Sample records for solfataricus p2 binds

  1. Expression of a synthetic gene encoding P2 ribonuclease from the extreme thermoacidophilic archaebacterium Sulfolobus solfataricus in mesophylic hosts.


    Fusi, P; Grisa, M; Mombelli, E; Consonni, R; Tortora, P; Vanoni, M


    This work reports the molecular cloning and expression of a synthetic gene encoding P2, a 7-kDa ribonuclease (RNase) previously isolated in our laboratory from the archaebacterium Sulfolobus solfataricus [Fusi et al., Eur. J. Biochem. 211 (1993) 305-310]. The P2-encoding synthetic gene was expressed in E. coli and in Saccharomyces cerevisiae. The recombinant (re-) protein was produced to approx. 1.5% of the total protein content in S. cerevisiae using the galactose-inducible GAL1 promoter and to 3% (tac/lac tandem promoters) or 6.5% (T7 promoter) in E. coli as judged by immunological and biochemical criteria. E. coli-produced P2 was purified to electrophoretic homogeneity through a one-step procedure, i.e., DEAE-Sephacel chromatography at pH 9.3. S. cerevisiae-produced P2 additionally required filtration through a Centricon-10 microconcentrator to obtain the same purity. The re-P2 was found to be indistinguishable from the Su. solfataricus enzyme on the basis of heat stability, pH optimum and RNA digestion pattern. Furthermore, monodimensional nuclear magnetic resonance showed that the E. coli- and Su. solfataricus-produced enzymes were structurally identical, the only exceptions being that Lys4 and Lys6 were not methylated in the re-enzyme, thus showing that lysine methylation does not play a role in P2 thermostabilization.

  2. Proteomic mapping of the hyperthermophilic and acidophilic archaeon Sulfolobus solfataricus P2

    SciTech Connect

    Barry, Richard C.; Young, Mark J.; Stedman, Kenneth M.; Dratz, Edward A.


    A proteomic map of Sulfolobus solfataricus P2, an archaeon that grows optimally at 80 C and pH 3.2, was developed using high resolution two-dimensional gel electrophoresis and peptide mass fingerprinting. A total of 867 protein spots (659 aqueous tris-soluble spots and 208 aqueous tris-insoluble) were mapped over IPG 3-10, 4-7, and 6-11, with second dimension gels made of 8-18% polyacrylamide. 324 different gene products were represented by the 867 spots, with 274 gene products being identified in the tris-soluble fractions and 100 gene products in the tris-insoluble portion. Fifty gene products were found on gels from both fractions. Additionally, an average of 1.50 + 0.12 isoforms/per protein were identified. This mapping study confirmed the expression of proteins involved in numerous metabolic, transport, energy production, nucleic acid replication, translation, and transcription pathways. Of particular interest, phosphoenolpyruvate carboxykinase (SSO2537) was detected even though the pathway for gluconeogenesis is unknown for this archaeon. Tris-soluble fractions contained many cytosolic proteins while tris-insoluble fractions contained many membrane-associated proteins, including ABC transporters and an ATP synthase. This study provides an optimized 2-DE approach for investigating the biochemical pathways and post-translational modifications employed by Sulfolobus to survive in its extreme environment.

  3. Functional curation of the Sulfolobus solfataricus P2 and S. acidocaldarius 98-3 complete genome sequences.


    Esser, Domink; Kouril, Theresa; Zaparty, Melanie; Sierocinski, Pawel; Chan, Patricia P; Lowe, Todd; Van der Oost, John; Albers, Sonja-Verena; Schomburg, Dietmar; Makarova, Kira S; Siebers, Bettina


    The thermoacidophiles Sulfolobus solfataricus P2 and S. acidocaldarius 98-3 are considered key model organisms representing a major phylum of the Crenarchaeota. Because maintaining current, accurate genome information is indispensable for modern biology, we have updated gene function annotation using the arCOGs database, plus other available functional, structural and phylogenetic information. The goal of this initiative is continuous improvement of genome annotation with the support of the Sulfolobus research community.

  4. Surface-exposed glycoproteins of hyperthermophilic Sulfolobus solfataricus P2 show a common N-glycosylation profile.


    Palmieri, Gianna; Balestrieri, Marco; Peter-Katalinić, Jasna; Pohlentz, Gottfried; Rossi, Mosè; Fiume, Immacolata; Pocsfalvi, Gabriella


    Cell surface proteins of hyperthermophilic Archaea actively participate in intercellular communication, cellular uptake, and energy conversion to sustain survival strategies in extreme habitats. Surface (S)-layer glycoproteins, the major component of the S-layers in many archaeal species and the best-characterized prokaryotic glycoproteins, were shown to have a large structural diversity in their glycan compositions. In spite of this, knowledge on glycosylation of proteins other than S-layer proteins in Archaea is quite limited. Here, the N-glycosylation pattern of cell-surface-exposed proteins of Sulfolobus solfataricus P2 were analyzed by lectin affinity purification, HPAEC-PAD, and multiple mass spectrometry-based techniques. Detailed analysis of SSO1273, one of the most abundant ABC transporters present in the cell surface fraction of S. solfataricus, revealed a novel glycan structure composed of a branched sulfated heptasaccharide, Hex4(GlcNAc)2 plus sulfoquinovose where Hex is d-mannose and d-glucose. Having one monosaccharide unit more than the glycan of the S-layer glycoprotein of S. acidocaldarius, this is the most complex archaeal glycan structure known today. SSO1273 protein is heavily glycosylated and all 20 theoretical N-X-S/T (where X is any amino acid except proline) consensus sequence sites were confirmed. Remarkably, we show that several other proteins in the surface fraction of S. solfataricus are N-glycosylated by the same sulfated oligosaccharide and we identified 56 N-glycosylation sites in this subproteome.

  5. Purification, crystallization and preliminary crystallographic analysis of a GTP-binding protein from the hyperthermophilic archaeon Sulfolobus solfataricus

    SciTech Connect

    Wu, Hao; Sun, Lei; Brouns, Stan J. J.; Fu, Sheng; Akerboom, Jasper; Li, Xuemei; Oost, John van der


    A GTP-binding protein from the hyperthermophilic archaeon Sulfolobus solfataricus has been crystallized. Combined with biochemical analyses, it is expected that the structure of this protein will give insight in the function of a relatively unknown subfamily of the GTPase superfamily. A predicted GTP-binding protein from the hyperthermophilic archaeon Sulfolobus solfataricus, termed SsGBP, has been cloned and overexpressed in Escherichia coli. The purified protein was crystallized using the hanging-drop vapour-diffusion technique in the presence of 0.05 M cadmium sulfate and 0.8 M sodium acetate pH 7.5. A single-wavelength anomalous dispersion data set was collected to a maximum resolution of 2.0 Å using a single cadmium-incorporated crystal. The crystal form belongs to space group P2{sub 1}2{sub 1}2{sub 1}, with approximate unit-cell parameters a = 65.0, b = 72.6, c = 95.9 Å and with a monomer in the asymmetric unit.

  6. The Sso7d DNA-binding protein from Sulfolobus solfataricus has ribonuclease activity.


    Shehi, E; Serina, S; Fumagalli, G; Vanoni, M; Consonni, R; Zetta, L; Dehò, G; Tortora, P; Fusi, P


    Sso7d is a small, basic, abundant protein from the thermoacidophilic archaeon Sulfolobus solfataricus. Previous research has shown that Sso7d can bind double-stranded DNA without sequence specificity by placing its triple-stranded beta-sheet across the minor groove. We previously found RNase activity both in preparations of Sso7d purified from its natural source and in recombinant, purified protein expressed in Escherichia coli. This paper provides conclusive evidence that supports the assignment of RNase activity to Sso7d, shown by the total absence of activity in the single-point mutants E35L and K12L, despite the preservation of their overall structure under the assay conditions. In keeping with our observation that the residues putatively involved in RNase activity and those playing a role in DNA binding are located on different surfaces of the molecule, the activity was not impaired in the presence of DNA. If a small synthetic RNA was used as a substrate, Sso7d attacked both predicted double- and single-stranded RNA stretches, with no evident preference for specific sequences or individual bases. Apparently, the more readily attacked bonds were those intrinsically more unstable.

  7. SMV1 virus-induced CRISPR spacer acquisition from the conjugative plasmid pMGB1 in Sulfolobus solfataricus P2

    PubMed Central

    Erdmann, Susanne; Shah, Shiraz A.; Garrett, Roger A.


    Organisms of the crenarchaeal order Sulfolobales carry complex CRISPR (clustered regularly interspaced short palindromic repeats) adaptive immune systems. These systems are modular and show extensive structural and functional diversity, especially in their interference complexes. The primary targets are an exceptional range of diverse viruses, many of which propagate stably within cells and follow lytic life cycles without producing cell lysis. These properties are consistent with the difficulty of activating CRISPR spacer uptake in the laboratory, but appear to conflict with the high complexity and diversity of the CRISPR immune systems that are found among the Sulfolobales. In the present article, we re-examine the first successful induction of archaeal spacer acquisition in our laboratory that occurred exclusively for the conjugative plasmid pMGB1 in Sulfolobus solfataricus P2 that was co-infected with the virus SMV1 (Sulfolobus monocaudavirus 1). Although we reaffirm that protospacer selection is essentially a random process with respect to the pMGB1 genome, we identified single spacer sequences specific for each of CRISPR loci C, D and E that, exceptionally, occurred in many sequenced clones. Moreover, the same sequence was reproducibly acquired for a given locus in independent experiments, consistent with it being the first protospacer to be selected. There was also a small protospacer bias (1.6:1) to the antisense strand of protein genes. In addition, new experiments demonstrated that spacer acquisition in the previously inactive CRISPR locus A could be induced on freeze–thawing of the infected cells, suggesting that environmental stress can facilitate activation. Coincidentally with spacer acquisition, a mobile OrfB element was deleted from pMGB1, suggesting that interplay can occur between spacer acquisition and transposition. PMID:24256236

  8. SMV1 virus-induced CRISPR spacer acquisition from the conjugative plasmid pMGB1 in Sulfolobus solfataricus P2.


    Erdmann, Susanne; Shah, Shiraz A; Garrett, Roger A


    Organisms of the crenarchaeal order Sulfolobales carry complex CRISPR (clustered regularly interspaced short palindromic repeats) adaptive immune systems. These systems are modular and show extensive structural and functional diversity, especially in their interference complexes. The primary targets are an exceptional range of diverse viruses, many of which propagate stably within cells and follow lytic life cycles without producing cell lysis. These properties are consistent with the difficulty of activating CRISPR spacer uptake in the laboratory, but appear to conflict with the high complexity and diversity of the CRISPR immune systems that are found among the Sulfolobales. In the present article, we re-examine the first successful induction of archaeal spacer acquisition in our laboratory that occurred exclusively for the conjugative plasmid pMGB1 in Sulfolobus solfataricus P2 that was co-infected with the virus SMV1 (Sulfolobus monocaudavirus 1). Although we reaffirm that protospacer selection is essentially a random process with respect to the pMGB1 genome, we identified single spacer sequences specific for each of CRISPR loci C, D and E that, exceptionally, occurred in many sequenced clones. Moreover, the same sequence was reproducibly acquired for a given locus in independent experiments, consistent with it being the first protospacer to be selected. There was also a small protospacer bias (1.6:1) to the antisense strand of protein genes. In addition, new experiments demonstrated that spacer acquisition in the previously inactive CRISPR locus A could be induced on freeze-thawing of the infected cells, suggesting that environmental stress can facilitate activation. Coincidentally with spacer acquisition, a mobile OrfB element was deleted from pMGB1, suggesting that interplay can occur between spacer acquisition and transposition.

  9. Enzymatic synthesis of dimaltosyl-{beta}-cyclodextrin via a transglycosylation reaction using TreX, a Sulfolobus solfataricus P2 debranching enzyme

    SciTech Connect

    Kang, Hee-Kwon; Cha, Hyunju; Yang, Tae-Joo; Park, Jong-Tae; Lee, Seungjae; Kim, Young-Wan; Auh, Joong-Hyuck; Okada, Yasuyo; Kim, Jung-Wan; Cha, Jaeho; Kim, Chung Ho; Park, Kwan-Hwa


    Di-O-{alpha}-maltosyl-{beta}-cyclodextrin ((G2){sub 2}-{beta}-CD) was synthesized from 6-O-{alpha}-maltosyl-{beta}-cyclodextrin (G2-{beta}-CD) via a transglycosylation reaction catalyzed by TreX, a debranching enzyme from Sulfolobus solfataricus P2. TreX showed no activity toward glucosyl-{beta}-CD, but a transfer product (1) was detected when the enzyme was incubated with maltosyl-{beta}-CD, indicating specificity for a branched glucosyl chain bigger than DP2. Analysis of the structure of the transfer product (1) using MALDI-TOF/MS and isoamylase or glucoamylase treatment revealed it to be dimaltosyl-{beta}-CD, suggesting that TreX transferred the maltosyl residue of a G2-{beta}-CD to another molecule of G2-{beta}-CD by forming an {alpha}-1,6-glucosidic linkage. When [{sup 14}C]-maltose and maltosyl-{beta}-CD were reacted with the enzyme, the radiogram showed no labeled dimaltosyl-{beta}-CD; no condensation product between the two substrates was detected, indicating that the synthesis of dimaltosyl-{beta}-CD occurred exclusively via transglycosylation of an {alpha}-1,6-glucosidic linkage. Based on the HPLC elution profile, the transfer product (1) was identified to be isomers of 6{sup 1},6{sup 3}- and 6{sup 1},6{sup 4}-dimaltosyl-{beta}-CD. Inhibition studies with {beta}-CD on the transglycosylation activity revealed that {beta}-CD was a mixed-type inhibitor, with a K{sub i} value of 55.6 {mu}mol/mL. Thus, dimaltosyl-{beta}-CD can be more efficiently synthesized by a transglycosylation reaction with TreX in the absence of {beta}-CD. Our findings suggest that the high yield of (G2){sub 2}-{beta}-CD from G2-{beta}-CD was based on both the transglycosylation action mode and elimination of the inhibitory effect of {beta}-CD.

  10. Identification of a system required for the functional surface localization of sugar binding proteins with class III signal peptides in Sulfolobus solfataricus.


    Zolghadr, Behnam; Weber, Stefan; Szabó, Zalán; Driessen, Arnold J M; Albers, Sonja-Verena


    The hyperthermophilic archaeon Sulfolobus solfataricus contains an unusual large number of sugar binding proteins that are synthesized as precursors with a class III signal peptide. Such signal peptides are commonly used to direct archaeal flagellin subunits or bacterial (pseudo)pilins into extracellular macromolecular surface appendages. Likewise, S. solfataricus binding proteins have been suggested to assemble in higher ordered surface structures as well, tentatively termed the bindosome. Here we show that S. solfataricus contains a specific system that is needed for the functional surface localization of sugar binding proteins. This system, encoded by the bas (bindosome assembly system) operon, is composed of five proteins: basABC, three homologues of so-called bacterial (pseudo)pilins; BasE, a cytoplasmic ATPase; and BasF, an integral membrane protein. Deletion of either the three (pseudo)pilin genes or the basEF genes resulted in a severe defect of the cells to grow on substrates which are transported by sugar binding proteins containing class III signal peptides, while growth on glucose and maltose was restored when the corresponding genes were reintroduced in these cells. Concomitantly, DeltabasABC and DeltabasEF cells were severely impaired in glucose uptake even though the sugar binding proteins were normally secreted across the cytoplasmic membrane. These data underline the hypothesis that the bas operon is involved in the functional localization of sugar binding proteins at the cell surface of S. solfataricus. In contrast to surface structure assembly systems of Gram-negative bacteria, the bas operon seems to resemble an ancestral simplified form of these machineries.

  11. Identification and properties of the crenarchaeal single-stranded DNA binding protein from Sulfolobus solfataricus

    PubMed Central

    Wadsworth, Ross I. M.; White, Malcolm F.


    Single-stranded DNA binding proteins (SSBs) play central roles in cellular and viral processes involving the generation of single-stranded DNA. These include DNA replication, homologous recombination and DNA repair pathways. SSBs bind DNA using four ‘OB-fold’ (oligonucleotide/oligosaccharide binding fold) domains that can be organised in a variety of overall quaternary structures. Thus eubacterial SSBs are homotetrameric whilst the eucaryal RPA protein is a heterotrimer and euryarchaeal proteins vary significantly in their subunit compositions. We demonstrate that the crenarchaeal SSB protein is an abundant protein with a unique structural organisation, existing as a monomer in solution and multimerising on DNA binding. The protein binds single-stranded DNA distributively with a binding site size of ~5 nt per monomer. Sulfolobus SSB lacks the zinc finger motif found in the eucaryal and euryarchaeal proteins, possessing instead a flexible C-terminal tail, sensitive to trypsin digestion, that is not required for DNA binding. In comparison with Escherichia coli SSB, the tail may play a role in protein–protein interactions during DNA replication and repair. PMID:11160923

  12. Extreme heat- and pressure-resistant 7-kDa protein P2 from the archaeon Sulfolobus solfataricus is dramatically destabilized by a single-point amino acid substitution.


    Fusi, P; Goossens, K; Consonni, R; Grisa, M; Puricelli, P; Vecchio, G; Vanoni, M; Zetta, L; Heremans, K; Tortora, P


    This study reports the characterization of the recombinant 7-kDa protein P2 from Sulfolobus solfataricus and the mutants F31A and F31Y with respect to temperature and pressure stability. As observed in the NMR, FTIR, and CD spectra, wild-type protein and mutants showed substantially similar structures under ambient conditions. However, midpoint transition temperatures of the denaturation process were 361, 334, and 347 K for wild type, F31A, and F31Y mutants, respectively: thus, alanine substitution of phenylalanine destabilized the protein by as much as 27 K. Midpoint transition pressures for wild type and F31Y mutant could not be accurately determined because they lay either beyond (wild type) or close to (F31Y) 14 kbar, a pressure at which water undergoes a phase transition. However, a midpoint transition pressure of 4 kbar could be determined for the F31A mutant, implying a shift in transition of at least 10 kbar. The pressure-induced denaturation was fully reversible; in contrast, thermal denaturation of wild type and mutants was only partially reversible. To our knowledge, both the pressure resistance of protein P2 and the dramatic pressure and temperature destabilization of the F31A mutant are unprecedented. These properties may be largely accounted for by the role of an aromatic cluster where Phe31 is found at the core, because interactions among aromatics are believed to be almost pressure insensitive; furthermore, the alanine substitution of phenylalanine should create a cavity with increased compressibility and flexibility, which also involves an impaired pressure and temperature resistance.

  13. Structural insight into DNA binding and oligomerization of the multifunctional Cox protein of bacteriophage P2.


    Berntsson, Ronnie P-A; Odegrip, Richard; Sehlén, Wilhelmina; Skaar, Karin; Svensson, Linda M; Massad, Tariq; Högbom, Martin; Haggård-Ljungquist, Elisabeth; Stenmark, Pål


    The Cox protein from bacteriophage P2 is a small multifunctional DNA-binding protein. It is involved in site-specific recombination leading to P2 prophage excision and functions as a transcriptional repressor of the P2 Pc promoter. Furthermore, it transcriptionally activates the unrelated, defective prophage P4 that depends on phage P2 late gene products for lytic growth. In this article, we have investigated the structural determinants to understand how P2 Cox performs these different functions. We have solved the structure of P2 Cox to 2.4 Å resolution. Interestingly, P2 Cox crystallized in a continuous oligomeric spiral with its DNA-binding helix and wing positioned outwards. The extended C-terminal part of P2 Cox is largely responsible for the oligomerization in the structure. The spacing between the repeating DNA-binding elements along the helical P2 Cox filament is consistent with DNA binding along the filament. Functional analyses of alanine mutants in P2 Cox argue for the importance of key residues for protein function. We here present the first structure from the Cox protein family and, together with previous biochemical observations, propose that P2 Cox achieves its various functions by specific binding of DNA while wrapping the DNA around its helical oligomer.

  14. An HflX-type GTPase from Sulfolobus solfataricus binds to the 50S ribosomal subunit in all nucleotide-bound states.


    Blombach, Fabian; Launay, Helene; Zorraquino, Violeta; Swarts, Daan C; Cabrita, Lisa D; Benelli, Dario; Christodoulou, John; Londei, Paola; van der Oost, John


    HflX GTPases are found in all three domains of life, the Bacteria, Archaea, and Eukarya. HflX from Escherichia coli has been shown to bind to the 50S ribosomal subunit in a nucleotide-dependent manner, and this interaction strongly stimulates its GTPase activity. We recently determined the structure of an HflX ortholog from the archaeon Sulfolobus solfataricus (SsoHflX). It revealed the presence of a novel HflX domain that might function in RNA binding and is linked to a canonical G domain. This domain arrangement is common to all archaeal, bacterial, and eukaryotic HflX GTPases. This paper shows that the archaeal SsoHflX, like its bacterial orthologs, binds to the 50S ribosomal subunit. This interaction does not depend on the presence of guanine nucleotides. The HflX domain is sufficient for ribosome interaction. Binding appears to be restricted to free 50S ribosomal subunits and does not occur with 70S ribosomes engaged in translation. The fingerprint (1)H-(15)N heteronuclear correlation nuclear magnetic resonance (NMR) spectrum of SsoHflX reveals a large number of well-resolved resonances that are broadened upon binding to the 50S ribosomal subunit. The GTPase activity of SsoHflX is stimulated by crude fractions of 50S ribosomal subunits, but this effect is lost with further high-salt purification of the 50S ribosomal subunits, suggesting that the stimulation depends on an extrinsic factor bound to the 50S ribosomal subunit. Our results reveal common properties but also marked differences between archaeal and bacterial HflX proteins.

  15. Expression, purification, crystallization and structure of human adipocyte lipid-binding protein (aP2)

    SciTech Connect

    Marr, Eric; Tardie, Mark; Carty, Maynard; Brown Phillips, Tracy; Wang, Ing-Kae; Soeller, Walt; Qiu, Xiayang Karam, George


    The crystal structure of human adipocyte lipid-binding protein (aP2) with a bound palmitate is reported at 1.5 Å resolution. Human adipocyte lipid-binding protein (aP2) belongs to a family of intracellular lipid-binding proteins involved in the transport and storage of lipids. Here, the crystal structure of human aP2 with a bound palmitate is described at 1.5 Å resolution. Unlike the known crystal structure of murine aP2 in complex with palmitate, this structure shows that the fatty acid is in a folded conformation and that the loop containing Phe57 acts as a lid to regulate ligand binding by excluding solvent exposure to the central binding cavity.

  16. The Arginine Pairs and C-Termini of the Sso7c4 from Sulfolobus solfataricus Participate in Binding and Bending DNA

    PubMed Central

    Huang, Chun-Hsiang; Ko, Tzu-Ping; Chiang, Cheng-Hung; Lin, Kuan-Fu; Chang, Yuan-Chih; Lin, Po-Yen; Tsai, Hui-Hsu Gavin; Wang, Andrew H.-J.


    The Sso7c4 from Sulfolobus solfataricus forms a dimer, which is believed to function as a chromosomal protein involved in genomic DNA compaction and gene regulation. Here, we present the crystal structure of wild-type Sso7c4 at a high resolution of 1.63 Å, showing that the two basic C-termini are disordered. Based on the fluorescence polarization (FP) binding assay, two arginine pairs, R11/R22′ and R11′/R22, on the top surface participate in binding DNA. As shown in electron microscopy (EM) images, wild-type Sso7c4 compacts DNA through bridging and bending interactions, whereas the binding of C-terminally truncated proteins rigidifies and opens DNA molecules, and no compaction of the DNA occurs. Moreover, the FP, EM and fluorescence resonance energy transfer (FRET) data indicated that the two basic and flexible C-terminal arms of the Sso7c4 dimer play a crucial role in binding and bending DNA. Sso7c4 has been classified as a repressor-like protein because of its similarity to Escherichia coli Ecrep 6.8 and Ecrep 7.3 as well as Agrobacterium tumefaciens ACCR in amino acid sequence. Based on these data, we proposed a model of the Sso7c4-DNA complex using a curved DNA molecule in the catabolite activator protein-DNA complex. The DNA end-to-end distance measured with FRET upon wild-type Sso7c4 binding is almost equal to the distance measured in the model, which supports the fidelity of the proposed model. The FRET data also confirm the EM observation showing that the binding of wild-type Sso7c4 reduces the DNA length while the C-terminal truncation does not. A functional role for Sso7c4 in the organization of chromosomal DNA and/or the regulation of gene expression through bridging and bending interactions is suggested. PMID:28068385

  17. Molecular mechanism of ATP binding and ion channel activation in P2X receptors

    SciTech Connect

    Hattori, Motoyuki; Gouaux, Eric


    P2X receptors are trimeric ATP-activated ion channels permeable to Na{sup +}, K{sup +} and Ca{sup 2+}. The seven P2X receptor subtypes are implicated in physiological processes that include modulation of synaptic transmission, contraction of smooth muscle, secretion of chemical transmitters and regulation of immune responses. Despite the importance of P2X receptors in cellular physiology, the three-dimensional composition of the ATP-binding site, the structural mechanism of ATP-dependent ion channel gating and the architecture of the open ion channel pore are unknown. Here we report the crystal structure of the zebrafish P2X4 receptor in complex with ATP and a new structure of the apo receptor. The agonist-bound structure reveals a previously unseen ATP-binding motif and an open ion channel pore. ATP binding induces cleft closure of the nucleotide-binding pocket, flexing of the lower body {beta}-sheet and a radial expansion of the extracellular vestibule. The structural widening of the extracellular vestibule is directly coupled to the opening of the ion channel pore by way of an iris-like expansion of the transmembrane helices. The structural delineation of the ATP-binding site and the ion channel pore, together with the conformational changes associated with ion channel gating, will stimulate development of new pharmacological agents.

  18. Distinction in binding of peptides (P2E) and its mutations (P2G, P2Q) to a graphene sheet via a hierarchical coarse-grained Monte Carlo simulation

    NASA Astrophysics Data System (ADS)

    Pandey, R. B.; Farmer, B. L.


    A hierarchical coarse-grained approach is used to study the binding of peptides (P2E: 1E2P3L4Q5L6K7M) and variants (P2G: 1G2P3L4Q5L6K7M and P2Q: 1Q2L3P4M5E6K7L) with a graphene sheet. Simulation-based residue-substrate and hydropathy index-based residue-residue interaction is used as input to a phenomenological interaction potential for peptide chains to execute the stochastic motion with a graphene sheet at the center of a box. Large-scale Monte Carlo simulations are performed at a range (low to high) of temperatures to identify peptides binding with the graphene sheet with a constant peptide concentration (Cp = 0.01). A number of local (energy, mobility, and substrate contact profiles) and global (density profiles, mean square displacement of the center of mass of a peptide and its radius of gyration) physical quantities are examined to monitor the patterns. We find that each peptide can bind to a graphene sheet at low temperatures but the residues that can anchor their binding vary among these three peptides. For example, P2E is anchored by 1E, 4Q, and 6K, P2Q by 1Q, 5E, and 6K, and P2G by nearly all its residues with about the same strength except 1G and 2P. The site-specific binding is reflected in the thermal response of the radius of gyration of the peptides. Despite the lack of a large difference in binding patterns, a systematic variation in radius of gyration and surface binding profile with the temperature reveals the distinction in their binding: the probability of P2E binding is the highest and that of P2G is the lowest.

  19. Ribonucleases from the extreme thermophilic archaebacterium S. solfataricus.


    Fusi, P; Tedeschi, G; Aliverti, A; Ronchi, S; Tortora, P; Guerritore, A


    A purification procedure consisting of DEAE-Sephacel chromatography, heparin-Sepharose CL-6B chromatography and Mono-S chromatography led to the isolation of three proteins endowed with RNase activity from the thermoacidophilic archaebacterium Sulfolobus solfataricus. They were referred to as p1, p2 and p3, according to their elution order from the Mono-S column. Complete amino acid sequence of p2 and partial sequence of p3 displayed high sequence similarity to the 7-kDa DNA-binding proteins previously isolated in Sulfolobus strains [Choli, T., Wittman-Liebold, B. & Reinhardt, R. (1988) J. Biol. Chem. 263, 7087-7093]. The molecular mass of p2, calculated from sequence data, was 7.02 kDa, which compares fairly well with the value of 7.4 kDa determined by SDS/PAGE. Gel filtration of the molecule under native conditions displayed, however, a largely prevailing form with an assessed molecular mass of 13.0 kDa, which points to a dimeric structure. Kinetic characterization of protein p2 showed a broad pH optimum in the range 6.7-7.6 using yeast RNA as substrate; also, it was shown that activity was unaffected by EDTA, Mg2+ and phosphate. The enzyme did not accept as substrate any homopolyribonucleotide, which points to a rather narrow substrate specificity. This was also confirmed by incubating p2 with tRNA(fMet)Met (fMet, N-formylmethionine) from Escherichia coli: the hydrolysis products were thus identified as 3'-phosphooligonucleotides.

  20. Cangrelor inhibits the binding of the active metabolites of clopidogrel and prasugrel to P2Y12 receptors in vitro.


    Judge, Heather M; Buckland, Robert J; Jakubowski, Joseph A; Storey, Robert F


    Cangrelor is a rapid-acting, direct-binding, and reversible P2Y12 antagonist which has been studied for use during percutaneous coronary intervention (PCI) in patients with or without pretreatment with an oral P2Y12 antagonist. As cangrelor is administered intravenously, it is necessary to switch to an oral P2Y12 antagonist following PCI, such as the thienopyridines clopidogrel, and prasugrel or the non-pyridine ticagrelor. Previous studies have suggested a negative pharmacodynamic interaction between cangrelor and thienopyridines. This in vitro study evaluated the receptor-level interaction between cangrelor and the active metabolite (AM) of clopidogrel or prasugrel by assessing functional P2Y12 receptor number using a (33)P-2MeSADP binding assay. All P2Y12 antagonists studied resulted in strong P2Y12 receptor blockade (cangrelor: 93.6%; clopidogrel AM: 93.0%; prasugrel AM: 97.9%). Adding a thienopyridine AM in the presence of cangrelor strongly reduces P2Y12 receptor blockade by the AM (clopidogrel AM: 7%, prasugrel AM: 3.2%). The thienopyridine AMs had limited ability to compete with cangrelor for binding to P2Y12 (% P2Y12 receptor blockade after co-incubation with cangrelor 1000 nmol/L: 11.7% for clopidogrel AM 3 µmol/L; 34.1% for prasugrel AM 3 µmol/L). In conclusion, in vitro cangrelor strongly inhibits the binding of clopidogrel and prasugrel AMs to the P2Y12 receptor, consistent with the previous observation of a negative pharmacodynamic interaction. Care may need to be taken to not overlap exposure to thienopyridine AMs and cangrelor in order to reduce the risk of thrombotic complications following PCI.

  1. Phospholipase Cζ binding to PtdIns(4,5)P2 requires the XY-linker region

    PubMed Central

    Nomikos, Michail; Elgmati, Khalil; Theodoridou, Maria; Calver, Brian L.; Nounesis, George; Swann, Karl; Lai, F. Anthony


    Phospholipase C-zeta (PLCζ) is a strong candidate for the mammalian sperm-derived factor that triggers the Ca2+ oscillations required for egg activation at fertilization. PLCζ lacks a PH domain, which targets PLCδ1 to the phosphatidylinositol 4,5-bisphosphate (PtdIns(4,5)P2) substrate in the plasma membrane. Previous studies failed to detect PLCζ in the plasma membrane, hence the means of PLCζ binding to PtdIns(4,5)P2 is unclear. We find that the PLCζ XY linker, but not the C2 domain, exhibits robust binding to PtdIns(4,5)P2 or to liposomes containing near-physiological levels of PtdIns(4,5)P2. The role of positively charged residues within the XY linker was addressed by sequentially substituting alanines for three lysine residues, K374, K375 and K377. Microinjection of these mutants into mouse eggs enabled their Ca2+ oscillation-inducing activities to be compared with wild-type PLCζ. The XY-linker mutant proteins were purified and the in vitro PtdIns(4,5)P2 hydrolysis and binding properties were monitored. Successive reduction of net positive charge within the PLCζ XY linker significantly affects both in vivo Ca2+-oscillation-inducing activity and in vitro PtdIns(4,5)P2 interaction of mouse PLCζ. Our data suggest that positively charged residues within the XY linker play an important role in the PLCζ interaction with PtdIns(4,5)P2, a crucial step in generating the Ca2+ activation signal that is essential for fertilization in mammals. PMID:21730019

  2. Evidence for co-operativity in coenzyme binding to tetrameric Sulfolobus solfataricus alcohol dehydrogenase and its structural basis: fluorescence, kinetic and structural studies of the wild-type enzyme and non-co-operative N249Y mutant

    PubMed Central


    The interaction of coenzyme with thermostable homotetrameric NAD(H)-dependent alcohol dehydrogenase from the thermoacidophilic sulphur-dependent crenarchaeon Sulfolobus solfataricus (SsADH) and its N249Y (Asn-249→Tyr) mutant was studied using the high fluorescence sensitivity of its tryptophan residues Trp-95 and Trp-117 to the binding of coenzyme moieties. Fluorescence quenching studies performed at 25 °C show that SsADH exhibits linearity in the NAD(H) binding [the Hill coefficient (h)∼1) at pH 9.8 and at moderate ionic strength, in addition to positive co-operativity (h=2.0–2.4) at pH 7.8 and 6.8, and at pH 9.8 in the presence of salt. Furthermore, NADH binding is positively co-operative below 20 °C (h∼3) and negatively co-operative at 40–50 °C (h∼0.7), as determined at moderate ionic strength and pH 9.8. Steady-state kinetic measurements show that SsADH displays standard Michaelis–Menten kinetics between 35 and 45 °C, but exhibits positive and negative co-operativity for NADH oxidation below (h=3.3 at 20 °C) and above (h=0.7 at 70–80 °C) this range of temperatures respectively. However, N249Y SsADH displays non-co-operative behaviour in coenzyme binding under the same experimental conditions used for the wild-type enzyme. In loop 270–275 of the coenzyme domain and segments at the interface of dimer A–B, analyses of the wild-type and mutant SsADH structures identified the structural elements involved in the intersubunit communication and suggested a possible structural basis for co-operativity. This is the first report of co-operativity in a tetrameric ADH and of temperature-induced co-operativity in a thermophilic enzyme. PMID:15651978

  3. An 8.5-kDa ribonuclease from the extreme thermophilic archaebacterium Sulfolobus solfataricus.


    Fusi, P; Grisa, M; Tedeschi, G; Negri, A; Guerritore, A; Tortora, P


    Protein p3, a ribonuclease we previously isolated from the archaebacterium Sulfolobus solfataricus [P. Fusi et al. (1993) Eur. J. Biochem. 211, 305-310], was subjected to complete amino acid sequencing. It consisted of 75 residues, with a calculated M(r) of 8582, a pI of 10.1, and had some degree of monomethylation at Lys-4 and Lys-6. p2, a previously sequenced, 62-residue ribonuclease from the same organism, had an identical sequence for 57 consecutive residues starting from the N-terminus. p2 and p3 also showed a striking similarity to five other proteins previously isolated from Sulfolobus strains and identified as DNA-binding proteins. However, the C-terminus, 10 residue region of p3 did not show any similarity to these proteins; in contrast, it was significantly similar to stretches in three eubacterial ribonucleases from Bacillus strains. No difference between p2 and p3 has so far been detected as regards their catalytic properties. Available data suggest that these molecules have a narrow substrate specificity and probably play specific roles in RNA processing.

  4. Validation of Alexa-647-ATP as a powerful tool to study P2X receptor ligand binding and desensitization.


    Bhargava, Yogesh; Nicke, Annette; Rettinger, Jürgen


    Ion channel opening and desensitization is a fundamental process in neurotransmission. The ATP-gated P2X1 receptor (P2X1R) shows rapid and long-lasting desensitization upon agonist binding. This makes the electrophysiological investigation of its desensitization process, agonist unbinding, and recovery from desensitization a challenging task. Here, we show that the fluorescent agonist Alexa-647-ATP is a potent agonist at the P2X1R and a versatile tool to directly visualize agonist binding and unbinding. We demonstrate that the long-lasting desensitization of the P2X1R is due to both slow unbinding of agonist from the desensitized receptor and agonist mediated receptor internalization. Furthermore, the unbinding of the agonist Alexa-647-ATP from the desensitized receptor is accelerated in the continuous presence of competitive ligand. Modeling of our data indicates that three agonist molecules are required to drive the receptor into desensitization. Direct visualization of ligand unbinding from the desensitized receptor demonstrates the cooperativity of this process.

  5. Regulation of expression of the arabinose and glucose transporter genes in the thermophilic archaeon Sulfolobus solfataricus.


    Lubelska, Joanna M; Jonuscheit, Melanie; Schleper, Christa; Albers, Sonja-Verena; Driessen, Arnold J M


    Sugar uptake in Sulfolobus solfataricus, a thermoacidophilic archaeon, occurs through high-affinity binding of protein-dependent ABC transporters. We have investigated the expression patterns of two sugar transport operons, that is, the glucose and arabinose transporters. Analysis of the araS promoter activity, and the mRNA and protein levels in S. solfataricus cells grown on different carbon sources showed that expression of the arabinose transporter gene cluster is highly regulated and dependent on the presence of arabinose in the medium. Glucose in the growth medium repressed the expression of the arabinose transport genes. By means of primer extension, the transcriptional start site for the arabinose operon was mapped. Interestingly, expression of the arabinose transporter is down-regulated by addition of a selective set of amino acids to the medium. Expression of the glucose transporter genes appeared constitutive. These data confirm the earlier observation of a catabolite repression-like system in S. solfataricus.

  6. Lactococcal bacteriophage p2 receptor-binding protein structure suggests a common ancestor gene with bacterial and mammalian viruses.


    Spinelli, Silvia; Desmyter, Aline; Verrips, C Theo; de Haard, Hans J W; Moineau, Sylvain; Cambillau, Christian


    Lactococcus lactis is a Gram-positive bacterium used extensively by the dairy industry for the manufacture of fermented milk products. The double-stranded DNA bacteriophage p2 infects specific L. lactis strains using a receptor-binding protein (RBP) located at the tip of its noncontractile tail. We have solved the crystal structure of phage p2 RBP, a homotrimeric protein composed of three domains: the shoulders, a beta-sandwich attached to the phage; the neck, an interlaced beta-prism; and the receptor-recognition head, a seven-stranded beta-barrel. We used the complex of RBP with a neutralizing llama VHH domain to identify the receptor-binding site. Structural similarity between the recognition-head domain of phage p2 and those of adenoviruses and reoviruses, which invade mammalian cells, suggests that these viruses, despite evolutionary distant targets, lack of sequence similarity and the different chemical nature of their genomes (DNA versus RNA), might have a common ancestral gene.

  7. Molecular Determinants of Phosphatidylinositol 4,5-Bisphosphate (PI(4,5)P2) Binding to Transient Receptor Potential V1 (TRPV1) Channels*

    PubMed Central

    Poblete, Horacio; Oyarzún, Ingrid; Olivero, Pablo; Comer, Jeffrey; Zuñiga, Matías; Sepulveda, Romina V.; Báez-Nieto, David; González Leon, Carlos; González-Nilo, Fernando; Latorre, Ramón


    Phosphatidylinositol 4,5-bisphosphate (PI(4,5)P2) has been recognized as an important activator of certain transient receptor potential (TRP) channels. More specifically, TRPV1 is a pain receptor activated by a wide range of stimuli. However, whether or not PI(4,5)P2 is a TRPV1 agonist remains open to debate. Utilizing a combined approach of mutagenesis and molecular modeling, we identified a PI(4,5)P2 binding site located between the TRP box and the S4-S5 linker. At this site, PI(4,5)P2 interacts with the amino acid residues Arg-575 and Arg-579 in the S4-S5 linker and with Lys-694 in the TRP box. We confirmed that PI(4,5)P2 behaves as a channel agonist and found that Arg-575, Arg-579, and Lys-694 mutations to alanine reduce PI(4,5)P2 binding affinity. Additionally, in silico mutations R575A, R579A, and K694A showed that the reduction in binding affinity results from the delocalization of PI(4,5)P2 in the binding pocket. Molecular dynamics simulations indicate that PI(4,5)P2 binding induces conformational rearrangements of the structure formed by S6 and the TRP domain, which cause an opening of the lower TRPV1 channel gate. PMID:25425643

  8. Transcriptomic analysis of the SSV2 infection of Sulfolobus solfataricus with and without the integrative plasmid pSSVi.


    Ren, Yi; She, Qunxin; Huang, Li


    The fusellovirus SSV2 and the integrative plasmid pSSVi, which constitute a unique helper-satellite virus system, replicate in Sulfolobus solfataricus P2. In this study, we investigated the interplay among SSV2, pSSVi and their host by transcriptomic analysis. Following infection of S. solfataricus P2, SSV2 activated its promoters in a temporal and distributive fashion, starting from the transcription of ORF305. Expression of several host genes encoding DNA replication and transcription proteins was up-regulated, suggesting that SSV2 depended heavily on the host replication machinery for its replication. SSV2 gene expression appeared to follow a similar pattern in S. solfataricus P2 harboring pSSVi to that in S. solfataricus P2 lacking the plasmid. Several early genes of the virus were transcribed earlier and more efficiently in the presence of pSSVi than in its absence. These results provide valuable clues to the understanding of the three-way interactions among SSV2, pSSVi and the host.

  9. Two suramin binding sites are present in guinea pig but only one in murine native P2X myenteric receptors.


    Guerrero-Alba, Raquel; Valdez-Morales, Eduardo; Juárez, Esri H; Miranda-Morales, Marcela; Ramírez-Martínez, Juan F; Espinosa-Luna, Rosa; Barajas-López, Carlos


    Whole-cell patch clamp recordings were used to characterise the physiological and pharmacological properties of P2X receptors of mouse and guinea pig myenteric neurons from the small intestine. ATP application induced a rapid inward current in 95% of recorded neurons of both species when were voltage clamped at -60 mV. Concentration-response curves for ATP (1-3000 microM) yielded EC(50) values of 114 and 115 microM for mouse and guinea pig myenteric neurons, respectively, with a Hill coefficient value of 1.02 and 0.79, respectively, which were not significantly different of unity. alpha,beta-methylene ATP (100 microM) was virtually inactive in both species. Pyridoxalphophate-6-azophenyl-2',4'-disulphonic acid (0.01-30 microM) inhibited the ATP-induced currents (I(ATP)) with a different potency; being the IC(50) 0.6 and 1.8 microM in mouse and guinea pig, respectively. In mouse myenteric neurons, I(ATP) were inhibited by suramin whereas in guinea pig neurons we observed two effects, potentiation and inhibition of these currents. On guinea pig, both effects of suramin had different recovering kinetics and concentration dependency, indicating that they are mediated by at least two different binding sites. Our observations indicate that myenteric P2X receptors in these two species have different pharmacological properties.

  10. The Ca(2+) -binding protein PCaP2 located on the plasma membrane is involved in root hair development as a possible signal transducer.


    Kato, Mariko; Aoyama, Takashi; Maeshima, Masayoshi


    Plasma membrane-associated Ca(2+) -binding protein-2 (PCaP2) of Arabidopsis thaliana is a novel-type protein that binds to the Ca(2+) /calmodulin complex and phosphatidylinositol phosphates (PtdInsPs) as well as free Ca(2+) . Although the PCaP2 gene is predominantly expressed in root hair cells, it remains unknown how PCaP2 functions in root hair cells via binding to ligands. From biochemical analyses using purified PCaP2 and its variants, we found that the N-terminal basic domain with 23 amino acids (N23) is necessary and sufficient for binding to PtdInsPs and the Ca(2+) /calmodulin complex, and that the residual domain of PCaP2 binds to free Ca(2+) . In mutant analysis, a pcap2 knockdown line displayed longer root hairs than the wild-type. To examine the function of each domain in root hair cells, we over-expressed PCaP2 and its variants using the root hair cell-specific EXPANSIN A7 promoter. Transgenic lines over-expressing PCaP2, PCaP2(G2A) (second glycine substituted by alanine) and ∆23PCaP2 (lacking the N23 domain) exhibited abnormal branched and bulbous root hair cells, while over-expression of the N23 domain suppressed root hair emergence and elongation. The N23 domain was necessary and sufficient for the plasma membrane localization of GFP-tagged PCaP2. These results suggest that the N23 domain of PCaP2 negatively regulates root hair tip growth via processing Ca(2+) and PtdInsP signals on the plasma membrane, while the residual domain is involved in the polarization of cell expansion.

  11. Genome-Scale Reconstruction and Analysis of the Metabolic Network in the Hyperthermophilic Archaeon Sulfolobus Solfataricus

    PubMed Central

    Ulas, Thomas; Riemer, S. Alexander; Zaparty, Melanie; Siebers, Bettina; Schomburg, Dietmar


    We describe the reconstruction of a genome-scale metabolic model of the crenarchaeon Sulfolobus solfataricus, a hyperthermoacidophilic microorganism. It grows in terrestrial volcanic hot springs with growth occurring at pH 2–4 (optimum 3.5) and a temperature of 75–80°C (optimum 80°C). The genome of Sulfolobus solfataricus P2 contains 2,992,245 bp on a single circular chromosome and encodes 2,977 proteins and a number of RNAs. The network comprises 718 metabolic and 58 transport/exchange reactions and 705 unique metabolites, based on the annotated genome and available biochemical data. Using the model in conjunction with constraint-based methods, we simulated the metabolic fluxes induced by different environmental and genetic conditions. The predictions were compared to experimental measurements and phenotypes of S. solfataricus. Furthermore, the performance of the network for 35 different carbon sources known for S. solfataricus from the literature was simulated. Comparing the growth on different carbon sources revealed that glycerol is the carbon source with the highest biomass flux per imported carbon atom (75% higher than glucose). Experimental data was also used to fit the model to phenotypic observations. In addition to the commonly known heterotrophic growth of S. solfataricus, the crenarchaeon is also able to grow autotrophically using the hydroxypropionate-hydroxybutyrate cycle for bicarbonate fixation. We integrated this pathway into our model and compared bicarbonate fixation with growth on glucose as sole carbon source. Finally, we tested the robustness of the metabolism with respect to gene deletions using the method of Minimization of Metabolic Adjustment (MOMA), which predicted that 18% of all possible single gene deletions would be lethal for the organism. PMID:22952675

  12. Uncoupling of Obesity from Insulin Resistance Through a Targeted Mutation in aP2, the Adipocyte Fatty Acid Binding Protein

    NASA Astrophysics Data System (ADS)

    Hotamisligil, Gokhan S.; Johnson, Randall S.; Distel, Robert J.; Ellis, Ramsey; Papaioannou, Virginia E.; Spiegelman, Bruce M.


    Fatty acid binding proteins (FABPs) are small cytoplasmic proteins that are expressed in a highly tissue-specific manner and bind to fatty acids such as oleic and retinoic acid. Mice with a null mutation in aP2, the gene encoding the adipocyte FABP, were developmentally and metabolically normal. The aP2-deficient mice developed dietary obesity but, unlike control mice, they did not develop insulin resistance or diabetes. Also unlike their obese wild-type counterparts, obese aP2-/- animals failed to express in adipose tissue tumor necrosis factor-α (TNF-α), a molecule implicated in obesity-related insulin resistance. These results indicate that aP2 is central to the pathway that links obesity to insulin resistance, possibly by linking fatty acid metabolism to expression of TNF-α.

  13. Conformational flexibility of the agonist binding jaw of the human P2X3 receptor is a prerequisite for channel opening

    PubMed Central

    Kowalski, M; Hausmann, R; Dopychai, A; Grohmann, M; Franke, H; Nieber, K; Schmalzing, G; Illes, P; Riedel, T


    Background and Purpose It is assumed that ATP induces closure of the binding jaw of ligand-gated P2X receptors, which eventually results in the opening of the membrane channel and the flux of cations. Immobilization by cysteine mutagenesis of the binding jaw inhibited ATP-induced current responses, but did not allow discrimination between disturbances of binding, gating, subunit assembly or trafficking to the plasma membrane. Experimental Approach A molecular model of the pain-relevant human (h)P2X3 receptor was used to identify amino acid pairs, which were located at the lips of the binding jaw and did not participate in agonist binding but strongly approached each other even in the absence of ATP. Key Results A series of cysteine double mutant hP2X3 receptors, expressed in HEK293 cells or Xenopus laevis oocytes, exhibited depressed current responses to α,β-methylene ATP (α,β-meATP) due to the formation of spontaneous inter-subunit disulfide bonds. Reducing these bonds with dithiothreitol reversed the blockade of the α,β-meATP transmembrane current. Amino-reactive fluorescence labelling of the His-tagged hP2X3 receptor and its mutants expressed in HEK293 or X. laevis oocytes demonstrated the formation of inter-subunit cross links in cysteine double mutants and, in addition, confirmed their correct trimeric assembly and cell surface expression. Conclusions and Implications In conclusion, spontaneous tightening of the binding jaw of the hP2X3 receptor by inter-subunit cross-linking of cysteine residues substituted at positions not directly involved in agonist binding inhibited agonist-evoked currents without interfering with binding, subunit assembly or trafficking. PMID:24989924

  14. Identification of Toxoplasma TgPH1, a pleckstrin homology domain-containing protein that binds to the phosphoinositide PI(3,5)P2.


    Daher, Wassim; Morlon-Guyot, Juliette; Alayi, Tchilabalo Dilezitoko; Tomavo, Stan; Wengelnik, Kai; Lebrun, Maryse


    The phosphoinositide phosphatidylinositol-3,5-bisphosphate (PI(3,5)P2) plays crucial roles in the maintenance of lysosome/vacuole morphology, membrane trafficking and regulation of endolysosome-localized membrane channel activity. In Toxoplasma gondii, we previously reported that PI(3,5)P2 is essential for parasite survival by controlling homeostasis of the apicoplast, a particular organelle of algal origin. Here, by using a phosphoinositide pull-down assay, we identified TgPH1 in Toxoplasma a protein conserved in many apicomplexan parasites. TgPH1 binds specifically to PI(3,5)P2, shows punctate intracellular localization, but plays no vital role for tachyzoite growth in vitro. TgPH1 is a protein predominantly formed by a pleckstrin homology (PH) domain. So far, PH domains have been described to bind preferentially to bis- or trisphosphate phosphoinositides containing two adjacent phosphates (i.e. PI(3,4)P2, PI(4,5)P2, PI(3,4,5)P3). Therefore, our study reveals an unusual feature of TgPH1 which binds preferentially to PI(3,5)P2.

  15. A BAR-Domain Protein SH3P2, Which Binds to Phosphatidylinositol 3-Phosphate and ATG8, Regulates Autophagosome Formation in Arabidopsis[C][W

    PubMed Central

    Zhuang, Xiaohong; Wang, Hao; Lam, Sheung Kwan; Gao, Caiji; Wang, Xiangfeng; Cai, Yi; Jiang, Liwen


    Autophagy is a well-defined catabolic mechanism whereby cytoplasmic materials are engulfed into a structure termed the autophagosome. In plants, little is known about the underlying mechanism of autophagosome formation. In this study, we report that SH3 DOMAIN-CONTAINING PROTEIN2 (SH3P2), a Bin-Amphiphysin-Rvs domain–containing protein, translocates to the phagophore assembly site/preautophagosome structure (PAS) upon autophagy induction and actively participates in the membrane deformation process. Using the SH3P2–green fluorescent protein fusion as a reporter, we found that the PAS develops from a cup-shaped isolation membranes or endoplasmic reticulum–derived omegasome-like structures. Using an inducible RNA interference (RNAi) approach, we show that RNAi knockdown of SH3P2 is developmentally lethal and significantly suppresses autophagosome formation. An in vitro membrane/lipid binding assay demonstrates that SH3P2 is a membrane-associated protein that binds to phosphatidylinositol 3-phosphate. SH3P2 may facilitate membrane expansion or maturation in coordination with the phosphatidylinositol 3-kinase (PI3K) complex during autophagy, as SH3P2 promotes PI3K foci formation, while PI3K inhibitor treatment inhibits SH3P2 from translocating to autophagosomes. Further interaction analysis shows that SH3P2 associates with the PI3K complex and interacts with ATG8s in Arabidopsis thaliana, whereby SH3P2 may mediate autophagy. Thus, our study has identified SH3P2 as a novel regulator of autophagy and provided a conserved model for autophagosome biogenesis in Arabidopsis. PMID:24249832

  16. Characterization of the Lipid Binding Properties of Otoferlin Reveals Specific Interactions between PI(4,5)P2 and the C2C and C2F Domains

    PubMed Central


    Otoferlin is a transmembrane protein consisting of six C2 domains, proposed to act as a calcium sensor for exocytosis. Although otoferlin is believed to bind calcium and lipids, the lipid specificity and identity of the calcium binding domains are controversial. Further, it is currently unclear whether the calcium binding affinity of otoferlin quantitatively matches the maximal intracellular presynaptic calcium concentrations of ∼30–50 μM known to elicit exocytosis. To characterize the calcium and lipid binding properties of otoferlin, we used isothermal titration calorimetry (ITC), liposome sedimentation assays, and fluorescence spectroscopy. Analysis of ITC data indicates that with the exception of the C2A domain, the C2 domains of otoferlin bind multiple calcium ions with moderate (Kd = 25–95 μM) and low affinities (Kd = 400–700 μM) in solution. However, in the presence of liposomes, the calcium sensitivity of the domains increased by up to 10-fold. It was also determined that calcium enhanced liposome binding for domains C2B–C2E, whereas the C2F domain bound liposomes in a calcium-independent manner. Mutations that abrogate calcium binding in C2F do not disrupt liposome binding, supporting the conclusion that the interaction of the C2F domain with phosphatidylserine is calcium-independent. Further, domains C2C and C2F, not domains C2A, C2B, C2D, and C2E, bound phosphatidylinositol 4,5-bisphosphate 1,2-dioleoyl-sn-glycero-3-phospho(1′-myoinositol-4′,5′-bisphosphate) [PI(4,5)P2], which preferentially steered them toward liposomes harboring PI(4,5)P2. Remarkably, lysine mutations L478A and L480A in C2C selectively weaken the PI(4,5)P2 interaction while leaving phosphatidylserine binding unaffected. Finally, shifts in the emission spectra of an environmentally sensitive fluorescent unnatural amino acid indicate that the calcium binding loops of the C2F domain directly interact with the lipid bilayer of negatively charged liposomes in a calcium

  17. Structure of dimeric, recombinant Sulfolobus solfataricus phosphoribosyl diphosphate synthase: a bent dimer defining the adenine specificity of the substrate ATP.


    Andersen, Rune W; Leggio, Leila Lo; Hove-Jensen, Bjarne; Kadziola, Anders


    The enzyme 5-phosphoribosyl-1-α-diphosphate (PRPP) synthase (EC catalyses the Mg(2+)-dependent transfer of a diphosphoryl group from ATP to the C1 hydroxyl group of ribose 5-phosphate resulting in the production of PRPP and AMP. A nucleotide sequence specifying Sulfolobus solfataricus PRPP synthase was synthesised in vitro with optimised codon usage for expression in Escherichia coli. Following expression of the gene in E. coli PRPP synthase was purified by heat treatment and ammonium sulphate precipitation and the structure of S. solfataricus PRPP synthase was determined at 2.8 Å resolution. A bent dimer oligomerisation was revealed, which seems to be an abundant feature among PRPP synthases for defining the adenine specificity of the substrate ATP. Molecular replacement was used to determine the S. solfataricus PRPP synthase structure with a monomer subunit of Methanocaldococcus jannaschii PRPP synthase as a search model. The two amino acid sequences share 35 % identity. The resulting asymmetric unit consists of three separated dimers. The protein was co-crystallised in the presence of AMP and ribose 5-phosphate, but in the electron density map of the active site only AMP and a sulphate ion were observed. Sulphate ion, reminiscent of the ammonium sulphate precipitation step of the purification, seems to bind tightly and, therefore, presumably occupies and blocks the ribose 5-phosphate binding site. The activity of S. solfataricus PRPP synthase is independent of phosphate ion.

  18. N-linked glycosylation of platelet P2Y12 ADP receptor is essential for signal transduction but not for ligand binding or cell surface expression.


    Zhong, Xiaotian; Kriz, Ron; Seehra, Jasbir; Kumar, Ravindra


    P(2)Y(12) receptor is a G(i)-coupled adenosine diphosphate (ADP) receptor with a critical role in platelet aggregation. It contains two potential N-linked glycosylation sites at its extra cellular amino-terminus, which may modulate its activity. Studies of both tunicamycin treatment and site-directed mutagenesis have revealed a dispensable role of the N-linked glycosylation in the receptor's surface expression and ligand binding activity. However, the non-glycosylated P(2)Y(12) receptor is defective in the P(2)Y(12)-mediated inhibition of the adenylyl cyclase activity. Thus the study uncovers an unexpected vital role of N-linked glycans in receptor's signal transducing step but not in surface expression or ligand binding.

  19. Structure and Biochemical Characterization of Protein Acetyltransferase from Sulfolobus solfataricus

    SciTech Connect

    Brent, Michael M.; Iwata, Ayaka; Carten, Juliana; Zhao, Kehao; Marmorstein, Ronen


    The Sulfolobus solfataricus protein acetyltransferase (PAT) acetylates ALBA, an abundant nonspecific DNA-binding protein, on Lys{sup 16} to reduce its DNA affinity, and the Sir2 deacetylase reverses the modification to cause transcriptional repression. This represents a 'primitive' model for chromatin regulation analogous to histone modification in eukaryotes. We report the 1.84-{angstrom} crystal structure of PAT in complex with coenzyme A. The structure reveals homology to both prokaryotic GNAT acetyltransferases and eukaryotic histone acetyltransferases (HATs), with an additional 'bent helix' proximal to the substrate binding site that might play an autoregulatory function. Investigation of active site mutants suggests that PAT does not use a single general base or acid residue for substrate deprotonation and product reprotonation, respectively, and that a diffusional step, such as substrate binding, may be rate-limiting. The catalytic efficiency of PAT toward ALBA is low relative to other acetyltransferases, suggesting that there may be better, unidentified substrates for PAT. The structural similarity of PAT to eukaryotic HATs combined with its conserved role in chromatin regulation suggests that PAT is evolutionarily related to the eukaryotic HATs.

  20. Enhanced binding capability of nuclear factor-κB with demethylated P2X3 receptor gene contributes to cancer pain in rats.


    Zhou, You-Lang; Jiang, Guo-Qin; Wei, Jinrong; Zhang, Hong-Hong; Chen, Wei; Zhu, Hongyan; Hu, Shufen; Jiang, Xinghong; Xu, Guang-Yin


    Nuclear factor-kappa B (NF-κB) signaling is implicated in both cancer development and inflammation processes. However, the roles and mechanisms of NF-κB signaling in the development of cancer-induced pain (CIP) remain unknown. This study was designed to investigate the roles of the p65 subunit of NF-κB in regulation of the purinergic receptor (P2X3R) plasticity in dorsal root ganglion (DRG) of CIP rats. We showed here that tumor cell injection produced mechanical and thermal hyperalgesia, and an enhanced body weight-bearing difference, which was correlated with an upregulation of p65 and P2X3R expression in lumber DRGs and a potentiation of ATP-evoked responses of tibia-innervating DRG neurons. Inhibition of NF-κB signaling using p65 inhibitor pyrrolidine dithiocarbamate, BAY-11-7082, or lentiviral-p65 short-hairpin RNA significantly attenuated CIP and reversed the activities of P2X3R. Interestingly, tumor cell injection led to a significant demethylation of CpG island in p2x3r gene promoter and enhanced ability of p65 to bind the promoter of p2x3r gene. Our findings suggest that upregulation of P2X3R expression was mediated by the enhanced binding capability of p65 with demethylated promoter of p2x3r gene, thus contributing to CIP. NF-κBp65 might be a potential target for treating CIP, a neuropathic pain generated by tumor cell-induced injury to nerves that innervate the skin.

  1. Enhanced binding capability of nuclear factor-κB with demethylated P2X3 receptor gene contributes to cancer pain in rats

    PubMed Central

    Zhou, You-Lang; Jiang, Guo-Qin; Wei, Jinrong; Zhang, Hong-Hong; Chen, Wei; Zhu, Hongyan; Hu, Shufen; Jiang, Xinghong; Xu, Guang-Yin


    Abstract Nuclear factor-kappa B (NF-κB) signaling is implicated in both cancer development and inflammation processes. However, the roles and mechanisms of NF-κB signaling in the development of cancer-induced pain (CIP) remain unknown. This study was designed to investigate the roles of the p65 subunit of NF-κB in regulation of the purinergic receptor (P2X3R) plasticity in dorsal root ganglion (DRG) of CIP rats. We showed here that tumor cell injection produced mechanical and thermal hyperalgesia, and an enhanced body weight–bearing difference, which was correlated with an upregulation of p65 and P2X3R expression in lumber DRGs and a potentiation of ATP-evoked responses of tibia-innervating DRG neurons. Inhibition of NF-κB signaling using p65 inhibitor pyrrolidine dithiocarbamate, BAY-11-7082, or lentiviral-p65 short-hairpin RNA significantly attenuated CIP and reversed the activities of P2X3R. Interestingly, tumor cell injection led to a significant demethylation of CpG island in p2x3r gene promoter and enhanced ability of p65 to bind the promoter of p2x3r gene. Our findings suggest that upregulation of P2X3R expression was mediated by the enhanced binding capability of p65 with demethylated promoter of p2x3r gene, thus contributing to CIP. NF-κBp65 might be a potential target for treating CIP, a neuropathic pain generated by tumor cell–induced injury to nerves that innervate the skin. PMID:26049406

  2. ATP release due to Thy-1–integrin binding induces P2X7-mediated calcium entry required for focal adhesion formation

    PubMed Central

    Henríquez, Mauricio; Herrera-Molina, Rodrigo; Valdivia, Alejandra; Alvarez, Alvaro; Kong, Milene; Muñoz, Nicolás; Eisner, Verónica; Jaimovich, Enrique; Schneider, Pascal; Quest, Andrew F. G.; Leyton, Lisette


    Thy-1, an abundant mammalian glycoprotein, interacts with αvβ3 integrin and syndecan-4 in astrocytes and thus triggers signaling events that involve RhoA and its effector p160ROCK, thereby increasing astrocyte adhesion to the extracellular matrix. The signaling cascade includes calcium-dependent activation of protein kinase Cα upstream of Rho; however, what causes the intracellular calcium transients required to promote adhesion remains unclear. Purinergic P2X7 receptors are important for astrocyte function and form large non-selective cation pores upon binding to their ligand, ATP. Thus, we evaluated whether the intracellular calcium required for Thy-1-induced cell adhesion stems from influx mediated by ATP-activated P2X7 receptors. Results show that adhesion induced by the fusion protein Thy-1-Fc was preceded by both ATP release and sustained intracellular calcium elevation. Elimination of extracellular ATP with Apyrase, chelation of extracellular calcium with EGTA, or inhibition of P2X7 with oxidized ATP, all individually blocked intracellular calcium increase and Thy-1-stimulated adhesion. Moreover, Thy-1 mutated in the integrin-binding site did not trigger ATP release, and silencing of P2X7 with specific siRNA blocked Thy-1-induced adhesion. This study is the first to demonstrate a functional link between αvβ3 integrin and P2X7 receptors, and to reveal an important, hitherto unanticipated, role for P2X7 in calcium-dependent signaling required for Thy-1-stimulated astrocyte adhesion. PMID:21502139

  3. PtdIns(4,5)P2 interacts with CaM binding domains on TRPM3 N-terminus.


    Holendova, Blanka; Grycova, Lenka; Jirku, Michaela; Teisinger, Jan


    TRPM3 has been reported to play an important role in Ca(2+) homeostasis, but its gating mechanisms and regulation via Ca(2+) are unknown. Ca(2+) binding proteins such as calmodulin (CaM) could be probable modulators of this ion channel. We have shown that this protein binds to two independent domains, A35-K124 and H291-G382 on the TRPM3 N-terminus, which contain conserved hydrophobic as well as positively charged residues in specific positions, and that these residues have a crucial impact on its binding. We also showed that the other Ca(2+) binding protein, S100A1, is able to bind to these regions and that CaM and S100A1 compete for these binding sites on the TRPM3 N-terminus. Moreover, our results suggest that another very important TRP channel activity modulator, PtdIns(4,5)P(2), interacts with the CaM/S100A1 binding sites on the TRPM3 N-terminus with high affinity.

  4. Crystal Structure of Cytochrome P450 (CYP105P2) from Streptomyces peucetius and Its Conformational Changes in Response to Substrate Binding

    PubMed Central

    Lee, Chang Woo; Lee, Joo-Ho; Rimal, Hemraj; Park, Hyun; Lee, Jun Hyuck; Oh, Tae-Jin


    Cytochrome P450 monooxygenases (CYP, EC belong to a large family of enzymes that catalyze the hydroxylation of various substrates. Here, we present the crystal structure of CYP105P2 isolated from Streptomyces peucetius ATCC27952 at a 2.1 Å resolution. The structure shows the presence of a pseudo-ligand molecule in the active site, which was co-purified fortuitously and is presumed to be a biphenyl derivative. Comparison with previously determined substrate-bound CYP structures showed that binding of the ligand produces large and distinctive conformational changes in α2–α3, α7–α9, and the C-terminal loop regions. This structural flexibility confirms our previous observation that CYP105P2 can accommodate a broad range of ligands. The structure complexed with a pseudo-ligand provides the first molecular view of CYP105P2–ligand interactions, and it indicates the involvement of hydrophobic residues (Pro82, Ala181, Met187, Leu189, Leu193, and Ile236) in the interactions between hydrophobic ligands and CYP105P2. These results provide useful insights into the structural changes involved in the recognition of different ligands by CYP105P2. PMID:27231902

  5. Structural insights into the Ca2+ and PI(4,5)P2 binding modes of the C2 domains of rabphilin 3A and synaptotagmin 1

    PubMed Central

    Guillén, Jaime; Ferrer-Orta, Cristina; Buxaderas, Mònica; Pérez-Sánchez, Dolores; Guerrero-Valero, Marta; Luengo-Gil, Ginés; Pous, Joan; Guerra, Pablo; Gómez-Fernández, Juan C.; Verdaguer, Nuria; Corbalán-García, Senena


    Proteins containing C2 domains are the sensors for Ca2+ and PI(4,5)P2 in a myriad of secretory pathways. Here, the use of a free-mounting system has enabled us to capture an intermediate state of Ca2+ binding to the C2A domain of rabphilin 3A that suggests a different mechanism of ion interaction. We have also determined the structure of this domain in complex with PI(4,5)P2 and IP3 at resolutions of 1.75 and 1.9 Å, respectively, unveiling that the polybasic cluster formed by strands β3–β4 is involved in the interaction with the phosphoinositides. A comparative study demonstrates that the C2A domain is highly specific for PI(4,5)P2/PI(3,4,5)P3, whereas the C2B domain cannot discriminate among any of the diphosphorylated forms. Structural comparisons between C2A domains of rabphilin 3A and synaptotagmin 1 indicated the presence of a key glutamic residue in the polybasic cluster of synaptotagmin 1 that abolishes the interaction with PI(4,5)P2. Together, these results provide a structural explanation for the ability of different C2 domains to pull plasma and vesicle membranes close together in a Ca2+-dependent manner and reveal how this family of proteins can use subtle structural changes to modulate their sensitivity and specificity to various cellular signals. PMID:24302762

  6. Evidence that Asn542 of neprilysin (EC is involved in binding of the P2' residue of substrates and inhibitors.

    PubMed Central

    Dion, N; Le Moual, H; Fournié-Zaluski, M C; Roques, B P; Crine, P; Boileau, G


    Neprilysin (EC is a Zn2+ metallopeptidase involved in the degradation of biologically active peptides, e.g. enkephalins and atrial natriuretic peptide. The substrate specificity and catalytic activity of neprilysin resemble those of thermolysin, a crystallized bacterial Zn2+ metalloprotease. Despite little overall homology between the primary structures of thermolysin and neprilysin, many of the amino acid residues involved in catalysis, as well as Zn2+ and substrate binding, are highly conserved. Most of the active-site residues of neprilysin have their homologues in thermolysin and have been characterized by site-directed mutagenesis. Furthermore, hydrophobic cluster analysis has revealed some other analogies between the neprilysin and thermolysin sequences [Benchetrit, Bissery, Mornon, Devault, Crine and Roques (1988) Biochemistry 27, 592-596]. According to this analysis the role of Asn542 in the neprilysin active site is analogous to that of Asn112 of thermolysin, which is to bind the substrate. Site-directed mutagenesis was used to change Asn542 to Gly or Gln residues. The effect of these mutations on substrate catalysis and inhibitor binding was examined with a series of thiorphan-like compounds containing various degrees of methylation at the P2' residue. For both mutated enzymes, determination of kinetic parameters with [D-Ala2,Leu5]enkephalin as substrate showed that the large decrease in activity was attributable to an increase in Km (14-16-fold) whereas kcat values were only slightly affected (2-3-fold decrease). This is in agreement with Asn542 being involved in substrate binding rather than directly in catalysis. Finally, the IC50 values for thiorphan and substituted thiorphans strongly suggest that Asn542 of neprilysin binds the substrate on the amino side of the P2' residue by formation of a unique hydrogen bond. Images Figure 2 Figure 3 PMID:7487905

  7. Adenine phosphoribosyltransferase from Sulfolobus solfataricus is an enzyme with unusual kinetic properties and a crystal structure that suggests it evolved from a 6-oxopurine phosphoribosyltransferase.


    Jensen, Kaj Frank; Hansen, Michael Riis; Jensen, Kristine Steen; Christoffersen, Stig; Poulsen, Jens-Christian Navarro; Mølgaard, Anne; Kadziola, Anders


    The adenine phosphoribosyltransferase (APRTase) encoded by the open reading frame SSO2342 of Sulfolobus solfataricus P2 was subjected to crystallographic, kinetic, and ligand binding analyses. The enzyme forms dimers in solution and in the crystals, and binds one molecule of the reactants 5-phosphoribosyl-α-1-pyrophosphate (PRPP) and adenine or the product adenosine monophosphate (AMP) or the inhibitor adenosine diphosphate (ADP) in each active site. The individual subunit adopts an overall structure that resembles a 6-oxopurine phosphoribosyltransferase (PRTase) more than known APRTases implying that APRT functionality in Crenarchaeotae has its evolutionary origin in this family of PRTases. Only the N-terminal two-thirds of the polypeptide chain folds as a traditional type I PRTase with a five-stranded β-sheet surrounded by helices. The C-terminal third adopts an unusual three-helix bundle structure that together with the nucleobase-binding loop undergoes a conformational change upon binding of adenine and phosphate resulting in a slight contraction of the active site. The inhibitor ADP binds like the product AMP with both the α- and β-phosphates occupying the 5'-phosphoribosyl binding site. The enzyme shows activity over a wide pH range, and the kinetic and ligand binding properties depend on both pH and the presence/absence of phosphate in the buffers. A slow hydrolysis of PRPP to ribose 5-phosphate and pyrophosphate, catalyzed by the enzyme, may be facilitated by elements in the C-terminal three-helix bundle part of the protein.

  8. High affinity P2x-purinoceptor binding sites for [35S]-adenosine 5'-O-[3-thiotriphosphate] in rat vas deferens membranes.

    PubMed Central

    Michel, A. D.; Humphrey, P. P.


    1. The binding sites labelled by [35S]-adenosine 5'-O-[3-thiotriphosphate]([35S]-ATP gamma S) at 4 degrees C in rat vas deferens membranes were studied and compared to the sites labelled by [3H]-alpha,beta-methylene ATP ([3H]-alpha beta meATP) to ascertain whether [35S]-ATP gamma S can be used to label the P2x purinoceptor. 2. In the presence of 4 mM CaCl2, the binding of 0.2 nM [35S]-ATP gamma S to vas deferens membranes was increased 3.4 fold, when compared to studies performed in the absence of calcium. However, binding did not appear to be solely to P2x purinoceptors since [35S]-ATP gamma S labelled a heterogeneous population of sites and about 72% of the sites possessed high affinity (pIC50 = 7.5) for guanosine 5'-O-[3-thiotriphosphate] (GTP gamma S). Even in the presence of 1 microM GTP gamma S, to occlude the sites with high affinity for GTP gamma S, the binding of [35S]-ATP gamma S was heterogeneous and since there was also evidence of extensive metabolism of ATP in the presence of calcium, the binding of [35S]-ATP gamma S under these conditions was not studied further. 3. In the absence of calcium ions, [35S]-ATP gamma S bound to a single population of sites (pKD = 9.23; Bmax = 4270 fmol mg-1 protein). Binding reached steady state within 3 h (t1/2 = 38 min), was stable for a further 4 h and was readily reversible upon addition of 10 microM unlabelled ATP gamma S (t1/2 = 45 min). In competition studies the binding of 0.2 nM [35S]-ATP gamma S was inhibited by a number of P2x purinoceptor agonists and antagonists, but not by adenosine receptor agonists, staurosporine (1 microM) or several ATPase inhibitors. The rank order of agonist affinity estimates (pIC50 values) in competing for the [35S]-ATP gamma S binding sites was: ATP (9.01), 2-methylthio- ATP (8.79), ATP gamma S (8.73), alpha beta meATP (7.57), ADP (7.24), beta, gamma-methylene ATP (7.18), L-beta, gamma-methylene ATP (5.83), alpha, beta-methylene ADP (4.36). 4. Affinity estimates (pIC50 values) for

  9. A cool tool for hot and sour Archaea: proteomics of Sulfolobus solfataricus.


    Kort, Julia Christin; Esser, Dominik; Pham, Trong Khoa; Noirel, Josselin; Wright, Phillip C; Siebers, Bettina


    In recent years, much progress has been made in proteomic studies to unravel metabolic pathways and basic cellular processes. This is especially interesting for members of the Archaea, the third domain of life. Archaea exhibit extraordinary features and many of their cultivable representatives are adaptable to extreme environments. Archaea harbor many unique traits besides bacterial attributes, such as size, shape, and DNA structure and eukaryal characteristics like information processing. Sulfolobus solfataricus P2, a thermoacidophilic archaeal representative, is a well-established model organism adapted to low-pH environments (pH 2-3) and high temperatures (80°C). The genome has a size of 3 Mbp and its sequence has been deciphered. Approximately 3033 predicted open reading frames have been identified and the genome is characterized by a great number of diverse insertion sequence elements. In unraveling the organisms' metabolism and lifestyle, proteomic analyses have played a major role. Much effort has been directed at this organism and is reviewed here. With the help of proteomics, unique metabolic pathways were resolved in S. solfataricus, targets for regulatory protein phosphorylation identified, and cellular responses upon virus infection as well as oxidative stress analyzed.

  10. DNA binding and antigene activity of a daunomycin-conjugated triplex-forming oligonucleotide targeting the P2 promoter of the human c-myc gene

    PubMed Central

    Carbone, Giuseppina M.; McGuffie, Eileen; Napoli, Sara; Flanagan, Courtney E.; Dembech, Chiara; Negri, Umberto; Arcamone, Federico; Capobianco, Massimo L.; Catapano, Carlo V.


    Triplex-forming oligonucleotides (TFO) that bind DNA in a sequence-specific manner might be used as selective repressors of gene expression and gene-targeted therapeutics. However, many factors, including instability of triple helical complexes in cells, limit the efficacy of this approach. In the present study, we tested whether covalent linkage of a TFO to daunomycin, which is a potent DNA-intercalating agent and anticancer drug, could increase stability of the triple helix and activity of the oligonucleotide in cells. The 11mer daunomycin-conjugated GT (dauno-GT11) TFO targeted a sequence upstream of the P2 promoter, a site known to be critical for transcription of the c-myc gene. Band-shift assays showed that the dauno-GT11 formed triplex DNA with enhanced stability compared to the unmodified TFO. Band shift and footprinting experiments demonstrated that binding of dauno-GT11 was highly sequence-specific with exclusive binding to the 11 bp target site in the c-myc promoter. The daunomycin-conjugated TFO inhibited transcription in vitro and reduced c-myc promoter activity in prostate and breast cancer cells. The daunomycin-conjugated TFO was taken up by cells with a distinctive intracellular distribution compared to free daunomycin. However, cationic lipid-mediated delivery was required for enhanced cellular uptake, nuclear localization and biological activity of the TFO in cells. Dauno-GT11 reduced transcription of the endogenous c-myc gene in cells, but did not affect expression of non-target genes, such as ets-1 and ets-2, which contained very similar target sequences in their promoters. Daunomycin-conjugated control oligonucleotides unable to form triplex DNA with the target sequence did not have any effect in these assays, indicating that daunomycin was not directly responsible for the activity of daunomycin-conjugated TFO. Thus, attachment of daunomycin resulted in increased triplex stability and biological activity of the 11mer GT-rich TFO without

  11. An Arabidopsis hydrophilic Ca2(+) -binding protein with a PEVK-rich domain, PCaP2, is associated with the plasma membrane and interacts with calmodulin and phosphatidylinositol phosphates.


    Kato, Mariko; Nagasaki-Takeuchi, Nahoko; Ide, Yuki; Maeshima, Masayoshi


    We found a new hydrophilic protein in Arabidopsis thaliana. Real-time PCR demonstrated that the protein was expressed in roots. Histochemical analysis of promoter-beta-glucuronidase fusions demonstrated its extensive expression in root hairs. The protein is rich in proline, glutamate, valine and lysine residues (PEVK-rich domain), and bound Ca(2+) even in the presence of Mg(2+) and K(+) when examined by the (45)Ca overlay assay. Treatment of seedlings with K(+), Mn(2+), Zn(2+), Na(+), ABA and gibberellic acid, and cold and drought stresses enhanced the transcription. Expression of the protein linked to green fluorescent protein in A. thaliana showed its plasma membrane localization and cell-specific expression in the epidermal cells including root hairs and the elongating pollen tubes. Therefore, we named the protein PCaP2 (plasma membrane-associated Ca(2+)-binding protein-2). The substitution of glycine at position 2 with alanine resulted in cytoplasmic localization of PCaP2. These results and the N-terminal characteristic motif suggest that PCaP2 is N-myristoylated at Gly2. We examined the capacity for binding to phosphatidylinositol phosphates (PtdInsPs), and found that PCaP2 interacts strongly with PtdIns(3,5)P(2), PtdIns(4,5)P(2) and PtdIns(3,4,5)P(3), and weakly with PtdIns(3,4)P(2). Furthermore, calmodulin was associated with PCaP2 in a Ca(2+)-dependent manner, and its association weakened the interaction of PCaP2 with PtdInsPs. These results indicate that PCaP2 is involved in intracellular signaling through interaction with PtdInsPs and calmodulin in growing root hairs. PCaP2 was previously reported as microtubule-associated protein-18. We discuss the physiological roles of PCaP2 in relation to microtubules in cells.

  12. Purification and properties of an ATPase from Sulfolobus solfataricus

    NASA Technical Reports Server (NTRS)

    Hochstein, Lawrence I.; Stan-Lotter, Helga


    The paper reports properties of a sulfite-activated ATPase from Sulfolobus solfataricus, purified using ammonium sulfate precipitation, column chromatography on UltraGel and Sepharose 6B, and SDS-PAGE. The 92-fold purified enzyme had a relative molecular mass of 370,000. It could be dissociated into three subunits with respective molecular masses of 63,000, 48,000, and 24,000. The ATPase activity was found to be inhibitable by nitrate, N-ethylmaleimide (which bound predominantly to the largest subunit), and 4-chloro 7-nitrobenzofurazan, but not by azide, quercetin, or vanadate. While the ATPase from S. solfataricus shared a number of properties with the S. acidocaldarius ATPase, there were also significant differences suggesting the existence of several types of archaeal ATPases.

  13. An Autonomously Replicating Transforming Vector for Sulfolobus solfataricus

    PubMed Central

    Cannio, Raffaele; Contursi, Patrizia; Rossi, Mosè; Bartolucci, Simonetta


    A plasmid able to transform and to be stably maintained both in Sulfolobus solfataricus and in Escherichia coli was constructed by insertion into an E. coli plasmid of the autonomously replicating sequence of the virus particle SSV1 and a suitable mutant of the hph (hygromycin phosphotransferase) gene as the transformation marker. The vector suffered no rearrangement and/or chromosome integration, and its copy number in Sulfolobus was increased by exposure of the cells to mitomycin C. PMID:9620978

  14. Appendage-mediated surface adherence of Sulfolobus solfataricus.


    Zolghadr, Behnam; Klingl, Andreas; Koerdt, Andrea; Driessen, Arnold J M; Rachel, Reinhard; Albers, Sonja-Verena


    Attachment of microorganisms to surfaces is a prerequisite for colonization and biofilm formation. The hyperthermophilic crenarchaeote Sulfolobus solfataricus was able to attach to a variety of surfaces, such as glass, mica, pyrite, and carbon-coated gold grids. Deletion mutant analysis showed that for initial attachment the presence of flagella and pili is essential. Attached cells produced extracellular polysaccharides containing mannose, galactose, and N-acetylglucosamine. Genes possibly involved in the production of the extracellular polysaccharides were identified.

  15. Purification and Properties of an ATPase from Sulfolobus solfataricus

    NASA Technical Reports Server (NTRS)

    Hochstein, Lawrence I.; Stan-Lotter, Helga


    A sulfite-activated ATPase isolated from Sulfolobus solfataricus had a relative molecular mass of 370,000. It was composed of three subunits whose relative molecular masses were 63,000, 48,000, and 24,000. The enzyme was inhibited by the vacuolar ATPase inhibitors nitrate and N-ethylmaleimide; 4-chloro-7-nitrobenzo-furazan (NBD-Cl) was also inhibitory. N-Ethylmaleimide was predominately bound to the largest subunit while NBD-CL was bound to both subunits. ATPase activity was inhibited by low concentrations of p-chloromercuri-phenyl sulfonate and the inhibition was reversed by cysteine which suggested that thiol groups were essential for activity. While the ATPase from S. solfataricus shared several properties with the ATPase from S. acidocaldarius there were significant differences. The latter enzyme was activated by sulfate and chloride and was unaffected by N-ethylmaleimide, whereas the S. solfataricus ATPase was inhibited by these anions as well as N-ethyimaleimide. These differences as well as differences that occur in other vacuolar-like ATPases isolated from the methanogenic and the extremely halophilic bacteria suggest the existence of several types of archaeal ATPases, none of which have been demonstrated to synthesize ATP.

  16. Complete Genome Sequence of Sulfolobus solfataricus Strain 98/2 and Evolved Derivatives

    PubMed Central

    McCarthy, Samuel; Gradnigo, Julien; Johnson, Tyler; Payne, Sophie; Lipzen, Anna; Martin, Joel; Schackwitz, Wendy; Moriyama, Etsuko


    Sulfolobus solfataricus is a thermoacidophilic crenarcheote with a 3.0-Mb genome. Here, we report the genome sequence of S. solfataricus strain 98/2, along with several evolved derivatives generated through experimental microbial evolution for enhanced thermoacidophily. PMID:26021927

  17. Identification of Two Binding Domains, One for Peptidoglycan and Another for a Secondary Cell Wall Polymer, on the N-Terminal Part of the S-Layer Protein SbsB from Bacillus stearothermophilus PV72/p2

    PubMed Central

    Sára, Margit; Egelseer, Eva M.; Dekitsch, Christine; Sleytr, Uwe B.


    First studies on the structure-function relationship of the S-layer protein from B. stearothermophilus PV72/p2 revealed the coexistence of two binding domains on its N-terminal part, one for peptidoglycan and another for a secondary cell wall polymer (SCWP). The peptidoglycan binding domain is located between amino acids 1 to 138 of the mature S-layer protein comprising a typical S-layer homologous domain. The SCWP binding domain lies between amino acids 240 to 331 and possesses a high serine plus glycine content. PMID:9852032

  18. Mucosal immunization of mice with recombinant OMP P2 induces antibodies that bind to surface epitopes of multiple strains of nontypeable Haemophilus influenzae

    PubMed Central

    Ostberg, KL; Russell, MW; Murphy, TF


    Nontypeable Haemophilus influenzae (NTHI) is a significant cause of otitis media in children and exacerbations in patients with chronic obstructive pulmonary disease. Vaccine research for NTHI has focused on the outer membrane proteins (OMPs) of NTHI. The goal of this study was to evaluate mucosal and systemic immune responses to recombinant OMP P2 (rP2) of NTHI. Enzyme-linked immunosorbent assay (ELISA) demonstrated that both mucosal and systemic routes of immunization resulted in antibodies to rP2. Whole-cell ELISA and flow cytometry indicated that mucosal immunization induced antibodies to epitopes that are on the bacterial surface of the homologous strain as well as several heterologous strains. In contrast, systemic immunization induced antibodies to non-surface exposed epitopes. These data show for the first time that mucosal immunization of mice with rP2 induces antibodies that recognize surface exposed epitopes on multiple strains, indicating that P2 is a candidate for development of a mucosal vaccine for NTHI. PMID:19079335

  19. Cloning, expression and evolution of the gene encoding the elongation factor 1alpha from a low thermophilic Sulfolobus solfataricus strain.


    Masullo, Mariorosario; Cantiello, Piergiuseppe; Lamberti, Annalisa; Longo, Olimpia; Fiengo, Antonio; Arcari, Paolo


    The gene encoding the elongation factor 1alpha (EF-1alpha) from the archaeon Sulfolobus solfataricus strain MT3 (optimum growth temperature 75 degrees C) was cloned, sequenced and expressed in Escherichia coli. The structural and biochemical properties of the purified enzyme were compared to those of EF-1alpha isolated from S. solfataricus strain MT4 (optimum growth temperature 87 degrees C). Only one amino acid change (Val15-->Ile) was found. Interestingly, the difference was in the first guanine nucleotide binding consensus sequence G(13)HIDHGK and was responsible for a reduced efficiency in protein synthesis, which was accompanied by an increased affinity for both guanosine diphosphate (GDP) and guanosine triphosphate (GTP), and an increased efficiency in the intrinsic GTPase activity. Despite the different thermophilicities of the two microorganisms, only very marginal effects on the thermal properties of the enzyme were observed. Molecular evolution among EF-1alpha genes from Sulfolobus species showed that the average rate of nucleotide substitution per site per year (0.0312x10(-9)) is lower than that reported for other functional genes.

  20. Molecular cloning, nucleotide sequence and expression of a Sulfolobus solfataricus gene encoding a class II fumarase.


    Colombo, S; Grisa, M; Tortora, P; Vanoni, M


    Fumarase catalyzes the interconversion of L-malate and fumarate. A Sulfolobus solfataricus fumarase gene (fumC) was cloned and sequenced. Typical archaebacterial regulatory sites were identified in the region flanking the fumC open reading frame. The fumC gene encodes a protein of 438 amino acids (47,899 Da) which shows several significant similarities with class II fumarases from both eubacterial and eukariotic sources as well as with aspartases. S. solfataricus fumarase expressed in Escherichia coli retains enzymatic activity and its thermostability is comparable to that of S. solfataricus purified enzyme despite a 11 amino acid C-terminal deletion.

  1. X-ray crystallographic analysis of adipocyte fatty acid binding protein (aP2) modified with 4-hydroxy-2-nonenal

    SciTech Connect

    Hellberg, Kristina; Grimsrud, Paul A.; Kruse, Andrew C.; Banaszak, Leonard J.; Ohlendorf, Douglas H.; Bernlohr, David A.


    Fatty acid binding proteins (FABP) have been characterized as facilitating the intracellular solubilization and transport of long-chain fatty acyl carboxylates via noncovalent interactions. More recent work has shown that the adipocyte FABP is also covalently modified in vivo on Cys117 with 4-hydroxy-2-nonenal (4-HNE), a bioactive aldehyde linked to oxidative stress and inflammation. To evaluate 4-HNE binding and modification, the crystal structures of adipocyte FABP covalently and noncovalently bound to 4-HNE have been solved to 1.9 {angstrom} and 2.3 {angstrom} resolution, respectively. While the 4-HNE in the noncovalently modified protein is coordinated similarly to a carboxylate of a fatty acid, the covalent form show a novel coordination through a water molecule at the polar end of the lipid. Other defining features between the two structures with 4-HNE and previously solved structures of the protein include a peptide flip between residues Ala36 and Lys37 and the rotation of the side chain of Phe57 into its closed conformation. Representing the first structure of an endogenous target protein covalently modified by 4-HNE, these results define a new class of in vivo ligands for FABPs and extend their physiological substrates to include bioactive aldehydes.

  2. Bacteriophage P2.


    Christie, Gail E; Calendar, Richard


    P2 is the original member of a highly successful family of temperate phages that are frequently found in the genomes of gram-negative bacteria. This article focuses on the organization of the P2 genome and reviews current knowledge about the function of each open reading frame.

  3. The Sulfolobus solfataricus radA paralogue sso0777 is DNA damage inducible and positively regulated by the Sta1 protein

    PubMed Central

    Abella, Marc; Rodríguez, Sonia; Paytubi, Sonia; Campoy, Susana; White, Malcolm F.; Barbé, Jordi


    Little is known about the regulation of the DNA damage-mediated gene expression in archaea. Here we report that the addition of actinomycin D to Sulfolobus solfataricus cultures triggers the expression of the radA paralogue sso0777. Furthermore, a specific retarded band is observed when electrophoretic mobility shift assays (EMSAs) with crude S. solfataricus cell extracts and the sso0777 promoter were carried out. The protein that binds to this promoter was isolated and identified as Sta1. Footprinting experiments have shown that the Sta1 DNA-binding site is included in the ATTTTTTATTTTCACATGTAAGATGTTTATT sequence, which is located upstream the putative TTG translation starting codon of the sso0777 gene. Additionally, gel electrophoretic mobility retardation experiments using mutant sso0777 promoter derivatives show the presence of three essential motifs (TTATT, CANGNA and TTATT) that are absolutely required for Sta1 DNA binding. Finally, in vitro transcription experiments confirm that Sta1 functions as an activator for sso0777 gene expression being the first identified archaeal regulatory protein associated with the DNA damage-mediated induction of gene expression. PMID:17921500

  4. A highly acid-stable and thermostable endo-β-glucanase from the thermoacidophilic archaeon Sulfolobus solfataricus

    PubMed Central


    The thermoacidophilic archaeon Sulfolobus solfataricus P2 encodes three hypothetic endo-β-glucanases, SSO1354, SSO1949 and SSO2534. We cloned and expressed the gene sso1949 encoding the 334 amino acids containing protein SSO1949, which can be classified as a member of glycoside hydrolase family 12. The purified recombinant enzyme hydrolyses carboxymethylcellulose as well as cello-oligomers, with cellobiose and cellotriose as main reaction products. By following the hydrolysis of a fluorescently labelled cellohexaoside under a wide variety of conditions, we show that SSO1949 is a unique extremophilic enzyme. This archaeal enzyme has a pH optimum of approx. pH 1.8 and a temperature optimum of approx. 80 °C. Furthermore, the enzyme is thermostable, with a half-life of approx. 8 h at 80 °C and pH 1.8. The thermostability is strongly pH-dependent. At neutral pH, the thermal inactivation rate is nearly two orders of magnitude higher than at pH 1.8. Homology modelling suggests that the catalytic domain of SSO1949 has a similar fold to other mesophilic, acidophilic and neutral cellulases. The presence of a signal peptide indicates that SSO1949 is a secreted protein, which enables S. solfataricus to use cellulose as an external carbon source. It appears that SSO1949 is perfectly adapted to the extreme environment in solfataric pools. A cellulolytic enzyme with such a combination of stability and activity at high temperatures and low pH has not been described so far and could be a valuable tool for the large-scale hydrolysis of cellulose under acidic conditions. PMID:15456402

  5. Crystallization and preliminary X-ray diffraction analysis of the hyperthermophilic Sulfolobus solfataricus phosphotriesterase

    SciTech Connect

    Elias, Mikael; Dupuy, Jérôme; Merone, Luigia; Lecomte, Claude; Rossi, Mosè; Masson, Patrick; Manco, Giuseppe; Chabriere, Eric


    A phosphotriesterase (PTE) from the hyperthermophilic archaeon S. solfataricus has been crystallized. Combined with biochemical and bioengineering studies, it is expected that the structure of this protein will provide insight into the natural function of the PTE family and provide important data for achieving an efficient organophosphate biodecontaminant. Organophosphates constitute the largest class of insecticides used worldwide and some of them are potent nerve agents. Consequently, organophosphate-degrading enzymes are of paramount interest as they could be used as bioscavengers and biodecontaminants. Phosphotriesterases (PTEs) are capable of hydrolyzing these toxic compounds with high efficiency. A distant and hyperthermophilic representative of the PTE family was cloned from the archeon Sulfolobus solfataricus MT4, overexpressed in Escherichia coli and crystallized; the crystals diffracted to 2.54 Å resolution. Owing to its exceptional thermostability, this PTE may be an excellent candidate for obtaining an efficient organophosphate biodecontaminant. Here, the crystallization conditions and data collection for the hyperthermophilic S. solfataricus PTE are reported.

  6. Harnessing hyperthermostable lactonase from Sulfolobus solfataricus for biotechnological applications

    PubMed Central

    Rémy, Benjamin; Plener, Laure; Poirier, Laetitia; Elias, Mikael; Daudé, David; Chabrière, Eric


    Extremozymes have gained considerable interest as they could meet industrial requirements. Among these, SsoPox is a hyperthermostable enzyme isolated from the archaeon Sulfolobus solfataricus. This enzyme is a lactonase catalyzing the hydrolysis of acyl-homoserine lactones; these molecules are involved in Gram-negative bacterial communication referred to as quorum sensing. SsoPox exhibits promiscuous phosphotriesterase activity for the degradation of organophosphorous chemicals including insecticides and chemical warfare agents. Owing to its bi-functional catalytic abilities as well as its intrinsic stability, SsoPox is appealing for many applications, having potential uses in the agriculture, defense, food and health industries. Here we investigate the biotechnological properties of the mutant SsoPox-W263I, a variant with increased lactonase and phosphotriesterase activities. We tested enzyme resistance against diverse process-like and operating conditions such as heat resistance, contact with organic solvents, sterilization, storage and immobilization. Bacterial secreted materials from both Gram-negative and positive bacteria were harmless on SsoPox-W263I activity and could reactivate heat-inactivated enzyme. SsoPox showed resistance to harsh conditions demonstrating that it is an extremely attractive enzyme for many applications. Finally, the potential of SsoPox-W263I to be active at subzero temperature is highlighted and discussed in regards to the common idea that hyperthermophile enzymes are nearly inactive at low temperatures. PMID:27876889

  7. Molecular cloning, nucleotide sequence, and expression of a carboxypeptidase-encoding gene from the archaebacterium Sulfolobus solfataricus.

    PubMed Central

    Colombo, S; Toietta, G; Zecca, L; Vanoni, M; Tortora, P


    Mammalian metallocarboxypeptidases play key roles in major biological processes, such as digestive-protein degradation and specific proteolytic processing. A Sulfolobus solfataricus gene (cpsA) encoding a recently described zinc carboxypeptidase with an unusually broad substrate specificity was cloned, sequenced, and expressed in Escherichia coli. Despite the lack of overall sequence homology with known carboxypeptidases, seven homology blocks, including the Zn-coordinating and catalytic residues, were identified by multiple alignment with carboxypeptidases A, B, and T. S. solfataricus carboxypeptidase expressed in E. coli was found to be enzymatically active, and both its substrate specificity and thermostability were comparable to those of the purified S. solfataricus enzyme. PMID:7559343

  8. Molecular cloning, nucleotide sequence, and expression of a carboxypeptidase-encoding gene from the archaebacterium Sulfolobus solfataricus.


    Colombo, S; Toietta, G; Zecca, L; Vanoni, M; Tortora, P


    Mammalian metallocarboxypeptidases play key roles in major biological processes, such as digestive-protein degradation and specific proteolytic processing. A Sulfolobus solfataricus gene (cpsA) encoding a recently described zinc carboxypeptidase with an unusually broad substrate specificity was cloned, sequenced, and expressed in Escherichia coli. Despite the lack of overall sequence homology with known carboxypeptidases, seven homology blocks, including the Zn-coordinating and catalytic residues, were identified by multiple alignment with carboxypeptidases A, B, and T. S. solfataricus carboxypeptidase expressed in E. coli was found to be enzymatically active, and both its substrate specificity and thermostability were comparable to those of the purified S. solfataricus enzyme.

  9. Use of chimeras, point mutants, and molecular modeling to map the antagonist-binding site of 4,4',4″,4‴-(carbonylbis-(imino-5,1,3-benzenetriylbis(carbonylimino)))tetrakisbenzene-1,3-disulfonic acid (NF449) at P2X1 receptors for ATP.


    Farmer, Louise K; Schmid, Ralf; Evans, Richard J


    P2X receptor subtype-selective antagonists are promising candidates for treatment of a range of pathophysiological conditions. However, in contrast to high resolution structural understanding of agonist action in the receptors, comparatively little is known about the molecular basis of antagonist binding. We have generated chimeras and point mutations in the extracellular ligand-binding loop of the human P2X1 receptor, which is inhibited by NF449, suramin, and pyridoxal-phosphate-6-azophenyl-2,4-disulfonate, with residues from the rat P2X4 receptor, which is insensitive to these antagonists. There was little or no effect on sensitivity to suramin and pyridoxal-phosphate-6-azophenyl-2,4-disulfonate in chimeric P2X1/4 receptors, indicating that a significant number of residues required for binding of these antagonists are present in the P2X4 receptor. Sensitivity to the P2X1 receptor-selective antagonist NF449 was reduced by ∼60- and ∼135-fold in chimeras replacing the cysteine-rich head, and the dorsal fin region below it in the adjacent subunit, respectively. Point mutants identified the importance of four positively charged residues at the base of the cysteine-rich head and two variant residues in the dorsal fin for high affinity NF449 binding. These six residues were used as the starting area for molecular docking. The four best potential NF449-binding poses were then discriminated by correspondence with the mutagenesis data and an additional mutant to validate the binding of one lobe of NF449 within the core conserved ATP-binding pocket and the other lobes coordinated by positive charge on the cysteine-rich head region and residues in the adjacent dorsal fin.

  10. Crystal structure of the alcohol dehydrogenase from the hyperthermophilic archaeon Sulfolobus solfataricus at 1.85 A resolution.


    Esposito, Luciana; Sica, Filomena; Raia, Carlo Antonio; Giordano, Antonietta; Rossi, Mosè; Mazzarella, Lelio; Zagari, Adriana


    The crystal structure of a medium-chain NAD(H)-dependent alcohol dehydrogenase (ADH) from an archaeon has been solved by multiwavelength anomalous diffraction, using a selenomethionine-substituted enzyme. The protein (SsADH), extracted from the hyperthermophilic organism Sulfolobus solfataricus, is a homo-tetramer with a crystallographic 222 symmetry. Despite the low level of sequence identity, the overall fold of the monomer is similar to that of the other homologous ADHs of known structure. However, a significant difference is the orientation of the catalytic domain relative to the coenzyme-binding domain that results in a larger interdomain cleft. At the bottom of this cleft, the catalytic zinc ion is coordinated tetrahedrally and lacks the zinc-bound water molecule that is usually found in ADH apoform structures. The fourth coordination position is indeed occupied by a Glu residue, as found in bacterial tetrameric ADHs. Other differences are found in the architecture of the substrate pocket whose entrance is more restricted than in other ADHs. SsADH is the first tetrameric ADH X-ray structure containing a second zinc ion playing a structural role. This latter metal ion shows a peculiar coordination, with a glutamic acid residue replacing one of the four cysteine ligands that are highly conserved throughout the structural zinc-containing dimeric ADHs.

  11. Characterization of a β-glucosidase from Sulfolobus solfataricus for isoflavone glycosides.


    Kim, Bi-Na; Yeom, Soo-Jin; Kim, Yeong-Su; Oh, Deok-Kun


    The specific activity of a recombinant β-glucosidase from Sulfolobus solfataricus for isoflavones was: daidzin > glycitin > genistin > malonyl genistin > malonyl daidzin > malonyl glycitin. The hydrolytic activity of this enzyme for daidzin was highest at pH 5.5 and 90°C with a half-life of 18 h, a K (m) of 0.5 mM, and a k (cat) of 2532 s(-1). The enzyme converted 1 mM daidzin to 1 mM daidzein after 1 h with a molar yield of 100% and a productivity of 1 mM h(-1). Among β-glucosidases, that from S. solfataricus β had the highest thermostability, k (cat), k (cat)/K (m), conversion yield, and productivity in the hydrolysis of daidzin.

  12. Modeling DNA Repair: Approaching In Vivo Techniques in the Hyperthermophile Sulfolobus Solfataricus

    SciTech Connect

    Blanton, J.; Fuss, J.; Yannone, S.M.; Tainer, J.A.; Cooper, P.K.


    Archaea are found in some of the most extreme environments on earth and represent a third domain of life distinct from Eukarya and Eubacteria. The hyperthermophilic archaeon Sulfolobus solfataricus, isolated from acidic hot springs (80oC, pH 3) in Yellowstone National Park, has emerged as a potential model system for studying human DNA repair processes. Archaea are more closely related to Eukarya than to Eubacteria, suggesting that archaeal DNA repair machinery may model the complex human system much more closely than that of other prokaryotes. DNA repair requires coordinated protein-protein interactions that are frequently transient. Protein complexes that are transient at extreme temperatures where archaea thrive may be more stable at room temperature, allowing for the characterization of otherwise short-lived complexes. However, characterization of these systems in archaea has been limited by the absence of a stable in vivo transformation and expression system. The work presented here is a pilot study in gene cloning and recombinant protein expression in S. solfataricus. Three genes associated with DNA repair were selected for expression: MRE11, PCNA1, and a putative CSB homologue. Though preparation of these recombinant genes followed standard methods, preparation of a suitable vector proved more challenging. The shuttle vector pSSV64, derived from the SSV1 virus and the E. coli vector pBSSK+, was most successfully isolated from the DH5α E. coli strain. Currently, alternative vectors are being designed for more efficient genetic manipulations in S. solfataricus.

  13. P2 receptors and immunity

    PubMed Central

    Rayah, Amel; Kanellopoulos, Jean M.; Di Virgilio, Francesco


    Immune cells express receptors for extracellular nucleotides named P2 receptors. P2 receptors transduce signals delivered by nucleotides present in the extracellular environment. Accruing evidence shows that purinergic signalling has a profound effect on multiple immune cell responses such as T lymphocyte proliferation, chemotaxis, cytokine release, phagocytosis, Ag presentation and cytotoxicity. This makes P2 receptors an attractive target for the therapy of immuno-mediated disease and cancer. PMID:22909902

  14. Bypass of Aflatoxin B[subscript 1] Adducts by the Sulfolobus solfataricus DNA Polymerase IV

    SciTech Connect

    Banerjee, Surajit; Brown, Kyle L.; Egli, Martin; Stone, Michael P.


    Aflatoxin B{sub 1} (AFB{sub 1}) is oxidized to an epoxide in vivo, which forms an N7-dG DNA adduct (AFB{sub 1}-N7-dG). The AFB{sub 1}-N7-dG can rearrange to a formamidopyrimidine (AFB{sub 1}-FAPY) derivative. Both AFB{sub 1}-N7-dG and the {beta}-anomer of the AFB{sub 1}-FAPY adduct yield G {yields} T transversions in Escherichia coli, but the latter is more mutagenic. We show that the Sulfolobus solfataricus P2 DNA polymerase IV (Dpo4) bypasses AFB{sub 1}-N7-dG in an error-free manner but conducts error-prone replication past the AFB{sub 1}-FAPY adduct, including misinsertion of dATP, consistent with the G {yields} T mutations observed in E. coli. Three ternary (Dpo4-DNA-dNTP) structures with AFB{sub 1}-N7-dG adducted template:primers have been solved. These demonstrate insertion of dCTP opposite the AFB{sub 1}-N7-dG adduct, and correct vs incorrect insertion of dATP vs dTTP opposite the 5'-template neighbor dT from a primed AFB{sub 1}-N7-dG:dC pair. The insertion of dTTP reveals hydrogen bonding between the template N3 imino proton and the O{sup 2} oxygen of dTTP, and between the template T O{sup 4} oxygen and the N3 imino proton of dTTP, perhaps explaining why this polymerase does not efficiently catalyze phosphodiester bond formation from this mispair. The AFB{sub 1}-N7-dG maintains the 5'-intercalation of the AFB{sub 1} moiety observed in DNA. The bond between N7-dG and C8 of the AFB{sub 1} moiety remains in plane with the alkylated guanine, creating a 16{sup o} inclination of the AFB{sub 1} moiety with respect to the guanine. A binary (Dpo4-DNA) structure with an AFB{sub 1}-FAPY adducted template:primer also maintains 5'-intercalation of the AFB{sub 1} moiety. The {beta}-deoxyribose anomer is observed. Rotation about the FAPY C5-N{sup 5} bond orients the bond between N{sup 5} and C8 of the AFB{sub 1} moiety out of plane in the 5'-direction, with respect to the FAPY base. The formamide group extends in the 3'-direction. This improves stacking of the AFB{sub 1

  15. Fuzzy C P2 spacetimes

    NASA Astrophysics Data System (ADS)

    Chaney, A.; Stern, A.


    Four-dimensional manifolds with changing signature are obtained by taking the large N limit of fuzzy C P2 solutions to a Lorentzian matrix model. The regions of Lorentzian signature give toy models of closed universes which exhibit cosmological singularities. These singularities are resolved at finite N , as the underlying C P2 solutions are expressed in terms of finite matrix elements.

  16. Crystallization and preliminary X-ray crystallographic analysis of Sulfolobus solfataricus thioredoxin reductase

    PubMed Central

    Ruggiero, Alessia; Ruocco, Maria Rosaria; Grimaldi, Pasquale; Arcari, Paolo; Masullo, Mariorosario; Zagari, Adriana; Vitagliano, Luigi


    A thermostable thioredoxin reductase isolated from Sulfolobus solfataricus (SsTrxR) has been successfully crystallized in the absence and in the presence of NADP. Two different crystal forms have been obtained. Crystals of the form that yields higher resolution data (1.8 Å) belong to space group P212121, with unit-cell parameters a = 76.77, b = 120.68, c = 126.85 Å. The structure of the enzyme has been solved by MAD methods using the anomalous signal from the Se atoms of selenomethionine-labelled SsTrxR. PMID:16511192

  17. Physicochemical characterisation of dietary fibre components and their ability to bind some process-induced mutagenic heterocyclic amines, Trp-P-1, Trp-P-2, AαC and MeAαC.


    Raman, Maya; Nilsson, Ulf; Skog, Kerstin; Lawther, Mark; Nair, Baboo; Nyman, Margareta


    The physicochemical properties of potato fibre, wheat bran and oat samples were investigated, along with their binding capability to heterocyclic amines (HCAs). Potato fibre displayed highest total dietary fibre content (71.8/100g dry weight basis, dwb), followed by wheat bran (57.2/100 g dwb) and oat sample 2 (53.0/100 g dwb). Oat samples 1, 3 and 4 displayed considerably lower dietary fibre content (20.5-28.8/100g, dwb). Oat samples 3 and 4 displayed highest soluble fibre content (70-83%), and oat sample 3 also displayed highest swelling and water retention capacity (WRC). Dietary fibre samples, except samples 3 and 4, displayed improved binding to HCAs as sample weight increased. The behaviour of wheat bran and potato fibre was similar to oat samples 1 and 2. Binding of MeAαC was comparatively greater than that of other HCAs. Dietary fibre fractions with high insoluble fibre and functional groups of HCAs may significantly contribute to the binding capacity.

  18. A Novel Thermostable Arylesterase from the Archaeon Sulfolobus solfataricus P1: Purification, Characterization, and Expression▿ †

    PubMed Central

    Park, Young-Jun; Yoon, Sung-Jin; Lee, Hee-Bong


    A novel thermostable arylesterase, a 35-kDa monomeric enzyme, was purified from the thermoacidophilic archaeon Sulfolobus solfataricus P1. The optimum temperature and pH were 94°C and 7.0, respectively. The enzyme displayed remarkable thermostability: it retained 52% of its activity after 50 h of incubation at 90°C. In addition, the purified enzyme showed high stability against denaturing agents, including various detergents, urea, and organic solvents. The enzyme has broad substrate specificity besides showing an arylesterase activity toward aromatic esters: it exhibits not only carboxylesterase activity toward tributyrin and p-nitrophenyl esters containing unsubstituted fatty acids from butyrate (C4) to palmitate (C16), but also paraoxonase activity toward organophosphates such as p-nitrophenylphosphate, paraoxon, and methylparaoxon. The kcat/Km ratios of the enzyme for phenyl acetate and paraoxon, the two most preferable substrates among all tested, were 30.6 and 119.4 s−1·μM−1, respectively. The arylesterase gene consists of 918 bp corresponding to 306 amino acid residues. The deduced amino acid sequence shares 34% identity with that of arylesterase from Acinetobacter sp. strain ADP1. Furthermore, we successfully expressed active recombinant S. solfataricus arylesterase in Escherichia coli. Together, our results show that the enzyme is a serine esterase belonging to the A-esterases and contains a catalytic triad composed of Ser156, Asp251, and His281 in the active site. PMID:18931117

  19. Thermal unfolding of nucleoside hydrolases from the hyperthermophilic archaeon Sulfolobus solfataricus: role of disulfide bonds.


    Porcelli, Marina; De Leo, Ester; Del Vecchio, Pompea; Fuccio, Francesca; Cacciapuoti, Giovanna


    Nucleoside hydrolases are metalloproteins that hydrolyze the N-glycosidic bond of β-ribonucleosides, forming the free purine/pyrimidine base and ribose. We report the stability of the two hyperthermophilic enzymes Sulfolobus solfataricus pyrimidine-specific nucleoside hydrolase (SsCU-NH) and Sulfolobus solfataricus purine-specific inosineadenosine- guanosine nucleoside hydrolase (SsIAG-NH) against the denaturing action of temperature and guanidine hydrochloride by means of circular dichroism and fluorescence spectroscopy. The guanidine hydrochloride-induced unfolding is reversible for both enzymes as demonstrated by the analysis of the refolding process by activity assays and fluorescence measurements. The evidence that the denaturation of SsIAG-NH carried out in the presence of reducing agents proved to be reversible indicates that the presence of disulfide bonds interferes with the refolding process of this enzyme. Both enzymes are highly thermostable and no thermal unfolding transition can be obtained up to 108°C. SsIAG-NH is thermally denatured under reducing conditions (T(m)=93°C) demonstrating the contribution of disulfide bridges to enzyme thermostability.

  20. Preliminary characterization of two different crystal forms of acylphosphatase from the hyperthermophile archaeon Sulfolobus solfataricus

    SciTech Connect

    Zuccotti, Simone; Rosano, Camillo; Bemporad, Francesco; Stefani, Massimo; Bolognesi, Martino


    S. solfataricus acylphosphatase has been expressed, purified and crystallized in two different crystal forms. Preliminary characterization of a triclinic and a monoclinic crystal form is reported and data were collected to 1.27 and 1.90 Å, respectively. Acylphosphatase is a ubiquitous small enzyme that was first characterized in mammals. It is involved in the hydrolysis of carboxyl-phosphate bonds in several acylphosphate substrates, such as carbamoylphosphate and 1,3-biphosphoglycerate; however, a consensus on acylphosphatase action in vivo has not yet been reached. Recent investigations have focused on acylphosphatases from lower phyla, such as Drosophila melanogaster and Escherichia coli, in view of the application of these small proteins as models in the study of folding, misfolding and aggregation processes. An acylphosphatase from the hyperthermophilic archaeon Sulfolobus solfataricus has been cloned, expressed and purified. Here, the growth and characterization of a triclinic and a monoclinic crystal form of the hyperthermophilic enzyme are reported; X-ray diffraction data have been collected to 1.27 and 1.90 Å resolution, respectively.

  1. A new phosphotriesterase from Sulfolobus acidocaldarius and its comparison with the homologue from Sulfolobus solfataricus.


    Porzio, Elena; Merone, Luigia; Mandrich, Luigi; Rossi, Mosè; Manco, Giuseppe


    The phosphotriesterase PTE, identified in the soil bacterium Pseudomonas diminuta, is thought to have evolved in the last several decades to degrade the pesticide paraoxon with proficiency approaching the limit of substrate diffusion (k(cat)/K(M) of 4 x 10(7)M(-1)s(-1)). It belongs to the amidohydrolase superfamily, but its evolutionary origin remains obscure. The enzyme has important potentiality in the field of the organophosphate decontamination. Recently we reported on the characterization of an archaeal member of the amidohydrolase superfamily, namely Sulfolobus solfataricus, showing low but significant and extremely thermostable paraoxonase activity (k(cat)/K(M) of 4 x 10(3)M(-1)s(-1)). Looking for other thermostable phosphotriesterases we assayed, among others, crude extracts of Sulfolobus acidocaldarius and detected activity. Since the genome of S. acidocaldarius has been recently reported, we identified there an open reading frame highly related to the S. solfataricus enzyme. The gene was cloned, the protein overexpressed in Escherichia coli, purified, and proven to have paraoxonase activity. A comparative analysis detected some significant differences between the two archaeal enzymes.

  2. Pressure and temperature as tools for investigating the role of individual non-covalent interactions in enzymatic reactions Sulfolobus solfataricus carboxypeptidase as a model enzyme.


    Occhipinti, Emanuela; Bec, Nicole; Gambirasio, Benedetta; Baietta, Gabriella; Martelli, Pier Luigi; Casadio, Rita; Balny, Claude; Lange, Reinhard; Tortora, Paolo


    Sulfolobus solfataricus carboxypeptidase, (CPSso), is a heat- and pressure-resistant zinc-metalloprotease. Thanks to its properties, it is an ideal tool for investigating the role of non-covalent interactions in substrate binding. It has a broad substrate specificity as it can cleave any N-blocked amino acid (except for N-blocked proline). Its catalytic and kinetic mechanisms are well understood, and the hydrolytic reaction is easily detectable spectrophotometrically. Here, we report investigations on the pressure- and temperature-dependence of the kinetic parameters (turnover number and Michaelis constant) of CPSso using several benzoyl- and 3-(2-furyl)acryloyl-amino acids as substrates. This approach enabled us to study these parameters in terms of individual rate constants and establish that the release of the free amino acid is the rate-limiting step, making it possible to dissect the individual non-covalent interactions participating in substrate binding. In keeping with molecular docking experiments performed on the 3D model of CPSso available to date, our results show that both hydrophobic and energetic interactions (i.e., stacking and van der Waals) are mainly involved, but their contribution varies strongly, probably due to changes in the conformational state of the enzyme.

  3. Identification of an RNase J ortholog in Sulfolobus solfataricus: implications for 5'-to-3' directional decay and 5'-end protection of mRNA in Crenarchaeota.


    Hasenöhrl, David; Konrat, Robert; Bläsi, Udo


    In both Bacteria and Eukaryotes, degradation is known to start at the 5' and at the 3' extremities of mRNAs. Until the recent discovery of 5'-to-3' exoribonucleases in hyperthermophilic Euryarchaeota, the exosome was assumed to be the key enzyme in mRNA degradation in Archaea. By means of zymogram assays and bioinformatics, we have identified a 5'-to-3' exoribonuclease activity in the crenarchaeum Sulfolobus solfataricus (Sso), which is affected by the phosphorylation state of the 5'-end of the mRNA. The protein comprises typical signature motifs of the β-CASP family of metallo-β-lactamases and was termed Sso-RNAse J. Thus, our study provides the first evidence for a 5'-to-3' directional mRNA decay pathway in the crenarchaeal clade of Archaea. In Bacteria the 5'-end of mRNAs is often protected by a tri-phosphorylated 5'-terminus and/or by stem-loop structures, while in Eukaryotes the cap-binding complex is responsible for this task. Here, we show that binding of translation initiation factor a/eIF2(γ) to the 5'-end of mRNA counteracts the 5'-to-3' exoribonucleolytic activity of Sso-RNase J in vitro. Hence, 5'-to-3' directional decay and 5'-end protection appear to be conserved features of mRNA turnover in all kingdoms of life.

  4. Crystal structure and nucleic acid-binding activity of the CRISPR-associated protein Csx1 of Pyrococcus furiosus.


    Kim, Young Kwan; Kim, Yeon-Gil; Oh, Byung-Ha


    In many prokaryotic organisms, chromosomal loci known as clustered regularly interspaced short palindromic repeats (CRISPRs) and CRISPR-associated (CAS) genes comprise an acquired immune defense system against invading phages and plasmids. Although many different Cas protein families have been identified, the exact biochemical functions of most of their constituents remain to be determined. In this study, we report the crystal structure of PF1127, a Cas protein of Pyrococcus furiosus DSM 3638 that is composed of 480 amino acids and belongs to the Csx1 family. The C-terminal domain of PF1127 has a unique β-hairpin structure that protrudes out of an α-helix and contains several positively charged residues. We demonstrate that PF1127 binds double-stranded DNA and RNA and that this activity requires an intact β-hairpin and involve the homodimerization of the protein. In contrast, another Csx1 protein from Sulfolobus solfataricus P2 that is composed of 377 amino acids does not have the β-hairpin structure and exhibits no DNA-binding properties under the same experimental conditions. Notably, the C-terminal domain of these two Csx1 proteins is greatly diversified, in contrast to the conserved N-terminal domain, which appears to play a common role in the homodimerization of the protein. Thus, although P. furiosus Csx1 is identified as a nucleic acid-binding protein, other Csx1 proteins are predicted to exhibit different individual biochemical activities.

  5. Design of HIV-1 Protease Inhibitors with Amino-bis-tetrahydrofuran Derivatives as P2-Ligands to Enhance Backbone-Binding Interactions. Synthesis, Biological Evaluation, and Protein-Ligand X-ray Studies

    SciTech Connect

    Ghosh, Arun K.; Martyr, Cuthbert D.; Osswald, Heather L.; Sheri, Venkat Reddy; Kassekert, Luke A.; Chen, Shujing; Agniswamy, Johnson; Wang, Yuan-Fang; Hayashi, Hironori; Aoki, Manabu; Weber, Irene T.; Mitsuya, Hiroaki


    Structure-based design, synthesis, and biological evaluation of a series of very potent HIV-1 protease inhibitors are described. In an effort to improve backbone ligand–binding site interactions, we have incorporated basic-amines at the C4 position of the bis-tetrahydrofuran (bis-THF) ring. We speculated that these substituents would make hydrogen bonding interactions in the flap region of HIV-1 protease. Synthesis of these inhibitors was performed diastereoselectively. A number of inhibitors displayed very potent enzyme inhibitory and antiviral activity. Inhibitors 25f, 25i, and 25j were evaluated against a number of highly-PI-resistant HIV-1 strains, and they exhibited improved antiviral activity over darunavir. Two high resolution X-ray structures of 25f- and 25g-bound HIV-1 protease revealed unique hydrogen bonding interactions with the backbone carbonyl group of Gly48 as well as with the backbone NH of Gly48 in the flap region of the enzyme active site. These ligand–binding site interactions are possibly responsible for their potent activity.

  6. Fusion-type lycopene beta-cyclase from a thermoacidophilic archaeon Sulfolobus solfataricus.


    Hemmi, Hisashi; Ikejiri, Satoru; Nakayama, Toru; Nishino, Tokuzo


    Examination of the sequence of a hypothetical gene with an unknown function included in the carotenogenic gene cluster in the genome of a thermoacidophilic archaeon Sulfolobus solfataricus led to the prediction that the gene encodes a novel-type lycopene beta-cyclase, whose N- and C-terminal halves are homologous to the subunits of the bacterial heterodimeric enzymes. The recombinant expression of the gene in lycopene-producing Escherichia coli resulted in the accumulation of beta-carotene in the cells, which verifies the function of the gene. Homologues of the archaeal lycopene beta-cyclase from various organisms such as bacteria, archaea, and fungi have been reported. Although their primary structures are clearly specific to the biological taxa, a phylogenetic analysis revealed the unexpected complicity of the evolutional route of these enzymes.

  7. The SLAC P2 Marx

    SciTech Connect

    Kemp, Mark; Benwell, Andrew; Burkhart, Craig; MacNair, David; Nguyen1, Minh; /SLAC


    A proposed high energy physics accelerator, the International Linear Collider, will require greater than five hundred rf stations. Each station is composed of a klystron driven by a modulator. Recently, the SLAC P2 Marx was designated the baseline modulator for the ILC. This paper describes some key features of this modulator and presents recent experimental results. The P2 Marx is presently being transported to another facility for lifetime testing. Here, we will gain understanding of how the Marx performs into a klystron load and gain experience operating the Marx for longer periods. Long term plans include the possibility of using this rf station for L-band technology demonstration at SLAC. While the Marx was designed with the ILC in mind, the topology can be readily applied to several different applications. We are currently evaluating the use of the topology for ESS, CLIC, and upgrades for systems at Fermi National Accelerator Laboratory. Because of the modular nature of the cell and the robustness of the control system, many different combinations of series and parallel operation are possible along with different load currents and pulse shapes.

  8. Activation and Regulation of Purinergic P2X Receptor Channels

    PubMed Central

    Coddou, Claudio; Yan, Zonghe; Obsil, Tomas; Huidobro-Toro, J. Pablo


    Mammalian ATP-gated nonselective cation channels (P2XRs) can be composed of seven possible subunits, denoted P2X1 to P2X7. Each subunit contains a large ectodomain, two transmembrane domains, and intracellular N and C termini. Functional P2XRs are organized as homomeric and heteromeric trimers. This review focuses on the binding sites involved in the activation (orthosteric) and regulation (allosteric) of P2XRs. The ectodomains contain three ATP binding sites, presumably located between neighboring subunits and formed by highly conserved residues. The detection and coordination of three ATP phosphate residues by positively charged amino acids are likely to play a dominant role in determining agonist potency, whereas an AsnPheArg motif may contribute to binding by coordinating the adenine ring. Nonconserved ectodomain histidines provide the binding sites for trace metals, divalent cations, and protons. The transmembrane domains account not only for the formation of the channel pore but also for the binding of ivermectin (a specific P2X4R allosteric regulator) and alcohols. The N- and C- domains provide the structures that determine the kinetics of receptor desensitization and/or pore dilation and are critical for the regulation of receptor functions by intracellular messengers, kinases, reactive oxygen species and mercury. The recent publication of the crystal structure of the zebrafish P2X4.1R in a closed state provides a major advance in the understanding of this family of receptor channels. We will discuss data obtained from numerous site-directed mutagenesis experiments accumulated during the last 15 years with reference to the crystal structure, allowing a structural interpretation of the molecular basis of orthosteric and allosteric ligand actions. PMID:21737531

  9. High-affinity RNA binding by a hyperthermophilic single-stranded DNA-binding protein.


    Morten, Michael J; Gamsjaeger, Roland; Cubeddu, Liza; Kariawasam, Ruvini; Peregrina, Jose; Penedo, J Carlos; White, Malcolm F


    Single-stranded DNA-binding proteins (SSBs), including replication protein A (RPA) in eukaryotes, play a central role in DNA replication, recombination, and repair. SSBs utilise an oligonucleotide/oligosaccharide-binding (OB) fold domain to bind DNA, and typically oligomerise in solution to bring multiple OB fold domains together in the functional SSB. SSBs from hyperthermophilic crenarchaea, such as Sulfolobus solfataricus, have an unusual structure with a single OB fold coupled to a flexible C-terminal tail. The OB fold resembles those in RPA, whilst the tail is reminiscent of bacterial SSBs and mediates interaction with other proteins. One paradigm in the field is that SSBs bind specifically to ssDNA and much less strongly to RNA, ensuring that their functions are restricted to DNA metabolism. Here, we use a combination of biochemical and biophysical approaches to demonstrate that the binding properties of S. solfataricus SSB are essentially identical for ssDNA and ssRNA. These features may represent an adaptation to a hyperthermophilic lifestyle, where DNA and RNA damage is a more frequent event.

  10. Understanding Molecular Recognition of Promiscuity of Thermophilic Methionine Adenosyltransferase, sMAT from Sulfolobus solfataricus

    PubMed Central

    Wang, Fengbin; Singh, Shanteri; Zhang, Jianjun; Huber, Tyler D.; Helmich, Kate E.; Sunkara, Manjula; Hurley, Katherine A.; Goff, Randal D.; Bingman, Craig A.; Morris, Andrew J.; Thorson, Jon S.; Phillips, George N.


    Methionine adenosyltransferase (MAT) is a family of enzymes that utilizes ATP and methionine to produce S-adenosylmethionine (AdoMet), the most crucial methyl donor in the biological methylation of biomolecules and bioactive natural products. Here, we report that the MAT from Sulfolobus solfataricus (sMAT), an enzyme from a poorly explored class of the MAT family, has the ability to produce a range of differentially alkylated AdoMet analogs in the presence of non-native methionine analogs and ATP. To investigate the molecular basis for AdoMet analog production, we have crystallized the sMAT in the AdoMet bound, S-adenosylethionine (AdoMet) bound, and unbound forms. Notably, among these structures, the AdoEth-bound form offers the first MAT structure containing a non-native product and cumulatively, these structures add new structural insight into the MAT family and allow for detailed active site comparison with its homologs in E. coli and human. As a thermostable MAT structure from archaea, the structures herein also provide as a basis for future engineering to potentially broaden AdoMet analog production as reagents for methyltransferase-catalyzed ‘alkylrandomization’ and/or the study of methylation in the context of biological processes. PMID:24649856

  11. Production of steviol from steviol glucosides using β-glycosidase from Sulfolobus solfataricus.


    Nguyen, Thi Thanh Hanh; Kim, Seong-Bo; Kim, Nahyun M; Kang, Choongil; Chung, Byoungsang; Park, Jun-Seong; Kim, Doman


    Steviol is a diterpene isolated from the plant Stevia rebaudiana that has a potential role as an antihyperglycemic agent by stimulating insulin secretion from pancreatic beta cells and also has significant potential to diminish the renal clearance of anionic drugs and their metabolites. In this study, the lacS gene, which encodes a thermostable β-glycosidase (SSbgly) enzyme from the extremely thermoacidophillic archaeon Sulfolobus solfataricus, was cloned and expressed in E. coli Rossetta BL21(DE3)pLyS using lactose as an inducer. Through fermentation, SSbgly was expressed as a 61kDa protein with activity of 24.3U/mg and the OD600 of 23 was reached after 18h induction with 10mM lactose. Purified protein was obtained by Ni-Sepharose chromatography with a yield of 92.3%. SSbgly hydrolyzed steviol glycosides to produce steviol with a yield of 99.2%. The optimum conditions for steviol production were 50U/ml SSbgly and 90mg/ml Ste at 75°C as determined by the response surface method.

  12. Role of MerH in mercury resistance in the archaeon Sulfolobus solfataricus

    PubMed Central

    Schelert, James; Rudrappa, Deepak; Johnson, Tyler


    Crenarchaeota include extremely thermoacidophilic organisms that thrive in geothermal environments dominated by sulfidic ores and heavy metals such as mercury. Mercuric ion, Hg(II), inactivates transcription in the crenarchaeote Sulfolobus solfataricus and simultaneously derepresses transcription of a resistance operon, merHAI, through interaction with the MerR transcription factor. While mercuric reductase (MerA) is required for metal resistance, the role of MerH, an adjacent small and predicted product of an ORF, has not been explored. Inactivation of MerH either by nonsense mutation or by in-frame deletion diminished Hg(II) resistance of mutant cells. Promoter mapping studies indicated that Hg(II) sensitivity of the merH nonsense mutant arose through transcriptional polarity, and its metal resistance was restored partially by single copy merH complementation. Since MerH was not required in vitro for MerA-catalysed Hg(II) reduction, MerH may play an alternative role in metal resistance. Inductively coupled plasma-mass spectrometry analysis of the MerH deletion strain following metal challenge indicated that there was prolonged retention of intracellular Hg(II). Finally, a reduced rate of mer operon induction in the merH deletion mutant suggested that the requirement for MerH could result from metal trafficking to the MerR transcription factor. PMID:23619003

  13. Decavanadate, a P2X receptor antagonist, and its use to study ligand interactions with P2X7 receptors.


    Michel, Anton D; Xing, Mengle; Thompson, Kyla M; Jones, Clare A; Humphrey, Patrick P A


    In this study we have studied decavanadate effects at P2X receptors. Decavanadate competitively blocked 2'- and 3'-O-(4benzoylbenzoyl) ATP (BzATP) stimulated ethidium accumulation in HEK293 cells expressing human recombinant P2X7 receptors (pK(B) 7.5). The effects of decavanadate were rapid (minutes) in both onset and offset and contrasted with the much slower kinetics of pyridoxal 5-phosphate (P5P), Coomassie brilliant blue (CBB) and 1-[N,O-bis(5-isoquinolinesulfonyl)-N-methyl-L-tyrosyl]-4-phenylpiperazine (KN62). Decavanadate competitively blocked the slowly reversible, or irreversible, blockade of the P2X7 receptor produced by P5P and oxidised ATP suggesting competition for a common binding site. However, the interaction between decavanadate and KN62 was non-competitive. Decavanadate also blocked P2X2 and P2X4 receptors but with slightly lower potency. These data demonstrate that decavanadate is the first reversible and competitive antagonist of the P2X7 receptor and is a useful tool for studying the mechanism of interaction of ligands with the P2X7 receptor.

  14. Nucleotides Acting at P2Y Receptors: Connecting Structure and Function.


    Jacobson, Kenneth A; Paoletta, Silvia; Katritch, Vsevolod; Wu, Beili; Gao, Zhan-Guo; Zhao, Qiang; Stevens, Raymond C; Kiselev, Evgeny


    Eight G protein-coupled P2Y receptor (P2YR) subtypes are important physiologic mediators. The human P2YRs are fully activated by ATP (P2Y2 and P2Y11), ADP (P2Y1, P2Y12, and P2Y13), UTP (P2Y2 and P2Y4), UDP (P2Y6 and P2Y14), and UDP glucose (P2Y14). Their structural elucidation is progressing rapidly. The X-ray structures of three ligand complexes of the Gi-coupled P2Y12R and two of the Gq-coupled P2Y1Rs were recently determined and will be especially useful in structure-based ligand design at two P2YR subfamilies. These high-resolution structures, which display unusual binding site features, complement mutagenesis studies for probing ligand recognition and activation. The structural requirements for nucleotide agonist recognition at P2YRs are relatively permissive with respect to the length of the phosphate moiety, but less so with respect to base recognition. Nucleotide-like antagonists and partial agonists are also known for P2Y1, P2Y2, P2Y4, and P2Y12Rs. Each P2YR subtype has the ability to be activated by structurally bifunctional agonists, such as dinucleotides, typically, dinucleoside triphosphates or tetraphosphates, and nucleoside polyphosphate sugars (e.g., UDP glucose) as well as the more conventional mononucleotide agonists. A range of dinucleoside polyphosphates, from triphosphates to higher homologs, occurs naturally. Earlier modeling predictions of the P2YRs were not very accurate, but recent findings have provided much detailed structural insight into this receptor family to aid in the rational design of new drugs.

  15. Nucleotides Acting at P2Y Receptors: Connecting Structure and Function

    PubMed Central

    Paoletta, Silvia; Katritch, Vsevolod; Wu, Beili; Gao, Zhan-Guo; Zhao, Qiang; Stevens, Raymond C.; Kiselev, Evgeny


    Eight G protein–coupled P2Y receptor (P2YR) subtypes are important physiologic mediators. The human P2YRs are fully activated by ATP (P2Y2 and P2Y11), ADP (P2Y1, P2Y12, and P2Y13), UTP (P2Y2 and P2Y4), UDP (P2Y6 and P2Y14), and UDP glucose (P2Y14). Their structural elucidation is progressing rapidly. The X-ray structures of three ligand complexes of the Gi-coupled P2Y12R and two of the Gq-coupled P2Y1Rs were recently determined and will be especially useful in structure-based ligand design at two P2YR subfamilies. These high-resolution structures, which display unusual binding site features, complement mutagenesis studies for probing ligand recognition and activation. The structural requirements for nucleotide agonist recognition at P2YRs are relatively permissive with respect to the length of the phosphate moiety, but less so with respect to base recognition. Nucleotide-like antagonists and partial agonists are also known for P2Y1, P2Y2, P2Y4, and P2Y12Rs. Each P2YR subtype has the ability to be activated by structurally bifunctional agonists, such as dinucleotides, typically, dinucleoside triphosphates or tetraphosphates, and nucleoside polyphosphate sugars (e.g., UDP glucose) as well as the more conventional mononucleotide agonists. A range of dinucleoside polyphosphates, from triphosphates to higher homologs, occurs naturally. Earlier modeling predictions of the P2YRs were not very accurate, but recent findings have provided much detailed structural insight into this receptor family to aid in the rational design of new drugs. PMID:25837834

  16. Modulation of P2X3 and P2X2/3 Receptors by Monoclonal Antibodies.


    Shcherbatko, Anatoly; Foletti, Davide; Poulsen, Kris; Strop, Pavel; Zhu, Guoyun; Hasa-Moreno, Adela; Melton Witt, Jody; Loo, Carole; Krimm, Stellanie; Pios, Ariel; Yu, Jessica; Brown, Colleen; Lee, John K; Stroud, Robert; Rajpal, Arvind; Shelton, David


    Purinergic homomeric P2X3 and heteromeric P2X2/3 receptors are ligand-gated cation channels activated by ATP. Both receptors are predominantly expressed in nociceptive sensory neurons, and an increase in extracellular ATP concentration under pathological conditions, such as tissue damage or visceral distension, induces channel opening, membrane depolarization, and initiation of pain signaling. Hence, these receptors are considered important therapeutic targets for pain management, and development of selective antagonists is currently progressing. To advance the search for novel analgesics, we have generated a panel of monoclonal antibodies directed against human P2X3 (hP2X3). We have found that these antibodies produce distinct functional effects, depending on the homomeric or heteromeric composition of the target, its kinetic state, and the duration of antibody exposure. The most potent antibody, 12D4, showed an estimated IC50 of 16 nm on hP2X3 after short term exposure (up to 18 min), binding to the inactivated state of the channel to inhibit activity. By contrast, with the same short term application, 12D4 potentiated the slow inactivating current mediated by the heteromeric hP2X2/3 channel. Extending the duration of exposure to ∼20 h resulted in a profound inhibition of both homomeric hP2X3 and heteromeric hP2X2/3 receptors, an effect mediated by efficient antibody-induced internalization of the channel from the plasma membrane. The therapeutic potential of mAb12D4 was assessed in the formalin, complete Freund's adjuvant, and visceral pain models. The efficacy of 12D4 in the visceral hypersensitivity model indicates that antibodies against P2X3 may have therapeutic potential in visceral pain indications.

  17. Structural features responsible for kinetic thermal stability of a carboxypeptidase from the archaebacterium Sulfolobus solfataricus.

    PubMed Central

    Villa, A; Zecca, L; Fusi, P; Colombo, S; Tedeschi, G; Tortora, P


    Investigations were performed on the structural features responsible for kinetic thermal stability of a thermostable carboxypeptidase from the thermoacidophilic archaebacterium Sulfolobus solfataricus which had been purified previously and identified as a zinc metalloprotease [Colombo, D'Auria, Fusi, Zecca, Raia and Tortora (1992) Eur. J. Biochem. 206, 349-357]. Removal of Zn2+ by dialysis led to reversible activity loss, which was promptly restored by addition of 80 microM ZnCl2 to the assay mixture. For the first-order irreversible thermal inactivation the metal-depleted enzyme showed an activation energy value of 205.6 kJ.mol-1, which is considerably lower than that of the holoenzyme (494.4 kJ.mol-1). The values of activation free energies, enthalpies and entropies also dropped with metal removal. Thermal inactivation of the apoenzyme was very quick at 80 degrees C, whereas the holoenzyme was stable at the same temperature. These findings suggest a major stabilizing role for the bivalent cation. Chaotropic salts strongly destabilized the holoenzyme, showing that hydrophobic interactions are involved in maintaining the native conformation of the enzyme. However, the inactivation rate was also increased by sodium sulphate, acetate and chloride, which are not chaotropes, indicating that one or more salt bridges concur in stabilizing the active enzyme. Furthermore, at the extremes of the pH-stability curve, NaCl did not affect the inactivation rate, confirming the stabilizing role of intramolecular ionic bonds, as a pH-dependent decrease in stability is likely to occur from breaking of salt bridges involved in maintaining the native conformation of the protein. PMID:8240298

  18. A heat-stable serine proteinase from the extreme thermophilic archaebacterium Sulfolobus solfataricus.


    Burlini, N; Magnani, P; Villa, A; Macchi, F; Tortora, P; Guerritore, A


    A proteinase was purified to electrophoretic homogeneity from crude extracts of the thermoacidophilic archaebacterium Sulfolobus solfataricus. Molecular mass values assessed by SDS-PAGE and gel filtration were 54 and 118 kDa, respectively, which points to a dimeric structure of the molecule. An isoelectric point of 5.6 was also determined. The enzyme behaved as a chymotrypsin-like serine proteinase, as shown by the inhibitory effects exerted by phenylmethanesulfonyl fluoride, 3,4-dichloroisocoumarin, tosylphenylalaninechloromethyl ketone and chymostatin. Consistently with the inhibition pattern, the enzyme cleaved chromogenic substrates at the carboxyl side of aromatic or bulky aliphatic amino acids; however, it effectively attacked only a small number of such substrates, thus, displaying a specificity much narrower than and clearly different from that of chymotrypsin. This was confirmed by its inability to digest a set of natural substrate proteins, as well as insulin chains A and B; only after alkylation casein was degraded to some extent. Proteinase activity was significantly stimulated by Mn2+ which acted as a mixed-type nonessential activator. The enzyme also displayed a broad pH optimum in the range 6.5-8.0. Furthermore, it was completely stable up to 90 degrees C; above this temperature it underwent first-order thermal inactivation with half-lives ranging from 342 min (92 degrees C) to 7 min (101 degrees C). At 50 degrees C it could withstand 6 M urea and, to some extent, different organic solvents; however, at 95 degrees C it was extensively inactivated by all of these compounds. None of the chemical physical properties of the enzyme, including amino-acid analysis, provided evidence of a possible relation to other well-known microbial serine proteinases.

  19. Structural features responsible for kinetic thermal stability of a carboxypeptidase from the archaebacterium Sulfolobus solfataricus.


    Villa, A; Zecca, L; Fusi, P; Colombo, S; Tedeschi, G; Tortora, P


    Investigations were performed on the structural features responsible for kinetic thermal stability of a thermostable carboxypeptidase from the thermoacidophilic archaebacterium Sulfolobus solfataricus which had been purified previously and identified as a zinc metalloprotease [Colombo, D'Auria, Fusi, Zecca, Raia and Tortora (1992) Eur. J. Biochem. 206, 349-357]. Removal of Zn2+ by dialysis led to reversible activity loss, which was promptly restored by addition of 80 microM ZnCl2 to the assay mixture. For the first-order irreversible thermal inactivation the metal-depleted enzyme showed an activation energy value of 205.6 kJ.mol-1, which is considerably lower than that of the holoenzyme (494.4 kJ.mol-1). The values of activation free energies, enthalpies and entropies also dropped with metal removal. Thermal inactivation of the apoenzyme was very quick at 80 degrees C, whereas the holoenzyme was stable at the same temperature. These findings suggest a major stabilizing role for the bivalent cation. Chaotropic salts strongly destabilized the holoenzyme, showing that hydrophobic interactions are involved in maintaining the native conformation of the enzyme. However, the inactivation rate was also increased by sodium sulphate, acetate and chloride, which are not chaotropes, indicating that one or more salt bridges concur in stabilizing the active enzyme. Furthermore, at the extremes of the pH-stability curve, NaCl did not affect the inactivation rate, confirming the stabilizing role of intramolecular ionic bonds, as a pH-dependent decrease in stability is likely to occur from breaking of salt bridges involved in maintaining the native conformation of the protein.

  20. Purification and characterization of a thermostable carboxypeptidase from the extreme thermophilic archaebacterium Sulfolobus solfataricus.


    Colombo, S; D'Auria, S; Fusi, P; Zecca, L; Raia, C A; Tortora, P


    A carboxypeptidase was purified to electrophoretic homogeneity from the thermoacidophilic archaebacterium Sulfolobus solfataricus. Molecular masses assessed by SDS/PAGE and gel filtration were 42 kDa and 170 kDa, respectively, which points to a tetrameric structure for the molecule. An isoelectric point of 5.9 was also determined. The enzyme was proven to be a metalloprotease, as shown by the inhibitory effects exerted by EDTA and o-phenanthroline; furthermore, dialysis against EDTA led to a complete loss of activity, which could be restored by addition of Zn2+ in the micromolar range, and, to a lesser extent, by Co2+. The enzyme was endowed with a broad substrate specificity, as shown by its ability to release basic, acidic and aromatic amino acids from the respective benzoylglycylated and benzyloxycarbonylated amino acids. An esterase activity of the carboxypeptidase was also demonstrated on different esterified amino acids and dipeptides blocked at the N-terminus. The enzyme displayed broad pH optima ranging over 5.5-7.0, or 5.5-9.0, when using an acidic or a basic benzyloxycarbonylated amino acid, respectively. With regard to thermostability, it was proven to be completely stable on incubation for 15 min at 85 degrees C. Furthermore, thanks to its relatively low activation energy, i.e. 31.0 kJ/mol, it was still significantly active at room temperature. At 40 degrees C, the enzyme could withstand 0.1% SDS and different organic solvents: particularly ethanol up to 99%. Amino acid and N-terminal sequence analyses did not evidence any similarity to carboxypeptidases A nor thermolysin. A weak similarity was only found with bovine carboxypeptidase B.

  1. Metabolism of pentose sugars in the hyperthermophilic archaea Sulfolobus solfataricus and Sulfolobus acidocaldarius.


    Nunn, Charlotte E M; Johnsen, Ulrike; Schönheit, Peter; Fuhrer, Tobias; Sauer, Uwe; Hough, David W; Danson, Michael J


    We have previously shown that the hyperthermophilic archaeon, Sulfolobus solfataricus, catabolizes d-glucose and d-galactose to pyruvate and glyceraldehyde via a non-phosphorylative version of the Entner-Doudoroff pathway. At each step, one enzyme is active with both C6 epimers, leading to a metabolically promiscuous pathway. On further investigation, the catalytic promiscuity of the first enzyme in this pathway, glucose dehydrogenase, has been shown to extend to the C5 sugars, D-xylose and L-arabinose. In the current paper we establish that this promiscuity for C6 and C5 metabolites is also exhibited by the third enzyme in the pathway, 2-keto-3-deoxygluconate aldolase, but that the second step requires a specific C5-dehydratase, the gluconate dehydratase being active only with C6 metabolites. The products of this pathway for the catabolism of D-xylose and L-arabinose are pyruvate and glycolaldehyde, pyruvate entering the citric acid cycle after oxidative decarboxylation to acetyl-coenzyme A. We have identified and characterized the enzymes, both native and recombinant, that catalyze the conversion of glycolaldehyde to glycolate and then to glyoxylate, which can enter the citric acid cycle via the action of malate synthase. Evidence is also presented that similar enzymes for this pentose sugar pathway are present in Sulfolobus acidocaldarius, and metabolic tracer studies in this archaeon demonstrate its in vivo operation in parallel with a route involving no aldol cleavage of the 2-keto-3-deoxy-pentanoates but direct conversion to the citric acid cycle C5-metabolite, 2-oxoglutarate.

  2. Stability of mRNA in the hyperthermophilic archaeon Sulfolobus solfataricus.

    PubMed Central

    Bini, Elisabetta; Dikshit, Vidula; Dirksen, Kristi; Drozda, Melissa; Blum, Paul


    Archaea-like bacteria are prokaryotes but, in contrast, use eukaryotic-like systems for key aspects of DNA, RNA, and protein metabolism. mRNA is typically unstable in bacteria and stable in eukaryotes, but little information is available about mRNA half-lives in archaea. Because archaea are generally insensitive to antibiotics, examination of mRNA stability in the hyperthermophile, Sulfolobus solfataricus, required the identification of transcription inhibitors for half-life determinations. An improved lacS promoter-dependent in vitro transcription system was used to assess inhibitor action. Efficient inhibitors were distinguished as blocking both lacSp transcription in vitro and the incorporation of 3H-uracil into bulk RNA in vivo. Actinomycin D was the most stable and potent compound identified. A survey of transcript chemical half-lives normalized to levels of the signal recognition particle 7S RNA ranged from at least 2 h for tfb1, a transcription factor TFIIB paralog, to a minimum of 6.3 min for gln1, one of three glutamine synthetase paralogs. Transcript half-lives for other mRNAs were: 2 h, superoxide dismutase (sod); 37.5 min, glucose dehydrogenase (dhg1); 25 min, alpha-glucosidase (malA); and 13.5 min, transcription factor TFIIB-2 (tfb2) resulting in a minimum average half-life of 54 min. These are the first mRNA half-lives reported for a hyperthermophile or member of the crenarchaea. The unexpected stability of several transcripts has important implications for gene expression and mRNA degradation in this organism. PMID:12358432

  3. Redox stress proteins are involved in adaptation response of the hyperthermoacidophilic archaeon Sulfolobus solfataricus to nickel challenge

    PubMed Central

    Salzano, Anna M; Febbraio, Ferdinando; Farias, Tiziana; Cetrangolo, Giovanni P; Nucci, Roberto; Scaloni, Andrea; Manco, Giuseppe


    Background Exposure to nickel (Ni) and its chemical derivatives has been associated with severe health effects in human. On the contrary, poor knowledge has been acquired on target physiological processes or molecular mechanisms of this metal in model organisms, including Bacteria and Archaea. In this study, we describe an analysis focused at identifying proteins involved in the recovery of the archaeon Sulfolobus solfataricus strain MT4 from Ni-induced stress. Results To this purpose, Sulfolobus solfataricus was grown in the presence of the highest nickel sulphate concentration still allowing cells to survive; crude extracts from treated and untreated cells were compared at the proteome level by using a bi-dimensional chromatography approach. We identified several proteins specifically repressed or induced as result of Ni treatment. Observed up-regulated proteins were largely endowed with the ability to trigger recovery from oxidative and osmotic stress in other biological systems. It is noteworthy that most of the proteins induced following Ni treatment perform similar functions and a few have eukaryal homologue counterparts. Conclusion These findings suggest a series of preferential gene expression pathways activated in adaptation response to metal challenge. PMID:17692131

  4. FoxP2 in songbirds.


    Wohlgemuth, Sandra; Adam, Iris; Scharff, Constance


    Humans with mutations in the transcription factor FOXP2 display a severe speech disorder. Songbirds are a powerful model system to study FoxP2. Like humans, songbirds communicate via vocalizations that are imitatively learned during critical periods and this learning is influenced by social factors and relies on functionally lateralized neural circuits. During the past five years significant progress has been made moving from a descriptive to a more mechanistic understanding of how FoxP2 functions in songbirds. Current evidence from molecular and electrophysiological studies indicates that FoxP2 is important for shaping synaptic plasticity of specific neuron populations. One future goal will be to identify the transcriptional regulation orchestrated by FoxP2 and its associated molecular network that brings about these physiological effects. This will be key to further unravel how FoxP2 influences synaptic function and thereby contributes to auditory guided vocal motor behavior in the songbird model.

  5. P2X Receptors as Drug Targets

    PubMed Central

    Jarvis, Michael F.


    The study of P2X receptors has long been handicapped by a poverty of small-molecule tools that serve as selective agonists and antagonists. There has been progress, particularly in the past 10 years, as cell-based high-throughput screening methods were applied, together with large chemical libraries. This has delivered some drug-like molecules in several chemical classes that selectively target P2X1, P2X3, or P2X7 receptors. Some of these are, or have been, in clinical trials for rheumatoid arthritis, pain, and cough. Current preclinical research programs are studying P2X receptor involvement in pain, inflammation, osteoporosis, multiple sclerosis, spinal cord injury, and bladder dysfunction. The determination of the atomic structure of P2X receptors in closed and open (ATP-bound) states by X-ray crystallography is now allowing new approaches by molecular modeling. This is supported by a large body of previous work using mutagenesis and functional expression, and is now being supplemented by molecular dynamic simulations and in silico ligand docking. These approaches should lead to P2X receptors soon taking their place alongside other ion channel proteins as therapeutically important drug targets. PMID:23253448

  6. P2 performance measurement tools workbook: Draft

    SciTech Connect


    The underlying purpose of the Department of Energy`s (DOE) Waste Minimization and Pollution Prevention (WMin/P2) Program is compliance with the waste management regulations set forth by the DOE, the federal government, and individual state and local agencies 1. In addition to these regulatory mandates, the increases in waste management costs and public interest in environmental issues have created other drivers to develop and demonstrate an effective WMin/P2 Program. The Waste Minimization Division (EM-334) must have adequate methods to calculate and roll up pollution prevention (P2) progress to meet the WMin/P2 requirements; these requirements support DOE and national objectives and direct funding. This document outlines a system to evaluate DOE`s P2 progress towards the waste reduction requirements. The emphasis of these pollution prevention measurements is to evaluate whether P2 activities are effective, (i.e., has the required amount of waste been reduced as a result of the P2 activities) and to evaluate the cost management of P2 projects. The performance evaluation system presented in this document encompass these aspects: (1) site requirements that apply to all DOE waste generating organizations, (2) a baseline that is not affected by short-term waste generation, and (3) key indicators that can be rolled up across DOE sites and across specific Cognizant Secretarial Officers` (CSO) sites. In a performance-based management system, requirements are the fundamental link between the planning and measurement process. The site requirements are {open_quotes}targets{close_quotes} at the process or activity level. Measuring DOE`s P2 progress toward these requirements provides the necessary feedback to (1) compare performance with the requirements/standards (i.e., whether the reduction requirement of 50% by 1999 is achievable) (2) detect departures from planned levels of performance, and (3) restore performance to the planned levels or achieve new levels of performance.


    PubMed Central

    Van Rhee, A. Michiel; Fischer, Bilha; Van Galen, Philip J. M.; Jacobson, Kenneth A.


    The P2Y1 purinoceptor cloned from chick brain (Webb, T. et al. (1993) FEBS Lett., 324, 219–225) is a 362 amino acid, 41 kDa protein. To locate residues tentatively involved in ligand recognition a molecular model of the P2Y purinoceptor has been constructed. The model was based on the primary sequence and structural homology with the G-protein coupled photoreceptor rhodopsin, in analogy to the method proposed by Ballesteros and Weinstein ((1995) Meth. Neurosci. 25, 366–428). Transmembrane helices were constructed from the amino acid sequence, minimized individually, and positioned in a helical bundle. The helical bundle was then minimized using the Amber forcefield in Discover (BIOSYM Technologies) to obtain the final model. Several residues that have been shown to be critical in ligand binding in other GPCRs are conserved in the P2Y1 purinoceptor. According to our model the side chains of these conserved residues are facing the internal cleft in which ligand binding likely occurs. The model also suggests four basic residues (H121 in TM3, H266 and K269 in TM6 and R299 in TM7) near the extracellular surface that might be involved in ligand binding. These basic residues might be essential in coordinating the triphosphate chain of the endogenous ligand adenosine 5′-triphosphate (ATP). Potential binding sites for agonists have been explored by docking several derivatives (including newly synthesized N6-derivatives) into the model. The N6-phenylethyl substituent is tolerated pharmacologically, and in our model this substituent occupies a region predominantly defined by aromatic residues such as F51 (TM1), Y100 (TM2) and F120 (TM3). The dimethylated analogue of ATP, N6,N6-dimethyl-adenosine 5′-triphosphate, is less well tolerated pharmacologically, and our model predicts that the attenuated activity is due to interference with hydrogen bonding capacity to Q296 (TM7). PMID:8872457

  8. P2X and P2Y receptor signaling in red blood cells.


    Sluyter, Ronald


    Purinergic signaling involves the activation of cell surface P1 and P2 receptors by extracellular nucleosides and nucleotides such as adenosine and adenosine triphosphate (ATP), respectively. P2 receptors comprise P2X and P2Y receptors, and have well-established roles in leukocyte and platelet biology. Emerging evidence indicates important roles for these receptors in red blood cells. P2 receptor activation stimulates a number of signaling pathways in progenitor red blood cells resulting in microparticle release, reactive oxygen species formation, and apoptosis. Likewise, activation of P2 receptors in mature red blood cells stimulates signaling pathways mediating volume regulation, eicosanoid release, phosphatidylserine exposure, hemolysis, impaired ATP release, and susceptibility or resistance to infection. This review summarizes the distribution of P2 receptors in red blood cells, and outlines the functions of P2 receptor signaling in these cells and its implications in red blood cell biology.

  9. Functionalized Congeners of P2Y1 Receptor Antagonists:

    SciTech Connect

    de Castro, Sonia; Maruoka, Hiroshi; Hong, Kunlun; Kilbey, II, S Michael; Costanzi, Stefano; Hechler, Béatrice; Gachet, Christian; Harden, T. Kendall; Jacobson, Kenneth A.


    The P2Y{sub 1} receptor is a prothrombotic G protein-coupled receptor (GPCR) activated by ADP. Preference for the North (N) ring conformation of the ribose moiety of adenine nucleotide 3',5'-bisphosphate antagonists of the P2Y{sub 1} receptor was established by using a ring-constrained methanocarba (a bicyclo[3.1.0]hexane) ring as a ribose substitute. A series of covalently linkable N{sup 6}-methyl-(N)-methanocarba-2'-deoxyadenosine-3',5'-bisphosphates containing extended 2-alkynyl chains was designed, and binding affinity at the human (h) P2Y{sub 1} receptor determined. The chain of these functionalized congeners contained hydrophilic moieties, a reactive substituent, or biotin, linked via an amide. Variation of the chain length and position of an intermediate amide group revealed high affinity of carboxylic congener 8 (K{sub i} 23 nM) and extended amine congener 15 (K{sub i} 132 nM), both having a 2-(1-pentynoyl) group. A biotin conjugate 18 containing an extended {epsilon}-aminocaproyl spacer chain exhibited higher affinity than a shorter biotinylated analogue. Alternatively, click coupling of terminal alkynes of homologous 2-dialkynyl nucleotide derivatives to alkyl azido groups produced triazole derivatives that bound to the P2Y{sub 1} receptor following deprotection of the bisphosphate groups. The preservation of receptor affinity of the functionalized congeners was consistent with new P2Y{sub 1} receptor modeling and ligand docking. Attempted P2Y{sub 1} antagonist conjugation to PAMAM dendrimer carriers by amide formation or palladium-catalyzed reaction between an alkyne on the dendrimer and a 2-iodopurine-derivatized nucleotide was unsuccessful. A dialkynyl intermediate containing the chain length favored in receptor binding was conjugated to an azide-derivatized dendrimer, and the conjugate inhibited ADP-promoted human platelet aggregation. This is the first example of attaching a strategically functionalized P2Y receptor antagonist to a PAMAM dendrimer to

  10. Characterization of P2P Systems

    NASA Astrophysics Data System (ADS)

    Stutzbach, Daniel; Rejaie, Reza

    The combination of large scale and geographically distributed nature of P2P system has led to their significant impact on the Internet. It is essential to characterize deployed P2P system for at least three reasons: (1) Accurately assessing their impact on the Internet, (2) identifying any performance bottleneck as well as any opportunity for performance improvement, (3) understanding user-driven dynamics in P2P systems. To characterize a P2P system, one needs to accurately capture snapshots of the resulting P2P overlay. This is challenging because the overlay is often large and dynamic. While the overlay is discovered by a crawler, it is changing which leads to a distorted view of the system. Capturing unbiased view of the traffic in the overlay is equally challenging because it is difficult to show that the captured behavior represent the observed behavior by all peers. In this chapter, we describe some of the fundamental problems in empirical characterization of widely deployed P2P systems. We present several examples to illustrate the effect of ad-hoc measurement/data collection on the resulting analysis/characterization. We then present two sampling techniques as a powerful approach to capture unbiased view of peer properties in a scalable fashion.

  11. A New Pepstatin-Insensitive Thermopsin-Like Protease Overproduced in Peptide-Rich Cultures of Sulfolobus solfataricus

    PubMed Central

    Gogliettino, Marta; Riccio, Alessia; Cocca, Ennio; Rossi, Mosè; Palmieri, Gianna; Balestrieri, Marco


    In this study, we gain insight into the extracellular proteolytic system of Sulfolobus solfataricus grown on proteinaceous substrates, providing further evidence that acidic proteases were specifically produced in response to peptide-rich media. The main proteolytic component was the previously isolated SsMTP (Sulfolobus solfataricus multi-domain thermopsin-like protease), while the less abundant (named SsMTP-1) one was purified, characterized and identified as the sso1175 gene-product. The protein revealed a multi-domain organization shared with the cognate SsMTP with a catalytic domain followed by several tandemly-repeated motifs. Moreover, both enzymes were found spread across the Crenarchaeota phylum and belonging to the thermopsin family, although segregated into diverse phylogenetic clusters. SsMTP-1 showed a 75-kDa molecular mass and was stable in the temperature range 50–90 °C, with optimal activity at 70 °C and pH 2.0. Serine, metallo and aspartic protease inhibitors did not affect the enzyme activity, designating SsMTP-1 as a new member of the pepstatin-insensitive aspartic protease family. The peptide-bond-specificity of SsMTP-1 in the cleavage of the oxidized insulin B chain was uncommon amongst thermopsins, suggesting that it could play a distinct, but cooperative role in the protein degradation machinery. Interestingly, predictions of the transmembrane protein topology of SsMTP and SsMTP-1 strongly suggest a possible contribution in signal-transduction pathways. PMID:24566144

  12. Anonymity in P2P Systems

    NASA Astrophysics Data System (ADS)

    Manzanares-Lopez, Pilar; Muñoz-Gea, Juan Pedro; Malgosa-Sanahuja, Josemaria; Sanchez-Aarnoutse, Juan Carlos

    In the last years, the use of peer-to-peer (P2P) applications to share and exchange knowledge among people around the world has experienced an exponential growth. Therefore, it is understandable that, like in any successful communication mechanism used by a lot of humans being, the anonymity can be a desirable characteristic in this scenario. Anonymity in P2P networks can be obtained by means of different methods, although the most significant ones are broadcast protocols, dining-cryptographer (DC) nets and multiple-hop paths. Each of these methods can be tunable in order to build a real anonymity P2P application. In addition, there is a mathematical tool called entropy that can be used in some scenarios to quantify anonymity in communication networks. In some cases, it can be calculated analytically but in others it is necessary to use simulation to obtain the network entropy.

  13. Data Sharing in P2P Systems

    NASA Astrophysics Data System (ADS)

    Hayek, Rabab; Raschia, Guillaume; Valduriez, Patrick; Mouaddib, Noureddine

    In this chapter, we survey P2P data sharing systems. All along, we focus on the evolution from simple file-sharing systems, with limited functionalities, to Peer Data Management Systems (PDMS) that support advanced applications with more sophisticated data management techniques. Advanced P2P applications are dealing with semantically rich data (e.g., XML documents, relational tables), using a high-level SQL-like query language. We start our survey with an overview over the existing P2P network architectures, and the associated routing protocols. Then, we discuss data indexing techniques based on their distribution degree and the semantics they can capture from the underlying data. We also discuss schema management techniques which allow integrating heterogeneous data. We conclude by discussing the techniques proposed for processing complex queries (e.g., range and join queries). Complex query facilities are necessary for advanced applications which require a high level of search expressiveness. This last part shows the lack of querying techniques that allow for an approximate query answering.

  14. A fluorescent approach for identifying P2X1 ligands

    PubMed Central

    Ruepp, Marc-David; Brozik, James A.; de Esch, Iwan J.P.; Farndale, Richard W.; Murrell-Lagnado, Ruth D.; Thompson, Andrew J.


    There are no commercially available, small, receptor-specific P2X1 ligands. There are several synthetic derivatives of the natural agonist ATP and some structurally-complex antagonists including compounds such as PPADS, NTP-ATP, suramin and its derivatives (e.g. NF279, NF449). NF449 is the most potent and selective ligand, but potencies of many others are not particularly high and they can also act at other P2X, P2Y and non-purinergic receptors. While there is clearly scope for further work on P2X1 receptor pharmacology, screening can be difficult owing to rapid receptor desensitisation. To reduce desensitisation substitutions can be made within the N-terminus of the P2X1 receptor, but these could also affect ligand properties. An alternative is the use of fluorescent voltage-sensitive dyes that respond to membrane potential changes resulting from channel opening. Here we utilised this approach in conjunction with fragment-based drug-discovery. Using a single concentration (300 μM) we identified 46 novel leads from a library of 1443 fragments (hit rate = 3.2%). These hits were independently validated by measuring concentration-dependence with the same voltage-sensitive dye, and by visualising the competition of hits with an Alexa-647-ATP fluorophore using confocal microscopy; confocal yielded kon (1.142 × 106 M−1 s−1) and koff (0.136 s−1) for Alexa-647-ATP (Kd = 119 nM). The identified hit fragments had promising structural diversity. In summary, the measurement of functional responses using voltage-sensitive dyes was flexible and cost-effective because labelled competitors were not needed, effects were independent of a specific binding site, and both agonist and antagonist actions were probed in a single assay. The method is widely applicable and could be applied to all P2X family members, as well as other voltage-gated and ligand-gated ion channels. This article is part of the Special Issue entitled ‘Fluorescent Tools in Neuropharmacology

  15. Allosteric modulation of ATP-gated P2X receptor channels

    PubMed Central

    Coddou, Claudio; Stojilkovic, Stanko S.; Huidobro-Toro, J. Pablo


    Seven mammalian purinergic receptor subunits, denoted P2X1 to P2X7, and several spliced forms of these subunits have been cloned. When heterologously expressed, these cDNAs encode ATP-gated non-selective cation channels organized as trimers. All activated receptors produce cell depolarization and promote Ca2+ influx through their pores and indirectly by activating voltage-gated calcium channels. However, the biophysical and pharmacological properties of these receptors differ considerably, and the majority of these subunits are also capable of forming heterotrimers with other members of the P2X receptor family, which confers further different properties. These channels have three ATP binding domains, presumably located between neighboring subunits, and occupancy of at least two binding sites is needed for their activation. In addition to the orthosteric binding sites for ATP, these receptors have additional allosteric sites that modulate the agonist action at receptors, including sites for trace metals, protons, neurosteroids, reactive oxygen species and phosphoinositides. The allosteric regulation of P2X receptors is frequently receptor-specific and could be a useful tool to identify P2X members in native tissues and their roles in signaling. The focus of this review is on common and receptor-specific allosteric modulation of P2X receptors and the molecular base accounting for allosteric binding sites. PMID:21639805

  16. Conformer and pharmacophore based identification of peptidomimetic inhibitors of chikungunya virus nsP2 protease.


    Dhindwal, Sonali; Kesari, Pooja; Singh, Harvijay; Kumar, Pravindra; Tomar, Shailly


    Chikungunya virus nsP2 replication protein is a cysteine protease, which cleaves the nonstructural nsP1234 polyprotein into functional replication components. The cleavage and processing of nsP1234 by nsP2 protease is essential for the replication and proliferation of the virus. Thus, ChikV nsP2 protease is a promising target for antiviral drug discovery. In this study, the crystal structure of the C-terminal domain of ChikV nsP2 protease (PDB ID: 4ZTB) was used for structure based identification and rational designing of peptidomimetic inhibitors against nsP2 protease. The interactions of the junction residues of nsP3/4 polyprotein in the active site of nsP2 protease have been mimicked to identify and design potential inhibitory molecules. Molecular docking of the nsP3/4 junction peptide in the active site of ChikV nsP2 protease provided the structural insight of the probable binding mode of nsP3/4 peptide and pigeonholed the molecular interactions critical for the substrate binding. Further, the shape and pharmacophoric properties of the viral nsP3/4 substrate peptide were taken into consideration and the mimetic molecules were identified and designed. The designed mimetic compounds were then analyzed by docking and their binding affinity was assessed by molecular dynamics simulations.

  17. Functional properties of five Dictyostelium discoideum P2X receptors.


    Baines, Abigail; Parkinson, Katie; Sim, Joan A; Bragg, Laricia; Thompson, Christopher R L; North, R Alan


    The Dictyostelium discoideum genome encodes five proteins that share weak sequence similarity with vertebrate P2X receptors. Unlike vertebrate P2X receptors, these proteins are not expressed on the surface of cells, but populate the tubules and bladders of the contractile vacuole. In this study, we expressed humanized cDNAs of P2XA, P2XB, P2XC, P2XD, and P2XE in human embryonic kidney cells and altered the ionic and proton environment in an attempt to reflect the situation in amoeba. Recording of whole-cell membrane currents showed that four receptors operated as ATP-gated channels (P2XA, P2XB, P2XD, and P2XE). At P2XA receptors, ATP was the only effective agonist of 17 structurally related putative ligands that were tested. Extracellular sodium, compared with potassium, strongly inhibited ATP responses in P2XB, P2XD, and P2XE receptors. Increasing the proton concentration (pH 6.2) accelerated desensitization at P2XA receptors and decreased currents at P2XD receptors, but increased the currents at P2XB and P2XE receptors. Dictyostelium lacking P2XA receptors showed impaired regulatory volume decrease in hypotonic solution. This phenotype was readily rescued by overexpression of P2XA and P2XD receptors, partially rescued by P2XB and P2XE receptors, and not rescued by P2XC receptors. The failure of the nonfunctional receptor P2XC to restore the regulatory volume decrease highlights the importance of ATP activation of P2X receptors for a normal response to hypo-osmotic shock, and the weak rescue by P2XB and P2XE receptors indicates that there is limited functional redundancy among Dictyostelium P2X receptors.

  18. A Highly Selective Oligopeptide Binding Protein from the Archaeon Sulfolobus Solfataricus▿ †

    PubMed Central

    Gogliettino, M.; Balestrieri, M.; Pocsfalvi, G.; Fiume, I.; Natale, L.; Rossi, M.; Palmieri, G.


    SSO1273 of Sulfolobus solfataricus was identified as a cell surface-bound protein by a proteomics approach. Sequence inspection of the genome revealed that the open reading frame of sso1273 is associated in an operon-like structure with genes encoding all the remaining components of a canonical protein-dependent ATP-binding cassette (ABC) transporter. sso1273 gene expression and SSO1273 protein accumulation on the cell surface were demonstrated to be strongly induced by the addition of a peptide mixture (tryptone) to the culture medium. The native protein was obtained in multimeric form, mostly hexameric, under the purification conditions used, and it was characterized as an oligopeptide binding protein, named S. solfataricus OppA (OppASs). OppaASs possesses typical sequence patterns required for glycosylphosphatidylinositol lipid anchoring, resulting in an N-linked glycoprotein with carbohydrate moieties likely composed of high mannose and/or hybrid complex carbohydrates. OppASs specifically binds oligopeptides and shows a marked selectivity for the amino acid composition of substrates when assayed in complex peptide mixtures. Moreover, a truncated version of OppASs, produced in recombinant form and including the putative binding domain, showed a low but significant oligopeptide binding activity. PMID:20382765

  19. Molecular determinants of P2Y2 nucleotide receptor function: implications for proliferative and inflammatory pathways in astrocytes.


    Weisman, Gary A; Wang, M; Kong, Q; Chorna, N E; Neary, J T; Sun, Grace Y; González, Fernando A; Seye, C I; Erb, L


    In the mammalian nervous system, P2 nucleotide receptors mediate neurotransmission, release of proinflammatory cytokines, and reactive astrogliosis. Extracellular nucleotides activate multiple P2 receptors in neurons and glial cells, including G protein-coupled P2Y receptors and P2X receptors, which are ligand-gated ion channels. In glial cells, the P2Y2 receptor subtype, distinguished by its ability to be equipotently activated by ATP and UTP, is coupled to pro-inflammatory signaling pathways. In situ hybridization studies with rodent brain slices indicate that P2Y2 receptors are expressed primarily in the hippocampus and cerebellum. Astrocytes express several P2 receptor subtypes, including P2Y2 receptors whose activation stimulates cell proliferation and migration. P2Y2 receptors, via an RGD (Arg-Gly-Asp) motif in their first extracellular loop, bind to alphavbeta3/beta5 integrins, whereupon P2Y2 receptor activation stimulates integrin signaling pathways that regulate cytoskeletal reorganization and cell motility. The C-terminus of the P2Y2 receptor contains two Src-homology-3 (SH3)-binding domains that upon receptor activation, promote association with Src and transactivation of growth factor receptors. Together, our results indicate that P2Y2 receptors complex with both integrins and growth factor receptors to activate multiple signaling pathways. Thus, P2Y2 receptors present novel targets to control reactive astrogliosis in neurodegenerative diseases.

  20. Eclogitic pyroxenes, ordered with P2 symmetry

    USGS Publications Warehouse

    Clark, J.R.; Papike, J.J.


    X-ray diffraction crystal-structure analysis of omphacite from eclogite, Tiburon Peninsula, Marin County, California, shows that this clinopyroxene has P2 symmetry with a nearly ordered distribution of the multiple cation content defined by its approximate formula: (Na0.5Ca0.5) (Mg 0.4Fe2+0.1Al0.4Fe3+0.1)Si2O6. Na+ and Ca2+ tend to assume alternate locations in the structure, and (Mg,Fe2+) octahedra alternate with Al3+ or (Al,F3+) octahedra in chains along c.

  1. A novel thermostable protein-tag: optimization of the Sulfolobus solfataricus DNA- alkyl-transferase by protein engineering.


    Vettone, Antonella; Serpe, Mario; Hidalgo, Aurelio; Berenguer, José; del Monaco, Giovanni; Valenti, Anna; Rossi, Mosé; Ciaramella, Maria; Perugino, Giuseppe


    In the last decade, a powerful biotechnological tool for the in vivo and in vitro specific labeling of proteins (SNAP-tag™ technology) was proposed as a valid alternative to classical protein-tags (green fluorescent proteins, GFPs). This was made possible by the discovery of the irreversible reaction of the human alkylguanine-DNA-alkyl-transferase (hAGT) in the presence of benzyl-guanine derivatives. However, the mild reaction conditions and the general instability of the mesophilic SNAP-tag™ make this new approach not fully applicable to (hyper-)thermophilic and, in general, extremophilic organisms. Here, we introduce an engineered variant of the thermostable alkylguanine-DNA-alkyl-transferase from the Archaea Sulfolobus solfataricus (SsOGT-H5), which displays a catalytic efficiency comparable to the SNAP-tag™ protein, but showing high intrinsic stability typical of proteins from this organism. The successful heterologous expression obtained in a thermophilic model organism makes SsOGT-H5 a valid candidate as protein-tag for organisms living in extreme environments.

  2. P2X and P2Y nucleotide receptors as targets in cardiovascular disease.


    Kennedy, Charles; Chootip, Krongkarn; Mitchell, Callum; Syed, Nawazish-i-Husain; Tengah, Asrin


    Endogenous nucleotides have widespread actions in the cardiovascular system, but it is only recently that the P2X and P2Y receptor subtypes, at which they act, have been identified and subtype-selective agonists and antagonists developed. These advances have greatly increased our understanding of the physiological and pathophysiological functions of P2X and P2Y receptors, but investigation of the clinical usefulness of selective ligands is at an early stage. Nonetheless, the evidence considered in this review demonstrates clearly that various cardiovascular disorders, including vasospasm, hypertension, congestive heart failure and cardiac damage during ischemic episodes, may be viable targets. With further development of novel, selective agonists and antagonists, our understanding will continue to improve and further therapeutic applications are likely to be discovered.

  3. The effect of anions on the human P2X7 receptor.


    Kubick, Christoph; Schmalzing, Günther; Markwardt, Fritz


    P2X7 receptors (P2X7Rs) are nonselective cation channels that are opened by the binding of extracellular ATP and are involved in the modulation of epithelial secretion, inflammation and nociception. Here, we investigated the effect of extracellular anions on channel gating and permeation of human P2X7Rs (hP2X7Rs) expressed in Xenopus laevis oocytes. Two-microelectrode voltage-clamp recordings showed that ATP-induced hP2X7R-mediated currents increased when extracellular chloride was substituted by the organic anions glutamate or aspartate and decreased when chloride was replaced by the inorganic anions nitrate, sulfate or iodide. ATP concentration-response comparisons revealed that substitution of chloride by glutamate decreased agonist efficacy, while substitution by iodide increased agonist efficacy at high ATP concentrations. Meanwhile, the ATP potency remained unchanged. Activation of the hP2X7R at low ATP concentrations via the high-affinity ATP effector site was not affected by the replacement of chloride by glutamate or iodide. To analyze the anion effect on the hP2X7R at the single-molecule level, we performed single-channel current measurements using the patch-clamp technique in the outside-out configuration. Chloride substitution did not affect the single-channel conductance, but the probability that the P2X7R channel was open increased when chloride was replaced by glutamate and decreased when chloride was replaced by iodide. This effect was due to an influence of the anions on the mean closed times of the hP2X7R channel. We conclude that hP2X7R channels are not anion-permeable in physiological Na+-based media and that external anions allosterically affect ion channel opening in the fully ATP4-liganded P2X7R through an extracellular anion binding site.

  4. Replication Bypass of the trans-4-Hydroxynonenal-Derived (6S,8R,11S)-1,N2-Deoxyguanosine DNA Adduct by the Sulfolobus solfataricus DNA Polymerase IV

    PubMed Central


    trans-4-Hydroxynonenal (HNE) is the major peroxidation product of ω-6 polyunsaturated fatty acids in vivo. Michael addition of the N2-amino group of dGuo to HNE followed by ring closure of N1 onto the aldehyde results in four diastereomeric 1,N2-dGuo (1,N2-HNE-dGuo) adducts. The (6S,8R,11S)-HNE-1,N2-dGuo adduct was incorporated into the 18-mer templates 5′-d(TCATXGAATCCTTCCCCC)-3′ and d(TCACXGAATCCTTCCCCC)-3′, where X = (6S,8R,11S)-HNE-1,N2-dGuo adduct. These differed in the identity of the template 5′-neighbor base, which was either Thy or Cyt, respectively. Each of these templates was annealed with either a 13-mer primer 5′-d(GGGGGAAGGATTC)-3′ or a 14-mer primer 5′-d(GGGGGAAGGATTCC)-3′. The addition of dNTPs to the 13-mer primer allowed analysis of dNTP insertion opposite to the (6S,8R,11S)-HNE-1,N2-dGuo adduct, whereas the 14-mer primer allowed analysis of dNTP extension past a primed (6S,8R,11S)-HNE-1,N2-dGuo:dCyd pair. The Sulfolobus solfataricus P2 DNA polymerase IV (Dpo4) belongs to the Y-family of error-prone polymerases. Replication bypass studies in vitro reveal that this polymerase inserted dNTPs opposite the (6S,8R,11S)-HNE-1,N2-dGuo adduct in a sequence-specific manner. If the template 5′-neighbor base was dCyt, the polymerase inserted primarily dGTP, whereas if the template 5′-neighbor base was dThy, the polymerase inserted primarily dATP. The latter event would predict low levels of Gua → Thy mutations during replication bypass when the template 5′-neighbor base is dThy. When presented with a primed (6S,8R,11S)-HNE-1,N2-dGuo:dCyd pair, the polymerase conducted full-length primer extension. Structures for ternary (Dpo4-DNA-dNTP) complexes with all four template-primers were obtained. For the 18-mer:13-mer template-primers in which the polymerase was confronted with the (6S,8R,11S)-HNE-1,N2-dGuo adduct, the (6S,8R,11S)-1,N2-dGuo lesion remained in the ring-closed conformation at the active site. The incoming dNTP, either d

  5. Central Role of P2Y6 UDP Receptor in Arteriolar Myogenic Tone

    PubMed Central

    Kauffenstein, Gilles; Tamareille, Sophie; Prunier, Fabrice; Roy, Charlotte; Ayer, Audrey; Toutain, Bertrand; Billaud, Marie; Isakson, Brant E.; Grimaud, Linda; Loufrani, Laurent; Rousseau, Pascal; Abraham, Pierre; Procaccio, Vincent; Monyer, Hannah; de Wit, Cor; Boeynaems, Jean-Marie; Robaye, Bernard; Kwak, Brenda R.; Henrion, Daniel


    Objective Myogenic tone (MT) of resistance arteries ensures autoregulation of blood flow in organs and relies on the intrinsic property of smooth muscle to contract in response to stretch. Nucleotides released by mechanical strain on cells are responsible for pleiotropic vascular effects, including vasoconstriction. Here, we evaluated the contribution of extracellular nucleotides to MT. Approach and Results We measured MT and the associated pathway in mouse mesenteric resistance arteries using arteriography for small arteries and molecular biology. Of the P2 receptors in mouse mesenteric resistance arteries, mRNA expression of P2X1 and P2Y6 was dominant. P2Y6 fully sustained UDP/UTP-induced contraction (abrogated in P2ry6−/− arteries). Preventing nucleotide hydrolysis with the ectonucleotidase inhibitor ARL67156 enhanced pressure-induced MT by 20%, whereas P2Y6 receptor blockade blunted MT in mouse mesenteric resistance arteries and human subcutaneous arteries. Despite normal hemodynamic parameters, P2ry6−/− mice were protected against MT elevation in myocardial infarction–induced heart failure. Although both P2Y6 and P2Y2 receptors contributed to calcium mobilization, P2Y6 activation was mandatory for RhoA–GTP binding, myosin light chain, P42–P44, and c-Jun N-terminal kinase phosphorylation in arterial smooth muscle cells. In accordance with the opening of a nucleotide conduit in pressurized arteries, MT was altered by hemichannel pharmacological inhibitors and impaired in Cx43+/− and P2rx7−/− mesenteric resistance arteries. Conclusions Signaling through P2 nucleotide receptors contributes to MT. This mechanism encompasses the release of nucleotides coupled to specific autocrine/paracrine activation of the uracil nucleotide P2Y6 receptor and may contribute to impaired tissue perfusion in cardiovascular diseases. PMID:27255725

  6. Structural basis for substrate specificity of alphavirus nsP2 proteases.


    Russo, Andrew T; Malmstrom, Robert D; White, Mark A; Watowich, Stanley J


    The alphavirus nsP2 protease is essential for correct processing of the alphavirus nonstructural polyprotein (nsP1234) and replication of the viral genome. We have combined molecular dynamics simulations with our structural studies to reveal features of the nsP2 protease catalytic site and S1'-S4 subsites that regulate the specificity of the protease. The catalytic mechanism of the nsP2 protease appears similar to the papain-like cysteine proteases, with the conserved catalytic dyad forming a thiolate-imidazolium ion pair in the nsP2-activated state. Substrate binding likely stabilizes this ion pair. Analysis of bimolecular complexes of Venezuelan equine encephalitis virus (VEEV) nsP2 protease with each of the nsP1234 cleavage sites identified protease residues His(510), Ser(511), His(546) and Lys(706) as critical for cleavage site recognition. Homology modelling and molecular dynamics simulations of diverse alphaviruses and their cognate cleavage site sequences revealed general features of substrate recognition that operate across alphavirus strains as well as strain specific covariance between binding site and cleavage site residues. For instance, compensatory changes occurred in the P3 and S3 subsite residues to maintain energetically favourable complementary binding surfaces. These results help explain how alphavirus nsP2 proteases recognize different cleavage sites within the nonstructural polyprotein and discriminate between closely related cleavage targets.

  7. P2 Receptors in Renal Autoregulation

    PubMed Central

    Guan, Zhengrong; Fellner, Robert C.; Van Beusecum, Justin; Inscho, Edward W.


    Accomplishing autoregulation of renal blood flow and glomerular filtration rate is an essential function of the renal microcirculation. While the existence of this phenomenon has been known for many years, the exact mechanisms that underlie this unique regulatory capability remain poorly understood. The work of many investigators has provided insights into many aspects of the autoregulatory mechanism, but many critical components remain elusive. This review is intended to update the reader on the role of P2 purinoceptors as a postulated mechanism responsible for renal autoregulatory resistance adjustments. It will summarize recent advances in normal function and it will touch on more recent ideas regarding autoregulatory insufficiency in hypertension and inflammation. Current thoughts on the nature of the mechanosensor responsible for myogenic behavior will be discussed as well as current thoughts on the mechanisms involved in ATP release to the extracellular fluid space. PMID:24066935

  8. Lipopolysaccharide Inhibits the Channel Activity of the P2X7 Receptor

    PubMed Central

    Leiva-Salcedo, Elias; Coddou, Claudio; Rodríguez, Felipe E.; Penna, Antonello; Lopez, Ximena; Neira, Tanya; Fernández, Ricardo; Imarai, Mónica; Rios, Miguel; Escobar, Jorge; Montoya, Margarita; Huidobro-Toro, J. Pablo; Escobar, Alejandro; Acuña-Castillo, Claudio


    The purinergic P2X7 receptor (P2X7R) plays an important role during the immune response, participating in several events such as cytokine release, apoptosis, and necrosis. The bacterial endotoxin lipopolysaccharide (LPS) is one of the strongest stimuli of the immune response, and it has been shown that P2X7R activation can modulate LPS-induced responses. Moreover, a C-terminal binding site for LPS has been proposed. In order to evaluate if LPS can directly modulate the activity of the P2X7R, we tested several signaling pathways associated with P2X7R activation in HEK293 cells that do not express the TLR-4 receptor. We found that LPS alone was unable to induce any P2X7R-related activity, suggesting that the P2X7R is not directly activated by the endotoxin. On the other hand, preapplication of LPS inhibited ATP-induced currents, intracellular calcium increase, and ethidium bromide uptake and had no effect on ERK activation in HEK293 cells. In splenocytes-derived T-regulatory cells, in which ATP-induced apoptosis is driven by the P2X7R, LPS inhibited ATP-induced apoptosis. Altogether, these results demonstrate that LPS modulates the activity of the P2X7R and suggest that this effect could be of physiological relevance. PMID:21941410

  9. P2X7 receptor knockout prevents streptozotocin-induced type 1 diabetes in mice.


    Vieira, Flávia Sarmento; Nanini, Hayandra Ferreira; Takiya, Christina Maeda; Coutinho-Silva, Robson


    Type 1 diabetes (T1D) is caused by autoimmune destruction of islet of Langerhans β-cells. P2X7 receptors (P2X7R) modulate proinflammatory immune responses by binding extracellular ATP, a classic 'danger signal'. Here, we evaluated whether the P2X7R has a role in T1D development. P2X7(-/-) mice are resistant to TD1 induction by streptozotocin (STZ) treatment, with no increase in blood glucose, decrease in insulin-positive cells, and pancreatic islet reduction, compared to WT (C57BL/6) mice. Also, the levels of proinflammatory mediators (IL-1β, IFN-γ and NO) did not increase after STZ treatment in P2X7(-/-) animals, with reduced infiltration of CD4(+), CD8(+), B220(+), CD11b(+) and CD11c(+) cells in the pancreatic lymph nodes. Treatment with a P2X7 antagonist mimicked the effect of P2X7 knockout, preventing STZ-induced diabetes. Our results show that the absence of the P2X7R provides resistance in the induction of diabetes in this model, and suggest that therapy targeting the P2X7R may be useful against clinical T1D.

  10. Participation of peripheral P2Y1, P2Y6 and P2Y11 receptors in formalin-induced inflammatory pain in rats.


    Barragán-Iglesias, Paulino; Mendoza-Garcés, Luis; Pineda-Farias, Jorge Baruch; Solano-Olivares, Verónica; Rodríguez-Silverio, Juan; Flores-Murrieta, Francisco Javier; Granados-Soto, Vinicio; Rocha-González, Héctor Isaac


    Metabotropic P2Y receptors subfamily consists of eight functional mammalian receptors. Specifically, P2Y1, P2Y6 and P2Y11 receptors have been described in the sensory nervous system, but their participation, at peripheral level, in behavioral pain models is scarcely understood. This study assessed the role of peripheral P2Y1, P2Y6 and P2Y11 receptors in formalin-induced inflammatory pain. Ipsilateral, but not contralateral peripheral pre-treatment with the endogenous P2Y1 (ADP, 100-1000nmol/paw), P2Y6 (UDP, 180-300nmol/paw) and P2Y11 (ATP, 100-1000nmol/paw), or selective P2Y1 (MRS2365, 0.1-10nmol/paw), P2Y6 (PSB0474, 0.1-0.10pmol/paw) and P2Y11 (NF546, 0.3-3nmol/paw) receptor agonists increased 0.5% formalin-induced flinching behavior. Concordantly, peripheral pre-treatment with the selective P2Y1 (MRS2500, 0.01-10pmol/paw), P2Y6 (MRS2578, 3-30nmol/paw) and P2Y11 (NF340, 1-10nmol/paw) receptor antagonists significantly decreased 1% formalin-induced flinching behavior. Furthermore, the pronociceptive effect of ADP (100nmol/paw) or MRS2365 (10nmol/paw), UDP (300nmol/paw) or PSB0474 (10pmol/paw) and ATP (1000nmol/paw) or NF546 (3nmol/paw) was blocked by the selective P2Y1 (MRS2500, 0.01nmol/paw), P2Y6 (MRS2578, 3nmol/paw), and P2Y11 (NF340, 1nmol/paw) receptor antagonists, respectively. Western blot analysis confirmed the presence of P2Y1 (66kDa), P2Y6 (36kDa) and P2Y11 (75kDa) receptors in dorsal root ganglia (DRG) and sciatic nerve. Results suggest that peripheral activation of P2Y1, P2Y6 and P2Y11 receptors plays a pronociceptive role in formalin-induced pain.

  11. Use-dependent inhibition of P2X3 receptors by nanomolar agonist.


    Pratt, Emily B; Brink, Thaddeus S; Bergson, Pamela; Voigt, Mark M; Cook, Sean P


    P2X3 receptors desensitize within 100 ms of channel activation, yet recovery from desensitization requires several minutes. The molecular basis for this slow rate of recovery is unknown. We designed experiments to test the hypothesis that this slow recovery is attributable to the high affinity (< 1 nM) of desensitized P2X3 receptors for agonist. We found that agonist binding to the desensitized state provided a mechanism for potent inhibition of P2X3 current. Sustained applications of 0.5 nM ATP inhibited > 50% of current to repetitive applications of P2X3 agonist. Inhibition occurred at 1000-fold lower agonist concentrations than required for channel activation and showed strong use dependence. No inhibition occurred without previous activation and desensitization. Our data are consistent with a model whereby inhibition of P2X3 by nanomolar [agonist] occurs by the rebinding of agonist to desensitized channels before recovery from desensitization. For several ATP analogs, the concentration required to inhibit P2X3 current inversely correlated with the rate of recovery from desensitization. This indicates that the affinity of the desensitized state and recovery rate primarily depend on the rate of agonist unbinding. Consistent with this hypothesis, unbinding of [32P]ATP from desensitized P2X3 receptors mirrored the rate of recovery from desensitization. As expected, disruption of agonist binding by site-directed mutagenesis increased the IC50 for inhibition and increased the rate of recovery.

  12. Molecular Modeling and Docking Study to Elucidate Novel Chikungunya Virus nsP2 Protease Inhibitors.


    Agarwal, T; Asthana, Somya; Bissoyi, A


    Chikungunya is one of the tropical viral infections that severely affect the Asian and African countries. Absence of any suitable drugs or vaccines against Chikungunya virus till date makes it essential to identify and develop novel leads for the same. Recently, nsP2 cysteine protease has been classified as a crucial drug target to combat infections caused by Alphaviruses including Chikungunya virus due to its involvement viral replication. Here in, we investigated the structural aspects of the nsP2 protease through homology modeling based on nsP2 protease from Venezuelan equine encephalitis virus. Further, the ligands were virtually screened based on various pharmacological, ADME/Tox filters and subjected to docking with the modeled Chikungunya nsP2 protease using AutoDock4.2. The interaction profiling of ligand with the protein was carried out using LigPlot(+). The results demonstrated that the ligand with PubChem Id (CID_5808891) possessed highest binding affinity towards Chikungunya nsP2 protease with a good interaction profile with the active site residues. We hereby propose that these compounds could inhibit the nsP2 protease by binding to its active site. Moreover, they may provide structural scaffold for the design of novel leads with better efficacy and specificity for the nsP2 protease.

  13. Molecular Modeling and Docking Study to Elucidate Novel Chikungunya Virus nsP2 Protease Inhibitors

    PubMed Central

    Agarwal, T.; Asthana, Somya; Bissoyi, A.


    Chikungunya is one of the tropical viral infections that severely affect the Asian and African countries. Absence of any suitable drugs or vaccines against Chikungunya virus till date makes it essential to identify and develop novel leads for the same. Recently, nsP2 cysteine protease has been classified as a crucial drug target to combat infections caused by Alphaviruses including Chikungunya virus due to its involvement viral replication. Here in, we investigated the structural aspects of the nsP2 protease through homology modeling based on nsP2 protease from Venezuelan equine encephalitis virus. Further, the ligands were virtually screened based on various pharmacological, ADME/Tox filters and subjected to docking with the modeled Chikungunya nsP2 protease using AutoDock4.2. The interaction profiling of ligand with the protein was carried out using LigPlot+. The results demonstrated that the ligand with PubChem Id (CID_5808891) possessed highest binding affinity towards Chikungunya nsP2 protease with a good interaction profile with the active site residues. We hereby propose that these compounds could inhibit the nsP2 protease by binding to its active site. Moreover, they may provide structural scaffold for the design of novel leads with better efficacy and specificity for the nsP2 protease. PMID:26664062

  14. Structural basis for subtype-specific inhibition of the P2X7 receptor

    SciTech Connect

    Karasawa, Akira; Kawate, Toshimitsu


    The P2X7 receptor is a non-selective cation channel activated by extracellular adenosine triphosphate (ATP). Chronic activation of P2X7 underlies many health problems such as pathologic pain, yet we lack effective antagonists due to poorly understood mechanisms of inhibition. Here we present crystal structures of a mammalian P2X7 receptor complexed with five structurally-unrelated antagonists. Unexpectedly, these drugs all bind to an allosteric site distinct from the ATP-binding pocket in a groove formed between two neighboring subunits. This novel drug-binding pocket accommodates a diversity of small molecules mainly through hydrophobic interactions. Functional assays propose that these compounds allosterically prevent narrowing of the drug-binding pocket and the turret-like architecture during channel opening, which is consistent with a site of action distal to the ATP-binding pocket. These novel mechanistic insights will facilitate the development of P2X7-specific drugs for treating human diseases.

  15. Structural basis for subtype-specific inhibition of the P2X7 receptor

    PubMed Central

    Karasawa, Akira; Kawate, Toshimitsu


    The P2X7 receptor is a non-selective cation channel activated by extracellular adenosine triphosphate (ATP). Chronic activation of P2X7 underlies many health problems such as pathologic pain, yet we lack effective antagonists due to poorly understood mechanisms of inhibition. Here we present crystal structures of a mammalian P2X7 receptor complexed with five structurally-unrelated antagonists. Unexpectedly, these drugs all bind to an allosteric site distinct from the ATP-binding pocket in a groove formed between two neighboring subunits. This novel drug-binding pocket accommodates a diversity of small molecules mainly through hydrophobic interactions. Functional assays propose that these compounds allosterically prevent narrowing of the drug-binding pocket and the turret-like architecture during channel opening, which is consistent with a site of action distal to the ATP-binding pocket. These novel mechanistic insights will facilitate the development of P2X7-specific drugs for treating human diseases. DOI: PMID:27935479

  16. Discovery of Potential Orthosteric and Allosteric Antagonists of P2Y1R from Chinese Herbs by Molecular Simulation Methods

    PubMed Central

    Lu, Fang; Jiang, Lu-di; Qiao, Lian-sheng; Xiang, Yu-hong


    P2Y1 receptor (P2Y1R), which belongs to G protein-coupled receptors (GPCRs), is an important target in ADP-induced platelet aggregation. The crystal structure of P2Y1R has been solved recently, which revealed orthosteric and allosteric ligand-binding sites with the details of ligand-protein binding modes. And it suggests that P2Y1R antagonists, which recognize two distinct sites, could potentially provide an efficacious and safe antithrombotic profile. In present paper, 2D similarity search, pharmacophore based screening, and molecular docking were used to explore the potential natural P2Y1R antagonists. 2D similarity search was used to classify orthosteric and allosteric antagonists of P2Y1R. Based on the result, pharmacophore models were constructed and validated by the test set. Optimal models were selected to discover potential P2Y1R antagonists of orthosteric and allosteric sites from Traditional Chinese Medicine (TCM). And the hits were filtered by Lipinski's rule. Then molecular docking was used to refine the results of pharmacophore based screening and analyze the binding mode of the hits and P2Y1R. Finally, two orthosteric and one allosteric potential compounds were obtained, which might be used in future P2Y1R antagonists design. This work provides a reliable guide for discovering natural P2Y1R antagonists acting on two distinct sites from TCM. PMID:27635149

  17. Structural and functional exchangeability of 5 S RNA species from the eubacterium E.coli and the thermoacidophilic archaebacterium Sulfolobus solfataricus.

    PubMed Central

    Teixidò, J; Altamura, S; Londei, P; Amils, R


    The role of 5 S RNA within the large ribosomal subunit of the extremely thermophilic archaebacterium Sulfolobus solfataricus has been analysed by means of in vitro reconstitution procedures. It is shown that Sulfolobus 50 S subunits reconstituted in the absence of 5 S RNA are inactive in protein synthesis and lack 2-3 ribosomal proteins. Furthermore, it has been determined that in the course of the in vitro assembly process Sulfolobus 5 S RNA can be replaced by the correspondent RNA species of E.coli; Sulfolobus reconstituted particles containing the eubacterial 5 S molecule are stable and active in polypeptide synthesis at high temperatures. Images PMID:2493632

  18. Role of purinergic P2X4 receptors in regulating striatal dopamine homeostasis and dependent behaviors.


    Khoja, Sheraz; Shah, Vivek; Garcia, Damaris; Asatryan, Liana; Jakowec, Michael W; Davies, Daryl L


    Purinergic P2X4 receptors (P2X4Rs) belong to the P2X superfamily of ion channels regulated by ATP. We recently demonstrated that P2X4R knockout (KO) mice exhibited deficits in sensorimotor gating, social interaction, and ethanol drinking behavior. Dopamine (DA) dysfunction may underlie these behavioral changes, but there is no direct evidence for P2X4Rs' role in DA neurotransmission. To test this hypothesis, we measured markers of DA function and dependent behaviors in P2X4R KO mice. P2X4R KO mice exhibited altered density of pre-synaptic markers including tyrosine hydroxylase, dopamine transporter; post-synaptic markers including dopamine receptors and phosphorylation of downstream targets including dopamine and cyclic-AMP regulated phosphoprotein of 32 kDa and cyclic-AMP-response element binding protein in different parts of the striatum. Ivermectin, an allosteric modulator of P2X4Rs, significantly affected dopamine and cyclic AMP regulated phosphoprotein of 32 kDa and extracellular regulated kinase1/2 phosphorylation in the striatum. Sensorimotor gating deficits in P2X4R KO mice were rescued by DA antagonists. Using the 6-hydroxydopamine model of DA depletion, P2X4R KO mice exhibited an attenuated levodopa (L-DOPA)-induced motor behavior, whereas ivermectin enhanced this behavior. Collectively, these findings identified an important role for P2X4Rs in maintaining DA homeostasis and illustrate how this association is important for CNS functions including motor control and sensorimotor gating. We propose that P2X4 receptors (P2X4Rs) regulate dopamine (DA) homeostasis and associated behaviors. Pre-synaptic and post-synaptic DA markers were significantly altered in the dorsal and ventral striatum of P2X4R KO mice, implicating altered DA neurotransmission. Sensorimotor gating deficits in P2X4R KO mice were rescued by DA antagonists. Ivermectin (IVM), a positive modulator of P2X4Rs, enhanced levodopa (L-DOPA)-induced motor behavior. These studies highlight potential

  19. Comparison of three GPCR structural templates for modeling of the P2Y12 nucleotide receptor

    NASA Astrophysics Data System (ADS)

    Deflorian, Francesca; Jacobson, Kenneth A.


    The P2Y12 receptor (P2Y12R) is an ADP-activated G protein-coupled receptor (GPCR) that is an important target for antithrombotic drugs. Three homology models of P2Y12R were compared, based on different GPCR structural templates: bovine rhodopsin (bRHO), human A2A adenosine receptor (A2AAR), and human C-X-C chemokine receptor type 4 (CXCR4). By criteria of sequence analysis (25.6% identity in transmembrane region), deviation from helicity in the second transmembrane helix (TM2), docked poses of ligands highlighting the role of key residues, accessibility of a conserved disulfide bridge that is reactive toward irreversibly-binding antagonists, and the presence of a shared disulfide bridge between the third extracellular loop (EL3) and the N-terminus, the CXCR4-based model appeared to be the most consistent with known characteristics of P2Y12R. The docked poses of agonist 2MeSADP and charged anthraquinone antagonist PSB-0739 in the binding pocket of P2Y12R-CXC agree with previously published site-directed mutagenesis studies of Arg256 and Lys280. A sulfonate at position 2 of the anthraquinone core created a strong interaction with the Lys174(EL2) side chain. The docking poses of the irreversibly-binding, active metabolite (existing as two diastereoisomers in vivo) of the clinically utilized antagonist Clopidogrel were compared. The free thiol group of the 4S diastereoisomer, but not the 4R isomer, was found in close proximity ( 4.7 Å) to the sulfur atom of a disulfide bridge involving Cys175, suggesting greater activity in covalent binding. Therefore, ligand docking to the CXCR4-based model of the P2Y12R predicted poses of both reversibly and irreversibly-binding small molecules, consistent with observed pharmacology and mutagenesis studies.

  20. Desensitization properties of P2X3 receptors shaping pain signaling

    PubMed Central

    Giniatullin, Rashid; Nistri, Andrea


    ATP-gated P2X3 receptors are mostly expressed by nociceptive sensory neurons and participate in transduction of pain signals. P2X3 receptors show a combination of fast desensitization onset and slow recovery. Moreover, even low nanomolar agonist concentrations unable to evoke a response, can induce desensitization via a phenomenon called “high affinity desensitization.” We have also observed that recovery from desensitization is agonist-specific and can range from seconds to minutes. The recovery process displays unusually high temperature dependence. Likewise, recycling of P2X3 receptors in peri-membrane regions shows unexpectedly large temperature sensitivity. By applying kinetic modeling, we have previously shown that desensitization characteristics of P2X3 receptor are best explained with a cyclic model of receptor operation involving three agonist molecules binding a single receptor and that desensitization is primarily developing from the open receptor state. Mutagenesis experiments suggested that desensitization depends on a certain conformation of the ATP binding pocket and on the structure of the transmembrane domains forming the ion pore. Further molecular determinants of desensitization have been identified by mutating the intracellular N- and C-termini of P2X3 receptor. Unlike other P2X receptors, the P2X3 subtype is facilitated by extracellular calcium that acts via specific sites in the ectodomain neighboring the ATP binding pocket. Thus, substitution of serine275 in this region (called “left flipper”) converts the natural facilitation induced by extracellular calcium to receptor inhibition. Given their strategic location in nociceptive neurons and unique desensitization properties, P2X3 receptors represent an attractive target for development of new analgesic drugs via promotion of desensitization aimed at suppressing chronic pain. PMID:24367291

  1. Potent and long-lasting inhibition of human P2X2 receptors by copper

    PubMed Central

    Punthambaker, Sukanya; Hume, Richard I.


    P2X receptors are ion channels gated by ATP. In rodents these channels are modulated by zinc and copper. Zinc is co-released with neurotransmitter at some synapses and can modulate neuronal activity, but the role of copper in the brain is unclear. Rat P2X2 receptors show potentiation by 2–100 µM zinc or copper in the presence of a submaximal concentration of ATP but are inhibited by zinc or copper at concentrations above 100 µM. In contrast, human P2X2 (hP2X2) receptors show no potentiation and are strongly inhibited by zinc over the range of 2–100 µM. The effect of copper on hP2X2 is of interest because there are human brain disorders in which copper concentration is altered. We found that hP2X2 receptors are potently inhibited by copper (IC50 = 40 nM). ATP responsiveness recovered extremely slowly after copper washout, with full recovery requiring over 1 h. ATP binding facilitated copper binding but not unbinding from this inhibitory site. A mutant receptor in which the first six extracellular cysteines were deleted, C(1–6)S, showed normal copper inhibition, however reducing agents dramatically accelerated recovery from copper inhibition in wild type hP2X2 and the C(1–6)S mutant, indicating that the final two disulfide bonds are required to maintain the high affinity copper binding site. Three histidine residues required for normal zinc inhibition were also required for normal copper inhibition. Humans with untreated Wilson’s disease have excess amounts of copper in the brain. The high copper sensitivity of hP2X2 receptors suggests that they are non-functional in these patients. PMID:24067922


    SciTech Connect

    Patterson, S.M.; Hatherill, J.R.; Hammel, M.; Hura, G.L.; Tainer, J.A.; Yannone, S.M.


    Vital molecular processes such as DNA replication, transcription, translation, and maintenance occur through transient protein interactions. Elucidating the mechanisms by which these protein complexes and interactions function could lead to treatments for diseases related to DNA damage and cell division control. In the recent decades since its introduction as a third domain, Archaea have shown to be simpler models for complicated eukaryotic processes such as DNA replication, repair, transcription, and translation. Sulfolobus solfataricus is one such model organism. A hyperthermophile with an optimal growth temperature of 80°C, Sulfolobus protein-protein complexes and transient protein interactions should be more stable at moderate temperatures, providing a means to isolate and study their structure and function. Here we provide the initial steps towards characterizing three DNA-related Sulfolobus proteins with small angle X-ray scattering (SAXS): Sso0257, a cell division control and origin recognition complex homolog, Sso0768, the small subunit of the replication factor C, and Sso3167, a Mut-T like protein. SAXS analysis was performed at multiple concentrations for both short and long exposure times. The Sso0257 sample was determined to be either a mixture of monomeric and dimeric states or a population of dynamic monomers in various conformational states in solution, consistent with a fl exible winged helix domain. Sso0768 was found to be a complex mixture of multimeric states in solution. Finally, molecular envelope reconstruction from SAXS data for Sso3167 revealed a novel structural component which may function as a disordered to ordered region in the presence of its substrates and/or protein partners.

  3. Immobilization of carboxypeptidase from Sulfolobus solfataricus on magnetic nanoparticles improves enzyme stability and functionality in organic media

    PubMed Central


    Background Superparamagnetic iron oxide nanoparticles (MNP) offer several advantages for applications in biomedical and biotechnological research. In particular, MNP-based immobilization of enzymes allows high surface-to-volume ratio, good dispersibility, easy separation of enzymes from the reaction mixture, and reuse by applying an external magnetic field. In a biotechnological perspective, extremophilic enzymes hold great promise as they often can be used under non-conventional harsh conditions, which may result in substrate transformations that are not achievable with normal enzymes. This prompted us to investigate the effect of MNP bioconjugation on the catalytic properties of a thermostable carboxypeptidase from the hyperthermophilic archaeon Sulfolobus solfataricus (CPSso), which exhibits catalytic properties that are useful in synthetic processes. Results CPSso was immobilized onto silica-coated iron oxide nanoparticles via NiNTA-His tag site-directed conjugation. Following the immobilization, CPSso acquired distinctly higher long-term stability at room temperature compared to the free native enzyme, which, in contrast, underwent extensive inactivation after 72 h incubation, thus suggesting a potential utilization of this enzyme under low energy consumption. Moreover, CPSso conjugation also resulted in a significantly higher stability in organic solvents at 40°C, which made it possible to synthesize N-blocked amino acids in remarkably higher yields compared to those of free enzyme. Conclusions The nanobioconjugate of CPSso immobilized on silica-coated magnetic nanoparticles exhibited enhanced stability in aqueous media at room temperature as well as in different organic solvents. The improved stability in ethanol paves the way to possible applications of immobilized CPSso, in particular as a biocatalyst for the synthesis of N-blocked amino acids. Another potential application might be amino acid racemate resolution, a critical and expensive step in

  4. Hepatitis C virus NS3-4A serine protease inhibitors: SAR of P'2 moiety with improved potency.


    Arasappan, A; Njoroge, F G; Chan, T-Y; Bennett, F; Bogen, S L; Chen, K; Gu, H; Hong, L; Jao, E; Liu, Y-T; Lovey, R G; Parekh, T; Pike, R E; Pinto, P; Santhanam, B; Venkatraman, S; Vaccaro, H; Wang, H; Yang, X; Zhu, Z; Mckittrick, B; Saksena, A K; Girijavallabhan, V; Pichardo, J; Butkiewicz, N; Ingram, R; Malcolm, B; Prongay, A; Yao, N; Marten, B; Madison, V; Kemp, S; Levy, O; Lim-Wilby, M; Tamura, S; Ganguly, A K


    We have discovered that introduction of appropriate amino acid derivatives at P'2 position improved the binding potency of P3-capped alpha-ketoamide inhibitors of HCV NS3 serine protease. X-ray crystal structure of one of the inhibitors (43) bound to the protease revealed the importance of the P'2 moiety.

  5. PI(3,5)P2 controls endosomal branched actin dynamics by regulating cortactin–actin interactions

    PubMed Central

    Hong, Nan Hyung; Qi, Aidong


    Branched actin critically contributes to membrane trafficking by regulating membrane curvature, dynamics, fission, and transport. However, how actin dynamics are controlled at membranes is poorly understood. Here, we identify the branched actin regulator cortactin as a direct binding partner of phosphatidylinositol 3,5-bisphosphate (PI(3,5)P2) and demonstrate that their interaction promotes turnover of late endosomal actin. In vitro biochemical studies indicated that cortactin binds PI(3,5)P2 via its actin filament-binding region. Furthermore, PI(3,5)P2 competed with actin filaments for binding to cortactin, thereby antagonizing cortactin activity. These findings suggest that PI(3,5)P2 formation on endosomes may remove cortactin from endosome-associated branched actin. Indeed, inhibition of PI(3,5)P2 production led to cortactin accumulation and actin stabilization on Rab7+ endosomes. Conversely, inhibition of Arp2/3 complex activity greatly reduced cortactin localization to late endosomes. Knockdown of cortactin reversed PI(3,5)P2-inhibitor–induced actin accumulation and stabilization on endosomes. These data suggest a model in which PI(3,5)P2 binding removes cortactin from late endosomal branched actin networks and thereby promotes net actin turnover. PMID:26323691

  6. Characterization of ATPase Activity of P2RX2 Cation Channel

    PubMed Central

    Mittal, Rahul; Grati, M'hamed; Sedlacek, Miloslav; Yuan, Fenghua; Chang, Qing; Yan, Denise; Lin, Xi; Kachar, Bechara; Farooq, Amjad; Chapagain, Prem; Zhang, Yanbin; Liu, Xue Z.


    P2X purinergic receptors are plasma membrane ATP-dependent cation channels that are broadly distributed in the mammalian tissues. P2RX2 is a modulator of auditory sensory hair cell mechanotransduction and plays an important role in hair cell tolerance to noise. In this study, we demonstrate for the first time in vitro and in cochlear neuroepithelium, that P2RX2 possesses the ATPase activity. We observed that the P2RX2 V60L human deafness mutation alters its ability to bind ATP, while the G353R has no effect on ATP binding or hydrolysis. A non-hydrolysable ATP assay using HEK293 cells suggests that ATP hydrolysis plays a significant role in the opening and gating of the P2RX2 ion channel. Moreover, the results of structural modeling of the molecule was in agreement with our experimental observations. These novel findings suggest the intrinsic ATPase activity of P2RX2 and provide molecular insights into the channel opening. PMID:27252659

  7. Small multicopy, non-integrative shuttle vectors based on the plasmid pRN1 for Sulfolobus acidocaldarius and Sulfolobus solfataricus, model organisms of the (cren-)archaea.


    Berkner, Silvia; Grogan, Dennis; Albers, Sonja-Verena; Lipps, Georg


    The extreme thermoacidophiles of the genus Sulfolobus are among the best-studied archaea but have lacked small, reliable plasmid vectors, which have proven extremely useful for manipulating and analyzing genes in other microorganisms. Here we report the successful construction of a series of Sulfolobus-Escherichia coli shuttle vectors based on the small multicopy plasmid pRN1 from Sulfolobus islandicus. Selection in suitable uracil auxotrophs is provided through inclusion of pyrEF genes in the plasmid. The shuttle vectors do not integrate into the genome and do not rearrange. The plasmids allow functional overexpression of genes, as could be demonstrated for the beta-glycosidase (lacS) gene of S. solfataricus. In addition, we demonstrate that this beta-glycosidase gene could function as selectable marker in S. solfataricus. The shuttle plasmids differ in their interruption sites within pRN1 and allowed us to delineate functionally important regions of pRN1. The orf56/orf904 operon appears to be essential for pRN1 replication, in contrast interruption of the highly conserved orf80/plrA gene is tolerated. The new vector system promises to facilitate genetic studies of Sulfolobus and to have biotechnological uses, such as the overexpression or optimization of thermophilic enzymes that are not readily performed in mesophilic hosts.

  8. P2 receptors activated by uracil nucleotides--an update.


    Brunschweiger, Andreas; Müller, Christa E


    Pyrimidine nucleotides, including UTP, UDP and UDP-glucose, are important signaling molecules which activate G protein-coupled membrane receptors (GPCRs) of the P2Y family. Four distinct pyrimidine nucleotide-sensitive P2Y receptor subtypes have been cloned, P2Y2, P2Y4, P2Y6 and P2Y14. P2Y2 and P2Y4 receptors are activated by UTP (the P2Y2, and the rat but not the human P2Y4 receptor are also activated by ATP), the P2Y6 receptor is activated by UDP, and the P2Y14 receptor by UDP-glucose. Furthermore, non-P2Y GPCRs, the cysteinylleukotriene receptors (CysLT1R and CysLT2R) have been described to be activated by UDP in addition to activation by cysteinylleukotrienes. While P2Y2, P2Y4, and P2Y6 receptor activation results in stimulation of phospholipase C, the P2Y14 receptor is coupled to inhibition of adenylate cyclase. Derivatives and analogs of the physiological nucleotides UTP, UDP and ATP have been synthesized and evaluated in order to obtain enzymatically stable, subtype-selective agonists. The P2Y2 receptor agonists diuridine tetraphosphate (diquafosol) and the uracil-cytosine dinucleotide denufosol are currently undergoing clinical trials for dry eye disease, retinal detachment disease, upper respiratory tract symptoms, and cystic fibrosis, respectively. The first antagonists for P2Y2 and P2Y6 receptors that appear to be selective versus other P2Y receptor subtypes have recently been described. Selective antagonists for P2Y4 and P2Y14 receptors are still lacking. Uracil nucleotide-sensitive P2Y receptor subtypes may constitute future targets for the treatment of certain cancer types, vascular diseases, inflammatory diseases, and immunomodulatory intervention. They have also been proposed to play a role in neurodegenerative diseases. This article is an updated version of "P2-Pyrimidinergic Receptors and Their Ligands" by C. E. Müller published in Curr. Pharm. Des. 2002, 8, 2353-2369.

  9. Transition strategies from cangrelor to oral platelet P2Y12 receptor antagonists.


    Schneider, David J


    Cangrelor is the first parenteral antagonist of the platelet P2Y12 receptor. This direct-acting antagonist of the platelet P2Y12 receptor should be considered an adjunct to a percutaneous coronary intervention in patients who have not been adequately pretreated with platelet P2Y12 receptor antagonists at the time of the procedure. The use of cangrelor requires transition to an oral platelet P2Y12 receptor antagonist. Transition strategies have been developed on the basis of pharmacologic characteristics of platelet P2Y12 receptor antagonists, results of pharmacodynamic studies, and results from clinical trials. Cangrelor blocks the binding to the platelet P2Y12 receptor of the active metabolite of the thienopyridines, clopidogrel and prasugrel. The active metabolite of thienopyridines is present in blood for a short interval after administration. For this reason, clopidogrel should be administered after cangrelor is stopped. Prasugrel can be administered at the end of the cangrelor infusion or up to 30 min before cangrelor is stopped. Ticagrelor is also a reversible direct-acting antagonist of the platelet P2Y12 receptor. Because there is no interaction between ticagrelor and cangrelor, ticagrelor can be administered before or during the infusion of cangrelor.

  10. Transcription factor IRF5 drives P2X4R+-reactive microglia gating neuropathic pain

    PubMed Central

    Masuda, Takahiro; Iwamoto, Shosuke; Yoshinaga, Ryohei; Tozaki-Saitoh, Hidetoshi; Nishiyama, Akira; Mak, Tak W.; Tamura, Tomohiko; Tsuda, Makoto; Inoue, Kazuhide


    In response to neuronal injury or disease, microglia adopt distinct reactive phenotypes via the expression of different sets of genes. Spinal microglia expressing the purinergic P2X4 receptor (P2X4R) after peripheral nerve injury (PNI) are implicated in neuropathic pain. Here we show that interferon regulatory factor-5 (IRF5), which is induced in spinal microglia after PNI, is responsible for direct transcriptional control of P2X4R. Upon stimulation of microglia by fibronectin, IRF5 induced de novo expression of P2X4R by directly binding to the promoter region of the P2rx4 gene. Mice lacking Irf5 did not upregulate spinal P2X4R after PNI, and also exhibited substantial resistance to pain hypersensitivity. Furthermore, we found that expression of IRF5 in microglia is regulated by IRF8. Thus, an IRF8-IRF5 transcriptional axis may contribute to shifting spinal microglia toward a P2X4R-expressing reactive state after PNI. These results may provide a new target for treating neuropathic pain. PMID:24818655

  11. Structural and functional evolution of the P2Y12-like receptor group

    PubMed Central

    Hermsdorf, Thomas; Engemaier, Eva; Engel, Kathrin; Liebscher, Ines; Thor, Doreen; Zierau, Klaas; Römpler, Holger; Schulz, Angela


    Metabotropic pyrimidine and purine nucleotide receptors (P2Y receptors) belong to the superfamily of G protein-coupled receptors (GPCR). They are distinguishable from adenosine receptors (P1) as they bind adenine and/or uracil nucleotide triphosphates or diphosphates depending on the subtype. Over the past decade, P2Y receptors have been cloned from a variety of tissues and species, and as many as eight functional subtypes have been characterized. Most recently, several members of the P2Y12-like receptor group, which includes the clopidogrel-sensitive ADP receptor P2Y12, have been deorphanized. The P2Y12-like receptor group comprises several structurally related GPCR which, however, display heterogeneous agonist specificity including nucleotides, their derivatives, and lipids. Besides the established function of P2Y12 in platelet activation, expression in macrophages, neuronal and glial cells as well as recent results from functional studies implicate that several members of this group may have specific functions in neurotransmission, inflammation, chemotaxis, and response to tissue injury. This review focuses specifically on the structure-function relation and shortly summarizes some aspects of the physiological relevance of P2Y12-like receptor members. PMID:18404440

  12. Comparative analysis of P2Y4 and P2Y6 receptor architecture in native and transfected neuronal systems.


    D'Ambrosi, Nadia; Iafrate, Monia; Saba, Elena; Rosa, Patrizia; Volonté, Cinzia


    Although extensive studies provided molecular and pharmacological characterization of metabotropic P2Y receptors for extracellular nucleotides, little is still known about their quaternary structure. By the use of transfected cellular systems and SDS-PAGE, in our previous work we established the propensity of P2Y(4) receptor to form dimeric interactions. Here we focused on endogenously expressed P2Y(4) and P2Y(6) subtypes, comparing their oligomeric complexes under Blue Native (BN) gel electrophoresis. We provided evidence that P2Y(4) and P2Y(6) receptors form high order complexes in native neuronal phenotypes and that the oligomers can be disaggregated down to the dimeric P2Y(4) or to the dimeric and monomeric P2Y(6) receptor. Moreover, dimeric P2Y(4) and monomeric P2Y(6) proteins display selective microdomain partitioning in lipid rafts from specialized subcellular compartments such as synaptosomes. Ligand activation by UTP shifted the oligomerization of P2Y(6) but not of P2Y(4) receptor, as analysed by BN electrophoresis. Finally, whereas transfected P2Y(4) and P2Y(6) proteins homo-interact and posses the appropriate domains to associate with all P2Y(1,2,4,6,11) subtypes, in naive PC12 cells the endogenous P2Y(4) forms hetero-oligomers only with the P2Y(6) subunit. In conclusion, our results indicate that quaternary structure distinguishing P2Y(4) from P2Y(6) receptors might be crucial for specific ligand activation, membrane partitioning and consequent functional regulation.

  13. Atomic resolution view into the structure–function relationships of the human myelin peripheral membrane protein P2

    PubMed Central

    Ruskamo, Salla; Yadav, Ravi P.; Sharma, Satyan; Lehtimäki, Mari; Laulumaa, Saara; Aggarwal, Shweta; Simons, Mikael; Bürck, Jochen; Ulrich, Anne S.; Juffer, André H.; Kursula, Inari; Kursula, Petri


    P2 is a fatty acid-binding protein expressed in vertebrate peripheral nerve myelin, where it may function in bilayer stacking and lipid transport. P2 binds to phospholipid membranes through its positively charged surface and a hydrophobic tip, and accommodates fatty acids inside its barrel structure. The structure of human P2 refined at the ultrahigh resolution of 0.93 Å allows detailed structural analyses, including the full organization of an internal hydrogen-bonding network. The orientation of the bound fatty-acid carboxyl group is linked to the protonation states of two coordinating arginine residues. An anion-binding site in the portal region is suggested to be relevant for membrane interactions and conformational changes. When bound to membrane multilayers, P2 has a preferred orientation and is stabilized, and the repeat distance indicates a single layer of P2 between membranes. Simulations show the formation of a double bilayer in the presence of P2, and in cultured cells wild-type P2 induces membrane-domain formation. Here, the most accurate structural and functional view to date on P2, a major component of peripheral nerve myelin, is presented, showing how it can interact with two membranes simultaneously while going through conformational changes at its portal region enabling ligand transfer. PMID:24419389

  14. Modeling ligand recognition at the P2Y12 receptor in light of X-ray structural information

    NASA Astrophysics Data System (ADS)

    Paoletta, Silvia; Sabbadin, Davide; von Kügelgen, Ivar; Hinz, Sonja; Katritch, Vsevolod; Hoffmann, Kristina; Abdelrahman, Aliaa; Straßburger, Jens; Baqi, Younis; Zhao, Qiang; Stevens, Raymond C.; Moro, Stefano; Müller, Christa E.; Jacobson, Kenneth A.


    The G protein-coupled P2Y12 receptor (P2Y12R) is an important antithrombotic target and of great interest for pharmaceutical discovery. Its recently solved, highly divergent crystallographic structures in complex either with nucleotides (full or partial agonist) or with a nonnucleotide antagonist raise the question of which structure is more useful to understand ligand recognition. Therefore, we performed extensive molecular modeling studies based on these structures and mutagenesis, to predict the binding modes of major classes of P2Y12R ligands previously reported. Various nucleotide derivatives docked readily to the agonist-bound P2Y12R, but uncharged nucleotide-like antagonist ticagrelor required a hybrid receptor resembling the agonist-bound P2Y12R except for the top portion of TM6. Supervised molecular dynamics (SuMD) of ticagrelor binding indicated interactions with the extracellular regions of P2Y12R, defining possible meta-binding sites. Ureas, sulfonylureas, sulfonamides, anthraquinones and glutamic acid piperazines docked readily to the antagonist-bound P2Y12R. Docking dinucleotides at both agonist- and antagonist-bound structures suggested interactions with two P2Y12R pockets. Thus, our structure-based approach consistently rationalized the main structure-activity relationships within each ligand class, giving useful information for designing improved ligands.

  15. Differential expression of porins OmpP2A and OmpP2B of Haemophilus ducreyi.


    Prather, Derrick T; Bains, Manjeet; Hancock, Robert E W; Filiatrault, Melanie J; Campagnari, Anthony A


    Haemophilus ducreyi is a strict human pathogen and the causative agent of the sexually transmitted disease chancroid. The genome of the human-passaged strain of H. ducreyi (35000HP) contains two homologous genes whose protein products have estimated molecular masses of 46 and 43 kDa. A comparative analysis of the deduced amino acid sequences revealed that these proteins share 27 to 33% identity to the outer membrane protein P2 (OmpP2), a major porin of Haemophilus influenzae. Therefore, these proteins have been designated OmpP2A and OmpP2B, respectively. The detection of ompP2A and ompP2B transcripts by reverse transcriptase PCR indicated that these genes were independently transcribed in H. ducreyi 35000HP. Western blot analysis of outer membrane proteins isolated from a geographically diverse collection of H. ducreyi clinical isolates revealed that OmpP2A and OmpP2B were differentially expressed among these strains. Although PCR analysis suggested that ompP2A and ompP2B were conserved among the strains tested, the differential expression observed was due to nucleotide additions and partial gene deletions. Purified OmpP2A and OmpP2B were isolated under nondenaturing conditions, and subsequent analysis demonstrated that these two proteins exhibited porin activity. OmpP2A and OmpP2B are the first porins described for H. ducreyi.

  16. Temperature-induced conformational change at the catalytic site of Sulfolobus solfataricus alcohol dehydrogenase highlighted by Asn249Tyr substitution. A hydrogen/deuterium exchange, kinetic, and fluorescence quenching study.


    Secundo, Francesco; Russo, Consiglia; Giordano, Antonietta; Carrea, Giacomo; Rossi, Mosè; Raia, Carlo A


    A combination of hydrogen/deuterium exchange, fluorescence quenching, and kinetic studies was used to acquire experimental evidence for the crystallographically hypothesized increase in local flexibility which occurs in thermophilic NAD(+)-dependent Sulfolobus solfataricus alcohol dehydrogenase (SsADH) upon substitution Asn249Tyr. The substitution, located at the adenine-binding site, proved to decrease the affinity for both coenzyme and substrate, rendering the mutant enzyme 6-fold more active when compared to the wild-type enzyme [Esposito et al. (2003) FEBS Lett. 539, 14-18]. The amide H/D exchange data show that the wild-type and mutant enzymes have similar global flexibility at 22 and 60 degrees C. However, the temperature dependence of the Stern-Volmer constant determined by acrylamide quenching shows that the increase in temperature affects the local flexibility differently, since the K(SV) increment is significantly higher for the wild-type than for the mutant enzyme over the range 18-45 degrees C. Interestingly, the corresponding van't Hoff plot (log K(SV) vs 1/T) proves nonlinear for the apo and holo wild-type and apo mutant enzymes, with a break at approximately 45 degrees C in all three cases due to a conformational change affecting the tryptophan microenvironment experienced by the quencher molecules. The Arrhenius and van't Hoff plots derived from the k(cat) and K(M) thermodependence measured with cyclohexanol and NAD(+) at different temperatures display an abrupt change of slope at 45-50 degrees C. This proves more pronounced in the case of the mutant enzyme compared to the wild-type enzyme due to a conformational change in the structure rather than to an overlapping of two or more rate-limiting reaction steps with different temperature dependencies of their rate constants. Three-dimensional analysis indicates that the observed conformational change induced by temperature is associated with the flexible loops directly involved in the substrate and

  17. A hydrophilic cation-binding protein of Arabidopsis thaliana, AtPCaP1, is localized to plasma membrane via N-myristoylation and interacts with calmodulin and the phosphatidylinositol phosphates PtdIns(3,4,5)P(3) and PtdIns(3,5)P(2).


    Nagasaki, Nahoko; Tomioka, Rie; Maeshima, Masayoshi


    A hydrophilic cation-binding protein, PCaP1, was found to be stably bound to the plasma membrane in Arabidopsis thaliana. PCaP1 was quantified to account for 0.03-0.08% of the crude membrane fractions from roots and shoots. Its homologous protein was detected in several plant species. We investigated the mechanism of membrane association of PCaP1 by transient expression of fusion protein with green fluorescent protein. The amino-terminal sequence of 27 residues of PCaP1 had a potential to localize the fusion protein with green fluorescent protein to the plasma membrane, and the substitution of Gly at position 2 with Ala resulted in the cytoplasmic localization of PCaP1. When PCaP1 was expressed in the in vitro transcription/translation system with [(3)H]myristic acid, the label was incorporated into PCaP1, but not into a mutant PCaP1 with Gly2 replaced by Ala. These results indicate that PCaP1 tightly binds to the plasma membrane via N-myristoylation at Gly2. We examined the binding capacity with phosphatidylinositol phosphates (PtdInsPs), and found that PCaP1 selectively interacts with phosphatidylinositol 3,5-bisphosphate and phosphatidylinositol 3,4,5-triphosphate. Competition assay with the N-terminal peptide and mutational analysis revealed that PCaP1 interacts with these two PtdInsPs at the N-terminal part. Interaction of PCaP1 with the membrane and PtdInsPs was not altered in the presence of Ca(2+) at physiological concentrations. Furthermore, calmodulin associated with PCaP1 in a Ca(2+)-dependent manner, and its association weakened the interaction of PCaP1 with PtdInsPs. These results indicate that the N-terminal part is essential for both N-myristoylation and interaction with PtdInsPs, and that PCaP1 may be involved in intracellular signalling through interaction with PtdInsPs and calmodulin.

  18. Collecting and Reporting P2 Results: Regional Measurement Guidance

    EPA Pesticide Factsheets

    Measuring results is an essential component of any successful P2 program and is one way to determine the success of a technical assistance or training effort. This PDF defines some terms of P2 measurement.

  19. Identification of chikungunya virus nsP2 protease inhibitors using structure-base approaches.


    Nguyen, Phuong T V; Yu, Haibo; Keller, Paul A


    The nsP2 protease of chikungunya virus (CHIKV) is one of the essential components of viral replication and it plays a crucial role in the cleavage of polyprotein precursors for the viral replication process. Therefore, it is gaining attention as a potential drug design target against CHIKV. Based on the recently determined crystal structure of the nsP2 protease of CHIKV, this study identified potential inhibitors of the virus using structure-based approaches with a combination of molecular docking, virtual screening and molecular dynamics (MD) simulations. The top hit compounds from database searching, using the NCI Diversity Set II, with targeting at five potential binding sites of the nsP2 protease, were identified by blind dockings and focused dockings. These complexes were then subjected to MD simulations to investigate the stability and flexibility of the complexes and to gain a more detailed insight into the interactions between the compounds and the enzyme. The hydrogen bonds and hydrophobic contacts were characterized for the complexes. Through structural alignment, the catalytic residues Cys1013 and His1083 were identified in the N-terminal region of the nsP2 protease. The absolute binding free energies were estimated by the linear interaction energy approach and compared with the binding affinities predicted with docking. The results provide valuable information for the development of inhibitors for CHIKV.

  20. Identification of a new dysfunctional platelet P2Y12 receptor variant associated with bleeding diathesis

    PubMed Central

    Lecchi, Anna; Razzari, Cristina; Paoletta, Silvia; Dupuis, Arnaud; Nakamura, Lea; Ohlmann, Philippe; Gachet, Christian; Jacobson, Kenneth A.; Zieger, Barbara


    Defects of the platelet P2Y12 receptor (P2Y12R) for adenosine diphosphate (ADP) are associated with increased bleeding risk. The study of molecular abnormalities associated with inherited qualitative defects of the P2Y12R protein is useful to unravel structure-function relationships of the receptor. We describe the case of 2 brothers, sons of first cousins, with lifelong history of abnormal bleeding, associated with dysfunctional P2Y12R and a previously undescribed missense mutation in the encoding gene. ADP (4-20 µM)–induced aggregation of patients’ platelets was markedly reduced and rapidly reversible. Other agonists induced borderline-normal aggregation. Inhibition of vasodilator-stimulated phosphoprotein phosphorylation and prostaglandin E1–induced increase in cyclic adenosine monophosphate (cAMP) by ADP was impaired, whereas inhibition of cAMP increase by epinephrine was normal. [3H]PSB-0413, a selective P2Y12R antagonist, bound to a normal number of binding sites; however, its affinity, and that of the agonists ADP and 2-methylthio-adenosine-5′-diphosphate, was reduced. Patients’ DNA showed a homozygous c.847T>A substitution that changed the codon for His-187 to Gln (p.His187Gln). Crystallographic data and molecular modeling studies indicated that His187 in transmembrane 5 is important for agonist and nucleotide antagonist binding and located in a region undergoing conformational changes. These studies delineate a region of P2Y12R required for normal function after ADP binding. PMID:25428217

  1. aP2-Cre-Mediated Inactivation of Estrogen Receptor Alpha Causes Hydrometra

    PubMed Central

    Antonson, Per; Matic, Marko; Portwood, Neil; Kuiper, Raoul V.; Bryzgalova, Galyna; Gao, Hui; Windahl, Sara H.; Humire, Patricia; Ohlsson, Claes; Berggren, Per-Olof; Gustafsson, Jan-Åke; Dahlman-Wright, Karin


    In this study we describe the reproductive phenotypes of a novel mouse model in which Cre-mediated deletion of ERα is regulated by the aP2 (fatty acid binding protein 4) promoter. ERα-floxed mice were crossed with transgenic mice expressing Cre-recombinase under the control of the aP2 promoter to generate aP2-Cre/ERαflox/flox mice. As expected, ERα mRNA levels were reduced in adipose tissue, but in addition we also detected an 80% reduction of ERα levels in the hypothalamus of aP2-Cre/ERαflox/flox mice. Phenotypic analysis revealed that aP2-Cre/ERαflox/flox female mice were infertile. In line with this, aP2-Cre/ERαflox/flox female mice did not cycle and presented 3.8-fold elevated estrogen levels. That elevated estrogen levels were associated with increased estrogen signaling was evidenced by increased mRNA levels of the estrogen-regulated genes lactoferrin and aquaporin 5 in the uterus. Furthermore, aP2-Cre/ERαflox/flox female mice showed an accumulation of intra-uterine fluid, hydrometra, without overt indications for causative anatomical anomalies. However, the vagina and cervix displayed advanced keratosis with abnormal quantities of accumulating squamous epithelial cells suggesting functional obstruction by keratin plugs. Importantly, treatment of aP2-Cre/ERαflox/flox mice with the aromatase inhibitor Letrozole caused regression of the hydrometra phenotype linking increased estrogen levels to the observed phenotype. We propose that in aP2-Cre/ERαflox/flox mice, increased serum estrogen levels cause over-stimulation in the uterus and genital tracts resulting in hydrometra and vaginal obstruction. PMID:24416430

  2. Ion access pathway to the transmembrane pore in P2X receptor channels

    PubMed Central

    Robertson, Janice L.; Li, Mufeng; Silberberg, Shai D.


    P2X receptors are trimeric cation channels that open in response to the binding of adenosine triphosphate (ATP) to a large extracellular domain. The x-ray structure of the P2X4 receptor from zebrafish (zfP2X4) receptor reveals that the extracellular vestibule above the gate opens to the outside through lateral fenestrations, providing a potential pathway for ions to enter and exit the pore. The extracellular region also contains a void at the central axis, providing a second potential pathway. To investigate the energetics of each potential ion permeation pathway, we calculated the electrostatic free energy by solving the Poisson-Boltzmann equation along each of these pathways in the zfP2X4 crystal structure and a homology model of rat P2X2 (rP2X2). We found that the lateral fenestrations are energetically favorable for monovalent cations even in the closed-state structure, whereas the central pathway presents strong electrostatic barriers that would require structural rearrangements to allow for ion accessibility. To probe ion accessibility along these pathways in the rP2X2 receptor, we investigated the modification of introduced Cys residues by methanethiosulfonate (MTS) reagents and constrained structural changes by introducing disulfide bridges. Our results show that MTS reagents can permeate the lateral fenestrations, and that these become larger after ATP binding. Although relatively small MTS reagents can access residues in one of the vestibules within the central pathway, no reactive positions were identified in the upper region of this pathway, and disulfide bridges that constrain movements in that region do not prevent ion conduction. Collectively, these results suggest that ions access the pore using the lateral fenestrations, and that these breathe as the channel opens. The accessibility of ions to one of the chambers in the central pathway likely serves a regulatory function. PMID:21624948

  3. Providing VoD Streaming Using P2P Networks

    NASA Astrophysics Data System (ADS)

    Pedro Muñoz-Gea, Juan; Malgosa-Sanahuja, Josemaria; Manzanares-Lopez, Pilar; Carlos Sanchez-Aarnoutse, Juan

    Overlays and P2P systems, initially developed to support IP multicast and file-sharing, have moved beyond that functionality. They are also proving to be key technologies for the delivery of video streaming. Recently, there have been a number of successful deployments for "live" P2P streaming. However, the question remains open whether similar P2P technologies can be used to provide VoD (Video-On-Demand) services. A P2P VoD service is more challenging to design than a P2P live streaming system because the system should allow users arriving at arbitrary times to watch (arbitrary parts of) the video.

  4. P2Y Receptors Sensitize Mouse and Human Colonic Nociceptors

    PubMed Central

    Hockley, James R. F.; Tranter, Michael M.; McGuire, Cian; Boundouki, George; Cibert-Goton, Vincent; Thaha, Mohamed A.; Blackshaw, L. Ashley; Michael, Gregory J.; Baker, Mark D.; Knowles, Charles H.; Winchester, Wendy J.


    Activation of visceral nociceptors by inflammatory mediators contributes to visceral hypersensitivity and abdominal pain associated with many gastrointestinal disorders. Purine and pyrimidine nucleotides (e.g., ATP and UTP) are strongly implicated in this process following their release from epithelial cells during mechanical stimulation of the gut, and from immune cells during inflammation. Actions of ATP are mediated through both ionotropic P2X receptors and metabotropic P2Y receptors. P2X receptor activation causes excitation of visceral afferents; however, the impact of P2Y receptor activation on visceral afferents innervating the gut is unclear. Here we investigate the effects of stimulating P2Y receptors in isolated mouse colonic sensory neurons, and visceral nociceptor fibers in mouse and human nerve-gut preparations. Additionally, we investigate the role of Nav1.9 in mediating murine responses. The application of UTP (P2Y2 and P2Y4 agonist) sensitized colonic sensory neurons by increasing action potential firing to current injection and depolarizing the membrane potential. The application of ADP (P2Y1, P2Y12, and P2Y13 agonist) also increased action potential firing, an effect blocked by the selective P2Y1 receptor antagonist MRS2500. UTP or ADP stimulated afferents, including mouse and human visceral nociceptors, in nerve-gut preparations. P2Y1 and P2Y2 transcripts were detected in 80% and 56% of retrogradely labeled colonic neurons, respectively. Nav1.9 transcripts colocalized in 86% of P2Y1-positive and 100% of P2Y2-positive colonic neurons, consistent with reduced afferent fiber responses to UTP and ADP in Nav1.9−/− mice. These data demonstrate that P2Y receptor activation stimulates mouse and human visceral nociceptors, highlighting P2Y-dependent mechanisms in the generation of visceral pain during gastrointestinal disease. SIGNIFICANCE STATEMENT Chronic visceral pain is a debilitating symptom of many gastrointestinal disorders. The activation of

  5. Mechanism of action of species-selective P2X7 receptor antagonists

    PubMed Central

    Michel, Anton D; Ng, Sin-Wei; Roman, Shilina; Clay, William C; Dean, David K; Walter, Daryl S


    Background and purpose: AZ11645373 and N-{2-methyl-5-[(1R, 5S)-9-oxa-3,7-diazabicyclo[3.3.1]non-3-ylcarbonyl]phenyl}-2-tricyclo[,7]dec-1-ylacetamide hydrochloride (compound-22) are recently described P2X7 receptor antagonists. In this study we have further characterized these compounds to determine their mechanism of action and interaction with other species orthologues. Experimental approach: Antagonist effects at recombinant and chimeric P2X7 receptors were assessed by ethidium accumulation and radioligand-binding studies. Key results: AZ11645373 and compound-22 were confirmed as selective non-competitive antagonists of human or rat P2X7 receptors respectively. Both compounds were weak antagonists of the mouse and guinea-pig P2X7 receptors and, for each compound, their potency estimates at human and dog P2X7 receptors were similar. The potency of compound-22 was moderately temperature-dependent while that of AZ11645373 was not. The antagonist effects of both compounds were slowly reversible and were not prevented by decavanadate, suggesting that they were allosteric antagonists. Indeed, the compounds competed for binding sites labelled by an allosteric radio-labelled P2X7 receptor antagonist. The species selectivity of AZ11645373, but not compound-22, was influenced by the nature of the amino acid at position 95 of the P2X7 receptor. N2-(3,4-difluorophenyl)-N1-[2-methyl-5-(1-piperazinylmethyl)phenyl]glycinamide dihydrochloride, a positive allosteric modulator of the rat receptor, reduced the potency of compound-22 at the rat receptor but had little effect on the actions of AZ11645373. Conclusions: AZ11645373 and compound-22 are allosteric antagonists of human and rat P2X7 receptors respectively. The differential interaction of the two compounds with the receptor suggests there may be more than one allosteric regulatory site on the P2X7 receptor at which antagonists can bind and affect receptor function. PMID:19309360

  6. P2X3 Receptors and Sensory Transduction

    NASA Astrophysics Data System (ADS)

    Kennedy, Charles

    It has been known for many years that exogenously administered adenosine 5 -triphosphate (ATP) evokes acute pain, but the physiological and pathophysiological roles of endogenous ATP in nociceptive signalling are only now becoming clear. ATP produces its effects through P2X and P2Y receptors, and the P2X3 receptor is of notable importance. It shows a selective expression, at high levels in nociceptive sensory neurons, where it forms functional receptors on its own and in combination with the P2X2 receptor. Recent studies have used gene knockout methods, antisense oligonucleotides, small interfering RNA technologies, and a novel selective P2X3 antagonist, A-317491, to show that P2X3 receptors play a prominent role in both chronic inflammatory and neuropathic pain. Several other P2X subunits also appear to be expressed in sensory neurons and there is evidence for functional P2X1/5 or P2X2/6 heteromers in some of these. These data indicate that P2X receptors, particularly the P2X3 subtype, could be targetted in the search for new, effective analgesics.

  7. ATP induces P2X7 receptor-independent cytokine and chemokine expression through P2X1 and P2X3 receptors in murine mast cells.


    Bulanova, Elena; Budagian, Vadim; Orinska, Zane; Koch-Nolte, Friedrich; Haag, Friedrich; Bulfone-Paus, Silvia


    Extracellular ATP mediates a diverse array of biological responses in many cell types and tissues, including immune cells. We have demonstrated that ATP induces purinergic receptor P2X(7) mediated membrane permeabilization, apoptosis, and cytokine expression in murine mast cells (MCs). Here, we report that MCs deficient in the expression of the P2X(7) receptor are resistant to the ATP-induced membrane permeabilization and apoptosis. However, ATP affects the tyrosine phosphorylation pattern of P2X(7)knockout cells, leading to the activation of ERK1/2. Furthermore, ATP induces expression of several cytokines and chemokines in these cells, including IL-4, IL-6, IFN-gamma, TNF-alpha, RANTES, and MIP-2, at the mRNA level. In addition, the release of IL-6 and IL-13 to cell-conditioned medium was confirmed by ELISA. The ligand selectivity and pharmacological profile indicate the involvement of two P2X family receptors, P2X(1) and P2X(3). Thus, depending on genetic background, particular tissue microenvironment, and ATP concentration, MCs can presumably engage different P2X receptor subtypes, which may result in functionally distinct biological responses to extracellular nucleotides. This finding highlights a novel level of complexity in the sophisticated biology of MCs and may facilitate the development of new therapeutic approaches to modulate MC activities.

  8. Sprouty2 Regulates PI(4,5)P2/Ca2+ Signaling and HIV-1 Gag Release

    PubMed Central

    Ehrlich, Lorna S.; Medina, Gisselle N.; Carter, Carol A.


    We recently reported that activation of the inositol 1,4,5-triphosphate receptor (IP3R) is required for efficient HIV-1 Gag trafficking and viral particle release (Ehrlich 2010). IP3R activation requires phospholipase C (PLC)-catalyzed hydrolysis of PI(4,5)P2 to IP3 and diacylglycerol. Here we show that Sprouty2 (Spry2), which binds PI(4,5)P2 and PLCγ, interfered with PI(4,5)P2 in a manner similar to U73122, an inhibitor of PI(4,5)P2 hydrolysis, suggesting that Spry2 may negatively regulate IP3R by preventing formation of its activating ligand, IP3. Mutation to Asp of R252, a critical determinant of PI(4,5)P2 binding in the C-terminal domain of Spry2, prevented the interference completely, indicating that binding to the phospholipid is required. In contrast, deletion of the PLCγ binding region or mutation of a critical Tyr residue in the region did not prevent the interference but Spry2-PI(4,5)P2 colocalization was not detected, suggesting that PLC binding is required for their stable association. Like U73122, Spry2 over-expression inhibited WT Gag release as virus-like particles. The inhibition was relieved by disrupting either binding determinant. IP3R-mediated Ca2+ signaling, in turn, was found to influence Spry2 subcellular distribution and ERK, a Spry2 regulator. Our findings suggest that Spry2 influences IP3R function through control of PI(4,5)P2 and IP3R influences Spry2 function by controlling its distribution and ERK activation. PMID:21762810

  9. Imaging P2X4 receptor subcellular distribution, trafficking, and regulation using P2X4-pHluorin.


    Xu, Ji; Chai, Hua; Ehinger, Konstantin; Egan, Terrance M; Srinivasan, Rahul; Frick, Manfred; Khakh, Baljit S


    P2X4 receptors are adenosine triphosphate (ATP)-gated cation channels present on the plasma membrane (PM) and also within intracellular compartments such as vesicles, vacuoles, lamellar bodies (LBs), and lysosomes. P2X4 receptors in microglia are up-regulated in epilepsy and in neuropathic pain; that is to say, their total and/or PM expression levels increase. However, the mechanisms underlying up-regulation of microglial P2X4 receptors remain unclear, in part because it has not been possible to image P2X4 receptor distribution within, or trafficking between, cellular compartments. Here, we report the generation of pH-sensitive fluorescently tagged P2X4 receptors that permit evaluations of cell surface and total receptor pools. Capitalizing on information gained from zebrafish P2X4.1 crystal structures, we designed a series of mouse P2X4 constructs in which a pH-sensitive green fluorescent protein, superecliptic pHluorin (pHluorin), was inserted into nonconserved regions located within flexible loops of the P2X4 receptor extracellular domain. One of these constructs, in which pHluorin was inserted after lysine 122 (P2X4-pHluorin123), functioned like wild-type P2X4 in terms of its peak ATP-evoked responses, macroscopic kinetics, calcium flux, current-voltage relationship, and sensitivity to ATP. P2X4-pHluorin123 also showed pH-dependent fluorescence changes, and was robustly expressed on the membrane and within intracellular compartments. P2X4-pHluorin123 identified cell surface and intracellular fractions of receptors in HEK-293 cells, hippocampal neurons, C8-B4 microglia, and alveolar type II (ATII) cells. Furthermore, it showed that the subcellular fractions of P2X4-pHluorin123 receptors were cell and compartment specific, for example, being larger in hippocampal neuron somata than in C8-B4 cell somata, and larger in C8-B4 microglial processes than in their somata. In ATII cells, P2X4-pHluorin123 showed that P2X4 receptors were secreted onto the PM when LBs

  10. P2 receptor subtypes in the cardiovascular system.

    PubMed Central

    Kunapuli, S P; Daniel, J L


    Extracellular nucleotides have been implicated in a number of physiological functions. Nucleotides act on cell-surface receptors known as P2 receptors, of which several subtypes have been cloned. Both ATP and ADP are stored in platelets and are released upon platelet activation. Furthermore, nucleotides are also released from damaged or broken cells. Thus during vascular injury nucleotides play an important role in haemostasis through activation of platelets, modulation of vascular tone, recruitment of neutrophils and monocytes to the site of injury, and facilitation of adhesion of leucocytes to the endothelium. Nucleotides also moderate these functions by generating nitric oxide and prostaglandin I2 through activation of endothelial cells, and by activating different receptor subtypes on vascular smooth muscle cells. In the heart, P2 receptors regulate contractility through modulation of L-type Ca2+ channels, although the molecular mechanisms involved are still under investigation. Classical pharmacological studies have identified several P2 receptor subtypes in the cardiovascular system. Molecular pharmacological studies have clarified the nature of some of these receptors, but have complicated the picture with others. In platelets, the classical P2T receptor has now been resolved into three P2 receptor subtypes: the P2Y1, P2X1 and P2TAC receptors (the last of these, which is coupled to the inhibition of adenylate cyclase, is yet to be cloned). In peripheral blood leucocytes, endothelial cells, vascular smooth muscle cells and cardiomyocytes, the effects of classical P2X, P2Y and P2U receptors have been found to be mediated by more than one P2 receptor subtype. However, the exact functions of these multiple receptor subtypes remain to be understood, as P2-receptor-selective agonists and antagonists are still under development. PMID:9841859

  11. Enhanced Allergic Inflammation of Der p 2 Affected by Polymorphisms of MD-2 Promoter

    PubMed Central

    Liao, En-Chih; Hsieh, Chia-Wei; Chang, Ching-Yun; Yu, Sheng-Jie; Sheu, Meei-Ling; Wu, Sheng-Mao


    Purpose Myeloid differentiation-2 (MD-2) has been associated with endotoxin and inflammatory disorders because it can recognize lipopolysaccharide (LPS) binding and attenuate Toll-like receptor 4 (TLR4)-mediated signaling. However, its role in allergic inflammation has yet to be clarified. We examined whether single nucleotide polymorphisms (SNPs) in MD-2 promoter can affect MD-2 expression and aimed to clarify the relationship between Der p 2 allergy and SNPs of MD-2 promoter. Methods The function of SNPs of MD-2 promoter and the effects of cytokines and immunoglobulin on the secretion and mRNA expression were investigated in 73 allergic subjects with different MD-2 gene promoter variants. Peripheral blood mononuclear cells were cultured with or without LPS in the presence of Dermatophagoides pteronyssinus group 2 allergen (Der p 2), followed by mRNA extraction and cytokine expression analysis. The culture supernatants were collected for cytokine measurement. Results Patients with the MD-2 promoter SNPs (rs1809441/rs1809442) had increased mRNA expressions of MD-2, ε heavy chain of IgE (Cε), and interleukin (IL)-8; however, only MD-2 and IL-8 were further up-regulated after Der p 2 stimulation. Patients with SNPs of MD-2 promoter tended to have high levels of IL-1β, IL-6, IL-8, IL-10, and tumor necrosis factor (TNF)-α after Der p 2 and LPS stimulation. Increased secretions of IL-6, IL-8, and IL-10 were found to be up-regulated by Der p 2 stimulation, and an increased secretion of IFN-γ and decreased secretion of IL-4 were noted after LPS stimulation. Conclusions The high levels of proinflammatory cytokines secreted by Der p 2 were predetermined by MD-2 promoter SNPs (rs1809441/rs1809442). Through cytokine secretion by Der p 2 and LPS, these SNPs may serve as an indicator of the pathological phenotype of Der p 2-induced allergic inflammation. PMID:26122509

  12. Neutron scattering studies on protein dynamics using the human myelin peripheral membrane protein P2

    NASA Astrophysics Data System (ADS)

    Laulumaa, Saara; Kursula, Petri; Natali, Francesca


    Myelin is a multilayered proteolipid membrane structure surrounding selected axons in the vertebrate nervous system, which allows the rapid saltatory conduction of nerve impulses. Deficits in myelin formation and maintenance may lead to chronic neurological disease. P2 is an abundant myelin protein from peripheral nerves, binding between two apposing lipid bilayers. We studied the dynamics of the human myelin protein P2 and its mutated P38G variant in hydrated powders using elastic incoherent neutron scattering. The local harmonic vibrations at low temperatures were very similar for both samples, but the mutant protein had increased flexibility and softness close to physiological temperatures. The results indicate that a drastic mutation of proline to glycine at a functional site can affect protein dynamics, and in the case of P2, they may explain functional differences between the two proteins.

  13. A Scalable P2P Video Streaming Framework

    NASA Astrophysics Data System (ADS)

    Lee, Ivan

    Peer-to-peer (P2P) networking technique represents a vast potential to overcome many constraints in the conventional content distribution networks, especially for the real-time applications such as P2P streaming. In this chapter, a P2P streaming system is examined, and the proposed system combines multiple-description source coding technique and a scalable streaming infrastructure. The proposed system aims to gradually offload congested traffic from a centralized bottleneck to the under-utilized P2P networks and hence, provides seamless transitions from client/server streaming to centralized P2P streaming and to decentralized P2P streaming. The performance of the proposed framework is evaluated in terms of video frame loss rate, which reflects the probability of freeze video frames.

  14. Vibrational properties of the Pt(111)- p(2 × 2)-K surface superstructure

    NASA Astrophysics Data System (ADS)

    Rusina, G. G.; Eremeev, S. V.; Borisova, S. D.; Chulkov, E. V.


    The vibrational spectra of the Pt(111)- p(2 × 2)-K ordered surface superstructure formed on the platinum surface upon adsorption of 0.25 potassium monolayer are calculated using the interatomic interaction potentials obtained within the tight-binding approximation. The surface relaxation, the dispersion of surface phonons, the local density of surface vibrational states, and the polarization of vibrational modes of adatoms and substrate atoms are discussed. The theoretical results are in good agreement with the recently obtained experimental data.

  15. Purinergic P2X receptors: structural models and analysis of ligand-target interaction.


    Dal Ben, Diego; Buccioni, Michela; Lambertucci, Catia; Marucci, Gabriella; Thomas, Ajiroghene; Volpini, Rosaria


    The purinergic P2X receptors are ligand-gated cation channels activated by the endogenous ligand ATP. They assemble as homo- or heterotrimers from seven cloned subtypes (P2X1-7) and all trimer subunits present a common topology consisting in intracellular N- and C- termini, two transmembrane domains and a large extracellular domain. These membrane proteins are present in virtually all mammalian tissues and regulate a large variety of responses in physio- and pathological conditions. The development of ligands that selectively activate or block specific P2X receptor subtypes hence represents a promising strategy to obtain novel pharmacological tools for the treatment of pain, cancer, inflammation, and neurological, cardiovascular, and endocrine diseases. The publication of the crystal structures of zebrafish P2X4 receptor in inactive and ATP-bound active forms provided structural data for the analysis of the receptor structure, the interpretation of mutagenesis data, and the depiction of ligand binding and receptor activation mechanism. In addition, the availability of ATP-competitive ligands presenting selectivity for P2X receptor subtypes supports the design of new potent and selective ligands with possibly improved pharmacokinetic profiles, with the final aim to obtain new drugs. This study describes molecular modelling studies performed to develop structural models of the human and rat P2X receptors in inactive and active states. These models allowed to analyse the role of some non-conserved residues at ATP binding site and to study the receptor interaction with some non-specific or subtype selective agonists and antagonists.

  16. Supporting Collaboration and Creativity Through Mobile P2P Computing

    NASA Astrophysics Data System (ADS)

    Wierzbicki, Adam; Datta, Anwitaman; Żaczek, Łukasz; Rzadca, Krzysztof

    Among many potential applications of mobile P2P systems, collaboration applications are among the most prominent. Examples of applications such as Groove (although not intended for mobile networks), collaboration tools for disaster recovery (the WORKPAD project), and Skype's collaboration extensions, all demonstrate the potential of P2P collaborative applications. Yet, the development of such applications for mobile P2P systems is still difficult because of the lack of middleware.

  17. The P2X7/P2X4 interaction shapes the purinergic response in murine macrophages.


    Pérez-Flores, Gabriela; Lévesque, Sébastien A; Pacheco, Jonathan; Vaca, Luis; Lacroix, Steve; Pérez-Cornejo, Patricia; Arreola, Jorge


    The ATP-gated P2X4 and P2X7 receptors are cation channels, co-expressed in excitable and non-excitable cells and play important roles in pain, bone development, cytokine release and cell death. Although these receptors interact the interacting domains are unknown and the functional consequences of this interaction remain unclear. Here we show by co-immunoprecipitation that P2X4 interacts with the C-terminus of P2X7 and by fluorescence resonance energy transfer experiments that this receptor-receptor interaction is driven by ATP. Furthermore, disrupting the ATP-driven interaction by knocking-out P2X4R provoked an attenuation of P2X7-induced cell death, dye uptake and IL-1β release in macrophages. Thus, P2X7 interacts with P2X4 via its C-terminus and disrupting the P2X7/P2X4 interaction hinders physiological responses in immune cells.

  18. FoxP2 regulates neurogenesis during embryonic cortical development.


    Tsui, David; Vessey, John P; Tomita, Hideaki; Kaplan, David R; Miller, Freda D


    The transcription factor FoxP2 has been associated with the development of human speech but the underlying cellular function of FoxP2 is still unclear. Here we provide evidence that FoxP2 regulates genesis of some intermediate progenitors and neurons in the mammalian cortex, one of the key centers for human speech. Specifically, knockdown of FoxP2 in embryonic cortical precursors inhibits neurogenesis, at least in part by inhibiting the transition from radial glial precursors to neurogenic intermediate progenitors. Moreover, overexpression of human, but not mouse, FoxP2 enhances the genesis of intermediate progenitors and neurons. In contrast, expression of a human FoxP2 mutant that causes vocalization deficits decreases neurogenesis, suggesting that in the murine system human FoxP2 acts as a gain-of-function protein, while a human FoxP2 mutant acts as a dominant-inhibitory protein. These results support the idea that FoxP2 regulates the transition from neural precursors to transit-amplifying progenitors and ultimately neurons, and shed light upon the molecular changes that might contribute to evolution of the mammalian cortex.

  19. The Cellular Prion Protein Prevents Copper-Induced Inhibition of P2X4 Receptors

    PubMed Central

    Lorca, Ramón A.; Varela-Nallar, Lorena; Inestrosa, Nibaldo C.; Huidobro-Toro, J. Pablo


    Although the physiological function of the cellular prion protein (PrPC) remains unknown, several evidences support the notion of its role in copper homeostasis. PrPC binds Cu2+ through a domain composed by four to five repeats of eight amino acids. Previously, we have shown that the perfusion of this domain prevents and reverses the inhibition by Cu2+ of the adenosine triphosphate (ATP)-evoked currents in the P2X4 receptor subtype, highlighting a modulatory role for PrPC in synaptic transmission through regulation of Cu2+ levels. Here, we study the effect of full-length PrPC in Cu2+ inhibition of P2X4 receptor when both are coexpressed. PrPC expression does not significantly change the ATP concentration-response curve in oocytes expressing P2X4 receptors. However, the presence of PrPC reduces the inhibition by Cu2+ of the ATP-elicited currents in these oocytes, confirming our previous observations with the Cu2+ binding domain. Thus, our observations suggest a role for PrPC in modulating synaptic activity through binding of extracellular Cu2+. PMID:22114745

  20. P2X7 Receptors in Neurological and Cardiovascular Disorders

    PubMed Central

    Skaper, Stephen D.; Debetto, Patrizia; Giusti, Pietro


    P2X receptors are ATP-gated cation channels that mediate fast excitatory transmission in diverse regions of the brain and spinal cord. Several P2X receptor subtypes, including P2X7, have the unusual property of changing their ion selectivity during prolonged exposure to ATP, which results in a channel pore permeable to molecules as large as 900 daltons. The P2X7 receptor was originally described in cells of hematopoietic origin, and mediates the influx of Ca2+ and Na+ and Ca2+ and Na+ ions as well as the release of proinflammatory cytokines. P2X7 receptors may affect neuronal cell death through their ability to regulate the processing and release of interleukin-1β, a key mediator in neurodegeneration, chronic inflammation, and chronic pain. Activation of P2X7, a key mediator in neurodegeneration, chronic inflammation, and chronic pain. Activation of P2X7 receptors provides an inflammatory stimulus, and P2X7 receptor-deficient mice have substantially attenuated inflammatory responses, including models of neuropathic and chronic inflammatory pain. Moreover, P2X7 receptor activity, by regulating the release of proinflammatory cytokines, may be involved in the pathophysiology of depression. Apoptotic cell death occurs in a number of vascular diseases, including atherosclerosis, restenosis, and hypertension, and may be linked to the release of ATP from endothelial cells, P2X7 receptor activation, proinflammatory cytokine production, and endothelial cell apoptosis. In this context, the P2X7 receptor may be viewed as a gateway of communication between the nervous, immune, and cardiovascular systems. PMID:20029634

  1. Porin OmpP2 of Haemophilus influenzae shows specificity for nicotinamide-derived nucleotide substrates.


    Andersen, Christian; Maier, Elke; Kemmer, Gabrielle; Blass, Julia; Hilpert, Anna-Karina; Benz, Roland; Reidl, Joachim


    Haemophilus influenzae has an absolute requirement for NAD (factor V) because it lacks all biosynthetic enzymes necessary for de novo synthesis of that cofactor. Therefore, growth in vitro requires the presence of NAD itself, NMN, or nicotinamide riboside (NR). To address uptake abilities of these compounds, we investigated outer membrane proteins. By analyzing ompP2 knockout mutants, we found that NAD and NMN uptake was prevented, whereas NR uptake was not. Through investigation of the properties of purified OmpP2 in artificial lipid membrane systems, the substrate specificity of OmpP2 for NAD and NMN was determined, with KS values of approximately 8 and 4mm, respectively, in 0.1 m KCl, whereas no interaction was detected for the nucleoside NR and other purine or pyrimidine nucleotide or nucleoside species. Based on our analysis, we assume that an intrinsic binding site within OmpP2 exists that facilitates diffusion of these compounds across the outer membrane, recognizing carbonyl and exposed phosphate groups. Because OmpP2 was formerly described as a general diffusion porin, an additional property of acting as a facilitator for nicotinamide-based nucleotide transport may have evolved to support and optimize utilization of the essential cofactor sources NAD and NMN in H. influenzae.

  2. Structure-function relationship of Chikungunya nsP2 protease: A comparative study with papain.


    Ramakrishnan, Chandrasekaran; Kutumbarao, Nidamarthi H V; Suhitha, Sivasubramanian; Velmurugan, Devadasan


    Chikungunya virus is a growing human pathogen transmitted by mosquito bite. It causes fever, chills, nausea, vomiting, joint pain, headache, and swelling in the joints. Its replication and propagation depend on the protease activity of the Chikungunya virus-nsP2 protein, which cleaves the nsP1234 polyprotein replication complex into individual functional units. The N-terminal segment of papain is structurally identical with the Chikungunya virus-nsP2 protease. Hence, molecular dynamics simulations were performed to compare molecular mechanism of these proteases. The Chikungunya virus-snP2 protease shows more conformational changes and adopts an alternate conformation. However, N-terminal segment of these two proteases has identical active site scaffold with the conserved catalytic diad. Hence, some of the non-peptide inhibitors of papain were used for induced fit docking at the active site of the nsP2 to assess the binding mode. In addition, the peptides that connect different domains/protein in Chikungunya virus poly-protein were also subjected for docking. The overall results suggest that the active site scaffold is the same in both the proteases and a possibility exists to experimentally assess the efficacy of some of the papain inhibitors to inhibit the Chikungunya virus-nsP2.

  3. Characterization of a Novel Function-Blocking Antibody Targeted Against The Platelet P2Y1 Receptor

    PubMed Central

    Karim, Zubair A.; Vemana, Hari Priya; Alshbool, Fatima Z.; Lin, Olivia A.; Alshehri, Abdullah M.; Javaherizadeh, Payam; Paez Espinosa, Enma V.; Khasawneh, Fadi T.


    Objective Platelet hyperactivity is associated with vascular disease and contributes to the genesis of thrombotic disorders. ADP plays an important role in platelet activation, and activates platelets through two G-Protein Coupled Receptors, the Gq-coupled P2Y1 receptor (P2Y1R), and the Gi-coupled P2Y12 receptor (P2Y12R). While the involvement of the P2Y1R in thrombogenesis is well established, there are no antagonists that are currently available for clinical use. Approach and Results Our goal is to determine whether a novel antibody targeting the ligand binding domain, i.e., second extracellular loop (EL2) of the P2Y1R [abbreviated as EL2Ab] could inhibit platelet function and protect against thrombogenesis. Our results revealed that the EL2Ab does indeed inhibit ADP-induced platelet aggregation, in a dose-dependent manner. Furthermore, EL2Ab was found to inhibit integrin GPIIb-IIIa activation, dense and alpha granule secretion and phosphatidylserine exposure. These inhibitory effects translated into protection against thrombus formation, as evident by a prolonged time for occlusion in a FeCl3 induced thrombosis model, but this was accompanied by a prolonged tail bleeding time. We also observed a dose dependent displacement of the radiolabelled P2Y1R antagonist [3H]MRS25000 from its ligand binding site by EL2Ab. Conclusions Collectively, our findings demonstrate that EL2Ab binds to and exhibits P2Y1R-dependent function-blocking activity in the context of platelets. These results add further evidence for a role of the P2Y1R in thrombosis and validate the concept that targeting it is a relevant alternative or complement to current antiplatelet strategies. PMID:25593131

  4. A Remedy for Network Operators against Increasing P2P Traffic: Enabling Packet Cache for P2P Applications

    NASA Astrophysics Data System (ADS)

    Nakao, Akihiro; Sasaki, Kengo; Yamamoto, Shu

    We observe that P2P traffic has peculiar characteristics as opposed to the other type of traffic such as web browsing and file transfer. Since they exploit swarm effect — a multitude of end points downloading the same content piece by piece nearly at the same time, thus, increasing the effectiveness of caching — the same pieces of data end up traversing the network over and over again within mostly a short time window. In the light of this observation, we propose a network layer packet-level caching for reducing the volume of emerging P2P traffic, transparently to the P2P applications — without affecting operations of the P2P applications at all — rather than banning it, restricting it, or modifying P2P systems themselves. Unlike the other caching techniques, we aim to provide as generic a caching mechanism as possible at network layer — without knowing much detail of P2P application protocols — to extend applicability to arbitrary P2P protocols. Our preliminary evaluation shows that our approach is expected to reduce a significant amount of P2P traffic transparently to P2P applications.

  5. P2X7 receptors stimulate AKT phosphorylation in astrocytes

    PubMed Central

    Jacques-Silva, Maria C; Rodnight, Richard; Lenz, Guido; Liao, Zhongji; Kong, Qiongman; Tran, Minh; Kang, Yuan; Gonzalez, Fernando A; Weisman, Gary A; Neary, Joseph T


    Emerging evidence indicates that nucleotide receptors are widely expressed in the nervous system. Here, we present evidence that P2Y and P2X receptors, particularly the P2X7 subtype, are coupled to the phosphoinositide 3-kinase (PI3K)/Akt pathway in astrocytes. P2Y and P2X receptor agonists ATP, uridine 5′-triphosphate (UTP) and 2′,3′-O-(4-benzoyl)-benzoyl ATP (BzATP) stimulated Akt phosphorylation in primary cultures of rat cortical astrocytes. BzATP induced Akt phosphorylation in a concentration- and time-dependent manner, similar to the effect of BzATP on Akt phosphorylation in 1321N1 astrocytoma cells stably transfected with the rat P2X7 receptor. Activation was maximal at 5 – 10 min and was sustained for 60 min; the EC50 for BzATP was approximately 50 μM. In rat cortical astrocytes, the positive effect of BzATP on Akt phosphorylation was independent of glutamate release. The effect of BzATP on Akt phosphorylation in rat cortical astrocytes was significantly reduced by the P2X7 receptor antagonist Brilliant Blue G and the P2X receptor antagonist iso-pyridoxal-5′-phosphate-6-azophenyl-2′,4′-disulfonic acid, but was unaffected by trinitrophenyl-ATP, oxidized ATP, suramin and reactive blue 2. Results with specific inhibitors of signal transduction pathways suggest that extracellular and intracellular calcium, PI3K and a Src family kinase are involved in the BzATP-induced Akt phosphorylation pathway. In conclusion, our data indicate that stimulation of astrocytic P2X7 receptors, as well as other P2 receptors, leads to Akt activation. Thus, signaling by nucleotide receptors in astrocytes may be important in several cellular downstream effects related to the Akt pathway, such as cell cycle and apoptosis regulation, protein synthesis, differentiation and glucose metabolism. PMID:15023862

  6. P2Y receptors in health and disease.


    Erlinge, David


    The purine- and pyrimidine-sensitive P2Y receptors belong to the large group of G-protein-coupled receptors that are the target of approximately one-third of the pharmaceutical drugs used in the clinic today. It is therefore not unexpected that the P2Y receptors could be useful targets for drug development. This chapter will discuss P2Y receptor-based therapies currently used, in development and possible future developments. The platelet inhibitors blocking the ADP-receptor P2Y(12) reduce myocardial infarction, stroke, and mortality in patients with cardiovascular disease. Clopidogrel (Plavix) was for many years the second most selling drug in the world. The improved P2Y(12) inhibitors prasugrel, ticagrelor, and elinogrel are now entering the clinic with even more pronounced protective effects. The UTP-activated P2Y(2) receptor stimulates ciliary movement and secretion from epithelial cells. Cystic fibrosis is a monogenetic disease where reduced chloride ion secretion results in a severe lung disease and early death. No specific treatment has been available, but the P2Y(2) agonist Denufosol has been shown to improve lung function and is expected to be introduced as treatment for cystic fibrosis soon. In preclinical studies, there are indications that P2Y receptors can be important for diabetes, osteoporosis, cardiovascular, and atherosclerotic disease. In conclusion, P2Y receptors are important for the health of humans for many diseases, and we can expect even more beneficial drugs targeting P2Y receptors in the future.

  7. Mechanism of ivermectin facilitation of human P2X4 receptor channels.


    Priel, Avi; Silberberg, Shai D


    Ivermectin (IVM), a widely used antiparasitic agent in human and veterinary medicine, was recently shown to augment macroscopic currents through rat P2X(4) receptor channels. In the present study, the effects of IVM on the human P2X(4) (hP2X(4)) receptor channel stably transfected in HEK293 cells were investigated by recording membrane currents using the patch clamp technique. In whole-cell recordings, IVM (< or =10 microM) applied from outside the cell (but not from inside) increased the maximum current activated by ATP, and slowed the rate of current deactivation. These two phenomena likely result from the binding of IVM to separate sites. A higher affinity site (EC(50) 0.25 microM) increased the maximal current activated by saturating concentrations of ATP without significantly changing the rate of current deactivation or the EC(50) and Hill slope of the ATP concentration-response relationship. A lower affinity site (EC(50) 2 microM) slowed the rate of current deactivation, and increased the apparent affinity for ATP. In cell-attached patch recordings, P2X(4) receptor channels exhibited complex kinetics, with multiple components in both the open and shut distributions. IVM (0.3 microM) increased the number of openings per burst, without significantly changing the mean open or mean shut time within a burst. At higher concentrations (1.5 microM) of IVM, two additional open time components of long duration were observed that gave rise to long-lasting bursts of channel activity. Together, the results suggest that the binding of IVM to the higher affinity site increases current amplitude by reducing channel desensitization, whereas the binding of IVM to the lower affinity site slows the deactivation of the current predominantly by stabilizing the open conformation of the channel.

  8. NTPase and 5'-RNA triphosphatase activities of Chikungunya virus nsP2 protein.


    Karpe, Yogesh A; Aher, Pankaj P; Lole, Kavita S


    Chikungunya virus (CHIKV) is an insect borne virus (genus: Alphavirus) which causes acute febrile illness in humans followed by a prolonged arthralgic disease that affects the joints of the extremities. Re-emergence of the virus in the form of outbreaks in last 6-7 years has posed a serious public health problem. CHIKV has a positive sense single stranded RNA genome of about 12,000 nt. Open reading frame 1 of the viral genome encodes a polyprotein precursor, nsP1234, which is processed further into different non structural proteins (nsP1, nsP2, nsP3 and nsP4). Sequence based analyses have shown helicase domain at the N-terminus and protease domain at C-terminus of nsP2. A detailed biochemical analysis of NTPase/RNA helicase and 5'-RNA phosphatase activities of recombinant CHIKV-nsP2T protein (containing conserved NTPase/helicase motifs in the N-terminus and partial papain like protease domain at the C-terminus) was carried out. The protein could hydrolyze all NTPs except dTTP and showed better efficiency for ATP, dATP, GTP and dGTP hydrolysis. ATP was the most preferred substrate by the enzyme. CHIKV-nsP2T also showed 5'-triphosphatase (RTPase) activity that specifically removes the γ-phosphate from the 5' end of RNA. Both NTPase and RTPase activities of the protein were completely dependent on Mg(2+) ions. RTPase activity was inhibited by ATP showing sharing of the binding motif by NTP and RNA. Both enzymatic activities were drastically reduced by mutations in the NTP binding motif (GKT) and co-factor, Mg(2+) ion binding motif (DEXX) suggesting that they have a common catalytic site.

  9. P2MP MPLS-Based Hierarchical Service Management System

    NASA Astrophysics Data System (ADS)

    Kumaki, Kenji; Nakagawa, Ikuo; Nagami, Kenichi; Ogishi, Tomohiko; Ano, Shigehiro

    This paper proposes a point-to-multipoint (P2MP) Multi-Protocol Label Switching (MPLS) based hierarchical service management system. Traditionally, general management systems deployed in some service providers control MPLS Label Switched Paths (LSPs) (e.g., RSVP-TE and LDP) and services (e.g., L2VPN, L3VPN and IP) separately. In order for dedicated management systems for MPLS LSPs and services to cooperate with each other automatically, a hierarchical service management system has been proposed with the main focus on point-to-point (P2P) TE LSPs in MPLS path management. In the case where P2MP TE LSPs and services are deployed in MPLS networks, the dedicated management systems for P2MP TE LSPs and services must work together automatically. Therefore, this paper proposes a new algorithm that uses a correlation between P2MP TE LSPs and multicast VPN services based on a P2MP MPLS-based hierarchical service management architecture. Also, the capacity and performance of the proposed algorithm are evaluated by simulations, which are actually based on certain real MPLS production networks, and are compared to that of the algorithm for P2P TE LSPs. Results show this system is very scalable within real MPLS production networks. This system, with the automatic correlation, appears to be deployable in real MPLS production networks.

  10. Role of P2Y12 Receptor in Thrombosis.


    Zhang, Yaqi; Zhang, Si; Ding, Zhongren


    P2Y12 receptor is a 342 amino acid Gi-coupled receptor predominantly expressed on platelets. P2Y12 receptor is physiologically activated by ADP and inhibits adenyl cyclase (AC) to decrease cyclic AMP (cAMP) level, resulting in platelet aggregation. It also activates PI3 kinase (PI3K) pathway leading to fibrinogen receptor activation, and may protect platelets from apoptosis. Abnormalities of P2Y12 receptor include congenital deficiencies or high activity in diseases like diabetes mellitus (DM) and chronic kidney disease (CKD), exposing such patients to a prothrombotic condition. A series of clinical antiplatelet drugs, such as clopidogrel and ticagrelor, are designed as indirect or direct antagonists of P2Y12 receptor to reduce incidence of thrombosis mainly for patients of acute coronary syndrome (ACS) who are at high risk of thrombotic events. Studies on novel dual-/multi-target antiplatelet agents consider P2Y12 receptor as a promising part in combined targets. However, the clinical practical phenomena, such as "clopidogrel resistance" due to gene variations of cytochrome P450 or P2Y12 receptor constitutive activation, call for better antiplatelet agents. Researches also showed inverse agonist of P2Y12 receptor could play a better role over neutral antagonists. Personalized antiplatelet therapy is the most ideal destination for antiplatelet therapy in ACS patients with or without other underlying diseases like DM or CKD, however, there is still a long way to go.

  11. P2RY14 — EDRN Public Portal

    P2RY14, or GPR105, is a G-protein coupled receptor that responds to extracellular purine and pyrimidine nucleotides. P2RY14 is not activated by ATP, ADP, UTP or ATP, but is a receptor for UDP-glucose and other UDP-sugars coupled to G-proteins. P2RY14 is thought to be involved in extending the known immune system functions of P2Y receptors by participating in the regulation of the stem cell compartment, and it may also play a role in neuroimmune function. Two transcript variants encoding the same protein have been identified for this gene. There are two transcript variants for this gene that result in the same protein.

  12. Uridine Triphosphate Thio Analogues Inhibit Platelet P2Y12 Receptor and Aggregation

    PubMed Central

    Gündüz, Dursun; Tanislav, Christian; Sedding, Daniel; Parahuleva, Mariana; Santoso, Sentot; Troidl, Christian; Hamm, Christian W.; Aslam, Muhammad


    Platelet P2Y12 is an important adenosine diphosphate (ADP) receptor that is involved in agonist-induced platelet aggregation and is a valuable target for the development of anti-platelet drugs. Here we characterise the effects of thio analogues of uridine triphosphate (UTP) on ADP-induced platelet aggregation. Using human platelet-rich plasma, we demonstrate that UTP inhibits P2Y12 but not P2Y1 receptors and antagonises 10 µM ADP-induced platelet aggregation in a concentration-dependent manner with an IC50 value of ~250 µM. An eight-fold higher platelet inhibitory activity was observed with a 2-thio analogue of UTP (2S-UTP), with an IC50 of 30 µM. The 4-thio analogue (4S-UTP) with an IC50 of 7.5 µM was 33-fold more effective. A three-fold decrease in inhibitory activity, however, was observed by introducing an isobutyl group at the 4S- position. A complete loss of inhibition was observed with thio-modification of the γ phosphate of the sugar moiety, which yields an enzymatically stable analogue. The interaction of UTP analogues with P2Y12 receptor was verified by P2Y12 receptor binding and cyclic AMP (cAMP) assays. These novel data demonstrate for the first time that 2- and 4-thio analogues of UTP are potent P2Y12 receptor antagonists that may be useful for therapeutic intervention. PMID:28146050

  13. Network Awareness in P2P-TV Applications

    NASA Astrophysics Data System (ADS)

    Traverso, Stefano; Leonardi, Emilio; Mellia, Marco; Meo, Michela

    The increasing popularity of applications for video-streaming based on P2P paradigm (P2P-TV) is raising the interest of both broadcasters and network operators. The former see a promising technology to reduce the cost of streaming content over the Internet, while offering a world-wide service. The latter instead fear that the traffic offered by these applications can grow without control, affecting other services, and possibly causing network congestion and collapse. The “Network-Aware P2P-TV Application over Wise Networks” FP7 project aims at studying and developing a novel P2P-TV application offering the chance to broadcast high definition video to broadcasters and to carefully manage the traffic offered by peers to the network, therefore avoiding worries to Internet providers about network overload. In such context, we design a simulator to evaluate performance of different P2P-TV solutions, to compare them both considering end-users’ and network providers’ perspectives, such as quality of service perceived by subscribers and link utilization. In this paper, we provide some results that show how effective can be a network aware P2P-TV system.

  14. Accelerated FoxP2 Evolution in Echolocating Bats

    PubMed Central

    Li, Gang; Wang, Jinhong; Rossiter, Stephen J.; Jones, Gareth; Zhang, Shuyi


    FOXP2 is a transcription factor implicated in the development and neural control of orofacial coordination, particularly with respect to vocalisation. Observations that orthologues show almost no variation across vertebrates yet differ by two amino acids between humans and chimpanzees have led to speculation that recent evolutionary changes might relate to the emergence of language. Echolocating bats face especially challenging sensorimotor demands, using vocal signals for orientation and often for prey capture. To determine whether mutations in the FoxP2 gene could be associated with echolocation, we sequenced FoxP2 from echolocating and non-echolocating bats as well as a range of other mammal species. We found that contrary to previous reports, FoxP2 is not highly conserved across all nonhuman mammals but is extremely diverse in echolocating bats. We detected divergent selection (a change in selective pressure) at FoxP2 between bats with contrasting sonar systems, suggesting the intriguing possibility of a role for FoxP2 in the evolution and development of echolocation. We speculate that observed accelerated evolution of FoxP2 in bats supports a previously proposed function in sensorimotor coordination. PMID:17878935

  15. Improving P2P live-content delivery using SVC

    NASA Astrophysics Data System (ADS)

    Schierl, T.; Sánchez, Y.; Hellge, C.; Wiegand, T.


    P2P content delivery techniques for video transmission have become of high interest in the last years. With the involvement of client into the delivery process, P2P approaches can significantly reduce the load and cost on servers, especially for popular services. However, previous studies have already pointed out the unreliability of P2P-based live streaming approaches due to peer churn, where peers may ungracefully leave the P2P infrastructure, typically an overlay networks. Peers ungracefully leaving the system cause connection losses in the overlay, which require repair operations. During such repair operations, which typically take a few roundtrip times, no data is received from the lost connection. While taking low delay for fast-channel tune-in into account as a key feature for broadcast-like streaming applications, the P2P live streaming approach can only rely on a certain media pre-buffer during such repair operations. In this paper, multi-tree based Application Layer Multicast as a P2P overlay technique for live streaming is considered. The use of Flow Forwarding (FF), a.k.a. Retransmission, or Forward Error Correction (FEC) in combination with Scalable video Coding (SVC) for concealment during overlay repair operations is shown. Furthermore the benefits of using SVC over the use of AVC single layer transmission are presented.

  16. P2Y2 purinergic receptor activation is essential for efficient hepatocyte proliferation in response to partial hepatectomy

    PubMed Central

    Tackett, Bryan C.; Sun, Hongdan; Mei, Yu; Maynard, Janielle P.; Cheruvu, Sayuri; Mani, Arunmani; Hernandez-Garcia, Andres; Vigneswaran, Nadarajah; Karpen, Saul J.


    Extracellular nucleotides via activation of P2 purinergic receptors influence hepatocyte proliferation and liver regeneration in response to 70% partial hepatectomy (PH). Adult hepatocytes express multiple P2Y (G protein-coupled) and P2X (ligand-gated ion channels) purinergic receptor subtypes. However, the identity of key receptor subtype(s) important for efficient hepatocyte proliferation in regenerating livers remains unknown. To evaluate the impact of P2Y2 purinergic receptor-mediated signaling on hepatocyte proliferation in regenerating livers, wild-type (WT) and P2Y2 purinergic receptor knockout (P2Y2−/−) mice were subjected to 70% PH. Liver tissues were analyzed for activation of early events critical for hepatocyte priming and subsequent cell cycle progression. Our findings suggest that early activation of p42/44 ERK MAPK (5 min), early growth response-1 (Egr-1) and activator protein-1 (AP-1) DNA-binding activity (30 min), and subsequent hepatocyte proliferation (24–72 h) in response to 70% PH were impaired in P2Y2−/− mice. Interestingly, early induction of cytokines (TNF-α, IL-6) and cytokine-mediated signaling (NF-κB, STAT-3) were intact in P2Y2−/− remnant livers, uncovering the importance of cytokine-independent and nucleotide-dependent early priming events critical for subsequent hepatocyte proliferation in regenerating livers. Hepatocytes isolated from the WT and P2Y2−/− mice were treated with ATP or ATPγS for 5–120 min and 12–24 h. Extracellular ATP alone, via activation of P2Y2 purinergic receptors, was sufficient to induce ERK phosphorylation, Egr-1 protein expression, and key cyclins and cell cycle progression of hepatocytes in vitro. Collectively, these findings highlight the functional significance of P2Y2 purinergic receptor activation for efficient hepatocyte priming and proliferation in response to PH. PMID:25301185

  17. Two different P2Y receptors linked to steroidogenesis in bovine adrenocortical cells.


    Nishi, H


    Both extracellular adenosine 5'-triphosphate (ATP) and uridine 5'-triphosphate (UTP) induced corticoid production (steroidogenesis) concentration-dependently in bovine adrenocortical cells (BA cells). Pertussis toxin (PTX, approx. 2 microg/ml) partially inhibited (approx. 55% inhibition) extracellular ATP (100 microM)-induced steroidogenesis in BA cells. However, PTX did not inhibit extracellular UTP (100 microM)-induced steroidogenesis. Both ATP- and UTP-induced steroidogeneses were significantly inhibited by suramin (50-200 microM). These effects were inhibited significantly by reactive blue-2 (more than 100 microM) and pyridoxal-phosphate-6-azophenyl-2',4'-disulphonic acid (more than 100 microM). Both nucleotides (1-100 microM) induced inositol phosphates accumulation and intracellular Ca2+ mobilization, but PTX did not inhibit them. The RT-PCR procedure identified only P2Y2-receptor mRNA in BA cells. These results suggest that extracellular ATP induces steroidogenesis via a unique P2 receptor linked to PTX-sensitive guanine nucleotide-binding protein (G-protein), while extracellular UTP induces steroidogenesis via P2 receptor linked to PTX-insensitive G-protein. Thus, it was concluded that at least two different P2Y-like receptors linking to steroidogenesis exist in BA cells.

  18. Structural insights into the nucleotide base specificity of P2X receptors

    PubMed Central

    Kasuya, Go; Fujiwara, Yuichiro; Tsukamoto, Hisao; Morinaga, Satoshi; Ryu, Satoshi; Touhara, Kazushige; Ishitani, Ryuichiro; Furutani, Yuji; Hattori, Motoyuki; Nureki, Osamu


    P2X receptors are trimeric ATP-gated cation channels involved in diverse physiological processes, ranging from muscle contraction to nociception. Despite the recent structure determination of the ATP-bound P2X receptors, the molecular mechanism of the nucleotide base specificity has remained elusive. Here, we present the crystal structure of zebrafish P2X4 in complex with a weak affinity agonist, CTP, together with structure-based electrophysiological and spectroscopic analyses. The CTP-bound structure revealed a hydrogen bond, between the cytosine base and the side chain of the basic residue in the agonist binding site, which mediates the weak but significant affinity for CTP. The cytosine base is further recognized by two main chain atoms, as in the ATP-bound structure, but their bond lengths seem to be extended in the CTP-bound structure, also possibly contributing to the weaker affinity for CTP over ATP. This work provides the structural insights for the nucleotide base specificity of P2X receptors. PMID:28332633

  19. Identification of high-affinity P2Y₁₂ antagonists based on a phenylpyrazole glutamic acid piperazine backbone.


    Zech, Gernot; Hessler, Gerhard; Evers, Andreas; Weiss, Tilo; Florian, Peter; Just, Melitta; Czech, Jörg; Czechtizky, Werngard; Görlitzer, Jochen; Ruf, Sven; Kohlmann, Markus; Nazaré, Marc


    A series of novel, highly potent P2Y₁₂ antagonists as inhibitors of platelet aggregation based on a phenylpyrazole glutamic acid piperazine backbone is described. Exploration of the structural requirements of the substituents by probing the structure-activity relationship along this backbone led to the discovery of the N-acetyl-(S)-proline cyclobutyl amide moiety as a highly privileged motif. Combining the most favorable substituents led to remarkably potent P2Y₁₂ antagonists displaying not only low nanomolar binding affinity to the P2Y₁₂ receptor but also a low nanomolar inhibition of platelet aggregation in the human platelet rich plasma assay with IC₅₀ values below 50 nM. Using a homology and a three-dimensional quantitative structure-activity relationship model, a binding hypothesis elucidating the impact of several structural features was developed.

  20. Discovering Antioxidant Molecules in the Archaea Domain: Peroxiredoxin Bcp1 from Sulfolobus solfataricus Protects H9c2 Cardiomyoblasts from Oxidative Stress

    PubMed Central

    Sarcinelli, Carmen; Pizzo, Elio


    Peroxiredoxins (Prxs) are ubiquitous thiol peroxidases that are involved in the reduction of peroxides. It has been reported that prokaryotic Prxs generally show greater structural robustness than their eukaryotic counterparts, making them less prone to inactivation by overoxidation. This difference has inspired the search for new antioxidants from prokaryotic sources that can be used as possible therapeutic biodrugs. Bacterioferritin comigratory proteins (Bcps) of the hyperthermophilic archaeon Sulfolobus solfataricus that belong to the Prx family have recently been characterized. One of these proteins, Bcp1, was chosen to determine its antioxidant effects in H9c2 rat cardiomyoblast cells. Bcp1 activity was measured in vitro under physiological temperature and pH conditions that are typical of mammalian cells; the yeast thioredoxin reductase (yTrxR)/thioredoxin (yTrx) reducing system was used to evaluate enzyme activity. A TAT-Bcp1 fusion protein was constructed to allow its internalization and verify the effect of Bcp1 on H9c2 rat cardiomyoblasts subjected to oxidative stress. The results reveal that TAT-Bcp1 is not cytotoxic and inhibits H2O2-induced apoptosis in H9c2 cells by reducing the H2O2 content inside these cells. PMID:27752237

  1. Identification of amino acids related to catalytic function of Sulfolobus solfataricus P1 carboxylesterase by site-directed mutagenesis and molecular modeling

    PubMed Central

    Choi, Yun-Ho; Lee, Ye-Na; Park, Young-Jun; Yoon, Sung-Jin; Lee, Hee-Bong


    The archaeon Sulfolobus solfataricus P1 carboxylesterase is a thermostable enzyme with a molecular mass of 33.5 kDa belonging to the mammalian hormone-sensitive lipase (HSL) family. In our previous study, we purified the enzyme and suggested the expected amino acids related to its catalysis by chemical modification and a sequence homology search. For further validating these amino acids in this study, we modified them using site-directed mutagenesis and examined the activity of the mutant enzymes using spectrophotometric analysis and then estimated by homology modeling and fluorescence analysis. As a result, it was identified that Ser151, Asp244, and His274 consist of a catalytic triad, and Gly80, Gly81, and Ala152 compose an oxyanion hole of the enzyme. In addition, it was also determined that the cysteine residues are located near the active site or at the positions inducing any conformational changes of the enzyme by their replacement with serine residues. [BMB Reports 2016; 49(6): 349-354] PMID:27222124

  2. Homology modeling, molecular dynamics, e-pharmacophore mapping and docking study of Chikungunya virus nsP2 protease.


    Singh, Kh Dhanachandra; Kirubakaran, Palani; Nagarajan, Shanthi; Sakkiah, Sugunadevi; Muthusamy, Karthikeyan; Velmurgan, Devadasan; Jeyakanthan, Jeyaraman


    To date, no suitable vaccine or specific antiviral drug is available to treat Chikungunya viral (CHIKV) fever. Hence, it is essential to identify drug candidates that could potentially impede CHIKV infection. Here, we present the development of a homology model of nsP2 protein based on the crystal structure of the nsP2 protein of Venezuelan equine encephalitis virus (VEEV). The protein modeled was optimized using molecular dynamics simulation; the junction peptides of a nonstructural protein complex were then docked in order to investigate the possible protein-protein interactions between nsP2 and the proteins cleaved by nsP2. The modeling studies conducted shed light on the binding modes, and the critical interactions with the peptides provide insight into the chemical features needed to inhibit the CHIK virus infection. Energy-optimized pharmacophore mapping was performed using the junction peptides. Based on the results, we propose the pharmacophore features that must be present in an inhibitor of nsP2 protease. The resulting pharmacophore model contained an aromatic ring, a hydrophobic and three hydrogen-bond donor sites. Using these pharmacophore features, we screened a large public library of compounds (Asinex, Maybridge, TOSLab, Binding Database) to find a potential ligand that could inhibit the nsP2 protein. The compounds that yielded a fitness score of more than 1.0 were further subjected to Glide HTVS and Glide XP. Here, we report the best four compounds based on their docking scores; these compounds have IDs of 27943, 21362, ASN 01107557 and ASN 01541696. We propose that these compounds could bind to the active site of nsP2 protease and inhibit this enzyme. Furthermore, the backbone structural scaffolds of these four lead compounds could serve as building blocks when designing drug-like molecules for the treatment of Chikungunya viral fever.

  3. Managing Linguistic Data Summaries in Advanced P2P Applications

    NASA Astrophysics Data System (ADS)

    Hayek, Rabab; Raschia, Guillaume; Valduriez, Patrick; Mouaddib, Noureddine

    As the amount of stored data increases, data localization techniques become no longer sufficient in P2P systems. A practical approach is to rely on compact database summaries rather than raw database records, whose access is costly in large P2P systems. In this chapter, we describe a solution for managing linguistic data summaries in advanced P2P applications which are dealing with semantically rich data. The produced summaries are synthetic, multidimensional views over relational tables. The novelty of this proposal relies on the double summary exploitation in distributed P2P systems. First, as semantic indexes, they support locating relevant nodes based on their data descriptions. Second, due to their intelligibility, these summaries can be directly queried and thus approximately answer a query without the need for exploring original data. The proposed solution consists first in defining a summary model for hierarchical P2P systems. Second, appropriate algorithms for summary creation and maintenance are presented. A query processing mechanism, which relies on summary querying, is then proposed to demonstrate the benefits that might be obtained from summary exploitation.

  4. Determinants of Default in P2P Lending.


    Serrano-Cinca, Carlos; Gutiérrez-Nieto, Begoña; López-Palacios, Luz


    This paper studies P2P lending and the factors explaining loan default. This is an important issue because in P2P lending individual investors bear the credit risk, instead of financial institutions, which are experts in dealing with this risk. P2P lenders suffer a severe problem of information asymmetry, because they are at a disadvantage facing the borrower. For this reason, P2P lending sites provide potential lenders with information about borrowers and their loan purpose. They also assign a grade to each loan. The empirical study is based on loans' data collected from Lending Club (N = 24,449) from 2008 to 2014 that are first analyzed by using univariate means tests and survival analysis. Factors explaining default are loan purpose, annual income, current housing situation, credit history and indebtedness. Secondly, a logistic regression model is developed to predict defaults. The grade assigned by the P2P lending site is the most predictive factor of default, but the accuracy of the model is improved by adding other information, especially the borrower's debt level.

  5. Determinants of Default in P2P Lending

    PubMed Central


    This paper studies P2P lending and the factors explaining loan default. This is an important issue because in P2P lending individual investors bear the credit risk, instead of financial institutions, which are experts in dealing with this risk. P2P lenders suffer a severe problem of information asymmetry, because they are at a disadvantage facing the borrower. For this reason, P2P lending sites provide potential lenders with information about borrowers and their loan purpose. They also assign a grade to each loan. The empirical study is based on loans’ data collected from Lending Club (N = 24,449) from 2008 to 2014 that are first analyzed by using univariate means tests and survival analysis. Factors explaining default are loan purpose, annual income, current housing situation, credit history and indebtedness. Secondly, a logistic regression model is developed to predict defaults. The grade assigned by the P2P lending site is the most predictive factor of default, but the accuracy of the model is improved by adding other information, especially the borrower’s debt level. PMID:26425854

  6. Protecting Data Privacy in Structured P2P Networks

    NASA Astrophysics Data System (ADS)

    Jawad, Mohamed; Serrano-Alvarado, Patricia; Valduriez, Patrick

    P2P systems are increasingly used for efficient, scalable data sharing. Popular applications focus on massive file sharing. However, advanced applications such as online communities (e.g., medical or research communities) need to share private or sensitive data. Currently, in P2P systems, untrusted peers can easily violate data privacy by using data for malicious purposes (e.g., fraudulence, profiling). To prevent such behavior, the well accepted Hippocratic database principle states that data owners should specify the purpose for which their data will be collected. In this paper, we apply such principles as well as reputation techniques to support purpose and trust in structured P2P systems. Hippocratic databases enforce purpose-based privacy while reputation techniques guarantee trust. We propose a P2P data privacy model which combines the Hippocratic principles and the trust notions. We also present the algorithms of PriServ, a DHT-based P2P privacy service which supports this model and prevents data privacy violation. We show, in a performance evaluation, that PriServ introduces a small overhead.

  7. An efficient query mechanism base on P2P networks

    NASA Astrophysics Data System (ADS)

    Wang, Xiaohua; Mu, Aiqin; Zhao, Defang


    How to implement the efficient query is the key problem deployed on P2P networks. This paper analyses the shortage of several query algorithm, and presents a new algorithm DDI, which means distributed searching with double indices. It discusses the popularity of documents and the linking status of the networks, and calculates the availability of the nodes in whole network, determines the route of the query process. It compares the items of time using, the quantity of requests and update information by the emulate experiments. Along with the rapid development of computer network technology, peer-to-peer (referred to as P2P) network research has gradually become mature, and it is widely used in different fields, some large P2P computing project has entered the implementation stage. At present, many more popular software systems such as Gnutella, Freenet, Napster are deployed based on P2P technology. How to achieve effective information query has become one of the key problems of P2P research.

  8. Replication Bypass of the trans-4-Hydroxynonenal-Derived (6S,8R,11S)-1,N[superscript 2]-Deoxyguanosine DNA Adduct by the Sulfolobus solfataricus DNA Polymerase IV

    SciTech Connect

    Banerjee, Surajit; Christov, Plamen P.; Kozekova, Albena; Rizzo, Carmelo J.; Egli, Martin; Stone, Michael P.


    trans-4-Hydroxynonenal (HNE) is the major peroxidation product of {omega}-6 polyunsaturated fatty acids in vivo. Michael addition of the N{sub 2}-amino group of dGuo to HNE followed by ring closure of N1 onto the aldehyde results in four diastereomeric 1,N{sub 2}-dGuo (1,N{sub 2}-HNE-dGuo) adducts. The (6S,8R,11S)-HNE-1,N{sub 2}-dGuo adduct was incorporated into the 18-mer templates 5'-d(TCATXGAATCCTTCCCCC)-3' and d(TCACXGAATCCTTCCCCC)-3', where X = (6S,8R,11S)-HNE-1,N{sub 2}-dGuo adduct. These differed in the identity of the template 5'-neighbor base, which was either Thy or Cyt, respectively. Each of these templates was annealed with either a 13-mer primer 5'-d(GGGGGAAGGATTC)-3' or a 14-mer primer 5'-d(GGGGGAAGGATTCC)-3'. The addition of dNTPs to the 13-mer primer allowed analysis of dNTP insertion opposite to the (6S,8R,11S)-HNE-1,N{sub 2}-dGuo adduct, whereas the 14-mer primer allowed analysis of dNTP extension past a primed (6S,8R,11S)-HNE-1,N{sub 2}-dGuo:dCyd pair. The Sulfolobus solfataricus P2 DNA polymerase IV (Dpo4) belongs to the Y-family of error-prone polymerases. Replication bypass studies in vitro reveal that this polymerase inserted dNTPs opposite the (6S,8R,11S)-HNE-1,N{sub 2}-dGuo adduct in a sequence-specific manner. If the template 5'-neighbor base was dCyt, the polymerase inserted primarily dGTP, whereas if the template 5'-neighbor base was dThy, the polymerase inserted primarily dATP. The latter event would predict low levels of Gua {yields} Thy mutations during replication bypass when the template 5'-neighbor base is dThy. When presented with a primed (6S,8R,11S)-HNE-1,N{sub 2}-dGuo:dCyd pair, the polymerase conducted full-length primer extension. Structures for ternary (Dpo4-DNA-dNTP) complexes with all four template-primers were obtained. For the 18-mer:13-mer template-primers in which the polymerase was confronted with the (6S,8R,11S)-HNE-1,N{sub 2}-dGuo adduct, the (6S,8R,11S)-1,N{sub 2}-dGuo lesion remained in the ring

  9. P2 receptor-mediated signaling in mast cell biology.


    Bulanova, Elena; Bulfone-Paus, Silvia


    Mast cells are widely recognized as effector cells of allergic inflammatory reactions. They contribute to the pathogenesis of different chronic inflammatory diseases, wound healing, fibrosis, thrombosis/fibrinolysis, and anti-tumor immune responses. In this paper, we summarized the role of P2X and P2Y receptors in mast cell activation and effector functions. Mast cells are an abundant source of ATP which is stored in their granules and secreted upon activation. We discuss the contribution of mast cells to the extracellular ATP release and to the maintenance of extracellular nucleotides pool. Recent publications highlight the importance of purinergic signaling for the pathogenesis of chronic airway inflammation. Therefore, the role of ATP and P2 receptors in allergic inflammation with focus on mast cells was analyzed. Finally, ATP functions as mast cell autocrine/paracrine factor and as messenger in intercellular communication between mast cells, nerves, and glia in the central nervous system.

  10. Market Design for a P2P Backup System

    NASA Astrophysics Data System (ADS)

    Seuken, Sven; Charles, Denis; Chickering, Max; Puri, Sidd

    Peer-to-peer (P2P) backup systems are an attractive alternative to server-based systems because the immense costs of large data centers can be saved by using idle resources on millions of private computers instead. This paper presents the design and theoretical analysis of a market for a P2P backup system. While our long-term goal is an open resource exchange market using real money, here we consider a system where monetary transfers are prohibited. A user who wants to backup his data must in return supply some of his resources (storage space, upload and download bandwidth) to the system.We propose a hybrid P2P architecture where all backup data is transferred directly between peers, but a dedicated server coordinates all operations and maintains meta-data. We achieve high reliability guarantees while keeping our data replication factor low by adopting sophisticated erasure coding technology (cf., [2]).

  11. Identification of Determinants Required for Agonistic and Inverse Agonistic Ligand Properties at the ADP Receptor P2Y12

    PubMed Central

    Schmidt, Philipp; Ritscher, Lars; Dong, Elizabeth N.; Hermsdorf, Thomas; Cöster, Maxi; Wittkopf, Doreen; Meiler, Jens


    The ADP receptor P2Y12 belongs to the superfamily of G protein–coupled receptors (GPCRs), and its activation triggers platelet aggregation. Therefore, potent antagonists, such as clopidogrel, are of high clinical relevance in prophylaxis and treatment of thromboembolic events. P2Y12 displays an elevated basal activity in vitro, and as such, inverse agonists may be therapeutically beneficial compared with antagonists. Only a few inverse agonists of P2Y12 have been described. To expand this limited chemical space and improve understanding of structural determinants of inverse agonist-receptor interaction, this study screened a purine compound library for lead structures using wild-type (WT) human P2Y12 and 28 constitutively active mutants. Results showed that ATP and ATP derivatives are agonists at P2Y12. The potency at P2Y12 was 2-(methylthio)-ADP > 2-(methylthio)-ATP > ADP > ATP. Determinants required for agonistic ligand activity were identified. Molecular docking studies revealed a binding pocket for the ATP derivatives that is bordered by transmembrane helices 3, 5, 6, and 7 in human P2Y12, with Y105, E188, R256, Y259, and K280 playing a particularly important role in ligand interaction. N-Methyl-anthraniloyl modification at the 3′-OH of the 2′-deoxyribose leads to ligands (mant-deoxy-ATP [dATP], mant-deoxy-ADP) with inverse agonist activity. Inverse agonist activity of mant-dATP was found at the WT human P2Y12 and half of the constitutive active P2Y12 mutants. This study showed that, in addition to ADP and ATP, other ATP derivatives are not only ligands of P2Y12 but also agonists. Modification of the ribose within ATP can result in inverse activity of ATP-derived ligands. PMID:23093496

  12. Effect of P2X4 and P2X7 receptor antagonism on the pressure diuresis relationship in rats

    PubMed Central

    Menzies, Robert I.; Unwin, Robert J.; Dash, Ranjan K.; Beard, Daniel A.; Cowley Jr., Allen W.; Carlson, Brian E.; Mullins, John J.; Bailey, Matthew A.


    Reduced glomerular filtration, hypertension and renal microvascular injury are hallmarks of chronic kidney disease, which has a global prevalence of ~10%. We have shown previously that the Fischer (F344) rat has lower GFR than the Lewis rat, and is more susceptible to renal injury induced by hypertension. In the early stages this injury is limited to the pre-glomerular vasculature. We hypothesized that poor renal hemodynamic function and vulnerability to vascular injury are causally linked and genetically determined. In the present study, normotensive F344 rats had a blunted pressure diuresis relationship, compared with Lewis rats. A kidney microarray was then interrogated using the Endeavour enrichment tool to rank candidate genes for impaired blood pressure control. Two novel candidate genes, P2rx7 and P2rx4, were identified, having a 7− and 3− fold increased expression in F344 rats. Immunohistochemistry localized P2X4 and P2X7 receptor expression to the endothelium of the pre-glomerular vasculature. Expression of both receptors was also found in the renal tubule; however there was no difference in expression profile between strains. Brilliant Blue G (BBG), a relatively selective P2X7 antagonist suitable for use in vivo, was administered to both rat strains. In Lewis rats, BBG had no effect on blood pressure, but increased renal vascular resistance, consistent with inhibition of some basal vasodilatory tone. In F344 rats BBG caused a significant reduction in blood pressure and a decrease in renal vascular resistance, suggesting that P2X7 receptor activation may enhance vasoconstrictor tone in this rat strain. BBG also reduced the pressure diuresis threshold in F344 rats, but did not alter its slope. These preliminary findings suggest a physiological and potential pathophysiological role for P2X7 in controlling renal and/or systemic vascular function, which could in turn affect susceptibility to hypertension-related kidney damage. PMID:24187541

  13. Faraday effect in Sn2P2S6 crystals.


    Krupych, Oleh; Adamenko, Dmytro; Mys, Oksana; Grabar, Aleksandr; Vlokh, Rostyslav


    We have revealed a large Faraday rotation in tin thiohypodiphosphate (Sn(2)P(2)S(6)) crystals, which makes this material promising for magneto-optics. The effective Faraday tensor component and the Verdet constant for the direction of the optic axis have been determined by measuring the pure Faraday rotation in Sn(2)P(2)S(6) crystals with both the single-ray and small-angular polarimetric methods at the normal conditions and a wavelength of 632.8 nm. The effective Verdet constant is found to be equal to 115 rad/T x m.

  14. Mini Magnetospheric Plasma Propulsion (M2P2)

    NASA Technical Reports Server (NTRS)

    Gallagher, Dennis; Winglee, Robert


    The M2P2 concept is based on the transfer of momentum from the solar wind to an artificial magnetic field structure like that naturally occurs at all magnetized planets in the Solar System, called the magnetosphere. The objectives of this program include the following: (1) Demonstrate artificial magnetospheric inflation through cold plasma filling in vacuum; (2) Demonstrate deflection of a surrogate solar wind by an artificial magnetosphere in the laboratory vacuum chamber; (3) Compare theoretical calculations for thrust forces with laboratory measurements; (4) Develop flight control algorithms for planning mission specific trajectories; and (5) Develop M2P2 system concept.

  15. The Social Impact of P2P Systems

    NASA Astrophysics Data System (ADS)

    Glorioso, Andrea; Pagallo, Ugo; Ruffo, Giancarlo

    The chapter deals with the social impact of P2P systems in light of a bidirectional connection by which technological developments influence, in a complex and often unpredictable way, the social environment whereas the dynamic evolution of the latter does affect technological progress. From this perspective, the aim is to deepen legal issues, sociological trends, economical aspects, and political dimensions of P2P technology, along with some of its next possible outputs, in order to assess one of the most compelling alternatives to the traditional frame of highly centralized human interaction.

  16. P2Y nucleotide receptors: Promise of therapeutic applications

    PubMed Central

    Jacobson, Kenneth A.; Boeynaems, Jean-Marie


    Extracellular nucleotides, such as ATP and UTP, have distinct signaling roles through a class of G protein-coupled receptors, termed P2Y. However, the receptor ligands are typically charged molecules of low bioavailability and stability in vivo. Recent progress in the development of selective agonists and antagonists for P2Y receptors and study of knockout mice have led to new drug concepts based on these receptors. The rapidly accelerating progress in this field has already resulted in drug candidates for cystic fibrosis, dry eye disease, and thrombosis. On the horizon are novel treatments of cardiovascular diseases, inflammatory diseases, and neurodegeneration. PMID:20594935

  17. Critical role of P2X7 receptors in the neuroinflammation and cognitive dysfunction after surgery.


    Zheng, Bin; Lai, Renchun; Li, Jun; Zuo, Zhiyi


    Postoperative cognitive dysfunction worsens patient outcome after surgery. Neuroinflammation is a critical neuropathological process for it. We determined the role of P2X7 receptors, proteins that participate in inflammatory response, in the neuroinflammation induction after surgery, and whether the choice of volatile anesthetics affects its occurrence. Eight-week old C57BL/6J or P2X7 receptor knockout male mice were subjected to right carotid arterial exposure under anesthesia with 1.8% isoflurane, 2.5% sevoflurane or 10% desflurane. They were tested by Barnes maze and fear conditioning from 2weeks after the surgery. Hippocampus was harvested 6h, 24h and 7days after the surgery for immunohistochemical staining and Western blotting. Mice with surgery under anesthesia with isoflurane, sevoflurane or desflurane took longer than control mice to identify the target box 1 or 8days after the training sessions in Barnes maze. Mice anesthetized by isoflurane or sevoflurane, but not by desflurane, had less freezing behavior than control mice in fear conditioning test. Mice with surgery and anesthesia had increased ionized calcium binding adapter molecule 1 and interleukin 1β in the hippocampus but this increase was smaller in mice anesthetized with desflurane than mice anesthetized with isoflurane. Mice with surgery had increased P2X7 receptors and its downstream molecule caspase 1. Inhibition or knockout of P2X7 receptors attenuated surgery and anesthesia-induced neuroinflammation and cognitive impairment. We conclude that surgery under desflurane anesthesia may have reduced neuroinflammation and cognitive impairment compared with surgery under isoflurane anesthesia. P2X7 receptors may mediate the neuroinflammation and cognitive impairment after surgery.

  18. P2X and P2Y Receptors—Role in the Pathophysiology of the Nervous System

    PubMed Central

    Puchałowicz, Kamila; Tarnowski, Maciej; Baranowska-Bosiacka, Irena; Chlubek, Dariusz; Dziedziejko, Violetta


    Purinergic signalling plays a crucial role in proper functioning of the nervous system. Mechanisms depending on extracellular nucleotides and their P2 receptors also underlie a number of nervous system dysfunctions. This review aims to present the role of purinergic signalling, with particular focus devoted to role of P2 family receptors, in epilepsy, depression, neuropathic pain, nervous system neoplasms, such as glioma and neuroblastoma, neurodegenerative diseases like Parkinson’s disease, Alzheimer’s disease and multiple sclerosis. The above-mentioned conditions are associated with changes in expression of extracellular ectonucleotidases, P2X and P2Y receptors in neurons and glial cells, as well as releasing considerable amounts of nucleotides from activated or damaged nervous tissue cells into the extracellular space, which contributes to disturbance in purinergic signalling. The numerous studies indicate a potential possibility of using synthetic agonists/antagonists of P2 receptors in treatment of selected nervous system diseases. This is of particular significance, since numerous available agents reveal a low effectiveness and often produce side effects. PMID:25530618

  19. Maltodextrin and fat preference deficits in "taste-blind" P2X2/P2X3 knockout mice.


    Sclafani, Anthony; Ackroff, Karen


    Adenosine triphosphate is a critical neurotransmitter in the gustatory response to the 5 primary tastes in mice. Genetic deletion of the purinergic P2X2/P2X3 receptor greatly reduces the neural and behavioral response to prototypical primary taste stimuli. In this study, we examined the behavioral response of P2X double knockout mice to maltodextrin and fat stimuli, which appear to activate additional taste channels. P2X double knockout and wild-type mice were given 24-h choice tests (vs. water) with ascending concentrations of Polycose and Intralipid. In Experiment 1, naive double knockout mice, unlike wild-type mice, were indifferent to dilute (0.5-4%) Polycose solutions but preferred concentrated (8-32%) Polycose to water. In a retest, the Polycose-experienced double knockout mice, like wild-type mice, preferred all Polycose concentrations. In Experiment 2, naive double knockout mice, unlike wild-type mice, were indifferent to dilute (0.313-2.5%) Intralipid emulsions but preferred concentrated (5-20%) Intralipid to water. In a retest, the fat-experienced double knockout mice, like wild-type mice, strongly preferred 0.313-5% Intralipid to water. These results indicate that the inherent preferences of mice for maltodextrin and fat are dependent upon adenosine triphosphate taste cell signaling. With experience, however, P2X double knockout mice develop strong preferences for the nontaste flavor qualities of maltodextrin and fat conditioned by the postoral actions of these nutrients.

  20. Tanshinone II A sulfonate, but not tanshinone II A, acts as potent negative allosteric modulator of the human purinergic receptor P2X7.


    Kaiser, M; Sobottka, H; Fischer, W; Schaefer, M; Nörenberg, W


    Tanshinone II A sulfonate (TIIAS) was identified as a potent, selective blocker of purinergic receptor P2X7 in a compound library screen. In this study, a detailed characterization of the pharmacologic effects of TIIAS on P2X7 is provided. Because TIIAS is a derivative of tanshinone II A (TIIA) and both compounds have been used interchangeably, TIIA was included in some assays. Fluorometric and electrophysiologic assays were used to characterize effects of TIIAS and TIIA on recombinantly expressed human, rat, and mouse P2X7. Results were confirmed in human monocyte-derived macrophages expressing native P2X7. In all experiments, involvement of P2X7 was verified using established P2X7 antagonists. TIIAS, but not TIIA, reduces Ca(2+) influx via human P2X7 (hP2X7) with an IC50 of 4.3 µM. TIIAS was less potent at mouse P2X7 and poorly inhibited rat P2X7. Monitoring of YO-PRO-1 uptake confirmed these findings, indicating that formation of the hP2X7 pore is also suppressed by TIIAS. Electrophysiologic experiments revealed a noncompetitive mode of action. TIIAS time-dependently inhibits hP2X7 gating, possibly by binding to the intracellular domain of the receptor. Inhibition of native P2X7 in macrophages by TIIAS was confirmed by monitoring Ca(2+) influx, YO-PRO-1 uptake, and release of the proinflammatory cytokine interleukin-1β. Fluorometric experiments involving recombinantly expressed rat P2X2 and human P2X4 were conducted and verified the compound's selectivity. Our data suggest that hP2X7 is a molecular target of TIIAS, but not of TIIA, a compound with different pharmacologic properties.

  1. The P2X7 Receptor-Interleukin-1 Liaison

    PubMed Central

    Giuliani, Anna Lisa; Sarti, Alba C.; Falzoni, Simonetta; Di Virgilio, Francesco


    Interleukin-1β (IL-1β) plays a central role in stimulation of innate immune system and inflammation and in several chronic inflammatory diseases. These include rare hereditary conditions, e.g., auto-inflammatory syndromes, as well as common pathologies, such as type II diabetes, gout and atherosclerosis. A better understanding of IL-1β synthesis and release is particularly relevant for the design of novel anti-inflammatory drugs. One of the molecules mainly involved in IL-1β maturation is the P2X7 receptor (P2X7R), an ATP-gated ion channel that chiefly acts through the recruitment of the NLRP3 inflammasome-caspase-1 complex. In this review, we will summarize evidence supporting the key role of the P2X7R in IL-1β production, with special emphasis on the mechanism of release, a process that is still a matter of controversy. Four different models have been proposed: (i) exocytosis via secretory lysosomes, (ii) microvesicles shedding from plasma membrane, (iii) release of exosomes, and (iv) passive efflux across a leaky plasma membrane during pyroptotic cell death. All these models involve the P2X7R. PMID:28360855

  2. Measurement and analysis of P2P IPTV program resource.


    Wang, Wenxian; Chen, Xingshu; Wang, Haizhou; Zhang, Qi; Wang, Cheng


    With the rapid development of P2P technology, P2P IPTV applications have received more and more attention. And program resource distribution is very important to P2P IPTV applications. In order to collect IPTV program resources, a distributed multi-protocol crawler is proposed. And the crawler has collected more than 13 million pieces of information of IPTV programs from 2009 to 2012. In addition, the distribution of IPTV programs is independent and incompact, resulting in chaos of program names, which obstructs searching and organizing programs. Thus, we focus on characteristic analysis of program resources, including the distributions of length of program names, the entropy of the character types, and hierarchy depth of programs. These analyses reveal the disorderly naming conventions of P2P IPTV programs. The analysis results can help to purify and extract useful information from chaotic names for better retrieval and accelerate automatic sorting of program and establishment of IPTV repository. In order to represent popularity of programs and to predict user behavior and popularity of hot programs over a period, we also put forward an analytical model of hot programs.

  3. Measurement and Analysis of P2P IPTV Program Resource

    PubMed Central

    Chen, Xingshu; Wang, Haizhou; Zhang, Qi


    With the rapid development of P2P technology, P2P IPTV applications have received more and more attention. And program resource distribution is very important to P2P IPTV applications. In order to collect IPTV program resources, a distributed multi-protocol crawler is proposed. And the crawler has collected more than 13 million pieces of information of IPTV programs from 2009 to 2012. In addition, the distribution of IPTV programs is independent and incompact, resulting in chaos of program names, which obstructs searching and organizing programs. Thus, we focus on characteristic analysis of program resources, including the distributions of length of program names, the entropy of the character types, and hierarchy depth of programs. These analyses reveal the disorderly naming conventions of P2P IPTV programs. The analysis results can help to purify and extract useful information from chaotic names for better retrieval and accelerate automatic sorting of program and establishment of IPTV repository. In order to represent popularity of programs and to predict user behavior and popularity of hot programs over a period, we also put forward an analytical model of hot programs. PMID:24772008

  4. On Numbers of the Form p + 2n - n

    DTIC Science & Technology


    p+2n−n∗ Florian Luca1,† and Pantelimon Stănică2, ‡ 1School of Mathematics,University of the Witwatersrand , P. O. Box Wits 2050, South Africa; and...the School of Mathematics of the University of the Witwatersrand . This author thanks this institution for hospitality. †E-mail address: florian.luca

  5. Spectroscopy of Pionic Atoms Via (p, 2He) Reaction

    NASA Astrophysics Data System (ADS)

    Watanabe, Yuni N.; Adachi, Satoshi; Aoi, Nori; Ashikaga, Sakiko; Fujioka, Hiroyuki; Furuno, Tatsuya; Geissel, Hans; Guillaume, Gey; Hashimoto, Takashi; Hatanaka, Kichiji; Hayano, Ryugo S.; Heguri, Katsuyoshi; Inaba, Kento; Inoue, Azusa; Itahashi, Kenta; Iwamoto, Chihiro; Kawabata, Takahiro; Matsuda, Yohei; Matsumoto, Shota; Morimoto, Takahiro; Murata, Motoki; Nishi, Takahiro; Noji, Shunpei; Ong, Hooi J.; Sakaue, Akane; Takahashi, Yu; Tamii, Atsushi; Tanaka, Yoshiki K.; Tang, Tsz L.; Terashima, Satoru; Tsumura, Miho; Watanabe, Ken

    We are planning to perform a spectroscopy experiment of pionic atoms via the (p, 2He) reaction in RCNP. Novel techniques such as Xe gas target and dispersion matching may lead to the better understanding of the partial restoration of chiral symmetry at finite density. The results of the feasibility study and the plan of the first experiment are reported.

  6. Pollution Prevention Successes Database (P2SDb) user guide

    SciTech Connect


    When Pollution Prevention Opportunity Assessments (P2OAs) were launched at the Hanford Site during the summer of 1994, the first comment received from those using them expressed the desire for a method to report assessments electronically. As a temporary measure, macros were developed for use on word processing systems, but a more formal database was obviously needed. Additionally, increased DOE and Washington state reporting requirements for pollution prevention suggested that a database system would streamline the reporting process. The Pollution Prevention Group of Westinghouse Hanford Company (WHC) contracted with the Data Automation Engineering Department from ICF Kaiser Hanford Company (ICFKH) to develop the system. The scope was to develop a database that will track P2OAs conducted by the facilities and contractors at the Hanford Site. It will also track pollution prevention accomplishments that are not the result of P2OAs and document a portion of the Process Waste Assessments conducted in the past. To accommodate the above criteria, yet complete the system in a timely manner, the Pollution Prevention Successes Database (P2SDb) is being implemented in three phases. The first phase will automate the worksheets to provide both input and output of the data associated with the worksheets. The second phase will automate standard summary reports and ad hoc reports. The third phase will provide automated searching of the database to facilitate the sharing of pollution prevention experiences among various users. This User`s Guide addresses only the Phase 1 system.

  7. P2Y Purinergic Regulation of the Glycine Neurotransmitter Transporters*

    PubMed Central

    Jiménez, Esperanza; Zafra, Francisco; Pérez-Sen, Raquel; Delicado, Esmerilda G.; Miras-Portugal, Maria Teresa; Aragón, Carmen; López-Corcuera, Beatriz


    The sodium- and chloride-coupled glycine neurotransmitter transporters (GLYTs) control the availability of glycine at glycine-mediated synapses. The mainly glial GLYT1 is the key regulator of the glycine levels in glycinergic and glutamatergic pathways, whereas the neuronal GLYT2 is involved in the recycling of synaptic glycine from the inhibitory synaptic cleft. In this study, we report that stimulation of P2Y purinergic receptors with 2-methylthioadenosine 5′-diphosphate in rat brainstem/spinal cord primary neuronal cultures and adult rat synaptosomes leads to the inhibition of GLYT2 and the stimulation of GLYT1 by a paracrine regulation. These effects are mainly mediated by the ADP-preferring subtypes P2Y1 and P2Y13 because the effects are partially reversed by the specific antagonists N6-methyl-2′-deoxyadenosine-3′,5′-bisphosphate and pyridoxal-5′-phosphate-6-azo(2-chloro-5-nitrophenyl)-2,4-disulfonate and are totally blocked by suramin. P2Y12 receptor is additionally involved in GLYT1 stimulation. Using pharmacological approaches and siRNA-mediated protein knockdown methodology, we elucidate the molecular mechanisms of GLYT regulation. Modulation takes place through a signaling cascade involving phospholipase C activation, inositol 1,4,5-trisphosphate production, intracellular Ca2+ mobilization, protein kinase C stimulation, nitric oxide formation, cyclic guanosine monophosphate production, and protein kinase G-I (PKG-I) activation. GLYT1 and GLYT2 are differentially sensitive to NO/cGMP/PKG-I both in brain-derived preparations and in heterologous systems expressing the recombinant transporters and P2Y1 receptor. Sensitivity to 2-methylthioadenosine 5′-diphosphate by GLYT1 and GLYT2 was abolished by small interfering RNA (siRNA)-mediated knockdown of nitric-oxide synthase. Our data may help define the role of GLYTs in nociception and pain sensitization. PMID:21245148

  8. The Specificity Protein Factor Sp1 Mediates Transcriptional Regulation of P2X7 Receptors in the Nervous System*

    PubMed Central

    García-Huerta, Paula; Díaz-Hernandez, Miguel; Delicado, Esmerilda G.; Pimentel-Santillana, María; Miras-Portugal, Mª Teresa; Gómez-Villafuertes, Rosa


    P2X7 receptors are involved not only in physiological functions but also in pathological brain processes. Although an increasing number of findings indicate that altered receptor expression has a causative role in neurodegenerative diseases and cancer, little is known about how expression of P2rx7 gene is controlled. Here we reported the first molecular and functional evidence that Specificity protein 1 (Sp1) transcription factor plays a pivotal role in the transcriptional regulation of P2X7 receptor. We delimited a minimal region in the murine P2rx7 promoter containing four SP1 sites, two of them being highly conserved in mammals. The functionality of these SP1 sites was confirmed by site-directed mutagenesis and Sp1 overexpression/down-regulation in neuroblastoma cells. Inhibition of Sp1-mediated transcriptional activation by mithramycin A reduced endogenous P2X7 receptor levels in primary cultures of cortical neurons and astrocytes. Using P2rx7-EGFP transgenic mice that express enhanced green fluorescent protein under the control of P2rx7 promoter, we found a high correlation between reporter expression and Sp1 levels in the brain, demonstrating that Sp1 is a key element in the transcriptional regulation of P2X7 receptor in the nervous system. Finally, we found that Sp1 mediates P2X7 receptor up-regulation in neuroblastoma cells cultured in the absence of serum, a condition that enhances chromatin accessibility and facilitates the exposure of SP1 binding sites. PMID:23139414

  9. A phenotypic assay to identify Chikungunya virus inhibitors targeting the nonstructural protein nsP2.


    Lucas-Hourani, Marianne; Lupan, Alexandru; Desprès, Philippe; Thoret, Sylviane; Pamlard, Olivier; Dubois, Joëlle; Guillou, Catherine; Tangy, Frédéric; Vidalain, Pierre-Olivier; Munier-Lehmann, Hélène


    Chikungunya virus (CHIKV) is a mosquito-transmitted pathogen responsible for an acute infection of abrupt onset, characterized by high fever, polyarthralgia, myalgia, headaches, chills, and rash. In 2006, CHIKV was responsible for an epidemic outbreak of unprecedented magnitude in the Indian Ocean, stressing the need for therapeutic approaches. Since then, we have acquired a better understanding of CHIKV biology, but we are still missing active molecules against this reemerging pathogen. We recently reported that the nonstructural nsP2 protein of CHIKV induces a transcriptional shutoff that allows the virus to block cellular antiviral response. This was demonstrated using various luciferase-based reporter gene assays, including a trans-reporter system where Gal4 DNA binding domain is fused to Fos transcription factor. Here, we turned this assay into a high-throughput screening system to identify small molecules targeting nsP2-mediated shutoff. Among 3040 molecules tested, we identified one natural compound that partially blocks nsP2 activity and inhibits CHIKV replication in vitro. This proof of concept suggests that similar functional assays could be developed to target other viral proteins mediating a cellular shutoff and identify innovative therapeutic molecules.

  10. Purinergic P2Y2 Receptor Control of Tissue Factor Transcription in Human Coronary Artery Endothelial Cells

    PubMed Central

    Liu, Yiwei; Zhang, Lingxin; Wang, Chuan; Roy, Shama; Shen, Jianzhong


    We recently reported that the P2Y2 receptor (P2Y2R) is the predominant nucleotide receptor expressed in human coronary artery endothelial cells (HCAEC) and that P2Y2R activation by ATP or UTP induces dramatic up-regulation of tissue factor (TF), a key initiator of the coagulation cascade. However, the molecular mechanism of this P2Y2R-TF axis remains unclear. Here, we report the role of a newly identified AP-1 consensus sequence in the TF gene promoter and its original binding components in P2Y2R regulation of TF transcription. Using bioinformatics tools, we found that a novel AP-1 site at −1363 bp of the human TF promoter region is highly conserved across multiple species. Activation of P2Y2R increased TF promoter activity and mRNA expression in HCAEC. Truncation, deletion, and mutation of this distal AP-1 site all significantly suppressed TF promoter activity in response to P2Y2R activation. EMSA and ChIP assays further confirmed that upon P2Y2R activation, c-Jun, ATF-2, and Fra-1, but not the typical c-Fos, bound to the new AP-1 site. In addition, loss-of-function studies using siRNAs confirmed a positive transactivation role of c-Jun and ATF-2 but unexpectedly revealed a strong negative role of Fra-1 in P2Y2R-induced TF up-regulation. Furthermore, we found that P2Y2R activation promoted ERK1/2 phosphorylation through Src, leading to Fra-1 activation, whereas Rho/JNK mediated P2Y2R-induced activation of c-Jun and ATF-2. These findings reveal the molecular basis for P2Y G protein-coupled receptor control of endothelial TF expression and indicate that targeting the P2Y2R-Fra-1-TF pathway may be an attractive new strategy for controlling vascular inflammation and thrombogenicity associated with endothelial dysfunction. PMID:26631725

  11. In silico Approach for Anti-Thrombosis Drug Discovery: P2Y1R Structure-Based TCMs Screening

    PubMed Central

    Yi, Fan; Sun, Le; Xu, Li-jia; Peng, Yong; Liu, Hai-bo; He, Chun-nian; Xiao, Pei-gen


    Cardiovascular diseases (CVDs), including thrombosis, which is induced by platelet aggregation, are the leading cause of mortality worldwide. The P2Y1 receptor (P2Y1R) facilitates platelet aggregation and is thus an important potential anti-thrombotic drug target. The P2Y1R protein structure contains a binding site for receptor antagonist MRS2500 within its seven-transmembrane bundle, which also provides suitable pockets for numerous other ligands to act as nucleotide antagonists of P2Y1R. The Traditional Chinese Medicine Systems Pharmacology Database and Analysis Platform (TCMSP) comprises 499 Chinese Pharmacopoeia-registered herbs and the structure information for 29,384 ingredients. In silico docking of these compounds into the P2Y1R protein structure within the MRS2500 pocket can identify potential antithrombotic drugs from natural medicinal plants. Docking studies were performed and scored to evaluate ligand-binding affinities. In this study, a total of 8987 compounds from Traditional Chinese Medicine (TCM) were filtered by Lipinski's rule of five, and their ideal oral-intake properties were evaluated. Of these, 1656 compounds distributed in 443 herbs docked into the P2Y1R-MRS2500 structure in 16,317 poses. A total of 38 compounds were ranked with a DockScore above 70, and these may have significant potential for development into anti-thrombosis drugs. These computational results suggested that licorice (Glycyrrhiza uralensis Fisch), cimicifugae (Cimicifuga foetida L.), and ganoderma (Ganoderma lucidum Karst) and their chemical constituents, which have not previously been widely used for anti-thrombosis, may have unexpected effects on platelet aggregation. Moreover, two types of triterpene scaffolds summarized from 10 compounds were distributed in these three herbs and also docked into P2Y1R. These scaffold structures may be utilized for the development of drugs to inhibit platelet aggregation. PMID:28119608

  12. Cangrelor: a novel P2Y12 receptor antagonist.


    Norgard, Nicholas B


    Antiplatelet therapy is critical in the prevention of thrombotic complications of acute coronary syndrome and percutaneous coronary interventions. Current antiplatelet agents (aspirin, clopidogrel and glycoprotein IIb/IIIa antagonists) have demonstrated the capacity to reduce major adverse cardiac events. However, these agents have limitations that compromise their clinical utility. The platelet P2Y12 receptor plays a central role in platelet function and is a focus in the development of antiplatelet therapies. Cangrelor is a potent, competitive inhibitor of the P2Y12 receptor that is administered by intravenous infusion and rapidly achieves near complete inhibition of ADP-induced platelet aggregation. This investigational drug has been studied for use during coronary procedures and the management of patients experiencing acute coronary syndrome and is undergoing evaluation for use in the prevention of perioperative stent thrombosis.

  13. The high-pressure compressibility of B12P2

    NASA Astrophysics Data System (ADS)

    Gao, Yang; Zhou, Mi; Wang, Haiyan; Ji, Cheng; Whiteley, C. E.; Edgar, J. H.; Liu, Haozhe; Ma, Yanzhang


    In situ high pressure synchrotron X-ray diffraction measurements were performed on icosahedral boron phosphide (B12P2) to 43.2 GPa. No structural phase transition occurs over this pressure range. The bulk modulus of B12P2 is KOT = 207 ± 7 GPa with pressure derivative of K'OT = 6.6 ± 0.8 . The structure is most compressible along the chain formed by phosphorus and boron atoms in the crystal structure. It is believed that the compressibility of boron-rich compounds at close to ambient pressure is determined by the boron icosahedral structure, while the inclusive atoms (both boron and non-boron) between the icosahedra determine the high-pressure compressibility and structure stability.

  14. Supporting seamless mobility for P2P live streaming.


    Kim, Eunsam; Kim, Sangjin; Lee, Choonhwa


    With advent of various mobile devices with powerful networking and computing capabilities, the users' demand to enjoy live video streaming services such as IPTV with mobile devices has been increasing rapidly. However, it is challenging to get over the degradation of service quality due to data loss caused by the handover. Although many handover schemes were proposed at protocol layers below the application layer, they inherently suffer from data loss while the network is being disconnected during the handover. We therefore propose an efficient application-layer handover scheme to support seamless mobility for P2P live streaming. By simulation experiments, we show that the P2P live streaming system with our proposed handover scheme can improve the playback continuity significantly compared to that without our scheme.

  15. Supporting Seamless Mobility for P2P Live Streaming

    PubMed Central

    Kim, Eunsam; Kim, Sangjin; Lee, Choonhwa


    With advent of various mobile devices with powerful networking and computing capabilities, the users' demand to enjoy live video streaming services such as IPTV with mobile devices has been increasing rapidly. However, it is challenging to get over the degradation of service quality due to data loss caused by the handover. Although many handover schemes were proposed at protocol layers below the application layer, they inherently suffer from data loss while the network is being disconnected during the handover. We therefore propose an efficient application-layer handover scheme to support seamless mobility for P2P live streaming. By simulation experiments, we show that the P2P live streaming system with our proposed handover scheme can improve the playback continuity significantly compared to that without our scheme. PMID:24977171

  16. Compound K Production from Red Ginseng Extract by β-Glycosidase from Sulfolobus solfataricus Supplemented with α-L-Arabinofuranosidase from Caldicellulosiruptor saccharolyticus

    PubMed Central

    Shin, Kyung-Chul; Choi, Hye-Yeon; Seo, Min-Ju; Oh, Deok-Kun


    Ginsenoside compound K (C-K) is attracting a lot of interest because of its biological and pharmaceutical activities, including hepatoprotective, antitumor, anti-wrinkling, and anti-skin aging activities. C-K has been used as the principal ingredient in skin care products. For the effective application of ginseng extracts to the manufacture of cosmetics, the PPD-type ginsenosides in ginseng extracts should be converted to C-K by enzymatic conversion. For increased yield of C-K from the protopanaxadiol (PPD)-type ginsenosides in red-ginseng extract (RGE), the α-l-arabinofuranoside-hydrolyzing α-l-arabinofuranosidase from Caldicellulosiruptor saccharolyticus (CS-abf) was used along with the β-d-glucopyranoside/α-l-arabinopyranoside-hydrolyzing β-glycosidase from Sulfolobus solfataricus (SS-bgly) because SS-bgly showed very low hydrolytic activity on the α-l-arabinofuranoside linkage in ginsenosides. The optimal reaction conditions for C-K production were as follows: pH 6.0, 80°C, 2 U/mL SS-bgly, 3 U/mL CS-abf, and 7.5 g/L PPD-type ginsenosides in RGE. Under these optimized conditions, SS-bgly supplemented with CS-abf produced 4.2 g/L C-K from 7.5 g/L PPD-type ginsenosides in 12 h without other ginsenosides, with a molar yield of 100% and a productivity of 348 mg/L/h. To the best of our knowledge, this is the highest concentration and productivity of C-K from ginseng extract ever published in literature. PMID:26710074

  17. Load Balancing in Structured P2P Networks

    NASA Astrophysics Data System (ADS)

    Zhu, Yingwu

    In this chapter we start by addressing the importance and necessity of load balancing in structured P2P networks, due to three main reasons. First, structured P2P networks assume uniform peer capacities while peer capacities are heterogeneous in deployed P2P networks. Second, resorting to pseudo-uniformity of the hash function used to generate node IDs and data item keys leads to imbalanced overlay address space and item distribution. Lastly, placement of data items cannot be randomized in some applications (e.g., range searching). We then present an overview of load aggregation and dissemination techniques that are required by many load balancing algorithms. Two techniques are discussed including tree structure-based approach and gossip-based approach. They make different tradeoffs between estimate/aggregate accuracy and failure resilience. To address the issue of load imbalance, three main solutions are described: virtual server-based approach, power of two choices, and address-space and item balancing. While different in their designs, they all aim to improve balance on the address space and data item distribution. As a case study, the chapter discusses a virtual server-based load balancing algorithm that strives to ensure fair load distribution among nodes and minimize load balancing cost in bandwidth. Finally, the chapter concludes with future research and a summary.

  18. Uniform Sampling for Directed P2P Networks

    NASA Astrophysics Data System (ADS)

    Hall, Cyrus; Carzaniga, Antonio

    Selecting a random peer with uniform probability across a peer-to-peer (P2P) network is a fundamental function for unstructured search, data replication, and monitoring algorithms. Such uniform sampling is supported by several techniques. However, current techniques suffer from sample bias and limited applicability. In this paper, we present a sampling algorithm that achieves a desired uniformity while making essentially no assumptions about the underlying P2P network. This algorithm, called doubly stochastic converge (DSC), iteratively adjusts the probabilities of crossing each link in the network during a random walk, such that the resulting transition matrix is doubly stochastic. DSC is fully decentralized and is designed to work on both directed and undirected topologies, making it suitable for virtually any P2P network. Our simulations show that DSC converges quickly on a wide variety of topologies, and that the random walks needed for sampling are short for most topologies. In simulation studies with FreePastry, we show that DSC is resilient to high levels of churn, while incurring a minimal sample bias.

  19. Pure P2P mediation system: A mappings discovery approach

    NASA Astrophysics Data System (ADS)

    selma, El yahyaoui El idrissi; Zellou, Ahmed; Idri, Ali


    The information integration systems consist in offering a uniform interface to provide access to a set of autonomous and distributed information sources. The most important advantage of this system is that it allows users to specify what they want, rather than thinking about how to get the responses. The works realized in this area have particular leads to two major classes of integration systems: the mediation systems based on the paradigm mediator / adapter and peer to peer systems (P2P). The combination of both systems has led to a third type; is the mediation P2P systems. The P2P systems are large-scale systems, self-organized and distributed. They allow the resource management in a completely decentralized way. However, the integration of structured information sources, heterogeneous and distributed proves to be a complex problem. The objective of this work is to propose an approach to resolve conflicts and establish a mapping between the heterogeneous elements. This approach is based on clustering; the latter is to group similar Peers that share common information in the same subnet. Thus, to facilitate the heterogeneity, we introduced three additional layers of our hierarchy of peers: internal schema, external schema and Schema directory peer. We used linguistic techniques, and precisely the name correspondence technique, that is based on the similarity of names to propose a correspondence.

  20. An Overlapping Structured P2P for REIK Overlay Network

    NASA Astrophysics Data System (ADS)

    Liu, Wenjun; Song, Jingjing; Yu, Jiguo

    REIK is based on a ring which embedded an inverse Kautz digraph, to enable multi-path P2P routing. It has the constant degree and the logarithmic diameter DHT scheme with constant congestion and Byzantine fault tolerance. However, REIK did not consider the interconnection of many independent smaller networks. In this paper, we propose a new approach to build overlay network, OLS-REIK which is an overlapping structured P2P for REIK overlay network. It is a more flexible interconnecting different REIK network. Peers can belong to several rings, allowing this interconnection. By connecting smaller structured overlay networks in an unstructured way, it provides a cost effective alternative to hierarchical structured P2P systems requiring costly merging. Routing of lookup messages is performed as in REIK within one ring, but a peer belonging to several rings forwards the request to the different rings it belongs to. Furthermore a small number of across point is enough to ensure a high exhaustiveness level.

  1. P2X4R+ microglia drive neuropathic pain

    PubMed Central

    Beggs, Simon; Trang, Tuan; Salter, Michael W


    Neuropathic pain, the most debilitating of all clinical pain syndromes, may be a consequence of trauma, infection or pathology from diseases that affect peripheral nerves. Here we provide a framework for understanding the spinal mechanisms of neuropathic pain as distinct from those of acute pain or inflammatory pain. Recent work suggests that a specific microglia response phenotype characterized by de novo expression of the purinergic receptor P2X4 is critical for the pathogenesis of pain hypersensitivity caused by injury to peripheral nerves. Stimulating P2X4 receptors initiates a core pain signaling pathway mediated by release of brain-derived neurotrophic factor, which produces a disinhibitory increase in intracellular chloride in nociceptive (pain-transmitting) neurons in the spinal dorsal horn. The changes caused by signaling from P2X4R+ microglia to nociceptive transmission neurons may account for the main symptoms of neuropathic pain in humans, and they point to specific interventions to alleviate this debilitating condition. PMID:22837036

  2. The G Protein-coupled Receptor P2Y14 Influences Insulin Release and Smooth Muscle Function in Mice*

    PubMed Central

    Meister, Jaroslawna; Le Duc, Diana; Ricken, Albert; Burkhardt, Ralph; Thiery, Joachim; Pfannkuche, Helga; Polte, Tobias; Grosse, Johannes; Schöneberg, Torsten; Schulz, Angela


    UDP sugars were identified as extracellular signaling molecules, assigning a new function to these compounds in addition to their well defined role in intracellular substrate metabolism and storage. Previously regarded as an orphan receptor, the G protein-coupled receptor P2Y14 (GPR105) was found to bind extracellular UDP and UDP sugars. Little is known about the physiological functions of this G protein-coupled receptor. To study its physiological role, we used a gene-deficient mouse strain expressing the bacterial LacZ reporter gene to monitor the physiological expression pattern of P2Y14. We found that P2Y14 is mainly expressed in pancreas and salivary glands and in subpopulations of smooth muscle cells of the gastrointestinal tract, blood vessels, lung, and uterus. Among other phenotypical differences, knock-out mice showed a significantly impaired glucose tolerance following oral and intraperitoneal glucose application. An unchanged insulin tolerance suggested altered pancreatic islet function. Transcriptome analysis of pancreatic islets showed that P2Y14 deficiency significantly changed expression of components involved in insulin secretion. Insulin secretion tests revealed a reduced insulin release from P2Y14-deficient islets, highlighting P2Y14 as a new modulator of proper insulin secretion. PMID:24993824

  3. Contribution of the P2Y12 receptor-mediated pathway to platelet hyperreactivity in hypercholesterolemia

    PubMed Central

    Nagy, Béla; Jin, Jianguo; Ashby, Barrie; Reilly, Michael P.; Kunapuli, Satya P.


    Summary Background In hypercholesterolemia, platelets demonstrate increased reactivity and promote the development of cardiovascular disease. Objective This study was carried out to investigate the contribution of the ADP receptor P2Y12-mediated pathway in platelet hyperreactivity due to hypercholesterolemia. Methods Low-density lipoprotein receptor deficient mice and C57Bl/6 wild type mice were fed on normal chow and high-fat (Western or Paigen) diets for 8 weeks to generate differently elevated cholesterol levels. P2Y12 receptor induced functional responses via Gi signaling were studied ex vivo when washed murine platelets were activated by 2MeSADP and PAR4 agonist AYPGKF in the presence and absence of indomethacin. Platelet aggregation, secretion, αIIbβ3 receptor activation and the phosphorylation of extracellular signal-regulated protein kinase (ERK) and Akt were analyzed. Results Plasma cholesterol levels ranged from 69±10 to 1011±185 mg/dl depending on diet in mice with different genotypes. Agonist-dependent aggregation, dense and α-granule secretion and JON/A binding were gradually and significantly (P < 0.05) augmented at low agonist concentration in correlation with the increasing plasma cholesterol levels even if elevated thromboxane generation was blocked. These functional responses were induced via increased level of Gi mediated ERK and Akt phosphorylation in hypercholesterolemic mice versus normocholesterolemic animals. In addition, blocking of the P2Y12 receptor by AR-C69931MX (Cangrelor) resulted in strongly reduced platelet aggregation in mice with elevated cholesterol levels compared to normocholesterolemic controls. Conclusions These data revealed that the P2Y12 receptor pathway was substantially involved in platelet hyperreactivity associated with mild and severe hypercholesterolemia. PMID:21261805

  4. Ca3P2 and other topological semimetals with line nodes and drumhead surface states

    NASA Astrophysics Data System (ADS)

    Chan, Y.-H.; Chiu, Ching-Kai; Chou, M. Y.; Schnyder, Andreas P.


    As opposed to ordinary metals, whose Fermi surfaces are two dimensional, topological (semi)metals can exhibit protected one-dimensional Fermi lines or zero-dimensional Fermi points, which arise due to an intricate interplay between symmetry and topology of the electronic wave functions. Here, we study how reflection symmetry, time-reversal symmetry, SU(2) spin-rotation symmetry, and inversion symmetry lead to the topological protection of line nodes in three-dimensional semimetals. We obtain the crystalline invariants that guarantee the stability of the line nodes in the bulk and show that a quantized Berry phase leads to the appearance of protected surfaces states, which take the shape of a drumhead. By deriving a relation between the crystalline invariants and the Berry phase, we establish a direct connection between the stability of the line nodes and the drumhead surface states. Furthermore, we show that the dispersion minimum of the drumhead state leads to a Van Hove singularity in the surface density of states, which can serve as an experimental fingerprint of the topological surface state. As a representative example of a topological semimetal, we consider Ca3P2 , which has a line of Dirac nodes near the Fermi energy. The topological properties of Ca3P2 are discussed in terms of a low-energy effective theory and a tight-binding model, derived from ab initio DFT calculations. Our microscopic model for Ca3P2 shows that the drumhead surface states have a rather weak dispersion, which implies that correlation effects are enhanced at the surface of Ca3P2 .

  5. PLC-mediated PI(4,5)P2 hydrolysis regulates activation and inactivation of TRPC6/7 channels.


    Itsuki, Kyohei; Imai, Yuko; Hase, Hideharu; Okamura, Yasushi; Inoue, Ryuji; Mori, Masayuki X


    Transient receptor potential classical (or canonical) (TRPC)3, TRPC6, and TRPC7 are a subfamily of TRPC channels activated by diacylglycerol (DAG) produced through the hydrolysis of phosphatidylinositol 4,5-bisphosphate (PI(4,5)P2) by phospholipase C (PLC). PI(4,5)P2 depletion by a heterologously expressed phosphatase inhibits TRPC3, TRPC6, and TRPC7 activity independently of DAG; however, the physiological role of PI(4,5)P2 reduction on channel activity remains unclear. We used Förster resonance energy transfer (FRET) to measure PI(4,5)P2 or DAG dynamics concurrently with TRPC6 or TRPC7 currents after agonist stimulation of receptors that couple to Gq and thereby activate PLC. Measurements made at different levels of receptor activation revealed a correlation between the kinetics of PI(4,5)P2 reduction and those of receptor-operated TRPC6 and TRPC7 current activation and inactivation. In contrast, DAG production correlated with channel activation but not inactivation; moreover, the time course of channel inactivation was unchanged in protein kinase C-insensitive mutants. These results suggest that inactivation of receptor-operated TRPC currents is primarily mediated by the dissociation of PI(4,5)P2. We determined the functional dissociation constant of PI(4,5)P2 to TRPC channels using FRET of the PLCδ Pleckstrin homology domain (PHd), which binds PI(4,5)P2, and used this constant to fit our experimental data to a model in which channel gating is controlled by PI(4,5)P2 and DAG. This model predicted similar FRET dynamics of the PHd to measured FRET in either human embryonic kidney cells or smooth muscle cells, whereas a model lacking PI(4,5)P2 regulation failed to reproduce the experimental data, confirming the inhibitory role of PI(4,5)P2 depletion on TRPC currents. Our model also explains various PLC-dependent characteristics of channel activity, including limitation of maximum open probability, shortening of the peak time, and the bell-shaped response of total

  6. Distribution of P2Y2 receptors in the guinea pig enteric nervous system and its coexistence with P2X2 and P2X3 receptors, neuropeptide Y, nitric oxide synthase and calretinin.


    Xiang, Zhenghua; Burnstock, Geoffrey


    The distribution of P2Y2 receptor-immunoreactive (ir) neurons and fibers and coexistence of P2Y2 with P2X2 and P2X3 receptors, neuropeptide Y (NPY), calretinin (CR), calbindin (CB) and nitric oxide synthase (NOS) was investigated with immunostaining methods. The results showed that P2Y2-ir neurons and fibers were distributed widely in myenteric and submucous plexuses of the guinea pig stomach corpus, jejunum, ileum and colon. The typical morphology of P2Y2-ir neurons was a long process with strong positive staining on the same side of the cell body. The P2Y2-ir neurons could be Dogiel type 1. About 40-60% P2X3-ir neurons were immunoreactive for P2Y2 in the myenteric plexus and all the P2X3-ir neurons expressed the P2Y2 receptor in the submucosal plexus; almost all the NPY-ir neurons and the majority of CR-ir neurons were also immunoreactive for P2Y2, especially in the myenteric plexus of the small intestine; no P2Y2-ir neurons were immunoreactive for P2X2 receptors, CB and NOS. It is shown for the first time that S type/Dogiel type 1 neurons with fast P2X and slow P2Y receptor-mediated depolarizations could be those neurons expressing both P2Y2-ir and P2X3-ir and that they are widely distributed in myenteric and submucosal plexuses of guinea pig gut.

  7. Evidence for associations between the purinergic receptor P2X7 (P2RX7) and toxoplasmosis

    PubMed Central

    Jamieson, Sarra E.; Peixoto-Rangel, Alba L.; Hargrave, Aubrey C.; de Roubaix, Lee-Anne; Mui, Ernest J.; Boulter, Nicola R.; Miller, E. Nancy; Fuller, Stephen J.; Wiley, James S.; Castellucci, Léa; Boyer, Kenneth; Peixe, Ricardo Guerra; Kirisits, Michael J.; de Souza Elias, Liliani; Coyne, Jessica J.; Correa-Oliveira, Rodrigo; Sautter, Mari; Smith, Nicholas C.; Lees, Michael P.; Swisher, Charles N.; Heydemann, Peter; Noble, A. Gwendolyn; Patel, Dushyant; Bardo, Dianna; Burrowes, Delilah; McLone, David; Roizen, Nancy; Withers, Shawn; Bahia-Oliveira, Lílian M. G.; McLeod, Rima; Blackwell, Jenefer M.


    Congenital Toxoplasma gondii infection can result in intracranial calcification, hydrocephalus, and retinochoroiditis. Acquired infection is commonly associated with ocular disease. Pathology is characterized by strong pro-inflammatory responses. Ligation of ATP by purinergic receptor P2X7, encoded by P2RX7, stimulates pro-inflammatory cytokines and can lead directly to killing of intracellular pathogens. To determine whether P2X7 plays a role in susceptibility to congenital toxoplasmosis, we examined polymorphisms at P2RX7 in 149 child/parent trios from North America. We found association (FBAT Z scores ±2.429; P= 0.015) between the derived C(+)G(−) allele (f= 0.68; OR= 2.06; 95% CI: 1.14–3.75) at SNP rs1718119 (1068T>C; Thr-348-Ala), and a second synonymous variant rs1621388 in linkage disequilibrium with it, and clinical signs of disease per se. Analysis of clinical sub-groups showed no association with hydrocephalus, with effect sizes for associations with retinal disease and brain calcifications enhanced (OR=3.0 to 4.25; 0.004

  8. Structure-Based Design of 3-(4-Aryl-1H-1,2,3-triazol-1-yl)-Biphenyl Derivatives as P2Y14 Receptor Antagonists

    PubMed Central


    UDP and UDP-glucose activate the P2Y14 receptor (P2Y14R) to modulate processes related to inflammation, diabetes, and asthma. A computational pipeline suggested alternatives to naphthalene of a previously reported P2Y14R antagonist (3, PPTN) using docking and molecular dynamics simulations on a hP2Y14R homology model based on P2Y12R structures. By reevaluating the binding of 3 to P2Y14R computationally, two alternatives, i.e., alkynyl and triazolyl derivatives, were identified. Improved synthesis of fluorescent antagonist 4 enabled affinity quantification (IC50s, nM) using flow cytometry of P2Y14R-expressing CHO cells. p-F3C-phenyl-triazole 65 (32) was more potent than a corresponding alkyne 11. Thus, additional triazolyl derivatives were prepared, as guided by docking simulations, with nonpolar aryl substituents favored. Although triazoles were less potent than 3 (6), simpler synthesis facilitated further structural optimization. Additionally, relative P2Y14R affinities agreed with predicted binding of alkynyl and triazole analogues. These triazoles, designed through a structure-based approach, can be assessed in disease models. PMID:27331270

  9. Motor Learning: The FoxP2 Puzzle Piece

    PubMed Central

    Teramitsu, Ikuko; White, Stephanie A.


    Mutation of the DNA-binding region of the FOXP2 protein causes an inherited language disorder. A recent study provides the first data on mice with this mutation, which exhibit deficits in motor-skill learning and abnormal properties of neural circuits that contribute to these skills. PMID:18430631

  10. Platelet collagen receptor integrin alpha2beta1 activation involves differential participation of ADP-receptor subtypes P2Y1 and P2Y12 but not intracellular calcium change.


    Jung, S M; Moroi, M


    In agonist-induced platelet activation, the collagen platelet receptor integrin alpha2beta1 is activated to high-affinity states through ADP involvement [Jung, S.M. & Moroi, M. (2000) J. Biol. Chem. 275, 8016-8026]. Here we determined the ADP-receptor subtypes involved and their relative contributions to alpha2beta1 activation (assessed by soluble-collagen binding) using the P2Y12 antagonist AR-C69931MX and P2Y1 antagonists adenosine 3',5'-diphosphate (Ado(3,5)PP) and adenosine 3'-phosphate 5'-phosphosulfate (AdoPPS). All three inhibited alpha2beta1 activation induced by low or high ADP, low thrombin, or low collagen-related peptide (CRP) concentrations; however, AR-C69931MX was markedly more inhibitory than the P2Y1 antagonists, suggesting the greater contribution of P2Y12. Inhibition patterns by various combinations of AR-C69931MX, AdoPPS, and wortmannin suggested that P2Y1 and P2Y12 mediate alpha2beta1 activation through different pathways, with possible involvement of phosphoinositide 3-kinase in both. Low concentrations of the acetoxy-methyl derivative of 1,2-bis(o-aminophenoxy) ethane-N,N,N',N'-tetra-acetic acid (calcium chelator) markedly decreased alpha2beta1 activation by low thrombin or CRP, but did not affect that by low or high ADP. Measurements of intracellular Ca2+ level (fluorimetric method) and alpha2beta1 activation (soluble-collagen binding) in the same platelet preparation indicated that alpha2beta1 activation via ADP receptors was independent of intracellular Ca2+ release. Our data indicate that integrin alpha2beta1 activation by ADP occurs through an inside-out signaling mechanism involving differential contributions by P2Y1 and P2Y12 wherein each contributes to some portion of the activation, with the stronger contribution of P2Y12. Furthermore, intracellular Ca2+ increase is not directly related to integrin alpha2beta1 activation, meaning that it is separate from the calcium mobilization pathways that these two ADP receptors are involved in.

  11. Final Design of the SLAC P2 Marx Klystron Modulator

    SciTech Connect

    Kemp, M.A.; Benwell, A.; Burkhart, C.; Larsen, R.; MacNair, D.; Nguyen, M.; Olsen, J.; /SLAC


    The SLAC P2 Marx has been under development for two years, and follows on the P1 Marx as an alternative to the baseline klystron modulator for the International Linear Collider. The P2 Marx utilizes a redundant architecture, air-insulation, a control system with abundant diagnostic access, and a novel nested droop correction scheme. This paper is an overview of the design of this modulator. There are several points of emphasis for the P2 Marx design. First, the modulator must be compatible with the ILC two-tunnel design. In this scheme, the modulator and klystron are located within a service tunnel with limited access and available footprint for a modulator. Access to the modulator is only practical from one side. Second, the modulator must have high availability. Robust components are not sufficient alone to achieve availability much higher than 99%. Therefore, redundant architectures are necessary. Third, the modulator must be relatively low cost. Because of the large number of stations in the ILC, the investment needed for the modulator components is significant. High-volume construction techniques which take advantage of an economy of scale must be utilized. Fourth, the modulator must be simple and efficient to maintain. If a modulator does become inoperable, the MTTR must be small. Fifth, even though the present application for the modulator is for the ILC, future accelerators can also take advantage of this development effort. The hardware, software, and concepts developed in this project should be designed such that further development time necessary for other applications is minimal.

  12. Nucleus of the active Centaur C/2011 P2 (PANSTARRS)

    NASA Astrophysics Data System (ADS)

    Mazzotta Epifani, E.; Perna, D.; Dotto, E.; Palumbo, P.; Dall'Ora, M.; Micheli, M.; Ieva, S.; Perozzi, E.


    Aims: In this paper we present observations of the active Centaur C/2011 P2 (PANSTARRS), showing a compact comet-like coma at the heliocentric distance of rh = 9 au. The observations were obtained in the framework of a wider program on Centaurs aimed at searching for comet-like activity in several targets outside Jupiter's aphelion. Methods: We analysed visible images of the Centaur taken at the TNG telescope in the R filter to investigate the level of coma contributing to the target brightness and to derive information on its nucleus size. Results: Centaur C/2011 P2 (PANSTARRS) shows a faint but still detectable comet-like activity, which accounts for more than 50% to the observed brightness. The coma contribution has been subtracted in order to derive an estimate for the Centaur's diameter of D 16 km, assuming an albedo of A = 0.07 (average of albedo measured within the Centaur group). The results for Centaur C/2011 P2 (PANSTARRS) fit in the general picture of the group: Centaurs with smaller perihelion distance q and semi-major axis a are smaller than those remaining farther from the Sun during their orbital path, thus reinforcing the idea that active Centaurs are "comets in fieri". Based on observations collected at the Telescopio Nazionale Galileo (TNG), operated on the island of La Palma by the Centro Galileo Galilei of the INAF (Istituto Nazionale di Astrofisica) at the Spanish Observatorio del Roque de los Muchachos of the Instituto de Astrofísica de Canarias.

  13. Birefringence and band structure of CdP2 crystals

    NASA Astrophysics Data System (ADS)

    Beril, S. I.; Stamov, I. G.; Syrbu, N. N.; Zalamai, V. V.


    The spatial dispersion in CdP2 crystals was investigated. The dispersion is positive (nk||с>nk||у) at λ>λ0 and negative (nk||сP2 crystals are isotropic for wavelength λо=896 nm. Indirect transitions in excitonic region Еgx are nonpolarized due to one pair of bands. Minimal direct energy intervals correspond to transitions Г1→Г1 for Е||с and Г2→Г1 for Е⊥с. The temperature coefficient of energy gap sifting in the case of temperature changing between 2 and 4.2 K equals to 10.6 meV/K and 3.2 mev/K for Г1→Г1 and Г2→Г1 band gap correspondingly. Reflectivity spectra were measured for energy interval 1.5-10 eV and optical functions (n, k, ε1, ε2,d2ε1/dE2 and d2ε2/dE2) were calculated by using Kramers-Kronig analyses. All features were interpreted as optical transitions on the basis of both theoretical calculations of band structure.

  14. P2X receptors in cochlear Deiters' cells.


    Chen, C; Bobbin, R P


    1. The ionotropic purinoceptors in isolated Deiters' cells of guinea-pig cochlea were characterized by use of the whole-cell variant of the patch-clamp technique. 2. Extracellular application of adenosine 5'-triphosphate (ATP) induced a dose-dependent inward current when the cells were voltage-clamped at -80 mV. The ATP-induced current showed desensitization and had a reversal potential around -4 mV. 3. Increasing intracellular free Ca2+ by decreasing the concentration of EGTA in the pipette solution reduced the amplitude of the ATP-gated current. 4. The order of agonist potency was: 2-methylthioATP (2-meSATP)>ATP>benzoylbenzoyl-ATP (BzATP)>alpha,beta-methyleneATP (alpha,beta,meATP>adenosine 5'-diphosphate (ADP)>uridine 5'-triphosphate (UTP)>adenosine 5'-monophosphate (AMP)=adenosine (Ad). 5. Pretreatment with forskolin (10 microM), 8-bromoadenosine-3',5'-cyclophosphate (8-Br-cyclic AMP, 1 mM), 3-isobutyl-1-methylxanthine (IBMX, 1 mM) or phorbol-12-myristate-13-acetate (PMA, 1 microM) reversibly reduced the ATP-induced peak current. 6. The results are consistent with molecular biological data which indicate that P2X2 purinoceptors are present in Deiters' cells. In addition, the reduction of the ATP-gated current by activators of protein kinase A and protein kinase C indicates that these P2X2 purinoceptors can be functionally modulated by receptor phosphorylation.

  15. P2P Reputation Management Through Social Networking

    NASA Astrophysics Data System (ADS)

    Despotovic, Zoran

    Reputation systems offer a viable solution to the problem of risk reduction in online communities, in situation in which other mechanism such as litigation or security cannot help. Building on the assumption that its participating entities engage in repeated interactions, a reputation system can either signal what happened in the past or aggregate the past feedback in such a way as to influence the future actions of the concerned entity. In the former case, the concerned entity's behavior is seen as static, while the sent signal is expected to be indicative of the entity's future actions. In the latter case, behavior is dynamic in the sense that the entity can adjust it given the observed feedback, while the purpose of the reputation system is to induce adjustments according to the designer's needs. In this chapter, we discuss these two classes of solutions in detail. In particular, we investigate how they apply to P2P networks, what additional problems and difficulties the P2P environment introduces and what scalable solutions to these problems the current research offers.

  16. miR-185/P2Y6 Axis Inhibits Angiotensin II-Induced Human Aortic Vascular Smooth Muscle Cell Proliferation.


    Wang, Shunmin; Tang, Lujun; Zhou, Qian; Lu, Duomei; Duan, Wulei; Chen, Cheng; Huang, Lu; Tan, Yuansheng


    The abnormal proliferation and apoptosis of human aortic vascular smooth muscle cells (HAVSMCs) play an important role in the pathogenesis of hypertension. Recent study revealed that angiotensin II (Ang II) could elicit HAVSMC dysfunction, to induce or aggravate hypertension. Purinergic receptor P2Y6, an inflammation-inducible G protein-coupled receptor, promoted Ang II-induced hypertension. In the present study, we revealed that Ang II induced HAVSMC proliferation and upregulated P2Y6 protein levels. After knockdown of P2Y6, the promotive effect of Ang II on HAVSMC proliferation was restored. microRNAs (miRNAs) involve in most biological processes. In this study, we scanned out seven candidate miRNAs, which were predicted to contain binding site of P2Y6's 3'-UTR by online tools. Among them, miR-185 was significantly downregulated by Ang II treatment. miR-185 reduced P2Y6 protein levels by direct binding to the 3'UTR of P2Y6. miR-185 overexpression suppressed HAVSMC proliferation; P2Y6 overexpression or Ang II treatment promoted HAVSMC proliferation, and restored the suppressive effect of miR-185 on HAVSMC proliferation. Besides, miR-185/P2Y6 axis also affected pERK1/2 protein levels. Taken together, the present study indicated that miR-185/P2Y6 axis might inhibit Ang II-induced HAVSMC proliferation through miR-185 negatively regulating P2Y6 expression and the downstream ERK pathway; rescuing miR-185 expression to inhibit P2Y6 may represent a therapeutic strategy against HAVSMC dysfunction and hypertension.

  17. Functional properties of internalization-deficient P2X4 receptors reveal a novel mechanism of ligand-gated channel facilitation by ivermectin.


    Toulmé, Estelle; Soto, Florentina; Garret, Maurice; Boué-Grabot, Eric


    Although P2X receptors within the central nervous system mediate excitatory ATP synaptic transmission, the identity of central ATP-gated channels has not yet been elucidated. P2X(4), the most widely expressed subunit in the brain, was previously shown to undergo clathrin-dependent constitutive internalization by direct interaction between activator protein (AP)2 adaptors and a tyrosine-based sorting signal specifically present in the cytosolic C-terminal tail of mammalian P2X(4) sequences. In this study, we first used internalization-deficient P2X(4) receptor mutants to show that suppression of the endocytosis motif significantly increased the apparent sensitivity to ATP and the ionic permeability of P2X(4) channels. These unique properties, observed at low channel density, suggest that interactions with AP2 complexes may modulate the function of P2X(4) receptors. In addition, ivermectin, an allosteric modulator of several receptor channels, including mammalian P2X(4), did not potentiate the maximal current of internalization-deficient rat or human P2X(4) receptors. We demonstrated that binding of ivermectin onto wild-type P2X(4) channels increased the fraction of plasma membrane P2X(4) receptors, whereas surface expression of internalization-deficient P2X(4) receptors remained unchanged. Disruption of the clathrin-mediated endocytosis with the dominant-negative mutants Eps15 or AP-50 abolished the ivermectin potentiation of wild-type P2X(4) channel currents. Likewise, ivermectin increased the membrane fraction of nicotinic alpha7 acetylcholine (nalpha7ACh) receptors and the potentiation of acetylcholine current by ivermectin was suppressed when the same dominant-negative mutants were expressed. These data showed that potentiation by ivermectin of both P2X(4) and nalpha7ACh receptors was primarily caused by an increase in the number of cell surface receptors resulting from a mechanism dependent on clathrin/AP2-mediated endocytosis.

  18. The Dynamic Behavior of the P2X4 Ion Channel in the Closed Conformation.


    Pierdominici-Sottile, Gustavo; Moffatt, Luciano; Palma, Juliana


    We present the results of a detailed molecular dynamics study of the closed form of the P2X4 receptor. The fluctuations observed in the simulations were compared with the changes that occur in the transition from the closed to the open structure. To get further insight on the opening mechanism, the actual displacements were decomposed into interchain motions and intrachain deformations. This analysis revealed that the iris-like expansion of the transmembrane helices mainly results from interchain motions that already take place in the closed conformation. However, these movements cannot reach the amplitude required for the opening of the channel because they are impeded by interactions occurring around the ATP binding pocket. This suggests that the union of ATP produces distortions in the chains that eliminate the restrictions on the interchain displacements, leading to the opening of the pore.

  19. Targeting of Murine Leukemia Virus Gag to the Plasma Membrane Is Mediated by PI(4,5)P2/PS and a Polybasic Region in the Matrix ▿

    PubMed Central

    Hamard-Peron, E.; Juillard, F.; Saad, J. S.; Roy, C.; Roingeard, P.; Summers, M. F.; Darlix, J.-L.; Picart, C.; Muriaux, D.


    Membrane targeting of the human immunodeficiency virus Gag proteins is dependent on phosphatidylinositol-(4,5)-bisphosphate [PI(4,5)P2] located in the plasma membrane. In order to determine if evolutionarily distant retroviral Gag proteins are targeted by a similar mechanism, we generated mutants of the matrix (MA) domain of murine leukemia virus (MuLV) Gag, examined their binding to membrane models in vitro, and analyzed their phenotypes in cell culture. In vitro, we showed that MA bound all the phosphatidylinositol phosphates with significant affinity but displayed a strong specificity for PI(4,5)P2 only if enhanced by phosphatidylserine. Mutations in the polybasic region in MA dramatically reduced this affinity. In cells, virus production was strongly impaired by PI(4,5)P2 depletion under conditions of 5ptaseIV overexpression, and mutations in the MA polybasic region altered Gag localization, membrane binding, and virion production. Our results suggest that the N-terminal polybasic cluster of MA is essential for Gag targeting to the plasma membrane. The binding of the MA domain to PI(4,5)P2 appears to be a conserved feature among retroviruses despite the fact that the MuLV-MA domain is structurally different from that of human immunodeficiency virus types 1 and 2 and lacks a readily identifiable PI(4,5)P2 binding cleft. PMID:19828619

  20. Versatility of Y-family Sulfolobus solfataricus DNA Polymerase Dpo4 in Translesion Synthesis Past Bulky N[superscript 2]-Alkylguanine Adducts

    SciTech Connect

    Zhang, Huidong; Eoff, Robert L.; Kozekov, Ivan D.; Rizzo, Carmelo J.; Egli, Martin; Guengerich, F. Peter


    In contrast to replicative DNA polymerases, Sulfolobus solfataricus Dpo4 showed a limited decrease in catalytic efficiency (k{sub cat}/K{sub m}) for insertion of dCTP opposite a series of N{sup 2}-alkylguanine templates of increasing size from (methyl (Me) to (9-anthracenyl)-Me (Anth)). Fidelity was maintained with increasing size up to (2-naphthyl)-Me (Naph). The catalytic efficiency increased slightly going from the N{sup 2}-NaphG to the N{sup 2}-AnthG substrate, at the cost of fidelity. Pre-steady-state kinetic bursts were observed for dCTP incorporation throughout the series (N{sup 2}-MeG to N{sup 2}-AnthG), with a decrease in the burst amplitude and k{sub pol}, the rate of single-turnover incorporation. The pre-steady-state kinetic courses with G and all of the six N{sup 2}-alkyl G adducts could be fit to a general DNA polymerase scheme to which was added an inactive complex in equilibrium with the active ternary Dpo4 {center_dot} DNA {center_dot} dNTP complex, and only the rates of equilibrium with the inactive complex and phosphodiester bond formation were altered. Two crystal structures of Dpo4 with a template N{sup 2}-NaphG (in a post-insertion register opposite a 3'-terminal C in the primer) were solved. One showed N{sup 2}-NaphG in a syn conformation, with the naphthyl group located between the template and the Dpo4 'little finger' domain. The Hoogsteen face was within hydrogen bonding distance of the N4 atoms of the cytosine opposite N{sup 2}-NaphG and the cytosine at the -2 position. The second structure showed N{sup 2}-Naph G in an anti conformation with the primer terminus largely disordered. Collectively these results explain the versatility of Dpo4 in bypassing bulky G lesions.

  1. P2X receptors in cochlear Deiters' cells

    PubMed Central

    Chen, Chu; Bobbin, Richard P


    The ionotropic purinoceptors in isolated Deiters' cells of guinea-pig cochlea were characterized by use of the whole-cell variant of the patch-clamp technique.Extracellular application of adenosine 5′-triphosphate (ATP) induced a dose-dependent inward current when the cells were voltage-clamped at −80 mV. The ATP-induced current showed desensitization and had a reversal potential around −4 mV.Increasing intracellular free Ca2+ by decreasing the concentration of EGTA in the pipette solution reduced the amplitude of the ATP-gated current.The order of agonist potency was: 2-methylthioATP (2-meSATP)>ATP>benzoylbenzoyl-ATP (BzATP)>α,β-methyleneATP (α,β,meATP>adenosine 5′-diphosphate (ADP)>uridine 5′-triphosphate (UTP)>adenosine 5′-monophosphate (AMP)=adenosine (Ad).Pretreatment with forskolin (10 μM), 8-bromoadenosine-3′,5′-cyclophosphate (8-Br-cyclic AMP, 1 mM), 3-isobutyl-1-methylxanthine (IBMX, 1 mM) or phorbol-12-myristate-13-acetate (PMA, 1 μM) reversibly reduced the ATP-induced peak current.The results are consistent with molecular biological data which indicate that P2X2 purinoceptors are present in Deiters' cells. In addition, the reduction of the ATP-gated current by activators of protein kinase A and protein kinase C indicates that these P2X2 purinoceptors can be functionally modulated by receptor phosphorylation. PMID:9641551

  2. P2C-Type ATPases and Their Regulation.


    Retamales-Ortega, Rocío; Vio, Carlos P; Inestrosa, Nibaldo C


    P2C-type ATPases are a subfamily of P-type ATPases comprising Na(+)/K(+)-ATPase and H(+)/K(+)-ATPase. Na(+)/K(+)-ATPase is ubiquitously expressed and has been implicated in several neurological diseases, whereas H(+)/K(+)-ATPase is found principally in the colon, stomach, and kidney. Both ATPases have two subunits, α and β, but Na(+)/K(+)-ATPase also has a regulatory subunit called FXYD, which has an important role in cancer. The most important functions of these ATPases are homeostasis, potassium regulation, and maintaining a gradient in different cell types, like epithelial cells. Na(+)/K(+)-ATPase has become a center of attention ever since it was proposed that it might play a crucial role in neurological disorders such as bipolar disorder, mania, depression, familial hemiplegic migraine, rapid-onset dystonia parkinsonism, chronic stress, epileptogenesis, and Alzheimer's disease. On the other hand, it has been reported that lithium could have a neuroprotective effect against ouabain, which is the best known Na(+)/K(+)-ATPase inhibitor, but and high concentrations of lithium could affect negatively H(+)/K(+)-ATPase activity, that has a key role in regulating acidosis and potassium deficiencies. Finally, potassium homeostasis regulation is composed of two main mechanisms, extrarenal and renal. Extrarenal mechanism controls plasma levels, shifting potassium from the extracellular to the intracellular, whereas renal mechanism concerns with body balance and is influenced by potassium intake and its urinary excretion. In this article, we discuss the functions, isoforms, and localization of P2C-type ATPases, describe some of their modulators, and discuss their implications in some diseases.

  3. Development of selective agonists and antagonists of P2Y receptors

    PubMed Central

    Ivanov, Andrei A.; de Castro, Sonia; Harden, T. Kendall; Ko, Hyojin


    Although elucidation of the medicinal chemistry of agonists and antagonists of the P2Y receptors has lagged behind that of many other members of group A G protein-coupled receptors, detailed qualitative and quantitative structure–activity relationships (SARs) were recently constructed for several of the subtypes. Agonists selective for P2Y1, P2Y2, and P2Y6 receptors and nucleotide antagonists selective for P2Y1 and P2Y12 receptors are now known. Selective nonnucleotide antagonists were reported for P2Y1, P2Y2, P2Y6, P2Y11, P2Y12, and P2Y13 receptors. At the P2Y1 and P2Y12 receptors, nucleotide agonists (5′-diphosphate derivatives) were converted into antagonists of nanomolar affinity by altering the phosphate moieties, with a focus particularly on the ribose conformation and substitution pattern. Nucleotide analogues with conformationally constrained ribose-like rings were introduced as selective receptor probes for P2Y1 and P2Y6 receptors. Screening chemically diverse compound libraries has begun to yield new lead compounds for the development of P2Y receptor antagonists, such as competitive P2Y12 receptor antagonists with antithrombotic activity. Selective agonists for the P2Y4, P2Y11, and P2Y13 receptors and selective antagonists for P2Y4 and P2Y14 receptors have not yet been identified. The P2Y14 receptor appears to be the most restrictive of the class with respect to modification of the nucleobase, ribose, and phosphate moieties. The continuing process of ligand design for the P2Y receptors will aid in the identification of new clinical targets. PMID:18600475

  4. Functional divergence between the two P1-P2 stalk dimers on the ribosome in their interaction with ricin A chain.


    Grela, Przemysław; Li, Xiao-Ping; Tchórzewski, Marek; Tumer, Nilgun E


    The eukaryotic stalk, which is responsible for the recruitment of translation factors, is a pentamer containing two P1-P2 dimers with unclear modes of action. In Saccharomyces cerevisiae, P1/P2 proteins (individual P1 and P2 proteins) are organized into two distinct dimers, P1A-P2B and P1B-P2A. To investigate the functional contribution of each dimer on the ribosome, RTA (ricin A chain), which binds to the stalk to depurinate the SRL (sarcin/ricin loop), was used as a molecular probe in yeast mutants in which the binding site for one or the other dimer on P0 was deleted. Ribosome depurination and toxicity of RTA were greatly reduced in mutants containing only P1A-P2B on the ribosome, whereas those with only P1B-P2A were reduced less in depurination and were unaffected in toxicity. Ribosomes bearing P1B-P2A were depurinated by RTA at a similar level as wild-type, but ribosomes bearing P1A-P2B were depurinated at a much lower level in vitro. The latter ribosomes showed the lowest association and almost no dissociation with RTA by surface plasmon resonance. These results indicate that the P1B-P2A dimer is more critical for facilitating the access of RTA to the SRL, providing the first in vivo evidence for functional divergence between the two stalk dimers on the ribosome.

  5. Molecular modeling of the human P2Y14 receptor: A template for structure-based design of selective agonist ligands.


    Trujillo, Kevin; Paoletta, Silvia; Kiselev, Evgeny; Jacobson, Kenneth A


    The P2Y14 receptor (P2Y14R) is a Gi protein-coupled receptor that is activated by uracil nucleotides UDP and UDP-glucose. The P2Y14R structure has yet to be solved through X-ray crystallography, but the recent agonist-bound crystal structure of the P2Y12R provides a potentially suitable template for its homology modeling for rational structure-based design of selective and high-affinity ligands. In this study, we applied ligand docking and molecular dynamics refinement to a P2Y14R homology model to qualitatively explain structure-activity relationships of previously published synthetic nucleotide analogues and to probe the quality of P2Y14R homology modeling as a template for structure-based design. The P2Y14R model supports the hypothesis of a conserved binding mode of nucleotides in the three P2Y12-like receptors involving functionally conserved residues. We predict phosphate group interactions with R253(6.55), K277(7.35), Y256(6.58) and Q260(6.62), nucleobase (anti-conformation) π-π stacking with Y102(3.33) and the role of F191(5.42) as a means for selectivity among P2Y12-like receptors. The glucose moiety of UDP-glucose docked in a secondary subpocket at the P2Y14R homology model. Thus, P2Y14R homology modeling may allow detailed prediction of interactions to facilitate the design of high affinity, selective agonists as pharmacological tools to study the P2Y14R.

  6. Conductance of P2X4 purinergic receptor is determined by conformational equilibrium in the transmembrane region

    PubMed Central

    Minato, Yuichi; Suzuki, Shiho; Hara, Tomoaki; Kofuku, Yutaka; Kasuya, Go; Fujiwara, Yuichiro; Igarashi, Shunsuke; Suzuki, Ei-ichiro; Nureki, Osamu; Hattori, Motoyuki; Ueda, Takumi; Shimada, Ichio


    Ligand-gated ion channels are partially activated by their ligands, resulting in currents lower than the currents evoked by the physiological full agonists. In the case of P2X purinergic receptors, a cation-selective pore in the transmembrane region expands upon ATP binding to the extracellular ATP-binding site, and the currents evoked by α,β-methylene ATP are lower than the currents evoked by ATP. However, the mechanism underlying the partial activation of the P2X receptors is unknown although the crystal structures of zebrafish P2X4 receptor in the apo and ATP-bound states are available. Here, we observed the NMR signals from M339 and M351, which were introduced in the transmembrane region, and the endogenous alanine and methionine residues of the zebrafish P2X4 purinergic receptor in the apo, ATP-bound, and α,β-methylene ATP-bound states. Our NMR analyses revealed that, in the α,β-methylene ATP-bound state, M339, M351, and the residues that connect the ATP-binding site and the transmembrane region, M325 and A330, exist in conformational equilibrium between closed and open conformations, with slower exchange rates than the chemical shift difference (<100 s−1), suggesting that the small population of the open conformation causes the partial activation in this state. Our NMR analyses also revealed that the transmembrane region adopts the open conformation in the state bound to the inhibitor trinitrophenyl-ATP, and thus the antagonism is due to the closure of ion pathways, except for the pore in the transmembrane region: i.e., the lateral cation access in the extracellular region. PMID:27071117

  7. Lipotoxic disruption of NHE1 interaction with PI(4,5)P2 expedites proximal tubule apoptosis.


    Khan, Shenaz; Abu Jawdeh, Bassam G; Goel, Monu; Schilling, William P; Parker, Mark D; Puchowicz, Michelle A; Yadav, Satya P; Harris, Raymond C; El-Meanawy, Ashraf; Hoshi, Malcolm; Shinlapawittayatorn, Krekwit; Deschênes, Isabelle; Ficker, Eckhard; Schelling, Jeffrey R


    Chronic kidney disease progression can be predicted based on the degree of tubular atrophy, which is the result of proximal tubule apoptosis. The Na+/H+ exchanger NHE1 regulates proximal tubule cell survival through interaction with phosphatidylinositol 4,5-bisphosphate [PI(4,5)P2], but pathophysiologic triggers for NHE1 inactivation are unknown. Because glomerular injury permits proximal tubule luminal exposure and reabsorption of fatty acid/albumin complexes, we hypothesized that accumulation of amphipathic, long-chain acyl-CoA (LC-CoA) metabolites stimulates lipoapoptosis by competing with the structurally similar PI(4,5)P2 for NHE1 binding. Kidneys from mouse models of progressive, albuminuric kidney disease exhibited increased fatty acids, LC-CoAs, and caspase-2-dependent proximal tubule lipoapoptosis. LC-CoAs and the cytosolic domain of NHE1 directly interacted, with an affinity comparable to that of the PI(4,5)P2-NHE1 interaction, and competing LC-CoAs disrupted binding of the NHE1 cytosolic tail to PI(4,5)P2. Inhibition of LC-CoA catabolism reduced NHE1 activity and enhanced apoptosis, whereas inhibition of proximal tubule LC-CoA generation preserved NHE1 activity and protected against apoptosis. Our data indicate that albuminuria/lipiduria enhances lipotoxin delivery to the proximal tubule and accumulation of LC-CoAs contributes to tubular atrophy by severing the NHE1-PI(4,5)P2 interaction, thereby lowering the apoptotic threshold. Furthermore, these data suggest that NHE1 functions as a metabolic sensor for lipotoxicity.

  8. Double P2X2/P2X3 Purinergic Receptor Knockout Mice Do Not Taste NaCl or the Artificial Sweetener SC45647

    PubMed Central

    Eddy, Meghan C.; Eschle, Benjamin K.; Barrows, Jennell; Hallock, Robert M.; Finger, Thomas E.


    The P2X ionotropic purinergic receptors, P2X2 and P2X3, are essential for transmission of taste information from taste buds to the gustatory nerves. Mice lacking both P2X2 and P2X3 purinergic receptors (P2X2/P2X3Dbl−/−) exhibit no taste-evoked activity in the chorda tympani and glossopharyngeal nerves when stimulated with taste stimuli from any of the 5 classical taste quality groups (salt, sweet, sour, bitter, and umami) nor do the mice show taste preferences for sweet or umami, or avoidance of bitter substances (Finger et al. 2005. ATP signaling is crucial for communication from taste buds to gustatory nerves. Science. 310[5753]:1495–1499). Here, we compare the ability of P2X2/P2X3Dbl−/− mice and P2X2/P2X3Dbl+/+ wild-type (WT) mice to detect NaCl in brief-access tests and conditioned aversion paradigms. Brief-access testing with NaCl revealed that whereas WT mice decrease licking at 300 mM and above, the P2X2/P2X3Dbl−/− mice do not show any change in lick rates. In conditioned aversion tests, P2X2/P2X3Dbl−/− mice did not develop a learned aversion to NaCl or the artificial sweetener SC45647, both of which are easily avoided by conditioned WT mice. The inability of P2X2/P2X3Dbl−/− mice to show avoidance of these taste stimuli was not due to an inability to learn the task because both WT and P2X2/P2X3Dbl−/− mice learned to avoid a combination of SC45647 and amyl acetate (an odor cue). These data suggest that P2X2/P2X3Dbl−/− mice are unable to respond to NaCl or SC45647 as taste stimuli, mirroring the lack of gustatory nerve responses to these substances. PMID:19833661

  9. A structural analysis of DNA binding by hSSB1 (NABP2/OBFC2B) in solution.


    Touma, Christine; Kariawasam, Ruvini; Gimenez, Adrian X; Bernardo, Ray E; Ashton, Nicholas W; Adams, Mark N; Paquet, Nicolas; Croll, Tristan I; O'Byrne, Kenneth J; Richard, Derek J; Cubeddu, Liza; Gamsjaeger, Roland


    Single-stranded DNA binding proteins (SSBs) play an important role in DNA processing events such as replication, recombination and repair. Human single-stranded DNA binding protein 1 (hSSB1/NABP2/OBFC2B) contains a single oligosaccharide/oligonucleotide binding (OB) domain followed by a charged C-terminus and is structurally homologous to the SSB from the hyperthermophilic crenarchaeote Sulfolobus solfataricus Recent work has revealed that hSSB1 is critical to homologous recombination and numerous other important biological processes such as the regulation of telomeres, the maintenance of DNA replication forks and oxidative damage repair. Since the ability of hSSB1 to directly interact with single-stranded DNA (ssDNA) is paramount for all of these processes, understanding the molecular details of ssDNA recognition is essential. In this study, we have used solution-state nuclear magnetic resonance in combination with biophysical and functional experiments to structurally analyse ssDNA binding by hSSB1. We reveal that ssDNA recognition in solution is modulated by base-stacking of four key aromatic residues within the OB domain. This DNA binding mode differs significantly from the recently determined crystal structure of the SOSS1 complex containing hSSB1 and ssDNA. Our findings elucidate the detailed molecular mechanism in solution of ssDNA binding by hSSB1, a major player in the maintenance of genomic stability.

  10. P2 receptors in human heart: upregulation of P2X6 in patients undergoing heart transplantation, interaction with TNFalpha and potential role in myocardial cell death.


    Banfi, Cristina; Ferrario, Silvia; De Vincenti, Ombretta; Ceruti, Stefania; Fumagalli, Marta; Mazzola, Alessia; D' Ambrosi, Nadia; Volontè, Cinzia; Fratto, Pasquale; Vitali, Ettore; Burnstock, Geoffrey; Beltrami, Elena; Parolari, Alessandro; Polvani, GianLuca; Biglioli, Paolo; Tremoli, Elena; Abbracchio, Maria P


    ATP acts as a neurotransmitter via seven P2X receptor-channels for Na(+) and Ca(2+), and eight G-protein-coupled P2Y receptors. Despite evidence suggesting roles in human heart, the map of myocardial P2 receptors is incomplete, and their involvement in chronic heart failure (CHF) has never received adequate attention. In left myocardia from five to nine control and 5-12 CHF subjects undergoing heart transplantation, we analyzed the full repertoire of P2 receptors and of 10 "orphan" P2Y-like receptors. All known P2Y receptors (i.e. P2Y(1,2,4,6,11,12,13,14)) and two P2Y-like receptors (GPR91 and GPR17) were detected in all subjects. All known P2X(1-7) receptors were also detected; of these, only P2X(6) was upregulated in CHF, as confirmed by quantitative real time-PCR. The potential significance of this change was studied in primary cardiac fibroblasts freshly isolated from young pigs. Exposure of cardiac fibroblasts to ATP or its hydrolysis-resistant-analog benzoylATP induced apoptosis. TNFalpha (a cytokine implicated in CHF progression) exacerbated cell death. Similar effects were induced by ATP and TNFalpha in a murine cardiomyocytic cell line. In cardiac fibroblasts, TNFalpha inhibited the downregulation of P2X(6) mRNA associated to prolonged agonist exposure, suggesting that, by preventing ATP-induced P2X(6) desensitization, TNFalpha may abolish a defense mechanism meant at avoiding Ca(2+) overload and, ultimately, Ca(2+)-dependent cell death. This may provide a basis for P2X(6) upregulation in CHF. In conclusion, we provide the first characterization of P2 receptors in the human heart and suggest that the interaction between TNFalpha and the upregulated P2X(6) receptor may represent a novel pathogenic mechanism in CHF.

  11. Ca(2+) induces PI(4,5)P2 clusters on lipid bilayers at physiological PI(4,5)P2 and Ca(2+) concentrations.


    Sarmento, Maria J; Coutinho, Ana; Fedorov, Aleksander; Prieto, Manuel; Fernandes, Fabio


    Calcium has been shown to induce clustering of PI(4,5)P2 at high and non-physiological concentrations of both the divalent ion and the phosphatidylinositol, or on supported lipid monolayers. In lipid bilayers at physiological conditions, clusters are not detected through microscopic techniques. Here, we aimed to determine through spectroscopic methodologies if calcium plays a role in PI(4,5)P2 lateral distribution on lipid bilayers under physiological conditions. Using several different approaches which included information on fluorescence quantum yield, polarization, spectra and diffusion properties of a fluorescent derivative of PI(4,5)P2 (TopFluor(TF)-PI(4,5)P2), we show that Ca(2+) promotes PI(4,5)P2 clustering in lipid bilayers at physiological concentrations of both Ca(2+) and PI(4,5)P2. Fluorescence depolarization data of TF-PI(4,5)P2 in the presence of calcium suggests that under physiological concentrations of PI(4,5)P2 and calcium, the average cluster size comprises ~15 PI(4,5)P2 molecules. The presence of Ca(2+)-induced PI(4,5)P2 clusters is supported by FCS data. Additionally, calcium mediated PI(4,5)P2 clustering was more pronounced in liquid ordered (lo) membranes, and the PI(4,5)P2-Ca(2+) clusters presented an increased affinity for lo domains. In this way, PI(4,5)P2 could function as a lipid calcium sensor and the increased efficiency of calcium-mediated PI(4,5)P2 clustering on lo domains might provide targeted nucleation sites for PI(4,5)P2 clusters upon calcium stimulus.

  12. Multicast Services over Structured P2P Networks

    NASA Astrophysics Data System (ADS)

    Manzanares-Lopez, Pilar; Malgosa-Sanahuja, Josemaria; Muñoz-Gea, Juan Pedro; Sanchez-Aarnoutse, Juan Carlos

    IP multicast functionality was defined as an efficient method to transmit datagrams to a group of receivers. However, although a lot of research work has been done in this technology, IP multicast has not spread out over the Internet as much as expected, reducing its use for local environments (i.e., LANs). The peer-to-peer networks paradigm can be used to overcome the IP multicast limitations. In this new scenario (called Application Layer Multicast or ALM), the multicast functionality is changed from network to application layer. Although ALM solution can be classified into unstructured and structured solutions, the last ones are the best option to offer multicast services due to the effectiveness in the discovery nodes, their mathematical definition and the totally decentralized management. In this chapter we are going to offer a tutorial of the main structured ALM solutions, but introducing two novelties with respect to related surveys in the past: first, the systematic description of most representative structured ALM solution in OverSim (one of the most popular p2p simulation frameworks). Second, some simulation comparatives between flooding-based and tree-based structured ALM solution are also presented.

  13. SLAC P2 Marx Control System and Regulation Scheme

    SciTech Connect

    MacNair, David; Kemp, Mark A.; Macken, Koen; Nguyen, Minh N.; Olsen, Jeff; /SLAC


    The SLAC P2 MARX Modulator consists of 32 cells charged in parallel by a -4 kV supply and discharged in series to provide a -120 kV 140 amp 1.7 millisecond pulse. Each cell has a 350 uF main storage capacitor. The voltage on the capacitor will droop approximately 640 volts during each pulse. Each cell will have a boost supply that can add up to 700 V to the cell output. This allows the output voltage of the cell to remain constant within 0.1% during the pulse. The modulator output voltage control is determined by the -4 kV charging voltage. A voltage divider will measure the modulator voltage on each pulse. The charging voltage will be adjusted by the data from previous pulses to provide the desired output. The boost supply in each cell consists of a 700 V buck regulator in series with the main capacitor. The supply uses a lookup table for PWM control. The lookup table is calculated from previous pulse data to provide a constant cell output. The paper will describe the modulator and cell regulation used by the MARX modulator. Measured data from a single cell and three cell string will be included.

  14. Syntheses of 2-keto-3-deoxy-D-xylonate and 2-keto-3-deoxy-L-arabinonate as stereochemical probes for demonstrating the metabolic promiscuity of Sulfolobus solfataricus towards D-xylose and L-arabinose.


    Archer, Robert M; Royer, Sylvain F; Mahy, William; Winn, Caroline L; Danson, Michael J; Bull, Steven D


    Practical syntheses of 2-keto-3-deoxy-D-xylonate (D-KDX) and 2-keto-3-deoxy-L-arabinonate (L-KDA) that rely on reaction of the anion of ethyl 2-[(tert-butyldimethylsilyl)oxy]-2-(dimethoxy phosphoryl) acetate with enantiopure glyceraldehyde acetonide, followed by global deprotection of the resultant O-silyl-enol esters, have been developed. This has enabled us to confirm that a 2-keto-3-deoxy-D-gluconate aldolase from the archaeon Sulfolobus solfataricus demonstrates good activity for catalysis of the retro-aldol cleavage of both these enantiomers to afford pyruvate and glycolaldehyde. The stereochemical promiscuity of this aldolase towards these enantiomeric aldol substrates confirms that this organism employs a metabolically promiscuous pathway to catabolise the C5-sugars D-xylose and L-arabinose.

  15. 4-Alkyloxyimino Derivatives of Uridine-5′-triphosphate: Distal Modification of Potent Agonists as a Strategy for Molecular Probes of P2Y2, P2Y4, and P2Y6 Receptors

    PubMed Central


    Extended N4-(3-arylpropyl)oxy derivatives of uridine-5′-triphosphate were synthesized and potently stimulated phospholipase C stimulation in astrocytoma cells expressing G protein-coupled human (h) P2Y receptors (P2YRs) activated by UTP (P2Y2/4R) or UDP (P2Y6R). The potent P2Y4R-selective N4-(3-phenylpropyl)oxy agonist was phenyl ring-substituted or replaced with terminal heterocyclic or naphthyl rings with retention of P2YR potency. This broad tolerance for steric bulk in a distal region was not observed for dinucleoside tetraphosphate agonists with both nucleobases substituted. The potent N4-(3-(4-methoxyphenyl)-propyl)oxy analogue 19 (EC50: P2Y2R, 47 nM; P2Y4R, 23 nM) was functionalized for chain extension using click tethering of fluorophores as prosthetic groups. The BODIPY 630/650 conjugate 28 (MRS4162) exhibited EC50 values of 70, 66, and 23 nM at the hP2Y2/4/6Rs, respectively, and specifically labeled cells expressing the P2Y6R. Thus, an extended N4-(3-arylpropyl)oxy group accessed a structurally permissive region on three Gq-coupled P2YRs, and potency and selectivity were modulated by distal structural changes. This freedom of substitution was utilized to design of a pan-agonist fluorescent probe of a subset of uracil nucleotide-activated hP2YRs. PMID:24712832

  16. Crystal structure of the ATP-gated P2X[subscript 4] ion channel in the closed state

    SciTech Connect

    Kawate, Toshimitsu; Michel, Jennifer Carlisle; Birdsong, William T.; Gouaux, Eric


    P2X receptors are cation-selective ion channels gated by extracellular ATP, and are implicated in diverse physiological processes, from synaptic transmission to inflammation to the sensing of taste and pain. Because P2X receptors are not related to other ion channel proteins of known structure, there is at present no molecular foundation for mechanisms of ligand-gating, allosteric modulation and ion permeation. Here we present crystal structures of the zebrafish P2X{sub 4} receptor in its closed, resting state. The chalice-shaped, trimeric receptor is knit together by subunit-subunit contacts implicated in ion channel gating and receptor assembly. Extracellular domains, rich in {beta}-strands, have large acidic patches that may attract cations, through fenestrations, to vestibules near the ion channel. In the transmembrane pore, the 'gate' is defined by an {approx}8 {angstrom} slab of protein. We define the location of three non-canonical, intersubunit ATP-binding sites, and suggest that ATP binding promotes subunit rearrangement and ion channel opening.

  17. Pharmacological insights into the role of P2X4 receptors in behavioral regulation: lessons from ivermectin

    PubMed Central

    Bortolato, Marco; Yardley, Megan; Khoja, Sheraz; Godar, Sean C; Asatryan, Liana; Finn, Deborah A.; Alkana, Ronald L.; Louie, Stan G.; Davies, Daryl L.


    Purinergic ionotropic P2X receptors are a family of cation-permeable channels that bind extracellular adenosine 5′-triphosphate (ATP). In particular, convergent lines of evidence have recently highlighted P2X4 receptors as a potentially critical target in the regulation of multiple nervous and behavioral functions, including pain, neuroendocrine regulation and hippocampal plasticity. Nevertheless, the role of the P2X4 receptor in behavioral organization remains poorly investigated. To study the effects of P2X4 activation, we tested the acute effects of its potent positive allosteric modulator ivermectin (IVM, 2.5–10 mg/kg, i.p.) on a broad set of paradigms capturing complementary aspects of perceptual, emotional and cognitive regulation in mice. In a novel open field, IVM did not induce significant changes in locomotor activity, but increased the time spent in the peripheral zone. In contrast, IVM produced anxiolytic-like effects in the elevated plus maze and marble burying tasks, as well as depression-like behaviors in the tail-suspension and forced swim tests. The agent induced no significant behavioral changes in the conditioned place preference test and in the novel object recognition task. Finally, the drug induced a dose-dependent decrease in sensorimotor gating, as assessed by prepulse inhibition (PPI) of the acoustic startle reflex. In P2X4 knockout mice, the effects of IVM in the open field and elevated plus maze were similar to those observed in wild type mice; conversely, the drug significantly increased startle amplitude and failed to reduce PPI. Taken together, these results suggest that P2X4 receptors may play a role in the regulation of sensorimotor gating. PMID:23174033

  18. Residual Chemosensory Capabilities in Double P2X2/P2X3 Purinergic Receptor Null Mice: Intraoral or Postingestive Detection?

    PubMed Central

    Hallock, Robert M.; Tatangelo, Marco; Barrows, Jennell


    Mice lacking the purinergic receptors, P2X2 and P2X3 (P2X2/P2X3Dbl−/−), exhibit essentially no tastant-evoked activity in the chorda tympani and glossopharyngeal nerves and substantial loss of tastant-evoked behavior as measured in long-term intake experiments. To assess whether the residual chemically driven behaviors in these P2X2/P2X3Dbl−/− mice were attributable to postingestive detection or oropharyngeal detection of the compounds, we used brief access lickometer tests to assess the behavioral capabilities of the P2X2/P2X3Dbl−/− animals. The P2X2/P2X3Dbl−/− mice showed avoidance to high levels (10 mM quinine and 10–30 mM denatonium benzoate) of classical “bitter”-tasting stimuli in 24-h, 2-bottle preference tests but minimal avoidance of these substances in the lickometer tests, suggesting that the strong avoidance in the intake tests was largely mediated by post-oral chemosensors. Similarly, increases in consumption of 1 M sucrose by P2X2/P2X3Dbl−/− mice in long-term intake tests were not mirrored by increases in consumption of sucrose in lickometer tests, suggesting that sucrose detection in these mice is mediated by postingestive consequences. In contrast, in brief access tests, P2X2/P2X3Dbl−/− mice avoided citric acid and hydrochloric acid at the same concentrations as their wild-type counterparts, indicating that these weak acids activate oropharyngeal chemoreceptors. PMID:19833662

  19. The pH-dependent unfolding mechanism of P2 myelin protein: an experimental and computational study.


    Polverini, Eugenia; Fornabaio, Micaela; Fasano, Anna; Carlone, Giulia; Riccio, Paolo; Cavatorta, Paolo


    The P2 protein is a small, extrinsic protein of the myelin membrane in the peripheral nervous system that structurally belongs to the fatty acid binding proteins (FABPs) family, sharing with them a 10 strands beta-barrel structure. FABPs appear to be involved in cellular fatty acid transport, but very little is known about the role of P2 in the metabolism of peripheral myelin lipids. Study of protein conformation at different pHs is a useful tool for the characterization of the unfolding mechanisms and the intrinsic conformational properties of the protein, and may give insight into factors that guide protein folding pathways. In particular, low pH conditions have been shown to induce partially folded states in several proteins. In this paper, the acidic unfolding of purified P2 protein was studied with both spectroscopic techniques and molecular dynamics simulation. Both experimental and computational results indicate the presence of a partly folded state at low pH, which shows structural changes mainly involving the lid that is formed by the helix-turn-helix domain. The opening of the lid, together with a barrel relaxation, could regulate the ligand exchanges near the cell membrane, supporting the hypothesis that the P2 protein may transport fatty acids between Schwann cells and peripheral myelin.

  20. Characterization of (11)C-GSK1482160 for Targeting the P2X7 Receptor as a Biomarker for Neuroinflammation.


    Territo, Paul R; Meyer, Jill A; Peters, Jonathan S; Riley, Amanda A; McCarthy, Brian P; Gao, Mingzhang; Wang, Min; Green, Mark A; Zheng, Qi-Huang; Hutchins, Gary D


    The purinergic receptor subtype 7 (P2X7R) represents a novel molecular target for imaging neuroinflammation via PET. GSK1482160, a potent P2X7R antagonist, has high receptor affinity, high blood-brain barrier penetration, and the ability to be radiolabeled with (11)C. We report the initial physical and biologic characterization of this novel ligand. Methods:(11)C-GSK1482160 was synthesized according to published methods. Cell density studies were performed on human embryonic kidney cell lines expressing human P2X7R (HEK293-hP2X7R) and underwent Western blotting, an immunofluorescence assay, and radioimmunohistochemistry analysis using P2X7R polyclonal antibodies. Receptor density and binding potential were determined by saturation and association-disassociation kinetics, respectively. Peak immune response to lipopolysaccharide treatment in mice was determined in time course studies and analyzed via Iba1 and P2X7R Western blotting and Iba1 immunohistochemistry. Whole-animal biodistribution studies were performed on saline- or lipopolysaccharide-treated mice at 15, 30, and 60 min after radiotracer administration. Dynamic in vivo PET/CT was performed on the mice at 72 h after administration of saline, lipopolysaccharide, or lipopolysaccharide + blocking, and 2-compartment, 5-parameter tracer kinetic modeling of brain regions was performed. Results: P2X7R changed linearly with concentrations or cell numbers. For high-specific-activity (11)C-GSK1482160, receptor density and Kd were 1.15 ± 0.12 nM and 3.03 ± 0.10 pmol/mg, respectively, in HEK293-hP2X7R membranes. Association constant kon, dissociation constant koff, and binding potential (kon/koff) in HEK293-hP2X7R cells were 0.2312 ± 0.01542 min(-1)⋅nM(-1), 0.2547 ± 0.0155 min(-1), and 1.0277 ± 0.207, respectively. Whole-brain Iba1 expression in lipopolysaccharide-treated mice peaked by 72 h on immunohistochemistry, and Western blot analysis of P2X7R for saline- and lipopolysaccharide-treated brain sections

  1. Expression of OmpP2A and OmpP2B is not required for pustule formation by Haemophilus ducreyi in human volunteers.


    Janowicz, Diane; Luke, Nicole R; Fortney, Kate R; Katz, Barry P; Campagnari, Anthony A; Spinola, Stanley M


    Haemophilus ducreyi express two porin proteins, termed OmpP2A and OmpP2B. To test whether expression of OmpP2A and OmpP2B was necessary for virulence in humans, eight volunteers were experimentally infected with the parent (35000HP) in one arm and a double OmpP2A OmpP2B mutant (35000HP::P2AB) in the other arm. The pustule formation rates were 58.3% (95% CI, 33.2-83.5%) for the parent and 41.7% (95% CI, 19.3-64.0%) for the mutant (P=0.25). Biopsy of 35000HP and 35000HP::P2AB-infected sites yielded similar amounts of bacteria in quantitative culture. These results indicate that expression of OmpP2A and OmpP2B is not necessary to initiate disease or to progress to pustule formation in humans.

  2. Distribution of P2Y6 and P2Y12 receptor: their colocalization with calbindin, calretinin and nitric oxide synthase in the guinea pig enteric nervous system.


    Xiang, Zhenghua; Burnstock, Geoffrey


    The distribution of P2Y(6) and P2Y(12) receptor-immunoreactive (ir) neurons and fibers and their coexistence with calbindin, calretinin and nitric oxide synthase (NOS) has been investigated with single and double labeling immunostaining methods. The results showed that 30-36% of the ganglion cells in the myenteric plexus are strongly P2Y(6) receptor-ir neurons; they are distributed widely in the myenteric plexus of stomach, jejunum, ileum and colon, but not in the submucosal plexus, with a typical morphology of multipolar neurons with a long axon-like process. About 42-46% of ganglion cells in both the myenteric and submucosal plexuses show P2Y(12) receptor-ir. About 28-35% of P2Y(6) receptor-ir neurons were found to coexist with NOS and 41-47% of them coexist with calretinin, but there was no coexistence of P2Y(6) receptor-ir with calbindin. In contrast, all P2Y(12) receptor-ir neurons were immunopositive for calbindin, although occasionally P2Y(12) receptor-ir neurons without calbindin immunoreactivity were found, while none of the P2Y(12) receptor-ir neurons were found to coexist with calretinin or NOS in the gastrointestinal system of guinea pig. The P2Y(12) receptor-ir neurons coexpressing calbindin-ir in the small intestine are Dogiel type II/AH, intrinsic primary afferent neurons.

  3. Structure and Functional Properties of the Active Form of the Proteolytic Complex, ClpP1P2, from Mycobacterium tuberculosis*

    PubMed Central

    Li, Mi; Kandror, Olga; Akopian, Tatos; Dharkar, Poorva; Wlodawer, Alexander; Maurizi, Michael R.; Goldberg, Alfred L.


    The ClpP protease complex and its regulatory ATPases, ClpC1 and ClpX, in Mycobacterium tuberculosis (Mtb) are essential and, therefore, promising drug targets. The Mtb ClpP protease consists of two heptameric rings, one composed of ClpP1 and the other of ClpP2 subunits. Formation of the enzymatically active ClpP1P2 complex requires binding of N-blocked dipeptide activators. We have found a new potent activator, benzoyl-leucine-leucine (Bz-LL), that binds with higher affinity and promotes 3–4-fold higher peptidase activity than previous activators. Bz-LL-activated ClpP1P2 specifically stimulates the ATPase activity of Mtb ClpC1 and ClpX. The ClpC1P1P2 and ClpXP1P2 complexes exhibit 2–3-fold enhanced ATPase activity, peptide cleavage, and ATP-dependent protein degradation. The crystal structure of ClpP1P2 with bound Bz-LL was determined at a resolution of 3.07 Å and with benzyloxycarbonyl-Leu-Leu (Z-LL) bound at 2.9 Å. Bz-LL was present in all 14 active sites, whereas Z-LL density was not resolved. Surprisingly, Bz-LL adopts opposite orientations in ClpP1 and ClpP2. In ClpP1, Bz-LL binds with the C-terminal leucine side chain in the S1 pocket. One C-terminal oxygen is close to the catalytic serine, whereas the other contacts backbone amides in the oxyanion hole. In ClpP2, Bz-LL binds with the benzoyl group in the S1 pocket, and the peptide hydrogen bonded between parallel β-strands. The ClpP2 axial loops are extended, forming an open axial channel as has been observed with bound ADEP antibiotics. Thus occupancy of the active sites of ClpP allosterically alters sites on the surfaces thereby affecting the association of ClpP1 and ClpP2 rings, interactions with regulatory ATPases, and entry of protein substrates. PMID:26858247

  4. Binding Procurement

    NASA Technical Reports Server (NTRS)

    Rao, Gopalakrishna M.; Vaidyanathan, Hari


    This viewgraph presentation reviews the use of the binding procurement process in purchasing Aerospace Flight Battery Systems. NASA Engineering and Safety Center (NESC) requested NASA Aerospace Flight Battery Systems Working Group to develop a set of guideline requirements document for Binding Procurement Contracts.

  5. Dynamics of the Peripheral Membrane Protein P2 from Human Myelin Measured by Neutron Scattering—A Comparison between Wild-Type Protein and a Hinge Mutant

    PubMed Central

    Laulumaa, Saara; Nieminen, Tuomo; Lehtimäki, Mari; Aggarwal, Shweta; Simons, Mikael; Koza, Michael M.; Vattulainen, Ilpo; Kursula, Petri; Natali, Francesca


    Myelin protein P2 is a fatty acid-binding structural component of the myelin sheath in the peripheral nervous system, and its function is related to its membrane binding capacity. Here, the link between P2 protein dynamics and structure and function was studied using elastic incoherent neutron scattering (EINS). The P38G mutation, at the hinge between the β barrel and the α-helical lid, increased the lipid stacking capacity of human P2 in vitro, and the mutated protein was also functional in cultured cells. The P38G mutation did not change the overall structure of the protein. For a deeper insight into P2 structure-function relationships, information on protein dynamics in the 10 ps to 1 ns time scale was obtained using EINS. Values of mean square displacements mainly from protein H atoms were extracted for wild-type P2 and the P38G mutant and compared. Our results show that at physiological temperatures, the P38G mutant is more dynamic than the wild-type P2 protein, especially on a slow 1-ns time scale. Molecular dynamics simulations confirmed the enhanced dynamics of the mutant variant, especially within the portal region in the presence of bound fatty acid. The increased softness of the hinge mutant of human myelin P2 protein is likely related to an enhanced flexibility of the portal region of this fatty acid-binding protein, as well as to its interactions with the lipid bilayer surface requiring conformational adaptations. PMID:26068118

  6. Full length and protease domain activity of chikungunya virus nsP2 differ from other alphavirus nsP2 proteases in recognition of small peptide substrates.


    Saisawang, Chonticha; Sillapee, Pornpan; Sinsirimongkol, Kwanhathai; Ubol, Sukathida; Smith, Duncan R; Ketterman, Albert J


    Alphavirus nsP2 proteins are multifunctional and essential for viral replication. The protease role of nsP2 is critical for virus replication as only the virus protease activity is used for processing of the viral non-structural polypeptide. Chikungunya virus is an emerging disease problem that is becoming a world-wide health issue. We have generated purified recombinant chikungunya virus nsP2 proteins, both full length and a truncated protease domain from the C-terminus of the nsP2 protein. Enzyme characterization shows that the protease domain alone has different properties compared with the full length nsP2 protease. We also show chikungunya nsP2 protease possesses different substrate specificity to the canonical alphavirus nsP2 polyprotein cleavage specificity. Moreover, the chikungunya nsP2 also appears to differ from other alphavirus nsP2 in its distinctive ability to recognize small peptide substrates.

  7. Full length and protease domain activity of chikungunya virus nsP2 differ from other alphavirus nsP2 proteases in recognition of small peptide substrates

    PubMed Central

    Saisawang, Chonticha; Sillapee, Pornpan; Sinsirimongkol, Kwanhathai; Ubol, Sukathida; Smith, Duncan R.; Ketterman, Albert J.


    Alphavirus nsP2 proteins are multifunctional and essential for viral replication. The protease role of nsP2 is critical for virus replication as only the virus protease activity is used for processing of the viral non-structural polypeptide. Chikungunya virus is an emerging disease problem that is becoming a world-wide health issue. We have generated purified recombinant chikungunya virus nsP2 proteins, both full length and a truncated protease domain from the C-terminus of the nsP2 protein. Enzyme characterization shows that the protease domain alone has different properties compared with the full length nsP2 protease. We also show chikungunya nsP2 protease possesses different substrate specificity to the canonical alphavirus nsP2 polyprotein cleavage specificity. Moreover, the chikungunya nsP2 also appears to differ from other alphavirus nsP2 in its distinctive ability to recognize small peptide substrates. PMID:26182358

  8. Inhibitors of hepatitis C virus NS3.4A protease. Part 3: P2 proline variants.


    Perni, Robert B; Farmer, Luc J; Cottrell, Kevin M; Court, John J; Courtney, Lawrence F; Deininger, David D; Gates, Cynthia A; Harbeson, Scott L; Kim, Joseph L; Lin, Chao; Lin, Kai; Luong, Yu-Ping; Maxwell, John P; Murcko, Mark A; Pitlik, Janos; Rao, B Govinda; Schairer, Wayne C; Tung, Roger D; Van Drie, John H; Wilson, Keith; Thomson, John A


    We recently described the identification of an optimized alpha-ketoamide warhead for our series of HCV NS3.4A inhibitors. We report herein a series of HCV protease inhibitors incorporating 3-alkyl-substituted prolines in P(2). These compounds show exceptional enzymatic and cellular potency given their relatively small size. The marked enhancement of activity of these 3-substituted proline derivatives relative to previously reported 4-hydroxyproline derivatives constitutes additional evidence for the importance of the S(2) binding pocket as the defining pharmacophore for inhibition of the NS3.4A enzyme.

  9. Vinylated linear P2 pyrimidinyloxyphenylglycine based inhibitors of the HCV NS3/4A protease and corresponding macrocycles.


    Lampa, Anna; Alogheli, Hiba; Ehrenberg, Angelica E; Åkerblom, Eva; Svensson, Richard; Artursson, Per; Danielson, U Helena; Karlén, Anders; Sandström, Anja


    With three recent market approvals and several inhibitors in advanced stages of development, the hepatitis C virus (HCV) NS3/4A protease represents a successful target for antiviral therapy against hepatitis C. As a consequence of dealing with viral diseases in general, there are concerns related to the emergence of drug resistant strains which calls for development of inhibitors with an alternative binding-mode than the existing highly optimized ones. We have previously reported on the use of phenylglycine as an alternative P2 residue in HCV NS3/4A protease inhibitors. Herein, we present the synthesis, structure-activity relationships and in vitro pharmacokinetic characterization of a diverse series of linear and macrocyclic P2 pyrimidinyloxyphenylglycine based inhibitors. With access to vinyl substituents in P3, P2 and P1' positions an initial probing of macrocyclization between different positions, using ring-closing metathesis (RCM) could be performed, after addressing some synthetic challenges. Biochemical results from the wild type enzyme and drug resistant variants (e.g., R155 K) indicate that P3-P1' macrocyclization, leaving the P2 substituent in a flexible mode, is a promising approach. Additionally, the study demonstrates that phenylglycine based inhibitors benefit from p-phenylpyrimidinyloxy and m-vinyl groups as well as from the combination with an aromatic P1 motif with alkenylic P1' elongations. In fact, linear P2-P1' spanning intermediate compounds based on these fragments were found to display promising inhibitory potencies and drug like properties.

  10. 2P2Idb v2: update of a structural database dedicated to orthosteric modulation of protein–protein interactions

    PubMed Central

    Basse, Marie-Jeanne; Betzi, Stéphane; Morelli, Xavier; Roche, Philippe


    2P2Idb is a hand-curated structural database dedicated to protein–protein interactions with known small molecule orthosteric modulators. It compiles the structural information related to orthosteric inhibitors and their target [i.e. related 3D structures available in the RCSB Protein Data Bank (PDB)] and provides links to other useful databases. 2P2Idb includes all interactions for which both the protein–protein and protein–inhibitor complexes have been structurally characterized. Since its first release in 2010, the database has grown constantly and the current version contains 27 protein–protein complexes and 274 protein–inhibitor complexes corresponding to 242 unique small molecule inhibitors which represent almost a 5-fold increase compared to the previous version. A number of new data have been added, including new protein–protein complexes, binding affinities, molecular descriptors, precalculated interface parameters and links to other webservers. A new query tool has been implemented to search for inhibitors within the database using standard molecular descriptors. A novel version of the 2P2I-inspector tool has been implemented to calculate a series of physical and chemical parameters of the protein interfaces. Several geometrical parameters including planarity, eccentricity and circularity have been added as well as customizable distance cutoffs. This tool has also been extended to protein–ligand interfaces. The 2P2I database thus represents a wealth of structural source of information for scientists interested in the properties of protein–protein interactions and the design of protein–protein interaction modulators. Database URL: PMID:26980515

  11. PI(3,4)P2 plays critical roles in the regulation of focal adhesion dynamics of MDA-MB-231 breast cancer cells.


    Fukumoto, Miki; Ijuin, Takeshi; Takenawa, Tadaomi


    Phosphoinositides play pivotal roles in the regulation of cancer cell phenotypes. Among them, phosphatidylinositol 3,4-bisphosphate (PI(3,4)P2 ) localizes to the invadopodia, and positively regulates tumor cell invasion. In this study, we examined the effect of PI(3,4)P2 on focal adhesion dynamics in MDA-MB-231 basal breast cancer cells. Knockdown of SHIP2, a phosphatidylinositol 3,4,5-trisphosphatase (PIP3 ) 5-phosphatase that generates PI(3,4)P2 , in MDA-MB-231 breast cancer cells, induced the development of focal adhesions and cell spreading, leading to the suppression of invasion. In contrast, knockdown of PTEN, a 3-phosphatase that de-phosphorylates PIP3 and PI(3,4)P2 , induced cell shrinkage and increased cell invasion. Interestingly, additional knockdown of SHIP2 rescued these phenotypes. Overexpression of the TAPP1 PH domain, which binds to PI(3,4)P2 , and knockdown of Lpd, a downstream effector of PI(3,4)P2 , resulted in similar phenotypes to those induced by SHIP2 knockdown. Taken together, our results suggest that inhibition of PI(3,4)P2 generation and/or downstream signaling could be useful for inhibiting breast cancer metastasis. This article is protected by copyright. All rights reserved.

  12. P2X4 receptors (P2X4Rs) represent a novel target for the development of drugs to prevent and/or treat alcohol use disorders

    PubMed Central

    Franklin, Kelle M.; Asatryan, Liana; Jakowec, Michael W.; Trudell, James R.; Bell, Richard L.; Davies, Daryl L.


    Alcohol use disorders (AUDs) have a staggering socioeconomic impact. Few therapeutic options are available, and they are largely inadequate. These shortcomings highlight the urgent need to develop effective medications to prevent and/or treat AUDs. A critical barrier is the lack of information regarding the molecular target(s) by which ethanol (EtOH) exerts its pharmacological activity. This review highlights findings implicating P2X4 receptors (P2X4Rs) as a target for the development of therapeutics to treat AUDs and discusses the use of ivermectin (IVM) as a potential clinical tool for treatment of AUDs. P2XRs are a family of ligand-gated ion channels (LGICs) activated by extracellular ATP. Of the P2XR subtypes, P2X4Rs are expressed the most abundantly in the CNS. Converging evidence suggests that P2X4Rs are involved in the development and progression of AUDs. First, in vitro studies report that pharmacologically relevant EtOH concentrations can negatively modulate ATP-activated currents. Second, P2X4Rs in the mesocorticolimbic dopamine system are thought to play a role in synaptic plasticity and are located ideally to modulate brain reward systems. Third, alcohol-preferring (P) rats have lower functional expression of the p2rx4 gene than alcohol-non-preferring (NP) rats suggesting an inverse relationship between alcohol intake and P2X4R expression. Similarly, whole brain p2rx4 expression has been shown to relate inversely to innate 24 h alcohol preference across 28 strains of rats. Fourth, mice lacking the p2rx4 gene drink more EtOH than wildtype controls. Fifth, IVM, a positive modulator of P2X4Rs, antagonizes EtOH-mediated inhibition of P2X4Rs in vitro and reduces EtOH intake and preference in vivo. These findings suggest that P2X4Rs contribute to EtOH intake. The present review summarizes recent findings focusing on the P2X4R as a molecular target of EtOH action, its role in EtOH drinking behavior and modulation of its activity by IVM as a potential therapy

  13. P2Y1 and P2Y2 receptor distribution varies along the human placental vascular tree: role of nucleotides in vascular tone regulation

    PubMed Central

    Buvinic, Sonja; Poblete, M Inés; Donoso, M Verónica; Delpiano, Ana María; Briones, René; Miranda, Ramiro; Huidobro-Toro, J Pablo


    The expression of purinergic P2Y receptors (P2YRs) along the cord, superficial chorionic vessels and cotyledons of the human placenta was analysed and functional assays were performed to determine their vasomotor activity. Immunoblots for the P2Y1R and P2Y2R revealed a 6- to 8-fold increase in receptor expression from the cord to the chorionic or cotyledon vessels. In the cord and chorionic vessels the receptor distribution was mainly in the smooth muscle, whereas in the cotyledon vessels these receptors were equally distributed between the endothelium and smooth muscle cells. An exception was the P2Y2R at the umbilical artery, which was distributed as in the cotyledon. mRNA coding for the P2Y1R and P2Y2R were detected by RT-PCR and the mRNA coding for the P2Y4R, P2Y6R and P2Y11R was also identified. Application of 2-MeSADP and uridine triphosphate (UTP), preferential P2Y1R and P2Y2R ligands, respectively, resulted in contraction of isolated rings from umbilical and chorionic vessels. The vasoconstriction was blocked in a concentration-dependent manner by 10–100 nm indomethacin or 10 nm GR32191, suggesting the involvement of thromboxane receptors. MRS 2179, a selective P2Y1R antagonist, reduced the 2-MeSADP- but not the UTP-evoked contractions. Perfusion of cotyledons with 2-MeSADP or UTP evoked concentration-dependent reductions in perfusion pressure mediated by the NO–cGMP pathway. Blockade of NO synthase abolished the vasodilatation and the rise in luminal NO elicited by either agonist. MRS 2179 antagonized the dilatation and rise in luminal NO evoked by 2-MeSADP but not by UTP. In summary, P2Y1R and P2Y2R are unevenly distributed along the human placental vascular tree; both receptors are coupled to different signalling pathways in the cord/chorionic vessels versus the cotyledon leading to opposing vasomotor responses. PMID:16543271

  14. Flexible subunit stoichiometry of functional human P2X2/3 heteromeric receptors.


    Kowalski, Maria; Hausmann, Ralf; Schmid, Julia; Dopychai, Anke; Stephan, Gabriele; Tang, Yong; Schmalzing, Günther; Illes, Peter; Rubini, Patrizia


    The aim of the present work was to clarify whether heterotrimeric P2X2/3 receptors have a fixed subunit stoichiometry consisting of one P2X2 and two P2X3 subunits as previously suggested, or a flexible stoichiometry containing also the inverse subunit composition. For this purpose we transfected HEK293 cells with P2X2 and P2X3 encoding cDNA at the ratios of 1:2 and 4:1, and analysed the biophysical and pharmacological properties of the generated receptors by means of the whole-cell patch-clamp technique. The concentration-response curves for the selective agonist α,β-meATP did not differ from each other under the two transfection ratios. However, co-expression of an inactive P2X2 mutant and the wild type P2X3 subunit and vice versa resulted in characteristic distortions of the α,β-meATP concentration-response relationships, depending on which subunit was expressed in excess, suggesting that HEK293 cells express mixtures of (P2X2)1/(P2X3)2 and (P2X2)2/(P2X3)1 receptors. Whereas the allosteric modulators H+ and Zn2+ failed to discriminate between the two possible heterotrimeric receptor variants, the α,β-meATP-induced responses were blocked more potently by the competitive antagonist A317491, when the P2X2 subunit was expressed in deficit of the P2X3 subunit. Furthermore, blue-native PAGE analysis of P2X2 and P2X3 subunits co-expressed in Xenopus laevis oocytes and HEK293 cells revealed that plasma membrane-bound P2X2/3 receptors appeared in two clearly distinct heterotrimeric complexes: a (P2X2-GFP)2/(P2X3)1 complex and a (P2X2-GFP)1/(P2X3)2 complex. These data strongly indicate that the stoichiometry of the heteromeric P2X2/3 receptor is not fixed, but determined in a permutational manner by the relative availability of P2X2 and P2X3 subunits.

  15. Synthesis and Potency of Novel Uracil Nucleotides and Derivatives as P2Y2 and P2Y6 Receptor Agonists

    PubMed Central

    Ko, Hyojin; Carter, Rhonda L.; Cosyn, Liesbet; Petrelli, Riccardo; de Castro, Sonia; Besada, Pedro; Zhou, Yixing; Cappellacci, Loredana; Franchetti, Palmarisa; Grifantini, Mario; Van Calenbergh, Serge; Harden, T. Kendall; Jacobson, Kenneth A.


    The phosphate, uracil, and ribose moieties of uracil nucleotides were varied structurally for evaluation of agonist activity at the human P2Y2, P2Y4, and P2Y6 receptors. The 2-thio modification, found previously to enhance P2Y2 receptor potency, could be combined with other favorable modifications to produce novel molecules that exhibit high potencies and receptor selectivities. Phosphonomethylene bridges introduced for stability in analogues of UDP, UTP and uracil dinucleotides markedly reduced potency. Truncation of dinucleotide agonists of the P2Y2 receptor, in the form of Up4-sugars, indicated that a terminal uracil ring is not essential for moderate potency at this receptor and that specific SAR patterns are observed at this distal end of the molecule. Key compounds reported in this study include: 9, α,β-methylene-UDP, a P2Y6 receptor agonist; 30, Up4-phenyl ester and 34, Up4-[1]glucose, selective P2Y2 receptor agonists; 43, the 2-thio analogue of INS37217 (P1-(uridine 5′)-P4- (2′-deoxycytidine 5′) tetraphosphate), a potent and selective P2Y2 receptor agonist. PMID:18514530

  16. Pore architecture and ion sites in acid-sensing ion channels and P2X receptors.


    Gonzales, Eric B; Kawate, Toshimitsu; Gouaux, Eric


    Acid-sensing ion channels are proton-activated, sodium-selective channels composed of three subunits, and are members of the superfamily of epithelial sodium channels, mechanosensitive and FMRF-amide peptide-gated ion channels. These ubiquitous eukaryotic ion channels have essential roles in biological activities as diverse as sodium homeostasis, taste and pain. Despite their crucial roles in biology and their unusual trimeric subunit stoichiometry, there is little knowledge of the structural and chemical principles underlying their ion channel architecture and ion-binding sites. Here we present the structure of a functional acid-sensing ion channel in a desensitized state at 3 A resolution, the location and composition of the approximately 8 A 'thick' desensitization gate, and the trigonal antiprism coordination of caesium ions bound in the extracellular vestibule. Comparison of the acid-sensing ion channel structure with the ATP-gated P2X(4) receptor reveals similarity in pore architecture and aqueous vestibules, suggesting that there are unanticipated yet common structural and mechanistic principles.

  17. Mechanistic insights from resolving ligand-dependent kinetics of conformational changes at ATP-gated P2X1R ion channels

    PubMed Central

    Fryatt, Alistair G.; Dayl, Sudad; Cullis, Paul M.; Schmid, Ralf; Evans, Richard J.


    Structural studies of P2X receptors show a novel U shaped ATP orientation following binding. We used voltage clamp fluorometry (VCF) and molecular dynamics (MD) simulations to investigate agonist action. For VCF the P2X1 receptor (P2X1R) K190C mutant (adjacent to the agonist binding pocket) was labelled with the fluorophore MTS-TAMRA and changes in fluorescence on agonist treatment provided a real time measure of conformational changes. Studies with heteromeric channels incorporating a key lysine mutation (K68A) in the ATP binding site demonstrate that normally three molecules of ATP activate the receptor. The time-course of VCF responses to ATP, 2′-deoxy ATP, 3′-deoxy ATP, Ap5A and αβmeATP were agonist dependent. Comparing the properties of the deoxy forms of ATP demonstrated the importance of the 2′ hydroxyl group on the ribose ring in determining agonist efficacy consistent with MD simulations showing that it forms a hydrogen bond with the γ-phosphate oxygen stabilizing the U-shaped conformation. Comparison of the recovery of fluorescence on agonist washout, with channel activation to a second agonist application for the partial agonists Ap5A and αβmeATP, showed a complex relationship between conformational change and desensitization. These results highlight that different agonists induce distinct conformational changes, kinetics and recovery from desensitization at P2X1Rs. PMID:27616669

  18. Phospholipid binding to the FAK catalytic domain impacts function

    PubMed Central

    Schaller, Michael D.


    Focal adhesion kinase is an essential nonreceptor tyrosine kinase that plays an important role in development, in homeostasis and in the progression of human disease. Multiple stimuli activate FAK, which requires a change in structure from an autoinhibited to activated conformation. In the autoinhibited conformation the FERM domain associates with the catalytic domain of FAK and PI(4,5)P2 binding to the FERM domain plays a role in the release of autoinhibition, activating the enzyme. An in silico model of FAK/PI(4,5)P2 interaction suggests that residues on the catalytic domain interact with PI(4,5)P2, in addition to the known FERM domain PI(4,5)P2 binding site. This study was undertaken to test the significance of this in silico observation. Mutations designed to disrupt the putative PI(4,5)P2 binding site were engineered into FAK. These mutants exhibited defects in phosphorylation and failed to completely rescue the phenotype associated with fak -/- phenotype fibroblasts demonstrating the importance of these residues in FAK function. The catalytic domain of FAK exhibited PI(4,5)P2 binding in vitro and binding activity was lost upon mutation of putative PI(4,5)P2 binding site basic residues. However, binding was not selective for PI(4,5)P2, and the catalytic domain bound to several phosphatidylinositol phosphorylation variants. The mutant exhibiting the most severe biological defect was defective for phosphatidylinositol phosphate binding, supporting the model that catalytic domain phospholipid binding is important for biochemical and biological function. PMID:28222177

  19. P2Y2R Deficiency Attenuates Experimental Autoimmune Uveitis Development

    PubMed Central

    Relvas, Lia Judice M.; Makhoul, Maya; Dewispelaere, Remi; Caspers, Laure; Communi, Didier; Boeynaems, Jean-Marie; Robaye, Bernard; Bruyns, Catherine; Willermain, François


    We aimed to study the role of the nucleotide receptor P2Y2R in the development of experimental autoimmune uveitis (EAU). EAU was induced in P2Y2+/+ and P2Y2-/- mice by immunization with IRBP peptide or by adoptive transfer of in vitro restimulated semi-purified IRBP-specific enriched T lymphocytes from spleens and lymph nodes isolated from native C57Bl/6 or P2Y2+/+ and P2Y2-/- immunized mice. Clinical and histological scores were used to grade disease severity. Splenocytes and lymph node cell phenotypes were analyzed using flow cytometry. Semi-purified lymphocytes and MACS-purified CD4+ T lymphocytes from P2Y2+/+ and P2Y2-/- immunized mice were tested for proliferation and cytokine secretion. Our data show that clinical and histological scores were significantly decreased in IRBP-immunized P2Y2-/- mice as in P2Y2-/- mice adoptively transfered with enriched T lymphocytes from C57Bl/6 IRBP-immunized mice. In parallel, naïve C57Bl/6 mice adoptively transferred with T lymphocytes from P2Y2-/- IRBP-immunized mice also showed significantly less disease. No differences in term of spleen and lymph node cell recruitment or phenotype appeared between P2Y2-/- and P2Y2+/+ immunized mice. However, once restimulated in vitro with IRBP, P2Y2-/- T cells proliferate less and secrete less cytokines than the P2Y2+/+ one. We further found that antigen-presenting cells of P2Y2-/- immunized mice were responsible for this proliferation defect. Together our data show that P2Y2-/- mice are less susceptible to mount an autoimmune response against IRBP. Those results are in accordance with the danger model, which makes a link between autoreactive lymphocyte activation, cell migration and the release of danger signals such as extracellular nucleotides. PMID:25692550

  20. Expression of P2Y receptors in cell lines derived from the human lung.


    Communi, D; Paindavoine, P; Place, G A; Parmentier, M; Boeynaems, J M


    1. Northern blotting experiments have been performed with RNA extracted from several cell lines derived from the human lung in order to detect P2Y1, P2Y2, P2Y4 and P2Y6 mRNA. We have investigated the 1HAEo- and 16HBE14o- epithelial cell lines derived from the airway epithelium, the A549 cell line displaying properties of type II alveolar epithelial cells, the CALU-3 serous cells, the 6CFSMEo- submucosal cells and the HASMSC1 airway smooth muscle cells. We have also evaluated one pancreatic epithelial cell line called CFPAC-1. These experiments revealed that P2Y2 and P2Y6 mRNA are co-expressed in the IHAEo-, 16HBE14o- and A549 epithelial cell lines. The CFPAC-1 pancreatic cell line was strongly positive for the P2Y2 receptor. No signal was obtained for the P2Y1 and P2Y4 receptors. 2. We have then performed RT-PCR experiments with specific oligonucleotides of these last two P2Y receptors with the RNA used for the Northern blotting experiments. P2Y4 mRNA was detected in five cell lines: 1HAEo-, 16HBE14o-, 6CFSMEo-, HASMSC1 and CFPAC-1. P2Y1 mRNA was only detected in the CALU-3 cell line. 3. Inositol trisphosphates assays have identified a response typical of the P2Y2 receptor in the 1HAEo- and the 16HBE14o- airway epithelial cell lines which co-express P2Y2 and P2Y6 mRNA. By contrast, the 6CFSMEo- submucosal cells expressed a UTP-specific response which displayed pharmacological characteristics compatible with the human P2Y4 receptor: in particular, there was no response to UDP or ATP and the UTP effect was totally inhibited by pertussis toxin.

  1. Band offset at the heterojunction interfaces of CdS/ZnSnP2, ZnS/ZnSnP2, and In2S3/ZnSnP2

    NASA Astrophysics Data System (ADS)

    Nakatsuka, Shigeru; Nose, Yoshitaro; Shirai, Yasuharu


    Heterojunctions were formed between ZnSnP2 and buffer materials, CdS, ZnS, and In2S3, using chemical bath deposition. The band offset was investigated by X-ray photoelectron spectroscopy based on Kraut method. The conduction band offset, ΔEC, between ZnSnP2 and CdS was estimated to be -1.2 eV, which significantly limits the open circuit voltage, VOC. Conversely, ΔEC at the heterojunction between ZnSnP2 and ZnS was +0.3 eV, which is within the optimal offset range. In the case of In2S3, ΔEC was a relatively small value, -0.2 eV, and In2S3 is potentially useful as a buffer layer in ZnSnP2 solar cells. The J-V characteristics of heterojunction diodes with an Al/sulfides/ZnSnP2 bulk/Mo structure also suggested that ZnS and In2S3 are promising candidates for buffer layers in ZnSnP2 thin film solar cells, and the band alignment is a key factor for the higher efficiency of solar cells with heterojunctions.

  2. The phenothiazine-class antipsychotic drugs prochlorperazine and trifluoperazine are potent allosteric modulators of the human P2X7 receptor.


    Hempel, Christoph; Nörenberg, Wolfgang; Sobottka, Helga; Urban, Nicole; Nicke, Annette; Fischer, Wolfgang; Schaefer, Michael


    P2X7, an ATP-gated cation channel, is involved in immune cell activation, hyperalgesia and neuropathic pain. By regulating cytokine release in the brain, P2X7 has been linked to the pathophysiology of mood disorders and schizophrenia. We here assess the impact of 123 drugs that act in the central nervous system on human P2X7. Most prominently, the tricyclic antipsychotics prochlorperazine (PCP) and trifluoperazine (TFP) potently inhibited P2X7-mediated Ca2+ entry, dye permeation and ionic currents. In divalent cation-containing bath solutions or after prolonged incubation, ATP-evoked P2X7 currents were inhibited by 10 μM PCP. This effect was not related to dopamine receptor antagonism. Surprisingly, PCP co-applied with ATP enhanced inward currents in bath solutions with low divalent cation concentrations. Intracellular perfusion with PCP did not substitute for the extracellularly applied drug, indicating that its binding sites are accessible from the extracellular space. Since P2X7 current potentiation by PCP was voltage-dependent, at least one site may be located within the electrical field of the membrane. While the channel opening and closure kinetic was altered by PCP, the apparent affinity of ATP remained unchanged (potentiation) or changed slightly (inhibition). Measurements in human monocyte-derived macrophages confirmed the PCP-induced inhibition of ATP-evoked Ca2+ influx, Yo-Pro-1 permeability, and whole cell currents. Interestingly, neither heterologously expressed rat or mouse P2X7 nor native P2X7 in rat astrocyte cultures or in mouse bone marrow-derived macrophages were inhibited by perazines with a similar potency. We conclude that perazine-type neuroleptics are potent, but species-selective allosteric modulators of human but not murine P2X7 receptors.

  3. Photo-switchable tweezers illuminate pore-opening motions of an ATP-gated P2X ion channel

    PubMed Central

    Habermacher, Chloé; Martz, Adeline; Calimet, Nicolas; Lemoine, Damien; Peverini, Laurie; Specht, Alexandre; Cecchini, Marco; Grutter, Thomas


    P2X receptors function by opening a transmembrane pore in response to extracellular ATP. Recent crystal structures solved in apo and ATP-bound states revealed molecular motions of the extracellular domain following agonist binding. However, the mechanism of pore opening still remains controversial. Here we use photo-switchable cross-linkers as ‘molecular tweezers’ to monitor a series of inter-residue distances in the transmembrane domain of the P2X2 receptor during activation. These experimentally based structural constraints combined with computational studies provide high-resolution models of the channel in the open and closed states. We show that the extent of the outer pore expansion is significantly reduced compared to the ATP-bound structure. Our data further reveal that the inner and outer ends of adjacent pore-lining helices come closer during opening, likely through a hinge-bending motion. These results provide new insight into the gating mechanism of P2X receptors and establish a versatile strategy applicable to other membrane proteins. DOI: PMID:26808983

  4. Photo-switchable tweezers illuminate pore-opening motions of an ATP-gated P2X ion channel.


    Habermacher, Chloé; Martz, Adeline; Calimet, Nicolas; Lemoine, Damien; Peverini, Laurie; Specht, Alexandre; Cecchini, Marco; Grutter, Thomas


    P2X receptors function by opening a transmembrane pore in response to extracellular ATP. Recent crystal structures solved in apo and ATP-bound states revealed molecular motions of the extracellular domain following agonist binding. However, the mechanism of pore opening still remains controversial. Here we use photo-switchable cross-linkers as 'molecular tweezers' to monitor a series of inter-residue distances in the transmembrane domain of the P2X2 receptor during activation. These experimentally based structural constraints combined with computational studies provide high-resolution models of the channel in the open and closed states. We show that the extent of the outer pore expansion is significantly reduced compared to the ATP-bound structure. Our data further reveal that the inner and outer ends of adjacent pore-lining helices come closer during opening, likely through a hinge-bending motion. These results provide new insight into the gating mechanism of P2X receptors and establish a versatile strategy applicable to other membrane proteins.

  5. BIN1 Membrane Curvature Sensing and Generation Show Autoinhibition Regulated by Downstream Ligands and PI(4,5)P2

    PubMed Central


    In striated muscles, invaginations from the plasma membrane, termed transverse tubules (T-tubule), function in the excitation–contraction coupling machinery. BIN1 (isoform8) plays a critical role in the biogenesis of T-tubules. BIN1 contains an N-terminal BAR domain to sense and induce membrane curvature, an isoform8-specific polybasic motif (exon10) as the phosphoinositide binding module and a C-terminal Src homology 3 (SH3) domain for the recruitment of downstream proteins such as dynamin 2. Previous studies of N-BAR domains focused on elucidating mechanisms of membrane curvature sensing and generation (MC-S&G). Less is known about how MC-S&G is regulated. We found that the SH3 domain binds to the exon10 motif more strongly compared to the proline-rich domain (PRD) of dynamin 2. Furthermore, we found that the MC-S&G ability of full-length BIN1 is inhibited on membranes lacking PI(4,5)P2. Addition of PI(4,5)P2 in the membrane activates BIN1 to sense and induce membrane curvature. Co-presence of the SH3 domain and exon10 motif leads to the strongest phosphoinositide-mediated control of BIN1 function. Addition of SH3 domain ligand (such as PRD peptides), as well as addition of the water-soluble PI(4,5)P2 analogue, can both enhance the MC-S&G ability of BIN1 on membranes without PI(4,5)P2, indicating that the key to activate BIN1 is to disrupt the exon10–SH3 interaction. The nonsense mutation K436X, found in centronuclear myopathy (CNM) patients, abolishes SH3 domain binding with either exon10 or the PRD motif, resulting in increased membrane deformation capacity. Our results suggest an autoinhibition model for BIN1 that involves a synergistic regulation by membrane composition and protein–protein interactions. PMID:25350771

  6. Purinergic P2Y2 Receptor Control of Tissue Factor Transcription in Human Coronary Artery Endothelial Cells: NEW AP-1 TRANSCRIPTION FACTOR SITE AND NEGATIVE REGULATOR.


    Liu, Yiwei; Zhang, Lingxin; Wang, Chuan; Roy, Shama; Shen, Jianzhong


    We recently reported that the P2Y2 receptor (P2Y2R) is the predominant nucleotide receptor expressed in human coronary artery endothelial cells (HCAEC) and that P2Y2R activation by ATP or UTP induces dramatic up-regulation of tissue factor (TF), a key initiator of the coagulation cascade. However, the molecular mechanism of this P2Y2R-TF axis remains unclear. Here, we report the role of a newly identified AP-1 consensus sequence in the TF gene promoter and its original binding components in P2Y2R regulation of TF transcription. Using bioinformatics tools, we found that a novel AP-1 site at -1363 bp of the human TF promoter region is highly conserved across multiple species. Activation of P2Y2R increased TF promoter activity and mRNA expression in HCAEC. Truncation, deletion, and mutation of this distal AP-1 site all significantly suppressed TF promoter activity in response to P2Y2R activation. EMSA and ChIP assays further confirmed that upon P2Y2R activation, c-Jun, ATF-2, and Fra-1, but not the typical c-Fos, bound to the new AP-1 site. In addition, loss-of-function studies using siRNAs confirmed a positive transactivation role of c-Jun and ATF-2 but unexpectedly revealed a strong negative role of Fra-1 in P2Y2R-induced TF up-regulation. Furthermore, we found that P2Y2R activation promoted ERK1/2 phosphorylation through Src, leading to Fra-1 activation, whereas Rho/JNK mediated P2Y2R-induced activation of c-Jun and ATF-2. These findings reveal the molecular basis for P2Y G protein-coupled receptor control of endothelial TF expression and indicate that targeting the P2Y2R-Fra-1-TF pathway may be an attractive new strategy for controlling vascular inflammation and thrombogenicity associated with endothelial dysfunction.

  7. Ionotropic P2X ATP Receptor Channels Mediate Purinergic Signaling in Mouse Odontoblasts

    PubMed Central

    Shiozaki, Yuta; Sato, Masaki; Kimura, Maki; Sato, Toru; Tazaki, Masakazu; Shibukawa, Yoshiyuki


    ATP modulates various functions in the dental pulp cells, such as intercellular communication and neurotransmission between odontoblasts and neurons, proliferation of dental pulp cells, and odontoblast differentiation. However, functional expression patterns and their biophysical properties of ionotropic ATP (P2X) receptors (P2X1–P2X7) in odontoblasts were still unclear. We examined these properties of P2X receptors in mouse odontoblasts by patch-clamp recordings. K+-ATP, nonselective P2X receptor agonist, induced inward currents in odontoblasts in a concentration-dependent manner. K+-ATP-induced currents were inhibited by P2X4 and P2X7 selective inhibitors (5-BDBD and KN62, respectively), while P2X1 and P2X3 inhibitors had no effects. P2X7 selective agonist (BzATP) induced inward currents dose-dependently. We could not observe P2X1, 2/3, 3 selective agonist (αβ-MeATP) induced currents. Amplitudes of K+-ATP-induced current were increased in solution without extracellular Ca2+, but decreased in Na+-free extracellular solution. In the absence of both of extracellular Na+ and Ca2+, K+-ATP-induced currents were completely abolished. K+-ATP-induced Na+ currents were inhibited by P2X7 inhibitor, while the Ca2+ currents were sensitive to P2X4 inhibitor. These results indicated that odontoblasts functionally expressed P2X4 and P2X7 receptors, which might play an important role in detecting extracellular ATP following local dental pulp injury. PMID:28163685

  8. Expression, assembly and function of novel C-terminal truncated variants of the mouse P2X7 receptor: re-evaluation of P2X7 knockouts

    PubMed Central

    Masin, Marianela; Young, Christopher; Lim, KoiNi; Barnes, Sara J; Xu, Xing Jian; Marschall, Viola; Brutkowski, Wojciech; Mooney, Elizabeth R; Gorecki, Dariusz C; Murrell-Lagnado, Ruth


    BACKGROUND AND PURPOSE Splice variants of P2X7 receptor transcripts contribute to the diversity of receptor-mediated responses. Here, we investigated expression and function of C-terminal truncated (ΔC) variants of the mP2X7 receptor, which are predicted to escape inactivation in one strain of P2X7−/− mice (Pfizer KO). EXPERIMENTAL APPROACH Expression in wild-type (WT) and Pfizer KO tissue was investigated by reverse transcription (RT)-PCR and Western blot analysis. ΔC variants were also cloned and expressed in HEK293 cells to investigate their assembly, trafficking and function. KEY RESULTS RT-PCR indicates expression of a ΔC splice variant in brain, salivary gland (SG) and spleen from WT and Pfizer KO mice. An additional ΔC hybrid transcript, containing sequences of P2X7 upstream of exon 12, part of exon 13 followed in-frame by the sequence of the vector used to disrupt the P2X7 gene, was also identified in the KO mice. By blue native (BN) PAGE analysis and the use of cross linking reagents followed by SDS-PAGE, P2X7 trimers, dimers and monomers were detected in the spleen and SG of Pfizer KO mice. The molecular mass was reduced compared with P2X7 in WT mice tissue, consistent with a ΔC variant. When expressed in HEK293 cells the ΔC variants were inefficiently trafficked to the cell surface and agonist-evoked whole cell currents were small. Co-expressed with P2X7A, the ΔC splice variant acted in a dominant negative fashion to inhibit function. CONCLUSIONS AND IMPLICATIONS Pfizer KO mice are not null for P2X7 receptor expression but express ΔC variants with reduced function. PMID:21838754

  9. Polymorphism of NaVO2F2: a P2₁/c superstructure with pseudosymmetry of P2₁/m in the subcell.


    Yu, Zi-Qun; Wang, Jing-Quan; Huang, Ya-Xi; Botis, Sanda M; Pan, Yuanming; Mi, Jin-Xiao


    The ADDSYM routine in the program PLATON [Spek (2015). Acta Cryst. C71, 9-18] has helped researchers to avoid structures of (metal-)organic compounds being reported in an unnecessarily low symmetry space group. However, determination of the correct space group may get more complicated in cases of pseudosymmetric inorganic compounds. One example is NaVO2F2, which was reported [Crosnier-Lopez et al. (1994). Eur. J. Solid State Inorg. Chem. 31, 957-965] in the acentric space group P2₁ based on properties but flagged by ADDSYM as (pseudo)centrosymmetric P2₁/m within default distance tolerances. Herein a systematic investigation reveals that NaVO2F2 exists in at least four polymorphs: P2₁, (I), P2₁/m, (II), P2₁/c, (III), and one or more low-temperature ones. The new centrosymmetric modification, (III), with the space group P2₁/c has a similar atomic packing geometry to phase (I), except for having a doubled c axis. The double-cell of phase (III) arises from atomic shifts from the glide plane c at (x, ¼, z). With increasing temperature, the number of observed reflections decreases. The odd l reflections gradually become weaker and, correspondingly, all atoms shift towards the glide plane, resulting in a gradual second-order transformation of (III) into high-temperature phase (II) (P2₁/m) at below 493 K. At least one first-order enantiotropic phase transition was observed below 139 K from both the single-crystal X-ray diffraction and the differential scanning calorimetry analyses. Periodic first-principles calculations within density functional theory show that both P2₁/c superstructure (III) and P2₁ substructure (I) are more stable than P2₁/m structure (II), and that P2₁/c superstructure (III) is more stable that P2₁ substructure (I).

  10. P2RX7: A receptor with a split personality in inflammation and cancer.


    Di Virgilio, Francesco


    P2X7 (also known as P2RX7) is a plasma membrane receptor for extracellular ATP that is expressed at a high level by immune and tumor cells. Previous data showed that increased P2rx7 expression by tumor cells accelerates tumor progression. We have now looked at the other side of the relationship by investigating the effect of a lack of host P2rx7 expression on tumor growth. Our novel observations highlight a surprising role of host P2rx7 in restraining tumor progression.

  11. Molecular and functional characterization of human P2X(2) receptors.


    Lynch, K J; Touma, E; Niforatos, W; Kage, K L; Burgard, E C; van Biesen, T; Kowaluk, E A; Jarvis, M F


    P2X receptors are a family of ATP-gated ion channels. Four cDNAs with a high degree of homology to the rat P2X(2) receptor were isolated from human pituitary and pancreas RNA. Genomic sequence indicated that these cDNAs represent alternatively spliced messages. Northern analysis revealed high levels of human P2X(2) (hP2X(2)) message in the pancreas, and splice variants could be detected in a variety of tissues. Two cDNAs encoded functional ion channels when expressed in Xenopus oocytes, a receptor structurally homologous to the prototype rat P2X(2) receptor (called hP2X(2a)) and a variant containing a deletion within its cytoplasmic C terminus (called hP2X(2b)). Pharmacologically, these functional human P2X(2) receptors were virtually indistinguishable, with the P2X receptor agonists ATP, 2-methylthio-ATP, 2' and 3'-O-(4-benzoylbenzoyl)-ATP, and ATP5'-O-(3-thiotriphosphate) being approximately equipotent (EC(50) = 1 microM) in eliciting extracellular Ca(2+) influx. The P2 receptor agonists alpha,beta-methylene ATP, adenosine, adenosine 5'-O-(2-thiodiphosphate), and UTP were inactive at concentrations up to 100 microM. Both hP2X(2a) and hP2X(2b) receptors were sensitive to the P2 receptor antagonist pyridoxal-5-phosphate-6-azophenyl-2', 4'-disulfonic acid (IC(50) = 3 microM). In contrast to the analogous rat P2X(2) and P2X(2b) receptors, the desensitization rates of the hP2X(2a) and hP2X(2b) receptors were equivalent. Both functional forms of the human P2X(2) receptors formed heteromeric channels with the human P2X(3) receptor. These data demonstrate that the gene structure and mRNA heterogeneity of the P2X(2) receptor subtype are evolutionarily conserved between rat and human, but also suggest that alternative splicing serves a function other than regulating the desensitization rate of the human receptor.

  12. Pharmacological identification of P2X1, P2X4 and P2X7 nucleotide receptors in the smooth muscles of human umbilical cord and chorionic blood vessels.


    Valdecantos, P; Briones, R; Moya, P; Germain, A; Huidobro-Toro, J P


    To ascertain the role of extracellular adenosine 5'-triphosphate (ATP) receptors in human placenta circulation, we identified and pharmacologically characterized the P2X receptor population in its superficial vessels. Total RNA was extracted from segments of chorionic and umbilical arteries and veins of terminal placentae delivered by vaginal or Caesarian births. Polymerase chain reaction (PCR), followed by sequencing of the products, identified the presence of P2X 1, 4, 5, 6, and 7mRNAs in smooth muscle from chorionic and umbilical arteries and veins. Umbilical vessels proximal to the fetus expressed the same population of P2X subtypes, except for the P2X(5), but additionally expressed the P2X(2). Rings of chorionic vessels contracted upon addition of nucleotides and analogs with the following relative rank order of potencies in arteries and veins: alpha,beta-methyleneATP>beta,gamma-methyleneATP>PNP>ATP=diBzATP>2-MeSATP>ADP>AMP; in umbilical vessels alpha,beta-methyleneATP was at least 100-fold more potent than ATP. Nucleotide potency was less than that of PGF(2alpha) or endothelin-2, but had the same magnitude as serotonin. ATP-desensitized receptors evidenced cross desensitization to alpha,beta-methyleneATP, 2-MeSATP and diBzATP, effect not observed when desensitization was elicited by alpha,beta-methyleneATP, confirming the presence of various P2X receptor subtypes in the smooth muscles of these vessels. The vasocontractile efficacy of alpha,beta-methyleneATP was unaltered by endothelium removal, while that of ATP was significantly attenuated and those elicited by 2-MeSATP were blunted, indicating the presence of additional endothelial nucleotide receptors. These results suggest that P2X receptors participate in the humoral regulation of placental blood flow.

  13. A Novel P2P traffic Prediction Algorithm Based on Hybrid Model

    NASA Astrophysics Data System (ADS)

    Zhi-jie, Han; Ru-chuan, Wang; Xiao-yang, Duan

    The increasing P2P network traffic on the Internet has leaded to the problem of network congestion. In the consequence of the diversification of the P2P traffic and protocol, research on the management of P2P traffic has had many problems needed to resolve. P2P traffic Prediction is kernel problem in the P2P traffic management. Based on the P2P traffic characters, this thesis present a P2P traffic model, gived a traffic prediction algorithm bases on wavelet-analysis, and proved the accuracy of the algorithm. Simulation has experiment figures that the algorithm a high prediction precision and superior real-time performance.

  14. Molecular Structure of P2Y Receptors: Mutagenesis, Modeling, and Chemical Probes

    PubMed Central

    Jayasekara, M.P. Suresh; Costanzi, Stefano


    There are eight subtypes of P2Y receptors (P2YRs) that are activated, and in some cases inhibited, by a range of extracellular nucleotides. These nucleotides are ubiquitous, but their extracellular concentration can rise dramatically in response to hypoxia, ischemia, or mechanical stress, injury, and release through channels and from vesicles. Two subclasses of P2YRs were defined based on clustering of sequences, second messengers, and receptor sequence analysis. The numbering system for P2YR subtypes is discontinuous; i.e., P2Y1–14Rs have been defined, but six of the intermediate-numbered cloned receptor sequences (e.g., P2y3, P2y5, P2y7–10) are not functional mammalian nucleotide receptors. Of these two clusters, the P2Y12–14 subtypes couple via Gαi to inhibit adenylate cyclase, while the remaining subtypes couple through Gαq to activate phospholipase C. Collectively, the P2YRs respond to both purine and pyrimidine nucleotides, in the form of 5′-mono- and dinucleotides and nucleoside-5′-diphosphosugars. In recent years, the medicinal chemistry of P2Y receptors has advanced significantly, to provide selective agonists and antagonists for many but not all of the subtypes. Ligand design has been aided by insights from structural probing using molecular modelling and mutagenesis. Currently, the molecular modelling of the receptors is effectively based on the X-ray structure of the CXCR4 receptor, which is the closest to the P2Y receptors among all the currently crystallized receptors in terms of sequence similarity. It is now a challenge to develop novel and selective P2YR ligands for disease treatment (although antagonists of the P2Y12R are already widely used as antithrombotics). PMID:23336097

  15. Osmoregulatory inositol transporter SMIT1 modulates electrical activity by adjusting PI(4,5)P2 levels

    PubMed Central

    Dai, Gucan; Yu, Haijie; Traynor-Kaplan, Alexis


    Myo-inositol is an important cellular osmolyte in autoregulation of cell volume and fluid balance, particularly for mammalian brain and kidney cells. We find it also regulates excitability. Myo-inositol is the precursor of phosphoinositides, key signaling lipids including phosphatidylinositol 4,5-bisphosphate [PI(4,5)P2]. However, whether myo-inositol accumulation during osmoregulation affects signaling and excitability has not been fully explored. We found that overexpression of the Na+/myo-inositol cotransporter (SMIT1) and myo-inositol supplementation enlarged intracellular PI(4,5)P2 pools, modulated several PI(4,5)P2-dependent ion channels including KCNQ2/3 channels, and attenuated the action potential firing of superior cervical ganglion neurons. Further experiments using the rapamycin-recruitable phosphatase Sac1 to hydrolyze PI(4)P and the P4M probe to visualize PI(4)P suggested that PI(4)P levels increased after myo-inositol supplementation with SMIT1 expression. Elevated relative levels of PIP and PIP2 were directly confirmed using mass spectrometry. Inositol trisphosphate production and release of calcium from intracellular stores also were augmented after myo-inositol supplementation. Finally, we found that treatment with a hypertonic solution mimicked the effect we observed with SMIT1 overexpression, whereas silencing tonicity-responsive enhancer binding protein prevented these effects. These results show that ion channel function and cellular excitability are under regulation by several “physiological” manipulations that alter the PI(4,5)P2 setpoint. We demonstrate a previously unrecognized linkage between extracellular osmotic changes and the electrical properties of excitable cells. PMID:27217553

  16. P2X receptors in the cardiovascular system and their potential as therapeutic targets in disease.


    Ralevic, Vera


    This review considers the expression and roles of P2X receptors in the cardiovascular system in health and disease and their potential as therapeutic targets. P2X receptors are ligand gated ion channels which are activated by the endogenous ligand ATP. They are formed from the assembly of three P2X subunit proteins from the complement of seven (P2X1-7), which can associate to form homomeric or heteromeric P2X receptors. The P2X1 receptor is widely expressed in the cardiovascular system, being located in the heart, in the smooth muscle of the majority of blood vessels and in platelets. P2X1 receptors expressed in blood vessels can be activated by ATP coreleased with noradrenaline as a sympathetic neurotransmitter, leading to smooth muscle depolarisation and contraction. There is evidence that the purinergic component of sympathetic neurotransmission is increased in hypertension, identifying P2X1 receptors as a possible therapeutic target in this disorder. P2X3 and P2X2/3 receptors are expressed on cardiac sympathetic neurones and may, through positive feedback of neuronal ATP at this prejunctional site, amplify sympathetic neurotransmission. Activation of P2X receptors expressed in the heart increases cardiac myocyte contractility, and an important role of the P2X4 receptor in this has been identified. Deletion of P2X4 receptors in the heart depresses contractile performance in models of heart failure, while overexpression of P2X4 receptors has been shown to be cardioprotective, thus P2X4 receptors may be therapeutic targets in the treatment of heart disease. P2X receptors have been identified on endothelial cells. Although immunoreactivity for all P2X1-7 receptor proteins has been shown on the endothelium, relatively little is known about their function, with the exception of the endothelial P2X4 receptor, which has been shown to mediate endothelium-dependent vasodilatation to ATP released during shear stress. The potential of P2X receptors as therapeutic targets

  17. Increase of intracellular Ca2+ by P2Y but not P2X receptors in cultured cortical multipolar neurons of the rat.


    Fischer, Wolfgang; Nörenberg, Wolfgang; Franke, Heike; Schaefer, Michael; Illes, Peter


    The expression and functionality of P2X/P2Y receptor subtypes in multipolar nonpyramidal neurons of mixed cortical cell cultures were investigated by means of immunocytochemistry and fura-2 microfluorimetry. The morphological studies revealed that most of the neurons are immunoreactive for GABA and express a range of P2X/P2Y receptors, predominantly of the P2X(2,4,6) and P2Y(1,2) subtypes. P2X(1) and P2X(7) receptor immunoreactivity (IR) was found on thin axon-like processes and presynaptic structures, respectively. Application of ATP caused a small concentration-dependent increase in intracellular Ca2+ concentration ([Ca2+]i) in most investigated neurons, whereas only about the half of these cells responded to 2',3'-O-(benzoyl-4-benzoyl)-ATP (BzATP), ADPbetaS, 2MeSADP, or 2MeSATP and even fewer cells to UTP. In contrast, alpha,beta-meATP, UDP, and UDP-glucose failed to produce any [Ca2+]i signaling. The response to ATP itself was inhibited by pyridoxal-5'-phosphate-6-azophenyl-2',4'-disulfonic acid (PPADS), Reactive Blue 2, 2'-deoxy-N(6)-methyl adenosine 3',5'-diphosphate (MRS2179), and suramin (300 microM) as well as by a cyclopiazonic acid-induced depletion of intracellular Ca2+ stores. A Ca2+-free external medium tended to decrease the ATP-induced [Ca2+]i transients, although this action did not reach statistical significance. Various blockers of voltage-sensitive Ca2+ channels and the gap junction inhibitor carbenoxolone did not interfere with the effect of ATP, whereas a combination of the ionotropic glutamate receptor antagonists D(-)-2-amino-5-phosphonopentanoic acid (AP5) and 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX) decreased it. Cross-desensitization experiments between ADPbetaS or UTP and ATP suggested that ATP acts on the one hand via P2Y(1,2) receptors and on the other hand by additional signaling mechanisms. These mechanisms may involve the release of glutamate (which in consequence activates ionotropic glutamate receptors) and the entry of Ca2

  18. The influence of variation in the P2Y12 receptor gene on in vitro platelet inhibition with the direct P2Y12 antagonist cangrelor.


    Bouman, H J; van Werkum, J W; Rudez, G; Leebeek, F W G; Kruit, A; Hackeng, C M; Ten Berg, J M; de Maat, M P M; Ruven, H J T


    Novel P2Y12 inhibitors are in development to overcome the occurrence of atherothrombotic events associated with poor responsiveness to the widely used P2Y12 inhibitor clopidogrel. Cangrelor is an intravenously administered P2Y12 inhibitor that does not need metabolic conversion to an active metabolite for its antiplatelet action, and as a consequence exhibits a more potent and consistent antiplatelet profile as compared to clopidogrel. It was the objective of this study to determine the contribution of variation in the P2Y12 receptor gene to platelet aggregation after in vitro partial P2Y12 receptor blockade with the direct antagonist cangrelor. Optical aggregometry was performed at baseline and after in vitro addition of 0.05 and 0.25 microM cangrelor to the platelet-rich plasma of 254 healthy subjects. Five haplotype-tagging (ht)-SNPs covering the entire P2Y12 receptor gene were genotyped (rs6798347C>t, rs6787801T>c, rs9859552C>a, rs6801273A>g and rs2046934T>c [T744C]) and haplotypes were inferred. The minor c allele of SNP rs6787801 was associated with a 5% lower 20 microM ADP-induced peak platelet aggregation (0.05 microM cangrelor, p<0.05). Aa homozygotes for SNP rs9859552 showed 20% and 17% less inhibition of platelet aggregation with cangrelor when compared to CC homozygotes (0.05 and 0.25 microM cangrelor respectively; p<0.05). Results of the haplotype analyses were consistent with those of the single SNPs. Polymorphisms of the P2Y12 receptor gene contribute significantly to the interindividual variability in platelet inhibition after partial in vitro blockade with the P2Y12 antagonist cangrelor.

  19. Residual Chemoresponsiveness to Acids in the Superior Laryngeal Nerve in “Taste-Blind” (P2X2/P2X3 Double-KO) Mice

    PubMed Central

    Ohkuri, Tadahiro; Horio, Nao; Stratford, Jennifer M.; Finger, Thomas E.; Ninomiya, Yuzo


    Mice lacking both the P2X2 and the P2X3 purinergic receptors (P2X-dblKO) exhibit loss of responses to all taste qualities in the taste nerves innervating the tongue. Similarly, these mice exhibit a near total loss of taste-related behaviors in brief access tests except for a near-normal avoidance of acidic stimuli. This persistent avoidance of acids despite the loss of gustatory neural responses to sour was postulated to be due to continued responsiveness of the superior laryngeal (SL) nerve. However, chemoresponses of the larynx are attributable both to taste buds and to free nerve endings. In order to test whether the SL nerve of P2X-dblKO mice remains responsive to acids but not to other tastants, we recorded responses from the SL nerve in wild-type (WT) and P2X-dblKO mice. WT mice showed substantial SL responses to monosodium glutamate, sucrose, urea, and denatonium—all of which were essentially absent in P2X-dblKO animals. In contrast, the SL nerve of P2X-dblKO mice exhibited near-normal responses to citric acid (50 mM) although responsiveness of both the chorda tympani and the glossopharyngeal nerves to this stimulus were absent or greatly reduced. These results are consistent with the hypothesis that the residual avoidance of acidic solutions by P2X-dblKO mice may be attributable to the direct chemosensitivity of nerve fibers innervating the laryngeal epithelium and not to taste. PMID:22362867

  20. Contribution of CD14 and TLR4 to changes of the PI(4,5)P2 level in LPS-stimulated cells.


    Płóciennikowska, Agnieszka; Hromada-Judycka, Aneta; Dembińska, Justyna; Roszczenko, Paula; Ciesielska, Anna; Kwiatkowska, Katarzyna


    LPS binds sequentially to CD14 and TLR4/MD2 receptor triggering production of proinflammatory mediators. The LPS-induced signaling is controlled by a plasma membrane lipid PI(4,5)P2 and its derivatives. Here, we show that stimulation of murine peritoneal macrophages with LPS induces biphasic accumulation of PI(4,5)P2 with peaks at 10 and 60-90 min that were still seen after silencing of TLR4 expression. In contrast, the PI(4,5)P2 elevation was abrogated when CD14 was removed from the cell surface. To assess the contribution of CD14 and TLR4 to the LPS-induced PI(4,5)P2 changes, we used HEK293 transfectants expressing various amounts of CD14 and TLR4. In cells with a low content of CD14 and high of TLR4, no accumulation of PI(4,5)P2 occurred. With an increasing amount of CD14 and concomitant decrease of TLR4, 2 peaks of PI(4,5)P2 accumulation appeared, eventually approaching those found in LPS-stimulated cells expressing CD14 alone. Mutation of the signaling domain of TLR4 let us conclude that the receptor activity can modulate PI(4,5)P2 accumulation in cells when expressed in high amounts compared with CD14. Among the factors limiting PI(4,5)P2 accumulation are its hydrolysis, phosphorylation, and availability of its precursor, PI(4)P. Inhibition of PLC and PI3K or overexpression of PI4K IIα that produces PI(4)P promoted PI(4,5)P2 elevation in LPS-stimulated cells. The elevation of PI(4,5)P2 was dispensable for TLR4 signaling yet enhanced its magnitude. Taken together, these data suggest that LPS-induced accumulation of PI(4,5)P2 that maximizes TLR4 signaling is controlled by CD14, whereas TLR4 can fine tune the process by affecting the PI(4,5)P2 turnover.

  1. Macrophage activation and polarization modify P2X7 receptor secretome influencing the inflammatory process

    PubMed Central

    de Torre-Minguela, Carlos; Barberà-Cremades, Maria; Gómez, Ana I.; Martín-Sánchez, Fátima; Pelegrín, Pablo


    The activation of P2X7 receptor (P2X7R) on M1 polarized macrophages induces the assembly of the NLRP3 inflammasome leading to the release of pro-inflammatory cytokines and the establishment of the inflammatory response. However, P2X7R signaling to the NLRP3 inflammasome is uncoupled on M2 macrophages without changes on receptor activation. In this study, we analyzed P2X7R secretome in wild-type and P2X7R-deficient macrophages polarized either to M1 or M2 and proved that proteins released after P2X7R stimulation goes beyond caspase-1 secretome. The characterization of P2X7R-secretome reveals a new function of this receptor through a fine-tuning of protein release. We found that P2X7R stimulation in macrophages is able to release potent anti-inflammatory proteins, such as Annexin A1, independently of their polarization state suggesting for first time a potential role for P2X7R during resolution of the inflammation and not linked to the release of pro-inflammatory cytokines. These results are of prime importance for the development of therapeutics targeting P2X7R. PMID:26935289

  2. Accelerated tumor progression in mice lacking the ATP receptor P2X7.


    Adinolfi, Elena; Capece, Marina; Franceschini, Alessia; Falzoni, Simonetta; Giuliani, Anna L; Rotondo, Alessandra; Sarti, Alba C; Bonora, Massimo; Syberg, Susanne; Corigliano, Domenica; Pinton, Paolo; Jorgensen, Niklas R; Abelli, Luigi; Emionite, Laura; Raffaghello, Lizzia; Pistoia, Vito; Di Virgilio, Francesco


    The ATP receptor P2X7 (P2X7R or P2RX7) has a key role in inflammation and immunity, but its possible roles in cancer are not firmly established. In the present study, we investigated the effect of host genetic deletion of P2X7R in the mouse on the growth of B16 melanoma or CT26 colon carcinoma cells. Tumor size and metastatic dissemination were assessed by in vivo calliper and luciferase luminescence emission measurements along with postmortem examination. In P2X7R-deficient mice, tumor growth and metastatic spreading were accelerated strongly, compared with wild-type (wt) mice. Intratumoral IL-1β and VEGF release were drastically reduced, and inflammatory cell infiltration was abrogated nearly completely. Similarly, tumor growth was also greatly accelerated in wt chimeric mice implanted with P2X7R-deficient bone marrow cells, defining hematopoietic cells as a sufficient site of P2X7R action. Finally, dendritic cells from P2X7R-deficient mice were unresponsive to stimulation with tumor cells, and chemotaxis of P2X7R-less cells was impaired. Overall, our results showed that host P2X7R expression was critical to support an antitumor immune response, and to restrict tumor growth and metastatic diffusion.

  3. Immunolocalization of the P2X4 receptor on neurons and glia in the mammalian retina.


    Ho, T; Vessey, K A; Fletcher, E L


    Extracellular adenosine 5'-triphosphate (eATP) acts as a neurotransmitter within the retina and brain, activating a range of ionotropic P2X and metabotropic P2Y receptors. In this study, the specific localization of the P2X4 receptor (P2X4-R) subunit was evaluated in the retina using fluorescence immunohistochemistry and pre-embedding immuno-electron microscopy. Punctate P2X4-R labeling was largely localized to the inner and outer plexiform layers of mouse, rat and cat retinae. In the mouse outer retina, double-labeling of P2X4-R with the horizontal cell marker, calbindin, revealed P2X4-R immunoreactivity (P2X4-R-IR) on horizontal cell somata and processes. In the inner retina, P2X4-R expression was found closely associated with rod and cone bipolar cell terminals, and the punctate labeling was observed on calretinin-positive amacrine cells. Using immuno-electron microscopy, P2X4-Rs were observed on processes post-synaptic to photoreceptor and bipolar cell terminals, likely representing horizontal, amacrine and ganglion cells, respectively. Furthermore, P2X4-R expression was also observed on Müller cells, astrocytes and microglia. These data suggest a role for P2X4-Rs in the lateral inhibitory pathways of the retina, modulating neuronal function of photoreceptors and bipolar cells. The expression on macro- and microglial cells implicates a role for P2X4-Rs in glial signaling, tissue homeostasis and immunosurveillance within the mammalian retina.

  4. Involvement of the P2X7-NLRP3 axis in leukemic cell proliferation and death

    PubMed Central

    Salaro, Erica; Rambaldi, Alessia; Falzoni, Simonetta; Amoroso, Francesca Saveria; Franceschini, Alessia; Sarti, Alba Clara; Bonora, Massimo; Cavazzini, Francesco; Rigolin, Gian Matteo; Ciccone, Maria; Audrito, Valentina; Deaglio, Silvia; Pelegrin, Pablo; Pinton, Paolo; Cuneo, Antonio; Di Virgilio, Francesco


    Lymphocyte growth and differentiation are modulated by extracellular nucleotides and P2 receptors. We previously showed that the P2X7 receptor (P2X7R or P2RX7) is overexpressed in circulating lymphocytes from chronic lymphocytic leukemia (CLL) patients. In the present study we investigated the P2X7R/NLRP3 inflammasome axis in lymphocytes from a cohort of 23 CLL patients. P2X7R, ASC and NLRP3 were investigated by Western blot, PCR and transfection techniques. P2X7R was overexpressed and correlated with chromosome 12 trisomy in CLL patients. ASC mRNA and protein were also overexpressed. On the contrary, NLRP3 was dramatically down-modulated in CLL lymphocytes relative to lymphocytes from healthy donors. To further investigate the correlation between P2X7R, NLRP3 and cell growth, NLRP3 was silenced in THP-1 cells, a leukemic cell line that natively expresses both NLRP3 and P2X7R. NLRP3 silencing enhanced P2X7R expression and promoted growth. On the contrary, NLRP3 overexpression caused accelerated apoptosis. The P2X7R was also up-modulated in hematopoietic cells from NLRP3-KO mice. In conclusion, we show that NLRP3 down-modulation stimulates P2X7R expression and promotes growth, while NLRP3 overexpression inhibits cell proliferation and stimulates apoptosis. These findings suggest that NLRP3 is a negative regulator of growth and point to a role of the P2X7R/NLRP3 axis in CLL. PMID:27221966

  5. Archaeal DnaG contains a conserved N-terminal RNA-binding domain and enables tailing of rRNA by the exosome.


    Hou, Linlin; Klug, Gabriele; Evguenieva-Hackenberg, Elena


    The archaeal exosome is a phosphorolytic 3'-5' exoribonuclease complex. In a reverse reaction it synthesizes A-rich RNA tails. Its RNA-binding cap comprises the eukaryotic orthologs Rrp4 and Csl4, and an archaea-specific subunit annotated as DnaG. In Sulfolobus solfataricus DnaG and Rrp4 but not Csl4 show preference for poly(rA). Archaeal DnaG contains N- and C-terminal domains (NTD and CTD) of unknown function flanking a TOPRIM domain. We found that the NT and TOPRIM domains have comparable, high conservation in all archaea, while the CTD conservation correlates with the presence of exosome. We show that the NTD is a novel RNA-binding domain with poly(rA)-preference cooperating with the TOPRIM domain in binding of RNA. Consistently, a fusion protein containing full-length Csl4 and NTD of DnaG led to enhanced degradation of A-rich RNA by the exosome. We also found that DnaG strongly binds native and in vitro transcribed rRNA and enables its polynucleotidylation by the exosome. Furthermore, rRNA-derived transcripts with heteropolymeric tails were degraded faster by the exosome than their non-tailed variants. Based on our data, we propose that archaeal DnaG is an RNA-binding protein, which, in the context of the exosome, is involved in targeting of stable RNA for degradation.

  6. PtdInsP2 and PtdSer cooperate to trap synaptotagmin-1 to the plasma membrane in the presence of calcium

    PubMed Central

    Pérez-Lara, Ángel; Thapa, Anusa; Nyenhuis, Sarah B; Nyenhuis, David A; Halder, Partho; Tietzel, Michael; Tittmann, Kai; Cafiso, David S; Jahn, Reinhard


    The Ca2+-sensor synaptotagmin-1 that triggers neuronal exocytosis binds to negatively charged membrane lipids (mainly phosphatidylserine (PtdSer) and phosphoinositides (PtdIns)) but the molecular details of this process are not fully understood. Using quantitative thermodynamic, kinetic and structural methods, we show that synaptotagmin-1 (from Rattus norvegicus and expressed in Escherichia coli) binds to PtdIns(4,5)P2 via a polybasic lysine patch in the C2B domain, which may promote the priming or docking of synaptic vesicles. Ca2+ neutralizes the negative charges of the Ca2+-binding sites, resulting in the penetration of synaptotagmin-1 into the membrane, via binding of PtdSer, and an increase in the affinity of the polybasic lysine patch to phosphatidylinositol-4,5-bisphosphate (PtdIns(4,5)P2). These Ca2+-induced events decrease the dissociation rate of synaptotagmin-1 membrane binding while the association rate remains unchanged. We conclude that both membrane penetration and the increased residence time of synaptotagmin-1 at the plasma membrane are crucial for triggering exocytotic membrane fusion. DOI: PMID:27791979

  7. Role of the extracellular loops of G protein-coupled receptors in ligand recognition: a molecular modeling study of the human P2Y1 receptor.


    Moro, S; Hoffmann, C; Jacobson, K A


    The P2Y1 receptor is a G protein-coupled receptor (GPCR) and is stimulated by extracellular ADP and ATP. Site-directed mutagenesis of the three extracellular loops (ELs) of the human P2Y1 receptor indicates the existence of two essential disulfide bridges (Cys124 in EL1 and Cys202 in EL2; Cys42 in the N-terminal segment and Cys296 in EL3) and several specific ionic and H-bonding interactions (involving Glu209 and Arg287). Through molecular modeling and molecular dynamics simulations, an energetically sound conformational hypothesis for the receptor has been calculated that includes transmembrane (TM) domains (using the electron density map of rhodopsin as a template), extracellular loops, and a truncated N-terminal region. ATP may be docked in the receptor, both within the previously defined TM cleft and within two other regions of the receptor, termed meta-binding sites, defined by the extracellular loops. The first meta-binding site is located outside of the TM bundle, between EL2 and EL3, and the second higher energy site is positioned immediately underneath EL2. Binding at both the principal TM binding site and the lower energy meta-binding sites potentially affects the observed ligand potency. In meta-binding site I, the side chain of Glu209 (EL2) is within hydrogen-bonding distance (2.8 A) of the ribose O3', and Arg287 (EL3) coordinates both alpha- and beta-phosphates of the triphosphate chain, consistent with the insensitivity in potency of the 5'-monophosphate agonist, HT-AMP, to mutation of Arg287 to Lys. Moreover, the selective reduction in potency of 3'NH2-ATP in activating the E209R mutant receptor is consistent with the hypothesis of direct contact between EL2 and nucleotide ligands. Our findings support ATP binding to at least two distinct domains of the P2Y1 receptor, both outside and within the TM core. The two disulfide bridges present in the human P2Y1 receptor play a major role in the structure and stability of the receptor, to constrain the

  8. Characterisation of P2X receptors expressed in rat pulmonary arteries.


    Syed, Nawazish-i-Husain; Tengah, Asrin; Paul, Andrew; Kennedy, Charles


    Previous studies indicated that a P2X receptor other than the P2X1 subtype might be present in rat large, but not small pulmonary arteries. The aim here was to characterise further these P2X receptors. Isometric tension was recorded from rat isolated small (i.d. 250-500 μm) and large pulmonary artery (i.d. 1-1.5 mm) rings mounted on a wire myograph. In both tissues the P2X receptor agonist α,β-meATP evoked rapidly-developing contractions that were inhibited by the P2X antagonists NF449, PPADS and suramin in a concentration-dependent manner and eventually abolished by each. The rank order of the potency in both tissues was NF449>PPADS=suramin. For each antagonist there was no significant difference between its potency in the small and large pulmonary arteries. Prolonged administration of a high concentration of α,β-meATP induced complete desensitisation in both tissues. RT-PCR followed by PCR with specific oligonucleotide primers, identified mRNA for all seven P2X subunits. Subtype-specific antibodies showed strong, punctate P2X1 receptor-like immunoreactivity in the majority of cells and faint, punctate staining with the anti-P2X2 and anti-P2X4 antibodies, whilst P2X5-like immunoreactivity was barely detectable and no P2X3, P2X6, and P2X7 receptor-like immunoreactivity was seen. No differences in P2X mRNA and protein expression were seen between small and large pulmonary arteries. In conclusion, the pharmacological properties and mRNA and protein expression profiles of P2X receptors in rat small and large pulmonary arteries are very similar. Thus P2X1 appears to be the predominant P2X subunit functionally expressed in smooth muscle cells of rat small and large pulmonary arteries.

  9. Role of P2 Receptors as Modulators of Rat Eosinophil Recruitment in Allergic Inflammation

    PubMed Central

    Alberto, Anael Viana Pinto; Faria, Robson Xavier; de Menezes, Joao Ricardo Lacerda; Surrage, Andrea; da Rocha, Natasha Cristina; Ferreira, Leonardo Gomes Braga; Frutuoso, Valber da Silva; Martins, Marco Aurélio; Alves, Luiz Anastácio


    ATP and other nucleotides are released from cells through regulated pathways or following the loss of plasma membrane integrity. Once outside the cell, these compounds can activate P2 receptors: P2X ionotropic receptors and G protein-coupled P2Y receptors. Eosinophils represent major effector cells in the allergic inflammatory response and they are, in fact, associated with several physiological and pathological processes. Here we investigate the expression of P2 receptors and roles of those receptors in murine eosinophils. In this context, our first step was to investigate the expression and functionality of the P2X receptors by patch clamping, our results showed a potency ranking order of ATP>ATPγS> 2meSATP> ADP> αβmeATP> βγmeATP>BzATP> UTP> UDP>cAMP. This data suggest the presence of P2X1, P2X2 and P2X7. Next we evaluate by microfluorimetry the expression of P2Y receptors, our results based in the ranking order of potency (UTP>ATPγS> ATP > UDP> ADP >2meSATP > αβmeATP) suggests the presence of P2Y2, P2Y4, P2Y6 and P2Y11. Moreover, we confirmed our findings by immunofluorescence assays. We also did chemotaxis assays to verify whether nucleotides could induce migration. After 1 or 2 hours of incubation, ATP increased migration of eosinophils, as well as ATPγS, a less hydrolysable analogue of ATP, while suramin a P2 blocker abolished migration. In keeping with this idea, we tested whether these receptors are implicated in the migration of eosinophils to an inflammation site in vivo, using a model of rat allergic pleurisy. In fact, migration of eosinophils has increased when ATP or ATPγS were applied in the pleural cavity, and once more suramin blocked this effect. We have demonstrated that rat eosinophils express P2X and P2Y receptors. In addition, the activation of P2 receptors can increase migration of eosinophils in vitro and in vivo, an effect blocked by suramin. PMID:26784445

  10. Role of P2 Receptors as Modulators of Rat Eosinophil Recruitment in Allergic Inflammation.


    Alberto, Anael Viana Pinto; Faria, Robson Xavier; de Menezes, Joao Ricardo Lacerda; Surrage, Andrea; da Rocha, Natasha Cristina; Ferreira, Leonardo Gomes Braga; Frutuoso, Valber da Silva; Martins, Marco Aurélio; Alves, Luiz Anastácio


    ATP and other nucleotides are released from cells through regulated pathways or following the loss of plasma membrane integrity. Once outside the cell, these compounds can activate P2 receptors: P2X ionotropic receptors and G protein-coupled P2Y receptors. Eosinophils represent major effector cells in the allergic inflammatory response and they are, in fact, associated with several physiological and pathological processes. Here we investigate the expression of P2 receptors and roles of those receptors in murine eosinophils. In this context, our first step was to investigate the expression and functionality of the P2X receptors by patch clamping, our results showed a potency ranking order of ATP>ATPγS> 2meSATP> ADP> αβmeATP> βγmeATP>BzATP> UTP> UDP>cAMP. This data suggest the presence of P2X1, P2X2 and P2X7. Next we evaluate by microfluorimetry the expression of P2Y receptors, our results based in the ranking order of potency (UTP>ATPγS> ATP > UDP> ADP >2meSATP > αβmeATP) suggests the presence of P2Y2, P2Y4, P2Y6 and P2Y11. Moreover, we confirmed our findings by immunofluorescence assays. We also did chemotaxis assays to verify whether nucleotides could induce migration. After 1 or 2 hours of incubation, ATP increased migration of eosinophils, as well as ATPγS, a less hydrolysable analogue of ATP, while suramin a P2 blocker abolished migration. In keeping with this idea, we tested whether these receptors are implicated in the migration of eosinophils to an inflammation site in vivo, using a model of rat allergic pleurisy. In fact, migration of eosinophils has increased when ATP or ATPγS were applied in the pleural cavity, and once more suramin blocked this effect. We have demonstrated that rat eosinophils express P2X and P2Y receptors. In addition, the activation of P2 receptors can increase migration of eosinophils in vitro and in vivo, an effect blocked by suramin.

  11. The saci_2123 gene of the hyperthermoacidophile Sulfolobus acidocaldarius encodes an ATP-binding cassette multidrug transporter.


    Yang, Nuan; Driessen, Arnold J M


    Multidrug resistance (MDR) transporters are capable of secreting structurally and functionally unrelated toxic compounds from the cell. Among this group are ATP-binding cassette (ABC) transporters. These membrane proteins are typically arranged as either hetero- or homo-dimers of ABC half-transporters with each subunit consisting of a membrane domain fused at the C-terminus to an ATP-binding domain, or as full transporters in which the two subunits are fused into a single polypeptide. The saci_2123 gene of the thermoacidophilic archaeon Sulfolobus acidocaldarius is the only gene in the genome that encodes an ATP-binding cassette half-transporter, while a homologous gene is present in the genomes of S. solfataricus, S. tokodaii and S islandicus. Saci_2123 shares homology with well-characterized bacterial and mammalian MDR transporters. The saci_2132 gene is up-regulated when cells are exposed to drugs. A deletion mutant of saci_2132 was found to be more vulnerable to a set of toxic compounds, including detergents, antibiotics and uncouplers as compared to the wild-type strain, while the drug resistance could be restored through the plasmid-based expression of saci_2132. These data demonstrate that Saci_2132 is an archaeal ABC-MDR transporter and therefore it was termed Smr1 (Sulfolobus multidrug resistance transporter 1).

  12. Synergistic inhibition of both P2Y1 and P2Y12 adenosine diphosphate receptors as novel approach to rapidly attenuate platelet-mediated thrombosis

    PubMed Central

    Gremmel, Thomas; Yanachkov, Ivan B.; Yanachkova, Milka I.; Wright, George E.; Wider, Joseph; Undyala, Vishnu V.R.; Michelson, Alan D.; Frelinger, Andrew L.; Przyklenk, Karin


    Objective Unlike currently approved adenosine diphosphate (ADP) receptor antagonists, the new diadenosine tetraphosphate derivative GLS-409 targets not only P2Y12 but also the second human platelet ADP receptor P2Y1, and may therefore be a promising antiplatelet drug candidate. The current study is the first to investigate the in vivo antithrombotic effects of GLS-409. Approach and Results We studied (1) the in vivo effects of GLS-409 on agonist-stimulated platelet aggregation in anesthetized rats, (2) the antithrombotic activity of GLS-409 and the associated effect on the bleeding time in a canine model of platelet-mediated coronary artery thrombosis, and (3) the inhibition of agonist-stimulated platelet aggregation by GLS-409 versus selective P2Y1 and P2Y12 inhibition in vitro in samples from healthy human subjects before and 2 hours after aspirin intake. In vivo treatment with GLS-409 significantly inhibited ADP- and collagen-stimulated platelet aggregation in rats. Further, GLS-409 attenuated cyclic flow variation, i.e., platelet-mediated thrombosis, in vivo in our canine model of unstable angina. The improvement in coronary patency was accompanied by a non-significant 30% increase in bleeding time. Of note, GLS-409 exerted its effects without affecting rat and canine hemodynamics. Finally, in vitro treatment with GLS-409 showed effects similar to that of cangrelor and the combination of cangrelor with the selective P2Y1 inhibitor MRS 2179 on agonist-stimulated platelet aggregation in human platelet-rich plasma and whole blood before and 2 hours after aspirin intake. Conclusions Synergistic inhibition of both P2Y1 and P2Y12 ADP receptors by GLS-409 immediately attenuates platelet-mediated thrombosis and effectively blocks agonist-stimulated platelet aggregation irrespective of concomitant aspirin therapy. PMID:26743169

  13. P2PQR-tree: a spatial index model for peer-to-peer environments

    NASA Astrophysics Data System (ADS)

    Chen, Chuanbo; Liu, Degang; Yi, Baolin


    It is necessary to build spatial index in order to managing complex spatial data in peer-to-peer (P2P) environments. This paper analysis and summarizes the related studies, designs a new spatial index model named P2PQR-tree which uses the distributed Quad-tree and the local R*-tree. P2PQR-tree applies Quad-tree techniques into P2P environments and uses replication strategy to improve the system's load balance. This paper includes gives the models definitions, the model's architecture design, the model's performance analysis results. P2PQR-tree has some advantages to the old methods, for example, its data management is more reasonable, it can support metadata management better, implement rights control easier, reduce changes of distributed index, and adapt to dynamic character of P2P network better.

  14. P2Y Receptors in Synaptic Transmission and Plasticity: Therapeutic Potential in Cognitive Dysfunction

    PubMed Central

    Guzman, Segundo J.; Gerevich, Zoltan


    ATP released from neurons and astrocytes during neuronal activity or under pathophysiological circumstances is able to influence information flow in neuronal circuits by activation of ionotropic P2X and metabotropic P2Y receptors and subsequent modulation of cellular excitability, synaptic strength, and plasticity. In the present paper we review cellular and network effects of P2Y receptors in the brain. We show that P2Y receptors inhibit the release of neurotransmitters, modulate voltage- and ligand-gated ion channels, and differentially influence the induction of synaptic plasticity in the prefrontal cortex, hippocampus, and cerebellum. The findings discussed here may explain how P2Y1 receptor activation during brain injury, hypoxia, inflammation, schizophrenia, or Alzheimer's disease leads to an impairment of cognitive processes. Hence, it is suggested that the blockade of P2Y1 receptors may have therapeutic potential against cognitive disturbances in these states. PMID:27069691

  15. P2Y Receptors in Synaptic Transmission and Plasticity: Therapeutic Potential in Cognitive Dysfunction.


    Guzman, Segundo J; Gerevich, Zoltan


    ATP released from neurons and astrocytes during neuronal activity or under pathophysiological circumstances is able to influence information flow in neuronal circuits by activation of ionotropic P2X and metabotropic P2Y receptors and subsequent modulation of cellular excitability, synaptic strength, and plasticity. In the present paper we review cellular and network effects of P2Y receptors in the brain. We show that P2Y receptors inhibit the release of neurotransmitters, modulate voltage- and ligand-gated ion channels, and differentially influence the induction of synaptic plasticity in the prefrontal cortex, hippocampus, and cerebellum. The findings discussed here may explain how P2Y1 receptor activation during brain injury, hypoxia, inflammation, schizophrenia, or Alzheimer's disease leads to an impairment of cognitive processes. Hence, it is suggested that the blockade of P2Y1 receptors may have therapeutic potential against cognitive disturbances in these states.

  16. Role of P2X7 and P2Y2 receptors on α-secretase-dependent APP processing: Control of amyloid plaques formation “in vivo” by P2X7 receptor

    PubMed Central

    Miras-Portugal, M. Teresa; Diaz-Hernandez, Juan I.; Gomez-Villafuertes, Rosa; Diaz-Hernandez, Miguel; Artalejo, Antonio R.; Gualix, Javier


    Amyloid precursor protein (APP) is expressed in a large variety of neural and non-neural cells. The balance between non-pathogenic and pathologic forms of APP processing, mediated by α-secretase and β-secretase respectively, remains a crucial step to understand β-amyloid, Aβ42 peptide, formation and aggregation that are at the origin of the senile plaques in the brain, a characteristic hallmark of Alzheimer's disease (AD). In Neuro-2a, a neuroblastoma cell line that constitutively expresses APP, activation of the P2X7 receptor leads to reduction of α-secretase activity, the opposite effect being obtained by P2Y2 receptor activation. The in vivo approach was made possible by the use of J20 mice, a transgenic mouse model of familial Alzheimer's disease (FAD) expressing human APP mutant protein. This animal exhibits prominent amyloid plaques by six months of age. In vivo inhibition of the P2X7 receptor induced a significant decrease in the number and size of hippocampal amyloid plaques. This reduction is mediated by an increase in the proteolytic processing of APP through α-secretase activity, which correlates with an increase in the phosphorylated form of GSK-3, a less active form of this enzyme. The in vivo findings corroborate the therapeutic potential of P2X7 antagonists in the treatment of FAD. PMID:25848496

  17. The role of P2X7 receptors in a rodent PCP-induced schizophrenia model

    PubMed Central

    Koványi, Bence; Csölle, Cecilia; Calovi, Stefano; Hanuska, Adrienn; Kató, Erzsébet; Köles, László; Bhattacharya, Anindya; Haller, József; Sperlágh, Beáta


    P2X7 receptors (P2X7Rs) are ligand-gated ion channels sensitive to extracellular ATP. Here we examined for the first time the role of P2X7R in an animal model of schizophrenia. Using the PCP induced schizophrenia model we show that both genetic deletion and pharmacological inhibition of P2X7Rs alleviate schizophrenia-like behavioral alterations. In P2rx7+/+ mice, PCP induced hyperlocomotion, stereotype behavior, ataxia and social withdrawal. In P2X7 receptor deficient mice (P2rx7−/−), the social interactions were increased, whereas the PCP induced hyperlocomotion and stereotype behavior were alleviated. The selective P2X7 receptor antagonist JNJ-47965567 partly replicated the effect of gene deficiency on PCP-induced behavioral changes and counteracted PCP-induced social withdrawal. We also show that PCP treatment upregulates and increases the functional responsiveness of P2X7Rs in the prefrontal cortex of young adult animals. The amplitude of NMDA evoked currents recorded from layer V pyramidal neurons of cortical slices were slightly decreased by both genetic deletion of P2rx7 and by JNJ-47965567. PCP induced alterations in mRNA expression encoding schizophrenia-related genes, such as NR2A, NR2B, neuregulin 1, NR1 and GABA α1 subunit were absent in the PFC of young adult P2rx7−/− animals. Our findings point to P2X7R as a potential therapeutic target in schizophrenia. PMID:27824163

  18. P2X7 deficiency attenuates hypertension and renal injury in deoxycorticosterone acetate-salt hypertension.


    Ji, Xu; Naito, Yukiko; Weng, Huachun; Endo, Kosuke; Ma, Xiao; Iwai, Naoharu


    The P2X(7) receptor is a ligand-gated ion channel, and genetic variations in the P2X(7) gene significantly affect blood pressure. P2X(7) receptor expression is associated with renal injury and inflammatory diseases. Uninephrectomized wild-type (WT) and P2X(7)-deficient (P2X(7) KO) mice were subcutaneously implanted with deoxycorticosterone acetate (DOCA) pellets and fed an 8% salt diet for 18 days. Their blood pressure was assessed by a telemetry system. The mice were placed in metabolic cages, and urine was collected for 24 h to assess renal function. After 18 days of DOCA-salt treatment, P2X(7) mRNA and protein expression increased in WT mice. Blood pressure in P2X(7) KO mice was less than that of WT mice (mean systolic blood pressure 133 ± 3 vs. 150 ± 2 mmHg). On day 18, urinary albumin excretion was lower in P2X(7) KO mice than in WT mice (0.11 ± 0.07 vs. 0.28 ± 0.07 mg/day). Creatinine clearance was higher in P2X(7) KO mice than in WT mice (551.53 ± 65.23 vs. 390.85 ± 32.81 μl·min(-1)·g renal weight(-1)). Moreover, renal interstitial fibrosis and infiltration of immune cells (macrophages, T cells, B cells, and leukocytes) were markedly attenuated in P2X(7) KO mice compared with WT mice. The levels of IL-1β, released by macrophages, in P2X(7) KO mice had decreased dramatically compared with that in WT mice. These results strongly suggest that the P2X(7) receptor plays a key role in the development of hypertension and renal disease via increased inflammation, indicating its potential as a novel therapeutic target.

  19. Sociocommunicative and Sensorimotor Impairments in Male P2X4-Deficient Mice

    PubMed Central

    Wyatt, Letisha R; Godar, Sean C; Khoja, Sheraz; Jakowec, Michael W; Alkana, Ronald L; Bortolato, Marco; Davies, Daryl L


    Purinergic P2X receptors are a family of ligand-gated ion channels gated by extracellular adenosine 5′-triphosphate (ATP). Of the seven P2X subtypes, P2X4 receptors (P2X4Rs) are richly expressed in the brain, yet their role in behavioral organization remains poorly understood. In this study, we examined the behavioral responses of P2X4R heterozygous (HZ) and knockout (KO) mice in a variety of testing paradigms designed to assess complementary aspects of sensory functions, emotional reactivity, and cognitive organization. P2X4R deficiency did not induce significant alterations of locomotor activity and anxiety-related indices in the novel open field and elevated plus-maze tests. Conversely, P2X4R KO mice displayed marked deficits in acoustic startle reflex amplitude, as well as significant sensorimotor gating impairments, as assessed by the prepulse inhibition of the startle. In addition, P2X4R KO mice displayed enhanced tactile sensitivity, as signified by a lower latency in the sticky-tape removal test. Moreover, both P2X4R HZ and KO mice showed significant reductions in social interaction and maternal separation-induced ultrasonic vocalizations in pups. Notably, brain regions of P2X4R KO mice exhibited significant brain-regional alterations in the subunit composition of glutamate ionotropic receptors. These results collectively document that P2X4-deficient mice exhibit a spectrum of phenotypic abnormalities partially akin to those observed in other murine models of autism-spectrum disorder. In conclusion, our findings highlight a putative role of P2X4Rs in the regulation of perceptual and sociocommunicative functions and point to these receptors as putative targets for disturbances associated with neurodevelopmental disorders. PMID:23604007

  20. Potential Involvement of P2 Receptors in the Pathological Processes of Hyperthyroidism: A Pilot Study.


    Hong, Wu; Li, Guodong; Nie, Yijun; Zou, Lifang; Zhang, Xi; Liu, Shuangmei; Li, Guilin; Xu, Hong; Zhang, Chun-Ping; Liang, Shangdong


    Symptoms of hyperthyroidism manifest mainly as changes in the nervous and metabolic systems. Whether P2X receptors (ionotropic ATP purinergic receptors, including P2X3 receptor and P2X7 receptor) are involved in the alterations of these disorders still remains unclear. Thus, this study aimed to assess the association of hyperthyroidism with the expression of P2X3 and P2X7 receptors and the concentrations of ATP in blood leukocytes and catecholamine. Twelve healthy subjects and twelve patients diagnosed with hyperthyroidism were recruited. Serum free triiodothyronine (FT3), free thyroxine (FT4) and thyroid stimulating hormone (TSH) levels had been detected by chemiluminescence method. Meanwhile, the catecholamine levels (including adrenaline, noradrenaline, and dopamine) in plasma, ATP level and P2X receptors (including P2X3 receptor and P2X7 receptor) in peripheral blood had been detected by high performance liquid chromatography, bioluminescence method, and reverse transcription polymerase chain reaction, respectively. Levels of epinephrine and norepinephrine were significantly higher in the hyperthyroidism group compared with the control group. The concentration of ATP in the hyperthyroidism group was significantly higher than its in the control group. The expression of P2X3 mRNA and P2X7 mRNA in hyperthyroidism group were significantly increased compared with those in control group. In a conclusion, there is a relationship between the elevated expression of P2X3 receptor and P2X7 receptor in peripheral blood leukocytes and high serum epinephrine and norepinephrine levels in hyperthyroidism patients.

  1. Novel Protective Role of Endogenous Cardiac Myocyte P2X4 Receptors in Heart Failure

    PubMed Central

    Yang, Tiehong; Shen, Jian-bing; Yang, Ronghua; Redden, John; Dodge-Kafka, Kimberly; Grady, James; Jacobson, Kenneth A.; Liang, Bruce T.


    Background Heart failure (HF), despite continuing progress, remains a leading cause of mortality and morbidity. P2X4 receptors (P2X4R) have emerged as potentially important molecules in regulating cardiac function and as potential targets for HF therapy. Transgenic P2X4R overexpression can protect against HF, but this does not explain the role of native cardiac P2X4R. Our goal is to define the physiological role of endogenous cardiac myocyte P2X4R under basal conditions and during HF induced by myocardial infarction or pressure overload. Methods and Results Mice established with conditional cardiac-specific P2X4R knockout were subjected to left anterior descending coronary artery ligation–induced postinfarct or transverse aorta constriction–induced pressure overload HF. Knockout cardiac myocytes did not show P2X4R by immunoblotting or by any response to the P2X4R-specific allosteric enhancer ivermectin. Knockout hearts showed normal basal cardiac function but depressed contractile performance in postinfarct and pressure overload models of HF by in vivo echocardiography and ex vivo isolated working heart parameters. P2X4R coimmunoprecipitated and colocalized with nitric oxide synthase 3 (eNOS) in wild-type cardiac myocytes. Mice with cardiac-specific P2X4R overexpression had increased S-nitrosylation, cyclic GMP, NO formation, and were protected from postinfarct and pressure overload HF. Inhibitor of eNOS, L-N5-(1-iminoethyl)ornithine hydrochloride, blocked the salutary effect of cardiac P2X4R overexpression in postinfarct and pressure overload HF as did eNOS knockout. Conclusions This study establishes a new protective role for endogenous cardiac myocyte P2X4R in HF and is the first to demonstrate a physical interaction between the myocyte receptor and eNOS, a mediator of HF protection. PMID:24622244

  2. Tent-shape technique: another procedure to repair P2 of posterior leaflet of mitral valve.


    Kassem, Samer; Moasis, Ghassan A; Biglioli, Paolo


    In this report, we describe a new procedure to repair the prolapsing high mid-scallop of the mitral valve (MV) posterior leaflet (P2) with detailed consideration of the anatomy and physiology of the MV. A new artificial chord is implanted in the body of the P2 at the same height of non-prolapsing P1 and P3, and the remaining part of the prolapsing P2 is anchored to the artificial chord taking the shape of a tent.

  3. Cleavage sites in the polypeptide precursors of poliovirus protein P2-X

    SciTech Connect

    Selmer, B.L.; Hanecak, R.; Anderson, C.W.; Wimmer, E.


    Partial amino-terminal sequence analysis has been performed on the three major polypeptide products (P2-3b, P2-5b, and P2-X) from the central region (P2) of the poliovirus polyprotein, and this analysis precisely locates the amino termini of these products with respect to the nucleotide sequence of the poliovirus RNA genome. Like most of the products of the replicase region (P3), the amino termini of P2-5b and P2-X are generated by cleavage between glutamine and glycine residues. Thus, P2-5b and P2-X are probably both produced by the action of a singly (virus-encoded.) proteinase. The amino terminus of P2-3b, on the other hand, is produced by a cleavage between the carboxy-terminal tyrosine of VP1 and the glycine encoded by nucleotides 3381-3383. This result may suggest that more than one proteolytic activity is required for the complete processing of the poliovirus polyprotein.

  4. Insights into the channel gating of P2X receptors from structures, dynamics and small molecules

    PubMed Central

    Wang, Jin; Yu, Ye


    P2X receptors, as ATP-gated non-selective trimeric ion channels, are permeable to Na+, K+ and Ca2+. Comparing with other ligand-gated ion channel families, P2X receptors are distinct in their unique gating properties and pathophysiological roles, and have attracted attention as promising drug targets for a variety of diseases, such as neuropathic pain, multiple sclerosis, rheumatoid arthritis and thrombus. Several small molecule inhibitors for distinct P2X subtypes have entered into clinical trials. However, many questions regarding the gating mechanism of P2X remain unsolved. The structural determinations of P2X receptors at the resting and ATP-bound open states revealed that P2X receptor gating is a cooperative allosteric process involving multiple domains, which marks the beginning of the post-structure era of P2X research at atomic level. Here, we review the current knowledge on the structure-function relationship of P2X receptors, depict the whole picture of allosteric changes during the channel gating, and summarize the active sites that may contribute to new strategies for developing novel allosteric drugs targeting P2X receptors. PMID:26725734

  5. Tungsten phosphanylarylthiolato complexes [W{PhP(2-SC6H4)2-kappa3S,S',P} 2] and [W{P(2-SC6H4)3-kappa4S,S',S",P}2]: synthesis, structures and redox chemistry.


    Hildebrand, Alexandra; Lönnecke, Peter; Silaghi-Dumitrescu, Luminita; Hey-Hawkins, Evamarie


    PhP(2-SHC6H4)2 (PS2H2) reacts with WCl6 with reduction of tungsten to give the air-sensitive tungsten(IV) complex [W{PhP(2-SC6H4)2-kappa(3)S,S',P}2] (1). 1 is oxidised in air to [WO{PhPO(2-SC6H4)2-kappa(3)S,S',O}{PhP(2-SC6H4)2-kappa(3)S,S',P}] (2). The attempted synthesis of 2 by reaction of 1 with iodosobenzene as oxidising agent was unsuccessful. [W{P(2-SC6H4)3-kappa(4)S,S',S",P}2] (3) was formed in the reaction of P(2-SHC6H4)3 (PS3H3) with WCl6. The W(VI) complex 3 contains two PS3(3-) ligands, each coordinated in a tetradentate fashion resulting in a tungsten coordination number of eight. The reaction of 3 with AgBF4 yields the dinuclear tungsten complex [W2{P(2-SC6H4)3-kappa(4)S,S',S",P}3]BF4 (4). Complexes 1-4 were characterised by spectral methods and X-ray structure determination.

  6. Purinergic P2X7 receptor regulates lung surfactant secretion in a paracrine manner

    PubMed Central

    Mishra, Amarjit; Chintagari, Narendranath Reddy; Guo, Yujie; Weng, Tingting; Su, Lijing; Liu, Lin


    Alveolar epithelium is composed of alveolar epithelial cells of type I (AEC I) and type II (AEC II). AEC II secrete lung surfactant by means of exocytosis. P2X7 receptor (P2X7R), a P2 purinergic receptor, has been implicated in the regulation of synaptic transmission and inflammation. Here, we report that P2X7R, which is expressed in AEC I but not AEC II, is a novel mediator for the paracrine regulation of surfactant secretion in AEC II. In primary co-cultures of AEC I and AEC II benzoyl ATP (BzATP; an agonist of P2X7R) increased surfactant secretion, which was blocked by the P2X7R antagonist Brilliant Blue G. This effect was observed in AEC II co-cultured with human embryonic kidney HEK-293 cells stably expressing rat P2X7R, but not when co-cultured with AEC I in which P2X7R was knocked down or in co-cultures of AEC I and AEC II isolated from P2X7R−/− mice. BzATP-mediated secretion involved P2Y2 receptor signaling because it was reduced by the addition of the ATP scavengers apyrase and adenosine deaminase and the P2Y2 receptor antagonist suramin. However, the stimulation with BzATP might also release other substances that potentially increase surfactant secretion as a greater stimulation of secretion was observed in AEC II incubated with BzATP when co-cultured with E10 or HEK-293-P2X7R cells than with ATP alone. P2X7R−/− mice failed to increase surfactant secretion in response to hyperventilation, pointing to the physiological relevance of P2X7R in maintaining surfactant homeostasis in the lung. These results suggest that the activation of P2X7R increases surfactant secretion by releasing ATP from AEC I and subsequently stimulating P2Y2 receptors in AEC II. PMID:21266468

  7. Optical control of trimeric P2X receptors and acid-sensing ion channels.


    Browne, Liam E; Nunes, João P M; Sim, Joan A; Chudasama, Vijay; Bragg, Laricia; Caddick, Stephen; North, R Alan


    P2X receptors are trimeric membrane proteins that function as ion channels gated by extracellular ATP. We have engineered a P2X2 receptor that opens within milliseconds by irradiation at 440 nm, and rapidly closes at 360 nm. This requires bridging receptor subunits via covalent attachment of 4,4'-bis(maleimido)azobenzene to a cysteine residue (P329C) introduced into each second transmembrane domain. The cis-trans isomerization of the azobenzene pushes apart the outer ends of the transmembrane helices and opens the channel in a light-dependent manner. Light-activated channels exhibited similar unitary currents, rectification, calcium permeability, and dye uptake as P2X2 receptors activated by ATP. P2X3 receptors with an equivalent mutation (P320C) were also light sensitive after chemical modification. They showed typical rapid desensitization, and they could coassemble with native P2X2 subunits in pheochromocytoma cells to form light-activated heteromeric P2X2/3 receptors. A similar approach was used to open and close human acid-sensing ion channels (ASICs), which are also trimers but are unrelated in sequence to P2X receptors. The experiments indicate that the opening of the permeation pathway requires similar and substantial movements of the transmembrane helices in both P2X receptors and ASICs, and the method will allow precise optical control of P2X receptors or ASICs in intact tissues.

  8. P2Y Receptors in the Mammalian Nervous System: Pharmacology, Ligands and Therapeutic Potential

    PubMed Central

    Weisman, Gary A.; Woods, Lucas T.; Erb, Laurie; Seye, Cheikh I.


    P2Y receptors for extracellular nucleotides are coupled to activation of a variety of G proteins and stimulate diverse intracellular signaling pathways that regulate functions of cell types that comprise the central nervous system (CNS). There are 8 different subtypes of P2Y receptor expressed in cells of the CNS that are activated by a select group of nucleotide agonists. Here, the agonist selectivity of these 8 P2Y receptor subtypes is reviewed with an emphasis on synthetic agonists with high potency and resistance to degradation by extracellular nucleotidases that have potential applications as therapeutic agents. In addition, the recent identification of a wide variety of subtype-selective antagonists is discussed, since these compounds are critical for discerning cellular responses mediated by activation of individual P2Y receptor subtypes. The functional expression of P2Y receptor subtypes in cells that comprise the CNS is also reviewed and the role of each subtype in the regulation of physiological and pathophysiological responses is considered. Other topics include the role of P2Y receptors in the regulation of blood-brain barrier integrity and potential interactions between different P2Y receptor subtypes that likely impact tissue responses to extracellular nucleotides in the CNS. Overall, current research suggests that P2Y receptors in the CNS regulate repair mechanisms that are triggered by tissue damage, inflammation and disease and thus P2Y receptors represent promising targets for the treatment of neurodegenerative diseases. PMID:22963441

  9. Crystal Chemistry of Cd 2- xCu xP 2O 7, 0 ≤ x ≤ 2 Structure of CdCuP 2O 7

    NASA Astrophysics Data System (ADS)

    El Belghiti, A. Alaoui; Elmarzouki, A.; Boukhari, A.; Holt, E. M.


    The domains of the system, Cd 2- xCu xP 2O 7, O ≤ x ≤ 2, have been established by powder diffraction methods. Two solid solutions have been found near Cd 2P 2O 7 (0 ≤ x ≤ 0.40) and Cu 2P 2O 7 (1.60 ≤ x ≤ 2). A new phase with x = 1 has been identified using single crystal X-ray diffraction. The mixed diphosphate CdCuP 2P 7 ( x = 1) crystallizes in monoclinic space group C2 with a = 6.806(7), b = 8.665(4), c = 4.504(2) Å, β = 105.85(6)°, V = 255.5(3) Å 3, λ(MoKα) = 0.71069 Å, μ MoKα, = 89.26 cm -1, Dcalc = 4.55 g cm -3, Dmeas = 4.59(5) g cm -3, Z = 2, F(000) = 326, T = 298 K, R = 3.9%, Rw = 5.1% for 247 observed reflections. P 2O 7 groups show staggered conformation identifying the solid state structure to be of the thortveitite type. The mixed Cd:Cu sites display sixfold coordination with average M-O distance 2.24(3) Å.

  10. RDGBα, a PtdIns-PtdOH transfer protein, regulates G-protein-coupled PtdIns(4,5)P2 signalling during Drosophila phototransduction

    PubMed Central

    Yadav, Shweta; Garner, Kathryn; Georgiev, Plamen; Li, Michelle; Gomez-Espinosa, Evelyn; Panda, Aniruddha; Mathre, Swarna; Okkenhaug, Hanneke; Cockcroft, Shamshad; Raghu, Padinjat


    ABSTRACT Many membrane receptors activate phospholipase C (PLC) during signalling, triggering changes in the levels of several plasma membrane lipids including phosphatidylinositol (PtdIns), phosphatidic acid (PtdOH) and phosphatidylinositol 4,5-bisphosphate [PtdIns(4,5)P2]. It is widely believed that exchange of lipids between the plasma membrane and endoplasmic reticulum (ER) is required to restore lipid homeostasis during PLC signalling, yet the mechanism remains unresolved. RDGBα (hereafter RDGB) is a multi-domain protein with a PtdIns transfer protein (PITP) domain (RDGB-PITPd). We find that, in vitro, the RDGB-PITPd binds and transfers both PtdOH and PtdIns. In Drosophila photoreceptors, which experience high rates of PLC activity, RDGB function is essential for phototransduction. We show that binding of PtdIns to RDGB-PITPd is essential for normal phototransduction; however, this property is insufficient to explain the in vivo function because another Drosophila PITP (encoded by vib) that also binds PtdIns cannot rescue the phenotypes of RDGB deletion. In RDGB mutants, PtdIns(4,5)P2 resynthesis at the plasma membrane following PLC activation is delayed and PtdOH levels elevate. Thus RDGB couples the turnover of both PtdIns and PtdOH, key lipid intermediates during G-protein-coupled PtdIns(4,5)P2 turnover. PMID:26203165

  11. Strong Enrichment of Aromatic Residues in Binding Sites from a Charge-neutralized Hyperthermostable Sso7d Scaffold Library*

    PubMed Central

    Kiefer, Jonathan D.; Srinivas, Raja R.; Lobner, Elisabeth; Tisdale, Alison W.; Mehta, Naveen K.; Yang, Nicole J.; Tidor, Bruce; Wittrup, K. Dane


    The Sso7d protein from the hyperthermophilic archaeon Sulfolobus solfataricus is an attractive binding scaffold because of its small size (7 kDa), high thermal stability (Tm of 98 °C), and absence of cysteines and glycosylation sites. However, as a DNA-binding protein, Sso7d is highly positively charged, introducing a strong specificity constraint for binding epitopes and leading to nonspecific interaction with mammalian cell membranes. In the present study, we report charge-neutralized variants of Sso7d that maintain high thermal stability. Yeast-displayed libraries that were based on this reduced charge Sso7d (rcSso7d) scaffold yielded binders with low nanomolar affinities against mouse serum albumin and several epitopes on human epidermal growth factor receptor. Importantly, starting from a charge-neutralized scaffold facilitated evolutionary adaptation of binders to differentially charged epitopes on mouse serum albumin and human epidermal growth factor receptor, respectively. Interestingly, the distribution of amino acids in the small and rigid binding surface of enriched rcSso7d-based binders is very different from that generally found in more flexible antibody complementarity-determining region loops but resembles the composition of antibody-binding energetic hot spots. Particularly striking was a strong enrichment of the aromatic residues Trp, Tyr, and Phe in rcSso7d-based binders. This suggests that the rigidity and small size of this scaffold determines the unusual amino acid composition of its binding sites, mimicking the energetic core of antibody paratopes. Despite the high frequency of aromatic residues, these rcSso7d-based binders are highly expressed, thermostable, and monomeric, suggesting that the hyperstability of the starting scaffold and the rigidness of the binding surface confer a high tolerance to mutation. PMID:27582495

  12. Modulation of bladder afferent signals in normal and spinal cord-injured rats by purinergic P2X3 and P2X2/3 receptors

    PubMed Central

    Munoz, Alvaro; Somogyi, George T.; Boone, Timothy B.; Ford, Anthony P.; Smith, Christopher P.


    OBJECTIVE • To evaluate the role of bladder sensory purinergic P2X3 and P2X2/3 receptors on modulating the activity of lumbosacral neurones and urinary bladder contractions in vivo in normal or spinal cord-injured (SCI) rats with neurogenic bladder overactivity. MATERIALS AND METHODS • SCI was induced in female rats by complete transection at T8 – T9 and experiments were performed 4 weeks later, when bladder overactivity developed. Non-transected rats were used as controls (normal rats). • Neural activity was recorded in the dorsal horn of the spinal cord and field potentials were acquired in response to intravesical pressure steps via a suprapubic catheter. Field potentials were recorded under control conditions, after stimulation of bladder mucosal purinergic receptors with intravesical ATP (1 mm), and after intravenous injection of the P2X3/P2X2/3 antagonist AF-353 (10 mg/kg and 20 mg/kg). • Cystometry was performed in urethaneanaesthetised rats intravesically infused with saline. AF-353 (10 mg/kg) was systemically applied after baseline recordings; the rats also received a second dose of AF-353 (20 mg/kg). Changes in the frequency of voiding (VC) and non-voiding (NVC) contractions were evaluated. RESULTS • SCI rats had significantly higher frequencies for field potentials and NVC than NL rats. Intravesical ATP increased field potential frequency in control but not SCI rats, while systemic AF-353 significantly reduced this parameter in both groups. • AF-353 also reduced the inter-contractile interval in control but not in SCI rats; however, the frequency of NVC in SCI rats was significantly reduced. CONCLUSION • The P2X3/P2X2/3 receptors on bladder afferent nerves positively regulate sensory activity and NVCs in overactive bladders. PMID:22540742

  13. Activation of P2Y1 and P2Y2 receptors induces chloride secretion via calcium-activated chloride channels in kidney inner medullary collecting duct cells

    PubMed Central

    Rajagopal, Madhumitha; Kathpalia, Paru P.; Thomas, Sheela V.


    Dysregulation of urinary sodium chloride (NaCl) excretion can result in extracellular fluid (ECF) volume expansion and hypertension. Recent studies demonstrated that urinary nucleotide excretion increases in mice ingesting a high-salt diet and that these increases in extracellular nucleotides can signal through P2Y2 receptors in the kidney collecting duct to inhibit epithelial Na+ channels (ENaC). However, under conditions of ECF volume expansion brought about by high-dietary salt intake, ENaC activity should already be suppressed. We hypothesized that alternative pathways exist by which extracellular nucleotides control renal NaCl excretion. We used an inner medullary collecting duct (mIMCD-K2) cell line in an Ussing chamber system as a model to study additional ion transport pathways that are regulated by extracellular nucleotides. When ENaC was inhibited, the addition of adenosine triphosphate (ATP) to the basal side of cell sheets activated both P2Y1 and P2Y2 receptors, inducing a transient increase in short-circuit current (Isc); addition of ATP to the apical side activated only P2Y2 receptors, inducing first a transient and then a sustained increase in Isc. The ATP-induced increases in Isc were blocked by pretreatment with a phospholipase C (PLC) inhibitor, a calcium (Ca2+) chelator, or Ca2+-activated Cl− channel (CACC) inhibitors, suggesting that ATP signals through both PLC and intracellular Ca2+ to activate CACC. We propose that P2Y1 and P2Y2 receptors operate in tandem in IMCD cells to provide an adaptive mechanism for enhancing urinary NaCl excretion in the setting of high-dietary NaCl intake. PMID:21653634

  14. [Effect of Zhuangyao Jianshen Wan (ZYJCW) on P2X1 and P2X3 mRNA expressions in rats with diuresis caused by kidney deficiency].


    Chen, Jia-yi; Jiang, Wei-wen; He, Feng-lei; Mo, Guo-qiang; Guo, Zhong-hui; Wang, Xiao-dan; Wu, Qing-he; Cao, Hong-yin


    To investigate the urination-reducing effect and mechanism of Zhuangyao Jianshen Wan (ZYJCW). In this study, SI rats were subcutaneously injected with 150 mg · kg(-1) dose of D-galactose to prepare the sub-acute aging model and randomly divided into the model group, the Suoquan Wan group (1.17 g · kg(-1) · d(-1)), and ZYJCW high, medium and low dose groups (2.39, 1.20, 0.60 g · kg(-1) · d(-1)) , with normal rats in the blank group. They were continuously administered with drugs for eight weeks. The metabolic cage method was adopted to measure the 24 h urine volume and 5 h water load urine volume in rats. The automatic biochemistry analyzer was adopted to detect urine concentrations of Na+, Cl-, K+. The ELISA method was used to determine serum aldosterone (ALD) and antidiuretic hormone (ADH). The changes in P2X1 and P2X3 mRNA expressions in bladder tissues of rats were detected by RT-PCR. According to the results, both ZYJCW high and medium dose groups showed significant down-regulations in 24 h urine volume and 5 h water load urine volume in (P <0.05, P <0.01), declines in Na+ and Cl- concentrations in urine (P <0.01), notable rises in plasma ALD and ADH contents (P <0.05, P <0.01) and remarkable down-regulations in the P2X1 and P2X3 mRNA expressions in bladder tissues (P <0.01). The ZYJCW low dose group revealed obvious reductions in Na+ and Cl- concentrations in urine (P <0.01). The results indicated that ZYJCW may show the urination-reducing effect by down-regulating the P2X1 and P2X3 mRNA expressions in bladder tissues of rats with diuresis caused by kidney deficiency.

  15. Targeting of the P2X7 receptor in pancreatic cancer and stellate cells

    PubMed Central

    Giannuzzo, Andrea; Saccomano, Mara; Napp, Joanna; Ellegaard, Maria; Alves, Frauke


    The ATP‐gated receptor P2X7 (P2X7R) is involved in regulation of cell survival and has been of interest in cancer field. Pancreatic ductal adenocarcinoma (PDAC) is a deadly cancer and new markers and therapeutic targets are needed. PDAC is characterized by a complex tumour microenvironment, which includes cancer and pancreatic stellate cells (PSCs), and potentially high nucleotide/side turnover. Our aim was to determine P2X7R expression and function in human pancreatic cancer cells in vitro as well as to perform in vivo efficacy study applying P2X7R inhibitor in an orthotopic xenograft mouse model of PDAC. In the in vitro studies we show that human PDAC cells with luciferase gene (PancTu‐1 Luc cells) express high levels of P2X7R protein. Allosteric P2X7R antagonist AZ10606120 inhibited cell proliferation in basal conditions, indicating that P2X7R was tonically active. Extracellular ATP and BzATP, to which the P2X7R is more sensitive, further affected cell survival and confirmed complex functionality of P2X7R. PancTu‐1 Luc migration and invasion was reduced by AZ10606120, and it was stimulated by PSCs, but not by PSCs from P2X7‐/‐ animals. PancTu‐1 Luc cells were orthotopically transplanted into nude mice and tumour growth was followed noninvasively by bioluminescence imaging. AZ10606120‐treated mice showed reduced bioluminescence compared to saline‐treated mice. Immunohistochemical analysis confirmed P2X7R expression in cancer and PSC cells, and in metaplastic/neoplastic acinar and duct structures. PSCs number/activity and collagen deposition was reduced in AZ10606120‐treated tumours. PMID:27513892

  16. Caveolin-1 regulates P2X7 receptor signaling in osteoblasts.


    Gangadharan, Vimal; Nohe, Anja; Caplan, Jeffrey; Czymmek, Kirk; Duncan, Randall L


    The synthesis of new bone in response to a novel applied mechanical load requires a complex series of cellular signaling events in osteoblasts and osteocytes. The activation of the purinergic receptor P2X(7)R is central to this mechanotransduction signaling cascade. Recently, P2X(7)R have been found to be associated with caveolae, a subset of lipid microdomains found in several cell types. Deletion of caveolin-1 (CAV1), the primary protein constituent of caveolae in osteoblasts, results in increased bone mass, leading us to hypothesize that the P2X(7)R is scaffolded to caveolae in osteoblasts. Thus, upon activation of the P2X(7)R, we postulate that caveolae are endocytosed, thereby modulating the downstream signal. Sucrose gradient fractionation of MC3T3-E1 preosteoblasts showed that CAV1 was translocated to the denser cytosolic fractions upon stimulation with ATP. Both ATP and the more specific P2X(7)R agonist 2'(3')-O-(4-benzoylbenzoyl)ATP (BzATP) induced endocytosis of CAV1, which was inhibited when MC3T3-E1 cells were pretreated with the specific P2X7R antagonist A-839977. The P2X7R cofractionated with CAV1, but, using superresolution structured illumination microscopy, we found only a subpopulation of P2X(7)R in these lipid microdomains on the membrane of MC3T3-E1 cells. Suppression of CAV1 enhanced the intracellular Ca(2+) response to BzATP, suggesting that caveolae regulate P2X(7)R signaling. This proposed mechanism is supported by increased mineralization in CAV1 knockdown MC3T3-E1 cells treated with BzATP. These data suggest that caveolae regulate P2X(7)R signaling upon activation by undergoing endocytosis and potentially carrying with it other signaling proteins, hence controlling the spatiotemporal signaling of P2X(7)R in osteoblasts.

  17. Expression of the apoptotic calcium channel P2X7 in the glandular epithelium.


    Slater, Michael; Danieletto, Suzanne; Barden, Julian A


    In the current study, expression of the apoptotic calcium channel receptor P2X(7) and prostate-specific antigen (PSA) levels were studied in biopsy cores from 174 patients as well as 20 radical prostatectomy cases. In clinical biopsies, we have previously demonstrated that P2X(1 )and P2X(2) calcium channel receptors are absent from normal prostate epithelium that does not progress to prostate cancer within 5 years. In cases that did progress to prostate cancer however, P2X(1 )and P2X(2) labeling was observed in a stage-specific manner first in the nucleus, then the cytoplasm and finally on the apical epithelium, as prostate cancer developed. These markers were present up to 5 years before cancer was detectable by the usual morphological criteria (Gleason grading) as determined by H and E staining. In the current study, the apoptotic calcium channel receptor P2X(7) yielded similar results to that of P2X(1) and P2X(2). Using radical prostatectomy tissue sections as well as biopsies, these changes in calcium channel metabolism were noted throughout the prostate, indicating a field effect. This finding suggests that the presence of a prostate tumor could be detected without the need for direct sampling of tumor tissue, leading to detection of false negative cases missed by H or E stain. The reliability of PSA levels as a prognostic indicator has been questioned in recent years. In the current study, PSA levels were correlated with the P2X(7) labeling results. All patients who exhibited no P2X(7) labeling had a prostatic serum antigen (PSA) level of <2. Patients who exhibited stage-specific P2X(7) expression, and who later developed obvious prostate cancer as diagnosed by H and E stain, all had a PSA > 2. This finding suggests that increasing PSA may be an accurate indicator of cancer development.

  18. Human neutrophils do not express purinergic P2X7 receptors

    PubMed Central

    Martel-Gallegos, Guadalupe; Rosales-Saavedra, María T.; Reyes, Juan P.; Casas-Pruneda, Griselda; Toro-Castillo, Carmen; Pérez-Cornejo, Patricia


    It has been reported that in human neutrophils, external ATP activates plasma membrane purinergic P2X7 receptors (P2X7R) to elicit Ca2+ entry, production of reactive oxygen species (ROS), processing and release of pro-inflammatory cytokines, shedding of adhesion molecules and uptake of large molecules. However, the expression of P2X7R at the plasma membrane of neutrophils has also been questioned since these putative responses are not always reproduced. In this work, we used electrophysiological recordings to measure functional responses associated with the activation of membrane receptors, spectrofluorometric measurements of ROS production and ethidium bromide uptake to asses coupling of P2X7R activation to downstream effectors, immune-labelling of P2X7R using a fluorescein isothiocyanate-conjugated antibody to detect the receptors at the plasma membrane, RT-PCR to determine mRNA expression of P2X7R and Western blot to determine protein expression in neutrophils and HL-60 cells. None of these assays reported the presence of P2X7R in the plasma membrane of neutrophils and non-differentiated or differentiated HL-60 cells—a model cell for human neutrophils. We concluded that P2X7R are not present at plasma membrane of human neutrophils and that the putative physiological responses triggered by external ATP should be reconsidered. PMID:21103213

  19. Microglial P2Y12 Receptors Regulate Microglial Activation and Surveillance during Neuropathic Pain

    PubMed Central

    Gu, Nan; Eyo, Ukpong B.; Murugan, Madhuvika; Peng, Jiyun; Matta, Sanjana; Dong, Hailong; Wu, Long-Jun


    Microglial cells are critical in the pathogenesis of neuropathic pain and several microglial receptors have been proposed to mediate this process. Of these receptors, the P2Y12 receptor is a unique purinergic receptor that is exclusively expressed by microglia in the central nervous system (CNS). In this study, we set forth to investigate the role of P2Y12 receptors in microglial electrophysiological and morphological (static and dynamic) activation during spinal nerve transection (SNT)-induced neuropathic pain in mice. First, we found that a genetic deficiency of the P2Y12 receptor (P2Y12−/− mice) ameliorated pain hypersensitivities during the initiation phase of neuropathic pain. Next, we characterized both the electrophysiological and morphological properties of microglia in the superficial spinal cord dorsal horn following SNT injury. We show dramatic alterations including a peak at 3 days post injury in microglial electrophysiology while high resolution two-photon imaging revealed significant changes of both static and dynamic microglial morphological properties by 7 days post injury. Finally, in P2Y12−/− mice, these electrophysiological and morphological changes were ameliorated suggesting roles for P2Y12 receptors in SNT-induced microglial activation. Our results therefore indicate that P2Y12 receptors regulate microglial electrophysiological as well as static and dynamic microglial properties after peripheral nerve injury, suggesting that the microglial P2Y12 receptor could be a potential therapeutic target for the treatment of neuropathic pain. PMID:26576724

  20. Purinergic P2Y12 Receptor Activation in Eosinophils and the Schistosomal Host Response.


    Muniz, Valdirene S; Baptista-Dos-Reis, Renata; Benjamim, Claudia F; Mata-Santos, Hilton A; Pyrrho, Alexandre S; Strauch, Marcelo A; Melo, Paulo A; Vicentino, Amanda R R; Silva-Paiva, Juliana; Bandeira-Melo, Christianne; Weller, Peter F; Figueiredo, Rodrigo T; Neves, Josiane S


    Identifying new target molecules through which eosinophils secrete their stored proteins may reveal new therapeutic approaches for the control of eosinophilic disorders such as host immune responses to parasites. We have recently reported the expression of the purinergic P2Y12 receptor (P2Y12R) in human eosinophils; however, its functional role in this cell type and its involvement in eosinophilic inflammation remain unknown. Here, we investigated functional roles of P2Y12R in isolated human eosinophils and in a murine model of eosinophilic inflammation induced by Schistosoma mansoni (S. mansoni) infection. We found that adenosine 5'-diphosphate (ADP) induced human eosinophils to secrete eosinophil peroxidase (EPO) in a P2Y12R dependent manner. However, ADP did not interfere with human eosinophil apoptosis or chemotaxis in vitro. In vivo, C57Bl/6 mice were infected with cercariae of the Belo Horizonte strain of S. mansoni. Analyses performed 55 days post infection revealed that P2Y12R blockade reduced the granulomatous hepatic area and the eosinophilic infiltrate, collagen deposition and IL-13/IL-4 production in the liver without affecting the parasite oviposition. As found for humans, murine eosinophils also express the P2Y12R. P2Y12R inhibition increased blood eosinophilia, whereas it decreased the bone marrow eosinophil count. Our results suggest that P2Y12R has an important role in eosinophil EPO secretion and in establishing the inflammatory response in the course of a S. mansoni infection.

  1. Purinergic receptor P2X₇: a novel target for anti-inflammatory therapy.


    Mehta, Nisha; Kaur, Maninder; Singh, Manjinder; Chand, Sukhvir; Vyas, Bhawna; Silakari, Pragati; Bahia, Malkeet Singh; Silakari, Om


    Purinergic receptors, also known as purinoceptors, are ligand gated membrane ion channels involved in many cellular functions. Among all identified purinergic receptors, P2X₇ subform is unique since it induces the caspase activity, cytokine secretion, and apoptosis. The distribution of P2X₇ receptors, and the need of high concentration of ATP required to activate this receptor exhibited its ability to function as 'danger' sensor associated with tissue inflammation and damage. Further, the modulation of other signalling pathways associated with P2X₇ has also been proposed to play an important role in the control of macrophage functions and inflammatory responses, especially towards lipopolysaccharides. Experimentally, researchers have also observed the decreased severity of inflammatory responses in P2X₇ receptor expressing gene (P2RX₇) knockout (KO) phenotypes. Therefore, newly developed potent antagonists of P2X₇ receptor would serve as novel therapeutic agents to combat various inflammatory conditions. In this review article, we tried to explore various aspects of P2X₇ receptors including therapeutic potential, and recent discoveries and developments of P2X₇ receptor antagonists.

  2. Birdsong decreases protein levels of FoxP2, a molecule required for human speech.


    Miller, Julie E; Spiteri, Elizabeth; Condro, Michael C; Dosumu-Johnson, Ryan T; Geschwind, Daniel H; White, Stephanie A


    Cognitive and motor deficits associated with language and speech are seen in humans harboring FOXP2 mutations. The neural bases for FOXP2 mutation-related deficits are thought to reside in structural abnormalities distributed across systems important for language and motor learning including the cerebral cortex, basal ganglia, and cerebellum. In these brain regions, our prior research showed that FoxP2 mRNA expression patterns are strikingly similar between developing humans and songbirds. Within the songbird brain, this pattern persists throughout life and includes the striatal subregion, Area X, that is dedicated to song development and maintenance. The persistent mRNA expression suggests a role for FoxP2 that extends beyond the formation of vocal learning circuits to their ongoing use. Because FoxP2 is a transcription factor, a role in shaping circuits likely depends on FoxP2 protein levels which might not always parallel mRNA levels. Indeed our current study shows that FoxP2 protein, like its mRNA, is acutely downregulated in mature Area X when adult males sing with some differences. Total corticosterone levels associated with the different behavioral contexts did not vary, indicating that differences in FoxP2 levels are not likely attributable to stress. Our data, together with recent reports on FoxP2's target genes, suggest that lowered FoxP2 levels may allow for expression of genes important for circuit modification and thus vocal variability.

  3. Nociceptive transmission and modulation via P2X receptors in central pain syndrome.


    Kuan, Yung-Hui; Shyu, Bai-Chuang


    Painful sensations are some of the most frequent complaints of patients who are admitted to local medical clinics. Persistent pain varies according to its causes, often resulting from local tissue damage or inflammation. Central somatosensory pathway lesions that are not adequately relieved can consequently cause central pain syndrome or central neuropathic pain. Research on the molecular mechanisms that underlie this pathogenesis is important for treating such pain. To date, evidence suggests the involvement of ion channels, including adenosine triphosphate (ATP)-gated cation channel P2X receptors, in central nervous system pain transmission and persistent modulation upon and following the occurrence of neuropathic pain. Several P2X receptor subtypes, including P2X2, P2X3, P2X4, and P2X7, have been shown to play diverse roles in the pathogenesis of central pain including the mediation of fast transmission in the peripheral nervous system and modulation of neuronal activity in the central nervous system. This review article highlights the role of the P2X family of ATP receptors in the pathogenesis of central neuropathic pain and pain transmission. We discuss basic research that may be translated to clinical application, suggesting that P2X receptors may be treatment targets for central pain syndrome.


    EPA Science Inventory

    The paper focuses on the Pollution Prevention (P2), Recycling, and Waste Treatment Systems Center of the EPA's Environmental Technology Verification (ETV) Program and, specifically, the P2 Innovating Coatings and Coating Equipment Program (CCEP) housed within the Center. The focu...

  5. Competing analysis of α and 2p2n-emission from compound nuclei formed in neutron induced reactions

    NASA Astrophysics Data System (ADS)

    Kaur, Amandeep; Sharma, Manoj K.


    The decay mechanism of compound system 61Ni* formed in fast neutron induced reactions is explored within the collective clusterization approach of the Dynamical Cluster-decay Model (DCM) in reference to a recent experiment over an energy spread of En = 1- 100 MeV. The excitation functions for the decay of the compound nucleus 61Ni* formed in the n +60Ni reaction show a double humped variation with incident beam energy where the peak at lower energy corresponds to α-emission while the one at higher energy originates from 2 p 2 n-emission. The experimentally observed transmutation of α-emission at lower energy into 2 p 2 n-emission at higher incident energies is explained on the basis of temperature dependence of the binding energies used within the framework of DCM. The cross-sections for the formation of the daughter nucleus 57Fe after emission of α-cluster from the 61Ni* nucleus are addressed by employing the neck length parameter (ΔR), finding decent agreement with the available experimental data. The calculations are done for non-sticking choice of moment of inertia (INS) in the centrifugal potential term, which forms the essential ingredient in DCM based calculations. In addition to this, the effect of mass (and charge) of the compound nucleus is exercised in view of α and 2 p 2 n emission and comparative study of the decay profiles of compound systems with mass A = 17-93 is employed to get better description of decay patterns.

  6. Mapping of Chikungunya Virus Interactions with Host Proteins Identified nsP2 as a Highly Connected Viral Component

    PubMed Central

    Bouraï, Mehdi; Lucas-Hourani, Marianne; Gad, Hans Henrik; Drosten, Christian; Jacob, Yves; Tafforeau, Lionel; Cassonnet, Patricia; Jones, Louis M.; Judith, Delphine; Couderc, Thérèse; Lecuit, Marc; André, Patrice; Kümmerer, Beate Mareike; Lotteau, Vincent; Desprès, Philippe; Vidalain, Pierre-Olivier


    Chikungunya virus (CHIKV) is a mosquito-transmitted alphavirus that has been responsible for an epidemic outbreak of unprecedented magnitude in recent years. Since then, significant efforts have been made to better understand the biology of this virus, but we still have poor knowledge of CHIKV interactions with host cell components at the molecular level. Here we describe the extensive use of high-throughput yeast two-hybrid (HT-Y2H) assays to characterize interactions between CHIKV and human proteins. A total of 22 high-confidence interactions, which essentially involved the viral nonstructural protein nsP2, were identified and further validated in protein complementation assay (PCA). These results were integrated to a larger network obtained by extensive mining of the literature for reports on alphavirus-host interactions. To investigate the role of cellular proteins interacting with nsP2, gene silencing experiments were performed in cells infected by a recombinant CHIKV expressing Renilla luciferase as a reporter. Collected data showed that heterogeneous nuclear ribonucleoprotein K (hnRNP-K) and ubiquilin 4 (UBQLN4) participate in CHIKV replication in vitro. In addition, we showed that CHIKV nsP2 induces a cellular shutoff, as previously reported for other Old World alphaviruses, and determined that among binding partners identified by yeast two-hybrid methods, the tetratricopeptide repeat protein 7B (TTC7B) plays a significant role in this activity. Altogether, this report provides the first interaction map between CHIKV and human proteins and describes new host cell proteins involved in the replication cycle of this virus. PMID:22258240

  7. Mapping of Chikungunya virus interactions with host proteins identified nsP2 as a highly connected viral component.


    Bouraï, Mehdi; Lucas-Hourani, Marianne; Gad, Hans Henrik; Drosten, Christian; Jacob, Yves; Tafforeau, Lionel; Cassonnet, Patricia; Jones, Louis M; Judith, Delphine; Couderc, Thérèse; Lecuit, Marc; André, Patrice; Kümmerer, Beate Mareike; Lotteau, Vincent; Desprès, Philippe; Tangy, Frédéric; Vidalain, Pierre-Olivier


    Chikungunya virus (CHIKV) is a mosquito-transmitted alphavirus that has been responsible for an epidemic outbreak of unprecedented magnitude in recent years. Since then, significant efforts have been made to better understand the biology of this virus, but we still have poor knowledge of CHIKV interactions with host cell components at the molecular level. Here we describe the extensive use of high-throughput yeast two-hybrid (HT-Y2H) assays to characterize interactions between CHIKV and human proteins. A total of 22 high-confidence interactions, which essentially involved the viral nonstructural protein nsP2, were identified and further validated in protein complementation assay (PCA). These results were integrated to a larger network obtained by extensive mining of the literature for reports on alphavirus-host interactions. To investigate the role of cellular proteins interacting with nsP2, gene silencing experiments were performed in cells infected by a recombinant CHIKV expressing Renilla luciferase as a reporter. Collected data showed that heterogeneous nuclear ribonucleoprotein K (hnRNP-K) and ubiquilin 4 (UBQLN4) participate in CHIKV replication in vitro. In addition, we showed that CHIKV nsP2 induces a cellular shutoff, as previously reported for other Old World alphaviruses, and determined that among binding partners identified by yeast two-hybrid methods, the tetratricopeptide repeat protein 7B (TTC7B) plays a significant role in this activity. Altogether, this report provides the first interaction map between CHIKV and human proteins and describes new host cell proteins involved in the replication cycle of this virus.

  8. An anti-attack model based on complex network theory in P2P networks

    NASA Astrophysics Data System (ADS)

    Peng, Hao; Lu, Songnian; Zhao, Dandan; Zhang, Aixin; Li, Jianhua


    Complex network theory is a useful way to study many real systems. In this paper, an anti-attack model based on complex network theory is introduced. The mechanism of this model is based on a dynamic compensation process and a reverse percolation process in P2P networks. The main purpose of the paper is: (i) a dynamic compensation process can turn an attacked P2P network into a power-law (PL) network with exponential cutoff; (ii) a local healing process can restore the maximum degree of peers in an attacked P2P network to a normal level; (iii) a restoring process based on reverse percolation theory connects the fragmentary peers of an attacked P2P network together into a giant connected component. In this way, the model based on complex network theory can be effectively utilized for anti-attack and protection purposes in P2P networks.

  9. Fuzzy-rule-based Adaptive Resource Control for Information Sharing in P2P Networks

    NASA Astrophysics Data System (ADS)

    Wu, Zhengping; Wu, Hao

    With more and more peer-to-peer (P2P) technologies available for online collaboration and information sharing, people can launch more and more collaborative work in online social networks with friends, colleagues, and even strangers. Without face-to-face interactions, the question of who can be trusted and then share information with becomes a big concern of a user in these online social networks. This paper introduces an adaptive control service using fuzzy logic in preference definition for P2P information sharing control, and designs a novel decision-making mechanism using formal fuzzy rules and reasoning mechanisms adjusting P2P information sharing status following individual users' preferences. Applications of this adaptive control service into different information sharing environments show that this service can provide a convenient and accurate P2P information sharing control for individual users in P2P networks.

  10. An evolutionary perspective on FoxP2: strictly for the birds?


    Scharff, Constance; Haesler, Sebastian


    FoxP2 mutations in humans are associated with a disorder that affects both the comprehension of language and its production, speech. This discovery provided the first opportunity to analyze the genetics of language with molecular and neurobiological tools. The amino acid sequence and the neural expression pattern of FoxP2 are extremely conserved, from reptile to man. This suggests an important role for FoxP2 in vertebrate brains, regardless of whether they support imitative vocal learning or not. Its expression pattern pinpoints neural circuits that might have been crucial for the evolution of speech and language, including the basal ganglia and the cerebellum. Recent studies in songbirds show that during times of song plasticity FoxP2 is upregulated in a striatal region essential for song learning. This suggests that FoxP2 plays important roles both in the development of neural circuits and in the postnatal behaviors they mediate.

  11. The Temporal Order of Word Presentation Modulates the Amplitudes of P2 and N400 during Recognition of Causal Relations

    PubMed Central

    Liang, Xiuling; Xiao, Feng; Wu, Lijun; Chen, Qingfei; Lei, Yi; Li, Hong


    The processing of causal relations has been constantly found to be asymmetrical once the roles of cause and effect are assigned to objects in interactions. We used a relationship recognition paradigm and recorded electroencephalographic (EEG) signals to explore the neural mechanism underlying the asymmetrical representations of causal relations in semantic memory. The results revealed that the verification of causal relations is faster if two words appear in “cause-effect” order (e.g., virus-epidemic) than if they appear in “effect-cause” order (e.g., epidemic-virus), whereas no such asymmetrical representation was found for the verification of hierarchical relations with reverse orders (e.g., bird-sparrow vs. sparrow-bird) in Experiment 1. Furthermore, the P2 amplitude elicited by “superordinate-subordinate” order was larger than that when in reverse order, whereas the N400 effect elicited by “cause-effect” order was smaller (more positive) than when in reverse order. However, no such asymmetry, as well as P2 and N400 components, were observed when verifying the existence of a general associative relation in Experiment 2. We suggested that the smaller N400 in cause-effect order indicates their increased salience in semantic memory relative to the effect-cause order. These results provide evidence for dissociable neural processes, which are related to role binding, contributing to the generation of causal asymmetry. PMID:27994564

  12. Luminescent nitridophosphates CaP2 N4 :Eu(2+) , SrP2 N4 :Eu(2+) , BaP2 N4 :Eu(2+) , and BaSr2 P6 N12 :Eu(2.).


    Pucher, Florian J; Marchuk, Alexey; Schmidt, Peter J; Wiechert, Detlef; Schnick, Wolfgang


    Nitridophosphates MP2 N4 :Eu(2+) (M=Ca, Sr, Ba) and BaSr2 P6 N12 :Eu(2+) have been synthesized at elevated pressures and 1100-1300 °C starting from the corresponding azides and P3 N5 with EuCl2 as dopant. Addition of NH4 Cl as mineralizer allowed for the growth of single crystals. This led to the successful structure elucidation of a highly condensed nitridophosphate from single-crystal X-ray diffraction data (CaP2 N4 :Eu(2+) (P63 , no. 173), a=16.847(2), c=7.8592(16) Å, V=1931.7(6) Å(3) , Z=24, 2033 observed reflections, 176 refined parameters, wR2 =0.096). Upon excitation by UV light, luminescence due to parity-allowed 4f(6) ((7) F)5d(1) →4f(7) ((8) S7/2 ) transition was observed in the orange (CaP2 N4 :Eu(2+) , λmax =575 nm), green (SrP2 N4 :Eu(2+) , λmax =529 nm), and blue regions of the visible spectrum (BaSr2 P6 N12 :Eu(2+) and BaP2 N4 :Eu(2+) , λmax =450 and 460 nm, respectively). Thus, the emission wavelength decreases with increasing ionic radius of the alkaline-earth ions. The corresponding full width at half maximum values (2240-2460 cm(-1) ) are comparable to those of other known Eu(2+) -doped (oxo)nitrides emitting in the same region of the visible spectrum. Following recently described quaternary Ba3 P5 N10 Br:Eu(2+) , this investigation represents the first report on the luminescence of Eu(2+) -doped ternary nitridophosphates. Similarly to nitridosilicates and related oxonitrides, Eu(2+) -doped nitridophosphates may have the potential to be further developed into efficient light-emitting diode phosphors.

  13. Radiosensitizing Effect of P2X7 Receptor Antagonist on Melanoma in vitro and in vivo.


    Tanamachi, Keisuke; Nishino, Keisuke; Mori, Natsuki; Suzuki, Toshihiro; Tanuma, Sei-Ichi; Abe, Ryo; Tsukimoto, Mitsutoshi


    Melanoma is highly malignant, and generally exhibits radioresistance, responding poorly to radiation therapy. We previously reported that activation of P2X7, P2Y6, and P2Y12 receptors is involved in the DNA damage response after γ-irradiation of human lung adenocarcinoma A549 cells. However, it is not clear whether these receptors are also involved in the case of melanoma cells, although P2X7 receptor is highly expressed in various cancers, including melanoma. Here, we show that P2X7 receptor antagonist enhances radiation-induced cytotoxicity in B16 melanoma cells in vitro and in vivo. We confirmed that these cells express P2X7 receptor mRNA and exhibit P2X7 receptor-mediated activities, such as ATP-induced pore formation and cytotoxicity. We further examined the radiosensitizing effect of P2X7 receptor antagonist Brilliant Blue G (BBG) in vitro by colony formation assay of B16 cells. γ-Irradiation dose-dependently reduced cell survival, and pretreatment with BBG enhanced the radiation-induced cytotoxicity. BBG pretreatment also decreased the number of DNA repair foci in nuclei, supporting involvement of P2X7 receptor in the DNA damage response. Finally, we investigated the radiosensitizing effect of BBG on B16 melanoma cells inoculated into the hind footpad of C57BL/6 mice. Neither 1 Gy γ-irradiation alone nor BBG alone suppressed the increase of tumor volume, but the combination of irradiation and BBG significantly suppressed tumor growth. Our results suggest that P2X7 receptor antagonist BBG has a radiosensitizing effect in melanoma in vitro and in vivo. BBG, which is used as a food coloring agent, appears to be a promising candidate as a radiosensitizer.

  14. Silencing of P2Y2 receptors reduces intraocular pressure in New Zealand rabbits

    PubMed Central

    Martin-Gil, Alba; de Lara, María Jesús Perez; Crooke, Almudena; Santano, Concepción; Peral, Assumpta; Pintor, Jesus


    BACKGROUND AND PURPOSE P2 receptors are involved in the regulation of ocular physiological processes like intraocular pressure (IOP). In the present study, the involvement of P2Y2 receptors in the hypertensive effect of nucleotides was investigated by use of antagonists and of a siRNA designed for the P2Y2 receptor. EXPERIMENTAL APPROACH Agonists of the P2Y2 receptor a as well as P2 antagonists were applied to eyes of New Zealand rabbits, and the changes in IOP were followed for up to 6 h. Cloning of the P2Y2 receptor cDNA was done using a combination of degenerate reverse transcription PCR (RT-PCR) and rapid amplification of cDNA ends (RACE). siRNA was synthesized and tested by immunohistochemistry. KEY RESULTS Single doses of 2-thioUTP, UTP-γ-S and UTP increased IOP. This behaviour was concentration-dependent and partially antagonized by reactive blue 2. Silencing the P2Y2 receptor was observed in the ciliary body by immunohistochemistry labelling, where a reduction in the immunofluorescence was observed. This reduction in the expression of the P2Y2 receptor was concomitant with a reduction in IOP, which was measurable 24 h after treatment with the siRNA, maximal after 2 days, followed by a slow increase towards control values for the following 5 days. Application of the P2Y2 agonists after pretreatment of the animals with this siRNA did not produce any change in IOP. CONCLUSIONS AND IMPLICATIONS P2Y2 receptors increase IOP in New Zealand rabbits. The application of a siRNA for this receptor significantly reduced IOP, suggesting that this technology might be used for the treatment of glaucoma. PMID:21740413

  15. Intracellular NAADP increase induced by extracellular NAADP via the P2Y11-like receptor.


    Djerada, Zoubir; Millart, Hervé


    The aim of the study was to identify a signalling pathway allowing NAADP-induced intracellular NAADP increase and involving the P2Y11-like receptor. P2Y11-like and β-adrenergic receptors may play important regulatory roles within the cardiovascular system. Both receptors have been shown to be involved in triggering myocardial preconditioning. Using a Langendorff model we report a positive inotropic response induced by extracellular NAADP via P2Y11-like receptor stimulation. In cardiomyocyte cultures, P2Y11-like receptor stimulation by extracellular NAADP ([NAADP]e) increased intracellular cADP-ribose and NAADP concentration as evidenced by direct measurements. NF546, a new selective P2Y11 receptor agonist, increased intracellular cAMP, cADP-ribose and NAADP concentration confirming the involvement of the P2Y11-like receptor in this signalling pathway. NF157, a P2Y11 receptor antagonist, suppressed the increase in intracellular cADPr, NAADP and NAAD induced by either [NAADP]e or NF546. The response profile for intracellular cADP-ribose and NAADP concentration following P2Y11-like stimulation with NF546 was similar to reported data relating β-adrenergic stimulation with isoprenaline. This response represents the signature of the Gs/ADP-ribosyl cyclase activity. Moreover, this study provides a signalling pathway: intracellular NAADP increase induced by extracellular NAADP via metabotropic activity of P2Y11-like receptor. This pathway implying P2Y11-like could take part in the intracellular calcium rise reported for extracellular NAADP.

  16. P2X receptors as targets for the treatment of status epilepticus

    PubMed Central

    Henshall, David C.; Diaz-Hernandez, Miguel; Miras-Portugal, M. Teresa; Engel, Tobias


    Prolonged seizures are amongst the most common neurological emergencies. Status epilepticus is a state of continuous seizures that is life-threatening and prompt termination of status epilepticus is critical to protect the brain from permanent damage. Frontline treatment comprises parenteral administration of anticonvulsants such as lorazepam that facilitate γ-amino butyric acid (GABA) transmission. Because status epilepticus can become refractory to anticonvulsants in a significant proportion of patients, drugs which act on different neurotransmitter systems may represent potential adjunctive treatments. P2X receptors are a class of ligand-gated ion channel activated by ATP that contributes to neuro- and glio-transmission. P2X receptors are expressed by both neurons and glia in various brain regions, including the hippocampus. Electrophysiology, pharmacology and genetic studies suggest certain P2X receptors are activated during pathologic brain activity. Expression of several members of the family including P2X2, P2X4, and P2X7 receptors has been reported to be altered in the hippocampus following status epilepticus. Recent studies have shown that ligands of the P2X7 receptor can have potent effects on seizure severity during status epilepticus and mice lacking this receptor display altered seizures in response to chemoconvulsants. Antagonists of the P2X7 receptor also modulate neuronal death, microglial responses and neuroinflammatory signaling. Recent work also found altered neuronal injury and inflammation after status epilepticus in mice lacking the P2X4 receptor. In summary, members of the P2X receptor family may serve important roles in the pathophysiology of status epilepticus and represent novel targets for seizure control and neuroprotection. PMID:24324404

  17. Sustained calcium entry through P2X nucleotide receptor channels in human airway epithelial cells.


    Zsembery, Akos; Boyce, Amanda T; Liang, Lihua; Peti-Peterdi, János; Bell, P Darwin; Schwiebert, Erik M


    Purinergic receptor stimulation has potential therapeutic effects for cystic fibrosis (CF). Thus, we explored roles for P2Y and P2X receptors in stably increasing [Ca(2+)](i) in human CF (IB3-1) and non-CF (16HBE14o(-)) airway epithelial cells. Cytosolic Ca(2+) was measured by fluorospectrometry using the fluorescent dye Fura-2/AM. Expression of P2X receptor (P2XR) subtypes was assessed by immunoblotting and biotinylation. In IB3-1 cells, ATP and other P2Y agonists caused only a transient increase in [Ca(2+)](i) derived from intracellular stores in a Na(+)-rich environment. In contrast, ATP induced an increase in [Ca(2+)](i) that had transient and sustained components in a Na(+)-free medium; the sustained plateau was potentiated by zinc or increasing extracellular pH. Benzoyl-benzoyl-ATP, a P2XR-selective agonist, increased [Ca(2+)](i) only in Na(+)-free medium, suggesting competition between Na(+) and Ca(2+) through P2XRs. Biochemical evidence showed that the P2X(4) receptor is the major subtype shared by these airway epithelial cells. A role for store-operated Ca(2+) channels, voltage-dependent Ca(2+) channels, or Na(+)/Ca(2+) exchanger in the ATP-induced sustained Ca(2+) signal was ruled out. In conclusion, these data show that epithelial P2X(4) receptors serve as ATP-gated calcium entry channels that induce a sustained increase in [Ca(2+)](i). In airway epithelia, a P2XR-mediated Ca(2+) signal may have therapeutic benefit for CF.

  18. Precision lifetime measurements of Cs 6p 2P1/2 and 6p 2P3/2 levels by single-photon counting

    NASA Astrophysics Data System (ADS)

    Young, L.; Hill, W. T., III; Sibener, S. J.; Price, Stephen D.; Tanner, C. E.; Wieman, C. E.; Leone, Stephen R.


    Time-correlated single-photon counting is used to measure the lifetimes of the 6p 2P1/2 and 6p 2P3/2 levels in atomic Cs with accuracies ~=0.2-0.3 %. A high-repetition-rate, femtosecond, self-mode-locked Ti:sapphire laser is used to excite Cs produced in a well-collimated atomic beam. The time interval between the excitation pulse and the arrival of a fluorescence photon is measured repetitively until the desired statistics are obtained. The lifetime results are 34.75(7) and 30.41(10) ns for the 6p 2P1/2 and 6p 2P3/2 levels, respectively. These lifetimes fall between those extracted from ab initio many-body perturbation-theory calculations by Blundell, Johnson, and Sapirstein [Phys. Rev. A 43, 3407 (1991)] and V. A. Dzuba et al. [Phys. Lett. A 142, 373 (1989)] and are in all cases within 0.9% of the calculated values. The measurement errors are dominated by systematic effects, and methods to alleviate these and to approach an accuracy of 0.1% are discussed. The technique is a viable alternative to the fast-beam laser approach for measuring lifetimes with extreme accuracy.


    PubMed Central

    Richards, Jodi; Johnson, Ken; Liu, Huanting; Oke, Stephen McMahon. Muse; Carter, Lester; Naismith, James H; White, Malcolm F


    Hel308 is a superfamily 2 helicase conserved in eukaryotes and archaea. It is thought to function in the early stages of recombination following replication fork arrest, and has a specificity for removal of the lagging strand in model replication forks. A homologous helicase constitutes the N-terminal domain of human DNA polymerase Q. The Drosophila homologue mus301 is implicated in double strand break repair and meiotic recombination. We have solved the high-resolution crystal structure of Hel308 from the crenarchaeon Sulfolobus solfataricus, revealing a five-domain structure with a central pore lined with essential DNA binding residues. The fifth domain is shown to act as a molecular brake, clamping the ssDNA extruded through the central pore of the helicase structure to limit the enzyme’s helicase activity. This provides an elegant mechanism to tune the enzyme’s processivity to its functional role. Hel308 can displace streptavidin from a biotinylated DNA molecule, suggesting that one function of the enzyme may be in the removal of bound proteins at stalled replication forks and recombination intermediates. PMID:18056710

  20. ATP P2X receptors downregulate AMPA receptor trafficking and postsynaptic efficacy in hippocampal neurons.


    Pougnet, Johan-Till; Toulme, Estelle; Martinez, Audrey; Choquet, Daniel; Hosy, Eric; Boué-Grabot, Eric


    P2X receptors (P2XRs) are ATP-gated cation channels widely expressed in the brain where they mediate action of extracellular ATP released by neurons or glia. Although purinergic signaling has multiple effects on synaptic transmission and plasticity, P2XR function at brain synapses remains to be established. Here, we show that activation of postsynaptic P2XRs by exogenous ATP or noradrenaline-dependent glial release of endogenous ATP decreases the amplitude of miniature excitatory postsynaptic currents and AMPA-evoked currents in cultured hippocampal neurons. We also observed a P2X-mediated depression of field potentials recorded in CA1 region from brain slices. P2X2Rs trigger dynamin-dependent internalization of AMPA receptors (AMPARs), leading to reduced surface AMPARs in dendrites and at synapses. AMPAR alteration required calcium influx through opened ATP-gated channels and phosphatase or CamKII activities. These findings indicate that postsynaptic P2XRs play a critical role in regulating the surface expression of AMPARs and thereby regulate the synaptic strength.

  1. P2P Technology for High-Performance Computing: An Overview

    NASA Technical Reports Server (NTRS)

    Follen, Gregory J. (Technical Monitor); Berry, Jason


    The transition from cluster computing to peer-to-peer (P2P) high-performance computing has recently attracted the attention of the computer science community. It has been recognized that existing local networks and dedicated clusters of headless workstations can serve as inexpensive yet powerful virtual supercomputers. It has also been recognized that the vast number of lower-end computers connected to the Internet stay idle for as long as 90% of the time. The growing speed of Internet connections and the high availability of free CPU time encourage exploration of the possibility to use the whole Internet rather than local clusters as massively parallel yet almost freely available P2P supercomputer. As a part of a larger project on P2P high-performance computing, it has been my goal to compile an overview of the 2P2 paradigm. I have studied various P2P platforms and I have compiled systematic brief descriptions of their most important characteristics. I have also experimented and obtained hands-on experience with selected P2P platforms focusing on those that seem promising with respect to P2P high-performance computing. I have also compiled relevant literature and web references. I have prepared a draft technical report and I have summarized my findings in a poster paper.

  2. Involvement of P2X7 receptor in neuronal degeneration triggered by traumatic injury

    PubMed Central

    Nadal-Nicolás, Francisco M.; Galindo-Romero, Caridad; Valiente-Soriano, Francisco J.; Barberà-Cremades, María; deTorre-Minguela, Carlos; Salinas-Navarro, Manuel; Pelegrín, Pablo; Agudo-Barriuso, Marta


    Axonal injury is a common feature of central nervous system insults that culminates with the death of the affected neurons, and an irreversible loss of function. Inflammation is an important component of the neurodegenerative process, where the microglia plays an important role by releasing proinflammatory factors as well as clearing the death neurons by phagocytosis. Here we have identified the purinergic signaling through the P2X7 receptor as an important component for the neuronal death in a model of optic nerve axotomy. We have found that in P2X7 receptor deficient mice there is a delayed loss of retinal ganglion cells and a decrease of phagocytic microglia at early times points after axotomy. In contralateral to the axotomy retinas, P2X7 receptor controlled the numbers of phagocytic microglia, suggesting that extracellular ATP could act as a danger signal activating the P2X7 receptor in mediating the loss of neurons in contralateral retinas. Finally, we show that intravitreal administration of the selective P2X7 receptor antagonist A438079 also delays axotomy-induced retinal ganglion cell death in retinas from wild type mice. Thus, our work demonstrates that P2X7 receptor signaling is involved in neuronal cell death after axonal injury, being P2X7 receptor antagonism a potential therapeutic strategy. PMID:27929040

  3. Blockade of P2X7 receptors or pannexin-1 channels similarly attenuates postischemic damage

    PubMed Central

    Cisneros-Mejorado, Abraham; Gottlieb, Miroslav; Cavaliere, Fabio; Magnus, Tim; Koch-Nolte, Friederich; Scemes, Eliana; Pérez-Samartín, Alberto; Matute, Carlos


    The role of P2X7 receptors and pannexin-1 channels in ischemic damage remains controversial. Here, we analyzed their contribution to postanoxic depolarization after ischemia in cultured neurons and in brain slices. We observed that pharmacological blockade of P2X7 receptors or pannexin-1 channels delayed the onset of postanoxic currents and reduced their slope, and that simultaneous inhibition did not further enhance the effects of blocking either one. These results were confirmed in acute cortical slices from P2X7 and pannexin-1 knockout mice. Oxygen-glucose deprivation in cortical organotypic cultures caused neuronal death that was reduced with P2X7 and pannexin-1 blockers as well as in organotypic cultures derived from mice lacking P2X7 and pannexin 1. Subsequently, we used transient middle cerebral artery occlusion to monitor the neuroprotective effect of those drugs in vivo. We found that P2X7 and pannexin-1 antagonists, and their ablation in knockout mice, substantially attenuated the motor symptoms and reduced the infarct volume to ~50% of that in vehicle-treated or wild-type animals. These results show that P2X7 receptors and pannexin-1 channels are major mediators of postanoxic depolarization in neurons and of brain damage after ischemia, and that they operate in the same deleterious signaling cascade leading to neuronal and tissue demise. PMID:25605289

  4. Orientation of Zn3P2 films via phosphidation of Zn precursors

    NASA Astrophysics Data System (ADS)

    Katsube, Ryoji; Nose, Yoshitaro


    Orientation of solar absorber is an important factor to achieve high efficiency of thin film solar cells. In the case of Zn3P2 which is a promising absorber of low-cost and high-efficiency solar cells, (110)/(001) orientation was only reported in previous studies. We have successfully prepared (101)-oriented Zn3P2 films by phosphidation of (0001)-oriented Zn films at 350 °C. The phosphidation mechanism of Zn is discussed through STEM observations on the partially-reacted sample and the consideration of the relationship between the crystal structures of Zn and Zn3P2 . We revealed that (0001)-oriented Zn led to nucleation of (101)-oriented Zn3P2 due to the similarity in atomic arrangement between Zn and Zn3P2 . The electrical resistivity of the (101)-oriented Zn3P2 film was lower than those of (110)/(001)-oriented films, which is an advantage of the phosphidation technique to the growth processes in previous works. The results in this study demonstrated that well-conductive Zn3P2 films could be obtained by controlling orientations of crystal grains, and provide a guiding principle for microstructure control in absorber materials.

  5. Important roles of P2Y receptors in the inflammation and cancer of digestive system

    PubMed Central

    Wan, Han-Xing; Hu, Jian-Hong; Xie, Rei; Yang, Shi-Ming; Dong, Hui


    Purinergic signaling is important for many biological processes in humans. Purinoceptors P2Y are widely distributed in human digestive system and different subtypes of P2Y receptors mediate different physiological functions from metabolism, proliferation, differentiation to apoptosis etc. The P2Y receptors are essential in many gastrointestinal functions and also involve in the occurrence of some digestive diseases. Since different subtypes of P2Y receptors are present on the same cell of digestive organs, varying subtypes of P2Y receptors may have opposite or synergetic functions on the same cell. Recently, growing lines of evidence strongly suggest the involvement of P2Y receptors in the pathogenesis of several digestive diseases. In this review, we will focus on their important roles in the development of digestive inflammation and cancer. We anticipate that as the special subtypes of P2Y receptors are studied in depth, specific modulators for them will have good potentials to become promising new drugs to treat human digestive diseases in the near future. PMID:26908460

  6. Blockade of P2X7 receptors or pannexin-1 channels similarly attenuates postischemic damage.


    Cisneros-Mejorado, Abraham; Gottlieb, Miroslav; Cavaliere, Fabio; Magnus, Tim; Koch-Nolte, Friederich; Scemes, Eliana; Pérez-Samartín, Alberto; Matute, Carlos


    The role of P2X7 receptors and pannexin-1 channels in ischemic damage remains controversial. Here, we analyzed their contribution to postanoxic depolarization after ischemia in cultured neurons and in brain slices. We observed that pharmacological blockade of P2X7 receptors or pannexin-1 channels delayed the onset of postanoxic currents and reduced their slope, and that simultaneous inhibition did not further enhance the effects of blocking either one. These results were confirmed in acute cortical slices from P2X7 and pannexin-1 knockout mice. Oxygen-glucose deprivation in cortical organotypic cultures caused neuronal death that was reduced with P2X7 and pannexin-1 blockers as well as in organotypic cultures derived from mice lacking P2X7 and pannexin 1. Subsequently, we used transient middle cerebral artery occlusion to monitor the neuroprotective effect of those drugs in vivo. We found that P2X7 and pannexin-1 antagonists, and their ablation in knockout mice, substantially attenuated the motor symptoms and reduced the infarct volume to ~50% of that in vehicle-treated or wild-type animals. These results show that P2X7 receptors and pannexin-1 channels are major mediators of postanoxic depolarization in neurons and of brain damage after ischemia, and that they operate in the same deleterious signaling cascade leading to neuronal and tissue demise.

  7. P2X7 receptors trigger ATP exocytosis and modify secretory vesicle dynamics in neuroblastoma cells.


    Gutiérrez-Martín, Yolanda; Bustillo, Diego; Gómez-Villafuertes, Rosa; Sánchez-Nogueiro, Jesús; Torregrosa-Hetland, Cristina; Binz, Thomas; Gutiérrez, Luis Miguel; Miras-Portugal, María Teresa; Artalejo, Antonio R


    Previously, we reported that purinergic ionotropic P2X7 receptors negatively regulate neurite formation in Neuro-2a (N2a) mouse neuroblastoma cells through a Ca(2+)/calmodulin-dependent kinase II-related mechanism. In the present study we used this cell line to investigate a parallel though faster P2X7 receptor-mediated signaling pathway, namely Ca(2+)-regulated exocytosis. Selective activation of P2X7 receptors evoked exocytosis as assayed by high resolution membrane capacitance measurements. Using dual-wavelength total internal reflection microscopy, we have observed both the increase in near-membrane Ca(2+) concentration and the exocytosis of fluorescently labeled vesicles in response to P2X7 receptor stimulation. Moreover, activation of P2X7 receptors also affects vesicle motion in the vertical and horizontal directions, thus, involving this receptor type in the control of early steps (docking and priming) of the secretory pathway. Immunocytochemical and RT-PCR experiments evidenced that N2a cells express the three neuronal SNAREs as well as vesicular nucleotide and monoamine (VMAT-1 and VMAT-2) transporters. Biochemical measurements indicated that ionomycin induced a significant release of ATP from N2a cells. Finally, P2X7 receptor stimulation and ionomycin increased the incidence of small transient inward currents, reminiscent of postsynaptic quantal events observed at synapses. Small transient inward currents were dependent on extracellular Ca(2+) and were abolished by Brilliant Blue G, suggesting they were mediated by P2X7 receptors. Altogether, these results suggest the existence of a positive feedback mechanism mediated by P2X7 receptor-stimulated exocytotic release of ATP that would act on P2X7 receptors on the same or neighbor cells to further stimulate its own release and negatively control N2a cell differentiation.

  8. P2X7 Receptors Trigger ATP Exocytosis and Modify Secretory Vesicle Dynamics in Neuroblastoma Cells*

    PubMed Central

    Gutiérrez-Martín, Yolanda; Bustillo, Diego; Gómez-Villafuertes, Rosa; Sánchez-Nogueiro, Jesús; Torregrosa-Hetland, Cristina; Binz, Thomas; Gutiérrez, Luis Miguel; Miras-Portugal, María Teresa; Artalejo, Antonio R.


    Previously, we reported that purinergic ionotropic P2X7 receptors negatively regulate neurite formation in Neuro-2a (N2a) mouse neuroblastoma cells through a Ca2+/calmodulin-dependent kinase II-related mechanism. In the present study we used this cell line to investigate a parallel though faster P2X7 receptor-mediated signaling pathway, namely Ca2+-regulated exocytosis. Selective activation of P2X7 receptors evoked exocytosis as assayed by high resolution membrane capacitance measurements. Using dual-wavelength total internal reflection microscopy, we have observed both the increase in near-membrane Ca2+ concentration and the exocytosis of fluorescently labeled vesicles in response to P2X7 receptor stimulation. Moreover, activation of P2X7 receptors also affects vesicle motion in the vertical and horizontal directions, thus, involving this receptor type in the control of early steps (docking and priming) of the secretory pathway. Immunocytochemical and RT-PCR experiments evidenced that N2a cells express the three neuronal SNAREs as well as vesicular nucleotide and monoamine (VMAT-1 and VMAT-2) transporters. Biochemical measurements indicated that ionomycin induced a significant release of ATP from N2a cells. Finally, P2X7 receptor stimulation and ionomycin increased the incidence of small transient inward currents, reminiscent of postsynaptic quantal events observed at synapses. Small transient inward currents were dependent on extracellular Ca2+ and were abolished by Brilliant Blue G, suggesting they were mediated by P2X7 receptors. Altogether, these results suggest the existence of a positive feedback mechanism mediated by P2X7 receptor-stimulated exocytotic release of ATP that would act on P2X7 receptors on the same or neighbor cells to further stimulate its own release and negatively control N2a cell differentiation. PMID:21292765

  9. Neuroprotection Mediated by P2Y13 Nucleotide Receptors in Neurons

    PubMed Central

    Pérez-Sen, Raquel; Queipo, Mª José; Morente, Verónica; Ortega, Felipe; Delicado, Esmerilda G.; Miras-Portugal, Mª Teresa


    ADP-specific P2Y13 receptor constitutes one of the most recently identified nucleotide receptor and the understanding of their physiological role is currently under investigation. Cerebellar astrocytes and granule neurons provide excellent models to study P2Y13 expression and function since the first identification of ADP-evoked calcium responses not attributable to the related P2Y1 receptor was performed in these cell populations. In this regard, all responses induced by ADP analogues in astrocytes resulted to be Gi-coupled activities mediated by P2Y13 instead of P2Y1 receptors. Similarly, both glycogen synthase kinase-3 (GSK3) and ERK1/2 signaling triggered by 2MeSADP in cerebellar granule neurons were also dependent on Gi-coupled receptors, and mediated by PI3K activity. In granule neurons, P2Y13 receptor was specifically coupled to the main neuronal survival PI3K/Akt-cascade targeting GSK3 phosphorylation. GSK3 inhibition led to nuclear translocation of transcriptional targets, including β-catenin and Nrf2. The activation of the Nrf2/heme oxygenase-1 (HO-1) axis was responsible for the prosurvival effect against oxidative stress. In addition, P2Y13-mediated ERK1/2 signaling in granule neurons also triggered activation of transcription factors, such as CREB, which underlined the antiapoptotic action against glutamate-induced excitotoxicity. Finally, a novel signaling mechanism has been recently described for a P2Y13 receptor in granule neurons that involved the expression of a dual protein phosphatase, DUSP2. This activity contributed to regulate MAPK activation after genotoxic stress. In conclusion, P2Y13 receptors harbored in cerebellar astrocytes and granule neurons exhibit specific signaling properties that link them to specialized functions at the level of neuroprotection and trophic activity in both cerebellar cell populations. PMID:25750704

  10. Current knowledge on the role of P2Y receptors in cardioprotection against ischemia-reperfusion.


    Djerada, Zoubir; Feliu, Catherine; Richard, Vincent; Millart, Hervé


    During ischemia, numerous effective endogenous extracellular mediators have been identified, particularly, nucleosides such as adenosine as well as purinergic and pyrimidinergic nucleotides. They may play important regulatory roles within the cardiovascular system and notably as cardio-protectants. Indeed, the distribution of the P2Y receptors in mammalian heart includes several cellular constituents relevant for the pathophysiology of myocardial ischemia. Beside the well-known cardioprotective effect of adenosine, the additional protective role of P2Y receptors has emerged. However, interpretation of experimental results may be sometimes perplexing. This is due to the variability of: the experimental models, the endpoints criteria, the chemical structure of agonist and antagonist ligands and their concentrations, the sequences of drug administration with respect to the model used (before and/or during and/or after ischemia). The net effect may be in the opposite direction after a transient or a prolonged stimulation. Nevertheless, the overall reading of published data highlights the beneficial role of the P2Y2/4 receptor stimulation, the useful and synergistic role of P2Y6/11 receptor activation and even of the P2Y11 receptor alone in cardioprotection. More, the P2Y11 receptor could be involved in counter-regulation of profibrotic processes. Paradoxically, transient P2X7 receptor stimulation could contribute to the net cardioprotective effect of ATP. Recently, experimental data have shown that blocking the P2Y12 receptor after ischemia confers cardioprotection independently of platelet antiaggregatory effect. This suggests for P2Y receptors an important role in primary prevention and as a therapeutic target in myocardial protection during ischemia and reperfusion.

  11. Research of trust model in P2P network based on trusted computing

    NASA Astrophysics Data System (ADS)

    Li, Rong; Li, Lei


    In order to strengthen the security of P2P networks, it is necessary to build trust relationships between nodes of networks. However, the traditional trust evaluation models can't resist the attacks of Pseudospoofing and Pseudostheft effectively. To resolve the problems, in this paper, the trusted computing method is introduced into P2P networks, and an idea of group trust model based on trusted computing methods is proposed. In the process of trust evaluation, the model can realize the anonymous attestation of the node body, which improves the creditability of trust relationships between nodes and resolves the security problems of P2P networks.

  12. Discovery of diarylurea P2Y(1) antagonists with improved aqueous solubility.


    Wang, Tammy C; Qiao, Jennifer X; Clark, Charles G; Jua, Ji; Price, Laura A; Wu, Qimin; Chang, Ming; Zheng, Joanna; Huang, Christine S; Everlof, Gerry; Schumacher, William A; Wong, Pancras C; Seiffert, Dietmar A; Stewart, Anne B; Bostwick, Jeffrey S; Crain, Earl J; Watson, Carol A; Rehfuss, Robert; Wexler, Ruth R; Lam, Patrick Y S


    Preclinical data suggests that P2Y1 antagonists, such as diarylurea compound 1, may provide antithrombotic efficacy similar to P2Y12 antagonists and may have the potential of providing reduced bleeding liabilities. This manuscript describes a series of diarylureas bearing solublizing amine side chains as potent P2Y1 antagonists. Among them, compounds 2l and 3h had improved aqueous solubility and maintained antiplatelet activity compared with compound 1. Compound 2l was moderately efficacious in both rat and rabbit thrombosis models and had a moderate prolongation of bleeding time in rats similar to that of compound 1.

  13. A Prognostic Method for Scheduling Maintenance on the P2- Marx Modulator

    SciTech Connect

    Benwell, Andrew; Burkhart, Craig; Kemp, Mark; Macken, Koen; Nguyen, Minh; MacNair, Dave; Olsen, Jeff; Larsen, Ray; /SLAC


    The SLAC National Accelerator Laboratory is developing a second generation Marx-type modulator for the ILC, the P2-Marx. The modulator is expected to operate reliably in excess of 10{sup 5} hours with minimum downtime. A prognostic system is being implemented with the development of the P2-Marx to monitor and track the health of key high voltage components. This paper discusses the way in which the prognostic system will be implemented and used to monitor the health of the P2-Marx modulator.

  14. Diversity of the P2 protein among nontypeable Haemophilus influenzae isolates.

    PubMed Central

    Bell, J; Grass, S; Jeanteur, D; Munson, R S


    The genes for outer membrane protein P2 of four nontypeable Haemophilus influenzae strains were cloned and sequenced. The derived amino acid sequences were compared with the outer membrane protein P2 sequence from H. influenzae type b MinnA and the sequences of P2 from three additional nontypeable H. influenzae strains. The sequences were 76 to 94% identical. The sequences had regions with considerable variability separated by regions which were highly conserved. The variable regions mapped to putative surface-exposed loops of the protein. PMID:8188390

  15. New P2X3 receptor antagonists. Part 2: Identification and SAR of quinazolinones.


    Szántó, Gábor; Makó, Attila; Vágó, István; Hergert, Tamás; Bata, Imre; Farkas, Bence; Kolok, Sándor; Vastag, Mónika


    Numerous potent P2X3 antagonists have been discovered and the therapeutic potential of P2X3 antagonism already comprises proof-of-concept data obtained in clinical trials with the most advanced compound. We have lately reported the discovery and optimization of thia-triaza-tricycle compounds with potent P2X3 antagonistic properties. This Letter describes the SAR of a back-up series containing a 4-oxo-quinazoline central ring. The discovery of the highly potent compounds 51 is presented.

  16. In vitro DNA binding of the archaeal protein Sso7d induces negative supercoiling at temperatures typical for thermophilic growth.

    PubMed Central

    López-García, P; Knapp, S; Ladenstein, R; Forterre, P


    The topological state of DNA in hyperthermophilic archaea appears to correspond to a linking excess in comparison with DNA in mesophilic organisms. Since DNA binding proteins often contribute to the control of DNA topology by affecting DNA geometry in the presence of DNA topoisomerases, we tested whether the histone-like protein Sso7d from the hyperthermophilic archaeon Sulfolobus solfataricus alters DNA conformation. In ligase-mediated supercoiling assays carried out at 37, 60, 70, 80 and 90 degrees C we found that DNA binding of increasing amounts of Sso7d led to a progressive decrease in plasmid linking number (Lk), producing negative supercoiling. Identical unwinding effects were observed when recombinant non-methylated Sso7d was used. For a given Sso7d concentration the DNA unwinding induced was augmented with increasing temperature. However, after correction for the overwinding effect of high temperature on DNA, plasmids ligated at 60-90 degrees C exhibited similar sigma values at the highest Sso7d concentrations assayed. These results suggest that Sso7d may play a compensatory role in vivo by counteracting the overwinding effect of high temperature on DNA. Additionally, Sso7d unwinding could be involved in the topological changes observed during thermal stress (heat and cold shock), playing an analogous role in crenarchaeal cells to that proposed for HU in bacteria. PMID:9580681

  17. Photodetectors and birefringence in ZnP2-С2h5 crystals

    NASA Astrophysics Data System (ADS)

    Stamov, I. G.; Syrbu, N. N.; Dorogan, A. V.


    The spectral dependences of refractive indexes no(n⊥), ne(n||) and Δn=no(n⊥)-ne(n||) were studied in ZnP2-C2h5 crystals. The intersection of no(n⊥) and ne(n||) was found for λ0=0.906 μm. The crystal possesses positive dispersion Δn=no(n⊥)-ne(n||) in the region where λ>λ0, and a negative dispersion is observed in the region where λ<λ0. The electrical, spectral and azimuth characteristics of monolith n-р- and Ме-n-р-ZnP2C2h5 and discrete ZnP2-C2h5-ZnP2-D48 structures were studied, and a prognosis was made on the usage perspective of these devices.

  18. An Escherichia coli gene required for bacteriophage P2-lambda interference.

    PubMed Central

    Ghisotti, D; Zangrossi, S; Sironi, G


    The gene old of bacteriophage P2 is known to (i) cause interference with phage lambda growth; (ii) kill recB- mutants of Escherichia coli after P2 infection; and (iii) determine increased sensitivity of P2 lysogenic cells to X-ray irradiation. In all of these phenomena, inhibition of protein synthesis occurs. We have isolated bacterial mutants, named pin (P2 interference), able to suppress all of the above-mentioned phenomena caused by the old+ gene product and the concurrent protein synthesis inhibition. Pin mutations are recessive, map at 12 min on the E. coli map, and identify a new gene. Satellite bacteriophage P4 does not plate on pin-3 mutant strains and causes cell lethality and protein synthesis inhibition in such mutants. P4 mutants able to grow on pin-3 strains have been isolated. PMID:6355505

  19. TRI P2 and Automotive Suppliers: Supplier information specific to the automotive industry sector

    EPA Pesticide Factsheets

    TRI’s Pollution Prevention (P2) Search Tool is one source of information to identify how facilities work with their suppliers and how suppliers work with their customers to achieve environmental improvement.

  20. Molecular cloning and developmental expression of foxP2 in zebrafish.


    Bonkowsky, Joshua L; Chien, Chi-Bin


    Forkhead domain transcription factors are a large gene family with multiple roles in development. FOXP2, a recently identified member of this family, has been shown to be critical for normal development of language in humans, but little is known of its broader function during nervous system development. We report here the cloning of foxP2, the zebrafish ortholog of FOXP2. Zebrafish FoxP2 is highly conserved in its zinc-finger and forkhead domains, but lacks the large glutamine repeat characteristic of its orthologs. In examining the spatial and temporal distribution of foxP2 during development, we find that it is specifically expressed in many domains of the nervous system, including the telencephalon, diencephalon, cerebellum, hindbrain, tectum, retinal ganglion cells, and spinal cord. Thus, in addition to specific roles in language development, foxP2 likely has a more general conserved role in nervous system development.

  1. Dispersion of Phonon Surface Polaritons in ZnGeP2: Anisotropy and Temperature Impacts

    NASA Astrophysics Data System (ADS)

    Shportko, K. V.; Otto, A.; Venger, E. F.


    Zinc germanium diphosphide (ZnGeP2) is an attractive and promising functional material for different devices of the nano- and optoelectronics. In this paper, dispersion of phonon surface polaritons (PSPs) in ZnGeP2 has been studied in the 200-500-cm-1 spectral range at 4 and 300 K. Dispersion of "real" and "virtual" PSPs were calculated for C-axis being normal and parallel to the surface. Anisotropy in ZnGeP2 leads to the different numbers of PSP dispersion branches for different orientations of the sample. The temperature-dependent phonon contributions in the dielectric permittivity shift dispersion of the surface polaritons in ZnGeP2 to the higher wavenumbers at 4 K. We have shown that experimental dispersion of PSP is in agreement with theory.

  2. The impact of playout policy on the performance of P2P live streaming: or how not to kill your P2P advantage

    NASA Astrophysics Data System (ADS)

    Vassilakis, Constantinos; Laoutaris, Nikolaos; Stavrakakis, Ioannis


    In this paper we examine the impact of the adopted playout policy on the performance of P2P live streaming systems. We argue and demonstrate experimentally that (popular) playout policies which permit the divergence of the playout points of different nodes can deteriorate drastically the performance of P2P live streaming. Consequently, we argue in favor of keeping different playout points "near-in-time", even if this requires sacrificing (dropping) some late frames that could otherwise be rendered (assuming no strict bidirectional interactivity requirements are in place). Such nearly synchronized playout policies create "positive correlation" with respect to the available frames at different playout buffers. Therefore, they increase the number of upstream relay nodes from which a node can pull frames and thus boost the playout quality of both single-parent (tree) and multiple-parent (mesh) systems. On the contrary, diverging playout points reduce the number of upstream parents that can offer a gapless relay of the stream. This is clearly undesirable and should be avoided as it contradicts the fundamental philosophy of P2P systems which is to supplement an original service point with as many additional ones presented by the very own users of the service.

  3. Activation of P2X7 and P2Y11 purinergic receptors inhibits migration and normalizes tumor-derived endothelial cells via cAMP signaling

    PubMed Central

    Avanzato, D.; Genova, T.; Fiorio Pla, A.; Bernardini, M.; Bianco, S.; Bussolati, B.; Mancardi, D.; Giraudo, E.; Maione, F.; Cassoni, P.; Castellano, I.; Munaron, L.


    Purinergic signaling is involved in inflammation and cancer. Extracellular ATP accumulates in tumor interstitium, reaching hundreds micromolar concentrations, but its functional role on tumor vasculature and endothelium is unknown. Here we show that high ATP doses (>20 μM) strongly inhibit migration of endothelial cells from human breast carcinoma (BTEC), but not of normal human microvascular EC. Lower doses (1–10 mm result ineffective. The anti-migratory activity is associated with cytoskeleton remodeling and is significantly prevented by hypoxia. Pharmacological and molecular evidences suggest a major role for P2X7R and P2Y11R in ATP-mediated inhibition of TEC migration: selective activation of these purinergic receptors by BzATP mimics the anti-migratory effect of ATP, which is in turn impaired by their pharmacological or molecular silencing. Downstream pathway includes calcium-dependent Adenilyl Cyclase 10 (AC10) recruitment, cAMP release and EPAC-1 activation. Notably, high ATP enhances TEC-mediated attraction of human pericytes, leading to a decrease of endothelial permeability, a hallmark of vessel normalization. Finally, we provide the first evidence of in vivo P2X7R expression in blood vessels of murine and human breast carcinoma. In conclusion, we have identified a purinergic pathway selectively acting as an antiangiogenic and normalizing signal for human tumor-derived vascular endothelium. PMID:27586846

  4. Bcl-2 promoter sequence G-quadruplex interactions with three planar and non-planar cationic porphyrins: TMPyP4, TMPyP3, and TMPyP2.


    Le, Vu H; Nagesh, Narayana; Lewis, Edwin A


    The interactions of three related cationic porphyrins, TMPyP4, TMPyP3 and TMPyP2, with a WT 39-mer Bcl-2 promoter sequence G-quadruplex were studied using Circular Dichroism, ESI mass spectrometry, Isothermal Titration Calorimetry, and Fluorescence spectroscopy. The planar cationic porphyrin TMPyP4 (5, 10, 15, 20-meso-tetra (N-methyl-4-pyridyl) porphine) is shown to bind to a WT Bcl-2 G-quadruplex via two different binding modes, an end binding mode and a weaker mode attributed to intercalation. The related non-planar ligands, TMPyP3 and TMPyP2, are shown to bind to the Bcl-2 G-quadruplex by a single mode. ESI mass spectrometry experiments confirmed that the saturation stoichiometry is 4:1 for the TMPyP4 complex and 2:1 for the TMPyP2 and TMPyP3 complexes. ITC experiments determined that the equilibrium constant for formation of the (TMPyP4)1/DNA complex (K1 = 3.7 × 10(6)) is approximately two orders of magnitude greater than the equilibrium constant for the formation of the (TMPyP2)1/DNA complex, (K1 = 7.0 × 10(4)). Porphyrin fluorescence is consistent with intercalation in the case of the (TMPyP4)3/DNA and (TMPyP4)4/DNA complexes. The non-planar shape of the TMPyP2 and TMPyP3 molecules results in both a reduced affinity for the end binding interaction and the elimination of the intercalation binding mode.

  5. P2Y12 receptor-mediated activation of spinal microglia and p38MAPK pathway contribute to cancer-induced bone pain

    PubMed Central

    Liu, Mingjuan; Yao, Ming; Wang, Hanqi; Xu, Longsheng; Zheng, Ying; Huang, Bing; Ni, Huadong; Xu, Shijie; Zhou, Xuyan; Lian, Qingquan


    Background Cancer-induced bone pain (CIBP) is one of the most challenging clinical problems due to a lack of understanding the mechanisms. Recent evidence has demonstrated that activation of microglial G-protein-coupled P2Y12 receptor (P2Y12R) and proinflammatory cytokine production play an important role in neuropathic pain generation and maintenance. However, whether P2Y12R is involved in CIBP remains unknown. Methods The purpose of this study was to investigate the role of P2Y12R in CIBP and its molecular mechanisms. Using the bone cancer model inoculated with Walker 256 tumor cells into the left tibia of Sprague Dawley rat, we blocked spinal P2Y12R through intrathecal administration of its selective antagonist MRS2395 (400 pmol/µL, 15 µL). Results We found that not only the ionized calcium-binding adapter molecule 1 (Iba-1)-positive microglia in the ipsilateral spinal cord but also mechanical allodynia was significantly inhibited. Furthermore, it decreased the phosphorylation of p38 mitogen-activated protein kinase (p38 MAPK) and the production of proinflammatory cytokines interleukin-1β (IL-1β) and interleukin-6 (IL-6), whereas it increased tumor necrosis factor-α (TNF-α). Conclusion Taken together, our present results suggest that microglial P2Y12R in the spinal cord may contribute to CIBP by the activation of spinal microglia and p38MAPK pathway, thus identifying a potential therapeutic target for the treatment of CIBP. PMID:28243146

  6. IL-1ra Secreted by ATP-Induced P2Y2 Negatively Regulates MUC5AC Overproduction via PLCβ3 during Airway Inflammation.


    Jeong, Jee-Yeong; Kim, Jiwook; Kim, Bokyoum; Kim, Joowon; Shin, Yusom; Kim, Judeok; Ryu, Siejeong; Yang, Yu-Mi; Song, Kyoung Seob


    Mucus secretion is often uncontrolled in many airway inflammatory diseases of humans. Identifying the regulatory pathway(s) of mucus gene expression, mucus overproduction, and hypersecretion is important to alleviate airway inflammation in these diseases. However, the regulatory signaling pathway controlling mucus overproduction has not been fully identified yet. In this study, we report that the ATP/P2Y2 complex secretes many cytokines and chemokines to regulate airway inflammation, among which IL-1 receptor antagonist (IL-1ra) downregulates MUC5AC gene expression via the inhibition of Gαq-induced Ca(2+) signaling. IL-1ra inhibited IL-1α protein expression and secretion, and vice versa. Interestingly, ATP/P2Y2-induced IL-1ra and IL-1α secretion were both mediated by PLCβ3. A dominant-negative mutation in the PDZ-binding domain of PLCβ3 inhibited ATP/P2Y2-induced IL-1ra and IL-1α secretion. IL-1α in the presence of the ATP/P2Y2 complex activated the ERK1/2 pathway in a greater degree and for a longer duration than the ATP/P2Y2 complex itself, which was dramatically inhibited by IL-1ra. These findings suggest that secreted IL-1ra exhibits a regulatory effect on ATP/P2Y2-induced MUC5AC gene expression, through inhibition of IL-1α secretion, to maintain the mucus homeostasis in the airway. Therefore, IL-1ra could be an excellent modality for regulating inflamed airway microenvironments in respiratory diseases.

  7. Porphyromonas gingivalis fimbriae dampen P2X7-dependent IL-1β secretion

    PubMed Central

    Morandini, Ana Carolina; Ramos-Junior, Erivan S.; Potempa, Jan; Nguyen, Ky-Anh; Oliveira, Ana Carolina; Bellio, Maria; Ojcius, David M.; Scharfstein, Julio; Coutinho-Silva, Robson


    Porphyromonas gingivalis is a major contributor to the pathogenesis of periodontitis, an infection-driven inflammatory disease that leads to bone destruction. This pathogen stimulates pro-IL-1β synthesis but not mature IL-1β secretion, unless the P2X7 receptor is activated by extracellular ATP. Here, we investigated the role of Pg fimbriae in eATP-induced IL-1β release. Bone marrow derived macrophages (BMDMs) from wild type (WT) or P2X7-deficient mice were infected with Pg (strain 381) or isogenic fimbriae deficient (strain DPG3) with or without subsequent eATP stimulation. DPG3 induced higher IL-1β secretion after eATP stimulation compared to 381 in WT BMDMs, but not in P2X7-deficient cells. This mechanism was dependent of K+ efflux and Ca2+-iPLA2 activity. Accordingly, non-fimbriated Pg failed to inhibit apoptosis via eATP/P2X7-pathway. Furthermore, Pg-driven stimulation of IL-1β was TLR2- and MyD88-dependent, and irrespective of fimbriae expression. Fimbriae-dependent down-modulation of IL-1β was selective, as levels of other cytokines remained unaffected by P2X7 deficiency. Confocal microscopy demonstrated the presence of discrete P2X7 expression in the absence of Pg stimulation which was enhanced by 381-stimulated cells. Notably, DPG3-infected macrophages revealed a distinct pattern of P2X7 receptor expression with a markedly foci formation. Collectively, these data demonstrate that eATP-induced IL-1β secretion is impaired by Pg fimbriae in a P2X7-dependent manner. PMID:24925032

  8. Uridine adenosine tetraphosphate is a novel neurogenic P2Y1 receptor activator in the gut

    PubMed Central

    Durnin, Leonie; Hwang, Sung Jin; Kurahashi, Masaaki; Drumm, Bernard T.; Ward, Sean M.; Sasse, Kent C.; Sanders, Kenton M.; Mutafova-Yambolieva, Violeta N.


    Enteric purinergic motor neurotransmission, acting through P2Y1 receptors (P2Y1R), mediates inhibitory neural control of the intestines. Recent studies have shown that NAD+ and ADP ribose better meet criteria for enteric inhibitory neurotransmitters in colon than ATP or ADP. Here we report that human and murine colon muscles also release uridine adenosine tetraphosphate (Up4A) spontaneously and upon stimulation of enteric neurons. Release of Up4A was reduced by tetrodotoxin, suggesting that at least a portion of Up4A is of neural origin. Up4A caused relaxation (human and murine colons) and hyperpolarization (murine colon) that was blocked by the P2Y1R antagonist, MRS 2500, and by apamin, an inhibitor of Ca2+-activated small-conductance K+ (SK) channels. Up4A responses were greatly reduced or absent in colons of P2ry1−/− mice. Up4A induced P2Y1R–SK-channel–mediated hyperpolarization in isolated PDGFRα+ cells, which are postjunctional targets for purinergic neurotransmission. Up4A caused MRS 2500-sensitive Ca2+ transients in human 1321N1 astrocytoma cells expressing human P2Y1R. Up4A was more potent than ATP, ADP, NAD+, or ADP ribose in colonic muscles. In murine distal colon Up4A elicited transient P2Y1R-mediated relaxation followed by a suramin-sensitive contraction. HPLC analysis of Up4A degradation suggests that exogenous Up4A first forms UMP and ATP in the human colon and UDP and ADP in the murine colon. Adenosine then is generated by extracellular catabolism of ATP and ADP. However, the relaxation and hyperpolarization responses to Up4A are not mediated by its metabolites. This study shows that Up4A is a potent native agonist for P2Y1R and SK-channel activation in human and mouse colon. PMID:25341729

  9. Critical Evaluation of P2X7 Receptor Antagonists in Selected Seizure Models

    PubMed Central

    Fischer, Wolfgang; Franke, Heike; Krügel, Ute; Müller, Heiko; Dinkel, Klaus; Lord, Brian; Letavic, Michael A.; Henshall, David C.; Engel, Tobias


    The ATP-gated P2X7 receptor (P2X7R) is a non-selective cation channel which senses high extracellular ATP concentrations and has been suggested as a target for the treatment of neuroinflammation and neurodegenerative diseases. The use of P2X7R antagonists may therefore be a viable approach for treating CNS pathologies, including epileptic disorders. Recent studies showed anticonvulsant potential of P2X7R antagonists in certain animal models. To extend this work, we tested three CNS-permeable P2X7R blocker (Brilliant Blue G, AFC-5128, JNJ-47965567) and a natural compound derivative (tanshinone IIA sulfonate) in four well-characterized animal seizure models. In the maximal electroshock seizure threshold test and the pentylenetetrazol (PTZ) seizure threshold test in mice, none of the four compounds demonstrated anticonvulsant effects when given alone. Notably, in combination with carbamazepine, both AFC-5128 and JNJ-47965567 increased the threshold in the maximal electroshock seizure test. In the PTZ-kindling model in rats, useful for testing antiepileptogenic activities, Brilliant Blue G and tanshinone exhibited a moderate retarding effect, whereas the potent P2X7R blocker AFC-5128 and JNJ-47965567 showed a significant and long-lasting delay in kindling development. In fully kindled rats, the investigated compounds revealed modest effects to reduce the mean seizure stage. Furthermore, AFC-5128- and JNJ-47965567-treated animals displayed strongly reduced Iba 1 and GFAP immunoreactivity in the hippocampal CA3 region. In summary, our results show that P2X7R antagonists possess no remarkable anticonvulsant effects in the used acute screening tests, but can attenuate chemically-induced kindling. Further studies would be of interest to support the concept that P2X7R signalling plays a crucial role in the pathogenesis of epileptic disorders. PMID:27281030

  10. An Efficient, Scalable and Robust P2P Overlay for Autonomic Communication

    NASA Astrophysics Data System (ADS)

    Li, Deng; Liu, Hui; Vasilakos, Athanasios

    The term Autonomic Communication (AC) refers to self-managing systems which are capable of supporting self-configuration, self-healing and self-optimization. However, information reflection and collection, lack of centralized control, non-cooperation and so on are just some of the challenges within AC systems. Since many self-* properties (e.g. selfconfiguration, self-optimization, self-healing, and self-protecting) are achieved by a group of autonomous entities that coordinate in a peer-to-peer (P2P) fashion, it has opened the door to migrating research techniques from P2P systems. P2P's meaning can be better understood with a set of key characteristics similar to AC: Decentralized organization, Self-organizing nature (i.e. adaptability), Resource sharing and aggregation, and Fault-tolerance. However, not all P2P systems are compatible with AC. Unstructured systems are designed more specifically than structured systems for the heterogeneous Internet environment, where the nodes' persistence and availability are not guaranteed. Motivated by the challenges in AC and based on comprehensive analysis of popular P2P applications, three correlative standards for evaluating the compatibility of a P2P system with AC are presented in this chapter. According to these standards, a novel Efficient, Scalable and Robust (ESR) P2P overlay is proposed. Differing from current structured and unstructured, or meshed and tree-like P2P overlay, the ESR is a whole new three dimensional structure to improve the efficiency of routing, while information exchanges take in immediate neighbors with local information to make the system scalable and fault-tolerant. Furthermore, rather than a complex game theory or incentive mechanism, asimple but effective punish mechanism has been presented based on a new ID structure which can guarantee the continuity of each node's record in order to discourage negative behavior on an autonomous environment as AC.

  11. Validation of a P2Y12-receptor specific whole blood platelet aggregation assay.


    Amann, Michael; Ferenc, Miroslaw; Valina, Christian M; Bömicke, Timo; Stratz, Christian; Leggewie, Stefan; Trenk, Dietmar; Neumann, Franz-Josef; Hochholzer, Willibald


    Testing of P2Y12-receptor antagonist effects can support clinical decision-making. However, most platelet function assays use only ADP as agonist which is not P2Y12-receptor specific. For this reason P2Y12-receptor specific assays have been developed by adding prostaglandin E1 (PGE1) to reduce ADP-induced platelet activation via the P2Y1-receptor. The present study sought to evaluate a P2Y12-receptor specific assay for determination of pharmacodynamic and clinical outcomes. This study enrolled 400 patients undergoing coronary stenting after loading with clopidogrel or prasugrel. ADP-induced platelet reactivity was assessed by whole blood aggregometry at multiple time points with a standard ADP assay (ADPtest) and a P2Y12-receptor specific assay (ADPtest HS, both run on Multiplate Analyzer, Roche Diagnostics). Patients were clinically followed for 1 month and all events adjudicated by an independent committee. In total, 2084 pairs of test results of ADPtest and ADPtest HS were available showing a strong correlation between results of both assays (r = 0.96, p < 0.001). These findings prevailed in multiple prespecified subgroups (e.g., age; body mass index; diabetes). Calculated cutoffs for ADPtest HS and the established cutoffs of ADPtest showed a substantial agreement for prediction of ischemic and hemorrhagic events with a Cohen's κ of 0.66 and 0.66, respectively. The P2Y12-receptor specific ADPtest HS assay appears similarly predictive for pharmacodynamic and clinical outcomes as compared to the established ADPtest assay indicating its applicability for clinical use. Further evaluation in large cohorts is needed to determine if P2Y12-receptor specific testing offers any advantage for prediction of clinical outcome.

  12. Oxygen substitution effects in Li10GeP2S12 solid electrolyte

    NASA Astrophysics Data System (ADS)

    Sun, Yulong; Suzuki, Kota; Hara, Kosuke; Hori, Satoshi; Yano, Taka-aki; Hara, Masahiko; Hirayama, Masaaki; Kanno, Ryoji


    For the lithium super-ionic conductor Li10GeP2S12, the partial substitution of sulfur by oxygen is achieved via a solid-state reaction. The solid-solution range of oxygen is found to be 0 ≤ x < 0.9 in Li10GeP2S12-xOx. Structure refinements using synchrotron X-ray diffraction data confirm the preference for oxygen substitution in the PS4 tetrahedra. The local structural change in the P(S/O)4 tetrahedra upon substitution is also indicated by Raman spectroscopy. Ionic conduction properties are maintained even after the oxygen substitution in Li10GeP2S12; the ionic conductivity of Li10GeP2S12-xOx (0.3 ≤ x ≤ 0.6) ranges from 1.03 × 10-2 to 8.43 × 10-3 S cm-1 at 298 K. No redox current is observed by cyclic voltammetry from nearly 0 to 10 V versus Li/Li+ except for that due to the lithium deposition/dissolution reactions. All-solid-state batteries using Li10GeP2S12-xOx (x = 0.3 and 0.6) as solid electrolytes with Li metal anodes show discharge capacities exceeding 100 mAh g-1 and better cycling performance compared to batteries using the original Li10GeP2S12. The partial substitution of oxygen for sulfur in Li10GeP2S12 affords a novel solid electrolyte, Li10GeP2S12-xOx, with high conductive properties and electrochemical stability.

  13. Construction of a Der p2-transgenic plant for the alleviation of airway inflammation

    PubMed Central

    Lee, CC; Ho, H; Lee, KT; Jeng, ST; Chiang, BL


    In clinical therapy, the amount of antigen administered to achieve oral tolerance for allergic diseases is large, and the cost is a major consideration. In this study, we used tobacco plants to develop a large-scale protein production system for allergen-specific immunotherapy, and we investigated the mechanisms of oral tolerance induced by a transgenic plant-derived antigen. We used plants (tobacco leaves) transgenic for the Dermatophagoides pteronyssinus 2 (Der p2) antigen to produce Der p2. Mice received total protein extract from Der p2 orally once per day over 6 days (days 0–2 and days 6–8). Mice were also sensitized and challenged with yeast-derived recombinant Der p2 (rDer p2), after which the mice were examined for airway hyper-responsiveness and airway inflammation. After sensitization and challenge with rDer p2, mice that were fed with total protein extracted from transgenic plants showed decreases in serum Der p2-specific IgE and IgG1 titers, decreased IL-5 and eotaxin levels in bronchial alveolar lavage fluid, and eosinophil infiltration in the airway. In addition, hyper-responsiveness was also decreased in mice that were fed with total protein extracted from transgenic plants, and CD4+CD25+Foxp3+ regulatory T cells were significantly increased in mediastinal and mesenteric lymph nodes. Furthermore, splenocytes isolated from transgenic plant protein-fed mice exhibited decreased proliferation and increased IL-10 secretion after stimulation with rDer p2. The data here suggest that allergen-expressing transgenic plants could be used for therapeutic purposes for allergic diseases. PMID:21602845

  14. P2X7 receptor activation regulates rapid unconventional export of transglutaminase-2

    PubMed Central

    Adamczyk, Magdalena; Griffiths, Rhiannon; Dewitt, Sharon; Knäuper, Vera; Aeschlimann, Daniel


    ABSTRACT Transglutaminases (denoted TG or TGM) are externalized from cells via an unknown unconventional secretory pathway. Here, we show for the first time that purinergic signaling regulates active secretion of TG2 (also known as TGM2), an enzyme with a pivotal role in stabilizing extracellular matrices and modulating cell–matrix interactions in tissue repair. Extracellular ATP promotes TG2 secretion by macrophages, and this can be blocked by a selective antagonist against the purinergic receptor P2X7 (P2X7R, also known as P2RX7). Introduction of functional P2X7R into HEK293 cells is sufficient to confer rapid, regulated TG2 export. By employing pharmacological agents, TG2 release could be separated from P2X7R-mediated microvesicle shedding. Neither Ca2+ signaling alone nor membrane depolarization triggered TG2 secretion, which occurred only upon receptor membrane pore formation and without pannexin channel involvement. A gain-of-function mutation in P2X7R associated with autoimmune disease caused enhanced TG2 externalization from cells, and this correlated with increased pore activity. These results provide a mechanistic explanation for a link between active TG2 secretion and inflammatory responses, and aberrant enhanced TG2 activity in c