ESD/MITRE Software Acquisition Symposium Proceedings; an ESD/Industry Dialogue held in Bedford, Massachusetts on May 6-7, 1986

DTIC Science & Technology

1986-05-07

Cycle? Moderator: Christine M. Anderson Dennis D. Doe Manager of Engineering Software and Artificial Intelligence Boeing Aerospace Company In... intelligence systems development pro- cess affect the life cycle? Artificial intelligence developers seem to be the last haven for people who don’t...of Engineering Software and Artificial Intelligence at the Boeing Aerospace Company. In this capacity, Mr. Doe is the focal point for software

National Cycle Program (NCP) Common Analysis Tool for Aeropropulsion

NASA Technical Reports Server (NTRS)

Follen, G.; Naiman, C.; Evans, A.

1999-01-01

Through the NASA/Industry Cooperative Effort (NICE) agreement, NASA Lewis and industry partners are developing a new engine simulation, called the National Cycle Program (NCP), which is the initial framework of NPSS. NCP is the first phase toward achieving the goal of NPSS. This new software supports the aerothermodynamic system simulation process for the full life cycle of an engine. The National Cycle Program (NCP) was written following the Object Oriented Paradigm (C++, CORBA). The software development process used was also based on the Object Oriented paradigm. Software reviews, configuration management, test plans, requirements, design were all apart of the process used in developing NCP. Due to the many contributors to NCP, the stated software process was mandatory for building a common tool intended for use by so many organizations. The U.S. aircraft and airframe companies recognize NCP as the future industry standard for propulsion system modeling.

Software Quality Assurance Metrics

NASA Technical Reports Server (NTRS)

McRae, Kalindra A.

2004-01-01

Software Quality Assurance (SQA) is a planned and systematic set of activities that ensures conformance of software life cycle processes and products conform to requirements, standards and procedures. In software development, software quality means meeting requirements and a degree of excellence and refinement of a project or product. Software Quality is a set of attributes of a software product by which its quality is described and evaluated. The set of attributes includes functionality, reliability, usability, efficiency, maintainability, and portability. Software Metrics help us understand the technical process that is used to develop a product. The process is measured to improve it and the product is measured to increase quality throughout the life cycle of software. Software Metrics are measurements of the quality of software. Software is measured to indicate the quality of the product, to assess the productivity of the people who produce the product, to assess the benefits derived from new software engineering methods and tools, to form a baseline for estimation, and to help justify requests for new tools or additional training. Any part of the software development can be measured. If Software Metrics are implemented in software development, it can save time, money, and allow the organization to identify the caused of defects which have the greatest effect on software development. The summer of 2004, I worked with Cynthia Calhoun and Frank Robinson in the Software Assurance/Risk Management department. My task was to research and collect, compile, and analyze SQA Metrics that have been used in other projects that are not currently being used by the SA team and report them to the Software Assurance team to see if any metrics can be implemented in their software assurance life cycle process.

Addressing software security and mitigations in the life cycle

NASA Technical Reports Server (NTRS)

Gilliam, David; Powell, John; Haugh, Eric; Bishop, Matt

2003-01-01

Traditionally, security is viewed as an organizational and Information Technology (IIJ systems function comprising of Firewalls, intrusion detection systems (IDS), system security settings and patches to the operating system (OS) and applications running on it. Until recently, little thought has been given to the importance of security as a formal approach in the software life cycle. The Jet Propulsion Laboratory has approached the problem through the development of an integrated formal Software Security Assessment Instrument (SSAI) with six foci for the software life cycle.

Addressing software security and mitigations in the life cycle

NASA Technical Reports Server (NTRS)

Gilliam, David; Powell, John; Haugh, Eric; Bishop, Matt

2004-01-01

Traditionally, security is viewed as an organizational and Information Technology (IT) systems function comprising of firewalls, intrusion detection systems (IDS), system security settings and patches to the operating system (OS) and applications running on it. Until recently, little thought has been given to the importance of security as a formal approach in the software life cycle. The Jet Propulsion Laboratory has approached the problem through the development of an integrated formal Software Security Assessment Instrument (SSAI) with six foci for the software life cycle.

Impact of Agile Software Development Model on Software Maintainability

ERIC Educational Resources Information Center

Gawali, Ajay R.

2012-01-01

Software maintenance and support costs account for up to 60% of the overall software life cycle cost and often burdens tightly budgeted information technology (IT) organizations. Agile software development approach delivers business value early, but implications on software maintainability are still unknown. The purpose of this quantitative study…

An Integrated Fuel Depletion Calculator for Fuel Cycle Options Analysis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schneider, Erich; Scopatz, Anthony

2016-04-25

Bright-lite is a reactor modeling software developed at the University of Texas Austin to expand upon the work done with the Bright [1] reactor modeling software. Originally, bright-lite was designed to function as a standalone reactor modeling software. However, this aim was refocused t couple bright-lite with the Cyclus fuel cycle simulator [2] to make it a module for the fuel cycle simulator.

Metrinome: Continuous Monitoring and Security Validation of Distributed Systems

DTIC Science & Technology

2014-03-01

Integration into the SDLC ( Software Development Life Cycle), Retrieved Nov 06 2013, https://www.owasp.org/ images/f/f6/Integration_into_the_SDLC.ppt [2...assessment as part of the software development life cycle, current approaches suffer from a number of shortcomings that limit their application in...with assessing security and correct functionality. Second, integrated and end-to-end testing and experimentation is often postponed until software

Software engineering standards and practices

NASA Technical Reports Server (NTRS)

Durachka, R. W.

1981-01-01

Guidelines are presented for the preparation of a software development plan. The various phases of a software development project are discussed throughout its life cycle including a general description of the software engineering standards and practices to be followed during each phase.

Artificial intelligence approaches to software engineering

NASA Technical Reports Server (NTRS)

Johannes, James D.; Macdonald, James R.

1988-01-01

Artificial intelligence approaches to software engineering are examined. The software development life cycle is a sequence of not so well-defined phases. Improved techniques for developing systems have been formulated over the past 15 years, but pressure continues to attempt to reduce current costs. Software development technology seems to be standing still. The primary objective of the knowledge-based approach to software development presented in this paper is to avoid problem areas that lead to schedule slippages, cost overruns, or software products that fall short of their desired goals. Identifying and resolving software problems early, often in the phase in which they first occur, has been shown to contribute significantly to reducing risks in software development. Software development is not a mechanical process but a basic human activity. It requires clear thinking, work, and rework to be successful. The artificial intelligence approaches to software engineering presented support the software development life cycle through the use of software development techniques and methodologies in terms of changing current practices and methods. These should be replaced by better techniques that that improve the process of of software development and the quality of the resulting products. The software development process can be structured into well-defined steps, of which the interfaces are standardized, supported and checked by automated procedures that provide error detection, production of the documentation and ultimately support the actual design of complex programs.

Resource utilization during software development

NASA Technical Reports Server (NTRS)

Zelkowitz, Marvin V.

1988-01-01

This paper discusses resource utilization over the life cycle of software development and discusses the role that the current 'waterfall' model plays in the actual software life cycle. Software production in the NASA environment was analyzed to measure these differences. The data from 13 different projects were collected by the Software Engineering Laboratory at NASA Goddard Space Flight Center and analyzed for similarities and differences. The results indicate that the waterfall model is not very realistic in practice, and that as technology introduces further perturbations to this model with concepts like executable specifications, rapid prototyping, and wide-spectrum languages, we need to modify our model of this process.

Lean Development with the Morpheus Simulation Software

NASA Technical Reports Server (NTRS)

Brogley, Aaron C.

2013-01-01

The Morpheus project is an autonomous robotic testbed currently in development at NASA's Johnson Space Center (JSC) with support from other centers. Its primary objectives are to test new 'green' fuel propulsion systems and to demonstrate the capability of the Autonomous Lander Hazard Avoidance Technology (ALHAT) sensor, provided by the Jet Propulsion Laboratory (JPL) on a lunar landing trajectory. If successful, these technologies and lessons learned from the Morpheus testing cycle may be incorporated into a landing descent vehicle used on the moon, an asteroid, or Mars. In an effort to reduce development costs and cycle time, the project employs lean development engineering practices in its development of flight and simulation software. The Morpheus simulation makes use of existing software packages where possible to reduce the development time. The development and testing of flight software occurs primarily through the frequent test operation of the vehicle and incrementally increasing the scope of the test. With rapid development cycles, risk of loss of the vehicle and loss of the mission are possible, but efficient progress in development would not be possible without that risk.

Towards Model-Driven End-User Development in CALL

ERIC Educational Resources Information Center

Farmer, Rod; Gruba, Paul

2006-01-01

The purpose of this article is to introduce end-user development (EUD) processes to the CALL software development community. EUD refers to the active participation of end-users, as non-professional developers, in the software development life cycle. Unlike formal software engineering approaches, the focus in EUD on means/ends development is…

Formal assessment instrument for ensuring the security of NASA's networks, systems and software

NASA Technical Reports Server (NTRS)

Gilliam, D. P.; Powell, J. D.; Sherif, J.

2002-01-01

To address the problem of security for NASA's networks, systems and software, NASA has funded the Jet Propulsion Lab in conjunction with UC Davis to begin work on developing a software security assessment instrument for use in the software development and maintenance life cycle.

Software Assurance Curriculum Project Volume 2: Undergraduate Course Outlines

DTIC Science & Technology

2010-08-01

Contents Acknowledgments iii Abstract v 1 An Undergraduate Curriculum Focus on Software Assurance 1 2 Computer Science I 7 3 Computer Science II...confidence that can be integrated into traditional software development and acquisition process models . Thus, in addition to a technology focus...testing throughout the software development life cycle ( SDLC ) AP Security and complexity—system development challenges: security failures

The Knowledge-Based Software Assistant: Beyond CASE

NASA Technical Reports Server (NTRS)

Carozzoni, Joseph A.

1993-01-01

This paper will outline the similarities and differences between two paradigms of software development. Both support the whole software life cycle and provide automation for most of the software development process, but have different approaches. The CASE approach is based on a set of tools linked by a central data repository. This tool-based approach is data driven and views software development as a series of sequential steps, each resulting in a product. The Knowledge-Based Software Assistant (KBSA) approach, a radical departure from existing software development practices, is knowledge driven and centers around a formalized software development process. KBSA views software development as an incremental, iterative, and evolutionary process with development occurring at the specification level.

The software-cycle model for re-engineering and reuse

NASA Technical Reports Server (NTRS)

Bailey, John W.; Basili, Victor R.

1992-01-01

This paper reports on the progress of a study which will contribute to our ability to perform high-level, component-based programming by describing means to obtain useful components, methods for the configuration and integration of those components, and an underlying economic model of the costs and benefits associated with this approach to reuse. One goal of the study is to develop and demonstrate methods to recover reusable components from domain-specific software through a combination of tools, to perform the identification, extraction, and re-engineering of components, and domain experts, to direct the applications of those tools. A second goal of the study is to enable the reuse of those components by identifying techniques for configuring and recombining the re-engineered software. This component-recovery or software-cycle model addresses not only the selection and re-engineering of components, but also their recombination into new programs. Once a model of reuse activities has been developed, the quantification of the costs and benefits of various reuse options will enable the development of an adaptable economic model of reuse, which is the principal goal of the overall study. This paper reports on the conception of the software-cycle model and on several supporting techniques of software recovery, measurement, and reuse which will lead to the development of the desired economic model.

Automated Estimation Of Software-Development Costs

NASA Technical Reports Server (NTRS)

Roush, George B.; Reini, William

1993-01-01

COSTMODL is automated software development-estimation tool. Yields significant reduction in risk of cost overruns and failed projects. Accepts description of software product developed and computes estimates of effort required to produce it, calendar schedule required, and distribution of effort and staffing as function of defined set of development life-cycle phases. Written for IBM PC(R)-compatible computers.

Information system life-cycle and documentation standards, volume 1

NASA Technical Reports Server (NTRS)

Callender, E. David; Steinbacher, Jody

1989-01-01

The Software Management and Assurance Program (SMAP) Information System Life-Cycle and Documentation Standards Document describes the Version 4 standard information system life-cycle in terms of processes, products, and reviews. The description of the products includes detailed documentation standards. The standards in this document set can be applied to the life-cycle, i.e., to each phase in the system's development, and to the documentation of all NASA information systems. This provides consistency across the agency as well as visibility into the completeness of the information recorded. An information system is software-intensive, but consists of any combination of software, hardware, and operational procedures required to process, store, or transmit data. This document defines a standard life-cycle model and content for associated documentation.

Product assurance policies and procedures for flight dynamics software development

NASA Technical Reports Server (NTRS)

Perry, Sandra; Jordan, Leon; Decker, William; Page, Gerald; Mcgarry, Frank E.; Valett, Jon

1987-01-01

The product assurance policies and procedures necessary to support flight dynamics software development projects for Goddard Space Flight Center are presented. The quality assurance and configuration management methods and tools for each phase of the software development life cycles are described, from requirements analysis through acceptance testing; maintenance and operation are not addressed.

A Recommended Framework for the Network-Centric Acquisition Process

DTIC Science & Technology

2009-09-01

ISO /IEC 12207 , Systems and Software Engineering-Software Life-Cycle Processes  ANSI/EIA 632, Processes for Engineering a System. There are...engineering [46]. Some of the process models presented in the DAG are:  ISO /IEC 15288, Systems and Software Engineering-System Life-Cycle Processes...e.g., ISO , IA, Security, etc.). Vetting developers helps ensure that they are using industry best industry practices and maximize the IA compliance

A software engineering approach to expert system design and verification

NASA Technical Reports Server (NTRS)

Bochsler, Daniel C.; Goodwin, Mary Ann

1988-01-01

Software engineering design and verification methods for developing expert systems are not yet well defined. Integration of expert system technology into software production environments will require effective software engineering methodologies to support the entire life cycle of expert systems. The software engineering methods used to design and verify an expert system, RENEX, is discussed. RENEX demonstrates autonomous rendezvous and proximity operations, including replanning trajectory events and subsystem fault detection, onboard a space vehicle during flight. The RENEX designers utilized a number of software engineering methodologies to deal with the complex problems inherent in this system. An overview is presented of the methods utilized. Details of the verification process receive special emphasis. The benefits and weaknesses of the methods for supporting the development life cycle of expert systems are evaluated, and recommendations are made based on the overall experiences with the methods.

The Improvement Cycle: Analyzing Our Experience

NASA Technical Reports Server (NTRS)

Pajerski, Rose; Waligora, Sharon

1996-01-01

NASA's Software Engineering Laboratory (SEL), one of the earliest pioneers in the areas of software process improvement and measurement, has had a significant impact on the software business at NASA Goddard. At the heart of the SEL's improvement program is a belief that software products can be improved by optimizing the software engineering process used to develop them and a long-term improvement strategy that facilitates small incremental improvements that accumulate into significant gains. As a result of its efforts, the SEL has incrementally reduced development costs by 60%, decreased error rates by 85%, and reduced cycle time by 25%. In this paper, we analyze the SEL's experiences on three major improvement initiatives to better understand the cyclic nature of the improvement process and to understand why some improvements take much longer than others.

Software Engineering Guidebook

NASA Technical Reports Server (NTRS)

Connell, John; Wenneson, Greg

1993-01-01

The Software Engineering Guidebook describes SEPG (Software Engineering Process Group) supported processes and techniques for engineering quality software in NASA environments. Three process models are supported: structured, object-oriented, and evolutionary rapid-prototyping. The guidebook covers software life-cycles, engineering, assurance, and configuration management. The guidebook is written for managers and engineers who manage, develop, enhance, and/or maintain software under the Computer Software Services Contract.

Software-Engineering Process Simulation (SEPS) model

NASA Technical Reports Server (NTRS)

Lin, C. Y.; Abdel-Hamid, T.; Sherif, J. S.

1992-01-01

The Software Engineering Process Simulation (SEPS) model is described which was developed at JPL. SEPS is a dynamic simulation model of the software project development process. It uses the feedback principles of system dynamics to simulate the dynamic interactions among various software life cycle development activities and management decision making processes. The model is designed to be a planning tool to examine tradeoffs of cost, schedule, and functionality, and to test the implications of different managerial policies on a project's outcome. Furthermore, SEPS will enable software managers to gain a better understanding of the dynamics of software project development and perform postmodern assessments.

Integrating automated support for a software management cycle into the TAME system

NASA Technical Reports Server (NTRS)

Sunazuka, Toshihiko; Basili, Victor R.

1989-01-01

Software managers are interested in the quantitative management of software quality, cost and progress. An integrated software management methodology, which can be applied throughout the software life cycle for any number purposes, is required. The TAME (Tailoring A Measurement Environment) methodology is based on the improvement paradigm and the goal/question/metric (GQM) paradigm. This methodology helps generate a software engineering process and measurement environment based on the project characteristics. The SQMAR (software quality measurement and assurance technology) is a software quality metric system and methodology applied to the development processes. It is based on the feed forward control principle. Quality target setting is carried out before the plan-do-check-action activities are performed. These methodologies are integrated to realize goal oriented measurement, process control and visual management. A metric setting procedure based on the GQM paradigm, a management system called the software management cycle (SMC), and its application to a case study based on NASA/SEL data are discussed. The expected effects of SMC are quality improvement, managerial cost reduction, accumulation and reuse of experience, and a highly visual management reporting system.

IEEE Computer Society/Software Engineering Institute Software Process Achievement (SPA) Award 2009

DTIC Science & Technology

2011-03-01

capabilities to our GDM. We also introduced software as a service ( SaaS ) as part our technology solutions and have further enhanced our ability to...model PROSPER Infosys production support methodology Q&P quality and productivity R&D research and development SaaS software as a service ... Software Development Life Cycle (SDLC) 23 Table 10: Scientific Estimation Coverage by Service Line 27 CMU/SEI-2011-TR-008 | vi CMU/SEI-2011

A high order approach to flight software development and testing

NASA Technical Reports Server (NTRS)

Steinbacher, J.

1981-01-01

The use of a software development facility is discussed as a means of producing a reliable and maintainable ECS software system, and as a means of providing efficient use of the ECS hardware test facility. Principles applied to software design are given, including modularity, abstraction, hiding, and uniformity. The general objectives of each phase of the software life cycle are also given, including testing, maintenance, code development, and requirement specifications. Software development facility tools are summarized, and tool deficiencies recognized in the code development and testing phases are considered. Due to limited lab resources, the functional simulation capabilities may be indispensable in the testing phase.

Predicting Software Suitability Using a Bayesian Belief Network

NASA Technical Reports Server (NTRS)

Beaver, Justin M.; Schiavone, Guy A.; Berrios, Joseph S.

2005-01-01

The ability to reliably predict the end quality of software under development presents a significant advantage for a development team. It provides an opportunity to address high risk components earlier in the development life cycle, when their impact is minimized. This research proposes a model that captures the evolution of the quality of a software product, and provides reliable forecasts of the end quality of the software being developed in terms of product suitability. Development team skill, software process maturity, and software problem complexity are hypothesized as driving factors of software product quality. The cause-effect relationships between these factors and the elements of software suitability are modeled using Bayesian Belief Networks, a machine learning method. This research presents a Bayesian Network for software quality, and the techniques used to quantify the factors that influence and represent software quality. The developed model is found to be effective in predicting the end product quality of small-scale software development efforts.

A conceptual model for megaprogramming

NASA Technical Reports Server (NTRS)

Tracz, Will

1990-01-01

Megaprogramming is component-based software engineering and life-cycle management. Magaprogramming and its relationship to other research initiatives (common prototyping system/common prototyping language, domain specific software architectures, and software understanding) are analyzed. The desirable attributes of megaprogramming software components are identified and a software development model and resulting prototype megaprogramming system (library interconnection language extended by annotated Ada) are described.

The Implications of Using Integrated Software Support Environment for Design of Guidance and Control Systems Software

DTIC Science & Technology

1990-02-01

inspections are performed before each formal review of each software life cycle phase. * Required software audits are performed . " The software is acceptable... Audits : Software audits are performed bySQA consistent with thegeneral audit rules and an auditreportis prepared. Software Quality Inspection (SQI...DSD Software Development Method 3-34 DEFINITION OF ACRONYMS Acronym Full Name or Description MACH Methode d’Analyse et de Conception Flierarchisee

One approach for evaluating the Distributed Computing Design System (DCDS)

NASA Technical Reports Server (NTRS)

Ellis, J. T.

1985-01-01

The Distributed Computer Design System (DCDS) provides an integrated environment to support the life cycle of developing real-time distributed computing systems. The primary focus of DCDS is to significantly increase system reliability and software development productivity, and to minimize schedule and cost risk. DCDS consists of integrated methodologies, languages, and tools to support the life cycle of developing distributed software and systems. Smooth and well-defined transistions from phase to phase, language to language, and tool to tool provide a unique and unified environment. An approach to evaluating DCDS highlights its benefits.

Formal Analysis of the Remote Agent Before and After Flight

NASA Technical Reports Server (NTRS)

Havelund, Klaus; Lowry, Mike; Park, SeungJoon; Pecheur, Charles; Penix, John; Visser, Willem; White, Jon L.

2000-01-01

This paper describes two separate efforts that used the SPIN model checker to verify deep space autonomy flight software. The first effort occurred at the beginning of a spiral development process and found five concurrency errors early in the design cycle that the developers acknowledge would not have been found through testing. This effort required a substantial manual modeling effort involving both abstraction and translation from the prototype LISP code to the PROMELA language used by SPIN. This experience and others led to research to address the gap between formal method tools and the development cycle used by software developers. The Java PathFinder tool which directly translates from Java to PROMELA was developed as part of this research, as well as automatic abstraction tools. In 1999 the flight software flew on a space mission, and a deadlock occurred in a sibling subsystem to the one which was the focus of the first verification effort. A second quick-response "cleanroom" verification effort found the concurrency error in a short amount of time. The error was isomorphic to one of the concurrency errors found during the first verification effort. The paper demonstrates that formal methods tools can find concurrency errors that indeed lead to loss of spacecraft functions, even for the complex software required for autonomy. Second, it describes progress in automatic translation and abstraction that eventually will enable formal methods tools to be inserted directly into the aerospace software development cycle.

A "Rainmaker" Process for Developing Internet-Based Retail Businesses

ERIC Educational Resources Information Center

Abrahams, Alan S.; Singh, Tirna

2011-01-01

Various systems development life cycles and business development models have been popularized by information systems researchers and practitioners over a number of decades. In the case of systems development life cycles, these have been targeted at software development projects within an organization, typically involving analysis, design,…

RT-Syn: A real-time software system generator

NASA Technical Reports Server (NTRS)

Setliff, Dorothy E.

1992-01-01

This paper presents research into providing highly reusable and maintainable components by using automatic software synthesis techniques. This proposal uses domain knowledge combined with automatic software synthesis techniques to engineer large-scale mission-critical real-time software. The hypothesis centers on a software synthesis architecture that specifically incorporates application-specific (in this case real-time) knowledge. This architecture synthesizes complex system software to meet a behavioral specification and external interaction design constraints. Some examples of these external constraints are communication protocols, precisions, timing, and space limitations. The incorporation of application-specific knowledge facilitates the generation of mathematical software metrics which are used to narrow the design space, thereby making software synthesis tractable. Success has the potential to dramatically reduce mission-critical system life-cycle costs not only by reducing development time, but more importantly facilitating maintenance, modifications, and extensions of complex mission-critical software systems, which are currently dominating life cycle costs.

Programming support environment issues in the Byron programming environment

NASA Technical Reports Server (NTRS)

Larsen, Matthew J.

1986-01-01

Issues are discussed which programming support environments need to address in order to successfully support software engineering. These concerns are divided into two categories. The first category, issues of how software development is supported by an environment, includes support of the full life cycle, methodology flexibility, and support of software reusability. The second category contains issues of how environments should operate, such as tool reusability and integration, user friendliness, networking, and use of a central data base. This discussion is followed by an examination of Byron, an Ada based programming support environment developed at Intermetrics, focusing on the solutions Byron offers to these problems, including the support provided for software reusability and the test and maintenance phases of the life cycle. The use of Byron in project development is described briefly, and some suggestions for future Byron tools and user written tools are presented.

Developing sustainable software solutions for bioinformatics by the “ Butterfly” paradigm

PubMed Central

Ahmed, Zeeshan; Zeeshan, Saman; Dandekar, Thomas

2014-01-01

Software design and sustainable software engineering are essential for the long-term development of bioinformatics software. Typical challenges in an academic environment are short-term contracts, island solutions, pragmatic approaches and loose documentation. Upcoming new challenges are big data, complex data sets, software compatibility and rapid changes in data representation. Our approach to cope with these challenges consists of iterative intertwined cycles of development (“ Butterfly” paradigm) for key steps in scientific software engineering. User feedback is valued as well as software planning in a sustainable and interoperable way. Tool usage should be easy and intuitive. A middleware supports a user-friendly Graphical User Interface (GUI) as well as a database/tool development independently. We validated the approach of our own software development and compared the different design paradigms in various software solutions. PMID:25383181

Applying CASE Tools for On-Board Software Development

NASA Astrophysics Data System (ADS)

Brammer, U.; Hönle, A.

For many space projects the software development is facing great pressure with respect to quality, costs and schedule. One way to cope with these challenges is the application of CASE tools for automatic generation of code and documentation. This paper describes two CASE tools: Rhapsody (I-Logix) featuring UML and ISG (BSSE) that provides modeling of finite state machines. Both tools have been used at Kayser-Threde in different space projects for the development of on-board software. The tools are discussed with regard to the full software development cycle.

Reuse-Driven Software Processes Guidebook. Version 02.00.03

DTIC Science & Technology

1993-11-01

a required sys - tem without unduly constraining the details of the solution. The Naval Research Laboratory Software Cost Reduction project developed...conventional manner. The emphasis is still on the development of "one-of-a-kind" sys - tems and the phased completion and review of corresponding...Application Engineering to improve the life-cycle productivity of Sy - 21 OVM ftrdauntals of Syatbes the total software development enterprise. The

Industry best practices for the software development life cycle

DOT National Transportation Integrated Search

2007-11-01

In the area of software development, there are many different views of what constitutes a best practice. The goal of this project was to identify a set of industry best practice techniques that fit the needs of the Montana Department of Transportatio...

The Package-Based Development Process in the Flight Dynamics Division

NASA Technical Reports Server (NTRS)

Parra, Amalia; Seaman, Carolyn; Basili, Victor; Kraft, Stephen; Condon, Steven; Burke, Steven; Yakimovich, Daniil

1997-01-01

The Software Engineering Laboratory (SEL) has been operating for more than two decades in the Flight Dynamics Division (FDD) and has adapted to the constant movement of the software development environment. The SEL's Improvement Paradigm shows that process improvement is an iterative process. Understanding, Assessing and Packaging are the three steps that are followed in this cyclical paradigm. As the improvement process cycles back to the first step, after having packaged some experience, the level of understanding will be greater. In the past, products resulting from the packaging step have been large process documents, guidebooks, and training programs. As the technical world moves toward more modularized software, we have made a move toward more modularized software development process documentation, as such the products of the packaging step are becoming smaller and more frequent. In this manner, the QIP takes on a more spiral approach rather than a waterfall. This paper describes the state of the FDD in the area of software development processes, as revealed through the understanding and assessing activities conducted by the COTS study team. The insights presented include: (1) a characterization of a typical FDD Commercial Off the Shelf (COTS) intensive software development life-cycle process, (2) lessons learned through the COTS study interviews, and (3) a description of changes in the SEL due to the changing and accelerating nature of software development in the FDD.

Using Modified Fagan Inspections to Control Rapid System Development

NASA Technical Reports Server (NTRS)

Griesel, M. A.; Welz, L. L.

1994-01-01

The Jet Propulsion Laboratory (JPL) has been developing new approaches to software and system development to shorten life cycle time and reduce total life-cycle cost, while maintaining product quality. One such approach has been taken by the Just-In-Time (JIT) Materiel Acquisition System Development Project.

Earth Observing System/Advanced Microwave Sounding Unit-A (EOS/AMSU-A) software management plan

NASA Technical Reports Server (NTRS)

Schwantje, Robert

1994-01-01

This document defines the responsibilites for the management of the like-cycle development of the flight software installed in the AMSU-A instruments, and the ground support software used in the test and integration of the AMSU-A instruments.

Software Assurance: Five Essential Considerations for Acquisition Officials

DTIC Science & Technology

2007-05-01

May 2007 www.stsc.hill.af.mil 17 2 • address security concerns in the software development life cycle ( SDLC )? • Are there formal software quality...What threat modeling process, if any, is used when designing the software ? What analysis, design, and construction tools are used by your software design...the-shelf (COTS), government off-the-shelf (GOTS), open- source, embedded, and legacy software . Attackers exploit unintentional vulnerabil- ities or

Ontology for Life-Cycle Modeling of Water Distribution Systems: Model View Definition

DTIC Science & Technology

2013-06-01

Research and Development Center, Construction Engineering Research Laboratory (ERDC-CERL) to develop a life-cycle building model have resulted in the...Laboratory (ERDC-CERL) to develop a life-cycle building model have resulted in the definition of a “core” building information model that contains...developed experimental BIM models us- ing commercial off-the-shelf (COTS) software. Those models represent three types of typical low-rise Army

Software assurance standard

NASA Technical Reports Server (NTRS)

1992-01-01

This standard specifies the software assurance program for the provider of software. It also delineates the assurance activities for the provider and the assurance data that are to be furnished by the provider to the acquirer. In any software development effort, the provider is the entity or individual that actually designs, develops, and implements the software product, while the acquirer is the entity or individual who specifies the requirements and accepts the resulting products. This standard specifies at a high level an overall software assurance program for software developed for and by NASA. Assurance includes the disciplines of quality assurance, quality engineering, verification and validation, nonconformance reporting and corrective action, safety assurance, and security assurance. The application of these disciplines during a software development life cycle is called software assurance. Subsequent lower-level standards will specify the specific processes within these disciplines.

Ada Software Design Methods Formulation.

DTIC Science & Technology

1982-10-01

cycle organization is also appropriate for another reason. The source material for the case studies is the work of the two contractors who participated in... working version of the system exist. The integration phase takes the pieces developed and combines them into a single working system. Interfaces...hardware, developed separately from the software, is united with the software, and further testing is performed until the system is a working whole

Product-oriented Software Certification Process for Software Synthesis

NASA Technical Reports Server (NTRS)

Nelson, Stacy; Fischer, Bernd; Denney, Ewen; Schumann, Johann; Richardson, Julian; Oh, Phil

2004-01-01

The purpose of this document is to propose a product-oriented software certification process to facilitate use of software synthesis and formal methods. Why is such a process needed? Currently, software is tested until deemed bug-free rather than proving that certain software properties exist. This approach has worked well in most cases, but unfortunately, deaths still occur due to software failure. Using formal methods (techniques from logic and discrete mathematics like set theory, automata theory and formal logic as opposed to continuous mathematics like calculus) and software synthesis, it is possible to reduce this risk by proving certain software properties. Additionally, software synthesis makes it possible to automate some phases of the traditional software development life cycle resulting in a more streamlined and accurate development process.

Development of computer software for pavement life cycle cost analysis.

DOT National Transportation Integrated Search

1988-01-01

The life cycle cost analysis program (LCCA) is designed to automate and standardize life cycle costing in Virginia. It allows the user to input information necessary for the analysis, and it then completes the calculations and produces a printed copy...

Support for life-cycle product reuse in NASA's SSE

NASA Technical Reports Server (NTRS)

Shotton, Charles

1989-01-01

The Software Support Environment (SSE) is a software factory for the production of Space Station Freedom Program operational software. The SSE is to be centrally developed and maintained and used to configure software production facilities in the field. The PRC product TTCQF provides for an automated qualification process and analysis of existing code that can be used for software reuse. The interrogation subsystem permits user queries of the reusable data and components which have been identified by an analyzer and qualified with associated metrics. The concept includes reuse of non-code life-cycle components such as requirements and designs. Possible types of reusable life-cycle components include templates, generics, and as-is items. Qualification of reusable elements requires analysis (separation of candidate components into primitives), qualification (evaluation of primitives for reusability according to reusability criteria) and loading (placing qualified elements into appropriate libraries). There can be different qualifications for different installations, methodologies, applications and components. Identifying reusable software and related components is labor-intensive and is best carried out as an integrated function of an SSE.

Full Life-Cycle Defect Management Assessment: Initial Inspection Data Collection Results and Research Questions for Further Study

NASA Technical Reports Server (NTRS)

Shull, Forrest; Feldmann, Raimund; Haingaertner, Ralf; Regardie, Myrna; Seaman, Carolyn

2007-01-01

It is often the case in software projects that when schedule and budget resources are limited, the Verification and Validation (V&V) activities suffer. Fewer V&V activities can be afforded and moreover, short-term challenges can result in V&V activities being scaled back or dropped altogether. As a result, too often the default solution is to save activities for improving software quality until too late in the life-cycle, relying on late-term code inspections followed by thorough testing activities to reduce defect counts to acceptable levels. As many project managers realize, however, this is a resource-intensive way of achieving the required quality for software. The Full Life-cycle Defect Management Assessment Initiative, funded by NASA s Office of Safety and Mission Assurance under the Software Assurance Research Program, aims to address these problems by: Improving the effectiveness of early life-cycle V&V activities to make their benefits more attractive to team leads. Specifically, we focus on software inspection, a proven method that can be applied to any software work product, long before executable code has been developed; Better communicating this effectiveness to software development teams, along with suggestions for parameters to improve in the future to increase effectiveness; Analyzing the impact of early life-cycle V&V on the effectiveness and cost required for late life-cycle V&V activities, such as testing, in order to make the tradeoffs more apparent. This white paper reports on an initial milestone in this work, the development of a preliminary model of inspection effectiveness across multiple NASA Centers. This model contributes toward reaching our project goals by: Allowing an examination of inspection parameters, across different types of projects and different work products, for an analysis of factors that impact defect detection effectiveness. Allowing a comparison of this NASA-specific model to existing recommendations in the literature regarding how to plan effective inspections. Forming a baseline model which can be extended to incorporate factors describing: the numbers and types of defects that are missed by inspections; how such defects flow downstream through software development phases; how effectively they can be caught by testing activities in the late stages of development. The model has been implemented in a prototype web-enabled decision-support tool which allows developers to enter their inspection data and receive feedback based on a comparison against the model. The tool also allows users to access reusable materials (such as checklists) from projects included in the baseline. Both the tool itself and the model underlying it will continue to be extended throughout the remainder of this initiative. As results of analyzing inspection effectiveness for defect containment are determined, they can be shared via the tool and also via updates to existing training courses on metrics and software inspections. Moreover, the tool will help satisfy key CMMI requirements for the NASA Centers, as it will enable NASA to take a global view across peer review results for various types of projects to identify systemic problems. This analysis can result in continuous improvements to the approach to verification.

Core Logistics Capability Policy Applied to USAF Combat Aircraft Avionics Software: A Systems Engineering Analysis

DTIC Science & Technology

2010-06-01

cannot make a distinction between software maintenance and development” (Sharma, 2004). ISO /IEC 12207 Software Lifecycle Processes offers a guide to...synopsis of ISO /IEC 12207 , Raghu Singh of the Federal Aviation Administration states “Whenever a software product needs modifications, the development...Corporation. Singh, R. (1998). International Standard ISO /IEC 12207 Software Life Cycle Processes. Washington: Federal Aviation Administration. The Joint

CrossTalk: The Journal of Defense Software Engineering. Volume 21, Number 1

DTIC Science & Technology

2008-01-01

project manage- ment and the individual components of the software life-cycle model ; it will be awarded for...software professionals that had been formally educated in software project manage- ment. The study indicated that our industry is lacking in program managers...soft- ware developments get bigger, more complicated, and more dependent on senior software pro- fessionals to get the project on the right path

A method for tailoring the information content of a software process model

NASA Technical Reports Server (NTRS)

Perkins, Sharon; Arend, Mark B.

1990-01-01

The framework is defined for a general method for selecting a necessary and sufficient subset of a general software life cycle's information products, to support new software development process. Procedures for characterizing problem domains in general and mapping to a tailored set of life cycle processes and products is presented. An overview of the method is shown using the following steps: (1) During the problem concept definition phase, perform standardized interviews and dialogs between developer and user, and between user and customer; (2) Generate a quality needs profile of the software to be developed, based on information gathered in step 1; (3) Translate the quality needs profile into a profile of quality criteria that must be met by the software to satisfy the quality needs; (4) Map the quality criteria to set of accepted processes and products for achieving each criterion; (5) Select the information products which match or support the accepted processes and product of step 4; and (6) Select the design methodology which produces the information products selected in step 5.

A method for tailoring the information content of a software process model

NASA Technical Reports Server (NTRS)

Perkins, Sharon; Arend, Mark B.

1990-01-01

The framework is defined for a general method for selecting a necessary and sufficient subset of a general software life cycle's information products, to support new software development process. Procedures for characterizing problem domains in general and mapping to a tailored set of life cycle processes and products is presented. An overview of the method is shown using the following steps: (1) During the problem concept definition phase, perform standardized interviews and dialogs between developer and user, and between user and customer; (2) Generate a quality needs profile of the software to be developed, based on information gathered in step 1; (3) Translate the quality needs profile into a profile of quality criteria that must be met by the software to satisfy the quality needs; (4) Map the quality criteria to a set of accepted processes and products for achieving each criterion; (5) select the information products which match or support the accepted processes and product of step 4; and (6) Select the design methodology which produces the information products selected in step 5.

Modernization of software quality assurance

NASA Technical Reports Server (NTRS)

Bhaumik, Gokul

1988-01-01

The customers satisfaction depends not only on functional performance, it also depends on the quality characteristics of the software products. An examination of this quality aspect of software products will provide a clear, well defined framework for quality assurance functions, which improve the life-cycle activities of software development. Software developers must be aware of the following aspects which have been expressed by many quality experts: quality cannot be added on; the level of quality built into a program is a function of the quality attributes employed during the development process; and finally, quality must be managed. These concepts have guided our development of the following definition for a Software Quality Assurance function: Software Quality Assurance is a formal, planned approach of actions designed to evaluate the degree of an identifiable set of quality attributes present in all software systems and their products. This paper is an explanation of how this definition was developed and how it is used.

Toward full life cycle control: Adding maintenance measurement to the SEL

NASA Technical Reports Server (NTRS)

Rombach, H. Dieter; Ulery, Bradford T.; Valett, Jon D.

1992-01-01

Organization-wide measurement of software products and processes is needed to establish full life cycle control over software products. The Software Engineering Laboratory (SEL)--a joint venture between NASA GSFC, the University of Maryland, and Computer Sciences Corporation--started measurement of software development more than 15 years ago. Recently, the measurement of maintenance was added to the scope of the SEL. In this article, the maintenance measurement program is presented as an addition to the already existing and well-established SEL development measurement program and evaluated in terms of its immediate benefits and long-term improvement potential. Immediate benefits of this program for the SEL include an increased understanding of the maintenance domain, the differences and commonalities between development and maintenance, and the cause-effect relationships between development and maintenance. Initial results from a sample maintenance study are presented to substantiate these benefits. The long-term potential of this program includes the use of maintenance baselines to better plan and manage future projects and to improve development and maintenance practices for future projects wherever warranted.

Software attribute visualization for high integrity software

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pollock, G.M.

1998-03-01

This report documents a prototype tool developed to investigate the use of visualization and virtual reality technologies for improving software surety confidence. The tool is utilized within the execution phase of the software life cycle. It provides a capability to monitor an executing program against prespecified requirements constraints provided in a program written in the requirements specification language SAGE. The resulting Software Attribute Visual Analysis Tool (SAVAnT) also provides a technique to assess the completeness of a software specification.

Development and Evaluation of the Effectiveness of Computer-Assisted Physics Instruction

ERIC Educational Resources Information Center

Rahman, Mohd. Jasmy Abd; Ismail, Mohd. Arif. Hj.; Nasir, Muhammad

2014-01-01

This study aims to design and develop an interactive software for teaching and learning physics about motion and vectors analysis. This study also assesses its effectiveness in classroom and assesses the learning motivation of SMA Pekanbaru's students. The software is developed using ADDIE Model design and Life Cycle Model and built using the…

Automatic Parameter Tuning for the Morpheus Vehicle Using Particle Swarm Optimization

NASA Technical Reports Server (NTRS)

Birge, B.

2013-01-01

A high fidelity simulation using a PC based Trick framework has been developed for Johnson Space Center's Morpheus test bed flight vehicle. There is an iterative development loop of refining and testing the hardware, refining the software, comparing the software simulation to hardware performance and adjusting either or both the hardware and the simulation to extract the best performance from the hardware as well as the most realistic representation of the hardware from the software. A Particle Swarm Optimization (PSO) based technique has been developed that increases speed and accuracy of the iterative development cycle. Parameters in software can be automatically tuned to make the simulation match real world subsystem data from test flights. Special considerations for scale, linearity, discontinuities, can be all but ignored with this technique, allowing fast turnaround both for simulation tune up to match hardware changes as well as during the test and validation phase to help identify hardware issues. Software models with insufficient control authority to match hardware test data can be immediately identified and using this technique requires very little to no specialized knowledge of optimization, freeing model developers to concentrate on spacecraft engineering. Integration of the PSO into the Morpheus development cycle will be discussed as well as a case study highlighting the tool's effectiveness.

Why and how Mastering an Incremental and Iterative Software Development Process

NASA Astrophysics Data System (ADS)

Dubuc, François; Guichoux, Bernard; Cormery, Patrick; Mescam, Jean Christophe

2004-06-01

One of the key issues regularly mentioned in the current software crisis of the space domain is related to the software development process that must be performed while the system definition is not yet frozen. This is especially true for complex systems like launchers or space vehicles.Several more or less mature solutions are under study by EADS SPACE Transportation and are going to be presented in this paper. The basic principle is to develop the software through an iterative and incremental process instead of the classical waterfall approach, with the following advantages:- It permits systematic management and incorporation of requirements changes over the development cycle with a minimal cost. As far as possible the most dimensioning requirements are analyzed and developed in priority for validating very early the architecture concept without the details.- A software prototype is very quickly available. It improves the communication between system and software teams, as it enables to check very early and efficiently the common understanding of the system requirements.- It allows the software team to complete a whole development cycle very early, and thus to become quickly familiar with the software development environment (methodology, technology, tools...). This is particularly important when the team is new, or when the environment has changed since the previous development. Anyhow, it improves a lot the learning curve of the software team.These advantages seem very attractive, but mastering efficiently an iterative development process is not so easy and induces a lot of difficulties such as:- How to freeze one configuration of the system definition as a development baseline, while most of thesystem requirements are completely and naturally unstable?- How to distinguish stable/unstable and dimensioning/standard requirements?- How to plan the development of each increment?- How to link classical waterfall development milestones with an iterative approach: when should theclassical reviews be performed: Software Specification Review? Preliminary Design Review? CriticalDesign Review? Code Review? Etc...Several solutions envisaged or already deployed by EADS SPACE Transportation will be presented, both from a methodological and technological point of view:- How the MELANIE EADS ST internal methodology improves the concurrent engineering activitiesbetween GNC, software and simulation teams in a very iterative and reactive way.- How the CMM approach can help by better formalizing Requirements Management and Planningprocesses.- How the Automatic Code Generation with "certified" tools (SCADE) can still dramatically shorten thedevelopment cycle.Then the presentation will conclude by showing an evaluation of the cost and planning reduction based on a pilot application by comparing figures on two similar projects: one with the classical waterfall process, the other one with an iterative and incremental approach.

Computer Program Development Specification for IDAMST Operational Flight Programs. Addendum 1. Executive Software.

DTIC Science & Technology

1976-11-01

system. b. Read different program configurations to reconfigure the software during flight. c. Write Digital Integrated Test System (DITS) results...associated witn > inor C):l.e Event must be Unlatched. The sole difference between a Latched ana an lnratcrec Condition is that upon the Scheduling...Table. Furthermore, the block of pointers for one Minor Cycle may be wholly contained witnir the Diock of ocinters for a different Minor Cycle. For

Integrated testing and verification system for research flight software

NASA Technical Reports Server (NTRS)

Taylor, R. N.

1979-01-01

The MUST (Multipurpose User-oriented Software Technology) program is being developed to cut the cost of producing research flight software through a system of software support tools. An integrated verification and testing capability was designed as part of MUST. Documentation, verification and test options are provided with special attention on real-time, multiprocessing issues. The needs of the entire software production cycle were considered, with effective management and reduced lifecycle costs as foremost goals.

Application of industry-standard guidelines for the validation of avionics software

NASA Technical Reports Server (NTRS)

Hayhurst, Kelly J.; Shagnea, Anita M.

1990-01-01

The application of industry standards to the development of avionics software is discussed, focusing on verification and validation activities. It is pointed out that the procedures that guide the avionics software development and testing process are under increased scrutiny. The DO-178A guidelines, Software Considerations in Airborne Systems and Equipment Certification, are used by the FAA for certifying avionics software. To investigate the effectiveness of the DO-178A guidelines for improving the quality of avionics software, guidance and control software (GCS) is being developed according to the DO-178A development method. It is noted that, due to the extent of the data collection and configuration management procedures, any phase in the life cycle of a GCS implementation can be reconstructed. Hence, a fundamental development and testing platform has been established that is suitable for investigating the adequacy of various software development processes. In particular, the overall effectiveness and efficiency of the development method recommended by the DO-178A guidelines are being closely examined.

Software engineering from a Langley perspective

NASA Technical Reports Server (NTRS)

Voigt, Susan

1994-01-01

A brief introduction to software engineering is presented. The talk is divided into four sections beginning with the question 'What is software engineering', followed by a brief history of the progression of software engineering at the Langley Research Center in the context of an expanding computing environment. Several basic concepts and terms are introduced, including software development life cycles and maturity levels. Finally, comments are offered on what software engineering means for the Langley Research Center and where to find more information on the subject.

Error-Free Software

NASA Technical Reports Server (NTRS)

1989-01-01

001 is an integrated tool suited for automatically developing ultra reliable models, simulations and software systems. Developed and marketed by Hamilton Technologies, Inc. (HTI), it has been applied in engineering, manufacturing, banking and software tools development. The software provides the ability to simplify the complex. A system developed with 001 can be a prototype or fully developed with production quality code. It is free of interface errors, consistent, logically complete and has no data or control flow errors. Systems can be designed, developed and maintained with maximum productivity. Margaret Hamilton, President of Hamilton Technologies, also directed the research and development of USE.IT, an earlier product which was the first computer aided software engineering product in the industry to concentrate on automatically supporting the development of an ultrareliable system throughout its life cycle. Both products originated in NASA technology developed under a Johnson Space Center contract.

Systematic on-site monitoring of compliance dust samples

DOE Office of Scientific and Technical Information (OSTI.GOV)

Grayson, R.L.; Gandy, J.R.

1996-12-31

Maintaining compliance with U.S. respirable coal mine dust standards can be difficult on high-productivity longwall panels. Comprehensive and systematic analysis of compliance dust sample data, coupled with access to the U.S. Bureau of Mines (USBM) DUSTPRO, can yield important information for use in maintaining compliance. The objective of this study was to develop and apply a customized software for the collection, storage, modification, and analysis of respirable dust data while providing for flexible export of data and linking with the USBM`s expert advisory system on dust control. An executable, IBM-compatible software was created and customized for use by the personmore » in charge of collecting, submitting, analyzing, and monitoring respirable dust compliance samples. Both descriptive statistics and multiple regression analysis were incorporated. The software allows ASCH files to be exported and directly links with DUSTPRO. After development and validation of the software, longwall compliance data from two different mines was analyzed to evaluate the value of the software. Data included variables on respirable dust concentration, tons produced, the existence of roof/floor rock (dummy variable), and the sampling cycle (dummy variables). Because of confidentiality, specific data will not be presented, only the equations and ANOVA tables. The final regression models explained 83.8% and 61.1% of the variation in the data for the two panels. Important correlations among variables within sampling cycles showed the value of using dummy variables for sampling cycles. The software proved flexible and fast for its intended use. The insights obtained from use improved the systematic monitoring of respirable dust compliance data, especially for pinpointing the most effective dust control methods during specific sampling cycles.« less

A Methodology for Cybercraft Requirement Definition and Initial System Design

DTIC Science & Technology

2008-06-01

the software development concepts of the SDLC , requirements, use cases and domain modeling . It ...collectively as Software Development 5 Life Cycle ( SDLC ) models . While there are numerous models that fit under the SDLC definition, all are based on... developed that provided expanded understanding of the domain, it is necessary to either update an existing domain model or create another domain

An application generator for rapid prototyping of Ada real-time control software

NASA Technical Reports Server (NTRS)

Johnson, Jim; Biglari, Haik; Lehman, Larry

1990-01-01

The need to increase engineering productivity and decrease software life cycle costs in real-time system development establishes a motivation for a method of rapid prototyping. The design by iterative rapid prototyping technique is described. A tool which facilitates such a design methodology for the generation of embedded control software is described.

Deep space network software cost estimation model

NASA Technical Reports Server (NTRS)

Tausworthe, R. C.

1981-01-01

A parametric software cost estimation model prepared for Jet PRopulsion Laboratory (JPL) Deep Space Network (DSN) Data System implementation tasks is described. The resource estimation mdel modifies and combines a number of existing models. The model calibrates the task magnitude and difficulty, development environment, and software technology effects through prompted responses to a set of approximately 50 questions. Parameters in the model are adjusted to fit JPL software life-cycle statistics.

A measurement system for large, complex software programs

NASA Technical Reports Server (NTRS)

Rone, Kyle Y.; Olson, Kitty M.; Davis, Nathan E.

1994-01-01

This paper describes measurement systems required to forecast, measure, and control activities for large, complex software development and support programs. Initial software cost and quality analysis provides the foundation for meaningful management decisions as a project evolves. In modeling the cost and quality of software systems, the relationship between the functionality, quality, cost, and schedule of the product must be considered. This explicit relationship is dictated by the criticality of the software being developed. This balance between cost and quality is a viable software engineering trade-off throughout the life cycle. Therefore, the ability to accurately estimate the cost and quality of software systems is essential to providing reliable software on time and within budget. Software cost models relate the product error rate to the percent of the project labor that is required for independent verification and validation. The criticality of the software determines which cost model is used to estimate the labor required to develop the software. Software quality models yield an expected error discovery rate based on the software size, criticality, software development environment, and the level of competence of the project and developers with respect to the processes being employed.

General object-oriented software development

NASA Technical Reports Server (NTRS)

Seidewitz, Edwin V.; Stark, Mike

1986-01-01

Object-oriented design techniques are gaining increasing popularity for use with the Ada programming language. A general approach to object-oriented design which synthesizes the principles of previous object-oriented methods into the overall software life-cycle, providing transitions from specification to design and from design to code. It therefore provides the basis for a general object-oriented development methodology.

NASA Software Safety Standard

NASA Technical Reports Server (NTRS)

Rosenberg, Linda

1997-01-01

If software is a critical element in a safety critical system, it is imperative to implement a systematic approach to software safety as an integral part of the overall system safety programs. The NASA-STD-8719.13A, "NASA Software Safety Standard", describes the activities necessary to ensure that safety is designed into software that is acquired or developed by NASA, and that safety is maintained throughout the software life cycle. A PDF version, is available on the WWW from Lewis. A Guidebook that will assist in the implementation of the requirements in the Safety Standard is under development at the Lewis Research Center (LeRC). After completion, it will also be available on the WWW from Lewis.

DOE Office of Scientific and Technical Information (OSTI.GOV)

None

An OpenStudio Measure is a script that can manipulate an OpenStudio model and associated data to apply energy conservation measures (ECMs), run supplemental simulations, or visualize simulation results. The OpenStudio software development kit (SDK) and accessibility of the Ruby scripting language makes measure authorship accessible to both software developers and energy modelers. This paper discusses the life cycle of an OpenStudio Measure from development, testing, and distribution, to application.

DbMap: improving database interoperability issues in medical software using a simple, Java-Xml based solution.

PubMed Central

Karadimas, H.; Hemery, F.; Roland, P.; Lepage, E.

2000-01-01

In medical software development, the use of databases plays a central role. However, most of the databases have heterogeneous encoding and data models. To deal with these variations in the application code directly is error-prone and reduces the potential reuse of the produced software. Several approaches to overcome these limitations have been proposed in the medical database literature, which will be presented. We present a simple solution, based on a Java library, and a central Metadata description file in XML. This development approach presents several benefits in software design and development cycles, the main one being the simplicity in maintenance. PMID:11079915

Ada developers' supplement to the recommended approach

NASA Technical Reports Server (NTRS)

Kester, Rush; Landis, Linda

1993-01-01

This document is a collection of guidelines for programmers and managers who are responsible for the development of flight dynamics applications in Ada. It is intended to be used in conjunction with the Recommended Approach to Software Development (SEL-81-305), which describes the software development life cycle, its products, reviews, methods, tools, and measures. The Ada Developers' Supplement provides additional detail on such topics as reuse, object-oriented analysis, and object-oriented design.

An Architecture, System Engineering, and Acquisition Approach for Space System Software Resiliency

NASA Astrophysics Data System (ADS)

Phillips, Dewanne Marie

Software intensive space systems can harbor defects and vulnerabilities that may enable external adversaries or malicious insiders to disrupt or disable system functions, risking mission compromise or loss. Mitigating this risk demands a sustained focus on the security and resiliency of the system architecture including software, hardware, and other components. Robust software engineering practices contribute to the foundation of a resilient system so that the system "can take a hit to a critical component and recover in a known, bounded, and generally acceptable period of time". Software resiliency must be a priority and addressed early in the life cycle development to contribute a secure and dependable space system. Those who develop, implement, and operate software intensive space systems must determine the factors and systems engineering practices to address when investing in software resiliency. This dissertation offers methodical approaches for improving space system resiliency through software architecture design, system engineering, increased software security, thereby reducing the risk of latent software defects and vulnerabilities. By providing greater attention to the early life cycle phases of development, we can alter the engineering process to help detect, eliminate, and avoid vulnerabilities before space systems are delivered. To achieve this objective, this dissertation will identify knowledge, techniques, and tools that engineers and managers can utilize to help them recognize how vulnerabilities are produced and discovered so that they can learn to circumvent them in future efforts. We conducted a systematic review of existing architectural practices, standards, security and coding practices, various threats, defects, and vulnerabilities that impact space systems from hundreds of relevant publications and interviews of subject matter experts. We expanded on the system-level body of knowledge for resiliency and identified a new software architecture framework and acquisition methodology to improve the resiliency of space systems from a software perspective with an emphasis on the early phases of the systems engineering life cycle. This methodology involves seven steps: 1) Define technical resiliency requirements, 1a) Identify standards/policy for software resiliency, 2) Develop a request for proposal (RFP)/statement of work (SOW) for resilient space systems software, 3) Define software resiliency goals for space systems, 4) Establish software resiliency quality attributes, 5) Perform architectural tradeoffs and identify risks, 6) Conduct architecture assessments as part of the procurement process, and 7) Ascertain space system software architecture resiliency metrics. Data illustrates that software vulnerabilities can lead to opportunities for malicious cyber activities, which could degrade the space mission capability for the user community. Reducing the number of vulnerabilities by improving architecture and software system engineering practices can contribute to making space systems more resilient. Since cyber-attacks are enabled by shortfalls in software, robust software engineering practices and an architectural design are foundational to resiliency, which is a quality that allows the system to "take a hit to a critical component and recover in a known, bounded, and generally acceptable period of time". To achieve software resiliency for space systems, acquirers and suppliers must identify relevant factors and systems engineering practices to apply across the lifecycle, in software requirements analysis, architecture development, design, implementation, verification and validation, and maintenance phases.

Software Process Assurance for Complex Electronics

NASA Technical Reports Server (NTRS)

Plastow, Richard A.

2007-01-01

Complex Electronics (CE) now perform tasks that were previously handled in software, such as communication protocols. Many methods used to develop software bare a close resemblance to CE development. Field Programmable Gate Arrays (FPGAs) can have over a million logic gates while system-on-chip (SOC) devices can combine a microprocessor, input and output channels, and sometimes an FPGA for programmability. With this increased intricacy, the possibility of software-like bugs such as incorrect design, logic, and unexpected interactions within the logic is great. With CE devices obscuring the hardware/software boundary, we propose that mature software methodologies may be utilized with slight modifications in the development of these devices. Software Process Assurance for Complex Electronics (SPACE) is a research project that used standardized S/W Assurance/Engineering practices to provide an assurance framework for development activities. Tools such as checklists, best practices and techniques were used to detect missing requirements and bugs earlier in the development cycle creating a development process for CE that was more easily maintained, consistent and configurable based on the device used.

3D graphics hardware accelerator programming methods for real-time visualization systems

NASA Astrophysics Data System (ADS)

Souetov, Andrew E.

2001-02-01

The paper deals with new approaches in software design for creating real-time applications that use modern graphics acceleration hardware. The growing complexity of such type of software compels programmers to use different types of CASE systems in design and development process. The subject under discussion is integration of such systems in a development process, their effective use, and the combination of these new methods with the necessity to produce optimal codes. A method of simulation integration and modeling tools in real-time software development cycle is described.

3D graphics hardware accelerator programming methods for real-time visualization systems

NASA Astrophysics Data System (ADS)

Souetov, Andrew E.

2000-02-01

The paper deals with new approaches in software design for creating real-time applications that use modern graphics acceleration hardware. The growing complexity of such type of software compels programmers to use different types of CASE systems in design and development process. The subject under discussion is integration of such systems in a development process, their effective use, and the combination of these new methods with the necessity to produce optimal codes. A method of simulation integration and modeling tools in real-time software development cycle is described.

Software life cycle methodologies and environments

NASA Technical Reports Server (NTRS)

Fridge, Ernest

1991-01-01

Products of this project will significantly improve the quality and productivity of Space Station Freedom Program software processes by: improving software reliability and safety; and broadening the range of problems that can be solved with computational solutions. Projects brings in Computer Aided Software Engineering (CASE) technology for: Environments such as Engineering Script Language/Parts Composition System (ESL/PCS) application generator, Intelligent User Interface for cost avoidance in setting up operational computer runs, Framework programmable platform for defining process and software development work flow control, Process for bringing CASE technology into an organization's culture, and CLIPS/CLIPS Ada language for developing expert systems; and methodologies such as Method for developing fault tolerant, distributed systems and a method for developing systems for common sense reasoning and for solving expert systems problems when only approximate truths are known.

Software safety - A user's practical perspective

NASA Technical Reports Server (NTRS)

Dunn, William R.; Corliss, Lloyd D.

1990-01-01

Software safety assurance philosophy and practices at the NASA Ames are discussed. It is shown that, to be safe, software must be error-free. Software developments on two digital flight control systems and two ground facility systems are examined, including the overall system and software organization and function, the software-safety issues, and their resolution. The effectiveness of safety assurance methods is discussed, including conventional life-cycle practices, verification and validation testing, software safety analysis, and formal design methods. It is concluded (1) that a practical software safety technology does not yet exist, (2) that it is unlikely that a set of general-purpose analytical techniques can be developed for proving that software is safe, and (3) that successful software safety-assurance practices will have to take into account the detailed design processes employed and show that the software will execute correctly under all possible conditions.

Software Development: A Product Life-Cycle Perspective

DTIC Science & Technology

1990-05-01

management came from these magazines and journals: Journal of Advertising Research , Business Marketing, Journal of Systems Manaament, nural Marketing...Johanna. "Price is More Sensitive." Software Magazine, March 1988, 44. Andrews, Kirby. "Communications Imperatives for New Products." Journal of Advertising Research , October

Cyber security best practices for the nuclear industry

DOE Office of Scientific and Technical Information (OSTI.GOV)

Badr, I.

2012-07-01

When deploying software based systems, such as, digital instrumentation and controls for the nuclear industry, it is vital to include cyber security assessment as part of architecture and development process. When integrating and delivering software-intensive systems for the nuclear industry, engineering teams should make use of a secure, requirements driven, software development life cycle, ensuring security compliance and optimum return on investment. Reliability protections, data loss prevention, and privacy enforcement provide a strong case for installing strict cyber security policies. (authors)

ENCOMPASS: A SAGA based environment for the compositon of programs and specifications, appendix A

NASA Technical Reports Server (NTRS)

Terwilliger, Robert B.; Campbell, Roy H.

1985-01-01

ENCOMPASS is an example integrated software engineering environment being constructed by the SAGA project. ENCOMPASS supports the specification, design, construction and maintenance of efficient, validated, and verified programs in a modular programming language. The life cycle paradigm, schema of software configurations, and hierarchical library structure used by ENCOMPASS is presented. In ENCOMPASS, the software life cycle is viewed as a sequence of developments, each of which reuses components from the previous ones. Each development proceeds through the phases planning, requirements definition, validation, design, implementation, and system integration. The components in a software system are modeled as entities which have relationships between them. An entity may have different versions and different views of the same project are allowed. The simple entities supported by ENCOMPASS may be combined into modules which may be collected into projects. ENCOMPASS supports multiple programmers and projects using a hierarchical library system containing a workspace for each programmer; a project library for each project, and a global library common to all projects.

Development of a Unix/VME data acquisition system

NASA Astrophysics Data System (ADS)

Miller, M. C.; Ahern, S.; Clark, S. M.

1992-01-01

The current status of a Unix-based VME data acquisition development project is described. It is planned to use existing Fortran data collection software to drive the existing CAMAC electronics via a VME CAMAC branch driver card and associated Daresbury Unix driving software. The first usable Unix driver has been written and produces single-action CAMAC cycles from test software. The data acquisition code has been implemented in test mode under Unix with few problems and effort is now being directed toward finalizing calls to the CAMAC-driving software and ultimate evaluation of the complete system.

Power generation using sugar cane bagasse: A heat recovery analysis

NASA Astrophysics Data System (ADS)

Seguro, Jean Vittorio

The sugar industry is facing the need to improve its performance by increasing efficiency and developing profitable by-products. An important possibility is the production of electrical power for sale. Co-generation has been practiced in the sugar industry for a long time in a very inefficient way with the main purpose of getting rid of the bagasse. The goal of this research was to develop a software tool that could be used to improve the way that bagasse is used to generate power. Special focus was given to the heat recovery components of the co-generation plant (economizer, air pre-heater and bagasse dryer) to determine if one, or a combination, of them led to a more efficient co-generation cycle. An extensive review of the state of the art of power generation in the sugar industry was conducted and is summarized in this dissertation. Based on this models were developed. After testing the models and comparing the results with the data collected from the literature, a software application that integrated all these models was developed to simulate the complete co-generation plant. Seven different cycles, three different pressures, and sixty-eight distributions of the flue gas through the heat recovery components can be simulated. The software includes an economic analysis tool that can help the designer determine the economic feasibility of different options. Results from running the simulation are presented that demonstrate its effectiveness in evaluating and comparing the different heat recovery components and power generation cycles. These results indicate that the economizer is the most beneficial option for heat recovery and that the use of waste heat in a bagasse dryer is the least desirable option. Quantitative comparisons of several possible cycle options with the widely-used traditional back-pressure turbine cycle are given. These indicate that a double extraction condensing cycle is best for co-generation purposes. Power generation gains between 40 and 100% are predicted for some cycles with the addition of optimum heat recovery systems.

Information System Life-Cycle And Documentation Standards (SMAP DIDS)

NASA Technical Reports Server (NTRS)

1990-01-01

Although not computer program, SMAP DIDS written to provide systematic, NASA-wide structure for documenting information system development projects. Each DID (data item description) outlines document required for top-quality software development. When combined with management, assurance, and life cycle standards, Standards protect all parties who participate in design and operation of new information system.

Evaluating Managerial Styles for System Development Life Cycle Stages to Ensure Software Project Success

ERIC Educational Resources Information Center

Kocherla, Showry

2012-01-01

Information technology (IT) projects are considered successful if they are completed on time, within budget, and within scope. Even though, the required tools and methodologies are in place, IT projects continue to fail at a higher rate. Current literature lacks explanation for success within the stages of system development life-cycle (SDLC) such…

Knowledge-Based Aircraft Automation: Managers Guide on the use of Artificial Intelligence for Aircraft Automation and Verification and Validation Approach for a Neural-Based Flight Controller

NASA Technical Reports Server (NTRS)

Broderick, Ron

1997-01-01

The ultimate goal of this report was to integrate the powerful tools of artificial intelligence into the traditional process of software development. To maintain the US aerospace competitive advantage, traditional aerospace and software engineers need to more easily incorporate the technology of artificial intelligence into the advanced aerospace systems being designed today. The future goal was to transition artificial intelligence from an emerging technology to a standard technology that is considered early in the life cycle process to develop state-of-the-art aircraft automation systems. This report addressed the future goal in two ways. First, it provided a matrix that identified typical aircraft automation applications conducive to various artificial intelligence methods. The purpose of this matrix was to provide top-level guidance to managers contemplating the possible use of artificial intelligence in the development of aircraft automation. Second, the report provided a methodology to formally evaluate neural networks as part of the traditional process of software development. The matrix was developed by organizing the discipline of artificial intelligence into the following six methods: logical, object representation-based, distributed, uncertainty management, temporal and neurocomputing. Next, a study of existing aircraft automation applications that have been conducive to artificial intelligence implementation resulted in the following five categories: pilot-vehicle interface, system status and diagnosis, situation assessment, automatic flight planning, and aircraft flight control. The resulting matrix provided management guidance to understand artificial intelligence as it applied to aircraft automation. The approach taken to develop a methodology to formally evaluate neural networks as part of the software engineering life cycle was to start with the existing software quality assurance standards and to change these standards to include neural network development. The changes were to include evaluation tools that can be applied to neural networks at each phase of the software engineering life cycle. The result was a formal evaluation approach to increase the product quality of systems that use neural networks for their implementation.

Section 508 Electronic Information Accessibility Requirements for Software Development

NASA Technical Reports Server (NTRS)

Ellis, Rebecca

2014-01-01

Section 508 Subpart B 1194.21 outlines requirements for operating system and software development in order to create a product that is accessible to users with various disabilities. This portion of Section 508 contains a variety of standards to enable those using assistive technology and with visual, hearing, cognitive and motor difficulties to access all information provided in software. The focus on requirements was limited to the Microsoft Windows® operating system as it is the predominant operating system used at this center. Compliance with this portion of the requirements can be obtained by integrating the requirements into the software development cycle early and by remediating issues in legacy software if possible. There are certain circumstances with software that may arise necessitating an exemption from these requirements, such as design or engineering software using dynamically changing graphics or numbers to convey information. These exceptions can be discussed with the Section 508 Coordinator and another method of accommodation used.

Statistics of software vulnerability detection in certification testing

NASA Astrophysics Data System (ADS)

Barabanov, A. V.; Markov, A. S.; Tsirlov, V. L.

2018-05-01

The paper discusses practical aspects of introduction of the methods to detect software vulnerability in the day-to-day activities of the accredited testing laboratory. It presents the approval results of the vulnerability detection methods as part of the study of the open source software and the software that is a test object of the certification tests under information security requirements, including software for communication networks. Results of the study showing the allocation of identified vulnerabilities by types of attacks, country of origin, programming languages used in the development, methods for detecting vulnerability, etc. are given. The experience of foreign information security certification systems related to the detection of certified software vulnerabilities is analyzed. The main conclusion based on the study is the need to implement practices for developing secure software in the development life cycle processes. The conclusions and recommendations for the testing laboratories on the implementation of the vulnerability analysis methods are laid down.

Transportable Payload Operations Control Center reusable software: Building blocks for quality ground data systems

NASA Technical Reports Server (NTRS)

Mahmot, Ron; Koslosky, John T.; Beach, Edward; Schwarz, Barbara

1994-01-01

The Mission Operations Division (MOD) at Goddard Space Flight Center builds Mission Operations Centers which are used by Flight Operations Teams to monitor and control satellites. Reducing system life cycle costs through software reuse has always been a priority of the MOD. The MOD's Transportable Payload Operations Control Center development team established an extensive library of 14 subsystems with over 100,000 delivered source instructions of reusable, generic software components. Nine TPOCC-based control centers to date support 11 satellites and achieved an average software reuse level of more than 75 percent. This paper shares experiences of how the TPOCC building blocks were developed and how building block developer's, mission development teams, and users are all part of the process.

Automated Translation of Safety Critical Application Software Specifications into PLC Ladder Logic

NASA Technical Reports Server (NTRS)

Leucht, Kurt W.; Semmel, Glenn S.

2008-01-01

The numerous benefits of automatic application code generation are widely accepted within the software engineering community. A few of these benefits include raising the abstraction level of application programming, shorter product development time, lower maintenance costs, and increased code quality and consistency. Surprisingly, code generation concepts have not yet found wide acceptance and use in the field of programmable logic controller (PLC) software development. Software engineers at the NASA Kennedy Space Center (KSC) recognized the need for PLC code generation while developing their new ground checkout and launch processing system. They developed a process and a prototype software tool that automatically translates a high-level representation or specification of safety critical application software into ladder logic that executes on a PLC. This process and tool are expected to increase the reliability of the PLC code over that which is written manually, and may even lower life-cycle costs and shorten the development schedule of the new control system at KSC. This paper examines the problem domain and discusses the process and software tool that were prototyped by the KSC software engineers.

Functional description of the ISIS system

NASA Technical Reports Server (NTRS)

Berman, W. J.

1979-01-01

Development of software for avionic and aerospace applications (flight software) is influenced by a unique combination of factors which includes: (1) length of the life cycle of each project; (2) necessity for cooperation between the aerospace industry and NASA; (3) the need for flight software that is highly reliable; (4) the increasing complexity and size of flight software; and (5) the high quality of the programmers and the tightening of project budgets. The interactive software invocation system (ISIS) which is described is designed to overcome the problems created by this combination of factors.

Analysis and specification tools in relation to the APSE

NASA Technical Reports Server (NTRS)

Hendricks, John W.

1986-01-01

Ada and the Ada Programming Support Environment (APSE) specifically address the phases of the system/software life cycle which follow after the user's problem was translated into system and software development specifications. The waterfall model of the life cycle identifies the analysis and requirements definition phases as preceeding program design and coding. Since Ada is a programming language and the APSE is a programming support environment, they are primarily targeted to support program (code) development, tecting, and maintenance. The use of Ada based or Ada related specification languages (SLs) and program design languages (PDLs) can extend the use of Ada back into the software design phases of the life cycle. Recall that the standardization of the APSE as a programming support environment is only now happening after many years of evolutionary experience with diverse sets of programming support tools. Restricting consideration to one, or even a few chosen specification and design tools, could be a real mistake for an organization or a major project such as the Space Station, which will need to deal with an increasingly complex level of system problems. To require that everything be Ada-like, be implemented in Ada, run directly under the APSE, and fit into a rigid waterfall model of the life cycle would turn a promising support environment into a straight jacket for progress.

Behavior driven testing in ALMA telescope calibration software

NASA Astrophysics Data System (ADS)

Gil, Juan P.; Garces, Mario; Broguiere, Dominique; Shen, Tzu-Chiang

2016-07-01

ALMA software development cycle includes well defined testing stages that involves developers, testers and scientists. We adapted Behavior Driven Development (BDD) to testing activities applied to Telescope Calibration (TELCAL) software. BDD is an agile technique that encourages communication between roles by defining test cases using natural language to specify features and scenarios, what allows participants to share a common language and provides a high level set of automated tests. This work describes how we implemented and maintain BDD testing for TELCAL, the infrastructure needed to support it and proposals to expand this technique to other subsystems.

Assurance of Complex Electronics. What Path Do We Take?

NASA Technical Reports Server (NTRS)

Plastow, Richard A.

2007-01-01

Many of the methods used to develop software bare a close resemblance to Complex Electronics (CE) development. CE are now programmed to perform tasks that were previously handled in software, such as communication protocols. For instance, Field Programmable Gate Arrays (FPGAs) can have over a million logic gates while system-on-chip (SOC) devices can combine a microprocessor, input and output channels, and sometimes an FPGA for programmability. With this increased intricacy, the possibility of "software-like" bugs such as incorrect design, logic, and unexpected interactions within the logic is great. Since CE devices are obscuring the hardware/software boundary, we propose that mature software methodologies may be utilized with slight modifications to develop these devices. By using standardized S/W Engineering methods such as checklists, missing requirements and "bugs" can be detected earlier in the development cycle, thus creating a development process for CE that will be easily maintained and configurable based on the device used.

A Reference Model for Software and System Inspections. White Paper

NASA Technical Reports Server (NTRS)

He, Lulu; Shull, Forrest

2009-01-01

Software Quality Assurance (SQA) is an important component of the software development process. SQA processes provide assurance that the software products and processes in the project life cycle conform to their specified requirements by planning, enacting, and performing a set of activities to provide adequate confidence that quality is being built into the software. Typical techniques include: (1) Testing (2) Simulation (3) Model checking (4) Symbolic execution (5) Management reviews (6) Technical reviews (7) Inspections (8) Walk-throughs (9) Audits (10) Analysis (complexity analysis, control flow analysis, algorithmic analysis) (11) Formal method Our work over the last few years has resulted in substantial knowledge about SQA techniques, especially the areas of technical reviews and inspections. But can we apply the same QA techniques to the system development process? If yes, what kind of tailoring do we need before applying them in the system engineering context? If not, what types of QA techniques are actually used at system level? And, is there any room for improvement.) After a brief examination of the system engineering literature (especially focused on NASA and DoD guidance) we found that: (1) System and software development process interact with each other at different phases through development life cycle (2) Reviews are emphasized in both system and software development. (Figl.3). For some reviews (e.g. SRR, PDR, CDR), there are both system versions and software versions. (3) Analysis techniques are emphasized (e.g. Fault Tree Analysis, Preliminary Hazard Analysis) and some details are given about how to apply them. (4) Reviews are expected to use the outputs of the analysis techniques. In other words, these particular analyses are usually conducted in preparation for (before) reviews. The goal of our work is to explore the interaction between the Quality Assurance (QA) techniques at the system level and the software level.

Process Improvement Should Link to Security: SEPG 2007 Security Track Recap

DTIC Science & Technology

2007-09-01

the Systems Security Engineering Capability Maturity Model (SSE- CMM / ISO 21827) and its use in system software developments ...software development life cycle ( SDLC )? 6. In what ways should process improvement support security in the SDLC ? 1.2 10BPANEL RESOURCES For each... project management, and support practices through the use of the capability maturity models including the CMMI and the Systems Security

Product specification documentation standard and Data Item Descriptions (DID). Volume of the information system life-cycle and documentation standards, volume 3

NASA Technical Reports Server (NTRS)

Callender, E. David; Steinbacher, Jody

1989-01-01

This is the third of five volumes on Information System Life-Cycle and Documentation Standards which present a well organized, easily used standard for providing technical information needed for developing information systems, components, and related processes. This volume states the Software Management and Assurance Program documentation standard for a product specification document and for data item descriptions. The framework can be applied to any NASA information system, software, hardware, operational procedures components, and related processes.

Software Process Assurance for Complex Electronics (SPACE)

NASA Technical Reports Server (NTRS)

Plastow, Richard A.

2007-01-01

Complex Electronics (CE) are now programmed to perform tasks that were previously handled in software, such as communication protocols. Many of the methods used to develop software bare a close resemblance to CE development. For instance, Field Programmable Gate Arrays (FPGAs) can have over a million logic gates while system-on-chip (SOC) devices can combine a microprocessor, input and output channels, and sometimes an FPGA for programmability. With this increased intricacy, the possibility of software-like bugs such as incorrect design, logic, and unexpected interactions within the logic is great. Since CE devices are obscuring the hardware/software boundary, we propose that mature software methodologies may be utilized with slight modifications in the development of these devices. Software Process Assurance for Complex Electronics (SPACE) is a research project that looks at using standardized S/W Assurance/Engineering practices to provide an assurance framework for development activities. Tools such as checklists, best practices and techniques can be used to detect missing requirements and bugs earlier in the development cycle creating a development process for CE that will be more easily maintained, consistent and configurable based on the device used.

Florida specific NTCIP MIB development for actuated signal controller (ASC), closed-circuit television (CCTV), and center-to-center (C2C) communications with SunGuideSM software and ITS device test procedure development : technical report documentation pa

DOT National Transportation Integrated Search

2009-06-30

The project has been focused on National Transportation Communications for ITS Protocol : (NTCIP) research and testing across the entire life cycle of traffic operations, ITS, and statewide : communications deployments. This life cycle includes desig...

Adopting Open Source Software to Address Software Risks during the Scientific Data Life Cycle

NASA Astrophysics Data System (ADS)

Vinay, S.; Downs, R. R.

2012-12-01

Software enables the creation, management, storage, distribution, discovery, and use of scientific data throughout the data lifecycle. However, the capabilities offered by software also present risks for the stewardship of scientific data, since future access to digital data is dependent on the use of software. From operating systems to applications for analyzing data, the dependence of data on software presents challenges for the stewardship of scientific data. Adopting open source software provides opportunities to address some of the proprietary risks of data dependence on software. For example, in some cases, open source software can be deployed to avoid licensing restrictions for using, modifying, and transferring proprietary software. The availability of the source code of open source software also enables the inclusion of modifications, which may be contributed by various community members who are addressing similar issues. Likewise, an active community that is maintaining open source software can be a valuable source of help, providing an opportunity to collaborate to address common issues facing adopters. As part of the effort to meet the challenges of software dependence for scientific data stewardship, risks from software dependence have been identified that exist during various times of the data lifecycle. The identification of these risks should enable the development of plans for mitigating software dependencies, where applicable, using open source software, and to improve understanding of software dependency risks for scientific data and how they can be reduced during the data life cycle.

Software engineering and simulation

NASA Technical Reports Server (NTRS)

Zhang, Shou X.; Schroer, Bernard J.; Messimer, Sherri L.; Tseng, Fan T.

1990-01-01

This paper summarizes the development of several automatic programming systems for discrete event simulation. Emphasis is given on the model development, or problem definition, and the model writing phases of the modeling life cycle.

Information systems analysis approach in hospitals: a national survey.

PubMed

Wong, B K; Sellaro, C L; Monaco, J A

1995-03-01

A survey of 216 hospitals reveals that some hospitals do not conduct cost-benefit analyses or analyze possible adverse effects in feasibility studies. In determining and analyzing system requirements, external factors that initiate the transaction are not examined, and computer-aided software engineering (CASE) tools are seldom used. Some hospitals do not investigate the advantages and disadvantages of using in-house-developed software versus purchased software packages in the evaluation of alternatives. The survey finds that, overall, most hospitals follow the traditional systems development life cycle (SDLC) approach in analyzing information systems.

Trends in computer hardware and software.

PubMed

Frankenfeld, F M

1993-04-01

Previously identified and current trends in the development of computer systems and in the use of computers for health care applications are reviewed. Trends identified in a 1982 article were increasing miniaturization and archival ability, increasing software costs, increasing software independence, user empowerment through new software technologies, shorter computer-system life cycles, and more rapid development and support of pharmaceutical services. Most of these trends continue today. Current trends in hardware and software include the increasing use of reduced instruction-set computing, migration to the UNIX operating system, the development of large software libraries, microprocessor-based smart terminals that allow remote validation of data, speech synthesis and recognition, application generators, fourth-generation languages, computer-aided software engineering, object-oriented technologies, and artificial intelligence. Current trends specific to pharmacy and hospitals are the withdrawal of vendors of hospital information systems from the pharmacy market, improved linkage of information systems within hospitals, and increased regulation by government. The computer industry and its products continue to undergo dynamic change. Software development continues to lag behind hardware, and its high cost is offsetting the savings provided by hardware.

Applying an MVC Framework for The System Development Life Cycle with Waterfall Model Extended

NASA Astrophysics Data System (ADS)

Hardyanto, W.; Purwinarko, A.; Sujito, F.; Masturi; Alighiri, D.

2017-04-01

This paper describes the extension of the waterfall model using MVC architectural pattern for software development. The waterfall model is the based model of the most widely used in software development, yet there are still many problems in it. The general issue usually happens on data changes that cause the delays on the process itself. On the other hand, the security factor on the software as well as one of the major problems. This study uses PHP programming language for implementation. Although this model can be implemented in several programming languages with the same concept. This study is based on MVC architecture so that it can improve the performance of both software development and maintenance, especially concerning security, validation, database access, and routing.

Ruby on Rails Issue Tracker

NASA Technical Reports Server (NTRS)

Rodriguez, Juan Jared

2014-01-01

The purpose of this report is to detail the tasks accomplished as a NASA NIFS intern for the summer 2014 session. This internship opportunity is to develop an issue tracker Ruby on Rails web application to improve the communication of developmental anomalies between the Support Software Computer Software Configuration Item (CSCI) teams, System Build and Information Architecture. As many may know software development is an arduous, time consuming, collaborative effort. It involves nearly as much work designing, planning, collaborating, discussing, and resolving issues as effort expended in actual development. This internship opportunity was put in place to help alleviate the amount of time spent discussing issues such as bugs, missing tests, new requirements, and usability concerns that arise during development and throughout the life cycle of software applications once in production.

Table-driven configuration and formatting of telemetry data in the Deep Space Network

NASA Technical Reports Server (NTRS)

Manning, Evan

1994-01-01

With a restructured software architecture for telemetry system control and data processing, the NASA/Deep Space Network (DSN) has substantially improved its ability to accommodate a wide variety of spacecraft in an era of 'better, faster, cheaper'. In the new architecture, the permanent software implements all capabilities needed by any system user, and text tables specify how these capabilities are to be used for each spacecraft. Most changes can now be made rapidly, outside of the traditional software development cycle. The system can be updated to support a new spacecraft through table changes rather than software changes, reducing the implementation, test, and delivery cycle for such a change from three months to three weeks. The mechanical separation of the text table files from the program software, with tables only loaded into memory when that mission is being supported, dramatically reduces the level of regression testing required. The format of each table is a different compromise between ease of human interpretation, efficiency of computer interpretation, and flexibility.

Cleared Hot: A Forward Air Control (Airborne) Concepts Trainer

DTIC Science & Technology

2006-09-01

list of high-level objectives imitating a detailed requirements document. In those cases, software developers are forced to make best guesses about...software developers are forced to make best guesses about how to meet those objectives. Is there a better method? We embarked on a project to create a...with participants at the end of an 18-month development cycle, we did the next best thing: Cleared Hot was taken to the mission subject matter

Life Cycle Assessment Software for Product and Process Sustainability Analysis

ERIC Educational Resources Information Center

Vervaeke, Marina

2012-01-01

In recent years, life cycle assessment (LCA), a methodology for assessment of environmental impacts of products and services, has become increasingly important. This methodology is applied by decision makers in industry and policy, product developers, environmental managers, and other non-LCA specialists working on environmental issues in a wide…

Software Configuration Management Across Project Boundaries and In Distributed Development Environments.

DTIC Science & Technology

1984-01-01

between projects and between host development systems, and between projects, using an integrated Programming Support Environment. The discussion assumes...the availability of some of the facilities that were proposed for inclusion in the UK CHAPSE (CHILL Ada Programming Support Environment). C’ Accession...life cycle of a product. In a programming support envirorment (PSE) with an underlying database, the software can be stored in the databave and

Software life cycle dynamic simulation model: The organizational performance submodel

NASA Technical Reports Server (NTRS)

Tausworthe, Robert C.

1985-01-01

The submodel structure of a software life cycle dynamic simulation model is described. The software process is divided into seven phases, each with product, staff, and funding flows. The model is subdivided into an organizational response submodel, a management submodel, a management influence interface, and a model analyst interface. The concentration here is on the organizational response model, which simulates the performance characteristics of a software development subject to external and internal influences. These influences emanate from two sources: the model analyst interface, which configures the model to simulate the response of an implementing organization subject to its own internal influences, and the management submodel that exerts external dynamic control over the production process. A complete characterization is given of the organizational response submodel in the form of parameterized differential equations governing product, staffing, and funding levels. The parameter values and functions are allocated to the two interfaces.

Ada education in a software life-cycle context

NASA Technical Reports Server (NTRS)

Clough, Anne J.

1986-01-01

Some of the experience gained from a comprehensive educational program undertaken at The Charles Stark Draper Lab. to introduce the Ada language and to transition modern software engineering technology into the development of Ada and non-Ada applications is described. Initially, a core group, which included manager, engineers and programmers, received training in Ada. An Ada Office was established to assume the major responsibility for training, evaluation, acquisition and benchmarking of tools, and consultation on Ada projects. As a first step in this process, and in-house educational program was undertaken to introduce Ada to the Laboratory. Later, a software engineering course was added to the educational program as the need to address issues spanning the entire software life cycle became evident. Educational efforts to date are summarized, with an emphasis on the educational approach adopted. Finally, lessons learned in administering this program are addressed.

Improving software quality - The use of formal inspections at the Jet Propulsion Laboratory

NASA Technical Reports Server (NTRS)

Bush, Marilyn

1990-01-01

The introduction of software formal inspections (Fagan Inspections) at JPL for finding and fixing defects early in the software development life cycle are reviewed. It is estimated that, by the year 2000, some software efforts will rise to as much as 80 percent of the total. Software problems are especially important at NASA as critical flight software must be error-free. It is shown that formal inspections are particularly effective at finding and removing defects having to do with clarity, correctness, consistency, and completeness. A very significant discovery was that code audits were not as effective at finding defects as code inspections.

Artificial Intelligence Software Engineering (AISE) model

NASA Technical Reports Server (NTRS)

Kiss, Peter A.

1990-01-01

The American Institute of Aeronautics and Astronautics has initiated a committee on standards for Artificial Intelligence. Presented are the initial efforts of one of the working groups of that committee. A candidate model is presented for the development life cycle of knowledge based systems (KBSs). The intent is for the model to be used by the aerospace community and eventually be evolved into a standard. The model is rooted in the evolutionary model, borrows from the spiral model, and is embedded in the standard Waterfall model for software development. Its intent is to satisfy the development of both stand-alone and embedded KBSs. The phases of the life cycle are shown and detailed as are the review points that constitute the key milestones throughout the development process. The applicability and strengths of the model are discussed along with areas needing further development and refinement by the aerospace community.

Software engineering and the role of Ada: Executive seminar

NASA Technical Reports Server (NTRS)

Freedman, Glenn B.

1987-01-01

The objective was to introduce the basic terminology and concepts of software engineering and Ada. The life cycle model is reviewed. The application of the goals and principles of software engineering is applied. An introductory understanding of the features of the Ada language is gained. Topics addressed include: the software crises; the mandate of the Space Station Program; software life cycle model; software engineering; and Ada under the software engineering umbrella.

The advanced software development workstation project

NASA Technical Reports Server (NTRS)

Fridge, Ernest M., III; Pitman, Charles L.

1991-01-01

The Advanced Software Development Workstation (ASDW) task is researching and developing the technologies required to support Computer Aided Software Engineering (CASE) with the emphasis on those advanced methods, tools, and processes that will be of benefit to support all NASA programs. Immediate goals are to provide research and prototype tools that will increase productivity, in the near term, in projects such as the Software Support Environment (SSE), the Space Station Control Center (SSCC), and the Flight Analysis and Design System (FADS) which will be used to support the Space Shuttle and Space Station Freedom. Goals also include providing technology for development, evolution, maintenance, and operations. The technologies under research and development in the ASDW project are targeted to provide productivity enhancements during the software life cycle phase of enterprise and information system modeling, requirements generation and analysis, system design and coding, and system use and maintenance. On-line user's guides will assist users in operating the developed information system with knowledge base expert assistance.

pyam: Python Implementation of YaM

NASA Technical Reports Server (NTRS)

Myint, Steven; Jain, Abhinandan

2012-01-01

pyam is a software development framework with tools for facilitating the rapid development of software in a concurrent software development environment. pyam provides solutions for development challenges associated with software reuse, managing multiple software configurations, developing software product lines, and multiple platform development and build management. pyam uses release-early, release-often development cycles to allow developers to integrate their changes incrementally into the system on a continual basis. It facilitates the creation and merging of branches to support the isolated development of immature software to avoid impacting the stability of the development effort. It uses modules and packages to organize and share software across multiple software products, and uses the concepts of link and work modules to reduce sandbox setup times even when the code-base is large. One sidebenefit is the enforcement of a strong module-level encapsulation of a module s functionality and interface. This increases design transparency, system stability, and software reuse. pyam is written in Python and is organized as a set of utilities on top of the open source SVN software version control package. All development software is organized into a collection of modules. pyam packages are defined as sub-collections of the available modules. Developers can set up private sandboxes for module/package development. All module/package development takes place on private SVN branches. High-level pyam commands support the setup, update, and release of modules and packages. Released and pre-built versions of modules are available to developers. Developers can tailor the source/link module mix for their sandboxes so that new sandboxes (even large ones) can be built up easily and quickly by pointing to pre-existing module releases. All inter-module interfaces are publicly exported via links. A minimal, but uniform, convention is used for building modules.

Software development to support decision making in the selection of nursing diagnoses and interventions for children and adolescents1

PubMed Central

Silva, Kenya de Lima; Évora, Yolanda Dora Martinez; Cintra, Camila Santana Justo

2015-01-01

Objective: to report the development of a software to support decision-making for the selection of nursing diagnoses and interventions for children and adolescents, based on the nomenclature of nursing diagnoses, outcomes and interventions of a university hospital in Paraiba. Method: a methodological applied study based on software engineering, as proposed by Pressman, developed in three cycles, namely: flow chart construction, development of the navigation interface, and construction of functional expressions and programming development. Result: the software consists of administrative and nursing process screens. The assessment is automatically selected according to age group, the nursing diagnoses are suggested by the system after information is inserted, and can be indicated by the nurse. The interventions for the chosen diagnosis are selected by structuring the care plan. Conclusion: the development of this tool used to document the nursing actions will contribute to decision-making and quality of care. PMID:26487144

Software development to support decision making in the selection of nursing diagnoses and interventions for children and adolescents.

PubMed

Silva, Kenya de Lima; Évora, Yolanda Dora Martinez; Cintra, Camila Santana Justo

2015-01-01

to report the development of a software to support decision-making for the selection of nursing diagnoses and interventions for children and adolescents, based on the nomenclature of nursing diagnoses, outcomes and interventions of a university hospital in Paraiba. a methodological applied study based on software engineering, as proposed by Pressman, developed in three cycles, namely: flow chart construction, development of the navigation interface, and construction of functional expressions and programming development. the software consists of administrative and nursing process screens. The assessment is automatically selected according to age group, the nursing diagnoses are suggested by the system after information is inserted, and can be indicated by the nurse. The interventions for the chosen diagnosis are selected by structuring the care plan. the development of this tool used to document the nursing actions will contribute to decision-making and quality of care.

Enhancement/upgrade of Engine Structures Technology Best Estimator (EST/BEST) Software System

NASA Technical Reports Server (NTRS)

Shah, Ashwin

2003-01-01

This report describes the work performed during the contract period and the capabilities included in the EST/BEST software system. The developed EST/BEST software system includes the integrated NESSUS, IPACS, COBSTRAN, and ALCCA computer codes required to perform the engine cycle mission and component structural analysis. Also, the interactive input generator for NESSUS, IPACS, and COBSTRAN computer codes have been developed and integrated with the EST/BEST software system. The input generator allows the user to create input from scratch as well as edit existing input files interactively. Since it has been integrated with the EST/BEST software system, it enables the user to modify EST/BEST generated files and perform the analysis to evaluate the benefits. Appendix A gives details of how to use the newly added features in the EST/BEST software system.

Risk-Based Object Oriented Testing

NASA Technical Reports Server (NTRS)

Rosenberg, Linda H.; Stapko, Ruth; Gallo, Albert

2000-01-01

Software testing is a well-defined phase of the software development life cycle. Functional ("black box") testing and structural ("white box") testing are two methods of test case design commonly used by software developers. A lesser known testing method is risk-based testing, which takes into account the probability of failure of a portion of code as determined by its complexity. For object oriented programs, a methodology is proposed for identification of risk-prone classes. Risk-based testing is a highly effective testing technique that can be used to find and fix the most important problems as quickly as possible.

Economic Analysis of Complex Nuclear Fuel Cycles with NE-COST

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ganda, Francesco; Dixon, Brent; Hoffman, Edward

The purpose of this work is to present a new methodology, and associated computational tools, developed within the U.S. Department of Energy (U.S. DOE) Fuel Cycle Option Campaign to quantify the economic performance of complex nuclear fuel cycles. The levelized electricity cost at the busbar is generally chosen to quantify and compare the economic performance of different baseload generating technologies, including of nuclear: it is the cost of electricity which renders the risk-adjusted discounted net present value of the investment cash flow equal to zero. The work presented here is focused on the calculation of the levelized cost of electricitymore » of fuel cycles at mass balance equilibrium, which is termed LCAE (Levelized Cost of Electricity at Equilibrium). To alleviate the computational issues associated with the calculation of the LCAE for complex fuel cycles, a novel approach has been developed, which has been called the “island approach” because of its logical structure: a generic complex fuel cycle is subdivided into subsets of fuel cycle facilities, called islands, each containing one and only one type of reactor or blanket and an arbitrary number of fuel cycle facilities. A nuclear economic software tool, NE-COST, written in the commercial programming software MATLAB®, has been developed to calculate the LCAE of complex fuel cycles with the “island” computational approach. NE-COST has also been developed with the capability to handle uncertainty: the input parameters (both unit costs and fuel cycle characteristics) can have uncertainty distributions associated with them, and the output can be computed in terms of probability density functions of the LCAE. In this paper NE-COST will be used to quantify, as examples, the economic performance of (1) current Light Water Reactors (LWR) once-through systems; (2) continuous plutonium recycling in Fast Reactors (FR) with driver and blanket; (3) Recycling of plutonium bred in FR into LWR. For each fuel cycle, the contributions to the total LCAE of the main cost components will be identified.« less

Filling the Assurance Gap on Complex Electronics

NASA Technical Reports Server (NTRS)

Plastow, Richard A.

2007-01-01

Many of the methods used to develop software bare a close resemblance to Complex Electronics (CE) development. CE are now programmed to perform tasks that were previously handled by software, such as communication protocols. For example, the James Webb Space Telescope will use Field Programmable Gate Arrays (FPGAs), which can have over a million logic gates, to send telemetry. System-on-chip (SoC) devices, another type of complex electronics, can combine a microprocessor, input and output channels, and sometimes an FPGA for programmability. With this increased intricacy, the possibility of software-like bugs such as incorrect design, logic, and unexpected interactions within the logic is great. Since CE devices are obscuring the hardware/software boundary, mature software methodologies have been proposed, with slight modifications, to develop these devices. By using standardized S/W Engineering methods such as checklists, missing requirements and bugs can be detected earlier in the development cycle, thus creating a development process for CE that can be easily maintained and configurable based on the device used.

Towards surgeon-authored VR training: the scene-development cycle.

PubMed

Dindar, Saleh; Nguyen, Thien; Peters, Jörg

2016-01-01

Enabling surgeon-educators to themselves create virtual reality (VR) training units promises greater variety, specialization, and relevance of the units. This paper describes a software bridge that semi-automates the scene-generation cycle, a key bottleneck in authoring, modeling, and developing VR units. Augmenting an open source modeling environment with physical behavior attachment and collision specifications yields single-click testing of the full force-feedback enabled anatomical scene.

Carbon footprint estimator, phase II : volume II - technical appendices.

DOT National Transportation Integrated Search

2014-03-01

The GASCAP model was developed to provide a software tool for analysis of the life-cycle GHG : emissions associated with the construction and maintenance of transportation projects. This phase : of development included techniques for estimating emiss...

Carbon footprint estimator, phase II : volume I - GASCAP model.

DOT National Transportation Integrated Search

2014-03-01

The GASCAP model was developed to provide a software tool for analysis of the life-cycle GHG : emissions associated with the construction and maintenance of transportation projects. This phase : of development included techniques for estimating emiss...

An approach to software cost estimation

NASA Technical Reports Server (NTRS)

Mcgarry, F.; Page, J.; Card, D.; Rohleder, M.; Church, V.

1984-01-01

A general procedure for software cost estimation in any environment is outlined. The basic concepts of work and effort estimation are explained, some popular resource estimation models are reviewed, and the accuracy of source estimates is discussed. A software cost prediction procedure based on the experiences of the Software Engineering Laboratory in the flight dynamics area and incorporating management expertise, cost models, and historical data is described. The sources of information and relevant parameters available during each phase of the software life cycle are identified. The methodology suggested incorporates these elements into a customized management tool for software cost prediction. Detailed guidelines for estimation in the flight dynamics environment developed using this methodology are presented.

Designing for Change: Minimizing the Impact of Changing Requirements in the Later Stages of a Spaceflight Software Project

NASA Technical Reports Server (NTRS)

Allen, B. Danette

1998-01-01

In the traditional 'waterfall' model of the software project life cycle, the Requirements Phase ends and flows into the Design Phase, which ends and flows into the Development Phase. Unfortunately, the process rarely, if ever, works so smoothly in practice. Instead, software developers often receive new requirements, or modifications to the original requirements, well after the earlier project phases have been completed. In particular, projects with shorter than ideal schedules are highly susceptible to frequent requirements changes, as the software requirements analysis phase is often forced to begin before the overall system requirements and top-level design are complete. This results in later modifications to the software requirements, even though the software design and development phases may be complete. Requirements changes received in the later stages of a software project inevitably lead to modification of existing developed software. Presented here is a series of software design techniques that can greatly reduce the impact of last-minute requirements changes. These techniques were successfully used to add built-in flexibility to two complex software systems in which the requirements were expected to (and did) change frequently. These large, real-time systems were developed at NASA Langley Research Center (LaRC) to test and control the Lidar In-Space Technology Experiment (LITE) instrument which flew aboard the space shuttle Discovery as the primary payload on the STS-64 mission.

Software Reliability Analysis of NASA Space Flight Software: A Practical Experience

PubMed Central

Sukhwani, Harish; Alonso, Javier; Trivedi, Kishor S.; Mcginnis, Issac

2017-01-01

In this paper, we present the software reliability analysis of the flight software of a recently launched space mission. For our analysis, we use the defect reports collected during the flight software development. We find that this software was developed in multiple releases, each release spanning across all software life-cycle phases. We also find that the software releases were developed and tested for four different hardware platforms, spanning from off-the-shelf or emulation hardware to actual flight hardware. For releases that exhibit reliability growth or decay, we fit Software Reliability Growth Models (SRGM); otherwise we fit a distribution function. We find that most releases exhibit reliability growth, with Log-Logistic (NHPP) and S-Shaped (NHPP) as the best-fit SRGMs. For the releases that experience reliability decay, we investigate the causes for the same. We find that such releases were the first software releases to be tested on a new hardware platform, and hence they encountered major hardware integration issues. Also such releases seem to have been developed under time pressure in order to start testing on the new hardware platform sooner. Such releases exhibit poor reliability growth, and hence exhibit high predicted failure rate. Other problems include hardware specification changes and delivery delays from vendors. Thus, our analysis provides critical insights and inputs to the management to improve the software development process. As NASA has moved towards a product line engineering for its flight software development, software for future space missions will be developed in a similar manner and hence the analysis results for this mission can be considered as a baseline for future flight software missions. PMID:29278255

Software Reliability Analysis of NASA Space Flight Software: A Practical Experience.

PubMed

Sukhwani, Harish; Alonso, Javier; Trivedi, Kishor S; Mcginnis, Issac

2016-01-01

In this paper, we present the software reliability analysis of the flight software of a recently launched space mission. For our analysis, we use the defect reports collected during the flight software development. We find that this software was developed in multiple releases, each release spanning across all software life-cycle phases. We also find that the software releases were developed and tested for four different hardware platforms, spanning from off-the-shelf or emulation hardware to actual flight hardware. For releases that exhibit reliability growth or decay, we fit Software Reliability Growth Models (SRGM); otherwise we fit a distribution function. We find that most releases exhibit reliability growth, with Log-Logistic (NHPP) and S-Shaped (NHPP) as the best-fit SRGMs. For the releases that experience reliability decay, we investigate the causes for the same. We find that such releases were the first software releases to be tested on a new hardware platform, and hence they encountered major hardware integration issues. Also such releases seem to have been developed under time pressure in order to start testing on the new hardware platform sooner. Such releases exhibit poor reliability growth, and hence exhibit high predicted failure rate. Other problems include hardware specification changes and delivery delays from vendors. Thus, our analysis provides critical insights and inputs to the management to improve the software development process. As NASA has moved towards a product line engineering for its flight software development, software for future space missions will be developed in a similar manner and hence the analysis results for this mission can be considered as a baseline for future flight software missions.

Management plan documentation standard and Data Item Descriptions (DID). Volume of the information system life-cycle and documentation standards, volume 2

NASA Technical Reports Server (NTRS)

Callender, E. David; Steinbacher, Jody

1989-01-01

This is the second of five volumes of the Information System Life-Cycle and Documentation Standards. This volume provides a well-organized, easily used standard for management plans used in acquiring, assuring, and developing information systems and software, hardware, and operational procedures components, and related processes.

DDP - a tool for life-cycle risk management

NASA Technical Reports Server (NTRS)

Cornford, S. L.; Feather, M. S.; Hicks, K. A.

2001-01-01

At JPL we have developed, and implemented, a process for achieving life-cycle risk management. This process has been embodied in a software tool and is called Defect Detection and Prevention (DDP). The DDP process can be succinctly stated as: determine where we want to be, what could get in the way and how we will get there.

Implications of Responsive Space on the Flight Software Architecture

NASA Technical Reports Server (NTRS)

Wilmot, Jonathan

2006-01-01

The Responsive Space initiative has several implications for flight software that need to be addressed not only within the run-time element, but the development infrastructure and software life-cycle process elements as well. The runtime element must at a minimum support Plug & Play, while the development and process elements need to incorporate methods to quickly generate the needed documentation, code, tests, and all of the artifacts required of flight quality software. Very rapid response times go even further, and imply little or no new software development, requiring instead, using only predeveloped and certified software modules that can be integrated and tested through automated methods. These elements have typically been addressed individually with significant benefits, but it is when they are combined that they can have the greatest impact to Responsive Space. The Flight Software Branch at NASA's Goddard Space Flight Center has been developing the runtime, infrastructure and process elements needed for rapid integration with the Core Flight software System (CFS) architecture. The CFS architecture consists of three main components; the core Flight Executive (cFE), the component catalog, and the Integrated Development Environment (DE). This paper will discuss the design of the components, how they facilitate rapid integration, and lessons learned as the architecture is utilized for an upcoming spacecraft.

Deep space network software cost estimation model

NASA Technical Reports Server (NTRS)

Tausworthe, R. C.

1981-01-01

A parametric software cost estimation model prepared for Deep Space Network (DSN) Data Systems implementation tasks is presented. The resource estimation model incorporates principles and data from a number of existing models. The model calibrates task magnitude and difficulty, development environment, and software technology effects through prompted responses to a set of approximately 50 questions. Parameters in the model are adjusted to fit DSN software life cycle statistics. The estimation model output scales a standard DSN Work Breakdown Structure skeleton, which is then input into a PERT/CPM system, producing a detailed schedule and resource budget for the project being planned.

Cost-Sensitive Radial Basis Function Neural Network Classifier for Software Defect Prediction

PubMed Central

Venkatesan, R.

2016-01-01

Effective prediction of software modules, those that are prone to defects, will enable software developers to achieve efficient allocation of resources and to concentrate on quality assurance activities. The process of software development life cycle basically includes design, analysis, implementation, testing, and release phases. Generally, software testing is a critical task in the software development process wherein it is to save time and budget by detecting defects at the earliest and deliver a product without defects to the customers. This testing phase should be carefully operated in an effective manner to release a defect-free (bug-free) software product to the customers. In order to improve the software testing process, fault prediction methods identify the software parts that are more noted to be defect-prone. This paper proposes a prediction approach based on conventional radial basis function neural network (RBFNN) and the novel adaptive dimensional biogeography based optimization (ADBBO) model. The developed ADBBO based RBFNN model is tested with five publicly available datasets from the NASA data program repository. The computed results prove the effectiveness of the proposed ADBBO-RBFNN classifier approach with respect to the considered metrics in comparison with that of the early predictors available in the literature for the same datasets. PMID:27738649

Cost-Sensitive Radial Basis Function Neural Network Classifier for Software Defect Prediction.

PubMed

Kumudha, P; Venkatesan, R

Effective prediction of software modules, those that are prone to defects, will enable software developers to achieve efficient allocation of resources and to concentrate on quality assurance activities. The process of software development life cycle basically includes design, analysis, implementation, testing, and release phases. Generally, software testing is a critical task in the software development process wherein it is to save time and budget by detecting defects at the earliest and deliver a product without defects to the customers. This testing phase should be carefully operated in an effective manner to release a defect-free (bug-free) software product to the customers. In order to improve the software testing process, fault prediction methods identify the software parts that are more noted to be defect-prone. This paper proposes a prediction approach based on conventional radial basis function neural network (RBFNN) and the novel adaptive dimensional biogeography based optimization (ADBBO) model. The developed ADBBO based RBFNN model is tested with five publicly available datasets from the NASA data program repository. The computed results prove the effectiveness of the proposed ADBBO-RBFNN classifier approach with respect to the considered metrics in comparison with that of the early predictors available in the literature for the same datasets.

Touchscreen questionnaire patient data collection in rheumatology practice: development of a highly successful system using process redesign.

PubMed

Newman, Eric D; Lerch, Virginia; Jones, J B; Stewart, Walter

2012-04-01

While questionnaires have been developed to capture patient-reported outcomes (PROs) in rheumatology practice, these instruments are not widely used. We developed a touchscreen interface designed to provide reliable and efficient data collection. Using the touchscreen to obtain PROs, we compared 2 different workflow models implemented separately in 2 rheumatology clinics. The Plan-Do-Study-Act methodology was used in 2 cycles of workflow redesign. Cycle 1 relied on off-the-shelf questionnaire builder software, and cycle 2 relied on a custom programmed software solution. During cycle 1, clinic 1 (private practice model, resource replete, simple flow) demonstrated a high completion rate at the start, averaging between 74% and 92% for the first 12 weeks. Clinic 2 (academic model, resource deficient, complex flow) did not achieve a consistent completion rate above 60%. The revised cycle 2 implementation protocol incorporated a 15-minute "nurse visit," an instant messaging system, and a streamlined authentication process, all of which contributed to substantial improvement in touchscreen questionnaire completion rates of ∼80% that were sustained without the need for any additional clinic staff support. Process redesign techniques and touchscreen technology were used to develop a highly successful, efficient, and effective process for the routine collection of PROs in a busy, complex, and resource-depleted academic practice and in typical private practice. The successful implementation required both a touchscreen questionnaire, human behavioral redesign, and other technical solutions. Copyright © 2012 by the American College of Rheumatology.

Guidance and Control Software Project Data - Volume 2: Development Documents

NASA Technical Reports Server (NTRS)

Hayhurst, Kelly J. (Editor)

2008-01-01

The Guidance and Control Software (GCS) project was the last in a series of software reliability studies conducted at Langley Research Center between 1977 and 1994. The technical results of the GCS project were recorded after the experiment was completed. Some of the support documentation produced as part of the experiment, however, is serving an unexpected role far beyond its original project context. Some of the software used as part of the GCS project was developed to conform to the RTCA/DO-178B software standard, "Software Considerations in Airborne Systems and Equipment Certification," used in the civil aviation industry. That standard requires extensive documentation throughout the software development life cycle, including plans, software requirements, design and source code, verification cases and results, and configuration management and quality control data. The project documentation that includes this information is open for public scrutiny without the legal or safety implications associated with comparable data from an avionics manufacturer. This public availability has afforded an opportunity to use the GCS project documents for DO-178B training. This report provides a brief overview of the GCS project, describes the 4-volume set of documents and the role they are playing in training, and includes the development documents from the GCS project. Volume 2 contains three appendices: A. Guidance and Control Software Development Specification; B. Design Description for the Pluto Implementation of the Guidance and Control Software; and C. Source Code for the Pluto Implementation of the Guidance and Control Software

Software analysis handbook: Software complexity analysis and software reliability estimation and prediction

NASA Technical Reports Server (NTRS)

Lee, Alice T.; Gunn, Todd; Pham, Tuan; Ricaldi, Ron

1994-01-01

This handbook documents the three software analysis processes the Space Station Software Analysis team uses to assess space station software, including their backgrounds, theories, tools, and analysis procedures. Potential applications of these analysis results are also presented. The first section describes how software complexity analysis provides quantitative information on code, such as code structure and risk areas, throughout the software life cycle. Software complexity analysis allows an analyst to understand the software structure, identify critical software components, assess risk areas within a software system, identify testing deficiencies, and recommend program improvements. Performing this type of analysis during the early design phases of software development can positively affect the process, and may prevent later, much larger, difficulties. The second section describes how software reliability estimation and prediction analysis, or software reliability, provides a quantitative means to measure the probability of failure-free operation of a computer program, and describes the two tools used by JSC to determine failure rates and design tradeoffs between reliability, costs, performance, and schedule.

The COMPASS Tokamak Plasma Control Software Performance

NASA Astrophysics Data System (ADS)

Valcarcel, Daniel F.; Neto, André; Carvalho, Ivo S.; Carvalho, Bernardo B.; Fernandes, Horácio; Sousa, Jorge; Janky, Filip; Havlicek, Josef; Beno, Radek; Horacek, Jan; Hron, Martin; Panek, Radomir

2011-08-01

The COMPASS tokamak has began operation at the IPP Prague in December 2008. A new control system has been built using an ATCA-based real-time system developed at IST Lisbon. The control software is implemented on top of the MARTe real-time framework attaining control cycles as short as 50 μs, with a jitter of less than 1 μs. The controlled parameters, important for the plasma performance, are the plasma current, position of the plasma current center, boundary shape and horizontal and vertical velocities. These are divided in two control cycles: slow at 500 μs and fast at 50 μs. The project has two phases. First, the software implements a digital controller, similar to the analog one used during the COMPASS-D operation in Culham. In the slow cycle, the plasma current and position are measured and controlled with PID and feedforward controllers, respectively, the shaping magnetic field is preprogrammed. The vertical instability and horizontal equilibrium are controlled with the faster 50-μs cycle PID controllers. The second phase will implement a plasma-shape reconstruction algorithm and controller, aiming at optimized plasma performance. The system was designed to be as modular as possible by breaking the functional requirements of the control system into several independent and specialized modules. This splitting enabled tuning the execution of each system part and to use the modules in a variety of applications with different time constraints. This paper presents the design and overall performance of the COMPASS control software.

Implementation of a production Ada project: The GRODY study

NASA Technical Reports Server (NTRS)

Godfrey, Sara; Brophy, Carolyn Elizabeth

1989-01-01

The use of the Ada language and design methodologies that encourage full use of its capabilities have a strong impact on all phases of the software development project life cycle. At the National Aeronautics and Space Administration/Goddard Space Flight Center (NASA/GSFC), the Software Engineering Laboratory (SEL) conducted an experiment in parallel development of two flight dynamics systems in FORTRAN and Ada. The differences observed during the implementation, unit testing, and integration phases of the two projects are described and the lessons learned during the implementation phase of the Ada development are outlined. Included are recommendations for future Ada development projects.

A methodology for testing fault-tolerant software

NASA Technical Reports Server (NTRS)

Andrews, D. M.; Mahmood, A.; Mccluskey, E. J.

1985-01-01

A methodology for testing fault tolerant software is presented. There are problems associated with testing fault tolerant software because many errors are masked or corrected by voters, limiter, or automatic channel synchronization. This methodology illustrates how the same strategies used for testing fault tolerant hardware can be applied to testing fault tolerant software. For example, one strategy used in testing fault tolerant hardware is to disable the redundancy during testing. A similar testing strategy is proposed for software, namely, to move the major emphasis on testing earlier in the development cycle (before the redundancy is in place) thus reducing the possibility that undetected errors will be masked when limiters and voters are added.

A self-referential HOWTO on release engineering

DOE Office of Scientific and Technical Information (OSTI.GOV)

Galassi, Mark C.

Release engineering is a fundamental part of the software development cycle: it is the point at which quality control is exercised and bug fixes are integrated. The way in which software is released also gives the end user her first experience of a software package, while in scientific computing release engineering can guarantee reproducibility. For these reasons and others, the release process is a good indicator of the maturity and organization of a development team. Software teams often do not put in place a release process at the beginning. This is unfortunate because the team does not have early andmore » continuous execution of test suites, and it does not exercise the software in the same conditions as the end users. I describe an approach to release engineering based on the software tools developed and used by the GNU project, together with several specific proposals related to packaging and distribution. I do this in a step-by-step manner, demonstrating how this very paper is written and built using proper release engineering methods. Because many aspects of release engineering are not exercised in the building of the paper, the accompanying software repository also contains examples of software libraries.« less

Product Definition Data Interface (PDDI) Product Specification

DTIC Science & Technology

1991-07-01

syntax of the language gives a precise specification of the data without interpretation of it. M - Constituent Read Block. CSECT - Control Section, the...to conform to the PDDI Access Software’s internal data representation so that it may be further processed. JCL - Job Control Language - IBM language...software development and life cycle * phases. OUALITY CONTROL - The planned and systematic application of all actions (management/technical) necessary to

NASA's Approach to Software Assurance

NASA Technical Reports Server (NTRS)

Wetherholt, Martha

2015-01-01

NASA defines software assurance as: the planned and systematic set of activities that ensure conformance of software life cycle processes and products to requirements, standards, and procedures via quality, safety, reliability, and independent verification and validation. NASA's implementation of this approach to the quality, safety, reliability, security and verification and validation of software is brought together in one discipline, software assurance. Organizationally, NASA has software assurance at each NASA center, a Software Assurance Manager at NASA Headquarters, a Software Assurance Technical Fellow (currently the same person as the SA Manager), and an Independent Verification and Validation Organization with its own facility. An umbrella risk mitigation strategy for safety and mission success assurance of NASA's software, software assurance covers a wide area and is better structured to address the dynamic changes in how software is developed, used, and managed, as well as it's increasingly complex functionality. Being flexible, risk based, and prepared for challenges in software at NASA is essential, especially as much of our software is unique for each mission.

INTERIM -- Starlink Software Environment

NASA Astrophysics Data System (ADS)

Pearce, Dave; Pavelin, Cliff; Lawden, M. D.

Early versions of this paper were based on a number of other papers produced at a very early stage of the Starlink project. They contained a description of a specific implementation of a subroutine library, speculations on the desirable attributes of a software environment, and future development plans. They reflected the experimental nature of the Starlink software environment at that time. Since then, the situation has changed. The implemented subroutine library, INTERIM_DIR:INTERIM.OLB, is now a well established and widely used piece of software. A completely new Starlink software environment (ADAM) has been developed and distributed. Thus the library released in 1980 as `STARLINK' and now called `INTERIM' has reached the end of its development cycle and is now frozen in its current state, apart from bug corrections. This paper has, therefore, been completely rewritten and restructured to reflect the new situation. Its aim is to describe the facilities of the INTERIM subroutine library as clearly and concisely as possible. It avoids speculation, discussion of design decisions, and announcements of future plans.

Real cost : user manual.

DOT National Transportation Integrated Search

2004-05-01

This manual provides basic instruction for using RealCost, software that was developed by the Federal Highway Administration (FHWA) to support the application of life-cycle cost analysis (LCCA) in the pavement project-level decisionmaking process. Th...

Agile

NASA Technical Reports Server (NTRS)

Trimble, Jay Phillip

2013-01-01

This is based on a previous talk on agile development. Methods for delivering software on a short cycle are described, including interactions with the customer, the affect on the team, and how to be more effective, streamlined and efficient.

Real-time software failure characterization

NASA Technical Reports Server (NTRS)

Dunham, Janet R.; Finelli, George B.

1990-01-01

A series of studies aimed at characterizing the fundamentals of the software failure process has been undertaken as part of a NASA project on the modeling of a real-time aerospace vehicle software reliability. An overview of these studies is provided, and the current study, an investigation of the reliability of aerospace vehicle guidance and control software, is examined. The study approach provides for the collection of life-cycle process data, and for the retention and evaluation of interim software life-cycle products.

Automation of the Environmental Control and Life Support System

NASA Technical Reports Server (NTRS)

Dewberry, Brandon S.; Carnes, J. Ray

1990-01-01

The objective of the Environmental Control and Life Support System (ECLSS) Advanced Automation Project is to recommend and develop advanced software for the initial and evolutionary Space Station Freedom (SSF) ECLS system which will minimize the crew and ground manpower needed for operations. Another objective includes capturing ECLSS design and development knowledge for future missions. This report summarizes our results from Phase I, the ECLSS domain analysis phase, which we broke down into three steps: 1) Analyze and document the baselined ECLS system, 2) envision as our goal an evolution to a fully automated regenerative life support system, built upon an augmented baseline, and 3) document the augmentations (hooks and scars) and advanced software systems which we see as necessary in achieving minimal manpower support for ECLSS operations. In addition, Phase I included development of an advanced software life cycle testing tools will be used in the development of the software. In this way, we plan in preparation for phase II and III, the development and integration phases, respectively. Automated knowledge acquisition, engineering, verification, and can capture ECLSS development knowledge for future use, develop more robust and complex software, provide feedback to the KBS tool community, and insure proper visibility of our efforts.

NASA Software Documentation Standard

NASA Technical Reports Server (NTRS)

1991-01-01

The NASA Software Documentation Standard (hereinafter referred to as "Standard") is designed to support the documentation of all software developed for NASA; its goal is to provide a framework and model for recording the essential information needed throughout the development life cycle and maintenance of a software system. The NASA Software Documentation Standard can be applied to the documentation of all NASA software. The Standard is limited to documentation format and content requirements. It does not mandate specific management, engineering, or assurance standards or techniques. This Standard defines the format and content of documentation for software acquisition, development, and sustaining engineering. Format requirements address where information shall be recorded and content requirements address what information shall be recorded. This Standard provides a framework to allow consistency of documentation across NASA and visibility into the completeness of project documentation. The basic framework consists of four major sections (or volumes). The Management Plan contains all planning and business aspects of a software project, including engineering and assurance planning. The Product Specification contains all technical engineering information, including software requirements and design. The Assurance and Test Procedures contains all technical assurance information, including Test, Quality Assurance (QA), and Verification and Validation (V&V). The Management, Engineering, and Assurance Reports is the library and/or listing of all project reports.

Software risk management through independent verification and validation

NASA Technical Reports Server (NTRS)

Callahan, John R.; Zhou, Tong C.; Wood, Ralph

1995-01-01

Software project managers need tools to estimate and track project goals in a continuous fashion before, during, and after development of a system. In addition, they need an ability to compare the current project status with past project profiles to validate management intuition, identify problems, and then direct appropriate resources to the sources of problems. This paper describes a measurement-based approach to calculating the risk inherent in meeting project goals that leverages past project metrics and existing estimation and tracking models. We introduce the IV&V Goal/Questions/Metrics model, explain its use in the software development life cycle, and describe our attempts to validate the model through the reverse engineering of existing projects.

Ground Systems Development Environment (GSDE) software configuration management

NASA Technical Reports Server (NTRS)

Church, Victor E.; Long, D.; Hartenstein, Ray; Perez-Davila, Alfredo

1992-01-01

This report presents a review of the software configuration management (CM) plans developed for the Space Station Training Facility (SSTF) and the Space Station Control Center. The scope of the CM assessed in this report is the Systems Integration and Testing Phase of the Ground Systems development life cycle. This is the period following coding and unit test and preceding delivery to operational use. This report is one of a series from a study of the interfaces among the Ground Systems Development Environment (GSDE), the development systems for the SSTF and the SSCC, and the target systems for SSCC and SSTF. This is the last report in the series. The focus of this report is on the CM plans developed by the contractors for the Mission Systems Contract (MSC) and the Training Systems Contract (TSC). CM requirements are summarized and described in terms of operational software development. The software workflows proposed in the TSC and MSC plans are reviewed in this context, and evaluated against the CM requirements defined in earlier study reports. Recommendations are made to improve the effectiveness of CM while minimizing its impact on the developers.

Impacts of software and its engineering on the carbon footprint of ICT

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kern, Eva, E-mail: e.kern@umwelt-campus.de; Dick, Markus, E-mail: sustainablesoftwareblog@gmail.com; Naumann, Stefan, E-mail: s.naumann@umwelt-campus.de

2015-04-15

The energy consumption of information and communication technology (ICT) is still increasing. Even though several solutions regarding the hardware side of Green IT exist, the software contribution to Green IT is not well investigated. The carbon footprint is one way to rate the environmental impacts of ICT. In order to get an impression of the induced CO{sub 2} emissions of software, we will present a calculation method for the carbon footprint of a software product over its life cycle. We also offer an approach on how to integrate some aspects of carbon footprint calculation into software development processes and discussmore » impacts and tools regarding this calculation method. We thus show the relevance of energy measurements and the attention to impacts on the carbon footprint by software within Green Software Engineering.« less

Guidance and Control Software Project Data - Volume 1: Planning Documents

NASA Technical Reports Server (NTRS)

Hayhurst, Kelly J. (Editor)

2008-01-01

The Guidance and Control Software (GCS) project was the last in a series of software reliability studies conducted at Langley Research Center between 1977 and 1994. The technical results of the GCS project were recorded after the experiment was completed. Some of the support documentation produced as part of the experiment, however, is serving an unexpected role far beyond its original project context. Some of the software used as part of the GCS project was developed to conform to the RTCA/DO-178B software standard, "Software Considerations in Airborne Systems and Equipment Certification," used in the civil aviation industry. That standard requires extensive documentation throughout the software development life cycle, including plans, software requirements, design and source code, verification cases and results, and configuration management and quality control data. The project documentation that includes this information is open for public scrutiny without the legal or safety implications associated with comparable data from an avionics manufacturer. This public availability has afforded an opportunity to use the GCS project documents for DO-178B training. This report provides a brief overview of the GCS project, describes the 4-volume set of documents and the role they are playing in training, and includes the planning documents from the GCS project. Volume 1 contains five appendices: A. Plan for Software Aspects of Certification for the Guidance and Control Software Project; B. Software Development Standards for the Guidance and Control Software Project; C. Software Verification Plan for the Guidance and Control Software Project; D. Software Configuration Management Plan for the Guidance and Control Software Project; and E. Software Quality Assurance Activities.

Atrioventricular junction (AVJ) motion tracking: a software tool with ITK/VTK/Qt.

PubMed

Pengdong Xiao; Shuang Leng; Xiaodan Zhao; Hua Zou; Ru San Tan; Wong, Philip; Liang Zhong

2016-08-01

The quantitative measurement of the Atrioventricular Junction (AVJ) motion is an important index for ventricular functions of one cardiac cycle including systole and diastole. In this paper, a software tool that can conduct AVJ motion tracking from cardiovascular magnetic resonance (CMR) images is presented by using Insight Segmentation and Registration Toolkit (ITK), The Visualization Toolkit (VTK) and Qt. The software tool is written in C++ by using Visual Studio Community 2013 integrated development environment (IDE) containing both an editor and a Microsoft complier. The software package has been successfully implemented. From the software engineering practice, it is concluded that ITK, VTK, and Qt are very handy software systems to implement automatic image analysis functions for CMR images such as quantitative measure of motion by visual tracking.

Dynamic visualization techniques for high consequence software

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pollock, G.M.

1998-02-01

This report documents a prototype tool developed to investigate the use of visualization and virtual reality technologies for improving software surety confidence. The tool is utilized within the execution phase of the software life cycle. It provides a capability to monitor an executing program against prespecified requirements constraints provided in a program written in the requirements specification language SAGE. The resulting Software Attribute Visual Analysis Tool (SAVAnT) also provides a technique to assess the completeness of a software specification. The prototype tool is described along with the requirements constraint language after a brief literature review is presented. Examples of howmore » the tool can be used are also presented. In conclusion, the most significant advantage of this tool is to provide a first step in evaluating specification completeness, and to provide a more productive method for program comprehension and debugging. The expected payoff is increased software surety confidence, increased program comprehension, and reduced development and debugging time.« less

ACS from development to operations

NASA Astrophysics Data System (ADS)

Caproni, Alessandro; Colomer, Pau; Jeram, Bogdan; Sommer, Heiko; Chiozzi, Gianluca; Mañas, Miguel M.

2016-08-01

The ALMA Common Software (ACS), provides the infrastructure of the distributed software system of ALMA and other projects. ACS, built on top of CORBA and Data Distribution Service (DDS) middleware, is based on a Component- Container paradigm and hides the complexity of the middleware allowing the developer to focus on domain specific issues. The transition of the ALMA observatory from construction to operations brings with it that ACS effort focuses primarily on scalability, stability and robustness rather than on new features. The transition came together with a shorter release cycle and a more extensive testing. For scalability, the most problematic area has been the CORBA notification service, used to implement the publisher subscriber pattern because of the asynchronous nature of the paradigm: a lot of effort has been spent to improve its stability and recovery from run time errors. The original bulk data mechanism, implemented using the CORBA Audio/Video Streaming Service, showed its limitations and has been replaced with a more performant and scalable DDS implementation. Operational needs showed soon the difference between releases cycles for Online software (i.e. used during observations) and Offline software, which requires much more frequent releases. This paper attempts to describe the impact the transition from construction to operations had on ACS, the solution adopted so far and a look into future evolution.

The development procedures and tools applied for the attitude control software of the Italian satellite SAX

NASA Astrophysics Data System (ADS)

Hameetman, G. J.; Dekker, G. J.

1993-11-01

The Italian satellite (with a large Dutch contribution) SAX is a scientific satellite which has the mission to study roentgen sources. One main requirement for the Attitude and Orbit Control Subsystem (AOCS) is to achieve and maintain a stable pointing accuracy with a limit cycle of less than 90 arcsec during pointings of maximal 28 hours. The main SAX instrument, the Narrow Field Instrument, is highly sensitive to (indirect) radiation coming from the Sun. This sensitivity leads to another main requirement that under no circumstances the safe attitude domain may be left. The paper describes the application software in relation with the overall SAX AOCS subsystem, the CASE tools that have been used during the development, some advantages and disadvantages of the use of these tools, the measures taken to meet the more or less conflicting requirements of reliability and flexibility, and the lessons learned during development. The quality of the approach to the development has proven the (separately executed) hardware/software integration tests. During these tests, a neglectible number of software errors has been detected in the application software.

Advanced software integration: The case for ITV facilities

NASA Technical Reports Server (NTRS)

Garman, John R.

1990-01-01

The array of technologies and methodologies involved in the development and integration of avionics software has moved almost as rapidly as computer technology itself. Future avionics systems involve major advances and risks in the following areas: (1) Complexity; (2) Connectivity; (3) Security; (4) Duration; and (5) Software engineering. From an architectural standpoint, the systems will be much more distributed, involve session-based user interfaces, and have the layered architectures typified in the layers of abstraction concepts popular in networking. Typified in the NASA Space Station Freedom will be the highly distributed nature of software development itself. Systems composed of independent components developed in parallel must be bound by rigid standards and interfaces, the clean requirements and specifications. Avionics software provides a challenge in that it can not be flight tested until the first time it literally flies. It is the binding of requirements for such an integration environment into the advances and risks of future avionics systems that form the basis of the presented concept and the basic Integration, Test, and Verification concept within the development and integration life cycle of Space Station Mission and Avionics systems.

Applications of AN OO Methodology and Case to a Daq System

NASA Astrophysics Data System (ADS)

Bee, C. P.; Eshghi, S.; Jones, R.; Kolos, S.; Magherini, C.; Maidantchik, C.; Mapelli, L.; Mornacchi, G.; Niculescu, M.; Patel, A.; Prigent, D.; Spiwoks, R.; Soloviev, I.; Caprini, M.; Duval, P. Y.; Etienne, F.; Ferrato, D.; Le van Suu, A.; Qian, Z.; Gaponenko, I.; Merzliakov, Y.; Ambrosini, G.; Ferrari, R.; Fumagalli, G.; Polesello, G.

The RD13 project has evaluated the use of the Object Oriented Information Engineering (OOIE) method during the development of several software components connected to the DAQ system. The method is supported by a sophisticated commercial CASE tool (Object Management Workbench) and programming environment (Kappa) which covers the full life-cycle of the software including model simulation, code generation and application deployment. This paper gives an overview of the method, CASE tool, DAQ components which have been developed and we relate our experiences with the method and tool, its integration into our development environment and the spiral lifecycle it supports.

Change management methodologies trained for automotive infotainment projects

NASA Astrophysics Data System (ADS)

Prostean, G.; Volker, S.; Hutanu, A.

2017-01-01

An Automotive Electronic Control Units (ECU) development project embedded within a car Environment is constantly under attack of a continuous flow of modifications of specifications throughout the life cycle. Root causes for those modifications are for instance simply software or hardware implementation errors or requirement changes to satisfy the forthcoming demands of the market to ensure the later commercial success. It is unavoidable that from the very beginning until the end of the project “requirement changes” will “expose” the agreed objectives defined by contract specifications, which are product features, budget, schedule and quality. The key discussions will focus upon an automotive radio-navigation (infotainment) unit, which challenges aftermarket devises such as smart phones. This competition stresses especially current used automotive development processes, which are fit into a 4 Year car development (introduction) cycle against a one-year update cycle of a smart phone. The research will focus the investigation of possible impacts of changes during all phases of the project: the Concept-Validation, Development and Debugging-Phase. Building a thorough understanding of prospective threats is of paramount importance in order to establish the adequate project management process to handle requirement changes. Personal automotive development experiences and Literature review of change- and configuration management software development methodologies led the authors to new conceptual models, which integrates into the structure of traditional development models used in automotive projects, more concretely of radio-navigation projects.

Software project management tools in global software development: a systematic mapping study.

PubMed

Chadli, Saad Yasser; Idri, Ali; Ros, Joaquín Nicolás; Fernández-Alemán, José Luis; de Gea, Juan M Carrillo; Toval, Ambrosio

2016-01-01

Global software development (GSD) which is a growing trend in the software industry is characterized by a highly distributed environment. Performing software project management (SPM) in such conditions implies the need to overcome new limitations resulting from cultural, temporal and geographic separation. The aim of this research is to discover and classify the various tools mentioned in literature that provide GSD project managers with support and to identify in what way they support group interaction. A systematic mapping study has been performed by means of automatic searches in five sources. We have then synthesized the data extracted and presented the results of this study. A total of 102 tools were identified as being used in SPM activities in GSD. We have classified these tools, according to the software life cycle process on which they focus and how they support the 3C collaboration model (communication, coordination and cooperation). The majority of the tools found are standalone tools (77%). A small number of platforms (8%) also offer a set of interacting tools that cover the software development lifecycle. Results also indicate that SPM areas in GSD are not adequately supported by corresponding tools and deserve more attention from tool builders.

Methods for cost estimation in software project management

NASA Astrophysics Data System (ADS)

Briciu, C. V.; Filip, I.; Indries, I. I.

2016-02-01

The speed in which the processes used in software development field have changed makes it very difficult the task of forecasting the overall costs for a software project. By many researchers, this task has been considered unachievable, but there is a group of scientist for which this task can be solved using the already known mathematical methods (e.g. multiple linear regressions) and the new techniques as genetic programming and neural networks. The paper presents a solution for building a model for the cost estimation models in the software project management using genetic algorithms starting from the PROMISE datasets related COCOMO 81 model. In the first part of the paper, a summary of the major achievements in the research area of finding a model for estimating the overall project costs is presented together with the description of the existing software development process models. In the last part, a basic proposal of a mathematical model of a genetic programming is proposed including here the description of the chosen fitness function and chromosome representation. The perspective of model described it linked with the current reality of the software development considering as basis the software product life cycle and the current challenges and innovations in the software development area. Based on the author's experiences and the analysis of the existing models and product lifecycle it was concluded that estimation models should be adapted with the new technologies and emerging systems and they depend largely by the chosen software development method.

Going in Cycles: Courseware and Material Development for Written Communication

ERIC Educational Resources Information Center

Schulze, Mathias; Liebscher, Grit

2010-01-01

The development of both the materials for an intermediate-level hybrid German writing course and the software in a virtual learning environment for the course may be viewed as activity systems. Viewing the individual components of each system as interrelated enables us to conceptualize the complexities of the development process, which goes well…

Discovering objects in a blood recipient information system.

PubMed

Qiu, D; Junghans, G; Marquardt, K; Kroll, H; Mueller-Eckhardt, C; Dudeck, J

1995-01-01

Application of object-oriented (OO) methodologies has been generally considered as a solution to the problem of improving the software development process and managing the so-called software crisis. Among them, object-oriented analysis (OOA) is the most essential and is a vital prerequisite for the successful use of other OO methodologies. Though there are already a good deal of OOA methods published, the most important aspect common to all these methods: discovering objects classes truly relevant to the given problem domain, has remained a subject to be intensively researched. In this paper, using the successful development of a blood recipient information system as an example, we present our approach which is based on the conceptual framework of responsibility-driven OOA. In the discussion, we also suggest that it may be inadequate to simply attribute the software crisis to the waterfall model of the software development life-cycle. We are convinced that the real causes for the failure of some software and information systems should be sought in the methodologies used in some crucial phases of the software development process. Furthermore, a software system can also fail if object classes essential to the problem domain are not discovered, implemented and visualized, so that the real-world situation cannot be faithfully traced by it.

Implementing Software Safety in the NASA Environment

NASA Technical Reports Server (NTRS)

Wetherholt, Martha S.; Radley, Charles F.

1994-01-01

Until recently, NASA did not consider allowing computers total control of flight systems. Human operators, via hardware, have constituted the ultimate safety control. In an attempt to reduce costs, NASA has come to rely more and more heavily on computers and software to control space missions. (For example. software is now planned to control most of the operational functions of the International Space Station.) Thus the need for systematic software safety programs has become crucial for mission success. Concurrent engineering principles dictate that safety should be designed into software up front, not tested into the software after the fact. 'Cost of Quality' studies have statistics and metrics to prove the value of building quality and safety into the development cycle. Unfortunately, most software engineers are not familiar with designing for safety, and most safety engineers are not software experts. Software written to specifications which have not been safety analyzed is a major source of computer related accidents. Safer software is achieved step by step throughout the system and software life cycle. It is a process that includes requirements definition, hazard analyses, formal software inspections, safety analyses, testing, and maintenance. The greatest emphasis is placed on clearly and completely defining system and software requirements, including safety and reliability requirements. Unfortunately, development and review of requirements are the weakest link in the process. While some of the more academic methods, e.g. mathematical models, may help bring about safer software, this paper proposes the use of currently approved software methodologies, and sound software and assurance practices to show how, to a large degree, safety can be designed into software from the start. NASA's approach today is to first conduct a preliminary system hazard analysis (PHA) during the concept and planning phase of a project. This determines the overall hazard potential of the system to be built. Shortly thereafter, as the system requirements are being defined, the second iteration of hazard analyses takes place, the systems hazard analysis (SHA). During the systems requirements phase, decisions are made as to what functions of the system will be the responsibility of software. This is the most critical time to affect the safety of the software. From this point, software safety analyses as well as software engineering practices are the main focus for assuring safe software. While many of the steps proposed in this paper seem like just sound engineering practices, they are the best technical and most cost effective means to assure safe software within a safe system.

OSI for hardware/software interoperability

NASA Astrophysics Data System (ADS)

Wood, Richard J.; Harvey, Donald L.; Linderman, Richard W.; Gardener, Gary A.; Capraro, Gerard T.

1994-03-01

There is a need in public safety for real-time data collection and transmission from one or more sensors. The Rome Laboratory and the Ballistic Missile Defense Organization are pursuing an effort to bring the benefits of Open System Architectures (OSA) to embedded systems within the Department of Defense. When developed properly OSA provides interoperability, commonality, graceful upgradeability, survivability and hardware/software transportability to greatly minimize life cycle costs, integration and supportability. Architecture flexibility can be achieved to take advantage of commercial accomplishments by basing these developments on vendor-neutral commercially accepted standards and protocols.

A generalized model for multi-marker analysis of cell cycle progression in synchrony experiments.

PubMed

Mayhew, Michael B; Robinson, Joshua W; Jung, Boyoun; Haase, Steven B; Hartemink, Alexander J

2011-07-01

To advance understanding of eukaryotic cell division, it is important to observe the process precisely. To this end, researchers monitor changes in dividing cells as they traverse the cell cycle, with the presence or absence of morphological or genetic markers indicating a cell's position in a particular interval of the cell cycle. A wide variety of marker data is available, including information-rich cellular imaging data. However, few formal statistical methods have been developed to use these valuable data sources in estimating how a population of cells progresses through the cell cycle. Furthermore, existing methods are designed to handle only a single binary marker of cell cycle progression at a time. Consequently, they cannot facilitate comparison of experiments involving different sets of markers. Here, we develop a new sampling model to accommodate an arbitrary number of different binary markers that characterize the progression of a population of dividing cells along a branching process. We engineer a strain of Saccharomyces cerevisiae with fluorescently labeled markers of cell cycle progression, and apply our new model to two image datasets we collected from the strain, as well as an independent dataset of different markers. We use our model to estimate the duration of post-cytokinetic attachment between a S.cerevisiae mother and daughter cell. The Java implementation is fast and extensible, and includes a graphical user interface. Our model provides a powerful and flexible cell cycle analysis tool, suitable to any type or combination of binary markers. The software is available from: http://www.cs.duke.edu/~amink/software/cloccs/. michael.mayhew@duke.edu; amink@cs.duke.edu.

The application of domain-driven design in NMS

NASA Astrophysics Data System (ADS)

Zhang, Jinsong; Chen, Yan; Qin, Shengjun

2011-12-01

In the traditional design approach of data-model-driven, system analysis and design phases are often separated which makes the demand information can not be expressed explicitly. The method is also easy to lead developer to the process-oriented programming, making codes between the modules or between hierarchies disordered. So it is hard to meet requirement of system scalability. The paper proposes a software hiberarchy based on rich domain model according to domain-driven design named FHRDM, then the Webwork + Spring + Hibernate (WSH) framework is determined. Domain-driven design aims to construct a domain model which not only meets the demand of the field where the software exists but also meets the need of software development. In this way, problems in Navigational Maritime System (NMS) development like big system business volumes, difficulty of requirement elicitation, high development costs and long development cycle can be resolved successfully.

Planning level assessment of greenhouse gas emissions for alternative transportation construction projects : carbon footprint estimator, phase II, volume I - GASCAP model.

DOT National Transportation Integrated Search

2014-03-01

The GASCAP model was developed to provide a software tool for analysis of the life-cycle GHG : emissions associated with the construction and maintenance of transportation projects. This phase : of development included techniques for estimating emiss...

Means of storage and automated monitoring of versions of text technical documentation

NASA Astrophysics Data System (ADS)

Leonovets, S. A.; Shukalov, A. V.; Zharinov, I. O.

2018-03-01

The paper presents automation of the process of preparation, storage and monitoring of version control of a text designer, and program documentation by means of the specialized software is considered. Automation of preparation of documentation is based on processing of the engineering data which are contained in the specifications and technical documentation or in the specification. Data handling assumes existence of strictly structured electronic documents prepared in widespread formats according to templates on the basis of industry standards and generation by an automated method of the program or designer text document. Further life cycle of the document and engineering data entering it are controlled. At each stage of life cycle, archive data storage is carried out. Studies of high-speed performance of use of different widespread document formats in case of automated monitoring and storage are given. The new developed software and the work benches available to the developer of the instrumental equipment are described.

A Survey and Evaluation of Software Quality Assurance.

DTIC Science & Technology

1984-09-01

activities; 2. Cryptologic activities related to national security; 3. Command and control of military forces; 4. Equipment that is an integral part of a...Testing and Integration , and Performance or Operation (6). Figure 3 shows the software life cycle and the key outputs of the phases. The first phase to...defects. This procedure is considered the Checkout (13:09-91). Once coding is complete, the Testing and Integration Phase begins. Here the developed

System Re-engineering Project Executive Summary

DTIC Science & Technology

1991-11-01

Management Information System (STAMIS) application. This project involved reverse engineering, evaluation of structured design and object-oriented design, and re- implementation of the system in Ada. This executive summary presents the approach to re-engineering the system, the lessons learned while going through the process, and issues to be considered in future tasks of this nature.... Computer-Aided Software Engineering (CASE), Distributed Software, Ada, COBOL, Systems Analysis, Systems Design, Life Cycle Development, Functional Decomposition, Object-Oriented

Analytical modeling of helium turbomachinery using FORTRAN 77

NASA Astrophysics Data System (ADS)

Balaji, Purushotham

Advanced Generation IV modular reactors, including Very High Temperature Reactors (VHTRs), utilize helium as the working fluid, with a potential for high efficiency power production utilizing helium turbomachinery. Helium is chemically inert and nonradioactive which makes the gas ideal for a nuclear power-plant environment where radioactive leaks are a high concern. These properties of helium gas helps to increase the safety features as well as to decrease the aging process of plant components. The lack of sufficient helium turbomachinery data has made it difficult to study the vital role played by the gas turbine components of these VHTR powered cycles. Therefore, this research work focuses on predicting the performance of helium compressors. A FORTRAN77 program is developed to simulate helium compressor operation, including surge line prediction. The resulting design point and off design performance data can be used to develop compressor map files readable by Numerical Propulsion Simulation Software (NPSS). This multi-physics simulation software that was developed for propulsion system analysis has found applications in simulating power-plant cycles.

A Strategy for Improved System Assurance

DTIC Science & Technology

2007-06-20

Quality (Measurements Life Cycle Safety, Security & Others) ISO /IEC 12207 * Software Life Cycle Processes ISO 9001 Quality Management System...14598 Software Product Evaluation Related ISO /IEC 90003 Guidelines for the Application of ISO 9001:2000 to Computer Software IEEE 12207 Industry...Implementation of International Standard ISO /IEC 12207 IEEE 1220 Standard for Application and Management of the System Engineering Process Use in

Assurance specification documentation standard and Data Item Descriptions (DID). Volume of the information system life-cycle and documentation standards, volume 4

NASA Technical Reports Server (NTRS)

Callender, E. David; Steinbacher, Jody

1989-01-01

This is the fourth of five volumes on Information System Life-Cycle and Documentation Standards. This volume provides a well organized, easily used standard for assurance documentation for information systems and software, hardware, and operational procedures components, and related processes. The specifications are developed in conjunction with the corresponding management plans specifying the assurance activities to be performed.

Air Force Systems Engineering Assessment Model (AF SEAM) Management Guide, Version 2

DTIC Science & Technology

2010-09-21

gleaned from experienced professionals who assisted with the model’s development. Examples of the references used include the following: • ISO /IEC...Defense Acquisition Guidebook, Chapter 4 • AFI 63-1201, Life Cycle Systems Engineering • IEEE/EIA 12207 , Software Life Cycle Processes • Air...Selection criteria Reference Material: IEEE/EIA 12207 , MIL-HDBK-514 Other Considerations: Modeling, simulation and analysis techniques can be

Management control and status reports documentation standard and Data Item Descriptions (DID). Volume of the information system life-cycle and documentation standards, volume 5

NASA Technical Reports Server (NTRS)

Callender, E. David; Steinbacher, Jody

1989-01-01

This is the fifth of five volumes on Information System Life-Cycle and Documentation Standards. This volume provides a well organized, easily used standard for management control and status reports used in monitoring and controlling the management, development, and assurance of informations systems and software, hardware, and operational procedures components, and related processes.

Software use cases to elicit the software requirements analysis within the ASTRI project

NASA Astrophysics Data System (ADS)

Conforti, Vito; Antolini, Elisa; Bonnoli, Giacomo; Bruno, Pietro; Bulgarelli, Andrea; Capalbi, Milvia; Fioretti, Valentina; Fugazza, Dino; Gardiol, Daniele; Grillo, Alessandro; Leto, Giuseppe; Lombardi, Saverio; Lucarelli, Fabrizio; Maccarone, Maria Concetta; Malaguti, Giuseppe; Pareschi, Giovanni; Russo, Federico; Sangiorgi, Pierluca; Schwarz, Joseph; Scuderi, Salvatore; Tanci, Claudio; Tosti, Gino; Trifoglio, Massimo; Vercellone, Stefano; Zanmar Sanchez, Ricardo

2016-07-01

The Italian National Institute for Astrophysics (INAF) is leading the Astrofisica con Specchi a Tecnologia Replicante Italiana (ASTRI) project whose main purpose is the realization of small size telescopes (SST) for the Cherenkov Telescope Array (CTA). The first goal of the ASTRI project has been the development and operation of an innovative end-to-end telescope prototype using a dual-mirror optical configuration (SST-2M) equipped with a camera based on silicon photo-multipliers and very fast read-out electronics. The ASTRI SST-2M prototype has been installed in Italy at the INAF "M.G. Fracastoro" Astronomical Station located at Serra La Nave, on Mount Etna, Sicily. This prototype will be used to test several mechanical, optical, control hardware and software solutions which will be used in the ASTRI mini-array, comprising nine telescopes proposed to be placed at the CTA southern site. The ASTRI mini-array is a collaborative and international effort led by INAF and carried out by Italy, Brazil and South-Africa. We present here the use cases, through UML (Unified Modeling Language) diagrams and text details, that describe the functional requirements of the software that will manage the ASTRI SST-2M prototype, and the lessons learned thanks to these activities. We intend to adopt the same approach for the Mini Array Software System that will manage the ASTRI miniarray operations. Use cases are of importance for the whole software life cycle; in particular they provide valuable support to the validation and verification activities. Following the iterative development approach, which breaks down the software development into smaller chunks, we have analysed the requirements, developed, and then tested the code in repeated cycles. The use case technique allowed us to formalize the problem through user stories that describe how the user procedurally interacts with the software system. Through the use cases we improved the communication among team members, fostered common agreement about system requirements, defined the normal and alternative course of events, understood better the business process, and defined the system test to ensure that the delivered software works properly. We present a summary of the ASTRI SST-2M prototype use cases, and how the lessons learned can be exploited for the ASTRI mini-array proposed for the CTA Observatory.

Importance of Requirements Analysis & Traceability to Improve Software Quality and Reduce Cost and Risk

NASA Technical Reports Server (NTRS)

Kapoor, Manju M.; Mehta, Manju

2010-01-01

The goal of this paper is to emphasize the importance of developing complete and unambiguous requirements early in the project cycle (prior to Preliminary Design Phase). Having a complete set of requirements early in the project cycle allows sufficient time to generate a traceability matrix. Requirements traceability and analysis are the key elements in improving verification and validation process, and thus overall software quality. Traceability can be most beneficial when the system changes. If changes are made to high-level requirements it implies that low-level requirements need to be modified. Traceability ensures that requirements are appropriately and efficiently verified at various levels whereas analysis ensures that a rightly interpreted set of requirements is produced.

RICIS Symposium 1988

NASA Technical Reports Server (NTRS)

1988-01-01

Integrated Environments for Large, Complex Systems is the theme for the RICIS symposium of 1988. Distinguished professionals from industry, government, and academia have been invited to participate and present their views and experiences regarding research, education, and future directions related to this topic. Within RICIS, more than half of the research being conducted is in the area of Computer Systems and Software Engineering. The focus of this research is on the software development life-cycle for large, complex, distributed systems. Within the education and training component of RICIS, the primary emphasis has been to provide education and training for software professionals.

Novel Analysis Software for Detecting and Classifying Ca2+ Transient Abnormalities in Stem Cell-Derived Cardiomyocytes

PubMed Central

Penttinen, Kirsi; Siirtola, Harri; Àvalos-Salguero, Jorge; Vainio, Tiina; Juhola, Martti; Aalto-Setälä, Katriina

2015-01-01

Comprehensive functioning of Ca2+ cycling is crucial for excitation–contraction coupling of cardiomyocytes (CMs). Abnormal Ca2+ cycling is linked to arrhythmogenesis, which is associated with cardiac disorders and heart failure. Accordingly, we have generated spontaneously beating CMs from induced pluripotent stem cells (iPSC) derived from patients with catecholaminergic polymorphic ventricular tachycardia (CPVT), which is an inherited and severe cardiac disease. Ca2+ cycling studies have revealed substantial abnormalities in these CMs. Ca2+ transient analysis performed manually lacks accepted analysis criteria, and has both low throughput and high variability. To overcome these issues, we have developed a software tool, AnomalyExplorer based on interactive visualization, to assist in the classification of Ca2+ transient patterns detected in CMs. Here, we demonstrate the usability and capability of the software, and we also compare the analysis efficiency to manual analysis. We show that AnomalyExplorer is suitable for detecting normal and abnormal Ca2+ transients; furthermore, this method provides more defined and consistent information regarding the Ca2+ abnormality patterns and cell line specific differences when compared to manual analysis. This tool will facilitate and speed up the analysis of CM Ca2+ transients, making it both more accurate and user-independent. AnomalyExplorer can be exploited in Ca2+ cycling analysis to study basic disease pathology and the effects of different drugs. PMID:26308621

Novel Analysis Software for Detecting and Classifying Ca2+ Transient Abnormalities in Stem Cell-Derived Cardiomyocytes.

PubMed

Penttinen, Kirsi; Siirtola, Harri; Àvalos-Salguero, Jorge; Vainio, Tiina; Juhola, Martti; Aalto-Setälä, Katriina

2015-01-01

Comprehensive functioning of Ca2+ cycling is crucial for excitation-contraction coupling of cardiomyocytes (CMs). Abnormal Ca2+ cycling is linked to arrhythmogenesis, which is associated with cardiac disorders and heart failure. Accordingly, we have generated spontaneously beating CMs from induced pluripotent stem cells (iPSC) derived from patients with catecholaminergic polymorphic ventricular tachycardia (CPVT), which is an inherited and severe cardiac disease. Ca2+ cycling studies have revealed substantial abnormalities in these CMs. Ca2+ transient analysis performed manually lacks accepted analysis criteria, and has both low throughput and high variability. To overcome these issues, we have developed a software tool, AnomalyExplorer based on interactive visualization, to assist in the classification of Ca2+ transient patterns detected in CMs. Here, we demonstrate the usability and capability of the software, and we also compare the analysis efficiency to manual analysis. We show that AnomalyExplorer is suitable for detecting normal and abnormal Ca2+ transients; furthermore, this method provides more defined and consistent information regarding the Ca2+ abnormality patterns and cell line specific differences when compared to manual analysis. This tool will facilitate and speed up the analysis of CM Ca2+ transients, making it both more accurate and user-independent. AnomalyExplorer can be exploited in Ca2+ cycling analysis to study basic disease pathology and the effects of different drugs.

COSTMODL - AN AUTOMATED SOFTWARE DEVELOPMENT COST ESTIMATION TOOL

NASA Technical Reports Server (NTRS)

Roush, G. B.

1994-01-01

The cost of developing computer software consumes an increasing portion of many organizations' budgets. As this trend continues, the capability to estimate the effort and schedule required to develop a candidate software product becomes increasingly important. COSTMODL is an automated software development estimation tool which fulfills this need. Assimilating COSTMODL to any organization's particular environment can yield significant reduction in the risk of cost overruns and failed projects. This user-customization capability is unmatched by any other available estimation tool. COSTMODL accepts a description of a software product to be developed and computes estimates of the effort required to produce it, the calendar schedule required, and the distribution of effort and staffing as a function of the defined set of development life-cycle phases. This is accomplished by the five cost estimation algorithms incorporated into COSTMODL: the NASA-developed KISS model; the Basic, Intermediate, and Ada COCOMO models; and the Incremental Development model. This choice affords the user the ability to handle project complexities ranging from small, relatively simple projects to very large projects. Unique to COSTMODL is the ability to redefine the life-cycle phases of development and the capability to display a graphic representation of the optimum organizational structure required to develop the subject project, along with required staffing levels and skills. The program is menu-driven and mouse sensitive with an extensive context-sensitive help system that makes it possible for a new user to easily install and operate the program and to learn the fundamentals of cost estimation without having prior training or separate documentation. The implementation of these functions, along with the customization feature, into one program makes COSTMODL unique within the industry. COSTMODL was written for IBM PC compatibles, and it requires Turbo Pascal 5.0 or later and Turbo Professional 5.0 for recompilation. An executable is provided on the distribution diskettes. COSTMODL requires 512K RAM. The standard distribution medium for COSTMODL is three 5.25 inch 360K MS-DOS format diskettes. The contents of the diskettes are compressed using the PKWARE archiving tools. The utility to unarchive the files, PKUNZIP.EXE, is included. COSTMODL was developed in 1991. IBM PC is a registered trademark of International Business Machines. Borland and Turbo Pascal are registered trademarks of Borland International, Inc. Turbo Professional is a trademark of TurboPower Software. MS-DOS is a registered trademark of Microsoft Corporation. Turbo Professional is a trademark of TurboPower Software.

Some key considerations in evolving a computer system and software engineering support environment for the space station program

NASA Technical Reports Server (NTRS)

Mckay, C. W.; Bown, R. L.

1985-01-01

The space station data management system involves networks of computing resources that must work cooperatively and reliably over an indefinite life span. This program requires a long schedule of modular growth and an even longer period of maintenance and operation. The development and operation of space station computing resources will involve a spectrum of systems and software life cycle activities distributed across a variety of hosts, an integration, verification, and validation host with test bed, and distributed targets. The requirement for the early establishment and use of an apporopriate Computer Systems and Software Engineering Support Environment is identified. This environment will support the Research and Development Productivity challenges presented by the space station computing system.

A CMMI-based approach for medical software project life cycle study.

PubMed

Chen, Jui-Jen; Su, Wu-Chen; Wang, Pei-Wen; Yen, Hung-Chi

2013-01-01

In terms of medical techniques, Taiwan has gained international recognition in recent years. However, the medical information system industry in Taiwan is still at a developing stage compared with the software industries in other nations. In addition, systematic development processes are indispensable elements of software development. They can help developers increase their productivity and efficiency and also avoid unnecessary risks arising during the development process. Thus, this paper presents an application of Light-Weight Capability Maturity Model Integration (LW-CMMI) to Chang Gung Medical Research Project (CMRP) in the Nuclear medicine field. This application was intended to integrate user requirements, system design and testing of software development processes into three layers (Domain, Concept and Instance) model. Then, expressing in structural System Modeling Language (SysML) diagrams and converts part of the manual effort necessary for project management maintenance into computational effort, for example: (semi-) automatic delivery of traceability management. In this application, it supports establishing artifacts of "requirement specification document", "project execution plan document", "system design document" and "system test document", and can deliver a prototype of lightweight project management tool on the Nuclear Medicine software project. The results of this application can be a reference for other medical institutions in developing medical information systems and support of project management to achieve the aim of patient safety.

The cleanroom case study in the Software Engineering Laboratory: Project description and early analysis

NASA Technical Reports Server (NTRS)

Green, Scott; Kouchakdjian, Ara; Basili, Victor; Weidow, David

1990-01-01

This case study analyzes the application of the cleanroom software development methodology to the development of production software at the NASA/Goddard Space Flight Center. The cleanroom methodology emphasizes human discipline in program verification to produce reliable software products that are right the first time. Preliminary analysis of the cleanroom case study shows that the method can be applied successfully in the FDD environment and may increase staff productivity and product quality. Compared to typical Software Engineering Laboratory (SEL) activities, there is evidence of lower failure rates, a more complete and consistent set of inline code documentation, a different distribution of phase effort activity, and a different growth profile in terms of lines of code developed. The major goals of the study were to: (1) assess the process used in the SEL cleanroom model with respect to team structure, team activities, and effort distribution; (2) analyze the products of the SEL cleanroom model and determine the impact on measures of interest, including reliability, productivity, overall life-cycle cost, and software quality; and (3) analyze the residual products in the application of the SEL cleanroom model, such as fault distribution, error characteristics, system growth, and computer usage.

Integrated testing and verification system for research flight software design document

NASA Technical Reports Server (NTRS)

Taylor, R. N.; Merilatt, R. L.; Osterweil, L. J.

1979-01-01

The NASA Langley Research Center is developing the MUST (Multipurpose User-oriented Software Technology) program to cut the cost of producing research flight software through a system of software support tools. The HAL/S language is the primary subject of the design. Boeing Computer Services Company (BCS) has designed an integrated verification and testing capability as part of MUST. Documentation, verification and test options are provided with special attention on real time, multiprocessing issues. The needs of the entire software production cycle have been considered, with effective management and reduced lifecycle costs as foremost goals. Capabilities have been included in the design for static detection of data flow anomalies involving communicating concurrent processes. Some types of ill formed process synchronization and deadlock also are detected statically.

A Case Study of 4 & 5 Cost Effectiveness

NASA Technical Reports Server (NTRS)

Neal, Ralph D.; McCaugherty, Dan; Joshi, Tulasi; Callahan, John

1997-01-01

This paper looks at the Independent Verification and Validation (IV&V) of NASA's Space Shuttle Day of Launch I-Load Update (DoLILU) project. IV&V is defined. The system's development life cycle is explained. Data collection and analysis are described. DoLILU Issue Tracking Reports (DITRs) authored by IV&V personnel are analyzed to determine the effectiveness of IV&V in finding errors before the code, testing, and integration phase of the software development life cycle. The study's findings are reported along with the limitations of the study and planned future research.

FloWave.US: validated, open-source, and flexible software for ultrasound blood flow analysis.

PubMed

Coolbaugh, Crystal L; Bush, Emily C; Caskey, Charles F; Damon, Bruce M; Towse, Theodore F

2016-10-01

Automated software improves the accuracy and reliability of blood velocity, vessel diameter, blood flow, and shear rate ultrasound measurements, but existing software offers limited flexibility to customize and validate analyses. We developed FloWave.US-open-source software to automate ultrasound blood flow analysis-and demonstrated the validity of its blood velocity (aggregate relative error, 4.32%) and vessel diameter (0.31%) measures with a skeletal muscle ultrasound flow phantom. Compared with a commercial, manual analysis software program, FloWave.US produced equivalent in vivo cardiac cycle time-averaged mean (TAMean) velocities at rest and following a 10-s muscle contraction (mean bias <1 pixel for both conditions). Automated analysis of ultrasound blood flow data was 9.8 times faster than the manual method. Finally, a case study of a lower extremity muscle contraction experiment highlighted the ability of FloWave.US to measure small fluctuations in TAMean velocity, vessel diameter, and mean blood flow at specific time points in the cardiac cycle. In summary, the collective features of our newly designed software-accuracy, reliability, reduced processing time, cost-effectiveness, and flexibility-offer advantages over existing proprietary options. Further, public distribution of FloWave.US allows researchers to easily access and customize code to adapt ultrasound blood flow analysis to a variety of vascular physiology applications. Copyright © 2016 the American Physiological Society.

A Content Markup Language for Data Services

NASA Astrophysics Data System (ADS)

Noviello, C.; Acampa, P.; Mango Furnari, M.

Network content delivery and documents sharing is possible using a variety of technologies, such as distributed databases, service-oriented applications, and so forth. The development of such systems is a complex job, because document life cycle involves a strong cooperation between domain experts and software developers. Furthermore, the emerging software methodologies, such as the service-oriented architecture and knowledge organization (e.g., semantic web) did not really solve the problems faced in a real distributed and cooperating settlement. In this chapter the authors' efforts to design and deploy a distribute and cooperating content management system are described. The main features of the system are a user configurable document type definition and a management middleware layer. It allows CMS developers to orchestrate the composition of specialized software components around the structure of a document. In this chapter are also reported some of the experiences gained on deploying the developed framework in a cultural heritage dissemination settlement.

Spacecraft Avionics Software Development Then and Now: Different but the Same

NASA Technical Reports Server (NTRS)

Mangieri, Mark L.; Garman, John (Jack); Vice, Jason

2012-01-01

NASA has always been in the business of balancing new technologies and techniques to achieve human space travel objectives. NASA s historic Software Production Facility (SPF) was developed to serve complex avionics software solutions during an era dominated by mainframes, tape drives, and lower level programming languages. These systems have proven themselves resilient enough to serve the Shuttle Orbiter Avionics life cycle for decades. The SPF and its predecessor the Software Development Lab (SDL) at NASA s Johnson Space Center (JSC) hosted flight software (FSW) engineering, development, simulation, and test. It was active from the beginning of Shuttle Orbiter development in 1972 through the end of the shuttle program in the summer of 2011 almost 40 years. NASA s Kedalion engineering analysis lab is on the forefront of validating and using many contemporary avionics HW/SW development and integration techniques, which represent new paradigms to NASA s heritage culture in avionics software engineering. Kedalion has validated many of the Orion project s HW/SW engineering techniques borrowed from the adjacent commercial aircraft avionics environment, inserting new techniques and skills into the Multi-Purpose Crew Vehicle (MPCV) Orion program. Using contemporary agile techniques, COTS products, early rapid prototyping, in-house expertise and tools, and customer collaboration, NASA has adopted a cost effective paradigm that is currently serving Orion effectively. This paper will explore and contrast differences in technology employed over the years of NASA s space program, due largely to technological advances in hardware and software systems, while acknowledging that the basic software engineering and integration paradigms share many similarities.

The Need for V&V in Reuse-Based Software Engineering

NASA Technical Reports Server (NTRS)

Addy, Edward A.

1997-01-01

V&V is currently performed during application development for many systems, especially safety-critical and mission-critical systems. The V&V process is intended to discover errors, especially errors related to entire' domain or product line rather than a critical processing, as early as possible during the development process. The system application provides the context under which the software artifacts are validated. engineering. This paper describes a framework that extends V&V from an individual application system to a product line of systems that are developed within an architecture-based software engineering environment. This framework includes the activities of traditional application-level V&V, and extends these activities into the transition between domain engineering and application engineering. The framework includes descriptions of the types of activities to be performed during each of the life-cycle phases, and provides motivation for activities.

Formal Methods Case Studies for DO-333

NASA Technical Reports Server (NTRS)

Cofer, Darren; Miller, Steven P.

2014-01-01

RTCA DO-333, Formal Methods Supplement to DO-178C and DO-278A provides guidance for software developers wishing to use formal methods in the certification of airborne systems and air traffic management systems. The supplement identifies the modifications and additions to DO-178C and DO-278A objectives, activities, and software life cycle data that should be addressed when formal methods are used as part of the software development process. This report presents three case studies describing the use of different classes of formal methods to satisfy certification objectives for a common avionics example - a dual-channel Flight Guidance System. The three case studies illustrate the use of theorem proving, model checking, and abstract interpretation. The material presented is not intended to represent a complete certification effort. Rather, the purpose is to illustrate how formal methods can be used in a realistic avionics software development project, with a focus on the evidence produced that could be used to satisfy the verification objectives found in Section 6 of DO-178C.

Agile informatics: application of agile project management to the development of a personal health application.

PubMed

Chung, Jeanhee; Pankey, Evan; Norris, Ryan J

2007-10-11

We describe the application of the Agile method-- a short iteration cycle, user responsive, measurable software development approach-- to the project management of a modular personal health record, iHealthSpace, to be deployed to the patients and providers of a large academic primary care practice.

Taking advantage of ground data systems attributes to achieve quality results in testing software

NASA Technical Reports Server (NTRS)

Sigman, Clayton B.; Koslosky, John T.; Hageman, Barbara H.

1994-01-01

During the software development life cycle process, basic testing starts with the development team. At the end of the development process, an acceptance test is performed for the user to ensure that the deliverable is acceptable. Ideally, the delivery is an operational product with zero defects. However, the goal of zero defects is normally not achieved but is successful to various degrees. With the emphasis on building low cost ground support systems while maintaining a quality product, a key element in the test process is simulator capability. This paper reviews the Transportable Payload Operations Control Center (TPOCC) Advanced Spacecraft Simulator (TASS) test tool that is used in the acceptance test process for unmanned satellite operations control centers. The TASS is designed to support the development, test and operational environments of the Goddard Space Flight Center (GSFC) operations control centers. The TASS uses the same basic architecture as the operations control center. This architecture is characterized by its use of distributed processing, industry standards, commercial off-the-shelf (COTS) hardware and software components, and reusable software. The TASS uses much of the same TPOCC architecture and reusable software that the operations control center developer uses. The TASS also makes use of reusable simulator software in the mission specific versions of the TASS. Very little new software needs to be developed, mainly mission specific telemetry communication and command processing software. By taking advantage of the ground data system attributes, successful software reuse for operational systems provides the opportunity to extend the reuse concept into the test area. Consistency in test approach is a major step in achieving quality results.

CASE tools and UML: state of the ART.

PubMed

Agarwal, S

2001-05-01

With increasing need for automated tools to assist complex systems development, software design methods are becoming popular. This article analyzes the state of art in computer-aided software engineering (CASE) tools and unified modeling language (UML), focusing on their evolution, merits, and industry usage. It identifies managerial issues for the tools' adoption and recommends an action plan to select and implement them. While CASE and UML offer inherent advantages like cheaper, shorter, and efficient development cycles, they suffer from poor user satisfaction. The critical success factors for their implementation include, among others, management and staff commitment, proper corporate infrastructure, and user training.

A generalized model for multi-marker analysis of cell cycle progression in synchrony experiments

PubMed Central

Mayhew, Michael B.; Robinson, Joshua W.; Jung, Boyoun; Haase, Steven B.; Hartemink, Alexander J.

2011-01-01

Motivation: To advance understanding of eukaryotic cell division, it is important to observe the process precisely. To this end, researchers monitor changes in dividing cells as they traverse the cell cycle, with the presence or absence of morphological or genetic markers indicating a cell's position in a particular interval of the cell cycle. A wide variety of marker data is available, including information-rich cellular imaging data. However, few formal statistical methods have been developed to use these valuable data sources in estimating how a population of cells progresses through the cell cycle. Furthermore, existing methods are designed to handle only a single binary marker of cell cycle progression at a time. Consequently, they cannot facilitate comparison of experiments involving different sets of markers. Results: Here, we develop a new sampling model to accommodate an arbitrary number of different binary markers that characterize the progression of a population of dividing cells along a branching process. We engineer a strain of Saccharomyces cerevisiae with fluorescently labeled markers of cell cycle progression, and apply our new model to two image datasets we collected from the strain, as well as an independent dataset of different markers. We use our model to estimate the duration of post-cytokinetic attachment between a S.cerevisiae mother and daughter cell. The Java implementation is fast and extensible, and includes a graphical user interface. Our model provides a powerful and flexible cell cycle analysis tool, suitable to any type or combination of binary markers. Availability: The software is available from: http://www.cs.duke.edu/~amink/software/cloccs/. Contact: michael.mayhew@duke.edu; amink@cs.duke.edu PMID:21685084

The experience factory: Can it make you a 5? or what is its relationship to other quality and improvement concepts?

NASA Technical Reports Server (NTRS)

Basili, Victor R.

1992-01-01

The concepts of quality improvements have permeated many businesses. It is clear that the nineties will be the quality era for software and there is a growing need to develop or adapt quality improvement approaches to the software business. Thus we must understand software as an artifact and software as a business. Since the business we are dealing with is software, we must understand the nature of software and software development. The software discipline is evolutionary and experimental; it is a laboratory science. Software is development not production. The technologies of the discipline are human based. There is a lack of models that allow us to reason about the process and the product. All software is not the same; process is a variable, goals are variable, etc. Packaged, reusable, experiences require additional resources in the form of organization, processes, people, etc. There have been a variety of organizational frameworks proposed to improve quality for various businesses. The ones discussed in this presentation include: Plan-Do-Check-Act, a quality improvement process based upon a feedback cycle for optimizing a single process model/production line; the Experience Factory/Quality Improvement Paradigm, continuous improvements through the experimentation, packaging, and reuse of experiences based upon a business's needs; Total Quality Management, a management approach to long term success through customer satisfaction based on the participation of all members of an organization; the SEI capability maturity model, a staged process improvement based upon assessment with regard to a set of key process areas until you reach a level 5 which represents a continuous process improvement; and Lean (software) Development, a principle supporting the concentration of the production on 'value added' activities and the elimination of reduction of 'not value added' activities.

Material Protection, Accounting, and Control Technologies (MPACT) Advanced Integration Roadmap

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miller, Mike; Cipiti, Ben; Demuth, Scott Francis

2017-01-30

The development of sustainable advanced nuclear fuel cycles is a long-term goal of the Office of Nuclear Energy’s (DOE-NE) Fuel Cycle Technologies program. The Material Protection, Accounting, and Control Technologies (MPACT) campaign is supporting research and development (R&D) of advanced instrumentation, analysis tools, and integration methodologies to meet this goal (Miller, 2015). This advanced R&D is intended to facilitate safeguards and security by design of fuel cycle facilities. The lab-scale demonstration of a virtual facility, distributed test bed, that connects the individual tools being developed at National Laboratories and university research establishments, is a key program milestone for 2020. Thesemore » tools will consist of instrumentation and devices as well as computer software for modeling, simulation and integration.« less

Material Protection, Accounting, and Control Technologies (MPACT) Advanced Integration Roadmap

DOE Office of Scientific and Technical Information (OSTI.GOV)

Durkee, Joe W.; Cipiti, Ben; Demuth, Scott Francis

The development of sustainable advanced nuclear fuel cycles is a long-term goal of the Office of Nuclear Energy’s (DOE-NE) Fuel Cycle Technologies program. The Material Protection, Accounting, and Control Technologies (MPACT) campaign is supporting research and development (R&D) of advanced instrumentation, analysis tools, and integration methodologies to meet this goal (Miller, 2015). This advanced R&D is intended to facilitate safeguards and security by design of fuel cycle facilities. The lab-scale demonstration of a virtual facility, distributed test bed, that connects the individual tools being developed at National Laboratories and university research establishments, is a key program milestone for 2020. Thesemore » tools will consist of instrumentation and devices as well as computer software for modeling, simulation and integration.« less

Reducing Design Cycle Time and Cost Through Process Resequencing

NASA Technical Reports Server (NTRS)

Rogers, James L.

2004-01-01

In today's competitive environment, companies are under enormous pressure to reduce the time and cost of their design cycle. One method for reducing both time and cost is to develop an understanding of the flow of the design processes and the effects of the iterative subcycles that are found in complex design projects. Once these aspects are understood, the design manager can make decisions that take advantage of decomposition, concurrent engineering, and parallel processing techniques to reduce the total time and the total cost of the design cycle. One software tool that can aid in this decision-making process is the Design Manager's Aid for Intelligent Decomposition (DeMAID). The DeMAID software minimizes the feedback couplings that create iterative subcycles, groups processes into iterative subcycles, and decomposes the subcycles into a hierarchical structure. The real benefits of producing the best design in the least time and at a minimum cost are obtained from sequencing the processes in the subcycles.

Application of Lightweight Formal Methods to Software Security

NASA Technical Reports Server (NTRS)

Gilliam, David P.; Powell, John D.; Bishop, Matt

2005-01-01

Formal specification and verification of security has proven a challenging task. There is no single method that has proven feasible. Instead, an integrated approach which combines several formal techniques can increase the confidence in the verification of software security properties. Such an approach which species security properties in a library that can be reused by 2 instruments and their methodologies developed for the National Aeronautics and Space Administration (NASA) at the Jet Propulsion Laboratory (JPL) are described herein The Flexible Modeling Framework (FMF) is a model based verijkation instrument that uses Promela and the SPIN model checker. The Property Based Tester (PBT) uses TASPEC and a Text Execution Monitor (TEM). They are used to reduce vulnerabilities and unwanted exposures in software during the development and maintenance life cycles.

A model for a knowledge-based system's life cycle

NASA Technical Reports Server (NTRS)

Kiss, Peter A.

1990-01-01

The American Institute of Aeronautics and Astronautics has initiated a Committee on Standards for Artificial Intelligence. Presented here are the initial efforts of one of the working groups of that committee. The purpose here is to present a candidate model for the development life cycle of Knowledge Based Systems (KBS). The intent is for the model to be used by the Aerospace Community and eventually be evolved into a standard. The model is rooted in the evolutionary model, borrows from the spiral model, and is embedded in the standard Waterfall model for software development. Its intent is to satisfy the development of both stand-alone and embedded KBSs. The phases of the life cycle are detailed as are and the review points that constitute the key milestones throughout the development process. The applicability and strengths of the model are discussed along with areas needing further development and refinement by the aerospace community.

Sonic Onyx: Case Study of an Interactive Artwork

NASA Astrophysics Data System (ADS)

Ahmed, Salah Uddin; Jaccheri, Letizia; M'kadmi, Samir

Software supported art projects are increasing in numbers in recent years as artists are exploring how computing can be used to create new forms of live art. Interactive sound installation is one kind of art in this genre. In this article we present the development process and functional description of Sonic Onyx, an interactive sound installation. The objective is to show, through the life cycle of Sonic Onyx, how a software dependent interactive artwork involves its users and raises issues related to its interaction and functionalities.

Development of a smart type motor operated valve for nuclear power plants

NASA Astrophysics Data System (ADS)

Kim, Chang-Hwoi; Park, Joo-Hyun; Lee, Dong-young; Koo, In-Soo

2005-12-01

In this paper, the design concept of the smart type motor operator valve for nuclear power plant was described. The development objective of the smart valve is to achieve superior accuracy, long-term reliability, and ease of use. In this reasons, developed smart valve has fieldbus communication such as deviceNet and Profibus-DP, auto-tuning PID controller, self-diagnostics, and on-line calibration capabilities. And also, to achieve pressure, temperature, and flow control with internal PID controller, the pressure sensor and transmitter were included in this valve. And, temperature and flow signal acquisition port was prepared. The developed smart valve will be performed equipment qualification test such as environment, EMI/EMC, and vibration in Korea Test Lab. And, the valve performance is tested in a test loop which is located in Seoul National University Lab. To apply nuclear power plant, the software is being developed according to software life cycle. The developed software is verified by independent software V and V team. It is expected that the smart valve can be applied to an existing NPPs for replacing or to a new nuclear power plants. The design and fabrication of smart valve is now being processed.

Software Dependability and Safety Evaluations ESA's Initiative

NASA Astrophysics Data System (ADS)

Hernek, M.

ESA has allocated funds for an initiative to evaluate Dependability and Safety methods of Software. The objectives of this initiative are; · More extensive validation of Safety and Dependability techniques for Software · Provide valuable results to improve the quality of the Software thus promoting the application of Dependability and Safety methods and techniques. ESA space systems are being developed according to defined PA requirement specifications. These requirements may be implemented through various design concepts, e.g. redundancy, diversity etc. varying from project to project. Analysis methods (FMECA. FTA, HA, etc) are frequently used during requirements analysis and design activities to assure the correct implementation of system PA requirements. The criticality level of failures, functions and systems is determined and by doing that the critical sub-systems are identified, on which dependability and safety techniques are to be applied during development. Proper performance of the software development requires the development of a technical specification for the products at the beginning of the life cycle. Such technical specification comprises both functional and non-functional requirements. These non-functional requirements address characteristics of the product such as quality, dependability, safety and maintainability. Software in space systems is more and more used in critical functions. Also the trend towards more frequent use of COTS and reusable components pose new difficulties in terms of assuring reliable and safe systems. Because of this, its dependability and safety must be carefully analysed. ESA identified and documented techniques, methods and procedures to ensure that software dependability and safety requirements are specified and taken into account during the design and development of a software system and to verify/validate that the implemented software systems comply with these requirements [R1].

SLS Flight Software Testing: Using a Modified Agile Software Testing Approach

NASA Technical Reports Server (NTRS)

Bolton, Albanie T.

2016-01-01

NASA's Space Launch System (SLS) is an advanced launch vehicle for a new era of exploration beyond earth's orbit (BEO). The world's most powerful rocket, SLS, will launch crews of up to four astronauts in the agency's Orion spacecraft on missions to explore multiple deep-space destinations. Boeing is developing the SLS core stage, including the avionics that will control vehicle during flight. The core stage will be built at NASA's Michoud Assembly Facility (MAF) in New Orleans, LA using state-of-the-art manufacturing equipment. At the same time, the rocket's avionics computer software is being developed here at Marshall Space Flight Center in Huntsville, AL. At Marshall, the Flight and Ground Software division provides comprehensive engineering expertise for development of flight and ground software. Within that division, the Software Systems Engineering Branch's test and verification (T&V) team uses an agile test approach in testing and verification of software. The agile software test method opens the door for regular short sprint release cycles. The idea or basic premise behind the concept of agile software development and testing is that it is iterative and developed incrementally. Agile testing has an iterative development methodology where requirements and solutions evolve through collaboration between cross-functional teams. With testing and development done incrementally, this allows for increased features and enhanced value for releases. This value can be seen throughout the T&V team processes that are documented in various work instructions within the branch. The T&V team produces procedural test results at a higher rate, resolves issues found in software with designers at an earlier stage versus at a later release, and team members gain increased knowledge of the system architecture by interfacing with designers. SLS Flight Software teams want to continue uncovering better ways of developing software in an efficient and project beneficial manner. Through agile testing, there has been increased value through individuals and interactions over processes and tools, improved customer collaboration, and improved responsiveness to changes through controlled planning. The presentation will describe agile testing methodology as taken with the SLS FSW Test and Verification team at Marshall Space Flight Center.

A Framework for Performing Verification and Validation in Reuse Based Software Engineering

NASA Technical Reports Server (NTRS)

Addy, Edward A.

1997-01-01

Verification and Validation (V&V) is currently performed during application development for many systems, especially safety-critical and mission- critical systems. The V&V process is intended to discover errors, especially errors related to critical processing, as early as possible during the development process. The system application provides the context under which the software artifacts are validated. This paper describes a framework that extends V&V from an individual application system to a product line of systems that are developed within an architecture-based software engineering environment. This framework includes the activities of traditional application-level V&V, and extends these activities into domain engineering and into the transition between domain engineering and application engineering. The framework includes descriptions of the types of activities to be performed during each of the life-cycle phases, and provides motivation for the activities.

Benefits of Matching Domain Structure for Planning Software: The Right Stuff

NASA Technical Reports Server (NTRS)

Billman, Dorrit Owen; Arsintescu, Lucica; Feary, Michael S.; Lee, Jessica Chia-Rong; Smith, Asha Halima; Tiwary, Rachna

2011-01-01

We investigated the role of domain structure in software design. We compared 2 planning applications, for a Mission Control group (International Space Station), and measured users speed and accuracy. Based on our needs analysis, we identified domain structure and used this to develop new prototype software that matched domain structure better than the legacy system. We took a high-fidelity analog of the natural task into the laboratory and found (large) periformance differences, favoring the system that matched domain structure. Our task design enabled us to attribute better periormance to better match of domain structure. We ran through the whole development cycle, in miniature, from needs analysis through design, development, and evaluation. Doing so enabled inferences not just about the particular systems compared, but also provided evidence for the viability of the design process (particularly needs analysis) that we are exploring.

Agile Acceptance Test–Driven Development of Clinical Decision Support Advisories: Feasibility of Using Open Source Software

PubMed Central

Baldwin, Krystal L; Kannan, Vaishnavi; Flahaven, Emily L; Parks, Cassandra J; Ott, Jason M; Willett, Duwayne L

2018-01-01

Background Moving to electronic health records (EHRs) confers substantial benefits but risks unintended consequences. Modern EHRs consist of complex software code with extensive local configurability options, which can introduce defects. Defects in clinical decision support (CDS) tools are surprisingly common. Feasible approaches to prevent and detect defects in EHR configuration, including CDS tools, are needed. In complex software systems, use of test–driven development and automated regression testing promotes reliability. Test–driven development encourages modular, testable design and expanding regression test coverage. Automated regression test suites improve software quality, providing a “safety net” for future software modifications. Each automated acceptance test serves multiple purposes, as requirements (prior to build), acceptance testing (on completion of build), regression testing (once live), and “living” design documentation. Rapid-cycle development or “agile” methods are being successfully applied to CDS development. The agile practice of automated test–driven development is not widely adopted, perhaps because most EHR software code is vendor-developed. However, key CDS advisory configuration design decisions and rules stored in the EHR may prove amenable to automated testing as “executable requirements.” Objective We aimed to establish feasibility of acceptance test–driven development of clinical decision support advisories in a commonly used EHR, using an open source automated acceptance testing framework (FitNesse). Methods Acceptance tests were initially constructed as spreadsheet tables to facilitate clinical review. Each table specified one aspect of the CDS advisory’s expected behavior. Table contents were then imported into a test suite in FitNesse, which queried the EHR database to automate testing. Tests and corresponding CDS configuration were migrated together from the development environment to production, with tests becoming part of the production regression test suite. Results We used test–driven development to construct a new CDS tool advising Emergency Department nurses to perform a swallowing assessment prior to administering oral medication to a patient with suspected stroke. Test tables specified desired behavior for (1) applicable clinical settings, (2) triggering action, (3) rule logic, (4) user interface, and (5) system actions in response to user input. Automated test suite results for the “executable requirements” are shown prior to building the CDS alert, during build, and after successful build. Conclusions Automated acceptance test–driven development and continuous regression testing of CDS configuration in a commercial EHR proves feasible with open source software. Automated test–driven development offers one potential contribution to achieving high-reliability EHR configuration. Vetting acceptance tests with clinicians elicits their input on crucial configuration details early during initial CDS design and iteratively during rapid-cycle optimization. PMID:29653922

Agile Acceptance Test-Driven Development of Clinical Decision Support Advisories: Feasibility of Using Open Source Software.

PubMed

Basit, Mujeeb A; Baldwin, Krystal L; Kannan, Vaishnavi; Flahaven, Emily L; Parks, Cassandra J; Ott, Jason M; Willett, Duwayne L

2018-04-13

Moving to electronic health records (EHRs) confers substantial benefits but risks unintended consequences. Modern EHRs consist of complex software code with extensive local configurability options, which can introduce defects. Defects in clinical decision support (CDS) tools are surprisingly common. Feasible approaches to prevent and detect defects in EHR configuration, including CDS tools, are needed. In complex software systems, use of test-driven development and automated regression testing promotes reliability. Test-driven development encourages modular, testable design and expanding regression test coverage. Automated regression test suites improve software quality, providing a "safety net" for future software modifications. Each automated acceptance test serves multiple purposes, as requirements (prior to build), acceptance testing (on completion of build), regression testing (once live), and "living" design documentation. Rapid-cycle development or "agile" methods are being successfully applied to CDS development. The agile practice of automated test-driven development is not widely adopted, perhaps because most EHR software code is vendor-developed. However, key CDS advisory configuration design decisions and rules stored in the EHR may prove amenable to automated testing as "executable requirements." We aimed to establish feasibility of acceptance test-driven development of clinical decision support advisories in a commonly used EHR, using an open source automated acceptance testing framework (FitNesse). Acceptance tests were initially constructed as spreadsheet tables to facilitate clinical review. Each table specified one aspect of the CDS advisory's expected behavior. Table contents were then imported into a test suite in FitNesse, which queried the EHR database to automate testing. Tests and corresponding CDS configuration were migrated together from the development environment to production, with tests becoming part of the production regression test suite. We used test-driven development to construct a new CDS tool advising Emergency Department nurses to perform a swallowing assessment prior to administering oral medication to a patient with suspected stroke. Test tables specified desired behavior for (1) applicable clinical settings, (2) triggering action, (3) rule logic, (4) user interface, and (5) system actions in response to user input. Automated test suite results for the "executable requirements" are shown prior to building the CDS alert, during build, and after successful build. Automated acceptance test-driven development and continuous regression testing of CDS configuration in a commercial EHR proves feasible with open source software. Automated test-driven development offers one potential contribution to achieving high-reliability EHR configuration. Vetting acceptance tests with clinicians elicits their input on crucial configuration details early during initial CDS design and iteratively during rapid-cycle optimization. ©Mujeeb A Basit, Krystal L Baldwin, Vaishnavi Kannan, Emily L Flahaven, Cassandra J Parks, Jason M Ott, Duwayne L Willett. Originally published in JMIR Medical Informatics (http://medinform.jmir.org), 13.04.2018.

Federal Communications Commission (FCC) Transponder Loading Data Conversion Software. User's guide and software maintenance manual, version 1.2

NASA Technical Reports Server (NTRS)

Mallasch, Paul G.

1993-01-01

This volume contains the complete software system documentation for the Federal Communications Commission (FCC) Transponder Loading Data Conversion Software (FIX-FCC). This software was written to facilitate the formatting and conversion of FCC Transponder Occupancy (Loading) Data before it is loaded into the NASA Geosynchronous Satellite Orbital Statistics Database System (GSOSTATS). The information that FCC supplies NASA is in report form and must be converted into a form readable by the database management software used in the GSOSTATS application. Both the User's Guide and Software Maintenance Manual are contained in this document. This volume of documentation passed an independent quality assurance review and certification by the Product Assurance and Security Office of the Planning Research Corporation (PRC). The manuals were reviewed for format, content, and readability. The Software Management and Assurance Program (SMAP) life cycle and documentation standards were used in the development of this document. Accordingly, these standards were used in the review. Refer to the System/Software Test/Product Assurance Report for the Geosynchronous Satellite Orbital Statistics Database System (GSOSTATS) for additional information.

Advanced Automation for Ion Trap Mass Spectrometry-New Opportunities for Real-Time Autonomous Analysis

NASA Technical Reports Server (NTRS)

Palmer, Peter T.; Wong, C. M.; Salmonson, J. D.; Yost, R. A.; Griffin, T. P.; Yates, N. A.; Lawless, James G. (Technical Monitor)

1994-01-01

The utility of MS/MS for both target compound analysis and the structure elucidation of unknowns has been described in a number of references. A broader acceptance of this technique has not yet been realized as it requires large, complex, and costly instrumentation which has not been competitive with more conventional techniques. Recent advancements in ion trap mass spectrometry promise to change this situation. Although the ion trap's small size, sensitivity, and ability to perform multiple stages of mass spectrometry have made it eminently suitable for on-line, real-time monitoring applications, advance automation techniques are required to make these capabilities more accessible to non-experts. Towards this end we have developed custom software for the design and implementation of MS/MS experiments. This software allows the user to take full advantage of the ion trap's versatility with respect to ionization techniques, scan proxies, and ion accumulation/ejection methods. Additionally, expert system software has been developed for autonomous target compound analysis. This software has been linked to ion trap control software and a commercial data system to bring all of the steps in the analysis cycle under control of the expert system. These software development efforts and their utilization for a number of trace analysis applications will be described.

Modeling of the competition life cycle using the software complex of cellular automata PyCAlab

NASA Astrophysics Data System (ADS)

Berg, D. B.; Beklemishev, K. A.; Medvedev, A. N.; Medvedeva, M. A.

2015-11-01

The aim of the work is to develop a numerical model of the life cycle of competition on the basis of software complex cellular automata PyCAlab. The model is based on the general patterns of growth of various systems in resource-limited settings. At examples it is shown that the period of transition from an unlimited growth of the market agents to the stage of competitive growth takes quite a long time and may be characterized as monotonic. During this period two main strategies of competitive selection coexist: 1) capture of maximum market space with any reasonable costs; 2) saving by reducing costs. The obtained results allow concluding that the competitive strategies of companies must combine two mentioned types of behavior, and this issue needs to be given adequate attention in the academic literature on management. The created numerical model may be used for market research when developing of the strategies for promotion of new goods and services.

Effort Drivers Estimation for Brazilian Geographically Distributed Software Development

NASA Astrophysics Data System (ADS)

Almeida, Ana Carina M.; Souza, Renata; Aquino, Gibeon; Meira, Silvio

To meet the requirements of today’s fast paced markets, it is important to develop projects on time and with the minimum use of resources. A good estimate is the key to achieve this goal. Several companies have started to work with geographically distributed teams due to cost reduction and time-to-market. Some researchers indicate that this approach introduces new challenges, because the teams work in different time zones and have possible differences in culture and language. It is already known that the multisite development increases the software cycle time. Data from 15 DSD projects from 10 distinct companies were collected. The analysis shows drivers that impact significantly the total effort planned to develop systems using DSD approach in Brazil.

Development strategies for the satellite flight software on-board Meteosat Third Generation

NASA Astrophysics Data System (ADS)

Tipaldi, Massimo; Legendre, Cedric; Koopmann, Olliver; Ferraguto, Massimo; Wenker, Ralf; D'Angelo, Gianni

2018-04-01

Nowadays, satellites are becoming increasingly software dependent. Satellite Flight Software (FSW), that is to say, the application software running on the satellite main On-Board Computer (OBC), plays a relevant role in implementing complex space mission requirements. In this paper, we examine relevant technical approaches and programmatic strategies adopted for the development of the Meteosat Third Generation Satellite (MTG) FSW. To begin with, we present its layered model-based architecture, and the means for ensuring a robust and reliable interaction among the FSW components. Then, we focus on the selection of an effective software development life cycle model. In particular, by combining plan-driven and agile approaches, we can fulfill the need of having preliminary SW versions. They can be used for the elicitation of complex system-level requirements as well as for the initial satellite integration and testing activities. Another important aspect can be identified in the testing activities. Indeed, very demanding quality requirements have to be fulfilled in satellite SW applications. This manuscript proposes a test automation framework, which uses an XML-based test procedure language independent of the underlying test environment. Finally, a short overview of the MTG FSW sizing and timing budgets concludes the paper.

GEDAE-LaB: A Free Software to Calculate the Energy System Contributions during Exercise

PubMed Central

Bertuzzi, Rômulo; Melegati, Jorge; Bueno, Salomão; Ghiarone, Thaysa; Pasqua, Leonardo A.; Gáspari, Arthur Fernandes; Lima-Silva, Adriano E.; Goldman, Alfredo

2016-01-01

Purpose The aim of the current study is to describe the functionality of free software developed for energy system contributions and energy expenditure calculation during exercise, namely GEDAE-LaB. Methods Eleven participants performed the following tests: 1) a maximal cycling incremental test to measure the ventilatory threshold and maximal oxygen uptake (V˙O2max); 2) a cycling workload constant test at moderate domain (90% ventilatory threshold); 3) a cycling workload constant test at severe domain (110% V˙O2max). Oxygen uptake and plasma lactate were measured during the tests. The contributions of the aerobic (AMET), anaerobic lactic (LAMET), and anaerobic alactic (ALMET) systems were calculated based on the oxygen uptake during exercise, the oxygen energy equivalents provided by lactate accumulation, and the fast component of excess post-exercise oxygen consumption, respectively. In order to assess the intra-investigator variation, four different investigators performed the analyses independently using GEDAE-LaB. A direct comparison with commercial software was also provided. Results All subjects completed 10 min of exercise at moderate domain, while the time to exhaustion at severe domain was 144 ± 65 s. The AMET, LAMET, and ALMET contributions during moderate domain were about 93, 2, and 5%, respectively. The AMET, LAMET, and ALMET contributions during severe domain were about 66, 21, and 13%, respectively. No statistical differences were found between the energy system contributions and energy expenditure obtained by GEDAE-LaB and commercial software for both moderate and severe domains (P > 0.05). The ICC revealed that these estimates were highly reliable among the four investigators for both moderate and severe domains (all ICC ≥ 0.94). Conclusion These findings suggest that GEDAE-LaB is a free software easily comprehended by users minimally familiarized with adopted procedures for calculations of energetic profile using oxygen uptake and lactate accumulation during exercise. By providing availability of the software and its source code we hope to facilitate future related research. PMID:26727499

GEDAE-LaB: A Free Software to Calculate the Energy System Contributions during Exercise.

PubMed

Bertuzzi, Rômulo; Melegati, Jorge; Bueno, Salomão; Ghiarone, Thaysa; Pasqua, Leonardo A; Gáspari, Arthur Fernandes; Lima-Silva, Adriano E; Goldman, Alfredo

2016-01-01

The aim of the current study is to describe the functionality of free software developed for energy system contributions and energy expenditure calculation during exercise, namely GEDAE-LaB. Eleven participants performed the following tests: 1) a maximal cycling incremental test to measure the ventilatory threshold and maximal oxygen uptake (V̇O2max); 2) a cycling workload constant test at moderate domain (90% ventilatory threshold); 3) a cycling workload constant test at severe domain (110% V̇O2max). Oxygen uptake and plasma lactate were measured during the tests. The contributions of the aerobic (AMET), anaerobic lactic (LAMET), and anaerobic alactic (ALMET) systems were calculated based on the oxygen uptake during exercise, the oxygen energy equivalents provided by lactate accumulation, and the fast component of excess post-exercise oxygen consumption, respectively. In order to assess the intra-investigator variation, four different investigators performed the analyses independently using GEDAE-LaB. A direct comparison with commercial software was also provided. All subjects completed 10 min of exercise at moderate domain, while the time to exhaustion at severe domain was 144 ± 65 s. The AMET, LAMET, and ALMET contributions during moderate domain were about 93, 2, and 5%, respectively. The AMET, LAMET, and ALMET contributions during severe domain were about 66, 21, and 13%, respectively. No statistical differences were found between the energy system contributions and energy expenditure obtained by GEDAE-LaB and commercial software for both moderate and severe domains (P > 0.05). The ICC revealed that these estimates were highly reliable among the four investigators for both moderate and severe domains (all ICC ≥ 0.94). These findings suggest that GEDAE-LaB is a free software easily comprehended by users minimally familiarized with adopted procedures for calculations of energetic profile using oxygen uptake and lactate accumulation during exercise. By providing availability of the software and its source code we hope to facilitate future related research.

Guidance and Control Software Project Data - Volume 3: Verification Documents

NASA Technical Reports Server (NTRS)

Hayhurst, Kelly J. (Editor)

2008-01-01

The Guidance and Control Software (GCS) project was the last in a series of software reliability studies conducted at Langley Research Center between 1977 and 1994. The technical results of the GCS project were recorded after the experiment was completed. Some of the support documentation produced as part of the experiment, however, is serving an unexpected role far beyond its original project context. Some of the software used as part of the GCS project was developed to conform to the RTCA/DO-178B software standard, "Software Considerations in Airborne Systems and Equipment Certification," used in the civil aviation industry. That standard requires extensive documentation throughout the software development life cycle, including plans, software requirements, design and source code, verification cases and results, and configuration management and quality control data. The project documentation that includes this information is open for public scrutiny without the legal or safety implications associated with comparable data from an avionics manufacturer. This public availability has afforded an opportunity to use the GCS project documents for DO-178B training. This report provides a brief overview of the GCS project, describes the 4-volume set of documents and the role they are playing in training, and includes the verification documents from the GCS project. Volume 3 contains four appendices: A. Software Verification Cases and Procedures for the Guidance and Control Software Project; B. Software Verification Results for the Pluto Implementation of the Guidance and Control Software; C. Review Records for the Pluto Implementation of the Guidance and Control Software; and D. Test Results Logs for the Pluto Implementation of the Guidance and Control Software.

Training: Plugging the information gaps

NASA Technical Reports Server (NTRS)

Scott, Carol J.

1993-01-01

Training is commonly viewed as an add-on function to the development cycle. It is imperative that this view be changed. The training developer needs to be a colleague in the system development process, contributing and learning along with the other development participants. Training developers can make contributions to design concepts that favor end-users. Early involvement will enhance the likelihood of training availability concurrent with software delivery. End-users will benefit and cost-savings will be realized.

Cleanroom certification model

NASA Technical Reports Server (NTRS)

Currit, P. A.

1983-01-01

The Cleanroom software development methodology is designed to take the gamble out of product releases for both suppliers and receivers of the software. The ingredients of this procedure are a life cycle of executable product increments, representative statistical testing, and a standard estimate of the MTTF (Mean Time To Failure) of the product at the time of its release. A statistical approach to software product testing using randomly selected samples of test cases is considered. A statistical model is defined for the certification process which uses the timing data recorded during test. A reasonableness argument for this model is provided that uses previously published data on software product execution. Also included is a derivation of the certification model estimators and a comparison of the proposed least squares technique with the more commonly used maximum likelihood estimators.

Development of an Ada programming support environment database SEAD (Software Engineering and Ada Database) administration manual

NASA Technical Reports Server (NTRS)

Liaw, Morris; Evesson, Donna

1988-01-01

Software Engineering and Ada Database (SEAD) was developed to provide an information resource to NASA and NASA contractors with respect to Ada-based resources and activities which are available or underway either in NASA or elsewhere in the worldwide Ada community. The sharing of such information will reduce duplication of effort while improving quality in the development of future software systems. SEAD data is organized into five major areas: information regarding education and training resources which are relevant to the life cycle of Ada-based software engineering projects such as those in the Space Station program; research publications relevant to NASA projects such as the Space Station Program and conferences relating to Ada technology; the latest progress reports on Ada projects completed or in progress both within NASA and throughout the free world; Ada compilers and other commercial products that support Ada software development; and reusable Ada components generated both within NASA and from elsewhere in the free world. This classified listing of reusable components shall include descriptions of tools, libraries, and other components of interest to NASA. Sources for the data include technical newletters and periodicals, conference proceedings, the Ada Information Clearinghouse, product vendors, and project sponsors and contractors.

Guidance and Control Software Project Data - Volume 4: Configuration Management and Quality Assurance Documents

NASA Technical Reports Server (NTRS)

Hayhurst, Kelly J. (Editor)

2008-01-01

The Guidance and Control Software (GCS) project was the last in a series of software reliability studies conducted at Langley Research Center between 1977 and 1994. The technical results of the GCS project were recorded after the experiment was completed. Some of the support documentation produced as part of the experiment, however, is serving an unexpected role far beyond its original project context. Some of the software used as part of the GCS project was developed to conform to the RTCA/DO-178B software standard, "Software Considerations in Airborne Systems and Equipment Certification," used in the civil aviation industry. That standard requires extensive documentation throughout the software development life cycle, including plans, software requirements, design and source code, verification cases and results, and configuration management and quality control data. The project documentation that includes this information is open for public scrutiny without the legal or safety implications associated with comparable data from an avionics manufacturer. This public availability has afforded an opportunity to use the GCS project documents for DO-178B training. This report provides a brief overview of the GCS project, describes the 4-volume set of documents and the role they are playing in training, and includes configuration management and quality assurance documents from the GCS project. Volume 4 contains six appendices: A. Software Accomplishment Summary for the Guidance and Control Software Project; B. Software Configuration Index for the Guidance and Control Software Project; C. Configuration Management Records for the Guidance and Control Software Project; D. Software Quality Assurance Records for the Guidance and Control Software Project; E. Problem Report for the Pluto Implementation of the Guidance and Control Software Project; and F. Support Documentation Change Reports for the Guidance and Control Software Project.

Software Engineering Laboratory (SEL) cleanroom process model

NASA Technical Reports Server (NTRS)

Green, Scott; Basili, Victor; Godfrey, Sally; Mcgarry, Frank; Pajerski, Rose; Waligora, Sharon

1991-01-01

The Software Engineering Laboratory (SEL) cleanroom process model is described. The term 'cleanroom' originates in the integrated circuit (IC) production process, where IC's are assembled in dust free 'clean rooms' to prevent the destructive effects of dust. When applying the clean room methodology to the development of software systems, the primary focus is on software defect prevention rather than defect removal. The model is based on data and analysis from previous cleanroom efforts within the SEL and is tailored to serve as a guideline in applying the methodology to future production software efforts. The phases that are part of the process model life cycle from the delivery of requirements to the start of acceptance testing are described. For each defined phase, a set of specific activities is discussed, and the appropriate data flow is described. Pertinent managerial issues, key similarities and differences between the SEL's cleanroom process model and the standard development approach used on SEL projects, and significant lessons learned from prior cleanroom projects are presented. It is intended that the process model described here will be further tailored as additional SEL cleanroom projects are analyzed.

Evaluating Predictive Models of Software Quality

NASA Astrophysics Data System (ADS)

Ciaschini, V.; Canaparo, M.; Ronchieri, E.; Salomoni, D.

2014-06-01

Applications from High Energy Physics scientific community are constantly growing and implemented by a large number of developers. This implies a strong churn on the code and an associated risk of faults, which is unavoidable as long as the software undergoes active evolution. However, the necessities of production systems run counter to this. Stability and predictability are of paramount importance; in addition, a short turn-around time for the defect discovery-correction-deployment cycle is required. A way to reconcile these opposite foci is to use a software quality model to obtain an approximation of the risk before releasing a program to only deliver software with a risk lower than an agreed threshold. In this article we evaluated two quality predictive models to identify the operational risk and the quality of some software products. We applied these models to the development history of several EMI packages with intent to discover the risk factor of each product and compare it with its real history. We attempted to determine if the models reasonably maps reality for the applications under evaluation, and finally we concluded suggesting directions for further studies.

Agile Learning: Sprinting through the Semester

ERIC Educational Resources Information Center

Lang, Guido

2017-01-01

This paper introduces agile learning, a novel pedagogical approach that applies the processes and principles of agile software development to the context of learning. Agile learning is characterized by short project cycles, called sprints, in which a usable deliverable is fully planned, designed, built, tested, reviewed, and launched. An…

APPLICATION OF THE US DECISION SUPPORT TOOL FOR MATERIALS AND WASTE MANAGEMENT

EPA Science Inventory

EPA¿s National Risk Management Research Laboratory has led the development of a municipal solid waste decision support tool (MSW-DST). The computer software can be used to calculate life-cycle environmental tradeoffs and full costs of different waste management plans or recycling...

Modular modeling system for building distributed hydrologic models with a user-friendly software package

NASA Astrophysics Data System (ADS)

Wi, S.; Ray, P. A.; Brown, C.

2015-12-01

A software package developed to facilitate building distributed hydrologic models in a modular modeling system is presented. The software package provides a user-friendly graphical user interface that eases its practical use in water resources-related research and practice. The modular modeling system organizes the options available to users when assembling models according to the stages of hydrological cycle, such as potential evapotranspiration, soil moisture accounting, and snow/glacier melting processes. The software is intended to be a comprehensive tool that simplifies the task of developing, calibrating, validating, and using hydrologic models through the inclusion of intelligent automation to minimize user effort, and reduce opportunities for error. Processes so far automated include the definition of system boundaries (i.e., watershed delineation), climate and geographical input generation, and parameter calibration. Built-in post-processing toolkits greatly improve the functionality of the software as a decision support tool for water resources system management and planning. Example post-processing toolkits enable streamflow simulation at ungauged sites with predefined model parameters, and perform climate change risk assessment by means of the decision scaling approach. The software is validated through application to watersheds representing a variety of hydrologic regimes.

Software Formal Inspections Guidebook

NASA Technical Reports Server (NTRS)

1993-01-01

The Software Formal Inspections Guidebook is designed to support the inspection process of software developed by and for NASA. This document provides information on how to implement a recommended and proven method for conducting formal inspections of NASA software. This Guidebook is a companion document to NASA Standard 2202-93, Software Formal Inspections Standard, approved April 1993, which provides the rules, procedures, and specific requirements for conducting software formal inspections. Application of the Formal Inspections Standard is optional to NASA program or project management. In cases where program or project management decide to use the formal inspections method, this Guidebook provides additional information on how to establish and implement the process. The goal of the formal inspections process as documented in the above-mentioned Standard and this Guidebook is to provide a framework and model for an inspection process that will enable the detection and elimination of defects as early as possible in the software life cycle. An ancillary aspect of the formal inspection process incorporates the collection and analysis of inspection data to effect continual improvement in the inspection process and the quality of the software subjected to the process.

Hybrid Modeling for Testing Intelligent Software for Lunar-Mars Closed Life Support

NASA Technical Reports Server (NTRS)

Malin, Jane T.; Nicholson, Leonard S. (Technical Monitor)

1999-01-01

Intelligent software is being developed for closed life support systems with biological components, for human exploration of the Moon and Mars. The intelligent software functions include planning/scheduling, reactive discrete control and sequencing, management of continuous control, and fault detection, diagnosis, and management of failures and errors. Four types of modeling information have been essential to system modeling and simulation to develop and test the software and to provide operational model-based what-if analyses: discrete component operational and failure modes; continuous dynamic performance within component modes, modeled qualitatively or quantitatively; configuration of flows and power among components in the system; and operations activities and scenarios. CONFIG, a multi-purpose discrete event simulation tool that integrates all four types of models for use throughout the engineering and operations life cycle, has been used to model components and systems involved in the production and transfer of oxygen and carbon dioxide in a plant-growth chamber and between that chamber and a habitation chamber with physicochemical systems for gas processing.

Automated Software Acceleration in Programmable Logic for an Efficient NFFT Algorithm Implementation: A Case Study.

PubMed

Rodríguez, Manuel; Magdaleno, Eduardo; Pérez, Fernando; García, Cristhian

2017-03-28

Non-equispaced Fast Fourier transform (NFFT) is a very important algorithm in several technological and scientific areas such as synthetic aperture radar, computational photography, medical imaging, telecommunications, seismic analysis and so on. However, its computation complexity is high. In this paper, we describe an efficient NFFT implementation with a hardware coprocessor using an All-Programmable System-on-Chip (APSoC). This is a hybrid device that employs an Advanced RISC Machine (ARM) as Processing System with Programmable Logic for high-performance digital signal processing through parallelism and pipeline techniques. The algorithm has been coded in C language with pragma directives to optimize the architecture of the system. We have used the very novel Software Develop System-on-Chip (SDSoC) evelopment tool that simplifies the interface and partitioning between hardware and software. This provides shorter development cycles and iterative improvements by exploring several architectures of the global system. The computational results shows that hardware acceleration significantly outperformed the software based implementation.

Automated Software Acceleration in Programmable Logic for an Efficient NFFT Algorithm Implementation: A Case Study

PubMed Central

Rodríguez, Manuel; Magdaleno, Eduardo; Pérez, Fernando; García, Cristhian

2017-01-01

Non-equispaced Fast Fourier transform (NFFT) is a very important algorithm in several technological and scientific areas such as synthetic aperture radar, computational photography, medical imaging, telecommunications, seismic analysis and so on. However, its computation complexity is high. In this paper, we describe an efficient NFFT implementation with a hardware coprocessor using an All-Programmable System-on-Chip (APSoC). This is a hybrid device that employs an Advanced RISC Machine (ARM) as Processing System with Programmable Logic for high-performance digital signal processing through parallelism and pipeline techniques. The algorithm has been coded in C language with pragma directives to optimize the architecture of the system. We have used the very novel Software Develop System-on-Chip (SDSoC) evelopment tool that simplifies the interface and partitioning between hardware and software. This provides shorter development cycles and iterative improvements by exploring several architectures of the global system. The computational results shows that hardware acceleration significantly outperformed the software based implementation. PMID:28350358

Towards a general object-oriented software development methodology

NASA Technical Reports Server (NTRS)

Seidewitz, ED; Stark, Mike

1986-01-01

An object is an abstract software model of a problem domain entity. Objects are packages of both data and operations of that data (Goldberg 83, Booch 83). The Ada (tm) package construct is representative of this general notion of an object. Object-oriented design is the technique of using objects as the basic unit of modularity in systems design. The Software Engineering Laboratory at the Goddard Space Flight Center is currently involved in a pilot program to develop a flight dynamics simulator in Ada (approximately 40,000 statements) using object-oriented methods. Several authors have applied object-oriented concepts to Ada (e.g., Booch 83, Cherry 85). It was found that these methodologies are limited. As a result a more general approach was synthesized with allows a designer to apply powerful object-oriented principles to a wide range of applications and at all stages of design. An overview is provided of this approach. Further, how object-oriented design fits into the overall software life-cycle is considered.

Parametric Crowd Generation Software for MS&T Simulations and Training

DTIC Science & Technology

2007-02-20

3 Technology Overview 5 Dynemotion System Components 5 Dynemotion System Architecture 6 Dynemotion-Enabled NPC Brain Cycles 9 Dynemotion API...Contents 10 Development Project Background Information 11 Potential Application and Impact for the DoD 13 Project Objectives, Scope...Methodology 13 Benefits of the Project 13 Project Innovation 14 *l_essons Learned and Open Questions 14 Research and Development Challenges 16

Structural dynamics payload loads estimates

NASA Technical Reports Server (NTRS)

Engels, R. C.

1982-01-01

Methods for the prediction of loads on large space structures are discussed. Existing approaches to the problem of loads calculation are surveyed. A full scale version of an alternate numerical integration technique to solve the response part of a load cycle is presented, and a set of short cut versions of the algorithm developed. The implementation of these techniques using the software package developed is discussed.

Computer Software for Life Cycle Cost.

DTIC Science & Technology

1987-04-01

34 111. 1111I .25 IL4 jj 16 MICROCOPY RESOLUTION TEST CHART hut FILE C AIR CoMMNAMN STFF COLLG STUJDET PORTO i COMpUTER SOFTWARE FOR LIFE CYCLE CO879...obsolete), physical life (utility before physically wearing out), or application life (utility in a given function)." (7:5) The costs are usually

Using Articulate Virtual Laboratories in Teaching Energy Conversion at the U.S. Naval Academy.

ERIC Educational Resources Information Center

Wu, C.

1998-01-01

The Mechanical Engineering Department at the U.S. Naval Academy is currently evaluating a new teaching method which uses computer software. Utilizing the thermodynamic-based software CyclePad, Intelligent Computer Aided Instruction is incorporated in an advanced energy conversion course for Mechanical Engineering students. The CyclePad software…

First experiences with the implementation of the European standard EN 62304 on medical device software for the quality assurance of a radiotherapy unit

PubMed Central

2014-01-01

Background According to the latest amendment of the Medical Device Directive standalone software qualifies as a medical device when intended by the manufacturer to be used for medical purposes. In this context, the EN 62304 standard is applicable which defines the life-cycle requirements for the development and maintenance of medical device software. A pilot project was launched to acquire skills in implementing this standard in a hospital-based environment (in-house manufacture). Methods The EN 62304 standard outlines minimum requirements for each stage of the software life-cycle, defines the activities and tasks to be performed and scales documentation and testing according to its criticality. The required processes were established for the pre-existent decision-support software FlashDumpComparator (FDC) used during the quality assurance of treatment-relevant beam parameters. As the EN 62304 standard implicates compliance with the EN ISO 14971 standard on the application of risk management to medical devices, a risk analysis was carried out to identify potential hazards and reduce the associated risks to acceptable levels. Results The EN 62304 standard is difficult to implement without proper tools, thus open-source software was selected and integrated into a dedicated development platform. The control measures yielded by the risk analysis were independently implemented and verified, and a script-based test automation was retrofitted to reduce the associated test effort. After all documents facilitating the traceability of the specified requirements to the corresponding tests and of the control measures to the proof of execution were generated, the FDC was released as an accessory to the HIT facility. Conclusions The implementation of the EN 62304 standard was time-consuming, and a learning curve had to be overcome during the first iterations of the associated processes, but many process descriptions and all software tools can be re-utilized in follow-up projects. It has been demonstrated that a standards-compliant development of small and medium-sized medical software can be carried out by a small team with limited resources in a clinical setting. This is of particular relevance as the upcoming revision of the Medical Device Directive is expected to harmonize and tighten the current legal requirements for all European in-house manufacturers. PMID:24655818

First experiences with the implementation of the European standard EN 62304 on medical device software for the quality assurance of a radiotherapy unit.

PubMed

Höss, Angelika; Lampe, Christian; Panse, Ralf; Ackermann, Benjamin; Naumann, Jakob; Jäkel, Oliver

2014-03-21

According to the latest amendment of the Medical Device Directive standalone software qualifies as a medical device when intended by the manufacturer to be used for medical purposes. In this context, the EN 62304 standard is applicable which defines the life-cycle requirements for the development and maintenance of medical device software. A pilot project was launched to acquire skills in implementing this standard in a hospital-based environment (in-house manufacture). The EN 62304 standard outlines minimum requirements for each stage of the software life-cycle, defines the activities and tasks to be performed and scales documentation and testing according to its criticality. The required processes were established for the pre-existent decision-support software FlashDumpComparator (FDC) used during the quality assurance of treatment-relevant beam parameters. As the EN 62304 standard implicates compliance with the EN ISO 14971 standard on the application of risk management to medical devices, a risk analysis was carried out to identify potential hazards and reduce the associated risks to acceptable levels. The EN 62304 standard is difficult to implement without proper tools, thus open-source software was selected and integrated into a dedicated development platform. The control measures yielded by the risk analysis were independently implemented and verified, and a script-based test automation was retrofitted to reduce the associated test effort. After all documents facilitating the traceability of the specified requirements to the corresponding tests and of the control measures to the proof of execution were generated, the FDC was released as an accessory to the HIT facility. The implementation of the EN 62304 standard was time-consuming, and a learning curve had to be overcome during the first iterations of the associated processes, but many process descriptions and all software tools can be re-utilized in follow-up projects. It has been demonstrated that a standards-compliant development of small and medium-sized medical software can be carried out by a small team with limited resources in a clinical setting. This is of particular relevance as the upcoming revision of the Medical Device Directive is expected to harmonize and tighten the current legal requirements for all European in-house manufacturers.

49 CFR 229.305 - Definitions.

Code of Federal Regulations, 2012 CFR

2012-10-01

... cohesion. Component means an electronic element, device, or appliance (including hardware or software) that... and software version, is documented and maintained through the life-cycle of the products in use. Executive software means software common to all installations of a given electronic product. It generally is...

49 CFR 229.305 - Definitions.

Code of Federal Regulations, 2013 CFR

2013-10-01

... cohesion. Component means an electronic element, device, or appliance (including hardware or software) that... and software version, is documented and maintained through the life-cycle of the products in use. Executive software means software common to all installations of a given electronic product. It generally is...

49 CFR 229.305 - Definitions.

Code of Federal Regulations, 2014 CFR

2014-10-01

... cohesion. Component means an electronic element, device, or appliance (including hardware or software) that... and software version, is documented and maintained through the life-cycle of the products in use. Executive software means software common to all installations of a given electronic product. It generally is...

Real time software for a heat recovery steam generator control system

DOE Office of Scientific and Technical Information (OSTI.GOV)

Valdes, R.; Delgadillo, M.A.; Chavez, R.

1995-12-31

This paper is addressed to the development and successful implementation of a real time software for the Heat Recovery Steam Generator (HRSG) control system of a Combined Cycle Power Plant. The real time software for the HRSG control system physically resides in a Control and Acquisition System (SAC) which is a component of a distributed control system (DCS). The SAC is a programmable controller. The DCS installed at the Gomez Palacio power plant in Mexico accomplishes the functions of logic, analog and supervisory control. The DCS is based on microprocessors and the architecture consists of workstations operating as a Man-Machinemore » Interface (MMI), linked to SAC controllers by means of a communication system. The HRSG real time software is composed of an operating system, drivers, dedicated computer program and application computer programs. The operating system used for the development of this software was the MultiTasking Operating System (MTOS). The application software developed at IIE for the HRSG control system basically consisted of a set of digital algorithms for the regulation of the main process variables at the HRSG. By using the multitasking feature of MTOS, the algorithms are executed pseudo concurrently. In this way, the applications programs continuously use the resources of the operating system to perform their functions through a uniform service interface. The application software of the HRSG consist of three tasks, each of them has dedicated responsibilities. The drivers were developed for the handling of hardware resources of the SAC controller which in turn allows the signals acquisition and data communication with a MMI. The dedicated programs were developed for hardware diagnostics, task initializations, access to the data base and fault tolerance. The application software and the dedicated software for the HRSG control system was developed using C programming language due to compactness, portability and efficiency.« less

Systems of Systems: Scaling Up the Development Process

DTIC Science & Technology

2006-08-01

many organizations are using the TSP and growing evidence sup- ports its efficacy [Davis 03, Grojeans 05, McAndrews 00, Pracchia 04, Rickets 05...January 2004. http://www.stsc.hill.af.mil/Crosstalk/2004/01 /0401Pracchia.html. [ Rickets 05] Rickets , Chris A. “A TSP Software Maintenance Life Cycle

Systems of Systems: Scaling up the Development Program

DTIC Science & Technology

2006-08-01

many organizations are using the TSP and growing evidence sup- ports its efficacy [Davis 03, Grojeans 05, McAndrews 00, Pracchia 04, Rickets 05...January 2004. http://www.stsc.hill.af.mil/Crosstalk/2004/01 /0401Pracchia.html. [ Rickets 05] Rickets , Chris A. “A TSP Software Maintenance Life Cycle

Enough to Go 'Round? Thinking Smart about Total Cost of Ownership

ERIC Educational Resources Information Center

McIntire, Todd

2006-01-01

Total cost of ownership or TCO refers to the life cycle of costs for technology, including both direct and indirect expenses. TCO includes costs incurred by capital (hardware, software, and facilities); administration and operation (planning, upgrade, replacement, and technical support); and end-user operation (staff development and user…

Formal Verification Toolkit for Requirements and Early Design Stages

NASA Technical Reports Server (NTRS)

Badger, Julia M.; Miller, Sheena Judson

2011-01-01

Efficient flight software development from natural language requirements needs an effective way to test designs earlier in the software design cycle. A method to automatically derive logical safety constraints and the design state space from natural language requirements is described. The constraints can then be checked using a logical consistency checker and also be used in a symbolic model checker to verify the early design of the system. This method was used to verify a hybrid control design for the suit ports on NASA Johnson Space Center's Space Exploration Vehicle against safety requirements.

Steady-State Cycle Deck Launcher Developed for Numerical Propulsion System Simulation

NASA Technical Reports Server (NTRS)

VanDrei, Donald E.

1997-01-01

One of the objectives of NASA's High Performance Computing and Communications Program's (HPCCP) Numerical Propulsion System Simulation (NPSS) is to reduce the time and cost of generating aerothermal numerical representations of engines, called customer decks. These customer decks, which are delivered to airframe companies by various U.S. engine companies, numerically characterize an engine's performance as defined by the particular U.S. airframe manufacturer. Until recently, all numerical models were provided with a Fortran-compatible interface in compliance with the Society of Automotive Engineers (SAE) document AS681F, and data communication was performed via a standard, labeled common structure in compliance with AS681F. Recently, the SAE committee began to develop a new standard: AS681G. AS681G addresses multiple language requirements for customer decks along with alternative data communication techniques. Along with the SAE committee, the NPSS Steady-State Cycle Deck project team developed a standard Application Program Interface (API) supported by a graphical user interface. This work will result in Aerospace Recommended Practice 4868 (ARP4868). The Steady-State Cycle Deck work was validated against the Energy Efficient Engine customer deck, which is publicly available. The Energy Efficient Engine wrapper was used not only to validate ARP4868 but also to demonstrate how to wrap an existing customer deck. The graphical user interface for the Steady-State Cycle Deck facilitates the use of the new standard and makes it easier to design and analyze a customer deck. This software was developed following I. Jacobson's Object-Oriented Design methodology and is implemented in C++. The AS681G standard will establish a common generic interface for U.S. engine companies and airframe manufacturers. This will lead to more accurate cycle models, quicker model generation, and faster validation leading to specifications. The standard will facilitate cooperative work between industry and NASA. The NPSS Steady-State Cycle Deck team released a batch version of the Steady-State Cycle Deck in March 1996. Version 1.1 was released in June 1996. During fiscal 1997, NPSS accepted enhancements and modifications to the Steady-State Cycle Deck launcher. Consistent with NPSS' commercialization plan, these modifications will be done by a third party that can provide long-term software support.

Identification of pre-impact conditions of a cyclist involved in a vehicle-bicycle accident using an optimized MADYMO reconstruction combined with motion capture.

PubMed

Sun, Jie; Li, Zhengdong; Pan, Shaoyou; Feng, Hao; Shao, Yu; Liu, Ningguo; Huang, Ping; Zou, Donghua; Chen, Yijiu

2018-05-01

The aim of the present study was to develop an improved method, using MADYMO multi-body simulation software combined with an optimization method and three-dimensional (3D) motion capture, for identifying the pre-impact conditions of a cyclist (walking or cycling) involved in a vehicle-bicycle accident. First, a 3D motion capture system was used to analyze coupled motions of a volunteer while walking and cycling. The motion capture results were used to define the posture of the human model during walking and cycling simulations. Then, cyclist, bicycle and vehicle models were developed. Pre-impact parameters of the models were treated as unknown design variables. Finally, a multi-objective genetic algorithm, the nondominated sorting genetic algorithm II, was used to find optimal solutions. The objective functions of the walk parameter were significantly lower than cycle parameter; thus, the cyclist was more likely to have been walking with the bicycle than riding the bicycle. In the most closely matched result found, all observed contact points matched and the injury parameters correlated well with the real injuries sustained by the cyclist. Based on the real accident reconstruction, the present study indicates that MADYMO multi-body simulation software, combined with an optimization method and 3D motion capture, can be used to identify the pre-impact conditions of a cyclist involved in a vehicle-bicycle accident. Copyright © 2018. Published by Elsevier Ltd.

Numerical System Solver Developed for the National Cycle Program

NASA Technical Reports Server (NTRS)

Binder, Michael P.

1999-01-01

As part of the National Cycle Program (NCP), a powerful new numerical solver has been developed to support the simulation of aeropropulsion systems. This software uses a hierarchical object-oriented design. It can provide steady-state and time-dependent solutions to nonlinear and even discontinuous problems typically encountered when aircraft and spacecraft propulsion systems are simulated. It also can handle constrained solutions, in which one or more factors may limit the behavior of the engine system. Timedependent simulation capabilities include adaptive time-stepping and synchronization with digital control elements. The NCP solver is playing an important role in making the NCP a flexible, powerful, and reliable simulation package.

A Roadmap to Continuous Integration for ATLAS Software Development

NASA Astrophysics Data System (ADS)

Elmsheuser, J.; Krasznahorkay, A.; Obreshkov, E.; Undrus, A.; ATLAS Collaboration

2017-10-01

The ATLAS software infrastructure facilitates efforts of more than 1000 developers working on the code base of 2200 packages with 4 million lines of C++ and 1.4 million lines of python code. The ATLAS offline code management system is the powerful, flexible framework for processing new package versions requests, probing code changes in the Nightly Build System, migration to new platforms and compilers, deployment of production releases for worldwide access and supporting physicists with tools and interfaces for efficient software use. It maintains multi-stream, parallel development environment with about 70 multi-platform branches of nightly releases and provides vast opportunities for testing new packages, for verifying patches to existing software and for migrating to new platforms and compilers. The system evolution is currently aimed on the adoption of modern continuous integration (CI) practices focused on building nightly releases early and often, with rigorous unit and integration testing. This paper describes the CI incorporation program for the ATLAS software infrastructure. It brings modern open source tools such as Jenkins and GitLab into the ATLAS Nightly System, rationalizes hardware resource allocation and administrative operations, provides improved feedback and means to fix broken builds promptly for developers. Once adopted, ATLAS CI practices will improve and accelerate innovation cycles and result in increased confidence in new software deployments. The paper reports the status of Jenkins integration with the ATLAS Nightly System as well as short and long term plans for the incorporation of CI practices.

Bushland Evapotranspiration and Agricultural Remote Sensing System (BEARS) software

NASA Astrophysics Data System (ADS)

Gowda, P. H.; Moorhead, J.; Brauer, D. K.

2017-12-01

Evapotranspiration (ET) is a major component of the hydrologic cycle. ET data are used for a variety of water management and research purposes such as irrigation scheduling, water and crop modeling, streamflow, water availability, and many more. Remote sensing products have been widely used to create spatially representative ET data sets which provide important information from field to regional scales. As UAV capabilities increase, remote sensing use is likely to also increase. For that purpose, scientists at the USDA-ARS research laboratory in Bushland, TX developed the Bushland Evapotranspiration and Agricultural Remote Sensing System (BEARS) software. The BEARS software is a Java based software that allows users to process remote sensing data to generate ET outputs using predefined models, or enter custom equations and models. The capability to define new equations and build new models expands the applicability of the BEARS software beyond ET mapping to any remote sensing application. The software also includes an image viewing tool that allows users to visualize outputs, as well as draw an area of interest using various shapes. This software is freely available from the USDA-ARS Conservation and Production Research Laboratory website.

Cradle-to-Gate Life-Cycle Inventory of Hardboard and Engineered Wood Siding and Trim Produced in North America

Treesearch

Richard D. Bergman

2015-01-01

Developing wood product LCI data helps construct product LCAs that are then incorporated into developing whole building LCAs in environmental footprint software such as the Athena Impact Estimator for Buildings (ASMI 2015). Conducting whole building LCAs provide for points that go toward green building certification in rating systems such as LEED v4, Green Globes, and...

Fly-by-light technology development plan

NASA Technical Reports Server (NTRS)

Todd, J. R.; Williams, T.; Goldthorpe, S.; Hay, J.; Brennan, M.; Sherman, B.; Chen, J.; Yount, Larry J.; Hess, Richard F.; Kravetz, J.

1990-01-01

The driving factors and developments which make a fly-by-light (FBL) viable are discussed. Documentation, analyses, and recommendations are provided on the major issues pertinent to facilitating the U.S. implementation of commercial FBL aircraft before the turn of the century. Areas of particular concern include ultra-reliable computing (hardware/software); electromagnetic environment (EME); verification and validation; optical techniques; life-cycle maintenance; and basis and procedures for certification.

Configurable technology development for reusable control and monitor ground systems

NASA Technical Reports Server (NTRS)

Uhrlaub, David R.

1994-01-01

The control monitor unit (CMU) uses configurable software technology for real-time mission command and control, telemetry processing, simulation, data acquisition, data archiving, and ground operations automation. The base technology is currently planned for the following control and monitor systems: portable Space Station checkout systems; ecological life support systems; Space Station logistics carrier system; and the ground system of the Delta Clipper (SX-2) in the Single-Stage Rocket Technology program. The CMU makes extensive use of commercial technology to increase capability and reduce development and life-cycle costs. The concepts and technology are being developed by McDonnell Douglas Space and Defense Systems for the Real-Time Systems Laboratory at NASA's Kennedy Space Center under the Payload Ground Operations Contract. A second function of the Real-Time Systems Laboratory is development and utilization of advanced software development practices.

Insights into Global Health Practice from the Agile Software Development Movement

PubMed Central

Flood, David; Chary, Anita; Austad, Kirsten; Diaz, Anne Kraemer; García, Pablo; Martinez, Boris; Canú, Waleska López; Rohloff, Peter

2016-01-01

Global health practitioners may feel frustration that current models of global health research, delivery, and implementation are overly focused on specific interventions, slow to provide health services in the field, and relatively ill-equipped to adapt to local contexts. Adapting design principles from the agile software development movement, we propose an analogous approach to designing global health programs that emphasizes tight integration between research and implementation, early involvement of ground-level health workers and program beneficiaries, and rapid cycles of iterative program improvement. Using examples from our own fieldwork, we illustrate the potential of ‘agile global health’ and reflect on the limitations, trade-offs, and implications of this approach. PMID:27134081

A conceptual persistent healthcare quality improvement process for software development management.

PubMed

Lin, Jen-Chiun; Su, Mei-Ju; Cheng, Po-Hsun; Weng, Yung-Chien; Chen, Sao-Jie; Lai, Jin-Shin; Lai, Feipei

2007-01-01

This paper illustrates a sustained conceptual service quality improvement process for the management of software development within a healthcare enterprise. Our proposed process is revised from Niland's healthcare quality information system (HQIS). This process includes functions to survey the satisfaction of system functions, describe the operation bylaws on-line, and provide on-demand training. To achieve these goals, we integrate five information systems in National Taiwan University Hospital, including healthcare information systems, health quality information system, requirement management system, executive information system, and digital learning system, to form a full Deming cycle. A preliminary user satisfaction survey showed that our outpatient information system scored an average of 71.31 in 2006.

Temperature distribution of thick thermoset composites

NASA Astrophysics Data System (ADS)

Guo, Zhan-Sheng; Du, Shanyi; Zhang, Boming

2004-05-01

The development of temperature distribution of thick polymeric matrix laminates during an autoclave vacuum bag process was measured and compared with numerically calculated results. The finite element formulation of the transient heat transfer problem was carried out for polymeric matrix composite materials from the heat transfer differential equations including internal heat generation produced by exothermic chemical reactions. Software based on the general finite element software package was developed for numerical simulation of the entire composite process. From the experimental and numerical results, it was found that the measured temperature profiles were in good agreement with the numerical ones, and conventional cure cycles recommended by prepreg manufacturers for thin laminates should be modified to prevent temperature overshoot.

Insights into Global Health Practice from the Agile Software Development Movement.

PubMed

Flood, David; Chary, Anita; Austad, Kirsten; Diaz, Anne Kraemer; García, Pablo; Martinez, Boris; Canú, Waleska López; Rohloff, Peter

2016-01-01

Global health practitioners may feel frustration that current models of global health research, delivery, and implementation are overly focused on specific interventions, slow to provide health services in the field, and relatively ill-equipped to adapt to local contexts. Adapting design principles from the agile software development movement, we propose an analogous approach to designing global health programs that emphasizes tight integration between research and implementation, early involvement of ground-level health workers and program beneficiaries, and rapid cycles of iterative program improvement. Using examples from our own fieldwork, we illustrate the potential of 'agile global health' and reflect on the limitations, trade-offs, and implications of this approach.

Increasing productivity through Total Reuse Management (TRM)

NASA Technical Reports Server (NTRS)

Schuler, M. P.

1991-01-01

Total Reuse Management (TRM) is a new concept currently being promoted by the NASA Langley Software Engineering and Ada Lab (SEAL). It uses concepts similar to those promoted in Total Quality Management (TQM). Both technical and management personnel are continually encouraged to think in terms of reuse. Reuse is not something that is aimed for after a product is completed, but rather it is built into the product from inception through development. Lowering software development costs, reducing risk, and increasing code reliability are the more prominent goals of TRM. Procedures and methods used to adopt and apply TRM are described. Reuse is frequently thought of as only being applicable to code. However, reuse can apply to all products and all phases of the software life cycle. These products include management and quality assurance plans, designs, and testing procedures. Specific examples of successfully reused products are given and future goals are discussed.

Software metrics: Software quality metrics for distributed systems. [reliability engineering

NASA Technical Reports Server (NTRS)

Post, J. V.

1981-01-01

Software quality metrics was extended to cover distributed computer systems. Emphasis is placed on studying embedded computer systems and on viewing them within a system life cycle. The hierarchy of quality factors, criteria, and metrics was maintained. New software quality factors were added, including survivability, expandability, and evolvability.

New developments and prospects on COSI, the simulation software for fuel cycle analysis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Eschbach, R.; Meyer, M.; Coquelet-Pascal, C.

2013-07-01

COSI, software developed by the Nuclear Energy Direction of the CEA, is a code simulating a pool of nuclear power plants with its associated fuel cycle facilities. This code has been designed to study various short, medium and long term options for the introduction of various types of nuclear reactors and for the use of associated nuclear materials. In the frame of the French Act for waste management, scenario studies are carried out with COSI, to compare different options of evolution of the French reactor fleet and options of partitioning and transmutation of plutonium and minor actinides. Those studies aimmore » in particular at evaluating the sustainability of Sodium cooled Fast Reactors (SFR) deployment and the possibility to transmute minor actinides. The COSI6 version is a completely renewed software released in 2006. COSI6 is now coupled with the last version of CESAR (CESAR5.3 based on JEFF3.1.1 nuclear data) allowing the calculations on irradiated fuel with 200 fission products and 100 heavy nuclides. A new release is planned in 2013, including in particular the coupling with a recommended database of reactors. An exercise of validation of COSI6, carried out on the French PWR historic nuclear fleet, has been performed. During this exercise quantities like cumulative natural uranium consumption, or cumulative depleted uranium, or UOX/MOX spent fuel storage, or stocks of reprocessed uranium, or plutonium content in fresh MOX fuel, or the annual production of high level waste, have been computed by COSI6 and compared to industrial data. The results have allowed us to validate the essential phases of the fuel cycle computation, and reinforces the credibility of the results provided by the code.« less

Validation of a program for supercritical power plant calculations

NASA Astrophysics Data System (ADS)

Kotowicz, Janusz; Łukowicz, Henryk; Bartela, Łukasz; Michalski, Sebastian

2011-12-01

This article describes the validation of a supercritical steam cycle. The cycle model was created with the commercial program GateCycle and validated using in-house code of the Institute of Power Engineering and Turbomachinery. The Institute's in-house code has been used extensively for industrial power plants calculations with good results. In the first step of the validation process, assumptions were made about the live steam temperature and pressure, net power, characteristic quantities for high- and low-pressure regenerative heat exchangers and pressure losses in heat exchangers. These assumptions were then used to develop a steam cycle model in Gate-Cycle and a model based on the code developed in-house at the Institute of Power Engineering and Turbomachinery. Properties, such as thermodynamic parameters at characteristic points of the steam cycle, net power values and efficiencies, heat provided to the steam cycle and heat taken from the steam cycle, were compared. The last step of the analysis was calculation of relative errors of compared values. The method used for relative error calculations is presented in the paper. The assigned relative errors are very slight, generally not exceeding 0.1%. Based on our analysis, it can be concluded that using the GateCycle software for calculations of supercritical power plants is possible.

Computational tool for simulation of power and refrigeration cycles

NASA Astrophysics Data System (ADS)

Córdoba Tuta, E.; Reyes Orozco, M.

2016-07-01

Small improvement in thermal efficiency of power cycles brings huge cost savings in the production of electricity, for that reason have a tool for simulation of power cycles allows modeling the optimal changes for a best performance. There is also a big boom in research Organic Rankine Cycle (ORC), which aims to get electricity at low power through cogeneration, in which the working fluid is usually a refrigerant. A tool to design the elements of an ORC cycle and the selection of the working fluid would be helpful, because sources of heat from cogeneration are very different and in each case would be a custom design. In this work the development of a multiplatform software for the simulation of power cycles and refrigeration, which was implemented in the C ++ language and includes a graphical interface which was developed using multiplatform environment Qt and runs on operating systems Windows and Linux. The tool allows the design of custom power cycles, selection the type of fluid (thermodynamic properties are calculated through CoolProp library), calculate the plant efficiency, identify the fractions of flow in each branch and finally generates a report very educational in pdf format via the LaTeX tool.

Concepts associated with a unified life cycle analysis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Whelan, Gene; Peffers, Melissa S.; Tolle, Duane A.

There is a risk associated with most things in the world, and all things have a life cycle unto themselves, even brownfields. Many components can be described by a''cycle of life.'' For example, five such components are life-form, chemical, process, activity, and idea, although many more may exist. Brownfields may touch upon several of these life cycles. Each life cycle can be represented as independent software; therefore, a software technology structure is being formulated to allow for the seamless linkage of software products, representing various life-cycle aspects. Because classes of these life cycles tend to be independent of each other,more » the current research programs and efforts do not have to be revamped; therefore, this unified life-cycle paradigm builds upon current technology and is backward compatible while embracing future technology. Only when two of these life cycles coincide and one impacts the other is there connectivity and a transfer of information at the interface. The current framework approaches (e.g., FRAMES, 3MRA, etc.) have a design that is amenable to capturing (1) many of these underlying philosophical concepts to assure backward compatibility of diverse independent assessment frameworks and (2) linkage communication to help transfer the needed information at the points of intersection. The key effort will be to identify (1) linkage points (i.e., portals) between life cycles, (2) the type and form of data passing between life cycles, and (3) conditions when life cycles interact and communicate. This paper discusses design aspects associated with a unified life-cycle analysis, which can support not only brownfields but also other types of assessments.« less

The Human Exposure Model (HEM): A Tool to Support Rapid Assessment of Human Health Impacts from Near-Field Consumer Product Exposures

EPA Science Inventory

The US EPA is developing an open and publically available software program called the Human Exposure Model (HEM) to provide near-field exposure information for Life Cycle Impact Assessments (LCIAs). Historically, LCIAs have often omitted impacts from near-field sources of exposur...

An Automated Program Testing Methodology and its Implementation.

DTIC Science & Technology

1980-01-01

correctly on its input data; the number of for each software system. asse rtions violated defines an "error function"Itiimoan tocos ecsswhh over the Input...space of the program. ThisItiimoan tocos tecse whh remove@ the need to examine a program’s output uncover errors early in the development cycle, in

Eliciting and Analyzing Quality Requirements: Management Influences on Software Quality Requirements

DTIC Science & Technology

2005-03-01

their portable devices [ Balfanz 04] can be applied to many of the quality requirements issues within the development life cycle: " Neither usability or...Systems. New York, NY: Wiley Computer Publishing, 2001. [ Balfanz 04] Balfanz , D.; Durfee, G; & Smetters, D. K. "Search of Usable Security: Five Lessons from

FluxPyt: a Python-based free and open-source software for 13C-metabolic flux analyses.

PubMed

Desai, Trunil S; Srivastava, Shireesh

2018-01-01

13 C-Metabolic flux analysis (MFA) is a powerful approach to estimate intracellular reaction rates which could be used in strain analysis and design. Processing and analysis of labeling data for calculation of fluxes and associated statistics is an essential part of MFA. However, various software currently available for data analysis employ proprietary platforms and thus limit accessibility. We developed FluxPyt, a Python-based truly open-source software package for conducting stationary 13 C-MFA data analysis. The software is based on the efficient elementary metabolite unit framework. The standard deviations in the calculated fluxes are estimated using the Monte-Carlo analysis. FluxPyt also automatically creates flux maps based on a template for visualization of the MFA results. The flux distributions calculated by FluxPyt for two separate models: a small tricarboxylic acid cycle model and a larger Corynebacterium glutamicum model, were found to be in good agreement with those calculated by a previously published software. FluxPyt was tested in Microsoft™ Windows 7 and 10, as well as in Linux Mint 18.2. The availability of a free and open 13 C-MFA software that works in various operating systems will enable more researchers to perform 13 C-MFA and to further modify and develop the package.

FluxPyt: a Python-based free and open-source software for 13C-metabolic flux analyses

PubMed Central

Desai, Trunil S.

2018-01-01

13C-Metabolic flux analysis (MFA) is a powerful approach to estimate intracellular reaction rates which could be used in strain analysis and design. Processing and analysis of labeling data for calculation of fluxes and associated statistics is an essential part of MFA. However, various software currently available for data analysis employ proprietary platforms and thus limit accessibility. We developed FluxPyt, a Python-based truly open-source software package for conducting stationary 13C-MFA data analysis. The software is based on the efficient elementary metabolite unit framework. The standard deviations in the calculated fluxes are estimated using the Monte-Carlo analysis. FluxPyt also automatically creates flux maps based on a template for visualization of the MFA results. The flux distributions calculated by FluxPyt for two separate models: a small tricarboxylic acid cycle model and a larger Corynebacterium glutamicum model, were found to be in good agreement with those calculated by a previously published software. FluxPyt was tested in Microsoft™ Windows 7 and 10, as well as in Linux Mint 18.2. The availability of a free and open 13C-MFA software that works in various operating systems will enable more researchers to perform 13C-MFA and to further modify and develop the package. PMID:29736347

Evolving software reengineering technology for the emerging innovative-competitive era

NASA Technical Reports Server (NTRS)

Hwang, Phillip Q.; Lock, Evan; Prywes, Noah

1994-01-01

This paper reports on a multi-tool commercial/military environment combining software Domain Analysis techniques with Reusable Software and Reengineering of Legacy Software. It is based on the development of a military version for the Department of Defense (DOD). The integrated tools in the military version are: Software Specification Assistant (SSA) and Software Reengineering Environment (SRE), developed by Computer Command and Control Company (CCCC) for Naval Surface Warfare Center (NSWC) and Joint Logistics Commanders (JLC), and the Advanced Research Project Agency (ARPA) STARS Software Engineering Environment (SEE) developed by Boeing for NAVAIR PMA 205. The paper describes transitioning these integrated tools to commercial use. There is a critical need for the transition for the following reasons: First, to date, 70 percent of programmers' time is applied to software maintenance. The work of these users has not been facilitated by existing tools. The addition of Software Reengineering will also facilitate software maintenance and upgrading. In fact, the integrated tools will support the entire software life cycle. Second, the integrated tools are essential to Business Process Reengineering, which seeks radical process innovations to achieve breakthrough results. Done well, process reengineering delivers extraordinary gains in process speed, productivity and profitability. Most importantly, it discovers new opportunities for products and services in collaboration with other organizations. Legacy computer software must be changed rapidly to support innovative business processes. The integrated tools will provide commercial organizations important competitive advantages. This, in turn, will increase employment by creating new business opportunities. Third, the integrated system will produce much higher quality software than use of the tools separately. The reason for this is that producing or upgrading software requires keen understanding of extremely complex applications which is facilitated by the integrated tools. The radical savings in the time and cost associated with software, due to use of CASE tools that support combined Reuse of Software and Reengineering of Legacy Code, will add an important impetus to improving the automation of enterprises. This will be reflected in continuing operations, as well as in innovating new business processes. The proposed multi-tool software development is based on state of the art technology, which will be further advanced through the use of open systems for adding new tools and experience in their use.

A Bibliography of the Personal Software Process (PSP) and the Team Software Process (TSP)

DTIC Science & Technology

2009-10-01

Postmortem.‖ Proceedings of the TSP Symposium (September 2007). http://www.sei.cmu.edu/tspsymposium/ Rickets , Chris; Lindeman, Robert; & Hodgins, Brad... Rickets , Chris A. ―A TSP Software Maintenance Life Cycle.‖ CrossTalk (March 2005). Rozanc, I. & Mahnic, V. ―Teaching Software Quality with Emphasis on PSP

Experience with case tools in the design of process-oriented software

NASA Astrophysics Data System (ADS)

Novakov, Ognian; Sicard, Claude-Henri

1994-12-01

In Accelerator systems such as the CERN PS complex, process equipment has a life time which may exceed the typical life cycle of its related software. Taking into account the variety of such equipment, it is important to keep the analysis and design of the software in a system-independent form. This paper discusses the experience gathered in using commercial CASE tools for analysis, design and reverse engineering of different process-oriented software modules, with a principal emphasis on maintaining the initial analysis in a standardized form. Such tools have been in existence for several years, but this paper shows that they are not fully adapted to our needs. In particular, the paper stresses the problems of integrating such a tool into an existing data-base-dependent development chain, the lack of real-time simulation tools and of Object-Oriented concepts in existing commercial packages. Finally, the paper gives a broader view of software engineering needs in our particular context.

A Problem-Solving Environment for Biological Network Informatics: Bio-Spice

DTIC Science & Technology

2007-06-01

user an environment to access software tools. The Dashboard is built upon the NetBeans Integrated Development Environment (IDE), an open source Java...based integration platform was demonstrated. During the subsequent six month development cycle, the first version of the NetBeans based Bio-SPICE...frameworks (OAA, NetBeans , and Systems Biology Workbench (SBW)[15]), it becomes possible for Bio-SPICE tools to truly interoperate. This interoperation

Modeling hydraulic regenerative hybrid vehicles using AMESim and Matlab/Simulink

NASA Astrophysics Data System (ADS)

Lynn, Alfred; Smid, Edzko; Eshraghi, Moji; Caldwell, Niall; Woody, Dan

2005-05-01

This paper presents the overview of the simulation modeling of a hydraulic system with regenerative braking used to improve vehicle emissions and fuel economy. Two simulation software packages were used together to enhance the simulation capability for fuel economy results and development of vehicle and hybrid control strategy. AMESim, a hydraulic simulation software package modeled the complex hydraulic circuit and component hardware and was interlinked with a Matlab/Simulink model of the vehicle, engine and the control strategy required to operate the vehicle and the hydraulic hybrid system through various North American and European drive cycles.

Automatic programming for critical applications

NASA Technical Reports Server (NTRS)

Loganantharaj, Raj L.

1988-01-01

The important phases of a software life cycle include verification and maintenance. Usually, the execution performance is an expected requirement in a software development process. Unfortunately, the verification and the maintenance of programs are the time consuming and the frustrating aspects of software engineering. The verification cannot be waived for the programs used for critical applications such as, military, space, and nuclear plants. As a consequence, synthesis of programs from specifications, an alternative way of developing correct programs, is becoming popular. The definition, or what is understood by automatic programming, has been changed with our expectations. At present, the goal of automatic programming is the automation of programming process. Specifically, it means the application of artificial intelligence to software engineering in order to define techniques and create environments that help in the creation of high level programs. The automatic programming process may be divided into two phases: the problem acquisition phase and the program synthesis phase. In the problem acquisition phase, an informal specification of the problem is transformed into an unambiguous specification while in the program synthesis phase such a specification is further transformed into a concrete, executable program.

Assembly flow simulation of a radar

NASA Technical Reports Server (NTRS)

Rutherford, W. C.; Biggs, P. M.

1994-01-01

A discrete event simulation model has been developed to predict the assembly flow time of a new radar product. The simulation was the key tool employed to identify flow constraints. The radar, production facility, and equipment complement were designed, arranged, and selected to provide the most manufacturable assembly possible. A goal was to reduce the assembly and testing cycle time from twenty-six weeks. A computer software simulation package (SLAM 2) was utilized as the foundation for simulating the assembly flow time. FORTRAN subroutines were incorporated into the software to deal with unique flow circumstances that were not accommodated by the software. Detailed information relating to the assembly operations was provided by a team selected from the engineering, manufacturing management, inspection, and production assembly staff. The simulation verified that it would be possible to achieve the cycle time goal of six weeks. Equipment and manpower constraints were identified during the simulation process and adjusted as required to achieve the flow with a given monthly production requirement. The simulation is being maintained as a planning tool to be used to identify constraints in the event that monthly output is increased. 'What-if' studies have been conducted to identify the cost of reducing constraints caused by increases in output requirement.

A Cloud-based, Open-Source, Command-and-Control Software Paradigm for Space Situational Awareness (SSA)

NASA Astrophysics Data System (ADS)

Melton, R.; Thomas, J.

With the rapid growth in the number of space actors, there has been a marked increase in the complexity and diversity of software systems utilized to support SSA target tracking, indication, warning, and collision avoidance. Historically, most SSA software has been constructed with "closed" proprietary code, which limits interoperability, inhibits the code transparency that some SSA customers need to develop domain expertise, and prevents the rapid injection of innovative concepts into these systems. Open-source aerospace software, a rapidly emerging, alternative trend in code development, is based on open collaboration, which has the potential to bring greater transparency, interoperability, flexibility, and reduced development costs. Open-source software is easily adaptable, geared to rapidly changing mission needs, and can generally be delivered at lower costs to meet mission requirements. This paper outlines Ball's COSMOS C2 system, a fully open-source, web-enabled, command-and-control software architecture which provides several unique capabilities to move the current legacy SSA software paradigm to an open source model that effectively enables pre- and post-launch asset command and control. Among the unique characteristics of COSMOS is the ease with which it can integrate with diverse hardware. This characteristic enables COSMOS to serve as the command-and-control platform for the full life-cycle development of SSA assets, from board test, to box test, to system integration and test, to on-orbit operations. The use of a modern scripting language, Ruby, also permits automated procedures to provide highly complex decision making for the tasking of SSA assets based on both telemetry data and data received from outside sources. Detailed logging enables quick anomaly detection and resolution. Integrated real-time and offline data graphing renders the visualization of the both ground and on-orbit assets simple and straightforward.

Methodology for Software Reliability Prediction. Volume 1.

DTIC Science & Technology

1987-11-01

SPACECRAFT 0 MANNED SPACECRAFT B ATCH SYSTEM AIRBORNE AVIONICS 0 UNMANNED EVENT C014TROL a REAL TIME CLOSED 0 UNMANNED SPACECRAFT LOOP OPERATINS SPACECRAFT...software reliability. A Software Reliability Measurement Framework was established which spans the life cycle of a software system and includes the...specification, prediction, estimation, and assessment of software reliability. Data from 59 systems , representing over 5 million lines of code, were

49 CFR 236.903 - Definitions.

Code of Federal Regulations, 2011 CFR

2011-10-01

... electrical, mechanical, hardware, or software) that is part of a system or subsystem. Configuration..., including the hardware components and software version, is documented and maintained through the life-cycle... or compensates individuals to perform the duties specified in § 236.921 (a). Executive software means...

49 CFR 236.903 - Definitions.

Code of Federal Regulations, 2014 CFR

2014-10-01

... electrical, mechanical, hardware, or software) that is part of a system or subsystem. Configuration..., including the hardware components and software version, is documented and maintained through the life-cycle... or compensates individuals to perform the duties specified in § 236.921 (a). Executive software means...

49 CFR 236.903 - Definitions.

Code of Federal Regulations, 2012 CFR

2012-10-01

... electrical, mechanical, hardware, or software) that is part of a system or subsystem. Configuration..., including the hardware components and software version, is documented and maintained through the life-cycle... or compensates individuals to perform the duties specified in § 236.921 (a). Executive software means...

49 CFR 236.903 - Definitions.

Code of Federal Regulations, 2013 CFR

2013-10-01

... electrical, mechanical, hardware, or software) that is part of a system or subsystem. Configuration..., including the hardware components and software version, is documented and maintained through the life-cycle... or compensates individuals to perform the duties specified in § 236.921 (a). Executive software means...

Migration of the Gaudi and LHCb software repositories from CVS to Subversion

NASA Astrophysics Data System (ADS)

Clemencic, M.; Degaudenzi, H.; LHCb Collaboration

2011-12-01

A common code repository is of primary importance in a distributed development environment such as large HEP experiments. CVS (Concurrent Versions System) has been used in the past years at CERN for the hosting of shared software repositories, among which were the repositories for the Gaudi Framework and the LHCb software projects. Many developers around the world produced alternative systems to share code and revisions among several developers, mainly to overcome the limitations in CVS, and CERN has recently started a new service for code hosting based on the version control system Subversion. The differences between CVS and Subversion and the way the code was organized in Gaudi and LHCb CVS repositories required careful study and planning of the migration. Special care was used to define the organization of the new Subversion repository. To avoid as much as possible disruption in the development cycle, the migration has been gradual with the help of tools developed explicitly to hide the differences between the two systems. The principles guiding the migration steps, the organization of the Subversion repository and the tools developed will be presented, as well as the problems encountered both from the librarian and the user points of view.

Usability Prediction & Ranking of SDLC Models Using Fuzzy Hierarchical Usability Model

NASA Astrophysics Data System (ADS)

Gupta, Deepak; Ahlawat, Anil K.; Sagar, Kalpna

2017-06-01

Evaluation of software quality is an important aspect for controlling and managing the software. By such evaluation, improvements in software process can be made. The software quality is significantly dependent on software usability. Many researchers have proposed numbers of usability models. Each model considers a set of usability factors but do not cover all the usability aspects. Practical implementation of these models is still missing, as there is a lack of precise definition of usability. Also, it is very difficult to integrate these models into current software engineering practices. In order to overcome these challenges, this paper aims to define the term `usability' using the proposed hierarchical usability model with its detailed taxonomy. The taxonomy considers generic evaluation criteria for identifying the quality components, which brings together factors, attributes and characteristics defined in various HCI and software models. For the first time, the usability model is also implemented to predict more accurate usability values. The proposed system is named as fuzzy hierarchical usability model that can be easily integrated into the current software engineering practices. In order to validate the work, a dataset of six software development life cycle models is created and employed. These models are ranked according to their predicted usability values. This research also focuses on the detailed comparison of proposed model with the existing usability models.

Air Force Research Laboratory Technology Milestones 2007

DTIC Science & Technology

2007-01-01

Propulsion Fuel Pumps and Fuel Systems Liquid Rockets and Combustion Gas Generators Micropropulsion Gears Monopropellants High-Cycle Fatigue and Its... Systems Electric Propulsion Engine Health Monitoring Systems High-Energy-Density Matter Exhaust Nozzles Injectors and Spray Measurements Fans Laser...of software models to drive development of component-based systems and lightweight domain-specific specification and verification technology. Highly

CMMI(Registered) for Development, Version 1.3

DTIC Science & Technology

2010-11-01

ISO /IEC 15288:2008 Systems and Software Engineering – System Life Cycle Processes [ ISO 2008b] ISO /IEC 27001 :2005 Information technology – Security...IEC 2005 International Organization for Standardization and International Electrotechnical Commission. ISO /IEC 27001 Information Technology...International Electrotechnical Commission ( ISO /IEC) body of standards. CMMs focus on improving processes in an organization. They contain the

Upgrading Custom Simulink Library Components for Use in Newer Versions of Matlab

NASA Technical Reports Server (NTRS)

Stewart, Camiren L.

2014-01-01

The Spaceport Command and Control System (SCCS) at Kennedy Space Center (KSC) is a control system for monitoring and launching manned launch vehicles. Simulations of ground support equipment (GSE) and the launch vehicle systems are required throughout the life cycle of SCCS to test software, hardware, and procedures to train the launch team. The simulations of the GSE at the launch site in conjunction with off-line processing locations are developed using Simulink, a piece of Commercial Off-The-Shelf (COTS) software. The simulations that are built are then converted into code and ran in a simulation engine called Trick, a Government off-the-shelf (GOTS) piece of software developed by NASA. In the world of hardware and software, it is not uncommon to see the products that are utilized be upgraded and patched or eventually fade away into an obsolete status. In the case of SCCS simulation software, Matlab, a MathWorks product, has released a number of stable versions of Simulink since the deployment of the software on the Development Work Stations in the Linux environment (DWLs). The upgraded versions of Simulink has introduced a number of new tools and resources that, if utilized fully and correctly, will save time and resources during the overall development of the GSE simulation and its correlating documentation. Unfortunately, simply importing the already built simulations into the new Matlab environment will not suffice as it will produce results that may not be expected as they were in the version that is currently being utilized. Thus, an upgrade execution plan was developed and executed to fully upgrade the simulation environment to one of the latest versions of Matlab.

Software Formal Inspections Standard

NASA Technical Reports Server (NTRS)

1993-01-01

This Software Formal Inspections Standard (hereinafter referred to as Standard) is applicable to NASA software. This Standard defines the requirements that shall be fulfilled by the software formal inspections process whenever this process is specified for NASA software. The objective of this Standard is to define the requirements for a process that inspects software products to detect and eliminate defects as early as possible in the software life cycle. The process also provides for the collection and analysis of inspection data to improve the inspection process as well as the quality of the software.

A Data Specification for Software Project Performance Measures: Results of a Collaboration on Performance Measurement

DTIC Science & Technology

2008-07-01

cycle Evolution of a system, product, service, project or other human-made entity from conception through retirement [ ISO 12207 ]. Logical line of...012 [ ISO 1995] International Organization for Standardization. ISO /IEC 12207 :1995—Information technology— Software life cycle processes. http...definitions, authors were asked to use or align with already existing standards such as those available through ISO and IEEE when possible. Literature

ELISA, a demonstrator environment for information systems architecture design

NASA Technical Reports Server (NTRS)

Panem, Chantal

1994-01-01

This paper describes an approach of reusability of software engineering technology in the area of ground space system design. System engineers have lots of needs similar to software developers: sharing of a common data base, capitalization of knowledge, definition of a common design process, communication between different technical domains. Moreover system designers need to simulate dynamically their system as early as possible. Software development environments, methods and tools now become operational and widely used. Their architecture is based on a unique object base, a set of common management services and they host a family of tools for each life cycle activity. In late '92, CNES decided to develop a demonstrative software environment supporting some system activities. The design of ground space data processing systems was chosen as the application domain. ELISA (Integrated Software Environment for Architectures Specification) was specified as a 'demonstrator', i.e. a sufficient basis for demonstrations, evaluation and future operational enhancements. A process with three phases was implemented: system requirements definition, design of system architectures models, and selection of physical architectures. Each phase is composed of several activities that can be performed in parallel, with the provision of Commercial Off the Shelves Tools. ELISA has been delivered to CNES in January 94, currently used for demonstrations and evaluations on real projects (e.g. SPOT4 Satellite Control Center). It is on the way of new evolutions.

Choosing a software design method for real-time Ada applications: JSD process inversion as a means to tailor a design specification to the performance requirements and target machine

NASA Technical Reports Server (NTRS)

Withey, James V.

1986-01-01

The validity of real-time software is determined by its ability to execute on a computer within the time constraints of the physical system it is modeling. In many applications the time constraints are so critical that the details of process scheduling are elevated to the requirements analysis phase of the software development cycle. It is not uncommon to find specifications for a real-time cyclic executive program included to assumed in such requirements. It was found that prelininary designs structured around this implementation abscure the data flow of the real world system that is modeled and that it is consequently difficult and costly to maintain, update and reuse the resulting software. A cyclic executive is a software component that schedules and implicitly synchronizes the real-time software through periodic and repetitive subroutine calls. Therefore a design method is sought that allows the deferral of process scheduling to the later stages of design. The appropriate scheduling paradigm must be chosen given the performance constraints, the largest environment and the software's lifecycle. The concept of process inversion is explored with respect to the cyclic executive.

Preliminary design of the redundant software experiment

NASA Technical Reports Server (NTRS)

Campbell, Roy; Deimel, Lionel; Eckhardt, Dave, Jr.; Kelly, John; Knight, John; Lauterbach, Linda; Lee, Larry; Mcallister, Dave; Mchugh, John

1985-01-01

The goal of the present experiment is to characterize the fault distributions of highly reliable software replicates, constructed using techniques and environments which are similar to those used in comtemporary industrial software facilities. The fault distributions and their effect on the reliability of fault tolerant configurations of the software will be determined through extensive life testing of the replicates against carefully constructed randomly generated test data. Each detected error will be carefully analyzed to provide insight in to their nature and cause. A direct objective is to develop techniques for reducing the intensity of coincident errors, thus increasing the reliability gain which can be achieved with fault tolerance. Data on the reliability gains realized, and the cost of the fault tolerant configurations can be used to design a companion experiment to determine the cost effectiveness of the fault tolerant strategy. Finally, the data and analysis produced by this experiment will be valuable to the software engineering community as a whole because it will provide a useful insight into the nature and cause of hard to find, subtle faults which escape standard software engineering validation techniques and thus persist far into the software life cycle.

Integrating Low-Cost Rapid Usability Testing into Agile System Development of Healthcare IT: A Methodological Perspective.

PubMed

Kushniruk, Andre W; Borycki, Elizabeth M

2015-01-01

The development of more usable and effective healthcare information systems has become a critical issue. In the software industry methodologies such as agile and iterative development processes have emerged to lead to more effective and usable systems. These approaches highlight focusing on user needs and promoting iterative and flexible development practices. Evaluation and testing of iterative agile development cycles is considered an important part of the agile methodology and iterative processes for system design and re-design. However, the issue of how to effectively integrate usability testing methods into rapid and flexible agile design cycles has remained to be fully explored. In this paper we describe our application of an approach known as low-cost rapid usability testing as it has been applied within agile system development in healthcare. The advantages of the integrative approach are described, along with current methodological considerations.

Integrated Advanced Sounding Unit-A (AMSU-A). Configuration Management Plan

NASA Technical Reports Server (NTRS)

Cavanaugh, J.

1996-01-01

The purpose of this plan is to identify the baseline to be established during the development life cycle of the integrated AMSU-A, and define the methods and procedures which Aerojet will follow in the implementation of configuration control for each established baseline. Also this plan establishes the Configuration Management process to be used for the deliverable hardware, software, and firmware of the Integrated AMSU-A during development, design, fabrication, test, and delivery.

Quantifying the Relationship between AMC Resources and U.S. Army Materiel Readiness

DTIC Science & Technology

1989-08-25

Resource Management report 984 for the same period. Insufficient data precluded analysis of the OMA PEs Total Package Fielding and Life Cycle Software...procurement, had the greatest failure rates when subjected to the statistical tests merely because of the reduced number of data pairs. Analyses of...ENGINEERING DEVELOPMENT 6.5 - MANAGEMENT AND SUPPORT 6.7 - OPERATIONAL SYSTEM DEVELOPMENT P2 - GENERAL PURPOSE FORCES P3 - INTELIGENCE AND COMMUNICATIONS P7

Digital control for the condensate system in a combined cycle power plant

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sanchez Parra, M.; Fuentes Gutierrez, J.E.; Castelo Cuevas, L.

1994-12-31

This paper presents the highlights by means of which development, installation and start up of the digital control system (DCS)for the condenser and hotwell (condensate system) were performed. This system belongs to the distributed control system installed by the Instituto de Investigaciones Electricas (IIE) at the Combined Cycle Power Plant in Gomez Palacio (GP), Durango, Mexico, during the February-March period, in 1993. The main steps for development of the condenser and hotwell control system include: process modeling, definition of control strategies, algorithms, design and software development, PC simulation tests, laboratory tests with an equipment similar to the one installed atmore » the GP Power Plant, installation, and finally, start up, which was a joint effort with the GP Power Plant engineering staff.« less

Efficiency enhancement for natural gas liquefaction with CO2 capture and sequestration through cycles innovation and process optimization

NASA Astrophysics Data System (ADS)

Alabdulkarem, Abdullah

Liquefied natural gas (LNG) plants are energy intensive. As a result, the power plants operating these LNG plants emit high amounts of CO2 . To mitigate global warming that is caused by the increase in atmospheric CO2, CO2 capture and sequestration (CCS) using amine absorption is proposed. However, the major challenge of implementing this CCS system is the associated power requirement, increasing power consumption by about 15--25%. Therefore, the main scope of this work is to tackle this challenge by minimizing CCS power consumption as well as that of the entire LNG plant though system integration and rigorous optimization. The power consumption of the LNG plant was reduced through improving the process of liquefaction itself. In this work, a genetic algorithm (GA) was used to optimize a propane pre-cooled mixed-refrigerant (C3-MR) LNG plant modeled using HYSYS software. An optimization platform coupling Matlab with HYSYS was developed. New refrigerant mixtures were found, with savings in power consumption as high as 13%. LNG plants optimization with variable natural gas feed compositions was addressed and the solution was proposed through applying robust optimization techniques, resulting in a robust refrigerant which can liquefy a range of natural gas feeds. The second approach for reducing the power consumption is through process integration and waste heat utilization in the integrated CCS system. Four waste heat sources and six potential uses were uncovered and evaluated using HYSYS software. The developed models were verified against experimental data from the literature with good agreement. Net available power enhancement in one of the proposed CCS configuration is 16% more than the conventional CCS configuration. To reduce the CO2 pressurization power into a well for enhanced oil recovery (EOR) applications, five CO2 pressurization methods were explored. New CO2 liquefaction cycles were developed and modeled using HYSYS software. One of the developed liquefaction cycles using NH3 as a refrigerant resulted in 5% less power consumption than the conventional multi-stage compression cycle. Finally, a new concept of providing the CO2 regeneration heat is proposed. The proposed concept is using a heat pump to provide the regeneration heat as well as process heat and CO2 liquefaction heat. Seven configurations of heat pumps integrated with CCS were developed. One of the heat pumps consumes 24% less power than the conventional system or 59% less total equivalent power demand than the conventional system with steam extraction and CO2 compression.

A Framework for Performing V&V within Reuse-Based Software Engineering

NASA Technical Reports Server (NTRS)

Addy, Edward A.

1996-01-01

Verification and validation (V&V) is performed during application development for many systems, especially safety-critical and mission-critical systems. The V&V process is intended to discover errors, especially errors related to critical processing, as early as possible during the development process. Early discovery is important in order to minimize the cost and other impacts of correcting these errors. In order to provide early detection of errors, V&V is conducted in parallel with system development, often beginning with the concept phase. In reuse-based software engineering, however, decisions on the requirements, design and even implementation of domain assets can be made prior to beginning development of a specific system. In this case, V&V must be performed during domain engineering in order to have an impact on system development. This paper describes a framework for performing V&V within architecture-centric, reuse-based software engineering. This framework includes the activities of traditional application-level V&V, and extends these activities into domain engineering and into the transition between domain engineering and application engineering. The framework includes descriptions of the types of activities to be performed during each of the life-cycle phases, and provides motivation for the activities.

Materials integrity in microsystems: a framework for a petascale predictive-science-based multiscale modeling and simulation system

NASA Astrophysics Data System (ADS)

To, Albert C.; Liu, Wing Kam; Olson, Gregory B.; Belytschko, Ted; Chen, Wei; Shephard, Mark S.; Chung, Yip-Wah; Ghanem, Roger; Voorhees, Peter W.; Seidman, David N.; Wolverton, Chris; Chen, J. S.; Moran, Brian; Freeman, Arthur J.; Tian, Rong; Luo, Xiaojuan; Lautenschlager, Eric; Challoner, A. Dorian

2008-09-01

Microsystems have become an integral part of our lives and can be found in homeland security, medical science, aerospace applications and beyond. Many critical microsystem applications are in harsh environments, in which long-term reliability needs to be guaranteed and repair is not feasible. For example, gyroscope microsystems on satellites need to function for over 20 years under severe radiation, thermal cycling, and shock loading. Hence a predictive-science-based, verified and validated computational models and algorithms to predict the performance and materials integrity of microsystems in these situations is needed. Confidence in these predictions is improved by quantifying uncertainties and approximation errors. With no full system testing and limited sub-system testings, petascale computing is certainly necessary to span both time and space scales and to reduce the uncertainty in the prediction of long-term reliability. This paper presents the necessary steps to develop predictive-science-based multiscale modeling and simulation system. The development of this system will be focused on the prediction of the long-term performance of a gyroscope microsystem. The environmental effects to be considered include radiation, thermo-mechanical cycling and shock. Since there will be many material performance issues, attention is restricted to creep resulting from thermal aging and radiation-enhanced mass diffusion, material instability due to radiation and thermo-mechanical cycling and damage and fracture due to shock. To meet these challenges, we aim to develop an integrated multiscale software analysis system that spans the length scales from the atomistic scale to the scale of the device. The proposed software system will include molecular mechanics, phase field evolution, micromechanics and continuum mechanics software, and the state-of-the-art model identification strategies where atomistic properties are calibrated by quantum calculations. We aim to predict the long-term (in excess of 20 years) integrity of the resonator, electrode base, multilayer metallic bonding pads, and vacuum seals in a prescribed mission. Although multiscale simulations are efficient in the sense that they focus the most computationally intensive models and methods on only the portions of the space time domain needed, the execution of the multiscale simulations associated with evaluating materials and device integrity for aerospace microsystems will require the application of petascale computing. A component-based software strategy will be used in the development of our massively parallel multiscale simulation system. This approach will allow us to take full advantage of existing single scale modeling components. An extensive, pervasive thrust in the software system development is verification, validation, and uncertainty quantification (UQ). Each component and the integrated software system need to be carefully verified. An UQ methodology that determines the quality of predictive information available from experimental measurements and packages the information in a form suitable for UQ at various scales needs to be developed. Experiments to validate the model at the nanoscale, microscale, and macroscale are proposed. The development of a petascale predictive-science-based multiscale modeling and simulation system will advance the field of predictive multiscale science so that it can be used to reliably analyze problems of unprecedented complexity, where limited testing resources can be adequately replaced by petascale computational power, advanced verification, validation, and UQ methodologies.

Low cycle fatigue numerical estimation of a high pressure turbine disc for the AL-31F jet engine

NASA Astrophysics Data System (ADS)

Spodniak, Miroslav; Klimko, Marek; Hocko, Marián; Žitek, Pavel

This article deals with the description of an approximate numerical estimation approach of a low cycle fatigue of a high pressure turbine disc for the AL-31F turbofan jet engine. The numerical estimation is based on the finite element method carried out in the SolidWorks software. The low cycle fatigue assessment of a high pressure turbine disc was carried out on the basis of dimensional, shape and material disc characteristics, which are available for the particular high pressure engine turbine. The method described here enables relatively fast setting of economically feasible low cycle fatigue of the assessed high pressure turbine disc using a commercially available software. The numerical estimation of accuracy of a low cycle fatigue depends on the accuracy of required input data for the particular investigated object.

Object-oriented programming for the biosciences.

PubMed

Wiechert, W; Joksch, B; Wittig, R; Hartbrich, A; Höner, T; Möllney, M

1995-10-01

The development of software systems for the biosciences is always closely connected to experimental practice. Programs must be able to handle the inherent complexity and heterogeneous structure of biological systems in combination with the measuring equipment. Moreover, a high degree of flexibility is required to treat rapidly changing experimental conditions. Object-oriented methodology seems to be well suited for this purpose. It enables an evolutionary approach to software development that still maintains a high degree of modularity. This paper presents experience with object-oriented technology gathered during several years of programming in the fields of bioprocess development and metabolic engineering. It concentrates on the aspects of experimental support, data analysis, interaction and visualization. Several examples are presented and discussed in the general context of the experimental cycle of knowledge acquisition, thus pointing out the benefits and problems of object-oriented technology in the specific application field of the biosciences. Finally, some strategies for future development are described.

GCS component development cycle

NASA Astrophysics Data System (ADS)

Rodríguez, Jose A.; Macias, Rosa; Molgo, Jordi; Guerra, Dailos; Pi, Marti

2012-09-01

The GTC1 is an optical-infrared 10-meter segmented mirror telescope at the ORM observatory in Canary Islands (Spain). First light was at 13/07/2007 and since them it is in the operation phase. The GTC control system (GCS) is a distributed object & component oriented system based on RT-CORBA8 and it is responsible for the management and operation of the telescope, including its instrumentation. GCS has used the Rational Unified process (RUP9) in its development. RUP is an iterative software development process framework. After analysing (use cases) and designing (UML10) any of GCS subsystems, an initial component description of its interface is obtained and from that information a component specification is written. In order to improve the code productivity, GCS has adopted the code generation to transform this component specification into the skeleton of component classes based on a software framework, called Device Component Framework. Using the GCS development tools, based on javadoc and gcc, in only one step, the component is generated, compiled and deployed to be tested for the first time through our GUI inspector. The main advantages of this approach are the following: It reduces the learning curve of new developers and the development error rate, allows a systematic use of design patterns in the development and software reuse, speeds up the deliverables of the software product and massively increase the timescale, design consistency and design quality, and eliminates the future refactoring process required for the code.

Improvement of Vivarium Biodecontamination through Data-acquisition Systems and Automation.

PubMed

Devan, Shakthi Rk; Vasu, Suresh; Mallikarjuna, Yogesha; Ponraj, Ramkumar; Kamath, Gireesh; Poosala, Suresh

2018-03-01

Biodecontamination is important for eliminating pathogens at research animal facilities, thereby preventing contamination within barrier systems. We enhanced our facility's standard biodecontamination method to replace the traditional foggers, and the new system was used effectively after creating bypass ducts in HVAC units so that individual rooms could be isolated. The entire system was controlled by inhouse-developed supervisory control and data-acquisition software that supported multiple cycles of decontamination by equipment, which had different decontamination capacities, operated in parallel, and used different agents, including H2O2 vapor and ClO2 gas. The process was validated according to facility mapping, and effectiveness was assessed by using biologic (Geobacillus stearothermophilus) and chemical indicator strips, which were positioned before decontamination, and by sampling contact plates after the completion of each cycle. The results of biologic indicators showed 6-log reduction in microbial counts after successful decontamination cycles for both agents and found to be compatible with clean-room panels including commonly used materials in vivarium such as racks, cages, trolleys, cage changing stations, biosafety cabinets, refrigerators and other equipment in both procedure and animal rooms. In conclusion, the automated process enabled users to perform effective decontamination through multiple cycles with realtime documentation and provided additional capability to deal with potential outbreaks. Enabling software integration of automation improved quality-control systems in our vivarium.

The Experience Factory: Strategy and Practice

NASA Technical Reports Server (NTRS)

Basili, Victor R.; Caldiera, Gianluigi

1995-01-01

The quality movement, that has had in recent years a dramatic impact on all industrial sectors, has recently reached the system and software industry. Although some concepts of quality management, originally developed for other product types, can be applied to software, its specificity as a product which is developed and not produced requires a special approach. This paper introduces a quality paradigm specifically tailored on the problem of the systems and software industry. Reuse of products, processes and experiences originating from the system life cycle is seen today as a feasible solution to the problem of developing higher quality systems at a lower cost. In fact, quality improvement is very often achieved by defining and developing an appropriate set of strategic capabilities and core competencies to support them. A strategic capability is, in this context, a corporate goal defined by the business position of the organization and implemented by key business processes. Strategic capabilities are supported by core competencies, which are aggregate technologies tailored to the specific needs of the organization in performing the needed business processes. Core competencies are non-transitional, have a consistent evolution, and are typically fueled by multiple technologies. Their selection and development requires commitment, investment and leadership. The paradigm introduced in this paper for developing core competencies is the Quality Improvement Paradigm which consists of six steps: (1) Characterize the environment, (2) Set the goals, (3) Choose the process, (4) Execute the process, (5) Analyze the process data, and (6) Package experience. The process must be supported by a goal oriented approach to measurement and control, and an organizational infrastructure, called Experience Factory. The Experience Factory is a logical and physical organization distinct from the project organizations it supports. Its goal is development and support of core competencies through capitalization and reuse of its cycle experience and products. The paper introduces the major concepts of the proposed approach, discusses their relationship with other approaches used in the industry, and presents a case in which those concepts have been successfully applied.

Development and weighting of a life cycle assessment screening model

NASA Astrophysics Data System (ADS)

Bates, Wayne E.; O'Shaughnessy, James; Johnson, Sharon A.; Sisson, Richard

2004-02-01

Nearly all life cycle assessment tools available today are high priced, comprehensive and quantitative models requiring a significant amount of data collection and data input. In addition, most of the available software packages require a great deal of training time to learn how to operate the model software. Even after this time investment, results are not guaranteed because of the number of estimations and assumptions often necessary to run the model. As a result, product development, design teams and environmental specialists need a simplified tool that will allow for the qualitative evaluation and "screening" of various design options. This paper presents the development and design of a generic, qualitative life cycle screening model and demonstrates its applicability and ease of use. The model uses qualitative environmental, health and safety factors, based on site or product-specific issues, to sensitize the overall results for a given set of conditions. The paper also evaluates the impact of different population input ranking values on model output. The final analysis is based on site or product-specific variables. The user can then evaluate various design changes and the apparent impact or improvement on the environment, health and safety, compliance cost and overall corporate liability. Major input parameters can be varied, and factors such as materials use, pollution prevention, waste minimization, worker safety, product life, environmental impacts, return of investment, and recycle are evaluated. The flexibility of the model format will be discussed in order to demonstrate the applicability and usefulness within nearly any industry sector. Finally, an example using audience input value scores will be compared to other population input results.

Application of square-root filtering for spacecraft attitude control

NASA Technical Reports Server (NTRS)

Sorensen, J. A.; Schmidt, S. F.; Goka, T.

1978-01-01

Suitable digital algorithms are developed and tested for providing on-board precision attitude estimation and pointing control for potential use in the Landsat-D spacecraft. These algorithms provide pointing accuracy of better than 0.01 deg. To obtain necessary precision with efficient software, a six state-variable square-root Kalman filter combines two star tracker measurements to update attitude estimates obtained from processing three gyro outputs. The validity of the estimation and control algorithms are established, and the sensitivity of their performance to various error sources and software parameters are investigated by detailed digital simulation. Spacecraft computer memory, cycle time, and accuracy requirements are estimated.

The Role of Data Archives in Synoptic Solar Physics

NASA Astrophysics Data System (ADS)

Reardon, Kevin

The detailed study of solar cycle variations requires analysis of recorded datasets spanning many years of observations, that is, a data archive. The use of digital data, combined with powerful database server software, gives such archives new capabilities to provide, quickly and flexibly, selected pieces of information to scientists. Use of standardized protocols will allow multiple databases, independently maintained, to be seamlessly joined, allowing complex searches spanning multiple archives. These data archives also benefit from being developed in parallel with the telescope itself, which helps to assure data integrity and to provide close integration between the telescope and archive. Development of archives that can guarantee long-term data availability and strong compatibility with other projects makes solar-cycle studies easier to plan and realize.

Are Integrated Portfolio Systems the Answer? An Evaluation of a Web-Based Portfolio System to Improve Preservice Teachers' Reflective Thinking Skills

ERIC Educational Resources Information Center

Oner, Diler; Adadan, Emine

2016-01-01

This study investigated the effectiveness of an integrated web-based portfolio system, namely the BOUNCE System, which primarily focuses on improving preservice teachers' reflective thinking skills. BOUNCE©, the software component of the system, was designed and developed to support a teaching practice model including a cycle of activities to be…

Engineering Margin Factors Used in the Design of the VVER Fuel Cycles

NASA Astrophysics Data System (ADS)

Lizorkin, M. P.; Shishkov, L. K.

2017-12-01

The article describes methods for determination of the engineering margin factors currently used to estimate the uncertainties of the VVER reactor design parameters calculated via the KASKAD software package developed at the National Research Center Kurchatov Institute. These margin factors ensure the meeting of the operating (design) limits and a number of other restrictions under normal operating conditions.

Software Requirements Specification for an Ammunition Management System

DTIC Science & Technology

1986-09-01

thesis takes the form of a software requirements specification. Such a specification, according to Pressman [Ref. 7], establishes a complete...defined by Pressman , is depicted in Figure 1.1. 11 Figure 1.1 Generalized Software Life Cycle The common thread which binds the various phases together...application of software engineering principles requires an established methodology. This methodology, according to Pressman [Ref. 8:p. 151 is an

Model-based software process improvement

NASA Technical Reports Server (NTRS)

Zettervall, Brenda T.

1994-01-01

The activities of a field test site for the Software Engineering Institute's software process definition project are discussed. Products tested included the improvement model itself, descriptive modeling techniques, the CMM level 2 framework document, and the use of process definition guidelines and templates. The software process improvement model represents a five stage cyclic approach for organizational process improvement. The cycles consist of the initiating, diagnosing, establishing, acting, and leveraging phases.

A Study of Emotions in Requirements Engineering

NASA Astrophysics Data System (ADS)

Colomo-Palacios, Ricardo; Hernández-López, Adrián; García-Crespo, Ángel; Soto-Acosta, Pedro

Requirements engineering (RE) is a crucial activity in software development projects. This phase in the software development cycle is knowledge intensive, and thus, human capital intensive. From the human point of view, emotions play an important role in behavior and can even act as behavioral motivators. Thus, if we consider that RE represents a set of knowledge-intensive tasks, which include acceptance and negotiation activities, then the emotional factor represents a key element in these issues. However, the emotional factor in RE has not received the attention it deserves. This paper aims to integrate the stakeholder's emotions into the requirement process, proposing to catalogue them like any other factor in the process such as clarity or stability. Results show that high arousal and low pleasure levels are predictors of high versioning requirements.

Material Protection, Accounting, and Control Technologies (MPACT): Modeling and Simulation Roadmap

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cipiti, Benjamin; Dunn, Timothy; Durbin, Samual

The development of sustainable advanced nuclear fuel cycles is a long-term goal of the Office of Nuclear Energy’s (DOE-NE) Fuel Cycle Technologies program. The Material Protection, Accounting, and Control Technologies (MPACT) campaign is supporting research and development (R&D) of advanced instrumentation, analysis tools, and integration methodologies to meet this goal. This advanced R&D is intended to facilitate safeguards and security by design of fuel cycle facilities. The lab-scale demonstration of a virtual facility, distributed test bed, that connects the individual tools being developed at National Laboratories and university research establishments, is a key program milestone for 2020. These tools willmore » consist of instrumentation and devices as well as computer software for modeling. To aid in framing its long-term goal, during FY16, a modeling and simulation roadmap is being developed for three major areas of investigation: (1) radiation transport and sensors, (2) process and chemical models, and (3) shock physics and assessments. For each area, current modeling approaches are described, and gaps and needs are identified.« less

Development of Software for a Lidar-Altimeter Processor

NASA Technical Reports Server (NTRS)

Rosenberg, Jacob S.; Trujillo, Carlos

2005-01-01

A report describes the development of software for a digital processor that operates in conjunction with a finite-impulse-response (FIR) chip in a spaceborne lidar altimeter. Processing is started by a laser-fire interrupt signal that is repeated at intervals of 25 ms. For the purpose of discriminating between returns from the ground and returns from such things as trees, buildings, and clouds, the software is required to scan digitized lidar-return data in reverse of the acquisition sequence in order to distinguish the last return pulse from within a commanded ground-return range window. The digitized waveform information within this range window is filtered through 6 matched filters, in the hardware electronics, in order to maximize the probability of finding echoes from sloped or rough terrain and minimize the probability of selecting cloud returns. From the data falling past the end of the range window, there is obtained a noise baseline that is used to calculate a threshold value for each filter. The data from each filter is analyzed by a complex weighting scheme and the filter with the greatest weight is selected. A region around the peak of the ground return pulse associated with the selected filter is placed in telemetry, as well as information on its location, height, and other characteristics. The software requires many uplinked parameters as input. Included in the report is a discussion of major software-development problems posed by the design of the FIR chip and the need for the software to complete its process within 20 ms to fit within the overall 25-ms cycle.

PopED lite: An optimal design software for preclinical pharmacokinetic and pharmacodynamic studies.

PubMed

Aoki, Yasunori; Sundqvist, Monika; Hooker, Andrew C; Gennemark, Peter

2016-04-01

Optimal experimental design approaches are seldom used in preclinical drug discovery. The objective is to develop an optimal design software tool specifically designed for preclinical applications in order to increase the efficiency of drug discovery in vivo studies. Several realistic experimental design case studies were collected and many preclinical experimental teams were consulted to determine the design goal of the software tool. The tool obtains an optimized experimental design by solving a constrained optimization problem, where each experimental design is evaluated using some function of the Fisher Information Matrix. The software was implemented in C++ using the Qt framework to assure a responsive user-software interaction through a rich graphical user interface, and at the same time, achieving the desired computational speed. In addition, a discrete global optimization algorithm was developed and implemented. The software design goals were simplicity, speed and intuition. Based on these design goals, we have developed the publicly available software PopED lite (http://www.bluetree.me/PopED_lite). Optimization computation was on average, over 14 test problems, 30 times faster in PopED lite compared to an already existing optimal design software tool. PopED lite is now used in real drug discovery projects and a few of these case studies are presented in this paper. PopED lite is designed to be simple, fast and intuitive. Simple, to give many users access to basic optimal design calculations. Fast, to fit a short design-execution cycle and allow interactive experimental design (test one design, discuss proposed design, test another design, etc). Intuitive, so that the input to and output from the software tool can easily be understood by users without knowledge of the theory of optimal design. In this way, PopED lite is highly useful in practice and complements existing tools. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Landsat-7 Simulation and Testing Environments

NASA Technical Reports Server (NTRS)

Holmes, E.; Ha, K.; Hawkins, K.; Lombardo, J.; Ram, M.; Sabelhaus, P.; Scott, S.; Phillips, R.

1999-01-01

A spacecraft Attitude Control and Determination Subsystem (ACDS) is heavily dependent upon simulation throughout its entire development, implementation and ground test cycle. Engineering simulation tools are typically developed to design and analyze control systems to validate the design and software simulation tools are required to qualify the flight software. However, the need for simulation does not end here. Operating the ACDS of a spacecraft on the ground requires the simulation of spacecraft dynamics, disturbance modeling and celestial body motion. Sensor data must also be simulated and substituted for actual sensor data on the ground so that the spacecraft will respond by sending commands to the actuators as they will on orbit. And finally, the simulators is the primary training tool and test-bed for the Flight Operations Team. In this paper various ACDS simulation, developed for or used by the Landsat 7 project will be described. The paper will include a description of each tool, its unique attributes, and its role in the overall development and testing of the ACDS. Finally, a section is included which discusses how the coordinated use of these simulation tools can maximize the probability of uncovering software, hardware and operations errors during the ground test process.

Space station advanced automation

NASA Technical Reports Server (NTRS)

Woods, Donald

1990-01-01

In the development of a safe, productive and maintainable space station, Automation and Robotics (A and R) has been identified as an enabling technology which will allow efficient operation at a reasonable cost. The Space Station Freedom's (SSF) systems are very complex, and interdependent. The usage of Advanced Automation (AA) will help restructure, and integrate system status so that station and ground personnel can operate more efficiently. To use AA technology for the augmentation of system management functions requires a development model which consists of well defined phases of: evaluation, development, integration, and maintenance. The evaluation phase will consider system management functions against traditional solutions, implementation techniques and requirements; the end result of this phase should be a well developed concept along with a feasibility analysis. In the development phase the AA system will be developed in accordance with a traditional Life Cycle Model (LCM) modified for Knowledge Based System (KBS) applications. A way by which both knowledge bases and reasoning techniques can be reused to control costs is explained. During the integration phase the KBS software must be integrated with conventional software, and verified and validated. The Verification and Validation (V and V) techniques applicable to these KBS are based on the ideas of consistency, minimal competency, and graph theory. The maintenance phase will be aided by having well designed and documented KBS software.

Unique Challenges Testing SDRs for Space

NASA Technical Reports Server (NTRS)

Chelmins, David; Downey, Joseph A.; Johnson, Sandra K.; Nappier, Jennifer M.

2013-01-01

This paper describes the approach used by the Space Communication and Navigation (SCaN) Testbed team to qualify three Software Defined Radios (SDR) for operation in space and the characterization of the platform to enable upgrades on-orbit. The three SDRs represent a significant portion of the new technologies being studied on board the SCAN Testbed, which is operating on an external truss on the International Space Station (ISS). The SCaN Testbed provides experimenters an opportunity to develop and demonstrate experimental waveforms and applications for communication, networking, and navigation concepts and advance the understanding of developing and operating SDRs in space. Qualifying a Software Defined Radio for the space environment requires additional consideration versus a hardware radio. Tests that incorporate characterization of the platform to provide information necessary for future waveforms, which might exercise extended capabilities of the hardware, are needed. The development life cycle for the radio follows the software development life cycle, where changes can be incorporated at various stages of development and test. It also enables flexibility to be added with minor additional effort. Although this provides tremendous advantages, managing the complexity inherent in a software implementation requires a testing beyond the traditional hardware radio test plan. Due to schedule and resource limitations and parallel development activities, the subsystem testing of the SDRs at the vendor sites was primarily limited to typical fixed transceiver type of testing. NASA s Glenn Research Center (GRC) was responsible for the integration and testing of the SDRs into the SCaN Testbed system and conducting the investigation of the SDR to advance the technology to be accepted by missions. This paper will describe the unique tests that were conducted at both the subsystem and system level, including environmental testing, and present results. For example, test waveforms were developed to measure the gain of the transmit system across the tunable frequency band. These were used during thermal vacuum testing to enable characterization of the integrated system in the wide operational temperature range of space. Receive power indicators were used for Electromagnetic Interference tests (EMI) to understand the platform s susceptibility to external interferers independent of the waveform. Additional approaches and lessons learned during the SCaN Testbed subsystem and system level testing will be discussed that may help future SDR integrators

Unique Challenges Testing SDRs for Space

NASA Technical Reports Server (NTRS)

Johnson, Sandra; Chelmins, David; Downey, Joseph; Nappier, Jennifer

2013-01-01

This paper describes the approach used by the Space Communication and Navigation (SCaN) Testbed team to qualify three Software Defined Radios (SDR) for operation in space and the characterization of the platform to enable upgrades on-orbit. The three SDRs represent a significant portion of the new technologies being studied on board the SCAN Testbed, which is operating on an external truss on the International Space Station (ISS). The SCaN Testbed provides experimenters an opportunity to develop and demonstrate experimental waveforms and applications for communication, networking, and navigation concepts and advance the understanding of developing and operating SDRs in space. Qualifying a Software Defined Radio for the space environment requires additional consideration versus a hardware radio. Tests that incorporate characterization of the platform to provide information necessary for future waveforms, which might exercise extended capabilities of the hardware, are needed. The development life cycle for the radio follows the software development life cycle, where changes can be incorporated at various stages of development and test. It also enables flexibility to be added with minor additional effort. Although this provides tremendous advantages, managing the complexity inherent in a software implementation requires a testing beyond the traditional hardware radio test plan. Due to schedule and resource limitations and parallel development activities, the subsystem testing of the SDRs at the vendor sites was primarily limited to typical fixed transceiver type of testing. NASA's Glenn Research Center (GRC) was responsible for the integration and testing of the SDRs into the SCaN Testbed system and conducting the investigation of the SDR to advance the technology to be accepted by missions. This paper will describe the unique tests that were conducted at both the subsystem and system level, including environmental testing, and present results. For example, test waveforms were developed to measure the gain of the transmit system across the tunable frequency band. These were used during thermal vacuum testing to enable characterization of the integrated system in the wide operational temperature range of space. Receive power indicators were used for Electromagnetic Interference tests (EMI) to understand the platform's susceptibility to external interferers independent of the waveform. Additional approaches and lessons learned during the SCaN Testbed subsystem and system level testing will be discussed that may help future SDR integrators.

Advanced software development workstation. Comparison of two object-oriented development methodologies

NASA Technical Reports Server (NTRS)

Izygon, Michel E.

1992-01-01

This report is an attempt to clarify some of the concerns raised about the OMT method, specifically that OMT is weaker than the Booch method in a few key areas. This interim report specifically addresses the following issues: (1) is OMT object-oriented or only data-driven?; (2) can OMT be used as a front-end to implementation in C++?; (3) the inheritance concept in OMT is in contradiction with the 'pure and real' inheritance concept found in object-oriented (OO) design; (4) low support for software life-cycle issues, for project and risk management; (5) uselessness of functional modeling for the ROSE project; and (6) problems with event-driven and simulation systems. The conclusion of this report is that both Booch's method and Rumbaugh's method are good OO methods, each with strengths and weaknesses in different areas of the development process.

Software Reviews.

ERIC Educational Resources Information Center

Science and Children, 1989

1989-01-01

Reviews of seven software packages are presented including "The Environment I: Habitats and EcoSystems; II Cycles and Interactions"; "Super Sign Maker"; "The Great Knowledge Race: Substance Abuse"; "Exploring Science: Temperature"; "Fast Food Calculator and RD Aide"; "The Human Body:…

Reusable Rack Interface Controller Common Software for Various Science Research Racks on the International Space Station

NASA Technical Reports Server (NTRS)

Lu, George C.

2003-01-01

The purpose of the EXPRESS (Expedite the PRocessing of Experiments to Space Station) rack project is to provide a set of predefined interfaces for scientific payloads which allow rapid integration into a payload rack on International Space Station (ISS). VxWorks' was selected as the operating system for the rack and payload resource controller, primarily based on the proliferation of VME (Versa Module Eurocard) products. These products provide needed flexibility for future hardware upgrades to meet everchanging science research rack configuration requirements. On the International Space Station, there are multiple science research rack configurations, including: 1) Human Research Facility (HRF); 2) EXPRESS ARIS (Active Rack Isolation System); 3) WORF (Window Observational Research Facility); and 4) HHR (Habitat Holding Rack). The RIC (Rack Interface Controller) connects payloads to the ISS bus architecture for data transfer between the payload and ground control. The RIC is a general purpose embedded computer which supports multiple communication protocols, including fiber optic communication buses, Ethernet buses, EIA-422, Mil-Std-1553 buses, SMPTE (Society Motion Picture Television Engineers)-170M video, and audio interfaces to payloads and the ISS. As a cost saving and software reliability strategy, the Boeing Payload Software Organization developed reusable common software where appropriate. These reusable modules included a set of low-level driver software interfaces to 1553B. RS232, RS422, Ethernet buses, HRDL (High Rate Data Link), video switch functionality, telemetry processing, and executive software hosted on the FUC computer. These drivers formed the basis for software development of the HRF, EXPRESS, EXPRESS ARIS, WORF, and HHR RIC executable modules. The reusable RIC common software has provided extensive benefits, including: 1) Significant reduction in development flow time; 2) Minimal rework and maintenance; 3) Improved reliability; and 4) Overall reduction in software life cycle cost. Due to the limited number of crew hours available on ISS for science research, operational efficiency is a critical customer concern. The current method of upgrading RIC software is a time consuming process; thus, an improved methodology for uploading RIC software is currently under evaluation.

Flexible control techniques for a lunar base

NASA Technical Reports Server (NTRS)

Kraus, Thomas W.

1992-01-01

The fundamental elements found in every terrestrial control system can be employed in all lunar applications. These elements include sensors which measure physical properties, controllers which acquire sensor data and calculate a control response, and actuators which apply the control output to the process. The unique characteristics of the lunar environment will certainly require the development of new control system technology. However, weightlessness, harsh atmospheric conditions, temperature extremes, and radiation hazards will most significantly impact the design of sensors and actuators. The controller and associated control algorithms, which are the most complex element of any control system, can be derived in their entirety from existing technology. Lunar process control applications -- ranging from small-scale research projects to full-scale processing plants -- will benefit greatly from the controller advances being developed today. In particular, new software technology aimed at commercial process monitoring and control applications will almost completely eliminate the need for custom programs and the lengthy development and testing cycle they require. The applicability of existing industrial software to lunar applications has other significant advantages in addition to cost and quality. This software is designed to run on standard hardware platforms and takes advantage of existing LAN and telecommunications technology. Further, in order to exploit the existing commercial market, the software is being designed to be implemented by users of all skill levels -- typically users who are familiar with their process, but not necessarily with software or control theory. This means that specialized technical support personnel will not need to be on-hand, and the associated costs are eliminated. Finally, the latest industrial software designed for the commercial market is extremely flexible, in order to fit the requirements of many types of processing applications with little or no customization. This means that lunar process control projects will not be delayed by unforeseen problems or last minute process modifications. The software will include all of the tools needed to adapt to virtually any changes. In contrast to other space programs which required the development of tremendous amounts of custom software, lunar-based processing facilities will benefit from the use of existing software technology which is being proven in commercial applications on Earth.

Hardware development process for Human Research facility applications

NASA Astrophysics Data System (ADS)

Bauer, Liz

2000-01-01

The simple goal of the Human Research Facility (HRF) is to conduct human research experiments on the International Space Station (ISS) astronauts during long-duration missions. This is accomplished by providing integration and operation of the necessary hardware and software capabilities. A typical hardware development flow consists of five stages: functional inputs and requirements definition, market research, design life cycle through hardware delivery, crew training, and mission support. The purpose of this presentation is to guide the audience through the early hardware development process: requirement definition through selecting a development path. Specific HRF equipment is used to illustrate the hardware development paths. .

Using a software-defined computer in teaching the basics of computer architecture and operation

NASA Astrophysics Data System (ADS)

Kosowska, Julia; Mazur, Grzegorz

2017-08-01

The paper describes the concept and implementation of SDC_One software-defined computer designed for experimental and didactic purposes. Equipped with extensive hardware monitoring mechanisms, the device enables the students to monitor the computer's operation on bus transfer cycle or instruction cycle basis, providing the practical illustration of basic aspects of computer's operation. In the paper, we describe the hardware monitoring capabilities of SDC_One and some scenarios of using it in teaching the basics of computer architecture and microprocessor operation.

IEEE Std 730 Software Quality Assurance: Supporting CMMI-DEV v1.3, Product and Process Quality Assurance

DTIC Science & Technology

2011-05-27

frameworks 4 CMMI-DEV IEEE / ISO / IEC 15288 / 12207 Quality Assurance ©2011 Walz IEEE Life Cycle Processes & Artifacts • Systems Life Cycle Processes...TAG to ISO TC 176 Quality Management • Quality: ASQ, work experience • Software: three books, consulting, work experience • Systems: Telecom & DoD...and IEEE 730 SQA need to align. The P730 IEEE standards working group has expanded the scope of the SQA process standard to align with IS 12207

Life cycle cost modeling of conceptual space vehicles

NASA Technical Reports Server (NTRS)

Ebeling, Charles

1993-01-01

This paper documents progress to date by the University of Dayton on the development of a life cycle cost model for use during the conceptual design of new launch vehicles and spacecraft. This research is being conducted under NASA Research Grant NAG-1-1327. This research effort changes the focus from that of the first two years in which a reliability and maintainability model was developed to the initial development of a life cycle cost model. Cost categories are initially patterned after NASA's three axis work breakdown structure consisting of a configuration axis (vehicle), a function axis, and a cost axis. The focus will be on operations and maintenance costs and other recurring costs. Secondary tasks performed concurrent with the development of the life cycle costing model include continual support and upgrade of the R&M model. The primary result of the completed research will be a methodology and a computer implementation of the methodology to provide for timely cost analysis in support of the conceptual design activities. The major objectives of this research are: to obtain and to develop improved methods for estimating manpower, spares, software and hardware costs, facilities costs, and other cost categories as identified by NASA personnel; to construct a life cycle cost model of a space transportation system for budget exercises and performance-cost trade-off analysis during the conceptual and development stages; to continue to support modifications and enhancements to the R&M model; and to continue to assist in the development of a simulation model to provide an integrated view of the operations and support of the proposed system.

A Holistic Approach to Systems Development

NASA Technical Reports Server (NTRS)

Wong, Douglas T.

2008-01-01

Introduces a Holistic and Iterative Design Process. Continuous process but can be loosely divided into four stages. More effort spent early on in the design. Human-centered and Multidisciplinary. Emphasis on Life-Cycle Cost. Extensive use of modeling, simulation, mockups, human subjects, and proven technologies. Human-centered design doesn t mean the human factors discipline is the most important Disciplines should be involved in the design: Subsystem vendors, configuration management, operations research, manufacturing engineering, simulation/modeling, cost engineering, hardware engineering, software engineering, test and evaluation, human factors, electromagnetic compatibility, integrated logistics support, reliability/maintainability/availability, safety engineering, test equipment, training systems, design-to-cost, life cycle cost, application engineering etc. 9

Operability engineering in the Deep Space Network

NASA Technical Reports Server (NTRS)

Wilkinson, Belinda

1993-01-01

Many operability problems exist at the three Deep Space Communications Complexes (DSCC's) of the Deep Space Network (DSN). Four years ago, the position of DSN Operability Engineer was created to provide the opportunity for someone to take a system-level approach to solving these problems. Since that time, a process has been developed for personnel and development engineers and for enforcing user interface standards in software designed for the DSCC's. Plans are for the participation of operations personnel in the product life-cycle to expand in the future.

Development of a Low-Latency, High Data Rate, Differential GPS Relative Positioning System for UAV Formation Flight Control

DTIC Science & Technology

2006-09-01

spiral development cycle involved transporting the software processes from a Windows XP / MATLAB environment to a Linux / C++ environment. This...tested on. Additionally, in the case of the GUMSTIX PC boards, the LINUX operating system is burned into the read-only memory. Lastly, both PC-104 and...both the real-time environment and the post-processed en - vironment. When the system operates in real-time mode, an output file is generated which

Testing and analysis of the impact on engine cycle parameters and control system modifications using hydrogen or methane as fuel in an industrial gas turbine

NASA Astrophysics Data System (ADS)

Funke, H. H.-W.; Keinz, J.; Börner, S.; Hendrick, P.; Elsing, R.

2016-07-01

The paper highlights the modification of the engine control software of the hydrogen (H2) converted gas turbine Auxiliary Power Unit (APU) GTCP 36-300 allowing safe and accurate methane (CH4) operation achieved without mechanical changes of the metering unit. The acceleration and deceleration characteristics of the engine controller from idle to maximum load are analyzed comparing H2 and CH4. Also, the paper presents the influence on the thermodynamic cycle of gas turbine resulting from the different fuels supported by a gas turbine cycle simulation of H2 and CH4 using the software GasTurb.

FUNDAMENTALS OF LIFE CYCLE ASSESSMENT AND OFF-THE-SHELF SOFTWARE DEMONSTRATION

EPA Science Inventory

As the name implies, Life Cycle Assesssment (LCA) evaluates the entire life cycle of a product, process, activity, or service, not just simple economics at the time of delivery. This course on LCA covers the following issues:
Basic principles of LCA for use in producing, des...

Cost benefits of advanced software: A review of methodology used at Kennedy Space Center

NASA Technical Reports Server (NTRS)

Joglekar, Prafulla N.

1993-01-01

To assist rational investments in advanced software, a formal, explicit, and multi-perspective cost-benefit analysis methodology is proposed. The methodology can be implemented through a six-stage process which is described and explained. The current practice of cost-benefit analysis at KSC is reviewed in the light of this methodology. The review finds that there is a vicious circle operating. Unsound methods lead to unreliable cost-benefit estimates. Unreliable estimates convince management that cost-benefit studies should not be taken seriously. Then, given external demands for cost-benefit estimates, management encourages software enginees to somehow come up with the numbers for their projects. Lacking the expertise needed to do a proper study, courageous software engineers with vested interests use ad hoc and unsound methods to generate some estimates. In turn, these estimates are unreliable, and the cycle continues. The proposed methodology should help KSC to break out of this cycle.

10 CFR 436.15 - Formatting cost data.

Code of Federal Regulations, 2013 CFR

2013-01-01

... Procedures for Life Cycle Cost Analyses § 436.15 Formatting cost data. In establishing cost data under §§ 436... software referenced in the Life Cycle Cost Manual for the Federal Energy Management Program. ...

10 CFR 436.15 - Formatting cost data.

Code of Federal Regulations, 2014 CFR

2014-01-01

... Procedures for Life Cycle Cost Analyses § 436.15 Formatting cost data. In establishing cost data under §§ 436... software referenced in the Life Cycle Cost Manual for the Federal Energy Management Program. ...

10 CFR 436.15 - Formatting cost data.

Code of Federal Regulations, 2012 CFR

2012-01-01

... Procedures for Life Cycle Cost Analyses § 436.15 Formatting cost data. In establishing cost data under §§ 436... software referenced in the Life Cycle Cost Manual for the Federal Energy Management Program. ...

10 CFR 436.15 - Formatting cost data.

Code of Federal Regulations, 2010 CFR

2010-01-01

... Procedures for Life Cycle Cost Analyses § 436.15 Formatting cost data. In establishing cost data under §§ 436... software referenced in the Life Cycle Cost Manual for the Federal Energy Management Program. ...

First-Order-hold interpolation digital-to-analog converter with application to aircraft simulation

NASA Technical Reports Server (NTRS)

Cleveland, W. B.

1976-01-01

Those who design piloted aircraft simulations must contend with the finite size and speed of the available digital computer and the requirement for simulation reality. With a fixed computational plant, the more complex the model, the more computing cycle time is required. While increasing the cycle time may not degrade the fidelity of the simulated aircraft dynamics, the larger steps in the pilot cue feedback variables (such as the visual scene cues), may be disconcerting to the pilot. The first-order-hold interpolation (FOHI) digital-to-analog converter (DAC) is presented as a device which offers smooth output, regardless of cycle time. The Laplace transforms of these three conversion types are developed and their frequency response characteristics and output smoothness are compared. The FOHI DAC exhibits a pure one-cycle delay. Whenever the FOHI DAC input comes from a second-order (or higher) system, a simple computer software technique can be used to compensate for the DAC phase lag. When so compensated, the FOHI DAC has (1) an output signal that is very smooth, (2) a flat frequency response in frequency ranges of interest, and (3) no phase error. When the input comes from a first-order system, software compensation may cause the FOHI DAC to perform as an FOHE DAC, which, although its output is not as smooth as that of the FOHI DAC, has a smoother output than that of the ZOH DAC.

IV&V Project Assessment Process Validation

NASA Technical Reports Server (NTRS)

Driskell, Stephen

2012-01-01

The Space Launch System (SLS) will launch NASA's Multi-Purpose Crew Vehicle (MPCV). This launch vehicle will provide American launch capability for human exploration and travelling beyond Earth orbit. SLS is designed to be flexible for crew or cargo missions. The first test flight is scheduled for December 2017. The SLS SRR/SDR provided insight into the project development life cycle. NASA IV&V ran the standard Risk Based Assessment and Portfolio Based Risk Assessment to identify analysis tasking for the SLS program. This presentation examines the SLS System Requirements Review/System Definition Review (SRR/SDR), IV&V findings for IV&V process validation correlation to/from the selected IV&V tasking and capabilities. It also provides a reusable IEEE 1012 scorecard for programmatic completeness across the software development life cycle.

Formalization of software requirements for information systems using fuzzy logic

NASA Astrophysics Data System (ADS)

Yegorov, Y. S.; Milov, V. R.; Kvasov, A. S.; Sorokoumova, S. N.; Suvorova, O. V.

2018-05-01

The paper considers an approach to the design of information systems based on flexible software development methodologies. The possibility of improving the management of the life cycle of information systems by assessing the functional relationship between requirements and business objectives is described. An approach is proposed to establish the relationship between the degree of achievement of business objectives and the fulfillment of requirements for the projected information system. It describes solutions that allow one to formalize the process of formation of functional and non-functional requirements with the help of fuzzy logic apparatus. The form of the objective function is formed on the basis of expert knowledge and is specified via learning from very small data set.

The relational database model and multiple multicenter clinical trials.

PubMed

Blumenstein, B A

1989-12-01

The Southwest Oncology Group (SWOG) chose to use a relational database management system (RDBMS) for the management of data from multiple clinical trials because of the underlying relational model's inherent flexibility and the natural way multiple entity types (patients, studies, and participants) can be accommodated. The tradeoffs to using the relational model as compared to using the hierarchical model include added computing cycles due to deferred data linkages and added procedural complexity due to the necessity of implementing protections against referential integrity violations. The SWOG uses its RDBMS as a platform on which to build data operations software. This data operations software, which is written in a compiled computer language, allows multiple users to simultaneously update the database and is interactive with respect to the detection of conditions requiring action and the presentation of options for dealing with those conditions. The relational model facilitates the development and maintenance of data operations software.

The Production Data Approach for Full Lifecycle Management

NASA Astrophysics Data System (ADS)

Schopf, J.

2012-04-01

The amount of data generated by scientists is growing exponentially, and studies have shown [Koe04] that un-archived data sets have a resource half-life that is only a fraction of those resources that are electronically archived. Most groups still lack standard approaches and procedures for data management. Arguably, however, scientists know something about building software. A recent article in Nature [Mer10] stated that 45% of research scientists spend more time now developing software than they did 5 years ago, and 38% spent at least 1/5th of their time developing software. Fox argues [Fox10] that a simple release of data is not the correct approach to data curation. In addition, just as software is used in a wide variety of ways never initially envisioned by its developers, we're seeing this even to a greater extent with data sets. In order to address the need for better data preservation and access, we propose that data sets should be managed in a similar fashion to building production quality software. These production data sets are not simply published once, but go through a cyclical process, including phases such as design, development, verification, deployment, support, analysis, and then development again, thereby supporting the full lifecycle of a data set. The process involved in academically-produced software changes over time with respect to issues such as how much it is used outside the development group, but factors in aspects such as knowing who is using the code, enabling multiple developers to contribute to code development with common procedures, formal testing and release processes, developing documentation, and licensing. When we work with data, either as a collection source, as someone tagging data, or someone re-using it, many of the lessons learned in building production software are applicable. Table 1 shows a comparison of production software elements to production data elements. Table 1: Comparison of production software and production data. Production Software Production Data End-user considerations End-user considerations Multiple Coders: Repository with check-in procedures Coding standards Multiple producers/collectors Local archive with check-in procedure Metadata Standards Formal testing Formal testing Bug tracking and fixes Bug tracking and fixes, QA/QC Documentation Documentation Formal Release Process Formal release process to external archive License Citation/usage statement The full presentation of this abstract will include a detailed discussion of these issues so that researchers can produce usable and accessible data sets as a first step toward reproducible science. By creating production-quality data sets, we extend the potential of our data, both in terms of usability and usefulness to ourselves and other researchers. The more we treat data with formal processes and release cycles, the more relevant and useful it can be to the scientific community.

The New Cloud Absorption Radiometer (CAR) Software: One Model for NASA Remote Sensing Virtual Instruments

NASA Technical Reports Server (NTRS)

Roth, Don J.; Rapchun, David A.; Jones, Hollis H.

2001-01-01

The Cloud Absorption Radiometer (CAR) instrument has been the most frequently used airborne instrument built in-house at NASA Goddard Space Flight Center, having flown scientific research missions on-board various aircraft to many locations in the United States, Azores, Brazil, and Kuwait since 1983. The CAR instrument is capable of measuring scattered light by clouds in fourteen spectral bands in UV, visible and near-infrared region. This document describes the control, data acquisition, display, and file storage software for the new version of CAR. This software completely replaces the prior CAR Data System and Control Panel with a compact and robust virtual instrument computer interface. Additionally, the instrument is now usable for the first time for taking data in an off-aircraft mode. The new instrument is controlled via a LabVIEW v5. 1.1-developed software interface that utilizes, (1) serial port writes to write commands to the controller module of the instrument, and (2) serial port reads to acquire data from the controller module of the instrument. Step-by-step operational procedures are provided in this document. A suite of other software programs has been developed to complement the actual CAR virtual instrument. These programs include: (1) a simulator mode that allows pretesting of new features that might be added in the future, as well as demonstrations to CAR customers, and development at times when the instrument/hardware is off-location, and (2) a post-experiment data viewer that can be used to view all segments of individual data cycles and to locate positions where 'start' and stop' byte sequences were incorrectly formulated by the instrument controller. The CAR software described here is expected to be the basis for CAR operation for many missions and many years to come.

A systematic approach to the Planck LFI end-to-end test and its application to the DPC Level 1 pipeline

NASA Astrophysics Data System (ADS)

Frailis, M.; Maris, M.; Zacchei, A.; Morisset, N.; Rohlfs, R.; Meharga, M.; Binko, P.; Türler, M.; Galeotta, S.; Gasparo, F.; Franceschi, E.; Butler, R. C.; D'Arcangelo, O.; Fogliani, S.; Gregorio, A.; Lowe, S. R.; Maggio, G.; Malaspina, M.; Mandolesi, N.; Manzato, P.; Pasian, F.; Perrotta, F.; Sandri, M.; Terenzi, L.; Tomasi, M.; Zonca, A.

2009-12-01

The Level 1 of the Planck LFI Data Processing Centre (DPC) is devoted to the handling of the scientific and housekeeping telemetry. It is a critical component of the Planck ground segment which has to strictly commit to the project schedule to be ready for the launch and flight operations. In order to guarantee the quality necessary to achieve the objectives of the Planck mission, the design and development of the Level 1 software has followed the ESA Software Engineering Standards. A fundamental step in the software life cycle is the Verification and Validation of the software. The purpose of this work is to show an example of procedures, test development and analysis successfully applied to a key software project of an ESA mission. We present the end-to-end validation tests performed on the Level 1 of the LFI-DPC, by detailing the methods used and the results obtained. Different approaches have been used to test the scientific and housekeeping data processing. Scientific data processing has been tested by injecting signals with known properties directly into the acquisition electronics, in order to generate a test dataset of real telemetry data and reproduce as much as possible nominal conditions. For the HK telemetry processing, validation software have been developed to inject known parameter values into a set of real housekeeping packets and perform a comparison with the corresponding timelines generated by the Level 1. With the proposed validation and verification procedure, where the on-board and ground processing are viewed as a single pipeline, we demonstrated that the scientific and housekeeping processing of the Planck-LFI raw data is correct and meets the project requirements.

Lessons Learned from the Deployment and Integration of a Microwave Sounder Based Tropical Cyclone Intensity and Surface Wind Estimation Algorithm into NOAA/NESDIS Satellite Product Operations

NASA Astrophysics Data System (ADS)

Longmore, S. P.; Knaff, J. A.; Schumacher, A.; Dostalek, J.; DeMaria, R.; Chirokova, G.; Demaria, M.; Powell, D. C.; Sigmund, A.; Yu, W.

2014-12-01

The Colorado State University (CSU) Cooperative Institute for Research in the Atmosphere (CIRA) has recently deployed a tropical cyclone (TC) intensity and surface wind radii estimation algorithm that utilizes Suomi National Polar-orbiting Partnership (S-NPP) satellite Advanced Technology Microwave Sounder (ATMS) and Advanced Microwave Sounding Unit (AMSU) from the NOAA18, NOAA19 and METOPA polar orbiting satellites for testing, integration and operations for the Product System Development and Implementation (PSDI) projects at NOAA's National Environmental Satellite, Data, and Information Service (NESDIS). This presentation discusses the evolution of the CIRA NPP/AMSU TC algorithms internally at CIRA and its migration and integration into the NOAA Data Exploitation (NDE) development and testing frameworks. The discussion will focus on 1) the development cycle of internal NPP/AMSU TC algorithms components by scientists and software engineers, 2) the exchange of these components into the NPP/AMSU TC software systems using the subversion version control system and other exchange methods, 3) testing, debugging and integration of the NPP/AMSU TC systems both at CIRA/NESDIS and 4) the update cycle of new releases through continuous integration. Lastly, a discussion of the methods that were effective and those that need revision will be detailed for the next iteration of the NPP/AMSU TC system.

Jitter Controller Software

NASA Technical Reports Server (NTRS)

Lansdowne, Chatwin; Schlensinger, Adam

2011-01-01

Sinusoidal jitter is produced by simply modulating a clock frequency sinusoidally with a given frequency and amplitude. But this can be expressed as phase jitter, frequency jitter, or cycle-to-cycle jitter, rms or peak, absolute units, or normalized to the base clock frequency. Jitter using other waveforms requires calculating and downloading these waveforms to an arbitrary waveform generator, and helping the user manage relationships among phase jitter crest factor, frequency jitter crest factor, and cycle-to-cycle jitter (CCJ) crest factor. Software was developed for managing these relationships, automatically configuring the generator, and saving test results documentation. Tighter management of clock jitter and jitter sensitivity is required by new codes that further extend the already high performance of space communication links, completely correcting symbol error rates higher than 10 percent, and therefore typically requiring demodulation and symbol synchronization hardware to operating at signal-to-noise ratios of less than one. To accomplish this, greater demands are also made on transmitter performance, and measurement techniques are needed to confirm performance. It was discovered early that sinusoidal jitter can be stepped on a grid such that one can connect points by constant phase jitter, constant frequency jitter, or constant cycle-cycle jitter. The tool automates adherence to a grid while also allowing adjustments off-grid. Also, the jitter can be set by the user on any dimension and the others are calculated. The calculations are all recorded, allowing the data to be rapidly plotted or re-plotted against different interpretations just by changing pointers to columns. A key advantage is taking data on a carefully controlled grid, which allowed a single data set to be post-analyzed many different ways. Another innovation was building a software tool to provide very tight coupling between the generator and the recorded data product, and the operator's worksheet. Together, these allowed the operator to sweep the jitter stimulus quickly along any of three dimensions and focus on the response of the system under test (response was jitter transfer ratio, or performance degradation to the symbol or codeword error rate). Additionally, managing multi-tone and noise waveforms automated a tedious manual process, and provided almost instantaneous decision- making control over test flow. The code was written in LabVIEW, and calls Agilent instrument drivers to write to the generator hardware.

Combined use of semantics and metadata to manage Research Data Life Cycle in Environmental Sciences

NASA Astrophysics Data System (ADS)

Aguilar Gómez, Fernando; de Lucas, Jesús Marco; Pertinez, Esther; Palacio, Aida

2017-04-01

The use of metadata to contextualize datasets is quite extended in Earth System Sciences. There are some initiatives and available tools to help data managers to choose the best metadata standard that fit their use cases, like the DCC Metadata Directory (http://www.dcc.ac.uk/resources/metadata-standards). In our use case, we have been gathering physical, chemical and biological data from a water reservoir since 2010. A well metadata definition is crucial not only to contextualize our own data but also to integrate datasets from other sources like satellites or meteorological agencies. That is why we have chosen EML (Ecological Metadata Language), which integrates many different elements to define a dataset, including the project context, instrumentation and parameters definition, and the software used to process, provide quality controls and include the publication details. Those metadata elements can contribute to help both human and machines to understand and process the dataset. However, the use of metadata is not enough to fully support the data life cycle, from the Data Management Plan definition to the Publication and Re-use. To do so, we need to define not only metadata and attributes but also the relationships between them, so semantics are needed. Ontologies, being a knowledge representation, can contribute to define the elements of a research data life cycle, including DMP, datasets, software, etc. They also can define how the different elements are related between them and how they interact. The first advantage of developing an ontology of a knowledge domain is that they provide a common vocabulary hierarchy (i.e. a conceptual schema) that can be used and standardized by all the agents interested in the domain (either humans or machines). This way of using ontologies is one of the basis of the Semantic Web, where ontologies are set to play a key role in establishing a common terminology between agents. To develop an ontology we are using a graphical tool Protégé, which is a graphical ontology-development tool that supports a rich knowledge model and it is open-source and freely available. To process and manage the ontology, we are using Semantic MediaWiki, which is able to process queries. Semantic MediaWiki is an extension of MediaWiki where we can do semantic search and export data in RDF. Our final goal is integrating our data repository portal and semantic processing engine in order to have a complete system to manage the data life cycle stages and their relationships, including machine-actionable DMP solution, datasets and software management, computing resources for processing and analysis and publication features (DOI mint). This way we will be able to reproduce the full data life cycle chain warranting the FAIR+R principles.

Develop a Model Component

NASA Technical Reports Server (NTRS)

Ensey, Tyler S.

2013-01-01

During my internship at NASA, I was a model developer for Ground Support Equipment (GSE). The purpose of a model developer is to develop and unit test model component libraries (fluid, electrical, gas, etc.). The models are designed to simulate software for GSE (Ground Special Power, Crew Access Arm, Cryo, Fire and Leak Detection System, Environmental Control System (ECS), etc. .) before they are implemented into hardware. These models support verifying local control and remote software for End-Item Software Under Test (SUT). The model simulates the physical behavior (function, state, limits and 110) of each end-item and it's dependencies as defined in the Subsystem Interface Table, Software Requirements & Design Specification (SRDS), Ground Integrated Schematic (GIS), and System Mechanical Schematic.(SMS). The software of each specific model component is simulated through MATLAB's Simulink program. The intensiv model development life cycle is a.s follows: Identify source documents; identify model scope; update schedule; preliminary design review; develop model requirements; update model.. scope; update schedule; detailed design review; create/modify library component; implement library components reference; implement subsystem components; develop a test script; run the test script; develop users guide; send model out for peer review; the model is sent out for verifictionlvalidation; if there is empirical data, a validation data package is generated; if there is not empirical data, a verification package is generated; the test results are then reviewed; and finally, the user. requests accreditation, and a statement of accreditation is prepared. Once each component model is reviewed and approved, they are intertwined together into one integrated model. This integrated model is then tested itself, through a test script and autotest, so that it can be concluded that all models work conjointly, for a single purpose. The component I was assigned, specifically, was a fluid component, a discrete pressure switch. The switch takes a fluid pressure input, and if the pressure is greater than a designated cutoff pressure, the switch would stop fluid flow.

A Structured Approach for Reviewing Architecture Documentation

DTIC Science & Technology

2009-12-01

as those found in ISO 12207 [ ISO /IEC 12207 :2008] (for software engineering), ISO 15288 [ ISO /IEC 15288:2008] (for systems engineering), the Rational...Open Distributed Processing - Reference Model: Foundations ( ISO /IEC 10746-2). 1996. [ ISO /IEC 12207 :2008] International Organization for...Standardization & International Electrotechnical Commission. Sys- tems and software engineering – Software life cycle processes ( ISO /IEC 12207 ). 2008. [ ISO

An Incremental Life-cycle Assurance Strategy for Critical System Certification

DTIC Science & Technology

2014-11-04

for Safe Aircraft Operation Embedded software systems introduce a new class of problems not addressed by traditional system modeling & analysis...Platform Runtime Architecture Application Software Embedded SW System Engineer Data Stream Characteristics Latency jitter affects control behavior...do system level failures still occur despite fault tolerance techniques being deployed in systems ? Embedded software system as major source of

Software Design Challenges in Time Series Prediction Systems Using Parallel Implementation of Artificial Neural Networks.

PubMed

Manikandan, Narayanan; Subha, Srinivasan

2016-01-01

Software development life cycle has been characterized by destructive disconnects between activities like planning, analysis, design, and programming. Particularly software developed with prediction based results is always a big challenge for designers. Time series data forecasting like currency exchange, stock prices, and weather report are some of the areas where an extensive research is going on for the last three decades. In the initial days, the problems with financial analysis and prediction were solved by statistical models and methods. For the last two decades, a large number of Artificial Neural Networks based learning models have been proposed to solve the problems of financial data and get accurate results in prediction of the future trends and prices. This paper addressed some architectural design related issues for performance improvement through vectorising the strengths of multivariate econometric time series models and Artificial Neural Networks. It provides an adaptive approach for predicting exchange rates and it can be called hybrid methodology for predicting exchange rates. This framework is tested for finding the accuracy and performance of parallel algorithms used.

Software Design Challenges in Time Series Prediction Systems Using Parallel Implementation of Artificial Neural Networks

PubMed Central

Manikandan, Narayanan; Subha, Srinivasan

2016-01-01

Software development life cycle has been characterized by destructive disconnects between activities like planning, analysis, design, and programming. Particularly software developed with prediction based results is always a big challenge for designers. Time series data forecasting like currency exchange, stock prices, and weather report are some of the areas where an extensive research is going on for the last three decades. In the initial days, the problems with financial analysis and prediction were solved by statistical models and methods. For the last two decades, a large number of Artificial Neural Networks based learning models have been proposed to solve the problems of financial data and get accurate results in prediction of the future trends and prices. This paper addressed some architectural design related issues for performance improvement through vectorising the strengths of multivariate econometric time series models and Artificial Neural Networks. It provides an adaptive approach for predicting exchange rates and it can be called hybrid methodology for predicting exchange rates. This framework is tested for finding the accuracy and performance of parallel algorithms used. PMID:26881271

Software Reliability, Measurement, and Testing. Volume 2. Guidebook for Software Reliability Measurement and Testing

DTIC Science & Technology

1992-04-01

contractor’s existing data collection, analysis and corrective action system shall be utilized, with modification only as necessary to meet the...either from test or from analysis of field data . The procedures of MIL-STD-756B assume that the reliability of a 18 DEFINE IDENTIFY SOFTWARE LIFE CYCLE...to generate sufficient data to report a statistically valid reliability figure for a class of software. Casual data gathering accumulates data more

CMMI (Trademark) for Development, Version 1.2

DTIC Science & Technology

2006-08-01

IEC TR 12207 Information Technology—Software Life Cycle Processes, 1995. http://www.jtc1-sc7.org. ISO 1998 International Organization for...We also consult other standards as needed, including the following: • ISO 9000 [ ISO 1987] • ISO /IEC 12207 [ ISO 1995] • ISO /IEC 15504 [ ISO 2006... ISO /IEC) body of standards. CMMs focus on improving processes in an organization. They contain the essential elements of effective processes for one

Discrete mathematics, formal methods, the Z schema and the software life cycle

NASA Technical Reports Server (NTRS)

Bown, Rodney L.

1991-01-01

The proper role and scope for the use of discrete mathematics and formal methods in support of engineering the security and integrity of components within deployed computer systems are discussed. It is proposed that the Z schema can be used as the specification language to capture the precise definition of system and component interfaces. This can be accomplished with an object oriented development paradigm.

Modeling and optimization of a hybrid solar combined cycle (HYCS)

NASA Astrophysics Data System (ADS)

Eter, Ahmad Adel

2011-12-01

The main objective of this thesis is to investigate the feasibility of integrating concentrated solar power (CSP) technology with the conventional combined cycle technology for electric generation in Saudi Arabia. The generated electricity can be used locally to meet the annual increasing demand. Specifically, it can be utilized to meet the demand during the hours 10 am-3 pm and prevent blackout hours, of some industrial sectors. The proposed CSP design gives flexibility in the operation system. Since, it works as a conventional combined cycle during night time and it switches to work as a hybrid solar combined cycle during day time. The first objective of the thesis is to develop a thermo-economical mathematical model that can simulate the performance of a hybrid solar-fossil fuel combined cycle. The second objective is to develop a computer simulation code that can solve the thermo-economical mathematical model using available software such as E.E.S. The developed simulation code is used to analyze the thermo-economic performance of different configurations of integrating the CSP with the conventional fossil fuel combined cycle to achieve the optimal integration configuration. This optimal integration configuration has been investigated further to achieve the optimal design of the solar field that gives the optimal solar share. Thermo-economical performance metrics which are available in the literature have been used in the present work to assess the thermo-economic performance of the investigated configurations. The economical and environmental impact of integration CSP with the conventional fossil fuel combined cycle are estimated and discussed. Finally, the optimal integration configuration is found to be solarization steam side in conventional combined cycle with solar multiple 0.38 which needs 29 hectare and LEC of HYCS is 63.17 $/MWh under Dhahran weather conditions.

Multiscale Fatigue Life Prediction for Composite Panels

NASA Technical Reports Server (NTRS)

Bednarcyk, Brett A.; Yarrington, Phillip W.; Arnold, Steven M.

2012-01-01

Fatigue life prediction capabilities have been incorporated into the HyperSizer Composite Analysis and Structural Sizing Software. The fatigue damage model is introduced at the fiber/matrix constituent scale through HyperSizer s coupling with NASA s MAC/GMC micromechanics software. This enables prediction of the micro scale damage progression throughout stiffened and sandwich panels as a function of cycles leading ultimately to simulated panel failure. The fatigue model implementation uses a cycle jumping technique such that, rather than applying a specified number of additional cycles, a specified local damage increment is specified and the number of additional cycles to reach this damage increment is calculated. In this way, the effect of stress redistribution due to damage-induced stiffness change is captured, but the fatigue simulations remain computationally efficient. The model is compared to experimental fatigue life data for two composite facesheet/foam core sandwich panels, demonstrating very good agreement.

Challenges and Demands on Automated Software Revision

NASA Technical Reports Server (NTRS)

Bonakdarpour, Borzoo; Kulkarni, Sandeep S.

2008-01-01

In the past three decades, automated program verification has undoubtedly been one of the most successful contributions of formal methods to software development. However, when verification of a program against a logical specification discovers bugs in the program, manual manipulation of the program is needed in order to repair it. Thus, in the face of existence of numerous unverified and un- certified legacy software in virtually any organization, tools that enable engineers to automatically verify and subsequently fix existing programs are highly desirable. In addition, since requirements of software systems often evolve during the software life cycle, the issue of incomplete specification has become a customary fact in many design and development teams. Thus, automated techniques that revise existing programs according to new specifications are of great assistance to designers, developers, and maintenance engineers. As a result, incorporating program synthesis techniques where an algorithm generates a program, that is correct-by-construction, seems to be a necessity. The notion of manual program repair described above turns out to be even more complex when programs are integrated with large collections of sensors and actuators in hostile physical environments in the so-called cyber-physical systems. When such systems are safety/mission- critical (e.g., in avionics systems), it is essential that the system reacts to physical events such as faults, delays, signals, attacks, etc, so that the system specification is not violated. In fact, since it is impossible to anticipate all possible such physical events at design time, it is highly desirable to have automated techniques that revise programs with respect to newly identified physical events according to the system specification.

Real-time monitoring of acoustic linear and nonlinear behavior of titanium alloys during low-cycle fatigue and high-cycle fatigue

NASA Astrophysics Data System (ADS)

Frouin, Jerome; Sathish, Shamachary; Na, Jeong K.

2000-05-01

An in-situ technique to measure sound velocity, ultrasonic attenuation and acoustic nonlinear property has been developed for characterization and early detection of fatigue damage in aerospace materials. For this purpose we have developed a computer software and measurement technique including hardware for the automation of the measurement. New transducer holder and special grips are designed. The automation has allowed us to test the long-term stability of the electronics over a period of time and so proof of the linearity of the system. Real-time monitoring of the material nonlinearity has been performed on dog-bone specimens from zero fatigue all the way to the final fracture under low-cycle fatigue test condition (LCF) and high-cycle test condition (HCF). Real-time health monitoring of the material can greatly contribute to the understanding of material behavior under cyclic loading. Interpretation of the results show that correlation exist between the slope of the curve described by the material nonlinearity and the life of the component. This new methodology was developed with an objective to predict the initiation of fatigue microcracks, and to detect, in-situ fatigue crack initiation as well as to quantify early stages of fatigue damage.

Integrated Modeling Environment

NASA Technical Reports Server (NTRS)

Mosier, Gary; Stone, Paul; Holtery, Christopher

2006-01-01

The Integrated Modeling Environment (IME) is a software system that establishes a centralized Web-based interface for integrating people (who may be geographically dispersed), processes, and data involved in a common engineering project. The IME includes software tools for life-cycle management, configuration management, visualization, and collaboration.

Next generation of decision making software for nanopatterns characterization: application to semiconductor industry

NASA Astrophysics Data System (ADS)

Dervilllé, A.; Labrosse, A.; Zimmermann, Y.; Foucher, J.; Gronheid, R.; Boeckx, C.; Singh, A.; Leray, P.; Halder, S.

2016-03-01

The dimensional scaling in IC manufacturing strongly drives the demands on CD and defect metrology techniques and their measurement uncertainties. Defect review has become as important as CD metrology and both of them create a new metrology paradigm because it creates a completely new need for flexible, robust and scalable metrology software. Current, software architectures and metrology algorithms are performant but it must be pushed to another higher level in order to follow roadmap speed and requirements. For example: manage defect and CD in one step algorithm, customize algorithms and outputs features for each R&D team environment, provide software update every day or every week for R&D teams in order to explore easily various development strategies. The final goal is to avoid spending hours and days to manually tune algorithm to analyze metrology data and to allow R&D teams to stay focus on their expertise. The benefits are drastic costs reduction, more efficient R&D team and better process quality. In this paper, we propose a new generation of software platform and development infrastructure which can integrate specific metrology business modules. For example, we will show the integration of a chemistry module dedicated to electronics materials like Direct Self Assembly features. We will show a new generation of image analysis algorithms which are able to manage at the same time defect rates, images classifications, CD and roughness measurements with high throughput performances in order to be compatible with HVM. In a second part, we will assess the reliability, the customization of algorithm and the software platform capabilities to follow new specific semiconductor metrology software requirements: flexibility, robustness, high throughput and scalability. Finally, we will demonstrate how such environment has allowed a drastic reduction of data analysis cycle time.

Models and metrics for software management and engineering

NASA Technical Reports Server (NTRS)

Basili, V. R.

1988-01-01

This paper attempts to characterize and present a state of the art view of several quantitative models and metrics of the software life cycle. These models and metrics can be used to aid in managing and engineering software projects. They deal with various aspects of the software process and product, including resources allocation and estimation, changes and errors, size, complexity and reliability. Some indication is given of the extent to which the various models have been used and the success they have achieved.

Software Assurance in Acquisition: Mitigating Risks to the Enterprise. A Reference Guide for Security-Enhanced Software Acquisition and Outsourcing

DTIC Science & Technology

2009-02-01

management, available at <http://www.iso.org/ iso /en/CatalogueDetailPage.CatalogueDetail?CSNUMBER=39612&ICS1=35&ICS2=40 &ICS3=>. ISO /IEC 27001 . Information...Management of the Systems Engineering Process. [ ISO /IEC 27001 ] ISO /IEC 27001 :2005. Information technology -- Security techniques -- Information security...software life cycles [ ISO /IEC 15026]. Software assurance is a key element of national security and homeland security. It is critical because dramatic

Software Engineering Education Directory

DTIC Science & Technology

1988-01-01

Dana Hausman and Suzanne Woolf were crucial to the successful completion of this edition of the directory. Their teamwork, energy, and dedication...for this directory began in the summer of 1986 with a questionnaire mailed to schools selected from Peterson’s Graduate Programs in Engineering and...Christoper, and Siegel, Stan Software Cost Estimation and Life-Cycle Control by Putnam, Lawrence H. Software Quality Assurance: A Practical Approach by

Advanced nickel-hydrogen spacecraft battery development

NASA Technical Reports Server (NTRS)

Coates, Dwaine K.; Fox, Chris L.; Standlee, D. J.; Grindstaff, B. K.

1994-01-01

Eagle-Picher currently has several advanced nickel-hydrogen (NiH2) cell component and battery designs under development including common pressure vessel (CPV), single pressure vessel (SPV), and dependent pressure vessel (DPV) designs. A CPV NiH2 battery, utilizing low-cost 64 mm (2.5 in.) cell diameter technology, has been designed and built for multiple smallsat programs, including the TUBSAT B spacecraft which is currently scheduled (24 Nov. 93) for launch aboard a Russian Proton rocket. An advanced 90 mm (3.5 in.) NiH2 cell design is currently being manufactured for the Space Station Freedom program. Prototype 254 mm (10 in.) diameter SPV batteries are currently under construction and initial boilerplate testing has shown excellent results. NiH2 cycle life testing is being continued at Eagle-Picher and IPV cells have currently completed more than 89,000 accelerated LEO cycles at 15% DOD, 49,000 real-time LEO cycles at 30 percent DOD, 37,800 cycles under a real-time LEO profile, 30 eclipse seasons in accelerated GEO, and 6 eclipse seasons in real-time GEO testing at 75 percent DOD maximum. Nickel-metal hydride battery development is continuing for both aerospace and electric vehicle applications. Eagle-Picher has also developed an extensive range of battery evaluation, test, and analysis (BETA) measurement and control equipment and software, based on Hewlett-Packard computerized data acquisition/control hardware.

Thermodynamic Analysis and Optimization of a High Temperature Triple Absorption Heat Transformer

PubMed Central

Khamooshi, Mehrdad; Yari, Mortaza; Egelioglu, Fuat; Salati, Hana

2014-01-01

First law of thermodynamics has been used to analyze and optimize inclusively the performance of a triple absorption heat transformer operating with LiBr/H2O as the working pair. A thermodynamic model was developed in EES (engineering equation solver) to estimate the performance of the system in terms of the most essential parameters. The assumed parameters are the temperature of the main components, weak and strong solutions, economizers' efficiencies, and bypass ratios. The whole cycle is optimized by EES software from the viewpoint of maximizing the COP via applying the direct search method. The optimization results showed that the COP of 0.2491 is reachable by the proposed cycle. PMID:25136702

Gate-to-gate Life-Cycle Inventory of Hardboard Production in North America

Treesearch

Richard Bergman

2014-01-01

Whole-building life-cycle assessments (LCAs) populated by life-cycle inventory (LCI) data are incorporated into environmental footprint software tools for establishing green building certification by building professionals and code. However, LCI data on some wood building products are still needed to help fill gaps in the data and thus provide a more complete picture...

Wake Cycle Robustness of the Mars Science Laboratory Flight Software

NASA Technical Reports Server (NTRS)

Whitehill, Robert

2011-01-01

The Mars Science Laboratory (MSL) is a spacecraft being developed by the Jet Propulsion Laboratory (JPL) for the purpose of in-situ exploration on the surface of Mars. The objective of MSL is to explore and quantitatively assess a local region on the Martian surface as a habitat for microbial life, past or present. This objective will be accomplished through the assessment of the biological potential of at least one target environment, the characterization of the geology and geochemistry of the landing region, an investigation of the planetary process relevant to past habitability, and a characterization of surface radiation. For this purpose, MSL incorporates a total of ten scientific instruments for which functions are to include, among others, atmospheric and descent imaging, chemical composition analysis, and radiation measurement. The Flight Software (FSW) system is responsible for all mission phases, including launch, cruise, entry-descent-landing, and surface operation of the rover. Because of the essential nature of flight software to project success, each of the software modules is undergoing extensive testing to identify and correct errors.

Inclusion of LCCA in Alaska flexible pavement design software manual.

DOT National Transportation Integrated Search

2012-10-01

Life cycle cost analysis is a key part for selecting materials and techniques that optimize the service life of a pavement in terms of cost and performance. While the Alaska : Flexible Pavement Design software has been in use since 2004, there is no ...

Autonomous Instrument Placement for Mars Exploration Rovers

NASA Technical Reports Server (NTRS)

Leger, P. Chris; Maimone, Mark

2009-01-01

Autonomous Instrument Placement (AutoPlace) is onboard software that enables a Mars Exploration Rover to act autonomously in using its manipulator to place scientific instruments on or near designated rock and soil targets. Prior to the development of AutoPlace, it was necessary for human operators on Earth to plan every motion of the manipulator arm in a time-consuming process that included downlinking of images from the rover, analysis of images and creation of commands, and uplinking of commands to the rover. AutoPlace incorporates image analysis and planning algorithms into the onboard rover software, eliminating the need for the downlink/uplink command cycle. Many of these algorithms are derived from the existing groundbased image analysis and planning algorithms, with modifications and augmentations for onboard use.

The Robust Software Feedback Model: An Effective Waterfall Model Tailoring for Space SW

NASA Astrophysics Data System (ADS)

Tipaldi, Massimo; Gotz, Christoph; Ferraguto, Massimo; Troiano, Luigi; Bruenjes, Bernhard

2013-08-01

The selection of the most suitable software life cycle process is of paramount importance in any space SW project. Despite being the preferred choice, the waterfall model is often exposed to some criticism. As matter of fact, its main assumption of moving to a phase only when the preceding one is completed and perfected (and under the demanding SW schedule constraints) is not easily attainable. In this paper, a tailoring of the software waterfall model (named “Robust Software Feedback Model”) is presented. The proposed methodology sorts out these issues by combining a SW waterfall model with a SW prototyping approach. The former is aligned with the SW main production line and is based on the full ECSS-E-ST-40C life-cycle reviews, whereas the latter is carried out in advance versus the main SW streamline (so as to inject its lessons learnt into the main streamline) and is based on a lightweight approach.

Global Precipitation Measurement (GPM) Safety Inhibit Timeline Tool

NASA Technical Reports Server (NTRS)

Dion, Shirley

2012-01-01

The Global Precipitation Measurement (GPM) Observatory is a joint mission under the partnership by National Aeronautics and Space Administration (NASA) and the Japan Aerospace Exploration Agency (JAXA), Japan. The NASA Goddard Space Flight Center (GSFC) has the lead management responsibility for NASA on GPM. The GPM program will measure precipitation on a global basis with sufficient quality, Earth coverage, and sampling to improve prediction of the Earth's climate, weather, and specific components of the global water cycle. As part of the development process, NASA built the spacecraft (built in-house at GSFC) and provided one instrument (GPM Microwave Imager (GMI) developed by Ball Aerospace) JAXA provided the launch vehicle (H2-A by MHI) and provided one instrument (Dual-Frequency Precipitation Radar (DPR) developed by NTSpace). Each instrument developer provided a safety assessment which was incorporated into the NASA GPM Safety Hazard Assessment. Inhibit design was reviewed for hazardous subsystems which included the High Gain Antenna System (HGAS) deployment, solar array deployment, transmitter turn on, propulsion system release, GMI deployment, and DPR radar turn on. The safety inhibits for these listed hazards are controlled by software. GPM developed a "pathfinder" approach for reviewing software that controls the electrical inhibits. This is one of the first GSFC in-house programs that extensively used software controls. The GPM safety team developed a methodology to document software safety as part of the standard hazard report. As part of this process a new tool "safety inhibit time line" was created for management of inhibits and their controls during spacecraft buildup and testing during 1& Tat GSFC and at the Range in Japan. In addition to understanding inhibits and controls during 1& T the tool allows the safety analyst to better communicate with others the changes in inhibit states with each phase of hardware and software testing. The tool was very useful for communicating compliance with safety requirements especially when working with a foreign partner.

SDDL- SOFTWARE DESIGN AND DOCUMENTATION LANGUAGE

NASA Technical Reports Server (NTRS)

Kleine, H.

1994-01-01

Effective, efficient communication is an essential element of the software development process. The Software Design and Documentation Language (SDDL) provides an effective communication medium to support the design and documentation of complex software applications. SDDL supports communication between all the members of a software design team and provides for the production of informative documentation on the design effort. Even when an entire development task is performed by a single individual, it is important to explicitly express and document communication between the various aspects of the design effort including concept development, program specification, program development, and program maintenance. SDDL ensures that accurate documentation will be available throughout the entire software life cycle. SDDL offers an extremely valuable capability for the design and documentation of complex programming efforts ranging from scientific and engineering applications to data management and business sytems. Throughout the development of a software design, the SDDL generated Software Design Document always represents the definitive word on the current status of the ongoing, dynamic design development process. The document is easily updated and readily accessible in a familiar, informative form to all members of the development team. This makes the Software Design Document an effective instrument for reconciling misunderstandings and disagreements in the development of design specifications, engineering support concepts, and the software design itself. Using the SDDL generated document to analyze the design makes it possible to eliminate many errors that might not be detected until coding and testing is attempted. As a project management aid, the Software Design Document is useful for monitoring progress and for recording task responsibilities. SDDL is a combination of language, processor, and methodology. The SDDL syntax consists of keywords to invoke design structures and a collection of directives which control processor actions. The designer has complete control over the choice of keywords, commanding the capabilities of the processor in a way which is best suited to communicating the intent of the design. The SDDL processor translates the designer's creative thinking into an effective document for communication. The processor performs as many automatic functions as possible, thereby freeing the designer's energy for the creative effort. Document formatting includes graphical highlighting of structure logic, accentuation of structure escapes and module invocations, logic error detection, and special handling of title pages and text segments. The SDDL generated document contains software design summary information including module invocation hierarchy, module cross reference, and cross reference tables of user selected words or phrases appearing in the document. The basic forms of the methodology are module and block structures and the module invocation statement. A design is stated in terms of modules that represent problem abstractions which are complete and independent enough to be treated as separate problem entities. Blocks are lower-level structures used to build the modules. Both kinds of structures may have an initiator part, a terminator part, an escape segment, or a substructure. The SDDL processor is written in PASCAL for batch execution on a DEC VAX series computer under VMS. SDDL was developed in 1981 and last updated in 1984.

Exergy analysis and simulation of a 30MW cogeneration cycle

NASA Astrophysics Data System (ADS)

Dev, Nikhil; Samsher; Kachhwaha, S. S.; Attri, Rajesh

2013-06-01

Cogeneration cycle is an efficient mean to recover the waste heat from the flue gases coming out of gas turbine. With the help of computer simulation, design parameters may be selected for the best performance of cogeneration cycle. In the present work a program is executed in software EES on the basis of mathematical modelling described in paper to study cogeneration cycle performance for different parameters. Results obtained are compared with the results available in literature and are found in good agreement with them. Real gas and water properties are inbuilt in the software. Results show that enthalpy of air entering the combustion chamber is higher than that of the flue gases at combustion chamber outlet. For different operative conditions, energy and exergy efficiencies follow similar trends; although, exergy efficiency values are always lower than the corresponding energy efficiency ones. From the results it is found that turbine outlet temperature (TIT) of 524°C is uniquely suited to efficient cogeneration cycle because it enables the transfer of heat from exhaust gas to the steam cycle to take place over a minimal temperature difference. This temperature range results in the maximum thermodynamic availability while operating with highest temperature and highest efficiency cogeneration cycle. Effect of cycle pressure ratio (CR), inlet air temperature (IAT) and water pressure at heat recovery steam generator (HRSG) inlet on the 30MW cogeneration cycle is also studied.

Vienna Fortran - A Language Specification. Version 1.1

DTIC Science & Technology

1992-03-01

other computer archi- tectures is the fact that the memory is physically distributed among the processors; the time required to access a non-local...datum may be an order of magnitude higher than the time taken to access locally stored data. This has important consequences for program efficiency. In...machine in many aspects. It is tedious, time -consuming and error prone. It has led to particularly slow software development cycles and, in consequence

USER'S GUIDE FOR THE MUNICIPAL SOLID WASTE LIFE-CYCLE DATABASE

EPA Science Inventory

The report describes how to use the municipal solid waste (MSW) life cycle database, a software application with Microsoft Access interfaces, that provides environmental data for energy production, materials production, and MSW management activities and equipment. The basic datab...

The methodology of multi-viewpoint clustering analysis

NASA Technical Reports Server (NTRS)

Mehrotra, Mala; Wild, Chris

1993-01-01

One of the greatest challenges facing the software engineering community is the ability to produce large and complex computer systems, such as ground support systems for unmanned scientific missions, that are reliable and cost effective. In order to build and maintain these systems, it is important that the knowledge in the system be suitably abstracted, structured, and otherwise clustered in a manner which facilitates its understanding, manipulation, testing, and utilization. Development of complex mission-critical systems will require the ability to abstract overall concepts in the system at various levels of detail and to consider the system from different points of view. Multi-ViewPoint - Clustering Analysis MVP-CA methodology has been developed to provide multiple views of large, complicated systems. MVP-CA provides an ability to discover significant structures by providing an automated mechanism to structure both hierarchically (from detail to abstract) and orthogonally (from different perspectives). We propose to integrate MVP/CA into an overall software engineering life cycle to support the development and evolution of complex mission critical systems.

Flight Dynamics Mission Support and Quality Assurance Process

NASA Technical Reports Server (NTRS)

Oh, InHwan

1996-01-01

This paper summarizes the method of the Computer Sciences Corporation Flight Dynamics Operation (FDO) quality assurance approach to support the National Aeronautics and Space Administration Goddard Space Flight Center Flight Dynamics Support Branch. Historically, a strong need has existed for developing systematic quality assurance using methods that account for the unique nature and environment of satellite Flight Dynamics mission support. Over the past few years FDO has developed and implemented proactive quality assurance processes applied to each of the six phases of the Flight Dynamics mission support life cycle: systems and operations concept, system requirements and specifications, software development support, operations planing and training, launch support, and on-orbit mission operations. Rather than performing quality assurance as a final step after work is completed, quality assurance has been built in as work progresses in the form of process assurance. Process assurance activities occur throughout the Flight Dynamics mission support life cycle. The FDO Product Assurance Office developed process checklists for prephase process reviews, mission team orientations, in-progress reviews, and end-of-phase audits. This paper will outline the evolving history of FDO quality assurance approaches, discuss the tailoring of Computer Science Corporations's process assurance cycle procedures, describe some of the quality assurance approaches that have been or are being developed, and present some of the successful results.

A Language Translator for a Computer Aided Rapid Prototyping System.

DTIC Science & Technology

1988-03-01

PROBLEM ................... S B. THE TRADITIONAL "WATERFALL LIFE CYCLE" .. ............... 14 C. RAPID PROTOTYPING...feature of everyday life for almost the entire industrialized world. Few governments or businesses function without the aid of computer systems. Com...engineering. B. TIE TRADITIONAL "WATERFALL LIFE CYCLE" I. Characteristics The traditional method of software engineering is the "waterfall life cycle

A numerical study of latent thermal energy storage in a phase change material/carbon panel

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mekaddem, Najoua, E-mail: mekaddem.najoua@gmail.com; Ali, Samia Ben, E-mail: samia.benali@enig.rnu.tn; Hannachi, Ahmed, E-mail: ahmed.hannachi@enig.rnu.tn

2016-07-25

To reduce the energetic dependence of building, it has become necessary to explore and develop new materials promoting energy conservation. Because of their high storage capacity, phase change materials (PCMs) are efficient to store thermal energy. In this paper, a 3D model was studied for simulation of energy storing cycles to predict the performances of PCM loaded panels. Carbon was used as supporting material for the PCM. The simulation was based on the enthalpy method using Ansys Fluent software. The panel was exposed to a daily heat flow including the effects of convection and radiation. The results show that themore » temperature decreased of approximately 2.5°C with a time shift about 2 hours. The steady state was reached after four cycles. Thus, after four cycles the PCM showed its effects on the temperature conditioning.« less

SU-E-J-211: Design and Study of In-House Software Based Respiratory Motion Monitoring, Controlling and Breath-Hold Device for Gated Radiotherapy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shanmugam, Senthilkumar

Purpose: The purpose of this present work was to fabricate an in-house software based respiratory monitoring, controlling and breath-hold device using computer software programme which guides the patient to have uniform breath hold in response to request during the gated radiotherapy. Methods: The respiratory controlling device consists of a computer, inhouse software, video goggles, a highly sensitive sensor for measurement of distance, mounting systems, a camera, a respiratory signal device, a speaker and a visual indicator. The computer is used to display the respiratory movements of the patient with digital as well as analogue respiration indicators during the respiration cycle,more » to control, breath-hold and analyze the respiratory movement using indigenously developed software. Results: Studies were conducted with anthropomophic phantoms by simulating the respiratory motion on phantoms and recording the respective movements using the respiratory monitoring device. The results show good agreement between the simulated and measured movements. Further studies were conducted for 60 cancer patients with several types of cancers in the thoracic region. The respiratory movement cycles for each fraction of radiotherapy treatment were recorded and compared. Alarm indications are provided in the system to indicate when the patient breathing movement exceeds the threshold level. This will help the patient to maintain uniform breath hold during the radiotherapy treatment. Our preliminary clinical test results indicate that our device is highly reliable and able to maintain the uniform respiratory motion and breathe hold during the entire course of gated radiotherapy treatment. Conclusion: An indigenous respiratory monitoring device to guide the patient to have uniform breath hold device was fabricated. The alarm feature and the visual waveform indicator in the system guide the patient to have normal respiration. The signal from the device can be connected to the radiation unit in near future to carry out the gated radiotherapy treatment.« less

Design and development of a community carbon cycle benchmarking system for CMIP5 models

NASA Astrophysics Data System (ADS)

Mu, M.; Hoffman, F. M.; Lawrence, D. M.; Riley, W. J.; Keppel-Aleks, G.; Randerson, J. T.

2013-12-01

Benchmarking has been widely used to assess the ability of atmosphere, ocean, sea ice, and land surface models to capture the spatial and temporal variability of observations during the historical period. For the carbon cycle and terrestrial ecosystems, the design and development of an open-source community platform has been an important goal as part of the International Land Model Benchmarking (ILAMB) project. Here we designed and developed a software system that enables the user to specify the models, benchmarks, and scoring systems so that results can be tailored to specific model intercomparison projects. We used this system to evaluate the performance of CMIP5 Earth system models (ESMs). Our scoring system used information from four different aspects of climate, including the climatological mean spatial pattern of gridded surface variables, seasonal cycle dynamics, the amplitude of interannual variability, and long-term decadal trends. We used this system to evaluate burned area, global biomass stocks, net ecosystem exchange, gross primary production, and ecosystem respiration from CMIP5 historical simulations. Initial results indicated that the multi-model mean often performed better than many of the individual models for most of the observational constraints.

VERSE - Virtual Equivalent Real-time Simulation

NASA Technical Reports Server (NTRS)

Zheng, Yang; Martin, Bryan J.; Villaume, Nathaniel

2005-01-01

Distributed real-time simulations provide important timing validation and hardware in the- loop results for the spacecraft flight software development cycle. Occasionally, the need for higher fidelity modeling and more comprehensive debugging capabilities - combined with a limited amount of computational resources - calls for a non real-time simulation environment that mimics the real-time environment. By creating a non real-time environment that accommodates simulations and flight software designed for a multi-CPU real-time system, we can save development time, cut mission costs, and reduce the likelihood of errors. This paper presents such a solution: Virtual Equivalent Real-time Simulation Environment (VERSE). VERSE turns the real-time operating system RTAI (Real-time Application Interface) into an event driven simulator that runs in virtual real time. Designed to keep the original RTAI architecture as intact as possible, and therefore inheriting RTAI's many capabilities, VERSE was implemented with remarkably little change to the RTAI source code. This small footprint together with use of the same API allows users to easily run the same application in both real-time and virtual time environments. VERSE has been used to build a workstation testbed for NASA's Space Interferometry Mission (SIM PlanetQuest) instrument flight software. With its flexible simulation controls and inexpensive setup and replication costs, VERSE will become an invaluable tool in future mission development.

Web usability evaluation on BloobIS website by using hallway usability testing method and ISO 9241:11

NASA Astrophysics Data System (ADS)

Dwi Susanto, Tony; Ingesti Prasetyo, Anisa; Astuti, Hanim Maria

2018-03-01

At this moment, the need for web as an information media is highly important. Not only confined in the infotainment area, government, and education, but health as well uses the web media as a medium for providing information effectively. BloobIS is a web based application which integrates blood supply and distribution information at the Blood Transfusion Unit. Knowing how easy information is on BloobIS is marked by how convenient the website is used. Up until now, the BloobIS website is nearing completion but testing has not yet been performed to users and is on the testing and development phase in the Development Life Cycle software. Thus, an evaluation namely the quality control software which focuses on the perspective of BloobIs web usability is required. Hallway Usability Testing and ISO 9241:11 are the methods chosen to measure the BloobIS application usability. The expected outputs of the quality control software focusing on the usability evaluation are being able to rectify the usability deficiencies on the BloobIs web and provide recommendations to develop the web as a basic BloobIS web quality upgraed which sets a goal to amplify the satisfaction of web users based on usability factors in ISO 9241:11.

Rehabilitation R@D Progress Reports, 1992-1993. Volume 30-31

DTIC Science & Technology

1993-01-01

Transcripts of the videotape are being ana- lyzed on a hypertext database and also by qualitative data analysis software ( NUDIST ) to determine elements...number of videotapes have been transcribed and are being analyzed by the hypertext and NUDIST software. The first cycle is in progress, reflecting

A STUDY OF SOME SOFTWARE PARAMETERS IN TIME-SHARING SYSTEMS.

DTIC Science & Technology

A review is made of some existing time-sharing computer systems and an exploration of various software characteristics is conducted. This...of the various parameters upon the average response cycle time, the average number in the queue awaiting service , the average length of time a user is

Construction of a century solar chromosphere data set for solar activity related research

NASA Astrophysics Data System (ADS)

Lin, Ganghua; Wang, Xiao Fan; Yang, Xiao; Liu, Suo; Zhang, Mei; Wang, Haimin; Liu, Chang; Xu, Yan; Tlatov, Andrey; Demidov, Mihail; Borovik, Aleksandr; Golovko, Aleksey

2017-06-01

This article introduces our ongoing project "Construction of a Century Solar Chromosphere Data Set for Solar Activity Related Research". Solar activities are the major sources of space weather that affects human lives. Some of the serious space weather consequences, for instance, include interruption of space communication and navigation, compromising the safety of astronauts and satellites, and damaging power grids. Therefore, the solar activity research has both scientific and social impacts. The major database is built up from digitized and standardized film data obtained by several observatories around the world and covers a time span of more than 100 years. After careful calibration, we will develop feature extraction and data mining tools and provide them together with the comprehensive database for the astronomical community. Our final goal is to address several physical issues: filament behavior in solar cycles, abnormal behavior of solar cycle 24, large-scale solar eruptions, and sympathetic remote brightenings. Significant signs of progress are expected in data mining algorithms and software development, which will benefit the scientific analysis and eventually advance our understanding of solar cycles.

Control and Information Systems for the National Ignition Facility

DOE PAGES

Brunton, Gordon; Casey, Allan; Christensen, Marvin; ...

2017-03-23

Orchestration of every National Ignition Facility (NIF) shot cycle is managed by the Integrated Computer Control System (ICCS), which uses a scalable software architecture running code on more than 1950 front-end processors, embedded controllers, and supervisory servers. The ICCS operates laser and industrial control hardware containing 66 000 control and monitor points to ensure that all of NIF’s laser beams arrive at the target within 30 ps of each other and are aligned to a pointing accuracy of less than 50 μm root-mean-square, while ensuring that a host of diagnostic instruments record data in a few billionths of a second.more » NIF’s automated control subsystems are built from a common object-oriented software framework that distributes the software across the computer network and achieves interoperation between different software languages and target architectures. A large suite of business and scientific software tools supports experimental planning, experimental setup, facility configuration, and post-shot analysis. Standard business services using open-source software, commercial workflow tools, and database and messaging technologies have been developed. An information technology infrastructure consisting of servers, network devices, and storage provides the foundation for these systems. Thus, this work is an overview of the control and information systems used to support a wide variety of experiments during the National Ignition Campaign.« less

Control and Information Systems for the National Ignition Facility

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brunton, Gordon; Casey, Allan; Christensen, Marvin

Orchestration of every National Ignition Facility (NIF) shot cycle is managed by the Integrated Computer Control System (ICCS), which uses a scalable software architecture running code on more than 1950 front-end processors, embedded controllers, and supervisory servers. The ICCS operates laser and industrial control hardware containing 66 000 control and monitor points to ensure that all of NIF’s laser beams arrive at the target within 30 ps of each other and are aligned to a pointing accuracy of less than 50 μm root-mean-square, while ensuring that a host of diagnostic instruments record data in a few billionths of a second.more » NIF’s automated control subsystems are built from a common object-oriented software framework that distributes the software across the computer network and achieves interoperation between different software languages and target architectures. A large suite of business and scientific software tools supports experimental planning, experimental setup, facility configuration, and post-shot analysis. Standard business services using open-source software, commercial workflow tools, and database and messaging technologies have been developed. An information technology infrastructure consisting of servers, network devices, and storage provides the foundation for these systems. Thus, this work is an overview of the control and information systems used to support a wide variety of experiments during the National Ignition Campaign.« less

Making the Business Case for Software Assurance

DTIC Science & Technology

2009-04-01

and Capability dEtermination-SPICE, ISO /IEC 15504, 1998. [ ISO 2007] International Organization for Standardization. " ISO /IEC 27001 & 27002 ...Implementing the Process Areas 6.2.7 Differences Between the CMMI and Software CMM Process Areas 6.3 The CMMI Appraisal Process 6.4 Adapting ISO 15504 to...Secure Software Assurance 6.4.1 Assessment and the Secure Life Cycle 6.4.2 ISO 15504 Capability Levels 6.5 Adapting the ISOIIEC 21287 Standard Approach to

Database & information tools for transportation research management : Connecticut transportation research peer exchange report of a thematic peer exchange.

DOT National Transportation Integrated Search

2006-05-01

Specific objectives of the Peer Exchange were: : Discuss and exchange information about databases and other software : used to support the program-cycles managed by state transportation : research offices. Elements of the program cycle include: :...

Modular, Autonomous Command and Data Handling Software with Built-In Simulation and Test

NASA Technical Reports Server (NTRS)

Cuseo, John

2012-01-01

The spacecraft system that plays the greatest role throughout the program lifecycle is the Command and Data Handling System (C&DH), along with the associated algorithms and software. The C&DH takes on this role as cost driver because it is the brains of the spacecraft and is the element of the system that is primarily responsible for the integration and interoperability of all spacecraft subsystems. During design and development, many activities associated with mission design, system engineering, and subsystem development result in products that are directly supported by the C&DH, such as interfaces, algorithms, flight software (FSW), and parameter sets. A modular system architecture has been developed that provides a means for rapid spacecraft assembly, test, and integration. This modular C&DH software architecture, which can be targeted and adapted to a wide variety of spacecraft architectures, payloads, and mission requirements, eliminates the current practice of rewriting the spacecraft software and test environment for every mission. This software allows missionspecific software and algorithms to be rapidly integrated and tested, significantly decreasing time involved in the software development cycle. Additionally, the FSW includes an Onboard Dynamic Simulation System (ODySSy) that allows the C&DH software to support rapid integration and test. With this solution, the C&DH software capabilities will encompass all phases of the spacecraft lifecycle. ODySSy is an on-board simulation capability built directly into the FSW that provides dynamic built-in test capabilities as soon as the FSW image is loaded onto the processor. It includes a six-degrees- of-freedom, high-fidelity simulation that allows complete closed-loop and hardware-in-the-loop testing of a spacecraft in a ground processing environment without any additional external stimuli. ODySSy can intercept and modify sensor inputs using mathematical sensor models, and can intercept and respond to actuator commands. ODySSy integration is unique in that it allows testing of actual mission sequences on the flight vehicle while the spacecraft is in various stages of assembly, test, and launch operations all without any external support equipment or simulators. The ODySSy component of the FSW significantly decreases the time required for integration and test by providing an automated, standardized, and modular approach to integrated avionics and component interface and functional verification. ODySSy further provides the capability for on-orbit support in the form of autonomous mission planning and fault protection.

Recent Advances in Resonance Region Nuclear Data Measurements and Analyses for Supporting Nuclear Energy Applications

NASA Astrophysics Data System (ADS)

Dunn, Michael

2008-10-01

For over 30 years, the Oak Ridge National Laboratory (ORNL) has performed research and development to provide more accurate nuclear cross-section data in the resonance region. The ORNL Nuclear Data (ND) Program consists of four complementary areas of research: (1) cross-section measurements at the Oak Ridge Electron Linear Accelerator; (2) resonance analysis methods development with the SAMMY R-matrix analysis software; (3) cross-section evaluation development; and (4) cross-section processing methods development with the AMPX software system. The ND Program is tightly coupled with nuclear fuel cycle analyses and radiation transport methods development efforts at ORNL. Thus, nuclear data work is performed in concert with nuclear science and technology needs and requirements. Recent advances in each component of the ORNL ND Program have led to improvements in resonance region measurements, R-matrix analyses, cross-section evaluations, and processing capabilities that directly support radiation transport research and development. Of particular importance are the improvements in cross-section covariance data evaluation and processing capabilities. The benefit of these advances to nuclear science and technology research and development will be discussed during the symposium on Nuclear Physics Research Connections to Nuclear Energy.

Integrated Component-based Data Acquisition Systems for Aerospace Test Facilities

NASA Technical Reports Server (NTRS)

Ross, Richard W.

2001-01-01

The Multi-Instrument Integrated Data Acquisition System (MIIDAS), developed by the NASA Langley Research Center, uses commercial off the shelf (COTS) products, integrated with custom software, to provide a broad range of capabilities at a low cost throughout the system s entire life cycle. MIIDAS combines data acquisition capabilities with online and post-test data reduction computations. COTS products lower purchase and maintenance costs by reducing the level of effort required to meet system requirements. Object-oriented methods are used to enhance modularity, encourage reusability, and to promote adaptability, reducing software development costs. Using only COTS products and custom software supported on multiple platforms reduces the cost of porting the system to other platforms. The post-test data reduction capabilities of MIIDAS have been installed at four aerospace testing facilities at NASA Langley Research Center. The systems installed at these facilities provide a common user interface, reducing the training time required for personnel that work across multiple facilities. The techniques employed by MIIDAS enable NASA to build a system with a lower initial purchase price and reduced sustaining maintenance costs. With MIIDAS, NASA has built a highly flexible next generation data acquisition and reduction system for aerospace test facilities that meets customer expectations.

Development of a Benchmark Example for Delamination Fatigue Growth Prediction

NASA Technical Reports Server (NTRS)

Krueger, Ronald

2010-01-01

The development of a benchmark example for cyclic delamination growth prediction is presented and demonstrated for a commercial code. The example is based on a finite element model of a Double Cantilever Beam (DCB) specimen, which is independent of the analysis software used and allows the assessment of the delamination growth prediction capabilities in commercial finite element codes. First, the benchmark result was created for the specimen. Second, starting from an initially straight front, the delamination was allowed to grow under cyclic loading in a finite element model of a commercial code. The number of cycles to delamination onset and the number of cycles during stable delamination growth for each growth increment were obtained from the analysis. In general, good agreement between the results obtained from the growth analysis and the benchmark results could be achieved by selecting the appropriate input parameters. Overall, the results are encouraging but further assessment for mixed-mode delamination is required

WEBTAS Software Life Cycle Development

DTIC Science & Technology

2006-09-01

may be published in both html and pdf formats via menu selection. Adobe® FrameMaker ® 7.1 and Quadralay Corporation WebWorks® Professional 2003...X X WebTAS 2.5.3 ISAM X X WebTAS 2.5.3 Domain Editor Guide X X 13 The backbone of the ISS publishing environment consists of Adobe® FrameMaker ...and WebWorks® Publisher Professional 2003. FrameMaker ® provides an enterprise-class authoring and publishing solution that combines the

New hardware and software platform for experiments on a HUBER-5042 X-ray diffractometer with a DISPLEX DE-202 helium cryostat in the temperature range of 20-300 K

NASA Astrophysics Data System (ADS)

Dudka, A. P.; Antipin, A. M.; Verin, I. A.

2017-09-01

Huber-5042 diffractometer with a closed-cycle Displex DE-202 helium cryostat is a unique scientific instrument for carrying out X-ray diffraction experiments when studying the single crystal structure in the temperature range of 20-300 K. To make the service life longer and develop new experimental techniques, the diffractometer control is transferred to a new hardware and software platform. To this end, a modern computer; a new detector reader unit; and new control interfaces for stepper motors, temperature controller, and cryostat vacuum pumping system are used. The system for cooling the X-ray tube, the high-voltage generator, and the helium compressor and pump for maintaining the desired vacuum in the cryostat are replaced. The system for controlling the primary beam shutter is upgraded. A biological shielding is installed. The new program tools, which use the Linux Ubuntu operating system and SPEC constructor, include a set of drivers for control units through the aforementioned interfaces. A program for searching reflections from a sample using fast continuous scanning and a priori information about crystal is written. Thus, the software package for carrying out the complete cycle of precise diffraction experiment (from determining the crystal unit cell to calculating the integral reflection intensities) is upgraded. High quality of the experimental data obtained on this equipment is confirmed in a number of studies in the temperature range from 20 to 300 K.

SOFTCOST - DEEP SPACE NETWORK SOFTWARE COST MODEL

NASA Technical Reports Server (NTRS)

Tausworthe, R. C.

1994-01-01

The early-on estimation of required resources and a schedule for the development and maintenance of software is usually the least precise aspect of the software life cycle. However, it is desirable to make some sort of an orderly and rational attempt at estimation in order to plan and organize an implementation effort. The Software Cost Estimation Model program, SOFTCOST, was developed to provide a consistent automated resource and schedule model which is more formalized than the often used guesswork model based on experience, intuition, and luck. SOFTCOST was developed after the evaluation of a number of existing cost estimation programs indicated that there was a need for a cost estimation program with a wide range of application and adaptability to diverse kinds of software. SOFTCOST combines several software cost models found in the open literature into one comprehensive set of algorithms that compensate for nearly fifty implementation factors relative to size of the task, inherited baseline, organizational and system environment, and difficulty of the task. SOFTCOST produces mean and variance estimates of software size, implementation productivity, recommended staff level, probable duration, amount of computer resources required, and amount and cost of software documentation. Since the confidence level for a project using mean estimates is small, the user is given the opportunity to enter risk-biased values for effort, duration, and staffing, to achieve higher confidence levels. SOFTCOST then produces a PERT/CPM file with subtask efforts, durations, and precedences defined so as to produce the Work Breakdown Structure (WBS) and schedule having the asked-for overall effort and duration. The SOFTCOST program operates in an interactive environment prompting the user for all of the required input. The program builds the supporting PERT data base in a file for later report generation or revision. The PERT schedule and the WBS schedule may be printed and stored in a file for later use. The SOFTCOST program is written in Microsoft BASIC for interactive execution and has been implemented on an IBM PC-XT/AT operating MS-DOS 2.1 or higher with 256K bytes of memory. SOFTCOST was originally developed for the Zylog Z80 system running under CP/M in 1981. It was converted to run on the IBM PC XT/AT in 1986. SOFTCOST is a copyrighted work with all copyright vested in NASA.

An NAFP Project: Use of Object Oriented Methodologies and Design Patterns to Refactor Software Design

NASA Technical Reports Server (NTRS)

Shaykhian, Gholam Ali; Baggs, Rhoda

2007-01-01

In the early problem-solution era of software programming, functional decompositions were mainly used to design and implement software solutions. In functional decompositions, functions and data are introduced as two separate entities during the design phase, and are followed as such in the implementation phase. Functional decompositions make use of refactoring through optimizing the algorithms, grouping similar functionalities into common reusable functions, and using abstract representations of data where possible; all these are done during the implementation phase. This paper advocates the usage of object-oriented methodologies and design patterns as the centerpieces of refactoring software solutions. Refactoring software is a method of changing software design while explicitly preserving its external functionalities. The combined usage of object-oriented methodologies and design patterns to refactor should also benefit the overall software life cycle cost with improved software.

Method of experimental and calculation determination of dissipative properties of carbon

NASA Astrophysics Data System (ADS)

Kazakova, Olga I.; Smolin, Igor Yu.; Bezmozgiy, Iosif M.

2017-12-01

This paper describes the process of definition of relations between the damping ratio and strain/state levels in a material. For these purposes, the experimental-calculation approach was applied. The experimental research was performed on plane composite specimens. The tests were accompanied by finite element modeling using the ANSYS software. Optimization was used as a tool for FEM property setting and for finding the above-mentioned relations. A difference between the calculation and experimental results was accepted as objective functions of this optimization. The optimization cycle was implemented using the pSeven DATADVANCE software platform. The developed approach makes it possible to determine the relations between the damping ratio and strain/state levels in the material, which can be used for computer modeling of the structure response under dynamic loading.

Towards a general object-oriented software development methodology

NASA Technical Reports Server (NTRS)

Seidewitz, ED; Stark, Mike

1986-01-01

Object diagrams were used to design a 5000 statement team training exercise and to design the entire dynamics simulator. The object diagrams are also being used to design another 50,000 statement Ada system and a personal computer based system that will be written in Modula II. The design methodology evolves out of these experiences as well as the limitations of other methods that were studied. Object diagrams, abstraction analysis, and associated principles provide a unified framework which encompasses concepts from Yourdin, Booch, and Cherry. This general object-oriented approach handles high level system design, possibly with concurrency, through object-oriented decomposition down to a completely functional level. How object-oriented concepts can be used in other phases of the software life-cycle, such as specification and testing is being studied concurrently.

AI tools in computer based problem solving

NASA Technical Reports Server (NTRS)

Beane, Arthur J.

1988-01-01

The use of computers to solve value oriented, deterministic, algorithmic problems, has evolved a structured life cycle model of the software process. The symbolic processing techniques used, primarily in research, for solving nondeterministic problems, and those for which an algorithmic solution is unknown, have evolved a different model, much less structured. Traditionally, the two approaches have been used completely independently. With the advent of low cost, high performance 32 bit workstations executing identical software with large minicomputers and mainframes, it became possible to begin to merge both models into a single extended model of computer problem solving. The implementation of such an extended model on a VAX family of micro/mini/mainframe systems is described. Examples in both development and deployment of applications involving a blending of AI and traditional techniques are given.

Object technology: A white paper

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jordan, S.R.; Arrowood, L.F.; Cain, W.D.

1992-05-11

Object-Oriented Technology (OOT), although not a new paradigm, has recently been prominently featured in the trade press and even general business publications. Indeed, the promises of object technology are alluring: the ability to handle complex design and engineering information through the full manufacturing production life cycle or to manipulate multimedia information, and the ability to improve programmer productivity in creating and maintaining high quality software. Groups at a number of the DOE facilities have been exploring the use of object technology for engineering, business, and other applications. In this white paper, the technology is explored thoroughly and compared with previousmore » means of developing software and storing databases of information. Several specific projects within the DOE Complex are described, and the state of the commercial marketplace is indicated.« less

The spectra program library: A PC based system for gamma-ray spectra analysis and INAA data reduction

USGS Publications Warehouse

Baedecker, P.A.; Grossman, J.N.

1995-01-01

A PC based system has been developed for the analysis of gamma-ray spectra and for the complete reduction of data from INAA experiments, including software to average the results from mulitple lines and multiple countings and to produce a final report of analysis. Graphics algorithms may be called for the analysis of complex spectral features, to compare the data from alternate photopeaks and to evaluate detector performance during a given counting cycle. A database of results for control samples can be used to prepare quality control charts to evaluate long term precision and to search for systemic variations in data on reference samples as a function of time. The entire software library can be accessed through a user-friendly menu interface with internal help.

Making Use of a Decade of Widely Varying Historical Data: SARP Project - "Full Life-Cycle Defect Management"

NASA Technical Reports Server (NTRS)

Shull, Forrest; Godfrey, Sally; Bechtel, Andre; Feldmann, Raimund L.; Regardie, Myrna; Seaman, Carolyn

2008-01-01

A viewgraph presentation describing the NASA Software Assurance Research Program (SARP) project, with a focus on full life-cycle defect management, is provided. The topics include: defect classification, data set and algorithm mapping, inspection guidelines, and tool support.

Biomes and Natural Cycles. [CD-ROM].

ERIC Educational Resources Information Center

1996

This interactive multimedia software illustrates and explains life on planet Earth through colorful and dynamic representations. Clear explanations and animation elucidate a variety of subjects such as the organization of the ecosphere, the flux of energy, water cycles, climates, and characteristics of regions across the globe. Five animated films…

The Influence of Different Recycling Scenarios on the Mechanical Design of an LED Weatherproof Light Fitting

PubMed Central

Camañes, Víctor; Elduque, Daniel; Javierre, Carlos; Fernández, Ángel

2014-01-01

This paper analyzes the high relevance of material selection for the sustainable development of an LED weatherproof light fitting. The research reveals how this choice modifies current and future end of life scenarios and can reduce the overall environmental impact. This life cycle assessment has been carried out with Ecotool, a software program especially developed for designers to assess the environmental performance of their designs at the same time that they are working on them. Results show that special attention can be put on the recycling and reusing of the product from the initial stages of development. PMID:28788160

The Influence of Different Recycling Scenarios on the Mechanical Design of an LED Weatherproof Light Fitting.

PubMed

Camañes, Víctor; Elduque, Daniel; Javierre, Carlos; Fernández, Ángel

2014-08-11

This paper analyzes the high relevance of material selection for the sustainable development of an LED weatherproof light fitting. The research reveals how this choice modifies current and future end of life scenarios and can reduce the overall environmental impact. This life cycle assessment has been carried out with Ecotool, a software program especially developed for designers to assess the environmental performance of their designs at the same time that they are working on them. Results show that special attention can be put on the recycling and reusing of the product from the initial stages of development.

Development of the CCP-200 mathematical model for Syzran CHPP using the Thermolib software package

NASA Astrophysics Data System (ADS)

Usov, S. V.; Kudinov, A. A.

2016-04-01

Simplified cycle diagram of the CCP-200 power generating unit of Syzran CHPP containing two gas turbines PG6111FA with generators, two steam recovery boilers KUP-110/15-8.0/0.7-540/200, and one steam turbine Siemens SST-600 (one-cylinder with two variable heat extraction units of 60/75 MW in heatextraction and condensing modes, accordingly) with S-GEN5-100 generators was presented. Results of experimental guarantee tests of the CCP-200 steam-gas unit are given. Brief description of the Thermolib application for the MatLab Simulink software package is given. Basic equations used in Thermolib for modeling thermo-technical processes are given. Mathematical models of gas-turbine plant, heat-recovery steam generator, steam turbine and integrated plant for power generating unit CCP-200 of Syzran CHPP were developed with the help of MatLab Simulink and Thermolib. The simulation technique at different ambient temperature values was used in order to get characteristics of the developed mathematical model. Graphic comparison of some characteristics of the CCP-200 simulation model (gas temperature behind gas turbine, gas turbine and combined cycle plant capacity, high and low pressure steam consumption and feed water consumption for high and low pressure economizers) with actual characteristics of the steam-gas unit received at experimental (field) guarantee tests at different ambient temperature are shown. It is shown that the chosen degrees of complexity, characteristics of the CCP-200 simulation model, developed by Thermolib, adequately correspond to the actual characteristics of the steam-gas unit received at experimental (field) guarantee tests; this allows considering the developed mathematical model as adequate and acceptable it for further work.

Moving Up the CMMI Capability and Maturity Levels Using Simulation

DTIC Science & Technology

2008-01-01

Alternative Process Tools, Including NPV and ROI 6 Figure 3: Top-Level View of the Full Life-Cycle Version of the IEEE 12207 PSIM, Including IV&V Layer 19...Figure 4: Screenshot of the Incremental Version Model 19 Figure 5: IEEE 12207 PSIM Showing the Top-Level Life-Cycle Phases 22 Figure 6: IEEE 12207 ...Software Detailed Design for the IEEE 12207 Life- Cycle Process 24 Figure 8: Incremental Life Cycle PSIM Configured for a Specific Project Using SEPG

A report on NASA software engineering and Ada training requirements

NASA Technical Reports Server (NTRS)

Legrand, Sue; Freedman, Glenn B.; Svabek, L.

1987-01-01

NASA's software engineering and Ada skill base are assessed and information that may result in new models for software engineering, Ada training plans, and curricula are provided. A quantitative assessment which reflects the requirements for software engineering and Ada training across NASA is provided. A recommended implementation plan including a suggested curriculum with associated duration per course and suggested means of delivery is also provided. The distinction between education and training is made. Although it was directed to focus on NASA's need for the latter, the key relationships to software engineering education are also identified. A rationale and strategy for implementing a life cycle education and training program are detailed in support of improved software engineering practices and the transition to Ada.

Flight design system-1 system design. Volume 5: Data management and data base documentation support system. [for shuttle flight planning

NASA Technical Reports Server (NTRS)

1979-01-01

Application software intended to reduce the man-hours required per flight design cycle by producing major flight design documents with little or no manual typing is described. The documentation support software is divided into two separately executable processors. However, since both processors support the same overall functions, and most of the software contained in one is also contained in the other, both are collectively presented.

Coleman performs VO2 Max PFS Software Calibrations and Instrument Check

NASA Image and Video Library

2011-02-24

ISS026-E-029180 (24 Feb. 2011) --- NASA astronaut Catherine (Cady) Coleman, Expedition 26 flight engineer, performs VO2max portable Pulmonary Function System (PFS) software calibrations and instrument check while using the Cycle Ergometer with Vibration Isolation System (CEVIS) in the Destiny laboratory of the International Space Station.

An Analysis of Related Software Cycles Among Organizations, People and the Software Industry

DTIC Science & Technology

2008-06-01

confirmatory, theory testing type of research. Miles and Huberman (1994) claim: Much qualitative research lies between these two extremes. Something is...either graphically or in narrative form, the main things to be studied” ( Miles and Huberman 1994). The “main things” mentioned here refer to the key

After the Fall: The RHESSI Legacy Archive

NASA Astrophysics Data System (ADS)

Schwartz, Richard A.; Zarro, Dominic M.; Tolbert, Anne K.

2017-08-01

Launched in 2002 the Ramaty High Energy Solar Spectroscopic Imager (RHESSI) continues to observe the Sun with a nearly 50% duty cycle. During that time the instrument has recorded ~100,000 solar flares in energies from 4 keV to over 10 MeV.with durations of 10s to 1000s of seconds. However, for the reasons of the decline of the solar cycle, possible failure of the instrument, or the absence of funding, our operational phase will end someday. We describe here our plans to continue to serve this dataset in raw, processed, and analyzed forms to the worldwide solar community to continue our legacy of a stream of rich scientific results.We have and are providing a stream of quicklook lightcurves, spectra, and images that we mainly serve through a web interface as well as the data in raw form to be fully analyzed within our own branch of Solar Software written in IDL. We are in the process of creating higher quality images for flares in multiple energy bands on relevant timescales for those whose needs can be met without further processing. For users with IDL licenses we expect this software to be available far into the unknowable future. Together with a database of AIA cutouts during all SDO-era flares, along with software to recover saturated images by using the AIA diffraction fringes, these will be a highly used resource.We also are developing additional tools and databases that will increase the utility of RHESSI data to members of the community with and without either IDL licenses or full access to the RHESSI database. We will provide a database of RHESSI x-ray visibilities obtained during flares at a >4 second cadence over a broad range of detectable energies. With our IDL software those can be rendered as images for times and energies of nearly the analysts's choosing. And going beyond that we are converting our imaging procedures to the Python language to eliminate the need for an IDL license. We are also developing methods to allow the customization of these visibilities in time and energy by access from a non-local server which has full access to all of the IDL software and database files.

Facial protection conferred by cycle safety helmets: use of digitized image processing to develop a new nondestructive test.

PubMed

Harrison, M; Shepherd, J P

1997-07-01

Cycle safety helmets are designed to prevent head injury. Although most commercially available helmets conform to one of several national and international standards, individual designs differ widely, particularly in relation to face coverage. A method was developed to assess the potential for the differing designs to protect the face from injury. A nonimpact test was assessed, using digitized image-processing software (Digithurst Ltd.) to measure the shadow cast by a helmet rim under a collimated plane light source onto the face of a mannequin headform. Twelve helmet designs available internationally were tested and ranked with respect to the direct protection conferred (area of the face directly covered by the helmet) and indirect protection (area of the face shaded). The three highest-ranking helmets for direct protection (Rosebank Stackhat, Asphalt Warrior, and Lazer Voyager) also ranked the highest for indirect protection. These helmets were more inferiorly extended and were of a more bulky construction. It was concluded that the dimensions of cycle helmets in relation to face coverage are crucial in influencing the extent to which facial protection is conferred. International test standards need urgent revision to ensure that face coverage is optimized. Lower-face protection could be achieved through incorporation of a lower-face bar to cycle helmets.

A "Do-It-Yourself" phenotyping system: measuring growth and morphology throughout the diel cycle in rosette shaped plants.

PubMed

Dobrescu, Andrei; Scorza, Livia C T; Tsaftaris, Sotirios A; McCormick, Alistair J

2017-01-01

Improvements in high-throughput phenotyping technologies are rapidly expanding the scope and capacity of plant biology studies to measure growth traits. Nevertheless, the costs of commercial phenotyping equipment and infrastructure remain prohibitively expensive for wide-scale uptake, while academic solutions can require significant local expertise. Here we present a low-cost methodology for plant biologists to build their own phenotyping system for quantifying growth rates and phenotypic characteristics of Arabidopsis thaliana rosettes throughout the diel cycle. We constructed an image capture system consisting of a near infra-red (NIR, 940 nm) LED panel with a mounted Raspberry Pi NoIR camera and developed a MatLab-based software module (iDIEL Plant) to characterise rosette expansion. Our software was able to accurately segment and characterise multiple rosettes within an image, regardless of plant arrangement or genotype, and batch process image sets. To further validate our system, wild-type Arabidopsis plants (Col-0) and two mutant lines with reduced Rubisco contents, pale leaves and slow growth phenotypes ( 1a3b and 1a2b ) were grown on a single plant tray. Plants were imaged from 9 to 24 days after germination every 20 min throughout the 24 h light-dark growth cycle (i.e. the diel cycle). The resulting dataset provided a dynamic and uninterrupted characterisation of differences in rosette growth and expansion rates over time for the three lines tested. Our methodology offers a straightforward solution for setting up automated, scalable and low-cost phenotyping facilities in a wide range of lab environments that could greatly increase the processing power and scalability of Arabidopsis soil growth experiments.

SU-E-T-266: Development of Evaluation System of Optimal Synchrotron Controlling Parameter for Spot Scanning Proton Therapy with Multiple Gate Irradiations in One Operation Cycle

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yamada, T; Fujii, Y; Hitachi Ltd., Hitachi-shi, Ibaraki

2015-06-15

Purpose: We have developed a gated spot scanning proton beam therapy system with real-time tumor-tracking. This system has the ability of multiple-gated irradiation in a single synchrotron operation cycle controlling the wait-time for consecutive gate signals during a flat-top phase so that the decrease in irradiation efficiency induced by irregular variation of gate signal is reduced. Our previous studies have shown that a 200 ms wait-time is appropriate to increase the average irradiation efficiency, but the optimal wait-time can vary patient by patient and day by day. In this research, we have developed an evaluation system of the optimal wait-timemore » in each irradiation based on the log data of the real-time-image gated proton beam therapy (RGPT) system. Methods: The developed system consists of logger for operation of RGPT system and software for evaluation of optimal wait-time. The logger records timing of gate on/off, timing and the dose of delivered beam spots, beam energy and timing of X-ray irradiation. The evaluation software calculates irradiation time in the case of different wait-time by simulating the multiple-gated irradiation operation using several timing information. Actual data preserved in the log data are used for gate on and off time, spot irradiation time, and time moving to the next spot. Design values are used for the acceleration and deceleration times. We applied this system to a patient treated with the RGPT system. Results: The evaluation system found the optimal wait-time of 390 ms that reduced the irradiation time by about 10 %. The irradiation time with actual wait-time used in treatment was reproduced with accuracy of 0.2 ms. Conclusion: For spot scanning proton therapy system with multiple-gated irradiation in one synchrotron operation cycle, an evaluation system of the optimal wait-time in each irradiation based on log data has been developed. Funding Support: Japan Society for the Promotion of Science (JSPS) through the FIRST Program.« less

Towards a software profession

NASA Technical Reports Server (NTRS)

Berard, Edward V.

1986-01-01

An increasing number of programmers have attempted to change their image. They have made it plain that they wish not only to be taken seriously, but they also wish to be regarded as professionals. Many programmers now wish to referred to as software engineers. If programmers wish to be considered professionals in every sense of the word, two obstacles must be overcome: the inability to think of software as a product, and the idea that little or no skill is required to create and handle software throughout its life cycle. The steps to be taken toward professionalization are outlined along with recommendations.

Imaging- and Flow Cytometry-based Analysis of Cell Position and the Cell Cycle in 3D Melanoma Spheroids

PubMed Central

Beaumont, Kimberley A.; Anfosso, Andrea; Ahmed, Farzana

2015-01-01

Three-dimensional (3D) tumor spheroids are utilized in cancer research as a more accurate model of the in vivo tumor microenvironment, compared to traditional two-dimensional (2D) cell culture. The spheroid model is able to mimic the effects of cell-cell interaction, hypoxia and nutrient deprivation, and drug penetration. One characteristic of this model is the development of a necrotic core, surrounded by a ring of G1 arrested cells, with proliferating cells on the outer layers of the spheroid. Of interest in the cancer field is how different regions of the spheroid respond to drug therapies as well as genetic or environmental manipulation. We describe here the use of the fluorescence ubiquitination cell cycle indicator (FUCCI) system along with cytometry and image analysis using commercial software to characterize the cell cycle status of cells with respect to their position inside melanoma spheroids. These methods may be used to track changes in cell cycle status, gene/protein expression or cell viability in different sub-regions of tumor spheroids over time and under different conditions. PMID:26779761

Specialty Engineering Supplement to IEEE-15288.1

DTIC Science & Technology

2015-05-15

receiver required to work in a dense EMI environment. (15) Any RF receiver with a burnout level of less than 30 dBm (1 mW). b. A summary of all...Context 2.1 ISO-IEC-IEEE-15288: 2015, Systems and Software Engineering — System life cycle processes ISO-IEC-IEEE 15288 is the DOD-adopted standard for...to ISO-15288 for application of systems engineering on defense programs that was developed by a joint services working group under the auspices of the

Space Environments and Effects: Trapped Proton Model

NASA Technical Reports Server (NTRS)

Huston, S. L.; Kauffman, W. (Technical Monitor)

2002-01-01

An improved model of the Earth's trapped proton environment has been developed. This model, designated Trapped Proton Model version 1 (TPM-1), determines the omnidirectional flux of protons with energy between 1 and 100 MeV throughout near-Earth space. The model also incorporates a true solar cycle dependence. The model consists of several data files and computer software to read them. There are three versions of the mo'del: a FORTRAN-Callable library, a stand-alone model, and a Web-based model.

Long-term care information systems: an overview of the selection process.

PubMed

Nahm, Eun-Shim; Mills, Mary Etta; Feege, Barbara

2006-06-01

Under the current Medicare Prospective Payment System method and the ever-changing managed care environment, the long-term care information system is vital to providing quality care and to surviving in business. system selection process should be an interdisciplinary effort involving all necessary stakeholders for the proposed system. The system selection process can be modeled following the Systems Developmental Life Cycle: identifying problems, opportunities, and objectives; determining information requirements; analyzing system needs; designing the recommended system; and developing and documenting software.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bachan, John

Chisel is a new open-source hardware construction language developed at UC Berkeley that supports advanced hardware design using highly parameterized generators and layered domain-specific hardware languages. Chisel is embedded in the Scala programming language, which raises the level of hardware design abstraction by providing concepts including object orientation, functional programming, parameterized types, and type inference. From the same source, Chisel can generate a high-speed C++-based cycle-accurate software simulator, or low-level Verilog designed to pass on to standard ASIC or FPGA tools for synthesis and place and route.

Control system development for a 1 MW/e/ solar thermal power plant

NASA Technical Reports Server (NTRS)

Daubert, E. R.; Bergthold, F. M., Jr.; Fulton, D. G.

1981-01-01

The point-focusing distributed receiver power plant considered consists of a number of power modules delivering power to a central collection point. Each power module contains a parabolic dish concentrator with a closed-cycle receiver/turbine/alternator assembly. Currently, a single-module prototype plant is under construction. The major control system tasks required are related to concentrator pointing control, receiver temperature control, and turbine speed control. Attention is given to operational control details, control hardware and software, and aspects of CRT output display.

Design and Implementation of a Computation Server for Optimization with Application to the Analysis of Critical Infrastructure

DTIC Science & Technology

2013-06-01

for crop irrigation. The disruptions also 1 idled key industries, led to billions of dollars of lost productivity, and stressed the entire Western...modify the super-system, and to resume the super-system run. 2.2 Requirements An important step in the software development life cycle is to capture...detects the . gms file and associated files in the remote directory that is allocated to the user. 4. If all of the files are present, the files are

Haptic Technologies for MEMS Design

NASA Astrophysics Data System (ADS)

Calis, Mustafa; Desmulliez, Marc P. Y.

2006-04-01

This paper presents for the first time a design methodology for MEMS/NEMS based on haptic sensing technologies. The software tool created as a result of this methodology will enable designers to model and interact in real time with their virtual prototype. One of the main advantages of haptic sensing is the ability to bring unusual microscopic forces back to the designer's world. Other significant benefits for developing such a methodology include gain productivity and the capability to include manufacturing costs within the design cycle.

Automated Theorem Proving in High-Quality Software Design

NASA Technical Reports Server (NTRS)

Schumann, Johann; Swanson, Keith (Technical Monitor)

2001-01-01

The amount and complexity of software developed during the last few years has increased tremendously. In particular, programs are being used more and more in embedded systems (from car-brakes to plant-control). Many of these applications are safety-relevant, i.e. a malfunction of hardware or software can cause severe damage or loss. Tremendous risks are typically present in the area of aviation, (nuclear) power plants or (chemical) plant control. Here, even small problems can lead to thousands of casualties and huge financial losses. Large financial risks also exist when computer systems are used in the area of telecommunication (telephone, electronic commerce) or space exploration. Computer applications in this area are not only subject to safety considerations, but also security issues are important. All these systems must be designed and developed to guarantee high quality with respect to safety and security. Even in an industrial setting which is (or at least should be) aware of the high requirements in Software Engineering, many incidents occur. For example, the Warshaw Airbus crash, was caused by an incomplete requirements specification. Uncontrolled reuse of an Ariane 4 software module was the reason for the Ariane 5 disaster. Some recent incidents in the telecommunication area, like illegal "cloning" of smart-cards of D2GSM handies, or the extraction of (secret) passwords from German T-online users show that also in this area serious flaws can happen. Due to the inherent complexity of computer systems, most authors claim that only a rigorous application of formal methods in all stages of the software life cycle can ensure high quality of the software and lead to real safe and secure systems. In this paper, we will have a look, in how far automated theorem proving can contribute to a more widespread application of formal methods and their tools, and what automated theorem provers (ATPs) must provide in order to be useful.

Software Quality Assurance and Controls Standard

DTIC Science & Technology

2010-04-27

Software Quality Assurance d C t l St d dan on ro s an ar Sue Carroll Principal Software Quality Analyst, SAS John Wal z VP Technology and...for Information Operations and Reports, 1215 Jefferson Davis Highway, Suite 1204, Arlington VA 22202-4302. Respondents should be aware that...Cycle (SLC) process? • What is in a SQA Process? • Where are SQA Controls? • What is the SQA standards history? Wh t i h i i SQA?• a s c ang ng n

Automated respiratory cycles selection is highly specific and improves respiratory mechanics analysis.

PubMed

Rigo, Vincent; Graas, Estelle; Rigo, Jacques

2012-07-01

Selected optimal respiratory cycles should allow calculation of respiratory mechanic parameters focusing on patient-ventilator interaction. New computer software automatically selecting optimal breaths and respiratory mechanics derived from those cycles are evaluated. Retrospective study. University level III neonatal intensive care unit. Ten mins synchronized intermittent mandatory ventilation and assist/control ventilation recordings from ten newborns. The ventilator provided respiratory mechanic data (ventilator respiratory cycles) every 10 secs. Pressure, flow, and volume waves and pressure-volume, pressure-flow, and volume-flow loops were reconstructed from continuous pressure-volume recordings. Visual assessment determined assisted leak-free optimal respiratory cycles (selected respiratory cycles). New software graded the quality of cycles (automated respiratory cycles). Respiratory mechanic values were derived from both sets of optimal cycles. We evaluated quality selection and compared mean values and their variability according to ventilatory mode and respiratory mechanic provenance. To assess discriminating power, all 45 "t" values obtained from interpatient comparisons were compared for each respiratory mechanic parameter. A total of 11,724 breaths are evaluated. Automated respiratory cycle/selected respiratory cycle selections agreement is high: 88% of maximal κ with linear weighting. Specificity and positive predictive values are 0.98 and 0.96, respectively. Averaged values are similar between automated respiratory cycle and ventilator respiratory cycle. C20/C alone is markedly decreased in automated respiratory cycle (1.27 ± 0.37 vs. 1.81 ± 0.67). Tidal volume apparent similarity disappears in assist/control: automated respiratory cycle tidal volume (4.8 ± 1.0 mL/kg) is significantly lower than for ventilator respiratory cycle (5.6 ± 1.8 mL/kg). Coefficients of variation decrease for all automated respiratory cycle parameters in all infants. "t" values from ventilator respiratory cycle data are two to three times higher than ventilator respiratory cycles. Automated selection is highly specific. Automated respiratory cycle reflects most the interaction of both ventilator and patient. Improving discriminating power of ventilator monitoring will likely help in assessing disease status and following trends. Averaged parameters derived from automated respiratory cycles are more precise and could be displayed by ventilators to improve real-time fine tuning of ventilator settings.

A flexible tool for diagnosing water, energy, and entropy budgets in climate models

NASA Astrophysics Data System (ADS)

Lembo, Valerio; Lucarini, Valerio

2017-04-01

We have developed a new flexible software for studying the global energy budget, the hydrological cycle, and the material entropy production of global climate models. The program receives as input radiative, latent and sensible energy fluxes, with the requirement that the variable names are in agreement with the Climate and Forecast (CF) conventions for the production of NetCDF datasets. Annual mean maps, meridional sections and time series are computed by means of Climate Data Operators (CDO) collection of command line operators developed at Max-Planck Institute for Meteorology (MPI-M). If a land-sea mask is provided, the program also computes the required quantities separately on the continents and oceans. Depending on the user's choice, the program also calls the MATLAB software to compute meridional heat transports and location and intensities of the peaks in the two hemispheres. We are currently planning to adapt the program in order to be included in the Earth System Model eValuation Tool (ESMValTool) community diagnostics.

Fast interactive real-time volume rendering of real-time three-dimensional echocardiography: an implementation for low-end computers

NASA Technical Reports Server (NTRS)

Saracino, G.; Greenberg, N. L.; Shiota, T.; Corsi, C.; Lamberti, C.; Thomas, J. D.

2002-01-01

Real-time three-dimensional echocardiography (RT3DE) is an innovative cardiac imaging modality. However, partly due to lack of user-friendly software, RT3DE has not been widely accepted as a clinical tool. The object of this study was to develop and implement a fast and interactive volume renderer of RT3DE datasets designed for a clinical environment where speed and simplicity are not secondary to accuracy. Thirty-six patients (20 regurgitation, 8 normal, 8 cardiomyopathy) were imaged using RT3DE. Using our newly developed software, all 3D data sets were rendered in real-time throughout the cardiac cycle and assessment of cardiac function and pathology was performed for each case. The real-time interactive volume visualization system is user friendly and instantly provides consistent and reliable 3D images without expensive workstations or dedicated hardware. We believe that this novel tool can be used clinically for dynamic visualization of cardiac anatomy.

Integrating Software-Architecture-Centric Methods into the Rational Unified Process

DTIC Science & Technology

2004-07-01

Architecture Design ...................................................................................... 19...QAW in a life- cycle context. One issue that needs to be addressed is how scenarios produced in a QAW can be used by a software architecture design method...implementation testing. 18 CMU/SEI-2004-TR-011 CMU/SEI-2004-TR-011 19 4 Architecture Design The Attribute-Driven Design (ADD) method

Feasibility study of an Integrated Program for Aerospace-vehicle Design (IPAD) system. Volume 6: Implementation schedule, development costs, operational costs, benefit assessment, impact on company organization, spin-off assessment, phase 1, tasks 3 to 8

NASA Technical Reports Server (NTRS)

Garrocq, C. A.; Hurley, M. J.; Dublin, M.

1973-01-01

A baseline implementation plan, including alternative implementation approaches for critical software elements and variants to the plan, was developed. The basic philosophy was aimed at: (1) a progressive release of capability for three major computing systems, (2) an end product that was a working tool, (3) giving participation to industry, government agencies, and universities, and (4) emphasizing the development of critical elements of the IPAD framework software. The results of these tasks indicate an IPAD first release capability 45 months after go-ahead, a five year total implementation schedule, and a total developmental cost of 2027 man-months and 1074 computer hours. Several areas of operational cost increases were identified mainly due to the impact of additional equipment needed and additional computer overhead. The benefits of an IPAD system were related mainly to potential savings in engineering man-hours, reduction of design-cycle calendar time, and indirect upgrading of product quality and performance.

Final Technical Report: Quantification of Uncertainty in Extreme Scale Computations (QUEST)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Knio, Omar M.

QUEST is a SciDAC Institute comprising Sandia National Laboratories, Los Alamos National Laboratory, University of Southern California, Massachusetts Institute of Technology, University of Texas at Austin, and Duke University. The mission of QUEST is to: (1) develop a broad class of uncertainty quantification (UQ) methods/tools, and (2) provide UQ expertise and software to other SciDAC projects, thereby enabling/guiding their UQ activities. The Duke effort focused on the development of algorithms and utility software for non-intrusive sparse UQ representations, and on participation in the organization of annual workshops and tutorials to disseminate UQ tools to the community, and to gather inputmore » in order to adapt approaches to the needs of SciDAC customers. In particular, fundamental developments were made in (a) multiscale stochastic preconditioners, (b) gradient-based approaches to inverse problems, (c) adaptive pseudo-spectral approximations, (d) stochastic limit cycles, and (e) sensitivity analysis tools for noisy systems. In addition, large-scale demonstrations were performed, namely in the context of ocean general circulation models.« less

Research on Occupational Safety, Health Management and Risk Control Technology in Coal Mines.

PubMed

Zhou, Lu-Jie; Cao, Qing-Gui; Yu, Kai; Wang, Lin-Lin; Wang, Hai-Bin

2018-04-26

This paper studies the occupational safety and health management methods as well as risk control technology associated with the coal mining industry, including daily management of occupational safety and health, identification and assessment of risks, early warning and dynamic monitoring of risks, etc.; also, a B/S mode software (Geting Coal Mine, Jining, Shandong, China), i.e., Coal Mine Occupational Safety and Health Management and Risk Control System, is developed to attain the aforementioned objectives, namely promoting the coal mine occupational safety and health management based on early warning and dynamic monitoring of risks. Furthermore, the practical effectiveness and the associated pattern for applying this software package to coal mining is analyzed. The study indicates that the presently developed coal mine occupational safety and health management and risk control technology and the associated software can support the occupational safety and health management efforts in coal mines in a standardized and effective manner. It can also control the accident risks scientifically and effectively; its effective implementation can further improve the coal mine occupational safety and health management mechanism, and further enhance the risk management approaches. Besides, its implementation indicates that the occupational safety and health management and risk control technology has been established based on a benign cycle involving dynamic feedback and scientific development, which can provide a reliable assurance to the safe operation of coal mines.

Research on Occupational Safety, Health Management and Risk Control Technology in Coal Mines

PubMed Central

Zhou, Lu-jie; Cao, Qing-gui; Yu, Kai; Wang, Lin-lin; Wang, Hai-bin

2018-01-01

This paper studies the occupational safety and health management methods as well as risk control technology associated with the coal mining industry, including daily management of occupational safety and health, identification and assessment of risks, early warning and dynamic monitoring of risks, etc.; also, a B/S mode software (Geting Coal Mine, Jining, Shandong, China), i.e., Coal Mine Occupational Safety and Health Management and Risk Control System, is developed to attain the aforementioned objectives, namely promoting the coal mine occupational safety and health management based on early warning and dynamic monitoring of risks. Furthermore, the practical effectiveness and the associated pattern for applying this software package to coal mining is analyzed. The study indicates that the presently developed coal mine occupational safety and health management and risk control technology and the associated software can support the occupational safety and health management efforts in coal mines in a standardized and effective manner. It can also control the accident risks scientifically and effectively; its effective implementation can further improve the coal mine occupational safety and health management mechanism, and further enhance the risk management approaches. Besides, its implementation indicates that the occupational safety and health management and risk control technology has been established based on a benign cycle involving dynamic feedback and scientific development, which can provide a reliable assurance to the safe operation of coal mines. PMID:29701715

Every apple has a voice: using stable isotopes to teach about food sourcing and the water cycle

DOE PAGES

Oerter, Erik; Malone, Molly; Putman, Annie; ...

2017-01-01

Agricultural crops such as fruits take up irrigation and meteoric water and incorporate it into their tissue (fruit water) during growth, and the geographic origin of a fruit may be traced by comparing the H and O stable isotope composition ( δ 2H and δ 18O values) of fruit water to the global geospatial distribution of H and O stable isotopes in precipitation. This connection between common fruits and the global water cycle provides an access point to connect with a variety of demographic groups to educate about isotope hydrology and the water cycle. Within the context of a 1-daymore » outreach activity designed for a wide spectrum of participants (high school students, undergraduate students, high school science teachers) we developed introductory lecture materials, in-class participatory demonstrations of fruit water isotopic measurement in real time, and a computer lab exercise to couple actual fruit water isotope data with open-source online geospatial analysis software. Here, we assessed learning outcomes with pre- and post-tests tied to learning objectives, as well as participant feedback surveys. Results indicate that this outreach activity provided effective lessons on the basics of stable isotope hydrology and the water cycle. But, the computer lab exercise needs to be more specifically tailored to the abilities of each participant group. This pilot study provides a foundation for further development of outreach materials that can effectively engage a range of participant groups in learning about the water cycle and the ways in which humans modify the water cycle through agricultural activity.« less

Every apple has a voice: using stable isotopes to teach about food sourcing and the water cycle

NASA Astrophysics Data System (ADS)

Oerter, Erik; Malone, Molly; Putman, Annie; Drits-Esser, Dina; Stark, Louisa; Bowen, Gabriel

2017-07-01

Agricultural crops such as fruits take up irrigation and meteoric water and incorporate it into their tissue (fruit water) during growth, and the geographic origin of a fruit may be traced by comparing the H and O stable isotope composition (δ2H and δ18O values) of fruit water to the global geospatial distribution of H and O stable isotopes in precipitation. This connection between common fruits and the global water cycle provides an access point to connect with a variety of demographic groups to educate about isotope hydrology and the water cycle. Within the context of a 1-day outreach activity designed for a wide spectrum of participants (high school students, undergraduate students, high school science teachers) we developed introductory lecture materials, in-class participatory demonstrations of fruit water isotopic measurement in real time, and a computer lab exercise to couple actual fruit water isotope data with open-source online geospatial analysis software. We assessed learning outcomes with pre- and post-tests tied to learning objectives, as well as participant feedback surveys. Results indicate that this outreach activity provided effective lessons on the basics of stable isotope hydrology and the water cycle. However, the computer lab exercise needs to be more specifically tailored to the abilities of each participant group. This pilot study provides a foundation for further development of outreach materials that can effectively engage a range of participant groups in learning about the water cycle and the ways in which humans modify the water cycle through agricultural activity.

Every apple has a voice: using stable isotopes to teach about food sourcing and the water cycle

DOE Office of Scientific and Technical Information (OSTI.GOV)

Oerter, Erik; Malone, Molly; Putman, Annie

Agricultural crops such as fruits take up irrigation and meteoric water and incorporate it into their tissue (fruit water) during growth, and the geographic origin of a fruit may be traced by comparing the H and O stable isotope composition ( δ 2H and δ 18O values) of fruit water to the global geospatial distribution of H and O stable isotopes in precipitation. This connection between common fruits and the global water cycle provides an access point to connect with a variety of demographic groups to educate about isotope hydrology and the water cycle. Within the context of a 1-daymore » outreach activity designed for a wide spectrum of participants (high school students, undergraduate students, high school science teachers) we developed introductory lecture materials, in-class participatory demonstrations of fruit water isotopic measurement in real time, and a computer lab exercise to couple actual fruit water isotope data with open-source online geospatial analysis software. Here, we assessed learning outcomes with pre- and post-tests tied to learning objectives, as well as participant feedback surveys. Results indicate that this outreach activity provided effective lessons on the basics of stable isotope hydrology and the water cycle. But, the computer lab exercise needs to be more specifically tailored to the abilities of each participant group. This pilot study provides a foundation for further development of outreach materials that can effectively engage a range of participant groups in learning about the water cycle and the ways in which humans modify the water cycle through agricultural activity.« less

10 CFR 436.15 - Formatting cost data.

Code of Federal Regulations, 2011 CFR

2011-01-01

... Procedures for Life Cycle Cost Analyses § 436.15 Formatting cost data. In establishing cost data under §§ 436.16 and 436.17 and measuring cost effectiveness by the modes of analysis described by § 436.19 through... software referenced in the Life Cycle Cost Manual for the Federal Energy Management Program. ...

NASA Operational Simulator for Small Satellites: Tools for Software Based Validation and Verification of Small Satellites

NASA Technical Reports Server (NTRS)

Grubb, Matt

2016-01-01

The NASA Operational Simulator for Small Satellites (NOS3) is a suite of tools to aid in areas such as software development, integration test (IT), mission operations training, verification and validation (VV), and software systems check-out. NOS3 provides a software development environment, a multi-target build system, an operator interface-ground station, dynamics and environment simulations, and software-based hardware models. NOS3 enables the development of flight software (FSW) early in the project life cycle, when access to hardware is typically not available. For small satellites there are extensive lead times on many of the commercial-off-the-shelf (COTS) components as well as limited funding for engineering test units (ETU). Considering the difficulty of providing a hardware test-bed to each developer tester, hardware models are modeled based upon characteristic data or manufacturers data sheets for each individual component. The fidelity of each hardware models is such that FSW executes unaware that physical hardware is not present. This allows binaries to be compiled for both the simulation environment, and the flight computer, without changing the FSW source code. For hardware models that provide data dependent on the environment, such as a GPS receiver or magnetometer, an open-source tool from NASA GSFC (42 Spacecraft Simulation) is used to provide the necessary data. The underlying infrastructure used to transfer messages between FSW and the hardware models can also be used to monitor, intercept, and inject messages, which has proven to be beneficial for VV of larger missions such as James Webb Space Telescope (JWST). As hardware is procured, drivers can be added to the environment to enable hardware-in-the-loop (HWIL) testing. When strict time synchronization is not vital, any number of combinations of hardware components and software-based models can be tested. The open-source operator interface used in NOS3 is COSMOS from Ball Aerospace. For testing, plug-ins are implemented in COSMOS to control the NOS3 simulations, while the command and telemetry tools available in COSMOS are used to communicate with FSW. NOS3 is actively being used for FSW development and component testing of the Simulation-to-Flight 1 (STF-1) CubeSat. As NOS3 matures, hardware models have been added for common CubeSat components such as Novatel GPS receivers, ClydeSpace electrical power systems and batteries, ISISpace antenna systems, etc. In the future, NASA IVV plans to distribute NOS3 to other CubeSat developers and release the suite to the open-source community.

Oscillating-Flow Regenerator Test Rig: Hardware and Theory With Derived Correlations for Screens and Felts

NASA Technical Reports Server (NTRS)

Gedeon, D.; Wood, J. G.

1996-01-01

A number of wire mesh and metal felt test samples, with a range of porosities, yield generic correlations for friction factor, Nusselt number, enhanced axial conduction ratio, and overall heat flux ratio. This information is directed primarily toward stirling cycle regenerator modelers, but will be of use to anyone seeking to better model fluid flow through these porous materials. Behind these results lies an oscillating-flow test rig, which measures pumping dissipation and thermal energy transport in sample matrices, and several stages of data-reduction software, which correlate instantaneous values for the above dimensionless groups. Within the software, theoretical model reduces instantaneous quantifies from cycle-averaged measurables using standard parameter estimation techniques.

Economic resilience through "One-Water" management

USGS Publications Warehouse

Hanson, Randall T.; Schmid, Wolfgang

2013-01-01

Disruption of water availability leads to food scarcity and loss of economic opportunity. Development of effective water-resource policies and management strategies could provide resiliance to local economies in the face of water disruptions such as drought, flood, and climate change. To accomplish this, a detailed understanding of human water use and natural water resource availability is needed. A hydrologic model is a computer software system that simulates the movement and use of water in a geographic area. It takes into account all components of the water cycle--“One Water”--and helps estimate water budgets for groundwater, surface water, and landscape features. The U.S. Geological Survey MODFLOW One-Water Integrated Hydrologic Model (MODFLOWOWHM) software and scientific methods can provide water managers and political leaders with hydrologic information they need to help ensure water security and economic resilience.

Novel pulsed switched power supply for a fast field cycling NMR spectrometer.

PubMed

Sousa, D M; Fernandes, P A L; Marques, G D; Ribeiro, A C; Sebastião, P J

2004-01-01

In this paper, we outline the operating principles of a pulsed switched power supply for a fast field-cycling nuclear magnetic resonance spectrometer. The power supply uses a variant of a four-quadrant chopper with a duty cycle that defines the average output current. With this topology only two semiconductors are necessary to drive hundreds of amperes with an output power of several kilowatts. The output current ripple has a well-defined shape that can be reduced to acceptable values by a careful design of the semiconductors' controlling circuits and drivers. A power supply prototype was tested with a home build air-core magnet operating with fields between 0 and 0.21 T. The system is computer controlled using pulse generator and data acquisition PC cards, and specific user-friendly home-developed software. A comparative proton relaxometry study in two well-known liquid crystal compounds 5CB and MBBA was performed to check the reproducibility of the T1 measurements.

Testing, Requirements, and Metrics

NASA Technical Reports Server (NTRS)

Rosenberg, Linda; Hyatt, Larry; Hammer, Theodore F.; Huffman, Lenore; Wilson, William

1998-01-01

The criticality of correct, complete, testable requirements is a fundamental tenet of software engineering. Also critical is complete requirements based testing of the final product. Modern tools for managing requirements allow new metrics to be used in support of both of these critical processes. Using these tools, potential problems with the quality of the requirements and the test plan can be identified early in the life cycle. Some of these quality factors include: ambiguous or incomplete requirements, poorly designed requirements databases, excessive or insufficient test cases, and incomplete linkage of tests to requirements. This paper discusses how metrics can be used to evaluate the quality of the requirements and test to avoid problems later. Requirements management and requirements based testing have always been critical in the implementation of high quality software systems. Recently, automated tools have become available to support requirements management. At NASA's Goddard Space Flight Center (GSFC), automated requirements management tools are being used on several large projects. The use of these tools opens the door to innovative uses of metrics in characterizing test plan quality and assessing overall testing risks. In support of these projects, the Software Assurance Technology Center (SATC) is working to develop and apply a metrics program that utilizes the information now available through the application of requirements management tools. Metrics based on this information provides real-time insight into the testing of requirements and these metrics assist the Project Quality Office in its testing oversight role. This paper discusses three facets of the SATC's efforts to evaluate the quality of the requirements and test plan early in the life cycle, thus preventing costly errors and time delays later.

Analysis of in vitro fertilization data with multiple outcomes using discrete time-to-event analysis

PubMed Central

Maity, Arnab; Williams, Paige; Ryan, Louise; Missmer, Stacey; Coull, Brent; Hauser, Russ

2014-01-01

In vitro fertilization (IVF) is an increasingly common method of assisted reproductive technology. Because of the careful observation and followup required as part of the procedure, IVF studies provide an ideal opportunity to identify and assess clinical and demographic factors along with environmental exposures that may impact successful reproduction. A major challenge in analyzing data from IVF studies is handling the complexity and multiplicity of outcome, resulting from both multiple opportunities for pregnancy loss within a single IVF cycle in addition to multiple IVF cycles. To date, most evaluations of IVF studies do not make use of full data due to its complex structure. In this paper, we develop statistical methodology for analysis of IVF data with multiple cycles and possibly multiple failure types observed for each individual. We develop a general analysis framework based on a generalized linear modeling formulation that allows implementation of various types of models including shared frailty models, failure specific frailty models, and transitional models, using standard software. We apply our methodology to data from an IVF study conducted at the Brigham and Women’s Hospital, Massachusetts. We also summarize the performance of our proposed methods based on a simulation study. PMID:24317880

Using Ada: The deeper challenges

NASA Technical Reports Server (NTRS)

Feinberg, David A.

1986-01-01

The Ada programming language and the associated Ada Programming Support Environment (APSE) and Ada Run Time Environment (ARTE) provide the potential for significant life-cycle cost reductions in computer software development and maintenance activities. The Ada programming language itself is standardized, trademarked, and controlled via formal validation procedures. Though compilers are not yet production-ready as most would desire, the technology for constructing them is sufficiently well known and understood that time and money should suffice to correct current deficiencies. The APSE and ARTE are, on the other hand, significantly newer issues within most software development and maintenance efforts. Currently, APSE and ARTE are highly dependent on differing implementer concepts, strategies, and market objectives. Complex and sophisticated mission-critical computing systems require the use of a complete Ada-based capability, not just the programming language itself; yet the range of APSE and ARTE features which must actually be utilized can vary significantly from one system to another. As a consequence, the need to understand, objectively evaluate, and select differing APSE and ARTE capabilities and features is critical to the effective use of Ada and the life-cycle efficiencies it is intended to promote. It is the selection, collection, and understanding of APSE and ARTE which provide the deeper challenges of using Ada for real-life mission-critical computing systems. Some of the current issues which must be clarified, often on a case-by-case basis, in order to successfully realize the full capabilities of Ada are discussed.

Algorithm Optimally Orders Forward-Chaining Inference Rules

NASA Technical Reports Server (NTRS)

James, Mark

2008-01-01

People typically develop knowledge bases in a somewhat ad hoc manner by incrementally adding rules with no specific organization. This often results in a very inefficient execution of those rules since they are so often order sensitive. This is relevant to tasks like Deep Space Network in that it allows the knowledge base to be incrementally developed and have it automatically ordered for efficiency. Although data flow analysis was first developed for use in compilers for producing optimal code sequences, its usefulness is now recognized in many software systems including knowledge-based systems. However, this approach for exhaustively computing data-flow information cannot directly be applied to inference systems because of the ubiquitous execution of the rules. An algorithm is presented that efficiently performs a complete producer/consumer analysis for each antecedent and consequence clause in a knowledge base to optimally order the rules to minimize inference cycles. An algorithm was developed that optimally orders a knowledge base composed of forwarding chaining inference rules such that independent inference cycle executions are minimized, thus, resulting in significantly faster execution. This algorithm was integrated into the JPL tool Spacecraft Health Inference Engine (SHINE) for verification and it resulted in a significant reduction in inference cycles for what was previously considered an ordered knowledge base. For a knowledge base that is completely unordered, then the improvement is much greater.

Manned/Unmanned Common Architecture Program (MCAP) net centric flight tests

NASA Astrophysics Data System (ADS)

Johnson, Dale

2009-04-01

Properly architected avionics systems can reduce the costs of periodic functional improvements, maintenance, and obsolescence. With this in mind, the U.S. Army Aviation Applied Technology Directorate (AATD) initiated the Manned/Unmanned Common Architecture Program (MCAP) in 2003 to develop an affordable, high-performance embedded mission processing architecture for potential application to multiple aviation platforms. MCAP analyzed Army helicopter and unmanned air vehicle (UAV) missions, identified supporting subsystems, surveyed advanced hardware and software technologies, and defined computational infrastructure technical requirements. The project selected a set of modular open systems standards and market-driven commercial-off-theshelf (COTS) electronics and software, and, developed experimental mission processors, network architectures, and software infrastructures supporting the integration of new capabilities, interoperability, and life cycle cost reductions. MCAP integrated the new mission processing architecture into an AH-64D Apache Longbow and participated in Future Combat Systems (FCS) network-centric operations field experiments in 2006 and 2007 at White Sands Missile Range (WSMR), New Mexico and at the Nevada Test and Training Range (NTTR) in 2008. The MCAP Apache also participated in PM C4ISR On-the-Move (OTM) Capstone Experiments 2007 (E07) and 2008 (E08) at Ft. Dix, NJ and conducted Mesa, Arizona local area flight tests in December 2005, February 2006, and June 2008.

Control software for two dimensional airfoil tests using a self-streamlining flexible walled transonic test section

NASA Technical Reports Server (NTRS)

Wolf, S. W. D.; Goodyer, M. J.

1982-01-01

Operation of the Transonic Self-Streamlining Wind Tunnel (TSWT) involved on-line data acquisition with automatic wall adjustment. A tunnel run consisted of streamlining the walls from known starting contours in iterative steps and acquiring model data. Each run performs what is described as a streamlining cycle. The associated software is presented.

Breaking the hype cycle: using the computer effectively with learners with intellectual disabilities.

PubMed

Lloyd, Jan; Moni, Karen B; Jobling, Anne

2006-06-01

There has been huge growth in the use of information technology (IT) in classrooms for learners of all ages. It has been suggested that computers in the classroom encourage independent and self-paced learning, provide immediate feedback and improve self-motivation and self-confidence. Concurrently there is increasing interest related to the role of technology in educational programs for individuals with intellectual disabilities. However, although many claims are made about the benefits of computers and software packages there is limited evidence based information to support these claims. Researchers are now starting to look at the specific instructional design features that are hypothesised to facilitate education outcomes rather than the over-emphasis on graphics and sounds. Research undertaken as part of a post-school program (Latch-On: Literacy and Technology - Hands On) at the University of Queensland investigated the use of computers by young adults with intellectual disabilities. The aims of the research reported in this paper were to address the challenges identified in the 'hype' surrounding different pieces of educational software and to develop a means of systematically analysing software for use in teaching programs.

Information and communication systems for the assistance of carers based on ACTION.

PubMed

Kraner, M; Emery, D; Cvetkovic, S R; Procter, P; Smythe, C

1999-01-01

Recent advances in telecommunication technologies allow the design of information and communication systems for people who are caring for others in the home as family members or as professionals in the health or community centres. The present paper analyses and classifies the information flow and maps it to an information life cycle, which governs the design of the deployed hardware, software and the data-structure. This is based on the initial findings of ACTION (assisting carers using telematics interventions to meet older persons' needs) a European Union funded project. The proposed information architecture discusses different designs such as centralized or decentralized Web and Client server solutions. A user interface is developed reflecting the special requirements of the targeted user group, which influences the functionality and design of the software, data architecture and the integrated communication system using video-conferencing. ACTION has engineered a system using plain Web technology based on HTML, extended with JavaScript and ActiveX and a software switch enabling the integration of different types of videoconferencing and other applications providing manufacturer independence.

Solving the Software Legacy Problem with RISA

NASA Astrophysics Data System (ADS)

Ibarra, A.; Gabriel, C.

2012-09-01

Nowadays hardware and system infrastructure evolve on time scales much shorter than the typical duration of space astronomy missions. Data processing software capabilities have to evolve to preserve the scientific return during the entire experiment life time. Software preservation is a key issue that has to be tackled before the end of the project to keep the data usable over many years. We present RISA (Remote Interface to Science Analysis) as a solution to decouple data processing software and infrastructure life-cycles, using JAVA applications and web-services wrappers to existing software. This architecture employs embedded SAS in virtual machines assuring a homogeneous job execution environment. We will also present the first studies to reactivate the data processing software of the EXOSAT mission, the first ESA X-ray astronomy mission launched in 1983, using the generic RISA approach.

Social and Personal Factors in Semantic Infusion Projects

NASA Astrophysics Data System (ADS)

West, P.; Fox, P. A.; McGuinness, D. L.

2009-12-01

As part of our semantic data framework activities across multiple, diverse disciplines we required the involvement of domain scientists, computer scientists, software engineers, data managers, and often, social scientists. This involvement from a cross-section of disciplines turns out to be a social exercise as much as it is a technical and methodical activity. Each member of the team is used to different modes of working, expectations, vocabularies, levels of participation, and incentive and reward systems. We will examine how both roles and personal responsibilities play in the development of semantic infusion projects, and how an iterative development cycle can contribute to the successful completion of such a project.

Development of advanced manufacturing technologies for low cost hydrogen storage vessels

DOE Office of Scientific and Technical Information (OSTI.GOV)

Leavitt, Mark; Lam, Patrick

2014-12-29

The U.S. Department of Energy (DOE) defined a need for low-cost gaseous hydrogen storage vessels at 700 bar to support cost goals aimed at 500,000 units per year. Existing filament winding processes produce a pressure vessel that is structurally inefficient, requiring more carbon fiber for manufacturing reasons, than would otherwise be necessary. Carbon fiber is the greatest cost driver in building a hydrogen pressure vessel. The objective of this project is to develop new methods for manufacturing Type IV pressure vessels for hydrogen storage with the purpose of lowering the overall product cost through an innovative hybrid process of optimizingmore » composite usage by combining traditional filament winding (FW) and advanced fiber placement (AFP) techniques. A numbers of vessels were manufactured in this project. The latest vessel design passed all the critical tests on the hybrid design per European Commission (EC) 79-2009 standard except the extreme temperature cycle test. The tests passed include burst test, cycle test, accelerated stress rupture test and drop test. It was discovered the location where AFP and FW overlap for load transfer could be weakened during hydraulic cycling at 85°C. To design a vessel that passed these tests, the in-house modeling software was updated to add capability to start and stop fiber layers to simulate the AFP process. The original in-house software was developed for filament winding only. Alternative fiber was also investigated in this project, but the added mass impacted the vessel cost negatively due to the lower performance from the alternative fiber. Overall the project was a success to show the hybrid design is a viable solution to reduce fiber usage, thus driving down the cost of fuel storage vessels. Based on DOE’s baseline vessel size of 147.3L and 91kg, the 129L vessel (scaled to DOE baseline) in this project shows a 32% composite savings and 20% cost savings when comparing Vessel 15 hybrid design and the Quantum baseline all filament wound vessel. Due to project timing, there was no additional time available to fine tune the design to improve the load transfer between AFP and FW. Further design modifications will likely help pass the extreme temperature cycle test, the remaining test that is critical to the hybrid design.« less

Inhibition of Breast Cancer-lnduced Bone Pain, Metastasis, and Osteolysis in Nude Mice by LOVAZA and DHA Fatty Acids

DTIC Science & Technology

2012-10-01

ASIC3, TGAGAGCCACCAGCTTACCT/ACATGTCCTCAAGGGAGTGG (30 cycles); mouse TRPV1 , GTGACCCTCTTGGTGGAGAA/ CTTCAGTGTGGGGTGGAGTT (30 cycles), mouse GAPDH...densitometry assisted by the image analysis software MetaMorph Image ( xx). Sizes are as follows: ASIC1a 506bp, ASCI1b 563bp, ASCI3 245pb, TRPV1

Software Tools For Building Decision-support Models For Flood Emergency Situations

NASA Astrophysics Data System (ADS)

Garrote, L.; Molina, M.; Ruiz, J. M.; Mosquera, J. C.

The SAIDA decision-support system was developed by the Spanish Ministry of the Environment to provide assistance to decision-makers during flood situations. SAIDA has been tentatively implemented in two test basins: Jucar and Guadalhorce, and the Ministry is currently planning to have it implemented in all major Spanish basins in a few years' time. During the development cycle of SAIDA, the need for providing as- sistance to end-users in model definition and calibration was clearly identified. System developers usually emphasise abstraction and generality with the goal of providing a versatile software environment. End users, on the other hand, require concretion and specificity to adapt the general model to their local basins. As decision-support models become more complex, the gap between model developers and users gets wider: Who takes care of model definition, calibration and validation?. Initially, model developers perform these tasks, but the scope is usually limited to a few small test basins. Before the model enters operational stage, end users must get involved in model construction and calibration, in order to gain confidence in the model recommendations. However, getting the users involved in these activities is a difficult task. The goal of this re- search is to develop representation techniques for simulation and management models in order to define, develop and validate a mechanism, supported by a software envi- ronment, oriented to provide assistance to the end-user in building decision models for the prediction and management of river floods in real time. The system is based on three main building blocks: A library of simulators of the physical system, an editor to assist the user in building simulation models, and a machine learning method to calibrate decision models based on the simulation models provided by the user.

Experiences in improving the state of the practice in verification and validation of knowledge-based systems

NASA Technical Reports Server (NTRS)

Culbert, Chris; French, Scott W.; Hamilton, David

1994-01-01

Knowledge-based systems (KBS's) are in general use in a wide variety of domains, both commercial and government. As reliance on these types of systems grows, the need to assess their quality and validity reaches critical importance. As with any software, the reliability of a KBS can be directly attributed to the application of disciplined programming and testing practices throughout the development life-cycle. However, there are some essential differences between conventional software and KBSs, both in construction and use. The identification of these differences affect the verification and validation (V&V) process and the development of techniques to handle them. The recognition of these differences is the basis of considerable on-going research in this field. For the past three years IBM (Federal Systems Company - Houston) and the Software Technology Branch (STB) of NASA/Johnson Space Center have been working to improve the 'state of the practice' in V&V of Knowledge-based systems. This work was motivated by the need to maintain NASA's ability to produce high quality software while taking advantage of new KBS technology. To date, the primary accomplishment has been the development and teaching of a four-day workshop on KBS V&V. With the hope of improving the impact of these workshops, we also worked directly with NASA KBS projects to employ concepts taught in the workshop. This paper describes two projects that were part of this effort. In addition to describing each project, this paper describes problems encountered and solutions proposed in each case, with particular emphasis on implications for transferring KBS V&V technology beyond the NASA domain.

Software design and code generation for the engineering graphical user interface of the ASTRI SST-2M prototype for the Cherenkov Telescope Array

NASA Astrophysics Data System (ADS)

Tanci, Claudio; Tosti, Gino; Antolini, Elisa; Gambini, Giorgio F.; Bruno, Pietro; Canestrari, Rodolfo; Conforti, Vito; Lombardi, Saverio; Russo, Federico; Sangiorgi, Pierluca; Scuderi, Salvatore

2016-08-01

ASTRI is an on-going project developed in the framework of the Cherenkov Telescope Array (CTA). An end- to-end prototype of a dual-mirror small-size telescope (SST-2M) has been installed at the INAF observing station on Mt. Etna, Italy. The next step is the development of the ASTRI mini-array composed of nine ASTRI SST-2M telescopes proposed to be installed at the CTA southern site. The ASTRI mini-array is a collaborative and international effort carried on by Italy, Brazil and South-Africa and led by the Italian National Institute of Astrophysics, INAF. To control the ASTRI telescopes, a specific ASTRI Mini-Array Software System (MASS) was designed using a scalable and distributed architecture to monitor all the hardware devices for the telescopes. Using code generation we built automatically from the ASTRI Interface Control Documents a set of communication libraries and extensive Graphical User Interfaces that provide full access to the capabilities offered by the telescope hardware subsystems for testing and maintenance. Leveraging these generated libraries and components we then implemented a human designed, integrated, Engineering GUI for MASS to perform the verification of the whole prototype and test shared services such as the alarms, configurations, control systems, and scientific on-line outcomes. In our experience the use of code generation dramatically reduced the amount of effort in development, integration and testing of the more basic software components and resulted in a fast software release life cycle. This approach could be valuable for the whole CTA project, characterized by a large diversity of hardware components.

Case Study of the Space Shuttle Cockpit Avionics Upgrade Software

NASA Technical Reports Server (NTRS)

Ferguson, Roscoe C.; Thompson, Hiram C.

2005-01-01

The purpose of the Space Shuttle Cockpit Avionics Upgrade project was to reduce crew workload and improve situational awareness. The upgrade was to augment the Shuttle avionics system with new hardware and software. An early version of this system was used to gather human factor statistics in the Space Shuttle Motion Simulator of the Johnson Space Center for one month by multiple teams of astronauts. The results were compiled by NASA Ames Research Center and it was was determined that the system provided a better than expected increase in situational awareness and reduction in crew workload. Even with all of the benefits nf the system, NASA cancelled the project towards the end of the development cycle. A major success of this project was the validation of the hardware architecture and software design. This was significant because the project incorporated new technology and approaches for the development of human rated space software. This paper serves as a case study to document knowledge gained and techniques that can be applied for future space avionics development efforts. The major technological advances were the use of reflective memory concepts for data acquisition and the incorporation of Commercial off the Shelf (COTS) products in a human rated space avionics system. The infused COTS products included a real time operating system, a resident linker and loader, a display generation tool set, and a network data manager. Some of the successful design concepts were the engineering of identical outputs in multiple avionics boxes using an event driven approach and inter-computer communication, a reconfigurable data acquisition engine, the use of a dynamic bus bandwidth allocation algorithm. Other significant experiences captured were the use of prototyping to reduce risk, and the correct balance between Object Oriented and Functional based programming.

Development of a Stirling System Dynamic Model With Enhanced Thermodynamics

NASA Technical Reports Server (NTRS)

Regan, Timothy F.; Lewandowski, Edward J.

2005-01-01

The Stirling Convertor System Dynamic Model developed at NASA Glenn Research Center is a software model developed from first principles that includes the mechanical and mounting dynamics, the thermodynamics, the linear alternator, and the controller of a free-piston Stirling power convertor, along with the end user load. As such it represents the first detailed modeling tool for fully integrated Stirling convertor-based power systems. The thermodynamics of the model were originally a form of the isothermal Stirling cycle. In some situations it may be desirable to improve the accuracy of the Stirling cycle portion of the model. An option under consideration is to enhance the SDM thermodynamics by coupling the model with Gedeon Associates Sage simulation code. The result will be a model that gives a more accurate prediction of the performance and dynamics of the free-piston Stirling convertor. A method of integrating the Sage simulation code with the System Dynamic Model is described. Results of SDM and Sage simulation are compared to test data. Model parameter estimation and model validation are discussed.

A Validation of Object-Oriented Design Metrics as Quality Indicators

NASA Technical Reports Server (NTRS)

Basili, Victor R.; Briand, Lionel C.; Melo, Walcelio

1997-01-01

This paper presents the results of a study in which we empirically investigated the suits of object-oriented (00) design metrics introduced in another work. More specifically, our goal is to assess these metrics as predictors of fault-prone classes and, therefore, determine whether they can be used as early quality indicators. This study is complementary to the work described where the same suite of metrics had been used to assess frequencies of maintenance changes to classes. To perform our validation accurately, we collected data on the development of eight medium-sized information management systems based on identical requirements. All eight projects were developed using a sequential life cycle model, a well-known 00 analysis/design method and the C++ programming language. Based on empirical and quantitative analysis, the advantages and drawbacks of these 00 metrics are discussed. Several of Chidamber and Kamerer's 00 metrics appear to be useful to predict class fault-proneness during the early phases of the life-cycle. Also, on our data set, they are better predictors than 'traditional' code metrics, which can only be collected at a later phase of the software development processes.

A Validation of Object-Oriented Design Metrics

NASA Technical Reports Server (NTRS)

Basili, Victor R.; Briand, Lionel; Melo, Walcelio L.

1995-01-01

This paper presents the results of a study conducted at the University of Maryland in which we experimentally investigated the suite of Object-Oriented (00) design metrics introduced by [Chidamber and Kemerer, 1994]. In order to do this, we assessed these metrics as predictors of fault-prone classes. This study is complementary to [Lieand Henry, 1993] where the same suite of metrics had been used to assess frequencies of maintenance changes to classes. To perform our validation accurately, we collected data on the development of eight medium-sized information management systems based on identical requirements. All eight projects were developed using a sequential life cycle model, a well-known 00 analysis/design method and the C++ programming language. Based on experimental results, the advantages and drawbacks of these 00 metrics are discussed and suggestions for improvement are provided. Several of Chidamber and Kemerer's 00 metrics appear to be adequate to predict class fault-proneness during the early phases of the life-cycle. We also showed that they are, on our data set, better predictors than "traditional" code metrics, which can only be collected at a later phase of the software development processes.

Development of a Stirling System Dynamic Model with Enhanced Thermodynamics

NASA Astrophysics Data System (ADS)

Regan, Timothy F.; Lewandowski, Edward J.

2005-02-01

The Stirling Convertor System Dynamic Model developed at NASA Glenn Research Center is a software model developed from first principles that includes the mechanical and mounting dynamics, the thermodynamics, the linear alternator, and the controller of a free-piston Stirling power convertor, along with the end user load. As such it represents the first detailed modeling tool for fully integrated Stirling convertor-based power systems. The thermodynamics of the model were originally a form of the isothermal Stirling cycle. In some situations it may be desirable to improve the accuracy of the Stirling cycle portion of the model. An option under consideration is to enhance the SDM thermodynamics by coupling the model with Gedeon Associates' Sage simulation code. The result will be a model that gives a more accurate prediction of the performance and dynamics of the free-piston Stirling convertor. A method of integrating the Sage simulation code with the System Dynamic Model is described. Results of SDM and Sage simulation are compared to test data. Model parameter estimation and model validation are discussed.

A fully automated liquid–liquid extraction system utilizing interface detection

PubMed Central

Maslana, Eugene; Schmitt, Robert; Pan, Jeffrey

2000-01-01

The development of the Abbott Liquid-Liquid Extraction Station was a result of the need for an automated system to perform aqueous extraction on large sets of newly synthesized organic compounds used for drug discovery. The system utilizes a cylindrical laboratory robot to shuttle sample vials between two loading racks, two identical extraction stations, and a centrifuge. Extraction is performed by detecting the phase interface (by difference in refractive index) of the moving column of fluid drawn from the bottom of each vial containing a biphasic mixture. The integration of interface detection with fluid extraction maximizes sample throughput. Abbott-developed electronics process the detector signals. Sample mixing is performed by high-speed solvent injection. Centrifuging of the samples reduces interface emulsions. Operating software permits the user to program wash protocols with any one of six solvents per wash cycle with as many cycle repeats as necessary. Station capacity is eighty, 15 ml vials. This system has proven successful with a broad spectrum of both ethyl acetate and methylene chloride based chemistries. The development and characterization of this automated extraction system will be presented. PMID:18924693

Integrated Computational System for Aerodynamic Steering and Visualization

NASA Technical Reports Server (NTRS)

Hesselink, Lambertus

1999-01-01

In February of 1994, an effort from the Fluid Dynamics and Information Sciences Divisions at NASA Ames Research Center with McDonnel Douglas Aerospace Company and Stanford University was initiated to develop, demonstrate, validate and disseminate automated software for numerical aerodynamic simulation. The goal of the initiative was to develop a tri-discipline approach encompassing CFD, Intelligent Systems, and Automated Flow Feature Recognition to improve the utility of CFD in the design cycle. This approach would then be represented through an intelligent computational system which could accept an engineer's definition of a problem and construct an optimal and reliable CFD solution. Stanford University's role focused on developing technologies that advance visualization capabilities for analysis of CFD data, extract specific flow features useful for the design process, and compare CFD data with experimental data. During the years 1995-1997, Stanford University focused on developing techniques in the area of tensor visualization and flow feature extraction. Software libraries were created enabling feature extraction and exploration of tensor fields. As a proof of concept, a prototype system called the Integrated Computational System (ICS) was developed to demonstrate CFD design cycle. The current research effort focuses on finding a quantitative comparison of general vector fields based on topological features. Since the method relies on topological information, grid matching and vector alignment is not needed in the comparison. This is often a problem with many data comparison techniques. In addition, since only topology based information is stored and compared for each field, there is a significant compression of information that enables large databases to be quickly searched. This report will (1) briefly review the technologies developed during 1995-1997 (2) describe current technologies in the area of comparison techniques, (4) describe the theory of our new method researched during the grant year (5) summarize a few of the results and finally (6) discuss work within the last 6 months that are direct extensions from the grant.

Air Force Space Command. Space and Missile Systems Center Standard. Configuration Management

DTIC Science & Technology

2008-06-13

Aerospace Corporation report number TOR-2006( 8583 )-1. 3. Beneficial comments (recommendations, additions, deletions) and any pertinent data that...Engineering Drawing Practices IEEE STD 610.12 Glossary of Software Engineering Terminology, September 28,1990 ISO /IEC 12207 Software Life...item, regardless of media, formally designated and fixed at a specific time during the configuration item’s life cycle. (Source: ISO /IEC 12207

Please Reduce Cycle Time

DTIC Science & Technology

2014-12-01

observed an ERP system implementation that encountered this exact model. The modified COTS software worked and passed the acceptance tests but never... software -intensive program. We decided to create a very detailed master sched- ule with multiple supporting subschedules that linked and Implementing ...processes in place as part of the COTS implementation . For hardware , COTS can also present some risks. Many pro- grams use COTS computers and servers

Independent backup mode transfer and mechanism for digital control computers

NASA Technical Reports Server (NTRS)

Tulpule, Bhalchandra R. (Inventor); Oscarson, Edward M. (Inventor)

1992-01-01

An interrupt is provided to a signal processor having a non-maskable interrupt input, in response to the detection of a request for transfer to backup software. The signal processor provides a transfer signal to a transfer mechanism only after completion of the present machine cycle. Transfer to the backup software is initiated by the transfer mechanism only upon reception of the transfer signal.

SU-F-I-11: Software Development for 4D-CBCT Research of Real-Time-Image Gated Spot Scanning Proton Therapy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fujii, T; Fujii, Y; Shimizu, S

Purpose: To acquire correct information for inside the body in patient positioning of Real-time-image Gated spot scanning Proton Therapy (RGPT), utilization of tomographic image at exhale phase of patient respiration obtained from 4-dimensional Cone beam CT (4D-CBCT) has been desired. We developed software named “Image Analysis Platform” for 4D-CBCT researches which has technique to segment projection-images based on 3D marker position in the body. The 3D marker position can be obtained by using two axes CBCT system at Hokkaido University Hospital Proton Therapy Center. Performance verification of the software was implemented. Methods: The software calculates 3D marker position retrospectively bymore » using matching positions on pair projection-images obtained by two axes fluoroscopy mode of CBCT system. Log data of 3D marker tracking are outputted after the tracking. By linking the Log data and gantry-angle file of projection-image, all projection-images are equally segmented to spatial five-phases according to marker 3D position of SI direction and saved to specified phase folder. Segmented projection-images are used for CBCT reconstruction of each phase. As performance verification of the software, test of segmented projection-images was implemented for sample CT phantom (Catphan) image acquired by two axes fluoroscopy mode of CBCT. Dummy marker was added on the images. Motion of the marker was modeled to move in 3D space. Motion type of marker is sin4 wave function has amplitude 10.0 mm/5.0 mm/0 mm, cycle 4 s/4 s/0 s for SI/AP/RL direction. Results: The marker was tracked within 0.58 mm accuracy in 3D for all images, and it was confirmed that all projection-images were segmented and saved to each phase folder correctly. Conclusion: We developed software for 4D-CBCT research which can segment projection-image based on 3D marker position. It will be helpful to create high quality of 4D-CBCT reconstruction image for RGPT.« less

Crew Launch Vehicle (CLV) Avionics and Software Integration Overview

NASA Technical Reports Server (NTRS)

Monell, Donald W.; Flynn, Kevin C.; Maroney, Johnny

2006-01-01

On January 14, 2004, the President of the United States announced a new plan to explore space and extend a human presence across our solar system. The National Aeronautics and Space Administration (NASA) established the Exploration Systems Mission Directorate (ESMD) to develop and field a Constellation Architecture that will bring the Space Exploration vision to fruition. The Constellation Architecture includes a human-rated Crew Launch Vehicle (CLV) segment, managed by the Marshall Space Flight Center (MSFC), comprised of the First Stage (FS), Upper Stage (US), and Upper Stage Engine (USE) elements. The CLV s purpose is to provide safe and reliable crew and cargo transportation into Low Earth Orbit (LEO), as well as insertion into trans-lunar trajectories. The architecture's Spacecraft segment includes, among other elements, the Crew Exploration Vehicle (CEV), managed by the Johnson Space Flight Center (JSC), which is launched atop the CLV. MSFC is also responsible for CLV and CEV stack integration. This paper provides an overview of the Avionics and Software integration approach (which includes the Integrated System Health Management (ISHM) functions), both within the CLV, and across the CEV interface; it addresses the requirements to be met, logistics of meeting those requirements, and the roles of the various groups. The Avionics Integration and Vehicle Systems Test (ANST) Office was established at the MSFC with system engineering responsibilities for defining and developing the integrated CLV Avionics and Software system. The AIVST Office has defined two Groups, the Avionics and Software Integration Group (AVSIG), and the Integrated System Simulation and Test Integration Group (ISSTIG), and four Panels which will direct trade studies and analyses to ensure the CLV avionics and software meet CLV system and CEV interface requirements. The four panels are: 1) Avionics Integration Panel (AIP), 2) Software Integration Panel, 3) EEE Panel, and 4) Systems Simulation and Test Panel. Membership on the groups and panels includes the MSFC representatives from the requisite engineering disciplines, the First Stage, the Upper Stage, the Upper Stage Engine projects, and key personnel from other NASA centers. The four panels will take the results of trade studies and analyses and develop documentation in support of Design Analysis Cycle Reviews and ultimately the System Requirements Review.

Development of a hip joint model for finite volume simulations.

PubMed

Cardiff, P; Karač, A; FitzPatrick, D; Ivanković, A

2014-01-01

This paper establishes a procedure for numerical analysis of a hip joint using the finite volume method. Patient-specific hip joint geometry is segmented directly from computed tomography and magnetic resonance imaging datasets and the resulting bone surfaces are processed into a form suitable for volume meshing. A high resolution continuum tetrahedral mesh has been generated, where a sandwich model approach is adopted; the bones are represented as a stiffer cortical shells surrounding more flexible cancellous cores. Cartilage is included as a uniform thickness extruded layer and the effect of layer thickness is investigated. To realistically position the bones, gait analysis has been performed giving the 3D positions of the bones for the full gait cycle. Three phases of the gait cycle are examined using a finite volume based custom structural contact solver implemented in open-source software OpenFOAM.

Status report of the SRT radiotelescope control software: the DISCOS project

NASA Astrophysics Data System (ADS)

Orlati, A.; Bartolini, M.; Buttu, M.; Fara, A.; Migoni, C.; Poppi, S.; Righini, S.

2016-08-01

The Sardinia Radio Telescope (SRT) is a 64-m fully-steerable radio telescope. It is provided with an active surface to correct for gravitational deformations, allowing observations from 300 MHz to 100 GHz. At present, three receivers are available: a coaxial LP-band receiver (305-410 MHz and 1.5-1.8 GHz), a C-band receiver (5.7-7.7 GHz) and a 7-feed K-band receiver (18-26.5 GHz). Several back-ends are also available in order to perform the different data acquisition and analysis procedures requested by scientific projects. The design and development of the SRT control software started in 2004, and now belongs to a wider project called DISCOS (Development of the Italian Single-dish COntrol System), which provides a common infrastructure to the three Italian radio telescopes (Medicina, Noto and SRT dishes). DISCOS is based on the Alma Common Software (ACS) framework, and currently consists of more than 500k lines of code. It is organized in a common core and three specific product lines, one for each telescope. Recent developments, carried out after the conclusion of the technical commissioning of the instrument (October 2013), consisted in the addition of several new features in many parts of the observing pipeline, spanning from the motion control to the digital back-ends for data acquisition and data formatting; we brie y describe such improvements. More importantly, in the last two years we have supported the astronomical validation of the SRT radio telescope, leading to the opening of the first public call for proposals in late 2015. During this period, while assisting both the engineering and the scientific staff, we massively employed the control software and were able to test all of its features: in this process we received our first feedback from the users and we could verify how the system performed in a real-life scenario, drawing the first conclusions about the overall system stability and performance. We examine how the system behaves in terms of network load and system load, how it reacts to failures and errors, and what components and services seem to be the most critical parts of our architecture, showing how the ACS framework impacts on these aspects. Moreover, the exposure to public utilization has highlighted the major flaws in our development and software management process, which had to be tuned and improved in order to achieve faster release cycles in response to user feedback, and safer deploy operations. In this regard we show how the introduction of testing practices, along with continuous integration, helped us to meet higher quality standards. Having identified the most critical aspects of our software, we conclude showing our intentions for the future development of DISCOS, both in terms of software features and software infrastructures.