequently used to interpret electrospray experiments.

  2. Multiply Reduced Oligofluorenes: Their Nature and Pairing with THF-Solvated Sodium Ions

    DOE PAGES

    Wu, Qin; Zaikowski, Lori; Kaur, Parmeet; ...

    2016-07-01

    Conjugated oligofluorenes are chemically reduced up to five charges in tetrahydrofuran solvent and confirmed with clear spectroscopic evidence. Stimulated by these experimental results, we have conducted a comprehensive computational study of the electronic structure and the solvation structure of representative oligofluorene anions with a focus on the pairing between sodium ions and these multianions. In addition, using density functional theory (DFT) methods and a solvation model of both explicit solvent molecules and implicit polarizable continuum, we first elucidate the structure of tightly solvated free sodium ions, and then explore the pairing of sodium ions either in contact with reduced oligofluorenesmore » or as solvent-separated ion pairs. Computed time-dependent-DFT absorption spectra are compared with experiments to assign the dominant ion pairing structure for each multianion. Computed ion pair binding energies further support our assignment. Lastly, the availability of different length and reducing level of oligofluorenes enables us to investigate the effects of total charge and charge density on the binding with sodium ions, and our results suggest both factors play important roles in ion pairing for small molecules. However, as the oligofluorene size grows, its charge density determines the binding strength with the sodium ion.« less

  3. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wu, Qin; Zaikowski, Lori; Kaur, Parmeet

    Conjugated oligofluorenes are chemically reduced up to five charges in tetrahydrofuran solvent and confirmed with clear spectroscopic evidence. Stimulated by these experimental results, we have conducted a comprehensive computational study of the electronic structure and the solvation structure of representative oligofluorene anions with a focus on the pairing between sodium ions and these multianions. In addition, using density functional theory (DFT) methods and a solvation model of both explicit solvent molecules and implicit polarizable continuum, we first elucidate the structure of tightly solvated free sodium ions, and then explore the pairing of sodium ions either in contact with reduced oligofluorenesmore » or as solvent-separated ion pairs. Computed time-dependent-DFT absorption spectra are compared with experiments to assign the dominant ion pairing structure for each multianion. Computed ion pair binding energies further support our assignment. Lastly, the availability of different length and reducing level of oligofluorenes enables us to investigate the effects of total charge and charge density on the binding with sodium ions, and our results suggest both factors play important roles in ion pairing for small molecules. However, as the oligofluorene size grows, its charge density determines the binding strength with the sodium ion.« less

  4. Exciplex: An Intermolecular Charge-Transfer Approach for TADF.

    PubMed

    Sarma, Monima; Wong, Ken-Tsung

    2018-04-03

    Organic materials that display thermally activated delayed fluorescence (TADF) are a striking class of functional materials that have witnessed a booming progress in recent years. In addition to pure TADF emitters achieved by the subtle manipulations of intramolecular charge transfer processes with sophisticated molecular structures, a new class of efficient TADF-based OLEDs with emitting layer formed by blending electron donor and acceptor molecules that involve intermolecular charge transfer have also been fabricated. In contrast to pure TADF materials, the exciplex-based systems can realize small ΔEST (0-0.05 eV) much more easily since the electron and hole are positioned on two different molecules, thereby giving small exchange energy. Consequently, exciplex-based OLEDs have the prospective to maximize the TADF contribution and achieve theoretical 100% internal quantum efficiency. Therefore, the challenging issue of achieving small ΔEST in organic systems could be solved. In this article, we summarize and discuss the latest and most significant developments regarding these rapidly evolving functional materials, wherein the majority of the reported exciplex forming systems are categorized into two sub-groups, viz. (a) exciplex as TADF emitters and (b) those as hosts for fluorescent, phosphorescent and TADF dopants according to their structural features and applications. The working mechanisms of the direct electroluminescence from the donor/acceptor interface and the exciplex-forming systems as co-host for the realization of high efficiency OLEDs are reviewed and discussed. This article delivers a summary of the current progresses and achievements of exciplex-based researches and points out the future challenges to trigger more research endeavors to this growing field.

  5. Effects of electrostatic screening on the conformation of single DNA molecules confined in a nanochannel

    NASA Astrophysics Data System (ADS)

    Zhang, Ce; Zhang, Fang; van Kan, Jeroen A.; van der Maarel, Johan R. C.

    2008-06-01

    Single T4-DNA molecules were confined in rectangular-shaped channels with a depth of 300 nm and a width in the range of 150-300 nm casted in a poly(dimethylsiloxane) nanofluidic chip. The extensions of the DNA molecules were measured with fluorescence microscopy as a function of the ionic strength and composition of the buffer as well as the DNA intercalation level by the YOYO-1 dye. The data were interpreted with the scaling theory for a wormlike polymer in good solvent, including the effects of confinement, charge, and self-avoidance. It was found that the elongation of the DNA molecules with decreasing ionic strength can be interpreted in terms of an increase of the persistence length. Self-avoidance effects on the extension are moderate, due to the small correlation length imposed by the channel cross-sectional diameter. Intercalation of the dye results in an increase of the DNA contour length and a partial neutralization of the DNA charge, but besides effects of electrostatic origin it has no significant effect on the bare bending rigidity. In the presence of divalent cations, the DNA molecules were observed to contract, but they do not collapse into a condensed structure. It is proposed that this contraction results from a divalent counterion mediated attractive force between the segments of the DNA molecule.

  6. Chemical Control of Charge Trapping and Charge Transfer Processes at the Organic-Inorganic Interface within Quantum Dot-Organic Complexes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Weiss, Emily A.

    Within the research program funded through the Early Career Research Award we designed complexes of colloidal semiconductor quantum dots (QDs) and organic molecules in which the interfacial chemistry controls the electronic structure and dynamics of the excitonic state of the QD. The program included two main projects; (1) investigation of the mechanisms by which organic surfactants control the quantum confinement of excitonic charge carriers; and (2) development of models for electron transfer between QDs and adsorbed molecules as a function of interfacial chemistry. This project was extremely successful in that our achievements in those two areas addressed the great majoritymore » of questions we outlined in the original proposal and answered questions I did not think to ask in that original proposal. Our work led to the discovery of “exciton delocalizing ligands”, which change the electronic structure of colloidal semiconductor nanocrystals by altering, with small synthetic modifications to their surfaces, their most defining characteristic – the quantum confinement of their excited states. It also led to detailed, quantitative descriptions of how the surface chemistry of a QD dictates, thermodynamically and kinetically, the probability of exchange of electrons between the QD and a small molecule. We used two of the three major techniques in the proposal (transient photoluminescence and transient absorption). Electrogenerated chemiluminescence was also proposed, but was too technically difficult with these systems to be useful. Instead, NMR spectroscopy emerged as a major analytical tool in our studies. With the fundamental advancements we made with this project, we believe that we can design QDs to be the next great class of visible-light photocatalysts.« less

  7. Imaging prototypical aromatic molecules on insulating surfaces: a review

    NASA Astrophysics Data System (ADS)

    Hoffmann-Vogel, R.

    2018-01-01

    Insulating substrates allow for in-plane contacted molecular electronics devices where the molecule is in contact with the insulator. For the development of such devices it is important to understand the interaction of molecules with insulating surfaces. As substrates, ionic crystals such as KBr, KCl, NaCl and CaF2 are discussed. The surface energies of these substrates are small and as a consequence intrinsic properties of the molecules, such as molecule–molecule interaction, become more important relative to interactions with the substrates. As prototypical molecules, three variants of graphene-related molecules are used, pentacene, C60 and PTCDA. Pentacene is a good candidate for molecular electronics applications due to its high charge carrier mobility. It shows mainly an upright standing growth mode and the morphology of the islands is strongly influenced by dewetting. A new second flat-lying phase of the molecule has been observed. Studying the local work function using the Kelvin method reveals details such as line defects in the center of islands. The local work function differences between the upright-standing and flat-lying phase can only be explained by charge transfer that is unusual on ionic crystalline surfaces. C60 nucleation and growth is explained by loosely bound molecules at kink sites as nucleation sites. The stability of C60 islands as a function of magic numbers is investigated. Peculiar island shapes are obtained from unusual dewetting processes already at work during growth, where molecules ‘climb’ to the second molecular layer. PTCDA is a prototypical semiconducting molecule with strong quadrupole moment. It grows in the form of elongated islands where the top and the facets can be molecularly resolved. In this way the precise molecular arrangement in the islands is revealed.

  8. Nanopore Device for Reversible Ion and Molecule Sensing or Migration

    NASA Technical Reports Server (NTRS)

    Seger, R. Adam (Inventor); Pourmand, Nader (Inventor); Actis, Paolo (Inventor); Singaram, Bakthan (Inventor); Vilozny, Boaz (Inventor)

    2015-01-01

    Disclosed are methods and devices for detection of ion migration and binding, utilizing a nanopipette adapted for use in an electrochemical sensing circuit. The nanopipette may be functionalized on its interior bore with metal chelators for binding and sensing metal ions or other specific binding molecules such as boronic acid for binding and sensing glucose. Such a functionalized nanopipette is comprised in an electrical sensor that detects when the nanopipette selectively and reversibly binds ions or small molecules. Also disclosed is a nanoreactor, comprising a nanopipette, for controlling precipitation in aqueous solutions by voltage-directed ion migration, wherein ions may be directed out of the interior bore by a repulsing charge in the bore.

  9. High-mobility strained organic semiconductors (Conference Presentation)

    NASA Astrophysics Data System (ADS)

    Takeya, Jun; Matsui, H.; Kubo, T.; Hausermann, Roger

    2016-11-01

    Small molecular organic semiconductor crystals form interesting electronic systems of periodically arranged "charge clouds" whose mutual electronic coupling determines whether or not electronic states can be coherent over fluctuating molecules. This presentation focuses on two methods to reduce molecular fluctuation, which strongly restricts mobility of highly mobile charge in single-crystal organic transistors. The first example is to apply external hydrostatic pressure. Using Hall-effect measurement for pentacene FETs, which tells us the extent of the electronic coherence, we found a crossover from hopping-like transport of nearly localized charge to band transport of delocalized charge with full coherence. As the result of temperature dependence measurement, it turned out that reduced molecular fluctuation is mainly responsible for the crossover. The second is to apply uniaxial strain to single-crystal organic FETs. We applied stain by bending thin films of newly synthesized decyldinaphthobenzodithiophene (C10-DNBDT) on plastic substrate so that 3% strain is uniaxially applied. As the result, the room-temperature mobility increased by the factor of 1.7. In-depth analysis using X-ray diffraction (XRD) measurements and density functional theory (DFT) calculations reveal the origin to be the suppression of the thermal fluctuation of the individual molecules, which is confirmed by temperature dependent measurements. Our findings show that compressing the crystal structure directly restricts the vibration of the molecules, thus suppressing dynamic disorder, a unique mechanism in organic semiconductors. Since strain can easily be induced during the fabrication process, these findings can directly be exploited to build high performance organic devices.

  10. Optimal charges in lead progression: a structure-based neuraminidase case study.

    PubMed

    Armstrong, Kathryn A; Tidor, Bruce; Cheng, Alan C

    2006-04-20

    Collective experience in structure-based lead progression has found electrostatic interactions to be more difficult to optimize than shape-based ones. A major reason for this is that the net electrostatic contribution observed includes a significant nonintuitive desolvation component in addition to the more intuitive intermolecular interaction component. To investigate whether knowledge of the ligand optimal charge distribution can facilitate more intuitive design of electrostatic interactions, we took a series of small-molecule influenza neuraminidase inhibitors with known protein cocrystal structures and calculated the difference between the optimal and actual charge distributions. This difference from the electrostatic optimum correlates with the calculated electrostatic contribution to binding (r(2) = 0.94) despite small changes in binding modes caused by chemical substitutions, suggesting that the optimal charge distribution is a useful design goal. Furthermore, detailed suggestions for chemical modification generated by this approach are in many cases consistent with observed improvements in binding affinity, and the method appears to be useful despite discrete chemical constraints. Taken together, these results suggest that charge optimization is useful in facilitating generation of compound ideas in lead optimization. Our results also provide insight into design of neuraminidase inhibitors.

  11. A comprehensive study of charge trapping in organic field-effect devices with promising semiconductors and different contact metals by displacement current measurements

    NASA Astrophysics Data System (ADS)

    Bisoyi, Sibani; Rödel, Reinhold; Zschieschang, Ute; Kang, Myeong Jin; Takimiya, Kazuo; Klauk, Hagen; Tiwari, Shree Prakash

    2016-02-01

    A systematic and comprehensive study on the charge-carrier injection and trapping behavior was performed using displacement current measurements in long-channel capacitors based on four promising small-molecule organic semiconductors (pentacene, DNTT, C10-DNTT and DPh-DNTT). In thin-film transistors, these semiconductors showed charge-carrier mobilities ranging from 1.0 to 7.8 cm2 V-1 s-1. The number of charges injected into and extracted from the semiconductor and the density of charges trapped in the device during each measurement were calculated from the displacement current characteristics and it was found that the density of trapped charges is very similar in all devices and of the order 1012 cm-2, despite the fact that the four semiconductors show significantly different charge-carrier mobilities. The choice of the contact metal (Au, Ag, Cu, Pd) was also found to have no significant effect on the trapping behavior.

  12. Whole-Cell-Based Assay To Evaluate Structure Permeation Relationships for Carbapenem Passage through the Pseudomonas aeruginosa Porin OprD.

    PubMed

    Iyer, Ramkumar; Sylvester, Mark A; Velez-Vega, Camilo; Tommasi, Ruben; Durand-Reville, Thomas F; Miller, Alita A

    2017-04-14

    The global emergence of antibiotic resistance, especially in Gram-negative bacteria, is an urgent threat to public health. Discovery of novel classes of antibiotics with activity against these pathogens has been impeded by a fundamental lack of understanding of the molecular drivers underlying small molecule uptake. Although it is well-known that outer membrane porins represent the main route of entry for small, hydrophilic molecules across the Gram-negative cell envelope, the structure-permeation relationship for porin passage has yet to be defined. To address this knowledge gap, we developed a sensitive and specific whole-cell approach in Escherichia coli called titrable outer membrane permeability assay system (TOMAS). We used TOMAS to characterize the structure porin-permeation relationships of a set of novel carbapenem analogues through the Pseudomonas aeruginosa porin OprD. Our results show that small structural modifications, especially the number and nature of charges and their position, have dramatic effects on the ability of these molecules to permeate cells through OprD. This is the first demonstration of a defined relationship between specific molecular changes in a substrate and permeation through an isolated porin. Understanding the molecular mechanisms that impact antibiotic transit through porins should provide valuable insights to antibacterial medicinal chemistry and may ultimately allow for the rational design of porin-mediated uptake of small molecules into Gram-negative bacteria.

  13. Directional charge separation in isolated organic semiconductor crystalline nanowires

    DOE PAGES

    Labastide, J. A.; Thompson, H. B.; Marques, S. R.; ...

    2016-02-25

    One of the fundamental design paradigms in organic photovoltaic device engineering is based on the idea that charge separation is an extrinsically driven process requiring an interface for exciton fission. This idea has driven an enormous materials science engineering effort focused on construction of domain sizes commensurate with a nominal exciton diffusion length of order 10 nm. Here, we show that polarized optical excitation of isolated pristine crystalline nanowires of a small molecule n-type organic semiconductor, 7,8,15,16-tetraazaterrylene, generates a significant population of charge-separated polaron pairs along the π-stacking direction. Charge separation was signalled by pronounced power-law photoluminescence decay polarized alongmore » the same axis. In the transverse direction, we observed exponential decay associated with excitons localized on individual monomers. We propose that this effect derives from an intrinsic directional charge-transfer interaction that can ultimately be programmed by molecular packing geometry.« less

  14. FTIR, FT-RAMAN, NMR, spectra, normal co-ordinate analysis, NBO, NLO and DFT calculation of N,N-diethyl-4-methylpiperazine-1-carboxamide molecule

    NASA Astrophysics Data System (ADS)

    Muthu, S.; Elamurugu Porchelvi, E.

    2013-11-01

    The Fourier Transform Infrared (FT-IR) and FT-Raman of N,N-diethyl-4-methylpiperazine-1-carboxamide (NND4MC) have been recorded and analyzed. The structure of the compound was optimized and the structural characteristics were determined by density functional theory (DFT) using B3LYP method with 6-31G(d,p) and 6-311G(d,p) basis sets. The difference between the observed and scaled wavenumber values of most of the fundamentals is very small. The theoretically predicted FT-IR and FT-Raman spectra of the title molecule have been constructed. The detailed interpretation of the vibrational spectra has been carried out with aid of normal coordinate analysis (NCA) following the scaled quantum mechanical force field methodology. Stability of the molecule arising from hyperconjugative interactions and charge delocalization has been analyzed using natural bond orbital (NBO) analysis. The results show that electron density (ED) in the σ* and π* antibonding orbitals and second order delocalization energies (E2) confirm the occurrence of intramolecular charge transfer (ICT) within the molecule. The electronic dipole moment (μD) and the first hyperpolarizability (βtot) values of the investigated molecule were computed using Density Functional Theory (DFT/B3LYP) with 6-31G(d,p) and 6-311G(d,p) basis sets. The calculated results also show that the NND4MC molecule may have microscopy nonlinear optical (NLO) behavior with non zero values. Mulliken atomic charges of NND4MC were calculated. The 13C nuclear magnetic resonance (NMR) chemical shifts of the molecule were calculated by the gauge independent atomic orbital (GIAO) method and compared with experimental results. The UV-Vis spectrum of the compound was recorded. The theoretical electronic absorption spectra have been calculated by using CIS, TD-DFT methods. A study on the electronic properties, such as HOMO and LUMO energies, molecular electrostatic potential (MEP) were also performed.

  15. Theoretical characterization of photoinduced electron transfer in rigidly linked donor-acceptor molecules: the fragment charge difference and the generalized Mulliken-Hush schemes

    NASA Astrophysics Data System (ADS)

    Lee, Sheng-Jui; Chen, Hung-Cheng; You, Zhi-Qiang; Liu, Kuan-Lin; Chow, Tahsin J.; Chen, I.-Chia; Hsu, Chao-Ping

    2010-10-01

    We calculate the electron transfer (ET) rates for a series of heptacyclo[6.6.0.02,6.03,13.014,11.05,9.010,14]-tetradecane (HCTD) linked donor-acceptor molecules. The electronic coupling factor was calculated by the fragment charge difference (FCD) [19] and the generalized Mulliken-Hush (GMH) schemes [20]. We found that the FCD is less prone to problems commonly seen in the GMH scheme, especially when the coupling values are small. For a 3-state case where the charge transfer (CT) state is coupled with two different locally excited (LE) states, we tested with the 3-state approach for the GMH scheme [30], and found that it works well with the FCD scheme. A simplified direct diagonalization based on Rust's 3-state scheme was also proposed and tested. This simplified scheme does not require a manual assignment of the states, and it yields coupling values that are largely similar to those from the full Rust's approach. The overall electron transfer (ET) coupling rates were also calculated.

  16. Luminescent systems based on the isolation of conjugated PI systems and edge charge compensation with polar molecules on a charged nanostructured surface

    DOEpatents

    Ivanov, Ilia N.; Puretzky, Alexander A.; Zhao, Bin; Geohegan, David B.; Styers-Barnett, David J.; Hu, Hui

    2014-07-15

    A photoluminescent or electroluminescent system and method of making a non-luminescent nanostructured material into such a luminescent system is presented. The method of preparing the luminescent system, generally, comprises the steps of modifying the surface of a nanostructured material to create isolated regions to act as luminescent centers and to create a charge imbalance on the surface; applying more than one polar molecule to the charged surface of the nanostructured material; and orienting the polar molecules to compensate for the charge imbalance on the surface of the nanostructured material. The compensation of the surface charge imbalance by the polar molecules allows the isolated regions to exhibit luminescence.

  17. Adsorption of gas molecules on Cu impurities embedded monolayer MoS2: A first- principles study

    NASA Astrophysics Data System (ADS)

    Zhao, B.; Li, C. Y.; Liu, L. L.; Zhou, B.; Zhang, Q. K.; Chen, Z. Q.; Tang, Z.

    2016-09-01

    Adsorption of small gas molecules (O2, NO, NO2 and NH3) on transition-metal Cu atom embedded monolayer MoS2 was investigated by first-principles calculations based on the density-functional theory (DFT). The embedded Cu atom is strongly constrained on the sulfur vacancy of monolayer MoS2 with a high diffusion barrier. The stable adsorption geometry, charge transfer and electronic structures of these gas molecules on monolayer MoS2 embedded with transition-metal Cu atom are discussed in detail. It is found that the monolayer MoS2 with embedded Cu atom can effectively capture these gas molecules with high adsorption energy. The NH3 molecule acts as electron donor after adsorption, which is different from the other gas molecules (O2, NO, and NO2). The results suggest that MoS2-Cu system may be promising for future applications in gas molecules sensing and catalysis, which is similar to those of the transition-metal embedded graphene.

  18. Doping graphene films via chemically mediated charge transfer.

    PubMed

    Ishikawa, Ryousuke; Bando, Masashi; Morimoto, Yoshitaka; Sandhu, Adarsh

    2011-01-31

    Transparent conductive films (TCFs) are critical components of a myriad of technologies including flat panel displays, light-emitting diodes, and solar cells. Graphene-based TCFs have attracted a lot of attention because of their high electrical conductivity, transparency, and low cost. Carrier doping of graphene would potentially improve the properties of graphene-based TCFs for practical industrial applications. However, controlling the carrier type and concentration of dopants in graphene films is challenging, especially for the synthesis of p-type films. In this article, a new method for doping graphene using the conjugated organic molecule, tetracyanoquinodimethane (TCNQ), is described. Notably, TCNQ is well known as a powerful electron accepter and is expected to favor electron transfer from graphene into TCNQ molecules, thereby leading to p-type doping of graphene films. Small amounts of TCNQ drastically improved the resistivity without degradation of optical transparency. Our carrier doping method based on charge transfer has a huge potential for graphene-based TCFs.

  19. A single molecule rectifier with strong push-pull coupling

    NASA Astrophysics Data System (ADS)

    Saraiva-Souza, Aldilene; Macedo de Souza, Fabricio; Aleixo, Vicente F. P.; Girão, Eduardo Costa; Filho, Josué Mendes; Meunier, Vincent; Sumpter, Bobby G.; Souza Filho, Antônio Gomes; Del Nero, Jordan

    2008-11-01

    We theoretically investigate the electronic charge transport in a molecular system composed of a donor group (dinitrobenzene) coupled to an acceptor group (dihydrophenazine) via a polyenic chain (unsaturated carbon bridge). Ab initio calculations based on the Hartree-Fock approximations are performed to investigate the distribution of electron states over the molecule in the presence of an external electric field. For small bridge lengths (n =0-3) we find a homogeneous distribution of the frontier molecular orbitals, while for n >3 a strong localization of the lowest unoccupied molecular orbital is found. The localized orbitals in between the donor and acceptor groups act as conduction channels when an external electric field is applied. We also calculate the rectification behavior of this system by evaluating the charge accumulated in the donor and acceptor groups as a function of the external electric field. Finally, we propose a phenomenological model based on nonequilibrium Green's function to rationalize the ab initio findings.

  20. Insight into the microscopic structure of an AdS black hole from a thermodynamical phase transition.

    PubMed

    Wei, Shao-Wen; Liu, Yu-Xiao

    2015-09-11

    Comparing with an ordinary thermodynamic system, we investigate the possible microscopic structure of a charged anti-de Sitter black hole completely from the thermodynamic viewpoint. The number density of the black hole molecules is introduced to measure the microscopic degrees of freedom of the black hole. We found that the number density suffers a sudden change accompanied by a latent heat when the black hole system crosses the small-large black hole coexistence curve, while when the system passes the critical point, it encounters a second-order phase transition with a vanishing latent heat due to the continuous change of the number density. Moreover, the thermodynamic scalar curvature suggests that there is a weak attractive interaction between two black hole molecules. These phenomena might cast new insight into the underlying microscopic structure of a charged anti-de Sitter black hole.

  1. Like-charge attraction and opposite-charge decomplexation between polymers and DNA molecules

    NASA Astrophysics Data System (ADS)

    Buyukdagli, Sahin

    2017-02-01

    We scrutinize the effect of polyvalent ions on polymer-DNA interactions. We extend a recently developed test-charge theory [S. Buyukdagli et al., Phys. Rev. E 94, 042502 (2016), 10.1103/PhysRevE.94.042502] to the case of a stiff polymer interacting with a DNA molecule in an electrolyte mixture. The theory accounts for one-loop level electrostatic correlation effects such as the ionic cloud deformation around the strongly charged DNA molecule as well as image-charge forces induced by the low DNA permittivity. Our model can reproduce and explain various characteristics of the experimental phase diagrams for polymer solutions. First, the addition of polyvalent cations to the electrolyte solution results in the attraction of the negatively charged polymer by the DNA molecule. The glue of the like-charge attraction is the enhanced shielding of the polymer charges by the dense counterion layer at the DNA surface. Second, through the shielding of the DNA-induced electrostatic potential, mono- and polyvalent cations of large concentration both suppress the like-charge attraction. Within the same formalism, we also predict a new opposite-charge repulsion effect between the DNA molecule and a positively charged polymer. In the presence of polyvalent anions such as sulfate or phosphate, their repulsion by the DNA charges leads to the charge screening deficiency of the region around the DNA molecule. This translates into a repulsive force that results in the decomplexation of the polymer from DNA. This opposite-charge repulsion phenomenon can be verified by current experiments and the underlying mechanism can be beneficial to gene therapeutic applications where the control over polymer-DNA interactions is the key factor.

  2. Quantum theory of atoms in molecules charge-charge flux-dipole flux models for the infrared intensities of X(2)CY (X = H, F, Cl; Y = O, S) molecules.

    PubMed

    Faria, Sergio H D M; da Silva, João Viçozo; Haiduke, Roberto L A; Vidal, Luciano N; Vazquez, Pedro A M; Bruns, Roy E

    2007-08-16

    The molecular dipole moments, their derivatives, and the fundamental IR intensities of the X2CY (X = H, F, Cl; Y = O, S) molecules are determined from QTAIM atomic charges and dipoles and their fluxes at the MP2/6-311++G(3d,3p) level. Root-mean-square errors of +/-0.03 D and +/-1.4 km mol(-1) are found for the molecular dipole moments and fundamental IR intensities calculated using quantum theory of atoms in molecules (QTAIM) parameters when compared with those obtained directly from the MP2/6-311++G(3d,3p) calculations and +/-0.05 D and 51.2 km mol(-1) when compared with the experimental values. Charge (C), charge flux (CF), and dipole flux (DF) contributions are reported for all the normal vibrations of these molecules. A large negative correlation coefficient of -0.83 is calculated between the charge flux and dipole flux contributions and indicates that electronic charge transfer from one side of the molecule to the other during vibrations is accompanied by a relaxation effect with electron density polarization in the opposite direction. The characteristic substituent effect that has been observed for experimental infrared intensity parameters and core electron ionization energies has been applied to the CCFDF/QTAIM parameters of F2CO, Cl2CO, F2CS, and Cl2CS. The individual atomic charge, atomic charge flux, and atomic dipole flux contributions are seen to obey the characteristic substituent effect equation just as accurately as the total dipole moment derivative. The CH, CF, and CCl stretching normal modes of these molecules are shown to have characteristic sets of charge, charge flux, and dipole flux contributions.

  3. Applying Thienyl Side Chains and Different π-Bridge to Aromatic Side-Chain Substituted Indacenodithiophene-Based Small Molecule Donors for High-Performance Organic Solar Cells.

    PubMed

    Wang, Jin-Liang; Liu, Kai-Kai; Liu, Sha; Liu, Feng; Wu, Hong-Bin; Cao, Yong; Russell, Thomas P

    2017-06-14

    A pair of linear tetrafluorinated small molecular donors, named as ThIDTTh4F and ThIDTSe4F, which are with tetrathienyl-substituted IDT as electron-rich central core, electron-deficient difluorobenzothiadiazole as acceptor units, and donor end-capping groups, but having differences in the π-bridge (thiophene and selenophene), were successfully synthesized and evaluated as donor materials in organic solar cells. Such π-bridge and core units in these small molecules play a decisive role in the formation of the nanoscale separation of the blend films, which were systematically investigated through absorption spectra, grazing incidence X-ray diffraction pattern, transmission electron microscopy images, resonant soft X-ray scattering profiles, and charge mobility measurement. The ThIDTSe4F (with selenophene π-bridge)-based device exhibited superior performance than devices based on ThIDTh4F (with thiophene π-bridge) after post annealing treatment owing to optimized film morphology and improved charge transport. Power conversion efficiency of 7.31% and fill factor of ∼0.70 were obtained by using a blend of ThIDTSe4F and PC 71 BM with thermal annealing and solvent vapor annealing treatments, which is the highest PCE from aromatic side-chain substituted IDT-based small molecular solar cells. The scope of this study is to reveal the structure-property relationship of the aromatic side-chain substituted IDT-based donor materials as a function of π-bridge and the post annealing conditions.

  4. Electron Transfer as a Probe of the Interfacial Quantum Dot-Organic Molecule Interaction

    NASA Astrophysics Data System (ADS)

    Peterson, Mark D.

    This dissertation describes a set of experimental and theoretical studies of the interaction between small organic molecules and the surfaces of semiconductor nanoparticles, also called quantum dots (QDs). Chapter 1 reviews the literature on the influence of ligands on exciton relaxation dynamics following photoexcitation of semiconductor QDs, and describes how ligands promote or inhibit processes such as emission, nonradiative relaxation, and charge transfer to redox active adsorbates. Chapter 2 investigates the specific interaction of alkylcarboxylated viologen derivatives with CdS QDs, and shows how a combination of steady-state photoluminescence (PL) and transient absorption (TA) experiments can be used to reveal the specific binding geometry of redox active organic molecules on QD surfaces. Chapter 3 expands on Chapter 2 by using PL and TA to provide information about the mechanisms through which methyl viologen (MV 2+) associates with CdS QDs to form a stable QD/MV2+ complex, suggesting two chemically distinct reactions. We use our understanding of the QD/molecule interaction to design a drug delivery system in Chapter 4, which employs PL and TA experiments to show that conformational changes in a redox active adsorbate may follow electron transfer, "activating" a biologically inert Schiff base to a protein inhibitor form. The protein inhibitor limits cell motility and may be used to prevent tumor metastasis in cancer patients. Chapter 5 discusses future applications of QD/molecule redox couples with an emphasis on efficient multiple charge-transfer reactions -- a process facilitated by the high degeneracy of band-edge states in QDs. These multiple charge-transfer reactions may potentially increase the thermodynamic efficiency of solar cells, and may also facilitate the splitting of water into fuel. Multiple exciton generation procedures, multi-electron transfer experiments, and future directions are discussed.

  5. Probe-based measurement of lateral single-electron transfer between individual molecules

    PubMed Central

    Steurer, Wolfram; Fatayer, Shadi; Gross, Leo; Meyer, Gerhard

    2015-01-01

    The field of molecular electronics aims at using single molecules as functional building blocks for electronics components, such as switches, rectifiers or transistors. A key challenge is to perform measurements with atomistic control over the alignment of the molecule and its contacting electrodes. Here we use atomic force microscopy to examine charge transfer between weakly coupled pentacene molecules on insulating films with single-electron sensitivity and control over the atomistic details. We show that, in addition to the imaging capability, the probe tip can be used to control the charge state of individual molecules and to detect charge transfers to/from the tip, as well as between individual molecules. Our approach represents a novel route for molecular charge transfer studies with a host of opportunities, especially in combination with single atom/molecule manipulation and nanopatterning techniques. PMID:26387533

  6. Ion-polycyclic aromatic hydrocarbon collisions: kinetic energy releases for specific fragmentation channels

    NASA Astrophysics Data System (ADS)

    Reitsma, G.; Zettergren, H.; Boschman, L.; Bodewits, E.; Hoekstra, R.; Schlathölter, T.

    2013-12-01

    We report on 30 keV He2 + collisions with naphthalene (C10H8) molecules, which leads to very extensive fragmentation. To unravel such complex fragmentation patterns, we designed and constructed an experimental setup, which allows for the determination of the full momentum vector by measuring charged collision products in coincidence in a recoil ion momentum spectrometer type of detection scheme. The determination of fragment kinetic energies is found to be considerably more accurate than for the case of mere coincidence time-of-flight spectrometers. In fission reactions involving two cationic fragments, typically kinetic energy releases of 2-3 eV are observed. The results are interpreted by means of density functional theory calculations of the reverse barriers. It is concluded that naphthalene fragmentation by collisions with keV ions clearly is much more violent than the corresponding photofragmentation with energetic photons. The ion-induced naphthalene fragmentation provides a feedstock of various small hydrocarbonic species of different charge states and kinetic energy, which could influence several molecule formation processes in the cold interstellar medium and facilitates growth of small hydrocarbon species on pre-existing polycyclic aromatic hydrocarbons.

  7. Role of Crystallization in the Morphology of Polymer: Non-fullerene Acceptor Bulk Heterojunctions

    DOE PAGES

    O’Hara, Kathryn A.; Ostrowski, David P.; Koldemir, Unsal; ...

    2017-05-22

    Many high efficiency organic photovoltaics use fullerene-based acceptors despite their high production cost, weak optical absorption in the visible range, and limited synthetic variability of electronic and optical properties. To circumvent this deficiency, non-fullerene small-molecule acceptors have been developed that have good synthetic flexibility, allowing for precise tuning of optoelectronic properties, leading to enhanced absorption of the solar spectrum and increased open-circuit voltages ( V OC). We examined the detailed morphology of bulk heterojunctions of poly(3-hexylthiophene) and the small-molecule acceptor HPI-BT to reveal structural changes that lead to improvements in the fill factor of solar cells upon thermal annealing. Themore » kinetics of the phase transformation process of HPI-BT during thermal annealing were investigated through in situ grazing incidence wide-angle X-ray scattering studies, atomic force microscopy, and transmission electron microscopy. The HPI-BT acceptor crystallizes during film formation to form micron-sized domains embedded within the film center and a donor rich capping layer at the cathode interface reducing efficient charge extraction. Thermal annealing changes the surface composition and improves charge extraction. In conclusion, this study reveals the need for complementary methods to investigate the morphology of BHJs.« less

  8. Role of Crystallization in the Morphology of Polymer: Non-fullerene Acceptor Bulk Heterojunctions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    O’Hara, Kathryn A.; Ostrowski, David P.; Koldemir, Unsal

    Many high efficiency organic photovoltaics use fullerene-based acceptors despite their high production cost, weak optical absorption in the visible range, and limited synthetic variability of electronic and optical properties. To circumvent this deficiency, non-fullerene small-molecule acceptors have been developed that have good synthetic flexibility, allowing for precise tuning of optoelectronic properties, leading to enhanced absorption of the solar spectrum and increased open-circuit voltages ( V OC). We examined the detailed morphology of bulk heterojunctions of poly(3-hexylthiophene) and the small-molecule acceptor HPI-BT to reveal structural changes that lead to improvements in the fill factor of solar cells upon thermal annealing. Themore » kinetics of the phase transformation process of HPI-BT during thermal annealing were investigated through in situ grazing incidence wide-angle X-ray scattering studies, atomic force microscopy, and transmission electron microscopy. The HPI-BT acceptor crystallizes during film formation to form micron-sized domains embedded within the film center and a donor rich capping layer at the cathode interface reducing efficient charge extraction. Thermal annealing changes the surface composition and improves charge extraction. In conclusion, this study reveals the need for complementary methods to investigate the morphology of BHJs.« less

  9. Trap density of states in small-molecule organic semiconductors: A quantitative comparison of thin-film transistors with single crystals

    NASA Astrophysics Data System (ADS)

    Kalb, Wolfgang L.; Haas, Simon; Krellner, Cornelius; Mathis, Thomas; Batlogg, Bertram

    2010-04-01

    We show that it is possible to reach one of the ultimate goals of organic electronics: producing organic field-effect transistors with trap densities as low as in the bulk of single crystals. We studied the spectral density of localized states in the band gap [trap density of states (trap DOS)] of small-molecule organic semiconductors as derived from electrical characteristics of organic field-effect transistors or from space-charge-limited current measurements. This was done by comparing data from a large number of samples including thin-film transistors (TFT’s), single crystal field-effect transistors (SC-FET’s) and bulk samples. The compilation of all data strongly suggests that structural defects associated with grain boundaries are the main cause of “fast” hole traps in TFT’s made with vacuum-evaporated pentacene. For high-performance transistors made with small-molecule semiconductors such as rubrene it is essential to reduce the dipolar disorder caused by water adsorbed on the gate dielectric surface. In samples with very low trap densities, we sometimes observe a steep increase in the trap DOS very close (<0.15eV) to the mobility edge with a characteristic slope of 10-20 meV. It is discussed to what degree band broadening due to the thermal fluctuation of the intermolecular transfer integral is reflected in this steep increase in the trap DOS. Moreover, we show that the trap DOS in TFT’s with small-molecule semiconductors is very similar to the trap DOS in hydrogenated amorphous silicon even though polycrystalline films of small-molecules with van der Waals-type interaction on the one hand are compared with covalently bound amorphous silicon on the other hand.

  10. Elimination of Spurious Fractional Charges in Dissociating Molecules by Correcting the Shape of Approximate Kohn-Sham Potentials.

    PubMed

    Komsa, Darya N; Staroverov, Viktor N

    2016-11-08

    Standard density-functional approximations often incorrectly predict that heteronuclear diatomic molecules dissociate into fractionally charged atoms. We demonstrate that these spurious charges can be eliminated by adapting the shape-correction method for Kohn-Sham potentials that was originally introduced to improve Rydberg excitation energies [ Phys. Rev. Lett. 2012 , 108 , 253005 ]. Specifically, we show that if a suitably determined fraction of electron charge is added to or removed from a frontier Kohn-Sham orbital level, the approximate Kohn-Sham potential of a stretched molecule self-corrects by developing a semblance of step structure; if this potential is used to obtain the electron density of the neutral molecule, charge delocalization is blocked and spurious fractional charges disappear beyond a certain internuclear distance.

  11. [Imaging Mass Spectrometry in Histopathologic Analysis].

    PubMed

    Yamazaki, Fumiyoshi; Seto, Mitsutoshi

    2015-04-01

    Matrix-assisted laser desorption/ionization (MALDI)-imaging mass spectrometry (IMS) enables visualization of the distribution of a range of biomolecules by integrating biochemical information from mass spectrometry with positional information from microscopy. IMS identifies a target molecule. In addition, IMS enables global analysis of biomolecules containing unknown molecules by detecting the ratio of the molecular weight to electric charge without any target, which makes it possible to identify novel molecules. IMS generates data on the distribution of lipids and small molecules in tissues, which is difficult to visualize with either conventional counter-staining or immunohistochemistry. In this review, we firstly introduce the principle of imaging mass spectrometry and recent advances in the sample preparation method. Secondly, we present findings regarding biological samples, especially pathological ones. Finally, we discuss the limitations and problems of the IMS technique and clinical application, such as in drug development.

  12. Atomic-scale inversion of spin polarization at an organic-antiferromagnetic interface

    NASA Astrophysics Data System (ADS)

    Caffrey, Nuala M.; Ferriani, Paolo; Marocchi, Simone; Heinze, Stefan

    2013-10-01

    Using first-principles calculations, we show that the magnetic properties of a two-dimensional antiferromagnetic transition-metal surface are modified on the atomic scale by the adsorption of small organic molecules. We consider benzene (C6H6), cyclooctatetraene (C8H8), and a small transition-metal-benzene complex (BzV) adsorbed on a single atomic layer of Mn deposited on the W(110) surface—a surface which exhibits a nearly antiferromagnetic alignment of the magnetic moments in adjacent Mn rows. Due to the spin dependent hybridization of the molecular pz orbitals with the d states of the Mn monolayer, there is a significant reduction of the magnetic moments in the Mn film. Furthermore, the spin polarization at this organic-antiferromagnetic interface is found to be modulated on the atomic scale, both enhanced and inverted, as a result of the molecular adsorption. We show that this effect can be resolved by spin-polarized scanning tunneling microscopy (SP-STM). Our simulated SP-STM images display a spatially dependent spin resolved vacuum charge density above an adsorbed molecule—i.e., different regions above the molecule sustain different signs of spin polarization. While states with s and p symmetry dominate the vacuum charge density in the vicinity of the Fermi energy for the clean magnetic surface, we demonstrate that after a molecule is adsorbed those d states, which are normally suppressed due to their symmetry, can play a crucial role in the vacuum due to their interaction with the molecular orbitals. We also model the effect of small deviations from perfect antiferromagnetic ordering, induced by the slight canting of magnetic moments due to the spin spiral ground state of Mn/W(110).

  13. Self-consistent field calculations of conductance through conjugated molecules at finite bias

    NASA Astrophysics Data System (ADS)

    Paulsson, Magnus; Stafström, Sven

    2001-03-01

    Conductance through conjugated molecules have previously been calculated for a large number of systems using the Landauer formula but only a few calculations have included charging effects. In this study we present calculations in the mean field approximation of the conductance of metal-molecule-metal systems using two different kinds of molecules for a large number of configurations and applied biases. The molecules are described in the Pariser-Parr Pople model. Current-voltage (I-V) characteristics and charge distribution of the molecule connected by one dimensional leads to reservoirs is solved within the Hartree-Fock approximation. Charging of the molecule occurs when the chemical potential of the reservoirs approach the resonant tunneling levels. The ensuing potential difference, due to the charging, shifts the tunneling peaks which affects the I-V curves considerably. Asymmetrical interaction with the metal leads, e.g. molecule on a metal surface contacted with an STM-tip, also give asymmetrical I-V curves where the potential of the molecule is shown to more closely follow the potential of the surface. Negative differential conductance is discussed in systems consisting of two weakly coupled molecules.

  14. Enhancement of Performance and Mechanism Studies of All-Solution Processed Small-Molecule based Solar Cells with an Inverted Structure.

    PubMed

    Long, Guankui; Wu, Bo; Yang, Xuan; Kan, Bin; Zhou, Ye-Cheng; Chen, Li-Chuan; Wan, Xiangjian; Zhang, Hao-Li; Sum, Tze Chien; Chen, Yongsheng

    2015-09-30

    Both solution-processed polymers and small molecule based solar cells have achieved PCEs over 9% with the conventional device structure. However, for the practical applications of photovoltaic technology, further enhancement of both device performance and stability are urgently required, particularly for the inverted structure devices, since this architecture will probably be most promising for the possible coming commercialization. In this work, we have fabricated both conventional and inverted structure devices using the same small molecular donor/acceptor materials and compared the performance of both device structures, and found that the inverted structure based device gave significantly improved performance, the highest PCE so far for inverted structure based device using small molecules as the donor. Furthermore, the inverted device shows a remarkable stability with almost no obvious degradation after three months. Systematic device physics and charge generation dynamics studies, including optical simulation, light-intensity-dependent current-voltage experiments, photocurrent density-effective voltage analyses, transient absorption measurements, and electrical simulations, indicate that the significantly enhanced performance using inverted device is ascribed to the increasing of Jsc compared to the conventional device, which in turn is mainly attributed to the increased absorption of photons in the active layers, rather than the reduced nongeminate recombination.

  15. Chitosugar translocation by an unexpressed monomeric protein channel

    NASA Astrophysics Data System (ADS)

    Soysa, H. Sasimali M.; Suginta, Wipa; Moonsap, Watcharaporn; Smith, M. F.

    2018-05-01

    The outer membrane protein channel Ec ChiP , associated with a silent gene in E . coli, is a monomeric chitoporin. In a glucose-deficient environment, E . coli can express the ChiP gene to exploit chitin degradation products. Single-channel small ion current measurements, which reveal the dynamics of single sugar molecules trapped in channel, are used here to study the exotic transport of chitosugars by E . coli. Molecules escape from the channel on multiple timescales. Voltage-dependent trapping rates observed for charged chitosan molecules, as well as model calculations, indicate that the rapid escape processes are those in which the molecule escapes back to the side of the membrane from which it originated. The probability that a sugar molecule is translocated through the membrane is thus estimated from the current data and the dependence of this translocation probability on the length of the chitosugar molecule and the applied voltage analyzed. The described method for obtaining the translocation probability and related molecular translocation current is applicable to other transport channels.

  16. Interaction between perylene-derivated molecules observed by low temperature scanning tunneling microscopy

    NASA Astrophysics Data System (ADS)

    Vernisse, Loranne; Guillermet, Olivier; Gourdon, André; Coratger, Roland

    2018-03-01

    Derivative perylene molecules deposited on Ag(111) and on NaCl(001) ultrathin layers have been investigated using low temperature STM and NC-AFM. When the metallic substrate is held at ambient temperature during evaporation, the molecules form characteristic trimers on the Ag(111) surface and interact through their polar groups. Close to the steps, the molecules form linear structures and seems to stand side by side. On the other hand, after deposition on a substrate cooled at liquid helium temperature, single molecules are observed both on metal and on NaCl. On the ultrathin insulator layers, the STM images present characteristic contrasts related to the molecular orbitals which favors the localization of aldehyde groups. In this case, the lateral molecular interactions may induce the formation of small assemblies in which the electronic levels are slightly shifted. A possible interpretation of this phenomenon is to take into account polar interactions and charge transfer between neighboring molecules.

  17. Fine-Tuning the Energy Levels of a Nonfullerene Small-Molecule Acceptor to Achieve a High Short-Circuit Current and a Power Conversion Efficiency over 12% in Organic Solar Cells.

    PubMed

    Kan, Bin; Zhang, Jiangbin; Liu, Feng; Wan, Xiangjian; Li, Chenxi; Ke, Xin; Wang, Yunchuang; Feng, Huanran; Zhang, Yamin; Long, Guankui; Friend, Richard H; Bakulin, Artem A; Chen, Yongsheng

    2018-01-01

    Organic solar cell optimization requires careful balancing of current-voltage output of the materials system. Here, such optimization using ultrafast spectroscopy as a tool to optimize the material bandgap without altering ultrafast photophysics is reported. A new acceptor-donor-acceptor (A-D-A)-type small-molecule acceptor NCBDT is designed by modification of the D and A units of NFBDT. Compared to NFBDT, NCBDT exhibits upshifted highest occupied molecular orbital (HOMO) energy level mainly due to the additional octyl on the D unit and downshifted lowest unoccupied molecular orbital (LUMO) energy level due to the fluorination of A units. NCBDT has a low optical bandgap of 1.45 eV which extends the absorption range toward near-IR region, down to ≈860 nm. However, the 60 meV lowered LUMO level of NCBDT hardly changes the V oc level, and the elevation of the NCBDT HOMO does not have a substantial influence on the photophysics of the materials. Thus, for both NCBDT- and NFBDT-based systems, an unusually slow (≈400 ps) but ultimately efficient charge generation mediated by interfacial charge-pair states is observed, followed by effective charge extraction. As a result, the PBDB-T:NCBDT devices demonstrate an impressive power conversion efficiency over 12%-among the best for solution-processed organic solar cells. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. DFT study of adsorption behavior of NO, CO, NO2, and NH3 molecules on graphene-like BC3: A search for highly sensitive molecular sensor

    NASA Astrophysics Data System (ADS)

    Mehdi Aghaei, Sadegh; Monshi, M. M.; Torres, I.; Zeidi, S. M. J.; Calizo, I.

    2018-01-01

    The adsorption behaviors of toxic gas molecules (NO, CO, NO2, and NH3) on the graphene-like boron carbide (BC3) are investigated using first-principle density functional theory. The graphene-like BC3 monolayer is a semiconductor with a band gap of 0.733 eV. It is discovered that all the above gas molecules are chemisorbed on the BC3 sheet while they retain their molecular forms. It is also revealed that the NO2 gas molecule could be dissociated into NO and O species through the adsorption process. The amounts of charge transfer upon adsorption of CO and NH3 gas molecules on the BC3 are found to be small. The band gap changes in BC3 as a result of interactions with CO and NH3 are only 4.63% and 16.7%, indicating that the BC3-based sensor has a low and moderate sensitivity to CO and NH3, respectively. Contrariwise, upon adsorption of NO or NO2 on the BC3, significant charges are transferred from the molecules to the BC3 sheet, causing a semiconductor-metal and semiconductor-p type semiconductor transition. Our study suggests that the BC3-based sensor has a high potential for NO and NO2 detection due to the significant conductance changes, moderate adsorption energy, and short recovery time. More excitingly, the BC3 is a likely catalyst for dissociation of the NO2 gas molecule.

  19. Intercalation of paracetamol into the hydrotalcite-like host

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kovanda, Frantisek, E-mail: Frantisek.Kovanda@vscht.cz; Maryskova, Zuzana; Kovar, Petr

    2011-12-15

    Hydrotalcite-like compounds are often used as host structures for intercalation of various anionic species. The product intercalated with the nonionic, water-soluble pharmaceuticals paracetamol, N-(4-hydroxyphenyl)acetamide, was prepared by rehydration of the Mg-Al mixed oxide obtained by calcination of hydrotalcite-like precursor at 500 Degree-Sign C. The successful intercalation of paracetamol molecules into the interlayer space was confirmed by powder X-ray diffraction and infrared spectroscopy measurements. Molecular simulations showed that the phenolic hydroxyl groups of paracetamol interact with hydroxide sheets of the host via the hydroxyl groups of the positively charged sites of Al-containing octahedra; the interlayer water molecules are located mostly nearmore » the hydroxide sheets. The arrangement of paracetamol molecules in the interlayer is rather disordered and interactions between neighboring molecules cause their tilting towards the hydroxide sheets. Dissolution tests in various media showed slower release of paracetamol intercalated in the hydrotalcite-like host in comparison with tablets containing the powdered pharmaceuticals. - Graphical abstract: Molecular simulations showed disordered arrangement of paracetamol molecules in the interlayer; most of the interlayer water molecules are located near the hydroxide sheets. Black-Small-Square Highlights: Black-Right-Pointing-Pointer Paracetamol was intercalated in Mg-Al hydrotalcite-like host by rehydration/reconstruction procedure. Black-Right-Pointing-Pointer Paracetamol phenolic groups interact with positively charged sites in hydroxide sheets. Black-Right-Pointing-Pointer Molecular simulations showed disordered arrangement of guest molecules in the interlayer. Black-Right-Pointing-Pointer Slower release of paracetamol intercalated in the hydrotalcite-like host was observed.« less

  20. Sequential water molecule binding enthalpies for aqueous nanodrops containing a mono-, di- or trivalent ion and between 20 and 500 water molecules† †Electronic supplementary information (ESI) available: Detailed description of the experimental and computational modeling methods. Isolation, BIRD and UVPD sequence for [Ru(NH3)6]3+·(H2O)169–171, nanoESI spectra for 2+ and 3+ ions. Detailed description of the isotope distribution simulation program. Comparison between experimental and simulated 1+, 2+ and 3+ ion isotope distributions. Wavelength dependence of the deduced sequential binding enthalpies. Comparison of experimental UVPD binding enthalpies to the liquid drop model at different temperatures. Complete list of binding enthalpies and average number of water molecules lost upon UVPD. See DOI: 10.1039/c6sc04957e Click here for additional data file.

    PubMed Central

    Heiles, Sven; Cooper, Richard J.; DiTucci, Matthew J.

    2017-01-01

    Sequential water molecule binding enthalpies, ΔH n,n–1, are important for a detailed understanding of competitive interactions between ions, water and solute molecules, and how these interactions affect physical properties of ion-containing nanodrops that are important in aerosol chemistry. Water molecule binding enthalpies have been measured for small clusters of many different ions, but these values for ion-containing nanodrops containing more than 20 water molecules are scarce. Here, ΔH n,n–1 values are deduced from high-precision ultraviolet photodissociation (UVPD) measurements as a function of ion identity, charge state and cluster size between 20–500 water molecules and for ions with +1, +2 and +3 charges. The ΔH n,n–1 values are obtained from the number of water molecules lost upon photoexcitation at a known wavelength, and modeling of the release of energy into the translational, rotational and vibrational motions of the products. The ΔH n,n–1 values range from 36.82 to 50.21 kJ mol–1. For clusters containing more than ∼250 water molecules, the binding enthalpies are between the bulk heat of vaporization (44.8 kJ mol–1) and the sublimation enthalpy of bulk ice (51.0 kJ mol–1). These values depend on ion charge state for clusters with fewer than 150 water molecules, but there is a negligible dependence at larger size. There is a minimum in the ΔH n,n–1 values that depends on the cluster size and ion charge state, which can be attributed to the competing effects of ion solvation and surface energy. The experimental ΔH n,n–1 values can be fit to the Thomson liquid drop model (TLDM) using bulk ice parameters. By optimizing the surface tension and temperature change of the logarithmic partial pressure for the TLDM, the experimental sequential water molecule binding enthalpies can be fit with an accuracy of ±3.3 kJ mol–1 over the entire range of cluster sizes. PMID:28451364

  1. Molecular imaging of drug-modulated protein-protein interactions in living subjects.

    PubMed

    Paulmurugan, Ramasamy; Massoud, Tarik F; Huang, Jing; Gambhir, Sanjiv S

    2004-03-15

    Networks of protein interactions mediate cellular responses to environmental stimuli and direct the execution of many different cellular functional pathways. Small molecules synthesized within cells or recruited from the external environment mediate many protein interactions. The study of small molecule-mediated interactions of proteins is important to understand abnormal signal transduction pathways in cancer and in drug development and validation. In this study, we used split synthetic renilla luciferase (hRLUC) protein fragment-assisted complementation to evaluate heterodimerization of the human proteins FRB and FKBP12 mediated by the small molecule rapamycin. The concentration of rapamycin required for efficient dimerization and that of its competitive binder ascomycin required for dimerization inhibition were studied in cell lines. The system was dually modulated in cell culture at the transcription level, by controlling nuclear factor kappaB promoter/enhancer elements using tumor necrosis factor alpha, and at the interaction level, by controlling the concentration of the dimerizer rapamycin. The rapamycin-mediated dimerization of FRB and FKBP12 also was studied in living mice by locating, quantifying, and timing the hRLUC complementation-based bioluminescence imaging signal using a cooled charged coupled device camera. This split reporter system can be used to efficiently screen small molecule drugs that modulate protein-protein interactions and also to assess drugs in living animals. Both are essential steps in the preclinical evaluation of candidate pharmaceutical agents targeting protein-protein interactions, including signaling pathways in cancer cells.

  2. Study of lithium cation in water clusters: based on atom-bond electronegativity equalization method fused into molecular mechanics.

    PubMed

    Li, Xin; Yang, Zhong-Zhi

    2005-05-12

    We present a potential model for Li(+)-water clusters based on a combination of the atom-bond electronegativity equalization and molecular mechanics (ABEEM/MM) that is to take ABEEM charges of the cation and all atoms, bonds, and lone pairs of water molecules into the intermolecular electrostatic interaction term in molecular mechanics. The model allows point charges on cationic site and seven sites of an ABEEM-7P water molecule to fluctuate responding to the cluster geometry. The water molecules in the first sphere of Li(+) are strongly structured and there is obvious charge transfer between the cation and the water molecules; therefore, the charge constraint on the ionic cluster includes the charged constraint on the Li(+) and the first-shell water molecules and the charge neutrality constraint on each water molecule in the external hydration shells. The newly constructed potential model based on ABEEM/MM is first applied to ionic clusters and reproduces gas-phase state properties of Li(+)(H(2)O)(n) (n = 1-6 and 8) including optimized geometries, ABEEM charges, binding energies, frequencies, and so on, which are in fair agreement with those measured by available experiments and calculated by ab initio methods. Prospects and benefits introduced by this potential model are pointed out.

  3. Asymmetric Ion-Pairing Catalysis

    PubMed Central

    Brak, Katrien

    2014-01-01

    Charged intermediates and reagents are ubiquitous in organic transformations. The interaction of these ionic species with chiral neutral, anionic, or cationic small molecules has emerged as a powerful strategy for catalytic, enantioselective synthesis. This review describes developments in the burgeoning field of asymmetric ion-pairing catalysis with an emphasis on the insights that have been gleaned into the structural and mechanistic features that contribute to high asymmetric induction. PMID:23192886

  4. High brilliance negative ion and neutral beam source

    DOEpatents

    Compton, Robert N.

    1991-01-01

    A high brilliance mass selected (Z-selected) negative ion and neutral beam source having good energy resolution. The source is based upon laser resonance ionization of atoms or molecules in a small gaseous medium followed by charge exchange through an alkali oven. The source is capable of producing microampere beams of an extremely wide variety of negative ions, and milliampere beams when operated in the pulsed mode.

  5. Single water entropy: hydrophobic crossover and application to drug binding.

    PubMed

    Sasikala, Wilbee D; Mukherjee, Arnab

    2014-09-11

    Entropy of water plays an important role in both chemical and biological processes e.g. hydrophobic effect, molecular recognition etc. Here we use a new approach to calculate translational and rotational entropy of the individual water molecules around different hydrophobic and charged solutes. We show that for small hydrophobic solutes, the translational and rotational entropies of each water molecule increase as a function of its distance from the solute reaching finally to a constant bulk value. As the size of the solute increases (0.746 nm), the behavior of the translational entropy is opposite; water molecules closest to the solute have higher entropy that reduces with distance from the solute. This indicates that there is a crossover in translational entropy of water molecules around hydrophobic solutes from negative to positive values as the size of the solute is increased. Rotational entropy of water molecules around hydrophobic solutes for all sizes increases with distance from the solute, indicating the absence of crossover in rotational entropy. This makes the crossover in total entropy (translation + rotation) of water molecule happen at much larger size (>1.5 nm) for hydrophobic solutes. Translational entropy of single water molecule scales logarithmically (Str(QH) = C + kB ln V), with the volume V obtained from the ellipsoid of inertia. We further discuss the origin of higher entropy of water around water and show the possibility of recovering the entropy loss of some hypothetical solutes. The results obtained are helpful to understand water entropy behavior around various hydrophobic and charged environments within biomolecules. Finally, we show how our approach can be used to calculate the entropy of the individual water molecules in a protein cavity that may be replaced during ligand binding.

  6. Phase-Transfer Energetics of Small-Molecule Alcohols Across the Water-Hexane Interface: Molecular Dynamics Simulation Using Charge Equilibration Models

    PubMed Central

    Bauer, Brad A.; Zhong, Yang; Meninger, David J.; Davis, Joseph E.; Patel, Sandeep

    2010-01-01

    We study the water-hexane interface using molecular dynamics (MD) and polarizable charge equilibration (CHEQ) force fields. Bulk densities for TIP4P-FQ water and hexane, 1.0086±0.0002 g/cm3 and 0.6378±0.0001 g/cm3, demonstrate excellent agreement with experiment. Interfacial width and interfacial tension are consistent with previously reported values. The in-plane component of the dielectric permittivity (ε∥) for water is shown to decrease from 81.7±0.04 to unity, transitioning longitudinally from bulk water to bulk hexane. ε∥ for hexane reaches a maximum in the interface, but this term represents only a small contribution to the total dielectric constant (as expected for a non-polar species). Structurally, net orientations of the molecules arise in the interfacial region such that hexane lies slightly parallel to the interface and water reorients to maximize hydrogen bonding. Interfacial potentials due to contributions of the water and hexane are calculated to be -567.9±0.13mV and 198.7±0.01mV, respectively, giving rise to a total potential in agreement with the range of values reported from previous simulations of similar systems. Potentials of mean force (PMF) calculated for methanol, ethanol, and 1-propanol for the transfer from water to hexane indicate an interfacial free energy minimum, corresponding to the amphiphilic nature of the molecules. The magnitudes of transfer free energies were further characterized from the solvation free energies of alcohols in water and hexane using thermodynamic integration. This analysis shows that solvation free energies for alcohols in hexane are 0.2-0.3 kcal/mol too unfavorable, whereas solvation of alcohols in water is approximately 1 kcal/mol too favorable. For the pure hexane-water interfacial simulations, we observe a monotonic decrease of the water dipole moment to near-vacuum values. This suggests that the electrostatic component of the desolvation free energy is not as severe for polarizable models than for fixed-charge force fields. The implications of such behavior pertain to the modeling of polar and charged solutes in lipidic environments. PMID:21414823

  7. A simple method for the fast calculation of charge redistribution of solutes in an implicit solvent model

    NASA Astrophysics Data System (ADS)

    Dias, L. G.; Shimizu, K.; Farah, J. P. S.; Chaimovich, H.

    2002-09-01

    We propose and demonstrate the usefulness of a method, defined as generalized Born electronegativity equalization method (GBEEM) to estimate solvent-induced charge redistribution. The charges obtained by GBEEM, in a representative series of small organic molecules, were compared to PM3-CM1 charges in vacuum and in water. Linear regressions with appropriate correlation coefficients and standard deviations between GBEEM and PM3-CM1 methods were obtained ( R=0.94,SD=0.15, Ftest=234, N=32, in vacuum; R=0.94,SD=0.16, Ftest=218, N=29, in water). In order to test the GBEEM response when intermolecular interactions are involved we calculated a water dimer in dielectric water using both GBEEM and PM3-CM1 and the results were similar. Hence, the method developed here is comparable to established calculation methods.

  8. Aqueous alkali halide solutions: can osmotic coefficients be explained on the basis of the ionic sizes alone?

    PubMed

    Kalyuzhnyi, Yu V; Vlachy, Vojko; Dill, Ken A

    2010-06-21

    We use the AMSA, associative mean spherical theory of associative fluids, to study ion-ion interactions in explicit water. We model water molecules as hard spheres with four off-center square-well sites and ions as charged hard spheres with sticky sites that bind to water molecules or other ions. We consider alkali halide salts. The choice of model parameters is based on two premises: (i) The strength of the interaction between a monovalent ion and a water molecule is inversely proportional to the ionic (crystal) diameter sigma(i). Smaller ions bind to water more strongly than larger ions do, taking into account the asymmetry of the cation-water and anion-water interactions. (ii) The number of contacts an ion can make is proportional to sigma2(i). In short, small ions bind waters strongly, but only a few of them. Large ions bind waters weakly, but many of them. When both a monovalent cation and anion are large, it yields a small osmotic coefficient of the salt, since the water molecules avoid the space in between large ions. On the other hand, salts formed from one small and one large ion remain hydrated and their osmotic coefficient is high. The osmotic coefficients, calculated using this model in combination with the integral equation theory developed for associative fluids, follow the experimental trends, including the unusual behavior of caesium salts.

  9. Signatures in vibrational and UV-visible absorption spectra for identifying cyclic hydrocarbons by graphene fragments.

    PubMed

    Meng, Yan; Wu, Qi; Chen, Lei; Wangmo, Sonam; Gao, Yang; Wang, Zhigang; Zhang, Rui-Qin; Ding, Dajun; Niehaus, Thomas A; Frauenheim, Thomas

    2013-12-21

    To promote possible applications of graphene in molecular identification based on stacking effects, in particular in recognizing aromatic amino acids and even sequencing nucleobases in life sciences, we comprehensively study the interaction between graphene segments and different cyclic organic hydrocarbons including benzene (C6H6), cyclohexane (C6H12), benzyne (C6H4), cyclohexene (C6H10), 1,3-cyclohexadiene (C6H8(1)) and 1,4-cyclohexadiene (C6H8(2)), using the density-functional tight-binding (DFTB) method. Interestingly, we find obviously different characteristics in Raman vibrational and ultraviolet visible absorption spectra of the small molecules adsorbed on the graphene sheet. Specifically, we find that both spectra involve clearly different characteristic peaks, belonging to the different small molecules upon adsorption, with the ones of ionized molecules being more substantial. Further analysis shows that the adsorptions are almost all due to the presence of dispersion energy in neutral cases and involve charge transfer from the graphene to the small molecules. In contrast, the main binding force in the ionic adsorption systems is the electronic interaction. The results present clear signatures that can be used to recognize different kinds of aromatic hydrocarbon rings on graphene sheets. We expect that our findings will be helpful for designing molecular recognition devices using graphene.

  10. Single-molecule detection of dihydroazulene photo-thermal reaction using break junction technique

    NASA Astrophysics Data System (ADS)

    Huang, Cancan; Jevric, Martyn; Borges, Anders; Olsen, Stine T.; Hamill, Joseph M.; Zheng, Jue-Ting; Yang, Yang; Rudnev, Alexander; Baghernejad, Masoud; Broekmann, Peter; Petersen, Anne Ugleholdt; Wandlowski, Thomas; Mikkelsen, Kurt V.; Solomon, Gemma C.; Brøndsted Nielsen, Mogens; Hong, Wenjing

    2017-05-01

    Charge transport by tunnelling is one of the most ubiquitous elementary processes in nature. Small structural changes in a molecular junction can lead to significant difference in the single-molecule electronic properties, offering a tremendous opportunity to examine a reaction on the single-molecule scale by monitoring the conductance changes. Here, we explore the potential of the single-molecule break junction technique in the detection of photo-thermal reaction processes of a photochromic dihydroazulene/vinylheptafulvene system. Statistical analysis of the break junction experiments provides a quantitative approach for probing the reaction kinetics and reversibility, including the occurrence of isomerization during the reaction. The product ratios observed when switching the system in the junction does not follow those observed in solution studies (both experiment and theory), suggesting that the junction environment was perturbing the process significantly. This study opens the possibility of using nano-structured environments like molecular junctions to tailor product ratios in chemical reactions.

  11. Acquiring Structural Information on Virus Particles with Charge Detection Mass Spectrometry

    NASA Astrophysics Data System (ADS)

    Keifer, David Z.; Motwani, Tina; Teschke, Carolyn M.; Jarrold, Martin F.

    2016-06-01

    Charge detection mass spectrometry (CDMS) is a single-molecule technique particularly well-suited to measuring the mass and charge distributions of heterogeneous, MDa-sized ions. In this work, CDMS has been used to analyze the assembly products of two coat protein variants of bacteriophage P22. The assembly products show broad mass distributions extending from 5 to 15 MDa for A285Y and 5 to 25 MDa for A285T coat protein variants. Because the charge of large ions generated by electrospray ionization depends on their size, the charge can be used to distinguish hollow shells from more compact structures. A285T was found to form T = 4 and T = 7 procapsids, and A285Y makes a small number of T = 3 and T = 4 procapsids. Owing to the decreased stability of the A285Y and A285T particles, chemical cross-linking was required to stabilize them for electrospray CDMS. Graphical Abstract[Figure not available: see fulltext.

  12. Large-area, flexible imaging arrays constructed by light-charge organic memories

    PubMed Central

    Zhang, Lei; Wu, Ti; Guo, Yunlong; Zhao, Yan; Sun, Xiangnan; Wen, Yugeng; Yu, Gui; Liu, Yunqi

    2013-01-01

    Existing organic imaging circuits, which offer attractive benefits of light weight, low cost and flexibility, are exclusively based on phototransistor or photodiode arrays. One shortcoming of these photo-sensors is that the light signal should keep invariant throughout the whole pixel-addressing and reading process. As a feasible solution, we synthesized a new charge storage molecule and embedded it into a device, which we call light-charge organic memory (LCOM). In LCOM, the functionalities of photo-sensor and non-volatile memory are integrated. Thanks to the deliberate engineering of electronic structure and self-organization process at the interface, 92% of the stored charges, which are linearly controlled by the quantity of light, retain after 20000 s. The stored charges can also be non-destructively read and erased by a simple voltage program. These results pave the way to large-area, flexible imaging circuits and demonstrate a bright future of small molecular materials in non-volatile memory. PMID:23326636

  13. Computer simulations and theoretical aspects of the depletion interaction in protein-oligomer mixtures.

    PubMed

    Boncina, M; Rescic, J; Kalyuzhnyi, Yu V; Vlachy, V

    2007-07-21

    The depletion interaction between proteins caused by addition of either uncharged or partially charged oligomers was studied using the canonical Monte Carlo simulation technique and the integral equation theory. A protein molecule was modeled in two different ways: either as (i) a hard sphere of diameter 30.0 A with net charge 0, or +5, or (ii) as a hard sphere with discrete charges (depending on the pH of solution) of diameter 45.4 A. The oligomers were pictured as tangentially jointed, uncharged, or partially charged, hard spheres. The ions of a simple electrolyte present in solution were represented by charged hard spheres distributed in the dielectric continuum. In this study we were particularly interested in changes of the protein-protein pair-distribution function, caused by addition of the oligomer component. In agreement with previous studies we found that addition of a nonadsorbing oligomer reduces the phase stability of solution, which is reflected in the shape of the protein-protein pair-distribution function. The value of this function in protein-protein contact increases with increasing oligomer concentration, and is larger for charged oligomers. The range of the depletion interaction and its strength also depend on the length (number of monomer units) of the oligomer chain. The integral equation theory, based on the Wertheim Ornstein-Zernike approach applied in this study, was found to be in fair agreement with Monte Carlo results only for very short oligomers. The computer simulations for a model mimicking the lysozyme molecule (ii) are in qualitative agreement with small-angle neutron experiments for lysozyme-dextran mixtures.

  14. Single Molecule Spectroelectrochemistry of Interfacial Charge Transfer Dynamics In Hybrid Organic Solar Cell

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pan, Shanlin

    2014-11-16

    Our research under support of this DOE grant is focused on applied and fundamental aspects of model organic solar cell systems. Major accomplishments are: 1) we developed a spectroelectorchemistry technique of single molecule single nanoparticle method to study charge transfer between conjugated polymers and semiconductor at the single molecule level. The fluorescence of individual fluorescent polymers at semiconductor surfaces was shown to exhibit blinking behavior compared to molecules on glass substrates. Single molecule fluorescence excitation anisotropy measurements showed the conformation of the polymer molecules did not differ appreciably between glass and semiconductor substrates. The similarities in molecular conformation suggest thatmore » the observed differences in blinking activity are due to charge transfer between fluorescent polymer and semiconductor, which provides additional pathways between states of high and low fluorescence quantum efficiency. Similar spectroelectrochemistry work has been done for small organic dyes for understand their charge transfer dynamics on various substrates and electrochemical environments; 2) We developed a method of transferring semiconductor nanoparticles (NPs) and graphene oxide (GO) nanosheets into organic solvent for a potential electron acceptor in bulk heterojunction organic solar cells which employed polymer semiconductor as the electron donor. Electron transfer from the polymer semiconductor to semiconductor and GO in solutions and thin films was established through fluorescence spectroscopy and electroluminescence measurements. Solar cells containing these materials were constructed and evaluated using transient absorption spectroscopy and dynamic fluorescence techniques to understand the charge carrier generation and recombination events; 3) We invented a spectroelectorchemistry technique using light scattering and electroluminescence for rapid size determination and studying electrochemistry of single NPs in an electrochemical cell. For example, we are able to use this technique to track electroluminescence of single Au NPs, and the electrodeposition of individual Ag NPs in-situ. These metallic NPs are useful to enhance light harvesting in organic photovoltaic systems. The scattering at the surface of an indium tin oxide (ITO) working electrode was measured during a potential sweep. Utilizing Mie scattering theory and high resolution scanning electron microscopy (SEM), the scattering data were used to calculate current-potential curves depicting the electrodeposition of individual Ag NPs. The oxidation of individual presynthesized and electrodeposited Ag NPs was also investigated using fluorescence and DFS microscopies. Our work has produced 1 US provisional patent, 15 published manuscripts, 1 submitted and two additional in-writing manuscripts. 5 graduate students, 1 postdoctoral student, 1 visiting professor, and two undergraduate students have received research training in the area of electrochemistry and optical spectroscopy under support of this award.« less

  15. Theoretical investigations on molecular structure, vibrational spectra, HOMO, LUMO, NBO analysis and hyperpolarizability calculations of thiophene-2-carbohydrazide.

    PubMed

    Balachandran, V; Janaki, A; Nataraj, A

    2014-01-24

    The Fourier-Transform infrared and Fourier-Transform Raman spectra of thiophene-2-carbohydrazide (TCH) was recorded in the region 4000-400 cm(-1) and 3500-100 cm(-1). Quantum chemical calculations of energies, geometrical structure and vibrational wavenumbers of TCH were carried out by DFT (B3LYP) method with 6-311++G(d,p) as basis set. The difference between the observed and scaled wavenumber values of most of the fundamentals is very small. Stability of the molecule arising from hyper conjugative interaction and charge delocalization has been analyzed using natural bond orbital (NBO) analysis. UV spectrum was measured in different solvent. The energy and oscillator strength are calculated by Time Dependant Density Functional Theory (TD-DFT) results. The calculated HOMO and LUMO energies also confirm that charge transfer occurs within the molecule. The complete assignments were performed on the basis of the potential energy distribution (PED) of vibrational modes, calculated with scaled quantum mechanics (SQM) method. Finally the theoretical FT-IR, FT-Raman, and UV spectra of the title molecule have also been constructed. Copyright © 2013 Elsevier B.V. All rights reserved.

  16. Mechanism of charge transfer and its impacts on Fermi-level pinning for gas molecules adsorbed on monolayer WS2.

    PubMed

    Zhou, Changjie; Yang, Weihuang; Zhu, Huili

    2015-06-07

    Density functional theory calculations were performed to assess changes in the geometric and electronic structures of monolayer WS2 upon adsorption of various gas molecules (H2, O2, H2O, NH3, NO, NO2, and CO). The most stable configuration of the adsorbed molecules, the adsorption energy, and the degree of charge transfer between adsorbate and substrate were determined. All evaluated molecules were physisorbed on monolayer WS2 with a low degree of charge transfer and accept charge from the monolayer, except for NH3, which is a charge donor. Band structure calculations showed that the valence and conduction bands of monolayer WS2 are not significantly altered upon adsorption of H2, H2O, NH3, and CO, whereas the lowest unoccupied molecular orbitals of O2, NO, and NO2 are pinned around the Fermi-level when these molecules are adsorbed on monolayer WS2. The phenomenon of Fermi-level pinning was discussed in light of the traditional and orbital mixing charge transfer theories. The impacts of the charge transfer mechanism on Fermi-level pinning were confirmed for the gas molecules adsorbed on monolayer WS2. The proposed mechanism governing Fermi-level pinning is applicable to the systems of adsorbates on recently developed two-dimensional materials, such as graphene and transition metal dichalcogenides.

  17. Carbon Nanotube Devices Engineered by Atomic Force Microscopy

    NASA Astrophysics Data System (ADS)

    Prisbrey, Landon

    This dissertation explores the engineering of carbon nanotube electronic devices using atomic force microscopy (AFM) based techniques. A possible application for such devices is an electronic interface with individual biological molecules. This single molecule biosensing application is explored both experimentally and with computational modeling. Scanning probe microscopy techniques, such as AFM, are ideal to study nanoscale electronics. These techniques employ a probe which is raster scanned above a sample while measuring probe-surface interactions as a function of position. In addition to topographical and electrostatic/magnetic surface characterization, the probe may also be used as a tool to manipulate and engineer at the nanoscale. Nanoelectronic devices built from carbon nanotubes exhibit many exciting properties including one-dimensional electron transport. A natural consequence of onedimensional transport is that a single perturbation along the conduction channel can have extremely large effects on the device's transport characteristics. This property may be exploited to produce electronic sensors with single-molecule resolution. Here we use AFM-based engineering to fabricate atomic-sized transistors from carbon nanotube network devices. This is done through the incorporation of point defects into the carbon nanotube sidewall using voltage pulses from an AFM probe. We find that the incorporation of an oxidative defect leads to a variety of possible electrical signatures including sudden switching events, resonant scattering, and breaking of the symmetry between electron and hole transport. We discuss the relationship between these different electronic signatures and the chemical structure/charge state of the defect. Tunneling through a defect-induced Coulomb barrier is modeled with numerical Verlet integration of Schrodinger's equation and compared with experimental results. Atomic-sized transistors are ideal for single-molecule applications due to their sensitivity to electric fields with very small detection volumes. In this work we demonstrate these devices as single-molecule sensors to detect individual N-(3-Dimethylaminopropyl)- N'-ethylcarbodiimide (EDC) molecules in an aqueous environment. An exciting application of these sensors is to study individual macromolecules participating in biological reactions, or undergoing conformational change. However, it is unknown whether the associated electrostatic signals exceed detection limits. We report calculations which reveal that enzymatic processes, such as substrate binding and internal protein dynamics, are detectable at the single-molecule level using existing atomic-sized transistors. Finally, we demonstrate the use of AFM-based engineering to control the function of nanoelectronic devices without creating a point defect in the sidewall of the nanotube. With a biased AFM probe we write charge patterns on a silicon dioxide surface in close proximity to a carbon nanotube device. The written charge induces image charges in the nearby electronics, and can modulate the Fermi level in a nanotube by +/-1 eV. We use this technique to induce a spatially controlled doping charge pattern in the conduction channel, and thereby reconfigure a field-effect transistor into a pn junction. Other simple charge patterns could be used to create other devices. The doping charge persists for days and can be erased and rewritten, offering a new tool for prototyping nanodevices and optimizing electrostatic doping profiles.

  18. Geometry, bonding and magnetism in planar triangulene graphene molecules with D3h symmetry: Zigzag Cm∗∗2+4m+1H3m+3 (m = 2, …, 15)

    NASA Astrophysics Data System (ADS)

    Philpott, Michael R.; Cimpoesu, Fanica; Kawazoe, Yoshiyuki

    2008-12-01

    Ab initio plane wave based all valence electron DFT calculations with geometry optimization are reported for the electronic structure of planar zigzag edged triangular shaped graphene molecules CH where the zigzag ring number m = 2, …, 15. The largest molecule C 286H 48 has a 3.8 nm side length and retains D3h symmetric geometry. The zone in the middle of the molecules, where the geometry and electronic properties resemble infinite single sheet graphite (graphene), expands with increasing ring number m, driving deviations in geometry, charge and spin to the perimeter. If a molecule is viewed as a set of nested triangular rings of carbon, then the zone where the lattice resembles an infinite sheet of graphene with CC = 142 pm, extends to the middle of the penultimate ring. The radial bonds joining the perimeter carbon atoms to the interior are long CC = 144 pm, except near the three apexes where the bonds are shorter. Isometric surfaces of the total charge density show that the two bonds joined at the apex have the highest valence charge. The perimeter CC bonds establish a simple pattern as the zigzag number increases, which shares some features with the zigzag edges in the D2h linear acenes C 4m+2H 2m+4 and the D6h hexangulenes CH6m but not the D6h symmetric annulenes (CH). The two CC bonds forming each apex are short (≈139 pm), next comes one long bond CC ≈ 142 pm and a middle region where all the CC bonds have length ≈141 pm. The homo-lumo gap declines from 0.53 eV at m = 2 to approximately 0.29 V at m = 15, the latter being larger than found for linear or hexagonal shaped graphenes with comparable edge lengths. Across the molecule the charge on the carbon atoms undergoes a small oscillation following the bipartite lattice. The magnitude of the charge in the same nested triangle decreases monotonically with the distance of the row from the center of the molecule. These systems are predicted to have spin polarized ground states with S = ½( m - 1), in accord with the theorems of Lieb for a bipartite lattice with unequal numbers of sub-lattice carbon atoms. The magnitude of the spin on the atoms increases monotonically from the center to the edges, this effect being greatest on the majority A-sub lattice atoms. The spins are delocalized, not confined to specific atoms as might result in geometries stabilized by islands of aromatic resonance. In the largest systems the magnetic non-bonding levels (NBL) occur as a narrowly distributed set of homos close to the Fermi level, separated from the lower lying valence bond manifold by a gap of about 1 eV. The NBL are a set of disjoint radical orbitals having charge only on atoms belonging to the A-lattice and this charge is concentrated on the perimeter and penultimate row atoms.

  19. Using quantum dynamics simulations to follow the competition between charge migration and charge transfer in polyatomic molecules

    NASA Astrophysics Data System (ADS)

    Spinlove, K. E.; Vacher, M.; Bearpark, M.; Robb, M. A.; Worth, G. A.

    2017-01-01

    Recent work, particularly by Cederbaum and co-workers, has identified the phenomenon of charge migration, whereby charge flow occurs over a static molecular framework after the creation of an electronic wavepacket. In a real molecule, this charge migration competes with charge transfer, whereby the nuclear motion also results in the re-distribution of charge. To study this competition, quantum dynamics simulations need to be performed. To break the exponential scaling of standard grid-based algorithms, approximate methods need to be developed that are efficient yet able to follow the coupled electronic-nuclear motion of these systems. Using a simple model Hamiltonian based on the ionisation of the allene molecule, the performance of different methods based on Gaussian Wavepackets is demonstrated.

  20. Nonlinear Optics and Organic Materials

    DTIC Science & Technology

    1989-10-01

    incrementally by making small changes in the generating optical harmonics. However, deficiencies in backbone or substituents. In this way the chemist can...experimental determination of Otx.l = 4.5 X 10-32 esu. ability of polymeric molecules to generate third Key parameters extracted from the UV and visible...solubility of most active organics in negative charge at the other end, thus generating a the polymer and their tendency to segregate or migrate out

  1. Effect of methyl groups on conformational properties of small ionized comb-like polyelectrolytes at the atomic level.

    PubMed

    Zhao, Hongxia; Liu, Jiaping; Ran, Qianping; Yang, Yong; Shu, Xin

    2017-03-01

    Comb-like polycarboxylate ether (PCE) molecules with different content of methyl groups substituted on backbone and different location of methyl groups substituted on the side chains, respectively, were designed and were studied in explicit salt solutions by all-atom molecular dynamics simulations. Methyl groups substituted on the backbone of PCE have a great effect on the conformation of PCE. Stiffness of charged backbone was not only affected by the rotational freedom but also the electrostatic repulsion between the charged COO - groups. The interaction of counterions (Na + ) with COO - groups for PCE3 (with part of AA substituted by MAA on the backbone) was stronger and the screen effect was great, which decided the smaller size of PCE3. The interaction between water and COO - groups was strong regardless of the content of AA substituted by MAA on the backbone. The effect of methyl groups substituted on the different location of side chains on the conformation of PCE was less than that of methyl groups substituted on the backbone. The equilibrium sizes of the four PCE molecules with methyl groups substituted on the side chains were similar. Graphical Abstract Effect of methyl groups on conformational properties of small ionized comb-like polyelectrolytes at the atomic level.

  2. The importance of electrostatic potential in the interaction of sweet proteins with the sweet taste receptor.

    PubMed

    Esposito, Veronica; Gallucci, Roberta; Picone, Delia; Saviano, Gabriella; Tancredi, Teodorico; Temussi, Piero A

    2006-07-07

    In addition to many small molecular mass sweeteners there are in nature a few sweet proteins. The molecular volume of sweet proteins is so different from that of common sweeteners that it was difficult to understand how molecules as large as proteins can activate a receptor designed to host small molecules. We have recently shown that sweet proteins can activate the sweet receptor by a mechanism of interaction, called ''wedge model", in which proteins fit a large cavity of the receptor with wedge-shaped surfaces of their structures. In order to substantiate this model we have designed, expressed and characterized seven mutants of MNEI, a single chain monellin. Three uncharged residues of the interaction surface, Met42, Tyr63 and Tyr65, were changed either into acidic or basic residues whereas Asp68, a key acidic residue, was changed into a basic one. As a general trend, we observe that an increase of the negative charge is much more detrimental for sweetness than an increase of positive charge. In addition we show that by a careful choice of a residue at the center of the interface between MNEI and receptor, it is possible even to increase the sweetness of MNEI. These results are fully consistent with the wedge model.

  3. Isoindigo-Based Small Molecules with Varied Donor Components for Solution-Processable Organic Field Effect Transistor Devices.

    PubMed

    Patil, Hemlata; Chang, Jingjing; Gupta, Akhil; Bilic, Ante; Wu, Jishan; Sonar, Prashant; Bhosale, Sheshanath V

    2015-09-18

    Two solution-processable small organic molecules, (E)-6,6'-bis(4-(diphenylamino)phenyl)-1,1'-bis(2-ethylhexyl)-(3,3'-biindolinylidene)-2,2'-dione (coded as S10) and (E)-6,6'-di(9H-carbazol-9-yl)-1,1'-bis(2-ethylhexyl)-(3,3'-biindolinylidene)-2,2'-dione (coded as S11) were successfully designed, synthesized and fully characterized. S10 and S11 are based on a donor-acceptor-donor structural motif and contain a common electron accepting moiety, isoindigo, along with different electron donating functionalities, triphenylamine and carbazole, respectively. Ultraviolet-visible absorption spectra revealed that the use of triphenylamine donor functionality resulted in an enhanced intramolecular charge transfer transition and reduction of optical band gap, when compared with its carbazole analogue. Both of these materials were designed to be donor semiconducting components, exerted excellent solubility in common organic solvents, showed excellent thermal stability, and their promising optoelectronic properties encouraged us to scrutinize charge-carrier mobilities using solution-processable organic field effect transistors. Hole mobilities of the order of 2.2 × 10(-4) cm²/Vs and 7.8 × 10(-3) cm²/Vs were measured using S10 and S11 as active materials, respectively.

  4. A study of the small-molecule system used to investigate the effect of arginine on antibody elution in hydrophobic charge-induction chromatography.

    PubMed

    Hirano, Atsushi; Maruyama, Takuya; Shiraki, Kentaro; Arakawa, Tsutomu; Kameda, Tomoshi

    2017-01-01

    Hydrophobic charge-induction chromatography (HCIC) using 4-mercaptoethylpyridine (4-MEP) as the ligand is used to purify antibodies. The 4-MEP resin ligand has high affinity for antibodies, which makes it difficult to optimize the elution conditions. Recent studies showed that arginine is effective at eluting and purifying antibodies using the HCIC with 4-MEP. In the present study, we investigated the mechanism of the action of arginine on the interaction between butyl gallate (BG) and the 4-MEP resin as a model system for protein-4-MEP interactions. Equilibrium adsorption experiments showed that arginine has a significant effect on the desorption of BG from the 4-MEP resin and, in fact, is found to exhibit a greater effectiveness than guanidine and urea, which are known denaturants. The calculated binding free energy between a BG molecule and a 4-MEP resin ligand molecule using molecular dynamics simulations was qualitatively consistent with the experimental results. A principal component analysis of the simulations showed that arginine molecules intervene in the interaction between the BG and 4-MEP molecules at a distance of 8.5 Å by entering the space between the phenol and pyridine planes. The present results suggest that arginine has a unique mechanism of interaction with the phenol-pyridine system, which should be associated with the effects of arginine on the protein-4-MEP systems. Copyright © 2016 Elsevier Inc. All rights reserved.

  5. Novel use of positively charged nylon transfer membranes for trapping indoleacetic acid or other small anions during efflux from plant tissues

    NASA Technical Reports Server (NTRS)

    Evans, M. L.; Hangarter, R. P.

    1993-01-01

    Positively charged nylon blotting membranes were used as an anion binding medium to trap [14C]indoleactic acid (IAA) as it exited cells at the basal ends of Coleus blumei L. stem and Zea mays L. coleoptile segments. Autoradiography was used to visualize where the [14C] that moved out of the cut ends was localized on the nylon membrane. Diffusion of [14C]IAA from the initial point of contact with the nylon membrane was minimal. Comparison of the autoradiograms with anatomical tissue prints of the cut ends of the segments was used to determine what tissues participate in IAA movement. The results of these initial studies were consistent with other reports suggesting that [14C]IAA movement was primarily associated with vascular tissues in both C. blumei stems and corn coleoptiles, but the resolution was not sufficient to identify which vascular tissues were involved in IAA transport. With further refinements, this technique could also be used for studying the movement of other small charged molecules through plant tissues.

  6. Novel use of positively charged nylon transfer membranes for trapping indoleacetic acid or other small anions during efflux from plant tissues.

    PubMed

    Cha M-R; Evans, M L; Hangarter, R P

    1993-01-01

    Positively charged nylon blotting membranes were used as an anion binding medium to trap [14C]indoleactic acid (IAA) as it exited cells at the basal ends of Coleus blumei L. stem and Zea mays L. coleoptile segments. Autoradiography was used to visualize where the [14C] that moved out of the cut ends was localized on the nylon membrane. Diffusion of [14C]IAA from the initial point of contact with the nylon membrane was minimal. Comparison of the autoradiograms with anatomical tissue prints of the cut ends of the segments was used to determine what tissues participate in IAA movement. The results of these initial studies were consistent with other reports suggesting that [14C]IAA movement was primarily associated with vascular tissues in both C. blumei stems and corn coleoptiles, but the resolution was not sufficient to identify which vascular tissues were involved in IAA transport. With further refinements, this technique could also be used for studying the movement of other small charged molecules through plant tissues.

  7. FTIR, FT-RAMAN, NMR, spectra, normal co-ordinate analysis, NBO, NLO and DFT calculation of N,N-diethyl-4-methylpiperazine-1-carboxamide molecule.

    PubMed

    Muthu, S; Elamurugu Porchelvi, E

    2013-11-01

    The Fourier Transform Infrared (FT-IR) and FT-Raman of N,N-diethyl-4-methylpiperazine-1-carboxamide (NND4MC) have been recorded and analyzed. The structure of the compound was optimized and the structural characteristics were determined by density functional theory (DFT) using B3LYP method with 6-31G(d,p) and 6-311G(d,p) basis sets. The difference between the observed and scaled wavenumber values of most of the fundamentals is very small. The theoretically predicted FT-IR and FT-Raman spectra of the title molecule have been constructed. The detailed interpretation of the vibrational spectra has been carried out with aid of normal coordinate analysis (NCA) following the scaled quantum mechanical force field methodology. Stability of the molecule arising from hyperconjugative interactions and charge delocalization has been analyzed using natural bond orbital (NBO) analysis. The results show that electron density (ED) in the σ(*) and π(*) antibonding orbitals and second order delocalization energies (E2) confirm the occurrence of intramolecular charge transfer (ICT) within the molecule. The electronic dipole moment (μD) and the first hyperpolarizability (βtot) values of the investigated molecule were computed using Density Functional Theory (DFT/B3LYP) with 6-31G(d,p) and 6-311G(d,p) basis sets. The calculated results also show that the NND4MC molecule may have microscopy nonlinear optical (NLO) behavior with non zero values. Mulliken atomic charges of NND4MC were calculated. The (13)C nuclear magnetic resonance (NMR) chemical shifts of the molecule were calculated by the gauge independent atomic orbital (GIAO) method and compared with experimental results. The UV-Vis spectrum of the compound was recorded. The theoretical electronic absorption spectra have been calculated by using CIS, TD-DFT methods. A study on the electronic properties, such as HOMO and LUMO energies, molecular electrostatic potential (MEP) were also performed. Copyright © 2013 Elsevier B.V. All rights reserved.

  8. Scaling Laws for NanoFET Sensors

    NASA Astrophysics Data System (ADS)

    Wei, Qi-Huo; Zhou, Fu-Shan

    2008-03-01

    In this paper, we report our numerical studies of the scaling laws for nanoplate field-effect transistor (FET) sensors by simplifying the nanoplates as random resistor networks. Nanowire/tube FETs are included as the limiting cases where the device width goes small. Computer simulations show that the field effect strength exerted by the binding molecules has significant impact on the scaling behaviors. When the field effect strength is small, nanoFETs have little size and shape dependence. In contrast, when the field-effect strength becomes stronger, there exists a lower detection threshold for charge accumulation FETs and an upper detection threshold for charge depletion FET sensors. At these thresholds, the nanoFET devices undergo a transition between low and large sensitivities. These thresholds may set the detection limits of nanoFET sensors. We propose to eliminate these detection thresholds by employing devices with very short source-drain distance and large width.

  9. Chemiresistive and Gravimetric Dual-Mode Gas Sensor toward Target Recognition and Differentiation.

    PubMed

    Chen, Yan; Zhang, Hao; Feng, Zhihong; Zhang, Hongxiang; Zhang, Rui; Yu, Yuanyuan; Tao, Jin; Zhao, Hongyuan; Guo, Wenlan; Pang, Wei; Duan, Xuexin; Liu, Jing; Zhang, Daihua

    2016-08-24

    We demonstrate a dual-mode gas sensor for simultaneous and independent acquisition of electrical and mechanical signals from the same gas adsorption event. The device integrates a graphene field-effect transistor (FET) with a piezoelectric resonator in a seamless manner by leveraging multiple structural and functional synergies. Dual signals resulting from independent physical processes, i.e., mass attachment and charge transfer can reflect intrinsic properties of gas molecules and potentially enable target recognition and quantification at the same time. Fabrication of the device is based on standard Integrated Circuit (IC) foundry processes and fully compatible with system-on-a-chip (SoC) integration to achieve extremely small form factors. In addition, the ability of simultaneous measurements of mass adsorption and charge transfer guides us to a more precise understanding of the interactions between graphene and various gas molecules. Besides its practical functions, the device serves as an effective tool to quantitatively investigate the physical processes and sensing mechanisms for a large library of sensing materials and target analytes.

  10. A Nonlinear Elasticity Model of Macromolecular Conformational Change Induced by Electrostatic Forces

    PubMed Central

    Zhou, Y. C.; Holst, Michael; McCammon, J. Andrew

    2008-01-01

    In this paper we propose a nonlinear elasticity model of macromolecular conformational change (deformation) induced by electrostatic forces generated by an implicit solvation model. The Poisson-Boltzmann equation for the electrostatic potential is analyzed in a domain varying with the elastic deformation of molecules, and a new continuous model of the electrostatic forces is developed to ensure solvability of the nonlinear elasticity equations. We derive the estimates of electrostatic forces corresponding to four types of perturbations to an electrostatic potential field, and establish the existance of an equilibrium configuration using a fixed-point argument, under the assumption that the change in the ionic strength and charges due to the additional molecules causing the deformation are sufficiently small. The results are valid for elastic models with arbitrarily complex dielectric interfaces and cavities, and can be generalized to large elastic deformation caused by high ionic strength, large charges, and strong external fields by using continuation methods. PMID:19461946

  11. Immune complexes with cationic antibodies deposit in glomeruli more effectively than cationic antibodies alone.

    PubMed

    Mannik, M; Gauthier, V J; Stapleton, S A; Agodoa, L Y

    1987-06-15

    In previously published studies, highly cationized antibodies alone and in immune complexes bound to glomeruli by charge-charge interaction, but only immune complexes persisted in glomeruli. Because normal IgG does not deposit in glomeruli, studies were conducted to determine whether cationized antibodies can be prepared which deposit in glomeruli when bound to antigen but not when free in circulation. A series of cationized rabbit antiHSA was prepared with the number of added amino groups ranging from 13.3 to 60.2 per antibody molecule. Antibodies alone or in preformed soluble immune complexes, prepared at fivefold or 50-fold antigen excess, were administered to mice. With the injection of a fixed dose of 100 micrograms per mouse, antibodies alone did not deposit in glomeruli with less than 29.6 added amino groups by immunofluorescence microscopy. In contrast, 100 micrograms of antibodies with 23.5 added amino groups in immune complexes, made at fivefold antigen excess, formed immune deposits in glomeruli. With selected preparations of cationized, radiolabeled antibodies, deposition in glomeruli was quantified by isolation of mouse glomeruli. These quantitative data were in good agreement with the results of immunofluorescence microscopy. Immune complexes made at 50-fold antigen excess, containing only small-latticed immune complexes with no more than two antibody molecules per complex, deposited in glomeruli similar to antibodies alone. Selected cationized antibodies alone or in immune complexes were administered to mice in varying doses. In these experiments, glomerular deposition of immune complexes, made at fivefold antigen excess, was detected with five- to 10-fold smaller doses than the deposition of the same antibodies alone. These studies demonstrate that antibody molecules in immune complexes are more likely to deposit in glomeruli by charge-charge interactions than antibodies alone.

  12. Metal oxide charge transport material doped with organic molecules

    DOEpatents

    Forrest, Stephen R.; Lassiter, Brian E.

    2016-08-30

    Doping metal oxide charge transport material with an organic molecule lowers electrical resistance while maintaining transparency and thus is optimal for use as charge transport materials in various organic optoelectronic devices such as organic photovoltaic devices and organic light emitting devices.

  13. Analysis of the biological activity of antilymphocyte serum

    PubMed Central

    Perper, R. J.; Monovich, R. E.; Van Gorder, T. J.

    1971-01-01

    Two IgG subfractions of horse antilymphocyte serum (ALS) were obtained by DEAE Sephadex chromatography. Although the fractions did not differ antigenically, they differed on amino acid and carbohydrate analysis, and in electrophoretic mobility. As demonstrated by binding studies, only the most positively charged population of IgG molecules (fraction 1) obtained from anti-lymphocyte serum had specificity for the small lymphocyte; 50 per cent of the molecules in this population bound specifically to lymphocytes in vitro. As determined by an in vitro correlate of immunosuppressive potency (rosette inhibition), fraction 1 (F1) IgG from ALS contained approximately 4 times the specific activity of fraction 2 (F2). F1 was significantly more effective in prolonging skin graft survival than F2, whereas F2 contained the major component of the non-specific anti-inflammatory activity of serum. The anti-inflammatory effect was mediated by anticomplement activity. F2 was found to be an effective inhibitor of the immunosuppressive activity of F1 both in vivo and in vitro. Quantitative studies indicated that 1 part of F2 could maximally inhibit 4 parts of F1. The percentage of F2 present in serum IgG was inversely related to the skin graft survival elicited by the serum, which indicated that F2 was active as an inhibitor when tested as purified fraction as well as in unfractionated serum. Following immunization when F1 gained immunosuppressive potency, it lost non-specific anti-inflammatory activity. These observations indicated that not only was there a quantitative, as well as a qualitative concentration of immunosuppressive antibodies in F1, but also that this activity was controlled by the concentration of F2. This report, therefore, describes an IgG control mechanism which can limit the expression of antibody induced biological activity. It is suggested that in ALS the immunosuppressive antibody molecules possess a greater net positive charge than the remaining population, and that this is due to the degree of the negative charge on the immunizing antigen. Using DEAE Sephadex chromatography, these populations could be separated into two differently charged populations of molecules, only one of which had significant immunosuppressive capability. This increase in activity resulted from the increase of specific molecules, the loss of non-specific molecules, and was manifest upon the removal of an IgG inhibitor. ImagesFIG. 1FIG. 2 PMID:4943146

  14. Small-scale Detonation Velocity Measurement of Select CL-20 Cocrystals

    NASA Astrophysics Data System (ADS)

    Vuppuluri, Vasant; Gunduz, I. Emre; Son, Steven F.

    2017-06-01

    The challenge of developing novel energetic materials makes cocrystallization using existing energetic molecules useful. Cocrystallization of CL-20 with other high explosives such as HMX has been demonstrated previously to yield novel energetic materials and may have favorable detonation performance. However, detonation performance characterization of these cocrystals is challenging due to limited availability of material. Also, the contribution of bonding energy between coformers contained within the cocrystal is not well-understood. We present the comparison of steady detonation velocities of CL-20 cocrystals to their corresponding physical mixtures using microwave interferometry. With less than 1.5 g of the cocrystal material contained within 6.52 mm diameter charges, shot-to-shot variation in detonation velocity of only about 100 m/s are achievable with this technique. This variation is adequate to resolve relatively small differences between physical mixed explosive molecules and cocrystals.

  15. Molecular Dynamics Studies of Structure and Functions of Water-Membrane Interfaces

    NASA Technical Reports Server (NTRS)

    Pohorille, Andrew; Wilson, Michael A.; DeVincenzi, Donald L. (Technical Monitor)

    2001-01-01

    A large number of essential cellular processes occur at the interfaces between water and membranes. The selectivity and dynamics of these processes are largely determined by the structural and electrical properties of the water-membrane interface. We investigate these properties by the molecular dynamics method. Over the time scales of the simulations, the membrane undergoes fluctuations described by the capillary wave model. These fluctuations produce occasional thinning defects in the membrane which provide effective pathways for passive transport of ions and small molecules across the membrane. Ions moving through the membrane markedly disrupt its structure and allow for significant water penetration into the membrane interior. Selectivity of transport, with respect to ionic charge, is determined by the interfacial electrostatic potential. Many small molecules. of potential significance in catalysis, bioenergetics and pharmacology, are shown to bind to the interface. The energetics and dynamics of this process will be discussed.

  16. Effect of organic small-molecule hole injection materials on the performance of inverted organic solar cells

    NASA Astrophysics Data System (ADS)

    Li, Jie; Zheng, Yifan; Zheng, Ding; Yu, Junsheng

    2016-07-01

    In this study, the influence of small-molecule organic hole injection materials on the performance of organic solar cells (OSCs) as the hole transport layer (HTL) with an architecture of ITO/ZnO/P3HT:PC71BM/HTL/Ag has been investigated. A significant enhancement on the performance of OSCs from 1.06% to 2.63% is obtained by using N, N‧-bis(1-naphthalenyl)-N, N‧-bis-phenyl-(1, 1‧-biphenyl)-4, 4‧-diamine (NPB) HTL. Through the resistance simulation and space-charge limited current analysis, we found that NPB HTL cannot merely improve the hole mobility of the device but also form the Ohmic contact between the active layer and anode. Besides, when we apply mix HTL by depositing the NPB on the surface of molybdenum oxide, the power conversion efficiency of OSC are able to be further improved to 2.96%.

  17. Space charge characteristics of fluorinated polyethylene: Different effects of fluorine and oxygen

    NASA Astrophysics Data System (ADS)

    Zhao, Ni; Nie, Yongjie; Li, Shengtao

    2018-04-01

    Direct fluorination are proved having obvious effect on space charge characteristics of polyethylene. It is believed that fluorine has a positive effect on suppressing space charge injection while oxygen impurity has a negative effect. However, the mechanism for the opposite effect of fluorine and oxygen is still not clear. In this paper, the different effects of fluorine and oxygen on space charge characteristics of fluorinated low density polyethylene (LDPE) are investigated on the basis of dielectric property, chemical constitutes and trap performance of surface fluorinated layers. The results show that direct fluorination has obvious effect on chemical constitutes and dielectric properties of surface fluorinated layer. Introduced fluorine is the main factor for suppressing charge injection from the electrodes, because it seriously changes the chemical constitutes and further the trap properties of the surface fluorinated layer. While introduction of oxygen results in heterocharges and makes space charge distribution complex, due to the ionization of generated small groups like C=O containing groups. Moreover, direct fluorination will result in cleavage of some LDPE molecules whatever there is oxygen impurity or not.

  18. Atomic Radius and Charge Parameter Uncertainty in Biomolecular Solvation Energy Calculations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yang, Xiu; Lei, Huan; Gao, Peiyuan

    Atomic radii and charges are two major parameters used in implicit solvent electrostatics and energy calculations. The optimization problem for charges and radii is under-determined, leading to uncertainty in the values of these parameters and in the results of solvation energy calculations using these parameters. This paper presents a method for quantifying this uncertainty in solvation energies using surrogate models based on generalized polynomial chaos (gPC) expansions. There are relatively few atom types used to specify radii parameters in implicit solvation calculations; therefore, surrogate models for these low-dimensional spaces could be constructed using least-squares fitting. However, there are many moremore » types of atomic charges; therefore, construction of surrogate models for the charge parameter space required compressed sensing combined with an iterative rotation method to enhance problem sparsity. We present results for the uncertainty in small molecule solvation energies based on these approaches. Additionally, we explore the correlation between uncertainties due to radii and charges which motivates the need for future work in uncertainty quantification methods for high-dimensional parameter spaces.« less

  19. Approaching Intra- and Interchain Charge Transport of Conjugated Polymers Facilely by Topochemical Polymerized Single Crystals.

    PubMed

    Yao, Yifan; Dong, Huanli; Liu, Feng; Russell, Thomas P; Hu, Wenping

    2017-08-01

    Charge transport of small molecules is measured well with scanning tunneling microscopy, conducting atomic force microscopy, break junction, nanopore, and covalently bridging gaps. However, the manipulation and measurement of polymer chains remain a long-standing fundamental issue in conjugated polymers and full of challenge since conjugated polymers are naturally disordered materials. Here, a fundamental breakthrough in generating high-quality conjugated-polymer nanocrystals with extended conjugation and exceptionally high degrees of order using a surface-supported topochemical polymerization method is demonstrated. In the crystal the conjugated-polymer chains are extended along the long axis of the crystal with the side chains perpendicular to the long axis. Devices with conducting channels along the polymer chains show efficient charge transport, nearly two orders of magnitude greater than the interchain charge transport along the π-π stacking direction. This is the first example to clarify intra- and interchain charge transport based on an individual single crystal of conjugated polymers, and demonstrate the importance of intrachain charge transport in plastic electronics. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Heparan Sulfate and Chondroitin Sulfate Glycosaminoglycans Are Targeted by Bleomycin in Cancer Cells.

    PubMed

    Li, Xiulian; Lan, Ying; He, Yanli; Liu, Yong; Luo, Heng; Yu, Haibo; Song, Ni; Ren, Sumei; Liu, Tianwei; Hao, Cui; Guo, Yunliang; Zhang, Lijuan

    2017-01-01

    Bleomycin is a clinically used anti-cancer drug that produces DNA breaks once inside of cells. However, bleomycin is a positively charged molecule and cannot get inside of cells by free diffusion. We previously reported that the cell surface negatively charged glycosaminoglycans (GAGs) may be involved in the cellular uptake of bleomycin. We also observed that a class of positively charged small molecules has Golgi localization once inside of the cells. We therefore hypothesized that bleomycin might perturb Golgi-operated GAG biosynthesis. We used stable isotope labeling coupled with LC/MS analysis of GAG disaccharides simultaneously from bleomycin-treated and non-treated cancer cells. To further understand the cytotoxicity of bleomycin and its relationship to GAGs, we used sodium chlorate to inhibit GAG sulfation and commercially available GAGs to compete for cell surface GAG/bleomycin interactions in seven cell lines including CHO745 defective in both heparan sulfate and chondroitin sulfate biosynthesis. we discovered that heparan sulfate GAG was significantly undersulfated and the quantity and disaccharide compositions of GAGs were changed in bleomycin-treated cells in a concentration- and time-dependent manner. We revealed that bleomycin-induced cytotoxicity was directly related to cell surface GAGs. GAGs were targeted by bleomycin both at cell surface and at Golgi. Thus, GAGs might be the biological relevant molecules that might be related to the bleomycin-induced fibrosis in certain cancer patients, a severe side effect with largely unknown molecular mechanism. © 2017 The Author(s). Published by S. Karger AG, Basel.

  1. The composition of liquid atmospheric pressure matrix-assisted laser desorption/ionization matrices and its effect on ionization in mass spectrometry.

    PubMed

    Ryumin, Pavel; Cramer, Rainer

    2018-07-12

    New liquid atmospheric pressure (AP) matrix-assisted laser desorption/ionization (MALDI) matrices that produce predominantly multiply charged ions have been developed and evaluated with respect to their performance for peptide and protein analysis by mass spectrometry (MS). Both the chromophore and the viscous support liquid in these matrices were optimized for highest MS signal intensity, S/N values and maximum charge state. The best performance in both protein and peptide analysis was achieved employing light diols as matrix support liquids (e.g. ethylene glycol and propylene glycol). Investigating the influence of the chromophore, it was found that 2,5-dihydroxybenzoic acid resulted in a higher analyte ion signal intensity for the analysis of small peptides; however, larger molecules (>17 kDa) were undetectable. For larger molecules, a sample preparation based on α-cyano-4-hydroxycinnammic acid as the chromophore was developed and multiply protonated analytes with charge states of more than 50 were detected. Thus, for the first time it was possible to detect with MALDI MS proteins as large as ∼80 kDa with a high number of charge states, i.e. m/z values below 2000. Systematic investigations of various matrix support liquids have revealed a linear dependency between laser threshold energy and surface tension of the liquid MALDI sample. Copyright © 2018 Elsevier B.V. All rights reserved.

  2. Probing the effect of charge transfer enhancement in off resonance mode SERS via conjugation of the probe dye between silver nanoparticles and metal substrates.

    PubMed

    Selvakannan, Pr; Ramanathan, Rajesh; Plowman, Blake J; Sabri, Ylias M; Daima, Hemant K; O'Mullane, Anthony P; Bansal, Vipul; Bhargava, Suresh K

    2013-08-21

    The charge transfer-mediated surface enhanced Raman scattering (SERS) of crystal violet (CV) molecules that were chemically conjugated between partially polarized silver nanoparticles and optically smooth gold and silver substrates has been studied under off-resonant conditions. Tyrosine molecules were used as a reducing agent to convert silver ions into silver nanoparticles where oxidised tyrosine caps the silver nanoparticle surface with its semiquinone group. This binding through the quinone group facilitates charge transfer and results in partially oxidised silver. This establishes a chemical link between the silver nanoparticles and the CV molecules, where the positively charged central carbon of CV molecules can bind to the terminal carboxylate anion of the oxidised tyrosine molecules. After drop casting Ag nanoparticles bound with CV molecules it was found that the free terminal amine groups tend to bind with the underlying substrates. Significantly, only those CV molecules that were chemically conjugated between the partially polarised silver nanoparticles and the underlying gold or silver substrates were found to show SERS under off-resonant conditions. The importance of partial charge transfer at the nanoparticle/capping agent interface and the resultant conjugation of CV molecules to off resonant SERS effects was confirmed by using gold nanoparticles prepared in a similar manner. In this case the capping agent binds to the nanoparticle through the amine group which does not facilitate charge transfer from the gold nanoparticle and under these conditions SERS enhancement in the sandwich configuration was not observed.

  3. Studying a Drug-like, RNA-Focused Small Molecule Library Identifies Compounds That Inhibit RNA Toxicity in Myotonic Dystrophy.

    PubMed

    Rzuczek, Suzanne G; Southern, Mark R; Disney, Matthew D

    2015-12-18

    There are many RNA targets in the transcriptome to which small molecule chemical probes and lead therapeutics are desired. However, identifying compounds that bind and modulate RNA function in cellulo is difficult. Although rational design approaches have been developed, they are still in their infancies and leave many RNAs "undruggable". In an effort to develop a small molecule library that is biased for binding RNA, we computationally identified "drug-like" compounds from screening collections that have favorable properties for binding RNA and for suitability as lead drugs. As proof-of-concept, this collection was screened for binding to and modulating the cellular dysfunction of the expanded repeating RNA (r(CUG)(exp)) that causes myotonic dystrophy type 1. Hit compounds bind the target in cellulo, as determined by the target identification approach Competitive Chemical Cross-Linking and Isolation by Pull-down (C-ChemCLIP), and selectively improve several disease-associated defects. The best compounds identified from our 320-member library are more potent in cellulo than compounds identified by high-throughput screening (HTS) campaigns against this RNA. Furthermore, the compound collection has a higher hit rate (9% compared to 0.01-3%), and the bioactive compounds identified are not charged; thus, RNA can be "drugged" with compounds that have favorable pharmacological properties. Finally, this RNA-focused small molecule library may serve as a useful starting point to identify lead "drug-like" chemical probes that affect the biological (dys)function of other RNA targets by direct target engagement.

  4. Nanoscale structure, dynamics and power conversion efficiency correlations in small molecule and oligomer-based photovoltaic devices

    PubMed Central

    Szarko, Jodi M.; Guo, Jianchang; Rolczynski, Brian S.; Chen, Lin X.

    2011-01-01

    Photovoltaic functions in organic materials are intimately connected to interfacial morphologies of molecular packing in films on the nanometer scale and molecular levels. This review will focus on current studies on correlations of nanoscale morphologies in organic photovoltaic (OPV) materials with fundamental processes relevant to photovoltaic functions, such as light harvesting, exciton splitting, exciton diffusion, and charge separation (CS) and diffusion. Small molecule photovoltaic materials will be discussed here. The donor and acceptor materials in small molecule OPV devices can be fabricated in vacuum-deposited, multilayer, crystalline thin films, or spin-coated together to form blended bulk heterojunction (BHJ) films. These two methods result in very different morphologies of the solar cell active layers. There is still a formidable debate regarding which morphology is favored for OPV optimization. The morphology of the conducting films has been systematically altered; using variations of the techniques above, the whole spectrum of film qualities can be fabricated. It is possible to form a highly crystalline material, one which is completely amorphous, or an intermediate morphology. In this review, we will summarize the past key findings that have driven organic solar cell research and the current state-of-the-art of small molecule and conducting oligomer materials. We will also discuss the merits and drawbacks of these devices. Finally, we will highlight some works that directly compare the spectra and morphology of systematically elongated oligothiophene derivatives and compare these oligomers to their polymer counterparts. We hope this review will shed some new light on the morphology differences of these two systems. PMID:22110870

  5. Charge transport network dynamics in molecular aggregates

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jackson, Nicholas E.; Chen, Lin X.; Ratner, Mark A.

    2016-07-20

    Due to the nonperiodic nature of charge transport in disordered systems, generating insight into static charge transport networks, as well as analyzing the network dynamics, can be challenging. Here, we apply time-dependent network analysis to scrutinize the charge transport networks of two representative molecular semiconductors: a rigid n-type molecule, perylenediimide, and a flexible p-type molecule, bBDT(TDPP)2. Simulations reveal the relevant timescale for local transfer integral decorrelation to be ~100 fs, which is shown to be faster than that of a crystalline morphology of the same molecule. Using a simple graph metric, global network changes are observed over timescales competitive withmore » charge carrier lifetimes. These insights demonstrate that static charge transport networks are qualitatively inadequate, whereas average networks often overestimate network connectivity. Finally, a simple methodology for tracking dynamic charge transport properties is proposed.« less

  6. Optical Spectroscopy Of Charged Quantum Dot Molecules

    NASA Astrophysics Data System (ADS)

    Scheibner, M.; Bracker, A. S.; Stinaff, E. A.; Doty, M. F.; Gammon, D.; Ponomarev, I. V.; Reinecke, T. L.; Korenev, V. L.

    2007-04-01

    Coupling between two closely spaced quantum dots is observed by means of photoluminescence spectroscopy. Hole coupling is realized by rational crystal growth and heterostructure design. We identify molecular resonances of different excitonic charge states, including the important case of a doubly charged quantum dot molecule.

  7. Electrophoretic assembly of organic molecules and composites for electrochemical supercapacitors.

    PubMed

    Su, Y; Zhitomirsky, I

    2013-02-15

    Electrophoretic deposition (EPD) method has been developed for the fabrication of 1-pyrenebutyric acid (PBH) films from aqueous solutions. The films can be deposited at constant voltage or potentiodynamic conditions. The method allowed the formation of 0.1-2 μm thick films, containing needle-shape PBH particles. The deposition mechanism involved the electrophoresis, pH decrease at the anode surface, charge neutralization and formation of insoluble PBH films. The film morphology and shape of the PBH particles are controlled by the π-π stacking mechanism of the polyaromatic PBH molecules. The important finding was the possibility of controlled EPD of multiwalled carbon nanotubes (MWCNTs) using PBH as a charging, dispersing and film forming agent. It was found that at low voltages or low PBH concentrations the deposits contained mainly MWCNT. The increase in the deposition voltage or/and PBH concentration resulted in co-deposition of MWCNT and needle-shape PBH particles. The new approach to the deposition of MWCNT was used for the fabrication of composite MnO(2)-MWCNT films for electrodes of electrochemical supercapacitors, which showed a specific capacitance of 250 F g(-1). The EPD method developed in this investigation paves the way for the deposition of other small organic molecules and composites and their applications in new materials and devices, utilizing functional properties of the organic molecules, CNT, and other advanced materials. Copyright © 2012 Elsevier Inc. All rights reserved.

  8. Co-administration of a charge-conversional dendrimer enhances antitumor efficacy of conventional chemotherapy.

    PubMed

    Cao, Jun; Wang, Chenhong; Guo, Leijia; Xiao, Zhiyong; Liu, Keliang; Yan, Husheng

    2018-06-01

    Despite extensive investigations, the clinical translation of nanocarrier-based drug delivery systems (NDDS) for cancer therapy is hindered by inefficient delivery and poor tumor penetration. Conventional chemotherapy by administration of free small molecule anticancer drugs remains the standard of care for many cancers. Herein, other than for carrying and releasing drugs, small nanoparticles were used as a potentiator of conventional chemotherapy by co-administration with free chemotherapeutic agents. This strategy avoided the problems associated with drug loading and controlled release encountered in NDDS, and was also much simpler than NDDS. Negatively charged poly(amido amine)-2,3-dimethylmaleic monoamide (PAMAM-DMA) dendrimers were prepared, which possessed low toxicity and can be converted to positively charged PAMAM dendrimers responsive to tumor acidic pH. The in situ formed PAMAM in tumor tissue promoted cellular uptake of co-administered doxorubicin by increasing the cell membrane permeability, and subsequently enhanced the cytotoxicity of doxorubicin. The small size of the dendrimers was favorable for deep penetration in tumor. Co-injection of PAMAM-DMA with doxorubicin into nude mice bearing human tumors almost completely inhibited tumor growth, with a mean tumor weight reducing by 55.9% after the treatment compared with the treatment with doxorubicin alone. Copyright © 2018 Elsevier B.V. All rights reserved.

  9. Photoinduced charge transfer from vacuum-deposited molecules to single-layer transition metal dichalcogenides

    NASA Astrophysics Data System (ADS)

    Osada, Kazuki; Tanaka, Masatoshi; Ohno, Shinya; Suzuki, Takanori

    2016-06-01

    Variations of photoluminescence (PL) and Raman spectra of single-layer MoS2, MoSe2, WS2, and WSe2 due to the vacuum deposition of C60 or copper phthalocyanine (CuPc) molecules have been investigated. PL spectra are decomposed into two competitive components, an exciton and a charged exciton (trion), depending on carrier density. The variation of PL spectra is interpreted in terms of charge transfer across the interfaces between transition metal dichalcogenides (TMDs) and dopant molecules. We find that deposited C60 molecules inject photoexcited electrons into MoS2, MoSe2, and WS2 or holes into WSe2. CuPc molecules also inject electrons into MoS2, MoSe2, and WS2, while holes are depleted from WSe2 to CuPc. We then propose a band alignment between TMDs and dopant molecules. Peak shifts of Raman spectra and doped carrier density estimated using a three-level model also support the band alignment. We thus demonstrate photoinduced charge transfer from dopant molecules to single-layer TMDs.

  10. Multifunctional Fe3O4@SiO2-Au Satellite Structured SERS Probe for Charge Selective Detection of Food Dyes.

    PubMed

    Sun, Zhenli; Du, Jingjing; Yan, Li; Chen, Shu; Yang, Zhilin; Jing, Chuanyong

    2016-02-10

    Nanofabrication of multifunctional surface-enhanced Raman scattering (SERS) substrates is strongly desirable but currently remains a challenge. The motivation of this study was to design such a substrate, a versatile core-satellite Fe3O4@SiO2-Au (FA) hetero-nanostructure, and demonstrate its use for charge-selective detection of food dye molecules as an exemplary application. Our experimental results and three-dimensional finite difference time domain (FDTD) simulation suggest that tuning the Au nanoparticle (NP) gap to sub-10 nm, which could be readily accomplished, substantially enhanced the Raman signals. Further layer-by-layer deposition of a charged polyelectrolyte on this magnetic SERS substrate induced active adsorption and selective detection of food dye molecules of opposite charge on the substrates. Molecular dynamics (MD) simulations suggest that the selective SERS enhancement could be attributed to the high affinity and close contact (within a 20 Å range) between the substrate and molecules. Density function theory (DFT) calculations confirm the charge transfer from food dye molecules to Au NPs via the polyelectrolytes. This multifunctional SERS platform provides easy separation and selective detection of charged molecules from complex chemical mixtures.

  11. Electrostatic effects in the collapse transition of phospholiquid monolayer

    NASA Astrophysics Data System (ADS)

    Nguyen, Toan T.; Gopal, Ajaykumar; Lee, Ka Yee C.; Witten, Thomas A.

    2004-03-01

    We study the collapse transition of fluidic phospholipid surfactant monolayers under lateral compression. DMPC, DPPC or POPG surfactants and their binary mixtures are used. Various collapsed structures (circular discs, cylinderical tubes and pearls-on-a-string) were observed during the transition. We show that electrostatics plays an important role in the formation of these structures. By changing the composition of charged surfactant (POGP) or the screening condition of the solution, one can change the dominant collapsed structure from discs to tubes to pearls in the order of increasing the strength of electrostatic interactions, in accordance with theoretical estimates. We also study a complimentary electrostatic effect due charge relaxation in the transitions between these structures. It is shown that free energy gained from relaxations of charge molecule is small and can be neglected when considering electrostatics of these systems.

  12. Effect of Aggregation on Squaraine Fullerene Bulk-Heterojunction Organic Photovoltaic Devices

    NASA Astrophysics Data System (ADS)

    Jalan, Ishita

    Organic photovoltaics (OPV) offer great promise as a low-cost renewable energy source, the relative low efficiency still challenges its commercialization potential. Small conjugated molecules like Squaraine (SQ) molecules show promising advancement in organic photovoltaics (OPV). Advantages of SQ over other materials is that it has a high extinction coefficient (>105), decent photo-stability, good synthetic reproducibility, and tunable molecular structure. With small chemical modifications, the squaraines can have substantial impact on photophysical properties and aggregation pattern, and thus on operational OPV efficiency. The squaraine molecule that will be studied in this work is a symmetric aniline-based squaraine with n-hexyl chain on the molecular arm with di hydroxyl substituents on the aniline, this will be referred to DHSQ(OH) 2. In this work, the assignment of the monomer and aggregate peak is discussed. It is known that crystallinity is important for efficient charge transport and exciton diffusion in the BHJ, this thesis focuses on thermal and solvent vapor annealing the as-cast films to reduce the amorphous regions. It is observed that crystallinity is improved but often at the expense of larger crystal size. Therefore, to achieve optimal OPV efficiency, this tradeoff is controlled to improve the crystallinity while maintaining a small, highly mixed BHJ morphology.

  13. Designing small molecule polyaromatic p- and n-type semiconductor materials for organic electronics

    NASA Astrophysics Data System (ADS)

    Collis, Gavin E.

    2015-12-01

    By combining computational aided design with synthetic chemistry, we are able to identify core 2D polyaromatic small molecule templates with the necessary optoelectronic properties for p- and n-type materials. By judicious selection of the functional groups, we can tune the physical properties of the material making them amenable to solution and vacuum deposition. In addition to solubility, we observe that the functional group can influence the thin film molecular packing. By developing structure-property relationships (SPRs) for these families of compounds we observe that some compounds are better suited for use in organic solar cells, while others, varying only slightly in structure, are favoured in organic field effect transistor devices. We also find that the processing conditions can have a dramatic impact on molecular packing (i.e. 1D vs 2D polymorphism) and charge mobility; this has implications for material and device long term stability. We have developed small molecule p- and n-type materials for organic solar cells with efficiencies exceeding 2%. Subtle variations in the functional groups of these materials produces p- and ntype materials with mobilities higher than 0.3 cm2/Vs. We are also interested in using our SPR approach to develop materials for sensor and bioelectronic applications.

  14. Toward Understanding the Outer Membrane Uptake of Small Molecules by Pseudomonas aeruginosa*

    PubMed Central

    Eren, Elif; Parkin, Jamie; Adelanwa, Ayodele; Cheneke, Belete; Movileanu, Liviu; Khalid, Syma; van den Berg, Bert

    2013-01-01

    Because small molecules enter Gram-negative bacteria via outer membrane (OM) channels, understanding OM transport is essential for the rational design of improved and new antibiotics. In the human pathogen Pseudomonas aeruginosa, most small molecules are taken up by outer membrane carboxylate channel (Occ) proteins, which can be divided into two distinct subfamilies, OccD and OccK. Here we characterize substrate transport mediated by Occ proteins belonging to both subfamilies. Based on the determination of the OccK2-glucuronate co-crystal structure, we identify the channel residues that are essential for substrate transport. We further show that the pore regions of the channels are rigid in the OccK subfamily and highly dynamic in the OccD subfamily. We also demonstrate that the substrate carboxylate group interacts with central residues of the basic ladder, a row of arginine and lysine residues that leads to and away from the binding site at the channel constriction. Moreover, the importance of the basic ladder residues corresponds to their degree of conservation. Finally, we apply the generated insights by converting the archetype of the entire family, OccD1, from a basic amino acid-specific channel into a channel with a preference for negatively charged amino acids. PMID:23467408

  15. Bistability in Doped Organic Thin Film Transistors (Preprint)

    DTIC Science & Technology

    2007-03-01

    small molecules (e.g. pentacene ). As such, they do not necessarily compete with these more typical organic transistors, but rather have pertinence...involves dipping a substrate between two dilute polyelectrolyte solutions of opposite charge to build up a thin film via the electrostatic interactions...recovery is due to trapped O2(g) remaining in the film, which causes the reverse of reaction (1) to occur and the concomitant increase in the level of

  16. Utilization of photoinduced charge-separated state of donor-acceptor-linked molecules for regulation of cell membrane potential and ion transport.

    PubMed

    Numata, Tomohiro; Murakami, Tatsuya; Kawashima, Fumiaki; Morone, Nobuhiro; Heuser, John E; Takano, Yuta; Ohkubo, Kei; Fukuzumi, Shunichi; Mori, Yasuo; Imahori, Hiroshi

    2012-04-11

    The control of ion transport across cell membranes by light is an attractive strategy that allows targeted, fast control of precisely defined events in the biological membrane. Here we report a novel general strategy for the control of membrane potential and ion transport by using charge-separation molecules and light. Delivery of charge-separation molecules to the plasma membrane of PC12 cells by a membranous nanocarrier and subsequent light irradiation led to depolarization of the membrane potential as well as inhibition of the potassium ion flow across the membrane. Photoregulation of the cell membrane potential and ion transport by using charge-separation molecules is highly promising for control of cell functions. © 2012 American Chemical Society

  17. A method to obtain static potential for electron-molecule scattering

    NASA Astrophysics Data System (ADS)

    Srivastava, Rajesh; Das, Tapasi; Stauffer, Allan

    2014-05-01

    Electron scattering from molecules is complicated by the fact that molecules are a multi-centered target with the nuclei of the constituent atoms being a center of charge. One of the most important parts of a scattering calculation is to obtain the static potential which represents the interaction of the incident electron with the unperturbed charge distribution of the molecule. A common way to represent the charge distribution of molecules is with Gaussian orbitals centered on the various nuclei. We have derived a way to calculate spherically-averaged molecular static potentials using this form of molecular wave function which is mostly analytic. This method has been applied to elastic electron scattering from water molecules and we obtained differential cross sections which are compared with previous experimental and theoretical results. The method can be extended to more complex molecules. One of us (RS) is thankful to IAEA, Vienna, Austria and DAE-BRNS, Mumbai, India for financial support.

  18. Adsorption of a cationic dye molecule on polystyrene microspheres in colloids: effect of surface charge and composition probed by second harmonic generation.

    PubMed

    Eckenrode, Heather M; Jen, Shih-Hui; Han, Jun; Yeh, An-Gong; Dai, Hai-Lung

    2005-03-17

    Nonlinear optical probe, second harmonic generation (SHG), of the adsorption of the dye molecule malachite green (MG), in cationic form at pH < or = 5, on polystyrene microspheres in aqueous solution is used to study the effect of surface charge and composition on molecular adsorption. Three types of polystyrene microspheres with different surface composition are investigated: (1) a sulfate terminated, anionic surface, (2) a neutral surface without any functional group termination, and (3) an amine terminated, cationic surface. The cationic dye was found to adsorb at all three surfaces, regardless of surface charge. The adsorption free energies, DeltaG's, measured for the three surfaces are -12.67, -12.39, and -10.46 kcal/mol, respectively, with the trend as expected from the charge interactions. The adsorption density on the anionic surface, where attractive charge-charge interaction dominates, is determined by the surface negative charge density. The adsorption densities on the neutral and cationic surfaces are on the other hand higher, perhaps as a result of a balance between minimizing repulsive charge interaction and maximizing attractive molecule-substrate and intermolecular interactions. The relative strength of the SH intensity per molecule, in combination of a model calculation, reveals that the C(2) axis of the MG molecule is nearly perpendicular to the surface on the anionic surface and tilts away from the surface norm when the surface is neutral and further away when cationic. Changing the pH of the solution may alter the surface charge and subsequently affect the adsorption configuration and SH intensity.

  19. Surface charge sensing by altering the phase transition in VO2

    NASA Astrophysics Data System (ADS)

    Kumar, S.; Esfandyarpour, R.; Davis, R.; Nishi, Y.

    2014-08-01

    Detection of surface charges has various applications in medicine, electronics, biotechnology, etc. The source of surface charge induction may range from simple charge-polarized molecules like water to complicated proteins. It was recently discovered that surface charge accumulation can alter the temperature at which VO2 undergoes a Mott transition. Here, we deposited polar molecules onto the surface of two-terminal thin-film VO2 lateral devices and monitored the joule-heating-driven Mott transition, or conductance switching. We observed that the power required to induce the conductance switching reduced upon treatment with polar molecules and, using in-situ blackbody-emission direct measurement of local temperature, we show that this reduction in power was accompanied by reduction in the Mott transition temperature. Further evidence suggested that this effect has specificity to the nature of the species used to induce surface charges. Using x-ray absorption spectroscopy, we also show that there is no detectable change in oxidation state of vanadium or structural phase in the bulk of the 40 nm VO2 thin-film even as the phase transition temperature is reduced by up to 20 K by the polar molecules. The ability to alter the phase transition parameters by depositing polar molecules suggests a potential application in sensing surface charges of different origins and this set of results also highlights interesting aspects of the phase transition in VO2.

  20. Exploring the Charge Transport in Conjugated Polymers.

    PubMed

    Xu, Yong; Sun, Huabin; Li, Wenwu; Lin, Yen-Fu; Balestra, Francis; Ghibaudo, Gerard; Noh, Yong-Young

    2017-11-01

    Conjugated polymers came to an unprecedented epoch that the charge transport is limited only by small disorder within aggregated domains. Accurate evaluation of transport performance is thus vital to optimizing further molecule design. Yet, the routine method by means of the conventional field-effect transistors may not satisfy such a requirement. Here, it is shown that the extrinsic effects of Schottky barrier, access transport through semiconductor bulk, and concurrent ambipolar conduction seriously influence transport analysis. The planar transistors incorporating ohmic contacts free of access and ambipolar conduction afford an ideal access to charge transport. It is found, however, that only the planar transistors operating in low-field regime are reliable to explore the inherent transport properties due to the energetic disorder lowering by the lateral field induced by high drain voltage. This work opens up a robust approach to comprehend the delicate charge transport in conjugated polymers so as to develop high-performance semiconducting polymers for promising plastic electronics. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Molecular layers of ZnPc and FePc on Au(111) surface: Charge transfer and chemical interaction

    NASA Astrophysics Data System (ADS)

    Ahmadi, Sareh; Shariati, M. Nina; Yu, Shun; Göthelid, Mats

    2012-08-01

    We have studied zinc phthalocyanine (ZnPc) and iron phthalocyanine (FePc) thick films and monolayers on Au(111) using photoelectron spectroscopy and x-ray absorption spectroscopy. Both molecules are adsorbed flat on the surface at monolayer. ZnPc keeps this orientation in all investigated coverages, whereas FePc molecules stand up in the thick film. The stronger inter-molecular interaction of FePc molecules leads to change of orientation, as well as higher conductivity in FePc layer in comparison with ZnPc, which is reflected in thickness-dependent differences in core-level shifts. Work function changes indicate that both molecules donate charge to Au; through the π-system. However, the Fe3d derived lowest unoccupied molecular orbital receives charge from the substrate when forming an interface state at the Fermi level. Thus, the central atom plays an important role in mediating the charge, but the charge transfer as a whole is a balance between the two different charge transfer channels; π-system and the central atom.

  2. Using a water-confined carbon nanotube to probe the electricity of sequential charged segments of macromolecules

    NASA Astrophysics Data System (ADS)

    Wang, Yu; Zhao, Yan-Jiao; Huang, Ji-Ping

    2012-07-01

    The detection of macromolecular conformation is particularly important in many physical and biological applications. Here we theoretically explore a method for achieving this detection by probing the electricity of sequential charged segments of macromolecules. Our analysis is based on molecular dynamics simulations, and we investigate a single file of water molecules confined in a half-capped single-walled carbon nanotube (SWCNT) with an external electric charge of +e or -e (e is the elementary charge). The charge is located in the vicinity of the cap of the SWCNT and along the centerline of the SWCNT. We reveal the picosecond timescale for the re-orientation (namely, from one unidirectional direction to the other) of the water molecules in response to a switch in the charge signal, -e → +e or +e → -e. Our results are well understood by taking into account the electrical interactions between the water molecules and between the water molecules and the external charge. Because such signals of re-orientation can be magnified and transported according to Tu et al. [2009 Proc. Natl. Acad. Sci. USA 106 18120], it becomes possible to record fingerprints of electric signals arising from sequential charged segments of a macromolecule, which are expected to be useful for recognizing the conformations of some particular macromolecules.

  3. Ambipolar nature of dimethyl benzo difuran (DMBDF) molecule: A charge transport study

    NASA Astrophysics Data System (ADS)

    Sahoo, Smruti Ranjan; Sahu, Sridhar

    2017-05-01

    We describe a theoretical study of the charge transport properties of the organic dimethyl benzo difuran (DMBDF) molecule based on density functional theory (DFT). Reorganization energy, ionization potential (IP), electron affinity (EA), energy gaps, transfer integral (t) and charge mobility (μ) has been studied to depict the transport properties in the conjugated organic molecules. We computed, large homo transfer integral and IP value leading to high hole mobility (4.46 cm2/V sec). However, the electron reorganization energy (0.34 eV) and the electron mobility of 1.62 cm2/V sec, infers that the DMBDF organic molecule bears an ambipolar character.

  4. Directional rolling of positively charged nanoparticles along a flexibility gradient on long DNA molecules.

    PubMed

    Park, Suehyun; Joo, Heesun; Kim, Jun Soo

    2018-01-31

    Directing the motion of molecules/colloids in any specific direction is of great interest in many applications of chemistry, physics, and biological sciences, where regulated positioning or transportation of materials is highly desired. Using Brownian dynamics simulations of coarse-grained models of a long, double-stranded DNA molecule and positively charged nanoparticles, we observed that the motion of a single nanoparticle bound to and wrapped by the DNA molecule can be directed along a gradient of DNA local flexibility. The flexibility gradient is constructed along a 0.8 kilobase-pair DNA molecule such that local persistence length decreases gradually from 50 nm to 40 nm, mimicking a gradual change in sequence-dependent flexibility. Nanoparticles roll over a long DNA molecule from less flexible regions towards more flexible ones as a result of the decreasing energetic cost of DNA bending and wrapping. In addition, the rolling becomes slightly accelerated as the positive charge of nanoparticles decreases due to a lower free energy barrier of DNA detachment from charged nanoparticle for processive rolling. This study suggests that the variation in DNA local flexibility can be utilized in constructing and manipulating supramolecular assemblies of DNA molecules and nanoparticles in structural DNA nanotechnology.

  5. Band-like temperature dependence of mobility in a solution-processed organic semiconductor

    NASA Astrophysics Data System (ADS)

    Sakanoue, Tomo; Sirringhaus, Henning

    2010-09-01

    The mobility μ of solution-processed organic semiconductorshas improved markedly to room-temperature values of 1-5cm2V-1s-1. In spite of their growing technological importance, the fundamental open question remains whether charges are localized onto individual molecules or exhibit extended-state band conduction like those in inorganic semiconductors. The high bulk mobility of 100cm2V-1s-1 at 10K of some molecular single crystals provides clear evidence that extended-state conduction is possible in van-der-Waals-bonded solids at low temperatures. However, the nature of conduction at room temperature with mobilities close to the Ioffe-Regel limit remains controversial. Here we investigate the origin of an apparent `band-like', negative temperature coefficient of the mobility (dμ/dT<0) in spin-coated films of 6,13-bis(triisopropylsilylethynyl)-pentacene. We use optical spectroscopy of gate-induced charge carriers to show that, at low temperature and small lateral electric field, charges become localized onto individual molecules in shallow trap states, but that a moderate lateral electric field is able to detrap them resulting in highly nonlinear, low-temperature transport. The negative temperature coefficient of the mobility at high fields is not due to extended-state conduction but to localized transport limited by thermal lattice fluctuations.

  6. Band-like temperature dependence of mobility in a solution-processed organic semiconductor.

    PubMed

    Sakanoue, Tomo; Sirringhaus, Henning

    2010-09-01

    The mobility mu of solution-processed organic semiconductors has improved markedly to room-temperature values of 1-5 cm(2) V(-1) s(-1). In spite of their growing technological importance, the fundamental open question remains whether charges are localized onto individual molecules or exhibit extended-state band conduction like those in inorganic semiconductors. The high bulk mobility of 100 cm(2) V(-1) s(-1) at 10 K of some molecular single crystals provides clear evidence that extended-state conduction is possible in van-der-Waals-bonded solids at low temperatures. However, the nature of conduction at room temperature with mobilities close to the Ioffe-Regel limit remains controversial. Here we investigate the origin of an apparent 'band-like', negative temperature coefficient of the mobility (dmu/dT<0) in spin-coated films of 6,13-bis(triisopropylsilylethynyl)-pentacene. We use optical spectroscopy of gate-induced charge carriers to show that, at low temperature and small lateral electric field, charges become localized onto individual molecules in shallow trap states, but that a moderate lateral electric field is able to detrap them resulting in highly nonlinear, low-temperature transport. The negative temperature coefficient of the mobility at high fields is not due to extended-state conduction but to localized transport limited by thermal lattice fluctuations.

  7. Electrostatic Charging and Particle Interactions in Microscopic Insulating Grains

    NASA Astrophysics Data System (ADS)

    Lee, Victor

    In this thesis, we experimentally investigate the electrostatic charging as well as the particle interactions in microscopic insulating grains. First, by tracking individual grains accelerated in an electric field, we quantitatively demonstrate that tribocharging of same-material grains depends on particle size. Large grains tend to charge positively, and small ones tend to charge negatively. Theories based on the transfer of trapped electrons can explain this tendency but have not been validated. Here we show that the number of trapped electrons, measured independently by a thermoluminescence technique, is orders of magnitude too small to be responsible for the amount of charge transferred. This result reveals that trapped electrons are not responsible for same-material tribocharging of dielectric particles. Second, same-material tribocharging in grains can result in important long-range electrostatic interactions. However, how these electrostatic interactions contribute to particle clustering remains elusive, primarily due to the lack of direct, detailed observations. Using a high-speed camera that falls with a stream charged grains, we observe for the first time how charged grains can undergo attractive as well as repulsive Kepler-like orbits. Charged particles can be captured in their mutual electrostatic potential and form clusters via multiple bounces. Dielectric polarization effects are directly observed, which lead to additional attractive forces and stabilize "molecule-like" arrangements of charged particles. Third, we have developed a new method to study the charge transfer of microscopic particles based on acoustic levitation techniques. This method allows us to narrow the complex problem of many-particle charging down to precise charge measurements of a single sub-millimeter particle colliding with a target plate. By simply attaching nonpolar groups onto glass surfaces, we show that the contact charging of a particle is highly dependent on hydrophobicity. Charging between a hydrophilic and a hydrophobic surface is enhanced in a basic atmosphere and suppressed in an acidic one. Moreover, hydrophobicity is also found to play a key role in particle charging driven by an external electric field. These results strongly support the idea that aqueous-ion transfer is responsible for the particle contact charging phenomenon.

  8. Simple method of DNA stretching on glass substrate for fluorescence image and spectroscopy

    NASA Astrophysics Data System (ADS)

    Neupane, Guru P.; Dhakal, Krishna P.; Lee, Hyunsoo; Guthold, Martin; Joseph, Vincent S.; Hong, Jong-Dal; Kim, Jeongyong

    2013-05-01

    Study of biological molecule DNA has contributed to developing many breaking thoughts and wide applications in multidisciplinary fields, such as genomic, medical, sensing and forensic fields. Stretching of DNA molecules is an important supportive tool for AFM or spectroscopic studies of DNA in a single molecular level. In this article, we established a simple method of DNA stretching (to its full length) that occurred on a rotating negatively-charged surface of glass substrate. The isolation of a single DNA molecule was attained by the two competitive forces on DNA molecules, that is, the electrostatic attraction developed between the positively charged YOYO-1 stained DNA and the negatively charged substrate, and the centrifugal force of the rotating substrate, which separates the DNA aggregates into the single molecule. Density of stretched DNA molecules was controlled by selecting the specific parameters such as spinning time and rates, loading volume of DNA-dye complex solution etc. The atomic force microscopy image exhibited a single DNA molecule on the negatively-charged substrate in an isolated state. Further, the photoluminescence spectra of a single DNA molecule stained with YOYO-1 were achieved using the method developed in the present study, which is strongly believed to effectively support the spectroscopic analysis of DNA in a single molecular level.

  9. Frenkel and Charge-Transfer Excitations in Donor-acceptor Complexes from Many-Body Green's Functions Theory.

    PubMed

    Baumeier, Björn; Andrienko, Denis; Rohlfing, Michael

    2012-08-14

    Excited states of donor-acceptor dimers are studied using many-body Green's functions theory within the GW approximation and the Bethe-Salpeter equation. For a series of prototypical small-molecule based pairs, this method predicts energies of local Frenkel and intermolecular charge-transfer excitations with the accuracy of tens of meV. Application to larger systems is possible and allowed us to analyze energy levels and binding energies of excitons in representative dimers of dicyanovinyl-substituted quarterthiophene and fullerene, a donor-acceptor pair used in state of the art organic solar cells. In these dimers, the transition from Frenkel to charge transfer excitons is endothermic and the binding energy of charge transfer excitons is still of the order of 1.5-2 eV. Hence, even such an accurate dimer-based description does not yield internal energetics favorable for the generation of free charges either by thermal energy or an external electric field. These results confirm that, for qualitative predictions of solar cell functionality, accounting for the explicit molecular environment is as important as the accurate knowledge of internal dimer energies.

  10. 2D coherent charge transport in highly ordered conducting polymers doped by solid state diffusion

    NASA Astrophysics Data System (ADS)

    Kang, Keehoon; Watanabe, Shun; Broch, Katharina; Sepe, Alessandro; Brown, Adam; Nasrallah, Iyad; Nikolka, Mark; Fei, Zhuping; Heeney, Martin; Matsumoto, Daisuke; Marumoto, Kazuhiro; Tanaka, Hisaaki; Kuroda, Shin-Ichi; Sirringhaus, Henning

    2016-08-01

    Doping is one of the most important methods to control charge carrier concentration in semiconductors. Ideally, the introduction of dopants should not perturb the ordered microstructure of the semiconducting host. In some systems, such as modulation-doped inorganic semiconductors or molecular charge transfer crystals, this can be achieved by spatially separating the dopants from the charge transport pathways. However, in conducting polymers, dopants tend to be randomly distributed within the conjugated polymer, and as a result the transport properties are strongly affected by the resulting structural and electronic disorder. Here, we show that in the highly ordered lamellar microstructure of a regioregular thiophene-based conjugated polymer, a small-molecule p-type dopant can be incorporated by solid state diffusion into the layers of solubilizing side chains without disrupting the conjugated layers. In contrast to more disordered systems, this allows us to observe coherent, free-electron-like charge transport properties, including a nearly ideal Hall effect in a wide temperature range, a positive magnetoconductance due to weak localization and the Pauli paramagnetic spin susceptibility.

  11. Aqueous TMAO solutions as seen by theoretical THz spectroscopy: hydrophilic versus hydrophobic water.

    PubMed

    Imoto, Sho; Forbert, Harald; Marx, Dominik

    2018-02-28

    Solvation of trimethylamine-N-oxide (TMAO) by water is of great fundamental interest because this small molecule has both strongly hydrophilic and large hydrophobic groups at its opposite ends and, furthermore, stabilizes proteins against temperature and pressure denaturation. Since hydrophilic and hydrophobic groups affect the structural dynamics of the respective solvation water molecules in vastly different ways, we dissect their distinct influences on the THz spectrum of TMAO(aq) by using ab initio molecular dynamics simulations. In particular, we demonstrate that exclusively electronic polarization and charge transfer effects, being absent in the usual fixed-charge biomolecular force fields, are responsible for the significant enhancement of the effective molecular dipole moment of hydrophilic solvation water. This, in turn, leads to pronounced solute-solvent couplings and thus to specific THz modes that involve well-defined H-bond bending and stretching motion being characteristic to hydrophilic solvation. The THz response of individual H-bonded pairs of water molecules involving hydrophobic solvation water, in stark contrast, is nearly indistinguishable from such pairs in bulk water. Transcending the specific case, THz spectroscopy is suggested to be an ideal experimental approach to unravel the controversial piezolytic properties of TMAO including its counteracting effect on pressure-induced denaturation of proteins.

  12. Physical Investigations of Small Particles: (I) Aerosol Particle Charging and Flux Enhancement and (II) Whispering Gallery Mode Sensing

    NASA Astrophysics Data System (ADS)

    Lopez-Yglesias, Xerxes

    Part I: Particles are a key feature of planetary atmospheres. On Earth they represent the greatest source of uncertainty in the global energy budget. This uncertainty can be addressed by making more measurement, by improving the theoretical analysis of measurements, and by better modeling basic particle nucleation and initial particle growth within an atmosphere. This work will focus on the latter two methods of improvement. Uncertainty in measurements is largely due to particle charging. Accurate descriptions of particle charging are challenging because one deals with particles in a gas as opposed to a vacuum, so different length scales come into play. Previous studies have considered the effects of transition between the continuum and kinetic regime and the effects of two and three body interactions within the kinetic regime. These studies, however, use questionable assumptions about the charging process which resulted in skewed observations, and bias in the proposed dynamics of aerosol particles. These assumptions affect both the ions and particles in the system. Ions are assumed to be point monopoles that have a single characteristic speed rather than follow a distribution. Particles are assumed to be perfect conductors that have up to five elementary charges on them. The effects of three body interaction, ion-molecule-particle, are also overestimated. By revising this theory so that the basic physical attributes of both ions and particles and their interactions are better represented, we are able to make more accurate predictions of particle charging in both the kinetic and continuum regimes. The same revised theory that was used above to model ion charging can also be applied to the flux of neutral vapor phase molecules to a particle or initial cluster. Using these results we can model the vapor flux to a neutral or charged particle due to diffusion and electromagnetic interactions. In many classical theories currently applied to these models, the finite size of the molecule and the electromagnetic interaction between the molecule and particle, especially for the neutral particle case, are completely ignored, or, as is often the case for a permanent dipole vapor species, strongly underestimated. Comparing our model to these classical models we determine an "enhancement factor" to characterize how important the addition of these physical parameters and processes is to the understanding of particle nucleation and growth. Part II: Whispering gallery mode (WGM) optical biosensors are capable of extraordinarily sensitive specific and non-specific detection of species suspended in a gas or fluid. Recent experimental results suggest that these devices may attain single-molecule sensitivity to protein solutions in the form of stepwise shifts in their resonance wavelength, lambdaR, but present sensor models predict much smaller steps than were reported. This study examines the physical interaction between a WGM sensor and a molecule adsorbed to its surface, exploring assumptions made in previous efforts to model WGM sensor behavior, and describing computational schemes that model the experiments for which single protein sensitivity was reported. The resulting model is used to simulate sensor performance, within constraints imposed by the limited material property data. On this basis, we conclude that nonlinear optical effects would be needed to attain the reported sensitivity, and that, in the experiments for which extreme sensitivity was reported, a bound protein experiences optical energy fluxes too high for such effects to be ignored.

  13. On contribution of known atomic partial charges of protein backbone in electrostatic potential density maps.

    PubMed

    Wang, Jimin

    2017-06-01

    Partial charges of atoms in a molecule and electrostatic potential (ESP) density for that molecule are known to bear a strong correlation. In order to generate a set of point-field force field parameters for molecular dynamics, Kollman and coworkers have extracted atomic partial charges for each of all 20 amino acids using restrained partial charge-fitting procedures from theoretical ESP density obtained from condensed-state quantum mechanics. The magnitude of atomic partial charges for neutral peptide backbone they have obtained is similar to that of partial atomic charges for ionized carboxylate side chain atoms. In this study, the effect of these known atomic partial charges on ESP is examined using computer simulations and compared with the experimental ESP density recently obtained for proteins using electron microscopy. It is found that the observed ESP density maps are most consistent with the simulations that include atomic partial charges of protein backbone. Therefore, atomic partial charges are integral part of atomic properties in protein molecules and should be included in model refinement. © 2017 The Protein Society.

  14. Insulator charging limits direct current across tunneling metal-insulator-semiconductor junctions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vilan, Ayelet

    Molecular electronics studies how the molecular nature affects the probability of charge carriers to tunnel through the molecules. Nevertheless, transport is also critically affected by the contacts to the molecules, an aspect that is often overlooked. Specifically, the limited ability of non-metallic contacts to maintain the required charge balance across the fairly insulating molecule often have dramatic effects. This paper shows that in the case of lead/organic monolayer-silicon junctions, a charge balance is responsible for an unusual current scaling, with the junction diameter (perimeter), rather than its area. This is attributed to the balance between the 2D charging at themore » metal/insulator interface and the 3D charging of the semiconductor space-charge region. A derivative method is developed to quantify transport across tunneling metal-insulator-semiconductor junctions; this enables separating the tunneling barrier from the space-charge barrier for a given current-voltage curve, without complementary measurements. The paper provides practical tools to analyze specific molecular junctions compatible with existing silicon technology, and demonstrates the importance of contacts' physics in modeling charge transport across molecular junctions.« less

  15. Synthesis of surface-anchored DNA-polymer bioconjugates using reversible addition-fragmentation chain transfer polymerization.

    PubMed

    He, Peng; He, Lin

    2009-07-13

    We report here an approach to grafting DNA-polymer bioconjugates on a planar solid support using reversible addition-fragmentation chain transfer (RAFT) polymerization. In particular, a trithiocarbonate compound as the RAFT chain transfer agent (CTA) is attached to the distal point of a surface-immobilized oligonucleotide. Initiation of RAFT polymerization leads to controlled growth of polymers atop DNA molecules on the surface. Growth kinetics of poly(monomethoxy-capped oligo(ethylene glycol) methacrylate) atop DNA molecules is investigated by monitoring the change of polymer film thickness as a function of reaction time. The reaction conditions, including the polymerization temperature, the initiator concentration, the CTA surface density, and the selection of monomers, are varied to examine their impacts on the grafting efficiency of DNA-polymer conjugates. Comparing to polymer growth atop small molecules, the experimental results suggest that DNA molecules significantly accelerate polymer growth, which is speculated as a result of the presence of highly charged DNA backbones and purine/pyrimidine moieties surrounding the reaction sites.

  16. Fine-Tuning of Molecular Packing and Energy Level through Methyl Substitution Enabling Excellent Small Molecule Acceptors for Nonfullerene Polymer Solar Cells with Efficiency up to 12.54.

    PubMed

    Luo, Zhenghui; Bin, Haijun; Liu, Tao; Zhang, Zhi-Guo; Yang, Yankang; Zhong, Cheng; Qiu, Beibei; Li, Guanghao; Gao, Wei; Xie, Dongjun; Wu, Kailong; Sun, Yanming; Liu, Feng; Li, Yongfang; Yang, Chuluo

    2018-03-01

    A novel small molecule acceptor MeIC with a methylated end-capping group is developed. Compared to unmethylated counterparts (ITCPTC), MeIC exhibits a higher lowest unoccupied molecular orbital (LUMO) level value, tighter molecular packing, better crystallites quality, and stronger absorption in the range of 520-740 nm. The MeIC-based polymer solar cells (PSCs) with J71 as donor, achieve high power conversion efficiency (PCE), up to 12.54% with a short-circuit current (J SC ) of 18.41 mA cm -2 , significantly higher than that of the device based on J71:ITCPTC (11.63% with a J SC of 17.52 mA cm -2 ). The higher J SC of the PSC based on J71:MeIC can be attributed to more balanced μ h /μ e , higher charge dissociation and charge collection efficiency, better molecular packing, and more proper phase separation features as indicated by grazing incident X-ray diffraction and resonant soft X-ray scattering results. It is worth mentioning that the as-cast PSCs based on MeIC also yield a high PCE of 11.26%, which is among the highest value for the as-cast nonfullerene PSCs so far. Such a small modification that leads to so significant an improvement of the photovoltaic performance is a quite exciting finding, shining a light on the molecular design of the nonfullerene acceptors. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Rapid Two-Millisecond Interrogation of Electrochemical, Aptamer-Based Sensor Response Using Intermittent Pulse Amperometry.

    PubMed

    Santos-Cancel, Mirelis; Lazenby, Robert A; White, Ryan J

    2018-06-22

    In this manuscript, we employ the technique intermittent pulse amperometry (IPA) to interrogate equilibrium and kinetic target binding to the surface of electrochemical, aptamer-based (E-AB) sensors, achieving as fast as 2 ms time resolution. E-AB sensors comprise an electrode surface modified with a flexible nucleic acid aptamer tethered at the 3'-terminus with a redox-active molecule. The introduction of a target changes the conformation and flexibility of the nucleic acid, which alters the charge transfer rate of the appended redox molecule. Typically, changes in charge transfer rate within this class of sensor are monitored via voltammetric methods. Here, we demonstrate that the use of IPA enables the detection of changes in charge transfer rates (i.e., current) at times <100 μs after the application of a potential pulse. Changes in sensor current are quantitatively related to target analyte concentration and can be used to create binding isotherms. Furthermore, the application of IPA enables rapid probing of the electrochemical surface with a time resolution equivalent to as low as twice the applied potential pulse width, not previously demonstrated with traditional voltammetric techniques employed with E-AB sensors (alternating current, square wave, cyclic). To visualize binding, we developed false-color plots analogous to those used in the field of fast-scan cyclic voltammetry. The use of IPA is universal, as demonstrated with two representative small molecule E-AB sensors directed against the aminoglycoside antibiotic tobramycin and adenosine triphosphate (ATP). Intermittent pulse amperometry exhibits an unprecedented sub-microsecond temporal response and is a general method for measuring rapid sensor performance.

  18. Synthesis, spectroscopic investigations (FT-IR, NMR, UV-Vis, and TD-DFT), and molecular docking of (E)-1-(benzo[d][1, 3]dioxol-6-yl)-3-(6-methoxynaphthalen-2-yl)prop-2-en-1-one

    NASA Astrophysics Data System (ADS)

    Therasa Alphonsa, A.; Loganathan, C.; Athavan Alias Anand, S.; Kabilan, S.

    2017-02-01

    The compound (E)-1-(benzo [d] [1, 3] dioxol-6-yl)-3-(6-methoxy naphthalen-2-yl) prop-2-en-1-one (AKN) was synthesized and characterized by FT-IR, NMR, and UV-Vis spectrometer. The optimized molecular geometry, bond lengths, bond angles, atomic charges, harmonic vibrational wave numbers and intensities of vibrational bonds of the title compound have been investigated by Time dependent- Density Functional Theory (TD-DFT) using a standard B3LYP method with 6-31 G (d, p) basis set available in the Gaussian 09W package. 1H and 13C NMR chemical shifts of the molecule were calculated using Gauge-independent atomic orbital method (GIAO). Experimental excitation energies of the molecules were matched with the theoretically calculated energies. The atomic charge distributions of the various atoms present in the AKN were obtained by Mulliken charge population analysis. The Molecular Electrostatic Potential (MEP) analysis reveals the sites for electrophilic attack and nucleophilic reactions in the molecule. The difference between the observed and scaled frequencies was small. The HOMO to LUMO transition implies an electron density transfer. The intramolecular contacts have been interpreted using Natural Bond Orbital (NBO) analysis. The calculation results were applied to simulate spectra of the title compound, which show excellent agreement with observed spectra. To provide information about the interactions between human cytochrome protein and the novel compound theoretically, docking studies were carried out using Schrödinger software.

  19. Remarkable Enhancement of the Hole Mobility in Several Organic Small-Molecules, Polymers, and Small-Molecule:Polymer Blend Transistors by Simple Admixing of the Lewis Acid p-Dopant B(C6F5)3.

    PubMed

    Panidi, Julianna; Paterson, Alexandra F; Khim, Dongyoon; Fei, Zhuping; Han, Yang; Tsetseris, Leonidas; Vourlias, George; Patsalas, Panos A; Heeney, Martin; Anthopoulos, Thomas D

    2018-01-01

    Improving the charge carrier mobility of solution-processable organic semiconductors is critical for the development of advanced organic thin-film transistors and their application in the emerging sector of printed electronics. Here, a simple method is reported for enhancing the hole mobility in a wide range of organic semiconductors, including small-molecules, polymers, and small-molecule:polymer blends, with the latter systems exhibiting the highest mobility. The method is simple and relies on admixing of the molecular Lewis acid B(C 6 F 5 ) 3 in the semiconductor formulation prior to solution deposition. Two prototypical semiconductors where B(C 6 F 5 ) 3 is shown to have a remarkable impact are the blends of 2,8-difluoro-5,11-bis(triethylsilylethynyl)anthradithiophene:poly(triarylamine) (diF-TESADT:PTAA) and 2,7-dioctyl[1]-benzothieno[3,2-b][1]benzothiophene:poly(indacenodithiophene-co-benzothiadiazole) (C8-BTBT:C16-IDTBT), for which hole mobilities of 8 and 11 cm 2 V -1 s -1 , respectively, are obtained. Doping of the 6,13-bis(triisopropylsilylethynyl)pentacene:PTAA blend with B(C 6 F 5 ) 3 is also shown to increase the maximum hole mobility to 3.7 cm 2 V -1 s -1 . Analysis of the single and multicomponent materials reveals that B(C 6 F 5 ) 3 plays a dual role, first acting as an efficient p-dopant, and secondly as a microstructure modifier. Semiconductors that undergo simultaneous p-doping and dopant-induced long-range crystallization are found to consistently outperform transistors based on the pristine materials. Our work underscores Lewis acid doping as a generic strategy towards high performance printed organic microelectronics.

  20. An electrostatic potassium channel opener targeting the final voltage sensor transition

    PubMed Central

    Börjesson, Sara I.

    2011-01-01

    Free polyunsaturated fatty acids (PUFAs) modulate the voltage dependence of voltage-gated ion channels. As an important consequence thereof, PUFAs can suppress epileptic seizures and cardiac arrhythmia. However, molecular details for the interaction between PUFA and ion channels are not well understood. In this study, we have localized the site of action for PUFAs on the voltage-gated Shaker K channel by introducing positive charges on the channel surface, which potentiated the PUFA effect. Furthermore, we found that PUFA mainly affects the final voltage sensor movement, which is closely linked to channel opening, and that specific charges at the extracellular end of the voltage sensor are critical for the PUFA effect. Because different voltage-gated K channels have different charge profiles, this implies channel-specific PUFA effects. The identified site and the pharmacological mechanism will potentially be very useful in future drug design of small-molecule compounds specifically targeting neuronal and cardiac excitability. PMID:21624947

  1. Indirect double photoionization of water

    NASA Astrophysics Data System (ADS)

    Resccigno, T. N.; Sann, H.; Orel, A. E.; Dörner, R.

    2011-05-01

    The vertical double ionization thresholds of small molecules generally lie above the dissociation limits corresponding to formation of two singly charged fragments. This gives the possibility of populating singly charged molecular ions by photoionization in the Franck-Condon region at energies below the lowest dication state, but above the dissociation limit into two singly charged fragment ions. This process can produce a superexcited neutral fragment that autoionizes at large internuclear separation. We study this process in water, where absorption of a photon produces an inner-shell excited state of H2O+ that fragments to H++OH*. The angular distribution of secondary electrons produced by OH* when it autoionizes produces a characteristic asymmetric pattern that reveals the distance, and therefore the time, at which the decay takes place. LBNL, Berkeley, CA, J. W. Goethe Universität, Frankfurt, Germany. Work performed under auspices of US DOE and supported by OBES, Div. of Chemical Sciences.

  2. Accuracy of free energies of hydration using CM1 and CM3 atomic charges.

    PubMed

    Udier-Blagović, Marina; Morales De Tirado, Patricia; Pearlman, Shoshannah A; Jorgensen, William L

    2004-08-01

    Absolute free energies of hydration (DeltaGhyd) have been computed for 25 diverse organic molecules using partial atomic charges derived from AM1 and PM3 wave functions via the CM1 and CM3 procedures of Cramer, Truhlar, and coworkers. Comparisons are made with results using charges fit to the electrostatic potential surface (EPS) from ab initio 6-31G* wave functions and from the OPLS-AA force field. OPLS Lennard-Jones parameters for the organic molecules were used together with the TIP4P water model in Monte Carlo simulations with free energy perturbation theory. Absolute free energies of hydration were computed for OPLS united-atom and all-atom methane by annihilating the solutes in water and in the gas phase, and absolute DeltaGhyd values for all other molecules were computed via transformation to one of these references. Optimal charge scaling factors were determined by minimizing the unsigned average error between experimental and calculated hydration free energies. The PM3-based charge models do not lead to lower average errors than obtained with the EPS charges for the subset of 13 molecules in the original study. However, improvement is obtained by scaling the CM1A partial charges by 1.14 and the CM3A charges by 1.15, which leads to average errors of 1.0 and 1.1 kcal/mol for the full set of 25 molecules. The scaled CM1A charges also yield the best results for the hydration of amides including the E/Z free-energy difference for N-methylacetamide in water. Copyright 2004 Wiley Periodicals, Inc.

  3. Electronegativity equalization method: parameterization and validation for organic molecules using the Merz-Kollman-Singh charge distribution scheme.

    PubMed

    Jirousková, Zuzana; Vareková, Radka Svobodová; Vanek, Jakub; Koca, Jaroslav

    2009-05-01

    The electronegativity equalization method (EEM) was developed by Mortier et al. as a semiempirical method based on the density-functional theory. After parameterization, in which EEM parameters A(i), B(i), and adjusting factor kappa are obtained, this approach can be used for calculation of average electronegativity and charge distribution in a molecule. The aim of this work is to perform the EEM parameterization using the Merz-Kollman-Singh (MK) charge distribution scheme obtained from B3LYP/6-31G* and HF/6-31G* calculations. To achieve this goal, we selected a set of 380 organic molecules from the Cambridge Structural Database (CSD) and used the methodology, which was recently successfully applied to EEM parameterization to calculate the HF/STO-3G Mulliken charges on large sets of molecules. In the case of B3LYP/6-31G* MK charges, we have improved the EEM parameters for already parameterized elements, specifically C, H, N, O, and F. Moreover, EEM parameters for S, Br, Cl, and Zn, which have not as yet been parameterized for this level of theory and basis set, we also developed. In the case of HF/6-31G* MK charges, we have developed the EEM parameters for C, H, N, O, S, Br, Cl, F, and Zn that have not been parameterized for this level of theory and basis set so far. The obtained EEM parameters were verified by a previously developed validation procedure and used for the charge calculation on a different set of 116 organic molecules from the CSD. The calculated EEM charges are in a very good agreement with the quantum mechanically obtained ab initio charges. 2008 Wiley Periodicals, Inc.

  4. Enhancement of charge transport properties of small molecule semiconductors by controlling fluorine substitution and effects on photovoltaic properties of organic solar cells and perovskite solar cells.

    PubMed

    Yun, Jae Hoon; Park, Sungmin; Heo, Jin Hyuck; Lee, Hyo-Sang; Yoon, Seongwon; Kang, Jinback; Im, Sang Hyuk; Kim, Hyunjung; Lee, Wonmok; Kim, BongSoo; Ko, Min Jae; Chung, Dae Sung; Son, Hae Jung

    2016-11-01

    We prepared a series of small molecules based on 7,7'-(4,4-bis(2-ethylhexyl)-4 H -silolo[3,2- b :4,5- b ']dithiophene-2,6-diyl)bis(4-(5'-hexyl-[2,2'-bithiophene]-5-yl)benzo[ c ][1,2,5]thiadiazole) with different fluorine substitution patterns ( 0F-4F ). Depending on symmetricity and numbers of fluorine atoms incorporated in the benzo[ c ][1,2,5]thiadiazole unit, they show very different optical and morphological properties in a film. 2F and 4F , which featured symmetric and even-numbered fluorine substitution patterns, display improved molecular packing structures and higher crystalline properties in a film compared with 1F and 3F and thus, 2F achieved the highest OTFT mobility, which is followed by 4F . In the bulk heterojunction solar cell fabricated with PC 71 BM, 2F achieves the highest photovoltaic performance with an 8.14% efficiency and 0F shows the lowest efficiency of 1.28%. Moreover, the planar-type perovskite solar cell (PSC) prepared with 2F as a dopant-free hole transport material shows a high power conversion efficiency of 14.5% due to its high charge transporting properties, which were significantly improved compared with the corresponding PSC device obtained from 0F (8.5%). From the studies, it is demonstrated that low variation in the local dipole moment and the narrow distribution of 2F conformers make intermolecular interactions favorable, which may effectively drive crystal formations in the solid state and thus, higher charge transport properties compared with 1F and 3F .

  5. Charge Structure and Counterion Distribution in Hexagonal DNA Liquid Crystal

    PubMed Central

    Dai, Liang; Mu, Yuguang; Nordenskiöld, Lars; Lapp, Alain; van der Maarel, Johan R. C.

    2007-01-01

    A hexagonal liquid crystal of DNA fragments (double-stranded, 150 basepairs) with tetramethylammonium (TMA) counterions was investigated with small angle neutron scattering (SANS). We obtained the structure factors pertaining to the DNA and counterion density correlations with contrast matching in the water. Molecular dynamics (MD) computer simulation of a hexagonal assembly of nine DNA molecules showed that the inter-DNA distance fluctuates with a correlation time around 2 ns and a standard deviation of 8.5% of the interaxial spacing. The MD simulation also showed a minimal effect of the fluctuations in inter-DNA distance on the radial counterion density profile and significant penetration of the grooves by TMA. The radial density profile of the counterions was also obtained from a Monte Carlo (MC) computer simulation of a hexagonal array of charged rods with fixed interaxial spacing. Strong ordering of the counterions between the DNA molecules and the absence of charge fluctuations at longer wavelengths was shown by the SANS number and charge structure factors. The DNA-counterion and counterion structure factors are interpreted with the correlation functions derived from the Poisson-Boltzmann equation, MD, and MC simulation. Best agreement is observed between the experimental structure factors and the prediction based on the Poisson-Boltzmann equation and/or MC simulation. The SANS results show that TMA is too large to penetrate the grooves to a significant extent, in contrast to what is shown by MD simulation. PMID:17098791

  6. A simple model for electrical charge in globular macromolecules and linear polyelectrolytes in solution

    NASA Astrophysics Data System (ADS)

    Krishnan, M.

    2017-05-01

    We present a model for calculating the net and effective electrical charge of globular macromolecules and linear polyelectrolytes such as proteins and DNA, given the concentration of monovalent salt and pH in solution. The calculation is based on a numerical solution of the non-linear Poisson-Boltzmann equation using a finite element discretized continuum approach. The model simultaneously addresses the phenomena of charge regulation and renormalization, both of which underpin the electrostatics of biomolecules in solution. We show that while charge regulation addresses the true electrical charge of a molecule arising from the acid-base equilibria of its ionizable groups, charge renormalization finds relevance in the context of a molecule's interaction with another charged entity. Writing this electrostatic interaction free energy in terms of a local electrical potential, we obtain an "interaction charge" for the molecule which we demonstrate agrees closely with the "effective charge" discussed in charge renormalization and counterion-condensation theories. The predictions of this model agree well with direct high-precision measurements of effective electrical charge of polyelectrolytes such as nucleic acids and disordered proteins in solution, without tunable parameters. Including the effective interior dielectric constant for compactly folded molecules as a tunable parameter, the model captures measurements of effective charge as well as published trends of pKa shifts in globular proteins. Our results suggest a straightforward general framework to model electrostatics in biomolecules in solution. In offering a platform that directly links theory and experiment, these calculations could foster a systematic understanding of the interrelationship between molecular 3D structure and conformation, electrical charge and electrostatic interactions in solution. The model could find particular relevance in situations where molecular crystal structures are not available or rapid, reliable predictions are desired.

  7. Intermolecular Interactions and Electrostatic Properties of the [beta]-Hydroquinone Apohost: Implications for Supramolecular Chemistry

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Clausen, Henrik F.; Chen, Yu-Sheng; Jayatilaka, Dylan

    2012-02-07

    The crystal structure of the {beta}-polymorph of hydroquinone ({beta}-HQ), the apohost of a large family of clathrates, is reported with a specific focus on intermolecular interactions and the electrostatic nature of its cavity. Hirshfeld surface analysis reveals subtle close contacts between two interconnecting HQ networks, and the local packing and related close contacts were examined by breakdown of the fingerprint plot. An experimental multipole model containing anisotropic thermal parameters for hydrogen atoms has been successfully refined against 15(2) K single microcrystal synchrotron X-ray diffraction data. The experimental electron density model has been compared with a theoretical electron density calculated withmore » the molecule embedded in its own crystal field. Hirshfeld charges, interaction energies and the electrostatic potential calculated for both models are qualitatively in good agreement, but small differences in the electrostatic potential persist due to charge transfer from all hydrogen atoms to the oxygen atoms in the theoretical model. The electrostatic potential in the center of the cavity is positive, very shallow and highly symmetric, suggesting that the inclusion of polar molecules in the void will involve a balance between opposing effects. The electric field is by symmetry zero in the center of the cavity, increasing to a value of 0.0185 e/{angstrom}{sup 2} (0.27 V/{angstrom}) 1 {angstrom} along the 3-fold axis and 0.0105 e/{angstrom}{sup 2} (0.15 V/{angstrom}) 1 {angstrom} along the perpendicular direction. While these values are substantial in a macroscopic context, they are quite small for a molecular cavity and are not expected to strongly polarize a guest molecule.« less

  8. Charging of dust grains in a plasma with negative ions

    NASA Astrophysics Data System (ADS)

    Kim, Su-Hyun; Merlino, Robert L.

    2006-05-01

    The effect of negative ions on the charging of dust particles in a plasma is investigated experimentally. A plasma containing a very low percentage of electrons is formed in a single-ended SF6 is admitted into the vacuum system. The relatively cold (Te≈0.2eV ) readily attach to SF6 molecules to form SF6- negative ions. Calculations of the dust charge indicate that for electrons, negative ions, and positive ions of comparable temperatures, the charge (or surface potential) of the dust can be positive if the positive ion mass is smaller than the negative ion mass and if ɛ, the ratio of the electron to positive ion density, is sufficiently small. The K+ positive ions (mass 39amu) and SF6- negative ions (mass 146amu), and also utilizes a rotating cylinder to dispense dust into the plasma column. Analysis of the current-voltage characteristics of a Langmuir probe in the dusty plasma shows evidence for the reduction in the (magnitude) of the negative dust charge and the transition to positively charged dust as the relative concentration of the residual electrons is reduced. Some remarks are offered concerning experiments that could become possible in a dusty plasma with positive grains.

  9. Theory of Charged Quantum Dot Molecules

    NASA Astrophysics Data System (ADS)

    Ponomarev, I. V.; Scheibner, M.; Stinaff, E. A.; Bracker, A. S.; Doty, M. F.; Ware, M. E.; Gammon, D.; Reinecke, T. L.; Korenev, V. L.

    2006-03-01

    Recent optical spectroscopy of excitonic molecules in coupled quantum dots (CQDs) tuned by electric field reveal a richer diversity in spectral line patterns than in their single quantum dot counterparts. We developed a theoretical model that allows us to classify energies and intensities of various PL transitions. In this approach the electric field induced resonance tunneling of the electron and hole states occurs at different biases due to the inherent asymmetry of CQDs. The truncated many-body basis configurations for each molecule are constructed from antisymmetrized products of single-particle states, where the electron occupies only one ground state level in single QD and the hole can occupy two lowest levels of CQD system. The Coulomb interaction between particles is treated with perturbation theory. As a result the observed PL spectral lines can be described with a small number of parameters. The theoretical predictions account well for recent experiments.

  10. A nanoscale study of charge extraction in organic solar cells: the impact of interfacial molecular configurations.

    PubMed

    Tang, Fu-Ching; Wu, Fu-Chiao; Yen, Chia-Te; Chang, Jay; Chou, Wei-Yang; Gilbert Chang, Shih-Hui; Cheng, Horng-Long

    2015-01-07

    In the optimization of organic solar cells (OSCs), a key problem lies in the maximization of charge carriers from the active layer to the electrodes. Hence, this study focused on the interfacial molecular configurations in efficient OSC charge extraction by theoretical investigations and experiments, including small molecule-based bilayer-heterojunction (sm-BLHJ) and polymer-based bulk-heterojunction (p-BHJ) OSCs. We first examined a well-defined sm-BLHJ model system of OSC composed of p-type pentacene, an n-type perylene derivative, and a nanogroove-structured poly(3,4-ethylenedioxythiophene) (NS-PEDOT) hole extraction layer. The OSC with NS-PEDOT shows a 230% increment in the short circuit current density compared with that of the conventional planar PEDOT layer. Our theoretical calculations indicated that small variations in the microscopic intermolecular interaction among these interfacial configurations could induce significant differences in charge extraction efficiency. Experimentally, different interfacial configurations were generated between the photo-active layer and the nanostructured charge extraction layer with periodic nanogroove structures. In addition to pentacene, poly(3-hexylthiophene), the most commonly used electron-donor material system in p-BHJ OSCs was also explored in terms of its possible use as a photo-active layer. Local conductive atomic force microscopy was used to measure the nanoscale charge extraction efficiency at different locations within the nanogroove, thus highlighting the importance of interfacial molecular configurations in efficient charge extraction. This study enriches understanding regarding the optimization of the photovoltaic properties of several types of OSCs by conducting appropriate interfacial engineering based on organic/polymer molecular orientations. The ultimate power conversion efficiency beyond at least 15% is highly expected when the best state-of-the-art p-BHJ OSCs are combined with present arguments.

  11. Resolving metal-molecule interfaces at single-molecule junctions

    NASA Astrophysics Data System (ADS)

    Komoto, Yuki; Fujii, Shintaro; Nakamura, Hisao; Tada, Tomofumi; Nishino, Tomoaki; Kiguchi, Manabu

    2016-05-01

    Electronic and structural detail at the electrode-molecule interface have a significant influence on charge transport across molecular junctions. Despite the decisive role of the metal-molecule interface, a complete electronic and structural characterization of the interface remains a challenge. This is in no small part due to current experimental limitations. Here, we present a comprehensive approach to obtain a detailed description of the metal-molecule interface in single-molecule junctions, based on current-voltage (I-V) measurements. Contrary to conventional conductance studies, this I-V approach provides a correlated statistical description of both, the degree of electronic coupling across the metal-molecule interface, and the energy alignment between the conduction orbital and the Fermi level of the electrode. This exhaustive statistical approach was employed to study single-molecule junctions of 1,4-benzenediamine (BDA), 1,4-butanediamine (C4DA), and 1,4-benzenedithiol (BDT). A single interfacial configuration was observed for both BDA and C4DA junctions, while three different interfacial arrangements were resolved for BDT. This multiplicity is due to different molecular adsorption sites on the Au surface namely on-top, hollow, and bridge. Furthermore, C4DA junctions present a fluctuating I-V curve arising from the greater conformational freedom of the saturated alkyl chain, in sharp contrast with the rigid aromatic backbone of both BDA and BDT.

  12. Cyclopentadithiophene-Based Organic Semiconductors: Effect of Fluorinated Substituents on Electrochemical and Charge Transport Properties

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Reddy, J. Sreedhar; Kale, Tejaswini; Balaji, Ganapathy

    2011-03-17

    Thiophene-based semiconductors are often hole conductors that have been converted to electron-transporting materials by incorporation of electron-withdrawing groups at terminal positions, such as fluorinated substituents. This conversion of an otherwise p-type material to n-type material is often attributed to the lowering of the lowest unoccupied molecular orbital (LUMO) energy level due to the increased electron affinity in the molecule. Yet, it is not clear if lowering of LUMO energy level is a sufficient condition for yielding n-type material. Herein, we report small-molecule semiconductors based on cyclopentadithiophene (CPD), which can be orthogonally functionalized at two different positions, which allows us tomore » tune the frontier orbital energy levels. We find that simply lowering the LUMO energy level, without inclusion of fluoro groups, does not result in conversion of the otherwise p-type material to n-type material, whereas incorporation of fluorinated substituents does. This indicates that charge transport behavior is not an exclusive function of the frontier orbital energy levels.« less

  13. Measurements of ion-molecule reactions of He plus, H plus, HeH plus with H sub 2 and D sub 2

    NASA Technical Reports Server (NTRS)

    Johnsen, R.; Biondi, M. A.

    1974-01-01

    A drift tube mass spectrometer apparatus has been used to determine the rate coefficient, energy dependence and product ions of the reaction He(+) +H2. The total rate coefficient at 300 K is 1.1 plus or minus 0.1) 10 to minus 13th power cu cm/sec. The reaction proceeds principally by dissociative charge transfer to produce H(+), with the small remainder going by charge transfer to produce H2(+) and by atom rearrangement to produce HeH(+). The rate coefficient increases slowly with increasing ion mean energy, reaching a value of 2.8 x ten to the minus 13th power cu cm sec at 0.18 eV. The corresponding reaction with deuterium, He(+) + D2, exhibits a value (5 plus or minus 1) x 10 to the minus 14th cu cm/sec at 300K. The reaction rates for conversion of H(+) and HeH(+) to H3(+) on collisions with H2 molecules are found to agree well with results of previous investigations.

  14. Methoxydiphenylamine-substituted fluorene derivatives as hole transporting materials: role of molecular interaction on device photovoltaic performance.

    PubMed

    Tiazkis, Robertas; Paek, Sanghyun; Daskeviciene, Maryte; Malinauskas, Tadas; Saliba, Michael; Nekrasovas, Jonas; Jankauskas, Vygintas; Ahmad, Shahzada; Getautis, Vytautas; Khaja Nazeeruddin, Mohammad

    2017-03-10

    The molecular structure of the hole transporting material (HTM) play an important role in hole extraction in a perovskite solar cells. It has a significant influence on the molecular planarity, energy level, and charge transport properties. Understanding the relationship between the chemical structure of the HTM's and perovskite solar cells (PSCs) performance is crucial for the continued development of the efficient organic charge transporting materials. Using molecular engineering approach we have constructed a series of the hole transporting materials with strategically placed aliphatic substituents to investigate the relationship between the chemical structure of the HTMs and the photovoltaic performance. PSCs employing the investigated HTMs demonstrate power conversion efficiency values in the range of 9% to 16.8% highlighting the importance of the optimal molecular structure. An inappropriately placed side group could compromise the device performance. Due to the ease of synthesis and moieties employed in its construction, it offers a wide range of possible structural modifications. This class of molecules has a great potential for structural optimization in order to realize simple and efficient small molecule based HTMs for perovskite solar cells application.

  15. Apport de la microscopie a effet tunnel a la caracterisation d'interfaces molecule-metal a fort transfert de charge

    NASA Astrophysics Data System (ADS)

    Bedwani, Stephane

    To assess the importance of charge-transfer on the interface properties, we studied the interaction of the tetracyanoethylene (TCNE) molecule with various copper surfaces. TCNE, a highly electrophilic molecule, appears as an ideal candidate to study the influence of high charge-transfer on the electronic and structural properties of molecule-surface interfaces. Indeed, various TCNE-transition metal complexes exhibit magnetism at room temperature, which is in agreement with a very significant change of the residual charge on the TCNE molecule. The adsorption of TCNE molecules on Cu(100) and Cu(111) surfaces was studied by scanning tunneling microscopy (STM) and by density functional theory (DFT) calculations with a local density approximation (LDA). DFT-LDA calculations were performed to determine the geometric and electronic structure of the studied interfaces. Mulliken analysis was used to evaluate the partial net charge on the adsorbed species. The density of states (DOS) diagrams provided informations on the nature of the frontier orbitals involved in the charge-transfer at molecule-metal interfaces. To validate the theoretical observations, a comparative study was conducted between our simulated STM images and experimental STM images provided by our collaborators. The theoretical STM images were obtained with the SPAGS-STM software using the Landauer-Buttiker formalism with a semi-empirical Hamiltonian based on the extended Huckel theory (EHT) and parameterized using DFT calculations. During the development of the SPAGS-STM software, we have created a discretization module allowing rapid generation of STM images. This module is based on an adaptive Delaunay meshing scheme to minimize the amount of tunneling current to be computed. The general idea consists into refining the mesh, and therefore the calculations, near large contrast zones rather than over the entire image. The adapted mesh provides an STM image resolution equivalent to that obtained with a conventional Cartesian grid but with a significantly smaller number of calculated pixels. This module is independent of the solver used to compute the tunneling current and can be transposed to different imaging techniques. Our work on the adsorption of TCNE molecules on Cu(100) surfaces revealed that the molecules assemble into a 1D chain, thereby buckling excessively a few Cu atoms from the surface. The large deformations observed at the molecule-metal interface show that the Cu atoms close to the TCNE nitrile groups assist the molecular assembly and show a distinct behavior compared with other Cu atoms. A strong charge-transfer is observed at the interface leading to an almost complete occupation of the state ascribed to the lowest unoccupied molecular orbital (LUMO) of TCNE in gas phase. In addition, a back-donation of charge from the molecule to the metal via the states associated with the highest occupied molecular orbitals (HOMO) of TCNE in gas phase may be seen. The magnitude of the charge-transfer between a TCNE molecule and Cu atoms is of the same order on the Cu(111) surface but causes much less buckling than that on the Cu(100) surface. However, experimental STM images of single TCNE molecules adsorbed on Cu(111) surfaces reveal a surprising electronic multistability. In addition, scanning tunneling spectroscopy (STS) reveals that one of these states has a magnetic nature and shows a Kondo resonance. STM simulations identified the source of two non-magnetic states. DFT-LDA calculations were able to ascribe the magnetic state to the partial occupation of a state corresponding to the LUMO+2 of TCNE. Moreover, the calculations showed that additional molecular deformations to those of TCNE in adsorbed phase, such the elongation of the C=C central bond and the bend of nitrile groups toward the surface, favor this charge-transfer to the LUMO+2. This suggested the presence of a Kondo state through the vibrational excitation of the stretching mode of the C=C central bond. The main results of this thesis led to the conclusion that strong charge-transfer between adsorbed molecules on a metallic surface may induce significant buckling of the surface. This surface reconstruction mechanism that involves a bidirectional charge-transfer between the species results into a partial net charge over the molecule. This mechanism is involved in the supramolecular self-assembly process that appears similar to a coordination network. Moreover, the adsorbed molecule presents some important geometric distortions that alter its electronic structure. Additional distortions on the adsorbed molecule induced by some molecular vibration modes seem to explain a stable magnetic state that can be switch on or off by an electrical impulse. (Abstract shortened by UMI.)

  16. Charge-dependent conformations and dynamics of pamam dendrimers revealed by neutron scattering and molecular dynamics

    NASA Astrophysics Data System (ADS)

    Wu, Bin

    Neutron scattering and fully atomistic molecular dynamics (MD) are employed to investigate the structural and dynamical properties of polyamidoamine (PAMAM) dendrimers with ethylenediamine (EDA) core under various charge conditions. Regarding to the conformational characteristics, we focus on scrutinizing density profile evolution of PAMAM dendrimers as the molecular charge of dendrimer increases from neutral state to highly charged condition. It should be noted that within the context of small angle neutron scattering (SANS), the dendrimers are composed of hydrocarbon component (dry part) and the penetrating water molecules. Though there have been SANS experiments that studied the charge-dependent structural change of PAMAM dendrimers, their results were limited to the collective behavior of the aforementioned two parts. This study is devoted to deepen the understanding towards the structural responsiveness of intra-molecular polymeric and hydration parts separately through advanced contrast variation SANS data analysis scheme available recently and unravel the governing principles through coupling with MD simulations. Two kinds of acids, namely hydrochloric and sulfuric acids, are utilized to tune the pH condition and hence the molecular charge. As far as the dynamical properties, we target at understanding the underlying mechanism that leads to segmental dynamic enhancement observed from quasielstic neutron scattering (QENS) experiment previously. PAMAM dendrimers have a wealth of potential applications, such as drug delivery agency, energy harvesting medium, and light emitting diodes. More importantly, it is regarded as an ideal system to test many theoretical predictions since dendrimers conjugate both colloid-like globular shape and polymer-like flexible chains. This Ph.D. research addresses two main challenges in studying PAMAM dendrimers. Even though neutron scattering is an ideal tool to study this PAMAM dendrimer solution due to its matching temporal and spatial instrumental scales, understanding experimental results involves extensive and difficult data analysis based on liquid theory and condensed matter physics. Therefore, a model that successfully describes the inter- and intra-dendrimer correlations is crucial in obtaining and delivering reliable information. On the other hand, making meaningful comparisons between molecular dynamics and neutron scattering is a fundamental challenge to link simulations and experiments at the nano-scale. This challenge stems from our approach to utilize MD simulation to explain the underlying mechanism of experimental observation. The SANS measurements were conducted on a series of SANS spectrometers including the Extended Q-Range Small-Angle Neutron Scattering Diffractometer (EQ-SANS) and the General-Purpose Small-Angle Neutron Scattering Diffractometer (GP-SANS) at the Oak Ridge National Laboratory (ORNL), and NG7 Small Angle Neutron Scattering Spectrometer at National Institute of Standards (NIST) and Technology in U.S.A., large dynamic range small-angle diffractometer D22 at Institut Laue-Langevin (ILL) in France, and 40m-SANS Spectrometer at Korea Atomic Energy Research Institute (KAERI) in Korea. On the other hand, the Amber molecular dynamics simulation package is utilized to carry out the computational study. In this dissertation, the following observations have been revealed. The previously developed theoretical model for polyelectrolyte dendrimers are adopted to analyze SANS measurements and superb model fitting quality is found. Coupling with advanced contrast variation small angle neutron scattering (CVSANS) data analysis scheme reported recently, the intra-dendrimer hydration and hydrocarbon components distributions are revealed experimentally. The results indeed indicate that the maximum density is located in the molecular center rather than periphery, which is consistent to previous SANS studies and the back-folding picture of PAMAM dendrimers. According to this picture, at neutral condition, the exterior residues folding back into interior would necessarily lead to higher entropy and equivalently lower free energy and thereby is energetically favored. As one decreases the pH condition of PAMAM dendrimers, the constituent residues would carry positive charges. The resultant inter-residue Coulomb repulsion would naturally result in conformational evolution. We found from CVSANS analysis that when dendrimers are charged by different acids, this conformational evolution is not the same. For dendrimers charged by DCl, the mass is seen to relocate from molecular interior to periphery. Nevertheless, those acidified by D 2SO4 exhibit surprisingly minor structural change under variation of molecular charge. To explain the above observation, we performed MD simulations and calculated the excess free energy of Cl- and SO 42- counterions. The binding between sulfate ions and charged amines of PAMAM dendrimers are found to be much stronger than the case for chlorides. This more energetic binding would serve as better screening effect among charged residues. Consequently, electrostatic repulsion triggered outstretching tendency is effectively diminished. In order to make direct comparison between MD simulations and neutron scattering experiments, we proposed and implemented a rigorous method, which incorporates the contribution from those invasive water molecules, to calculate scattering functions of a single PAMAM dendrimer using equilibrium MD trajectories. The bridge between neutron scattering experiments and MD simulation is successfully established. Aside from structural comparisons between MD simulations and experiments, we utilized MD simulation to decipher the previously reported QENS experimental observation that the segmental dynamics of PAMAM dendrimer would enhance with increasing molecular charge. We pursued the mechanism from the perspective of hydrocarbon component of dendrimer and solvent (water) interaction as a form similar to hydrogen bonding. It is found that the population of this bonding would increase and the corresponding relaxation would slow down as molecular charge increases. We perceive that through more and longer interaction between penetrating water molecules and polymeric part of dendrimer, the dynamics of latter could be enhanced.

  17. Fluorescent Phthalocyanine Assembly Distinguishes Chiral Isomers of Different Types of Amino Acids and Sugars.

    PubMed

    Jiang, Yuying; Liu, Chenxi; Wang, Xiqian; Wang, Tianyu; Jiang, Jianzhuang

    2017-07-25

    The functions of some natural supramolecular architectures, such as ribosomes, are dependent on the recognition of different types of chiral biomolecules. However, the recognition of different types of chiral molecules (multiobject chiral recognition), such as amino acids and sugars, by independent and identically artificial supramolecular assembly, was rarely achieved. In this article, simple amphiphilic achiral phthalocyanine was found to form supramolecular chiral assemblies with charged water-soluble polymers upon host-guest interactions at the air/water interface. Among these systems, one identical phthalocyanine/poly(l-lysine) assembly not only can distinguish enantiomers of different amino acids but also can recognize several epimers of monose. The chiral recognitions were achieved by comparing either the steady-state fluorescence intensity or fluorescence quenching rate of phthalocyanine/poly(l-lysine) assemblies, before and after interaction with different small chiral molecules. It was demonstrated that the interactions between poly(l-lysine) and different small chiral molecules could change the aggregation of phthalocyanines. And the sensitivity of fluorescence and the excellent multiobject chiral recognition properties of the phthalocyanine/poly(l-lysine) assembly are dependent on the subtle molecular packing mode and the cooperation of different noncovalent interactions.

  18. Charge Transfer Effect on Raman and Surface Enhanced Raman Spectroscopy of Furfural Molecules.

    PubMed

    Wan, Fu; Shi, Haiyang; Chen, Weigen; Gu, Zhaoliang; Du, Lingling; Wang, Pinyi; Wang, Jianxin; Huang, Yingzhou

    2017-08-02

    The detection of furfural in transformer oil through surface enhanced Raman spectroscopy (SERS) is one of the most promising online monitoring techniques in the process of transformer aging. In this work, the Raman of individual furfural molecules and SERS of furfural-M x (M = Ag, Au, Cu) complexes are investigated through density functional theory (DFT). In the Raman spectrum of individual furfural molecules, the vibration mode of each Raman peak is figured out, and the deviation from experimental data is analyzed by surface charge distribution. In the SERS of furfural-M x complexes, the influence of atom number and species on SERS chemical enhancement factors (EFs) are studied, and are further analyzed by charge transfer effect. Our studies strengthen the understanding of charge transfer effect in the SERS of furfural molecules, which is important in the online monitoring of the transformer aging process through SERS.

  19. Charge Transfer Effect on Raman and Surface Enhanced Raman Spectroscopy of Furfural Molecules

    PubMed Central

    Wan, Fu; Shi, Haiyang; Chen, Weigen; Gu, Zhaoliang; Du, Lingling; Wang, Pinyi; Wang, Jianxin

    2017-01-01

    The detection of furfural in transformer oil through surface enhanced Raman spectroscopy (SERS) is one of the most promising online monitoring techniques in the process of transformer aging. In this work, the Raman of individual furfural molecules and SERS of furfural-Mx (M = Ag, Au, Cu) complexes are investigated through density functional theory (DFT). In the Raman spectrum of individual furfural molecules, the vibration mode of each Raman peak is figured out, and the deviation from experimental data is analyzed by surface charge distribution. In the SERS of furfural-Mx complexes, the influence of atom number and species on SERS chemical enhancement factors (EFs) are studied, and are further analyzed by charge transfer effect. Our studies strengthen the understanding of charge transfer effect in the SERS of furfural molecules, which is important in the online monitoring of the transformer aging process through SERS. PMID:28767053

  20. Oil Contact Angles in a Water-Decane-Silicon Dioxide System: Effects of Surface Charge

    NASA Astrophysics Data System (ADS)

    Xu, Shijing; Wang, Jingyao; Wu, Jiazhong; Liu, Qingjie; Sun, Chengzhen; Bai, Bofeng

    2018-04-01

    Oil wettability in the water-oil-rock systems is very sensitive to the evolution of surface charges on the rock surfaces induced by the adsorption of ions and other chemical agents in water flooding. Through a set of large-scale molecular dynamics simulations, we reveal the effects of surface charge on the oil contact angles in an ideal water-decane-silicon dioxide system. The results show that the contact angles of oil nano-droplets have a great dependence on the surface charges. As the surface charge density exceeds a critical value of 0.992 e/nm2, the contact angle reaches up to 78.8° and the water-wet state is very apparent. The variation of contact angles can be confirmed from the number density distributions of oil molecules. With increasing the surface charge density, the adsorption of oil molecules weakens and the contact areas between nano-droplets and silicon dioxide surface are reduced. In addition, the number density distributions, RDF distributions, and molecular orientations indicate that the oil molecules are adsorbed on the silicon dioxide surface layer-by-layer with an orientation parallel to the surface. However, the layered structure of oil molecules near the silicon dioxide surface becomes more and more obscure at higher surface charge densities.

  1. Oil Contact Angles in a Water-Decane-Silicon Dioxide System: Effects of Surface Charge.

    PubMed

    Xu, Shijing; Wang, Jingyao; Wu, Jiazhong; Liu, Qingjie; Sun, Chengzhen; Bai, Bofeng

    2018-04-19

    Oil wettability in the water-oil-rock systems is very sensitive to the evolution of surface charges on the rock surfaces induced by the adsorption of ions and other chemical agents in water flooding. Through a set of large-scale molecular dynamics simulations, we reveal the effects of surface charge on the oil contact angles in an ideal water-decane-silicon dioxide system. The results show that the contact angles of oil nano-droplets have a great dependence on the surface charges. As the surface charge density exceeds a critical value of 0.992 e/nm 2 , the contact angle reaches up to 78.8° and the water-wet state is very apparent. The variation of contact angles can be confirmed from the number density distributions of oil molecules. With increasing the surface charge density, the adsorption of oil molecules weakens and the contact areas between nano-droplets and silicon dioxide surface are reduced. In addition, the number density distributions, RDF distributions, and molecular orientations indicate that the oil molecules are adsorbed on the silicon dioxide surface layer-by-layer with an orientation parallel to the surface. However, the layered structure of oil molecules near the silicon dioxide surface becomes more and more obscure at higher surface charge densities.

  2. On contribution of known atomic partial charges of protein backbone in electrostatic potential density maps

    PubMed Central

    2017-01-01

    Abstract Partial charges of atoms in a molecule and electrostatic potential (ESP) density for that molecule are known to bear a strong correlation. In order to generate a set of point‐field force field parameters for molecular dynamics, Kollman and coworkers have extracted atomic partial charges for each of all 20 amino acids using restrained partial charge‐fitting procedures from theoretical ESP density obtained from condensed‐state quantum mechanics. The magnitude of atomic partial charges for neutral peptide backbone they have obtained is similar to that of partial atomic charges for ionized carboxylate side chain atoms. In this study, the effect of these known atomic partial charges on ESP is examined using computer simulations and compared with the experimental ESP density recently obtained for proteins using electron microscopy. It is found that the observed ESP density maps are most consistent with the simulations that include atomic partial charges of protein backbone. Therefore, atomic partial charges are integral part of atomic properties in protein molecules and should be included in model refinement. PMID:28370507

  3. Fano effect in the transport of an artificial molecule

    NASA Astrophysics Data System (ADS)

    Norimoto, Shota; Nakamura, Shuji; Okazaki, Yuma; Arakawa, Tomonori; Asano, Kenichi; Onomitsu, Koji; Kobayashi, Kensuke; Kaneko, Nobu-hisa

    2018-05-01

    The Fano effect is a ubiquitous phenomenon arising from interference between a discrete energy state and an energy continuum. We explore this effect in an artificial molecule, namely, two lateral quantum dots (QDs) fabricated from a two-dimensional electron gas system and coupled in series. When the coupling between the leads and QDs is small, the charge stability diagram of the system shows a honeycomb lattice structure that is characteristic of a double QD system. As the coupling increases, a honeycomb structure consisting of the Fano resonances emerges. A numerical simulation based on the T-matrix method can satisfactorily reproduce our experimental observation. This report constitutes a clear example of the ubiquitous nature of the Fano effect in mesoscopic transport.

  4. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Öner, Nazmiye, E-mail: fizikcinaz@gmail.com; Tamer, Ömer, E-mail: omertamer@sakarya.edu.tr; Avci, Davut, E-mail: davci@sakarya.edu.tr

    Quantum mechanical calculations on cis-2, 6-bis (2-chlorophenyl)-3, 3-dimethylpiperidin-4-one were performed by using HSEH1PBE level of density functional theory (DFT) with 6-311++G (d, p) basis set. Geometric parameters of the title molecule in the ground state were found to be in good agreement with experimental data. The frontier molecular orbitals (HOMO and LUMO) were simulated by the same level. Small energy gap between the HOMO and LUMO is an indicator molecular charge transfer within the title molecule. The electronegativity, chemical hardness and softness were also calculated by using HOMO and LUMO energies. Dipole moment, polarizability and hyperpolarizability parameters were also calculatedmore » by using HSEH1PBE level. All calculations were carried out with the GAUSSIAN 09 package program.« less

  5. Simple and green synthesis of protein-conjugated CdS nanoparticles and spectroscopic study on the interaction between CdS and zein

    NASA Astrophysics Data System (ADS)

    Qin, Dezhi; Zhang, Li; Du, Xian; Wang, Yabo; Zhang, Qiuxia

    2016-09-01

    The present study demonstrates the role of zein molecules in synthesizing CdS nanoassemblies through protein-directed, green synthetic approach. Zein molecules can as capping ligand and stabilizing agent to regulate the nucleation and growth of CdS nanocrystals, and the obtained products are organic-inorganic nanocomposites. The analysis of surface charge and conductivity indicates that strong electrostatic force restricts mobility of ions, which creates a local supersaturation surrounding the binding sites of zein and reduces the activated energy of nucleation. The interaction between Cd2+/CdS and zein molecules was systematically investigated through spectroscopy techniques. Fourier transform infrared (FT-IR) spectra were used to envisage the binding of the functional groups of zein with the surface of CdS nanoparticles. Ultraviolet visible (UV-Vis) and photoluminescence (PL) spectra results show that Cd2+/CdS might interact with the aromatic amino acids of protein molecules and change its chemical microenvironment. The quantum-confined effect of nanocrystals is confirmed by optical absorption spectrum due to the small size (3-5 nm) of CdS particles. The data of circular dichroism (CD) spectra indicate that the formation of CdS nanocrystals could lead to the conformational change of zein molecules. Moreover, the possible mechanism of CdS nanocrystals growth in zein solution was also discussed. The weak interactions such as Van der Waals, hydrophobic forces and hydrogen bonds in zein molecules should play a crucial factor in the self-assembly of small nanoparticles.

  6. Gastrointestinal bioavailability of 2.0 nm diameter gold nanoparticles.

    PubMed

    Smith, Candice A; Simpson, Carrie A; Kim, Ganghyeok; Carter, Carly J; Feldheim, Daniel L

    2013-05-28

    The use of gold nanoparticles as imaging agents and therapeutic delivery systems is growing rapidly. However, a significant limitation of gold nanoparticles currently is their low absorption efficiencies in the gastrointestinal (GI) tract following oral administration. In an attempt to identify ligands that facilitate gold nanoparticle absorption in the GI tract, we have studied the oral bioavailability of 2.0 nm diameter gold nanoparticles modified with the small molecules p-mercaptobenzoic acid and glutathione, and polyethylene glycols (PEG) of different lengths and charge (neutral and anionic). We show that GI absorption of gold nanoparticles modified with the small molecules tested was undetectable. However, the absorption of PEGs depended upon PEG length, with the shortest PEG studied yielding gold nanoparticle absorptions that are orders-of-magnitude larger than observed previously. As the oral route is the most convenient one for administering drugs and diagnostic reagents, these results suggest that short-chain PEGs may be useful in the design of gold nanoparticles for the diagnosis and treatment of disease.

  7. Integrated Solvent Design for CO 2 Capture and Viscosity Tuning

    DOE PAGES

    Cantu, David C.; Malhotra, Deepika; Koech, Phillip K.; ...

    2017-08-18

    We present novel design strategies for reduced viscosity single-component, water-lean CO 2 capture organic solvent systems. Through molecular simulation, we identify the main molecular-level descriptor that influences bulk solvent viscosity. Upon loading, a zwitterionic structure forms with a small activation energy of ca 16 kJ/mol and a small stabilization of ca 6 kJ/mol. Viscosity increases exponentially with CO 2 loading due to hydrogen-bonding between neighboring Zwitterions. We find that molecular structures that promote internal hydrogen bonding (within the same molecule) and suppress interactions with neighboring molecules have low viscosities. In addition, tuning the acid/base properties leads to a shift ofmore » the equilibrium toward a non-charged (acid) form that further reduces the viscosity. Here, based on the above structural criteria, a reduced order model is also presented that allows for the quick screening of large compound libraries and down selection of promising candidates for synthesis and testing.« less

  8. An artificial tongue fluorescent sensor array for identification and quantitation of various heavy metal ions.

    PubMed

    Xu, Wang; Ren, Changliang; Teoh, Chai Lean; Peng, Juanjuan; Gadre, Shubhankar Haribhau; Rhee, Hyun-Woo; Lee, Chi-Lik Ken; Chang, Young-Tae

    2014-09-02

    Herein, a small-molecule fluorescent sensor array for rapid identification of seven heavy metal ions was designed and synthesized, with its sensing mechanism mimicking that of a tongue. The photoinduced electron transfer and intramolecular charge transfer mechanism result in combinatorial interactions between sensor array and heavy metal ions, which lead to diversified fluorescence wavelength shifts and emission intensity changes. Upon principle component analysis (PCA), this result renders clear identification of each heavy metal ion on a 3D spatial dispersion graph. Further exploration provides a concentration-dependent pattern, allowing both qualitative and quantitative measurements of heavy metal ions. On the basis of this information, a "safe-zone" concept was proposed, which provides rapid exclusion of versatile hazardous species from clean water samples based on toxicity characteristic leaching procedure standards. This type of small-molecule fluorescent sensor array could open a new avenue for multiple heavy metal ion detection and simplified water quality analysis.

  9. Voltage-sensing domain of voltage-gated proton channel Hv1 shares mechanism of block with pore domains.

    PubMed

    Hong, Liang; Pathak, Medha M; Kim, Iris H; Ta, Dennis; Tombola, Francesco

    2013-01-23

    Voltage-gated sodium, potassium, and calcium channels are made of a pore domain (PD) controlled by four voltage-sensing domains (VSDs). The PD contains the ion permeation pathway and the activation gate located on the intracellular side of the membrane. A large number of small molecules are known to inhibit the PD by acting as open channel blockers. The voltage-gated proton channel Hv1 is made of two VSDs and lacks the PD. The location of the activation gate in the VSD is unknown and open channel blockers for VSDs have not yet been identified. Here, we describe a class of small molecules which act as open channel blockers on the Hv1 VSD and find that a highly conserved phenylalanine in the charge transfer center of the VSD plays a key role in blocker binding. We then use one of the blockers to show that Hv1 contains two intracellular and allosterically coupled gates. Copyright © 2013 Elsevier Inc. All rights reserved.

  10. Mitochondrial targeting of electron scavenging antioxidants: Regulation of selective oxidation vs random chain reactions

    PubMed Central

    Kagan, Valerian E.; Wipf, Peter; Stoyanovsky, Detcho; Greenberger, Joel S.; Borisenko, Grigory; Belikova, Natalia A.; Yanamala, Naveena; Samhan Arias, Alejandro K.; Tungekar, Muhammad A.; Jiang, Jianfei; Tyurina, Yulia Y.; Ji, Jing; Klein-Seetharaman, Judith; Pitt, Bruce R.; Shvedova, Anna A; Bayır, Hülya

    2009-01-01

    Effective regulation of highly compartmentalized production of reactive oxygen species and peroxidation reactions in mitochondria requires targeting of small molecule antioxidants and antioxidant enzymes into the organelles. This review describes recently developed approaches to mitochondrial targeting of small biologically active molecules based on: (i) preferential accumulation in mitochondria because of their hydrophobicity and positive charge (hydrophobic cations), (ii) binding with high affinity to an intra-mitochondrial constituent, and (iii) metabolic conversions by specific mitochondrial enzymes to reveal an active entity. In addition, targeted delivery of antioxidant enzymes via expression of leader-sequences directing the proteins into mitochondria is considered. Examples of successful antioxidant and anti-apoptotic protection based on the ability of targeted cargoes to inhibit cytochrome c-catalyzed peroxidation of a mitochondria-specific phospholipid cardiolipin, in vitro and in vivo are presented. Particular emphasis is placed on the employment of triphenylphosphonium- and hemi-gramicidin S-moieties as two effective vehicles for mitochondrial delivery of antioxidants. PMID:19716396

  11. Chirality-induced spin polarization places symmetry constraints on biomolecular interactions.

    PubMed

    Kumar, Anup; Capua, Eyal; Kesharwani, Manoj K; Martin, Jan M L; Sitbon, Einat; Waldeck, David H; Naaman, Ron

    2017-03-07

    Noncovalent interactions between molecules are key for many biological processes. Necessarily, when molecules interact, the electronic charge in each of them is redistributed. Here, we show experimentally that, in chiral molecules, charge redistribution is accompanied by spin polarization. We describe how this spin polarization adds an enantioselective term to the forces, so that homochiral interaction energies differ from heterochiral ones. The spin polarization was measured by using a modified Hall effect device. An electric field that is applied along the molecules causes charge redistribution, and for chiral molecules, a Hall voltage is measured that indicates the spin polarization. Based on this observation, we conjecture that the spin polarization enforces symmetry constraints on the biorecognition process between two chiral molecules, and we describe how these constraints can lead to selectivity in the interaction between enantiomers based on their handedness. Model quantum chemistry calculations that rigorously enforce these constraints show that the interaction energy for methyl groups on homochiral molecules differs significantly from that found for heterochiral molecules at van der Waals contact and shorter (i.e., ∼0.5 kcal/mol at 0.26 nm).

  12. Investigation of multi-state charge-storage properties of redox-active organic molecules in silicon-molecular hybrid devices for DRAM and Flash applications

    NASA Astrophysics Data System (ADS)

    Gowda, Srivardhan Shivappa

    Molecular electronics has recently spawned a considerable amount of interest with several molecules possessing charge-conduction and charge-storage properties proposed for use in electronic devices. Hybrid silicon-molecular technology has the promise of augmenting the current silicon technology and provide for a transitional path to future molecule-only technology. The focus of this dissertation work has been on developing a class of hybrid silicon-molecular electronic devices for DRAM and Flash memory applications utilizing redox-active molecules. This work exploits the ability of molecules to store charges with single-electron precision at room temperature. The hybrid devices are fabricated by forming self-assembled monolayers of redox-active molecules on Si and oxide (SiO2 and HfO2) surfaces via formation of covalent linkages. The molecules possess discrete quantum states from which electrons can tunnel to the Si substrate at discrete applied voltages (oxidation process, cell write), leaving behind a positively charged layer of molecules. The reduction (erase) process, which is the process of electrons tunneling back from Si to the molecules, neutralizes the positively charged molecular monolayer. Hybrid silicon-molecular capacitor test structures were electrically characterized with an electrolyte gate using cyclic voltammetry (CyV) and impedance spectroscopy (CV) techniques. The redox voltages, kinetics (write/erase speeds) and charge-retention characteristics were found to be strongly dependent on the Si doping type and densities, and ambient light. It was also determined that the redox energy states in the molecules communicate with the valence band of the Si substrate. This allows tuning of write and read states by modulating minority carriers in n- and p-Si substrates. Ultra-thin dielectric tunnel barriers (SiO2, HfO2) were placed between the molecules and the Si substrate to augment charge-retention for Flash memory applications. The redox response was studied as a function of tunnel oxide thickness, dielectric permittivity and energy barrier, and modified Butler-Volmer expressions were postulated to describe the redox kinetics. The speed vs. retention performance of the devices was improved via asymmetric layered tunnel barriers. The properties of molecules can be tailored by molecular design and synthetic chemistry. In this work, it was demonstrated that an alternate route to tune/enhance the properties of the hybrid device is to engineer the substrate (silicon) component. The molecules were attached to diode surfaces to tune redox voltages and improve charge-retention characteristics. N+ pockets embedded in P-Si well were utilized to obtain multiple states from a two-state molecule. The structure was also employed as a characterization tool in investigating the intrinsic properties of the molecules such as lateral conductivity within the monolayer. Redox molecules were also incorporated on an ultra thin gate-oxide of Si MOSFETs with the intent of studying the interaction of redox states with Si MOSFETs. The discrete molecular states were manifested in the drain current and threshold voltage characteristics of the device. This work demonstrates the multi-state modulation of Si-MOSFETs' drain current via redox-active molecular monolayers. Polymeric films of redox-active molecules were incorporated to improve the charge-density (ON/OFF ratio) and these structures may be employed for multi-state, low-voltage Flash memory applications. The most critical aspect of this research effort is to build a reliable and high density solid state memory technology. To this end, efforts were directed towards replacement of the electrolytic gate, which forms an extremely thin insulating double layer (˜10 nm) at the electrolyte-molecule interface, with a combination of an ultra-thin high-K dielectric layer and a metal gate. Several interesting observations were made in the research approaches towards integration and provided valuable insights into the electrolyte-redox systems. In summary, this work provides fundamental insights into the interaction of redox-energy states with silicon substrate and realistic approaches for exploiting the unique properties of the molecules that may enable solutions for nanoscale high density, low-voltage, long retention and multiple bit memory applications.

  13. Charge Transport Processes in Molecular Junctions

    NASA Astrophysics Data System (ADS)

    Smith, Christopher Eugene

    Molecular electronics (ME) has evolved into a rich area of exploration that combines the fields of chemistry, materials, electronic engineering and computational modeling to explore the physics behind electronic conduction at the molecular level. Through studying charge transport properties of single molecules and nanoscale molecular materials the field has gained the potential to bring about new avenues for the miniaturization of electrical components where quantum phenomena are utilized to achieve solid state molecular device functionality. Molecular junctions are platforms that enable these studies and consist of a single molecule or a small group of molecules directly connected to electrodes. The work presented in this thesis has built upon the current understanding of the mechanisms of charge transport in ordered junctions using self-assembled monolayer (SAM) molecular thin films. Donor and acceptor compounds were synthesized and incorporated into SAMs grown on metal substrates then the transport properties were measured with conducting probe atomic force microscopy (CP-AFM). In addition to experimentally measured current-voltage (I-V) curves, the transport properties were addressed computationally and modeled theoretically. The key objectives of this project were to 1) investigate the impact of molecular structure on hole and electron charge transport, 2) understand the nature of the charge carriers and their structure-transport properties through long (<4 nm) conjugated molecular wires, and 3) quantitatively extract interfacial properties characteristic to macroscopic junctions, such as energy level alignment and molecule-contact electronic coupling from experimental I-V curves. Here, we lay ground work for creating a more complete picture of charge transport in macroscopically ordered molecular junctions of controlled architecture, length and charge carrier. The polaronic nature of hopping transport has been predicted in long, conjugated molecular wires. Using quantum-based calculations, we modeled 'p-type' polaron transport through oligophenylenethiophene (OPTI) wires and assigned transport activation energies to specific modes of nuclear motion. We also show control over 'n-type', LUMO-mediated transport in short ( 2 nm) redox-active perylenediimide (PDI) SAMs bound to contacts through isocyano linkers. By changing the contact work function (φ) and temperature, we were able to verify thermally-assisted LUMO transport. Transition voltage spectroscopy and the single level model was employed to fit the experimental I-V curves and extract the electronic coupling (epsilon) and the EF-LUMO offset (epsilonl). It was found that epsilonl does not change with φ (LUMO pinning), while Gamma changes with both φ and temperature. Further, the PDI SAMs could be reversibly chemically gated to modulate the transport. These results help advance our understanding of transport behavior in semiconducting molecular thin films, and open opportunities to engineer improved electronic functionality into molecular devices.

  14. Modeling the Partial Atomic Charges in Inorganometallic Molecules and Solids and Charge Redistribution in Lithium-Ion Cathodes

    DOE PAGES

    Wang, Bo; Li, Shaohong L.; Truhlar, Donald G.

    2014-10-30

    Partial atomic charges are widely used for the description of charge distributions of molecules and solids. These charges are useful to indicate the extent of charge transfer and charge flow during chemical reactions in batteries, fuel cells, and catalysts and to characterize charge distributions in capacitors, liquid-phase electrolytes, and solids and at electrochemical interfaces. However, partial atomic charges given by various charge models differ significantly, especially for systems containing metal atoms. In the present study, we have compared various charge models on both molecular systems and extended systems, including Hirshfeld, CM5, MK, ChElPG, Mulliken, MBS, NPA, DDEC, LoProp, and Badermore » charges. Their merits and drawbacks are compared. The CM5 charge model is found to perform well on the molecular systems, with a mean unsigned percentage deviation of only 9% for the dipole moments. We therefore formulated it for extended systems and applied it to study charge flow during the delithiation process in lithium-containing oxides used as cathodes. Our calculations show that the charges given by the CM5 charge model are reasonable and that during the delithiation process, the charge flow can occur not only on the transition metal but also on the anions. The oxygen atoms can lose a significant density of electrons, especially for deeply delithiated materials. We also discuss other methods in current use to analyze the charge transfer and charge flow in batteries, in particular the use of formal charge, spin density, and orbital occupancy. Here, we conclude that CM5 charges provide useful information in describing charge distributions in various materials and are very promising for the study of charge transfer and charge flows in both molecules and solids.« less

  15. Modeling the Partial Atomic Charges in Inorganometallic Molecules and Solids and Charge Redistribution in Lithium-Ion Cathodes.

    PubMed

    Wang, Bo; Li, Shaohong L; Truhlar, Donald G

    2014-12-09

    Partial atomic charges are widely used for the description of charge distributions of molecules and solids. These charges are useful to indicate the extent of charge transfer and charge flow during chemical reactions in batteries, fuel cells, and catalysts and to characterize charge distributions in capacitors, liquid-phase electrolytes, and solids and at electrochemical interfaces. However, partial atomic charges given by various charge models differ significantly, especially for systems containing metal atoms. In the present study, we have compared various charge models on both molecular systems and extended systems, including Hirshfeld, CM5, MK, ChElPG, Mulliken, MBS, NPA, DDEC, LoProp, and Bader charges. Their merits and drawbacks are compared. The CM5 charge model is found to perform well on the molecular systems, with a mean unsigned percentage deviation of only 9% for the dipole moments. We therefore formulated it for extended systems and applied it to study charge flow during the delithiation process in lithium-containing oxides used as cathodes. Our calculations show that the charges given by the CM5 charge model are reasonable and that during the delithiation process, the charge flow can occur not only on the transition metal but also on the anions. The oxygen atoms can lose a significant density of electrons, especially for deeply delithiated materials. We also discuss other methods in current use to analyze the charge transfer and charge flow in batteries, in particular the use of formal charge, spin density, and orbital occupancy. We conclude that CM5 charges provide useful information in describing charge distributions in various materials and are very promising for the study of charge transfer and charge flows in both molecules and solids.

  16. Assessing the properties of internal standards for quantitative matrix-assisted laser desorption/ionization mass spectrometry of small molecules.

    PubMed

    Sleno, Lekha; Volmer, Dietrich A

    2006-01-01

    Growing interest in the ability to conduct quantitative assays for small molecules by matrix-assisted laser desorption/ionization (MALDI) has been the driving force for several recent studies. This present work includes the investigation of internal standards for these analyses using a high-repetition rate MALDI triple quadrupole instrument. Certain physicochemical properties are assessed for predicting possible matches for internal standards for different small molecules. The importance of similar molecular weight of an internal standard to its analyte is seen through experiments with a series of acylcarnitines, having a fixed charge site and growing alkyl chain length. Both acetyl- and hexanoyl-carnitine were systematically assessed with several other acylcarnitine compounds as internal standards. The results clearly demonstrate that closely matched molecular weights between analyte and internal standard are essential for acceptable quantitation results. Using alpha-cyano-4-hydroxycinnamic acid as the organic matrix, the similarities between analyte and internal standard remain the most important parameter and not necessarily their even distribution within the solid sample spot. Several 4-quinolone antibiotics as well as a diverse group of pharmaceutical drugs were tested as internal standards for the 4-quinolone, ciprofloxacin. Quantitative results were shown using the solution-phase properties, log D and pKa, of these molecules. Their distribution coefficients, log D, are demonstrated as a fundamental parameter for similar crystallization patterns of analyte and internal standard. In the end, it was also possible to quantify ciprofloxacin using a drug from a different compound class, namely quinidine, having a similar log D value as the analyte. Copyright 2006 John Wiley & Sons, Ltd.

  17. Exploration of sensing of nitrogen dioxide and ozone molecules using novel TiO2/Stanene heterostructures employing DFT calculations

    NASA Astrophysics Data System (ADS)

    Abbasi, Amirali; Sardroodi, Jaber Jahanbin

    2018-06-01

    Based on the density functional theory (DFT) calculations, we explored the sensing capabilities and electronic structures of TiO2/Stanene heterostructures as novel and highly efficient materials for detection of toxic NO2 and O3 molecules in the environment. Studied gas molecules were positioned at different sites and orientations towards the nanocomposite, and the adsorption process was examined based on the most stable structures. We found that both of these molecules are chemically adsorbed on the TiO2/Stanene heterostructures. The calculations of the adsorption energy indicate that the fivefold coordinated titanium sites of the TiO2/Stanene are the most stable sites for the adsorption of NO2 and O3 molecules. The side oxygen atoms of the gas molecules were found to be chemically bonded to these titanium atoms. The adsorption of gas molecules is an exothermic process, and the adsorption on the pristine nanocomposite is more favorable in energy than that on the nitrogen-doped nanocomposite. The effects of van der Waals interactions were taken into account, which indicate the adsorption energies were increased for the most sable configurations. The gas sensing response and charge transfers were analyzed in detail. The pristine nanocomposites have better sensing response than the doped ones. The spin density distribution plots indicate that the magnetization was mainly located over the adsorbed gas molecules. Mulliken charge analysis reveals that both NO2 and O3 molecules behave as charge acceptors, as evidenced by the accumulation of electronic charges on the adsorbed molecules predicted by charge density difference calculations. Our DFT results provide a theoretical basis for an innovative gas sensor system designed from a sensitive TiO2/Stanene heterostructures for efficient detection of harmful air pollutants such as NO2 and O3.

  18. On energetic prerequisites of attracting electrons

    NASA Astrophysics Data System (ADS)

    Sundholm, Dage

    2014-06-01

    The internal reorganization energy and the zero-point vibrational energy (ZPE) of fractionally charged molecules embedded in molecular materials are discussed. The theory for isolated open quantum systems is taken as the starting point. It is shown that for isolated molecules the internal reorganization-energy function and its slope, i.e., the chemical potential of an open molecular system are monotonically decreasing functions with respect to increasing amount of negative excess charge (q) in the range of q = [0, 1]. Calculations of the ZPE for fractionally charged molecules show that the ZPE may have a minimum for fractional occupation. The calculations show that the internal reorganization energy and changes in the ZPE are of the same order of magnitude with different behavior as a function of the excess charge. The sum of the contributions might favor molecules with fractional occupation of the molecular units and partial delocalization of the excess electrons in solid-state materials also when considering Coulomb repulsion between the excess electrons. The fractional electrons are then coherently distributed on many molecules of the solid-state material forming a condensate of attracting electrons, which is crucial for the superconducting state.

  19. On energetic prerequisites of attracting electrons.

    PubMed

    Sundholm, Dage

    2014-06-21

    The internal reorganization energy and the zero-point vibrational energy (ZPE) of fractionally charged molecules embedded in molecular materials are discussed. The theory for isolated open quantum systems is taken as the starting point. It is shown that for isolated molecules the internal reorganization-energy function and its slope, i.e., the chemical potential of an open molecular system are monotonically decreasing functions with respect to increasing amount of negative excess charge (q) in the range of q = [0, 1]. Calculations of the ZPE for fractionally charged molecules show that the ZPE may have a minimum for fractional occupation. The calculations show that the internal reorganization energy and changes in the ZPE are of the same order of magnitude with different behavior as a function of the excess charge. The sum of the contributions might favor molecules with fractional occupation of the molecular units and partial delocalization of the excess electrons in solid-state materials also when considering Coulomb repulsion between the excess electrons. The fractional electrons are then coherently distributed on many molecules of the solid-state material forming a condensate of attracting electrons, which is crucial for the superconducting state.

  20. Surface Electrostatic Potential and Water Orientation in the presence of Sodium Octanoate Dilute Monolayers Studied by Means of Molecular Dynamics Simulations.

    PubMed

    Bernardino, Kalil; de Moura, André F

    2015-10-13

    A series of atomistic molecular dynamics simulations were performed in the present investigation to assess the spontaneous formation of surfactant monolayers of sodium octanoate at the water-vacuum interface. The surfactant surface coverage increased until a saturation threshold was achieved, after which any further surfactant addition led to the formation of micellar aggregates within the solution. The saturated films were not densely packed, as might be expected for short-chained surfactants, and all films regardless of the surface coverage presented surfactant molecules with the same ordering pattern, namely, with the ionic heads toward the aqueous solution and the tails lying nearly parallel to the interface. The major contributions to the electrostatic surface potential came from the charged heads and the counterion distribution, which nearly canceled out each other. The balance between the oppositely charged ions rendered the electrostatic contributions from water meaningful, amounting to ca. 10% of the contributions arising from the ionic species. And even the aliphatic tails, whose atoms bear relatively small partial atomic charges as compared to the polar molecules and molecular fragments, contributed with ca. 20% of the total electrostatic surface potential of the systems under investigation. Although the aliphatic tails were not so orderly arranged as in a compact film, the C-H bonds assumed a preferential orientation, leading to an increased contribution to the electrostatic properties of the interface. The most prominent feature arising from the partitioning of the electrostatic potential into individual contributions was the long-range ordering of the water molecules. This ordering of the water molecules produced a repulsive dipole-dipole interaction between the two interfaces, which increased with the surface coverage. Only for a water layer wider than 10 nm was true bulk behavior observed, and the repulsive dipole-dipole interaction faded away.

  1. Electronegativity Equalization Method: Parameterization and Validation for Large Sets of Organic, Organohalogene and Organometal Molecule

    PubMed Central

    Vařeková, Radka Svobodová; Jiroušková, Zuzana; Vaněk, Jakub; Suchomel, Šimon; Koča, Jaroslav

    2007-01-01

    The Electronegativity Equalization Method (EEM) is a fast approach for charge calculation. A challenging part of the EEM is the parameterization, which is performed using ab initio charges obtained for a set of molecules. The goal of our work was to perform the EEM parameterization for selected sets of organic, organohalogen and organometal molecules. We have performed the most robust parameterization published so far. The EEM parameterization was based on 12 training sets selected from a database of predicted 3D structures (NCI DIS) and from a database of crystallographic structures (CSD). Each set contained from 2000 to 6000 molecules. We have shown that the number of molecules in the training set is very important for quality of the parameters. We have improved EEM parameters (STO-3G MPA charges) for elements that were already parameterized, specifically: C, O, N, H, S, F and Cl. The new parameters provide more accurate charges than those published previously. We have also developed new parameters for elements that were not parameterized yet, specifically for Br, I, Fe and Zn. We have also performed crossover validation of all obtained parameters using all training sets that included relevant elements and confirmed that calculated parameters provide accurate charges.

  2. Computer simulations of the solvatochromism of betaine-30

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mente, S.R.; Maroncelli, M.

    1999-09-09

    Monte Carlo simulations of the pyridinium N-phenolate dye betaine-30 in 12 solvents (20 solvent representations) were performed in order to explore the molecular basis of the E{sub T}(30) scale of solvent polarity. Ab initio (HF/6-31G{sup *}) and semiempirical (AM1 and INDO/S) electronic structure calculations were used to determine the geometry and charge distribution of betaine-30 in its S{sub 0} and S{sub 1} states. The solvent effect on the betaine absorption spectrum was assumed to derive from electrostatic interactions between the effective charge distributions of solvent molecules and the charge shift brought about by the S{sub 0} {r_arrow} S{sub 1} transition.more » Two models for this charge shift, one obtained from INDO/S calculations and the other an idealized two-site model, were used for the spectral calculations. Good agreement between simulated and observed {Delta}E{sub T} shifts (E{sub T}(30) values measured relative to the nonpolar standard tetramethylsilane) was found for both charge-shift models. In water and other hydroxylic solvents, the O atom of the betaine solute was observed to form moderately strong hydrogen bonds to between one and two solvent molecules. The contribution of these specifically coordinated molecules to the {Delta}E{sub T} shift was found to be large, (30--60%) and comparable to experimental estimates. Additional simulations of acetonitrile and methanol in equilibrium with the S{sub 1} state of betaine-30 were used to determine reorganization energies in these solvents and to decide the extent to which the solvent response to the S{sub 0} {leftrightarrow} S{sub 1} transition conforms to linear response predictions. In both solvents, the spectral distributions observed in the S{sub 0} state simulations were {approximately} 15% narrower than those in the S{sub 1} simulations, indicating only a relatively small departure from linear behavior. Reorganization energies were also estimated for a number of other solvents and compared to values reported in previous experimental and theoretical studies.« less

  3. Tuning Curvature and Stability of Monoolein Bilayers by Designer Lipid-Like Peptide Surfactants

    PubMed Central

    Yaghmur, Anan; Laggner, Peter; Zhang, Shuguang; Rappolt, Michael

    2007-01-01

    This study reports the effect of loading four different charged designer lipid-like short anionic and cationic peptide surfactants on the fully hydrated monoolein (MO)-based Pn3m phase (Q224). The studied peptide surfactants comprise seven amino acid residues, namely A6D, DA6, A6K, and KA6. D (aspartic acid) bears two negative charges, K (lysine) bears one positive charge, and A (alanine) constitutes the hydrophobic tail. To elucidate the impact of these peptide surfactants, the ternary MO/peptide/water system has been investigated using small-angle X-ray scattering (SAXS), within a certain range of peptide concentrations (R≤0.2) and temperatures (25 to 70°C). We demonstrate that the bilayer curvature and the stability are modulated by: i) the peptide/lipid molar ratio, ii) the peptide molecular structure (the degree of hydrophobicity, the type of the hydrophilic amino acid, and the headgroup location), and iii) the temperature. The anionic peptide surfactants, A6D and DA6, exhibit the strongest surface activity. At low peptide concentrations (R = 0.01), the Pn3m structure is still preserved, but its lattice increases due to the strong electrostatic repulsion between the negatively charged peptide molecules, which are incorporated into the interface. This means that the anionic peptides have the effect of enlarging the water channels and thus they serve to enhance the accommodation of positively charged water-soluble active molecules in the Pn3m phase. At higher peptide concentration (R = 0.10), the lipid bilayers are destabilized and the structural transition from the Pn3m to the inverted hexagonal phase (H2) is induced. For the cationic peptides, our study illustrates how even minor modifications, such as changing the location of the headgroup (A6K vs. KA6), affects significantly the peptide's effectiveness. Only KA6 displays a propensity to promote the formation of H2, which suggests that KA6 molecules have a higher degree of incorporation in the interface than those of A6K. PMID:17534429

  4. Critical Dipole Length for the Wetting Transition Due to Collective Water-dipoles Interactions

    PubMed Central

    Wang, Chunlei; Zhou, Bo; Tu, Yusong; Duan, Manyi; Xiu, Peng; Li, Jingye; Fang, Haiping

    2012-01-01

    The wetting behavior of water on the solid surfaces is fundamental to various physical, chemical and biological processes. Conventionally, the surface with charges or charge dipoles is hydrophilic, whereas the non-polar surface is hydrophobic though some exceptions were recently reported. Using molecular dynamics simulations, we show that there is a critical length of the charge dipoles on the solid surface. The solid surface still exhibited hydrophobic behavior when the dipole length was less than the critical value, indicating that the water molecules on the solid surface seemed not “feel” attractive interactions from the charge dipoles on the solid surface. Those unexpected observations result from the collective interactions between the water molecules and charge dipoles on the solid surface, where the steric exclusion effect between water molecules greatly reduces the water-dipole interactions. Remarkably, the steric exclusion effect is also important for surfaces with charge dipole lengths greater than this critical length. PMID:22496954

  5. Long-lived charge carrier generation in ordered films of a covalent perylenediimide–diketopyrrolopyrrole–perylenediimide molecule

    DOE PAGES

    Hartnett, Patrick E.; Dyar, Scott M.; Margulies, Eric A.; ...

    2015-07-31

    The photophysics of a covalently linked perylenediimide–diketopyrrolopyrrole–perylenediimide acceptor–donor–acceptor molecule (PDI–DPP–PDI, 1) were investigated and found to be markedly different in solution versus in unannealed and solvent annealed films. Photoexcitation of 1 in toluene results in quantitative charge separation in τ = 3.1 ± 0.2 ps, with charge recombination in τ = 340 ± 10 ps, while in unannealed/disordered films of 1, charge separation occurs in τ < 250 fs, while charge recombination displays a multiexponential decay in ~6 ns. The absence of long-lived, charge separation in the disordered film suggests that few free charge carriers are generated. In contrast, uponmore » CH₂Cl₂ vapor annealing films of 1, grazing-incidence X-ray scattering shows that the molecules form a more ordered structure. Photoexcitation of the ordered films results in initial formation of a spin-correlated radical ion pair (electron–hole pair) as indicated by magnetic field effects on the formation of free charge carriers which live for ~4 μs. This result has significant implications for the design of organic solar cells based on covalent donor–acceptor systems and shows that long-lived, charge-separated states can be achieved by controlling intramolecular charge separation dynamics in well-ordered systems.« less

  6. Understanding the Charge Transfer at the Interface of Electron Donors and Acceptors: TTF–TCNQ as an Example

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Park, Changwon; Atalla, Viktor; Smith, Sean

    Charge transfer between an electron donor and an electron acceptor is widely accepted as being independent of their relative configurations if the interaction between them is weak; however, the limit of this concept for an interacting system has not yet been well established. Our study of prototypical electron donor–acceptor molecules, tetrathiafulvalene–tetracyanoquinodimethane, using density functional theory based on an advanced functional, clearly demonstrates that for interacting molecules, their configurational arrangement is as important as their individual electronic properties in the asymptotic limit to determine the charge transfer direction. For the first time, we demonstrate that by changing their relative orientation, onemore » can reverse the charge transfer direction of the pair, causing the molecules to exchange roles as donor and acceptor. In conclusion, our theory has important implications for understanding the interfacial charge-transfer mechanism of hybrid systems and related phenomena.« less

  7. Understanding the Charge Transfer at the Interface of Electron Donors and Acceptors: TTF–TCNQ as an Example

    DOE PAGES

    Park, Changwon; Atalla, Viktor; Smith, Sean; ...

    2017-06-16

    Charge transfer between an electron donor and an electron acceptor is widely accepted as being independent of their relative configurations if the interaction between them is weak; however, the limit of this concept for an interacting system has not yet been well established. Our study of prototypical electron donor–acceptor molecules, tetrathiafulvalene–tetracyanoquinodimethane, using density functional theory based on an advanced functional, clearly demonstrates that for interacting molecules, their configurational arrangement is as important as their individual electronic properties in the asymptotic limit to determine the charge transfer direction. For the first time, we demonstrate that by changing their relative orientation, onemore » can reverse the charge transfer direction of the pair, causing the molecules to exchange roles as donor and acceptor. In conclusion, our theory has important implications for understanding the interfacial charge-transfer mechanism of hybrid systems and related phenomena.« less

  8. AtomicChargeCalculator: interactive web-based calculation of atomic charges in large biomolecular complexes and drug-like molecules.

    PubMed

    Ionescu, Crina-Maria; Sehnal, David; Falginella, Francesco L; Pant, Purbaj; Pravda, Lukáš; Bouchal, Tomáš; Svobodová Vařeková, Radka; Geidl, Stanislav; Koča, Jaroslav

    2015-01-01

    Partial atomic charges are a well-established concept, useful in understanding and modeling the chemical behavior of molecules, from simple compounds, to large biomolecular complexes with many reactive sites. This paper introduces AtomicChargeCalculator (ACC), a web-based application for the calculation and analysis of atomic charges which respond to changes in molecular conformation and chemical environment. ACC relies on an empirical method to rapidly compute atomic charges with accuracy comparable to quantum mechanical approaches. Due to its efficient implementation, ACC can handle any type of molecular system, regardless of size and chemical complexity, from drug-like molecules to biomacromolecular complexes with hundreds of thousands of atoms. ACC writes out atomic charges into common molecular structure files, and offers interactive facilities for statistical analysis and comparison of the results, in both tabular and graphical form. Due to high customizability and speed, easy streamlining and the unified platform for calculation and analysis, ACC caters to all fields of life sciences, from drug design to nanocarriers. ACC is freely available via the Internet at http://ncbr.muni.cz/ACC.

  9. Tuning charge and correlation effects for a single molecule on a graphene device

    DOE PAGES

    Wickenburg, Sebastian; Lu, Jiong; Lischner, Johannes; ...

    2016-11-25

    The ability to understand and control the electronic properties of individual molecules in a device environment is crucial for developing future technologies at the nanometre scale and below. Achieving this, however, requires the creation of three-terminal devices that allow single molecules to be both gated and imaged at the atomic scale. We have accomplished this by integrating a graphene field effect transistor with a scanning tunnelling microscope, thus allowing gate-controlled charging and spectroscopic interrogation of individual tetrafluoro-tetracyanoquinodimethane molecules. We observe a non-rigid shift in the molecule’s lowest unoccupied molecular orbital energy (relative to the Dirac point) as a function ofmore » gate voltage due to graphene polarization effects. Our results show that electron–electron interactions play an important role in how molecular energy levels align to the graphene Dirac point, and may significantly influence charge transport through individual molecules incorporated in graphene-based nanodevices.« less

  10. Effect of charged and excited states on the decomposition of 1,1-diamino-2,2-dinitroethylene molecules

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kimmel, Anna V.; Sushko, Peter V.; Shluger, Alexander L.

    The authors have calculated the electronic structure of individual 1,1-diamino-2,2-dinitroethylene molecules (FOX-7) in the gas phase by means of density functional theory with the hybrid B3LYP functional and 6-31+G(d,p) basis set and considered their dissociation pathways. Positively and negatively charged states as well as the lowest excited states of the molecule were simulated. They found that charging and excitation can not only reduce the activation barriers for decomposition reactions but also change the dominating chemistry from endo- to exothermic type. In particular, they found that there are two competing primary initiation mechanisms of FOX-7 decomposition: C-NO{sub 2} bond fission andmore » C-NO{sub 2} to CONO isomerization. Electronic excitation or charging of FOX-7 disfavors CONO formation and, thus, terminates this channel of decomposition. However, if CONO is formed from the neutral FOX-7 molecule, charge trapping and/or excitation results in spontaneous splitting of an NO group accompanied by the energy release. Intramolecular hydrogen transfer is found to be a rare event in FOX-7 unless free electrons are available in the vicinity of the molecule, in which case HONO formation is a feasible exothermic reaction with a relatively low energy barrier. The effect of charged and excited states on other possible reactions is also studied. Implications of the obtained results to FOX-7 decomposition in condensed state are discussed.« less

  11. A Small Aptamer with Strong and Specific Recognition of the Triphosphate of ATP

    PubMed Central

    Sazani, Peter L.; Larralde, Rosa

    2004-01-01

    We report the in vitro selection of an RNA-based ATP aptamer with the ability to discriminate between adenosine ligands based on their 5‘ phosphorylation state. Previous selection of ATP aptamers yielded molecules that do not significantly discriminate between ligands at the 5‘ position. By applying a selective pressure that demands recognition of the 5‘ triphosphate, we obtained an aptamer that binds to ATP with a Kd of approximately 5 μM, and to AMP with a Kd of approximately 5.5 mM, a difference of 1100-fold. This aptamer demonstrates the ability of small RNAs to interact with negatively charged moieties. PMID:15237981

  12. Adsorption of Bromine on Gold Nanoclusters

    NASA Astrophysics Data System (ADS)

    Salvo, Christopher; Keagy, Josiah; Yarmoff, Jory

    Small metal nanoclusters are extremely effective as catalysts, with rates that rival those of enzymes in biological systems. The first step in a catalytic reaction is the adsorption of a precursor molecule. The neutralization of alkali projectiles during low energy ion scattering (LEIS), which is acutely sensitive to the local electrostatic potential a few Å's above the surface, is used here to probe Au nanoclusters grown on SiO2 as they are reacted with Br2. Previous work had demonstrated very efficient neutralization in scattering from small catalytically active Au clusters, which was interpreted as an indication that the bare clusters are negatively charged. X-ray photoelectron spectroscopy and LEIS show little or no Br signal after exposing SiO2 and Au foil to Br2, suggesting that adsorption does not occur because the Br-Br bond does not break. Dissociative adsorption occurs rapidly, however, when small Au nanoclusters are reacted with Br2. 1.5 keV Na+ ions scattered from the Au clusters show a decrease in the neutralization probability as Br is reacted, indicating that adsorption results in charge being transferred from the cluster to the Br adatom. This material is based upon work supported by the National Science Foundation under CHE - 1611563.

  13. Use of stabilizing mutations to engineer a charged group within a ligand-binding hydrophobic cavity in T4 lysozyme.

    PubMed

    Liu, Lijun; Baase, Walter A; Michael, Miya M; Matthews, Brian W

    2009-09-22

    Both large-to-small and nonpolar-to-polar mutations in the hydrophobic core of T4 lysozyme cause significant loss in stability. By including supplementary stabilizing mutations we constructed a variant that combines the cavity-creating substitution Leu99 --> Ala with the buried charge mutant Met102 --> Glu. Crystal structure determination confirmed that this variant has a large cavity with the side chain of Glu102 located within the cavity wall. The cavity includes a large disk-shaped region plus a bulge. The disk-like region is essentially nonpolar, similar to L99A, while the Glu102 substituent is located in the vicinity of the bulge. Three ordered water molecules bind within this part of the cavity and appear to stabilize the conformation of Glu102. Glu102 has an estimated pKa of about 5.5-6.5, suggesting that it is at least partially charged in the crystal structure. The polar ligands pyridine, phenol and aniline bind within the cavity, and crystal structures of the complexes show one or two water molecules to be retained. Nonpolar ligands of appropriate shape can also bind in the cavity and in some cases exclude all three water molecules. This disrupts the hydrogen-bond network and causes the Glu102 side chain to move away from the ligand by up to 0.8 A where it remains buried in a completely nonpolar environment. Isothermal titration calorimetry revealed that the binding of these compounds stabilizes the protein by 4-6 kcal/mol. For both polar and nonpolar ligands the binding is enthalpically driven. Large negative changes in entropy adversely balance the binding of the polar ligands, whereas entropy has little effect on the nonpolar ligand binding.

  14. Development of molecularly imprinted polymer-based field effect transistor for sugar chain sensing

    NASA Astrophysics Data System (ADS)

    Nishitani, Shoichi; Kajisa, Taira; Sakata, Toshiya

    2017-04-01

    In this study, we developed a molecularly imprinted polymer-based field-effect transistor (MIP-gate FET) for selectively detecting sugar chains in aqueous media, focusing on 3‧-sialyllactose (3SLac) and 6‧-sialyllactose (6SLac). The FET biosensor enables the detection of small molecules as long as they have intrinsic charges. Additionally, the MIP gels include the template for the target molecule, which is selectively trapped without requiring enzyme-target molecule reaction. The MIP gels were synthesized on the gate surface of the FET device, including phenylboronic acid (PBA), which enables binding to sugar chains. Firstly, the 3SLac-MIP-gate FET quantitatively detected 3SLac at µM levels. This is because the FET device recognized the change in molecular charges on the basis of PBA-3SLac binding in the MIP gel. Moreover, 3SLac was selectively detected using the 3SLac- and 6SLac-MIP-gate FETs to some extent, where the detecting signal from the competent was suppressed by 40% at maximum. Therefore, a platform based on the MIP-coupled FET biosensor is suitable for a selective biosensing system in an enzyme-free manner, which can be applied widely in medical fields. However, we need to further improve the selectivity of MIP-gate FETs to discriminate more clearly between similar structures of sugar chains such as 3SLac and 6SLac.

  15. Antibacterial Peptidomimetics: Polymeric Synthetic Mimics of Antimicrobial Peptides

    NASA Astrophysics Data System (ADS)

    Lienkamp, Karen; Madkour, Ahmad E.; Tew, Gregory N.

    Polymer-based peptidomimetics, or proteinomimetics, are a relatively young and dynamic field of research. The ability to successfully mimic the biochemical activity of antimicrobial peptides (AMPs) has been demonstrated by several groups. This has been accomplished by careful tuning of the molecule's hydrophobicity and charge density. At the same time, many important questions remain to be answered, including the role of backbone rigidity, details of membrane insertion, and the role of curvature in the self-assemblies between these novel peptidemimetics and phospholipids. As the biological properties of polymeric synthetic mimics of AMPs (SMAMPs) result from the interplay of many parameters, it is not yet possible to predict the exact properties of such molecules from their mere chemical structure. However, as demonstrated here, the effect of certain design features such as charge and hydrophobicity on the properties across a polymer series is understood. Compared to the mechanistic specifics that are known about the interactions of AMPs or small antibacterial molecules with membranes and cells, relatively little is known concerning the interaction of polymeric SMAMPs with membranes. Beyond SMAMPs, numerous opportunities exist and protein transduction domain mimics are an active area of research in the Tew laboratory. These two examples, one quite new and the other studied for almost a decade, demonstrate that it is possible to teach synthetic polymers to behave like peptides, despite their lack of sequence specificity and secondary structure.

  16. The voltage-dependent anion channel as a biological transistor: theoretical considerations.

    PubMed

    Lemeshko, V V; Lemeshko, S V

    2004-07-01

    The voltage-dependent anion channel (VDAC) is a porin of the mitochondrial outer membrane with a bell-shaped permeability-voltage characteristic. This porin restricts the flow of negatively charged metabolites at certain non-zero voltages, and thus might regulate their flux across the mitochondrial outer membrane. Here, we have developed a mathematical model illustrating the possibility of interaction between two steady-state fluxes of negatively charged metabolites circulating across the VDAC in a membrane. The fluxes interact by contributing to generation of the membrane electrical potential with subsequent closure of the VDAC. The model predicts that the VDAC might function as a single-molecule biological transistor and amplifier, because according to the obtained calculations a small change in the flux of one pair of different negatively charged metabolites causes a significant modulation of a more powerful flux of another pair of negatively charged metabolites circulating across the same membrane with the VDAC. Such transistor-like behavior of the VDAC in the mitochondrial outer membrane might be an important principle of the cell energy metabolism regulation under some physiological conditions.

  17. Organic field-effect transistors using single crystals.

    PubMed

    Hasegawa, Tatsuo; Takeya, Jun

    2009-04-01

    Organic field-effect transistors using small-molecule organic single crystals are developed to investigate fundamental aspects of organic thin-film transistors that have been widely studied for possible future markets for 'plastic electronics'. In reviewing the physics and chemistry of single-crystal organic field-effect transistors (SC-OFETs), the nature of intrinsic charge dynamics is elucidated for the carriers induced at the single crystal surfaces of molecular semiconductors. Materials for SC-OFETs are first reviewed with descriptions of the fabrication methods and the field-effect characteristics. In particular, a benchmark carrier mobility of 20-40 cm 2 Vs -1 , achieved with thin platelets of rubrene single crystals, demonstrates the significance of the SC-OFETs and clarifies material limitations for organic devices. In the latter part of this review, we discuss the physics of microscopic charge transport by using SC-OFETs at metal/semiconductor contacts and along semiconductor/insulator interfaces. Most importantly, Hall effect and electron spin resonance (ESR) measurements reveal that interface charge transport in molecular semiconductors is properly described in terms of band transport and localization by charge traps.

  18. Organic field-effect transistors using single crystals

    PubMed Central

    Hasegawa, Tatsuo; Takeya, Jun

    2009-01-01

    Organic field-effect transistors using small-molecule organic single crystals are developed to investigate fundamental aspects of organic thin-film transistors that have been widely studied for possible future markets for ‘plastic electronics’. In reviewing the physics and chemistry of single-crystal organic field-effect transistors (SC-OFETs), the nature of intrinsic charge dynamics is elucidated for the carriers induced at the single crystal surfaces of molecular semiconductors. Materials for SC-OFETs are first reviewed with descriptions of the fabrication methods and the field-effect characteristics. In particular, a benchmark carrier mobility of 20–40 cm2 Vs−1, achieved with thin platelets of rubrene single crystals, demonstrates the significance of the SC-OFETs and clarifies material limitations for organic devices. In the latter part of this review, we discuss the physics of microscopic charge transport by using SC-OFETs at metal/semiconductor contacts and along semiconductor/insulator interfaces. Most importantly, Hall effect and electron spin resonance (ESR) measurements reveal that interface charge transport in molecular semiconductors is properly described in terms of band transport and localization by charge traps. PMID:27877287

  19. Formation and fragmentation of quadruply charged molecular ions by intense femtosecond laser pulses.

    PubMed

    Yatsuhashi, Tomoyuki; Nakashima, Nobuaki

    2010-07-22

    We investigated the formation and fragmentation of multiply charged molecular ions of several aromatic molecules by intense nonresonant femtosecond laser pulses of 1.4 mum with a 130 fs pulse duration (up to 2 x 10(14) W cm(-2)). Quadruply charged states were produced for 2,3-benzofluorene and triphenylene molecular ion in large abundance, whereas naphthalene and 1,1'-binaphthyl resulted only in up to triply charged molecular ions. The laser wavelength was nonresonant with regard to the electronic transitions of the neutral molecules, and the degree of fragmentation was strongly correlated with the absorption of the singly charged cation radical. Little fragmentation was observed for naphthalene (off-resonant with cation), whereas heavy fragmentation was observed in the case of 1,1'-binaphthyl (resonant with cation). The degree of H(2) (2H) and 2H(2) (4H) elimination from molecular ions increased as the charge states increased in all the molecules examined. A striking difference was found between triply and quadruply charged 2,3-benzofluorene: significant suppression of molecular ions with loss of odd number of hydrogen was observed in the quadruply charged ions. The Coulomb explosion of protons in the quadruply charged state and succeeding fragmentation resulted in the formation of triply charged molecular ions with an odd number of hydrogens. The hydrogen elimination mechanism in the highly charged state is discussed.

  20. Charge transfer and adsorption-desorption kinetics in carbon nanotube and graphene gas sensing

    NASA Astrophysics Data System (ADS)

    Liang, Sang-Zi; Chen, Gugang; Harutyunyan, Avetik; Cole, Milton; Sofo, Jorge

    2014-03-01

    Detection of molecules in the gas phase by carbon nanotube and graphene has great application potentials due to the high sensitivity and surface-to-volume ratio. In chemiresistor, the conductance of the materials has been proposed to change as a result of charge transfer from the adsorbed molecules. Due to self-interaction errors, calculations using LDA or GGA density functionals have an innate disadvantage in dealing with charge transfer situations. A model which takes into consideration the dielectric interaction between the graphene surface and the molecule is employed to estimate the distance where charge transfer becomes favorable. Adsorption-desorption kinetics is studied with a modified Langmuir model, including sites from which the molecules do not desorb within the experimental time. Assuming a constant mobility, the model reproduces existing experimental conductance data. Its parameters provide information about the microscopic process during the detection and varying them allows optimization of aspects of sensor performance, including sensitivity, detection limit and response time. This work is supported by Honda Research Institute USA, Inc.

  1. Asymmetric distribution of charged lipids between the leaflets of a vesicle bilayer induced by melittin and alamethicin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Qian, Shuo; Heller, William T

    2011-01-01

    Cellular membranes are complex mixtures of lipids, proteins, and other small molecules that provide functional, dynamic barriers between the cell and its environment, as well as between environments within the cell. The lipid composition of the membrane is highly specific and controlled in terms of both content and lipid localization. The membrane structure results from the complex interplay between the wide varieties of molecules present. Here, small-angle neutron scattering and selective deuterium labeling were used to probe the impact of the membrane-active peptides melittin and alamethicin on the structure of lipid bilayers composed of a mixture of the lipids dimyristoylmore » phosphatidylglycerol (DMPG) and chain-perdeuterated dimyristoyl phosphatidylcholine (DMPC). We found that both peptides enriched the outer leaflet of the bilayer with the negatively charged DMPG, creating an asymmetric distribution of lipids. The level of enrichment is peptide concentration-dependent and is stronger for melittin than it is for alamethicin. The enrichment between the inner and outer bilayer leaflets occurs at very low peptide concentrations and increases with peptide concentration, including when the peptide adopts a membrane-spanning, pore-forming state. The results suggest that these membrane-active peptides may have a secondary stressful effect on target cells at low concentrations that results from a disruption of the lipid distribution between the inner and outer leaflets of the bilayer that is independent of the formation of transmembrane pores.« less

  2. Effect of π-bridge units on properties of A-π-D-π-A-type nonfullerene acceptors for organic solar cells.

    PubMed

    Wang, Yan-Ling; Li, Quan-Song; Li, Ze-Sheng

    2018-05-15

    Acceptor-π-donor-π-acceptor (A-π-D-π-A)-types of small molecules are very promising nonfullerene acceptors to overcome the drawbacks of fullerene derivatives such as the weak absorption ability and electronic adjustability. However, only few attempts have been made to develop π-bridge units to construct highly efficient acceptors in OSCs. Herein, taking the reported acceptor P1 as a reference, five small-structured acceptors (P2, P3, P4, P5, and P6) have been designed via the replacement of the π-bridge unit. A combination of quantum chemistry and Marcus theory approaches is employed to investigate the effect of different π-bridge units on the optical, electronic, and charge transport properties of P1-P6. The calculation results show that the designed molecules P2 and P5 can become potential acceptor replacements of P1 due to their red-shifted absorption bands, appropriate energy levels, low exciton binding energy, and high electron affinity and electron mobility. Additionally, compared with P3HT/P1, P3HT/P2 and P3HT/P5 exhibit stronger and wider absorption peaks, larger electron transfer distances (DCT), greater transferred charge amounts (Δq), and smaller overlaps (Λ), which shows that P2 and P5 have more significant electron transfer characteristics and favorable exciton dissociation capabilities for enhancing the short-circuit current density (JSC) and thus, they are potential acceptors in OSCs.

  3. Molecular charge distribution and dispersion of electronic states in the contact layer between pentacene and Cu(119) and beyond

    NASA Astrophysics Data System (ADS)

    Annese, E.; Fujii, J.; Baldacchini, C.; Zhou, B.; Viol, C. E.; Vobornik, I.; Betti, M. G.; Rossi, G.

    2008-05-01

    The interaction of pentacene molecules in contact with the Cu(119) stepped surface has been directly imaged by scanning tunneling microscopy and analyzed by angle resolved photoemission spectroscopy. Interacting molecules, which are in contact with copper, generate dispersive electronic states associated with a perturbed electron charge density distribution of the molecular orbitals. In contrast, the electron charge density of molecules of the pentacene on top of the first layer, which is not in direct contact with the Cu surface, shows an intramolecular structure very similar to that of the free molecule. Our results indicate that the delocalization of the molecular states in the pentacene/Cu system is confined to the very first molecular layer at the interface.

  4. Trivalent Ions under Charged Langmuir Monolayers: Nanoscale Mechanisms for Charge Inversion and Liquid-Liquid Extraction

    NASA Astrophysics Data System (ADS)

    Miller, Mitchell

    Ions dissolved in solution are known to interact in remarkable ways with charged Langmuir monolayers. The organic monolayer can be used as a molecular template for ordered nucleation of inorganic crystals (biomineralization) and functional nanoparticles. However, the clear majority of experiments demonstrating these behaviors have been performed with divalent ions. Trivalent ions are present in several important processes that are unique from previously studied divalent systems. We will demonstrate that trivalent ions under floating monolayers can model two important systems: charge inversion and liquid-liquid solvent extraction. Using in situ synchrotron x-ray scattering and emission methods, we can make direct, nanoscale observations of the interactions between ion and monolayer. Charge inversion is a fascinating phenomenon in which small ions of an opposite charge to some large object (colloidal particle, DNA molecule, etc.) will attach to and reverse the object's charge, rather than simply neutralizing it. There are many experimental systems demonstrating this behavior and an enormous body of theoretical work to explain it. Two classes of explanation exist for how charge inversion may occur, "chemical" and "physical" mechanism. Using grazing incidence diffraction (GID), we have found that ions can form an ordered lattice which is incommensurate to a floating, charged monolayer. Because the ions are incommensurate, they cannot be specifically attached to molecules in the monolayer and must be, therefore, held in place by "physical" means. Solvent extraction can be an extremely complex procedure, so our approach to studying it is to simplify the system into a basic model. Ordinarily, two immiscible liquids--an aqueous phase containing some desired species and other impurities and an organic phase, which sometimes contains extractant molecules that improve efficiency--are mixed together and allowed to separate again. While the liquids are being mixed together, the target species from the aqueous phase is pulled across the interface into the organic phase. The mechanism by which the transfer occurs is very poorly understood and very difficult to study directly since it is a very dynamic process and obscured by the bulk of the liquids. Here we propose that the air-water interface is a model of the liquid-liquid interface; in our model, the hydrophobic "organic" phase is the air above the water. This lets us make direct observations of the interactions between ions dissolved in the aqueous phase and the extractant molecules in the organic phase with x-rays, something which would be impossible in an ordinary solvent extraction experiment. We observed a sharp transition in ordering as the atomic weight of the ion dissolved in solution is increased. One would expect a continuous variation, since the size of the ions varies continuously. Second, using x-ray fluorescence, we find that heavier lanthanides are much more strongly attracted to the monolayer than light ones. The unexpected nature of our results emphasizes the need for bottom-up approaches to understanding these systems rather than the top-down method used for the last century. In addition, our results demonstrate that it is, indeed, possible to overcome the experimental difficulties and make the types of measurements necessary for this approach.

  5. An improved limit on the charge of antihydrogen from stochastic acceleration.

    PubMed

    Ahmadi, M; Baquero-Ruiz, M; Bertsche, W; Butler, E; Capra, A; Carruth, C; Cesar, C L; Charlton, M; Charman, A E; Eriksson, S; Evans, L T; Evetts, N; Fajans, J; Friesen, T; Fujiwara, M C; Gill, D R; Gutierrez, A; Hangst, J S; Hardy, W N; Hayden, M E; Isaac, C A; Ishida, A; Jones, S A; Jonsell, S; Kurchaninov, L; Madsen, N; Maxwell, D; McKenna, J T K; Menary, S; Michan, J M; Momose, T; Munich, J J; Nolan, P; Olchanski, K; Olin, A; Povilus, A; Pusa, P; Rasmussen, C Ø; Robicheaux, F; Sacramento, R L; Sameed, M; Sarid, E; Silveira, D M; So, C; Tharp, T D; Thompson, R I; van der Werf, D P; Wurtele, J S; Zhmoginov, A I

    2016-01-21

    Antimatter continues to intrigue physicists because of its apparent absence in the observable Universe. Current theory requires that matter and antimatter appeared in equal quantities after the Big Bang, but the Standard Model of particle physics offers no quantitative explanation for the apparent disappearance of half the Universe. It has recently become possible to study trapped atoms of antihydrogen to search for possible, as yet unobserved, differences in the physical behaviour of matter and antimatter. Here we consider the charge neutrality of the antihydrogen atom. By applying stochastic acceleration to trapped antihydrogen atoms, we determine an experimental bound on the antihydrogen charge, Qe, of |Q| < 0.71 parts per billion (one standard deviation), in which e is the elementary charge. This bound is a factor of 20 less than that determined from the best previous measurement of the antihydrogen charge. The electrical charge of atoms and molecules of normal matter is known to be no greater than about 10(-21)e for a diverse range of species including H2, He and SF6. Charge-parity-time symmetry and quantum anomaly cancellation demand that the charge of antihydrogen be similarly small. Thus, our measurement constitutes an improved limit and a test of fundamental aspects of the Standard Model. If we assume charge superposition and use the best measured value of the antiproton charge, then we can place a new limit on the positron charge anomaly (the relative difference between the positron and elementary charge) of about one part per billion (one standard deviation), a 25-fold reduction compared to the current best measurement.

  6. Probing protein orientation near charged nanosurfaces for simulation-assisted biosensor design.

    PubMed

    Cooper, Christopher D; Clementi, Natalia C; Barba, Lorena A

    2015-09-28

    Protein-surface interactions are ubiquitous in biological processes and bioengineering, yet are not fully understood. In biosensors, a key factor determining the sensitivity and thus the performance of the device is the orientation of the ligand molecules on the bioactive device surface. Adsorption studies thus seek to determine how orientation can be influenced by surface preparation, varying surface charge, and ambient salt concentration. In this work, protein orientation near charged nanosurfaces is obtained under electrostatic effects using the Poisson-Boltzmann equation, in an implicit-solvent model. Sampling the free energy for protein G B1 D4' at a range of tilt and rotation angles with respect to the charged surface, we calculated the probability of the protein orientations and observed a dipolar behavior. This result is consistent with published experimental studies and combined Monte Carlo and molecular dynamics simulations using this small protein, validating our method. More relevant to biosensor technology, antibodies such as immunoglobulin G are still a formidable challenge to molecular simulation, due to their large size. With the Poisson-Boltzmann model, we obtained the probability distribution of orientations for the iso-type IgG2a at varying surface charge and salt concentration. This iso-type was not found to have a preferred orientation in previous studies, unlike the iso-type IgG1 whose larger dipole moment was assumed to make it easier to control. Our results show that the preferred orientation of IgG2a can be favorable for biosensing with positive charge on the surface of 0.05 C/m(2) or higher and 37 mM salt concentration. The results also show that local interactions dominate over dipole moment for this protein. Improving immunoassay sensitivity may thus be assisted by numerical studies using our method (and open-source code), guiding changes to fabrication protocols or protein engineering of ligand molecules to obtain more favorable orientations.

  7. Probing protein orientation near charged nanosurfaces for simulation-assisted biosensor design

    NASA Astrophysics Data System (ADS)

    Cooper, Christopher D.; Clementi, Natalia C.; Barba, Lorena A.

    2015-09-01

    Protein-surface interactions are ubiquitous in biological processes and bioengineering, yet are not fully understood. In biosensors, a key factor determining the sensitivity and thus the performance of the device is the orientation of the ligand molecules on the bioactive device surface. Adsorption studies thus seek to determine how orientation can be influenced by surface preparation, varying surface charge, and ambient salt concentration. In this work, protein orientation near charged nanosurfaces is obtained under electrostatic effects using the Poisson-Boltzmann equation, in an implicit-solvent model. Sampling the free energy for protein G B1 D4' at a range of tilt and rotation angles with respect to the charged surface, we calculated the probability of the protein orientations and observed a dipolar behavior. This result is consistent with published experimental studies and combined Monte Carlo and molecular dynamics simulations using this small protein, validating our method. More relevant to biosensor technology, antibodies such as immunoglobulin G are still a formidable challenge to molecular simulation, due to their large size. With the Poisson-Boltzmann model, we obtained the probability distribution of orientations for the iso-type IgG2a at varying surface charge and salt concentration. This iso-type was not found to have a preferred orientation in previous studies, unlike the iso-type IgG1 whose larger dipole moment was assumed to make it easier to control. Our results show that the preferred orientation of IgG2a can be favorable for biosensing with positive charge on the surface of 0.05 C/m2 or higher and 37 mM salt concentration. The results also show that local interactions dominate over dipole moment for this protein. Improving immunoassay sensitivity may thus be assisted by numerical studies using our method (and open-source code), guiding changes to fabrication protocols or protein engineering of ligand molecules to obtain more favorable orientations.

  8. The effect of polymer size and charge of molecules on permeation through synovial membrane and accumulation in hyaline articular cartilage.

    PubMed

    Sterner, B; Harms, M; Wöll, S; Weigandt, M; Windbergs, M; Lehr, C M

    2016-04-01

    The treatment of joint related diseases often involves direct intra-articular injections. For rational development of novel delivery systems with extended residence time in the joint, detailed understanding of transport and retention phenomena within the joint is mandatory. This work presents a systematic study on the in vitro permeation, penetration and accumulation of model polymers with differing charges and molecular weights in bovine joint tissue. Permeation experiments with bovine synovial membrane were performed with PEG polymers (6-200 kDa) and methylene blue in customized diffusion chambers. For polyethylene glycol, 2-fold (PEG 6 kDa), 3-fold (PEG 10 kDa) and 13-fold (PEG 35 kDa) retention by the synovial membrane in reference to the small molecule methylene blue was demonstrated. No PEG 200 kDa was found in the acceptor in detectable amounts after 48 h. This showed the potential for a distinct extension of joint residence times by increasing molecular weights. In addition, experiments with bovine cartilage tissue were conducted. The ability for positively charged, high molecular weight chitosans and HEMA-Co-TMAP (HCT) polymers (up to 233 kDa) to distribute throughout the entire cartilage matrix was demonstrated. In contrast, a distribution into cartilage was not observed for neutral PEG polymers (6-200 kDa). Furthermore, the positive charge density of different compounds (chitosan, HEMA-Co-TMAP, methylene blue, MSC C1 (neutral NCE) and MSC D1 (positively charged NCE) was found to correlate with their accumulation in bovine cartilage tissue. In summary, the results offer pre-clinical in vitro data, indicating that the modification of molecular size and charge of a substance has the potential to decelerate its clearance through the synovial membrane and to promote accumulation inside the cartilage matrix. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. Selective adsorption of toluene-3,4-dithiol on Si(553)-Au surfaces

    NASA Astrophysics Data System (ADS)

    Suchkova, Svetlana; Hogan, Conor; Bechstedt, Friedhelm; Speiser, Eugen; Esser, Norbert

    2018-01-01

    The adsorption of small organic molecules onto vicinal Au-stabilized Si(111) surfaces is shown to be a versatile route towards controlled growth of ordered organic-metal hybrid one-dimensional nanostructures. Density functional theory is used to investigate the site-specific adsorption of toluene-3,4-dithiol (TDT) molecules onto the clean Si(553)-Au surface and onto a co-doped surface whose steps are passivated by hydrogen. We find that the most reactive sites involve bonding to silicon at the step edge or on the terraces, while gold sites are relatively unfavored. H passivation and TDT adsorption both induce a controlled charge redistribution within the surface layer, causing the surface metallicity, electronic structure, and chemical reactivity of individual adsorption sites to be substantially altered.

  10. Gaussian polarizable-ion tight binding.

    PubMed

    Boleininger, Max; Guilbert, Anne Ay; Horsfield, Andrew P

    2016-10-14

    To interpret ultrafast dynamics experiments on large molecules, computer simulation is required due to the complex response to the laser field. We present a method capable of efficiently computing the static electronic response of large systems to external electric fields. This is achieved by extending the density-functional tight binding method to include larger basis sets and by multipole expansion of the charge density into electrostatically interacting Gaussian distributions. Polarizabilities for a range of hydrocarbon molecules are computed for a multipole expansion up to quadrupole order, giving excellent agreement with experimental values, with average errors similar to those from density functional theory, but at a small fraction of the cost. We apply the model in conjunction with the polarizable-point-dipoles model to estimate the internal fields in amorphous poly(3-hexylthiophene-2,5-diyl).

  11. Gaussian polarizable-ion tight binding

    NASA Astrophysics Data System (ADS)

    Boleininger, Max; Guilbert, Anne AY; Horsfield, Andrew P.

    2016-10-01

    To interpret ultrafast dynamics experiments on large molecules, computer simulation is required due to the complex response to the laser field. We present a method capable of efficiently computing the static electronic response of large systems to external electric fields. This is achieved by extending the density-functional tight binding method to include larger basis sets and by multipole expansion of the charge density into electrostatically interacting Gaussian distributions. Polarizabilities for a range of hydrocarbon molecules are computed for a multipole expansion up to quadrupole order, giving excellent agreement with experimental values, with average errors similar to those from density functional theory, but at a small fraction of the cost. We apply the model in conjunction with the polarizable-point-dipoles model to estimate the internal fields in amorphous poly(3-hexylthiophene-2,5-diyl).

  12. Electronic levels and charge distribution near the interface of nickel

    NASA Technical Reports Server (NTRS)

    Waber, J. T.

    1982-01-01

    The energy levels in clusters of nickel atoms were investigated by means of a series of cluster calculations using both the multiple scattering and computational techniques (designated SSO) which avoids the muffin-tin approximation. The point group symmetry of the cluster has significant effect on the energy of levels nominally not occupied. This influences the electron transfer process during chemisorption. The SSO technique permits the approaching atom or molecule plus a small number of nickel atoms to be treated as a cluster. Specifically, molecular levels become more negative in the O atom, as well as in a CO molecule, as the metal atoms are approached. Thus, electron transfer from the nickel and bond formation is facilitated. This result is of importance in understanding chemisorption and catalytic processes.

  13. Encapsulation of small ionic molecules within alpha-cyclodextrins.

    PubMed

    Rodriguez, Javier; Elola, M Dolores

    2009-02-05

    Results from molecular dynamics experiments pertaining to the encapsulation of ClO4- within the hydrophobic cavity of an aqueous alpha-cyclodextrin (alpha-CD) are presented. Using a biased sampling procedure, we constructed the Gibbs free energy profile associated with the complexation process. The profile presents a global minimum at the vicinity of the primary hydroxyl groups, where the ion remains tightly coordinated to four water molecules via hydrogen bonds. Our estimate for the global free energy of encapsulation yields DeltaGenc approximately -2.5 kBT. The decomposition of the average forces acting on the trapped ion reveals that the encapsulation is controlled by Coulomb interactions between the ion and OH groups in the CD, with a much smaller contribution from the solvent molecules. Changes in the previous results, arising from the partial methylation of the host CD and modifications in the charge distribution of the guest molecule are also discussed. The global picture that emerges from our results suggests that the stability of the ClO4- encapsulation involves not only the individual ion but also its first solvation shell.

  14. Electrohydrodynamic pressure enhanced by free space charge for electrically induced structure formation with high aspect ratio.

    PubMed

    Tian, Hongmiao; Wang, Chunhui; Shao, Jinyou; Ding, Yucheng; Li, Xiangming

    2014-10-28

    Electrically induced structure formation (EISF) is an interesting and unique approach for generating a microstructured duplicate from a rheological polymer by a spatially modulated electric field induced by a patterned template. Most of the research on EISF have so far used various dielectric polymers (with an electrical conductivity smaller than 10(-10) S/m that can be considered a perfect dielectric), on which the electric field induces a Maxwell stress only due to the dipoles (or bounded charges) in the polymer molecules, leading to a structure with a small aspect ratio. This paper presents a different approach for improving the aspect ratio allowed in EISF by doping organic salt into the perfect dielectric polymer, i.e., turning the perfect dielectric into a leaky dielectric, considering the fact that the free space charges enriched in the leaky dielectric polymer can make an additional contribution to the Maxwell stress, i.e., electrohydrodynamic pressure, which is desirable for high aspect ratio structuring. Our numerical simulations and experimental tests have shown that a leaky dielectric polymer, with a small conductivity comparable to that of deionized water, can be much more effective at being electrohydrodynamically deformed into a high aspect ratio in comparison with a perfect dielectric polymer when both of them have roughly the same dielectric constant.

  15. Imaging fluorescence-correlation spectroscopy for measuring fast surface diffusion at liquid/solid interfaces.

    PubMed

    Cooper, Justin T; Harris, Joel M

    2014-08-05

    The development of techniques to probe interfacial molecular transport is important for understanding and optimizing surface-based analytical methods including surface-enhanced spectroscopies, biological assays, and chemical separations. Single-molecule-fluorescence imaging and tracking has been used to measure lateral diffusion rates of fluorescent molecules at surfaces, but the technique is limited to the study of slower diffusion, where molecules must remain relatively stationary during acquisition of an image in order to build up sufficient intensity in a spot to detect and localize the molecule. Although faster time resolution can be achieved by fluorescence-correlation spectroscopy (FCS), where intensity fluctuations in a small spot are related to the motions of molecules on the surface, long-lived adsorption events arising from surface inhomogeneity can overwhelm the correlation measurement and mask the surface diffusion of the moving population. Here, we exploit a combination of these two techniques, imaging-FCS, for measurement of fast interfacial transport at a model chromatographic surface. This is accomplished by rapid imaging of the surface using an electron-multiplied-charged-coupled-device (CCD) camera, while limiting the acquisition to a small area on the camera to allow fast framing rates. The total intensity from the sampled region is autocorrelated to determine surface diffusion rates of molecules with millisecond time resolution. The technique allows electronic control over the acquisition region, which can be used to avoid strong adsorption sites and thus minimize their contribution to the measured autocorrelation decay and to vary the acquisition area to resolve surface diffusion from adsorption and desorption kinetics. As proof of concept, imaging-FCS was used to measure surface diffusion rates, interfacial populations, and adsorption-desorption rates of 1,1'-dioctadecyl-3,3,3'3'-tetramethylindocarbocyanine (DiI) on planar C18- and C1-modified surfaces.

  16. On energetic prerequisites of attracting electrons

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sundholm, Dage

    The internal reorganization energy and the zero-point vibrational energy (ZPE) of fractionally charged molecules embedded in molecular materials are discussed. The theory for isolated open quantum systems is taken as the starting point. It is shown that for isolated molecules the internal reorganization-energy function and its slope, i.e., the chemical potential of an open molecular system are monotonically decreasing functions with respect to increasing amount of negative excess charge (q) in the range of q = [0, 1]. Calculations of the ZPE for fractionally charged molecules show that the ZPE may have a minimum for fractional occupation. The calculations showmore » that the internal reorganization energy and changes in the ZPE are of the same order of magnitude with different behavior as a function of the excess charge. The sum of the contributions might favor molecules with fractional occupation of the molecular units and partial delocalization of the excess electrons in solid-state materials also when considering Coulomb repulsion between the excess electrons. The fractional electrons are then coherently distributed on many molecules of the solid-state material forming a condensate of attracting electrons, which is crucial for the superconducting state.« less

  17. Single Molecule Conductance of Oligothiophene Derivatives

    NASA Astrophysics Data System (ADS)

    Dell, Emma J.

    This thesis studies the electronic properties of small organic molecules based on the thiophene motif. If we are to build next-generation devices, advanced materials must be designed which possess requisite electronic functionality. Molecules present attractive candidates for these ad- vanced materials since nanoscale devices are particularly sought after. However, selecting a molecule that is suited to a certain electronic function remains a challenge, and characterization of electronic behavior is therefore critical. Single molecule conductance measurements are a powerful tool to determine properties on the nanoscale and, as such, can be used to investigate novel building blocks that may fulfill the design requirements of next-generation devices. Combining these conductance results with strategic chemical synthesis allows for the development of new families of molecules that show attractive properties for future electronic devices. Since thiophene rings are the fruitflies of organic semiconductors on the bulk scale, they present an intriguing starting point for building functional materials on the nanoscale, and therefore form the structural basis of all molecules studied herein. First, the single-molecule conductance of a family of bithiophene derivatives was measured. A broad distribution in the single-molecule conductance of bithiophene was found compared with that of a biphenyl. This increased breadth in the conductance distribution was shown to be explained by the difference in 5-fold symmetry of thiophene rings as compared to the 6-fold symmetry of benzene rings. The reduced symmetry of thiophene rings results in a restriction on the torsion angle space available to these molecules when bound between two metal electrodes in a junction, causing each molecular junction to sample a different set of conformers in the conductance measurements. By contrast, the rotations of biphenyl are essentially unimpeded by junction binding, allowing each molecular junction to sample similar conformers. This work demonstrates that the conductance of bithiophene displays a strong dependence on the conformational fluctuations accessible within a given junction configuration, and that the symmetry of such small molecules can significantly influence their conductance behavior. Next, the single-molecule conductance of a family of oligothiophenes comprising one to six thiophene units was measured. An anomalous behavior was found: the peak of the conductance histogram distribution did not follow a clear exponential decay with increasing number of thiophene units in the chain. The electronic properties of the materials were characterized by optical spectroscopy and electrochemistry to gain an understanding of the factors affecting the conductance of these molecules. Different conformers in the junction were postulated to be a contributing factor to the anomalous trend in the observed conductance as a function of molecule length. Then, the electronic properties of the thiophene-1,1-dioxide unit were investigated. These motifs have become synthetically accessible in the last decade, due to Rozen's unprecedentedly potent oxidizing reagent - HOF˙CH 3CN - which has been shown to be powerful yet selective enough to oxidize thiophenes in various environments. The resulting thiophene-1,1-dioxides show great promise for electronic devices. The oxidation chemistry of thiophenes was expanded and tuning of the frontier energy levels was demonstrated through combining electron poor and electron rich units. Finally, charge carriers in single-molecule junctions were shown to be tunable within a family of molecules containing these thiophene-1,1-dioxide (TDO) building blocks. Oligomers of TDO were designed in order to increase electron affinity, maintain delocalized frontier orbitals, while significantly decreasing the transport gap. Through thermopower measurements, the dominant charge carriers were shown to change from holes to electrons as the number of TDO units was increased. This resulted in a unique system in which the charge carrier depends on backbone length, providing a new means to tune p- and n-type transport in organic materials. Taken together, the results presented in this thesis offer an insight into how molecular symme- try and the accessible conformers within a junction have important consequences on conductance behavior. Additionally, thiophene-1,1-dioxide is shown to be an exciting unit for single molecule devices, especially when combined with electron rich thiophene flanking groups. By demon- strating, for the first time, a change in conductance pathway with molecular length, this work provides a framework for using frontier orbital levels to strategically design electronic building blocks.

  18. Generalized Breit-Wigner treatment of molecular transport: Charging effects in a single decanedithiol molecule

    NASA Astrophysics Data System (ADS)

    Cabrera-Tinoco, Hugo Andres; Moreira, Augusto C. L.; de Melo, Celso P.

    2018-05-01

    We examine the relative contribution of ballistic and elastic cotunneling mechanisms to the charge transport through a single decanedithiol molecule linked to two terminal clusters of gold atoms. For this, we first introduced a conceptual model that permits a generalization of the Breit-Wigner scattering formalism where the cation, anion, and neutral forms of the molecule can participate with different probabilities of the charge transfer process, but in a simultaneous manner. We used a density functional theory treatment and considered the fixed geometry of each charge state to calculate the corresponding eigenvalues and eigenvectors of the extended system for different values of the external electric field. We have found that for the ballistic transport the HOMO and LUMO of the neutral species play a key role, while the charged states give a negligible contribution. On the other hand, an elastic cotunneling charge transfer can occur whenever a molecular orbital (MO) of the cation or anion species, even if localized in just one side of the molecule-gold clusters complex, has energy close to that of a delocalized MO of the neutral species. Under these conditions, a conduction channel is formed throughout the entire system, in a process that is controlled by the degree of resonance between the MOs involved. Our results indicate that while different charge transfer mechanisms contribute to the overall charge transport, quantum effects such as avoided-crossing situations between relevant frontier MOs can be of special importance. In these specific situations, the interchange of spatial localization of two MOs involved in the crossing can open a new channel of charge transfer that otherwise would not be available.

  19. Observation of giant conductance fluctuations in a protein

    NASA Astrophysics Data System (ADS)

    Zhang, Bintian; Song, Weisi; Pang, Pei; Zhao, Yanan; Zhang, Peiming; Csabai, István; Vattay, Gábor; Lindsay, Stuart

    2017-12-01

    Proteins are insulating molecular solids, yet even those containing easily reduced or oxidized centers can have single-molecule electronic conductances that are too large to account for with conventional transport theories. Here, we report the observation of remarkably high electronic conductance states in an electrochemically inactive protein, the ∼200 kD α V β 3 extracellular domain of human integrin. Large current pulses (up to nA) were observed for long durations (many ms, corresponding to many pC of charge transfer) at large gap (>5 nm) distances in an STM when the protein was bound specifically by a small peptide ligand attached to the electrodes. The effect is greatly reduced when a homologous, weakly binding protein (α 4 β 1) is used as a control. In order to overcome the limitations of the STM, the time- and voltage-dependence of the conductance were further explored using a fixed-gap (5 nm) tunneling junction device that was small enough to trap a single protein molecule at any one time. Transitions to a high conductance (∼nS) state were observed, the protein being ‘on’ for times from ms to tenths of a second. The high-conductance states only occur above ∼100 mV applied bias, and thus are not an equilibrium property of the protein. Nanoamp two-level signals indicate the specific capture of a single molecule in an electrode gap functionalized with the ligand. This offers a new approach to label-free electronic detection of single protein molecules. Electronic structure calculations yield a distribution of energy level spacings that is consistent with a recently proposed quantum-critical state for proteins, in which small fluctuations can drive transitions between localized and band-like electronic states.

  20. NALDB: nucleic acid ligand database for small molecules targeting nucleic acid

    PubMed Central

    Kumar Mishra, Subodh; Kumar, Amit

    2016-01-01

    Nucleic acid ligand database (NALDB) is a unique database that provides detailed information about the experimental data of small molecules that were reported to target several types of nucleic acid structures. NALDB is the first ligand database that contains ligand information for all type of nucleic acid. NALDB contains more than 3500 ligand entries with detailed pharmacokinetic and pharmacodynamic information such as target name, target sequence, ligand 2D/3D structure, SMILES, molecular formula, molecular weight, net-formal charge, AlogP, number of rings, number of hydrogen bond donor and acceptor, potential energy along with their Ki, Kd, IC50 values. All these details at single platform would be helpful for the development and betterment of novel ligands targeting nucleic acids that could serve as a potential target in different diseases including cancers and neurological disorders. With maximum 255 conformers for each ligand entry, our database is a multi-conformer database and can facilitate the virtual screening process. NALDB provides powerful web-based search tools that make database searching efficient and simplified using option for text as well as for structure query. NALDB also provides multi-dimensional advanced search tool which can screen the database molecules on the basis of molecular properties of ligand provided by database users. A 3D structure visualization tool has also been included for 3D structure representation of ligands. NALDB offers an inclusive pharmacological information and the structurally flexible set of small molecules with their three-dimensional conformers that can accelerate the virtual screening and other modeling processes and eventually complement the nucleic acid-based drug discovery research. NALDB can be routinely updated and freely available on bsbe.iiti.ac.in/bsbe/naldb/HOME.php. Database URL: http://bsbe.iiti.ac.in/bsbe/naldb/HOME.php PMID:26896846

  1. Observation of Giant Conductance Fluctuations in a Protein

    PubMed Central

    Zhang, Bintian; Song, Weisi; Pang, Pei; Zhao, Yanan; Zhang, Peiming; Csabai, István; Vattay, Gábor; Lindsay, Stuart

    2017-01-01

    Proteins are insulating molecular solids, yet even those containing easily reduced or oxidized centers can have single-molecule electronic conductances that are too large to account for with conventional transport theories. Here, we report the observation of remarkably high electronic conductance states in an electrochemically-inactive protein, the ~200 kD αVβ3 extracelluar domain of human integrin. Large current pulses (up to nA) were observed for long durations (many ms, corresponding to many pC of charge transfer) at large gap (>5nm) distances in an STM when the protein was bound specifically by a small peptide ligand attached to the electrodes. The effect is greatly reduced when a homologous, weakly-binding protein (α4β1) is used as a control. In order to overcome the limitations of the STM, the time- and voltage-dependence of the conductance were further explored using a fixed-gap (5 nm) tunneling junction device that was small enough to trap a single protein molecule at any one time. Transitions to a high conductance (~ nS) state were observed, the protein being “on” for times from ms to tenths of a second. The high-conductance states only occur above ~ 100mV applied bias, and thus are not an equilibrium property of the protein. Nanoamp two-level signals indicate the specific capture of a single molecule in an electrode gap functionalized with the ligand. This offers a new approach to label-free electronic detection of single protein molecules. Electronic structure calculations yield a distribution of energy level spacings that is consistent with a recently proposed quantum-critical state for proteins, in which small fluctuations can drive transitions between localized and band-like electronic states. PMID:29552645

  2. Direct Observation of Individual Charges and Their Dynamics on Graphene by Low-Energy Electron Holography.

    PubMed

    Latychevskaia, Tatiana; Wicki, Flavio; Longchamp, Jean-Nicolas; Escher, Conrad; Fink, Hans-Werner

    2016-09-14

    Visualizing individual charges confined to molecules and observing their dynamics with high spatial resolution is a challenge for advancing various fields in science, ranging from mesoscopic physics to electron transfer events in biological molecules. We show here that the high sensitivity of low-energy electrons to local electric fields can be employed to directly visualize individual charged adsorbates and to study their behavior in a quantitative way. This makes electron holography a unique probing tool for directly visualizing charge distributions with a sensitivity of a fraction of an elementary charge. Moreover, spatial resolution in the nanometer range and fast data acquisition inherent to lens-less low-energy electron holography allows for direct visual inspection of charge transfer processes.

  3. Formation mechanism of human serum albumin monolayers on positively charged polymer microparticles.

    PubMed

    Nattich-Rak, Małgorzata; Sadowska, Marta; Adamczyk, Zbigniew; Cieśla, Michał; Kąkol, Małgorzata

    2017-11-01

    Human serum albumin (HSA) adsorption on positively and negatively charged polystyrene microparticles was studied at various pHs and NaCl concentrations. Thorough electrophoretic mobility measurements were carried out that enabled to monitor in situ the progress of protein adsorption. The maximum coverage of irreversibly adsorbed HSA on microparticles was determined by different concentration depletion methods, one of them involving AFM imaging of residual molecules. An anomalous adsorption of HSA on the positive microparticles was observed at pH 3.5 where the maximum coverage attained 1.0mgm -2 for NaCl concentrations of 0.05M despite that the molecules were on average positively charged. For comparison, the maximum coverage of HSA on negatively charged microparticles was equal to 1.3mgm -2 at this pH and NaCl concentration. At pH 7.4 the maximum coverage on positive microparticles was equal to 2.1mgm -2 for 0.05M NaCl concentration. On the other hand, for negative microparticles, negligible adsorption of HSA was observed at pH 7.4 and 9.7. These experimental data were adequately interpreted in terms of the random sequential adsorption approach exploiting the bead model of the HSA molecule. Different orientations of adsorbed molecules, inert alia, the edge-on orientation prevailing for positively charged microparticles at pH 7.4, were confirmed. This was explained in terms of a heterogeneous charge distribution over the HSA molecule prevailing for a wide range of pHs. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. Vibrational spectra, NLO analysis, and HOMO-LUMO studies of 2-chloro-6-fluorobenzoic acid and 3,4-dichlorobenzoic acid by density functional method

    NASA Astrophysics Data System (ADS)

    Senthil kumar, J.; Arivazhagan, M.; Thangaraju, P.

    2015-08-01

    The FTIR and FT-Raman spectra of 2-chloro-6-fluorobenzoic acid and 3,4-dichlorobenzoic acid have been recorded in the region 4000-400 cm-1 and 3500-50 cm-1, respectively. Utilizing the observed FTIR and FT-Raman data, a complete vibrational assignment and analysis of fundamental modes of the compounds were carried out. The optimized molecular geometries, vibrational frequencies, thermodynamic properties and atomic charge of the compounds were calculated by using density functional theory (B3LYP) method with 6-311+G and 6-311++G basis sets. The difference between the observed and scaled wave number values of most of fundamentals is very small. Unambiguous vibration assignment of all the fundamentals is made up the total energy distribution (TED). The calculated HOMO and LUMO energies show that charge transfer occurs within the molecules. Besides, molecular electro static potential (MESP), Mulliken's charge analysis, first order hyper polarizability and several thermodynamic properties were performed by the DFT method.

  5. Charge separation and carrier dynamics in donor-acceptor heterojunction photovoltaic systems.

    PubMed

    Teuscher, Joël; Brauer, Jan C; Stepanov, Andrey; Solano, Alicia; Boziki, Ariadni; Chergui, Majed; Wolf, Jean-Pierre; Rothlisberger, Ursula; Banerji, Natalie; Moser, Jacques-E

    2017-11-01

    Electron transfer and subsequent charge separation across donor-acceptor heterojunctions remain the most important areas of study in the field of third-generation photovoltaics. In this context, it is particularly important to unravel the dynamics of individual ultrafast processes (such as photoinduced electron transfer, carrier trapping and association, and energy transfer and relaxation), which prevail in materials and at their interfaces. In the frame of the National Center of Competence in Research "Molecular Ultrafast Science and Technology," a research instrument of the Swiss National Science Foundation, several groups active in the field of ultrafast science in Switzerland have applied a number of complementary experimental techniques and computational simulation tools to scrutinize these critical photophysical phenomena. Structural, electronic, and transport properties of the materials and the detailed mechanisms of photoinduced charge separation in dye-sensitized solar cells, conjugated polymer- and small molecule-based organic photovoltaics, and high-efficiency lead halide perovskite solar energy converters have been scrutinized. Results yielded more than thirty research articles, an overview of which is provided here.

  6. Characterization of 1,5-dimethoxynaphthalene by vibrational spectroscopy (FT-IR and FT-Raman) and density functional theory calculations.

    PubMed

    Kandasamy, M; Velraj, G; Kalaichelvan, S; Mariappan, G

    2015-01-05

    In this work, we reported a combined experimental and theoretical study on molecular structure, vibrational spectra and natural bond orbital (NBO) analysis of 1,5-dimethoxynaphthalene. The optimized molecular structure, atomic charges, vibrational frequencies and natural bond orbital analysis of 1,5-dimethoxynaphthalene have been studied by performing DFT/B3LYP/6-31G(d,p) level of theory. The FTIR, FT-Raman spectra were recorded in the region of 4000-400 cm(-1) and 3500-50 cm(-1) respectively. The scaled wavenumbers are compared with the experimental values. The difference between the observed and scaled wavenumber values of the most fundamentals is very small. The formation of hydrogen bond was investigated in terms of the charge density by the NBO analysis. Natural Population Analysis (NPA) was used for charge determination in the title molecule. Besides, molecular electrostatic potential (MEP), frontier molecular orbitals (FMO) analysis were investigated using theoretical calculations. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. On the Charge transport regime of crystalline organic semiconductors: diffusion limited by thermal off-diagonal electronic disorder

    NASA Astrophysics Data System (ADS)

    Troisi, Alessandro

    2006-03-01

    In organic crystalline semiconductor molecular components are held together by very weak interactions and the transfer integrals between neighboring molecular orbitals are extremely sensitive to small nuclear displacements. We used a mixed quantum chemical and molecular dynamic methodology to assess the effect of thermal structural fluctuations on the modulation of the transfer integrals between close molecules. We have found that the fluctuations of the transfer integrals are of the same order of magnitude of their average value for pentacene and anthracene. This condition makes the band description inadequate because a dynamic localization takes place and the translational symmetry is completely broken for the electronic states. We also present a simple one-dimensional semiclassical model that incorporates the effects of dynamical localization and allows the numerical computation of the charge mobility for ordered organic semiconductors. These results explain several contrasting experimental observations pointing sometimes to a delocalized ``band-like'' transport and sometimes to the existence of strongly localized charge carriers.

  8. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dincă, Mircea; Léonard, François

    Metal–organic frameworks (MOFs), with their crystalline nanoporous three-dimensional structures, have emerged as unique multifunctional materials that combine high porosity with catalytic, photophysical, or other properties to reveal new fundamental science and applications. Because MOFs are composed of organic molecules linking metal centers in ways that are not usually conducive to the formation of free-charge carriers or low-energy charge-transport pathways, they are typically insulators. Accordingly, applications so far have harnessed the unique structural properties and porosity of MOFs, which depend only to a small extent on the ability to manipulate their electronic structure. An exciting new area has emerged due tomore » the recent demonstration of MOFs with controlled electronic and optical properties, which is enabling new fundamental science and opens up the possibility of applications in electronics and photonics. This article presents an overview of the fundamental science issues related to controlling electronic and optical properties of MOFs, and how research groups worldwide have been exploring such properties for electronics, thermoelectrics, photophysics, and charge storage.« less

  9. Magnetic Control of the Charge-Separated State Lifetime Realized by Covalent Attachment of a Platinum Complex.

    PubMed

    Miura, Tomoaki; Fujiwara, Dai; Akiyama, Kimio; Horikoshi, Takafumi; Suzuki, Shuichi; Kozaki, Masatoshi; Okada, Keiji; Ikoma, Tadaaki

    2017-02-02

    Dynamics of the photogenerated charge-separated (CS) state is studied for a newly synthesized molecular triad, in which the donor (D) dimethoxytriphenylamine, 1,3-bis(2-pyridylimino)isoindolate platinum (BPIPt), and the acceptor (A) naphthaldiimide are linked with a triethynylbenzene unit (BPIPt-DA). Photoexcitation of BPIPt gives rise to generation of a long-lived (∼4 μs) CS state BPIPt-D + A - , of which the lifetime is considerably increased by an applied magnetic field of 270 mT. The positive magnetic field effect (MFE) is in contrast to the negative MFE for the reference DA molecule, which indicates successful switching of the initial spin state of the CS state from singlet to triplet. Simulations of the MFE and time-resolved electron paramagnetic resonance show that spin-selective charge recombination and spin relaxation are unaffected by attachment of BPIPt. The minimum impact of heavy atom substitution on the electronic and magnetic properties has been realized by the small electronic coupling mediated by the rigid meta-triethynylbenzene.

  10. Effects of Charge Transfer on the Adsorption of CO on Small Molybdenum-Doped Platinum Clusters.

    PubMed

    Ferrari, Piero; Vanbuel, Jan; Tam, Nguyen Minh; Nguyen, Minh Tho; Gewinner, Sandy; Schöllkopf, Wieland; Fielicke, André; Janssens, Ewald

    2017-03-23

    The interaction of carbon monoxide with platinum alloy nanoparticles is an important problem in the context of fuel cell catalysis. In this work, molybdenum-doped platinum clusters have been studied in the gas phase to obtain a better understanding of the fundamental nature of the Pt-CO interaction in the presence of a dopant atom. For this purpose, Pt n + and MoPt n-1 + (n=3-7) clusters were studied by combined mass spectrometry and density functional theory calculations, making it possible to investigate the effects of molybdenum doping on the reactivity of platinum clusters with CO. In addition, IR photodissociation spectroscopy was used to measure the stretching frequency of CO molecules adsorbed on Pt n + and MoPt n-1 + (n=3-14), allowing an investigation of dopant-induced charge redistribution within the clusters. This electronic charge transfer is correlated with the observed changes in reactivity. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Representability of algebraic topology for biomolecules in machine learning based scoring and virtual screening

    PubMed Central

    Mu, Lin

    2018-01-01

    This work introduces a number of algebraic topology approaches, including multi-component persistent homology, multi-level persistent homology, and electrostatic persistence for the representation, characterization, and description of small molecules and biomolecular complexes. In contrast to the conventional persistent homology, multi-component persistent homology retains critical chemical and biological information during the topological simplification of biomolecular geometric complexity. Multi-level persistent homology enables a tailored topological description of inter- and/or intra-molecular interactions of interest. Electrostatic persistence incorporates partial charge information into topological invariants. These topological methods are paired with Wasserstein distance to characterize similarities between molecules and are further integrated with a variety of machine learning algorithms, including k-nearest neighbors, ensemble of trees, and deep convolutional neural networks, to manifest their descriptive and predictive powers for protein-ligand binding analysis and virtual screening of small molecules. Extensive numerical experiments involving 4,414 protein-ligand complexes from the PDBBind database and 128,374 ligand-target and decoy-target pairs in the DUD database are performed to test respectively the scoring power and the discriminatory power of the proposed topological learning strategies. It is demonstrated that the present topological learning outperforms other existing methods in protein-ligand binding affinity prediction and ligand-decoy discrimination. PMID:29309403

  12. Explaining rISC and 100% efficient TADF (Conference Presentation)

    NASA Astrophysics Data System (ADS)

    Monkman, Andrew P.; Etherington, Marc; Graves, David; Data, Przemyslaw; Dos Santos, Paloma Lays; Nobuyasu, Roberto; Baiao Dias, Fernando M.

    2016-09-01

    Detailed photophysical measurements of intramolecular charge transfer (ICT) states have been made both in solution and solid state. Temperature dependent time resolved emission, delayed emission and photoinduced absorption are used to map the energy levels involved in molecule decay, and through detailed kinetic modelling of the thermally activated processes observed, true electron exchange energies and other energy barriers of the systems determined with the real states involved in the reversed intersystem crossing mechanism elucidated. For specific donor acceptor molecules, the CT singlet and local triplet states (of donor or acceptor) are found to be the lowest lying excited states of the molecule with very small energy barrier between them ? kT. In these cases the decay kinetics of the molecules become significantly different to normal molecules, and the effect of rapid recycling between CT singlet and local triplet states is observed which gives rise to the true triplet harvesting mechanism in TADF. Using a series of different TADF emitters we will show how the energy level ordering effects or does not effect TADF and how ultimate OLED performance is dictated by energy level ordering, from 5% to 22% external quantum efficiency. From this understanding, we are able to define three criterion for TADF in different molecules and these will be discussed.

  13. Atomic charges of sulfur in ionic liquids: experiments and calculations.

    PubMed

    Fogarty, Richard M; Rowe, Rebecca; Matthews, Richard P; Clough, Matthew T; Ashworth, Claire R; Brandt, Agnieszka; Corbett, Paul J; Palgrave, Robert G; Smith, Emily F; Bourne, Richard A; Chamberlain, Thomas W; Thompson, Paul B J; Hunt, Patricia A; Lovelock, Kevin R J

    2017-12-14

    Experimental near edge X-ray absorption fine structure (NEXAFS) spectra, X-ray photoelectron (XP) spectra and Auger electron spectra are reported for sulfur in ionic liquids (ILs) with a range of chemical structures. These values provide experimental measures of the atomic charge in each IL and enable the evaluation of the suitability of NEXAFS spectroscopy and XPS for probing the relative atomic charge of sulfur. In addition, we use Auger electron spectroscopy to show that when XPS binding energies differ by less than 0.5 eV, conclusions on atomic charge should be treated with caution. Our experimental data provides a benchmark for calculations of the atomic charge of sulfur obtained using different methods. Atomic charges were computed for lone ions and ion pairs, both in the gas phase (GP) and in a solvation model (SMD), with a wide range of ion pair conformers considered. Three methods were used to compute the atomic charges: charges from the electrostatic potential using a grid based method (ChelpG), natural bond orbital (NBO) population analysis and Bader's atoms in molecules (AIM) approach. By comparing the experimental and calculated measures of the atomic charge of sulfur, we provide an order for the sulfur atoms, ranging from the most negative to the most positive atomic charge. Furthermore, we show that both ChelpG and NBO are reasonable methods for calculating the atomic charge of sulfur in ILs, based on the agreement with both the XPS and NEXAFS spectroscopy results. However, the atomic charges of sulfur derived from ChelpG are found to display significant, non-physical conformational dependence. Only small differences in individual atomic charge of sulfur were observed between lone ion (GP) and ion pair IL(SMD) model systems, indicating that ion-ion interactions do not strongly influence individual atomic charges.

  14. Parsimonious Charge Deconvolution for Native Mass Spectrometry

    PubMed Central

    2018-01-01

    Charge deconvolution infers the mass from mass over charge (m/z) measurements in electrospray ionization mass spectra. When applied over a wide input m/z or broad target mass range, charge-deconvolution algorithms can produce artifacts, such as false masses at one-half or one-third of the correct mass. Indeed, a maximum entropy term in the objective function of MaxEnt, the most commonly used charge deconvolution algorithm, favors a deconvolved spectrum with many peaks over one with fewer peaks. Here we describe a new “parsimonious” charge deconvolution algorithm that produces fewer artifacts. The algorithm is especially well-suited to high-resolution native mass spectrometry of intact glycoproteins and protein complexes. Deconvolution of native mass spectra poses special challenges due to salt and small molecule adducts, multimers, wide mass ranges, and fewer and lower charge states. We demonstrate the performance of the new deconvolution algorithm on a range of samples. On the heavily glycosylated plasma properdin glycoprotein, the new algorithm could deconvolve monomer and dimer simultaneously and, when focused on the m/z range of the monomer, gave accurate and interpretable masses for glycoforms that had previously been analyzed manually using m/z peaks rather than deconvolved masses. On therapeutic antibodies, the new algorithm facilitated the analysis of extensions, truncations, and Fab glycosylation. The algorithm facilitates the use of native mass spectrometry for the qualitative and quantitative analysis of protein and protein assemblies. PMID:29376659

  15. Plasmon enhanced heterogeneous electron transfer with continuous band energy model

    NASA Astrophysics Data System (ADS)

    Zhao, Dandan; Niu, Lu; Wang, Luxia

    2017-08-01

    Photoinduced charge injection from a perylene dye molecule into the conduction band of a TiO2 system decorated by a metal nanoparticles (MNP) is studied theoretically. Utilizing the density matrix theory the charge transfer dynamics is analyzed. The continuous behavior of the TiO2 conduction band is accounted for by a Legendre polynomials expansion. The simulations consider optical excitation of the dye molecule coupled to the MNP and the subsequent electron injection into the TiO2 semiconductor. Due to the energy transfer coupling between the molecule and the MNP optical excitation and subsequent charge injection into semiconductor is strongly enhanced. The respective enhancement factor can reach values larger than 103. Effects of pulse duration, coupling strength and energetic resonances are also analyzed. The whole approach offers an efficient way to increase charge injection in dye-sensitized solar cells.

  16. Cationic antimicrobial polymers and their assemblies.

    PubMed

    Carmona-Ribeiro, Ana Maria; de Melo Carrasco, Letícia Dias

    2013-05-10

    Cationic compounds are promising candidates for development of antimicrobial agents. Positive charges attached to surfaces, particles, polymers, peptides or bilayers have been used as antimicrobial agents by themselves or in sophisticated formulations. The main positively charged moieties in these natural or synthetic structures are quaternary ammonium groups, resulting in quaternary ammonium compounds (QACs). The advantage of amphiphilic cationic polymers when compared to small amphiphilic molecules is their enhanced microbicidal activity. Besides, many of these polymeric structures also show low toxicity to human cells; a major requirement for biomedical applications. Determination of the specific elements in polymers, which affect their antimicrobial activity, has been previously difficult due to broad molecular weight distributions and random sequences characteristic of radical polymerization. With the advances in polymerization control, selection of well defined polymers and structures are allowing greater insight into their structure-antimicrobial activity relationship. On the other hand, antimicrobial polymers grafted or self-assembled to inert or non inert vehicles can yield hybrid antimicrobial nanostructures or films, which can act as antimicrobials by themselves or deliver bioactive molecules for a variety of applications, such as wound dressing, photodynamic antimicrobial therapy, food packing and preservation and antifouling applications.

  17. Cationic Antimicrobial Polymers and Their Assemblies

    PubMed Central

    Carmona-Ribeiro, Ana Maria; de Melo Carrasco, Letícia Dias

    2013-01-01

    Cationic compounds are promising candidates for development of antimicrobial agents. Positive charges attached to surfaces, particles, polymers, peptides or bilayers have been used as antimicrobial agents by themselves or in sophisticated formulations. The main positively charged moieties in these natural or synthetic structures are quaternary ammonium groups, resulting in quaternary ammonium compounds (QACs). The advantage of amphiphilic cationic polymers when compared to small amphiphilic molecules is their enhanced microbicidal activity. Besides, many of these polymeric structures also show low toxicity to human cells; a major requirement for biomedical applications. Determination of the specific elements in polymers, which affect their antimicrobial activity, has been previously difficult due to broad molecular weight distributions and random sequences characteristic of radical polymerization. With the advances in polymerization control, selection of well defined polymers and structures are allowing greater insight into their structure-antimicrobial activity relationship. On the other hand, antimicrobial polymers grafted or self-assembled to inert or non inert vehicles can yield hybrid antimicrobial nanostructures or films, which can act as antimicrobials by themselves or deliver bioactive molecules for a variety of applications, such as wound dressing, photodynamic antimicrobial therapy, food packing and preservation and antifouling applications. PMID:23665898

  18. Structures and unimolecular chemistry of M(Pro2-H)(+) (M = Mg, Ca, Sr, Ba, Mn, Fe, Co, Ni, Cu, Zn) by IRMPD spectroscopy, SORI-CID, and theoretical studies.

    PubMed

    Jami-Alahmadi, Yasaman; Fridgen, Travis D

    2016-01-21

    M(Pro2-H)(+) complexes were electrosprayed and isolated in an FTICR cell where their unimolecular chemistries and structures were explored using SORI-CID and IRMPD spectroscopy. These experiments were augmented by computational methods such as electronic structure, simulated annealing, and atoms in molecules (AIM) calculations. The unimolecular chemistries of the larger metal cation (Ca(2+), Sr(2+) and Ba(2+)) complexes predominantly involve loss of neutral proline whereas the complexes involving the smaller Mg(2+) and transition metal dications tend to lose small neutral molecules such as water and carbon dioxide. Interestingly, all complexes involving transition metal dications except for Cu(Pro2-H)(+) lose H2 upon collisional or IRMPD activation. IRMPD spectroscopy shows that the intact proline in the transition metal complexes and Cu(Pro2-H)(+) is predominantly canonical (charge solvated) while for the Ca(2+), Sr(2+), and Ba(2+) complexes, proline is in its zwitterionic form. The IRMPD spectra for both Mg(Pro2-H)(+) and Mn(Pro2-H)(+) are concluded to have contributions from both charge-solvated and canonical structures.

  19. Interstellar Chemistry Gets More Complex With New Charged-Molecule Discovery

    NASA Astrophysics Data System (ADS)

    2007-07-01

    Astronomers using data from the National Science Foundation's Robert C. Byrd Green Bank Telescope (GBT) have found the largest negatively-charged molecule yet seen in space. The discovery of the third negatively-charged molecule, called an anion, in less than a year and the size of the latest anion will force a drastic revision of theoretical models of interstellar chemistry, the astronomers say. Molecule formation Formation Process of Large, Negatively-Charged Molecule in Interstellar Space CREDIT: Bill Saxton, NRAO/AUI/NSF Click on image for page of graphics and detailed information "This discovery continues to add to the diversity and complexity that is already seen in the chemistry of interstellar space," said Anthony J. Remijan of the National Radio Astronomy Observatory (NRAO). "It also adds to the number of paths available for making the complex organic molecules and other large molecular species that may be precursors to life in the giant clouds from which stars and planets are formed," he added. Two teams of scientists found negatively-charged octatetraynyl, a chain of eight carbon atoms and one hydrogen atom, in the envelope of gas around an old, evolved star and in a cold, dark cloud of molecular gas. In both cases, the molecule had an extra electron, giving it a negative charge. About 130 neutral and about a dozen positively-charged molecules have been discovered in space, but the first negatively-charged molecule was not discovered until late last year. The largest previously-discovered negative ion found in space has six carbon atoms and one hydrogen atom. "Until recently, many theoretical models of how chemical reactions evolve in interstellar space have largely neglected the presence of anions. This can no longer be the case, and this means that there are many more ways to build large organic molecules in cosmic environments than have been explored," said Jan M. Hollis of NASA's Goddard Space Flight Center (GSFC). Ultraviolet light from stars can knock an electron off a molecule, creating a positively-charged ion. Astronomers had thought that molecules would not be able to retain an extra electron, and thus a negative charge, in interstellar space for a significant time. "That obviously is not the case," said Mike McCarthy of the Harvard-Smithsonian Center for Astrophysics. "Anions are surprisingly abundant in these regions." Remijan and his colleagues found the octatetraynyl anions in the envelope of the evolved giant star IRC +10 216, about 550 light-years from Earth in the constellation Leo. They found radio waves emitted at specific frequencies characteristic of the charged molecule by searching archival data from the GBT, the largest fully-steerable radio telescope in the world. Another team from the Harvard-Smithsonian Center for Astrophysics (CfA) found the same characteristic emission when they observed a cold cloud of molecular gas called TMC-1 in the constellation Taurus. These observations also were done with the GBT. In both cases, preceding laboratory experiments by the CfA team showed which radio frequencies actually are emitted by the molecule, and thus told the astronomers what to look for. "It is essential that likely interstellar molecule candidates are first studied in laboratory experiments so that the radio frequencies they can emit are known in advance of an astronomical observation," said Frank Lovas of the National Institute of Standards and Technology (NIST). Both teams announced their results in the July 20 edition of the Astrophysical Journal Letters. "With three negatively-charged molecules now found in a short period of time, and in very different environments, it appears that many more probably exist. We believe that we can discover more new species using very sensitive and advanced radio telescopes such as the GBT, once they have been characterized in the laboratory," said Sandra Bruenken of the CfA. "Further detailed studies of anions, including astronomical observations, laboratory studies, and theoretical calculations, will allow us to use them to reveal new information about the physical and chemical processes going on in interstellar space," said Martin Cordiner, of Queen's University in Belfast, Northern Ireland. "The GBT continues to take a leading role in discovering, identifying and mapping the distribution of the largest molecules ever found in astronomical environments and will continue to do so for the next several decades," said Phil Jewell of NRAO. In addition to Hollis, Lovas, Cordiner and Jewell, Remijan worked with Tom Millar of Queen's University in Belfast, Northern Ireland, and Andrew Markwick-Kemper of the University of Manchester in the UK. Bruenken worked with McCarthy, Harshal Gupta, Carl Gottlieb, and Patrick Thaddeus, all of the Harvard-Smithsonian Center for Astrophysics. The National Radio Astronomy Observatory is a facility of the National Science Foundation, operated under cooperative agreement by Associated Universities, Inc. Headquartered in Cambridge, Mass., the Harvard-Smithsonian Center for Astrophysics is a joint collaboration between the Smithsonian Astrophysical Observatory and the Harvard College Observatory. CfA scientists, organized into six research divisions, study the origin, evolution and ultimate fate of the universe.

  20. Single-Molecule Electronics: Chemical and Analytical Perspectives.

    PubMed

    Nichols, Richard J; Higgins, Simon J

    2015-01-01

    It is now possible to measure the electrical properties of single molecules using a variety of techniques including scanning probe microcopies and mechanically controlled break junctions. Such measurements can be made across a wide range of environments including ambient conditions, organic liquids, ionic liquids, aqueous solutions, electrolytes, and ultra high vacuum. This has given new insights into charge transport across molecule electrical junctions, and these experimental methods have been complemented with increasingly sophisticated theory. This article reviews progress in single-molecule electronics from a chemical perspective and discusses topics such as the molecule-surface coupling in electrical junctions, chemical control, and supramolecular interactions in junctions and gating charge transport. The article concludes with an outlook regarding chemical analysis based on single-molecule conductance.

  1. Charge transfer at organic-organic heterojunctions, and remote doping of a pentacene transistor

    NASA Astrophysics Data System (ADS)

    Zhao, Wei

    Organic-organic heterojunctions (OOHs) are the fundamental building blocks of organic devices, such as organic light-emitting diodes, organic photovoltaic cells, and photo detectors. Transport of free electrons and holes, exciton formation, recombination or dissociation, and various other physical processes all take place in OOHs. Understanding the electronic structures of OOH is critical for studying device physics and further improving the performance of organic devices. This work focuses on the electronic structure, i.e., the energy level alignment, at OOHs, investigated by ultraviolet and inverse photoemission spectroscopy (UPS and IPES). The weak interaction that generally prevails at OOH interfaces leads to small interface dipoles of 0˜0.5eV. The experimental observations on the majority of OOHs studied can be semi-quantitatively predicted by the model derived from the induced density of interface states and charge neutrality level (IDIS/CNL). However, we also find that the electronic structure of interfaces between two small-band-gap semiconductors, e.g., using copper phthalocyanine (CuPc) as the donor and a tris(thieno)-hexaazatriphenylene derivative (THAP) as the acceptor, is strongly influenced by changes in the substrate work function. In these cases, the charge transfer that takes place at the interface is governed by thermodynamic equilibrium, dominating any subtle interaction due to IDIS/CNL. The impact of doping on the energy level alignment of OOHs is also studied. The charges donated by the dopant molecules transfer from the parent doped layer to the adjacent undoped layer, taking advantage of the molecular level offset, and are then spatially separated from the dopant molecules. Remote doping, based on this charge transfer mechanism, is demonstrated with the heterojunction formed between pentacene and N,N'-diphenyl-N,N'-bis(1-naphthyl)-1,1'bisphenyl-4,4'diazine (alpha-NPD) p-doped with tris[1,2-bis(trifluoromethyl) ethane-1,2-dithiolene] (Mo(tfd)3). A remotely doped pentacene transistor, based on this type of hetero-structure, exhibits increased conductivity, decreased activation energy for carrier hopping, and enhanced mobility, compared to an undoped transistor. Another featured improvement of the remotely doped transistor is that it can be reasonably switched off by placing an undoped interlayer in the structure. Our preliminary results show chemical doping technology can potentially benefit the organic thin film transistors.

  2. Quantitative Super-Resolution Microscopy of Nanopipette-Deposited Fluorescent Patterns.

    PubMed

    Hennig, Simon; van de Linde, Sebastian; Bergmann, Stephan; Huser, Thomas; Sauer, Markus

    2015-08-25

    We describe a method for the deposition of minute amounts of fluorophore-labeled oligonucleotides with high local precision in conductive and transparent solid layers of poly(vinyl alcohol) (PVA) doped with glycerin and cysteamine (PVA-G-C layers). Deposition of negatively charged fluorescent molecules was accomplished with a setup based on a scanning ion conductance microscope (SICM) using nanopipettes with tip diameters of ∼100 nm by using the ion flux flowing between two electrodes through the nanopipette. To investigate the precision of the local deposition process, we performed in situ super-resolution microscopy by direct stochastic optical reconstruction microscopy (dSTORM). Exploiting the single-molecule sensitivity and reliability of dSTORM, we determine the number of fluorescent molecules deposited in single spots. The correlation of applied charge and number of deposited molecules enables the quantification of delivered molecules by measuring the charge during the delivery process. We demonstrate the reproducible deposition of 3-168 fluorescent molecules in single spots and the creation of fluorescent structures. The fluorescent structures are highly stable and can be reused several times.

  3. DFT computational analysis of piracetam

    NASA Astrophysics Data System (ADS)

    Rajesh, P.; Gunasekaran, S.; Seshadri, S.; Gnanasambandan, T.

    2014-11-01

    Density functional theory calculation with B3LYP using 6-31G(d,p) and 6-31++G(d,p) basis set have been used to determine ground state molecular geometries. The first order hyperpolarizability (β0) and related properties (β, α0 and Δα) of piracetam is calculated using B3LYP/6-31G(d,p) method on the finite-field approach. The stability of molecule has been analyzed by using NBO/NLMO analysis. The calculation of first hyperpolarizability shows that the molecule is an attractive molecule for future applications in non-linear optics. Molecular electrostatic potential (MEP) at a point in the space around a molecule gives an indication of the net electrostatic effect produced at that point by the total charge distribution of the molecule. The calculated HOMO and LUMO energies show that charge transfer occurs within these molecules. Mulliken population analysis on atomic charge is also calculated. Because of vibrational analysis, the thermodynamic properties of the title compound at different temperatures have been calculated. Finally, the UV-Vis spectra and electronic absorption properties are explained and illustrated from the frontier molecular orbitals.

  4. Screening of charged impurities as a possible mechanism for conductance change in graphene gas sensing

    NASA Astrophysics Data System (ADS)

    Liang, Sang-Zi; Chen, Gugang; Harutyunyan, Avetik R.; Sofo, Jorge O.

    2014-09-01

    In carbon nanotube and graphene gas sensing, the measured conductance change after the sensor is exposed to target molecules has been traditionally attributed to carrier density change due to charge transfer between the sample and the adsorbed molecule. However, this explanation has many problems when it is applied to graphene: The increased amount of Coulomb impurities should lead to decrease in carrier mobility which was not observed in many experiments, carrier density is controlled by the gate voltage in the experimental setup, and there are inconsistencies in the energetics of the charge transfer. In this paper we explore an alternative mechanism. Charged functional groups and dipolar molecules on the surface of graphene may counteract the effect of charged impurities on the substrate. Because scattering of electrons with these charged impurities has been shown to be the limiting factor in graphene conductivity, this leads to significant changes in the transport behavior. A model for the conductivity is established using the random phase approximation dielectric function of graphene and the first-order Born approximation for scattering. The model predicts optimal magnitudes for the charge and dipole moment which maximally screen a given charged impurity. The dipole screening is shown to be generally weaker than the charge screening although the former becomes more effective with higher gate voltage away from the charge neutrality point. The model also predicts that with increasing amount of adsorbates, the charge impurities eventually become saturated and additional adsorption always lead to decreasing conductivity.

  5. Charge-specific size-dependent separation of water-soluble organic molecules by fluorinated nanoporous networks

    NASA Astrophysics Data System (ADS)

    Byun, Jeehye; Patel, Hasmukh A.; Thirion, Damien; Yavuz, Cafer T.

    2016-11-01

    Molecular architecture in nanoscale spaces can lead to selective chemical interactions and separation of species with similar sizes and functionality. Substrate specific sorbent chemistry is well known through highly crystalline ordered structures such as zeolites, metal organic frameworks and widely available nanoporous carbons. Size and charge-dependent separation of aqueous molecular contaminants, on the contrary, have not been adequately developed. Here we report a charge-specific size-dependent separation of water-soluble molecules through an ultra-microporous polymeric network that features fluorines as the predominant surface functional groups. Treatment of similarly sized organic molecules with and without charges shows that fluorine interacts with charges favourably. Control experiments using similarly constructed frameworks with or without fluorines verify the fluorine-cation interactions. Lack of a σ-hole for fluorine atoms is suggested to be responsible for this distinct property, and future applications of this discovery, such as desalination and mixed matrix membranes, may be expected to follow.

  6. Charge-specific size-dependent separation of water-soluble organic molecules by fluorinated nanoporous networks

    PubMed Central

    Byun, Jeehye; Patel, Hasmukh A.; Thirion, Damien; Yavuz, Cafer T.

    2016-01-01

    Molecular architecture in nanoscale spaces can lead to selective chemical interactions and separation of species with similar sizes and functionality. Substrate specific sorbent chemistry is well known through highly crystalline ordered structures such as zeolites, metal organic frameworks and widely available nanoporous carbons. Size and charge-dependent separation of aqueous molecular contaminants, on the contrary, have not been adequately developed. Here we report a charge-specific size-dependent separation of water-soluble molecules through an ultra-microporous polymeric network that features fluorines as the predominant surface functional groups. Treatment of similarly sized organic molecules with and without charges shows that fluorine interacts with charges favourably. Control experiments using similarly constructed frameworks with or without fluorines verify the fluorine-cation interactions. Lack of a σ-hole for fluorine atoms is suggested to be responsible for this distinct property, and future applications of this discovery, such as desalination and mixed matrix membranes, may be expected to follow. PMID:27830697

  7. The R.E.D. tools: advances in RESP and ESP charge derivation and force field library building.

    PubMed

    Dupradeau, François-Yves; Pigache, Adrien; Zaffran, Thomas; Savineau, Corentin; Lelong, Rodolphe; Grivel, Nicolas; Lelong, Dimitri; Rosanski, Wilfried; Cieplak, Piotr

    2010-07-28

    Deriving atomic charges and building a force field library for a new molecule are key steps when developing a force field required for conducting structural and energy-based analysis using molecular mechanics. Derivation of popular RESP charges for a set of residues is a complex and error prone procedure because it depends on numerous input parameters. To overcome these problems, the R.E.D. Tools (RESP and ESP charge Derive, ) have been developed to perform charge derivation in an automatic and straightforward way. The R.E.D. program handles chemical elements up to bromine in the periodic table. It interfaces different quantum mechanical programs employed for geometry optimization and computing molecular electrostatic potential(s), and performs charge fitting using the RESP program. By defining tight optimization criteria and by controlling the molecular orientation of each optimized geometry, charge values are reproduced at any computer platform with an accuracy of 0.0001 e. The charges can be fitted using multiple conformations, making them suitable for molecular dynamics simulations. R.E.D. allows also for defining charge constraints during multiple molecule charge fitting, which are used to derive charges for molecular fragments. Finally, R.E.D. incorporates charges into a force field library, readily usable in molecular dynamics computer packages. For complex cases, such as a set of homologous molecules belonging to a common family, an entire force field topology database is generated. Currently, the atomic charges and force field libraries have been developed for more than fifty model systems and stored in the RESP ESP charge DDataBase. Selected results related to non-polarizable charge models are presented and discussed.

  8. Polarizable atomic multipole-based force field for DOPC and POPE membrane lipids

    NASA Astrophysics Data System (ADS)

    Chu, Huiying; Peng, Xiangda; Li, Yan; Zhang, Yuebin; Min, Hanyi; Li, Guohui

    2018-04-01

    A polarizable atomic multipole-based force field for the membrane bilayer models 1,2-dioleoyl-phosphocholine (DOPC) and 1-palmitoyl-2-oleoyl-phosphatidylethanolamine (POPE) has been developed. The force field adopts the same framework as the Atomic Multipole Optimized Energetics for Biomolecular Applications (AMOEBA) model, in which the charge distribution of each atom is represented by the permanent atomic monopole, dipole and quadrupole moments. Many-body polarization including the inter- and intra-molecular polarization is modelled in a consistent manner with distributed atomic polarizabilities. The van der Waals parameters were first transferred from existing AMOEBA parameters for small organic molecules and then optimised by fitting to ab initio intermolecular interaction energies between models and a water molecule. Molecular dynamics simulations of the two aqueous DOPC and POPE membrane bilayer systems, consisting of 72 model molecules, were then carried out to validate the force field parameters. Membrane width, area per lipid, volume per lipid, deuterium order parameters, electron density profile, etc. were consistent with experimental values.

  9. Investigating protein-protein interaction surfaces using a reduced stereochemical and electrostatic model.

    PubMed

    Warwicker, J

    1989-03-20

    A method of calculating the electrostatic potential energy between two molecules, using finite difference potential, is presented. A reduced charge set is used so that the interaction energy can be calculated as the two static molecules explore their full six-dimensional configurational space. The energies are contoured over surfaces fixed to each molecule with an interactive computer graphics program. For two crystal structures (trypsin-trypsin inhibitor and anti-lysozyme Fab-lysozyme), it is found that the complex corresponds to highly favourable interacting regions in the contour plots. These matches arise from a small number of protruding basic residues interacting with enhanced negative potential in each case. The redox pair cytochrome c peroxidase-cytochrome c exhibits an extensive favourably interacting surface within which a possible electron transfer complex may be defined by an increased electrostatic complementarity, but a decreased electrostatic energy. A possible substrate transfer configuration for the glycolytic enzyme pair glyceraldehyde phosphate dehydrogenase-phosphoglycerate kinase is presented.

  10. Dissociation of methane on the surface of charged defective carbon nanotubes

    NASA Astrophysics Data System (ADS)

    Guo, Z. H.; Yan, X. H.; Xiao, Y.

    2010-03-01

    Based on the framework of density functional theory (CASTEP and DMOL 3 codes), we simulate the dissociation of methane (CH 4) molecule on the surface of charged defective carbon nanotubes (CNTs). The results display that a charged CNT with carbon (C) and molybdenum (Mo) dopants can effectively dissociate CH 4 molecule, and the adsorption strength of H and CH 3 can be controlled by the injected negative charges. Moreover, the barrier between the transition state (TS) and the reactant is 0.1014 eV, and a single imaginary frequency of -0.3 cm is found for the transition state structure.

  11. A study of vibrational spectra and investigations of charge transfer and chemical bonding features of 2-chloro benzimidazole based on DFT computations

    NASA Astrophysics Data System (ADS)

    Muthunatesan, S.; Ragavendran, V.

    2015-01-01

    Benzimidazoles are bicyclic heteroatomic molecules. Polycyclic heteroatomic molecules have extensive coupling of different modes leading to strong coupling of force constants associated with the various chemical bonds of the molecules. To carry out a detailed vibrational spectroscopic analysis of such a bicyclic heteroatomic molecule, FT-IR and FT-Raman spectra of 2-chloro benzimidazole (CBZ) have been recorded in the condensed phase. Density Functional Theory calculations in the B3LYP/6-31G* level have been carried out to determine the optimized geometry and vibrational frequencies. In order to obtain a close agreement between theoretical and observed frequencies and hence to perform a reliable assignment, the theoretical DFT force field was transformed from Cartesian to local symmetry co-ordinates and then scaled empirically using SQM methodology. The SQM treatment resulted in a RMS deviation of 9.4 cm-1. For visual comparison, the observed and calculated spectra are presented on a common wavenumber scale. From the NBO analysis, the electron density (ED) charge transfers in the σ* and π* antibonding orbitals and second order delocalization energies E(2) confirms the occurrence of intramolecular charge transfer (ICT) within the molecule. The calculated Homo and Lumo energies show that charge transfer occurs within the molecule. The results obtained from the vibrational, NBO and HOMO-LUMO analyses have been properly tabulated.

  12. Charge transfer in dissociating iodomethane and fluoromethane molecules ionized by intense femtosecond X-ray pulses

    PubMed Central

    Boll, Rebecca; Erk, Benjamin; Coffee, Ryan; Trippel, Sebastian; Kierspel, Thomas; Bomme, Cédric; Bozek, John D.; Burkett, Mitchell; Carron, Sebastian; Ferguson, Ken R.; Foucar, Lutz; Küpper, Jochen; Marchenko, Tatiana; Miron, Catalin; Patanen, Minna; Osipov, Timur; Schorb, Sebastian; Simon, Marc; Swiggers, Michelle; Techert, Simone; Ueda, Kiyoshi; Bostedt, Christoph; Rolles, Daniel; Rudenko, Artem

    2016-01-01

    Ultrafast electron transfer in dissociating iodomethane and fluoromethane molecules was studied at the Linac Coherent Light Source free-electron laser using an ultraviolet-pump, X-ray-probe scheme. The results for both molecules are discussed with respect to the nature of their UV excitation and different chemical properties. Signatures of long-distance intramolecular charge transfer are observed for both species, and a quantitative analysis of its distance dependence in iodomethane is carried out for charge states up to I21+. The reconstructed critical distances for electron transfer are in good agreement with a classical over-the-barrier model and with an earlier experiment employing a near-infrared pump pulse. PMID:27051675

  13. Effects of the charge-transfer reorganization energy on the open-circuit voltage in small-molecular bilayer organic photovoltaic devices: comparison of the influence of deposition rates of the donor.

    PubMed

    Lee, Chih-Chien; Su, Wei-Cheng; Chang, Wen-Chang

    2016-05-14

    The theoretical maximum of open-circuit voltage (VOC) of organic photovoltaic (OPV) devices has yet to be determined, and its origin remains debated. Here, we demonstrate that VOC of small-molecule OPV devices can be improved by controlling the deposition rate of a donor without changing the interfacial energy gap at the donor/acceptor interface. The measurement of external quantum efficiency and electroluminescence spectra facilitates the observation of the existence of charge transfer (CT) states. A simplified approach by reusing the reciprocity relationship for obtaining the properties of the CT states is proposed without introducing complex techniques. We compare experimental and fitting results and propose that reorganization energy is the primary factor in determining VOC instead of either the CT energy or electronic coupling term in bilayer OPV devices. Atomic force microscopy images indicate a weak molecular aggregation when a higher deposition rate is used. The results of temperature-dependent measurements suggest the importance of molecular stacking for the CT properties.

  14. Nitrogen-doped MOF-derived micropores carbon as immobilizer for small sulfur molecules as a cathode for lithium sulfur batteries with excellent electrochemical performance.

    PubMed

    Li, Zhaoqiang; Yin, Longwei

    2015-02-25

    Nitrogen-doped carbon (NDC) spheres with abundant 22 nm mesopores and 0.5 nm micropores are obtained by directly carbonization of nitrogen-contained metal organic framework (MOF) nanocrystals. Large S8 and small S2-4 molecules are successfully infiltrated into 22 nm mesopores and 0.5 nm micropores, respectively. We successfully investigate the effect of sulfur immobilization in mesopores and micropores on the electrochemical performance of lithium-sulfur (Li-S) battery based on NDC-sulfur hybrid cathodes. The large S8 molecules in 22 nm mesopores can be removed by a prolonged heat treatment, with only small molecules of S2-4 immobilized in micropores of NDC matrices. The NDC/S2-4 hybrid exhibits excellent cycling performance, high Coulombic efficiency, and good rate capability as cathode for Li-S batteries. The confinement of smaller S2-4 molecules in the micropores of NDS efficiently avoids the loss of active sulfur and formation of soluble high-order Li polysulfides. The porous carbon can buffer the volume expansion and contraction changes, promising a stable structure for cathode. Furthermore, N doping in MOF-derived carbon not only facilitates the fast charge transfer but also is helpful in building a stronger interaction between carbon and sulfur, strengthening immobilization ability of S2-4 in micropores. The NDS-sulfur hybrid cathode exhibits a reversible capacity of 936.5 mAh g(-1) at 100th cycle with a Coulombic efficiency of 100% under a current density of 335 mA g(-1). It displays a superior rate capability performance, delivering a capacity of 632 mAh g(-1) at a high rate of 5 A g(-1). This uniquely porous NDC derived from MOF nanocrystals could be applied in related high-energy storage devices.

  15. Threshold-like complexation of conjugated polymers with small molecule acceptors in solution within the neighbor-effect model.

    PubMed

    Sosorev, Andrey Yu; Parashchuk, Olga D; Zapunidi, Sergey A; Kashtanov, Grigoriy S; Golovnin, Ilya V; Kommanaboyina, Srikanth; Perepichka, Igor F; Paraschuk, Dmitry Yu

    2016-02-14

    In some donor-acceptor blends based on conjugated polymers, a pronounced charge-transfer complex (CTC) forms in the electronic ground state. In contrast to small-molecule donor-acceptor blends, the CTC concentration in polymer:acceptor solution can increase with the acceptor content in a threshold-like way. This threshold-like behavior was earlier attributed to the neighbor effect (NE) in the polymer complexation, i.e., next CTCs are preferentially formed near the existing ones; however, the NE origin is unknown. To address the factors affecting the NE, we record the optical absorption data for blends of the most studied conjugated polymers, poly(2-methoxy-5-(2-ethylhexyloxy)-1,4-phenylenevinylene) (MEH-PPV) and poly(3-hexylthiophene) (P3HT), with electron acceptors of fluorene series, 1,8-dinitro-9,10-antraquinone (), and 7,7,8,8-tetracyanoquinodimethane () in different solvents, and then analyze the data within the NE model. We have found that the NE depends on the polymer and acceptor molecular skeletons and solvent, while it does not depend on the acceptor electron affinity and polymer concentration. We conclude that the NE operates within a single macromolecule and stems from planarization of the polymer chain involved in the CTC with an acceptor molecule; as a result, the probability of further complexation with the next acceptor molecules at the adjacent repeat units increases. The steric and electronic microscopic mechanisms of NE are discussed.

  16. Point Charges Optimally Placed to Represent the Multipole Expansion of Charge Distributions

    PubMed Central

    Onufriev, Alexey V.

    2013-01-01

    We propose an approach for approximating electrostatic charge distributions with a small number of point charges to optimally represent the original charge distribution. By construction, the proposed optimal point charge approximation (OPCA) retains many of the useful properties of point multipole expansion, including the same far-field asymptotic behavior of the approximate potential. A general framework for numerically computing OPCA, for any given number of approximating charges, is described. We then derive a 2-charge practical point charge approximation, PPCA, which approximates the 2-charge OPCA via closed form analytical expressions, and test the PPCA on a set of charge distributions relevant to biomolecular modeling. We measure the accuracy of the new approximations as the RMS error in the electrostatic potential relative to that produced by the original charge distribution, at a distance the extent of the charge distribution–the mid-field. The error for the 2-charge PPCA is found to be on average 23% smaller than that of optimally placed point dipole approximation, and comparable to that of the point quadrupole approximation. The standard deviation in RMS error for the 2-charge PPCA is 53% lower than that of the optimal point dipole approximation, and comparable to that of the point quadrupole approximation. We also calculate the 3-charge OPCA for representing the gas phase quantum mechanical charge distribution of a water molecule. The electrostatic potential calculated by the 3-charge OPCA for water, in the mid-field (2.8 Å from the oxygen atom), is on average 33.3% more accurate than the potential due to the point multipole expansion up to the octupole order. Compared to a 3 point charge approximation in which the charges are placed on the atom centers, the 3-charge OPCA is seven times more accurate, by RMS error. The maximum error at the oxygen-Na distance (2.23 Å ) is half that of the point multipole expansion up to the octupole order. PMID:23861790

  17. Probing Biomolecular Structures and Dynamics of Single Molecules Using In-Gel Alternating-Laser Excitation

    PubMed Central

    Santoso, Yusdi; Kapanidis, Achillefs N.

    2009-01-01

    Gel electrophoresis is a standard biochemical technique used for separating biomolecules on the basis of size and charge. Despite the use of gels in early single-molecule experiments, gel electrophoresis has not been widely adopted for single-molecule fluorescence spectroscopy. We present a novel method that combines gel electrophoresis and single-molecule fluorescence spectroscopy to simultaneously purify and analyze biomolecules in a gel matrix. Our method, in-gel ALEX, uses non-denaturing gels to purify biomolecular complexes of interest from free components, aggregates, and non-specific complexes. The gel matrix also slows down translational diffusion of molecules, giving rise to long, high-resolution time traces without surface immobilization, which allow extended observations of conformational dynamics in a biologically friendly environment. We demonstrated the compatibility of this method with different types of single molecule spectroscopy techniques, including confocal detection and fluorescence-correlation spectroscopy. We demonstrated that in-gel ALEX can be used to study conformational dynamics at the millisecond timescale; by studying a DNA hairpin in gels, we directly observed fluorescence fluctuations due to conformational interconversion between folded and unfolded states. Our method is amenable to the addition of small molecules that can alter the equilibrium and dynamic properties of the system. In-gel ALEX will be a versatile tool for studying structures and dynamics of complex biomolecules and their assemblies. PMID:19863108

  18. Predicting p Ka values from EEM atomic charges

    PubMed Central

    2013-01-01

    The acid dissociation constant p Ka is a very important molecular property, and there is a strong interest in the development of reliable and fast methods for p Ka prediction. We have evaluated the p Ka prediction capabilities of QSPR models based on empirical atomic charges calculated by the Electronegativity Equalization Method (EEM). Specifically, we collected 18 EEM parameter sets created for 8 different quantum mechanical (QM) charge calculation schemes. Afterwards, we prepared a training set of 74 substituted phenols. Additionally, for each molecule we generated its dissociated form by removing the phenolic hydrogen. For all the molecules in the training set, we then calculated EEM charges using the 18 parameter sets, and the QM charges using the 8 above mentioned charge calculation schemes. For each type of QM and EEM charges, we created one QSPR model employing charges from the non-dissociated molecules (three descriptor QSPR models), and one QSPR model based on charges from both dissociated and non-dissociated molecules (QSPR models with five descriptors). Afterwards, we calculated the quality criteria and evaluated all the QSPR models obtained. We found that QSPR models employing the EEM charges proved as a good approach for the prediction of p Ka (63% of these models had R2 > 0.9, while the best had R2 = 0.924). As expected, QM QSPR models provided more accurate p Ka predictions than the EEM QSPR models but the differences were not significant. Furthermore, a big advantage of the EEM QSPR models is that their descriptors (i.e., EEM atomic charges) can be calculated markedly faster than the QM charge descriptors. Moreover, we found that the EEM QSPR models are not so strongly influenced by the selection of the charge calculation approach as the QM QSPR models. The robustness of the EEM QSPR models was subsequently confirmed by cross-validation. The applicability of EEM QSPR models for other chemical classes was illustrated by a case study focused on carboxylic acids. In summary, EEM QSPR models constitute a fast and accurate p Ka prediction approach that can be used in virtual screening. PMID:23574978

  19. Protein interactions with layers of TiO2 nanotube and nanopore arrays: Morphology and surface charge influence.

    PubMed

    Kulkarni, Mukta; Mazare, Anca; Park, Jung; Gongadze, Ekaterina; Killian, Manuela Sonja; Kralj, Slavko; von der Mark, Klaus; Iglič, Aleš; Schmuki, Patrik

    2016-11-01

    In the present work we investigate the key factors involved in the interaction of small-sized charged proteins with TiO 2 nanostructures, i.e. albumin (negatively charged), histone (positively charged). We examine anodic nanotubes with specific morphology (simultaneous control over diameter and length, e.g. diameter - 15, 50 or 100nm, length - 250nm up to 10μm) and nanopores. The nanostructures surface area has a direct influence on the amount of bound protein, nonetheless the protein physical properties as electric charge and size (in relation to nanotopography and biomaterial's electric charge) are crucial too. The highest quantity of adsorbed protein is registered for histone, for 100nm diameter nanotubes (10μm length) while higher values are registered for 15nm diameter nanotubes when normalizing protein adsorption to nanostructures' surface unit area (evaluated from dye desorption measurements) - consistent with theoretical considerations. The proteins presence on the nanostructures is evaluated by XPS and ToF-SIMS; additionally, we qualitatively assess their presence along the nanostructures length by ToF-SIMS depth profiles, with decreasing concentration towards the bottom. Surface nanostructuring of titanium biomedical devices with TiO 2 nanotubes was shown to significantly influence the adhesion, proliferation and differentiation of mesenchymal stem cells (and other cells too). A high level of control over the nanoscale topography and over the surface area of such 1D nanostructures enables a direct influence on protein adhesion. Herein, we investigate and show how the nanostructure morphology (nanotube diameter and length) influences the interactions with small-sized charged proteins, using as model proteins bovine serum albumin (negatively charged) and histone (positively charged). We show that the protein charge strongly influences their adhesion to the TiO 2 nanostructures. Protein adhesion is quantified by ELISA measurements and determination of the nanostructures' total surface area. We use a quantitative surface charge model to describe charge interactions and obtain an increased magnitude of the surface charge density at the top edges of the nanotubes. In addition, we track the proteins presence on and inside the nanostructures. We believe that these aspects are crucial for applications where the incorporation of active molecules such as proteins, drugs, growth factors, etc., into nanotubes is desired. Copyright © 2016 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

  20. Prediction of octanol-water partition coefficients of organic compounds by multiple linear regression, partial least squares, and artificial neural network.

    PubMed

    Golmohammadi, Hassan

    2009-11-30

    A quantitative structure-property relationship (QSPR) study was performed to develop models those relate the structure of 141 organic compounds to their octanol-water partition coefficients (log P(o/w)). A genetic algorithm was applied as a variable selection tool. Modeling of log P(o/w) of these compounds as a function of theoretically derived descriptors was established by multiple linear regression (MLR), partial least squares (PLS), and artificial neural network (ANN). The best selected descriptors that appear in the models are: atomic charge weighted partial positively charged surface area (PPSA-3), fractional atomic charge weighted partial positive surface area (FPSA-3), minimum atomic partial charge (Qmin), molecular volume (MV), total dipole moment of molecule (mu), maximum antibonding contribution of a molecule orbital in the molecule (MAC), and maximum free valency of a C atom in the molecule (MFV). The result obtained showed the ability of developed artificial neural network to prediction of partition coefficients of organic compounds. Also, the results revealed the superiority of ANN over the MLR and PLS models. Copyright 2009 Wiley Periodicals, Inc.

  1. Enhanced Light Absorption in Fluorinated Ternary Small-Molecule Photovoltaics

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Eastham, Nicholas D.; Dudnik, Alexander S.; Harutyunyan, Boris

    2017-06-14

    Using small-molecule donor (SMD) semiconductors in organic photovoltaics (OPVs) has historically afforded lower power conversion efficiencies (PCEs) than their polymeric counterparts. The PCE difference is attributed to shorter conjugated backbones, resulting in reduced intermolecular interactions. Here, a new pair of SMDs is synthesized based on the diketopyrrolopyrrole-benzodithiophene-diketopyrrolopyrrole (BDT-DPP2) skeleton but having fluorinated and fluorinefree aromatic side-chain substituents. Ternary OPVs having varied ratios of the two SMDs with PC61BM as the acceptor exhibit tunable open-circuit voltages (Vocs) between 0.833 and 0.944 V due to a fluorination-induced shift in energy levels and the electronic “alloy” formed from the miscibility of the twomore » SMDs. A 15% increase in PCE is observed at the optimal ternary SMD ratio, with the short-circuit current density (Jsc) significantly increased to 9.18 mA/cm2. The origin of Jsc enhancement is analyzed via charge generation, transport, and diffuse reflectance measurements, and is attributed to increased optical absorption arising from a maximum in film crystallinity at this SMD ratio, observed by grazing incidence wide-angle X-ray scattering.« less

  2. Atomic partial charges on CH{sub 3}NH{sub 3}PbI{sub 3} from first-principles electronic structure calculations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Madjet, Mohamed E., E-mail: mmadjet@qf.org.qa; El-Mellouhi, Fedwa; Carignano, Marcelo A.

    We calculated the partial charges in methylammonium (MA) lead-iodide perovskite CH{sub 3}NH{sub 3}PbI{sub 3} in its different crystalline phases using different first-principles electronic charge partitioning approaches, including the Bader, ChelpG, and density-derived electrostatic and chemical (DDEC) schemes. Among the three charge partitioning methods, the DDEC approach provides chemically intuitive and reliable atomic charges for this material, which consists of a mixture of transition metals, halide ions, and organic molecules. The DDEC charges are also found to be robust against the use of hybrid functionals and/or upon inclusion of spin–orbit coupling or dispersive interactions. We calculated explicitly the atomic charges withmore » a special focus on the dipole moment of the MA molecules within the perovskite structure. The value of the dipole moment of the MA is reduced with respect to the isolated molecule due to charge redistribution involving the inorganic cage. DDEC charges and dipole moment of the organic part remain nearly unchanged upon its rotation within the octahedral cavities. Our findings will be of both fundamental and practical importance, as the accurate and consistent determination of the atomic charges is important in order to understand the average equilibrium distribution of the electrons and to help in the development of force fields for larger scale atomistic simulations to describe static, dynamic, and thermodynamic properties of the material.« less

  3. Apparatus and method of determining molecular weight of large molecules

    DOEpatents

    Fuerstenau, S.; Benner, W.H.; Madden, N.M.; Searles, W.

    1998-06-23

    A mass spectrometer determines the mass of multiply charged high molecular weight molecules. This spectrometer utilizes an ion detector which is capable of simultaneously measuring the charge z and transit time of a single ion as it passes through the detector. From this transit time, the velocity of the single ion may then be derived, thus providing the mass-to-charge ratio m/z for a single ion which has been accelerated through a known potential. Given z and m/z, the mass m of the single ion can then be calculated. Electrospray ions with masses in excess of 1 MDa and charge numbers greater than 425 e{sup {minus}} are readily detected. The on-axis single ion detection configuration enables a duty cycle of nearly 100% and extends the practical application of electrospray mass spectrometry to the analysis of very large molecules with relatively inexpensive instrumentation. 14 figs.

  4. Apparatus and method of determining molecular weight of large molecules

    DOEpatents

    Fuerstenau, Stephen; Benner, W. Henry; Madden, Norman; Searles, William

    1998-01-01

    A mass spectrometer determines the mass of multiply charged high molecular weight molecules. This spectrometer utilizes an ion detector which is capable of simultaneously measuring the charge z and transit time of a single ion as it passes through the detector. From this transit time, the velocity of the single ion may then be derived, thus providing the mass-to-charge ratio m/z for a single ion which has been accelerated through a known potential. Given z and m/z, the mass m of the single ion can then be calculated. Electrospray ions with masses in excess of 1 MDa and charge numbers greater than 425 e.sup.- are readily detected. The on-axis single ion detection configuration enables a duty cycle of nearly 100% and extends the practical application of electrospray mass spectrometry to the analysis of very large molecules with relatively inexpensive instrumentation.

  5. Application of double-hybrid density functionals to charge transfer in N-substituted pentacenequinones.

    PubMed

    Sancho-García, J C

    2012-05-07

    A set of N-heteroquinones, deriving from oligoacenes, have been recently proposed as n-type organic semiconductors with high electron mobilities in thin-film transistors. Generally speaking, this class of compounds self-assembles in neighboring π-stacks linked by weak hydrogen bonds. We aim at theoretically characterizing here the sequential charge transport (hopping) process expected to take place across these arrays of molecules. To do so, we need to accurately address the preferred packing of these materials simultaneously to single-molecule properties related to charge-transfer events, carefully employing dispersion-corrected density functional theory methods to accurately extract the key molecular parameters governing this phenomenon at the nanoscale. This study confirms the great deal of interest around these compounds, since controlled functionalization of model molecules (i.e., pentacene) allows to efficiently tune the corresponding charge mobilities, and the capacity of modern quantum-chemical methods to predict it after rationalizing the underlying structure-property relationships.

  6. Balancing charge in the complementarity-determining regions of humanized mAbs without affecting pI reduces non-specific binding and improves the pharmacokinetics.

    PubMed

    Datta-Mannan, Amita; Thangaraju, Arunkumar; Leung, Donmienne; Tang, Ying; Witcher, Derrick R; Lu, Jirong; Wroblewski, Victor J

    2015-01-01

    Lowering the isoelectric point (pI) through engineering the variable region or framework of an IgG can improve its exposure and half-life via a reduction in clearance mediated through non-specific interactions. As such, net charge is a potentially important property to consider in developing therapeutic IgG molecules having favorable pharmaceutical characteristics. Frequently, it may not be possible to shift the pI of monoclonal antibodies (mAbs) dramatically without the introduction of other liabilities such as increased off-target interactions or reduced on-target binding properties. In this report, we explored the influence of more subtle modifications of molecular charge on the in vivo properties of an IgG1 and IgG4 monoclonal antibody. Molecular surface modeling was used to direct residue substitutions in the complementarity-determining regions (CDRs) to disrupt positive charge patch regions, resulting in a reduction in net positive charge without affecting the overall pI of the mAbs. The effect of balancing the net positive charge on non-specific binding was more significant for the IgG4 versus the IgG1 molecule that we examined. This differential effect was connected to the degree of influence on cellular degradation in vitro and in vivo clearance, distribution and metabolism in mice. In the more extreme case of the IgG4, balancing the charge yielded an ∼7-fold improvement in peripheral exposure, as well as significantly reduced tissue catabolism and subsequent excretion of proteolyzed products in urine. Balancing charge on the IgG1 molecule had a more subtle influence on non-specific binding and yielded only a modest alteration in clearance, distribution and elimination. These results suggest that balancing CDR charge without affecting the pI can lead to improved mAb pharmacokinetics, the magnitude of which is likely dependent on the relative influence of charge imbalance and other factors affecting the molecule's disposition.

  7. Balancing charge in the complementarity-determining regions of humanized mAbs without affecting pI reduces non-specific binding and improves the pharmacokinetics

    PubMed Central

    Datta-Mannan, Amita; Thangaraju, Arunkumar; Leung, Donmienne; Tang, Ying; Witcher, Derrick R; Lu, Jirong; Wroblewski, Victor J

    2015-01-01

    Lowering the isoelectric point (pI) through engineering the variable region or framework of an IgG can improve its exposure and half-life via a reduction in clearance mediated through non-specific interactions. As such, net charge is a potentially important property to consider in developing therapeutic IgG molecules having favorable pharmaceutical characteristics. Frequently, it may not be possible to shift the pI of monoclonal antibodies (mAbs) dramatically without the introduction of other liabilities such as increased off-target interactions or reduced on-target binding properties. In this report, we explored the influence of more subtle modifications of molecular charge on the in vivo properties of an IgG1 and IgG4 monoclonal antibody. Molecular surface modeling was used to direct residue substitutions in the complementarity-determining regions (CDRs) to disrupt positive charge patch regions, resulting in a reduction in net positive charge without affecting the overall pI of the mAbs. The effect of balancing the net positive charge on non-specific binding was more significant for the IgG4 versus the IgG1 molecule that we examined. This differential effect was connected to the degree of influence on cellular degradation in vitro and in vivo clearance, distribution and metabolism in mice. In the more extreme case of the IgG4, balancing the charge yielded an ∼7-fold improvement in peripheral exposure, as well as significantly reduced tissue catabolism and subsequent excretion of proteolyzed products in urine. Balancing charge on the IgG1 molecule had a more subtle influence on non-specific binding and yielded only a modest alteration in clearance, distribution and elimination. These results suggest that balancing CDR charge without affecting the pI can lead to improved mAb pharmacokinetics, the magnitude of which is likely dependent on the relative influence of charge imbalance and other factors affecting the molecule's disposition. PMID:25695748

  8. Role of organic interfacial modifiers in inverted polymers solar cells: An in-depth analysis of perylene vs fullerene organic modifiers

    NASA Astrophysics Data System (ADS)

    Kumar, S.; Panigrahi, D.; Dhar, A.

    2018-03-01

    Interfacial issues can significantly restrict the performance of photovoltaic devices by exacerbating the charge recombination channels, macroscopic phase separation, and providing a non-ideal contact for selective extraction of charges particularly in photovoltaic devices using organic and inorganic materials together. Organic interfacial modifiers (IMs) are often used to mitigate these issues by modifying the organic-inorganic interface. In order to extricate the role of these IMs on the photovoltaic performance we have made a comprehensive study on the application of perylene-based and fullerene small molecules having different molecular origin as organic IMs on ZnO electron extracting layers in inverted BHJs photovoltaic devices. We report an elaborate study on the electronic and surface altering properties of these IMs and correlated their effect on the different PV performance parameters of the inverted BHJ solar cells employing P3HT: PCBM photoactive layer. Our investigations demonstrate the role of these organic IMs in reducing the ZnO cathode work function and increasing its electron transportation property along with the passivation of superficial traps states present on ZnO which helps in selective extraction of charge carriers from the devices and minimize the recombination losses. These different aspects of IMs compete and their balanced effect decides the final outcome. As a result, we obtain a substantial improvement in the device performance with power conversion efficiency (PCE) of 3.0% for the C70/ZnO cathode device which shows over 60% improvement in contrast to the devices without any ZnO surface modification. The present investigation intents to exhibit the feasibility of vacuum sublimated organic small molecules in performance improvement in BHJ solar cells utilizing the ZnO ETLs and contrast their efficacy for the purpose rather than setting any benchmark device performance although the efficiencies obtained are typical for the active layer used in the study.

  9. Dependence of interface charge trapping on channel engineering in pentacene field effect transistors.

    PubMed

    Lee, Sunwoo; Park, Junghyuck; Park, In-Sung; Ahn, Jinho

    2014-07-01

    We investigate the dependence of charge carrier mobility by trap states at various interface regions through channel engineering. Prior to evaluation of interface trap density, the electrical performance in pentaene field effect transistors (FET) with high-k gate oxide are also investigated depending on four channel engineering. As a channel engineering, gas treatment, coatings of thin polymer layer, and chemical surface modification using small molecules were carried out. After channel engineering, the performance of device as well as interface trap density calculated by conductance method are remarkably improved. It is found that the reduced interface trap density is closely related to decreasing the sub-threshold swing and improving the mobility. Particularly, we also found that performance of device such as mobility, subthreshold swing, and interface trap density after gas same is comparable to those of OTS.

  10. The structure and properties of a simple model mixture of amphiphilic molecules and ions at a solid surface

    NASA Astrophysics Data System (ADS)

    Pizio, O.; Sokołowski, S.; Sokołowska, Z.

    2014-05-01

    We investigate microscopic structure, adsorption, and electric properties of a mixture that consists of amphiphilic molecules and charged hard spheres in contact with uncharged or charged solid surfaces. The amphiphilic molecules are modeled as spheres composed of attractive and repulsive parts. The electrolyte component of the mixture is considered in the framework of the restricted primitive model (RPM). The system is studied using a density functional theory that combines fundamental measure theory for hard sphere mixtures, weighted density approach for inhomogeneous charged hard spheres, and a mean-field approximation to describe anisotropic interactions. Our principal focus is in exploring the effects brought by the presence of ions on the distribution of amphiphilic particles at the wall, as well as the effects of amphiphilic molecules on the electric double layer formed at solid surface. In particular, we have found that under certain thermodynamic conditions a long-range translational and orientational order can develop. The presence of amphiphiles produces changes of the shape of the differential capacitance from symmetric or non-symmetric bell-like to camel-like. Moreover, for some systems the value of the potential of the zero charge is non-zero, in contrast to the RPM at a charged surface.

  11. Polypeptide multilayer film co-delivers oppositely-charged drug molecules in sustained manners.

    PubMed

    Jiang, Bingbing; Defusco, Elizabeth; Li, Bingyun

    2010-12-13

    The current state-of-the-art for drug-carrying biomedical devices is mostly limited to those that release a single drug. Yet there are many situations in which more than one therapeutic agent is needed. Also, most polyelectrolyte multilayer films intended for drug delivery are loaded with active molecules only during multilayer film preparation. In this paper, we present the integration of capsules as vehicles within polypeptide multilayer films for sustained release of multiple oppositely charged drug molecules using layer-by-layer nanoassembly technology. Calcium carbonate (CaCO(3)) particles were impregnated with polyelectrolytes, shelled with polyelectrolyte multilayers, and then assembled onto polypeptide multilayer films using glutaraldehyde. Capsule-integrated polypeptide multilayer films were obtained after decomposition of CaCO(3) templates. Two oppositely charged drugs were loaded into capsules within polypeptide multilayer films postpreparation based on electrostatic interactions between the drugs and the polyelectrolytes impregnated within capsules. We determined that the developed innovative capsule-integrated polypeptide multilayer films could be used to load multiple drugs of very different properties (e.g., opposite charges) any time postpreparation (e.g., minutes before surgical implantation inside an operating room), and such capsule-integrated films allowed simultaneous delivery of two oppositely charged drug molecules and a sustained (up to two weeks or longer) and sequential release was achieved.

  12. Polypeptide Multilayer Film Co-Delivers Oppositely-Charged Drug Molecules in Sustained Manners

    PubMed Central

    Jiang, Bingbing; DeFusco, Elizabeth; Li, Bingyun

    2010-01-01

    The current state-of-the-art for drug-carrying biomedical devices is mostly limited to those that release a single drug. Yet there are many situations in which more than one therapeutic agent is needed. Also, most polyelectrolyte multilayer films intending for drug delivery are loaded with active molecules only during multilayer film preparation. In this paper, we present the integration of capsules as vehicles within polypeptide multilayer films for sustained release of multiple oppositely-charged drug molecules using layer-by-layer nanoassembly technology. Calcium carbonate (CaCO3) particles were impregnated with polyelectrolytes, shelled with polyelectrolyte multilayers, and then assembled onto polypeptide multilayer films using glutaraldehyde. Capsule-integrated polypeptide multilayer films were obtained after decomposition of CaCO3 templates. Two oppositely-charged drugs were loaded into capsules within polypeptide multilayer films post-preparation based on electrostatic interactions between the drugs and the polyelectrolytes impregnated within capsules. We determined that the developed innovative capsule-integrated polypeptide multilayer films could be used to load multiple drugs of very different properties (e.g. opposite charges) any time post-preparation (e.g. minutes before surgical implantation inside an operating room), and such capsule-integrated films allowed simultaneous delivery of two oppositely-charged drug molecules and a sustained (up to two weeks or longer) and sequential release was achieved. PMID:21058719

  13. What Is the Structure of the Naphthalene-Benzene Heterodimer Radical Cation? Binding Energy, Charge Delocalization, and Unexpected Charge-Transfer Interaction in Stacked Dimer and Trimer Radical Cations.

    PubMed

    Attah, Isaac K; Platt, Sean P; Meot-Ner Mautner, Michael; El-Shall, M Samy; Peverati, Roberto; Head-Gordon, Martin

    2015-04-02

    The binding energy of the naphthalene(+•)(benzene) heterodimer cation has been determined to be 7.9 ± 1 kcal/mol for C10H8(+•)(C6H6) and 8.1 ± 1 kcal/mol for C10H8(+•)(C6D6) by equilibrium thermochemical measurements using the mass-selected drift cell technique. A second benzene molecule binds to the C10H8(+•)(C6D6) dimer with essentially the same energy (8.4 ± 1 kcal/mol), suggesting that the two benzene molecules are stacked on opposite sides of the naphthalene cation in the (C6D6)C10H8(+•)(C6D6) heterotrimer. The lowest-energy isomers of the C10H8(+•)(C6D6) and (C6D6)C10H8(+•)(C6D6) dimer and trimer calculated using the M11/cc-pVTZ method have parallel stacked structures with enthalpies of binding (-ΔH°) of 8.4 and 9.0 kcal/mol, respectively, in excellent agreement with the experimental values. The stacked face-to-face class of isomers is calculated to have substantial charge-transfer stabilization of about 45% of the total interaction energy despite the large difference between the ionization energies of benzene and naphthalene. Similarly, significant delocalization of the positive charge is found among all three fragments of the (C6D6)C10H8(+•)(C6D6) heterotrimer, thus leaving only 46% of the total charge on the central naphthalene moiety. This unexpectedly high charge-transfer component results in activating two benzene molecules in the naphthalene(+•)(benzene)2 heterotrimer cation to associate with a third benzene molecule at 219 K to form a benzene trimer cation and a neutral naphthalene molecule. The global minimum of the C10H8(+•)(C6H6)2 heterotrimer is found to be the one where the naphthalene cation is sandwiched between two benzene molecules. It is remarkable, and rather unusual, that the binding energy of the second benzene molecule is essentially the same as that of the first. This is attributed to the enhanced charge-transfer interaction in the stacked trimer radical cation.

  14. Host-guest chemistry of dendrimer-drug complexes: 7. Formation of stable inclusions between acetylated dendrimers and drugs bearing multiple charges.

    PubMed

    Fang, Min; Zhang, Jiahai; Wu, Qinglin; Xu, Tongwen; Cheng, Yiyun

    2012-03-15

    Drug molecules bearing multiple charges usually form precipitates with cationic dendrimers, which presents a challenge during the preparation of dendrimer inclusions for these drugs. In the present study, fully acetylated polyamidoamine (PAMAM) dendrimers were proposed as stable vehicles for drug molecules bearing two negative charges such as Congo red and indocyanine green. NMR techniques including (1)H NMR and (1)H-(1)H NOESY were used to characterize the host-guest chemistry of acetylated dendrimer and these guest molecules. The cationic PAMAM dendrimer was found to form a precipitate with Congo red and indocyanine green, but the acetylated one avoided the formation of cross-linking structures in aqueous solutions. NOESY studies revealed the encapsulation of Congo red and indocyanine green within the interior cavities of PAMAM dendrimers at mild acidic conditions and acetylated dendrimers show much stronger ability to encapsulate the guest molecules than cationic ones. Also, UV-vis-NIR studies suggest that acetylated dendrimers significantly improve the photostability of indocyanine green and prevent the formation of indocyanine green J-aggregates in aqueous solutions. The present study provides a new insight into dendrimer-based host-guest systems, especially for those guest molecules bearing multiple charges. © 2012 American Chemical Society

  15. Polarization and charge transfer in the hydration of chloride ions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhao Zhen; Rogers, David M.; Beck, Thomas L.

    2010-01-07

    A theoretical study of the structural and electronic properties of the chloride ion and water molecules in the first hydration shell is presented. The calculations are performed on an ensemble of configurations obtained from molecular dynamics simulations of a single chloride ion in bulk water. The simulations utilize the polarizable AMOEBA force field for trajectory generation and MP2-level calculations are performed to examine the electronic structure properties of the ions and surrounding waters in the external field of more distant waters. The ChelpG method is employed to explore the effective charges and dipoles on the chloride ions and first-shell waters.more » The quantum theory of atoms in molecules (QTAIM) is further utilized to examine charge transfer from the anion to surrounding water molecules. The clusters extracted from the AMOEBA simulations exhibit high probabilities of anisotropic solvation for chloride ions in bulk water. From the QTAIM analysis, 0.2 elementary charges are transferred from the ion to the first-shell water molecules. The default AMOEBA model overestimates the average dipole moment magnitude of the ion compared to the quantum mechanical value. The average magnitude of the dipole moment of the water molecules in the first shell treated at the MP2-level, with the more distant waters handled with an AMOEBA effective charge model, is 2.67 D. This value is close to the AMOEBA result for first-shell waters (2.72 D) and is slightly reduced from the bulk AMOEBA value (2.78 D). The magnitude of the dipole moment of the water molecules in the first solvation shell is most strongly affected by the local water-water interactions and hydrogen bonds with the second solvation shell, rather than by interactions with the ion.« less

  16. Swell Gels to Dumbbell Micelles: Construction of Materials and Nanostructure with Self-assembly

    NASA Astrophysics Data System (ADS)

    Pochan, Darrin

    2007-03-01

    Bionanotechnology, the emerging field of using biomolecular and biotechnological tools for nanostructure or nanotecnology development, provides exceptional opportunity in the design of new materials. Self-assembly of molecules is an attractive materials construction strategy due to its simplicity in application. By considering peptidic or charged synthetic polymer molecules in the bottom-up materials self-assembly design process, one can take advantage of inherently biomolecular attributes; intramolecular folding events, secondary structure, and electrostatic interactions; in addition to more traditional self-assembling molecular attributes such as amphiphilicty, to define hierarchical material structure and consequent properties. Several molecular systems will be discussed. Synthetic block copolymers with charged corona blocks can be assembled in dilute solution containing multivalent organic counterions to produce micelle structures such as toroids. These ring-like micelles are similar to the toroidal bundling of charged semiflexible biopolymers like DNA in the presence of multivalent counterions. Micelle structure can be tuned between toroids, cylinders, and disks simply by using different concentrations or molecular volumes of organic counterion. In addition, these charged blocks can consist of amino acids as monomers producing block copolypeptides. In addition to the above attributes, block copolypeptides provide the control of block secondary structure to further control self-assembly. Design strategies based on small (less than 24 amino acids) beta-hairpin peptides will be discussed. Self-assembly of the peptides is predicated on an intramolecular folding event caused by desired solution properties. Importantly, the intramolecular folding event impart a molecular-level mechanism for environmental responsiveness at the material level (e.g. infinite change in viscosity of a solution to a gel with changes in pH, ionic strength, temperature).

  17. Time-resolved terahertz spectroscopy of electrically conductive metal-organic frameworks doped with redox active species

    NASA Astrophysics Data System (ADS)

    Alberding, Brian G.; Heilweil, Edwin J.

    2015-09-01

    Metal-Organic Frameworks (MOFs) are three-dimensional coordination polymers that are well known for large pore surface area and their ability to adsorb molecules from both the gaseous and solution phases. In general, MOFs are electrically insulating, but promising opportunities for tuning the electronic structure exist because MOFs possess synthetic versatility; the metal and organic ligand subunits can be exchanged or dopant molecules can be introduced into the pore space. Two such MOFs with demonstrated electrical conductivity are Cu3(1,3,5-benzenetricarboxylate)2, a.k.a HKUST-1, and Cu[Ni(pyrazine-2,3-dithiolate)2]. Herein, these two MOFs have been infiltrated with the redox active species 7,7,8,8-tetracyanoquinodimethane (TCNQ) and iodine under solution phase conditions and shown to produce redox products within the MOF pore space. Vibrational bands assignable to TCNQ anion and triiodide anion have been observed in the Mid-IR and Terahertz ranges using FTIR Spectroscopy. The MOF samples have been further investigated by Time-Resolved Terehertz Spectroscopy (TRTS). Using this technique, the charge mobility, separation, and recombination dynamics have been followed on the picosecond time scale following photoexcitation with visible radiation. The preliminary results show that the MOF samples have small inherent photoconductivity with charge separation lifetimes on the order of a few picoseconds. In the case of HKUST-1, the MOF can also be supported by a TiO2 film and initial results show that charge injection into the TiO2 layer occurs with a comparable efficiency to the dye sensitizer N3, [cis-Bis(isothiocyanato)-bis(2,2'-bipyridyl-4,4'-dicarboxylato ruthenium(II)], and therefore this MOF has potential as a new light absorbing and charge conducting material in photovoltaic devices.

  18. From Peptides to Proteins: Systematic Control of Net Molecular Charge and Hydrophilicity on the Kinetics of Calcite Growth

    NASA Astrophysics Data System (ADS)

    Elhadj, S.; de Yoreo, J. J.; Hoyer, J. J.; Dove, P. M.

    2006-12-01

    The compartment-specific compositions of biologic molecules isolated from biominerals suggest that control of mineral growth may be linked to biochemical features. Here we define a systematic relationship between the ability of biomolecules in solution to promote the growth of calcite (CaCO3) and their net negative molecular charge and hydrophilicity. The degree of enhancement is dependent on peptide composition, but not on peptide sequence. Data analysis shows that this rate enhancement arises from an increase in the kinetic coefficient. We interpret the mechanism of growth enhancement to be a catalytic process whereby biomolecules reduce the magnitude of the diffusive barrier, Ek, by perturbations that displace water molecules- a water shell destruction mechanism. The result is a decrease in the repulsive barrier for attachment of solutes to the solid phase. This previously unrecognized relationship also rationalizes recently reported data showing acceleration of calcite growth rates over rates measured in the pure system by nanomolar levels of abalone nacre proteins. These findings show that the growth-modifying properties of small model peptides may be scaled up to analyze mineralization processes that are mediated by more complex proteins. We suggest that enhancement of calcite growth may now be estimated a priori from the composition of peptide sequences and the calculated values of hydrophilicity and net molecular charge without need for detailed tests for each biomolecule. This insight may contribute to an improved understanding of mineralization in diverse systems of biomineralization.

  19. Conformational stability, vibrational spectra, molecular structure, NBO and HOMO-LUMO analysis of 5-nitro-2-furaldehyde oxime based on DFT calculations.

    PubMed

    Arivazhagan, M; Jeyavijayan, S; Geethapriya, J

    2013-03-01

    The FTIR and FT-Raman spectra of 5-nitro-2-furaldehyde oxime (NFAO) have been recorded in the regions 4000-400 cm(-1) and 3500-50 cm(-1), respectively. The total energies of different conformations have been obtained from DFT (B3LYP) with 6-311++G(d,p) basis set calculations. The computational results identify the most stable conformer of NFAO as the C1 form. Utilizing the observed FTIR and FT-Raman data, a complete vibrational assignment and analysis of the fundamental modes of the compound were carried out. The optimum molecular geometry, harmonic vibrational frequencies, infrared intensities and Raman scattering activities, were calculated by density functional theory (DFT/B3LYP) method with 6-31+G(d,p) and 6-311++G(d,p) basis sets. The difference between the observed and scaled wavenumber values of most of the fundamentals is very small. A detailed interpretation of the infrared and Raman spectra of NFAO is also reported based on total energy distribution (TED). Stability of the molecule arising from hyperconjugative interactions, charge delocalization have been analyzed using natural bond orbital (NBO) analysis. Besides, molecular electrostatic potential (MEP), HOMO and LUMO analysis, and several thermodynamic properties were performed by the DFT method. Mulliken's net charges have been calculated and compared with the natural atomic charges. Ultraviolet-visible spectrum of the title molecule has also been calculated using TD-DFT method. Copyright © 2012 Elsevier B.V. All rights reserved.

  20. Selective CO2 adsorption by a new metal-organic framework: synergy between open metal sites and a charged imidazolinium backbone.

    PubMed

    Kochetygov, Ilia; Bulut, Safak; Asgari, Mehrdad; Queen, Wendy L

    2018-05-30

    Metal-organic frameworks (MOFs) are porous, tunable crystalline materials that are attracting widespread scientific attention for their potential use in post-combustion CO2 capture. In this work, we report the synthesis of a new ligand, 1,3-bis(4-carboxyphenyl)-4,5-dihydro-1H-imidazol-3-ium tetrafluoroborate, H2Sp5-BF4, that is subsequently used for the construction of a novel MOF, Cu-Sp5-EtOH. This highly crystalline material has a charged framework that is expected to give rise to high CO2/N2 selectivity. However, the pores of the parent structure could not be accessed due to the presence of strongly coordinated ethanol molecules. After solvent exchange with methanol and subsequently heating Cu-Sp5-MeOH under vacuum, we are able to liberate the solvent providing other small molecules like CO2 access to the inside of the now porous structure, Cu-Sp5. The combination of open metal sites and framework charge leads to an exceptionally high CO2/N2 selectivity, as determined by Ideal Adsorbed Solution Theory (IAST) calculations performed on single-component adsorption isotherms. The CO2/N2 selectivity of Cu-Sp5 reaches a value of over 200 at pressures typically found in post-combustion flue gas (0.15 bar CO2/0.85 bar N2), a value that is among the highest reported to date.

  1. C{sub 60}-dyad aggregates: Self-organized structures in aqueous solutions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Guskova, O. A., E-mail: guskova@ipfdd.de, E-mail: s.raovaranasi@uq.edu.au; Varanasi, S. R., E-mail: guskova@ipfdd.de, E-mail: s.raovaranasi@uq.edu.au; Sommer, J.-U.

    2014-10-14

    Extensive full-atomistic molecular dynamics simulations are performed to study the self-organization of C{sub 60}-fullerene dyad molecules in water, namely phenyl-C{sub 61}-butyric acid methyl ester and fulleropyrrolidines, which have two elements of ordering, the hydrophobic fullerene cage and the hydrophilic/ionic group. While pristine fullerene or phenyl-C{sub 61}-butyric acid methyl ester forms spherical droplets in order to minimize the surface tension, the amphiphilic nature of charged solute molecules leads to the formation of supramolecular assemblies having cylindrical shape driven by charge repulsion between the ionic groups located on the surface of the aggregates. We show that formation of non-spherical micelles is themore » geometrical consequence if the fullerene derivatives are considered as surfactants where the ionized groups are only hydrophilic unit. The agglomeration behavior of fullerenes is evaluated by determining sizes of the clusters, solvent accessible surface areas, and shape parameters. By changing the size of the counterions from chloride over iodide to perchlorate we find a thickening of the cylinder-like structures which can be explained by stronger condensation of larger ions and thus partial screening of the charge repulsion on the cluster surface. The reason for the size dependence of counterion condensation is the formation of a stronger hydration shell in case of small ions which in turn are repelled from the fullerene aggregates. Simulations are also in good agreement with the experimentally observed morphologies of decorated C{sub 60}-nanoparticles.« less

  2. Hydration Free Energy from Orthogonal Space Random Walk and Polarizable Force Field.

    PubMed

    Abella, Jayvee R; Cheng, Sara Y; Wang, Qiantao; Yang, Wei; Ren, Pengyu

    2014-07-08

    The orthogonal space random walk (OSRW) method has shown enhanced sampling efficiency in free energy calculations from previous studies. In this study, the implementation of OSRW in accordance with the polarizable AMOEBA force field in TINKER molecular modeling software package is discussed and subsequently applied to the hydration free energy calculation of 20 small organic molecules, among which 15 are positively charged and five are neutral. The calculated hydration free energies of these molecules are compared with the results obtained from the Bennett acceptance ratio method using the same force field, and overall an excellent agreement is obtained. The convergence and the efficiency of the OSRW are also discussed and compared with BAR. Combining enhanced sampling techniques such as OSRW with polarizable force fields is very promising for achieving both accuracy and efficiency in general free energy calculations.

  3. Tuning structure of oppositely charged nanoparticle and protein complexes

    NASA Astrophysics Data System (ADS)

    Kumar, Sugam; Aswal, V. K.; Callow, P.

    2014-04-01

    Small-angle neutron scattering (SANS) has been used to probe the structures of anionic silica nanoparticles (LS30) and cationic lyszyme protein (M.W. 14.7kD, I.P. ˜ 11.4) by tuning their interaction through the pH variation. The protein adsorption on nanoparticles is found to be increasing with pH and determined by the electrostatic attraction between two components as well as repulsion between protein molecules. We show the strong electrostatic attraction between nanoparticles and protein molecules leads to protein-mediated aggregation of nanoparticles which are characterized by fractal structures. At pH 5, the protein adsorption gives rise to nanoparticle aggregation having surface fractal morphology with close packing of nanoparticles. The surface fractals transform to open structures of mass fractal morphology at higher pH (7 and 9) on approaching isoelectric point (I.P.).

  4. Origin of bias-stress induced instability in organic thin-film transistors with semiconducting small-molecule/insulating polymer blend channel.

    PubMed

    Park, Ji Hoon; Lee, Young Tack; Lee, Hee Sung; Lee, Jun Young; Lee, Kimoon; Lee, Gyu Baek; Han, Jiwon; Kim, Tae Woong; Im, Seongil

    2013-03-13

    The stabilities of a blending type organic thin-film transistor with phase-separated TIPS-pentacene channel layer were characterized under the conditions of negative-bias-stress (NBS) and positive-bias-stress (PBS). During NBS, threshold voltage (Vth) shifts noticeably. NBS-imposed devices revealed interfacial trap density-of-states (DOS) at 1.56 and 1.66 eV, whereas initial device showed the DOS at only 1.56 eV, as measured by photoexcited charge-collection spectroscopy (PECCS) method. Possible origin of this newly created defect is related to ester group in PMMA, which induces some hole traps at the TIPS-pentacene/i-PMMA interface. PBS-imposed device showed little Vth shift but visible off-current increase as "back-channel" effect, which is attributed to the water molecules trapped on the TFT surface.

  5. Anionized and cationized hemeundecapeptides as probes for cell surface charge and permeability studies: differentiated labeling of endothelial plasmalemmal vesicles

    PubMed Central

    1985-01-01

    To obtain small membrane markers easily accessible to the charged groups of the cell surface, we prepared, from hemeundecapeptide (HUP), three derivatives that maintain the peroxidatic activity: the anionized hemeundecapeptide, Mr 1,963, estimated diameter 1.68 nm, pl 3.5, for the detection of basic groups; and both a cationized hemeundecapeptide containing predominantly tertiary amino groups, Mr 2,215, estimated diameter 1.75 nm, pl 9.0, and a cationized hemeundecapeptide containing only primary amino groups, Mr 2,271, estimated diameter 1.75 nm, pl 10.6, for labeling acidic residues. The markers were perfused in situ in mice to label the luminal surface of fenestrated endothelium of pancreatic capillaries. Specimens were processed through the cytochemical reaction for peroxidatic activity and examined by electron microscopy. The anionized HUP and HUP (pl 4.85) marked the plasmalemma proper, the coated pits, and the membrane and diaphragms of plasmalemmal vesicles and transendothelial channels. The cationized HUP containing predominantly tertiary amino groups (pl 9.0) decorated all cell surface components with the exception of plasmalemmal vesicles and channels; the latter were, however, labeled by the cationized HUP containing only primary groups (pl 10.6), which suggests that these structures contain on their luminal surface very weak acidic residues of high pKa values. The fact that the membrane of plasmalemmal vesicles can discriminate against permeant cationic macromolecules only up to a pl of approximately 9.0 indicates that in the electrostatic restriction there is a charge limit. In the case of fenestrated capillary endothelium, the upper charge limit seems to be a pl of approximately 9.0. In these vessels, the charge discrimination is effective for molecules as small as 2 nm. PMID:3968182

  6. Anionized and cationized hemeundecapeptides as probes for cell surface charge and permeability studies: differentiated labeling of endothelial plasmalemmal vesicles.

    PubMed

    Ghinea, N; Simionescu, N

    1985-02-01

    To obtain small membrane markers easily accessible to the charged groups of the cell surface, we prepared, from hemeundecapeptide (HUP), three derivatives that maintain the peroxidatic activity: the anionized hemeundecapeptide, Mr 1,963, estimated diameter 1.68 nm, pl 3.5, for the detection of basic groups; and both a cationized hemeundecapeptide containing predominantly tertiary amino groups, Mr 2,215, estimated diameter 1.75 nm, pl 9.0, and a cationized hemeundecapeptide containing only primary amino groups, Mr 2,271, estimated diameter 1.75 nm, pl 10.6, for labeling acidic residues. The markers were perfused in situ in mice to label the luminal surface of fenestrated endothelium of pancreatic capillaries. Specimens were processed through the cytochemical reaction for peroxidatic activity and examined by electron microscopy. The anionized HUP and HUP (pl 4.85) marked the plasmalemma proper, the coated pits, and the membrane and diaphragms of plasmalemmal vesicles and transendothelial channels. The cationized HUP containing predominantly tertiary amino groups (pl 9.0) decorated all cell surface components with the exception of plasmalemmal vesicles and channels; the latter were, however, labeled by the cationized HUP containing only primary groups (pl 10.6), which suggests that these structures contain on their luminal surface very weak acidic residues of high pKa values. The fact that the membrane of plasmalemmal vesicles can discriminate against permeant cationic macromolecules only up to a pl of approximately 9.0 indicates that in the electrostatic restriction there is a charge limit. In the case of fenestrated capillary endothelium, the upper charge limit seems to be a pl of approximately 9.0. In these vessels, the charge discrimination is effective for molecules as small as 2 nm.

  7. The Generation of Dehydroalanine Residues in Protonated Polypeptides: Ion/Ion Reactions for Introducing Selective Cleavages

    NASA Astrophysics Data System (ADS)

    Peng, Zhou; Bu, Jiexun; McLuckey, Scott A.

    2017-09-01

    We examine a gas-phase approach for converting a subset of amino acid residues in polypeptide cations to dehydroalanine (Dha). Subsequent activation of the modified polypeptide ions gives rise to specific cleavage N-terminal to the Dha residue. This process allows for the incorporation of selective cleavages in the structural characterization of polypeptide ions. An ion/ion reaction within the mass spectrometer between a multiply protonated polypeptide and the sulfate radical anion introduces a radical site into the multiply protonated polypeptide reactant. Subsequent collisional activation of the polypeptide radical cation gives rise to radical side chain loss from one of several particular amino acid side chains (e.g., leucine, asparagine, lysine, glutamine, and glutamic acid) to yield a Dha residue. The Dha residues facilitate preferential backbone cleavages to produce signature c- and z-ions, demonstrated with cations derived from melittin, mechano growth factor (MGF), and ubiquitin. The efficiencies for radical side chain loss and for subsequent generation of specific c- and z-ions have been examined as functions of precursor ion charge state and activation conditions using cations of ubiquitin as a model for a small protein. It is noted that these efficiencies are not strongly dependent on ion trap collisional activation conditions but are sensitive to precursor ion charge state. Moderate to low charge states show the greatest overall yields for the specific Dha cleavages, whereas small molecule losses (e.g., water/ammonia) dominate at the lowest charge states and proton catalyzed amide bond cleavages that give rise to b- and y-ions tend to dominate at high charge states. [Figure not available: see fulltext.

  8. Delivery of small interfering RNA against Nogo-B receptor via tumor-acidity responsive nanoparticles for tumor vessel normalization and metastasis suppression.

    PubMed

    Wang, Bin; Ding, Yanping; Zhao, Xiaozheng; Han, Xuexiang; Yang, Na; Zhang, Yinlong; Zhao, Ying; Zhao, Xiao; Taleb, Mohammad; Miao, Qing Robert; Nie, Guangjun

    2018-08-01

    Nogo-B receptor (NgBR) plays fundamental roles in regulating angiogenesis, vascular development, and the epithelial-mesenchymal transition (EMT) of cancer cells. However, the therapeutic effect of NgBR blockade on tumor vasculature and malignancy is unknown, investigations on which requires an adequate delivery system for small interfering RNA against NgBR (NgBR siRNA). Here a surface charge switchable polymeric nanoparticle that was sensitive to the slightly acidic tumor microenvironment was developed for steady delivery of NgBR siRNA to tumor tissues. The nanoformulation was constructed by conjugating 2, 3-dimethylmaleic anhydride (DMMA) molecules to the surface amines of micelles formed by cationic co-polymer poly(lactic-co-glycolic acid) 2 -poly(ethylenimine) and subsequent absorption of NgBR siRNAs. The nanoparticles remained negatively charged in physiological condition and smartly converted to positive surface charge due to tumor-acidity-activated shedding of DMMA. The charge conversion facilitated cellular uptake of siRNAs and in turn efficiently depleted the expression of NgBR in tumor-bearing tissues. Silencing of NgBR suppressed endothelial cell migration and tubule formation, and reverted the EMT process of breast cancer cells. Delivery of the nanoformulation to mice bearing orthotopic breast carcinoma showed no effect on tumor growth, but led to remarkable decrease of distant metastasis by normalizing tumor vessels and suppressing the EMT of breast cancer cells. This study demonstrated that NgBR is a promising therapeutic target in abnormal tumor vasculature and aggressive cancer cells, and the tumor-responsive nanoparticle with the feature of charge transformation offers great potential for tumor-specific delivery of gene therapeutics. Copyright © 2018 Elsevier Ltd. All rights reserved.

  9. Formation and stability of water-soluble, molecular polyelectrolyte complexes: effects of charge density, mixing ratio, and polyelectrolyte concentration.

    PubMed

    Shovsky, Alexander; Varga, Imre; Makuska, Ricardas; Claesson, Per M

    2009-06-02

    The formation of complexes with stoichiometric (1:1) as well as nonstoichiometric (2:1) and (1:2) compositions between oppositely charged synthetic polyelectrolytes carrying strong ionic groups and significantly different molecular weights is reported in this contribution. Poly(sodium styrenesulfonate) (NaPSS) was used as polyanion, and a range of copolymers with various molar ratios of the poly(methacryloxyethyltrimethylammonium) chloride, poly(METAC), and the nonionic poly(ethylene oxide) ether methacrylate, poly(PEO45MEMA), were used as polycations. Formation and stability of PECs have been investigated by dynamic and static light scattering (LS), turbidity, and electrophoretic mobility measurements as a function of polyelectrolyte solution concentration, charge density of the cationic polyelectrolyte, and mixing ratio. The data obtained demonstrate that in the absence of PEO45 side chains the 100% charged polymer (polyMETAC) formed insoluble PECs with PSS that precipitate from solution when exact stoichiometry is achieved. In nonstoichiometric complexes (1:2) and (2:1) large colloidally stable aggregates were formed. The presence of even a relatively small amount of PEO45 side chains (25%) in the cationic copolymer was sufficient for preventing precipitation of the formed stoichiometric and nonstoichiometric complexes. These PEC's are sterically stabilized by the PEO45 chains. By further increasing the PEO45 side-chain content (50 and 75%) of the cationic copolymer, small, water-soluble molecular complexes could be formed. The data suggest that PSS molecules and the charged backbone of the cationic brush form a compact core, and with sufficiently high PEO45 chain density (above 25%) molecular complexes are formed that are stable over prolonged times.

  10. Combinatorial effects of charge characteristics and hydrophobicity of silk fibroin on the sorption and release of charged dyes.

    PubMed

    Wongpanit, Panya; Rujiravanit, Ratana

    2012-01-01

    The present study was designed to examine the influence of the charge characteristics of silk fibroin on the sorption and release of charged dyes by varying the pH values of the sorption and release media as well as types of charged dyes. Negatively charged dyes (phenol red and chromotrope 2R) and positively charged dyes (crystal violet and indoine blue) were used as the model compounds. Silk fibroin films were prepared by using a solution casting technique. The prepared films were then treated with an aqueous methanol solution or annealed with water to control their conformation. The sorption behavior of the model compounds made by the methanol-treated and water-annealed silk fibroin films was investigated. Compared to the water- annealed silk fibroin films, a higher hydrophobicity of the methanol-treated silk fibroin films caused a higher sorption of the hydrophobic dyes. The dye molecules had a fairly high affinity to the silk fibroin film, even though the dye and the matrix possessed the same charge. However, in the presence of two charged groups in a single dye molecule, the electrostatic repulsion become more dominant. Stronger interaction was observed when the charges of the film and the dye were opposite. The results of dye sorption and release experiments showed that the degree of synergism or competition between electrostatic and hydrophobic interactions directly depended on the charges and chemical structure of the dye molecules and the environmental pH conditions of the existing silk fibroin film.

  11. FT-IR, FT-Raman, NMR studies and ab initio-HF, DFT-B3LYP vibrational analysis of 4-chloro-2-fluoroaniline

    NASA Astrophysics Data System (ADS)

    Arivazhagan, M.; Anitha Rexalin, D.

    2012-10-01

    The Fourier transform infrared (FT-IR) and Fourier transform Raman (FT-Raman) spectra of 4-chloro-2-fluoroaniline (CFA) have been recorded and analyzed. The equilibrium geometry, bonding features and harmonic vibrational frequencies have been investigated with the help of ab initio and density functional theory (DFT) methods. The assignments of the vibrational spectra have been carried out with the help of normal coordinate analysis (NCA) following the scaled quantum mechanical force field methodology. The 1H and 13C nuclear magnetic resonance (NMR) chemical shifts of the molecule are calculated by the Gauge including atomic orbital (GIAO) method. The first order hyperpolarizability (β0) of this novel molecular system and related properties (β, α0 and Δα) of CFA are calculated using B3LYP/6-311++G(d,p) and HF/6-311++G(d,p) methods on the finite-field approach. The calculated results also show that the CFA molecule might have microscopic nonlinear optical (NLO) behavior with non-zero values. Stability of the molecule arising from hyper conjugative interactions, charge delocalization has been analyzed using natural bond orbital (NBO) analysis. The result confirms the occurrence of intramolecular charge transfer (ICT) within the molecule. The HOMO-LUMO energies UV-vis spectral analysis and MEP are performed by B3LYP/6-311++G(d,p) approach. A detailed interpretation of the infrared and Raman spectra of CFA is also reported based on total energy distribution (TED). The difference between the observed and scaled wave number values of the most of the fundamentals is very small.

  12. FT-IR, FT-Raman, NMR studies and ab initio-HF, DFT-B3LYP vibrational analysis of 4-chloro-2-fluoroaniline.

    PubMed

    Arivazhagan, M; Anitha Rexalin, D

    2012-10-01

    The Fourier transform infrared (FT-IR) and Fourier transform Raman (FT-Raman) spectra of 4-chloro-2-fluoroaniline (CFA) have been recorded and analyzed. The equilibrium geometry, bonding features and harmonic vibrational frequencies have been investigated with the help of ab initio and density functional theory (DFT) methods. The assignments of the vibrational spectra have been carried out with the help of normal coordinate analysis (NCA) following the scaled quantum mechanical force field methodology. The (1)H and (13)C nuclear magnetic resonance (NMR) chemical shifts of the molecule are calculated by the Gauge including atomic orbital (GIAO) method. The first order hyperpolarizability (β(0)) of this novel molecular system and related properties (β, α(0) and Δα) of CFA are calculated using B3LYP/6-311++G(d,p) and HF/6-311++G(d,p) methods on the finite-field approach. The calculated results also show that the CFA molecule might have microscopic nonlinear optical (NLO) behavior with non-zero values. Stability of the molecule arising from hyper conjugative interactions, charge delocalization has been analyzed using natural bond orbital (NBO) analysis. The result confirms the occurrence of intramolecular charge transfer (ICT) within the molecule. The HOMO-LUMO energies UV-vis spectral analysis and MEP are performed by B3LYP/6-311++G(d,p) approach. A detailed interpretation of the infrared and Raman spectra of CFA is also reported based on total energy distribution (TED). The difference between the observed and scaled wave number values of the most of the fundamentals is very small. Copyright © 2012 Elsevier B.V. All rights reserved.

  13. Solvation effects on like-charge attraction.

    PubMed

    Ghanbarian, Shahzad; Rottler, Jörg

    2013-02-28

    We present results of molecular dynamics simulations of the electrostatic interaction between two parallel charged rods in the presence of divalent counterions. Such polyelectrolytes have been considered as a simple model for understanding electrostatic interactions in highly charged biomolecules such as DNA. Since there are correlations between the free charge carriers, the phenomenon of like charge attraction appears for specific parameters. We explore the role of solvation effects and the resulting deviations from Coulomb's law on the nanoscale on this peculiar phenomenon. The behavior of the force between the charged rods in a simulation with atomistic representation of water molecules is completely different from a model in which water is modeled as a continuum dielectric. By calculating counterion-rodion pair correlation functions, we find that the presence of water molecules changes the structure of the counterion cloud and results in both qualitative and quantitative changes of the force between highly charged polyelectrolytes.

  14. EUV emission spectra in collisions of highly charged tantalum ions with nitrogen and oxygen molecules

    NASA Astrophysics Data System (ADS)

    Tanuma, Hajime; Numadate, Naoki; Uchikura, Yoshiyuki; Shimada, Kento; Akutsu, Takuto; Long, Elaine; O'Sullivan, Gerry

    2017-10-01

    We have performed ion beam collision experiments using multiply charged tantalum ions and observed EUV (extreme ultra-violet) emission spectra in collisions of ions with molecular targets, N2 and O2. Broad UTAs (un-resolved transition arrays) from multiply charged Ta ions were observed, and the mean wavelengths of the UTAs shifted and became shorter at higher charge statea of Ta ions. These UTAs may be attributed to the 4f-5d and 4f-5g transitions. Not only the UTA emission from incident ions, but also the sharp emission lines from multiply charged fragment atomic ions were observed. Production of temporary highly charged molecular ions, their kinetic energy and fragmentation processes have been investigated with coincident detection technique. However, the observation of emission from the fragments might be for the first time. The formation mechanisms of the multiply charged fragment atomic ions from target molecules are discussed.

  15. Understanding charge transport in molecular electronics.

    PubMed

    Kushmerick, J J; Pollack, S K; Yang, J C; Naciri, J; Holt, D B; Ratner, M A; Shashidhar, R

    2003-12-01

    For molecular electronics to become a viable technology the factors that control charge transport across a metal-molecule-metal junction need to be elucidated. We use an experimentally simple crossed-wire tunnel junction to interrogate how factors such as metal-molecule coupling, molecular structure, and the choice of metal electrode influence the current-voltage characteristics of a molecular junction.

  16. [Distribution of electric charges in 2 substances inducing tumor cell regression].

    PubMed

    Smeyers, Y G; Huertas, A

    1983-01-01

    The charge distribution of anti-cancer molecules 4-thiazolidine-carboxylic acid and 2-amino-2-thiazoline hydrochloride was calculated with a CNDO/2 semiempiral quantum mechanic method. The activity seems to be related with the formation of Zn2+ and Mn2+ ions. Both molecules show local isosterism, origin of their chelating properties.

  17. A simple model of solvent-induced symmetry-breaking charge transfer in excited quadrupolar molecules

    NASA Astrophysics Data System (ADS)

    Ivanov, Anatoly I.; Dereka, Bogdan; Vauthey, Eric

    2017-04-01

    A simple model has been developed to describe the symmetry-breaking of the electronic distribution of AL-D-AR type molecules in the excited state, where D is an electron donor and AL and AR are identical acceptors. The origin of this process is usually associated with the interaction between the molecule and the solvent polarization that stabilizes an asymmetric and dipolar state, with a larger charge transfer on one side than on the other. An additional symmetry-breaking mechanism involving the direct Coulomb interaction of the charges on the acceptors is proposed. At the same time, the electronic coupling between the two degenerate states, which correspond to the transferred charge being localised either on AL or AR, favours a quadrupolar excited state with equal amount of charge-transfer on both sides. Because of these counteracting effects, symmetry breaking is only feasible when the electronic coupling remains below a threshold value, which depends on the solvation energy and the Coulomb repulsion energy between the charges located on AL and AR. This model allows reproducing the solvent polarity dependence of the symmetry-breaking reported recently using time-resolved infrared spectroscopy.

  18. Nonadiabatic coupling reduces the activation energy in thermally activated delayed fluorescence.

    PubMed

    Gibson, J; Penfold, T J

    2017-03-22

    The temperature dependent rate of a thermally activated process is given by the Arrhenius equation. The exponential decrease in the rate with activation energy, which this imposes, strongly promotes processes with small activation barriers. This criterion is one of the most challenging during the design of thermally activated delayed fluorescence (TADF) emitters used in organic light emitting diodes. The small activation energy is usually achieved with donor-acceptor charge transfer complexes. However, this sacrifices the radiative rate and is therefore incommensurate with the high luminescence quantum yields required for applications. Herein we demonstrate that the spin-vibronic mechanism, operative for efficient TADF, overcomes this limitation. Nonadiabatic coupling between the lowest two triplet states give rise to a strong enhancement of the rate of reserve intersystem crossing via a second order mechanism and promotes population transfer between the T 1 to T 2 states. Consequently the rISC mechanism is actually operative between initial and final state exhibiting an energy gap that is smaller than between the T 1 and S 1 states. This contributes to the small activation energies for molecules exhibiting a large optical gap, identifies limitations of the present design procedures and provides a basis from which to construct TADF molecules with simultaneous high radiative and rISC rates.

  19. On the solvation structure of dimethylsulfoxide/water around the phosphatidylcholine head group in solution

    NASA Astrophysics Data System (ADS)

    Dabkowska, Aleksandra P.; Foglia, Fabrizia; Lawrence, M. Jayne; Lorenz, Christian D.; McLain, Sylvia E.

    2011-12-01

    The solution structure of the phosphocholine (PC) head group in 1,2-dipropionyl-sn-glycero-3-phosphocholine (C3-PC) in 30 mol. % dimethylsulfoxide (DMSO)-water solutions has been determined by using neutron diffraction enhanced with isotopic substitution in combination with computer simulation techniques. By investigating the atomic scale hydration structure around the PC head group, a unique description of the displacement of water molecules by DMSO molecules is detailed around various locations of the head group. Specifically, DMSO molecules were found to be the most prevalent around the onium portion of the head group, with the dipoles of the DMSO molecules being aligned where the negatively charged oxygen can interact strongly with the positively charged lipid group. The phosphate group is also partially dehydrated by the presence of the DMSO molecules. However, around this group the bulkier positive end of the DMSO dipole is interacting with negatively charged groups of the lipid head group, the DMSO layer shows no obvious ordering as it cannot form hydrogen bonds with the oxygen atoms in the PO4 group such as water molecules can. Interestingly, DMSO-water contacts have also increased in the presence of the lipid molecule relative to DMSO-water contacts observed in pure DMSO/water solutions at similar concentrations.

  20. Controlling molecular condensation/diffusion of copper phthalocyanine by local electric field induced with scanning tunneling microscope tip

    NASA Astrophysics Data System (ADS)

    Nagaoka, Katsumi; Yaginuma, Shin; Nakayama, Tomonobu

    2018-02-01

    We have discovered the condensation/diffusion phenomena of copper phthalocyanine (CuPc) molecules controlled with a pulsed electric field induced by the scanning tunneling microscope tip. This behavior is not explained by the conventional induced dipole model. In order to understand the mechanism, we have measured the electronic structure of the molecule by tunneling spectroscopy and also performed theoretical calculations on molecular orbitals. These data clearly indicate that the molecule is positively charged owing to charge transfer to the substrate, and that hydrogen bonding exists between CuPc molecules, which makes the molecular island stable.

  1. Surface enhanced Raman scattering of aged graphene: Effects of annealing in vacuum

    NASA Astrophysics Data System (ADS)

    Wang, Yingying; Ni, Zhenhua; Li, Aizhi; Zafar, Zainab; Zhang, Yan; Ni, Zhonghua; Qu, Shiliang; Qiu, Teng; Yu, Ting; Xiang Shen, Ze

    2011-12-01

    In this paper, we report a simple method to recover the surface enhanced Raman scattering activity of aged graphene. The Raman signals of Rhodamine molecules absorbed on aged graphene are dramatically increased after vacuum annealing and comparable to those on fresh graphene. Atomic force microscopy measurements indicate that residues on aged graphene surface can efficiently be removed by vacuum annealing, which makes target molecule closely contact with graphene. We also find that the hole doping in graphene will facilitate charge transfer between graphene and molecule. These results confirm the strong Raman enhancement of target molecule absorbed on graphene is due to the charge transfer mechanism.

  2. DFT computational analysis of piracetam.

    PubMed

    Rajesh, P; Gunasekaran, S; Seshadri, S; Gnanasambandan, T

    2014-11-11

    Density functional theory calculation with B3LYP using 6-31G(d,p) and 6-31++G(d,p) basis set have been used to determine ground state molecular geometries. The first order hyperpolarizability (β0) and related properties (β, α0 and Δα) of piracetam is calculated using B3LYP/6-31G(d,p) method on the finite-field approach. The stability of molecule has been analyzed by using NBO/NLMO analysis. The calculation of first hyperpolarizability shows that the molecule is an attractive molecule for future applications in non-linear optics. Molecular electrostatic potential (MEP) at a point in the space around a molecule gives an indication of the net electrostatic effect produced at that point by the total charge distribution of the molecule. The calculated HOMO and LUMO energies show that charge transfer occurs within these molecules. Mulliken population analysis on atomic charge is also calculated. Because of vibrational analysis, the thermodynamic properties of the title compound at different temperatures have been calculated. Finally, the UV-Vis spectra and electronic absorption properties are explained and illustrated from the frontier molecular orbitals. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. Contactless experiments on individual DNA molecules show no evidence for molecular wire behavior.

    PubMed

    Gómez-Navarro, C; Moreno-Herrero, F; de Pablo, P J; Colchero, J; Gómez-Herrero, J; Baró, A M

    2002-06-25

    A fundamental requirement for a molecule to be considered a molecular wire (MW) is the ability to transport electrical charge with a reasonably low resistance. We have carried out two experiments that measure first, the charge transfer from an electrode to the molecule, and second, the dielectric response of the MW. The latter experiment requires no contacts to either end of the molecule. From our experiments we conclude that adsorbed individual DNA molecules have a resistivity similar to mica, glass, and silicon oxide substrates. Therefore adsorbed DNA is not a conductor, and it should not be considered as a viable candidate for MW applications. Parallel studies on other nanowires, including single-walled carbon nanotubes, showed conductivity as expected.

  4. Concepts for the material development of phosphorescent organic materials processable from solution and their application in OLEDs

    NASA Astrophysics Data System (ADS)

    Janietz, S.; Krueger, H.; Thesen, M.; Salert, B.; Wedel, A.

    2014-10-01

    One example of organic electronics is the application of polymer based light emitting devices (PLEDs). PLEDs are very attractive for large area and fine-pixel displays, lighting and signage. The polymers are more amenable to solution processing by printing techniques which are favourable for low cost production in large areas. With phosphorescent emitters like Ir-complexes higher quantum efficiencies were obtained than with fluorescent systems, especially if multilayer stack systems with separated charge transport and emitting layers were applied in the case of small molecules. Polymers exhibit the ability to integrate all the active components like the hole-, electron-transport and phosphorescent molecules in only one layer. Here, the active components of a phosphorescent system - triplet emitter, hole- and electron transport molecules - can be linked as a side group to a polystyrene main chain. By varying the molecular structures of the side groups as well as the composition of the side chains with respect to the triplet emitter, hole- and electron transport structure, and by blending with suitable glass-forming, so-called small molecules, brightness, efficiency and lifetime of the produced OLEDs can be optimized. By choosing the triplet emitter, such as iridium complexes, different emission colors can be specially set. Different substituted triazine molecules were introduced as side chain into a polystyrene backbone and applied as electron transport material in PLED blend systems. The influence of alkyl chain lengths of the performance will be discussed. For an optimized blend system with a green emitting phosphorescent Ir-complex efficiencies of 60 cd/A and an lifetime improvement of 66.000 h @ 1000 cd/m2 were achieved.

  5. Single charging events on colloidal particles in a nonpolar liquid with surfactant

    NASA Astrophysics Data System (ADS)

    Schreuer, Caspar; Vandewiele, Stijn; Brans, Toon; Strubbe, Filip; Neyts, Kristiaan; Beunis, Filip

    2018-01-01

    Electrical charging of colloidal particles in nonpolar liquids due to surfactant additives is investigated intensively, motivated by its importance in a variety of applications. Most methods rely on average electrophoretic mobility measurements of many particles, which provide only indirect information on the charging mechanism. In the present work, we present a method that allows us to obtain direct information on the charging mechanism, by measuring the charge fluctuations on individual particles with a precision higher than the elementary charge using optical trapping electrophoresis. We demonstrate the capabilities of the method by studying the influence of added surfactant OLOA 11000 on the charging of single colloidal PMMA particles in dodecane. The particle charge and the frequency of charging events are investigated both below and above the critical micelle concentration (CMC) and with or without applying a DC offset voltage. It is found that at least two separate charging mechanisms are present below the critical micelle concentration. One mechanism is a process where the particle is stripped from negatively charged ionic molecules. An increase in the charging frequency with increased surfactant concentration suggests a second mechanism that involves single surfactant molecules. Above the CMC, neutral inverse micelles can also be involved in the charging process.

  6. An accurate and linear-scaling method for calculating charge-transfer excitation energies and diabatic couplings

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pavanello, Michele; Van Voorhis, Troy; Visscher, Lucas

    2013-02-07

    Quantum-mechanical methods that are both computationally fast and accurate are not yet available for electronic excitations having charge transfer character. In this work, we present a significant step forward towards this goal for those charge transfer excitations that take place between non-covalently bound molecules. In particular, we present a method that scales linearly with the number of non-covalently bound molecules in the system and is based on a two-pronged approach: The molecular electronic structure of broken-symmetry charge-localized states is obtained with the frozen density embedding formulation of subsystem density-functional theory; subsequently, in a post-SCF calculation, the full-electron Hamiltonian and overlapmore » matrix elements among the charge-localized states are evaluated with an algorithm which takes full advantage of the subsystem DFT density partitioning technique. The method is benchmarked against coupled-cluster calculations and achieves chemical accuracy for the systems considered for intermolecular separations ranging from hydrogen-bond distances to tens of Angstroms. Numerical examples are provided for molecular clusters comprised of up to 56 non-covalently bound molecules.« less

  7. An accurate and linear-scaling method for calculating charge-transfer excitation energies and diabatic couplings.

    PubMed

    Pavanello, Michele; Van Voorhis, Troy; Visscher, Lucas; Neugebauer, Johannes

    2013-02-07

    Quantum-mechanical methods that are both computationally fast and accurate are not yet available for electronic excitations having charge transfer character. In this work, we present a significant step forward towards this goal for those charge transfer excitations that take place between non-covalently bound molecules. In particular, we present a method that scales linearly with the number of non-covalently bound molecules in the system and is based on a two-pronged approach: The molecular electronic structure of broken-symmetry charge-localized states is obtained with the frozen density embedding formulation of subsystem density-functional theory; subsequently, in a post-SCF calculation, the full-electron Hamiltonian and overlap matrix elements among the charge-localized states are evaluated with an algorithm which takes full advantage of the subsystem DFT density partitioning technique. The method is benchmarked against coupled-cluster calculations and achieves chemical accuracy for the systems considered for intermolecular separations ranging from hydrogen-bond distances to tens of Ångstroms. Numerical examples are provided for molecular clusters comprised of up to 56 non-covalently bound molecules.

  8. Rapid preparative separation of monoclonal antibody charge variants using laterally-fed membrane chromatography.

    PubMed

    Sadavarte, Rahul; Madadkar, Pedram; Filipe, Carlos Dm; Ghosh, Raja

    2018-01-15

    Monoclonal antibodies undergo various forms of chemical transformation which have been shown to cause loss in efficacy and alteration in pharmacokinetic properties of these molecules. Such modified antibody molecules are known as variants. They also display physical properties such as charge that are different from intact antibody molecules. However, the difference in charge is very subtle and separation based on it is quite challenging. Charge variants are usually separated using ion-exchange column chromatography or isoelectric focusing. In this paper, we report a rapid and scalable method for fractionating monoclonal antibody charge variants, based on the use of cation exchange laterally-fed membrane chromatography (LFMC). Starting with a sample of monoclonal antibody hIgG1-CD4, three well-resolved fractions were obtained using either pH or salt gradient. These fractions were identified as acidic, neutral and basic variants. Each of these fractions contained intact heavy and light chains and so antibody fragmentation had no role in variant generation. The separation was comparable to that using column chromatography but was an order of magnitude faster. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Gas-phase geometry optimization of biological molecules as a reasonable alternative to a continuum environment description: fact, myth, or fiction?

    PubMed

    Sousa, Sérgio Filipe; Fernandes, Pedro Alexandrino; Ramos, Maria João

    2009-12-31

    Gas-phase optimization of single biological molecules and of small active-site biological models has become a standard approach in first principles computational enzymology. The important role played by the surrounding environment (solvent, enzyme, both) is normally only accounted for through higher-level single point energy calculations performed using a polarizable continuum model (PCM) and an appropriate dielectric constant with the gas-phase-optimized geometries. In this study we analyze this widely used approximation, by comparing gas-phase-optimized geometries with geometries optimized with different PCM approaches (and considering different dielectric constants) for a representative data set of 20 very important biological molecules--the 20 natural amino acids. A total of 323 chemical bonds and 469 angles present in standard amino acid residues were evaluated. The results show that the use of gas-phase-optimized geometries can in fact be quite a reasonable alternative to the use of the more computationally intensive continuum optimizations, providing a good description of bond lengths and angles for typical biological molecules, even for charged amino acids, such as Asp, Glu, Lys, and Arg. This approximation is particularly successful if the protonation state of the biological molecule could be reasonably described in vacuum, a requirement that was already necessary in first principles computational enzymology.

  10. Ligand solvation in molecular docking.

    PubMed

    Shoichet, B K; Leach, A R; Kuntz, I D

    1999-01-01

    Solvation plays an important role in ligand-protein association and has a strong impact on comparisons of binding energies for dissimilar molecules. When databases of such molecules are screened for complementarity to receptors of known structure, as often occurs in structure-based inhibitor discovery, failure to consider ligand solvation often leads to putative ligands that are too highly charged or too large. To correct for the different charge states and sizes of the ligands, we calculated electrostatic and non-polar solvation free energies for molecules in a widely used molecular database, the Available Chemicals Directory (ACD). A modified Born equation treatment was used to calculate the electrostatic component of ligand solvation. The non-polar component of ligand solvation was calculated based on the surface area of the ligand and parameters derived from the hydration energies of apolar ligands. These solvation energies were subtracted from the ligand-receptor interaction energies. We tested the usefulness of these corrections by screening the ACD for molecules that complemented three proteins of known structure, using a molecular docking program. Correcting for ligand solvation improved the rankings of known ligands and discriminated against molecules with inappropriate charge states and sizes.

  11. Tuning Charge and Correlation Effects for a Single Molecule on a Graphene Device

    NASA Astrophysics Data System (ADS)

    Tsai, Hsin-Zon; Wickenburg, Sebastian; Lu, Jiong; Lischner, Johannes; Omrani, Arash A.; Riss, Alexander; Karrasch, Christoph; Jung, Han Sae; Khajeh, Ramin; Wong, Dillon; Watanabe, Kenji; Taniguchi, Takashi; Zettl, Alex; Louie, Steven G.; Crommie, Michael F.

    Controlling electronic devices down to the single molecule level is a grand challenge of nanotechnology. Single-molecules have been integrated into devices capable of tuning electronic response, but a drawback for these systems is that their microscopic structure remains unknown due to inability to image molecules in the junction region. Here we present a combined STM and nc-AFM study demonstrating gate-tunable control of the charge state of individual F4TCNQ molecules at the surface of a graphene field effect transistor. This is different from previous studies in that the Fermi level of the substrate was continuously tuned across the molecular orbital energy level. Using STS we have determined the resulting energy level evolution of the LUMO, its associated vibronic modes, and the graphene Dirac point (ED). We show that the energy difference between ED and the LUMO increases as EF is moved away from ED due to electron-electron interactions that renormalize the molecular quasiparticle energy. This is attributed to gate-tunable image-charge screening in graphene and corroborated by ab initio calculations.

  12. Charge-controlled switchable CO adsorption on FeN4 cluster embedded in graphene

    NASA Astrophysics Data System (ADS)

    Omidvar, Akbar

    2018-02-01

    Electrical charging of an FeN4 cluster embedded in graphene (FeN4G) is proposed as an approach for electrocatalytically switchable carbon monoxide (CO) adsorption. Using density functional theory (DFT), we found that the CO molecule is strongly adsorbed on the uncharged FeN4G cluster. Our results show that the adsorption energy of a CO molecule on the FeN4G cluster is dramatically decreased by introducing extra electrons into the cluster. Once the charges are removed, the CO molecule is spontaneously adsorbed on the FeN4G absorbent. In the framework of frontier molecular orbital (FMO) analysis, the enhanced sensitivity and reactivity of the FeN4G cluster towards the CO molecule can be interpreted in terms of interaction between the HOMO of CO molecule and the LUMO of FeN4G cluster. Therefore, this approach promises both facile reversibility and tunable kinetics without the need of specific catalysts. Our study indicates that the FeN4G nanomaterial is an excellent absorbent for controllable and reversible capture and release of the CO.

  13. Nonlinear nonlocal infrared plasmonic arrays for pump-probe studies on protein monolayers

    NASA Astrophysics Data System (ADS)

    Erramilli, Shyamsunder; Adato, Ronen; Gabel, Alan; Yanik, Ahmet Ali; Altug, Hatice; Hong, Mi K.

    2010-03-01

    Infrared spectroscopy is an exquisite bond-specific tool for studying biomolecules with characteristic vibrational normal modes that serve as a molecular ``fingerprint''. Intrinsic absorption cross-sections for proteins are significant (˜10-19 -10-21 cm^2), although small compared to label-based fluorescence methods. We have shown that carefully designed plasmonic nanoantenna arrays can enhance the vibrational signatures by ˜ 10^5 (Adato et al, Proc Natl Acad Sci USA, 2009). Theoretical modeling combined with polarized FTIR-microscopy show that enhancement is due both to localized effects and nonlocal collective effects, governed by the dielectric properties of silicon and gold nanoantennae, coupled to protein molecules. The resonance properties can be modulated by photoinduced excitation of charge carriers and excitons, causing both a shift in the resonance frequency and a change in the enhancement factor. An ultrafast visible pump laser can then be used to extend visible pump-infrared probe studies to protein molecules even when the molecules lack a chromophore. This provides a toolkit for biophysical studies in which the nonlinear, nonlocal interaction between a 35-fs visible or near-infrared laser and the designed plasmonic nanoantenna arrays are used to study dynamics of protein molecules.

  14. Effect of pH buffer molecules on the light-induced currents from oriented purple membrane.

    PubMed Central

    Liu, S Y; Kono, M; Ebrey, T G

    1991-01-01

    The effect of pH buffers on the microsecond photocurrent component, B2, of oriented purple membranes has been studied. We found that under low salt conditions (less than 10 mM monovalent cationic salt) pH buffers can dramatically alter the waveform of the B2 component. The effect is induced by the protonation process of the buffer molecules by protons expelled from the membrane. These effects can be classified according to the charge transition upon protonation of the buffer. Buffers that carry two positive charges in their protonated form add a negative current component (N component) to B2. Almost all of the other buffers add a positive current component (P component) to B2, which is essentially a mirror image of the N component. Buffers with a pK less than 5.5 have only a small positive buffer component. The pH dependence of the buffer effect is closely related to the pK of the buffer; it requires that the buffer be in its unprotonated form. The rise time of the buffer component increases with the concentration of the buffer molecules. All the buffer effects can be inhibited by the addition of 5 mM of a divalent cation such as Ca2+. Reducing the surface potential slows down the N component but accelerates the P component without affecting the amplitude of the buffer effect significantly. Many of the buffer effects can be explained if we assume that upon protonation of the buffer by a proton expelled from the membrane by light, the buffer molecules move toward the membrane. This backward movement of buffer molecules forms a counter current very similar to that due to cations discussed in Liu, S. Y., R. Govindjee, and T. G. Ebrey. (1990. Biophys. J. 57:951-963). PMID:1883939

  15. Advances in structure elucidation of small molecules using mass spectrometry

    PubMed Central

    Fiehn, Oliver

    2010-01-01

    The structural elucidation of small molecules using mass spectrometry plays an important role in modern life sciences and bioanalytical approaches. This review covers different soft and hard ionization techniques and figures of merit for modern mass spectrometers, such as mass resolving power, mass accuracy, isotopic abundance accuracy, accurate mass multiple-stage MS(n) capability, as well as hybrid mass spectrometric and orthogonal chromatographic approaches. The latter part discusses mass spectral data handling strategies, which includes background and noise subtraction, adduct formation and detection, charge state determination, accurate mass measurements, elemental composition determinations, and complex data-dependent setups with ion maps and ion trees. The importance of mass spectral library search algorithms for tandem mass spectra and multiple-stage MS(n) mass spectra as well as mass spectral tree libraries that combine multiple-stage mass spectra are outlined. The successive chapter discusses mass spectral fragmentation pathways, biotransformation reactions and drug metabolism studies, the mass spectral simulation and generation of in silico mass spectra, expert systems for mass spectral interpretation, and the use of computational chemistry to explain gas-phase phenomena. A single chapter discusses data handling for hyphenated approaches including mass spectral deconvolution for clean mass spectra, cheminformatics approaches and structure retention relationships, and retention index predictions for gas and liquid chromatography. The last section reviews the current state of electronic data sharing of mass spectra and discusses the importance of software development for the advancement of structure elucidation of small molecules. Electronic supplementary material The online version of this article (doi:10.1007/s12566-010-0015-9) contains supplementary material, which is available to authorized users. PMID:21289855

  16. Comprehensive quantitative analysis of Chinese patent drug YinHuang drop pill by ultra high-performance liquid chromatography quadrupole time of flight mass spectrometry.

    PubMed

    Wong, Tin-Long; An, Ya-Qi; Yan, Bing-Chao; Yue, Rui-Qi; Zhang, Tian-Bo; Ho, Hing-Man; Ren, Tian-Jing; Fung, Hau-Yee; Ma, Dik-Lung; Leung, Chung-Hang; Liu, Zhong-Liang; Pu, Jian-Xin; Han, Quan-Bin; Sun, Han-Dong

    2016-06-05

    YinHuang drop pill (YHDP) is a new preparation, derived from the traditional YinHuang (YH) decoction. Since drop pills are one of the newly developed forms of Chinese patent drugs, not much research has been done regarding the quality and efficacy. This study aims to establish a comprehensive quantitative analysis of the chemical profile of YHDP. ultra high-performance liquid chromatography quadrupole time of flight mass spectrometry (UHPLC-Q-TOF-MS/MS) was used to identify 34 non-sugar small molecules including 15 flavonoids, 9 phenolic acids, 5 saponins, 1 iridoid, and 4 iridoid glycosides in YHDP samples, and 26 of them were quantitatively determined. Sugar composition of YHDP in terms of fructose, glucose and sucrose was examined via a high performance liquid chromatography-evaporative light scattering detector on an amide column (HPLC-NH2P-ELSD). Macromolecules were examined by high performance gel permeation chromatography coupled with ELSD (HPGPC-ELSD). The content of the drop pill's skeleton component PEG-4000 was also quantified via ultra-high performance liquid chromatography coupled with charged aerosol detector (UHPLC-CAD). The results showed that up to 73% (w/w) of YHDP could be quantitatively determined. Small molecules accounted for approximately 5%, PEG-4000 represented 68%, while no sugars or macromolecules were found. Furthermore, YHDP showed no significant differences in terms of daily dosage, compared to YinHuang granules and YinHuang oral liquid; however, it has a higher small molecules content compared to YinHuang lozenge. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. Enhanced Mitochondrial DNA Repair of the Common Disease-Associated Variant, Ser326Cys, of hOGG1 through Small Molecule Intervention.

    PubMed

    Baptiste, Beverly A; Katchur, Steven R; Fivenson, Elayne M; Croteau, Deborah L; Rumsey, William L; Bohr, Vilhelm A

    2018-06-04

    The common oxidatively generated lesion, 8-oxo-7,8-dihydroguanine (8-oxoGua), is removed from DNA by base excision repair. The glycosylase primarily charged with recognition and removal of this lesion is 8-oxoGuaDNA glycosylase 1 (OGG1). When left unrepaired, 8-oxodG alters transcription and is mutagenic. Individuals homozygous for the less active OGG1 allele, Ser326Cys, have increased risk of several cancers. Here, small molecule enhancers of OGG1 were identified and tested for their ability to stimulate DNA repair and protect cells from the environmental hazard paraquat (PQ). PQ-induced mtDNA damage was inversely proportional to the levels of OGG1 expression whereas stimulation of OGG1, in some cases, entirely abolished its cellular effects. The PQ-mediated decline of mitochondrial membrane potential or nuclear condensation were prevented by the OGG1 activators. In addition, in Ogg1 -/- mouse embryonic fibroblasts complemented with hOGG1 S326C , there was increased cellular and mitochondrial reactive oxygen species compared to their wild type counterparts. Mitochondrial extracts from cells expressing hOGG1 S326C were deficient in mitochondrial 8-oxodG incision activity, which was rescued by the OGG1 activators. These data demonstrate that small molecules can stimulate OGG1 activity with consequent cellular protection. Thus, OGG1-activating compounds may be useful in select humans to mitigate the deleterious effects of environmental oxidants and mutagens. Copyright © 2018 Elsevier Inc. All rights reserved.

  18. Ultrasmall visible-to-near-infrared emitting silver-sulfide quantum dots for cancer detection and imaging

    NASA Astrophysics Data System (ADS)

    Tang, Rui; Xu, Baogang; Shen, Duanwen; Sudlow, Gail; Achilefu, Samuel

    2018-02-01

    The large size of many near infrared (NIR) fluorescent nanoparticles prevents rapid extravasation from blood vessels and subsequent diffusion to tumors. This confines in vivo uptake to the peritumoral space and results in high liver retention. We developed a viscosity modulated approach to synthesize ultrasmall silver sulfide quantum dots (QDs) with distinct tunable light emission from visible to near-infrared in spectrum and a QD core diameter between less than 5 nm. Further functionalization of these Ag2S QDs with different type of molecules such as targeting peptides, retains monodisperse, relatively small water soluble QDs without loss of the functionality of the peptide's high binding affinity to cancerous tumor. Fluorescence and electron microscopy showed that selective integrin-mediated internalization was observed only in cancer cells treated with the peptide-labeled QDs, demonstrating that the unlabeled hydrophilic nanoparticles exhibit characteristics of negatively charged fluorescent dye molecules, which typically do not internalize in cells. The biodistribution profiles of intravenously administered QDs in different mouse models of cancer reveal an exceptionally high tumor-to-liver uptake ratio, suggesting that the small sized QDs evaded conventional opsonization and subsequent high uptake in the liver and spleen. The seamless tunability of the QDs over a wide spectral range with only a small increase in size, as well as the ease of labeling the bright and non-cytotoxic QDs with biomolecules, provides a platform for multiplexing information, tracking the trafficking of single molecules in cells, and selectively targeting disease biomarkers in living organisms without premature QD opsonization in circulating blood.

  19. On the influence of singlet oxygen molecules on characteristics of HCCI combustion: A numerical study

    NASA Astrophysics Data System (ADS)

    Starik, A. M.; Kozlov, V. E.; Titova, N. S.

    2013-08-01

    Mechanisms of homogeneous charge compression ignition (HCCI) combustion enhancement are investigated numerically when excited O2(a 1Δg) molecules are produced at different points in the compression stroke. The analysis is conducted with the use of an extended kinetic model involving the submechanism of nitric oxide formation in the presence of singlet oxygen O2(a 1Δg) or O2(b 1Σg +) molecules in the methane-air mixture. It is demonstrated that the abundance of excited O2(a 1Δg) molecules in the mixture even in a small amounts intensifies the ignition and combustion and allows one to control the ignition event in the HCCI engine. Such a method of energy supply in the HCCI engine is much more effective in advancement of combustion timing than mere heating of the mixture, because it leads to acceleration of the chain-branching mechanism. The excitation of O2 molecules to the a 1Δg electronic state makes it possible to organise the successful combustion in the cylinder at diminished initial temperature of the mixture and increase the effective energy released during HCCI combustion. The advance in the value of this energy is much higher than the energy needed for the excitation of oxygen molecules. Moreover, in this case, the output concentration of NO and CO can be reduced significantly.

  20. Control of microtubule trajectory within an electric field by altering surface charge density

    PubMed Central

    Isozaki, Naoto; Ando, Suguru; Nakahara, Tasuku; Shintaku, Hirofumi; Kotera, Hidetoshi; Meyhöfer, Edgar; Yokokawa, Ryuji

    2015-01-01

    One of challenges for using microtubules (MTs) driven by kinesin motors in microfluidic environments is to control their direction of movement. Although applying physical biases to rectify MTs is prevalent, it has not been established as a design methodology in conjunction with microfluidic devices. In the future, the methodology is expected to achieve functional motor-driven nanosystems. Here, we propose a method to guide kinesin-propelled MTs in multiple directions under an electric field by designing a charged surface of MT minus ends labeled with dsDNA via a streptavidin-biotin interaction. MTs labeled with 20-bp or 50-bp dsDNA molecules showed significantly different trajectories according to the DNA length, which were in good agreement with values predicted from electrophoretic mobilities measured for their minus ends. Since the effective charge of labeled DNA molecules was equal to that of freely dispersed DNA molecules in a buffer solution, MT trajectory could be estimated by selecting labeling molecules with known charges. Moreover, the estimated trajectory enables to define geometrical sizes of a microfluidic device. This rational molecular design and prediction methodology allows MTs to be guided in multiple directions, demonstrating the feasibility of using molecular sorters driven by motor proteins. PMID:25567007

  1. Control of microtubule trajectory within an electric field by altering surface charge density.

    PubMed

    Isozaki, Naoto; Ando, Suguru; Nakahara, Tasuku; Shintaku, Hirofumi; Kotera, Hidetoshi; Meyhöfer, Edgar; Yokokawa, Ryuji

    2015-01-08

    One of challenges for using microtubules (MTs) driven by kinesin motors in microfluidic environments is to control their direction of movement. Although applying physical biases to rectify MTs is prevalent, it has not been established as a design methodology in conjunction with microfluidic devices. In the future, the methodology is expected to achieve functional motor-driven nanosystems. Here, we propose a method to guide kinesin-propelled MTs in multiple directions under an electric field by designing a charged surface of MT minus ends labeled with dsDNA via a streptavidin-biotin interaction. MTs labeled with 20-bp or 50-bp dsDNA molecules showed significantly different trajectories according to the DNA length, which were in good agreement with values predicted from electrophoretic mobilities measured for their minus ends. Since the effective charge of labeled DNA molecules was equal to that of freely dispersed DNA molecules in a buffer solution, MT trajectory could be estimated by selecting labeling molecules with known charges. Moreover, the estimated trajectory enables to define geometrical sizes of a microfluidic device. This rational molecular design and prediction methodology allows MTs to be guided in multiple directions, demonstrating the feasibility of using molecular sorters driven by motor proteins.

  2. Controlling the orbital sequence in individual Cu-phthalocyanine molecules.

    PubMed

    Uhlmann, C; Swart, I; Repp, J

    2013-02-13

    We report on the controlled change of the energetic ordering of molecular orbitals. Negatively charged copper(II)phthalocyanine on NaCl/Cu(100) undergoes a Jahn-Teller distortion that lifts the degeneracy of two frontier orbitals. The energetic order of the levels can be controlled by Au and Ag atoms in the vicinity of the molecule. As only one of the states is occupied, the control of the energetic order is accompanied by bistable changes of the charge distribution inside the molecule, rendering it a bistable switch.

  3. Contact and Length Dependent Effects in Single-Molecule Electronics

    NASA Astrophysics Data System (ADS)

    Hines, Thomas

    Understanding charge transport in single molecules covalently bonded to electrodes is a fundamental goal in the field of molecular electronics. In the past decade, it has become possible to measure charge transport on the single-molecule level using the STM break junction method. Measurements on the single-molecule level shed light on charge transport phenomena which would otherwise be obfuscated by ensemble measurements of groups of molecules. This thesis will discuss three projects carried out using STM break junction. In the first project, the transition between two different charge transport mechanisms is reported in a set of molecular wires. The shortest wires show highly length dependent and temperature invariant conductance behavior, whereas the longer wires show weakly length dependent and temperature dependent behavior. This trend is consistent with a model whereby conduction occurs by coherent tunneling in the shortest wires and by incoherent hopping in the longer wires. Measurements are supported with calculations and the evolution of the molecular junction during the pulling process is investigated. The second project reports controlling the formation of single-molecule junctions by means of electrochemically reducing two axial-diazonium terminal groups on a molecule, thereby producing direct Au-C covalent bonds in-situ between the molecule and gold electrodes. Step length analysis shows that the molecular junction is significantly more stable, and can be pulled over a longer distance than a comparable junction created with amine anchoring bonds. The stability of the junction is explained by the calculated lower binding energy associated with the direct Au-C bond compared with the Au-N bond. Finally, the third project investigates the role that molecular conformation plays in the conductance of oligothiophene single-molecule junctions. Ethyl substituted oligothiophenes were measured and found to exhibit temperature dependent conductance and transition voltage for molecules with between two and six repeat units. While the molecule with only one repeat unit shows temperature invariant behavior. Density functional theory calculations show that at higher temperatures the oligomers with multiple repeat units assume a more planar conformation, which increases the conjugation length and decreases the effective energy barrier of the junction.

  4. Recent advances in the structure elucidation of small organic molecules by the LSD software.

    PubMed

    Plainchont, Bertrand; de Paulo Emerenciano, Vicente; Nuzillard, Jean-Marc

    2013-08-01

    The LSD software proposes the structures of small organic molecules that fit with structural constraints from 1D and 2D NMR spectroscopy. Its initial design introduced limits that needed to be eliminated to extend its scope and help its users choose the most likely structure among those proposed. The LSD software code has been improved, so that it recognizes a wider set of atom types to build molecules. More flexibility has been given in the interpretation of 2D NMR data, including the automatic detection of very long-range correlations. A program named pyLSD was written to deal with problems in which atom types are ambiguously defined. It also provides a (13)C NMR chemical shift-based solution ranking algorithm. PyLSD was able to propose the correct structure of hexacyclinol, a natural product whose structure determination has been highly controversal. The solution was ranked first within a list of ten structures that were produced by pyLSD from the literature NMR data. The structure of an aporphin natural product was determined by pyLSD, taking advantage of the possibility of handling electrically charged atoms. The structure generation of the insect antifeedant azadirachtin by LSD was reinvestigated by pyLSD, considering that three (13)C resonances did not lead to univocal hybridization states. Copyright © 2013 John Wiley & Sons, Ltd.

  5. SERS of semiconducting nanoparticles (TiO{sub 2} hybrid composites).

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Musumeci, A.; Gosztola, D.; Schiller, T.

    Raman scattering of molecules adsorbed on the surface of TiO{sub 2} nanoparticles was investigated. We find strong enhancement of Raman scattering in hybrid composites that exhibit charge transfer absorption with TiO{sub 2} nanoparticles. An enhancement factor up to {approx}10{sup 3} was observed in the solutions containing TiO{sub 2} nanoparticles and biomolecules, including the important class of neurotransmitters such as dopamine and dopac (3,4-dihydroxy-phenylacetic acid). Only selected vibrations are enhanced, indicating molecular specificity due to distinct binding and orientation of the biomolecules coupled to the TiO{sub 2} surface. All enhanced modes are associated with the asymmetric vibrations of attached molecules thatmore » lower the symmetry of the charge transfer complex. The intensity and the energy of selected vibrations are dependent on the size and shape of nanoparticle support. Moreover, we show that localization of the charge in quantized nanoparticles (2 nm), demonstrated as the blue shift of particle absorption, diminishes SERS enhancement. Importantly, the smallest concentration of adsorbed molecules shows the largest Raman enhancements suggesting the possibility for high sensitivity of this system in the detection of biomolecules that form a charge transfer complex with metal oxide nanoparticles. The wavelength-dependent properties of a hybrid composite suggest a Raman resonant state. Adsorbed molecules that do not show a charge transfer complex show weak enhancements probably due to the dielectric cavity effect.« less

  6. SERS of semiconducting nanoparticles (TIO{sub 2} hybrid composites).

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rajh, T.; Musumeci, A.; Gosztola, D.

    Raman scattering of molecules adsorbed on the surface of TiO{sub 2} nanoparticles was investigated. We find strong enhancement of Raman scattering in hybrid composites that exhibit charge transfer absorption with TiO{sub 2} nanoparticles. An enhancement factor up to {approx}10{sup 3} was observed in the solutions containing TiO{sub 2} nanoparticles and biomolecules, including the important class of neurotransmitters such as dopamine and dopac (3,4-dihydroxy-phenylacetic acid). Only selected vibrations are enhanced, indicating molecular specificity due to distinct binding and orientation of the biomolecules coupled to the TiO{sub 2} surface. All enhanced modes are associated with the asymmetric vibrations of attached molecules thatmore » lower the symmetry of the charge transfer complex. The intensity and the energy of selected vibrations are dependent on the size and shape of nanoparticle support. Moreover, we show that localization of the charge in quantized nanoparticles (2 nm), demonstrated as the blue shift of particle absorption, diminishes SERS enhancement. Importantly, the smallest concentration of adsorbed molecules shows the largest Raman enhancements suggesting the possibility for high sensitivity of this system in the detection of biomolecules that form a charge transfer complex with metal oxide nanoparticles. The wavelength-dependent properties of a hybrid composite suggest a Raman resonant state. Adsorbed molecules that do not show a charge transfer complex show weak enhancements probably due to the dielectric cavity effect.« less

  7. Atomic charge transfer-counter polarization effects determine infrared CH intensities of hydrocarbons: a quantum theory of atoms in molecules model.

    PubMed

    Silva, Arnaldo F; Richter, Wagner E; Meneses, Helen G C; Bruns, Roy E

    2014-11-14

    Atomic charge transfer-counter polarization effects determine most of the infrared fundamental CH intensities of simple hydrocarbons, methane, ethylene, ethane, propyne, cyclopropane and allene. The quantum theory of atoms in molecules/charge-charge flux-dipole flux model predicted the values of 30 CH intensities ranging from 0 to 123 km mol(-1) with a root mean square (rms) error of only 4.2 km mol(-1) without including a specific equilibrium atomic charge term. Sums of the contributions from terms involving charge flux and/or dipole flux averaged 20.3 km mol(-1), about ten times larger than the average charge contribution of 2.0 km mol(-1). The only notable exceptions are the CH stretching and bending intensities of acetylene and two of the propyne vibrations for hydrogens bound to sp hybridized carbon atoms. Calculations were carried out at four quantum levels, MP2/6-311++G(3d,3p), MP2/cc-pVTZ, QCISD/6-311++G(3d,3p) and QCISD/cc-pVTZ. The results calculated at the QCISD level are the most accurate among the four with root mean square errors of 4.7 and 5.0 km mol(-1) for the 6-311++G(3d,3p) and cc-pVTZ basis sets. These values are close to the estimated aggregate experimental error of the hydrocarbon intensities, 4.0 km mol(-1). The atomic charge transfer-counter polarization effect is much larger than the charge effect for the results of all four quantum levels. Charge transfer-counter polarization effects are expected to also be important in vibrations of more polar molecules for which equilibrium charge contributions can be large.

  8. A rotation-translation invariant molecular descriptor of partial charges and its use in ligand-based virtual screening

    PubMed Central

    2014-01-01

    Background Measures of similarity for chemical molecules have been developed since the dawn of chemoinformatics. Molecular similarity has been measured by a variety of methods including molecular descriptor based similarity, common molecular fragments, graph matching and 3D methods such as shape matching. Similarity measures are widespread in practice and have proven to be useful in drug discovery. Because of our interest in electrostatics and high throughput ligand-based virtual screening, we sought to exploit the information contained in atomic coordinates and partial charges of a molecule. Results A new molecular descriptor based on partial charges is proposed. It uses the autocorrelation function and linear binning to encode all atoms of a molecule into two rotation-translation invariant vectors. Combined with a scoring function, the descriptor allows to rank-order a database of compounds versus a query molecule. The proposed implementation is called ACPC (AutoCorrelation of Partial Charges) and released in open source. Extensive retrospective ligand-based virtual screening experiments were performed and other methods were compared with in order to validate the method and associated protocol. Conclusions While it is a simple method, it performed remarkably well in experiments. At an average speed of 1649 molecules per second, it reached an average median area under the curve of 0.81 on 40 different targets; hence validating the proposed protocol and implementation. PMID:24887178

  9. Time-dependent transition density matrix for visualizing charge-transfer excitations in photoexcited organic donor-acceptor systems

    NASA Astrophysics Data System (ADS)

    Li, Yonghui; Ullrich, Carsten

    2013-03-01

    The time-dependent transition density matrix (TDM) is a useful tool to visualize and interpret the induced charges and electron-hole coherences of excitonic processes in large molecules. Combined with time-dependent density functional theory on a real-space grid (as implemented in the octopus code), the TDM is a computationally viable visualization tool for optical excitation processes in molecules. It provides real-time maps of particles and holes which gives information on excitations, in particular those that have charge-transfer character, that cannot be obtained from the density alone. Some illustration of the TDM and comparison with standard density difference plots will be shown for photoexcited organic donor-acceptor molecules. This work is supported by NSF Grant DMR-1005651

  10. Current at Metal-Organic Interfaces

    NASA Astrophysics Data System (ADS)

    Kern, Klaus

    2012-02-01

    Charge transport through atomic and molecular constrictions greatly affects the operation and performance of organic electronic devices. Much of our understanding of the charge injection and extraction processes in these systems relays on our knowledge of the electronic structure at the metal-organic interface. Despite significant experimental and theoretical advances in studying charge transport in nanoscale junctions, a microscopic understanding at the single atom/molecule level is missing. In the present talk I will present our recent results to probe directly the nanocontact between single molecules and a metal electrode using scanning probe microscopy and spectroscopy. The experiments provide unprecedented microscopic details of single molecule and atom junctions and open new avenues to study quantum critical and many body phenomena at the atomic scale. Implications for energy conversion devices and carbon based nanoelectronics will also be discussed.

  11. A Simple Picaxe Microcontroller Pulse Source for Juxtacellular Neuronal Labelling.

    PubMed

    Verberne, Anthony J M

    2016-10-19

    Juxtacellular neuronal labelling is a method which allows neurophysiologists to fill physiologically-identified neurons with small positively-charged marker molecules. Labelled neurons are identified by histochemical processing of brain sections along with immunohistochemical identification of neuropeptides, neurotransmitters, neurotransmitter transporters or biosynthetic enzymes. A microcontroller-based pulser circuit and associated BASIC software script is described for incorporation into the design of a commercially-available intracellular electrometer for use in juxtacellular neuronal labelling. Printed circuit board construction has been used for reliability and reproducibility. The current design obviates the need for a separate digital pulse source and simplifies the juxtacellular neuronal labelling procedure.

  12. Structure and interactions of human respiratory mucin

    NASA Astrophysics Data System (ADS)

    Purdy, Kirstin; Sheehan, John; Rubinstein, Michael; Wong, Gerard

    2006-03-01

    Human respiratory mucin plays a crucial role in the pathology of Cystic Fibrosis lung infections. Mucin is a flexible, linear polyelectrolyte, characterized by its many charged oligo-carbohydrate side chains that give it its bottle-brush structure. The macroscopic properties of a mucin suspension are known to change drastically with changes in ion concentration and solution pH, but little is known about the effect of these variables on individual mucin structure. We present preliminary results on the structural response of individual human respiratory mucin molecules to variations in concentration of ions of different valences via small angle x-ray diffraction.

  13. Mesoporous gold sponges: electric charge-assisted seed mediated synthesis and application as surface-enhanced Raman scattering substrates

    NASA Astrophysics Data System (ADS)

    Yi, Zao; Luo, Jiangshan; Tan, Xiulan; Yi, Yong; Yao, Weitang; Kang, Xiaoli; Ye, Xin; Zhu, Wenkun; Duan, Tao; Yi, Yougen; Tang, Yongjian

    2015-11-01

    Mesoporous gold sponges were prepared using 4-dimethylaminopyridine (DMAP)-stabilized Au seeds. This is a general process, which involves a simple template-free method, room temperature reduction of HAuCl4·4H2O with hydroxylamine. The formation process of mesoporous gold sponges could be accounted for the electrostatic interaction (the small Au nanoparticles (~3 nm) and the positively charged DMAP-stabilized Au seeds) and Ostwald ripening process. The mesoporous gold sponges had appeared to undergo electrostatic adsorption initially, sequentially linear aggregation, welding and Ostwald ripening, then, they randomly cross link into self-supporting, three-dimensional networks with time. The mesoporous gold sponges exhibit higher surface area than the literature. In addition, application of the spongelike networks as an active material for surface-enhanced Raman scattering has been investigated by employing 4-aminothiophenol (4-ATP) molecules as a probe.

  14. First-Principle Characterization for Singlet Fission Couplings.

    PubMed

    Yang, Chou-Hsun; Hsu, Chao-Ping

    2015-05-21

    The electronic coupling for singlet fission, an important parameter for determining the rate, has been found to be too small unless charge-transfer (CT) components were introduced in the diabatic states, mostly through perturbation or a model Hamiltonian. In the present work, the fragment spin difference (FSD) scheme was generalized to calculate the singlet fission coupling. The largest coupling strength obtained was 14.8 meV for two pentacenes in a crystal structure, or 33.7 meV for a transition-state structure, which yielded a singlet fission lifetime of 239 or 37 fs, generally consistent with experimental results (80 fs). Test results with other polyacene molecules are similar. We found that the charge on one fragment in the S1 diabatic state correlates well with FSD coupling, indicating the importance of the CT component. The FSD approach is a useful first-principle method for singlet fission coupling, without the need to include the CT component explicitly.

  15. Modifications in nanoparticle-protein interactions by varying the protein conformation

    NASA Astrophysics Data System (ADS)

    Kumar, Sugam; Yadav, I.; Aswal, V. K.; Kohlbrecher, J.

    2017-05-01

    Small-angle neutron scattering has been used to study the interaction of silica nanoparticle with Bovine Serum Albumin (BSA) protein without and with a protein denaturing agent urea. The measurements have been carried out at pH 7 where both the components (nanoparticle and protein) are similarly charged. We show that the interactions in nanoparticle-protein system can be modified by changing the conformation of protein through the presence of urea. In the absence of urea, the strong electrostatic repulsion between the nanoparticle and protein prevents protein adsorption on nanoparticle surface. This non-adsorption, in turn gives rise to depletion attraction between nanoparticles. However, with addition of urea the depletion attraction is completely suppressed. Urea driven denaturation of protein is utilized to expose the positively charged patched of the BSA molecules which eventually leads to adsorption of BSA on nanoparticles eliminating the depletion interaction.

  16. Mesoporous gold sponges: electric charge-assisted seed mediated synthesis and application as surface-enhanced Raman scattering substrates

    PubMed Central

    Yi, Zao; Luo, Jiangshan; Tan, Xiulan; Yi, Yong; Yao, Weitang; Kang, Xiaoli; Ye, Xin; Zhu, Wenkun; Duan, Tao; Yi, Yougen; Tang, Yongjian

    2015-01-01

    Mesoporous gold sponges were prepared using 4-dimethylaminopyridine (DMAP)-stabilized Au seeds. This is a general process, which involves a simple template-free method, room temperature reduction of HAuCl4·4H2O with hydroxylamine. The formation process of mesoporous gold sponges could be accounted for the electrostatic interaction (the small Au nanoparticles (~3 nm) and the positively charged DMAP-stabilized Au seeds) and Ostwald ripening process. The mesoporous gold sponges had appeared to undergo electrostatic adsorption initially, sequentially linear aggregation, welding and Ostwald ripening, then, they randomly cross link into self-supporting, three-dimensional networks with time. The mesoporous gold sponges exhibit higher surface area than the literature. In addition, application of the spongelike networks as an active material for surface-enhanced Raman scattering has been investigated by employing 4-aminothiophenol (4-ATP) molecules as a probe. PMID:26538365

  17. Vibrational spectroscopic investigation and normal coordinate analysis of the fibrate hypolipidemic agent 5-(2,5-dimethylphenoxy)-2,2-dimethyl pentanoic acid (Gemfibrozil)

    NASA Astrophysics Data System (ADS)

    Priya, M. Siva; Benitta, T. Asenath; James, C.

    2011-03-01

    Colorless crystals of 5-(2,5-dimethylphenoxy)-2,2-dimethyl pentanoic acid were grown by slow evaporation method and the FT-IR and FT-Raman spectra of the sample were recorded in the region 4000-450 cm -1 and 4000-50 cm -1 respectively. Molecular structure is optimized with the help of B3LYP/6-31G (d) density functional theory method. Stability of the molecule arising from hyperconjugation and charge delocalization is confirmed by the natural bond orbital analysis (NBO). The results show that electron density (ED) in the σ ∗ antibonding orbitals and E (2) energies confirms the occurrence of intra-molecular charge transfer (ICT) within the molecule. The assignments of the vibrational spectra have been carried out with the help of Normal coordinate analysis following the scaled quantum mechanical force field (SQMFF) methodology. Mulliken population analysis on atomic charges is also calculated. The calculated HOMO and LUMO energy gap shows that charge transfer occurs within the molecule.

  18. Pnicogen bonded complexes of PO2X (X = F, Cl) with nitrogen bases.

    PubMed

    Alkorta, Ibon; Elguero, José; Del Bene, Janet E

    2013-10-10

    An ab initio MP2/aug'-cc-pVTZ study has been carried out on complexes formed between PO2X (X = F and Cl) as the Lewis acids and a series of nitrogen bases ZN, including NH3, H2C═NH, NH2F, NP, NCH, NCF, NF3, and N2. Binding energies of these complexes vary from -10 to -150 kJ/mol, and P-N distances from 1.88 to 2.72 Å. Complexes ZN:PO2F have stronger P(...)N bonds and shorter P-N distances than the corresponding complexes ZN:PO2Cl. Charge transfer from the N lone pair through the π-hole to the P-X and P-O σ* orbitals leads to stabilization of these complexes, although charge-transfer energies can be evaluated only for complexes with binding energies less than -71 kJ/mol. Complexation of PO2X with the strongest bases leads to P···N bonds with a significant degree of covalency, and P-N distances that approach the P-N distances in the molecules PO2NC and PO2NH2. In these complexes, the PO2X molecules distort from planarity. Changes in (31)P absolute chemical shieldings upon complexation do not correlate with changes in charges on P, although they do correlate with the binding energies of the complexes. EOM-CCSD spin-spin coupling constants (1p)J(P-N) are dominated by the Fermi-contact term, which is an excellent approximation to total J. (1p)J(P-N) values are small at long distances, increase as the distance decreases, but then decrease at short P-N distances. At the shortest distances, values of (1p)J(P-N) approach (1)J(P-N) for the molecules PO2NC and PO2NH2.

  19. Single-molecule interfacial electron transfer dynamics in solar energy conversion

    NASA Astrophysics Data System (ADS)

    Dhital, Bharat

    This dissertation work investigated the parameters affecting the interfacial electron transfer (ET) dynamics in dye-semiconductor nanoparticles (NPs) system by using single-molecule fluorescence spectroscopy and imaging combined with electrochemistry. The influence of the molecule-substrate electronic coupling, the molecular structure, binding geometry on the surface and the molecule-attachment surface chemistry on interfacial charge transfer processes was studied on zinc porphyrin-TiO2 NP systems. The fluorescence blinking measurement on TiO2 NP demonstrated that electronic coupling regulates dynamics of charge transfer processes at the interface depending on the conformation of molecule on the surface. Moreover, semiconductor surface charge induced electronic coupling of molecule which is electrostatically adsorbed on the semiconductor surface also predominantly alters the ET dynamics. Furthermore, interfacial electric field and electron accepting state density dependent ET dynamics has been dissected in zinc porphyrin-TiO2 NP system by observing the single-molecule fluorescence blinking dynamics and fluorescence lifetime with and without applied bias. The significant difference in fluorescence fluctuation and lifetime suggested the modulation of charge transfer dynamics at the interface with external electric field perturbation. Quasi-continuous distribution of fluorescence intensity with applied negative potential was attributed to the faster charge recombination due to reduced density of electron accepting states. The driving force and electron accepting state density ET dependent dynamics has also been probed in zinc porphyrin-TiO2 NP and zinc porphyrin-indium tin oxide (ITO) systems. Study of a molecule adsorbed on two different semiconductors (ITO and TiO2), with large difference in electron densities and distinct driving forces, allows us to observe the changes in rates of back electron transfer process reflected by the suppressed fluorescence blinking of molecule on ITO surface. Finally, the electric field effect on the interface properties has been probed by using surface-enhanced Raman spectroscopy and supported by density functional theory calculations in alizarin-TiO2 system. The perturbation, created by the external potential, has been observed to cause a shift and/or splitting interfacial bond vibrational mode, typical indicator of the coupling energy changes between alizarin and TiO2. Such splitting provides evidence for electric field-dependent electronic coupling changes that have a significant impact on the interfacial electron transfer dynamics.

  20. Single-Molecule Electronic Measurements with Metal Electrodes

    ERIC Educational Resources Information Center

    Lindsay, Stuart

    2005-01-01

    A review of concepts like tunneling through a metal-molecule-metal-junction, contrast with electrochemical and optical-charge injection, strong-coupling limit, calculations of tunnel transport, electron transfer through Redox-active molecules is presented. This is followed by a discussion of experimental approaches for single-molecule measurements.

  1. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    NASA Astrophysics Data System (ADS)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  2. Single molecule transistor based nanopore for the detection of nicotine

    NASA Astrophysics Data System (ADS)

    Ray, S. J.

    2014-12-01

    A nanopore based detection methodology was proposed and investigated for the detection of Nicotine. This technique uses a Single Molecular Transistor working as a nanopore operational in the Coulomb Blockade regime. When the Nicotine molecule is pulled through the nanopore area surrounded by the Source(S), Drain (D), and Gate electrodes, the charge stability diagram can detect the presence of the molecule and is unique for a specific molecular structure. Due to the weak coupling between the different electrodes which is set by the nanopore size, the molecular energy states stay almost unaffected by the electrostatic environment that can be realised from the charge stability diagram. Identification of different orientation and position of the Nicotine molecule within the nanopore area can be made from specific regions of overlap between different charge states on the stability diagram that could be used as an electronic fingerprint for detection. This method could be advantageous and useful to detect the presence of Nicotine in smoke which is usually performed using chemical chromatography techniques.

  3. Electrochromic Graphene Molecules

    DOE PAGES

    Ji, Zhiqiang; Doorn, Stephen K.; Sykora, Milan

    2015-03-13

    Polyclic aromatic hydrocarbons, also called Graphene Molecules (GMs), with chemical composition C 132H 36(COOH) 2 were synthesized in-situ on the surface of transparent nanocrystaline indium tin oxide (nc-ITO) electrodes. Their electronic structure was studied electrochemically and spectro-electrochemically. Variations in the potential applied onto the nc-ITO/GM electrodes induce only small changes in the observed current but they produce dramatic changes in the absorption of the GMs, which are associated with their oxidation and reduction. Analysis of the absorption changes using modified Nernst equation is used to determine standard potentials associated with the individual charge transfer processes. For the GMs prepared heremore » these were found to be E 1,ox 0 = 0.77± 0.01 V and E 2,ox 0 = 1.24 ± 0.02 V vs. NHE for the first and second oxidation and E 1,red 0 = -1.50 ± 0.04 V for the first reduction. The charge transfer processes are found to be non-ideal. The non-ideality factors associated with the oxidation and reduction processes suggest presence of strong interactions between the GM redox centers. Under the conditions of potential cycling GMs show rapid (seconds) color change with high contrast and stability. An electrochromic application is demonstrated wherein the GMs are used as the optically active component.« less

  4. Insight Into the Role of PC71BM on Enhancing the Photovoltaic Performance of Ternary Organic Solar Cells.

    PubMed

    Wang, Bei; Fu, Yingying; Yan, Chi; Zhang, Rui; Yang, Qingqing; Han, Yanchun; Xie, Zhiyuan

    2018-01-01

    The development of non-fullerene acceptor molecules have remarkably boosted power conversion efficiency (PCE) of polymer solar cells (PSCs) due to the improved spectral coverage and reduced energy loss. An introduction of fullerene molecules into the non-fullerene acceptor-based blend may further improve the photovoltaic performance of the resultant ternary PSCs. However, the underlying mechanism is still debatable. Herein, the ternary PSCs based on PBDB-T:ITIC:PC 71 BM blend were fabricated and its PCE was increased to 10.2% compared to 9.2% for the binary PBDB-T:ITIC devices and 8.1% for the PBDB-T:PC 71 BM PSCs. Systematic investigation was carried out to disclose the effect of PC 71 BM on the blend morphology and charge transport behavior. It is found that the PC 71 BM tends to intermix with the PBDB-T donor compared to the ITIC counterpart. A small amount of PC 71 BM in the ternary blend is helpful for ITIC to aggregate and form efficient electron-transport pathways. Accordingly, the electron mobility is increased and the density of electron traps is decreased in the ternary blend in comparison with the PBDB-T:ITIC blend. Finally, the suppressed bimolecular recombination and enhanced charge collection lead to high PCE for the ternary solar cells.

  5. Charge separation and carrier dynamics in donor-acceptor heterojunction photovoltaic systems

    PubMed Central

    Teuscher, Joël; Brauer, Jan C.; Stepanov, Andrey; Solano, Alicia; Boziki, Ariadni; Chergui, Majed; Wolf, Jean-Pierre; Rothlisberger, Ursula; Banerji, Natalie; Moser, Jacques-E.

    2017-01-01

    Electron transfer and subsequent charge separation across donor-acceptor heterojunctions remain the most important areas of study in the field of third-generation photovoltaics. In this context, it is particularly important to unravel the dynamics of individual ultrafast processes (such as photoinduced electron transfer, carrier trapping and association, and energy transfer and relaxation), which prevail in materials and at their interfaces. In the frame of the National Center of Competence in Research “Molecular Ultrafast Science and Technology,” a research instrument of the Swiss National Science Foundation, several groups active in the field of ultrafast science in Switzerland have applied a number of complementary experimental techniques and computational simulation tools to scrutinize these critical photophysical phenomena. Structural, electronic, and transport properties of the materials and the detailed mechanisms of photoinduced charge separation in dye-sensitized solar cells, conjugated polymer- and small molecule-based organic photovoltaics, and high-efficiency lead halide perovskite solar energy converters have been scrutinized. Results yielded more than thirty research articles, an overview of which is provided here. PMID:29308415

  6. Spectroscopic Analysis of a Biomimetic Model of Tyr(Z) Function in PSII.

    PubMed

    Ravensbergen, Janneke; Antoniuk-Pablant, Antaeres; Sherman, Benjamin D; Kodis, Gerdenis; Megiatto, Jackson D; Méndez-Hernández, Dalvin D; Frese, Raoul N; van Grondelle, Rienk; Moore, Thomas A; Moore, Ana L; Gust, Devens; Kennis, John T M

    2015-09-17

    Using natural photosynthesis as a model, bio-inspired constructs for fuel generation from sunlight are being developed. Here we report the synthesis and time-resolved spectroscopic analysis of a molecular triad in which a porphyrin electron donor is covalently linked to both a cyanoporphyrin electron acceptor and a benzimidazole-phenol model for the TyrZ-D1His190 pair of PSII. A dual-laser setup enabled us to record the ultrafast kinetics and long-living species in a single experiment. From this data, the photophysical relaxation pathways were elucidated for the triad and reference compounds. For the triad, quenching of the cyanoporphyrin singlet excited state lifetime was interpreted as photoinduced electron transfer from the porphyrin to the excited cyanoporphyrin. In contrast to a previous study of a related molecule, we were unable to observe subsequent formation of a long-lived charge separated state involving the benzimidazole-phenol moiety. The lack of detection of a long-lived charge separated state is attributed to a change in energetic landscape for charge separation/recombination due to small differences in structure and solvation of the new triad.

  7. The tilt-dependent potential of mean force of a pair of DNA oligomers from all-atom molecular dynamics simulations

    DOE PAGES

    Cortini, Ruggero; Cheng, Xiaolin; Smith, Jeremy C.

    2017-01-16

    Electrostatic interactions between DNA molecules have been extensively studied experimentally and theoretically, but several aspects (e.g. its role in determining the pitch of the cholesteric DNA phase) still remain unclear. Here, we performed large-scale all-atom molecular dynamics simulations in explicit water and 150 mM sodium chloride, to reconstruct the potential of mean force (PMF) of two DNA oligomers 24 base pairs long as a function of their interaxial angle and intermolecular distance. We find that the potential of mean force is dominated by total DNA charge, and not by the helical geometry of its charged groups. The theory of homogeneously charged cylinders fits well all our simulation data, and the fit yields the optimal value of the total compensated charge on DNA to ≈65% of its total fixed charge (arising from the phosphorous atoms), close to the value expected from Manning's theory of ion condensation. The PMF calculated from our simulations does not show a significant dependence on the handedness of the angle between the two DNA molecules, or its size is on the order ofmore » $$1{{k}_{\\text{B}}}T$$ . Thermal noise for molecules of the studied length seems to mask the effect of detailed helical charge patterns of DNA. The fact that in monovalent salt the effective interaction between two DNA molecules is independent on the handedness of the tilt may suggest that alternative mechanisms are required to understand the cholesteric phase of DNA.« less

  8. The tilt-dependent potential of mean force of a pair of DNA oligomers from all-atom molecular dynamics simulations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cortini, Ruggero; Cheng, Xiaolin; Smith, Jeremy C.

    Electrostatic interactions between DNA molecules have been extensively studied experimentally and theoretically, but several aspects (e.g. its role in determining the pitch of the cholesteric DNA phase) still remain unclear. Here, we performed large-scale all-atom molecular dynamics simulations in explicit water and 150 mM sodium chloride, to reconstruct the potential of mean force (PMF) of two DNA oligomers 24 base pairs long as a function of their interaxial angle and intermolecular distance. We find that the potential of mean force is dominated by total DNA charge, and not by the helical geometry of its charged groups. The theory of homogeneously charged cylinders fits well all our simulation data, and the fit yields the optimal value of the total compensated charge on DNA to ≈65% of its total fixed charge (arising from the phosphorous atoms), close to the value expected from Manning's theory of ion condensation. The PMF calculated from our simulations does not show a significant dependence on the handedness of the angle between the two DNA molecules, or its size is on the order ofmore » $$1{{k}_{\\text{B}}}T$$ . Thermal noise for molecules of the studied length seems to mask the effect of detailed helical charge patterns of DNA. The fact that in monovalent salt the effective interaction between two DNA molecules is independent on the handedness of the tilt may suggest that alternative mechanisms are required to understand the cholesteric phase of DNA.« less

  9. Characterizing and engineering tunable spin functionality inside indium arsenide/gallium arsenide quantum dot molecules

    NASA Astrophysics Data System (ADS)

    Liu, Weiwen

    The continual downsizing of the basic functional units used in the electronics industry has motivated the study of the quantum computation and related topics. To overcome the limitations of classical physics and engineering, some unique quantum mechanical features, especially entanglement and superpositions have begun to be considered as important properties for future bits. Including these quantum mechanical features is attractive because the ability to utilize quantum mechanics can dramatically enhance computational power. Among the various ways of constructing the basic building blocks for quantum computation, we are particularly interested in using spins inside epitaxially grown InAs/GaAs quantum dot molecules as quantum bits (qubits). The ability to design and engineer nanostructures with tailored quantum properties is critical to engineering quantum computers and other novel electro-optical devices and is one of the key challenges for scaling up new ideas for device application. In this thesis, we will focus on how the structure and composition of quantum dot molecules can be used to control spin properties and charge interactions. Tunable spin and charge properties can enable new, more scalable, methods of initializing and manipulating quantum information. In this thesis, we demonstrate one method to enable electric-field tunability of Zeeman splitting for a single electron spin inside a quantum dot molecules by using heterostructure engineering techniques to modify the barrier that separates quantum dots. We describe how these structural changes to the quantum dot molecules also change charge interactions and propose ways to use this effect to enable accurate measurement of coulomb interactions and possibly charge occupancy inside these complicated quantum dot molecules.

  10. Correlations and enlarged superconducting phase of t -J⊥ chains of ultracold molecules on optical lattices

    NASA Astrophysics Data System (ADS)

    Manmana, Salvatore R.; Möller, Marcel; Gezzi, Riccardo; Hazzard, Kaden R. A.

    2017-10-01

    We compute physical properties across the phase diagram of the t -J⊥ chain with long-range dipolar interactions, which describe ultracold polar molecules on optical lattices. Our results obtained by the density-matrix renormalization group indicate that superconductivity is enhanced when the Ising component Jz of the spin-spin interaction and the charge component V are tuned to zero and even further by the long-range dipolar interactions. At low densities, a substantially larger spin gap is obtained. We provide evidence that long-range interactions lead to algebraically decaying correlation functions despite the presence of a gap. Although this has recently been observed in other long-range interacting spin and fermion models, the correlations in our case have the peculiar property of having a small and continuously varying exponent. We construct simple analytic models and arguments to understand the most salient features.

  11. Kinetics of proton migration in liquid water.

    PubMed

    Chen, Hanning; Voth, Gregory A; Agmon, Noam

    2010-01-14

    We have utilized multistate empirical valence bond (MS-EVB3) simulations of protonated liquid water to calculate the relative mean-square displacement (MSD) and the history-independent time correlation function, c(t), of the hydrated proton center of excess charge (CEC) with respect to the water molecule on which it has initially resided. The MSD is nonlinear for the first 15 ps, suggesting that the relative diffusion coefficient increases from a small value, D(0), at short separations to its larger bulk value, D(infinity), at large separations. With the ensuing distance-dependent diffusion coefficient, D(r), the time dependence of both the MSD and c(t) agrees quantitatively with the solution of a diffusion equation for reversible geminate recombination. This suggests that the relative motion of the CEC is not independent from the nearby water molecules, in agreement with theoretical and experimental observations that large water clusters participate in the mechanism of proton mobility.

  12. An artificial molecular pump

    NASA Astrophysics Data System (ADS)

    Cheng, Chuyang; McGonigal, Paul R.; Schneebeli, Severin T.; Li, Hao; Vermeulen, Nicolaas A.; Ke, Chenfeng; Stoddart, J. Fraser

    2015-06-01

    Carrier proteins consume fuel in order to pump ions or molecules across cell membranes, creating concentration gradients. Their control over diffusion pathways, effected entirely through noncovalent bonding interactions, has inspired chemists to devise artificial systems that mimic their function. Here, we report a wholly artificial compound that acts on small molecules to create a gradient in their local concentration. It does so by using redox energy and precisely organized noncovalent bonding interactions to pump positively charged rings from solution and ensnare them around an oligomethylene chain, as part of a kinetically trapped entanglement. A redox-active viologen unit at the heart of a dumbbell-shaped molecular pump plays a dual role, first attracting and then repelling the rings during redox cycling, thereby enacting a flashing energy ratchet mechanism with a minimalistic design. Our artificial molecular pump performs work repetitively for two cycles of operation and drives rings away from equilibrium toward a higher local concentration.

  13. Vibrational spectroscopic and DFT calculation studies of 2-amino-7-bromo-5-oxo-[1]benzopyrano [2,3-b]pyridine-3 carbonitrile

    NASA Astrophysics Data System (ADS)

    Premkumar, S.; Jawahar, A.; Mathavan, T.; Kumara Dhas, M.; Milton Franklin Benial, A.

    2015-03-01

    The vibrational spectra of 2-amino-7-bromo-5-oxo-[1]benzopyrano [2,3-b]pyridine-3 carbonitrile were recorded using fourier transform-infrared and fourier transform-Raman spectrometer. The optimized structural parameters, vibrational frequencies, Mulliken atomic charge distribution, frontier molecular orbitals, thermodynamic properties, temperature dependence of thermodynamic parameters, first order hyperpolarizability and natural bond orbital calculations of the molecule were performed using the Gaussian 09 program. The vibrational frequencies were assigned on the basis of potential energy distribution calculation using the VEDA 4.0 program. The calculated first order hyperpolarizability of ABOBPC molecule was obtained as 6.908 × 10-30 issue, which was 10.5 times greater than urea. The nonlinear optical activity of the molecule was also confirmed by the frontier molecular orbitals and natural bond orbital analysis. The frontier molecular orbitals analysis shows that the lower energy gap of the molecule, which leads to the higher value of first order hyperpolarizability. The natural bond orbital analysis indicates that the nonlinear optical activity of the molecule arises due to the π → π∗ transitions. The Mulliken atomic charge distribution confirms the presence of intramolecular charge transfer within the molecule. The reactive site of the molecule was predicted from the molecular electrostatic potential contour map. The values of thermo dynamic parameters were increasing with increasing temperature.

  14. Electrospray ionization of uranyl-citrate complexes

    NASA Astrophysics Data System (ADS)

    Somogyi, Árpád; Pasilis, Sofie P.; Pemberton, Jeanne E.

    2007-09-01

    Results presented here demonstrate the usefulness of electrospray ionization and gas-phase ion-molecule reactions to predict structural and electronic differences in complex inorganic ions. Electrospray ionization of uranyl citrate solutions generates positively and negatively charged ions that participate in further ion-molecule reactions in 3D ion trap and FT-ICR mass analyzers. Most ions observed are derived from the major solution uranyl-citrate complexes and involve species of {(UO2)2Cit2}2-, (UO2)3Cit2, and {(UO2)3Cit3}3-, where Cit indicates the citrate trianion, C6H5O73-. In a 3D ion trap operated at relatively high pressure, complex adducts containing solvent molecules, alkali and ammonium cations, and nitrate or chloride anions are dominant, and proton/alkali cation (Na+, K+) exchange is observed for up to six exchangeable protons in an excess of alkali cations. Adduct formation in a FT-ICR cell that is operated at lower pressures is less dominant, and direct detection of positive and negative ions of the major solution complexes is possible. Multiply charged ions are also detected, suggesting the presence of uranium in different oxidation states. Changes in uranium oxidation state are detected by He-CID and SORI-CID fragmentation, and certain fragments undergo association reactions in trapping analyzers, forming "exotic" species such as [(UO2)4O3]-, [(UO2)4O4]-, and [(UO2)4O5]-. Ion-molecule reactions with D2O in the FT-ICR cell indicate substantial differences in H/D exchange rate and D2O accommodation for different ion structures and charge states. Most notably, the positively charged ions [H2(UO2)2Cit2(H)]+ and [(UO2)2(Cit)]+ accommodate two and three D2O molecules, respectively, which reflects well the structural differences, i.e., tighter uranyl-citrate coordination in the former ion than in the latter. The corresponding negatively charged ions accommodate zero or two D2O molecules, which can be rationalized using suggested solution phase structures and charge state distributions.

  15. Single-molecule DNA detection with an engineered MspA protein nanopore

    PubMed Central

    Butler, Tom Z.; Pavlenok, Mikhail; Derrington, Ian M.; Niederweis, Michael; Gundlach, Jens H.

    2008-01-01

    Nanopores hold great promise as single-molecule analytical devices and biophysical model systems because the ionic current blockades they produce contain information about the identity, concentration, structure, and dynamics of target molecules. The porin MspA of Mycobacterium smegmatis has remarkable stability against environmental stresses and can be rationally modified based on its crystal structure. Further, MspA has a short and narrow channel constriction that is promising for DNA sequencing because it may enable improved characterization of short segments of a ssDNA molecule that is threaded through the pore. By eliminating the negative charge in the channel constriction, we designed and constructed an MspA mutant capable of electronically detecting and characterizing single molecules of ssDNA as they are electrophoretically driven through the pore. A second mutant with additional exchanges of negatively-charged residues for positively-charged residues in the vestibule region exhibited a factor of ≈20 higher interaction rates, required only half as much voltage to observe interaction, and allowed ssDNA to reside in the vestibule ≈100 times longer than the first mutant. Our results introduce MspA as a nanopore for nucleic acid analysis and highlight its potential as an engineerable platform for single-molecule detection and characterization applications. PMID:19098105

  16. Bond-equilibrium theory of liquid Se-Te alloys. II. Effect of singly attached ring molecules

    NASA Astrophysics Data System (ADS)

    Cutler, Melvin; Bez, Wolfgang G.

    1981-06-01

    A statistical-mechanical theory for bond equilibrium of chain polymers containing threefold (3F) and onefold (1F) bond defects is extended to include the effects of free ring molecules and ring molecules attached to chains by a single 3F atom. Positively charged singly attached rings are shown to play a key role in bond equilibrium in liquid Sex Te1-x by permitting the formation of ion pairs in which both constituents are effectively chain terminators, thus decreasing the average polymer size. The theory is applied to explain the behavior of the paramagnetic susceptibility, χp, and electronic transport as affected by the Fermi energy EF. It is found that the increase in χp with the concentration of Te is primarily the result of the smaller energy for breaking Te bonds. In addition, attached rings play an important role in determining the effect of temperature on χp. At x<~0.5, the concentrations of both free and attached rings becomes small at high T because of the high concentration of bond defects.

  17. Molecular adsorption on graphene

    NASA Astrophysics Data System (ADS)

    Kong, Lingmei; Enders, Axel; Rahman, Talat S.; Dowben, Peter A.

    2014-11-01

    Current studies addressing the engineering of charge carrier concentration and the electronic band gap in epitaxial graphene using molecular adsorbates are reviewed. The focus here is on interactions between the graphene surface and the adsorbed molecules, including small gas molecules (H2O, H2, O2, CO, NO2, NO, and NH3), aromatic, and non-aromatic molecules (F4-TCNQ, PTCDA, TPA, Na-NH2, An-CH3, An-Br, Poly (ethylene imine) (PEI), and diazonium salts), and various biomolecules such as peptides, DNA fragments, and other derivatives. This is followed by a discussion on graphene-based gas sensor concepts. In reviewing the studies of the effects of molecular adsorption on graphene, it is evident that the strong manipulation of graphene’s electronic structure, including p- and n-doping, is not only possible with molecular adsorbates, but that this approach appears to be superior compared to these exploiting edge effects, local defects, or strain. However, graphene-based gas sensors, albeit feasible because huge adsorbate-induced variations in the relative conductivity are possible, generally suffer from the lack of chemical selectivity.

  18. Preface: Charge transport in nanoscale junctions

    NASA Astrophysics Data System (ADS)

    Albrecht, Tim; Kornyshev, Alexei; Bjørnholm, Thomas

    2008-09-01

    Understanding the fundamentals of nanoscale charge transfer is pivotal for designing future nano-electronic devices. Such devices could be based on individual or groups of molecular bridges, nanotubes, nanoparticles, biomolecules and other 'active' components, mimicking wire, diode and transistor functions. These have operated in various environments including vacuum, air and condensed matter, in two- or three-electrode configurations, at ultra-low and room temperatures. Interest in charge transport in ultra-small device components has a long history and can be dated back to Aviram and Ratner's letter in 1974 (Chem. Phys. Lett. 29 277-83). So why is there a necessity for a special issue on this subject? The area has reached some degree of maturity, and even subtle geometric effects in the nanojunction and noise features can now be resolved and rationalized based on existing theoretical concepts. One purpose of this special issue is thus to showcase various aspects of nanoscale and single-molecule charge transport from experimental and theoretical perspectives. The main principles have 'crystallized' in our minds, but there is still a long way to go before true single-molecule electronics can be implemented. Major obstacles include the stability of electronic nanojunctions, reliable operation at room temperature, speed of operation and, last but not least, integration into large networks. A gradual transition from traditional silicon-based electronics to devices involving a single (or a few) molecule(s) therefore appears to be more viable from technologic and economic perspectives than a 'quantum leap'. As research in this area progresses, new applications emerge, e.g. with a view to characterizing interfacial charge transfer at the single-molecule level in general. For example, electrochemical experiments with individual enzyme molecules demonstrate that catalytic processes can be studied with nanometre resolution, offering a route towards optimizing biosensors at the molecular level. Nanoscale charge transport experiments in ionic liquids extend the field to high temperatures and to systems with intriguing interfacial potential distributions. Other directions may include dye-sensitized solar cells, new sensor applications and diagnostic tools for the study of surface-bound single molecules. Another motivation for this special issue is thus to highlight activities across different research communities with nanoscale charge transport as a common denominator. This special issue gathers 27 articles by scientists from the United States, Germany, the UK, Denmark, Russia, France, Israel, Canada, Australia, Sweden, Switzerland, the Netherlands, Belgium and Singapore; it gives us a flavour of the current state-of-the-art of this diverse research area. While based on contributions from many renowned groups and institutions, it obviously cannot claim to represent all groups active in this very broad area. Moreover, a number of world-leading groups were unable to take part in this project within the allocated time limit. Nevertheless, we regard the current selection of papers to be representative enough for the reader to draw their own conclusions about the current status of the field. Each paper is original and has its own merit, as all papers in Journal of Physics: Condensed Matter special issues are subjected to the same scrutiny as regular contributions. The Guest Editors have deliberately not defined the specific subjects covered in this issue. These came out logically from the development of this area, for example: 'Traditional' solid state nanojunctions based on adsorbed layers, oxide films or nanowires sandwiched between two electrodes: effects of molecular structure (aromaticity, anchoring groups), symmetry, orientation, dynamics (noise patterns) and current-induced heating. Various 'physical effects': inelastic tunnelling and Coulomb blockade, polaron effects, switching modes, and negative differential resistance; the role of many particle excitations, new surface states in semiconductor electrodes, various mechanisms for single molecule rectification of the current, inelastic electron spectra and SERS spectroscopy. Three terminal architectures allowing (electrochemical) gating and transistor effects. Electrochemical nanojunctions and gating: intermolecular electron transfer in multi-redox metalloproteins, contact force modulation, characteristic current-noise patterns due to conformational fluctuations, resonance effects and electrocatalysis. Novel architectures: linear coupled quantum-dot-bridged junctions, electrochemical redox mediated transfer in two center systems leading to double maxima current-voltage plots and negative differential resistance, molecular-nanoparticle hybrid junctions and unexpected mesoscopic effects in polymeric wires. Device integration: techniques for creating stable metal/molecule/metal junctions using 'nano-alligator clips' and integration with 'traditional' silicon-based technology. The Guest Editors would like to thank all of the authors and referees of this special issue for their meticulous work in making each paper a valuable contribution to this research area, the early-bird authors for their patience, and Journal of Physics: Condensed Matter editorial staff in Bristol for their continuous support.

  19. Charge transport in nanoscale junctions.

    PubMed

    Albrecht, Tim; Kornyshev, Alexei; Bjørnholm, Thomas

    2008-09-03

    Understanding the fundamentals of nanoscale charge transfer is pivotal for designing future nano-electronic devices. Such devices could be based on individual or groups of molecular bridges, nanotubes, nanoparticles, biomolecules and other 'active' components, mimicking wire, diode and transistor functions. These have operated in various environments including vacuum, air and condensed matter, in two- or three-electrode configurations, at ultra-low and room temperatures. Interest in charge transport in ultra-small device components has a long history and can be dated back to Aviram and Ratner's letter in 1974 (Chem. Phys. Lett. 29 277-83). So why is there a necessity for a special issue on this subject? The area has reached some degree of maturity, and even subtle geometric effects in the nanojunction and noise features can now be resolved and rationalized based on existing theoretical concepts. One purpose of this special issue is thus to showcase various aspects of nanoscale and single-molecule charge transport from experimental and theoretical perspectives. The main principles have 'crystallized' in our minds, but there is still a long way to go before true single-molecule electronics can be implemented. Major obstacles include the stability of electronic nanojunctions, reliable operation at room temperature, speed of operation and, last but not least, integration into large networks. A gradual transition from traditional silicon-based electronics to devices involving a single (or a few) molecule(s) therefore appears to be more viable from technologic and economic perspectives than a 'quantum leap'. As research in this area progresses, new applications emerge, e.g. with a view to characterizing interfacial charge transfer at the single-molecule level in general. For example, electrochemical experiments with individual enzyme molecules demonstrate that catalytic processes can be studied with nanometre resolution, offering a route towards optimizing biosensors at the molecular level. Nanoscale charge transport experiments in ionic liquids extend the field to high temperatures and to systems with intriguing interfacial potential distributions. Other directions may include dye-sensitized solar cells, new sensor applications and diagnostic tools for the study of surface-bound single molecules. Another motivation for this special issue is thus to highlight activities across different research communities with nanoscale charge transport as a common denominator. This special issue gathers 27 articles by scientists from the United States, Germany, the UK, Denmark, Russia, France, Israel, Canada, Australia, Sweden, Switzerland, the Netherlands, Belgium and Singapore; it gives us a flavour of the current state-of-the-art of this diverse research area. While based on contributions from many renowned groups and institutions, it obviously cannot claim to represent all groups active in this very broad area. Moreover, a number of world-leading groups were unable to take part in this project within the allocated time limit. Nevertheless, we regard the current selection of papers to be representative enough for the reader to draw their own conclusions about the current status of the field. Each paper is original and has its own merit, as all papers in Journal of Physics: Condensed Matter special issues are subjected to the same scrutiny as regular contributions. The Guest Editors have deliberately not defined the specific subjects covered in this issue. These came out logically from the development of this area, for example: 'Traditional' solid state nanojunctions based on adsorbed layers, oxide films or nanowires sandwiched between two electrodes: effects of molecular structure (aromaticity, anchoring groups), symmetry, orientation, dynamics (noise patterns) and current-induced heating. Various 'physical effects': inelastic tunnelling and Coulomb blockade, polaron effects, switching modes, and negative differential resistance; the role of many particle excitations, new surface states in semiconductor electrodes, various mechanisms for single molecule rectification of the current, inelastic electron spectra and SERS spectroscopy. Three terminal architectures allowing (electrochemical) gating and transistor effects. Electrochemical nanojunctions and gating: intermolecular electron transfer in multi-redox metalloproteins, contact force modulation, characteristic current-noise patterns due to conformational fluctuations, resonance effects and electrocatalysis. Novel architectures: linear coupled quantum-dot-bridged junctions, electrochemical redox mediated transfer in two center systems leading to double maxima current-voltage plots and negative differential resistance, molecular-nanoparticle hybrid junctions and unexpected mesoscopic effects in polymeric wires. Device integration: techniques for creating stable metal/molecule/metal junctions using 'nano-alligator clips' and integration with 'traditional' silicon-based technology. The Guest Editors would like to thank all of the authors and referees of this special issue for their meticulous work in making each paper a valuable contribution to this research area, the early-bird authors for their patience, and Journal of Physics: Condensed Matter editorial staff in Bristol for their continuous support.

  20. Long-Ranged Oppositely Charged Interactions for Designing New Types of Colloidal Clusters

    NASA Astrophysics Data System (ADS)

    Demirörs, Ahmet Faik; Stiefelhagen, Johan C. P.; Vissers, Teun; Smallenburg, Frank; Dijkstra, Marjolein; Imhof, Arnout; van Blaaderen, Alfons

    2015-04-01

    Getting control over the valency of colloids is not trivial and has been a long-desired goal for the colloidal domain. Typically, tuning the preferred number of neighbors for colloidal particles requires directional bonding, as in the case of patchy particles, which is difficult to realize experimentally. Here, we demonstrate a general method for creating the colloidal analogs of molecules and other new regular colloidal clusters without using patchiness or complex bonding schemes (e.g., DNA coating) by using a combination of long-ranged attractive and repulsive interactions between oppositely charged particles that also enable regular clusters of particles not all in close contact. We show that, due to the interplay between their attractions and repulsions, oppositely charged particles dispersed in an intermediate dielectric constant (4 <ɛ <10 ) provide a viable approach for the formation of binary colloidal clusters. Tuning the size ratio and interactions of the particles enables control of the type and shape of the resulting regular colloidal clusters. Finally, we present an example of clusters made up of negatively charged large and positively charged small satellite particles, for which the electrostatic properties and interactions can be changed with an electric field. It appears that for sufficiently strong fields the satellite particles can move over the surface of the host particles and polarize the clusters. For even stronger fields, the satellite particles can be completely pulled off, reversing the net charge on the cluster. With computer simulations, we investigate how charged particles distribute on an oppositely charged sphere to minimize their energy and compare the results with the solutions to the well-known Thomson problem. We also use the simulations to explore the dependence of such clusters on Debye screening length κ-1 and the ratio of charges on the particles, showing good agreement with experimental observations.

  1. Spin Polarization Transfer from a Photogenerated Radical Ion Pair to a Stable Radical Controlled by Charge Recombination.

    PubMed

    Horwitz, Noah E; Phelan, Brian T; Nelson, Jordan N; Mauck, Catherine M; Krzyaniak, Matthew D; Wasielewski, Michael R

    2017-06-15

    Photoexcitation of electron donor-acceptor molecules frequently produces radical ion pairs with well-defined initial spin-polarized states that have attracted significant interest for spintronics. Transfer of this initial spin polarization to a stable radical is predicted to depend on the rates of the radical ion pair recombination reactions, but this prediction has not been tested experimentally. In this study, a stable radical/electron donor/chromophore/electron acceptor molecule, BDPA • -mPD-ANI-NDI, where BDPA • is α,γ-bisdiphenylene-β-phenylallyl, mPD is m-phenylenediamine, ANI is 4-aminonaphthalene-1,8-dicarboximide, and NDI is naphthalene-1,4:5,8-bis(dicarboximide), was synthesized. Photoexcitation of ANI produces the triradical BDPA • -mPD +• -ANI-NDI -• in which the mPD +• -ANI-NDI -• radical ion pair is spin coupled to the BDPA • stable radical. BDPA • -mPD +• -ANI-NDI -• and its counterpart lacking the stable radical are found to exhibit spin-selective charge recombination in which the triplet radical ion pair 3 (mPD +• -ANI-NDI -• ) is in equilibrium with the 3 *NDI charge recombination product. Time-resolved EPR measurements show that this process is associated with an inversion of the sign of the polarization transferred to BDPA • over time. The polarization transfer rates are found to be strongly solvent dependent, as shifts in this equilibrium affect the spin dynamics. These results demonstrate that even small changes in electron transfer dynamics can have a large effect on the spin dynamics of photogenerated multispin systems.

  2. Ionization in atmospheres of brown dwarfs and extrasolar planets VI: Properties of large-scale discharge events

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bailey, R. L.; Helling, Ch.; Hodosán, G.

    2014-03-20

    Mineral clouds in substellar atmospheres play a special role as a catalyst for a variety of charge processes. If clouds are charged, the surrounding environment becomes electrically activated, and ensembles of charged grains are electrically discharging (e.g., by lightning), which significantly influences the local chemistry creating conditions similar to those thought responsible for life in early planetary atmospheres. We note that such lightning discharges contribute also to the ionization state of the atmosphere. We apply scaling laws for electrical discharge processes from laboratory measurements and numerical experiments to DRIFT-PHOENIX model atmosphere results to model the discharge's propagation downward (as lightning)more » and upward (as sprites) through the atmospheric clouds. We evaluate the spatial extent and energetics of lightning discharges. The atmospheric volume affected (e.g., by increase of temperature or electron number) is larger in a brown dwarf atmosphere (10{sup 8}-10{sup 10} m{sup 3}) than in a giant gas planet (10{sup 4}-10{sup 6} m{sup 3}). Our results suggest that the total dissipated energy in one event is <10{sup 12} J for all models of initial solar metallicity. First attempts to show the influence of lightning on the local gas phase indicate an increase of small carbohydrate molecules like CH and CH{sub 2} at the expense of CO and CH{sub 4}. Dust-forming molecules are destroyed and the cloud particle properties are frozen in unless enough time is available for complete evaporation. We summarize instruments potentially suitable to observe lightning on extrasolar objects.« less

  3. Molecular targets for small-molecule modulators of circadian clocks

    PubMed Central

    He, Baokun; Chen, Zheng

    2016-01-01

    Background Circadian clocks are endogenous timing systems that regulate various aspects of mammalian metabolism, physiology and behavior. Traditional chronotherapy refers to the administration of drugs in a defined circadian time window to achieve optimal pharmacokinetic and therapeutic efficacies. In recent years, substantial efforts have been dedicated to developing novel small-molecule modulators of circadian clocks. Methods Here, we review the recent progress in the identification of molecular targets of small-molecule clock modulators and their efficacies in clock-related disorders. Specifically, we examine the clock components and regulatory factors as possible molecular targets of small molecules, and we review several key clock-related disorders as promising venues for testing the preventive/therapeutic efficacies of these small molecules. Finally, we also discuss circadian regulation of drug metabolism. Results Small molecules can modulate the period, phase and/or amplitude of the circadian cycle. Core clock proteins, nuclear hormone receptors, and clock-related kinases and other epigenetic regulators are promising molecular targets for small molecules. Through these targets small molecules exert protective effects against clock-related disorders including the metabolic syndrome, immune disorders, sleep disorders and cancer. Small molecules can also modulate circadian drug metabolism and response to existing therapeutics. Conclusion Small-molecule clock modulators target clock components or diverse cellular pathways that functionally impinge upon the clock. Target identification of new small-molecule modulators will deepen our understanding of key regulatory nodes in the circadian network. Studies of clock modulators will facilitate their therapeutic applications, alone or in combination, for clock-related diseases. PMID:26750111

  4. Correlational Effects of the Molecular-Tilt Configuration and the Intermolecular van der Waals Interaction on the Charge Transport in the Molecular Junction.

    PubMed

    Shin, Jaeho; Gu, Kyungyeol; Yang, Seunghoon; Lee, Chul-Ho; Lee, Takhee; Jang, Yun Hee; Wang, Gunuk

    2018-06-25

    Molecular conformation, intermolecular interaction, and electrode-molecule contacts greatly affect charge transport in molecular junctions and interfacial properties of organic devices by controlling the molecular orbital alignment. Here, we statistically investigated the charge transport in molecular junctions containing self-assembled oligophenylene molecules sandwiched between an Au probe tip and graphene according to various tip-loading forces ( F L ) that can control the molecular-tilt configuration and the van der Waals (vdW) interactions. In particular, the molecular junctions exhibited two distinct transport regimes according to the F L dependence (i.e., F L -dependent and F L -independent tunneling regimes). In addition, the charge-injection tunneling barriers at the junction interfaces are differently changed when the F L ≤ 20 nN. These features are associated to the correlation effects between the asymmetry-coupling factor (η), the molecular-tilt angle (θ), and the repulsive intermolecular vdW force ( F vdW ) on the molecular-tunneling barriers. A more-comprehensive understanding of these charge transport properties was thoroughly developed based on the density functional theory calculations in consideration of the molecular-tilt configuration and the repulsive vdW force between molecules.

  5. Agglutination of like-charged red blood cells induced by binding of beta2-glycoprotein I to outer cell surface.

    PubMed

    Lokar, Marusa; Urbanija, Jasna; Frank, Mojca; Hägerstrand, Henry; Rozman, Blaz; Bobrowska-Hägerstrand, Malgorzata; Iglic, Ales; Kralj-Iglic, Veronika

    2008-08-01

    Plasma protein-mediated attractive interaction between membranes of red blood cells (RBCs) and phospholipid vesicles was studied. It is shown that beta(2)-glycoprotein I (beta(2)-GPI) may induce RBC discocyte-echinocyte-spherocyte shape transformation and subsequent agglutination of RBCs. Based on the observed beta(2)-GPI-induced RBC cell shape transformation it is proposed that the hydrophobic portion of beta(2)-GPI molecule protrudes into the outer lipid layer of the RBC membrane and increases the area of this layer. It is also suggested that the observed agglutination of RBCs is at least partially driven by an attractive force which is of electrostatic origin and depends on the specific molecular shape and internal charge distribution of membrane-bound beta(2)-GPI molecules. The suggested beta(2)-GPI-induced attractive electrostatic interaction between like-charged RBC membrane surfaces is qualitatively explained by using a simple mathematical model within the functional density theory of the electric double layer, where the electrostatic attraction between the positively charged part of the first domains of bound beta(2)-GPI molecules and negatively charged glycocalyx of the adjacent RBC membrane is taken into account.

  6. Visualizing electron dynamics in organic materials: Charge transport through molecules and angular resolved photoemission

    NASA Astrophysics Data System (ADS)

    Kümmel, Stephan

    Being able to visualize the dynamics of electrons in organic materials is a fascinating perspective. Simulations based on time-dependent density functional theory allow to realize this hope, as they visualize the flow of charge through molecular structures in real-space and real-time. We here present results on two fundamental processes: Photoemission from organic semiconductor molecules and charge transport through molecular structures. In the first part we demonstrate that angular resolved photoemission intensities - from both theory and experiment - can often be interpreted as a visualization of molecular orbitals. However, counter-intuitive quantum-mechanical electron dynamics such as emission perpendicular to the direction of the electrical field can substantially alter the picture, adding surprising features to the molecular orbital interpretation. In a second study we calculate the flow of charge through conjugated molecules. The calculations show in real time how breaks in the conjugation can lead to a local buildup of charge and the formation of local electrical dipoles. These can interact with neighboring molecular chains. As a consequence, collections of ''molecular electrical wires'' can show distinctly different characteristics than ''classical electrical wires''. German Science Foundation GRK 1640.

  7. How Many States Can the Motor Molecule, Prestin, Assume in an Electric Field?

    PubMed Central

    Scherer, Marc P.; Gummer, Anthony W.

    2005-01-01

    By using an analogy between the magnetization of a paramagnetic material in an external magnetic field and the electric polarization of the lateral wall of outer hair cells in response to the transmembrane potential, we show that, based on experimental data on the charge transfer across the membrane, it is impossible to make a statement about the number of possible conformational states of the motor molecule, prestin. Although the choice of model affects the values of derived parameters, such as total charge and motor charge, this is frequently overlooked in the literature. PMID:15764650

  8. Theoretical and Experimental Studies of N,N-Dimethyl-N'-Picryl-4,4'-Stilbenediamine.

    PubMed

    Papper, Vladislav; Wu, Yuanyuan; Kharlanov, Vladimir; Sukharaharja, Ayrine; Steele, Terry W J; Marks, Robert S

    2018-01-01

    N,N-dimethyl-N'-picryl-4,4'-stilbenediamine (DMPSDA) was prepared, purified and crystallised in a form of black lustrous crystals, and its absorption and fluorescence spectra were recorded in cyclohexane, acetonitrile and dimethyl sulfoxide. Non-emissive intramolecular charge transfer state (ICT) was clearly observed in this molecule in all three solvents. Theoretical calculations demonstrating a betaine electronic structure of the trinitrophenyl group in the ground state of the molecule and a charge transfer nature of the long wavelength transition S 0  → S 1 supported the experimental observations of the ICT formation in the molecule.

  9. Van der Waals corrected DFT study of adsorption of groups VA and VIA hydrides on graphene monoxide

    NASA Astrophysics Data System (ADS)

    Notash, M. Yaghoobi; Ebrahimzadeh, A. Rastkar

    2016-06-01

    Adsorption properties of H2O, H2S, NH3 and PH3 on graphene monoxide (GMO) nano flack are investigated using density functional theory (DFT). Calculations were carried out by van der Waals correction and general gradient approximation. The adsorption energies and charge transfer between species are obtained and discussed for the considered positions of adsorbate molecules. Charge transfer analysis show that the gas molecules act as an electron acceptor in all cases. The analysis of the adsorption energies suggest GMO can be a good candidate for the adsorption of these molecules.

  10. Enhancement of atom transfer in different surface chemistry of hydrogenated vs. fluorinated tribromobenzene on Ag(111) and Cu(111)

    NASA Astrophysics Data System (ADS)

    Cecily mary glory, D.; Sambathkumar, K.; Madivanane, R.; Rajkamal, N.; Venkatachalapathy, M.

    2017-12-01

    Systematic interactions of hydrogenated & fluorinated tribromobenzene on Ag and Cu surfaces. First bromine dehalogenation takes place right upon adsorption due to catalytic properties of Ag. Different adsorption geometries of monomers and dimmers of 1,3,5-tribromo-2,4,6-trifluoro-benzene(TBFB) and 1,3,5-tribromobenzene(TBB). DFT calculations of the Csbnd Br binding energy dependent on the amount of remaining bromine atoms for both TBFB and TBB were performed. The experiments were performed at low temperature of 80 K.STM measurements where performed for of TBFB and TBB. STM show adsorbed molecules in a loose arrangement of molecules. NBO analysis the stability of the molecule arising within hyper-conjugative interactions. The HOMO and LUMO energies and electronic charge transfer (ECT) confirms that electronic transition. High field indicates that this molecule exhibit considerable electrical conductivity in atomic charges. The ESP map is found to be positive within the molecule. The negative charges have a tendency to drift from left to right. The computed thermodynamic parameters like heat capacities (Cºp,m), entropies (Sºm) and enthalpies changes (Hºm) are used for various electrical field.

  11. Photoelectron spectroscopy study of the electronic structures at CoPc/Bi(111) interface

    NASA Astrophysics Data System (ADS)

    Sun, Haoliang; Liang, Zhaofeng; Shen, Kongchao; Hu, Jinbang; Ji, Gengwu; Li, Zheshen; Li, Haiyang; Zhu, Zhiyuan; Li, Jiong; Gao, Xingyu; Han, Huang; Jiang, Zheng; Song, Fei

    2017-07-01

    Self-assembly of functional molecules on solid substrate has been recognized as an appealing approach for the fabrication of diverse nanostructures for nanoelectronics. Herein, we investigate the growth of cobalt phthalocyanine (CoPc) on a Bi(111) surface with focus on the interface electronic structures utilizing photoelectron spectroscopy. While charge transfer from bismuth substrate to the molecule results in the emergence of an interface component in the Co 3p core level at lower binding energy, core-levels associated to the molecular ligand (C 1s and N 1s) are less influenced by the adsorption. In addition, density functional theory (DFT) calculations also support the empirical inference that the molecule-substrate interaction mainly involves the out-of-plane empty Co 3d orbital and bismuth states. Finally, valence band spectra demonstrate the molecule-substrate interaction is induced by interface charge transfer, agreeing well with core level measurements. Charge transfer is shown to be mainly from the underlying bismuth substrate to the empty states located at the central Co atom in the CoPc molecules. This report may provide a fundamental basis to the on-surface engineering of interfaces for molecular devices and spintronics.

  12. Performances and impedance spectroscopy of Small-molecule bulk heterojunction solar cells based on PtOEP: PCBM

    NASA Astrophysics Data System (ADS)

    Abuelwafa, A. A.; Dongol, M.; El-Nahass, M. M.; Soga, T.

    2018-03-01

    Small-molecule bulk heterojunction (SBHJ) solar cells based on platinum octaethylporphyrin (PtOEP) as donor material and phenyl-C61-butyric acid methyl ester (PCBM) as the acceptor were fabricated using spin coating techniques with weight ratios from 1:0.1 to 1:9. The formation of charge transfer complex CTC in the PtOEP: PCBM blend was specified from the redshift of the PtOEP absorption peak after blending with PCBM. The photovoltaic performance for PtOEP: PCBM blends were investigated using the external quantum efficiency (EQE) besides the current density-voltage (J-V) characteristics under illumination100 mW/cm2 (AM1.5G). The BHJ solar cell with PtOEP: PCBM ratio of 1:9 exhibited the best performance. The impedance spectroscopy (IS) was examined in the frequency range from 25 Hz to 1 MHz. The equivalent circuit model was evaluated in details to evaluate the impedance spectroscopy parameters. Dielectric constant {ɛ ^' }, dielectric loss {ɛ ^' ' }} and dielectric modulus were included and discussed in terms of dielectric polarization processes. Dielectric modulus displays the non-Debye relaxation in PtOEP: PCBM BHJ solar cells.

  13. Proton transfer along water bridges in biological systems with density-functional tight-binding

    NASA Astrophysics Data System (ADS)

    Reiss, Krystle; Wise, Abigail; Mazzuca, James

    2015-03-01

    When examining the dynamics of charge transfer in high dimensional enzymatic systems, the cost of quantum mechanical treatment of electrons increases exponentially with the size of the system. As a semi-empirical method, density-functional tight-binding aids in shortening these calculation times, but can be inaccurate in the regime where bonds are being formed and broken. To address these inaccuracies with respect to proton transfer in an enzymatic system, DFTB is being used to calculate small model systems containing only a single amino acid residue donor, represented by an imidazole molecule, and a water acceptor. When DFTB calculations are compared to B3LYP geometry calculations of the donor molecule, we observe a bond angle error on the order of 1.2 degrees and a bond length error on the order of 0.011 Å. As we move forward with small donor-acceptor systems, comparisons between DFTB and B3LYP energy profiles will provide a better clue as to what extent improvements need to be made. To improve the accuracy of the DFTB calculations, the internuclear repulsion term may be altered. This would result in energy profiles that closely resemble those produced by higher-level theory. Alma College Provost's Office.

  14. Effect of the Molecular Configuration of Perylene Diimide Acceptors on Charge Transfer and Device Performance

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Qu, Jianfei; Mu, Zhao; Lai, Hanjian

    Three perylene diimides (PDI)-based small molecules, T2-SePDI2, T3B-SePDI3, and T4B-SePDI4, with different molecular configurations are synthesized. Due to a large steric hindrance, the molecular configuration of T3B-SePDI3 is the most distorted, followed by T4BSePDI4, while T2-SePDI2 shows the smallest steric hindrance. Inverted bulk heterojunction solar cells based on T3B-SePDI3 and PBDB-T show the highest power conversion efficiency (PCE) of 5.82% with an open-circuit voltage of 0.98 V, a high short-circuit current density of 10.52 mA/cm2, and a fill factor of 56.31%. The PCEs of the T2-SePDI2- and T4B-SePDI4- based devices are 4.10% and 5.10%, respectively. Furthermore, the results demonstrate thatmore » the molecular configuration of the PDI-based small molecule acceptor is critical and that increasing the steric hindrance is helpful in suppressing aggregation and improving device performance.« less

  15. Toward Environmentally Robust Organic Electronics: Approaches and Applications.

    PubMed

    Lee, Eun Kwang; Lee, Moo Yeol; Park, Cheol Hee; Lee, Hae Rang; Oh, Joon Hak

    2017-11-01

    Recent interest in flexible electronics has led to a paradigm shift in consumer electronics, and the emergent development of stretchable and wearable electronics is opening a new spectrum of ubiquitous applications for electronics. Organic electronic materials, such as π-conjugated small molecules and polymers, are highly suitable for use in low-cost wearable electronic devices, and their charge-carrier mobilities have now exceeded that of amorphous silicon. However, their commercialization is minimal, mainly because of weaknesses in terms of operational stability, long-term stability under ambient conditions, and chemical stability related to fabrication processes. Recently, however, many attempts have been made to overcome such instabilities of organic electronic materials. Here, an overview is provided of the strategies developed for environmentally robust organic electronics to overcome the detrimental effects of various critical factors such as oxygen, water, chemicals, heat, and light. Additionally, molecular design approaches to π-conjugated small molecules and polymers that are highly stable under ambient and harsh conditions are explored; such materials will circumvent the need for encapsulation and provide a greater degree of freedom using simple solution-based device-fabrication techniques. Applications that are made possible through these strategies are highlighted. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Effect of the Molecular Configuration of Perylene Diimide Acceptors on Charge Transfer and Device Performance

    DOE PAGES

    Qu, Jianfei; Mu, Zhao; Lai, Hanjian; ...

    2018-01-25

    Three perylene diimides (PDI)-based small molecules, T2-SePDI2, T3B-SePDI3, and T4B-SePDI4, with different molecular configurations are synthesized. Due to a large steric hindrance, the molecular configuration of T3B-SePDI3 is the most distorted, followed by T4BSePDI4, while T2-SePDI2 shows the smallest steric hindrance. Inverted bulk heterojunction solar cells based on T3B-SePDI3 and PBDB-T show the highest power conversion efficiency (PCE) of 5.82% with an open-circuit voltage of 0.98 V, a high short-circuit current density of 10.52 mA/cm2, and a fill factor of 56.31%. The PCEs of the T2-SePDI2- and T4B-SePDI4- based devices are 4.10% and 5.10%, respectively. Furthermore, the results demonstrate thatmore » the molecular configuration of the PDI-based small molecule acceptor is critical and that increasing the steric hindrance is helpful in suppressing aggregation and improving device performance.« less

  17. Reducing the efficiency-stability-cost gap of organic photovoltaics with highly efficient and stable small molecule acceptor ternary solar cells

    NASA Astrophysics Data System (ADS)

    Baran, Derya; Ashraf, Raja Shahid; Hanifi, David A.; Abdelsamie, Maged; Gasparini, Nicola; Röhr, Jason A.; Holliday, Sarah; Wadsworth, Andrew; Lockett, Sarah; Neophytou, Marios; Emmott, Christopher J. M.; Nelson, Jenny; Brabec, Christoph J.; Amassian, Aram; Salleo, Alberto; Kirchartz, Thomas; Durrant, James R.; McCulloch, Iain

    2017-03-01

    Technological deployment of organic photovoltaic modules requires improvements in device light-conversion efficiency and stability while keeping material costs low. Here we demonstrate highly efficient and stable solar cells using a ternary approach, wherein two non-fullerene acceptors are combined with both a scalable and affordable donor polymer, poly(3-hexylthiophene) (P3HT), and a high-efficiency, low-bandgap polymer in a single-layer bulk-heterojunction device. The addition of a strongly absorbing small molecule acceptor into a P3HT-based non-fullerene blend increases the device efficiency up to 7.7 +/- 0.1% without any solvent additives. The improvement is assigned to changes in microstructure that reduce charge recombination and increase the photovoltage, and to improved light harvesting across the visible region. The stability of P3HT-based devices in ambient conditions is also significantly improved relative to polymer:fullerene devices. Combined with a low-bandgap donor polymer (PBDTTT-EFT, also known as PCE10), the two mixed acceptors also lead to solar cells with 11.0 +/- 0.4% efficiency and a high open-circuit voltage of 1.03 +/- 0.01 V.

  18. Selectively Modulating Triplet Exciton Formation in Host Materials for Highly Efficient Blue Electrophosphorescence.

    PubMed

    Li, Huanhuan; Bi, Ran; Chen, Ting; Yuan, Kai; Chen, Runfeng; Tao, Ye; Zhang, Hongmei; Zheng, Chao; Huang, Wei

    2016-03-23

    The concept of limiting the triplet exciton formation to fundamentally alleviate triplet-involved quenching effects is introduced to construct host materials for highly efficient and stable blue phosphorescent organic light-emitting diodes (PhOLEDs). The low triplet exciton formation is realized by small triplet exciton formation fraction and rate with high binding energy and high reorganization energy of triplet exciton. Demonstrated in two analogue molecules in conventional donor-acceptor molecule structure for bipolar charge injection and transport with nearly the same frontier orbital energy levels and triplet excited energies, the new concept host material shows significantly suppressed triplet exciton formation in the host to avoid quenching effects, leading to much improved device efficiencies and stabilities. The low-voltage-driving blue PhOLED devices exhibit maximum efficiencies of 43.7 cd A(-1) for current efficiency, 32.7 lm W(-1) for power efficiency, and 20.7% for external quantum efficiency with low roll-off and remarkable relative quenching effect reduction ratio up to 41%. Our fundamental solution for preventing quenching effects of long-lived triplet excitons provides exciting opportunities for fabricating high-performance devices using the advanced host materials with intrinsically small triplet exciton formation cross section.

  19. Recent advances in developing small molecules targeting RNA.

    PubMed

    Guan, Lirui; Disney, Matthew D

    2012-01-20

    RNAs are underexploited targets for small molecule drugs or chemical probes of function. This may be due, in part, to a fundamental lack of understanding of the types of small molecules that bind RNA specifically and the types of RNA motifs that specifically bind small molecules. In this review, we describe recent advances in the development and design of small molecules that bind to RNA and modulate function that aim to fill this void.

  20. Molecular design and nanoscale engineering of organic nanofibril donor-acceptor heterojunctions

    NASA Astrophysics Data System (ADS)

    Huang, Helin

    Organic nanofibril heterojunction materials have gained increasing research interest due to their broad applications in organic semiconductor devices. In order to enhance the device performance, we have investigated the structure-property relationship of these nanostructures by designing and synthesizing functional building block molecules, selfassembling the molecules into well-defined nanofibers, fabricating the nanofibers into optical and electrical devices, and testing their photoconductivity and sensor properties. In Chapter 2, we present a simple approach to fabricate efficient nanofibril heterojunctions by interfacial engineering of electron donor (D) coating onto acceptor (A) nanofibers. The nanofibers both create a large D/A interface for increased charge separation and act as long-range transport pathways for photogenerated charge carriers towards the electrodes, and the alkyl groups modified at the A molecules not only enable effective surface adsorption of D molecules on the nanofibers for effective electron-transfer communication, but also spatially separate the photogenerated charge carriers to prevent their recombination. In Chapter 3, we further investigated the effect of D molecular structure and coating morphology on photoconductivity of organic nanofiber materials. A series of D molecules with varying side-chain modifications were synthesized and investigated for the different intermolecular arrangements caused by pi-pi stacking in balance with steric hindrance of side-chains. Different molecular assemblies of D resulted in distinctive phase segregation between D and A nanofiber, which significantly affects the interfacial charge separation. In Chapter 4, we developed an alternative nanofibril heterojunction structure that is composed of D as the nanofiber, onto which a monolayer of A molecule was coated. Due to the strong redox (charge transfer) interaction between D and A, the nanofibril junction demonstrated high conductivity even without light illumination, which makes this material suitable for applications in chemiresistor sensors for detection of amines. In Chapter 5, a series of perylene tetracarboxylic monoimides were synthesized through a one-step reaction between cycloalkyl amines and the parent perylene dianhydride. The selection of appropriate reaction medium is the most critical for achieving the high purity of product. This approach opens up a new way for large scale production of the monoimides, which are the precursor for making a variety of perylene based building block molecules.

Top