Sample records for solfataricus p2 binds

  1. The complete genome of the crenarchaeon Sulfolobus solfataricus P2

    PubMed Central

    She, Qunxin; Singh, Rama K.; Confalonieri, Fabrice; Zivanovic, Yvan; Allard, Ghislaine; Awayez, Mariana J.; Chan-Weiher, Christina C.-Y.; Clausen, Ib Groth; Curtis, Bruce A.; De Moors, Anick; Erauso, Gael; Fletcher, Cynthia; Gordon, Paul M. K.; Heikamp-de Jong, Ineke; Jeffries, Alex C.; Kozera, Catherine J.; Medina, Nadine; Peng, Xu; Thi-Ngoc, Hoa Phan; Redder, Peter; Schenk, Margaret E.; Theriault, Cynthia; Tolstrup, Niels; Charlebois, Robert L.; Doolittle, W. Ford; Duguet, Michel; Gaasterland, Terry; Garrett, Roger A.; Ragan, Mark A.; Sensen, Christoph W.; Van der Oost, John


    The genome of the crenarchaeon Sulfolobus solfataricus P2 contains 2,992,245 bp on a single chromosome and encodes 2,977 proteins and many RNAs. One-third of the encoded proteins have no detectable homologs in other sequenced genomes. Moreover, 40% appear to be archaeal-specific, and only 12% and 2.3% are shared exclusively with bacteria and eukarya, respectively. The genome shows a high level of plasticity with 200 diverse insertion sequence elements, many putative nonautonomous mobile elements, and evidence of integrase-mediated insertion events. There are also long clusters of regularly spaced tandem repeats. Different transfer systems are used for the uptake of inorganic and organic solutes, and a wealth of intracellular and extracellular proteases, sugar, and sulfur metabolizing enzymes are encoded, as well as enzymes of the central metabolic pathways and motility proteins. The major metabolic electron carrier is not NADH as in bacteria and eukarya but probably ferredoxin. The essential components required for DNA replication, DNA repair and recombination, the cell cycle, transcriptional initiation and translation, but not DNA folding, show a strong eukaryal character with many archaeal-specific features. The results illustrate major differences between crenarchaea and euryarchaea, especially for their DNA replication mechanism and cell cycle processes and their translational apparatus. PMID:11427726

  2. Evolutionary analysis of the hisCGABdFDEHI gene cluster from the archaeon Sulfolobus solfataricus P2.

    PubMed Central

    Charlebois, R L; Sensen, C W; Doolittle, W F; Brown, J R


    While sequencing the genome of the archaeon Sulfolobus solfataricus P2, we found an 8,313-bp sequence containing a cluster of nine histidine biosynthesis genes in an order different from that of any known his operon. Results of phylogenetic analysis of the coding regions in the putative operon give conflicting evolutionary histories for individual his genes. PMID:9209067

  3. Expression of a synthetic gene encoding P2 ribonuclease from the extreme thermoacidophilic archaebacterium Sulfolobus solfataricus in mesophylic hosts.


    Fusi, P; Grisa, M; Mombelli, E; Consonni, R; Tortora, P; Vanoni, M


    This work reports the molecular cloning and expression of a synthetic gene encoding P2, a 7-kDa ribonuclease (RNase) previously isolated in our laboratory from the archaebacterium Sulfolobus solfataricus [Fusi et al., Eur. J. Biochem. 211 (1993) 305-310]. The P2-encoding synthetic gene was expressed in E. coli and in Saccharomyces cerevisiae. The recombinant (re-) protein was produced to approx. 1.5% of the total protein content in S. cerevisiae using the galactose-inducible GAL1 promoter and to 3% (tac/lac tandem promoters) or 6.5% (T7 promoter) in E. coli as judged by immunological and biochemical criteria. E. coli-produced P2 was purified to electrophoretic homogeneity through a one-step procedure, i.e., DEAE-Sephacel chromatography at pH 9.3. S. cerevisiae-produced P2 additionally required filtration through a Centricon-10 microconcentrator to obtain the same purity. The re-P2 was found to be indistinguishable from the Su. solfataricus enzyme on the basis of heat stability, pH optimum and RNA digestion pattern. Furthermore, monodimensional nuclear magnetic resonance showed that the E. coli- and Su. solfataricus-produced enzymes were structurally identical, the only exceptions being that Lys4 and Lys6 were not methylated in the re-enzyme, thus showing that lysine methylation does not play a role in P2 thermostabilization.

  4. Proteomic mapping of the hyperthermophilic and acidophilic archaeon Sulfolobus solfataricus P2

    SciTech Connect

    Barry, Richard C.; Young, Mark J.; Stedman, Kenneth M.; Dratz, Edward A.


    A proteomic map of Sulfolobus solfataricus P2, an archaeon that grows optimally at 80 C and pH 3.2, was developed using high resolution two-dimensional gel electrophoresis and peptide mass fingerprinting. A total of 867 protein spots (659 aqueous tris-soluble spots and 208 aqueous tris-insoluble) were mapped over IPG 3-10, 4-7, and 6-11, with second dimension gels made of 8-18% polyacrylamide. 324 different gene products were represented by the 867 spots, with 274 gene products being identified in the tris-soluble fractions and 100 gene products in the tris-insoluble portion. Fifty gene products were found on gels from both fractions. Additionally, an average of 1.50 + 0.12 isoforms/per protein were identified. This mapping study confirmed the expression of proteins involved in numerous metabolic, transport, energy production, nucleic acid replication, translation, and transcription pathways. Of particular interest, phosphoenolpyruvate carboxykinase (SSO2537) was detected even though the pathway for gluconeogenesis is unknown for this archaeon. Tris-soluble fractions contained many cytosolic proteins while tris-insoluble fractions contained many membrane-associated proteins, including ABC transporters and an ATP synthase. This study provides an optimized 2-DE approach for investigating the biochemical pathways and post-translational modifications employed by Sulfolobus to survive in its extreme environment.

  5. Functional curation of the Sulfolobus solfataricus P2 and S. acidocaldarius 98-3 complete genome sequences.


    Esser, Domink; Kouril, Theresa; Zaparty, Melanie; Sierocinski, Pawel; Chan, Patricia P; Lowe, Todd; Van der Oost, John; Albers, Sonja-Verena; Schomburg, Dietmar; Makarova, Kira S; Siebers, Bettina


    The thermoacidophiles Sulfolobus solfataricus P2 and S. acidocaldarius 98-3 are considered key model organisms representing a major phylum of the Crenarchaeota. Because maintaining current, accurate genome information is indispensable for modern biology, we have updated gene function annotation using the arCOGs database, plus other available functional, structural and phylogenetic information. The goal of this initiative is continuous improvement of genome annotation with the support of the Sulfolobus research community.

  6. Surface-exposed glycoproteins of hyperthermophilic Sulfolobus solfataricus P2 show a common N-glycosylation profile.


    Palmieri, Gianna; Balestrieri, Marco; Peter-Katalinić, Jasna; Pohlentz, Gottfried; Rossi, Mosè; Fiume, Immacolata; Pocsfalvi, Gabriella


    Cell surface proteins of hyperthermophilic Archaea actively participate in intercellular communication, cellular uptake, and energy conversion to sustain survival strategies in extreme habitats. Surface (S)-layer glycoproteins, the major component of the S-layers in many archaeal species and the best-characterized prokaryotic glycoproteins, were shown to have a large structural diversity in their glycan compositions. In spite of this, knowledge on glycosylation of proteins other than S-layer proteins in Archaea is quite limited. Here, the N-glycosylation pattern of cell-surface-exposed proteins of Sulfolobus solfataricus P2 were analyzed by lectin affinity purification, HPAEC-PAD, and multiple mass spectrometry-based techniques. Detailed analysis of SSO1273, one of the most abundant ABC transporters present in the cell surface fraction of S. solfataricus, revealed a novel glycan structure composed of a branched sulfated heptasaccharide, Hex4(GlcNAc)2 plus sulfoquinovose where Hex is d-mannose and d-glucose. Having one monosaccharide unit more than the glycan of the S-layer glycoprotein of S. acidocaldarius, this is the most complex archaeal glycan structure known today. SSO1273 protein is heavily glycosylated and all 20 theoretical N-X-S/T (where X is any amino acid except proline) consensus sequence sites were confirmed. Remarkably, we show that several other proteins in the surface fraction of S. solfataricus are N-glycosylated by the same sulfated oligosaccharide and we identified 56 N-glycosylation sites in this subproteome.

  7. Purification, crystallization and preliminary crystallographic analysis of a GTP-binding protein from the hyperthermophilic archaeon Sulfolobus solfataricus

    SciTech Connect

    Wu, Hao; Sun, Lei; Brouns, Stan J. J.; Fu, Sheng; Akerboom, Jasper; Li, Xuemei; Oost, John van der


    A GTP-binding protein from the hyperthermophilic archaeon Sulfolobus solfataricus has been crystallized. Combined with biochemical analyses, it is expected that the structure of this protein will give insight in the function of a relatively unknown subfamily of the GTPase superfamily. A predicted GTP-binding protein from the hyperthermophilic archaeon Sulfolobus solfataricus, termed SsGBP, has been cloned and overexpressed in Escherichia coli. The purified protein was crystallized using the hanging-drop vapour-diffusion technique in the presence of 0.05 M cadmium sulfate and 0.8 M sodium acetate pH 7.5. A single-wavelength anomalous dispersion data set was collected to a maximum resolution of 2.0 Å using a single cadmium-incorporated crystal. The crystal form belongs to space group P2{sub 1}2{sub 1}2{sub 1}, with approximate unit-cell parameters a = 65.0, b = 72.6, c = 95.9 Å and with a monomer in the asymmetric unit.

  8. The Sso7d DNA-binding protein from Sulfolobus solfataricus has ribonuclease activity.


    Shehi, E; Serina, S; Fumagalli, G; Vanoni, M; Consonni, R; Zetta, L; Dehò, G; Tortora, P; Fusi, P


    Sso7d is a small, basic, abundant protein from the thermoacidophilic archaeon Sulfolobus solfataricus. Previous research has shown that Sso7d can bind double-stranded DNA without sequence specificity by placing its triple-stranded beta-sheet across the minor groove. We previously found RNase activity both in preparations of Sso7d purified from its natural source and in recombinant, purified protein expressed in Escherichia coli. This paper provides conclusive evidence that supports the assignment of RNase activity to Sso7d, shown by the total absence of activity in the single-point mutants E35L and K12L, despite the preservation of their overall structure under the assay conditions. In keeping with our observation that the residues putatively involved in RNase activity and those playing a role in DNA binding are located on different surfaces of the molecule, the activity was not impaired in the presence of DNA. If a small synthetic RNA was used as a substrate, Sso7d attacked both predicted double- and single-stranded RNA stretches, with no evident preference for specific sequences or individual bases. Apparently, the more readily attacked bonds were those intrinsically more unstable.

  9. CBD binding domain fused γ-lactamase from Sulfolobus solfataricus is an efficient catalyst for (-) γ-lactam production

    PubMed Central


    Background γ-lactamase is used for the resolution of γ-lactam which is utilized in the synthesizing of abacavir and peramivir. In some cases, enzymatic method is the most utilized method because of its high efficiency and productivity. The cellulose binding domain (CBD) of cellulose is often used as the bio-specific affinity matrix for enzyme immobilization. Cellulose is cheap and it has excellent chemical and physical properties. Meanwhile, binding between cellulose and CBD is tight and the desorption rarely happened. Results We prepared two fusion constructs of the γ-lactamase gene gla, which was from Sulfolobus solfataricus P2. These two constructs had Cbd (cellulose binding domain from Clostridium thermocellum) fused at amino or carboxyl terminus of the γ-lactamase. These two constructs were heterogeneously expressed in E. coli rosetta (DE3) as two fusion proteins. Both of them were immobilized well on Avicel (microcrystalline cellulose matrix). The apparent kinetic parameters revealed that carboxyl terminus fused protein (Gla-linker-Cbd) was a better catalyst. The Vmax and kcat value of Avicel immobilized Gla-linker-Cbd were 381 U mg-1 and 4.7 × 105 s-1 respectively. And the values of the free Gla-linker-Cbd were 151 U mg-1 and 1.8 × 105 s-1 respectively. These data indicated that the catalytic efficiency of the enzyme was upgraded after immobilization. The immobilized Gla-linker-Cbd had a 10-degree temperature optimum dropping from 80°C to 70°C but it was stable when incubated at 60°C for 48 h. It remained stable in catalyzing 20-batch reactions. After optimization, the immobilized enzyme concentration in transformation was set as 200 mg/mL. We found out that there was inhibition that occurred to the immobilized enzyme when substrate concentration exceeded 60 mM. Finally a 10 mL-volume transformation was conducted, in which 0.6 M substrate was hydrolyzed and the resolution was completed within 9 h with a 99.5% ee value. Conclusions

  10. CBD binding domain fused γ-lactamase from Sulfolobus solfataricus is an efficient catalyst for (-) γ-lactam production.


    Wang, Jianjun; Zhu, Junge; Min, Cong; Wu, Sheng


    γ-lactamase is used for the resolution of γ-lactam which is utilized in the synthesizing of abacavir and peramivir. In some cases, enzymatic method is the most utilized method because of its high efficiency and productivity. The cellulose binding domain (CBD) of cellulose is often used as the bio-specific affinity matrix for enzyme immobilization. Cellulose is cheap and it has excellent chemical and physical properties. Meanwhile, binding between cellulose and CBD is tight and the desorption rarely happened. We prepared two fusion constructs of the γ-lactamase gene gla, which was from Sulfolobus solfataricus P2. These two constructs had Cbd (cellulose binding domain from Clostridium thermocellum) fused at amino or carboxyl terminus of the γ-lactamase. These two constructs were heterogeneously expressed in E. coli rosetta (DE3) as two fusion proteins. Both of them were immobilized well on Avicel (microcrystalline cellulose matrix). The apparent kinetic parameters revealed that carboxyl terminus fused protein (Gla-linker-Cbd) was a better catalyst. The V(max) and k(cat) value of Avicel immobilized Gla-linker-Cbd were 381 U mg⁻¹ and 4.7 × 10⁵ s⁻¹ respectively. And the values of the free Gla-linker-Cbd were 151 U mg⁻¹ and 1.8 × 10⁵ s⁻¹ respectively. These data indicated that the catalytic efficiency of the enzyme was upgraded after immobilization. The immobilized Gla-linker-Cbd had a 10-degree temperature optimum dropping from 80°C to 70°C but it was stable when incubated at 60°C for 48 h. It remained stable in catalyzing 20-batch reactions. After optimization, the immobilized enzyme concentration in transformation was set as 200 mg/mL. We found out that there was inhibition that occurred to the immobilized enzyme when substrate concentration exceeded 60 mM. Finally a 10 mL-volume transformation was conducted, in which 0.6 M substrate was hydrolyzed and the resolution was completed within 9 h with a 99.5% ee value. Cellulose is the most

  11. The genome-wide binding profile of the Sulfolobus solfataricus transcription factor Ss-LrpB shows binding events beyond direct transcription regulation.


    Nguyen-Duc, Trong; van Oeffelen, Liesbeth; Song, Ningning; Hassanzadeh-Ghassabeh, Gholamreza; Muyldermans, Serge; Charlier, Daniel; Peeters, Eveline


    Gene regulatory processes are largely resulting from binding of transcription factors to specific genomic targets. Leucine-responsive Regulatory Protein (Lrp) is a prevalent transcription factor family in prokaryotes, however, little information is available on biological functions of these proteins in archaea. Here, we study genome-wide binding of the Lrp-like transcription factor Ss-LrpB from Sulfolobus solfataricus. Chromatin immunoprecipitation in combination with DNA microarray analysis (ChIP-chip) has revealed that Ss-LrpB interacts with 36 additional loci besides the four previously identified local targets. Only a subset of the newly identified binding targets, concentrated in a highly variable IS-dense genomic region, is also bound in vitro by pure Ss-LrpB. There is no clear relationship between the in vitro measured DNA-binding specificity of Ss-LrpB and the in vivo association suggesting a limited permissivity of the crenarchaeal chromatin for transcription factor binding. Of 37 identified binding regions, 29 are co-bound by LysM, another Lrp-like transcription factor in S. solfataricus. Comparative gene expression analysis in an Ss-lrpB mutant strain shows no significant Ss-LrpB-mediated regulation for most targeted genes, with exception of the CRISPR B cluster, which is activated by Ss-LrpB through binding to a specific motif in the leader region. The genome-wide binding profile presented here implies that Ss-LrpB is associated at additional genomic binding sites besides the local gene targets, but acts as a specific transcription regulator in the tested growth conditions. Moreover, we have provided evidence that two Lrp-like transcription factors in S. solfataricus, Ss-LrpB and LysM, interact in vivo.

  12. SMV1 virus-induced CRISPR spacer acquisition from the conjugative plasmid pMGB1 in Sulfolobus solfataricus P2.


    Erdmann, Susanne; Shah, Shiraz A; Garrett, Roger A


    Organisms of the crenarchaeal order Sulfolobales carry complex CRISPR (clustered regularly interspaced short palindromic repeats) adaptive immune systems. These systems are modular and show extensive structural and functional diversity, especially in their interference complexes. The primary targets are an exceptional range of diverse viruses, many of which propagate stably within cells and follow lytic life cycles without producing cell lysis. These properties are consistent with the difficulty of activating CRISPR spacer uptake in the laboratory, but appear to conflict with the high complexity and diversity of the CRISPR immune systems that are found among the Sulfolobales. In the present article, we re-examine the first successful induction of archaeal spacer acquisition in our laboratory that occurred exclusively for the conjugative plasmid pMGB1 in Sulfolobus solfataricus P2 that was co-infected with the virus SMV1 (Sulfolobus monocaudavirus 1). Although we reaffirm that protospacer selection is essentially a random process with respect to the pMGB1 genome, we identified single spacer sequences specific for each of CRISPR loci C, D and E that, exceptionally, occurred in many sequenced clones. Moreover, the same sequence was reproducibly acquired for a given locus in independent experiments, consistent with it being the first protospacer to be selected. There was also a small protospacer bias (1.6:1) to the antisense strand of protein genes. In addition, new experiments demonstrated that spacer acquisition in the previously inactive CRISPR locus A could be induced on freeze-thawing of the infected cells, suggesting that environmental stress can facilitate activation. Coincidentally with spacer acquisition, a mobile OrfB element was deleted from pMGB1, suggesting that interplay can occur between spacer acquisition and transposition.

  13. SMV1 virus-induced CRISPR spacer acquisition from the conjugative plasmid pMGB1 in Sulfolobus solfataricus P2

    PubMed Central

    Erdmann, Susanne; Shah, Shiraz A.; Garrett, Roger A.


    Organisms of the crenarchaeal order Sulfolobales carry complex CRISPR (clustered regularly interspaced short palindromic repeats) adaptive immune systems. These systems are modular and show extensive structural and functional diversity, especially in their interference complexes. The primary targets are an exceptional range of diverse viruses, many of which propagate stably within cells and follow lytic life cycles without producing cell lysis. These properties are consistent with the difficulty of activating CRISPR spacer uptake in the laboratory, but appear to conflict with the high complexity and diversity of the CRISPR immune systems that are found among the Sulfolobales. In the present article, we re-examine the first successful induction of archaeal spacer acquisition in our laboratory that occurred exclusively for the conjugative plasmid pMGB1 in Sulfolobus solfataricus P2 that was co-infected with the virus SMV1 (Sulfolobus monocaudavirus 1). Although we reaffirm that protospacer selection is essentially a random process with respect to the pMGB1 genome, we identified single spacer sequences specific for each of CRISPR loci C, D and E that, exceptionally, occurred in many sequenced clones. Moreover, the same sequence was reproducibly acquired for a given locus in independent experiments, consistent with it being the first protospacer to be selected. There was also a small protospacer bias (1.6:1) to the antisense strand of protein genes. In addition, new experiments demonstrated that spacer acquisition in the previously inactive CRISPR locus A could be induced on freeze–thawing of the infected cells, suggesting that environmental stress can facilitate activation. Coincidentally with spacer acquisition, a mobile OrfB element was deleted from pMGB1, suggesting that interplay can occur between spacer acquisition and transposition. PMID:24256236

  14. Enzymatic synthesis of dimaltosyl-{beta}-cyclodextrin via a transglycosylation reaction using TreX, a Sulfolobus solfataricus P2 debranching enzyme

    SciTech Connect

    Kang, Hee-Kwon; Cha, Hyunju; Yang, Tae-Joo; Park, Jong-Tae; Lee, Seungjae; Kim, Young-Wan; Auh, Joong-Hyuck; Okada, Yasuyo; Kim, Jung-Wan; Cha, Jaeho; Kim, Chung Ho; Park, Kwan-Hwa


    Di-O-{alpha}-maltosyl-{beta}-cyclodextrin ((G2){sub 2}-{beta}-CD) was synthesized from 6-O-{alpha}-maltosyl-{beta}-cyclodextrin (G2-{beta}-CD) via a transglycosylation reaction catalyzed by TreX, a debranching enzyme from Sulfolobus solfataricus P2. TreX showed no activity toward glucosyl-{beta}-CD, but a transfer product (1) was detected when the enzyme was incubated with maltosyl-{beta}-CD, indicating specificity for a branched glucosyl chain bigger than DP2. Analysis of the structure of the transfer product (1) using MALDI-TOF/MS and isoamylase or glucoamylase treatment revealed it to be dimaltosyl-{beta}-CD, suggesting that TreX transferred the maltosyl residue of a G2-{beta}-CD to another molecule of G2-{beta}-CD by forming an {alpha}-1,6-glucosidic linkage. When [{sup 14}C]-maltose and maltosyl-{beta}-CD were reacted with the enzyme, the radiogram showed no labeled dimaltosyl-{beta}-CD; no condensation product between the two substrates was detected, indicating that the synthesis of dimaltosyl-{beta}-CD occurred exclusively via transglycosylation of an {alpha}-1,6-glucosidic linkage. Based on the HPLC elution profile, the transfer product (1) was identified to be isomers of 6{sup 1},6{sup 3}- and 6{sup 1},6{sup 4}-dimaltosyl-{beta}-CD. Inhibition studies with {beta}-CD on the transglycosylation activity revealed that {beta}-CD was a mixed-type inhibitor, with a K{sub i} value of 55.6 {mu}mol/mL. Thus, dimaltosyl-{beta}-CD can be more efficiently synthesized by a transglycosylation reaction with TreX in the absence of {beta}-CD. Our findings suggest that the high yield of (G2){sub 2}-{beta}-CD from G2-{beta}-CD was based on both the transglycosylation action mode and elimination of the inhibitory effect of {beta}-CD.

  15. Identification and properties of the crenarchaeal single-stranded DNA binding protein from Sulfolobus solfataricus

    PubMed Central

    Wadsworth, Ross I. M.; White, Malcolm F.


    Single-stranded DNA binding proteins (SSBs) play central roles in cellular and viral processes involving the generation of single-stranded DNA. These include DNA replication, homologous recombination and DNA repair pathways. SSBs bind DNA using four ‘OB-fold’ (oligonucleotide/oligosaccharide binding fold) domains that can be organised in a variety of overall quaternary structures. Thus eubacterial SSBs are homotetrameric whilst the eucaryal RPA protein is a heterotrimer and euryarchaeal proteins vary significantly in their subunit compositions. We demonstrate that the crenarchaeal SSB protein is an abundant protein with a unique structural organisation, existing as a monomer in solution and multimerising on DNA binding. The protein binds single-stranded DNA distributively with a binding site size of ~5 nt per monomer. Sulfolobus SSB lacks the zinc finger motif found in the eucaryal and euryarchaeal proteins, possessing instead a flexible C-terminal tail, sensitive to trypsin digestion, that is not required for DNA binding. In comparison with Escherichia coli SSB, the tail may play a role in protein–protein interactions during DNA replication and repair. PMID:11160923

  16. Insertion of dNTPs Opposite the 1,N[superscript 2]-Propanodeoxyguanosine Adduct by Sulfolobus solfataricus P2 DNA Polymerase IV

    SciTech Connect

    Wang, Yazhen; Musser, Sarah K.; Saleh, Sam; Marnett, Lawrence J.; Egli, Martin; Stone, Michael P.


    1,N{sup 2}-Propanodeoxyguanosine (PdG) is a stable structural analogue for the 3-(2'-deoxy-{beta}-d-erythro-pentofuranosyl)pyrimido[1,2-?]purin-10(3H)-one (M{sub 1}dG) adduct derived from exposure of DNA to base propenals and to malondialdehyde. The structures of ternary polymerase-DNA-dNTP complexes for three template-primer DNA sequences were determined, with the Y-family Sulfolobus solfataricus DNA polymerase IV (Dpo4), at resolutions between 2.4 and 2.7 {angstrom}. Three template 18-mer-primer 13-mer sequences, 5'-d(TCACXAAATCCTTCCCCC)-3'{center_dot}5'-d(GGGGGAAGGATTT)-3' (template I), 5'-d(TCACXGAATCCTTCCCCC)-3'{center_dot}5'-d(GGGGGAAGGATTC)-3' (template II), and 5'-d(TCATXGAATCCTTCCCCC)-3'{center_dot}5'-d(GGGGGAAGGATTC)-3' (template III), where X is PdG, were analyzed. With templates I and II, diffracting ternary complexes including dGTP were obtained. The dGTP did not pair with PdG, but instead with the 5'-neighboring template dC, utilizing Watson-Crick geometry. Replication bypass experiments with the template-primer 5?-TCACXAAATCCTTACGAGCATCGCCCCC-3'{center_dot}5'-GGGGGCGATGCTCGTAAGGATTT-3', where X is PdG, which includes PdG in the 5'-CXA-3' template sequence as in template I, showed that the Dpo4 polymerase inserted dGTP and dATP when challenged by the PdG adduct. For template III, in which the template sequence was 5'-TXG-3', a diffracting ternary complex including dATP was obtained. The dATP did not pair with PdG, but instead with the 5'-neighboring T, utilizing Watson-Crick geometry. Thus, all three ternary complexes were of the 'type II' structure described for ternary complexes with native DNA [Ling, H., Boudsocq, F., Woodgate, R., and Yang, W. (2001) Cell 107, 91--102]. The PdG adduct remained in the anti conformation about the glycosyl bond in each of these threee ternary complexes. These results provide insight into how -1 frameshift mutations might be generated for the PdG adduct, a structural model for the exocylic M{sub 1}dG adduct formed by

  17. Extreme heat- and pressure-resistant 7-kDa protein P2 from the archaeon Sulfolobus solfataricus is dramatically destabilized by a single-point amino acid substitution.


    Fusi, P; Goossens, K; Consonni, R; Grisa, M; Puricelli, P; Vecchio, G; Vanoni, M; Zetta, L; Heremans, K; Tortora, P


    This study reports the characterization of the recombinant 7-kDa protein P2 from Sulfolobus solfataricus and the mutants F31A and F31Y with respect to temperature and pressure stability. As observed in the NMR, FTIR, and CD spectra, wild-type protein and mutants showed substantially similar structures under ambient conditions. However, midpoint transition temperatures of the denaturation process were 361, 334, and 347 K for wild type, F31A, and F31Y mutants, respectively: thus, alanine substitution of phenylalanine destabilized the protein by as much as 27 K. Midpoint transition pressures for wild type and F31Y mutant could not be accurately determined because they lay either beyond (wild type) or close to (F31Y) 14 kbar, a pressure at which water undergoes a phase transition. However, a midpoint transition pressure of 4 kbar could be determined for the F31A mutant, implying a shift in transition of at least 10 kbar. The pressure-induced denaturation was fully reversible; in contrast, thermal denaturation of wild type and mutants was only partially reversible. To our knowledge, both the pressure resistance of protein P2 and the dramatic pressure and temperature destabilization of the F31A mutant are unprecedented. These properties may be largely accounted for by the role of an aromatic cluster where Phe31 is found at the core, because interactions among aromatics are believed to be almost pressure insensitive; furthermore, the alanine substitution of phenylalanine should create a cavity with increased compressibility and flexibility, which also involves an impaired pressure and temperature resistance.

  18. The role of the salt concentration, proton, and phosphate binding on the thermal stability of wild and cloned DNA-binding protein Sso7d from Sulfolobus solfataricus.


    Todorova, Roumiana; Atanasov, Boris


    The acidic pH (1.5-7.0) and ionic strength (0.005-0.2M) dependence of thermodynamic functions of protein Sso7d from Sulfolobus solfataricus, cloned (c-Sso7d) and N-heptapeptide deleted [c-des(1-7)Sso7d] in glycine, and phosphate buffers was studied by means of adiabatic scanning calorimetry. The difference of proton binding was estimated from deltaHcal(pH), Td(pH), and (deltaTd/deltapH). It was found that a single group non-co-operative ionization with apparent pKa = 3.25 for both cloned and deleted proteins govern the thermal unfolding of two different (protonated and unprotonated) forms. deltaH degrees is found to be pH-independent and the changes in stability (deltaG degrees ) originate from changes in entropy terms. The apparent pKa measured at high salt concentrations decreases with 0.5 pH units from glycine to phosphate and the free energy of transfer at high ionic strength is 0.7 kcal/mol. The ionic strength dependence for the pH-dependent D-states is very different at pH 6.0 and 1.5. This is consistent with the property of denatured state to be more compacted or "closed" (Dc) at neutral or weak acidic pH and more random or "open" (Do) at acidic pH. From the Bjerrum's relation was found the number of screened charges important for the unfolding process. The main conclusions are: (1) the thermal stability of Sso7d has prominently entropic nature; (2) a single non-co-operative ionization controls the conformations in the D-state; and (3) pH-dependent conformational equilibrium could be functionally important in Sso7d-DNA recognition. Copyright 2004 Elsevier B.V.

  19. A recombinase paralog from the hyperthermophilic crenarchaeon Sulfolobus solfataricus enhances SsoRadA ssDNA binding and strand displacement.


    Graham, William J; Haseltine, Cynthia A


    Homologous recombination (HR) is a major pathway for the repair of double-strand DNA breaks, a highly deleterious form of DNA damage. The main catalytic protein in HR is the essential RecA-family recombinase, which is conserved across all three domains of life. Eukaryotes and archaea encode varying numbers of proteins paralogous to their main recombinase. Although there is increasing evidence for the functions of some of these paralog proteins, overall their mechanism of action remains largely unclear. Here we present the first biochemical characterization of one of the paralog proteins, SsoRal3, from the crenarchaeaon Sulfolobus solfataricus. The SsoRal3 protein is a ssDNA-dependent ATPase that can catalyze strand invasion at both saturating and subsaturating concentrations. It can bind both ssDNA and dsDNA, but its binding preference is altered by the presence or absence of ATP. Addition of SsoRal3 to SsoRadA nucleoprotein filaments reduces total ATPase activity. Subsaturating concentrations of SsoRal3 increase the ssDNA binding activity of SsoRadA approximately 9-fold and also increase the persistence of SsoRadA catalyzed strand invasion products. Overall, these results suggest that SsoRal3 functions to stabilize the SsoRadA presynaptic filament. Copyright © 2012 Elsevier B.V. All rights reserved.

  20. Identification of substrate-binding and selectivity-related residues of maltooligosyltrehalose synthase from the thermophilic archaeon Sulfolobus solfataricus ATCC 35092.


    Tseng, Wen-Chi; Lin, Chia-Ray; Hung, Xing-Guang; Wei, Tsen-Yun; Chen, Yu-Chun; Fang, Tsuei-Yun


    Maltooligosyltrehalose synthase (MTSase) is a key enzyme in the synthesis of trehalose. Computer simulations using AutoDock and NAMD were employed to assess the substrate-binding and selectivity-related residues of MTSase. We introduced mutations at residues D411, D610, and R614 to determine the substrate-binding residues of Sulfolobus solfataricus ATCC 35092 MTSase, and introduced mutations at residues P402, A406, and V426 to investigate the enzyme's selectivity-related residues. Kinetic studies of D411A, D610A, and R614A MTSases reveal significant reductions in catalytic efficiency and cause increase in the transition-state energy of mutant MTSases, indicating that residues D411, D610, and R614 form hydrogen bonds to the substrate. Compared with wild-type MTSase, the hydrolysis: transglycosylation selectivity ratio was significantly decreased for P402Q and significantly increased for A406S MTSases, while the ratio for V426T MTSase showed little change. The results suggest that P402 and A406 residues are selectivity-related. Copyright © 2014 Elsevier Inc. All rights reserved.

  1. Mutational analysis of divalent metal ion binding in the active site of class II α-mannosidase from Sulfolobus solfataricus.


    Hansen, Dennis K; Webb, Helen; Nielsen, Jonas Willum; Harris, Pernille; Winther, Jakob R; Willemoës, Martin


    Mutational analysis of Sulfolobus solfataricus class II α-mannosidase was focused on side chains that interact with the hydroxyls of the -1 mannosyl of the substrate (Asp-534) or form ligands to the active site divalent metal ion (His-228 and His-533) judged from crystal structures of homologous enzymes. D534A and D534N appeared to be completely inactive. When compared to the wild-type enzyme, the mutant enzymes in general showed only small changes in K(M) for the substrate, p-nitrophenyl-α-mannoside, but elevated activation constants, K(A), for the divalent metal ion (Co²⁺, Zn²⁺, Mn²⁺, or Cd²⁺). Some mutant enzyme forms displayed an altered preference for the metal ion compared to that of the wild type-enzyme. Furthermore, the H228Q, H533E, and H533Q enzymes were inhibited at increasing Zn²⁺ concentrations. The catalytic rate was reduced for all enzymes compared to that of the wild-type enzyme, although less dramatically with some activating metal ions. No major differences in the pH dependence between wild-type and mutant enzymes were found in the presence of different metal ions. The pH optimum was 5, but enzyme instability was observed at pH <4.5; therefore, only the basic limb of the bell-shaped pH profile was analyzed.

  2. The SmAP2 RNA binding motif in the 3'UTR affects mRNA stability in the crenarchaeum Sulfolobus solfataricus.


    Märtens, Birgit; Sharma, Kundan; Urlaub, Henning; Bläsi, Udo


    Sm and Sm-like proteins represent an evolutionarily conserved family with key roles in RNA metabolism in Pro- and Eukaryotes. In this study, a collection of 53 mRNAs that co-purified with Sulfolobus solfataricus (Sso) SmAP2 were surveyed for a specific RNA binding motif (RBM). SmAP2 was shown to bind with high affinity to the deduced consensus RNA binding motif (SmAP2-cRBM) in vitro. Residues in SmAP2 interacting with the SmAP2-cRBM were mapped by UV-induced crosslinking in combination with mass-spectrometry, and verified by mutational analyses. The RNA-binding site on SmAP2 includes a modified uracil binding pocket containing a unique threonine (T40) located on the L3 face and a second residue, K25, located in the pore. To study the function of the SmAP2-RBM in vivo, three authentic RBMs were inserted in the 3'UTR of a lacS reporter gene. The presence of the SmAP2-RBM in the reporter-constructs resulted in decreased LacS activity and reduced steady state levels of lacS mRNA. Moreover, the presence of the SmAP2-cRBM in and the replacement of the lacS 3'UTR with that of Sso2194 encompassing a SmAP2-RBM apparently impacted on the stability of the chimeric transcripts. These results are discussed in light of the function(s) of eukaryotic Lsm proteins in RNA turnover. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  3. An HflX-type GTPase from Sulfolobus solfataricus binds to the 50S ribosomal subunit in all nucleotide-bound states.


    Blombach, Fabian; Launay, Helene; Zorraquino, Violeta; Swarts, Daan C; Cabrita, Lisa D; Benelli, Dario; Christodoulou, John; Londei, Paola; van der Oost, John


    HflX GTPases are found in all three domains of life, the Bacteria, Archaea, and Eukarya. HflX from Escherichia coli has been shown to bind to the 50S ribosomal subunit in a nucleotide-dependent manner, and this interaction strongly stimulates its GTPase activity. We recently determined the structure of an HflX ortholog from the archaeon Sulfolobus solfataricus (SsoHflX). It revealed the presence of a novel HflX domain that might function in RNA binding and is linked to a canonical G domain. This domain arrangement is common to all archaeal, bacterial, and eukaryotic HflX GTPases. This paper shows that the archaeal SsoHflX, like its bacterial orthologs, binds to the 50S ribosomal subunit. This interaction does not depend on the presence of guanine nucleotides. The HflX domain is sufficient for ribosome interaction. Binding appears to be restricted to free 50S ribosomal subunits and does not occur with 70S ribosomes engaged in translation. The fingerprint (1)H-(15)N heteronuclear correlation nuclear magnetic resonance (NMR) spectrum of SsoHflX reveals a large number of well-resolved resonances that are broadened upon binding to the 50S ribosomal subunit. The GTPase activity of SsoHflX is stimulated by crude fractions of 50S ribosomal subunits, but this effect is lost with further high-salt purification of the 50S ribosomal subunits, suggesting that the stimulation depends on an extrinsic factor bound to the 50S ribosomal subunit. Our results reveal common properties but also marked differences between archaeal and bacterial HflX proteins.

  4. Structural insight into DNA binding and oligomerization of the multifunctional Cox protein of bacteriophage P2.


    Berntsson, Ronnie P-A; Odegrip, Richard; Sehlén, Wilhelmina; Skaar, Karin; Svensson, Linda M; Massad, Tariq; Högbom, Martin; Haggård-Ljungquist, Elisabeth; Stenmark, Pål


    The Cox protein from bacteriophage P2 is a small multifunctional DNA-binding protein. It is involved in site-specific recombination leading to P2 prophage excision and functions as a transcriptional repressor of the P2 Pc promoter. Furthermore, it transcriptionally activates the unrelated, defective prophage P4 that depends on phage P2 late gene products for lytic growth. In this article, we have investigated the structural determinants to understand how P2 Cox performs these different functions. We have solved the structure of P2 Cox to 2.4 Å resolution. Interestingly, P2 Cox crystallized in a continuous oligomeric spiral with its DNA-binding helix and wing positioned outwards. The extended C-terminal part of P2 Cox is largely responsible for the oligomerization in the structure. The spacing between the repeating DNA-binding elements along the helical P2 Cox filament is consistent with DNA binding along the filament. Functional analyses of alanine mutants in P2 Cox argue for the importance of key residues for protein function. We here present the first structure from the Cox protein family and, together with previous biochemical observations, propose that P2 Cox achieves its various functions by specific binding of DNA while wrapping the DNA around its helical oligomer.

  5. The Arginine Pairs and C-Termini of the Sso7c4 from Sulfolobus solfataricus Participate in Binding and Bending DNA

    PubMed Central

    Huang, Chun-Hsiang; Ko, Tzu-Ping; Chiang, Cheng-Hung; Lin, Kuan-Fu; Chang, Yuan-Chih; Lin, Po-Yen; Tsai, Hui-Hsu Gavin; Wang, Andrew H.-J.


    The Sso7c4 from Sulfolobus solfataricus forms a dimer, which is believed to function as a chromosomal protein involved in genomic DNA compaction and gene regulation. Here, we present the crystal structure of wild-type Sso7c4 at a high resolution of 1.63 Å, showing that the two basic C-termini are disordered. Based on the fluorescence polarization (FP) binding assay, two arginine pairs, R11/R22′ and R11′/R22, on the top surface participate in binding DNA. As shown in electron microscopy (EM) images, wild-type Sso7c4 compacts DNA through bridging and bending interactions, whereas the binding of C-terminally truncated proteins rigidifies and opens DNA molecules, and no compaction of the DNA occurs. Moreover, the FP, EM and fluorescence resonance energy transfer (FRET) data indicated that the two basic and flexible C-terminal arms of the Sso7c4 dimer play a crucial role in binding and bending DNA. Sso7c4 has been classified as a repressor-like protein because of its similarity to Escherichia coli Ecrep 6.8 and Ecrep 7.3 as well as Agrobacterium tumefaciens ACCR in amino acid sequence. Based on these data, we proposed a model of the Sso7c4-DNA complex using a curved DNA molecule in the catabolite activator protein-DNA complex. The DNA end-to-end distance measured with FRET upon wild-type Sso7c4 binding is almost equal to the distance measured in the model, which supports the fidelity of the proposed model. The FRET data also confirm the EM observation showing that the binding of wild-type Sso7c4 reduces the DNA length while the C-terminal truncation does not. A functional role for Sso7c4 in the organization of chromosomal DNA and/or the regulation of gene expression through bridging and bending interactions is suggested. PMID:28068385

  6. Expression, purification, crystallization and structure of human adipocyte lipid-binding protein (aP2)

    SciTech Connect

    Marr, Eric; Tardie, Mark; Carty, Maynard; Brown Phillips, Tracy; Wang, Ing-Kae; Soeller, Walt; Qiu, Xiayang Karam, George


    The crystal structure of human adipocyte lipid-binding protein (aP2) with a bound palmitate is reported at 1.5 Å resolution. Human adipocyte lipid-binding protein (aP2) belongs to a family of intracellular lipid-binding proteins involved in the transport and storage of lipids. Here, the crystal structure of human aP2 with a bound palmitate is described at 1.5 Å resolution. Unlike the known crystal structure of murine aP2 in complex with palmitate, this structure shows that the fatty acid is in a folded conformation and that the loop containing Phe57 acts as a lid to regulate ligand binding by excluding solvent exposure to the central binding cavity.

  7. Defining the nucleotide binding sites of P2Y receptors using rhodopsin-based homology modeling

    NASA Astrophysics Data System (ADS)

    Ivanov, Andrei A.; Costanzi, Stefano; Jacobson, Kenneth A.


    Ongoing efforts to model P2Y receptors for extracellular nucleotides, i.e., endogenous ADP, ATP, UDP, UTP, and UDP-glucose, were summarized and correlated for the eight known subtypes. The rhodopsin-based homology modeling of the P2Y receptors is supported by a growing body of site-directed mutagenesis data, mainly for P2Y1 receptors. By comparing molecular models of the P2Y receptors, it was concluded that nucleotide binding could occur in the upper part of the helical bundle, with the ribose moiety accommodated between transmembrane domain (TM) 3 and TM7. The nucleobase was oriented towards TM1, TM2, and TM7, in the direction of the extracellular side of the receptor. The phosphate chain was oriented towards TM6, in the direction of the extracellular loops (ELs), and was coordinated by three critical cationic residues. In particular, in the P2Y1, P2Y2, P2Y4, and P2Y6 receptors the nucleotide ligands had very similar positions. ADP in the P2Y12 receptor was located deeper inside the receptor in comparison to other subtypes, and the uridine moiety of UDP-glucose in the P2Y14 receptor was located even deeper and shifted toward TM7. In general, these findings are in agreement with the proposed binding site of small molecules to other class A GPCRs.

  8. Molecular mechanism of ATP binding and ion channel activation in P2X receptors

    SciTech Connect

    Hattori, Motoyuki; Gouaux, Eric


    P2X receptors are trimeric ATP-activated ion channels permeable to Na{sup +}, K{sup +} and Ca{sup 2+}. The seven P2X receptor subtypes are implicated in physiological processes that include modulation of synaptic transmission, contraction of smooth muscle, secretion of chemical transmitters and regulation of immune responses. Despite the importance of P2X receptors in cellular physiology, the three-dimensional composition of the ATP-binding site, the structural mechanism of ATP-dependent ion channel gating and the architecture of the open ion channel pore are unknown. Here we report the crystal structure of the zebrafish P2X4 receptor in complex with ATP and a new structure of the apo receptor. The agonist-bound structure reveals a previously unseen ATP-binding motif and an open ion channel pore. ATP binding induces cleft closure of the nucleotide-binding pocket, flexing of the lower body {beta}-sheet and a radial expansion of the extracellular vestibule. The structural widening of the extracellular vestibule is directly coupled to the opening of the ion channel pore by way of an iris-like expansion of the transmembrane helices. The structural delineation of the ATP-binding site and the ion channel pore, together with the conformational changes associated with ion channel gating, will stimulate development of new pharmacological agents.

  9. Distinction in binding of peptides (P2E) and its mutations (P2G, P2Q) to a graphene sheet via a hierarchical coarse-grained Monte Carlo simulation

    NASA Astrophysics Data System (ADS)

    Pandey, R. B.; Farmer, B. L.


    A hierarchical coarse-grained approach is used to study the binding of peptides (P2E: 1E2P3L4Q5L6K7M) and variants (P2G: 1G2P3L4Q5L6K7M and P2Q: 1Q2L3P4M5E6K7L) with a graphene sheet. Simulation-based residue-substrate and hydropathy index-based residue-residue interaction is used as input to a phenomenological interaction potential for peptide chains to execute the stochastic motion with a graphene sheet at the center of a box. Large-scale Monte Carlo simulations are performed at a range (low to high) of temperatures to identify peptides binding with the graphene sheet with a constant peptide concentration (Cp = 0.01). A number of local (energy, mobility, and substrate contact profiles) and global (density profiles, mean square displacement of the center of mass of a peptide and its radius of gyration) physical quantities are examined to monitor the patterns. We find that each peptide can bind to a graphene sheet at low temperatures but the residues that can anchor their binding vary among these three peptides. For example, P2E is anchored by 1E, 4Q, and 6K, P2Q by 1Q, 5E, and 6K, and P2G by nearly all its residues with about the same strength except 1G and 2P. The site-specific binding is reflected in the thermal response of the radius of gyration of the peptides. Despite the lack of a large difference in binding patterns, a systematic variation in radius of gyration and surface binding profile with the temperature reveals the distinction in their binding: the probability of P2E binding is the highest and that of P2G is the lowest.

  10. Ribonucleases from the extreme thermophilic archaebacterium S. solfataricus.


    Fusi, P; Tedeschi, G; Aliverti, A; Ronchi, S; Tortora, P; Guerritore, A


    A purification procedure consisting of DEAE-Sephacel chromatography, heparin-Sepharose CL-6B chromatography and Mono-S chromatography led to the isolation of three proteins endowed with RNase activity from the thermoacidophilic archaebacterium Sulfolobus solfataricus. They were referred to as p1, p2 and p3, according to their elution order from the Mono-S column. Complete amino acid sequence of p2 and partial sequence of p3 displayed high sequence similarity to the 7-kDa DNA-binding proteins previously isolated in Sulfolobus strains [Choli, T., Wittman-Liebold, B. & Reinhardt, R. (1988) J. Biol. Chem. 263, 7087-7093]. The molecular mass of p2, calculated from sequence data, was 7.02 kDa, which compares fairly well with the value of 7.4 kDa determined by SDS/PAGE. Gel filtration of the molecule under native conditions displayed, however, a largely prevailing form with an assessed molecular mass of 13.0 kDa, which points to a dimeric structure. Kinetic characterization of protein p2 showed a broad pH optimum in the range 6.7-7.6 using yeast RNA as substrate; also, it was shown that activity was unaffected by EDTA, Mg2+ and phosphate. The enzyme did not accept as substrate any homopolyribonucleotide, which points to a rather narrow substrate specificity. This was also confirmed by incubating p2 with tRNA(fMet)Met (fMet, N-formylmethionine) from Escherichia coli: the hydrolysis products were thus identified as 3'-phosphooligonucleotides.

  11. Cangrelor inhibits the binding of the active metabolites of clopidogrel and prasugrel to P2Y12 receptors in vitro.


    Judge, Heather M; Buckland, Robert J; Jakubowski, Joseph A; Storey, Robert F


    Cangrelor is a rapid-acting, direct-binding, and reversible P2Y12 antagonist which has been studied for use during percutaneous coronary intervention (PCI) in patients with or without pretreatment with an oral P2Y12 antagonist. As cangrelor is administered intravenously, it is necessary to switch to an oral P2Y12 antagonist following PCI, such as the thienopyridines clopidogrel, and prasugrel or the non-pyridine ticagrelor. Previous studies have suggested a negative pharmacodynamic interaction between cangrelor and thienopyridines. This in vitro study evaluated the receptor-level interaction between cangrelor and the active metabolite (AM) of clopidogrel or prasugrel by assessing functional P2Y12 receptor number using a (33)P-2MeSADP binding assay. All P2Y12 antagonists studied resulted in strong P2Y12 receptor blockade (cangrelor: 93.6%; clopidogrel AM: 93.0%; prasugrel AM: 97.9%). Adding a thienopyridine AM in the presence of cangrelor strongly reduces P2Y12 receptor blockade by the AM (clopidogrel AM: 7%, prasugrel AM: 3.2%). The thienopyridine AMs had limited ability to compete with cangrelor for binding to P2Y12 (% P2Y12 receptor blockade after co-incubation with cangrelor 1000 nmol/L: 11.7% for clopidogrel AM 3 µmol/L; 34.1% for prasugrel AM 3 µmol/L). In conclusion, in vitro cangrelor strongly inhibits the binding of clopidogrel and prasugrel AMs to the P2Y12 receptor, consistent with the previous observation of a negative pharmacodynamic interaction. Care may need to be taken to not overlap exposure to thienopyridine AMs and cangrelor in order to reduce the risk of thrombotic complications following PCI.

  12. 2,2′-Pyridylisatogen tosylate antagonizes P2Y1 receptor signaling without affecting nucleotide binding

    PubMed Central

    Gao, Zhan-Guo; Mamedova, Liaman; Tchilibon, Susanna; Gross, Ariel S.; Jacobson, Kenneth A.


    The effect of 2,2′-pyridylisatogen tosylate (PIT) on the human P2Y1 receptor and on other recombinant P2Y receptors has been studied. We first examined the modulation by PIT of the agonist-induced accumulation of inositol phosphates. PIT blocked 2-methylthio-ADP (2-MeSADP)-induced accumulation of inositol phosphates in 1321N1 astrocytoma cells stably expressing human P2Y1 receptors in a non-competitive and concentration-dependent manner. The IC50 for reduction of the maximal agonist effect was 0.14 μM. In contrast, MRS2179, a competitive P2Y1 receptor antagonist, parallel-shifted the agonist concentration–response curve to the right. PIT also concentration-dependently blocked the P2Y1 receptor signaling induced by the endogenous agonists, ADP and ATP. A simple structural analogue of PIT was synthesized and found to be inactive as a P2Y1 receptor antagonist, suggesting that the nitroxyl group of PIT is a necessary structural component for P2Y1 receptor antagonism. We next examined the possible modulation of the binding of the newly available antagonist radioligand for the P2Y1 receptor, [3H] MRS2279. It was found that PIT (0.01–10 μM) did not inhibit [3H] MRS2279 binding to the human P2Y1 receptor. PIT (10 μM) had no effect on the competition for [3H] MRS2279 binding by agonists, ADP and ATP, suggesting that its antagonism of the P2Y1 receptor may be allosteric. PIT had no significant effect on agonist activation of other P2Y receptors, including P2Y2, P2Y4, P2Y6, P2Y11 and P2Y12 receptors. Thus, PIT selectively and non-competitively blocked P2Y1 receptor signaling without affecting nucleotide binding. PMID:15193995

  13. Binding of the P2Y2 Nucleotide Receptor to Filamin A Regulates Migration of Vascular Smooth Muscle Cells

    PubMed Central

    Yu, Ningpu; Erb, Laurie; Shivaji, Rikka; Weisman, Gary A.; Seye, Cheikh I.


    The functional expression of the G protein– coupled P2Y2 nucleotide receptor (P2Y2R) has been associated with proliferation and migration of vascular smooth muscle cells (SMCs), 2 processes involved in atherosclerosis and restenosis. Activation of the P2Y2R causes dynamic reorganization of the actin cytoskeleton, which transmits biochemical signals and forces necessary for cell locomotion, suggesting that P2Y2Rs may be linked to the actin cytoskeleton. Here, we identified filamin A (FLNa) as a P2Y2R-interacting protein using a yeast 2-hybrid system screen with the C-terminal region of the P2Y2R as bait. The FLNa binding site in the P2Y2R is localized between amino acids 322 and 333. Deletion of this region led to selective loss of FLNa binding to the P2Y2R and abolished Tyr phosphorylation of FLNa induced by the P2Y2R agonist UTP. Using both time-lapse microscopy and the Transwell cell migration assay, we showed that UTP significantly increased SMC spreading on collagen I (6.8 fold; P≤0.01) and migration (3.6 fold; P≤0.01) of aortic SMCs isolated from wild-type mice, as compared with unstimulated SMCs. UTP-induced spreading and migration of aortic SMCs did not occur with cells isolated from P2Y2R knockout mice. Expression of the full-length P2Y2R in SMCs isolated from P2Y2R knockout mice restored both UTP-induced spreading and migration. In contrast, UTP-induced spreading and migration did not occur in SMCs isolated from P2Y2R knockout mice transfected with a mutant P2Y2R that does not bind FLNa. Furthermore, ex vivo studies showed that both ATP and UTP (10 µmol/L) promoted migration of SMCs out of aortic explants isolated from wild-type but not P2Y2R knockout mice. Thus, this study demonstrates that P2Y2R/FLNa interaction selectively regulates spreading and migration of vascular SMCs. PMID:18202316

  14. Assembly of Saccharomyces cerevisiae ribosomal stalk: binding of P1 proteins is required for the interaction of P2 proteins.


    Zurdo, J; Parada, P; van den Berg, A; Nusspaumer, G; Jimenez-Diaz, A; Remacha, M; Ballesta, J P


    The yeast ribosomal stalk is formed by a protein pentamer made of the 38 kDa P0 and four 12 kDa acidic P1/P2. The interaction of recombinant acidic proteins P1 alpha and P2 beta with ribosomes from Saccharomyces cerevisiae D4567, lacking all the 12 kDa stalk components, has been used to study the in vitro assembly of this important ribosomal structure. Stimulation of the ribosome activity was obtained by incubating simultaneously the particles with both proteins, which were nonphosphorylated initially and remained unmodified afterward. The N-terminus state, free or blocked, did not affect either the binding or reactivating activity of both proteins. Independent incubation with each protein did not affect the activity of the particles, however, protein P2 beta alone was unable to bind the ribosome whereas P1 alpha could. The binding of P1 alpha alone is a saturable process in acidic-protein-deficient ribosomes and does not take place in complete wild-type particles. Binding of P1 proteins in the absence of P2 proteins takes also place in vivo, when protein P1 beta is overexpressed in S. cerevisiae. In contrast, protein P2 beta is not detected in the ribosome in the P1-deficient D67 strain despite being accumulated in the cytoplasm. The results confirm that neither phosphorylation nor N-terminal blocking of the 12 kDa acidic proteins is required for the assembly and function of the yeast stalk. More importantly, and regardless of the involvement of other elements, they indicate that stalk assembling is a coordinated process, in which P1 proteins would provide a ribosomal anchorage to P2 proteins, and P2 components would confer functionality to the complex.

  15. Evidence for co-operativity in coenzyme binding to tetrameric Sulfolobus solfataricus alcohol dehydrogenase and its structural basis: fluorescence, kinetic and structural studies of the wild-type enzyme and non-co-operative N249Y mutant

    PubMed Central


    The interaction of coenzyme with thermostable homotetrameric NAD(H)-dependent alcohol dehydrogenase from the thermoacidophilic sulphur-dependent crenarchaeon Sulfolobus solfataricus (SsADH) and its N249Y (Asn-249→Tyr) mutant was studied using the high fluorescence sensitivity of its tryptophan residues Trp-95 and Trp-117 to the binding of coenzyme moieties. Fluorescence quenching studies performed at 25 °C show that SsADH exhibits linearity in the NAD(H) binding [the Hill coefficient (h)∼1) at pH 9.8 and at moderate ionic strength, in addition to positive co-operativity (h=2.0–2.4) at pH 7.8 and 6.8, and at pH 9.8 in the presence of salt. Furthermore, NADH binding is positively co-operative below 20 °C (h∼3) and negatively co-operative at 40–50 °C (h∼0.7), as determined at moderate ionic strength and pH 9.8. Steady-state kinetic measurements show that SsADH displays standard Michaelis–Menten kinetics between 35 and 45 °C, but exhibits positive and negative co-operativity for NADH oxidation below (h=3.3 at 20 °C) and above (h=0.7 at 70–80 °C) this range of temperatures respectively. However, N249Y SsADH displays non-co-operative behaviour in coenzyme binding under the same experimental conditions used for the wild-type enzyme. In loop 270–275 of the coenzyme domain and segments at the interface of dimer A–B, analyses of the wild-type and mutant SsADH structures identified the structural elements involved in the intersubunit communication and suggested a possible structural basis for co-operativity. This is the first report of co-operativity in a tetrameric ADH and of temperature-induced co-operativity in a thermophilic enzyme. PMID:15651978

  16. Low affinity binding in cis to P2Y2R mediates force-dependent integrin activation during hantavirus infection.


    Bondu, Virginie; Wu, Chenyu; Cao, Wenpeng; Simons, Peter C; Gillette, Jennifer; Zhu, Jieqing; Erb, Laurie; Zhang, X Frank; Buranda, Tione


    Pathogenic hantaviruses bind to the Plexin Semaphorin Integrin (PSI) domain of inactive, β3 integrins. Previous studies have implicated a cognate cis interaction between the bent conformation β5/β3 integrins and an RGD sequence in the first extracellular loop of P2Y2R (Erb et al., 2001). With single-molecule atomic force microscopy, we show a cognate interaction between (RGD)P2Y2R and an AFM tip decorated with recombinant αIIbβ3 integrins expressed on cell membranes. Mutation of the RGD sequence to RGE in the P2Y2R removes this interaction. Binding of inactivated and fluorescently labeled Sin Nombre virus (SNV) to the integrin PSI domain stimulates higher affinity for (RGD)P2Y2R on cells, as measured by an increase in the unbinding force. In CHO cells, stably expressing αIIbβ3 integrins, virus engagement at the integrin PSI domain, recapitulates physiologic activation of the integrin as indicated by staining with the activation specific mAB PAC1. The data also show that blocking of the Gα13 protein from binding to the cytoplasmic domain of the β3 integrin prevents outside-in signaling and infection. We propose that the cis interaction with P2Y2R provides allosteric resistance to the membrane-normal motion associated with the switchblade model of integrin activation, where the development of tensile force, yields physiological integrin activation. © 2017 by The American Society for Cell Biology.

  17. Anomalous behaviour of the STAT3 binding site in the human c-myc P2 promoter

    SciTech Connect

    Vougier, Stephanie; Cheung, S.-H.; Li Li; Hodgson, Glenn; Shaw, Peter E


    The Signal Transducer and Activator of Transcription 3 (STAT3) is necessary for ES cell renewal, plays critical roles during vertebrate development, and has oncogenic potential. STAT3 also mediates cytokine responses notably in the induction of acute phase response genes in the liver. Thus STAT3 is a pleiotropic regulator during cell proliferation and a cell-specific mediator of pro-inflammatory responses. How STAT3 fulfils both roles is unclear. To address this question we attempted to characterise pre-initiation complexes (PICs) on STAT3-responsive promoters containing the c-myc P2 promoter element (P2E) or c-fos Serum-Inducible Element (SIE). Although both promoters mediated cytokine responses in HepG2 cells, poor binding of STAT1 and STAT3 in vitro precluded isolation of active promoter complexes on the P2E. The inability of STAT3 to bind the P2E in vitro correlated with failure of the P2E to mediate cytokine-responsive gene expression in several other cell types. Thus the c-myc P2E behaves as a dual-purpose STAT3 element with anomalous characteristics in HepG2 cells.

  18. Phospholipase Cζ binding to PtdIns(4,5)P2 requires the XY-linker region

    PubMed Central

    Nomikos, Michail; Elgmati, Khalil; Theodoridou, Maria; Calver, Brian L.; Nounesis, George; Swann, Karl; Lai, F. Anthony


    Phospholipase C-zeta (PLCζ) is a strong candidate for the mammalian sperm-derived factor that triggers the Ca2+ oscillations required for egg activation at fertilization. PLCζ lacks a PH domain, which targets PLCδ1 to the phosphatidylinositol 4,5-bisphosphate (PtdIns(4,5)P2) substrate in the plasma membrane. Previous studies failed to detect PLCζ in the plasma membrane, hence the means of PLCζ binding to PtdIns(4,5)P2 is unclear. We find that the PLCζ XY linker, but not the C2 domain, exhibits robust binding to PtdIns(4,5)P2 or to liposomes containing near-physiological levels of PtdIns(4,5)P2. The role of positively charged residues within the XY linker was addressed by sequentially substituting alanines for three lysine residues, K374, K375 and K377. Microinjection of these mutants into mouse eggs enabled their Ca2+ oscillation-inducing activities to be compared with wild-type PLCζ. The XY-linker mutant proteins were purified and the in vitro PtdIns(4,5)P2 hydrolysis and binding properties were monitored. Successive reduction of net positive charge within the PLCζ XY linker significantly affects both in vivo Ca2+-oscillation-inducing activity and in vitro PtdIns(4,5)P2 interaction of mouse PLCζ. Our data suggest that positively charged residues within the XY linker play an important role in the PLCζ interaction with PtdIns(4,5)P2, a crucial step in generating the Ca2+ activation signal that is essential for fertilization in mammals. PMID:21730019

  19. An 8.5-kDa ribonuclease from the extreme thermophilic archaebacterium Sulfolobus solfataricus.


    Fusi, P; Grisa, M; Tedeschi, G; Negri, A; Guerritore, A; Tortora, P


    Protein p3, a ribonuclease we previously isolated from the archaebacterium Sulfolobus solfataricus [P. Fusi et al. (1993) Eur. J. Biochem. 211, 305-310], was subjected to complete amino acid sequencing. It consisted of 75 residues, with a calculated M(r) of 8582, a pI of 10.1, and had some degree of monomethylation at Lys-4 and Lys-6. p2, a previously sequenced, 62-residue ribonuclease from the same organism, had an identical sequence for 57 consecutive residues starting from the N-terminus. p2 and p3 also showed a striking similarity to five other proteins previously isolated from Sulfolobus strains and identified as DNA-binding proteins. However, the C-terminus, 10 residue region of p3 did not show any similarity to these proteins; in contrast, it was significantly similar to stretches in three eubacterial ribonucleases from Bacillus strains. No difference between p2 and p3 has so far been detected as regards their catalytic properties. Available data suggest that these molecules have a narrow substrate specificity and probably play specific roles in RNA processing.

  20. Validation of Alexa-647-ATP as a powerful tool to study P2X receptor ligand binding and desensitization.


    Bhargava, Yogesh; Nicke, Annette; Rettinger, Jürgen


    Ion channel opening and desensitization is a fundamental process in neurotransmission. The ATP-gated P2X1 receptor (P2X1R) shows rapid and long-lasting desensitization upon agonist binding. This makes the electrophysiological investigation of its desensitization process, agonist unbinding, and recovery from desensitization a challenging task. Here, we show that the fluorescent agonist Alexa-647-ATP is a potent agonist at the P2X1R and a versatile tool to directly visualize agonist binding and unbinding. We demonstrate that the long-lasting desensitization of the P2X1R is due to both slow unbinding of agonist from the desensitized receptor and agonist mediated receptor internalization. Furthermore, the unbinding of the agonist Alexa-647-ATP from the desensitized receptor is accelerated in the continuous presence of competitive ligand. Modeling of our data indicates that three agonist molecules are required to drive the receptor into desensitization. Direct visualization of ligand unbinding from the desensitized receptor demonstrates the cooperativity of this process.

  1. Loss of Fatty Acid Binding Protein 4/aP2 Reduces Macrophage Inflammation Through Activation of SIRT3

    PubMed Central

    Xu, Hongliang; Hertzel, Ann V.; Steen, Kaylee A.


    Activation of proinflammatory macrophages plays an important role in the pathogenesis of insulin resistance, type 2 diabetes, and atherosclerosis. Previous work using high fat-fed mice has shown that ablation of the adipocyte fatty acid binding protein (FABP4/aP2) in macrophages leads to an antiinflammatory state both in situ and in vivo, and the mechanism is linked, in part, to increased intracellular monounsaturated fatty acids and the up-regulation of uncoupling protein 2. Here, we show that loss of FABP4/aP2 in macrophages additionally induces sirtuin 3 (SIRT3) expression and that monounsaturated fatty acids (C16:1, C18:1) lead to increased SIRT3 protein expression. Increased expression of SirT3 in FABP4/aP2 null macrophages occurs at the protein level with no change in SirT3 mRNA. When compared with controls, silencing of SIRT3 in Raw246.7 macrophages leads to increased expression of inflammatory cytokines, inducible nitric oxide synthase and cyclooxygenase 2. In contrast, loss of SIRT3 in FABP4/aP2-deficient macrophages attenuates the suppressed inflammatory signaling, reduced reactive oxygen species production, lipopolysaccharide-induced mitochondrial dysfunction, and increased fatty acid oxidation. These results suggest that the antiinflammatory phenotype of FABP4/aP2 null mice is mediated by increased intracellular monounsaturated fatty acids leading to the increased expression of both uncoupling protein 2 and SirT3. PMID:26789108

  2. Purification and functional characterization of the phage P2 Ogr protein: A prokaryotic zinc-binding transcriptional activator

    SciTech Connect

    Lee, Techung.


    These studies have focused on the mechanism underlying positive control of bacteriophage P2 and P4 late gene expression; specifically, the role played by the activator ogr gene product. The phage P2 late genes are organized into four transcriptional units. Late transcription depends on the host RNA polymerase, the phage ogr gene product, and concurrent P2 DNA replication. Ogr is a 72-residue basic protein rich in cysteine and histidine. The genetic evidence implicates a physical interaction between RNA polymerase and Ogr. The Ogr protein is also a positive regulatory factor for satellite phage P4 late gene transcription. P2 and P4 together constitute a promising model for studying viral transactivation. The authors have developed a simple purification procedure for Ogr protein synthesized from an overproducing plasmid. Inclusion bodies formed upon overproduction were denatured, and the overproduced protein was purified by one-step gel filtration chromatography. The purified Ogr was allowed to refold under optimized conditions and was subsequently shown to be able to transactivate the phage P4 late promoter P{sub sid} in an in vitro coupled transcription-translation system. Using a {sup 65}Zn blotting method and absorption spectroscopy, the author show that Ogr is a zinc-binding protein and that the conserved cysteine residues are involved in forming a complex with Zn(II). The purification procedure allows Ogr to be obtained in both high purity and yield. In addition, Ogr is characterized as to its molar extinction coefficient, molecular weight, amino acid composition, N-terminal sequence and secondary structure. Ogr is not a phage virion protein and is a low abundant protein during a phage P2 life cycle. The Ogr protein alone does not appear to bind to the phage late promoters P{sub F} and P{sub sid}, nor is it capable of directing RNA polymerase to the promoters in vitro.

  3. Lactococcal bacteriophage p2 receptor-binding protein structure suggests a common ancestor gene with bacterial and mammalian viruses.


    Spinelli, Silvia; Desmyter, Aline; Verrips, C Theo; de Haard, Hans J W; Moineau, Sylvain; Cambillau, Christian


    Lactococcus lactis is a Gram-positive bacterium used extensively by the dairy industry for the manufacture of fermented milk products. The double-stranded DNA bacteriophage p2 infects specific L. lactis strains using a receptor-binding protein (RBP) located at the tip of its noncontractile tail. We have solved the crystal structure of phage p2 RBP, a homotrimeric protein composed of three domains: the shoulders, a beta-sandwich attached to the phage; the neck, an interlaced beta-prism; and the receptor-recognition head, a seven-stranded beta-barrel. We used the complex of RBP with a neutralizing llama VHH domain to identify the receptor-binding site. Structural similarity between the recognition-head domain of phage p2 and those of adenoviruses and reoviruses, which invade mammalian cells, suggests that these viruses, despite evolutionary distant targets, lack of sequence similarity and the different chemical nature of their genomes (DNA versus RNA), might have a common ancestral gene.

  4. Transcriptomic analysis of the SSV2 infection of Sulfolobus solfataricus with and without the integrative plasmid pSSVi.


    Ren, Yi; She, Qunxin; Huang, Li


    The fusellovirus SSV2 and the integrative plasmid pSSVi, which constitute a unique helper-satellite virus system, replicate in Sulfolobus solfataricus P2. In this study, we investigated the interplay among SSV2, pSSVi and their host by transcriptomic analysis. Following infection of S. solfataricus P2, SSV2 activated its promoters in a temporal and distributive fashion, starting from the transcription of ORF305. Expression of several host genes encoding DNA replication and transcription proteins was up-regulated, suggesting that SSV2 depended heavily on the host replication machinery for its replication. SSV2 gene expression appeared to follow a similar pattern in S. solfataricus P2 harboring pSSVi to that in S. solfataricus P2 lacking the plasmid. Several early genes of the virus were transcribed earlier and more efficiently in the presence of pSSVi than in its absence. These results provide valuable clues to the understanding of the three-way interactions among SSV2, pSSVi and the host.

  5. An exosome-like complex in Sulfolobus solfataricus

    PubMed Central

    Evguenieva-Hackenberg, Elena; Walter, Pamela; Hochleitner, Elisabeth; Lottspeich, Friedrich; Klug, Gabriele


    We present the first experimental evidence for the existence of an exosome-like protein complex in Archaea. In Eukarya, the exosome is essential for many pathways of RNA processing and degradation. Co-immunoprecipitation with antibodies directed against the previously predicted Sulfolobus solfataricus orthologue of the exosome subunit ribosomal-RNA-processing protein 41 (Rrp41) led to the purification of a 250-kDa protein complex from S. solfataricus. Approximately half of the complex cosediments with ribosomal subunits. It comprises four previously predicted orthologues of the core exosome subunits from yeast (Rrp41, Rrp42, Rrp4 and Csl4 (cep1 synthetic lethality 4; an RNA-binding protein and exosome subunit)), whereas other predicted subunits were not found. Surprisingly, the archaeal homologue of the bacterial DNA primase DnaG was tightly associated with the complex. This suggests an RNA-related function for the archaeal DnaG-like proteins. Comparison of experimental data from different organisms shows that the minimal core of the exosome consists of at least one phosphate-dependent ribonuclease PH homologue, and of Rrp4 and Csl4. Such a protein complex was probably present in the last common ancestor of Archaea and Eukarya. PMID:12947419

  6. Genome-Scale Reconstruction and Analysis of the Metabolic Network in the Hyperthermophilic Archaeon Sulfolobus Solfataricus

    PubMed Central

    Ulas, Thomas; Riemer, S. Alexander; Zaparty, Melanie; Siebers, Bettina; Schomburg, Dietmar


    We describe the reconstruction of a genome-scale metabolic model of the crenarchaeon Sulfolobus solfataricus, a hyperthermoacidophilic microorganism. It grows in terrestrial volcanic hot springs with growth occurring at pH 2–4 (optimum 3.5) and a temperature of 75–80°C (optimum 80°C). The genome of Sulfolobus solfataricus P2 contains 2,992,245 bp on a single circular chromosome and encodes 2,977 proteins and a number of RNAs. The network comprises 718 metabolic and 58 transport/exchange reactions and 705 unique metabolites, based on the annotated genome and available biochemical data. Using the model in conjunction with constraint-based methods, we simulated the metabolic fluxes induced by different environmental and genetic conditions. The predictions were compared to experimental measurements and phenotypes of S. solfataricus. Furthermore, the performance of the network for 35 different carbon sources known for S. solfataricus from the literature was simulated. Comparing the growth on different carbon sources revealed that glycerol is the carbon source with the highest biomass flux per imported carbon atom (75% higher than glucose). Experimental data was also used to fit the model to phenotypic observations. In addition to the commonly known heterotrophic growth of S. solfataricus, the crenarchaeon is also able to grow autotrophically using the hydroxypropionate-hydroxybutyrate cycle for bicarbonate fixation. We integrated this pathway into our model and compared bicarbonate fixation with growth on glucose as sole carbon source. Finally, we tested the robustness of the metabolism with respect to gene deletions using the method of Minimization of Metabolic Adjustment (MOMA), which predicted that 18% of all possible single gene deletions would be lethal for the organism. PMID:22952675

  7. Molecular Determinants of Phosphatidylinositol 4,5-Bisphosphate (PI(4,5)P2) Binding to Transient Receptor Potential V1 (TRPV1) Channels*

    PubMed Central

    Poblete, Horacio; Oyarzún, Ingrid; Olivero, Pablo; Comer, Jeffrey; Zuñiga, Matías; Sepulveda, Romina V.; Báez-Nieto, David; González Leon, Carlos; González-Nilo, Fernando; Latorre, Ramón


    Phosphatidylinositol 4,5-bisphosphate (PI(4,5)P2) has been recognized as an important activator of certain transient receptor potential (TRP) channels. More specifically, TRPV1 is a pain receptor activated by a wide range of stimuli. However, whether or not PI(4,5)P2 is a TRPV1 agonist remains open to debate. Utilizing a combined approach of mutagenesis and molecular modeling, we identified a PI(4,5)P2 binding site located between the TRP box and the S4-S5 linker. At this site, PI(4,5)P2 interacts with the amino acid residues Arg-575 and Arg-579 in the S4-S5 linker and with Lys-694 in the TRP box. We confirmed that PI(4,5)P2 behaves as a channel agonist and found that Arg-575, Arg-579, and Lys-694 mutations to alanine reduce PI(4,5)P2 binding affinity. Additionally, in silico mutations R575A, R579A, and K694A showed that the reduction in binding affinity results from the delocalization of PI(4,5)P2 in the binding pocket. Molecular dynamics simulations indicate that PI(4,5)P2 binding induces conformational rearrangements of the structure formed by S6 and the TRP domain, which cause an opening of the lower TRPV1 channel gate. PMID:25425643

  8. Two suramin binding sites are present in guinea pig but only one in murine native P2X myenteric receptors.


    Guerrero-Alba, Raquel; Valdez-Morales, Eduardo; Juárez, Esri H; Miranda-Morales, Marcela; Ramírez-Martínez, Juan F; Espinosa-Luna, Rosa; Barajas-López, Carlos


    Whole-cell patch clamp recordings were used to characterise the physiological and pharmacological properties of P2X receptors of mouse and guinea pig myenteric neurons from the small intestine. ATP application induced a rapid inward current in 95% of recorded neurons of both species when were voltage clamped at -60 mV. Concentration-response curves for ATP (1-3000 microM) yielded EC(50) values of 114 and 115 microM for mouse and guinea pig myenteric neurons, respectively, with a Hill coefficient value of 1.02 and 0.79, respectively, which were not significantly different of unity. alpha,beta-methylene ATP (100 microM) was virtually inactive in both species. Pyridoxalphophate-6-azophenyl-2',4'-disulphonic acid (0.01-30 microM) inhibited the ATP-induced currents (I(ATP)) with a different potency; being the IC(50) 0.6 and 1.8 microM in mouse and guinea pig, respectively. In mouse myenteric neurons, I(ATP) were inhibited by suramin whereas in guinea pig neurons we observed two effects, potentiation and inhibition of these currents. On guinea pig, both effects of suramin had different recovering kinetics and concentration dependency, indicating that they are mediated by at least two different binding sites. Our observations indicate that myenteric P2X receptors in these two species have different pharmacological properties.

  9. The Ca(2+) -binding protein PCaP2 located on the plasma membrane is involved in root hair development as a possible signal transducer.


    Kato, Mariko; Aoyama, Takashi; Maeshima, Masayoshi


    Plasma membrane-associated Ca(2+) -binding protein-2 (PCaP2) of Arabidopsis thaliana is a novel-type protein that binds to the Ca(2+) /calmodulin complex and phosphatidylinositol phosphates (PtdInsPs) as well as free Ca(2+) . Although the PCaP2 gene is predominantly expressed in root hair cells, it remains unknown how PCaP2 functions in root hair cells via binding to ligands. From biochemical analyses using purified PCaP2 and its variants, we found that the N-terminal basic domain with 23 amino acids (N23) is necessary and sufficient for binding to PtdInsPs and the Ca(2+) /calmodulin complex, and that the residual domain of PCaP2 binds to free Ca(2+) . In mutant analysis, a pcap2 knockdown line displayed longer root hairs than the wild-type. To examine the function of each domain in root hair cells, we over-expressed PCaP2 and its variants using the root hair cell-specific EXPANSIN A7 promoter. Transgenic lines over-expressing PCaP2, PCaP2(G2A) (second glycine substituted by alanine) and ∆23PCaP2 (lacking the N23 domain) exhibited abnormal branched and bulbous root hair cells, while over-expression of the N23 domain suppressed root hair emergence and elongation. The N23 domain was necessary and sufficient for the plasma membrane localization of GFP-tagged PCaP2. These results suggest that the N23 domain of PCaP2 negatively regulates root hair tip growth via processing Ca(2+) and PtdInsP signals on the plasma membrane, while the residual domain is involved in the polarization of cell expansion.

  10. The P2Y₂ receptor promotes Wnt3a- and EGF-induced epithelial tubular formation by IEC6 cells by binding to integrins.


    Ibuka, Souji; Matsumoto, Shinji; Fujii, Shinsuke; Kikuchi, Akira


    Epithelial tubular structures are essential units in various organs. Here, we used rat intestinal epithelial IEC6 cells to investigate tubulogenesis and we found that tubular formation was induced by a combination of Wnt3a and EGF signaling during three-dimensional culture. Wnt3a and EGF induced the expression of the P2Y2 receptor (P2Y2R, also known as P2RY2), and knockdown of P2Y2R suppressed tubular formation. A P2Y2R mutant that lacks nucleotide responsiveness rescued the phenotypes resulting from P2Y2R knockdown, suggesting that nucleotide-dependent responses are not required for P2Y2R functions in tubular formation. The Arg-Gly-Asp (RGD) sequence of P2Y2R has been shown to interact with integrins, and a P2Y2R mutant lacking integrin-binding activity was unable to induce tubular formation. P2Y2R expression inhibited the interaction between integrins and fibronectin, and induced cell morphological changes and proliferation. Inhibition of integrin and fibronectin binding by treatment with the cyclic RGD peptide and fibronectin knockdown induced tubular formation in the presence of EGF alone, but a fibronectin coat suppressed Wnt3a- and EGF-induced tubular formation. These results suggest that Wnt3a- and EGF-induced P2Y2R expression causes tubular formation by preventing the binding of integrins and fibronectin rather than by mediating nucleotide responses. © 2015. Published by The Company of Biologists Ltd.

  11. The P1/P2 proteins of the human ribosomal stalk are required for ribosome binding and depurination by ricin in human cells

    PubMed Central

    May, Kerrie L.; Li, Xiao-Ping; Martínez-Azorín, Francisco; Ballesta, Juan P.G.; Grela, Przemysław; Tchórzewski, Marek; Tumer, Nilgun E.


    Ricin A chain (RTA) depurinates the sarcin/ricin loop (SRL) of 28S ribosomal RNA and inhibits protein synthesis in mammalian cells. In yeast, the ribosomal stalk facilitates the interaction of RTA with the ribosome and subsequent depurination. Despite homology between the stalk structures from yeast and humans there are notable differences. The human ribosomal stalk contains two identical heterodimers of P1/P2 bound to P0, while the yeast stalk consists of two different heterodimers, P1α/P2β and P2α/P1β, bound to P0. RTA exhibits higher activity towards mammalian ribosomes than ribosomes from other organisms, suggesting that the mode of interaction with ribosomes may vary. Here we examine whether the human ribosomal stalk proteins facilitate the interaction of RTA with human ribosomes and subsequent depurination of the SRL. Using siRNA-mediated knockdown of P1/P2 expression in human cells, we demonstrate that the depurination activity of RTA is lower when P1 and P2 protein levels are reduced. Ribosomes from P1/P2-depleted cells have a reduced ability to bind RTA by Biacore analysis, which correlates with reduced depurination activity both in vitro and inside cells. RTA interacts directly with recombinant human P1/P2 dimer, further demonstrating the importance of the human P1/P2 proteins in enabling RTA to bind and depurinate human ribosomes. PMID:22909382

  12. Structure of dimeric, recombinant Sulfolobus solfataricus phosphoribosyl diphosphate synthase: a bent dimer defining the adenine specificity of the substrate ATP.


    Andersen, Rune W; Leggio, Leila Lo; Hove-Jensen, Bjarne; Kadziola, Anders


    The enzyme 5-phosphoribosyl-1-α-diphosphate (PRPP) synthase (EC catalyses the Mg(2+)-dependent transfer of a diphosphoryl group from ATP to the C1 hydroxyl group of ribose 5-phosphate resulting in the production of PRPP and AMP. A nucleotide sequence specifying Sulfolobus solfataricus PRPP synthase was synthesised in vitro with optimised codon usage for expression in Escherichia coli. Following expression of the gene in E. coli PRPP synthase was purified by heat treatment and ammonium sulphate precipitation and the structure of S. solfataricus PRPP synthase was determined at 2.8 Å resolution. A bent dimer oligomerisation was revealed, which seems to be an abundant feature among PRPP synthases for defining the adenine specificity of the substrate ATP. Molecular replacement was used to determine the S. solfataricus PRPP synthase structure with a monomer subunit of Methanocaldococcus jannaschii PRPP synthase as a search model. The two amino acid sequences share 35 % identity. The resulting asymmetric unit consists of three separated dimers. The protein was co-crystallised in the presence of AMP and ribose 5-phosphate, but in the electron density map of the active site only AMP and a sulphate ion were observed. Sulphate ion, reminiscent of the ammonium sulphate precipitation step of the purification, seems to bind tightly and, therefore, presumably occupies and blocks the ribose 5-phosphate binding site. The activity of S. solfataricus PRPP synthase is independent of phosphate ion.

  13. Conformational flexibility of the agonist binding jaw of the human P2X3 receptor is a prerequisite for channel opening

    PubMed Central

    Kowalski, M; Hausmann, R; Dopychai, A; Grohmann, M; Franke, H; Nieber, K; Schmalzing, G; Illes, P; Riedel, T


    Background and Purpose It is assumed that ATP induces closure of the binding jaw of ligand-gated P2X receptors, which eventually results in the opening of the membrane channel and the flux of cations. Immobilization by cysteine mutagenesis of the binding jaw inhibited ATP-induced current responses, but did not allow discrimination between disturbances of binding, gating, subunit assembly or trafficking to the plasma membrane. Experimental Approach A molecular model of the pain-relevant human (h)P2X3 receptor was used to identify amino acid pairs, which were located at the lips of the binding jaw and did not participate in agonist binding but strongly approached each other even in the absence of ATP. Key Results A series of cysteine double mutant hP2X3 receptors, expressed in HEK293 cells or Xenopus laevis oocytes, exhibited depressed current responses to α,β-methylene ATP (α,β-meATP) due to the formation of spontaneous inter-subunit disulfide bonds. Reducing these bonds with dithiothreitol reversed the blockade of the α,β-meATP transmembrane current. Amino-reactive fluorescence labelling of the His-tagged hP2X3 receptor and its mutants expressed in HEK293 or X. laevis oocytes demonstrated the formation of inter-subunit cross links in cysteine double mutants and, in addition, confirmed their correct trimeric assembly and cell surface expression. Conclusions and Implications In conclusion, spontaneous tightening of the binding jaw of the hP2X3 receptor by inter-subunit cross-linking of cysteine residues substituted at positions not directly involved in agonist binding inhibited agonist-evoked currents without interfering with binding, subunit assembly or trafficking. PMID:24989924

  14. Uncoupling of Obesity from Insulin Resistance Through a Targeted Mutation in aP2, the Adipocyte Fatty Acid Binding Protein

    NASA Astrophysics Data System (ADS)

    Hotamisligil, Gokhan S.; Johnson, Randall S.; Distel, Robert J.; Ellis, Ramsey; Papaioannou, Virginia E.; Spiegelman, Bruce M.


    Fatty acid binding proteins (FABPs) are small cytoplasmic proteins that are expressed in a highly tissue-specific manner and bind to fatty acids such as oleic and retinoic acid. Mice with a null mutation in aP2, the gene encoding the adipocyte FABP, were developmentally and metabolically normal. The aP2-deficient mice developed dietary obesity but, unlike control mice, they did not develop insulin resistance or diabetes. Also unlike their obese wild-type counterparts, obese aP2-/- animals failed to express in adipose tissue tumor necrosis factor-α (TNF-α), a molecule implicated in obesity-related insulin resistance. These results indicate that aP2 is central to the pathway that links obesity to insulin resistance, possibly by linking fatty acid metabolism to expression of TNF-α.

  15. Identification of Toxoplasma TgPH1, a pleckstrin homology domain-containing protein that binds to the phosphoinositide PI(3,5)P2.


    Daher, Wassim; Morlon-Guyot, Juliette; Alayi, Tchilabalo Dilezitoko; Tomavo, Stan; Wengelnik, Kai; Lebrun, Maryse


    The phosphoinositide phosphatidylinositol-3,5-bisphosphate (PI(3,5)P2) plays crucial roles in the maintenance of lysosome/vacuole morphology, membrane trafficking and regulation of endolysosome-localized membrane channel activity. In Toxoplasma gondii, we previously reported that PI(3,5)P2 is essential for parasite survival by controlling homeostasis of the apicoplast, a particular organelle of algal origin. Here, by using a phosphoinositide pull-down assay, we identified TgPH1 in Toxoplasma a protein conserved in many apicomplexan parasites. TgPH1 binds specifically to PI(3,5)P2, shows punctate intracellular localization, but plays no vital role for tachyzoite growth in vitro. TgPH1 is a protein predominantly formed by a pleckstrin homology (PH) domain. So far, PH domains have been described to bind preferentially to bis- or trisphosphate phosphoinositides containing two adjacent phosphates (i.e. PI(3,4)P2, PI(4,5)P2, PI(3,4,5)P3). Therefore, our study reveals an unusual feature of TgPH1 which binds preferentially to PI(3,5)P2.

  16. A BAR-Domain Protein SH3P2, Which Binds to Phosphatidylinositol 3-Phosphate and ATG8, Regulates Autophagosome Formation in Arabidopsis[C][W

    PubMed Central

    Zhuang, Xiaohong; Wang, Hao; Lam, Sheung Kwan; Gao, Caiji; Wang, Xiangfeng; Cai, Yi; Jiang, Liwen


    Autophagy is a well-defined catabolic mechanism whereby cytoplasmic materials are engulfed into a structure termed the autophagosome. In plants, little is known about the underlying mechanism of autophagosome formation. In this study, we report that SH3 DOMAIN-CONTAINING PROTEIN2 (SH3P2), a Bin-Amphiphysin-Rvs domain–containing protein, translocates to the phagophore assembly site/preautophagosome structure (PAS) upon autophagy induction and actively participates in the membrane deformation process. Using the SH3P2–green fluorescent protein fusion as a reporter, we found that the PAS develops from a cup-shaped isolation membranes or endoplasmic reticulum–derived omegasome-like structures. Using an inducible RNA interference (RNAi) approach, we show that RNAi knockdown of SH3P2 is developmentally lethal and significantly suppresses autophagosome formation. An in vitro membrane/lipid binding assay demonstrates that SH3P2 is a membrane-associated protein that binds to phosphatidylinositol 3-phosphate. SH3P2 may facilitate membrane expansion or maturation in coordination with the phosphatidylinositol 3-kinase (PI3K) complex during autophagy, as SH3P2 promotes PI3K foci formation, while PI3K inhibitor treatment inhibits SH3P2 from translocating to autophagosomes. Further interaction analysis shows that SH3P2 associates with the PI3K complex and interacts with ATG8s in Arabidopsis thaliana, whereby SH3P2 may mediate autophagy. Thus, our study has identified SH3P2 as a novel regulator of autophagy and provided a conserved model for autophagosome biogenesis in Arabidopsis. PMID:24249832

  17. Characterization of the lipid binding properties of Otoferlin reveals specific interactions between PI(4,5)P2 and the C2C and C2F domains.


    Padmanarayana, Murugesh; Hams, Nicole; Speight, Lee C; Petersson, E James; Mehl, Ryan A; Johnson, Colin P


    Otoferlin is a transmembrane protein consisting of six C2 domains, proposed to act as a calcium sensor for exocytosis. Although otoferlin is believed to bind calcium and lipids, the lipid specificity and identity of the calcium binding domains are controversial. Further, it is currently unclear whether the calcium binding affinity of otoferlin quantitatively matches the maximal intracellular presynaptic calcium concentrations of ∼30-50 μM known to elicit exocytosis. To characterize the calcium and lipid binding properties of otoferlin, we used isothermal titration calorimetry (ITC), liposome sedimentation assays, and fluorescence spectroscopy. Analysis of ITC data indicates that with the exception of the C2A domain, the C2 domains of otoferlin bind multiple calcium ions with moderate (Kd = 25-95 μM) and low affinities (Kd = 400-700 μM) in solution. However, in the presence of liposomes, the calcium sensitivity of the domains increased by up to 10-fold. It was also determined that calcium enhanced liposome binding for domains C2B-C2E, whereas the C2F domain bound liposomes in a calcium-independent manner. Mutations that abrogate calcium binding in C2F do not disrupt liposome binding, supporting the conclusion that the interaction of the C2F domain with phosphatidylserine is calcium-independent. Further, domains C2C and C2F, not domains C2A, C2B, C2D, and C2E, bound phosphatidylinositol 4,5-bisphosphate 1,2-dioleoyl-sn-glycero-3-phospho(1'-myoinositol-4',5'-bisphosphate) [PI(4,5)P2], which preferentially steered them toward liposomes harboring PI(4,5)P2. Remarkably, lysine mutations L478A and L480A in C2C selectively weaken the PI(4,5)P2 interaction while leaving phosphatidylserine binding unaffected. Finally, shifts in the emission spectra of an environmentally sensitive fluorescent unnatural amino acid indicate that the calcium binding loops of the C2F domain directly interact with the lipid bilayer of negatively charged liposomes in a calcium

  18. Characterization of the Lipid Binding Properties of Otoferlin Reveals Specific Interactions between PI(4,5)P2 and the C2C and C2F Domains

    PubMed Central


    Otoferlin is a transmembrane protein consisting of six C2 domains, proposed to act as a calcium sensor for exocytosis. Although otoferlin is believed to bind calcium and lipids, the lipid specificity and identity of the calcium binding domains are controversial. Further, it is currently unclear whether the calcium binding affinity of otoferlin quantitatively matches the maximal intracellular presynaptic calcium concentrations of ∼30–50 μM known to elicit exocytosis. To characterize the calcium and lipid binding properties of otoferlin, we used isothermal titration calorimetry (ITC), liposome sedimentation assays, and fluorescence spectroscopy. Analysis of ITC data indicates that with the exception of the C2A domain, the C2 domains of otoferlin bind multiple calcium ions with moderate (Kd = 25–95 μM) and low affinities (Kd = 400–700 μM) in solution. However, in the presence of liposomes, the calcium sensitivity of the domains increased by up to 10-fold. It was also determined that calcium enhanced liposome binding for domains C2B–C2E, whereas the C2F domain bound liposomes in a calcium-independent manner. Mutations that abrogate calcium binding in C2F do not disrupt liposome binding, supporting the conclusion that the interaction of the C2F domain with phosphatidylserine is calcium-independent. Further, domains C2C and C2F, not domains C2A, C2B, C2D, and C2E, bound phosphatidylinositol 4,5-bisphosphate 1,2-dioleoyl-sn-glycero-3-phospho(1′-myoinositol-4′,5′-bisphosphate) [PI(4,5)P2], which preferentially steered them toward liposomes harboring PI(4,5)P2. Remarkably, lysine mutations L478A and L480A in C2C selectively weaken the PI(4,5)P2 interaction while leaving phosphatidylserine binding unaffected. Finally, shifts in the emission spectra of an environmentally sensitive fluorescent unnatural amino acid indicate that the calcium binding loops of the C2F domain directly interact with the lipid bilayer of negatively charged liposomes in a calcium

  19. Structure and Biochemical Characterization of Protein Acetyltransferase from Sulfolobus solfataricus

    SciTech Connect

    Brent, Michael M.; Iwata, Ayaka; Carten, Juliana; Zhao, Kehao; Marmorstein, Ronen


    The Sulfolobus solfataricus protein acetyltransferase (PAT) acetylates ALBA, an abundant nonspecific DNA-binding protein, on Lys{sup 16} to reduce its DNA affinity, and the Sir2 deacetylase reverses the modification to cause transcriptional repression. This represents a 'primitive' model for chromatin regulation analogous to histone modification in eukaryotes. We report the 1.84-{angstrom} crystal structure of PAT in complex with coenzyme A. The structure reveals homology to both prokaryotic GNAT acetyltransferases and eukaryotic histone acetyltransferases (HATs), with an additional 'bent helix' proximal to the substrate binding site that might play an autoregulatory function. Investigation of active site mutants suggests that PAT does not use a single general base or acid residue for substrate deprotonation and product reprotonation, respectively, and that a diffusional step, such as substrate binding, may be rate-limiting. The catalytic efficiency of PAT toward ALBA is low relative to other acetyltransferases, suggesting that there may be better, unidentified substrates for PAT. The structural similarity of PAT to eukaryotic HATs combined with its conserved role in chromatin regulation suggests that PAT is evolutionarily related to the eukaryotic HATs.

  20. N-linked glycosylation of platelet P2Y12 ADP receptor is essential for signal transduction but not for ligand binding or cell surface expression.


    Zhong, Xiaotian; Kriz, Ron; Seehra, Jasbir; Kumar, Ravindra


    P(2)Y(12) receptor is a G(i)-coupled adenosine diphosphate (ADP) receptor with a critical role in platelet aggregation. It contains two potential N-linked glycosylation sites at its extra cellular amino-terminus, which may modulate its activity. Studies of both tunicamycin treatment and site-directed mutagenesis have revealed a dispensable role of the N-linked glycosylation in the receptor's surface expression and ligand binding activity. However, the non-glycosylated P(2)Y(12) receptor is defective in the P(2)Y(12)-mediated inhibition of the adenylyl cyclase activity. Thus the study uncovers an unexpected vital role of N-linked glycans in receptor's signal transducing step but not in surface expression or ligand binding.

  1. Arabidopsis SH3P2 is an ubiquitin-binding protein that functions together with ESCRT-I and the deubiquitylating enzyme AMSH3.


    Nagel, Marie-Kristin; Kalinowska, Kamila; Vogel, Karin; Reynolds, Gregory D; Wu, Zhixiang; Anzenberger, Franziska; Ichikawa, Mie; Tsutsumi, Chie; Sato, Masa H; Kuster, Bernhard; Bednarek, Sebastian Y; Isono, Erika


    Clathrin-mediated endocytosis of plasma membrane proteins is an essential regulatory process that controls plasma membrane protein abundance and is therefore important for many signaling pathways, such as hormone signaling and biotic and abiotic stress responses. On endosomal sorting, plasma membrane proteins maybe recycled or targeted for vacuolar degradation, which is dependent on ubiquitin modification of the cargos and is driven by the endosomal sorting complexes required for transport (ESCRTs). Components of the ESCRT machinery are highly conserved among eukaryotes, but homologs of ESCRT-0 that are responsible for recognition and concentration of ubiquitylated proteins are absent in plants. Recently several ubiquitin-binding proteins have been identified that serve in place of ESCRT-0; however, their function in ubiquitin recognition and endosomal trafficking is not well understood yet. In this study, we identified Src homology-3 (SH3) domain-containing protein 2 (SH3P2) as a ubiquitin- and ESCRT-I-binding protein that functions in intracellular trafficking. SH3P2 colocalized with clathrin light chain-labeled punctate structures and interacted with clathrin heavy chain in planta, indicating a role for SH3P2 in clathrin-mediated endocytosis. Furthermore, SH3P2 cofractionates with clathrin-coated vesicles (CCVs), suggesting that it associates with CCVs in planta Mutants of SH3P2 and VPS23 genetically interact, suggesting that they could function in the same pathway. Based on these results, we suggest a role of SH3P2 as an ubiquitin-binding protein that binds and transfers ubiquitylated proteins to the ESCRT machinery.

  2. Involvement of the N-terminus of Der p 2 in IgE and monoclonal antibody binding.


    Hakkaart, G A; Aalberse, R C; van Ree, R


    The major house dust mite allergen Der p 2 was expressed as a recombinant fusion protein in Escherichia coli either with glutathione-S-transferase as fusion partner or with a poly-histidine tag. Both recombinant fusion proteins failed to react with 3/14 Der p 2-specific monoclonal antibodies (mAbs). When Der p 2 was expressed in yeast with one alanine linked N-terminally to the allergen, no reactivity was observed. When expressed without any fusion partner, all 14 mAbs showed reactivity. The addition of a single N-terminal alanine also disrupted an important epitope for IgE. In RAST inhibitions, an average decrease in inhibitory potency of 72+/-32% was observed (n = 16) with a maximum decrease of 91%. These observations suggest that the N-terminus of Der p 2 is involved in an important epitope for IgE that is disrupted by the addition of one single amino-acid. Recombinant Der p 2 molecules should therefore preferably lack any fusion peptide.

  3. Enhanced binding capability of nuclear factor-κB with demethylated P2X3 receptor gene contributes to cancer pain in rats

    PubMed Central

    Zhou, You-Lang; Jiang, Guo-Qin; Wei, Jinrong; Zhang, Hong-Hong; Chen, Wei; Zhu, Hongyan; Hu, Shufen; Jiang, Xinghong; Xu, Guang-Yin


    Abstract Nuclear factor-kappa B (NF-κB) signaling is implicated in both cancer development and inflammation processes. However, the roles and mechanisms of NF-κB signaling in the development of cancer-induced pain (CIP) remain unknown. This study was designed to investigate the roles of the p65 subunit of NF-κB in regulation of the purinergic receptor (P2X3R) plasticity in dorsal root ganglion (DRG) of CIP rats. We showed here that tumor cell injection produced mechanical and thermal hyperalgesia, and an enhanced body weight–bearing difference, which was correlated with an upregulation of p65 and P2X3R expression in lumber DRGs and a potentiation of ATP-evoked responses of tibia-innervating DRG neurons. Inhibition of NF-κB signaling using p65 inhibitor pyrrolidine dithiocarbamate, BAY-11-7082, or lentiviral-p65 short-hairpin RNA significantly attenuated CIP and reversed the activities of P2X3R. Interestingly, tumor cell injection led to a significant demethylation of CpG island in p2x3r gene promoter and enhanced ability of p65 to bind the promoter of p2x3r gene. Our findings suggest that upregulation of P2X3R expression was mediated by the enhanced binding capability of p65 with demethylated promoter of p2x3r gene, thus contributing to CIP. NF-κBp65 might be a potential target for treating CIP, a neuropathic pain generated by tumor cell–induced injury to nerves that innervate the skin. PMID:26049406

  4. Enhanced binding capability of nuclear factor-κB with demethylated P2X3 receptor gene contributes to cancer pain in rats.


    Zhou, You-Lang; Jiang, Guo-Qin; Wei, Jinrong; Zhang, Hong-Hong; Chen, Wei; Zhu, Hongyan; Hu, Shufen; Jiang, Xinghong; Xu, Guang-Yin


    Nuclear factor-kappa B (NF-κB) signaling is implicated in both cancer development and inflammation processes. However, the roles and mechanisms of NF-κB signaling in the development of cancer-induced pain (CIP) remain unknown. This study was designed to investigate the roles of the p65 subunit of NF-κB in regulation of the purinergic receptor (P2X3R) plasticity in dorsal root ganglion (DRG) of CIP rats. We showed here that tumor cell injection produced mechanical and thermal hyperalgesia, and an enhanced body weight-bearing difference, which was correlated with an upregulation of p65 and P2X3R expression in lumber DRGs and a potentiation of ATP-evoked responses of tibia-innervating DRG neurons. Inhibition of NF-κB signaling using p65 inhibitor pyrrolidine dithiocarbamate, BAY-11-7082, or lentiviral-p65 short-hairpin RNA significantly attenuated CIP and reversed the activities of P2X3R. Interestingly, tumor cell injection led to a significant demethylation of CpG island in p2x3r gene promoter and enhanced ability of p65 to bind the promoter of p2x3r gene. Our findings suggest that upregulation of P2X3R expression was mediated by the enhanced binding capability of p65 with demethylated promoter of p2x3r gene, thus contributing to CIP. NF-κBp65 might be a potential target for treating CIP, a neuropathic pain generated by tumor cell-induced injury to nerves that innervate the skin.

  5. Role of the ectodomain serine 275 in shaping the binding pocket of the ATP-gated P2X3 receptor.


    Petrenko, Nataliia; Khafizov, Kamil; Tvrdonova, Vendula; Skorinkin, Andrei; Giniatullin, Rashid


    ATP-activated P2X3 receptors expressed in nociceptive sensory neurons play an important role in pain signaling. Basic properties of this receptor subtype, including very strong desensitization, depend on the rate of dissociation of the agonist from the binding site. Even though the rough structure of the ATP binding site has been proposed on the basis of the X-ray structure of the zebrafish P2X4 receptor and mutagenesis studies, the fine subunit-specific structural properties predisposing the receptor to tight capture of the agonist inside the binding pocket have not been elucidated. In this work, by exploring in silico the functional role for the left flipper located in the ectodomain region, we identified within this loop a candidate residue S275, which could contribute to the closure of the agonist-binding pocket. Testing of the S275 mutants using the patch-clamp technique revealed a crucial role for S275 in agonist binding and receptor desensitization. The S275A mutant showed a reduced rate of onset of desensitization and accelerated resensitization and was weakly inhibited by nanomolar agonist. Extracellular calcium application produced inhibition instead of facilitation of membrane currents. Moreover, some full agonists became only partial agonists when applied to the S275A receptor. These effects were stronger with the more hydrophobic mutants S275C and S275V. Taken together, our data suggest that S275 contributes to the closure of the agonist-binding pocket and that effective capture of the agonist provided by the left flipper in calcium-dependent manner determines the high rate of desensitization, slow recovery, and sensitivity to nanomolar agonist of the P2X3 receptor.

  6. ATP release due to Thy-1–integrin binding induces P2X7-mediated calcium entry required for focal adhesion formation

    PubMed Central

    Henríquez, Mauricio; Herrera-Molina, Rodrigo; Valdivia, Alejandra; Alvarez, Alvaro; Kong, Milene; Muñoz, Nicolás; Eisner, Verónica; Jaimovich, Enrique; Schneider, Pascal; Quest, Andrew F. G.; Leyton, Lisette


    Thy-1, an abundant mammalian glycoprotein, interacts with αvβ3 integrin and syndecan-4 in astrocytes and thus triggers signaling events that involve RhoA and its effector p160ROCK, thereby increasing astrocyte adhesion to the extracellular matrix. The signaling cascade includes calcium-dependent activation of protein kinase Cα upstream of Rho; however, what causes the intracellular calcium transients required to promote adhesion remains unclear. Purinergic P2X7 receptors are important for astrocyte function and form large non-selective cation pores upon binding to their ligand, ATP. Thus, we evaluated whether the intracellular calcium required for Thy-1-induced cell adhesion stems from influx mediated by ATP-activated P2X7 receptors. Results show that adhesion induced by the fusion protein Thy-1-Fc was preceded by both ATP release and sustained intracellular calcium elevation. Elimination of extracellular ATP with Apyrase, chelation of extracellular calcium with EGTA, or inhibition of P2X7 with oxidized ATP, all individually blocked intracellular calcium increase and Thy-1-stimulated adhesion. Moreover, Thy-1 mutated in the integrin-binding site did not trigger ATP release, and silencing of P2X7 with specific siRNA blocked Thy-1-induced adhesion. This study is the first to demonstrate a functional link between αvβ3 integrin and P2X7 receptors, and to reveal an important, hitherto unanticipated, role for P2X7 in calcium-dependent signaling required for Thy-1-stimulated astrocyte adhesion. PMID:21502139

  7. PtdIns(4,5)P2 interacts with CaM binding domains on TRPM3 N-terminus.


    Holendova, Blanka; Grycova, Lenka; Jirku, Michaela; Teisinger, Jan


    TRPM3 has been reported to play an important role in Ca(2+) homeostasis, but its gating mechanisms and regulation via Ca(2+) are unknown. Ca(2+) binding proteins such as calmodulin (CaM) could be probable modulators of this ion channel. We have shown that this protein binds to two independent domains, A35-K124 and H291-G382 on the TRPM3 N-terminus, which contain conserved hydrophobic as well as positively charged residues in specific positions, and that these residues have a crucial impact on its binding. We also showed that the other Ca(2+) binding protein, S100A1, is able to bind to these regions and that CaM and S100A1 compete for these binding sites on the TRPM3 N-terminus. Moreover, our results suggest that another very important TRP channel activity modulator, PtdIns(4,5)P(2), interacts with the CaM/S100A1 binding sites on the TRPM3 N-terminus with high affinity.

  8. Crystal Structure of Cytochrome P450 (CYP105P2) from Streptomyces peucetius and Its Conformational Changes in Response to Substrate Binding

    PubMed Central

    Lee, Chang Woo; Lee, Joo-Ho; Rimal, Hemraj; Park, Hyun; Lee, Jun Hyuck; Oh, Tae-Jin


    Cytochrome P450 monooxygenases (CYP, EC belong to a large family of enzymes that catalyze the hydroxylation of various substrates. Here, we present the crystal structure of CYP105P2 isolated from Streptomyces peucetius ATCC27952 at a 2.1 Å resolution. The structure shows the presence of a pseudo-ligand molecule in the active site, which was co-purified fortuitously and is presumed to be a biphenyl derivative. Comparison with previously determined substrate-bound CYP structures showed that binding of the ligand produces large and distinctive conformational changes in α2–α3, α7–α9, and the C-terminal loop regions. This structural flexibility confirms our previous observation that CYP105P2 can accommodate a broad range of ligands. The structure complexed with a pseudo-ligand provides the first molecular view of CYP105P2–ligand interactions, and it indicates the involvement of hydrophobic residues (Pro82, Ala181, Met187, Leu189, Leu193, and Ile236) in the interactions between hydrophobic ligands and CYP105P2. These results provide useful insights into the structural changes involved in the recognition of different ligands by CYP105P2. PMID:27231902

  9. Oxidative Stickland reactions in an obligate aerobic organism - amino acid catabolism in the Crenarchaeon Sulfolobus solfataricus.


    Stark, Helge; Wolf, Jacqueline; Albersmeier, Andreas; Pham, Trong K; Hofmann, Julia D; Siebers, Bettina; Kalinowski, Jörn; Wright, Phillip C; Neumann-Schaal, Meina; Schomburg, Dietmar


    The thermoacidophilic Crenarchaeon Sulfolobus solfataricus is a model organism for archaeal adaptation to extreme environments and renowned for its ability to degrade a broad variety of substrates. It has been well characterised concerning the utilisation of numerous carbohydrates as carbon source. However, its amino acid metabolism, especially the degradation of single amino acids, is not as well understood. In this work, we performed metabolic modelling as well as metabolome, transcriptome and proteome analysis on cells grown on caseinhydrolysate as carbon source in order to draw a comprehensive picture of amino acid metabolism in S. solfataricus P2. We found that 10 out of 16 detectable amino acids are imported from the growth medium. Overall, uptake of glutamate, methionine, leucine, phenylalanine and isoleucine was the highest of all observed amino acids. Our simulations predict an incomplete degradation of leucine and tyrosine to organic acids, and in accordance with this, we detected the export of branched-chain and aromatic organic acids as well as amino acids, ammonium and trehalose into the culture supernatants. The branched-chain amino acids as well as phenylalanine and tyrosine are degraded to organic acids via oxidative Stickland reactions. Such reactions are known for prokaryotes capable of anaerobic growth, but so far have never been observed in an obligate aerobe. Also, 3-methyl-2-butenoate and 2-methyl-2-butenoate are for the first time found as products of modified Stickland reactions for the degradation of branched-chain amino acids. This work presents the first detailed description of branched-chain and aromatic amino acid catabolism in S. solfataricus. © 2017 Federation of European Biochemical Societies.

  10. Structural insights into the Ca2+ and PI(4,5)P2 binding modes of the C2 domains of rabphilin 3A and synaptotagmin 1

    PubMed Central

    Guillén, Jaime; Ferrer-Orta, Cristina; Buxaderas, Mònica; Pérez-Sánchez, Dolores; Guerrero-Valero, Marta; Luengo-Gil, Ginés; Pous, Joan; Guerra, Pablo; Gómez-Fernández, Juan C.; Verdaguer, Nuria; Corbalán-García, Senena


    Proteins containing C2 domains are the sensors for Ca2+ and PI(4,5)P2 in a myriad of secretory pathways. Here, the use of a free-mounting system has enabled us to capture an intermediate state of Ca2+ binding to the C2A domain of rabphilin 3A that suggests a different mechanism of ion interaction. We have also determined the structure of this domain in complex with PI(4,5)P2 and IP3 at resolutions of 1.75 and 1.9 Å, respectively, unveiling that the polybasic cluster formed by strands β3–β4 is involved in the interaction with the phosphoinositides. A comparative study demonstrates that the C2A domain is highly specific for PI(4,5)P2/PI(3,4,5)P3, whereas the C2B domain cannot discriminate among any of the diphosphorylated forms. Structural comparisons between C2A domains of rabphilin 3A and synaptotagmin 1 indicated the presence of a key glutamic residue in the polybasic cluster of synaptotagmin 1 that abolishes the interaction with PI(4,5)P2. Together, these results provide a structural explanation for the ability of different C2 domains to pull plasma and vesicle membranes close together in a Ca2+-dependent manner and reveal how this family of proteins can use subtle structural changes to modulate their sensitivity and specificity to various cellular signals. PMID:24302762

  11. Evidence that Asn542 of neprilysin (EC is involved in binding of the P2' residue of substrates and inhibitors.

    PubMed Central

    Dion, N; Le Moual, H; Fournié-Zaluski, M C; Roques, B P; Crine, P; Boileau, G


    Neprilysin (EC is a Zn2+ metallopeptidase involved in the degradation of biologically active peptides, e.g. enkephalins and atrial natriuretic peptide. The substrate specificity and catalytic activity of neprilysin resemble those of thermolysin, a crystallized bacterial Zn2+ metalloprotease. Despite little overall homology between the primary structures of thermolysin and neprilysin, many of the amino acid residues involved in catalysis, as well as Zn2+ and substrate binding, are highly conserved. Most of the active-site residues of neprilysin have their homologues in thermolysin and have been characterized by site-directed mutagenesis. Furthermore, hydrophobic cluster analysis has revealed some other analogies between the neprilysin and thermolysin sequences [Benchetrit, Bissery, Mornon, Devault, Crine and Roques (1988) Biochemistry 27, 592-596]. According to this analysis the role of Asn542 in the neprilysin active site is analogous to that of Asn112 of thermolysin, which is to bind the substrate. Site-directed mutagenesis was used to change Asn542 to Gly or Gln residues. The effect of these mutations on substrate catalysis and inhibitor binding was examined with a series of thiorphan-like compounds containing various degrees of methylation at the P2' residue. For both mutated enzymes, determination of kinetic parameters with [D-Ala2,Leu5]enkephalin as substrate showed that the large decrease in activity was attributable to an increase in Km (14-16-fold) whereas kcat values were only slightly affected (2-3-fold decrease). This is in agreement with Asn542 being involved in substrate binding rather than directly in catalysis. Finally, the IC50 values for thiorphan and substituted thiorphans strongly suggest that Asn542 of neprilysin binds the substrate on the amino side of the P2' residue by formation of a unique hydrogen bond. Images Figure 2 Figure 3 PMID:7487905

  12. Adenine phosphoribosyltransferase from Sulfolobus solfataricus is an enzyme with unusual kinetic properties and a crystal structure that suggests it evolved from a 6-oxopurine phosphoribosyltransferase.


    Jensen, Kaj Frank; Hansen, Michael Riis; Jensen, Kristine Steen; Christoffersen, Stig; Poulsen, Jens-Christian Navarro; Mølgaard, Anne; Kadziola, Anders


    The adenine phosphoribosyltransferase (APRTase) encoded by the open reading frame SSO2342 of Sulfolobus solfataricus P2 was subjected to crystallographic, kinetic, and ligand binding analyses. The enzyme forms dimers in solution and in the crystals, and binds one molecule of the reactants 5-phosphoribosyl-α-1-pyrophosphate (PRPP) and adenine or the product adenosine monophosphate (AMP) or the inhibitor adenosine diphosphate (ADP) in each active site. The individual subunit adopts an overall structure that resembles a 6-oxopurine phosphoribosyltransferase (PRTase) more than known APRTases implying that APRT functionality in Crenarchaeotae has its evolutionary origin in this family of PRTases. Only the N-terminal two-thirds of the polypeptide chain folds as a traditional type I PRTase with a five-stranded β-sheet surrounded by helices. The C-terminal third adopts an unusual three-helix bundle structure that together with the nucleobase-binding loop undergoes a conformational change upon binding of adenine and phosphate resulting in a slight contraction of the active site. The inhibitor ADP binds like the product AMP with both the α- and β-phosphates occupying the 5'-phosphoribosyl binding site. The enzyme shows activity over a wide pH range, and the kinetic and ligand binding properties depend on both pH and the presence/absence of phosphate in the buffers. A slow hydrolysis of PRPP to ribose 5-phosphate and pyrophosphate, catalyzed by the enzyme, may be facilitated by elements in the C-terminal three-helix bundle part of the protein.

  13. A cool tool for hot and sour Archaea: proteomics of Sulfolobus solfataricus.


    Kort, Julia Christin; Esser, Dominik; Pham, Trong Khoa; Noirel, Josselin; Wright, Phillip C; Siebers, Bettina


    In recent years, much progress has been made in proteomic studies to unravel metabolic pathways and basic cellular processes. This is especially interesting for members of the Archaea, the third domain of life. Archaea exhibit extraordinary features and many of their cultivable representatives are adaptable to extreme environments. Archaea harbor many unique traits besides bacterial attributes, such as size, shape, and DNA structure and eukaryal characteristics like information processing. Sulfolobus solfataricus P2, a thermoacidophilic archaeal representative, is a well-established model organism adapted to low-pH environments (pH 2-3) and high temperatures (80°C). The genome has a size of 3 Mbp and its sequence has been deciphered. Approximately 3033 predicted open reading frames have been identified and the genome is characterized by a great number of diverse insertion sequence elements. In unraveling the organisms' metabolism and lifestyle, proteomic analyses have played a major role. Much effort has been directed at this organism and is reviewed here. With the help of proteomics, unique metabolic pathways were resolved in S. solfataricus, targets for regulatory protein phosphorylation identified, and cellular responses upon virus infection as well as oxidative stress analyzed.

  14. High affinity P2x-purinoceptor binding sites for [35S]-adenosine 5'-O-[3-thiotriphosphate] in rat vas deferens membranes.

    PubMed Central

    Michel, A. D.; Humphrey, P. P.


    1. The binding sites labelled by [35S]-adenosine 5'-O-[3-thiotriphosphate]([35S]-ATP gamma S) at 4 degrees C in rat vas deferens membranes were studied and compared to the sites labelled by [3H]-alpha,beta-methylene ATP ([3H]-alpha beta meATP) to ascertain whether [35S]-ATP gamma S can be used to label the P2x purinoceptor. 2. In the presence of 4 mM CaCl2, the binding of 0.2 nM [35S]-ATP gamma S to vas deferens membranes was increased 3.4 fold, when compared to studies performed in the absence of calcium. However, binding did not appear to be solely to P2x purinoceptors since [35S]-ATP gamma S labelled a heterogeneous population of sites and about 72% of the sites possessed high affinity (pIC50 = 7.5) for guanosine 5'-O-[3-thiotriphosphate] (GTP gamma S). Even in the presence of 1 microM GTP gamma S, to occlude the sites with high affinity for GTP gamma S, the binding of [35S]-ATP gamma S was heterogeneous and since there was also evidence of extensive metabolism of ATP in the presence of calcium, the binding of [35S]-ATP gamma S under these conditions was not studied further. 3. In the absence of calcium ions, [35S]-ATP gamma S bound to a single population of sites (pKD = 9.23; Bmax = 4270 fmol mg-1 protein). Binding reached steady state within 3 h (t1/2 = 38 min), was stable for a further 4 h and was readily reversible upon addition of 10 microM unlabelled ATP gamma S (t1/2 = 45 min). In competition studies the binding of 0.2 nM [35S]-ATP gamma S was inhibited by a number of P2x purinoceptor agonists and antagonists, but not by adenosine receptor agonists, staurosporine (1 microM) or several ATPase inhibitors. The rank order of agonist affinity estimates (pIC50 values) in competing for the [35S]-ATP gamma S binding sites was: ATP (9.01), 2-methylthio- ATP (8.79), ATP gamma S (8.73), alpha beta meATP (7.57), ADP (7.24), beta, gamma-methylene ATP (7.18), L-beta, gamma-methylene ATP (5.83), alpha, beta-methylene ADP (4.36). 4. Affinity estimates (pIC50 values) for

  15. Receptor binding activities of Chlorella on cysteinyl leukotriene CysLT, glutamate AMPA, ion channels, purinergic P 2Y, tachykinin NK2 receptors and adenosine transporter.


    Cheng, Fong-Chi; Feng, Jin-Jye; Chen, Kuo-Hsin; Imanishi, Hideyo; Fujishima, Masaki; Takekoshi, Hideo; Naoki, Yo; Shimoda, Minoru


    A Chlorella powder was tested in a total of 129 in vitro receptor binding assay systems. The results showed a potent inhibition of this powder on cysteinyl leukotriene CysLT2, and glutamate AMPA in a dose-concentration manner with IC(50) mean +/- SEM values of 20 +/- 4.5 microg/mL and 44 +/- 14 microg/mL, respectively. Other moderate and weak activities reflected in competitive binding experiments were seen versus adenosine transporter; calcium channel L-type, benzothiazepine; gabapentin; kainate, NMDA-glycine; inositol trisphosphate IP(3); cysteinyl CysLT(1), LTB(4); purinergic P(2Y); tachykinin NK(2); serotonin 5-HT(2B) and prostanoid, thromboxane A(2). Together, the results suggest that the various inhibitory effects of Chlorella powder in these receptor binding assays could reflect its actions in modulating Ca(2+)-dependent signal related targets and might be relevant to the mechanisms of its biological effects. These results reveal important potential biochemical activities that might be exploited for the prevention or treatment of several pathologies. From these results, the possible therapeutic usage of the product is discussed. (c) 2009 John Wiley & Sons, Ltd.

  16. DNA binding and antigene activity of a daunomycin-conjugated triplex-forming oligonucleotide targeting the P2 promoter of the human c-myc gene

    PubMed Central

    Carbone, Giuseppina M.; McGuffie, Eileen; Napoli, Sara; Flanagan, Courtney E.; Dembech, Chiara; Negri, Umberto; Arcamone, Federico; Capobianco, Massimo L.; Catapano, Carlo V.


    Triplex-forming oligonucleotides (TFO) that bind DNA in a sequence-specific manner might be used as selective repressors of gene expression and gene-targeted therapeutics. However, many factors, including instability of triple helical complexes in cells, limit the efficacy of this approach. In the present study, we tested whether covalent linkage of a TFO to daunomycin, which is a potent DNA-intercalating agent and anticancer drug, could increase stability of the triple helix and activity of the oligonucleotide in cells. The 11mer daunomycin-conjugated GT (dauno-GT11) TFO targeted a sequence upstream of the P2 promoter, a site known to be critical for transcription of the c-myc gene. Band-shift assays showed that the dauno-GT11 formed triplex DNA with enhanced stability compared to the unmodified TFO. Band shift and footprinting experiments demonstrated that binding of dauno-GT11 was highly sequence-specific with exclusive binding to the 11 bp target site in the c-myc promoter. The daunomycin-conjugated TFO inhibited transcription in vitro and reduced c-myc promoter activity in prostate and breast cancer cells. The daunomycin-conjugated TFO was taken up by cells with a distinctive intracellular distribution compared to free daunomycin. However, cationic lipid-mediated delivery was required for enhanced cellular uptake, nuclear localization and biological activity of the TFO in cells. Dauno-GT11 reduced transcription of the endogenous c-myc gene in cells, but did not affect expression of non-target genes, such as ets-1 and ets-2, which contained very similar target sequences in their promoters. Daunomycin-conjugated control oligonucleotides unable to form triplex DNA with the target sequence did not have any effect in these assays, indicating that daunomycin was not directly responsible for the activity of daunomycin-conjugated TFO. Thus, attachment of daunomycin resulted in increased triplex stability and biological activity of the 11mer GT-rich TFO without

  17. Purification and properties of an ATPase from Sulfolobus solfataricus

    NASA Technical Reports Server (NTRS)

    Hochstein, Lawrence I.; Stan-Lotter, Helga


    The paper reports properties of a sulfite-activated ATPase from Sulfolobus solfataricus, purified using ammonium sulfate precipitation, column chromatography on UltraGel and Sepharose 6B, and SDS-PAGE. The 92-fold purified enzyme had a relative molecular mass of 370,000. It could be dissociated into three subunits with respective molecular masses of 63,000, 48,000, and 24,000. The ATPase activity was found to be inhibitable by nitrate, N-ethylmaleimide (which bound predominantly to the largest subunit), and 4-chloro 7-nitrobenzofurazan, but not by azide, quercetin, or vanadate. While the ATPase from S. solfataricus shared a number of properties with the S. acidocaldarius ATPase, there were also significant differences suggesting the existence of several types of archaeal ATPases.

  18. Purification and properties of an ATPase from Sulfolobus solfataricus

    NASA Technical Reports Server (NTRS)

    Hochstein, Lawrence I.; Stan-Lotter, Helga


    The paper reports properties of a sulfite-activated ATPase from Sulfolobus solfataricus, purified using ammonium sulfate precipitation, column chromatography on UltraGel and Sepharose 6B, and SDS-PAGE. The 92-fold purified enzyme had a relative molecular mass of 370,000. It could be dissociated into three subunits with respective molecular masses of 63,000, 48,000, and 24,000. The ATPase activity was found to be inhibitable by nitrate, N-ethylmaleimide (which bound predominantly to the largest subunit), and 4-chloro 7-nitrobenzofurazan, but not by azide, quercetin, or vanadate. While the ATPase from S. solfataricus shared a number of properties with the S. acidocaldarius ATPase, there were also significant differences suggesting the existence of several types of archaeal ATPases.

  19. Appendage-mediated surface adherence of Sulfolobus solfataricus.


    Zolghadr, Behnam; Klingl, Andreas; Koerdt, Andrea; Driessen, Arnold J M; Rachel, Reinhard; Albers, Sonja-Verena


    Attachment of microorganisms to surfaces is a prerequisite for colonization and biofilm formation. The hyperthermophilic crenarchaeote Sulfolobus solfataricus was able to attach to a variety of surfaces, such as glass, mica, pyrite, and carbon-coated gold grids. Deletion mutant analysis showed that for initial attachment the presence of flagella and pili is essential. Attached cells produced extracellular polysaccharides containing mannose, galactose, and N-acetylglucosamine. Genes possibly involved in the production of the extracellular polysaccharides were identified.

  20. An Autonomously Replicating Transforming Vector for Sulfolobus solfataricus

    PubMed Central

    Cannio, Raffaele; Contursi, Patrizia; Rossi, Mosè; Bartolucci, Simonetta


    A plasmid able to transform and to be stably maintained both in Sulfolobus solfataricus and in Escherichia coli was constructed by insertion into an E. coli plasmid of the autonomously replicating sequence of the virus particle SSV1 and a suitable mutant of the hph (hygromycin phosphotransferase) gene as the transformation marker. The vector suffered no rearrangement and/or chromosome integration, and its copy number in Sulfolobus was increased by exposure of the cells to mitomycin C. PMID:9620978

  1. Purification and Properties of an ATPase from Sulfolobus solfataricus

    NASA Technical Reports Server (NTRS)

    Hochstein, Lawrence I.; Stan-Lotter, Helga


    A sulfite-activated ATPase isolated from Sulfolobus solfataricus had a relative molecular mass of 370,000. It was composed of three subunits whose relative molecular masses were 63,000, 48,000, and 24,000. The enzyme was inhibited by the vacuolar ATPase inhibitors nitrate and N-ethylmaleimide; 4-chloro-7-nitrobenzo-furazan (NBD-Cl) was also inhibitory. N-Ethylmaleimide was predominately bound to the largest subunit while NBD-CL was bound to both subunits. ATPase activity was inhibited by low concentrations of p-chloromercuri-phenyl sulfonate and the inhibition was reversed by cysteine which suggested that thiol groups were essential for activity. While the ATPase from S. solfataricus shared several properties with the ATPase from S. acidocaldarius there were significant differences. The latter enzyme was activated by sulfate and chloride and was unaffected by N-ethylmaleimide, whereas the S. solfataricus ATPase was inhibited by these anions as well as N-ethyimaleimide. These differences as well as differences that occur in other vacuolar-like ATPases isolated from the methanogenic and the extremely halophilic bacteria suggest the existence of several types of archaeal ATPases, none of which have been demonstrated to synthesize ATP.

  2. An Arabidopsis hydrophilic Ca2(+) -binding protein with a PEVK-rich domain, PCaP2, is associated with the plasma membrane and interacts with calmodulin and phosphatidylinositol phosphates.


    Kato, Mariko; Nagasaki-Takeuchi, Nahoko; Ide, Yuki; Maeshima, Masayoshi


    We found a new hydrophilic protein in Arabidopsis thaliana. Real-time PCR demonstrated that the protein was expressed in roots. Histochemical analysis of promoter-beta-glucuronidase fusions demonstrated its extensive expression in root hairs. The protein is rich in proline, glutamate, valine and lysine residues (PEVK-rich domain), and bound Ca(2+) even in the presence of Mg(2+) and K(+) when examined by the (45)Ca overlay assay. Treatment of seedlings with K(+), Mn(2+), Zn(2+), Na(+), ABA and gibberellic acid, and cold and drought stresses enhanced the transcription. Expression of the protein linked to green fluorescent protein in A. thaliana showed its plasma membrane localization and cell-specific expression in the epidermal cells including root hairs and the elongating pollen tubes. Therefore, we named the protein PCaP2 (plasma membrane-associated Ca(2+)-binding protein-2). The substitution of glycine at position 2 with alanine resulted in cytoplasmic localization of PCaP2. These results and the N-terminal characteristic motif suggest that PCaP2 is N-myristoylated at Gly2. We examined the capacity for binding to phosphatidylinositol phosphates (PtdInsPs), and found that PCaP2 interacts strongly with PtdIns(3,5)P(2), PtdIns(4,5)P(2) and PtdIns(3,4,5)P(3), and weakly with PtdIns(3,4)P(2). Furthermore, calmodulin was associated with PCaP2 in a Ca(2+)-dependent manner, and its association weakened the interaction of PCaP2 with PtdInsPs. These results indicate that PCaP2 is involved in intracellular signaling through interaction with PtdInsPs and calmodulin in growing root hairs. PCaP2 was previously reported as microtubule-associated protein-18. We discuss the physiological roles of PCaP2 in relation to microtubules in cells.

  3. Complete Genome Sequence of Sulfolobus solfataricus Strain 98/2 and Evolved Derivatives

    PubMed Central

    McCarthy, Samuel; Gradnigo, Julien; Johnson, Tyler; Payne, Sophie; Lipzen, Anna; Martin, Joel; Schackwitz, Wendy; Moriyama, Etsuko


    Sulfolobus solfataricus is a thermoacidophilic crenarcheote with a 3.0-Mb genome. Here, we report the genome sequence of S. solfataricus strain 98/2, along with several evolved derivatives generated through experimental microbial evolution for enhanced thermoacidophily. PMID:26021927

  4. Crystallization and preliminary X-ray crystallographic analysis of the Sulfolobus solfataricus nucleotide-exchange factor 1β

    SciTech Connect

    Ruggiero, Alessia; Masullo, Mariorosario; Arcari, Paolo; Raimo, Gennaro; Vitagliano, Luigi; Zagari, Adriana


    Nucleotide-exchange factor from S. solfataricus (SsEF-1β) has been successfully crystallized. X-ray diffraction data have been collected from the native enzyme and from the selenomethionine derivative of SsEF-1β to 1.97 and 1.83 Å resolution, respectively. The nucleotide-exchange factor isolated from the hyperthermophilic archaeon Sulfolobus solfataricus (SsEF-1β) consists of 90 residues and differs from eukaryal EF-1βs. The protein has been successfully crystallized using either microbatch-under-oil or vapour-diffusion methods. Crystals of native SsEF-1β diffract to 1.97 Å resolution and belong to space group P2{sub 1}2{sub 1}2, with unit-cell parameters a = 106.46, b = 54.87, c = 44.03 Å. Diffraction data have also been collected from a selenomethionine derivative of SsEF-1β at 1.83 Å resolution. Model building using the phases derived from the MAD experiment is in progress.

  5. Effects of P2, a peptide derived from a homophilic binding site in the neural cell adhesion molecule on learning and memory in rats.


    Rizhova, L; Klementiev, B; Cambon, K; Venero, C; Sandi, C; Vershinina, E; Vaudano, E; Berezin, V; Bock, E


    The neural cell adhesion molecule (NCAM) plays a pivotal role in neural development, regeneration, synaptic plasticity, and memory processes. P2 is a 12-amino-acid peptide derived from the second immunoglobulin-like (Ig) module of NCAM mediating cis-homophilic interactions between NCAM molecules present on the same cell. P2 is a potent NCAM agonist, capable of promoting neuronal differentiation and survival in vitro. The aim of this study was to assess the effect of P2 on learning and memory. Rats treated with P2 intracerebroventricularly (1 h prior to test) performed significantly better than controls in the reinforced T-maze, a test of spatial working memory. Further, rats treated with P2 exhibited decreased anxiety-like behavior while learning the T-maze task. In the social recognition test, both intracerebroventricular (1 h prior to test) and systemic (1 and 24 h prior to test) P2 treatment enhanced short-term social memory and counteracted (administration 24 h prior test) scopolamine-induced social memory impairment. In contrast, P2 (1 h prior to test) did not significantly improve long-term (24 h) retention of social memory, nor did it have any significant effects on long-term memory evaluated by the Morris water maze (administration between 2 days before training and 5.5 h posttraining). In the open field test, P2 (1 h prior to test) decreased general locomotion and rearing, but did not influence any other anxiety-related behaviors, indicating only a minimal influence on baseline anxiety levels. Taken together, these data indicate that in vivo P2 enhances short-term memory and protects against the amnestic effects of scopolamine, while modulating emotional behavior in a learning or novelty-related task.

  6. Identification of Two Binding Domains, One for Peptidoglycan and Another for a Secondary Cell Wall Polymer, on the N-Terminal Part of the S-Layer Protein SbsB from Bacillus stearothermophilus PV72/p2

    PubMed Central

    Sára, Margit; Egelseer, Eva M.; Dekitsch, Christine; Sleytr, Uwe B.


    First studies on the structure-function relationship of the S-layer protein from B. stearothermophilus PV72/p2 revealed the coexistence of two binding domains on its N-terminal part, one for peptidoglycan and another for a secondary cell wall polymer (SCWP). The peptidoglycan binding domain is located between amino acids 1 to 138 of the mature S-layer protein comprising a typical S-layer homologous domain. The SCWP binding domain lies between amino acids 240 to 331 and possesses a high serine plus glycine content. PMID:9852032

  7. Cloning, expression and evolution of the gene encoding the elongation factor 1alpha from a low thermophilic Sulfolobus solfataricus strain.


    Masullo, Mariorosario; Cantiello, Piergiuseppe; Lamberti, Annalisa; Longo, Olimpia; Fiengo, Antonio; Arcari, Paolo


    The gene encoding the elongation factor 1alpha (EF-1alpha) from the archaeon Sulfolobus solfataricus strain MT3 (optimum growth temperature 75 degrees C) was cloned, sequenced and expressed in Escherichia coli. The structural and biochemical properties of the purified enzyme were compared to those of EF-1alpha isolated from S. solfataricus strain MT4 (optimum growth temperature 87 degrees C). Only one amino acid change (Val15-->Ile) was found. Interestingly, the difference was in the first guanine nucleotide binding consensus sequence G(13)HIDHGK and was responsible for a reduced efficiency in protein synthesis, which was accompanied by an increased affinity for both guanosine diphosphate (GDP) and guanosine triphosphate (GTP), and an increased efficiency in the intrinsic GTPase activity. Despite the different thermophilicities of the two microorganisms, only very marginal effects on the thermal properties of the enzyme were observed. Molecular evolution among EF-1alpha genes from Sulfolobus species showed that the average rate of nucleotide substitution per site per year (0.0312x10(-9)) is lower than that reported for other functional genes.

  8. Mucosal immunization of mice with recombinant OMP P2 induces antibodies that bind to surface epitopes of multiple strains of nontypeable Haemophilus influenzae

    PubMed Central

    Ostberg, KL; Russell, MW; Murphy, TF


    Nontypeable Haemophilus influenzae (NTHI) is a significant cause of otitis media in children and exacerbations in patients with chronic obstructive pulmonary disease. Vaccine research for NTHI has focused on the outer membrane proteins (OMPs) of NTHI. The goal of this study was to evaluate mucosal and systemic immune responses to recombinant OMP P2 (rP2) of NTHI. Enzyme-linked immunosorbent assay (ELISA) demonstrated that both mucosal and systemic routes of immunization resulted in antibodies to rP2. Whole-cell ELISA and flow cytometry indicated that mucosal immunization induced antibodies to epitopes that are on the bacterial surface of the homologous strain as well as several heterologous strains. In contrast, systemic immunization induced antibodies to non-surface exposed epitopes. These data show for the first time that mucosal immunization of mice with rP2 induces antibodies that recognize surface exposed epitopes on multiple strains, indicating that P2 is a candidate for development of a mucosal vaccine for NTHI. PMID:19079335

  9. Molecular cloning, nucleotide sequence and expression of a Sulfolobus solfataricus gene encoding a class II fumarase.


    Colombo, S; Grisa, M; Tortora, P; Vanoni, M


    Fumarase catalyzes the interconversion of L-malate and fumarate. A Sulfolobus solfataricus fumarase gene (fumC) was cloned and sequenced. Typical archaebacterial regulatory sites were identified in the region flanking the fumC open reading frame. The fumC gene encodes a protein of 438 amino acids (47,899 Da) which shows several significant similarities with class II fumarases from both eubacterial and eukariotic sources as well as with aspartases. S. solfataricus fumarase expressed in Escherichia coli retains enzymatic activity and its thermostability is comparable to that of S. solfataricus purified enzyme despite a 11 amino acid C-terminal deletion.

  10. Myosin VI targeting to clathrin-coated structures and dimerisation is mediated by binding to Disabled-2 and PtdIns(4,5)P2

    PubMed Central

    Spudich, Giulietta; Chibalina, Margarita V.; Au, Josephine Sui-Yan; Arden, Susan D.; Buss, Folma; Kendrick-Jones, John


    Vesicle transport is essential for the movement of proteins, lipids and other molecules between membrane compartments within the cell. The role of the class VI myosins in vesicular transport is especially intriguing because they are the only class that has been shown to move “backwards” towards the minus end of actin filaments1. Myosin VI is found in distinct intracellular locations and implicated in processes such as endocytosis2,3, exocytosis, maintenance of Golgi morphology4,5 and cell movement6. We have shown that the C-terminal tail is the key targeting region and have identified three binding sites: a WWY motif for Dab2 binding, a RRL motif for GIPC/Optineurin binding and a site that binds specifically and with high affinity (Kd 0.3 μM) to PIP2-containing liposomes. This is the first demonstration that myosin VI binds lipid membranes. Lipid binding induces a large structural change in the tail (31% increase in helicity) and when associated with lipid vesicles it can dimerise. In vivo targeting and recruitment of myosin VI to clathrin-coated structures (CCSs) at the plasma membrane is mediated by Dab2 and PIP2 binding. PMID:17187061

  11. Transcriptional Regulation of the Gene Encoding an Alcohol Dehydrogenase in the Archaeon Sulfolobus solfataricus Involves Multiple Factors and Control Elements

    PubMed Central

    Fiorentino, Gabriella; Cannio, Raffaele; Rossi, Mosè; Bartolucci, Simonetta


    A transcriptionally active region has been identified in the 5′ flanking region of the alcohol dehydrogenase gene of the crenarchaeon Sulfolobus solfataricus through the evaluation of the activity of putative transcriptional regulators and the role of the region upstream of the gene under specific metabolic circumstances. Electrophoretic mobility shift assays with crude extracts revealed protein complexes that most likely contain TATA box-associated factors. When the TATA element was deleted from the region, binding sites for both DNA binding proteins, such as the small chromatin structure-modeling Sso7d and Sso10b (Alba), and transcription factors, such as the repressor Lrs14, were revealed. To understand the molecular mechanisms underlying the substrate-induced expression of the adh gene, the promoter was analyzed for the presence of cis-acting elements recognized by specific transcription factors upon exposure of the cell to benzaldehyde. Progressive dissection of the identified promoter region restricted the analysis to a minimal responsive element (PAL) located immediately upstream of the transcription factor B-responsive element-TATA element, resembling typical bacterial regulatory sequences. A benzaldehyde-activated transcription factor (Bald) that specifically binds to the PAL cis-acting element was also identified. This protein was purified from heparin-fractionated extracts of benzaldehyde-induced cells and was shown to have a molecular mass of ∼16 kDa. The correlation between S. solfataricus adh gene activation and benzaldehyde-inducible occupation of a specific DNA sequence in its promoter suggests that a molecular signaling mechanism is responsible for the switch of the aromatic aldehyde metabolism as a response to environmental changes. PMID:12813087

  12. Responses of Rat P2X2 Receptors to Ultrashort Pulses of ATP Provide Insights into ATP Binding and Channel Gating

    PubMed Central

    Moffatt, Luciano; Hume, Richard I.


    To gain insight into the way that P2X2 receptors localized at synapses might function, we explored the properties of outside-out patches containing many of these channels as ATP was very rapidly applied and removed. Using a new method to calibrate the speed of exchange of solution over intact patches, we were able to reliably produce applications of ATP lasting <200 μs. For all concentrations of ATP, there was a delay of at least 80 μs between the time when ATP arrived at the receptor and the first detectable flow of inward current. In response to 200-μs pulses of ATP, the time constant of the rising phase of the current was ∼600 μs. Thus, most channel openings occurred when no free ATP was present. The current deactivated with a time constant of ∼60 ms. The amplitude of the peak response to a brief pulse of a saturating concentration of ATP was ∼70% of that obtained during a long application of the same concentration of ATP. Thus, ATP leaves fully liganded channels without producing an opening at least 30% of the time. Extensive kinetic modeling revealed three different schemes that fit the data well, a sequential model and two allosteric models. To account for the delay in opening at saturating ATP, it was necessary to incorporate an intermediate closed state into all three schemes. These kinetic properties indicate that responses to ATP at synapses that use homomeric P2X2 receptors would be expected to greatly outlast the duration of the synaptic ATP transient produced by a single presynaptic spike. Like NMDA receptors, P2X2 receptors provide the potential for complex patterns of synaptic integration over a time scale of hundreds of milliseconds. PMID:17664346

  13. Kinetics and Fidelity of Polymerization by DNA Polymerase III from Sulfolobus solfataricus

    PubMed Central

    Bauer, Robert J.; Begley, Michael T.; Trakselis, Michael A.


    We have biochemically and kinetically characterized the polymerase and exonuclease activities of the third B-family polymerase (Dpo3) from the hyperthermophilic Crenarchaeon, Sulfolobus solfataricus (Sso). We have established through mutagenesis that despite incomplete sequence conservation; the polymerase and exonuclease active sites are functionally conserved in Dpo3. Using presteady-state kinetics, we can measure the fidelity of nucleotide incorporation by Dpo3 from the polymerase active site alone to be 103 to 104 at 37 °C. The functional exonuclease proofreading active site will increase fidelity by at least 102 making Dpo3 comparable to other DNA polymerases in this family. Additionally, Dpo3’s exonuclease activity is modulated by temperature, where a loss in promiscuous degradation activity can be attributed to a reorganization of the exonuclease domain when bound to primer template DNA at high temperatures. Unexpectedly, the DNA binding affinity is weak compared with other DNA polymerases of this family. A comparison of the fidelities, polymerization kinetics, and associated functional exonuclease domain with those previously reported for other Sso polymerases (Dpo1 and Dpo4) illustrates that Dpo3 is a potential player in the proper maintenance of the archaeal genome. PMID:22339170

  14. X-ray crystallographic analysis of adipocyte fatty acid binding protein (aP2) modified with 4-hydroxy-2-nonenal

    SciTech Connect

    Hellberg, Kristina; Grimsrud, Paul A.; Kruse, Andrew C.; Banaszak, Leonard J.; Ohlendorf, Douglas H.; Bernlohr, David A.


    Fatty acid binding proteins (FABP) have been characterized as facilitating the intracellular solubilization and transport of long-chain fatty acyl carboxylates via noncovalent interactions. More recent work has shown that the adipocyte FABP is also covalently modified in vivo on Cys117 with 4-hydroxy-2-nonenal (4-HNE), a bioactive aldehyde linked to oxidative stress and inflammation. To evaluate 4-HNE binding and modification, the crystal structures of adipocyte FABP covalently and noncovalently bound to 4-HNE have been solved to 1.9 {angstrom} and 2.3 {angstrom} resolution, respectively. While the 4-HNE in the noncovalently modified protein is coordinated similarly to a carboxylate of a fatty acid, the covalent form show a novel coordination through a water molecule at the polar end of the lipid. Other defining features between the two structures with 4-HNE and previously solved structures of the protein include a peptide flip between residues Ala36 and Lys37 and the rotation of the side chain of Phe57 into its closed conformation. Representing the first structure of an endogenous target protein covalently modified by 4-HNE, these results define a new class of in vivo ligands for FABPs and extend their physiological substrates to include bioactive aldehydes.

  15. Chemical modification by pyridoxal 5'-phosphate and cyclohexane-1,2-dione indicates that Lys-7 and Arg-10 are involved in the p2 phosphate-binding subsite of bovine pancreatic ribonuclease A.

    PubMed Central

    Richardson, R M; Parés, X; Cuchillo, C M


    Steric and chemical evidence had previously shown that residues Lys-7 and/or Arg-10 of bovine pancreatic RNAase A could belong to the p2 phosphate-binding subsite, adjacent to the 3' side of the main site p1. In the present work chemical modification of the enzyme with pyridoxal 5'-phosphate and cyclohexane-1,2-dione was carried out in order to identify these residues positively as part of the p2 site. The reaction with pyridoxal 5'-phosphate yields three monosubstituted derivatives, at Lys-1, Lys-7 and Lys-41. A strong decrease in the yield of derivatives at Lys-7 and Lys-41 was observed when either p1 or p2 was specifically blocked by 5'-AMP or 3'-AMP respectively. These experiments indicate that both sites are needed for the reaction of pyridoxal 5'-phosphate with RNAase A to take place. The positive charge in one of the sites interacts with the phosphate group of pyridoxal 5'-phosphate, giving the proper orientation to the carbonyl group, which then reacts with the lysine residue present in the other site. The absence of reaction between pyridoxal 5'-phosphate and an RNAase derivative that has the p2 site blocked supports this hypothesis. Labelling of Lys-7 with pyridoxal 5'-phosphate has a more pronounced effect on the kinetics with RNA than with the smaller substrate 2',3'-cyclic CMP. In addition, when the phosphate moiety of the 5'-phosphopyridoxyl group was removed with alkaline phosphatase the kinetic constants with 2',3'-cyclic CMP returned to values very similar to those of the native enzyme, whereas a higher Km and lower Vmax. were still observed for RNA. This indicates that this new derivative has recovered a free p1 site and, hence, the capability to act on 2',3'-cyclic CMP, but the presence of the pyridoxyl group bound to Lys-7 is still blocking a secondary phosphate-binding site, namely p2. Finally, reaction of cyclohexane-1,2-dione at Arg-10 is suppressed in the presence of 3'-AMP but only a 19% decrease is observed with 5'-AMP, suggesting that Arg

  16. The Sulfolobus solfataricus radA paralogue sso0777 is DNA damage inducible and positively regulated by the Sta1 protein

    PubMed Central

    Abella, Marc; Rodríguez, Sonia; Paytubi, Sonia; Campoy, Susana; White, Malcolm F.; Barbé, Jordi


    Little is known about the regulation of the DNA damage-mediated gene expression in archaea. Here we report that the addition of actinomycin D to Sulfolobus solfataricus cultures triggers the expression of the radA paralogue sso0777. Furthermore, a specific retarded band is observed when electrophoretic mobility shift assays (EMSAs) with crude S. solfataricus cell extracts and the sso0777 promoter were carried out. The protein that binds to this promoter was isolated and identified as Sta1. Footprinting experiments have shown that the Sta1 DNA-binding site is included in the ATTTTTTATTTTCACATGTAAGATGTTTATT sequence, which is located upstream the putative TTG translation starting codon of the sso0777 gene. Additionally, gel electrophoretic mobility retardation experiments using mutant sso0777 promoter derivatives show the presence of three essential motifs (TTATT, CANGNA and TTATT) that are absolutely required for Sta1 DNA binding. Finally, in vitro transcription experiments confirm that Sta1 functions as an activator for sso0777 gene expression being the first identified archaeal regulatory protein associated with the DNA damage-mediated induction of gene expression. PMID:17921500

  17. A highly acid-stable and thermostable endo-β-glucanase from the thermoacidophilic archaeon Sulfolobus solfataricus

    PubMed Central


    The thermoacidophilic archaeon Sulfolobus solfataricus P2 encodes three hypothetic endo-β-glucanases, SSO1354, SSO1949 and SSO2534. We cloned and expressed the gene sso1949 encoding the 334 amino acids containing protein SSO1949, which can be classified as a member of glycoside hydrolase family 12. The purified recombinant enzyme hydrolyses carboxymethylcellulose as well as cello-oligomers, with cellobiose and cellotriose as main reaction products. By following the hydrolysis of a fluorescently labelled cellohexaoside under a wide variety of conditions, we show that SSO1949 is a unique extremophilic enzyme. This archaeal enzyme has a pH optimum of approx. pH 1.8 and a temperature optimum of approx. 80 °C. Furthermore, the enzyme is thermostable, with a half-life of approx. 8 h at 80 °C and pH 1.8. The thermostability is strongly pH-dependent. At neutral pH, the thermal inactivation rate is nearly two orders of magnitude higher than at pH 1.8. Homology modelling suggests that the catalytic domain of SSO1949 has a similar fold to other mesophilic, acidophilic and neutral cellulases. The presence of a signal peptide indicates that SSO1949 is a secreted protein, which enables S. solfataricus to use cellulose as an external carbon source. It appears that SSO1949 is perfectly adapted to the extreme environment in solfataric pools. A cellulolytic enzyme with such a combination of stability and activity at high temperatures and low pH has not been described so far and could be a valuable tool for the large-scale hydrolysis of cellulose under acidic conditions. PMID:15456402

  18. Bacteriophage P2.


    Christie, Gail E; Calendar, Richard


    P2 is the original member of a highly successful family of temperate phages that are frequently found in the genomes of gram-negative bacteria. This article focuses on the organization of the P2 genome and reviews current knowledge about the function of each open reading frame.

  19. Crystallization and preliminary X-ray diffraction analysis of the hyperthermophilic Sulfolobus solfataricus phosphotriesterase

    SciTech Connect

    Elias, Mikael; Dupuy, Jérôme; Merone, Luigia; Lecomte, Claude; Rossi, Mosè; Masson, Patrick; Manco, Giuseppe; Chabriere, Eric


    A phosphotriesterase (PTE) from the hyperthermophilic archaeon S. solfataricus has been crystallized. Combined with biochemical and bioengineering studies, it is expected that the structure of this protein will provide insight into the natural function of the PTE family and provide important data for achieving an efficient organophosphate biodecontaminant. Organophosphates constitute the largest class of insecticides used worldwide and some of them are potent nerve agents. Consequently, organophosphate-degrading enzymes are of paramount interest as they could be used as bioscavengers and biodecontaminants. Phosphotriesterases (PTEs) are capable of hydrolyzing these toxic compounds with high efficiency. A distant and hyperthermophilic representative of the PTE family was cloned from the archeon Sulfolobus solfataricus MT4, overexpressed in Escherichia coli and crystallized; the crystals diffracted to 2.54 Å resolution. Owing to its exceptional thermostability, this PTE may be an excellent candidate for obtaining an efficient organophosphate biodecontaminant. Here, the crystallization conditions and data collection for the hyperthermophilic S. solfataricus PTE are reported.

  20. Harnessing hyperthermostable lactonase from Sulfolobus solfataricus for biotechnological applications

    PubMed Central

    Rémy, Benjamin; Plener, Laure; Poirier, Laetitia; Elias, Mikael; Daudé, David; Chabrière, Eric


    Extremozymes have gained considerable interest as they could meet industrial requirements. Among these, SsoPox is a hyperthermostable enzyme isolated from the archaeon Sulfolobus solfataricus. This enzyme is a lactonase catalyzing the hydrolysis of acyl-homoserine lactones; these molecules are involved in Gram-negative bacterial communication referred to as quorum sensing. SsoPox exhibits promiscuous phosphotriesterase activity for the degradation of organophosphorous chemicals including insecticides and chemical warfare agents. Owing to its bi-functional catalytic abilities as well as its intrinsic stability, SsoPox is appealing for many applications, having potential uses in the agriculture, defense, food and health industries. Here we investigate the biotechnological properties of the mutant SsoPox-W263I, a variant with increased lactonase and phosphotriesterase activities. We tested enzyme resistance against diverse process-like and operating conditions such as heat resistance, contact with organic solvents, sterilization, storage and immobilization. Bacterial secreted materials from both Gram-negative and positive bacteria were harmless on SsoPox-W263I activity and could reactivate heat-inactivated enzyme. SsoPox showed resistance to harsh conditions demonstrating that it is an extremely attractive enzyme for many applications. Finally, the potential of SsoPox-W263I to be active at subzero temperature is highlighted and discussed in regards to the common idea that hyperthermophile enzymes are nearly inactive at low temperatures. PMID:27876889

  1. A New Archaeal β-Glycosidase from Sulfolobus solfataricus

    PubMed Central

    Cobucci-Ponzano, Beatrice; Aurilia, Vincenzo; Riccio, Gennaro; Henrissat, Bernard; Coutinho, Pedro M.; Strazzulli, Andrea; Padula, Anna; Corsaro, Maria Michela; Pieretti, Giuseppina; Pocsfalvi, Gabriella; Fiume, Immacolata; Cannio, Raffaele; Rossi, Mosè; Moracci, Marco


    Carbohydrate active enzymes (CAZymes) are a large class of enzymes, which build and breakdown the complex carbohydrates of the cell. On the basis of their amino acid sequences they are classified in families and clans that show conserved catalytic mechanism, structure, and active site residues, but may vary in substrate specificity. We report here the identification and the detailed molecular characterization of a novel glycoside hydrolase encoded from the gene sso1353 of the hyperthermophilic archaeon Sulfolobus solfataricus. This enzyme hydrolyzes aryl β-gluco- and β-xylosides and the observation of transxylosylation reactions products demonstrates that SSO1353 operates via a retaining reaction mechanism. The catalytic nucleophile (Glu-335) was identified through trapping of the 2-deoxy-2-fluoroglucosyl enzyme intermediate and subsequent peptide mapping, while the general acid/base was identified as Asp-462 through detailed mechanistic analysis of a mutant at that position, including azide rescue experiments. SSO1353 has detectable homologs of unknown specificity among Archaea, Bacteria, and Eukarya and shows distant similarity to the non-lysosomal bile acid β-glucosidase GBA2 also known as glucocerebrosidase. On the basis of our findings we propose that SSO1353 and its homologs are classified in a new CAZy family, named GH116, which so far includes β-glucosidases (EC, β-xylosidases (EC, and glucocerebrosidases (EC as known enzyme activities. PMID:20427274

  2. The Sulfolobus solfataricus Lrp-like protein LysM regulates lysine biosynthesis in response to lysine availability.


    Brinkman, Arie B; Bell, Stephen D; Lebbink, Robert Jan; de Vos, Willem M; van der Oost, John


    Although the archaeal transcription apparatus resembles the eukaryal RNA polymerase II system, many bacterial-like regulators can be found in archaea. Particularly, all archaeal genomes sequenced to date contain genes encoding homologues of Lrp (leucine-responsive regulatory protein). Whereas Lrp-like proteins in bacteria are involved in regulation of amino acid metabolism, their physiological role in archaea is unknown. Although several archaeal Lrp-like proteins have been characterized recently, no target genes apart from their own coding genes have been discovered yet, and no ligands for these regulators have been identified so far. In this study, we show that the Lrp-like protein LysM from Sulfolobus solfataricus is involved in the regulation of lysine and possibly also arginine biosynthesis, encoded by the lys gene cluster. Exogenous lysine is the regulatory signal for lys gene expression and specifically serves as a ligand for LysM by altering its DNA binding affinity. LysM binds directly upstream of the TFB-responsive element of the intrinsically weak lysW promoter, and DNA binding is favored in the absence of lysine, when lysWXJK transcription is maximal. The combined in vivo and in vitro data are most compatible with a model in which the bacterial-like LysM activates the eukarya-like transcriptional machinery. As with transcriptional activation by Escherichia coli Lrp, activation by LysM is apparently dependent on a co-activator, which remains to be identified.

  3. Molecular cloning, nucleotide sequence, and expression of a carboxypeptidase-encoding gene from the archaebacterium Sulfolobus solfataricus.

    PubMed Central

    Colombo, S; Toietta, G; Zecca, L; Vanoni, M; Tortora, P


    Mammalian metallocarboxypeptidases play key roles in major biological processes, such as digestive-protein degradation and specific proteolytic processing. A Sulfolobus solfataricus gene (cpsA) encoding a recently described zinc carboxypeptidase with an unusually broad substrate specificity was cloned, sequenced, and expressed in Escherichia coli. Despite the lack of overall sequence homology with known carboxypeptidases, seven homology blocks, including the Zn-coordinating and catalytic residues, were identified by multiple alignment with carboxypeptidases A, B, and T. S. solfataricus carboxypeptidase expressed in E. coli was found to be enzymatically active, and both its substrate specificity and thermostability were comparable to those of the purified S. solfataricus enzyme. PMID:7559343

  4. Molecular cloning, nucleotide sequence, and expression of a carboxypeptidase-encoding gene from the archaebacterium Sulfolobus solfataricus.


    Colombo, S; Toietta, G; Zecca, L; Vanoni, M; Tortora, P


    Mammalian metallocarboxypeptidases play key roles in major biological processes, such as digestive-protein degradation and specific proteolytic processing. A Sulfolobus solfataricus gene (cpsA) encoding a recently described zinc carboxypeptidase with an unusually broad substrate specificity was cloned, sequenced, and expressed in Escherichia coli. Despite the lack of overall sequence homology with known carboxypeptidases, seven homology blocks, including the Zn-coordinating and catalytic residues, were identified by multiple alignment with carboxypeptidases A, B, and T. S. solfataricus carboxypeptidase expressed in E. coli was found to be enzymatically active, and both its substrate specificity and thermostability were comparable to those of the purified S. solfataricus enzyme.

  5. Binding.

    ERIC Educational Resources Information Center

    Rebsamen, Werner


    Categorizes contemporary methods of binding printed materials in terms of physical preservation--hand binding (archival restoration), edition binding (paperback, hardcover), publication binding (magazines), textbook binding (sidesewn), single-sheet binding (loose-leaf, mechanical), and library binding (oversewn, sidesewn). Seven references are…

  6. Solution Structure of Ribosomal Protein L40E, a Unique C4 Zinc Finger Protein Encoded by Archaeon Sulfolobus Solfataricus

    SciTech Connect

    Wu, Bin; Lukin, Jonathan A.; Yee, Adelinda; Lemak, Alexander; Semesi, Anthony; Ramelot, Theresa A.; Kennedy, Michael A.; Arrowsmith, Cheryl H.


    The ribosomal protein L40E from archaeon Sulfolobus solfataricus is a component of the 50S ribosomal subunit. L40E is a 56-residue, highly basic protein that contains a C4 zinc finger motif, CRKC_X10_CRRC. Homologs are found in both archaea and eukaryotes but are not present in bacteria. Eukaryotic genomes encode L40E as a ubiquitin-fusion protein. L40E was absent from the crystal structure of euryarchaeota 50S ribosomal subunit. Here we report the three-dimensional solution structure of L40E by NMR spectroscopy. The structure of L40E is a three-stranded b-sheet with a simple b2b1b3 topology. There are two unique characteristics revealed by the structure. First, a large and ordered b2–b3 loop twists to pack across the one side of the protein. L40E contains a buried polar cluster comprising Lys19, Lys20, Cys22, Asn29, and Cys36. Second, the surface of L40E is almost entirely positively charged. Ten conserved basic residues are positioned on the two sides of the surface. It is likely that binding of zinc is essential in stabilizing the tertiary structure of L40E to act as a scaffold to create a broad positively charged surface for RNA and/or protein recognition. A portion of this work was performed in the Environmental Molecular Sciences Facility, a DOE national scientific user facility.

  7. Crystal structure of the alcohol dehydrogenase from the hyperthermophilic archaeon Sulfolobus solfataricus at 1.85 A resolution.


    Esposito, Luciana; Sica, Filomena; Raia, Carlo Antonio; Giordano, Antonietta; Rossi, Mosè; Mazzarella, Lelio; Zagari, Adriana


    The crystal structure of a medium-chain NAD(H)-dependent alcohol dehydrogenase (ADH) from an archaeon has been solved by multiwavelength anomalous diffraction, using a selenomethionine-substituted enzyme. The protein (SsADH), extracted from the hyperthermophilic organism Sulfolobus solfataricus, is a homo-tetramer with a crystallographic 222 symmetry. Despite the low level of sequence identity, the overall fold of the monomer is similar to that of the other homologous ADHs of known structure. However, a significant difference is the orientation of the catalytic domain relative to the coenzyme-binding domain that results in a larger interdomain cleft. At the bottom of this cleft, the catalytic zinc ion is coordinated tetrahedrally and lacks the zinc-bound water molecule that is usually found in ADH apoform structures. The fourth coordination position is indeed occupied by a Glu residue, as found in bacterial tetrameric ADHs. Other differences are found in the architecture of the substrate pocket whose entrance is more restricted than in other ADHs. SsADH is the first tetrameric ADH X-ray structure containing a second zinc ion playing a structural role. This latter metal ion shows a peculiar coordination, with a glutamic acid residue replacing one of the four cysteine ligands that are highly conserved throughout the structural zinc-containing dimeric ADHs.

  8. The archaeal DnaG protein needs Csl4 for binding to the exosome and enhances its interaction with adenine-rich RNAs

    PubMed Central

    Hou, Linlin; Klug, Gabriele; Evguenieva-Hackenberg, Elena


    The archaeal RNA-degrading exosome contains a catalytically active hexameric core, an RNA-binding cap formed by Rrp4 and Csl4 and the protein annotated as DnaG (bacterial type primase) with so-far-unknown functions in RNA metabolism. We found that the archaeal DnaG binds to the Csl4-exosome but not to the Rrp4-exosome of Sulfolobus solfataricus. In vitro assays revealed that DnaG is a poly(A)-binding protein enhancing the degradation of adenine-rich transcripts by the Csl4-exosome. DnaG is the second poly(A)-binding protein besides Rrp4 in the heteromeric, RNA-binding cap of the S. solfataricus exosome. This apparently reflects the need for effective and selective recruitment of adenine-rich RNAs to the exosome in the RNA metabolism of S. solfataricus. PMID:23324612

  9. Characterization of a β-glucosidase from Sulfolobus solfataricus for isoflavone glycosides.


    Kim, Bi-Na; Yeom, Soo-Jin; Kim, Yeong-Su; Oh, Deok-Kun


    The specific activity of a recombinant β-glucosidase from Sulfolobus solfataricus for isoflavones was: daidzin > glycitin > genistin > malonyl genistin > malonyl daidzin > malonyl glycitin. The hydrolytic activity of this enzyme for daidzin was highest at pH 5.5 and 90°C with a half-life of 18 h, a K (m) of 0.5 mM, and a k (cat) of 2532 s(-1). The enzyme converted 1 mM daidzin to 1 mM daidzein after 1 h with a molar yield of 100% and a productivity of 1 mM h(-1). Among β-glucosidases, that from S. solfataricus β had the highest thermostability, k (cat), k (cat)/K (m), conversion yield, and productivity in the hydrolysis of daidzin.

  10. Modeling DNA Repair: Approaching In Vivo Techniques in the Hyperthermophile Sulfolobus Solfataricus

    SciTech Connect

    Blanton, J.; Fuss, J.; Yannone, S.M.; Tainer, J.A.; Cooper, P.K.


    Archaea are found in some of the most extreme environments on earth and represent a third domain of life distinct from Eukarya and Eubacteria. The hyperthermophilic archaeon Sulfolobus solfataricus, isolated from acidic hot springs (80oC, pH 3) in Yellowstone National Park, has emerged as a potential model system for studying human DNA repair processes. Archaea are more closely related to Eukarya than to Eubacteria, suggesting that archaeal DNA repair machinery may model the complex human system much more closely than that of other prokaryotes. DNA repair requires coordinated protein-protein interactions that are frequently transient. Protein complexes that are transient at extreme temperatures where archaea thrive may be more stable at room temperature, allowing for the characterization of otherwise short-lived complexes. However, characterization of these systems in archaea has been limited by the absence of a stable in vivo transformation and expression system. The work presented here is a pilot study in gene cloning and recombinant protein expression in S. solfataricus. Three genes associated with DNA repair were selected for expression: MRE11, PCNA1, and a putative CSB homologue. Though preparation of these recombinant genes followed standard methods, preparation of a suitable vector proved more challenging. The shuttle vector pSSV64, derived from the SSV1 virus and the E. coli vector pBSSK+, was most successfully isolated from the DH5α E. coli strain. Currently, alternative vectors are being designed for more efficient genetic manipulations in S. solfataricus.

  11. Use of chimeras, point mutants, and molecular modeling to map the antagonist-binding site of 4,4',4″,4‴-(carbonylbis-(imino-5,1,3-benzenetriylbis(carbonylimino)))tetrakisbenzene-1,3-disulfonic acid (NF449) at P2X1 receptors for ATP.


    Farmer, Louise K; Schmid, Ralf; Evans, Richard J


    P2X receptor subtype-selective antagonists are promising candidates for treatment of a range of pathophysiological conditions. However, in contrast to high resolution structural understanding of agonist action in the receptors, comparatively little is known about the molecular basis of antagonist binding. We have generated chimeras and point mutations in the extracellular ligand-binding loop of the human P2X1 receptor, which is inhibited by NF449, suramin, and pyridoxal-phosphate-6-azophenyl-2,4-disulfonate, with residues from the rat P2X4 receptor, which is insensitive to these antagonists. There was little or no effect on sensitivity to suramin and pyridoxal-phosphate-6-azophenyl-2,4-disulfonate in chimeric P2X1/4 receptors, indicating that a significant number of residues required for binding of these antagonists are present in the P2X4 receptor. Sensitivity to the P2X1 receptor-selective antagonist NF449 was reduced by ∼60- and ∼135-fold in chimeras replacing the cysteine-rich head, and the dorsal fin region below it in the adjacent subunit, respectively. Point mutants identified the importance of four positively charged residues at the base of the cysteine-rich head and two variant residues in the dorsal fin for high affinity NF449 binding. These six residues were used as the starting area for molecular docking. The four best potential NF449-binding poses were then discriminated by correspondence with the mutagenesis data and an additional mutant to validate the binding of one lobe of NF449 within the core conserved ATP-binding pocket and the other lobes coordinated by positive charge on the cysteine-rich head region and residues in the adjacent dorsal fin.

  12. Bypass of Aflatoxin B[subscript 1] Adducts by the Sulfolobus solfataricus DNA Polymerase IV

    SciTech Connect

    Banerjee, Surajit; Brown, Kyle L.; Egli, Martin; Stone, Michael P.


    Aflatoxin B{sub 1} (AFB{sub 1}) is oxidized to an epoxide in vivo, which forms an N7-dG DNA adduct (AFB{sub 1}-N7-dG). The AFB{sub 1}-N7-dG can rearrange to a formamidopyrimidine (AFB{sub 1}-FAPY) derivative. Both AFB{sub 1}-N7-dG and the {beta}-anomer of the AFB{sub 1}-FAPY adduct yield G {yields} T transversions in Escherichia coli, but the latter is more mutagenic. We show that the Sulfolobus solfataricus P2 DNA polymerase IV (Dpo4) bypasses AFB{sub 1}-N7-dG in an error-free manner but conducts error-prone replication past the AFB{sub 1}-FAPY adduct, including misinsertion of dATP, consistent with the G {yields} T mutations observed in E. coli. Three ternary (Dpo4-DNA-dNTP) structures with AFB{sub 1}-N7-dG adducted template:primers have been solved. These demonstrate insertion of dCTP opposite the AFB{sub 1}-N7-dG adduct, and correct vs incorrect insertion of dATP vs dTTP opposite the 5'-template neighbor dT from a primed AFB{sub 1}-N7-dG:dC pair. The insertion of dTTP reveals hydrogen bonding between the template N3 imino proton and the O{sup 2} oxygen of dTTP, and between the template T O{sup 4} oxygen and the N3 imino proton of dTTP, perhaps explaining why this polymerase does not efficiently catalyze phosphodiester bond formation from this mispair. The AFB{sub 1}-N7-dG maintains the 5'-intercalation of the AFB{sub 1} moiety observed in DNA. The bond between N7-dG and C8 of the AFB{sub 1} moiety remains in plane with the alkylated guanine, creating a 16{sup o} inclination of the AFB{sub 1} moiety with respect to the guanine. A binary (Dpo4-DNA) structure with an AFB{sub 1}-FAPY adducted template:primer also maintains 5'-intercalation of the AFB{sub 1} moiety. The {beta}-deoxyribose anomer is observed. Rotation about the FAPY C5-N{sup 5} bond orients the bond between N{sup 5} and C8 of the AFB{sub 1} moiety out of plane in the 5'-direction, with respect to the FAPY base. The formamide group extends in the 3'-direction. This improves stacking of the AFB{sub 1

  13. P2 receptors and immunity

    PubMed Central

    Rayah, Amel; Kanellopoulos, Jean M.; Di Virgilio, Francesco


    Immune cells express receptors for extracellular nucleotides named P2 receptors. P2 receptors transduce signals delivered by nucleotides present in the extracellular environment. Accruing evidence shows that purinergic signalling has a profound effect on multiple immune cell responses such as T lymphocyte proliferation, chemotaxis, cytokine release, phagocytosis, Ag presentation and cytotoxicity. This makes P2 receptors an attractive target for the therapy of immuno-mediated disease and cancer. PMID:22909902

  14. Crystallization and preliminary X-ray crystallographic analysis of Sulfolobus solfataricus thioredoxin reductase

    PubMed Central

    Ruggiero, Alessia; Ruocco, Maria Rosaria; Grimaldi, Pasquale; Arcari, Paolo; Masullo, Mariorosario; Zagari, Adriana; Vitagliano, Luigi


    A thermostable thioredoxin reductase isolated from Sulfolobus solfataricus (SsTrxR) has been successfully crystallized in the absence and in the presence of NADP. Two different crystal forms have been obtained. Crystals of the form that yields higher resolution data (1.8 Å) belong to space group P212121, with unit-cell parameters a = 76.77, b = 120.68, c = 126.85 Å. The structure of the enzyme has been solved by MAD methods using the anomalous signal from the Se atoms of selenomethionine-labelled SsTrxR. PMID:16511192

  15. Homology modeling, molecular dynamics simulations, and analysis of CYP119, a P450 enzyme from extreme acidothermophilic archaeon Sulfolobus solfataricus.


    Chang, Y T; Loew, G


    The recent characterization of a thermophilic and barophilic CYP119 from Sulfolobus solfataricus offers a new opportunity to identify the origin of its stability by comparing it with mesophilic P450s with known structures. Since the three-dimensional structure of CYP119 is not yet available, homology modeling techniques were used to build model structures for this enzyme. The overall quality and stability of the models were assessed using three protein analysis programs and by monitoring structural stability during 1 ns of molecular dynamics simulations at 300 and 390 K. The results show the CYP119 models to be of good quality. Possible origins of the thermo- and barostability of CYP119 were then investigated by examining the amino acid compositions and the three-dimensional structure of CYP119 compared with the five mesophilic templates. Three possible factors were identified that could contribute to the enhanced stability of CYP119. The first was the higher relative population of salt bridges and the presence of a few unique salt bridges found in CYP119 that were absent in all five template CYP450s. The second factor was a decreased population of Ala and an increased population of Ile found in the interior of CYP119, which are likely to improve packing in CYP119. The third factor was a more extensive aromatic cluster seen in CYP119 which was not found in all five template P450s. In addition, the model CYP119 three-dimensional structures were also used to determine key properties related to its function. Specifically, binding site residues and surface residues for redox partner interactions were identified. These residues identified together with those residues found that might contribute to the increased stability are suggested for future mutagenesis studies. The results obtained from these experimental studies shall then provide further validation of the suggested origins of stability and the structure-function relationships derived from the model structures of

  16. Fuzzy C P2 spacetimes

    NASA Astrophysics Data System (ADS)

    Chaney, A.; Stern, A.


    Four-dimensional manifolds with changing signature are obtained by taking the large N limit of fuzzy C P2 solutions to a Lorentzian matrix model. The regions of Lorentzian signature give toy models of closed universes which exhibit cosmological singularities. These singularities are resolved at finite N , as the underlying C P2 solutions are expressed in terms of finite matrix elements.

  17. Role of vapBC toxin–antitoxin loci in the thermal stress response of Sulfolobus solfataricus

    PubMed Central

    Cooper, Charlotte R.; Daugherty, Amanda J.; Tachdjian, Sabrina; Blum, Paul H.; Kelly, Robert M.


    TA (toxin–antitoxin) loci are ubiquitous in prokaryotic microorganisms, including archaea, yet their physiological function is largely unknown. For example, preliminary reports have suggested that TA loci are microbial stress-response elements, although it was recently shown that knocking out all known chromosomally located TA loci in Escherichia coli did not have an impact on survival under certain types of stress. The hyperthermophilic crenarchaeon Sulfolobus solfataricus encodes at least 26 vapBC (where vap is virulence-associated protein) family TA loci in its genome. VapCs are PIN (PilT N-terminus) domain proteins with putative ribonuclease activity, while VapBs are proteolytically labile proteins, which purportedly function to silence VapCs when associated as a cognate pair. Global transcriptional analysis of S. solfataricus heat-shock-response dynamics (temperature shift from 80 to 90°C) revealed that several vapBC genes were triggered by the thermal shift, suggesting a role in heat-shock-response. Indeed, knocking out a specific vapBC locus in S. solfataricus substantially changed the transcriptome and, in one case, rendered the crenarchaeon heat-shock-labile. These findings indicate that more work needs to be done to determine the role of VapBCs in S. solfataricus and other thermophilic archaea, especially with respect to post-transcriptional regulation. PMID:19143615

  18. Role of vapBC toxin-antitoxin loci in the thermal stress response of Sulfolobus solfataricus.


    Cooper, Charlotte R; Daugherty, Amanda J; Tachdjian, Sabrina; Blum, Paul H; Kelly, Robert M


    TA (toxin-antitoxin) loci are ubiquitous in prokaryotic micro-organisms, including archaea, yet their physiological function is largely unknown. For example, preliminary reports have suggested that TA loci are microbial stress-response elements, although it was recently shown that knocking out all known chromosomally located TA loci in Escherichia coli did not have an impact on survival under certain types of stress. The hyperthermophilic crenarchaeon Sulfolobus solfataricus encodes at least 26 vapBC (where vap is virulence-associated protein) family TA loci in its genome. VapCs are PIN (PilT N-terminus) domain proteins with putative ribonuclease activity, while VapBs are proteolytically labile proteins, which purportedly function to silence VapCs when associated as a cognate pair. Global transcriptional analysis of S. solfataricus heat-shock-response dynamics (temperature shift from 80 to 90 degrees C) revealed that several vapBC genes were triggered by the thermal shift, suggesting a role in heat-shock-response. Indeed, knocking out a specific vapBC locus in S. solfataricus substantially changed the transcriptome and, in one case, rendered the crenarchaeon heat-shock-labile. These findings indicate that more work needs to be done to determine the role of VapBCs in S. solfataricus and other thermophilic archaea, especially with respect to post-transcriptional regulation.

  19. Dynamic metabolic adjustments and genome plasticity are implicated in the heat shock response of the extremely thermoacidophilic archaeon Sulfolobus solfataricus.


    Tachdjian, Sabrina; Kelly, Robert M


    Approximately one-third of the open reading frames encoded in the Sulfolobus solfataricus genome were differentially expressed within 5 min following an 80 to 90 degrees C temperature shift at pH 4.0. This included many toxin-antitoxin loci and insertion elements, implicating a connection between genome plasticity and metabolic regulation in the early stages of stress response.

  20. Mercury inactivates transcription and the generalized transcription factor TFB in the archaeon Sulfolobus solfataricus.


    Dixit, Vidula; Bini, Elisabetta; Drozda, Melissa; Blum, Paul


    Mercury has a long history as an antimicrobial agent effective against eukaryotic and prokaryotic organisms. Despite its prolonged use, the basis for mercury toxicity in prokaryotes is not well understood. Archaea, like bacteria, are prokaryotes but they use a simplified version of the eukaryotic transcription apparatus. This study examined the mechanism of mercury toxicity to the archaeal prokaryote Sulfolobus solfataricus. In vivo challenge with mercuric chloride instantaneously blocked cell division, eliciting a cytostatic response at submicromolar concentrations and a cytocidal response at micromolar concentrations. The cytostatic response was accompanied by a 70% reduction in bulk RNA synthesis and elevated rates of degradation of several transcripts, including tfb-1, tfb-2, and lacS. Whole-cell extracts prepared from mercuric chloride-treated cells or from cell extracts treated in vitro failed to support in vitro transcription of 16S rRNAp and lacSp promoters. Extract-mixing experiments with treated and untreated extracts excluded the occurrence of negative-acting factors in the mercury-treated cell extracts. Addition of transcription factor B (TFB), a general transcription factor homolog of eukaryotic TFIIB, to mercury-treated cell extracts restored >50% of in vitro transcription activity. Consistent with this finding, mercuric ion treatment of TFB in vitro inactivated its ability to restore the in vitro transcription activity of TFB-immunodepleted cell extracts. These findings indicate that the toxicity of mercuric ion in S. solfataricus is in part the consequence of transcription inhibition due to TFB-1 inactivation.

  1. Thermal unfolding of nucleoside hydrolases from the hyperthermophilic archaeon Sulfolobus solfataricus: role of disulfide bonds.


    Porcelli, Marina; De Leo, Ester; Del Vecchio, Pompea; Fuccio, Francesca; Cacciapuoti, Giovanna


    Nucleoside hydrolases are metalloproteins that hydrolyze the N-glycosidic bond of β-ribonucleosides, forming the free purine/pyrimidine base and ribose. We report the stability of the two hyperthermophilic enzymes Sulfolobus solfataricus pyrimidine-specific nucleoside hydrolase (SsCU-NH) and Sulfolobus solfataricus purine-specific inosineadenosine- guanosine nucleoside hydrolase (SsIAG-NH) against the denaturing action of temperature and guanidine hydrochloride by means of circular dichroism and fluorescence spectroscopy. The guanidine hydrochloride-induced unfolding is reversible for both enzymes as demonstrated by the analysis of the refolding process by activity assays and fluorescence measurements. The evidence that the denaturation of SsIAG-NH carried out in the presence of reducing agents proved to be reversible indicates that the presence of disulfide bonds interferes with the refolding process of this enzyme. Both enzymes are highly thermostable and no thermal unfolding transition can be obtained up to 108°C. SsIAG-NH is thermally denatured under reducing conditions (T(m)=93°C) demonstrating the contribution of disulfide bridges to enzyme thermostability.

  2. A new phosphotriesterase from Sulfolobus acidocaldarius and its comparison with the homologue from Sulfolobus solfataricus.


    Porzio, Elena; Merone, Luigia; Mandrich, Luigi; Rossi, Mosè; Manco, Giuseppe


    The phosphotriesterase PTE, identified in the soil bacterium Pseudomonas diminuta, is thought to have evolved in the last several decades to degrade the pesticide paraoxon with proficiency approaching the limit of substrate diffusion (k(cat)/K(M) of 4 x 10(7)M(-1)s(-1)). It belongs to the amidohydrolase superfamily, but its evolutionary origin remains obscure. The enzyme has important potentiality in the field of the organophosphate decontamination. Recently we reported on the characterization of an archaeal member of the amidohydrolase superfamily, namely Sulfolobus solfataricus, showing low but significant and extremely thermostable paraoxonase activity (k(cat)/K(M) of 4 x 10(3)M(-1)s(-1)). Looking for other thermostable phosphotriesterases we assayed, among others, crude extracts of Sulfolobus acidocaldarius and detected activity. Since the genome of S. acidocaldarius has been recently reported, we identified there an open reading frame highly related to the S. solfataricus enzyme. The gene was cloned, the protein overexpressed in Escherichia coli, purified, and proven to have paraoxonase activity. A comparative analysis detected some significant differences between the two archaeal enzymes.

  3. A Novel Thermostable Arylesterase from the Archaeon Sulfolobus solfataricus P1: Purification, Characterization, and Expression▿ †

    PubMed Central

    Park, Young-Jun; Yoon, Sung-Jin; Lee, Hee-Bong


    A novel thermostable arylesterase, a 35-kDa monomeric enzyme, was purified from the thermoacidophilic archaeon Sulfolobus solfataricus P1. The optimum temperature and pH were 94°C and 7.0, respectively. The enzyme displayed remarkable thermostability: it retained 52% of its activity after 50 h of incubation at 90°C. In addition, the purified enzyme showed high stability against denaturing agents, including various detergents, urea, and organic solvents. The enzyme has broad substrate specificity besides showing an arylesterase activity toward aromatic esters: it exhibits not only carboxylesterase activity toward tributyrin and p-nitrophenyl esters containing unsubstituted fatty acids from butyrate (C4) to palmitate (C16), but also paraoxonase activity toward organophosphates such as p-nitrophenylphosphate, paraoxon, and methylparaoxon. The kcat/Km ratios of the enzyme for phenyl acetate and paraoxon, the two most preferable substrates among all tested, were 30.6 and 119.4 s−1·μM−1, respectively. The arylesterase gene consists of 918 bp corresponding to 306 amino acid residues. The deduced amino acid sequence shares 34% identity with that of arylesterase from Acinetobacter sp. strain ADP1. Furthermore, we successfully expressed active recombinant S. solfataricus arylesterase in Escherichia coli. Together, our results show that the enzyme is a serine esterase belonging to the A-esterases and contains a catalytic triad composed of Ser156, Asp251, and His281 in the active site. PMID:18931117

  4. Preliminary characterization of two different crystal forms of acylphosphatase from the hyperthermophile archaeon Sulfolobus solfataricus

    SciTech Connect

    Zuccotti, Simone; Rosano, Camillo; Bemporad, Francesco; Stefani, Massimo; Bolognesi, Martino


    S. solfataricus acylphosphatase has been expressed, purified and crystallized in two different crystal forms. Preliminary characterization of a triclinic and a monoclinic crystal form is reported and data were collected to 1.27 and 1.90 Å, respectively. Acylphosphatase is a ubiquitous small enzyme that was first characterized in mammals. It is involved in the hydrolysis of carboxyl-phosphate bonds in several acylphosphate substrates, such as carbamoylphosphate and 1,3-biphosphoglycerate; however, a consensus on acylphosphatase action in vivo has not yet been reached. Recent investigations have focused on acylphosphatases from lower phyla, such as Drosophila melanogaster and Escherichia coli, in view of the application of these small proteins as models in the study of folding, misfolding and aggregation processes. An acylphosphatase from the hyperthermophilic archaeon Sulfolobus solfataricus has been cloned, expressed and purified. Here, the growth and characterization of a triclinic and a monoclinic crystal form of the hyperthermophilic enzyme are reported; X-ray diffraction data have been collected to 1.27 and 1.90 Å resolution, respectively.

  5. Systematic Functional Comparative Analysis of Four Single-Stranded DNA-Binding Proteins and Their Affection on Viral RNA Metabolism

    PubMed Central

    Guo, Jinlei; Zhang, Xun; Song, Haiyan; Lv, Jianxin; Gao, Jimin; Wang, Yuepeng; Chen, Litian; Wang, Yue


    The accumulation of single-stranded DNA-binding (SSB) proteins is essential for organisms and has various applications. However, no study has simultaneously and systematically compared the characteristics of SSB proteins. In addition, SSB proteins may bind RNA and play an unknown biological role in RNA metabolism. Here, we expressed a novel species of SSB protein derived from Thermococcus kodakarensis KOD1 (KOD), as well as SSB proteins from Thermus thermophilus (TTH), Escherichia coli, and Sulfolobus Solfataricus P2 (SSOB), abbreviated kod, tth, bl21, and ssob, respectively. These SSB proteins could bind ssDNA and viral RNA. bl21 resisted heat treatment for more than 9 h, Ssob and kod could withstand 95°C for 10 h and retain its ssDNA- and RNA-binding ability. Four SSB proteins promoted the specificity of the DNA polymerase in PCR-based 5- and 9-kb genome fragment amplification. kod also increased the amplification of a 13-kb PCR product, and SSB protein–bound RNA resisted Benzonase digestion. The SSB proteins could also enter the host cell bound to RNA, which resulted in modulation of viral RNA metabolism, particularly ssob and bl21. PMID:23365690

  6. Identification of an RNase J ortholog in Sulfolobus solfataricus: implications for 5'-to-3' directional decay and 5'-end protection of mRNA in Crenarchaeota.


    Hasenöhrl, David; Konrat, Robert; Bläsi, Udo


    In both Bacteria and Eukaryotes, degradation is known to start at the 5' and at the 3' extremities of mRNAs. Until the recent discovery of 5'-to-3' exoribonucleases in hyperthermophilic Euryarchaeota, the exosome was assumed to be the key enzyme in mRNA degradation in Archaea. By means of zymogram assays and bioinformatics, we have identified a 5'-to-3' exoribonuclease activity in the crenarchaeum Sulfolobus solfataricus (Sso), which is affected by the phosphorylation state of the 5'-end of the mRNA. The protein comprises typical signature motifs of the β-CASP family of metallo-β-lactamases and was termed Sso-RNAse J. Thus, our study provides the first evidence for a 5'-to-3' directional mRNA decay pathway in the crenarchaeal clade of Archaea. In Bacteria the 5'-end of mRNAs is often protected by a tri-phosphorylated 5'-terminus and/or by stem-loop structures, while in Eukaryotes the cap-binding complex is responsible for this task. Here, we show that binding of translation initiation factor a/eIF2(γ) to the 5'-end of mRNA counteracts the 5'-to-3' exoribonucleolytic activity of Sso-RNase J in vitro. Hence, 5'-to-3' directional decay and 5'-end protection appear to be conserved features of mRNA turnover in all kingdoms of life.

  7. Pressure and temperature as tools for investigating the role of individual non-covalent interactions in enzymatic reactions Sulfolobus solfataricus carboxypeptidase as a model enzyme.


    Occhipinti, Emanuela; Bec, Nicole; Gambirasio, Benedetta; Baietta, Gabriella; Martelli, Pier Luigi; Casadio, Rita; Balny, Claude; Lange, Reinhard; Tortora, Paolo


    Sulfolobus solfataricus carboxypeptidase, (CPSso), is a heat- and pressure-resistant zinc-metalloprotease. Thanks to its properties, it is an ideal tool for investigating the role of non-covalent interactions in substrate binding. It has a broad substrate specificity as it can cleave any N-blocked amino acid (except for N-blocked proline). Its catalytic and kinetic mechanisms are well understood, and the hydrolytic reaction is easily detectable spectrophotometrically. Here, we report investigations on the pressure- and temperature-dependence of the kinetic parameters (turnover number and Michaelis constant) of CPSso using several benzoyl- and 3-(2-furyl)acryloyl-amino acids as substrates. This approach enabled us to study these parameters in terms of individual rate constants and establish that the release of the free amino acid is the rate-limiting step, making it possible to dissect the individual non-covalent interactions participating in substrate binding. In keeping with molecular docking experiments performed on the 3D model of CPSso available to date, our results show that both hydrophobic and energetic interactions (i.e., stacking and van der Waals) are mainly involved, but their contribution varies strongly, probably due to changes in the conformational state of the enzyme.

  8. Physicochemical characterisation of dietary fibre components and their ability to bind some process-induced mutagenic heterocyclic amines, Trp-P-1, Trp-P-2, AαC and MeAαC.


    Raman, Maya; Nilsson, Ulf; Skog, Kerstin; Lawther, Mark; Nair, Baboo; Nyman, Margareta


    The physicochemical properties of potato fibre, wheat bran and oat samples were investigated, along with their binding capability to heterocyclic amines (HCAs). Potato fibre displayed highest total dietary fibre content (71.8/100g dry weight basis, dwb), followed by wheat bran (57.2/100 g dwb) and oat sample 2 (53.0/100 g dwb). Oat samples 1, 3 and 4 displayed considerably lower dietary fibre content (20.5-28.8/100g, dwb). Oat samples 3 and 4 displayed highest soluble fibre content (70-83%), and oat sample 3 also displayed highest swelling and water retention capacity (WRC). Dietary fibre samples, except samples 3 and 4, displayed improved binding to HCAs as sample weight increased. The behaviour of wheat bran and potato fibre was similar to oat samples 1 and 2. Binding of MeAαC was comparatively greater than that of other HCAs. Dietary fibre fractions with high insoluble fibre and functional groups of HCAs may significantly contribute to the binding capacity.

  9. 2p2 Team News

    NASA Astrophysics Data System (ADS)

    Jones, H.


    The 2p2 Team continued towards the implementation at the 2.2-m of the same BOB (Broker for Observation Blocks) observing interface as seen at other ESO telescopes. This requires an interface to be written between the existing BOB software and the non-VLT compatible control software for the Wide-Field Imager (WFI) and 2.2-m. Cristian Urrutia, Tatiana Paz and Eduardo Robledo are heading its development. With this software in place, observers can use the VLT Phase 2 Proposal Preparation System (P2PP) for definition of their exposures, whether they are for Visitor or Service Mode.

  10. Crystal structure and nucleic acid-binding activity of the CRISPR-associated protein Csx1 of Pyrococcus furiosus.


    Kim, Young Kwan; Kim, Yeon-Gil; Oh, Byung-Ha


    In many prokaryotic organisms, chromosomal loci known as clustered regularly interspaced short palindromic repeats (CRISPRs) and CRISPR-associated (CAS) genes comprise an acquired immune defense system against invading phages and plasmids. Although many different Cas protein families have been identified, the exact biochemical functions of most of their constituents remain to be determined. In this study, we report the crystal structure of PF1127, a Cas protein of Pyrococcus furiosus DSM 3638 that is composed of 480 amino acids and belongs to the Csx1 family. The C-terminal domain of PF1127 has a unique β-hairpin structure that protrudes out of an α-helix and contains several positively charged residues. We demonstrate that PF1127 binds double-stranded DNA and RNA and that this activity requires an intact β-hairpin and involve the homodimerization of the protein. In contrast, another Csx1 protein from Sulfolobus solfataricus P2 that is composed of 377 amino acids does not have the β-hairpin structure and exhibits no DNA-binding properties under the same experimental conditions. Notably, the C-terminal domain of these two Csx1 proteins is greatly diversified, in contrast to the conserved N-terminal domain, which appears to play a common role in the homodimerization of the protein. Thus, although P. furiosus Csx1 is identified as a nucleic acid-binding protein, other Csx1 proteins are predicted to exhibit different individual biochemical activities.

  11. Fusion-type lycopene beta-cyclase from a thermoacidophilic archaeon Sulfolobus solfataricus.


    Hemmi, Hisashi; Ikejiri, Satoru; Nakayama, Toru; Nishino, Tokuzo


    Examination of the sequence of a hypothetical gene with an unknown function included in the carotenogenic gene cluster in the genome of a thermoacidophilic archaeon Sulfolobus solfataricus led to the prediction that the gene encodes a novel-type lycopene beta-cyclase, whose N- and C-terminal halves are homologous to the subunits of the bacterial heterodimeric enzymes. The recombinant expression of the gene in lycopene-producing Escherichia coli resulted in the accumulation of beta-carotene in the cells, which verifies the function of the gene. Homologues of the archaeal lycopene beta-cyclase from various organisms such as bacteria, archaea, and fungi have been reported. Although their primary structures are clearly specific to the biological taxa, a phylogenetic analysis revealed the unexpected complicity of the evolutional route of these enzymes.

  12. VapC6, a ribonucleolytic toxin regulates thermophilicity in the crenarchaeote Sulfolobus solfataricus

    PubMed Central

    Maezato, Yukari; Daugherty, Amanda; Dana, Karl; Soo, Edith; Cooper, Charlotte; Tachdjian, Sabrina; Kelly, Robert M.; Blum, Paul


    The phylum Crenarchaeota includes hyperthermophilic micro-organisms subjected to dynamic thermal conditions. Previous transcriptomic studies of Sulfolobus solfataricus identified vapBC6 as a heat-shock (HS)-inducible member of the Vap toxin–antitoxin gene family. In this study, the inactivation of the vapBC6 operon by targeted gene disruption produced two recessive phenotypes related to fitness, HS sensitivity and a heat-dependent reduction in the rate of growth. In-frame vapBC6 deletion mutants were analyzed to examine the respective roles of each protein. Since vapB6 transcript abundance was elevated in the vapC6 deletion, the VapC6 toxin appears to regulate abundance of its cognate antitoxin. In contrast, vapC6 transcript abundance was reduced in the vapB6 deletion. A putative intergenic terminator may underlie these observations by coordinating vapBC6 expression. As predicted by structural modeling, recombinant VapC6 produced using chaperone cosynthesis exhibited heat-dependent ribonucleolytic activity toward S. solfataricus total RNA. This activity could be blocked by addition of preheated recombinant VapB6. In vivo transcript targets were identified by assessing the relative expression of genes that naturally respond to thermal stress in VapBC6-deficient cells. Preferential increases were observed for dppB-1 and tetR, and preferential decreases were observed for rpoD and eIF2 gamma. Specific VapC6 ribonucleolytic action could also be demonstrated in vitro toward RNAs whose expression increased in the VapBC6-deficient strain during heat shock. These findings provide a biochemical mechanism and identify cellular targets underlying VapBC6-mediated control over microbial growth and survival at temperature extremes. PMID:21622901

  13. VapC6, a ribonucleolytic toxin regulates thermophilicity in the crenarchaeote Sulfolobus solfataricus.


    Maezato, Yukari; Daugherty, Amanda; Dana, Karl; Soo, Edith; Cooper, Charlotte; Tachdjian, Sabrina; Kelly, Robert M; Blum, Paul


    The phylum Crenarchaeota includes hyperthermophilic micro-organisms subjected to dynamic thermal conditions. Previous transcriptomic studies of Sulfolobus solfataricus identified vapBC6 as a heat-shock (HS)-inducible member of the Vap toxin-antitoxin gene family. In this study, the inactivation of the vapBC6 operon by targeted gene disruption produced two recessive phenotypes related to fitness, HS sensitivity and a heat-dependent reduction in the rate of growth. In-frame vapBC6 deletion mutants were analyzed to examine the respective roles of each protein. Since vapB6 transcript abundance was elevated in the vapC6 deletion, the VapC6 toxin appears to regulate abundance of its cognate antitoxin. In contrast, vapC6 transcript abundance was reduced in the vapB6 deletion. A putative intergenic terminator may underlie these observations by coordinating vapBC6 expression. As predicted by structural modeling, recombinant VapC6 produced using chaperone cosynthesis exhibited heat-dependent ribonucleolytic activity toward S. solfataricus total RNA. This activity could be blocked by addition of preheated recombinant VapB6. In vivo transcript targets were identified by assessing the relative expression of genes that naturally respond to thermal stress in VapBC6-deficient cells. Preferential increases were observed for dppB-1 and tetR, and preferential decreases were observed for rpoD and eIF2 gamma. Specific VapC6 ribonucleolytic action could also be demonstrated in vitro toward RNAs whose expression increased in the VapBC6-deficient strain during heat shock. These findings provide a biochemical mechanism and identify cellular targets underlying VapBC6-mediated control over microbial growth and survival at temperature extremes.

  14. Design of HIV-1 Protease Inhibitors with Amino-bis-tetrahydrofuran Derivatives as P2-Ligands to Enhance Backbone-Binding Interactions. Synthesis, Biological Evaluation, and Protein-Ligand X-ray Studies

    SciTech Connect

    Ghosh, Arun K.; Martyr, Cuthbert D.; Osswald, Heather L.; Sheri, Venkat Reddy; Kassekert, Luke A.; Chen, Shujing; Agniswamy, Johnson; Wang, Yuan-Fang; Hayashi, Hironori; Aoki, Manabu; Weber, Irene T.; Mitsuya, Hiroaki


    Structure-based design, synthesis, and biological evaluation of a series of very potent HIV-1 protease inhibitors are described. In an effort to improve backbone ligand–binding site interactions, we have incorporated basic-amines at the C4 position of the bis-tetrahydrofuran (bis-THF) ring. We speculated that these substituents would make hydrogen bonding interactions in the flap region of HIV-1 protease. Synthesis of these inhibitors was performed diastereoselectively. A number of inhibitors displayed very potent enzyme inhibitory and antiviral activity. Inhibitors 25f, 25i, and 25j were evaluated against a number of highly-PI-resistant HIV-1 strains, and they exhibited improved antiviral activity over darunavir. Two high resolution X-ray structures of 25f- and 25g-bound HIV-1 protease revealed unique hydrogen bonding interactions with the backbone carbonyl group of Gly48 as well as with the backbone NH of Gly48 in the flap region of the enzyme active site. These ligand–binding site interactions are possibly responsible for their potent activity.

  15. Molecular Recognition at Purine and Pyrimidine Nucleotide (P2) Receptors

    PubMed Central

    Jacobson, Kenneth A.; Constanzi, Stefano; Ohno, Michihiro; Joshi, Bhalchandra V.; Besada, Pedro; Xu, Bin; Tchilibon, Susanna


    In comparison to other classes of cell surface receptors, the medicinal chemistry at P2X (ligand-gated ion channels) and P2Y (G protein-coupled) nucleotide receptors has been relatively slow to develop. Recent effort to design selective agonists and antagonists based on a combination of library screening, empirical modification of known ligands, and rational design have led to the introduction of potent antagonists of the P2X1 (derivatives of pyridoxal phosphates and suramin), P2X3 (A-317491), P2X7 (derivatives of the isoquinoline KN-62), P2Y1 (nucleotide analogues MRS 2179 and MRS 2279), P2Y2 (thiouracil derivatives such as AR-C126313), and P2Y12 (nucleotide/nucleoside analogues AR-C69931X and AZD6140) receptors. A variety of native agonist ligands (ATP, ADP, UTP, UDP, and UDP-glucose) are currently the subject of structural modification efforts to improve selectivity. MRS2365 is a selective agonist for P2Y1 receptors. The dinucleotide INS 37217 potently activates the P2Y2 receptor. UTP-γ-S and UDP-β-S are selective agonists for P2Y2/P2Y4 and P2Y6 receptors, respectively. The current knowledge of the structures of P2X and P2Y receptors, is derived mainly from mutagenesis studies. Site-directed mutagenesis has shown that ligand recognition in the human P2Y1 receptor involves individual residues of both the TMs (3, 5, 6, and 7), as well as EL 2 and 3. The binding of the negatively-charged phosphate moiety is dependent on positively charged lysine and arginine residues near the exofacial side of TMs 3 and 7. PMID:15078212

  16. An error-prone family Y DNA polymerase (DinB homolog from Sulfolobus solfataricus) uses a 'steric gate' residue for discrimination against ribonucleotides.


    DeLucia, Angela M; Grindley, Nigel D F; Joyce, Catherine M


    DNA polymerases of the A and B families, and reverse transcriptases, share a common mechanism for preventing incorporation of ribonucleotides: a highly conserved active site residue obstructing the position that would be occupied by a 2' hydroxyl group on the incoming nucleotide. In the family Y (lesion bypass) polymerases, the enzyme active site is more open, with fewer contacts to the DNA and nucleotide substrates. Nevertheless, ribonucleotide discrimination by the DinB homolog (Dbh) DNA polymerase of Sulfolobus solfataricus is as stringent as in other polymerases. A highly conserved aromatic residue (Phe12 in Dbh) occupies a position analogous to the residues responsible for excluding ribonucleotides in other DNA polymerases. The F12A mutant of Dbh incorporates ribonucleoside triphosphates almost as efficiently as deoxyribonucleoside triphosphates, and, unlike analogous mutants in other polymerase families, shows no barrier to adding multiple ribonucleotides, suggesting that Dbh can readily accommodate a DNA-RNA duplex product. Like other members of the DinB group of bypass polymerases, Dbh makes single-base deletion errors at high frequency in particular sequence contexts. When making a deletion error, ribonucleotide discrimination by wild-type and F12A Dbh is the same as in normal DNA synthesis, indicating that the geometry of nucleotide binding is similar in both circumstances.

  17. The SLAC P2 Marx

    SciTech Connect

    Kemp, Mark; Benwell, Andrew; Burkhart, Craig; MacNair, David; Nguyen1, Minh; /SLAC


    A proposed high energy physics accelerator, the International Linear Collider, will require greater than five hundred rf stations. Each station is composed of a klystron driven by a modulator. Recently, the SLAC P2 Marx was designated the baseline modulator for the ILC. This paper describes some key features of this modulator and presents recent experimental results. The P2 Marx is presently being transported to another facility for lifetime testing. Here, we will gain understanding of how the Marx performs into a klystron load and gain experience operating the Marx for longer periods. Long term plans include the possibility of using this rf station for L-band technology demonstration at SLAC. While the Marx was designed with the ILC in mind, the topology can be readily applied to several different applications. We are currently evaluating the use of the topology for ESS, CLIC, and upgrades for systems at Fermi National Accelerator Laboratory. Because of the modular nature of the cell and the robustness of the control system, many different combinations of series and parallel operation are possible along with different load currents and pulse shapes.

  18. Activation and Regulation of Purinergic P2X Receptor Channels

    PubMed Central

    Coddou, Claudio; Yan, Zonghe; Obsil, Tomas; Huidobro-Toro, J. Pablo


    Mammalian ATP-gated nonselective cation channels (P2XRs) can be composed of seven possible subunits, denoted P2X1 to P2X7. Each subunit contains a large ectodomain, two transmembrane domains, and intracellular N and C termini. Functional P2XRs are organized as homomeric and heteromeric trimers. This review focuses on the binding sites involved in the activation (orthosteric) and regulation (allosteric) of P2XRs. The ectodomains contain three ATP binding sites, presumably located between neighboring subunits and formed by highly conserved residues. The detection and coordination of three ATP phosphate residues by positively charged amino acids are likely to play a dominant role in determining agonist potency, whereas an AsnPheArg motif may contribute to binding by coordinating the adenine ring. Nonconserved ectodomain histidines provide the binding sites for trace metals, divalent cations, and protons. The transmembrane domains account not only for the formation of the channel pore but also for the binding of ivermectin (a specific P2X4R allosteric regulator) and alcohols. The N- and C- domains provide the structures that determine the kinetics of receptor desensitization and/or pore dilation and are critical for the regulation of receptor functions by intracellular messengers, kinases, reactive oxygen species and mercury. The recent publication of the crystal structure of the zebrafish P2X4.1R in a closed state provides a major advance in the understanding of this family of receptor channels. We will discuss data obtained from numerous site-directed mutagenesis experiments accumulated during the last 15 years with reference to the crystal structure, allowing a structural interpretation of the molecular basis of orthosteric and allosteric ligand actions. PMID:21737531

  19. Production of steviol from steviol glucosides using β-glycosidase from Sulfolobus solfataricus.


    Nguyen, Thi Thanh Hanh; Kim, Seong-Bo; Kim, Nahyun M; Kang, Choongil; Chung, Byoungsang; Park, Jun-Seong; Kim, Doman


    Steviol is a diterpene isolated from the plant Stevia rebaudiana that has a potential role as an antihyperglycemic agent by stimulating insulin secretion from pancreatic beta cells and also has significant potential to diminish the renal clearance of anionic drugs and their metabolites. In this study, the lacS gene, which encodes a thermostable β-glycosidase (SSbgly) enzyme from the extremely thermoacidophillic archaeon Sulfolobus solfataricus, was cloned and expressed in E. coli Rossetta BL21(DE3)pLyS using lactose as an inducer. Through fermentation, SSbgly was expressed as a 61kDa protein with activity of 24.3U/mg and the OD600 of 23 was reached after 18h induction with 10mM lactose. Purified protein was obtained by Ni-Sepharose chromatography with a yield of 92.3%. SSbgly hydrolyzed steviol glycosides to produce steviol with a yield of 99.2%. The optimum conditions for steviol production were 50U/ml SSbgly and 90mg/ml Ste at 75°C as determined by the response surface method. Copyright © 2016 Elsevier Inc. All rights reserved.

  20. Understanding Molecular Recognition of Promiscuity of Thermophilic Methionine Adenosyltransferase, sMAT from Sulfolobus solfataricus

    PubMed Central

    Wang, Fengbin; Singh, Shanteri; Zhang, Jianjun; Huber, Tyler D.; Helmich, Kate E.; Sunkara, Manjula; Hurley, Katherine A.; Goff, Randal D.; Bingman, Craig A.; Morris, Andrew J.; Thorson, Jon S.; Phillips, George N.


    Methionine adenosyltransferase (MAT) is a family of enzymes that utilizes ATP and methionine to produce S-adenosylmethionine (AdoMet), the most crucial methyl donor in the biological methylation of biomolecules and bioactive natural products. Here, we report that the MAT from Sulfolobus solfataricus (sMAT), an enzyme from a poorly explored class of the MAT family, has the ability to produce a range of differentially alkylated AdoMet analogs in the presence of non-native methionine analogs and ATP. To investigate the molecular basis for AdoMet analog production, we have crystallized the sMAT in the AdoMet bound, S-adenosylethionine (AdoMet) bound, and unbound forms. Notably, among these structures, the AdoEth-bound form offers the first MAT structure containing a non-native product and cumulatively, these structures add new structural insight into the MAT family and allow for detailed active site comparison with its homologs in E. coli and human. As a thermostable MAT structure from archaea, the structures herein also provide as a basis for future engineering to potentially broaden AdoMet analog production as reagents for methyltransferase-catalyzed ‘alkylrandomization’ and/or the study of methylation in the context of biological processes. PMID:24649856

  1. Role of MerH in mercury resistance in the archaeon Sulfolobus solfataricus

    PubMed Central

    Schelert, James; Rudrappa, Deepak; Johnson, Tyler


    Crenarchaeota include extremely thermoacidophilic organisms that thrive in geothermal environments dominated by sulfidic ores and heavy metals such as mercury. Mercuric ion, Hg(II), inactivates transcription in the crenarchaeote Sulfolobus solfataricus and simultaneously derepresses transcription of a resistance operon, merHAI, through interaction with the MerR transcription factor. While mercuric reductase (MerA) is required for metal resistance, the role of MerH, an adjacent small and predicted product of an ORF, has not been explored. Inactivation of MerH either by nonsense mutation or by in-frame deletion diminished Hg(II) resistance of mutant cells. Promoter mapping studies indicated that Hg(II) sensitivity of the merH nonsense mutant arose through transcriptional polarity, and its metal resistance was restored partially by single copy merH complementation. Since MerH was not required in vitro for MerA-catalysed Hg(II) reduction, MerH may play an alternative role in metal resistance. Inductively coupled plasma-mass spectrometry analysis of the MerH deletion strain following metal challenge indicated that there was prolonged retention of intracellular Hg(II). Finally, a reduced rate of mer operon induction in the merH deletion mutant suggested that the requirement for MerH could result from metal trafficking to the MerR transcription factor. PMID:23619003

  2. High-affinity RNA binding by a hyperthermophilic single-stranded DNA-binding protein.


    Morten, Michael J; Gamsjaeger, Roland; Cubeddu, Liza; Kariawasam, Ruvini; Peregrina, Jose; Penedo, J Carlos; White, Malcolm F


    Single-stranded DNA-binding proteins (SSBs), including replication protein A (RPA) in eukaryotes, play a central role in DNA replication, recombination, and repair. SSBs utilise an oligonucleotide/oligosaccharide-binding (OB) fold domain to bind DNA, and typically oligomerise in solution to bring multiple OB fold domains together in the functional SSB. SSBs from hyperthermophilic crenarchaea, such as Sulfolobus solfataricus, have an unusual structure with a single OB fold coupled to a flexible C-terminal tail. The OB fold resembles those in RPA, whilst the tail is reminiscent of bacterial SSBs and mediates interaction with other proteins. One paradigm in the field is that SSBs bind specifically to ssDNA and much less strongly to RNA, ensuring that their functions are restricted to DNA metabolism. Here, we use a combination of biochemical and biophysical approaches to demonstrate that the binding properties of S. solfataricus SSB are essentially identical for ssDNA and ssRNA. These features may represent an adaptation to a hyperthermophilic lifestyle, where DNA and RNA damage is a more frequent event.

  3. Agonists and antagonists for P2 receptors

    PubMed Central

    Jacobson, Kenneth A.; Costanzi, Stefano; Joshi, Bhalchandra V.; Besada, Pedro; Shin, Dae Hong; Ko, Hyojin; Ivanov, Andrei A.; Mamedova, Liaman


    Recent work has identified nucleotide agonists selective for P2Y1, P2Y2 and P2Y6 receptors and nucleotide antagonists selective for P2Y1, P2Y12 and P2X1 receptors. Selective non-nucleotide antagonists have been reported for P2Y1, P2Y2, P2Y6, P2Y12, P2Y13, P2X2/3/P2X3 and P2X7 receptors. For example, the dinucleotide INS 37217 (Up4dC) potently activates the P2Y2 receptor, and the non-nucleotide antagonist A-317491 is selective for P2X2/3/P2X3 receptors. Nucleotide analogues in which the ribose moiety is substituted by a variety of novel ring systems, including conformation-ally locked moieties, have been synthesized as ligands for P2Y receptors. The focus on conformational factors of the ribose-like moiety allows the inclusion of general modifications that lead to enhanced potency and selectivity. At P2Y1,2,4,11 receptors, there is a preference for the North conformation as indicated with (N)-methanocarba analogues. The P2Y1 antagonist MRS2500 inhibited ADP-induced human platelet aggregation with an IC50 of 0.95 nM. MRS2365, an (N)-methanocarba analogue of 2-MeSADP, displayed potency (EC50) of 0.4 nM at the P2Y1 receptor, with >10 000-fold selectivity in comparison to P2Y12 and P2Y13 receptors. At P2Y6 receptors there is a dramatic preference for the South conformation. Three-dimensional structures of P2Y receptors have been deduced from structure activity relationships (SAR), mutagenesis and modelling studies. Detailed three-dimensional structures of P2X receptors have not yet been proposed. PMID:16805423

  4. Structural features responsible for kinetic thermal stability of a carboxypeptidase from the archaebacterium Sulfolobus solfataricus.

    PubMed Central

    Villa, A; Zecca, L; Fusi, P; Colombo, S; Tedeschi, G; Tortora, P


    Investigations were performed on the structural features responsible for kinetic thermal stability of a thermostable carboxypeptidase from the thermoacidophilic archaebacterium Sulfolobus solfataricus which had been purified previously and identified as a zinc metalloprotease [Colombo, D'Auria, Fusi, Zecca, Raia and Tortora (1992) Eur. J. Biochem. 206, 349-357]. Removal of Zn2+ by dialysis led to reversible activity loss, which was promptly restored by addition of 80 microM ZnCl2 to the assay mixture. For the first-order irreversible thermal inactivation the metal-depleted enzyme showed an activation energy value of 205.6 kJ.mol-1, which is considerably lower than that of the holoenzyme (494.4 kJ.mol-1). The values of activation free energies, enthalpies and entropies also dropped with metal removal. Thermal inactivation of the apoenzyme was very quick at 80 degrees C, whereas the holoenzyme was stable at the same temperature. These findings suggest a major stabilizing role for the bivalent cation. Chaotropic salts strongly destabilized the holoenzyme, showing that hydrophobic interactions are involved in maintaining the native conformation of the enzyme. However, the inactivation rate was also increased by sodium sulphate, acetate and chloride, which are not chaotropes, indicating that one or more salt bridges concur in stabilizing the active enzyme. Furthermore, at the extremes of the pH-stability curve, NaCl did not affect the inactivation rate, confirming the stabilizing role of intramolecular ionic bonds, as a pH-dependent decrease in stability is likely to occur from breaking of salt bridges involved in maintaining the native conformation of the protein. PMID:8240298

  5. Metabolism of Pentose Sugars in the Hyperthermophilic Archaea Sulfolobus solfataricus and Sulfolobus acidocaldarius

    PubMed Central

    Nunn, Charlotte E. M.; Johnsen, Ulrike; Schönheit, Peter; Fuhrer, Tobias; Sauer, Uwe; Hough, David W.; Danson, Michael J.


    We have previously shown that the hyperthermophilic archaeon, Sulfolobus solfataricus, catabolizes d-glucose and d-galactose to pyruvate and glyceraldehyde via a non-phosphorylative version of the Entner-Doudoroff pathway. At each step, one enzyme is active with both C6 epimers, leading to a metabolically promiscuous pathway. On further investigation, the catalytic promiscuity of the first enzyme in this pathway, glucose dehydrogenase, has been shown to extend to the C5 sugars, d-xylose and l-arabinose. In the current paper we establish that this promiscuity for C6 and C5 metabolites is also exhibited by the third enzyme in the pathway, 2-keto-3-deoxygluconate aldolase, but that the second step requires a specific C5-dehydratase, the gluconate dehydratase being active only with C6 metabolites. The products of this pathway for the catabolism of d-xylose and l-arabinose are pyruvate and glycolaldehyde, pyruvate entering the citric acid cycle after oxidative decarboxylation to acetyl-coenzyme A. We have identified and characterized the enzymes, both native and recombinant, that catalyze the conversion of glycolaldehyde to glycolate and then to glyoxylate, which can enter the citric acid cycle via the action of malate synthase. Evidence is also presented that similar enzymes for this pentose sugar pathway are present in Sulfolobus acidocaldarius, and metabolic tracer studies in this archaeon demonstrate its in vivo operation in parallel with a route involving no aldol cleavage of the 2-keto-3-deoxy-pentanoates but direct conversion to the citric acid cycle C5-metabolite, 2-oxoglutarate. PMID:20736170

  6. Metabolism of pentose sugars in the hyperthermophilic archaea Sulfolobus solfataricus and Sulfolobus acidocaldarius.


    Nunn, Charlotte E M; Johnsen, Ulrike; Schönheit, Peter; Fuhrer, Tobias; Sauer, Uwe; Hough, David W; Danson, Michael J


    We have previously shown that the hyperthermophilic archaeon, Sulfolobus solfataricus, catabolizes d-glucose and d-galactose to pyruvate and glyceraldehyde via a non-phosphorylative version of the Entner-Doudoroff pathway. At each step, one enzyme is active with both C6 epimers, leading to a metabolically promiscuous pathway. On further investigation, the catalytic promiscuity of the first enzyme in this pathway, glucose dehydrogenase, has been shown to extend to the C5 sugars, D-xylose and L-arabinose. In the current paper we establish that this promiscuity for C6 and C5 metabolites is also exhibited by the third enzyme in the pathway, 2-keto-3-deoxygluconate aldolase, but that the second step requires a specific C5-dehydratase, the gluconate dehydratase being active only with C6 metabolites. The products of this pathway for the catabolism of D-xylose and L-arabinose are pyruvate and glycolaldehyde, pyruvate entering the citric acid cycle after oxidative decarboxylation to acetyl-coenzyme A. We have identified and characterized the enzymes, both native and recombinant, that catalyze the conversion of glycolaldehyde to glycolate and then to glyoxylate, which can enter the citric acid cycle via the action of malate synthase. Evidence is also presented that similar enzymes for this pentose sugar pathway are present in Sulfolobus acidocaldarius, and metabolic tracer studies in this archaeon demonstrate its in vivo operation in parallel with a route involving no aldol cleavage of the 2-keto-3-deoxy-pentanoates but direct conversion to the citric acid cycle C5-metabolite, 2-oxoglutarate.

  7. A heat-stable serine proteinase from the extreme thermophilic archaebacterium Sulfolobus solfataricus.


    Burlini, N; Magnani, P; Villa, A; Macchi, F; Tortora, P; Guerritore, A


    A proteinase was purified to electrophoretic homogeneity from crude extracts of the thermoacidophilic archaebacterium Sulfolobus solfataricus. Molecular mass values assessed by SDS-PAGE and gel filtration were 54 and 118 kDa, respectively, which points to a dimeric structure of the molecule. An isoelectric point of 5.6 was also determined. The enzyme behaved as a chymotrypsin-like serine proteinase, as shown by the inhibitory effects exerted by phenylmethanesulfonyl fluoride, 3,4-dichloroisocoumarin, tosylphenylalaninechloromethyl ketone and chymostatin. Consistently with the inhibition pattern, the enzyme cleaved chromogenic substrates at the carboxyl side of aromatic or bulky aliphatic amino acids; however, it effectively attacked only a small number of such substrates, thus, displaying a specificity much narrower than and clearly different from that of chymotrypsin. This was confirmed by its inability to digest a set of natural substrate proteins, as well as insulin chains A and B; only after alkylation casein was degraded to some extent. Proteinase activity was significantly stimulated by Mn2+ which acted as a mixed-type nonessential activator. The enzyme also displayed a broad pH optimum in the range 6.5-8.0. Furthermore, it was completely stable up to 90 degrees C; above this temperature it underwent first-order thermal inactivation with half-lives ranging from 342 min (92 degrees C) to 7 min (101 degrees C). At 50 degrees C it could withstand 6 M urea and, to some extent, different organic solvents; however, at 95 degrees C it was extensively inactivated by all of these compounds. None of the chemical physical properties of the enzyme, including amino-acid analysis, provided evidence of a possible relation to other well-known microbial serine proteinases.

  8. Structural features responsible for kinetic thermal stability of a carboxypeptidase from the archaebacterium Sulfolobus solfataricus.


    Villa, A; Zecca, L; Fusi, P; Colombo, S; Tedeschi, G; Tortora, P


    Investigations were performed on the structural features responsible for kinetic thermal stability of a thermostable carboxypeptidase from the thermoacidophilic archaebacterium Sulfolobus solfataricus which had been purified previously and identified as a zinc metalloprotease [Colombo, D'Auria, Fusi, Zecca, Raia and Tortora (1992) Eur. J. Biochem. 206, 349-357]. Removal of Zn2+ by dialysis led to reversible activity loss, which was promptly restored by addition of 80 microM ZnCl2 to the assay mixture. For the first-order irreversible thermal inactivation the metal-depleted enzyme showed an activation energy value of 205.6 kJ.mol-1, which is considerably lower than that of the holoenzyme (494.4 kJ.mol-1). The values of activation free energies, enthalpies and entropies also dropped with metal removal. Thermal inactivation of the apoenzyme was very quick at 80 degrees C, whereas the holoenzyme was stable at the same temperature. These findings suggest a major stabilizing role for the bivalent cation. Chaotropic salts strongly destabilized the holoenzyme, showing that hydrophobic interactions are involved in maintaining the native conformation of the enzyme. However, the inactivation rate was also increased by sodium sulphate, acetate and chloride, which are not chaotropes, indicating that one or more salt bridges concur in stabilizing the active enzyme. Furthermore, at the extremes of the pH-stability curve, NaCl did not affect the inactivation rate, confirming the stabilizing role of intramolecular ionic bonds, as a pH-dependent decrease in stability is likely to occur from breaking of salt bridges involved in maintaining the native conformation of the protein.

  9. Purification and characterization of a thermostable carboxypeptidase from the extreme thermophilic archaebacterium Sulfolobus solfataricus.


    Colombo, S; D'Auria, S; Fusi, P; Zecca, L; Raia, C A; Tortora, P


    A carboxypeptidase was purified to electrophoretic homogeneity from the thermoacidophilic archaebacterium Sulfolobus solfataricus. Molecular masses assessed by SDS/PAGE and gel filtration were 42 kDa and 170 kDa, respectively, which points to a tetrameric structure for the molecule. An isoelectric point of 5.9 was also determined. The enzyme was proven to be a metalloprotease, as shown by the inhibitory effects exerted by EDTA and o-phenanthroline; furthermore, dialysis against EDTA led to a complete loss of activity, which could be restored by addition of Zn2+ in the micromolar range, and, to a lesser extent, by Co2+. The enzyme was endowed with a broad substrate specificity, as shown by its ability to release basic, acidic and aromatic amino acids from the respective benzoylglycylated and benzyloxycarbonylated amino acids. An esterase activity of the carboxypeptidase was also demonstrated on different esterified amino acids and dipeptides blocked at the N-terminus. The enzyme displayed broad pH optima ranging over 5.5-7.0, or 5.5-9.0, when using an acidic or a basic benzyloxycarbonylated amino acid, respectively. With regard to thermostability, it was proven to be completely stable on incubation for 15 min at 85 degrees C. Furthermore, thanks to its relatively low activation energy, i.e. 31.0 kJ/mol, it was still significantly active at room temperature. At 40 degrees C, the enzyme could withstand 0.1% SDS and different organic solvents: particularly ethanol up to 99%. Amino acid and N-terminal sequence analyses did not evidence any similarity to carboxypeptidases A nor thermolysin. A weak similarity was only found with bovine carboxypeptidase B.

  10. Stability of mRNA in the hyperthermophilic archaeon Sulfolobus solfataricus.

    PubMed Central

    Bini, Elisabetta; Dikshit, Vidula; Dirksen, Kristi; Drozda, Melissa; Blum, Paul


    Archaea-like bacteria are prokaryotes but, in contrast, use eukaryotic-like systems for key aspects of DNA, RNA, and protein metabolism. mRNA is typically unstable in bacteria and stable in eukaryotes, but little information is available about mRNA half-lives in archaea. Because archaea are generally insensitive to antibiotics, examination of mRNA stability in the hyperthermophile, Sulfolobus solfataricus, required the identification of transcription inhibitors for half-life determinations. An improved lacS promoter-dependent in vitro transcription system was used to assess inhibitor action. Efficient inhibitors were distinguished as blocking both lacSp transcription in vitro and the incorporation of 3H-uracil into bulk RNA in vivo. Actinomycin D was the most stable and potent compound identified. A survey of transcript chemical half-lives normalized to levels of the signal recognition particle 7S RNA ranged from at least 2 h for tfb1, a transcription factor TFIIB paralog, to a minimum of 6.3 min for gln1, one of three glutamine synthetase paralogs. Transcript half-lives for other mRNAs were: 2 h, superoxide dismutase (sod); 37.5 min, glucose dehydrogenase (dhg1); 25 min, alpha-glucosidase (malA); and 13.5 min, transcription factor TFIIB-2 (tfb2) resulting in a minimum average half-life of 54 min. These are the first mRNA half-lives reported for a hyperthermophile or member of the crenarchaea. The unexpected stability of several transcripts has important implications for gene expression and mRNA degradation in this organism. PMID:12358432

  11. Redox stress proteins are involved in adaptation response of the hyperthermoacidophilic archaeon Sulfolobus solfataricus to nickel challenge

    PubMed Central

    Salzano, Anna M; Febbraio, Ferdinando; Farias, Tiziana; Cetrangolo, Giovanni P; Nucci, Roberto; Scaloni, Andrea; Manco, Giuseppe


    Background Exposure to nickel (Ni) and its chemical derivatives has been associated with severe health effects in human. On the contrary, poor knowledge has been acquired on target physiological processes or molecular mechanisms of this metal in model organisms, including Bacteria and Archaea. In this study, we describe an analysis focused at identifying proteins involved in the recovery of the archaeon Sulfolobus solfataricus strain MT4 from Ni-induced stress. Results To this purpose, Sulfolobus solfataricus was grown in the presence of the highest nickel sulphate concentration still allowing cells to survive; crude extracts from treated and untreated cells were compared at the proteome level by using a bi-dimensional chromatography approach. We identified several proteins specifically repressed or induced as result of Ni treatment. Observed up-regulated proteins were largely endowed with the ability to trigger recovery from oxidative and osmotic stress in other biological systems. It is noteworthy that most of the proteins induced following Ni treatment perform similar functions and a few have eukaryal homologue counterparts. Conclusion These findings suggest a series of preferential gene expression pathways activated in adaptation response to metal challenge. PMID:17692131

  12. Decavanadate, a P2X receptor antagonist, and its use to study ligand interactions with P2X7 receptors.


    Michel, Anton D; Xing, Mengle; Thompson, Kyla M; Jones, Clare A; Humphrey, Patrick P A


    In this study we have studied decavanadate effects at P2X receptors. Decavanadate competitively blocked 2'- and 3'-O-(4benzoylbenzoyl) ATP (BzATP) stimulated ethidium accumulation in HEK293 cells expressing human recombinant P2X7 receptors (pK(B) 7.5). The effects of decavanadate were rapid (minutes) in both onset and offset and contrasted with the much slower kinetics of pyridoxal 5-phosphate (P5P), Coomassie brilliant blue (CBB) and 1-[N,O-bis(5-isoquinolinesulfonyl)-N-methyl-L-tyrosyl]-4-phenylpiperazine (KN62). Decavanadate competitively blocked the slowly reversible, or irreversible, blockade of the P2X7 receptor produced by P5P and oxidised ATP suggesting competition for a common binding site. However, the interaction between decavanadate and KN62 was non-competitive. Decavanadate also blocked P2X2 and P2X4 receptors but with slightly lower potency. These data demonstrate that decavanadate is the first reversible and competitive antagonist of the P2X7 receptor and is a useful tool for studying the mechanism of interaction of ligands with the P2X7 receptor.

  13. Nucleotides Acting at P2Y Receptors: Connecting Structure and Function

    PubMed Central

    Paoletta, Silvia; Katritch, Vsevolod; Wu, Beili; Gao, Zhan-Guo; Zhao, Qiang; Stevens, Raymond C.; Kiselev, Evgeny


    Eight G protein–coupled P2Y receptor (P2YR) subtypes are important physiologic mediators. The human P2YRs are fully activated by ATP (P2Y2 and P2Y11), ADP (P2Y1, P2Y12, and P2Y13), UTP (P2Y2 and P2Y4), UDP (P2Y6 and P2Y14), and UDP glucose (P2Y14). Their structural elucidation is progressing rapidly. The X-ray structures of three ligand complexes of the Gi-coupled P2Y12R and two of the Gq-coupled P2Y1Rs were recently determined and will be especially useful in structure-based ligand design at two P2YR subfamilies. These high-resolution structures, which display unusual binding site features, complement mutagenesis studies for probing ligand recognition and activation. The structural requirements for nucleotide agonist recognition at P2YRs are relatively permissive with respect to the length of the phosphate moiety, but less so with respect to base recognition. Nucleotide-like antagonists and partial agonists are also known for P2Y1, P2Y2, P2Y4, and P2Y12Rs. Each P2YR subtype has the ability to be activated by structurally bifunctional agonists, such as dinucleotides, typically, dinucleoside triphosphates or tetraphosphates, and nucleoside polyphosphate sugars (e.g., UDP glucose) as well as the more conventional mononucleotide agonists. A range of dinucleoside polyphosphates, from triphosphates to higher homologs, occurs naturally. Earlier modeling predictions of the P2YRs were not very accurate, but recent findings have provided much detailed structural insight into this receptor family to aid in the rational design of new drugs. PMID:25837834

  14. Nucleotides Acting at P2Y Receptors: Connecting Structure and Function.


    Jacobson, Kenneth A; Paoletta, Silvia; Katritch, Vsevolod; Wu, Beili; Gao, Zhan-Guo; Zhao, Qiang; Stevens, Raymond C; Kiselev, Evgeny


    Eight G protein-coupled P2Y receptor (P2YR) subtypes are important physiologic mediators. The human P2YRs are fully activated by ATP (P2Y2 and P2Y11), ADP (P2Y1, P2Y12, and P2Y13), UTP (P2Y2 and P2Y4), UDP (P2Y6 and P2Y14), and UDP glucose (P2Y14). Their structural elucidation is progressing rapidly. The X-ray structures of three ligand complexes of the Gi-coupled P2Y12R and two of the Gq-coupled P2Y1Rs were recently determined and will be especially useful in structure-based ligand design at two P2YR subfamilies. These high-resolution structures, which display unusual binding site features, complement mutagenesis studies for probing ligand recognition and activation. The structural requirements for nucleotide agonist recognition at P2YRs are relatively permissive with respect to the length of the phosphate moiety, but less so with respect to base recognition. Nucleotide-like antagonists and partial agonists are also known for P2Y1, P2Y2, P2Y4, and P2Y12Rs. Each P2YR subtype has the ability to be activated by structurally bifunctional agonists, such as dinucleotides, typically, dinucleoside triphosphates or tetraphosphates, and nucleoside polyphosphate sugars (e.g., UDP glucose) as well as the more conventional mononucleotide agonists. A range of dinucleoside polyphosphates, from triphosphates to higher homologs, occurs naturally. Earlier modeling predictions of the P2YRs were not very accurate, but recent findings have provided much detailed structural insight into this receptor family to aid in the rational design of new drugs.

  15. Modulation of P2X3 and P2X2/3 Receptors by Monoclonal Antibodies.


    Shcherbatko, Anatoly; Foletti, Davide; Poulsen, Kris; Strop, Pavel; Zhu, Guoyun; Hasa-Moreno, Adela; Melton Witt, Jody; Loo, Carole; Krimm, Stellanie; Pios, Ariel; Yu, Jessica; Brown, Colleen; Lee, John K; Stroud, Robert; Rajpal, Arvind; Shelton, David


    Purinergic homomeric P2X3 and heteromeric P2X2/3 receptors are ligand-gated cation channels activated by ATP. Both receptors are predominantly expressed in nociceptive sensory neurons, and an increase in extracellular ATP concentration under pathological conditions, such as tissue damage or visceral distension, induces channel opening, membrane depolarization, and initiation of pain signaling. Hence, these receptors are considered important therapeutic targets for pain management, and development of selective antagonists is currently progressing. To advance the search for novel analgesics, we have generated a panel of monoclonal antibodies directed against human P2X3 (hP2X3). We have found that these antibodies produce distinct functional effects, depending on the homomeric or heteromeric composition of the target, its kinetic state, and the duration of antibody exposure. The most potent antibody, 12D4, showed an estimated IC50 of 16 nm on hP2X3 after short term exposure (up to 18 min), binding to the inactivated state of the channel to inhibit activity. By contrast, with the same short term application, 12D4 potentiated the slow inactivating current mediated by the heteromeric hP2X2/3 channel. Extending the duration of exposure to ∼20 h resulted in a profound inhibition of both homomeric hP2X3 and heteromeric hP2X2/3 receptors, an effect mediated by efficient antibody-induced internalization of the channel from the plasma membrane. The therapeutic potential of mAb12D4 was assessed in the formalin, complete Freund's adjuvant, and visceral pain models. The efficacy of 12D4 in the visceral hypersensitivity model indicates that antibodies against P2X3 may have therapeutic potential in visceral pain indications.

  16. P2 receptor web: complexity and fine-tuning.


    Volonté, Cinzia; Amadio, Susanna; D'Ambrosi, Nadia; Colpi, Monica; Burnstock, Geoffrey


    The present review offers a new perspective on a family of receptors, termed P2 receptors, specific for nucleoside tri- and diphosphates of purines/pyrimidines. We emphasize here that while decoding the inputs of various related extracellular ligands, P2 receptors are a clear example of increasing biological complexity. They are represented by 7 ionotropic P2X and 8 metabotropic P2Y receptors; they have very heterogeneous ligands and binding characteristics, molecular properties, transduction mechanisms, cellular localization and protein-protein interactions. While the reason for this sophistication is unknown, a few compelling issues emerge while looking at such a rich variety. We ask, for instance, why so many different receptor subtypes are necessary for triggering biological properties and functions, and if these receptors are more than the sum of their single entities. A first possibility is that newly synthesized P2 proteins are casually located on the cell surface (stochastic hypothesis). Alternatively, distinct subunits are engaged on different cell phenotypes by genetic control (genetic determinism) and/or selective recruitment under physiopathological conditions and epigenetic stimuli (epigenetic determinism). Nevertheless, an appropriate way to both dissect the vast biological scenario and molecular complexity among P2 receptors and to integrate and upgrade their assortment is to regard them as a "combinatorial receptor web", that is, a dynamic architecture of P2 proteins demonstrating economic efficiency and involving a process of "fine-tuning", a mechanism which endorses the dynamic nature of all biological reactions. In the present analysis, we stimulate a scientific query about what contributes to such a vast P2 receptor sophistication.

  17. Biochemical properties of a P2Y-purinergic receptor.


    Harden, T K; Boyer, J L; Brown, H A; Cooper, C L; Jeffs, R A; Martin, M W


    The turkey erythrocyte has substantial value as a model for the study of a receptor that exhibits pharmacological properties very similar to those delineated in mammalian tissues for a P2Y-purinergic receptor. The G protein-dependent coupling of this receptor to phospholipase C can be studied in detail, and the availability of an abundant source of homogeneous cells from which highly purified plasma membranes can be prepared, has led to the development of a radiolabeled, reversibly binding radioligand for a P2Y-purinergic receptor and a photoaffinity covalent radiolabel for this receptor. This source of plasma membranes highly enriched in P2Y-purinergic receptors should also serve as a rich starting material for the eventual purification and structural characterization of this important signaling protein.

  18. Signal transmission within the P2X2 trimeric receptor

    PubMed Central

    Kubo, Yoshihiro


    P2X2 receptor channel, a homotrimer activated by the binding of extracellular adenosine triphosphate (ATP) to three intersubunit ATP-binding sites (each located ∼50 Å from the ion permeation pore), also shows voltage-dependent activation upon hyperpolarization. Here, we used tandem trimeric constructs (TTCs) harboring critical mutations at the ATP-binding, linker, and pore regions to investigate how the ATP activation signal is transmitted within the trimer and how signals generated by ATP and hyperpolarization converge. Analysis of voltage- and [ATP]-dependent gating in these TTCs showed that: (a) Voltage- and [ATP]-dependent gating of P2X2 requires binding of at least two ATP molecules. (b) D315A mutation in the β-14 strand of the linker region connecting the ATP-binding domains to the pore-forming helices induces two different gating modes; this requires the presence of the D315A mutation in at least two subunits. (c) The T339S mutation in the pore domains of all three subunits abolishes the voltage dependence of P2X2 gating in saturating [ATP], making P2X2 equally active at all membrane potentials. Increasing the number of T339S mutations in the TTC results in gradual changes in the voltage dependence of gating from that of the wild-type channel, suggesting equal and independent contributions of the subunits at the pore level. (d) Voltage- and [ATP]-dependent gating in TTCs differs depending on the location of one D315A relative to one K308A that blocks the ATP binding and downstream signal transmission. (e) Voltage- and [ATP]-dependent gating does not depend on where one T339S is located relative to K308A (or D315A). Our results suggest that each intersubunit ATP-binding signal is directly transmitted on the same subunit to the level of D315 via the domain that contributes K308 to the β-14 strand. The signal subsequently spreads equally to all three subunits at the level of the pore, resulting in symmetric and independent contributions of the three

  19. FoxP2 in songbirds.


    Wohlgemuth, Sandra; Adam, Iris; Scharff, Constance


    Humans with mutations in the transcription factor FOXP2 display a severe speech disorder. Songbirds are a powerful model system to study FoxP2. Like humans, songbirds communicate via vocalizations that are imitatively learned during critical periods and this learning is influenced by social factors and relies on functionally lateralized neural circuits. During the past five years significant progress has been made moving from a descriptive to a more mechanistic understanding of how FoxP2 functions in songbirds. Current evidence from molecular and electrophysiological studies indicates that FoxP2 is important for shaping synaptic plasticity of specific neuron populations. One future goal will be to identify the transcriptional regulation orchestrated by FoxP2 and its associated molecular network that brings about these physiological effects. This will be key to further unravel how FoxP2 influences synaptic function and thereby contributes to auditory guided vocal motor behavior in the songbird model.

  20. Identification of a cell-bound extracellular protease overproduced by Sulfolobus solfataricus in peptide-rich media.


    Cannio, Raffaele; Catara, Giuliana; Fiume, Imma; Balestrieri, Marco; Rossi, Mosè; Palmieri, Gianna


    A new protease, named SsMTP was identified from the archeon Sulfolobus solfataricus. The enzyme is associated to the cell-membrane and over-produced in response to the peptide-enriched media. SsMTP has a molecular mass of 120 kDa showing optimal activity at pH 2.0 in the temperature range 70 - 90 degrees C, and a half-life of 20 days at 80 degrees C. Primary structure analysis revealed that SsMTP represents a novel type of multi-domain thermopsin-like protease containing the catalytic domain followed by two distinct domains, PKD and Y_Y_Y, which are usually involved in a range of protein-protein interactions among the extracellular proteins.

  1. P2X Receptors as Drug Targets

    PubMed Central

    Jarvis, Michael F.


    The study of P2X receptors has long been handicapped by a poverty of small-molecule tools that serve as selective agonists and antagonists. There has been progress, particularly in the past 10 years, as cell-based high-throughput screening methods were applied, together with large chemical libraries. This has delivered some drug-like molecules in several chemical classes that selectively target P2X1, P2X3, or P2X7 receptors. Some of these are, or have been, in clinical trials for rheumatoid arthritis, pain, and cough. Current preclinical research programs are studying P2X receptor involvement in pain, inflammation, osteoporosis, multiple sclerosis, spinal cord injury, and bladder dysfunction. The determination of the atomic structure of P2X receptors in closed and open (ATP-bound) states by X-ray crystallography is now allowing new approaches by molecular modeling. This is supported by a large body of previous work using mutagenesis and functional expression, and is now being supplemented by molecular dynamic simulations and in silico ligand docking. These approaches should lead to P2X receptors soon taking their place alongside other ion channel proteins as therapeutically important drug targets. PMID:23253448

  2. P2 performance measurement tools workbook: Draft

    SciTech Connect


    The underlying purpose of the Department of Energy`s (DOE) Waste Minimization and Pollution Prevention (WMin/P2) Program is compliance with the waste management regulations set forth by the DOE, the federal government, and individual state and local agencies 1. In addition to these regulatory mandates, the increases in waste management costs and public interest in environmental issues have created other drivers to develop and demonstrate an effective WMin/P2 Program. The Waste Minimization Division (EM-334) must have adequate methods to calculate and roll up pollution prevention (P2) progress to meet the WMin/P2 requirements; these requirements support DOE and national objectives and direct funding. This document outlines a system to evaluate DOE`s P2 progress towards the waste reduction requirements. The emphasis of these pollution prevention measurements is to evaluate whether P2 activities are effective, (i.e., has the required amount of waste been reduced as a result of the P2 activities) and to evaluate the cost management of P2 projects. The performance evaluation system presented in this document encompass these aspects: (1) site requirements that apply to all DOE waste generating organizations, (2) a baseline that is not affected by short-term waste generation, and (3) key indicators that can be rolled up across DOE sites and across specific Cognizant Secretarial Officers` (CSO) sites. In a performance-based management system, requirements are the fundamental link between the planning and measurement process. The site requirements are {open_quotes}targets{close_quotes} at the process or activity level. Measuring DOE`s P2 progress toward these requirements provides the necessary feedback to (1) compare performance with the requirements/standards (i.e., whether the reduction requirement of 50% by 1999 is achievable) (2) detect departures from planned levels of performance, and (3) restore performance to the planned levels or achieve new levels of performance.

  3. Lack of nucleotide-promoted second messenger signaling responses in 1321N1 cells expressing the proposed P2Y receptor, p2y7.


    Herold, C L; Li, Q; Schachter, J B; Harden, T K; Nicholas, R A


    A recently cloned G protein-coupled receptor (named the p2y7 receptor) with relatively low sequence identity to previously cloned P2Y receptors was proposed to be a member of this family of receptors on the basis of both a radioligand binding assay with [35S]dATP alphaS and an inositol phosphate response to ATP in COS-7 cells transiently transfected with receptor cDNA. Previous work in our laboratory has shown that [35S]dATP alphaS is not a general radioligand for the identification of P2Y receptors and that COS-7 cells express an endogenous P2Y receptor (P2Y2) that complicates the analysis of nucleotide-promoted inositol phosphate responses. Thus, data supporting inclusion of the p2y7 receptor in the P2Y family of receptors are equivocal. To determine unambiguously whether the p2y7 receptor is a P2Y receptor subtype, a p2y7 receptor bearing an epitope-tag at its NH2-terminus was expressed in 1321N1 cells and cell surface expression of the receptor was demonstrated by an intact cell-based ELISA. Cells shown to express epitope-tagged p2y7 receptors by ELISA were examined for their second messenger signaling properties in response to a range of nucleotides. ATP, UTP, ADP, UDP, and dATP alphaS had no effect on phospholipase C or adenylyl cyclase activities in cells expressing the p2y7 receptor. Experimental controls utilizing expression of other G protein-coupled receptors showed that 1321N1 cells displayed robust responses for each of these signaling pathways. These data, together with the low sequence identity of the p2y7 receptor to other P2Y receptors, indicate that the p2y7 is not a member of the P2Y family of signaling molecules.


    PubMed Central

    Van Rhee, A. Michiel; Fischer, Bilha; Van Galen, Philip J. M.; Jacobson, Kenneth A.


    The P2Y1 purinoceptor cloned from chick brain (Webb, T. et al. (1993) FEBS Lett., 324, 219–225) is a 362 amino acid, 41 kDa protein. To locate residues tentatively involved in ligand recognition a molecular model of the P2Y purinoceptor has been constructed. The model was based on the primary sequence and structural homology with the G-protein coupled photoreceptor rhodopsin, in analogy to the method proposed by Ballesteros and Weinstein ((1995) Meth. Neurosci. 25, 366–428). Transmembrane helices were constructed from the amino acid sequence, minimized individually, and positioned in a helical bundle. The helical bundle was then minimized using the Amber forcefield in Discover (BIOSYM Technologies) to obtain the final model. Several residues that have been shown to be critical in ligand binding in other GPCRs are conserved in the P2Y1 purinoceptor. According to our model the side chains of these conserved residues are facing the internal cleft in which ligand binding likely occurs. The model also suggests four basic residues (H121 in TM3, H266 and K269 in TM6 and R299 in TM7) near the extracellular surface that might be involved in ligand binding. These basic residues might be essential in coordinating the triphosphate chain of the endogenous ligand adenosine 5′-triphosphate (ATP). Potential binding sites for agonists have been explored by docking several derivatives (including newly synthesized N6-derivatives) into the model. The N6-phenylethyl substituent is tolerated pharmacologically, and in our model this substituent occupies a region predominantly defined by aromatic residues such as F51 (TM1), Y100 (TM2) and F120 (TM3). The dimethylated analogue of ATP, N6,N6-dimethyl-adenosine 5′-triphosphate, is less well tolerated pharmacologically, and our model predicts that the attenuated activity is due to interference with hydrogen bonding capacity to Q296 (TM7). PMID:8872457

  5. P2Y6 and vascular inflammation.


    Blackburn, Michael R


    In this issue of Blood, Riegel and colleagues demonstrate that inflammatory stimuli induce the expression of the P2Y6 receptor on the vascular endothelium where it serves to enhance systemic inflammatory responses.

  6. P2Y receptors and kidney function

    PubMed Central

    Stockand, James; Rieg, Timo


    Cellular release of nucleotides is of physiological importance to regulate and maintain cell function and integrity. Also in the tubular and collecting duct system of the kidney, nucleotides are released in response to changes in cell volume or luminal flow rate and act in a paracrine and autocrine way on basolateral and luminal P2Y receptors. Recent studies using gene knockout mice assigned a prominent role to G protein-coupled P2Y2 receptors, which are activated by both ATP and UTP. The antidiuretic hormone, arginine-vasopressin (AVP), and possibly an increase in collecting duct cell volume induce ATP release. The subsequent activation of P2Y2 receptors inhibits AVP-induced cAMP formation and water reabsorption, which stabilizes cell volume and facilitates water excretion. An increase in NaCl intake enhances luminal release of ATP and UTP in the aldosterone-sensitive distal nephron which by activating apical P2Y2 receptors and phospholipase C lowers the open probability of the epithelial sodium channel ENaC, thereby facilitating sodium excretion. Thus, the renal ATP/UTP/P2Y2 receptor system not only serves to preserve cell volume and integrity but is also regulated by stimuli that derive from body NaCl homeostasis. The system also inhibits ENaC activity during aldosterone escape, i.e. when sodium reabsorption via ENaC is inappropriately high. The P2Y2 receptor tone inhibits the expression and activity of the Na-K-2Cl cotransporter NKCC2 in the thick ascending limb and mediates vasodilation. While the role of other P2Y receptors in the kidney is less clear, the ATP/UTP/P2Y2 receptor system regulates NaCl and water homeostasis and blood pressure. PMID:23145369

  7. Reduced Expression of P2Y2 Receptor and Acetylcholinesterase at Neuromuscular Junction of P2Y1 Receptor Knock-out Mice.


    Xu, Miranda L; Bi, Cathy W C; Cheng, Lily K W; Mak, Shinghung; Yao, Ping; Luk, Wilson K W; Lau, Kitty K M; Cheng, Anthony W M; Tsim, Karl W K


    ATP is co-stored and co-released with acetylcholine (ACh) at the pre-synaptic vesicles in vertebrate neuromuscular junction (nmj). Several lines of studies demonstrated that binding of ATP to its corresponding P2Y1 and P2Y2 receptors in the muscle regulated post-synaptic gene expressions. To further support the notion that P2Y receptors are playing indispensable role in formation of post-synaptic specifications at the nmj, the knock-out mice of P2Y1 receptor (P2Y1R (-/-)) were employed here for analyses. In P2Y1R (-/-) mice, the expression of P2Y2 receptor in muscle was reduced by over 50 %, as compared to P2Y1R (+/+) mice. In parallel, the expression of acetylcholinesterase (AChE) in muscle was markedly decreased. In the analysis of the expression of anchoring subunits of AChE in P2Y1R (-/-) mice, the proline-rich membrane anchor (PRiMA) subunit was reduced by 60 %; while the collagen tail (ColQ) subunit was reduced by 50 %. AChE molecular forms in the muscle were not changed, except the amount of enzyme was reduced. Immuno-staining of P2Y1R (-/-) mice nmj, both AChE and AChR were still co-localized at the nmj, and the staining was diminished. Taken together our data demonstrated that P2Y1 receptor regulated the nmj gene expression.

  8. P2X and P2Y receptor signaling in red blood cells.


    Sluyter, Ronald


    Purinergic signaling involves the activation of cell surface P1 and P2 receptors by extracellular nucleosides and nucleotides such as adenosine and adenosine triphosphate (ATP), respectively. P2 receptors comprise P2X and P2Y receptors, and have well-established roles in leukocyte and platelet biology. Emerging evidence indicates important roles for these receptors in red blood cells. P2 receptor activation stimulates a number of signaling pathways in progenitor red blood cells resulting in microparticle release, reactive oxygen species formation, and apoptosis. Likewise, activation of P2 receptors in mature red blood cells stimulates signaling pathways mediating volume regulation, eicosanoid release, phosphatidylserine exposure, hemolysis, impaired ATP release, and susceptibility or resistance to infection. This review summarizes the distribution of P2 receptors in red blood cells, and outlines the functions of P2 receptor signaling in these cells and its implications in red blood cell biology.

  9. Purinoceptors: are there families of P2X and P2Y purinoceptors?


    Abbracchio, M P; Burnstock, G


    There has been an exponential growth in interest in purinoceptors since the potent effects of purines were first reported in 1929 and purinoceptors defined in 1978. A distinction between P1 (adenosine) and P2 (ATP/ADP) purinoceptors was recognized at that time and later, A1 and A2, as well as P2x and P2y subclasses of P1 and P2 purinoceptors were also defined. However, in recent years, many new subclasses have been claimed, particularly for the receptors to nucleotides, including P2t, P2z, P2u(n) and P2D, and there is some confusion now about how to incorporate additional discoveries concerning the responses of different tissues to purines. The studies beginning to appear defining the molecular structure of P2-purinoceptor subtypes are clearly going to be important in resolving this problem, as well as the introduction of new compounds that can discriminate pharmacologically between subtypes. Thus, in this review, on the basis of this new data and after a detailed analysis of the literature, we propose that: (1) P2X(ligand-gated) and P2Y(G-protein-coupled) purinoceptor families are established; (2) four subclasses of P2X-purinoceptor can be identified (P2X1-P2X4) to date; (3) the variously named P2-purinoceptors that are G-protein-coupled should be incorporated into numbered subclasses of the P2Y family. Thus: P2Y1 represents the recently cloned P2Y receptor (clone 803) from chick brain; P2Y2 represents the recently cloned P2u (or P2n) receptor from neuroblastoma, human epithelial and rat heart cells; P2Y3 represents the recently cloned P2Y receptor (clone 103) from chick brain that resembles the former P2t receptor; P2Y4-P2Y6 represent subclasses based on agonist potencies of newly synthesised analogues; P2Y7 represents the former P2D receptor for dinucleotides. This new framework for P2 purinoceptors would be fully consistent with what is emerging for the receptors to other major transmitters, such as acetylcholine, gamma-aminobutyric acid, glutamate and

  10. Nanomolar ambient ATP decelerates P2X3 receptor kinetics.


    Grote, Alexander; Hans, Michael; Boldogkoi, Zsolt; Zimmer, Andreas; Steinhäuser, Christian; Jabs, Ronald


    Homomeric P2X receptors differ in their electrophysiological and pharmacological profiles. The rapidly activating and desensitizing P2X3 receptors are known for their involvement in pain signalling pathways. Modulatory effects on P2X3 receptors have been reported for low concentrations of ATP ([ATP]). This includes both, enhancement and reduction of receptor currents. The first has been reported to be mediated by activation of ectoprotein kinases and high affinity desensitization (HAD), respectively. Both processes influence receptor current amplitudes. Here we describe a new phenomenon, the modulatory influence of ambient low [ATP] on P2X3 receptor kinetics. First, we studied in HEK cells whether persistent ATP affects current decay. To this end, P2X3 receptor mediated currents, elicited by pressure application of saturating [ATP], were analyzed after pre-application of low [ATP]. Second, UV-flash photolysis of ATP was employed to investigate whether submicromolar [ATP] affects receptor activation. Finally we confirmed the action of nanomolar [ATP] on native P2X3 receptors of neurons freshly isolated from rat dorsal root ganglia. We found that persistent low [ATP] caused pronounced deceleration of receptor current activation and decay. This priming effect indicates a mechanism different from HAD. It could be explained by a pre-opening receptor isomerization, induced by the occupation of a high affinity binding site already at the resting state. The observed modulation of the receptor kinetics could be considered as a physiological fine tuning mechanism of the nociceptive system, driven by the actual ambient agonist concentration.

  11. Functionalized Congeners of P2Y1 Receptor Antagonists:

    SciTech Connect

    de Castro, Sonia; Maruoka, Hiroshi; Hong, Kunlun; Kilbey, II, S Michael; Costanzi, Stefano; Hechler, Béatrice; Gachet, Christian; Harden, T. Kendall; Jacobson, Kenneth A.


    The P2Y{sub 1} receptor is a prothrombotic G protein-coupled receptor (GPCR) activated by ADP. Preference for the North (N) ring conformation of the ribose moiety of adenine nucleotide 3',5'-bisphosphate antagonists of the P2Y{sub 1} receptor was established by using a ring-constrained methanocarba (a bicyclo[3.1.0]hexane) ring as a ribose substitute. A series of covalently linkable N{sup 6}-methyl-(N)-methanocarba-2'-deoxyadenosine-3',5'-bisphosphates containing extended 2-alkynyl chains was designed, and binding affinity at the human (h) P2Y{sub 1} receptor determined. The chain of these functionalized congeners contained hydrophilic moieties, a reactive substituent, or biotin, linked via an amide. Variation of the chain length and position of an intermediate amide group revealed high affinity of carboxylic congener 8 (K{sub i} 23 nM) and extended amine congener 15 (K{sub i} 132 nM), both having a 2-(1-pentynoyl) group. A biotin conjugate 18 containing an extended {epsilon}-aminocaproyl spacer chain exhibited higher affinity than a shorter biotinylated analogue. Alternatively, click coupling of terminal alkynes of homologous 2-dialkynyl nucleotide derivatives to alkyl azido groups produced triazole derivatives that bound to the P2Y{sub 1} receptor following deprotection of the bisphosphate groups. The preservation of receptor affinity of the functionalized congeners was consistent with new P2Y{sub 1} receptor modeling and ligand docking. Attempted P2Y{sub 1} antagonist conjugation to PAMAM dendrimer carriers by amide formation or palladium-catalyzed reaction between an alkyne on the dendrimer and a 2-iodopurine-derivatized nucleotide was unsuccessful. A dialkynyl intermediate containing the chain length favored in receptor binding was conjugated to an azide-derivatized dendrimer, and the conjugate inhibited ADP-promoted human platelet aggregation. This is the first example of attaching a strategically functionalized P2Y receptor antagonist to a PAMAM dendrimer to

  12. Anonymity in P2P Systems

    NASA Astrophysics Data System (ADS)

    Manzanares-Lopez, Pilar; Muñoz-Gea, Juan Pedro; Malgosa-Sanahuja, Josemaria; Sanchez-Aarnoutse, Juan Carlos

    In the last years, the use of peer-to-peer (P2P) applications to share and exchange knowledge among people around the world has experienced an exponential growth. Therefore, it is understandable that, like in any successful communication mechanism used by a lot of humans being, the anonymity can be a desirable characteristic in this scenario. Anonymity in P2P networks can be obtained by means of different methods, although the most significant ones are broadcast protocols, dining-cryptographer (DC) nets and multiple-hop paths. Each of these methods can be tunable in order to build a real anonymity P2P application. In addition, there is a mathematical tool called entropy that can be used in some scenarios to quantify anonymity in communication networks. In some cases, it can be calculated analytically but in others it is necessary to use simulation to obtain the network entropy.

  13. High Potency Zinc Modulation of Human P2X2 Receptors and Low Potency Zinc Modulation of Rat P2X2 Receptors Share a Common Molecular Mechanism*

    PubMed Central

    Punthambaker, Sukanya; Blum, Jacob A.; Hume, Richard I.


    Human P2X2 receptors (hP2X2) are strongly inhibited by zinc over the range of 2–100 μm, whereas rat P2X2 receptors (rP2X2) are strongly potentiated over the same range, and then inhibited by zinc over 100 μm. However, the biological role of zinc modulation is unknown in either species. To identify candidate regions controlling zinc inhibition in hP2X2 a homology model based on the crystal structure of zebrafish P2X4.1 was made. In this model, His-204 and His-209 of one subunit were near His-330 of the adjacent subunit. Cross-linking studies confirmed that these residues are within 8 Å of each other. Simultaneous mutation of these three histidines to alanines decreased the zinc potency of hP2X2 nearly 100-fold. In rP2X2, one of these histidines is replaced by a lysine, and in a background in which zinc potentiation was eliminated, mutation of Lys-197 to histidine converted rP2X2 from low potency to high potency inhibition. We explored whether the zinc-binding site lies within the vestibules running down the central axis of the receptor. Elimination of all negatively charged residues from the upper vestibule had no effect on zinc inhibition. In contrast, mutation of several residues in the hP2X2 middle vestibule resulted in dramatic changes in the potency of zinc inhibition. In particular, the zinc potency of P206C could be reversibly shifted from extremely high (∼10 nm) to very low (>100 μm) by binding and unbinding MTSET. These results suggest that the cluster of histidines at the subunit interface controls access of zinc to its binding site. PMID:22556417

  14. Methanocarba Modification of Uracil and Adenine Nucleotides: High Potency of Northern Ring Conformation at P2Y1, P2Y2, P2Y4, and P2Y11 but Not P2Y6 Receptors

    PubMed Central

    Kim, Hak Sung; Ravi, R. Gnana; Marquez, Victor E.; Maddileti, Savitri; Wihlborg, Anna-Karin; Erlinge, David; Malmsjö, Malin; Boyer, José L.; Harden, T. Kendall; Jacobson, Kenneth A.


    The potency of nucleotide antagonists at P2Y1 receptors was enhanced by replacing the ribose moiety with a constrained carbocyclic ring (Nandanan, et al. J. Med. Chem. 2000, 43, 829—842). We have now synthesized ring-constrained methanocarba analogues (in which a fused cyclopropane moiety constrains the pseudosugar ring) of adenine and uracil nucleotides, the endogenous activators of P2Y receptors. Methanocarba-adenosine 5′-triphosphate (ATP) was fixed in either a Northern (N) or a Southern (S) conformation, as defined in the pseudorotational cycle. (N)-Methanocarba-uridine was prepared from the 1-amino-pseudosugar ring by treatment with β-ethoxyacryloyl cyanate and cyclization to form the uracil ring. Phosphorylation was carried out at the 5′-hydroxyl group through a multistep process: Reaction with phosphoramidite followed by oxidation provided the 5′-monophosphates, which then were treated with 1,1′-carbonyldiimidazole for condensation with additional phosphate groups. The ability of the analogues to stimulate phospholipase C through activation of turkey P2Y1 or human P2Y1, P2Y2, P2Y4, P2Y6, and P2Y11 receptors stably expressed in astrocytoma cells was measured. At recombinant human P2Y1 and P2Y2 receptors, (N)-methanocarba-ATP was 138- and 41-fold, respectively, more potent than racemic (S)-methanocarba-ATP as an agonist. (N)-methanocarba-ATP activated P2Y11 receptors with a potency similar to ATP. (N)-Methanocarba-uridine 5′-triphosphate (UTP) was equipotent to UTP as an agonist at human P2Y2 receptors and also activated P2Y4 receptors with an EC50 of 85 nM. (N)-Methanocarba-uridine 5′-diphosphate (UDP) was inactive at the hP2Y6 receptor. The vascular effects of (N)-methanocarba-UTP and (N)-methanocarba-UDP were studied in a model of the rat mesenteric artery. The triphosphate was more potent than UTP in inducing a dilatory P2Y4 response (pEC50 = 6.1 ± 0.2), while the diphosphate was inactive as either an agonist or antagonist in a P2Y6

  15. Data Sharing in P2P Systems

    NASA Astrophysics Data System (ADS)

    Hayek, Rabab; Raschia, Guillaume; Valduriez, Patrick; Mouaddib, Noureddine

    In this chapter, we survey P2P data sharing systems. All along, we focus on the evolution from simple file-sharing systems, with limited functionalities, to Peer Data Management Systems (PDMS) that support advanced applications with more sophisticated data management techniques. Advanced P2P applications are dealing with semantically rich data (e.g., XML documents, relational tables), using a high-level SQL-like query language. We start our survey with an overview over the existing P2P network architectures, and the associated routing protocols. Then, we discuss data indexing techniques based on their distribution degree and the semantics they can capture from the underlying data. We also discuss schema management techniques which allow integrating heterogeneous data. We conclude by discussing the techniques proposed for processing complex queries (e.g., range and join queries). Complex query facilities are necessary for advanced applications which require a high level of search expressiveness. This last part shows the lack of querying techniques that allow for an approximate query answering.

  16. A novel thermostable protein-tag: optimization of the Sulfolobus solfataricus DNA- alkyl-transferase by protein engineering.


    Vettone, Antonella; Serpe, Mario; Hidalgo, Aurelio; Berenguer, José; del Monaco, Giovanni; Valenti, Anna; Rossi, Mosé; Ciaramella, Maria; Perugino, Giuseppe


    In the last decade, a powerful biotechnological tool for the in vivo and in vitro specific labeling of proteins (SNAP-tag™ technology) was proposed as a valid alternative to classical protein-tags (green fluorescent proteins, GFPs). This was made possible by the discovery of the irreversible reaction of the human alkylguanine-DNA-alkyl-transferase (hAGT) in the presence of benzyl-guanine derivatives. However, the mild reaction conditions and the general instability of the mesophilic SNAP-tag™ make this new approach not fully applicable to (hyper-)thermophilic and, in general, extremophilic organisms. Here, we introduce an engineered variant of the thermostable alkylguanine-DNA-alkyl-transferase from the Archaea Sulfolobus solfataricus (SsOGT-H5), which displays a catalytic efficiency comparable to the SNAP-tag™ protein, but showing high intrinsic stability typical of proteins from this organism. The successful heterologous expression obtained in a thermophilic model organism makes SsOGT-H5 a valid candidate as protein-tag for organisms living in extreme environments.

  17. A Highly Selective Oligopeptide Binding Protein from the Archaeon Sulfolobus Solfataricus▿ †

    PubMed Central

    Gogliettino, M.; Balestrieri, M.; Pocsfalvi, G.; Fiume, I.; Natale, L.; Rossi, M.; Palmieri, G.


    SSO1273 of Sulfolobus solfataricus was identified as a cell surface-bound protein by a proteomics approach. Sequence inspection of the genome revealed that the open reading frame of sso1273 is associated in an operon-like structure with genes encoding all the remaining components of a canonical protein-dependent ATP-binding cassette (ABC) transporter. sso1273 gene expression and SSO1273 protein accumulation on the cell surface were demonstrated to be strongly induced by the addition of a peptide mixture (tryptone) to the culture medium. The native protein was obtained in multimeric form, mostly hexameric, under the purification conditions used, and it was characterized as an oligopeptide binding protein, named S. solfataricus OppA (OppASs). OppaASs possesses typical sequence patterns required for glycosylphosphatidylinositol lipid anchoring, resulting in an N-linked glycoprotein with carbohydrate moieties likely composed of high mannose and/or hybrid complex carbohydrates. OppASs specifically binds oligopeptides and shows a marked selectivity for the amino acid composition of substrates when assayed in complex peptide mixtures. Moreover, a truncated version of OppASs, produced in recombinant form and including the putative binding domain, showed a low but significant oligopeptide binding activity. PMID:20382765

  18. Medicinal chemistry of adenosine, P2Y and P2X receptors.


    Jacobson, Kenneth A; Müller, Christa E


    Pharmacological tool compounds are now available to define action at the adenosine (ARs), P2Y and P2X receptors. We present a selection of the most commonly used agents to study purines in the nervous system. Some of these compounds, including A1 and A3 AR agonists, P2Y1R and P2Y12R antagonists, and P2X3, P2X4 and P2X7 antagonists, are potentially of clinical use in treatment of disorders of the nervous system, such as chronic pain, neurodegeneration and brain injury. Agonists of the A2AAR and P2Y2R are already used clinically, P2Y12R antagonists are widely used antithrombotics and an antagonist of the A2AAR is approved in Japan for treating Parkinson's disease. The selectivity defined for some of the previously introduced compounds has been revised with updated pharmacological characterization, for example, various AR agonists and antagonists were deemed A1AR or A3AR selective based on human data, but species differences indicated a reduction in selectivity ratios in other species. Also, many of the P2R ligands still lack bioavailability due to charged groups or hydrolytic (either enzymatic or chemical) instability. X-ray crystallographic structures of AR and P2YRs have shifted the mode of ligand discovery to structure-based approaches rather than previous empirical approaches. The X-ray structures can be utilized either for in silico screening of chemically diverse libraries for the discovery of novel ligands or for enhancement of the properties of known ligands by chemical modification. Although X-ray structures of the zebrafish P2X4R have been reported, there is scant structural information about ligand recognition in these trimeric ion channels. In summary, there are definitive, selective agonists and antagonists for all of the ARs and some of the P2YRs; while the pharmacochemistry of P2XRs is still in nascent stages. The therapeutic potential of selectively modulating these receptors is continuing to gain interest in such fields as cancer, inflammation, pain

  19. A fluorescent approach for identifying P2X1 ligands

    PubMed Central

    Ruepp, Marc-David; Brozik, James A.; de Esch, Iwan J.P.; Farndale, Richard W.; Murrell-Lagnado, Ruth D.; Thompson, Andrew J.


    There are no commercially available, small, receptor-specific P2X1 ligands. There are several synthetic derivatives of the natural agonist ATP and some structurally-complex antagonists including compounds such as PPADS, NTP-ATP, suramin and its derivatives (e.g. NF279, NF449). NF449 is the most potent and selective ligand, but potencies of many others are not particularly high and they can also act at other P2X, P2Y and non-purinergic receptors. While there is clearly scope for further work on P2X1 receptor pharmacology, screening can be difficult owing to rapid receptor desensitisation. To reduce desensitisation substitutions can be made within the N-terminus of the P2X1 receptor, but these could also affect ligand properties. An alternative is the use of fluorescent voltage-sensitive dyes that respond to membrane potential changes resulting from channel opening. Here we utilised this approach in conjunction with fragment-based drug-discovery. Using a single concentration (300 μM) we identified 46 novel leads from a library of 1443 fragments (hit rate = 3.2%). These hits were independently validated by measuring concentration-dependence with the same voltage-sensitive dye, and by visualising the competition of hits with an Alexa-647-ATP fluorophore using confocal microscopy; confocal yielded kon (1.142 × 106 M−1 s−1) and koff (0.136 s−1) for Alexa-647-ATP (Kd = 119 nM). The identified hit fragments had promising structural diversity. In summary, the measurement of functional responses using voltage-sensitive dyes was flexible and cost-effective because labelled competitors were not needed, effects were independent of a specific binding site, and both agonist and antagonist actions were probed in a single assay. The method is widely applicable and could be applied to all P2X family members, as well as other voltage-gated and ligand-gated ion channels. This article is part of the Special Issue entitled ‘Fluorescent Tools in Neuropharmacology

  20. A fluorescent approach for identifying P2X1 ligands.


    Ruepp, Marc-David; Brozik, James A; de Esch, Iwan J P; Farndale, Richard W; Murrell-Lagnado, Ruth D; Thompson, Andrew J


    There are no commercially available, small, receptor-specific P2X1 ligands. There are several synthetic derivatives of the natural agonist ATP and some structurally-complex antagonists including compounds such as PPADS, NTP-ATP, suramin and its derivatives (e.g. NF279, NF449). NF449 is the most potent and selective ligand, but potencies of many others are not particularly high and they can also act at other P2X, P2Y and non-purinergic receptors. While there is clearly scope for further work on P2X1 receptor pharmacology, screening can be difficult owing to rapid receptor desensitisation. To reduce desensitisation substitutions can be made within the N-terminus of the P2X1 receptor, but these could also affect ligand properties. An alternative is the use of fluorescent voltage-sensitive dyes that respond to membrane potential changes resulting from channel opening. Here we utilised this approach in conjunction with fragment-based drug-discovery. Using a single concentration (300 μM) we identified 46 novel leads from a library of 1443 fragments (hit rate = 3.2%). These hits were independently validated by measuring concentration-dependence with the same voltage-sensitive dye, and by visualising the competition of hits with an Alexa-647-ATP fluorophore using confocal microscopy; confocal yielded kon (1.142 × 10(6) M(-1) s(-1)) and koff (0.136 s(-1)) for Alexa-647-ATP (Kd = 119 nM). The identified hit fragments had promising structural diversity. In summary, the measurement of functional responses using voltage-sensitive dyes was flexible and cost-effective because labelled competitors were not needed, effects were independent of a specific binding site, and both agonist and antagonist actions were probed in a single assay. The method is widely applicable and could be applied to all P2X family members, as well as other voltage-gated and ligand-gated ion channels. This article is part of the Special Issue entitled 'Fluorescent Tools in Neuropharmacology'. Copyright

  1. Replication Bypass of the trans-4-Hydroxynonenal-Derived (6S,8R,11S)-1,N2-Deoxyguanosine DNA Adduct by the Sulfolobus solfataricus DNA Polymerase IV

    PubMed Central


    trans-4-Hydroxynonenal (HNE) is the major peroxidation product of ω-6 polyunsaturated fatty acids in vivo. Michael addition of the N2-amino group of dGuo to HNE followed by ring closure of N1 onto the aldehyde results in four diastereomeric 1,N2-dGuo (1,N2-HNE-dGuo) adducts. The (6S,8R,11S)-HNE-1,N2-dGuo adduct was incorporated into the 18-mer templates 5′-d(TCATXGAATCCTTCCCCC)-3′ and d(TCACXGAATCCTTCCCCC)-3′, where X = (6S,8R,11S)-HNE-1,N2-dGuo adduct. These differed in the identity of the template 5′-neighbor base, which was either Thy or Cyt, respectively. Each of these templates was annealed with either a 13-mer primer 5′-d(GGGGGAAGGATTC)-3′ or a 14-mer primer 5′-d(GGGGGAAGGATTCC)-3′. The addition of dNTPs to the 13-mer primer allowed analysis of dNTP insertion opposite to the (6S,8R,11S)-HNE-1,N2-dGuo adduct, whereas the 14-mer primer allowed analysis of dNTP extension past a primed (6S,8R,11S)-HNE-1,N2-dGuo:dCyd pair. The Sulfolobus solfataricus P2 DNA polymerase IV (Dpo4) belongs to the Y-family of error-prone polymerases. Replication bypass studies in vitro reveal that this polymerase inserted dNTPs opposite the (6S,8R,11S)-HNE-1,N2-dGuo adduct in a sequence-specific manner. If the template 5′-neighbor base was dCyt, the polymerase inserted primarily dGTP, whereas if the template 5′-neighbor base was dThy, the polymerase inserted primarily dATP. The latter event would predict low levels of Gua → Thy mutations during replication bypass when the template 5′-neighbor base is dThy. When presented with a primed (6S,8R,11S)-HNE-1,N2-dGuo:dCyd pair, the polymerase conducted full-length primer extension. Structures for ternary (Dpo4-DNA-dNTP) complexes with all four template-primers were obtained. For the 18-mer:13-mer template-primers in which the polymerase was confronted with the (6S,8R,11S)-HNE-1,N2-dGuo adduct, the (6S,8R,11S)-1,N2-dGuo lesion remained in the ring-closed conformation at the active site. The incoming dNTP, either d

  2. Functional properties of five Dictyostelium discoideum P2X receptors.


    Baines, Abigail; Parkinson, Katie; Sim, Joan A; Bragg, Laricia; Thompson, Christopher R L; North, R Alan


    The Dictyostelium discoideum genome encodes five proteins that share weak sequence similarity with vertebrate P2X receptors. Unlike vertebrate P2X receptors, these proteins are not expressed on the surface of cells, but populate the tubules and bladders of the contractile vacuole. In this study, we expressed humanized cDNAs of P2XA, P2XB, P2XC, P2XD, and P2XE in human embryonic kidney cells and altered the ionic and proton environment in an attempt to reflect the situation in amoeba. Recording of whole-cell membrane currents showed that four receptors operated as ATP-gated channels (P2XA, P2XB, P2XD, and P2XE). At P2XA receptors, ATP was the only effective agonist of 17 structurally related putative ligands that were tested. Extracellular sodium, compared with potassium, strongly inhibited ATP responses in P2XB, P2XD, and P2XE receptors. Increasing the proton concentration (pH 6.2) accelerated desensitization at P2XA receptors and decreased currents at P2XD receptors, but increased the currents at P2XB and P2XE receptors. Dictyostelium lacking P2XA receptors showed impaired regulatory volume decrease in hypotonic solution. This phenotype was readily rescued by overexpression of P2XA and P2XD receptors, partially rescued by P2XB and P2XE receptors, and not rescued by P2XC receptors. The failure of the nonfunctional receptor P2XC to restore the regulatory volume decrease highlights the importance of ATP activation of P2X receptors for a normal response to hypo-osmotic shock, and the weak rescue by P2XB and P2XE receptors indicates that there is limited functional redundancy among Dictyostelium P2X receptors.

  3. Eclogitic pyroxenes, ordered with P2 symmetry

    USGS Publications Warehouse

    Clark, J.R.; Papike, J.J.


    X-ray diffraction crystal-structure analysis of omphacite from eclogite, Tiburon Peninsula, Marin County, California, shows that this clinopyroxene has P2 symmetry with a nearly ordered distribution of the multiple cation content defined by its approximate formula: (Na0.5Ca0.5) (Mg 0.4Fe2+0.1Al0.4Fe3+0.1)Si2O6. Na+ and Ca2+ tend to assume alternate locations in the structure, and (Mg,Fe2+) octahedra alternate with Al3+ or (Al,F3+) octahedra in chains along c.

  4. Allosteric modulation of ATP-gated P2X receptor channels

    PubMed Central

    Coddou, Claudio; Stojilkovic, Stanko S.; Huidobro-Toro, J. Pablo


    Seven mammalian purinergic receptor subunits, denoted P2X1 to P2X7, and several spliced forms of these subunits have been cloned. When heterologously expressed, these cDNAs encode ATP-gated non-selective cation channels organized as trimers. All activated receptors produce cell depolarization and promote Ca2+ influx through their pores and indirectly by activating voltage-gated calcium channels. However, the biophysical and pharmacological properties of these receptors differ considerably, and the majority of these subunits are also capable of forming heterotrimers with other members of the P2X receptor family, which confers further different properties. These channels have three ATP binding domains, presumably located between neighboring subunits, and occupancy of at least two binding sites is needed for their activation. In addition to the orthosteric binding sites for ATP, these receptors have additional allosteric sites that modulate the agonist action at receptors, including sites for trace metals, protons, neurosteroids, reactive oxygen species and phosphoinositides. The allosteric regulation of P2X receptors is frequently receptor-specific and could be a useful tool to identify P2X members in native tissues and their roles in signaling. The focus of this review is on common and receptor-specific allosteric modulation of P2X receptors and the molecular base accounting for allosteric binding sites. PMID:21639805

  5. Conformer and pharmacophore based identification of peptidomimetic inhibitors of chikungunya virus nsP2 protease.


    Dhindwal, Sonali; Kesari, Pooja; Singh, Harvijay; Kumar, Pravindra; Tomar, Shailly


    Chikungunya virus nsP2 replication protein is a cysteine protease, which cleaves the nonstructural nsP1234 polyprotein into functional replication components. The cleavage and processing of nsP1234 by nsP2 protease is essential for the replication and proliferation of the virus. Thus, ChikV nsP2 protease is a promising target for antiviral drug discovery. In this study, the crystal structure of the C-terminal domain of ChikV nsP2 protease (PDB ID: 4ZTB) was used for structure based identification and rational designing of peptidomimetic inhibitors against nsP2 protease. The interactions of the junction residues of nsP3/4 polyprotein in the active site of nsP2 protease have been mimicked to identify and design potential inhibitory molecules. Molecular docking of the nsP3/4 junction peptide in the active site of ChikV nsP2 protease provided the structural insight of the probable binding mode of nsP3/4 peptide and pigeonholed the molecular interactions critical for the substrate binding. Further, the shape and pharmacophoric properties of the viral nsP3/4 substrate peptide were taken into consideration and the mimetic molecules were identified and designed. The designed mimetic compounds were then analyzed by docking and their binding affinity was assessed by molecular dynamics simulations.

  6. Autoradiography of P2x ATP receptors in the rat brain.

    PubMed Central

    Balcar, V. J.; Li, Y.; Killinger, S.; Bennett, M. R.


    1. Binding of a P2x receptor specific radioligand, [3H]-alpha,beta-methylene adenosine triphosphate ([3H]-alpha,beta-MeATP) to sections of rat brain was reversible and association/dissociation parameters indicated that it consisted of two saturable components. Non-specific binding was very low (< 7% at 10 nM ligand concentration). 2. The binding was completely inhibited by suramin (IC50 approximately 14-26 microM) but none of the ligands specific for P2y receptors such as 2-methylthio-adenosine triphosphate (2-methyl-S-ATP) and 2-chloro-adenosine triphosphate (2-C1-ATP) nor 2-methylthio-adenosine diphosphate (2-methyl-S-ADP) a ligand for the P2 receptor on blood platelets ('P2T' type) produced strong inhibitions except for P1,P4-di(adenosine-5')tetraphosphate (Ap4A). 3. Inhibitors of Na+,K(+)-dependent adenosine triphosphatase (ATPase) ouabain, P1-ligand adenosine and an inhibitor of transport of, respectively, adenosine and cyclic nucleotides, dilazep, had no effect. 4. The highest density of P2x binding sites was found to be in the cerebellar cortex but the binding sites were present in all major brain regions, especially in areas known to receive strong excitatory innervation. Images Figure 2 PMID:7670731

  7. P2X and P2Y nucleotide receptors as targets in cardiovascular disease.


    Kennedy, Charles; Chootip, Krongkarn; Mitchell, Callum; Syed, Nawazish-i-Husain; Tengah, Asrin


    Endogenous nucleotides have widespread actions in the cardiovascular system, but it is only recently that the P2X and P2Y receptor subtypes, at which they act, have been identified and subtype-selective agonists and antagonists developed. These advances have greatly increased our understanding of the physiological and pathophysiological functions of P2X and P2Y receptors, but investigation of the clinical usefulness of selective ligands is at an early stage. Nonetheless, the evidence considered in this review demonstrates clearly that various cardiovascular disorders, including vasospasm, hypertension, congestive heart failure and cardiac damage during ischemic episodes, may be viable targets. With further development of novel, selective agonists and antagonists, our understanding will continue to improve and further therapeutic applications are likely to be discovered.

  8. Structural and functional exchangeability of 5 S RNA species from the eubacterium E.coli and the thermoacidophilic archaebacterium Sulfolobus solfataricus.

    PubMed Central

    Teixidò, J; Altamura, S; Londei, P; Amils, R


    The role of 5 S RNA within the large ribosomal subunit of the extremely thermophilic archaebacterium Sulfolobus solfataricus has been analysed by means of in vitro reconstitution procedures. It is shown that Sulfolobus 50 S subunits reconstituted in the absence of 5 S RNA are inactive in protein synthesis and lack 2-3 ribosomal proteins. Furthermore, it has been determined that in the course of the in vitro assembly process Sulfolobus 5 S RNA can be replaced by the correspondent RNA species of E.coli; Sulfolobus reconstituted particles containing the eubacterial 5 S molecule are stable and active in polypeptide synthesis at high temperatures. Images PMID:2493632

  9. P2 Receptors in Renal Autoregulation

    PubMed Central

    Guan, Zhengrong; Fellner, Robert C.; Van Beusecum, Justin; Inscho, Edward W.


    Accomplishing autoregulation of renal blood flow and glomerular filtration rate is an essential function of the renal microcirculation. While the existence of this phenomenon has been known for many years, the exact mechanisms that underlie this unique regulatory capability remain poorly understood. The work of many investigators has provided insights into many aspects of the autoregulatory mechanism, but many critical components remain elusive. This review is intended to update the reader on the role of P2 purinoceptors as a postulated mechanism responsible for renal autoregulatory resistance adjustments. It will summarize recent advances in normal function and it will touch on more recent ideas regarding autoregulatory insufficiency in hypertension and inflammation. Current thoughts on the nature of the mechanosensor responsible for myogenic behavior will be discussed as well as current thoughts on the mechanisms involved in ATP release to the extracellular fluid space. PMID:24066935

  10. Molecular determinants of P2Y2 nucleotide receptor function: implications for proliferative and inflammatory pathways in astrocytes.


    Weisman, Gary A; Wang, M; Kong, Q; Chorna, N E; Neary, J T; Sun, Grace Y; González, Fernando A; Seye, C I; Erb, L


    In the mammalian nervous system, P2 nucleotide receptors mediate neurotransmission, release of proinflammatory cytokines, and reactive astrogliosis. Extracellular nucleotides activate multiple P2 receptors in neurons and glial cells, including G protein-coupled P2Y receptors and P2X receptors, which are ligand-gated ion channels. In glial cells, the P2Y2 receptor subtype, distinguished by its ability to be equipotently activated by ATP and UTP, is coupled to pro-inflammatory signaling pathways. In situ hybridization studies with rodent brain slices indicate that P2Y2 receptors are expressed primarily in the hippocampus and cerebellum. Astrocytes express several P2 receptor subtypes, including P2Y2 receptors whose activation stimulates cell proliferation and migration. P2Y2 receptors, via an RGD (Arg-Gly-Asp) motif in their first extracellular loop, bind to alphavbeta3/beta5 integrins, whereupon P2Y2 receptor activation stimulates integrin signaling pathways that regulate cytoskeletal reorganization and cell motility. The C-terminus of the P2Y2 receptor contains two Src-homology-3 (SH3)-binding domains that upon receptor activation, promote association with Src and transactivation of growth factor receptors. Together, our results indicate that P2Y2 receptors complex with both integrins and growth factor receptors to activate multiple signaling pathways. Thus, P2Y2 receptors present novel targets to control reactive astrogliosis in neurodegenerative diseases.

  11. The effect of anions on the human P2X7 receptor.


    Kubick, Christoph; Schmalzing, Günther; Markwardt, Fritz


    P2X7 receptors (P2X7Rs) are nonselective cation channels that are opened by the binding of extracellular ATP and are involved in the modulation of epithelial secretion, inflammation and nociception. Here, we investigated the effect of extracellular anions on channel gating and permeation of human P2X7Rs (hP2X7Rs) expressed in Xenopus laevis oocytes. Two-microelectrode voltage-clamp recordings showed that ATP-induced hP2X7R-mediated currents increased when extracellular chloride was substituted by the organic anions glutamate or aspartate and decreased when chloride was replaced by the inorganic anions nitrate, sulfate or iodide. ATP concentration-response comparisons revealed that substitution of chloride by glutamate decreased agonist efficacy, while substitution by iodide increased agonist efficacy at high ATP concentrations. Meanwhile, the ATP potency remained unchanged. Activation of the hP2X7R at low ATP concentrations via the high-affinity ATP effector site was not affected by the replacement of chloride by glutamate or iodide. To analyze the anion effect on the hP2X7R at the single-molecule level, we performed single-channel current measurements using the patch-clamp technique in the outside-out configuration. Chloride substitution did not affect the single-channel conductance, but the probability that the P2X7R channel was open increased when chloride was replaced by glutamate and decreased when chloride was replaced by iodide. This effect was due to an influence of the anions on the mean closed times of the hP2X7R channel. We conclude that hP2X7R channels are not anion-permeable in physiological Na+-based media and that external anions allosterically affect ion channel opening in the fully ATP4-liganded P2X7R through an extracellular anion binding site.

  12. Immobilization of carboxypeptidase from Sulfolobus solfataricus on magnetic nanoparticles improves enzyme stability and functionality in organic media

    PubMed Central


    Background Superparamagnetic iron oxide nanoparticles (MNP) offer several advantages for applications in biomedical and biotechnological research. In particular, MNP-based immobilization of enzymes allows high surface-to-volume ratio, good dispersibility, easy separation of enzymes from the reaction mixture, and reuse by applying an external magnetic field. In a biotechnological perspective, extremophilic enzymes hold great promise as they often can be used under non-conventional harsh conditions, which may result in substrate transformations that are not achievable with normal enzymes. This prompted us to investigate the effect of MNP bioconjugation on the catalytic properties of a thermostable carboxypeptidase from the hyperthermophilic archaeon Sulfolobus solfataricus (CPSso), which exhibits catalytic properties that are useful in synthetic processes. Results CPSso was immobilized onto silica-coated iron oxide nanoparticles via NiNTA-His tag site-directed conjugation. Following the immobilization, CPSso acquired distinctly higher long-term stability at room temperature compared to the free native enzyme, which, in contrast, underwent extensive inactivation after 72 h incubation, thus suggesting a potential utilization of this enzyme under low energy consumption. Moreover, CPSso conjugation also resulted in a significantly higher stability in organic solvents at 40°C, which made it possible to synthesize N-blocked amino acids in remarkably higher yields compared to those of free enzyme. Conclusions The nanobioconjugate of CPSso immobilized on silica-coated magnetic nanoparticles exhibited enhanced stability in aqueous media at room temperature as well as in different organic solvents. The improved stability in ethanol paves the way to possible applications of immobilized CPSso, in particular as a biocatalyst for the synthesis of N-blocked amino acids. Another potential application might be amino acid racemate resolution, a critical and expensive step in


    SciTech Connect

    Patterson, S.M.; Hatherill, J.R.; Hammel, M.; Hura, G.L.; Tainer, J.A.; Yannone, S.M.


    Vital molecular processes such as DNA replication, transcription, translation, and maintenance occur through transient protein interactions. Elucidating the mechanisms by which these protein complexes and interactions function could lead to treatments for diseases related to DNA damage and cell division control. In the recent decades since its introduction as a third domain, Archaea have shown to be simpler models for complicated eukaryotic processes such as DNA replication, repair, transcription, and translation. Sulfolobus solfataricus is one such model organism. A hyperthermophile with an optimal growth temperature of 80°C, Sulfolobus protein-protein complexes and transient protein interactions should be more stable at moderate temperatures, providing a means to isolate and study their structure and function. Here we provide the initial steps towards characterizing three DNA-related Sulfolobus proteins with small angle X-ray scattering (SAXS): Sso0257, a cell division control and origin recognition complex homolog, Sso0768, the small subunit of the replication factor C, and Sso3167, a Mut-T like protein. SAXS analysis was performed at multiple concentrations for both short and long exposure times. The Sso0257 sample was determined to be either a mixture of monomeric and dimeric states or a population of dynamic monomers in various conformational states in solution, consistent with a fl exible winged helix domain. Sso0768 was found to be a complex mixture of multimeric states in solution. Finally, molecular envelope reconstruction from SAXS data for Sso3167 revealed a novel structural component which may function as a disordered to ordered region in the presence of its substrates and/or protein partners.

  14. Central Role of P2Y6 UDP Receptor in Arteriolar Myogenic Tone

    PubMed Central

    Kauffenstein, Gilles; Tamareille, Sophie; Prunier, Fabrice; Roy, Charlotte; Ayer, Audrey; Toutain, Bertrand; Billaud, Marie; Isakson, Brant E.; Grimaud, Linda; Loufrani, Laurent; Rousseau, Pascal; Abraham, Pierre; Procaccio, Vincent; Monyer, Hannah; de Wit, Cor; Boeynaems, Jean-Marie; Robaye, Bernard; Kwak, Brenda R.; Henrion, Daniel


    Objective Myogenic tone (MT) of resistance arteries ensures autoregulation of blood flow in organs and relies on the intrinsic property of smooth muscle to contract in response to stretch. Nucleotides released by mechanical strain on cells are responsible for pleiotropic vascular effects, including vasoconstriction. Here, we evaluated the contribution of extracellular nucleotides to MT. Approach and Results We measured MT and the associated pathway in mouse mesenteric resistance arteries using arteriography for small arteries and molecular biology. Of the P2 receptors in mouse mesenteric resistance arteries, mRNA expression of P2X1 and P2Y6 was dominant. P2Y6 fully sustained UDP/UTP-induced contraction (abrogated in P2ry6−/− arteries). Preventing nucleotide hydrolysis with the ectonucleotidase inhibitor ARL67156 enhanced pressure-induced MT by 20%, whereas P2Y6 receptor blockade blunted MT in mouse mesenteric resistance arteries and human subcutaneous arteries. Despite normal hemodynamic parameters, P2ry6−/− mice were protected against MT elevation in myocardial infarction–induced heart failure. Although both P2Y6 and P2Y2 receptors contributed to calcium mobilization, P2Y6 activation was mandatory for RhoA–GTP binding, myosin light chain, P42–P44, and c-Jun N-terminal kinase phosphorylation in arterial smooth muscle cells. In accordance with the opening of a nucleotide conduit in pressurized arteries, MT was altered by hemichannel pharmacological inhibitors and impaired in Cx43+/− and P2rx7−/− mesenteric resistance arteries. Conclusions Signaling through P2 nucleotide receptors contributes to MT. This mechanism encompasses the release of nucleotides coupled to specific autocrine/paracrine activation of the uracil nucleotide P2Y6 receptor and may contribute to impaired tissue perfusion in cardiovascular diseases. PMID:27255725

  15. Participation of peripheral P2Y1, P2Y6 and P2Y11 receptors in formalin-induced inflammatory pain in rats.


    Barragán-Iglesias, Paulino; Mendoza-Garcés, Luis; Pineda-Farias, Jorge Baruch; Solano-Olivares, Verónica; Rodríguez-Silverio, Juan; Flores-Murrieta, Francisco Javier; Granados-Soto, Vinicio; Rocha-González, Héctor Isaac


    Metabotropic P2Y receptors subfamily consists of eight functional mammalian receptors. Specifically, P2Y1, P2Y6 and P2Y11 receptors have been described in the sensory nervous system, but their participation, at peripheral level, in behavioral pain models is scarcely understood. This study assessed the role of peripheral P2Y1, P2Y6 and P2Y11 receptors in formalin-induced inflammatory pain. Ipsilateral, but not contralateral peripheral pre-treatment with the endogenous P2Y1 (ADP, 100-1000nmol/paw), P2Y6 (UDP, 180-300nmol/paw) and P2Y11 (ATP, 100-1000nmol/paw), or selective P2Y1 (MRS2365, 0.1-10nmol/paw), P2Y6 (PSB0474, 0.1-0.10pmol/paw) and P2Y11 (NF546, 0.3-3nmol/paw) receptor agonists increased 0.5% formalin-induced flinching behavior. Concordantly, peripheral pre-treatment with the selective P2Y1 (MRS2500, 0.01-10pmol/paw), P2Y6 (MRS2578, 3-30nmol/paw) and P2Y11 (NF340, 1-10nmol/paw) receptor antagonists significantly decreased 1% formalin-induced flinching behavior. Furthermore, the pronociceptive effect of ADP (100nmol/paw) or MRS2365 (10nmol/paw), UDP (300nmol/paw) or PSB0474 (10pmol/paw) and ATP (1000nmol/paw) or NF546 (3nmol/paw) was blocked by the selective P2Y1 (MRS2500, 0.01nmol/paw), P2Y6 (MRS2578, 3nmol/paw), and P2Y11 (NF340, 1nmol/paw) receptor antagonists, respectively. Western blot analysis confirmed the presence of P2Y1 (66kDa), P2Y6 (36kDa) and P2Y11 (75kDa) receptors in dorsal root ganglia (DRG) and sciatic nerve. Results suggest that peripheral activation of P2Y1, P2Y6 and P2Y11 receptors plays a pronociceptive role in formalin-induced pain. Copyright © 2014 Elsevier Inc. All rights reserved.

  16. P2Y2 Nucleotide Receptor-Mediated Responses in Brain Cells

    PubMed Central

    Camden, Jean M.; Wang, Yanfang; Seye, Cheikh I.; Wood, W. G.; Sun, Grace Y.; Erb, Laurie; Petris, Michael J.; Weisman, Gary A.


    Acute inflammation is important for tissue repair; however, chronic inflammation contributes to neurodegeneration in Alzheimer’s disease (AD) and occurs when glial cells undergo prolonged activation. In the brain, stress or damage causes the release of nucleotides and activation of the Gq protein-coupled P2Y2 nucleotide receptor subtype (P2Y2R) leading to pro-inflammatory responses that can protect neurons from injury, including the stimulation and recruitment of glial cells. P2Y2R activation induces the phosphorylation of the epidermal growth factor receptor (EGFR), a response dependent upon the presence of a SH3 binding domain in the intracellular C terminus of the P2Y2R that promotes Src binding and transactivation of EGFR, a pathway that regulates the proliferation of cortical astrocytes. Other studies indicate that P2Y2R activation increases astrocyte migration. P2Y2R activation by UTP increases the expression in astrocytes of αVβ3/5 integrins that bind directly to the P2Y2R via an Arg-Gly-Asp (RGD) motif in the first extracellular loop of the P2Y2R, an interaction required for Go and G12 protein-dependent astrocyte migration. In rat primary cortical neurons (rPCNs) P2Y2R expression is increased by stimulation with interleukin-1β (IL-1β), a pro-inflammatory cytokine whose levels are elevated in AD, in part due to nucleotide-stimulated release from glial cells. Other results indicate that oligomeric β-amyloid peptide (Aβ1-42), a contributor to AD, increases nucleotide release from astrocytes, which would serve to activate upregulated P2Y2Rs in neurons. Data with rPCNs suggest that P2Y2R upregulation by IL-1β and subsequent activation by UTP are neuroprotective, since this increases the non-amyloidogenic cleavage of amyloid precursor protein. Furthermore, activation of IL-1β-upregulated P2Y2Rs in rPCNs increases the phosphorylation of cofilin, a cytoskeletal protein that stabilizes neurite outgrowths. Thus, activation of pro-inflammatory P2Y2Rs in

  17. Structural basis for substrate specificity of alphavirus nsP2 proteases.


    Russo, Andrew T; Malmstrom, Robert D; White, Mark A; Watowich, Stanley J


    The alphavirus nsP2 protease is essential for correct processing of the alphavirus nonstructural polyprotein (nsP1234) and replication of the viral genome. We have combined molecular dynamics simulations with our structural studies to reveal features of the nsP2 protease catalytic site and S1'-S4 subsites that regulate the specificity of the protease. The catalytic mechanism of the nsP2 protease appears similar to the papain-like cysteine proteases, with the conserved catalytic dyad forming a thiolate-imidazolium ion pair in the nsP2-activated state. Substrate binding likely stabilizes this ion pair. Analysis of bimolecular complexes of Venezuelan equine encephalitis virus (VEEV) nsP2 protease with each of the nsP1234 cleavage sites identified protease residues His(510), Ser(511), His(546) and Lys(706) as critical for cleavage site recognition. Homology modelling and molecular dynamics simulations of diverse alphaviruses and their cognate cleavage site sequences revealed general features of substrate recognition that operate across alphavirus strains as well as strain specific covariance between binding site and cleavage site residues. For instance, compensatory changes occurred in the P3 and S3 subsite residues to maintain energetically favourable complementary binding surfaces. These results help explain how alphavirus nsP2 proteases recognize different cleavage sites within the nonstructural polyprotein and discriminate between closely related cleavage targets.

  18. Deciphering the regulation of P2X4 receptor channel gating by ivermectin using Markov models.


    Mackay, Laurent; Zemkova, Hana; Stojilkovic, Stanko S; Sherman, Arthur; Khadra, Anmar


    The P2X4 receptor (P2X4R) is a member of a family of purinergic channels activated by extracellular ATP through three orthosteric binding sites and allosterically regulated by ivermectin (IVM), a broad-spectrum antiparasitic agent. Treatment with IVM increases the efficacy of ATP to activate P2X4R, slows both receptor desensitization during sustained ATP application and receptor deactivation after ATP washout, and makes the receptor pore permeable to NMDG+, a large organic cation. Previously, we developed a Markov model based on the presence of one IVM binding site, which described some effects of IVM on rat P2X4R. Here we present two novel models, both with three IVM binding sites. The simpler one-layer model can reproduce many of the observed time series of evoked currents, but does not capture well the short time scales of activation, desensitization, and deactivation. A more complex two-layer model can reproduce the transient changes in desensitization observed upon IVM application, the significant increase in ATP-induced current amplitudes at low IVM concentrations, and the modest increase in the unitary conductance. In addition, the two-layer model suggests that this receptor can exist in a deeply inactivated state, not responsive to ATP, and that its desensitization rate can be altered by each of the three IVM binding sites. In summary, this study provides a detailed analysis of P2X4R kinetics and elucidates the orthosteric and allosteric mechanisms regulating its channel gating.

  19. P2 Receptors for Extracellular Nucleotides in the Central Nervous System: Role of P2X7 and P2Y2 Receptor Interactions in Neuroinflammation

    PubMed Central

    Weisman, Gary A.; Camden, Jean M.; Peterson, Troy S.; Ajit, Deepa V.; Woods, Lucas T.; Erb, Laurie


    Extracellular nucleotides induce cellular responses in the central nervous system (CNS) through the activation of ionotropic P2X and metabotropic P2Y nucleotide receptors. Activation of these receptors regulates a wide range of physiological and pathological processes. In this review, we present an overview of the current literature regarding P2X and P2Y receptors in the CNS with a focus on the contribution of P2X7 and P2Y2 receptor-mediated responses to neuroinflammatory and neuroprotective mechanisms. PMID:22467178

  20. Lipopolysaccharide Inhibits the Channel Activity of the P2X7 Receptor

    PubMed Central

    Leiva-Salcedo, Elias; Coddou, Claudio; Rodríguez, Felipe E.; Penna, Antonello; Lopez, Ximena; Neira, Tanya; Fernández, Ricardo; Imarai, Mónica; Rios, Miguel; Escobar, Jorge; Montoya, Margarita; Huidobro-Toro, J. Pablo; Escobar, Alejandro; Acuña-Castillo, Claudio


    The purinergic P2X7 receptor (P2X7R) plays an important role during the immune response, participating in several events such as cytokine release, apoptosis, and necrosis. The bacterial endotoxin lipopolysaccharide (LPS) is one of the strongest stimuli of the immune response, and it has been shown that P2X7R activation can modulate LPS-induced responses. Moreover, a C-terminal binding site for LPS has been proposed. In order to evaluate if LPS can directly modulate the activity of the P2X7R, we tested several signaling pathways associated with P2X7R activation in HEK293 cells that do not express the TLR-4 receptor. We found that LPS alone was unable to induce any P2X7R-related activity, suggesting that the P2X7R is not directly activated by the endotoxin. On the other hand, preapplication of LPS inhibited ATP-induced currents, intracellular calcium increase, and ethidium bromide uptake and had no effect on ERK activation in HEK293 cells. In splenocytes-derived T-regulatory cells, in which ATP-induced apoptosis is driven by the P2X7R, LPS inhibited ATP-induced apoptosis. Altogether, these results demonstrate that LPS modulates the activity of the P2X7R and suggest that this effect could be of physiological relevance. PMID:21941410

  1. Direct Observation of ATP-Induced Conformational Changes in Single P2X4 Receptors

    PubMed Central

    Shinozaki, Youichi; Sumitomo, Koji; Tsuda, Makoto; Koizumi, Schuichi; Inoue, Kazuhide; Torimitsu, Keiichi


    The ATP-gated P2X4 receptor is a cation channel, which is important in various pathophysiological events. The architecture of the P2X4 receptor in the activated state and how to change its structure in response to ATP binding are not fully understood. Here, we analyze the architecture and ATP-induced structural changes in P2X4 receptors using fast-scanning atomic force microscopy (AFM). AFM images of the membrane-dissociated and membrane-inserted forms of P2X4 receptors and a functional analysis revealed that P2X4 receptors have an upward orientation on mica but lean to one side. Time-lapse imaging of the ATP-induced structural changes in P2X4 receptors revealed two different forms of activated structures under 0 Ca2+ conditions, namely a trimer structure and a pore dilation-like tripartite structure. A dye uptake measurement demonstrated that ATP-activated P2X4 receptors display pore dilation in the absence of Ca2+. With Ca2+, the P2X4 receptors exhibited only a disengaged trimer and no dye uptake was observed. Thus our data provide a new insight into ATP-induced structural changes in P2X4 receptors that correlate with pore dynamics. PMID:19419241

  2. P2X7 receptor knockout prevents streptozotocin-induced type 1 diabetes in mice.


    Vieira, Flávia Sarmento; Nanini, Hayandra Ferreira; Takiya, Christina Maeda; Coutinho-Silva, Robson


    Type 1 diabetes (T1D) is caused by autoimmune destruction of islet of Langerhans β-cells. P2X7 receptors (P2X7R) modulate proinflammatory immune responses by binding extracellular ATP, a classic 'danger signal'. Here, we evaluated whether the P2X7R has a role in T1D development. P2X7(-/-) mice are resistant to TD1 induction by streptozotocin (STZ) treatment, with no increase in blood glucose, decrease in insulin-positive cells, and pancreatic islet reduction, compared to WT (C57BL/6) mice. Also, the levels of proinflammatory mediators (IL-1β, IFN-γ and NO) did not increase after STZ treatment in P2X7(-/-) animals, with reduced infiltration of CD4(+), CD8(+), B220(+), CD11b(+) and CD11c(+) cells in the pancreatic lymph nodes. Treatment with a P2X7 antagonist mimicked the effect of P2X7 knockout, preventing STZ-induced diabetes. Our results show that the absence of the P2X7R provides resistance in the induction of diabetes in this model, and suggest that therapy targeting the P2X7R may be useful against clinical T1D.

  3. Small multicopy, non-integrative shuttle vectors based on the plasmid pRN1 for Sulfolobus acidocaldarius and Sulfolobus solfataricus, model organisms of the (cren-)archaea.


    Berkner, Silvia; Grogan, Dennis; Albers, Sonja-Verena; Lipps, Georg


    The extreme thermoacidophiles of the genus Sulfolobus are among the best-studied archaea but have lacked small, reliable plasmid vectors, which have proven extremely useful for manipulating and analyzing genes in other microorganisms. Here we report the successful construction of a series of Sulfolobus-Escherichia coli shuttle vectors based on the small multicopy plasmid pRN1 from Sulfolobus islandicus. Selection in suitable uracil auxotrophs is provided through inclusion of pyrEF genes in the plasmid. The shuttle vectors do not integrate into the genome and do not rearrange. The plasmids allow functional overexpression of genes, as could be demonstrated for the beta-glycosidase (lacS) gene of S. solfataricus. In addition, we demonstrate that this beta-glycosidase gene could function as selectable marker in S. solfataricus. The shuttle plasmids differ in their interruption sites within pRN1 and allowed us to delineate functionally important regions of pRN1. The orf56/orf904 operon appears to be essential for pRN1 replication, in contrast interruption of the highly conserved orf80/plrA gene is tolerated. The new vector system promises to facilitate genetic studies of Sulfolobus and to have biotechnological uses, such as the overexpression or optimization of thermophilic enzymes that are not readily performed in mesophilic hosts.

  4. Small multicopy, non-integrative shuttle vectors based on the plasmid pRN1 for Sulfolobus acidocaldarius and Sulfolobus solfataricus, model organisms of the (cren-)archaea

    PubMed Central

    Berkner, Silvia; Grogan, Dennis; Albers, Sonja-Verena; Lipps, Georg


    The extreme thermoacidophiles of the genus Sulfolobus are among the best-studied archaea but have lacked small, reliable plasmid vectors, which have proven extremely useful for manipulating and analyzing genes in other microorganisms. Here we report the successful construction of a series of Sulfolobus–Escherichia coli shuttle vectors based on the small multicopy plasmid pRN1 from Sulfolobus islandicus. Selection in suitable uracil auxotrophs is provided through inclusion of pyrEF genes in the plasmid. The shuttle vectors do not integrate into the genome and do not rearrange. The plasmids allow functional overexpression of genes, as could be demonstrated for the β-glycosidase (lacS) gene of S. solfataricus. In addition, we demonstrate that this β-glycosidase gene could function as selectable marker in S. solfataricus. The shuttle plasmids differ in their interruption sites within pRN1 and allowed us to delineate functionally important regions of pRN1. The orf56/orf904 operon appears to be essential for pRN1 replication, in contrast interruption of the highly conserved orf80/plrA gene is tolerated. The new vector system promises to facilitate genetic studies of Sulfolobus and to have biotechnological uses, such as the overexpression or optimization of thermophilic enzymes that are not readily performed in mesophilic hosts. PMID:17576673

  5. Functional and molecular evidence for heteromeric association of P2Y1 receptor with P2Y2 and P2Y4 receptors in mouse granulocytes.


    Ribeiro-Filho, Antonio Carlos; Buri, Marcus Vinicius; Barros, Carlos Castilho; Dreyfuss, Juliana Luporini; Nader, Helena Bonciani; Justo, Giselle Zenker; Craveiro, Rogério Bastos; Pesquero, João Bosco; Miranda, Antonio; Ferreira, Alice Teixeira; Paredes-Gamero, Edgar Julian


    All hematopoietic cells express P2 receptors, however pharmacological characteristics such as expression and affinity in granulocytes are unknown. Pharmacological characteristics of P2 receptors were evaluated by Ca(2+) measurements using Fura-2 fluorophore. P2 receptors expression were analyzed by flow cytometry and RT-PCR. P2 interaction were shown by coimmunoprecipitation, western blotting and FRET. Granulocytes were responsive to P2Y agonists, whereas P2X agonists were ineffective. Ca(2+) increase, elicited by ADP and UTP was dependent on intracellular stocks and sensitive to G-coupled receptor inhibition. Moreover, MRS2179, a specific antagonist of the P2Y1 receptor, abolished ADP response. Interestingly, ADP and UTP exhibited full heterologous desensitization, suggesting that these agonists interact with the same receptor. The heteromeric association between P2Y1 receptor and the P2Y2 and P2Y4 receptors was shown by immunoprecipitation and FRET analysis. Clear evidence of heteromeric association of P2Y receptors was found during the evaluation of P2 receptors present in mice granulocytes, which could impact in the classical pharmacology of P2Y receptors in granulocytes.

  6. Structural basis for subtype-specific inhibition of the P2X7 receptor

    PubMed Central

    Karasawa, Akira; Kawate, Toshimitsu


    The P2X7 receptor is a non-selective cation channel activated by extracellular adenosine triphosphate (ATP). Chronic activation of P2X7 underlies many health problems such as pathologic pain, yet we lack effective antagonists due to poorly understood mechanisms of inhibition. Here we present crystal structures of a mammalian P2X7 receptor complexed with five structurally-unrelated antagonists. Unexpectedly, these drugs all bind to an allosteric site distinct from the ATP-binding pocket in a groove formed between two neighboring subunits. This novel drug-binding pocket accommodates a diversity of small molecules mainly through hydrophobic interactions. Functional assays propose that these compounds allosterically prevent narrowing of the drug-binding pocket and the turret-like architecture during channel opening, which is consistent with a site of action distal to the ATP-binding pocket. These novel mechanistic insights will facilitate the development of P2X7-specific drugs for treating human diseases. DOI: PMID:27935479

  7. Structural basis for subtype-specific inhibition of the P2X7 receptor

    SciTech Connect

    Karasawa, Akira; Kawate, Toshimitsu


    The P2X7 receptor is a non-selective cation channel activated by extracellular adenosine triphosphate (ATP). Chronic activation of P2X7 underlies many health problems such as pathologic pain, yet we lack effective antagonists due to poorly understood mechanisms of inhibition. Here we present crystal structures of a mammalian P2X7 receptor complexed with five structurally-unrelated antagonists. Unexpectedly, these drugs all bind to an allosteric site distinct from the ATP-binding pocket in a groove formed between two neighboring subunits. This novel drug-binding pocket accommodates a diversity of small molecules mainly through hydrophobic interactions. Functional assays propose that these compounds allosterically prevent narrowing of the drug-binding pocket and the turret-like architecture during channel opening, which is consistent with a site of action distal to the ATP-binding pocket. These novel mechanistic insights will facilitate the development of P2X7-specific drugs for treating human diseases.

  8. Molecular Modeling and Docking Study to Elucidate Novel Chikungunya Virus nsP2 Protease Inhibitors.


    Agarwal, T; Asthana, Somya; Bissoyi, A


    Chikungunya is one of the tropical viral infections that severely affect the Asian and African countries. Absence of any suitable drugs or vaccines against Chikungunya virus till date makes it essential to identify and develop novel leads for the same. Recently, nsP2 cysteine protease has been classified as a crucial drug target to combat infections caused by Alphaviruses including Chikungunya virus due to its involvement viral replication. Here in, we investigated the structural aspects of the nsP2 protease through homology modeling based on nsP2 protease from Venezuelan equine encephalitis virus. Further, the ligands were virtually screened based on various pharmacological, ADME/Tox filters and subjected to docking with the modeled Chikungunya nsP2 protease using AutoDock4.2. The interaction profiling of ligand with the protein was carried out using LigPlot(+). The results demonstrated that the ligand with PubChem Id (CID_5808891) possessed highest binding affinity towards Chikungunya nsP2 protease with a good interaction profile with the active site residues. We hereby propose that these compounds could inhibit the nsP2 protease by binding to its active site. Moreover, they may provide structural scaffold for the design of novel leads with better efficacy and specificity for the nsP2 protease.

  9. Use-dependent inhibition of P2X3 receptors by nanomolar agonist.


    Pratt, Emily B; Brink, Thaddeus S; Bergson, Pamela; Voigt, Mark M; Cook, Sean P


    P2X3 receptors desensitize within 100 ms of channel activation, yet recovery from desensitization requires several minutes. The molecular basis for this slow rate of recovery is unknown. We designed experiments to test the hypothesis that this slow recovery is attributable to the high affinity (< 1 nM) of desensitized P2X3 receptors for agonist. We found that agonist binding to the desensitized state provided a mechanism for potent inhibition of P2X3 current. Sustained applications of 0.5 nM ATP inhibited > 50% of current to repetitive applications of P2X3 agonist. Inhibition occurred at 1000-fold lower agonist concentrations than required for channel activation and showed strong use dependence. No inhibition occurred without previous activation and desensitization. Our data are consistent with a model whereby inhibition of P2X3 by nanomolar [agonist] occurs by the rebinding of agonist to desensitized channels before recovery from desensitization. For several ATP analogs, the concentration required to inhibit P2X3 current inversely correlated with the rate of recovery from desensitization. This indicates that the affinity of the desensitized state and recovery rate primarily depend on the rate of agonist unbinding. Consistent with this hypothesis, unbinding of [32P]ATP from desensitized P2X3 receptors mirrored the rate of recovery from desensitization. As expected, disruption of agonist binding by site-directed mutagenesis increased the IC50 for inhibition and increased the rate of recovery.

  10. Molecular Modeling and Docking Study to Elucidate Novel Chikungunya Virus nsP2 Protease Inhibitors

    PubMed Central

    Agarwal, T.; Asthana, Somya; Bissoyi, A.


    Chikungunya is one of the tropical viral infections that severely affect the Asian and African countries. Absence of any suitable drugs or vaccines against Chikungunya virus till date makes it essential to identify and develop novel leads for the same. Recently, nsP2 cysteine protease has been classified as a crucial drug target to combat infections caused by Alphaviruses including Chikungunya virus due to its involvement viral replication. Here in, we investigated the structural aspects of the nsP2 protease through homology modeling based on nsP2 protease from Venezuelan equine encephalitis virus. Further, the ligands were virtually screened based on various pharmacological, ADME/Tox filters and subjected to docking with the modeled Chikungunya nsP2 protease using AutoDock4.2. The interaction profiling of ligand with the protein was carried out using LigPlot+. The results demonstrated that the ligand with PubChem Id (CID_5808891) possessed highest binding affinity towards Chikungunya nsP2 protease with a good interaction profile with the active site residues. We hereby propose that these compounds could inhibit the nsP2 protease by binding to its active site. Moreover, they may provide structural scaffold for the design of novel leads with better efficacy and specificity for the nsP2 protease. PMID:26664062

  11. Clemastine Potentiates the Human P2X7 Receptor by Sensitizing It to Lower ATP Concentrations*

    PubMed Central

    Nörenberg, Wolfgang; Hempel, Christoph; Urban, Nicole; Sobottka, Helga; Illes, Peter; Schaefer, Michael


    P2X7 receptors have emerged as potential drug targets for the treatment of medical conditions such as e.g. rheumatoid arthritis and neuropathic pain. To assess the impact of pharmaceuticals on P2X7, we screened a compound library comprising approved or clinically tested drugs and identified several compounds that augment the ATP-triggered P2X7 activity in a stably transfected HEK293 cell line. Of these, clemastine markedly sensitized Ca2+ entry through P2X7 to lower ATP concentrations. Extracellularly but not intracellularly applied clemastine rapidly and reversibly augmented P2X7-mediated whole-cell currents evoked by non-saturating ATP concentrations. Clemastine also accelerated the ATP-induced pore formation and Yo-Pro-1 uptake, increased the fractional NMDG+ permeability, and stabilized the open channel conformation of P2X7. Thus, clemastine is an extracellularly binding allosteric modulator of P2X7 that sensitizes P2X7 to lower ATP concentrations and facilitates its pore dilation. The activity of clemastine on native P2X7 receptors, Ca2+ entry, and whole-cell currents was confirmed in human monocyte-derived macrophages. Similar effects were observed in murine bone marrow-derived macrophages. Consistent with the data on recombinant P2X7, clemastine augmented the ATP-induced cation entry and Yo-Pro-1 uptake. In accordance with the observation that P2X7 controls the cytokine release from LPS-primed macrophages, we found that clemastine augmented the IL-1β release from LPS-primed human macrophages. Collectively, these data point to a sensitization of the recombinantly or natively expressed human P2X7 receptor toward its physiological activator, ATP, possibly leading to a modulation of macrophage-dependent immune responses. PMID:21262970

  12. Single Channel Properties of P2X2 Purinoceptors

    PubMed Central

    Ding, Shinghua; Sachs, Frederick


    The single channel properties of cloned P2X2 purinoceptors expressed in human embryonic kidney (HEK) 293 cells and Xenopus oocytes were studied in outside-out patches. The mean single channel current–voltage relationship exhibited inward rectification in symmetric solutions with a chord conductance of ∼30 pS at −100 mV in 145 mM NaCl. The channel open state exhibited fast flickering with significant power beyond 10 kHz. Conformational changes, not ionic blockade, appeared responsible for the flickering. The equilibrium constant of Na+ binding in the pore was ∼150 mM at 0 mV and voltage dependent. The binding site appeared to be ∼0.2 of the electrical distance from the extracellular surface. The mean channel current and the excess noise had the selectivity: K+ > Rb+ > Cs+ > Na+ > Li+. ATP increased the probability of being open (Po) to a maximum of 0.6 with an EC50 of 11.2 μM and a Hill coefficient of 2.3. Lowering extracellular pH enhanced the apparent affinity of the channel for ATP with a pKa of ∼7.9, but did not cause a proton block of the open channel. High pH slowed the rise time to steps of ATP without affecting the fall time. The mean single channel amplitude was independent of pH, but the excess noise increased with decreasing pH. Kinetic analysis showed that ATP shortened the mean closed time but did not affect the mean open time. Maximum likelihood kinetic fitting of idealized single channel currents at different ATP concentrations produced a model with four sequential closed states (three binding steps) branching to two open states that converged on a final closed state. The ATP association rates increased with the sequential binding of ATP showing that the binding sites are not independent, but positively cooperative. Partially liganded channels do not appear to open. The predicted Po vs. ATP concentration closely matches the single channel current dose–response curve. PMID:10228183

  13. Discovery of Potential Orthosteric and Allosteric Antagonists of P2Y1R from Chinese Herbs by Molecular Simulation Methods

    PubMed Central

    Lu, Fang; Jiang, Lu-di; Qiao, Lian-sheng; Xiang, Yu-hong


    P2Y1 receptor (P2Y1R), which belongs to G protein-coupled receptors (GPCRs), is an important target in ADP-induced platelet aggregation. The crystal structure of P2Y1R has been solved recently, which revealed orthosteric and allosteric ligand-binding sites with the details of ligand-protein binding modes. And it suggests that P2Y1R antagonists, which recognize two distinct sites, could potentially provide an efficacious and safe antithrombotic profile. In present paper, 2D similarity search, pharmacophore based screening, and molecular docking were used to explore the potential natural P2Y1R antagonists. 2D similarity search was used to classify orthosteric and allosteric antagonists of P2Y1R. Based on the result, pharmacophore models were constructed and validated by the test set. Optimal models were selected to discover potential P2Y1R antagonists of orthosteric and allosteric sites from Traditional Chinese Medicine (TCM). And the hits were filtered by Lipinski's rule. Then molecular docking was used to refine the results of pharmacophore based screening and analyze the binding mode of the hits and P2Y1R. Finally, two orthosteric and one allosteric potential compounds were obtained, which might be used in future P2Y1R antagonists design. This work provides a reliable guide for discovering natural P2Y1R antagonists acting on two distinct sites from TCM. PMID:27635149

  14. Role of purinergic P2X4 receptors in regulating striatal dopamine homeostasis and dependent behaviors.


    Khoja, Sheraz; Shah, Vivek; Garcia, Damaris; Asatryan, Liana; Jakowec, Michael W; Davies, Daryl L


    Purinergic P2X4 receptors (P2X4Rs) belong to the P2X superfamily of ion channels regulated by ATP. We recently demonstrated that P2X4R knockout (KO) mice exhibited deficits in sensorimotor gating, social interaction, and ethanol drinking behavior. Dopamine (DA) dysfunction may underlie these behavioral changes, but there is no direct evidence for P2X4Rs' role in DA neurotransmission. To test this hypothesis, we measured markers of DA function and dependent behaviors in P2X4R KO mice. P2X4R KO mice exhibited altered density of pre-synaptic markers including tyrosine hydroxylase, dopamine transporter; post-synaptic markers including dopamine receptors and phosphorylation of downstream targets including dopamine and cyclic-AMP regulated phosphoprotein of 32 kDa and cyclic-AMP-response element binding protein in different parts of the striatum. Ivermectin, an allosteric modulator of P2X4Rs, significantly affected dopamine and cyclic AMP regulated phosphoprotein of 32 kDa and extracellular regulated kinase1/2 phosphorylation in the striatum. Sensorimotor gating deficits in P2X4R KO mice were rescued by DA antagonists. Using the 6-hydroxydopamine model of DA depletion, P2X4R KO mice exhibited an attenuated levodopa (L-DOPA)-induced motor behavior, whereas ivermectin enhanced this behavior. Collectively, these findings identified an important role for P2X4Rs in maintaining DA homeostasis and illustrate how this association is important for CNS functions including motor control and sensorimotor gating. We propose that P2X4 receptors (P2X4Rs) regulate dopamine (DA) homeostasis and associated behaviors. Pre-synaptic and post-synaptic DA markers were significantly altered in the dorsal and ventral striatum of P2X4R KO mice, implicating altered DA neurotransmission. Sensorimotor gating deficits in P2X4R KO mice were rescued by DA antagonists. Ivermectin (IVM), a positive modulator of P2X4Rs, enhanced levodopa (L-DOPA)-induced motor behavior. These studies highlight potential

  15. Comparison of three GPCR structural templates for modeling of the P2Y12 nucleotide receptor

    NASA Astrophysics Data System (ADS)

    Deflorian, Francesca; Jacobson, Kenneth A.


    The P2Y12 receptor (P2Y12R) is an ADP-activated G protein-coupled receptor (GPCR) that is an important target for antithrombotic drugs. Three homology models of P2Y12R were compared, based on different GPCR structural templates: bovine rhodopsin (bRHO), human A2A adenosine receptor (A2AAR), and human C-X-C chemokine receptor type 4 (CXCR4). By criteria of sequence analysis (25.6% identity in transmembrane region), deviation from helicity in the second transmembrane helix (TM2), docked poses of ligands highlighting the role of key residues, accessibility of a conserved disulfide bridge that is reactive toward irreversibly-binding antagonists, and the presence of a shared disulfide bridge between the third extracellular loop (EL3) and the N-terminus, the CXCR4-based model appeared to be the most consistent with known characteristics of P2Y12R. The docked poses of agonist 2MeSADP and charged anthraquinone antagonist PSB-0739 in the binding pocket of P2Y12R-CXC agree with previously published site-directed mutagenesis studies of Arg256 and Lys280. A sulfonate at position 2 of the anthraquinone core created a strong interaction with the Lys174(EL2) side chain. The docking poses of the irreversibly-binding, active metabolite (existing as two diastereoisomers in vivo) of the clinically utilized antagonist Clopidogrel were compared. The free thiol group of the 4S diastereoisomer, but not the 4R isomer, was found in close proximity ( 4.7 Å) to the sulfur atom of a disulfide bridge involving Cys175, suggesting greater activity in covalent binding. Therefore, ligand docking to the CXCR4-based model of the P2Y12R predicted poses of both reversibly and irreversibly-binding small molecules, consistent with observed pharmacology and mutagenesis studies.

  16. Structure activity and molecular modeling analyses of ribose- and base-modified uridine 5'-triphosphate analogues at the human P2Y2 and P2Y4 receptors.


    Jacobson, Kenneth A; Costanzi, Stefano; Ivanov, Andrei A; Tchilibon, Susanna; Besada, Pedro; Gao, Zhan-Guo; Maddileti, Savitri; Harden, T Kendall


    With the long-term goal of developing receptor subtype-selective high affinity agonists for the uracil nucleotide-activated P2Y receptors we have carried out a series of structure activity and molecular modeling studies of the human P2Y2 and P2Y4 receptors. UTP analogues with substitutions in the 2'-position of the ribose moiety retained capacity to activate both P2Y2 and P2Y4 receptors. Certain of these analogues were equieffective for activation of both receptors whereas 2'-amino-2'-deoxy-UTP exhibited higher potency for the P2Y2 receptor and 2'-azido-UTP exhibited higher potency for the P2Y4 receptor. 4-Thio substitution of the uracil base resulted in a UTP analogue with increased potency relative to UTP for activation of both the P2Y2 and P2Y4 receptors. In contrast, 2-thio substitution and halo- or alkyl substitution in the 5-position of the uracil base resulted in molecules that were 3-30-fold more potent at the P2Y2 receptor than P2Y4 receptor. 6-Aza-UTP was a P2Y2 receptor agonist that exhibited no activity at the P2Y4 receptor. Stereoisomers of UTPalphaS and 2'-deoxy-UTPalphaS were more potent at the P2Y2 than P2Y4 receptor, and the R-configuration was favored at both receptors. Molecular docking studies revealed that the binding mode of UTP is similar for both the P2Y2 and P2Y4 receptor binding pockets with the most prominent dissimilarities of the two receptors located in the second transmembrane domain (V90 in the P2Y2 receptor and I92 in the P2Y4 receptor) and the second extracellular loop (T182 in the P2Y2 receptor and L184 in the P2Y4 receptor). In summary, this work reveals substitutions in UTP that differentially affect agonist activity at P2Y2 versus P2Y4 receptors and in combination with molecular modeling studies should lead to chemical synthesis of new receptor subtype-selective drugs.

  17. Desensitization properties of P2X3 receptors shaping pain signaling

    PubMed Central

    Giniatullin, Rashid; Nistri, Andrea


    ATP-gated P2X3 receptors are mostly expressed by nociceptive sensory neurons and participate in transduction of pain signals. P2X3 receptors show a combination of fast desensitization onset and slow recovery. Moreover, even low nanomolar agonist concentrations unable to evoke a response, can induce desensitization via a phenomenon called “high affinity desensitization.” We have also observed that recovery from desensitization is agonist-specific and can range from seconds to minutes. The recovery process displays unusually high temperature dependence. Likewise, recycling of P2X3 receptors in peri-membrane regions shows unexpectedly large temperature sensitivity. By applying kinetic modeling, we have previously shown that desensitization characteristics of P2X3 receptor are best explained with a cyclic model of receptor operation involving three agonist molecules binding a single receptor and that desensitization is primarily developing from the open receptor state. Mutagenesis experiments suggested that desensitization depends on a certain conformation of the ATP binding pocket and on the structure of the transmembrane domains forming the ion pore. Further molecular determinants of desensitization have been identified by mutating the intracellular N- and C-termini of P2X3 receptor. Unlike other P2X receptors, the P2X3 subtype is facilitated by extracellular calcium that acts via specific sites in the ectodomain neighboring the ATP binding pocket. Thus, substitution of serine275 in this region (called “left flipper”) converts the natural facilitation induced by extracellular calcium to receptor inhibition. Given their strategic location in nociceptive neurons and unique desensitization properties, P2X3 receptors represent an attractive target for development of new analgesic drugs via promotion of desensitization aimed at suppressing chronic pain. PMID:24367291

  18. Potent and long-lasting inhibition of human P2X2 receptors by copper

    PubMed Central

    Punthambaker, Sukanya; Hume, Richard I.


    P2X receptors are ion channels gated by ATP. In rodents these channels are modulated by zinc and copper. Zinc is co-released with neurotransmitter at some synapses and can modulate neuronal activity, but the role of copper in the brain is unclear. Rat P2X2 receptors show potentiation by 2–100 µM zinc or copper in the presence of a submaximal concentration of ATP but are inhibited by zinc or copper at concentrations above 100 µM. In contrast, human P2X2 (hP2X2) receptors show no potentiation and are strongly inhibited by zinc over the range of 2–100 µM. The effect of copper on hP2X2 is of interest because there are human brain disorders in which copper concentration is altered. We found that hP2X2 receptors are potently inhibited by copper (IC50 = 40 nM). ATP responsiveness recovered extremely slowly after copper washout, with full recovery requiring over 1 h. ATP binding facilitated copper binding but not unbinding from this inhibitory site. A mutant receptor in which the first six extracellular cysteines were deleted, C(1–6)S, showed normal copper inhibition, however reducing agents dramatically accelerated recovery from copper inhibition in wild type hP2X2 and the C(1–6)S mutant, indicating that the final two disulfide bonds are required to maintain the high affinity copper binding site. Three histidine residues required for normal zinc inhibition were also required for normal copper inhibition. Humans with untreated Wilson’s disease have excess amounts of copper in the brain. The high copper sensitivity of hP2X2 receptors suggests that they are non-functional in these patients. PMID:24067922

  19. One-pot carbanionic synthesis of P1,P2-diglycosyl, P1,P1,P2-triglycosyl, and P1,P1,P2,P2-tetraribosyl methylenediphosphonates.


    Grison, Claude; Chibli, Hicham; Barthès, Nicolas; Coutrot, Philippe


    Novel lithiated carbanions derived from ethyl glycosyl- and diglycosyl methylphosphonates were used in a direct and convenient synthesis of P1,P2-diglycosyl, P1,P1,P2-triglycosyl, and P1,P1,P2,P2-tetraribosyl methylenediphosphonates involving a one-pot methylidenediphosphonylation of sugars.

  20. Heteromeric association creates a P2Y-like adenosine receptor.


    Yoshioka, K; Saitoh, O; Nakata, H


    Adenosine and its endogenous precursor ATP are main components of the purinergic system that modulates cellular and tissue functions via specific adenosine and ATP receptors (P1 and P2 receptors), respectively. Although adenosine inhibits excitability and ATP functions as an excitatory transmitter in the central nervous system, little is known about the ability of P1 and P2 receptors to form new functional structures such as a heteromer to control the complex purinergic cascade. Here we have shown that G(i/o) protein-coupled A1 adenosine receptor (A1R) and Gq protein-coupled P2Y1 receptor (P2Y1R) coimmunoprecipitate in cotransfected HEK293T cells, suggesting the oligomeric association between distinct G protein-coupled P1 and P2 receptors. A1R and P2Y2 receptor, but not A1R and dopamine D2 receptor, also were found to coimmunoprecipitate in cotransfected cells. A1R agonist and antagonist binding to cell membranes were reduced by coexpression of A1R and P2Y1R, whereas a potent P2Y1R agonist adenosine 5'-O-(2-thiotriphosphate) (ADPbetaS) revealed a significant potency to A1R binding only in the cotransfected cell membranes. Moreover, the A1R/P2Y1R coexpressed cells showed an ADPbetaS-dependent reduction of forskolin-evoked cAMP accumulation that was sensitive to pertussis toxin and A1R antagonist, indicating that ADPbetaS binds A1R and inhibits adenylyl cyclase activity via G(i/o) proteins. Also, a high degree of A1R and P2Y1R colocalization was demonstrated in cotransfected cells by double immunofluorescence experiments with confocal laser microscopy. These results suggest that oligomeric association of A1R with P2Y1R generates A1R with P2Y1R-like agonistic pharmacology and provides a molecular mechanism for an increased diversity of purine signaling.

  1. P2X7 on Mouse T Cells: One Channel, Many Functions

    PubMed Central

    Rissiek, Björn; Haag, Friedrich; Boyer, Olivier; Koch-Nolte, Friedrich; Adriouch, Sahil


    The P2X7 receptor is an adenosine triphosphate (ATP)-gated cation channel that is expressed by several cells of the immune system. P2X7 is best known for its proinflammatory role in promoting inflammasome formation and release of mature interleukin (IL)-1β by innate immune cells. Mounting evidence indicates that P2X7 is also an important regulatory receptor of murine and human T cell functions. Murine T cells express a sensitive splice variant of P2X7 that can be activated either by non-covalent binding of ATP or, in the presence of nicotinamide adenine dinucleotide, by its covalent ADP-ribosylation catalyzed by the ecto-ADP-ribosyltransferase ARTC2.2. Prolonged activation of P2X7 by either one of these pathways triggers the induction of T cell death. Conversely, lower concentrations of ATP can activate P2X7 to enhance T cell proliferation and production of IL-2. In this review, we will highlight the molecular and cellular consequences of P2X7 activation on mouse T cells and its versatile role in T cell homeostasis and activation. Further, we will discuss important differences in the function of P2X7 on human and murine T cells. PMID:26042119

  2. Expression of the house dust mite allergen Der p 2 in the baker's yeast Saccharomyces cerevisiae.


    Hakkaart, G A; Harmsen, M M; Chua, K Y; Thomas, W R; Aalberse, R C; Van Ree, R


    The major house dust mite allergen Der p 2 was expressed as a recombinant mature protein in the baker's yeast Saccharomyces cerevisiae. The yeast produces the protein fused to the invertase signal peptide, leading to the secretion of Der p 2 as a soluble protein into the culture medium. The signal peptide is hereby cleaved off, resulting in a mature allergen. In this system Der p 2 was produced in 7.6 (+/-2.9) mg/L growth culture. Purification of the recombinant allergen was achieved by a single gel filtration step, resulting in a purity > or = 95%. The yeast-derived Der p 2 was almost indistinguishable from natural Der p 2 with respect to IgE-reactivity and binding to the majority of Der p 2 specific MoAbs -- as was shown in RAST analysis (n = 168) and a sandwich ELISA and RIA analysis, respectively. Recombinant and natural Der p 2 also showed similar biological activity in histamine release assays (n = 4). An expression system for Der p 2 was developed that enables the production of a soluble allergen in the culture supernatant with immunological characteristics similar to the natural allergen. In addition, yeast offers the advantage of the absence of endotoxin in comparison to E. coli. This might facilitate acceptance of recombinant allergens for in vivo applications as immunotherapy or skin-prick testing.

  3. [32P]2-iodo-N6-methyl-(N)-methanocarba-2′-deoxyadenosine-3′,5′-bisphosphate ([32P]MRS2500), a novel radioligand for quantification of native P2Y1 receptors

    PubMed Central

    Houston, Dayle; Ohno, Michihiro; Nicholas, Robert A; Jacobson, Kenneth A; Harden, T Kendall


    Analysis of the P2Y family of nucleotide-activated G-protein-coupled receptors has been compromised by the lack of selective high-affinity, high-specific-radioactivity radioligands. We have pursued quantification of the P2Y1 receptor through the development of a series of selective P2Y1 receptor antagonists. Recently, we synthesized 2-iodo-N6-methyl-(N)-methanocarba-2′-deoxyadenosine 3′,5′-bisphosphate (MRS2500), a selective, competitive antagonist that exhibits a Ki of 0.8 nM in competition-binding assays with [3H]MRS2279. A 3′-monophosphate precursor molecule, MRS2608, was radiolabeled at the 5′ position with 32P using polynucleotide kinase and [γ32P]ATP to yield [32P]MRS2500. [32P]MRS2500 bound selectively to Sf9 insect cell membranes expressing the human P2Y1 receptor (Sf9-P2Y1), but did not detectably bind membranes expressing other P2Y receptors. P2Y1 receptor binding to [32P]MRS2500 was saturable with a KD of 1.2 nM. Agonists and antagonists of the P2Y1 receptor inhibited [32P]MRS2500 binding in Sf9-P2Y1 membranes with values in agreement with those observed in functional assays of the P2Y1 receptor. A high-affinity binding site for [32P]MRS2500 (KD=0.33 nM) was identified in rat brain, which exhibited the pharmacological selectivity of the P2Y1 receptor. Distribution of this binding site varied among rat tissues, with the highest amount of binding appearing in lung, liver, and brain. Among brain regions, distribution of the [32P]MRS2500 binding site varied by six-fold, with the highest and lowest amounts of sites detected in cerebellum and cortex, respectively. Taken together, these data illustrate the synthesis and characterization of a novel P2Y1 receptor radioligand and its utility for examining P2Y1 receptor expression in native mammalian tissues. PMID:16299552

  4. P2X6 Knockout Mice Exhibit Normal Electrolyte Homeostasis

    PubMed Central

    Viering, Daan H. H. M.; Bos, Caro; Bindels, René J. M.; Hoenderop, Joost G. J.


    ATP-mediated signaling is an important regulator of electrolyte transport in the kidney. The purinergic cation channel P2X6 has been previously localized to the distal convoluted tubule (DCT), a nephron segment important for Mg2+ and Na+ reabsorption, but its role in ion transport remains unknown. In this study, P2x6 knockout (P2x6-/-) mice were generated to investigate the role of P2X6 in renal electrolyte transport. The P2x6-/- animals displayed a normal phenotype and did not differ physiologically from wild type mice. Differences in serum concentration and 24-hrs urine excretion of Na+, K+, Mg2+ and Ca2+ were not detected between P2x6+/+, P2x6+/- and P2x6-/- mice. Quantitative PCR was applied to examine potential compensatory changes in renal expression levels of other P2x subunits and electrolyte transporters, including P2x1-5, P2x7, Trpm6, Ncc, Egf, Cldn16, Scnn1, Slc12a3, Slc41a1, Slc41a3, Cnnm2, Kcnj10 and Fxyd2. Additionally, protein levels of P2X2 and P2X4 were assessed in P2x6+/+ and P2x6-/- mouse kidneys. However, significant changes in expression were not detected. Furthermore, no compensatory changes in gene expression could be demonstrated in heart material isolated from P2x6-/- mice. Except for a significant (P<0.05) upregulation of P2x2 in the heart of P2x6-/- mice compared to the P2x6+/+ mice. Thus, our data suggests that purinergic signaling via P2X6 is not significantly involved in the regulation of renal electrolyte handling under normal physiological conditions. PMID:27254077

  5. Positive allosteric modulation by ivermectin of human but not murine P2X7 receptors

    PubMed Central

    Nörenberg, W; Sobottka, H; Hempel, C; Plötz, T; Fischer, W; Schmalzing, G; Schaefer, M


    BACKGROUND AND PURPOSE In mammalian cells, the anti-parasitic drug ivermectin is known as a positive allosteric modulator of the ATP-activated ion channel P2X4 and is used to discriminate between P2X4- and P2X7-mediated cellular responses. In this paper we provide evidence that the reported isoform selectivity of ivermectin is a species-specific phenomenon. EXPERIMENTAL APPROACH Complementary electrophysiological and fluorometric methods were applied to evaluate the effect of ivermectin on recombinantly expressed and on native P2X7 receptors. A biophysical characterization of ionic currents and of the pore dilation properties is provided. KEY RESULTS Unexpectedly, ivermectin potentiated currents in human monocyte-derived macrophages that endogenously express hP2X7 receptors. Likewise, currents and [Ca2+]i influx through recombinant human (hP2X7) receptors were potently enhanced by ivermectin at submaximal or saturating ATP concentrations. Since intracellular ivermectin did not mimic or prevent its activity when applied to the bath solution, the binding site of ivermectin on hP2X7 receptors appears to be accessible from the extracellular side. In contrast to currents through P2X4 receptors, ivermectin did not cause a delay in hP2X7 current decay upon ATP removal. Interestingly, NMDG+ permeability and Yo-Pro-1 uptake were not affected by ivermectin. On rat or mouse P2X7 receptors, ivermectin was only poorly effective, suggesting a species-specific mode of action. CONCLUSIONS AND IMPLICATIONS The data indicate a previously unrecognized species-specific modulation of human P2X7 receptors by ivermectin that should be considered when using this cell-biological tool in human cells and tissues. PMID:22506590

  6. Hepatitis C virus NS3-4A serine protease inhibitors: SAR of P'2 moiety with improved potency.


    Arasappan, A; Njoroge, F G; Chan, T-Y; Bennett, F; Bogen, S L; Chen, K; Gu, H; Hong, L; Jao, E; Liu, Y-T; Lovey, R G; Parekh, T; Pike, R E; Pinto, P; Santhanam, B; Venkatraman, S; Vaccaro, H; Wang, H; Yang, X; Zhu, Z; Mckittrick, B; Saksena, A K; Girijavallabhan, V; Pichardo, J; Butkiewicz, N; Ingram, R; Malcolm, B; Prongay, A; Yao, N; Marten, B; Madison, V; Kemp, S; Levy, O; Lim-Wilby, M; Tamura, S; Ganguly, A K


    We have discovered that introduction of appropriate amino acid derivatives at P'2 position improved the binding potency of P3-capped alpha-ketoamide inhibitors of HCV NS3 serine protease. X-ray crystal structure of one of the inhibitors (43) bound to the protease revealed the importance of the P'2 moiety.

  7. Temperature-induced conformational change at the catalytic site of Sulfolobus solfataricus alcohol dehydrogenase highlighted by Asn249Tyr substitution. A hydrogen/deuterium exchange, kinetic, and fluorescence quenching study.


    Secundo, Francesco; Russo, Consiglia; Giordano, Antonietta; Carrea, Giacomo; Rossi, Mosè; Raia, Carlo A


    A combination of hydrogen/deuterium exchange, fluorescence quenching, and kinetic studies was used to acquire experimental evidence for the crystallographically hypothesized increase in local flexibility which occurs in thermophilic NAD(+)-dependent Sulfolobus solfataricus alcohol dehydrogenase (SsADH) upon substitution Asn249Tyr. The substitution, located at the adenine-binding site, proved to decrease the affinity for both coenzyme and substrate, rendering the mutant enzyme 6-fold more active when compared to the wild-type enzyme [Esposito et al. (2003) FEBS Lett. 539, 14-18]. The amide H/D exchange data show that the wild-type and mutant enzymes have similar global flexibility at 22 and 60 degrees C. However, the temperature dependence of the Stern-Volmer constant determined by acrylamide quenching shows that the increase in temperature affects the local flexibility differently, since the K(SV) increment is significantly higher for the wild-type than for the mutant enzyme over the range 18-45 degrees C. Interestingly, the corresponding van't Hoff plot (log K(SV) vs 1/T) proves nonlinear for the apo and holo wild-type and apo mutant enzymes, with a break at approximately 45 degrees C in all three cases due to a conformational change affecting the tryptophan microenvironment experienced by the quencher molecules. The Arrhenius and van't Hoff plots derived from the k(cat) and K(M) thermodependence measured with cyclohexanol and NAD(+) at different temperatures display an abrupt change of slope at 45-50 degrees C. This proves more pronounced in the case of the mutant enzyme compared to the wild-type enzyme due to a conformational change in the structure rather than to an overlapping of two or more rate-limiting reaction steps with different temperature dependencies of their rate constants. Three-dimensional analysis indicates that the observed conformational change induced by temperature is associated with the flexible loops directly involved in the substrate and

  8. Characterization of ATPase Activity of P2RX2 Cation Channel

    PubMed Central

    Mittal, Rahul; Grati, M'hamed; Sedlacek, Miloslav; Yuan, Fenghua; Chang, Qing; Yan, Denise; Lin, Xi; Kachar, Bechara; Farooq, Amjad; Chapagain, Prem; Zhang, Yanbin; Liu, Xue Z.


    P2X purinergic receptors are plasma membrane ATP-dependent cation channels that are broadly distributed in the mammalian tissues. P2RX2 is a modulator of auditory sensory hair cell mechanotransduction and plays an important role in hair cell tolerance to noise. In this study, we demonstrate for the first time in vitro and in cochlear neuroepithelium, that P2RX2 possesses the ATPase activity. We observed that the P2RX2 V60L human deafness mutation alters its ability to bind ATP, while the G353R has no effect on ATP binding or hydrolysis. A non-hydrolysable ATP assay using HEK293 cells suggests that ATP hydrolysis plays a significant role in the opening and gating of the P2RX2 ion channel. Moreover, the results of structural modeling of the molecule was in agreement with our experimental observations. These novel findings suggest the intrinsic ATPase activity of P2RX2 and provide molecular insights into the channel opening. PMID:27252659

  9. Control of P2X3 channel function by metabotropic P2Y2 utp receptors in primary sensory neurons.


    Mo, Gary; Peleshok, Jennifer C; Cao, Chang-Qing; Ribeiro-da-Silva, Alfredo; Séguéla, Philippe


    Purinergic signaling contributes significantly to pain mechanisms, and the nociceptor-specific P2X3 ATP receptor channel is considered a target in pain therapeutics. Recent findings suggesting the coexpression of metabotropic P2Y receptors with P2X3 implies that ATP release triggers the activation of both ionotropic and metabotropic purinoceptors, with strong potential for functional interaction. Modulation of native P2X3 function by P2Y receptor activation was investigated in rat dorsal root ganglia (DRG) neurons using whole cell patch-clamp recordings. Application of the selective P2Y receptor agonist UTP decreased peak amplitudes of α,β-meATP-evoked homomeric P2X3-mediated currents, but had no effect on heteromeric P2X2/3-mediated currents. Treatment with phospholipase C inhibitor U73122 significantly reversed P2X3 current inhibition induced by UTP-sensitive P2Y receptor activation. We previously reported the modulation of P2X receptors by phospholipids in DRG neurons and injection of exogenous phosphatidylinositol-4,5-bisphosphate (PIP(2)) fully reverses UTP-mediated regulation of P2X3 channel activity. Pharmacological as well as functional screening of P2Y receptor subtypes indicates the predominant involvement of P2Y2 receptor in P2X3 inhibition, and immunolocalization confirms a significant cellular coexpression of P2X3 and P2Y2 in rat DRG neurons. In summary, the function of P2X3 ATP receptor can be inhibited by P2Y2-mediated depletion of PIP(2). We propose that expression of P2Y2 purinoceptor in nociceptive sensory neurons provides an homeostatic mechanism to prevent excessive ATP signaling through P2X3 receptor channels.

  10. P2 receptors activated by uracil nucleotides--an update.


    Brunschweiger, Andreas; Müller, Christa E


    Pyrimidine nucleotides, including UTP, UDP and UDP-glucose, are important signaling molecules which activate G protein-coupled membrane receptors (GPCRs) of the P2Y family. Four distinct pyrimidine nucleotide-sensitive P2Y receptor subtypes have been cloned, P2Y2, P2Y4, P2Y6 and P2Y14. P2Y2 and P2Y4 receptors are activated by UTP (the P2Y2, and the rat but not the human P2Y4 receptor are also activated by ATP), the P2Y6 receptor is activated by UDP, and the P2Y14 receptor by UDP-glucose. Furthermore, non-P2Y GPCRs, the cysteinylleukotriene receptors (CysLT1R and CysLT2R) have been described to be activated by UDP in addition to activation by cysteinylleukotrienes. While P2Y2, P2Y4, and P2Y6 receptor activation results in stimulation of phospholipase C, the P2Y14 receptor is coupled to inhibition of adenylate cyclase. Derivatives and analogs of the physiological nucleotides UTP, UDP and ATP have been synthesized and evaluated in order to obtain enzymatically stable, subtype-selective agonists. The P2Y2 receptor agonists diuridine tetraphosphate (diquafosol) and the uracil-cytosine dinucleotide denufosol are currently undergoing clinical trials for dry eye disease, retinal detachment disease, upper respiratory tract symptoms, and cystic fibrosis, respectively. The first antagonists for P2Y2 and P2Y6 receptors that appear to be selective versus other P2Y receptor subtypes have recently been described. Selective antagonists for P2Y4 and P2Y14 receptors are still lacking. Uracil nucleotide-sensitive P2Y receptor subtypes may constitute future targets for the treatment of certain cancer types, vascular diseases, inflammatory diseases, and immunomodulatory intervention. They have also been proposed to play a role in neurodegenerative diseases. This article is an updated version of "P2-Pyrimidinergic Receptors and Their Ligands" by C. E. Müller published in Curr. Pharm. Des. 2002, 8, 2353-2369.

  11. Gating properties of the P2X2a and P2X2b receptor channels: Experiments and mathematical modeling

    PubMed Central

    Khadra, Anmar; Yan, Zonghe; Coddou, Claudio; Tomić, Melanija; Stojilkovic, Stanko S.


    Adenosine triphosphate (ATP)-gated P2X2 receptors exhibit two opposite activation-dependent changes, pore dilation and pore closing (desensitization), through a process that is incompletely understood. To address this issue and to clarify the roles of calcium and the C-terminal domain in gating, we combined biophysical and mathematical approaches using two splice forms of receptors: the full-size form (P2X2aR) and the shorter form missing 69 residues in the C-terminal domain (P2X2bR). Both receptors developed conductivity for N-methyl-d-glucamine within 2–6 s of ATP application. However, pore dilation was accompanied with a decrease rather than an increase in the total conductance, which temporally coincided with rapid and partial desensitization. During sustained agonist application, receptors continued to desensitize in calcium-independent and calcium-dependent modes. Calcium-independent desensitization was more pronounced in P2X2bR, and calcium-dependent desensitization was more pronounced in P2X2aR. In whole cell recording, we also observed use-dependent facilitation of desensitization of both receptors. Such behavior was accounted for by a 16-state Markov kinetic model describing ATP binding/unbinding and activation/desensitization. The model assumes that naive receptors open when two to three ATP molecules bind and undergo calcium-independent desensitization, causing a decrease in the total conductance, or pore dilation, causing a shift in the reversal potential. In calcium-containing media, receptor desensitization is facilitated and the use-dependent desensitization can be modeled by a calcium-dependent toggle switch. The experiments and the model together provide a rationale for the lack of sustained current growth in dilating P2X2Rs and show that receptors in the dilated state can also desensitize in the presence of calcium. PMID:22547664

  12. Comparative analysis of P2Y4 and P2Y6 receptor architecture in native and transfected neuronal systems.


    D'Ambrosi, Nadia; Iafrate, Monia; Saba, Elena; Rosa, Patrizia; Volonté, Cinzia


    Although extensive studies provided molecular and pharmacological characterization of metabotropic P2Y receptors for extracellular nucleotides, little is still known about their quaternary structure. By the use of transfected cellular systems and SDS-PAGE, in our previous work we established the propensity of P2Y(4) receptor to form dimeric interactions. Here we focused on endogenously expressed P2Y(4) and P2Y(6) subtypes, comparing their oligomeric complexes under Blue Native (BN) gel electrophoresis. We provided evidence that P2Y(4) and P2Y(6) receptors form high order complexes in native neuronal phenotypes and that the oligomers can be disaggregated down to the dimeric P2Y(4) or to the dimeric and monomeric P2Y(6) receptor. Moreover, dimeric P2Y(4) and monomeric P2Y(6) proteins display selective microdomain partitioning in lipid rafts from specialized subcellular compartments such as synaptosomes. Ligand activation by UTP shifted the oligomerization of P2Y(6) but not of P2Y(4) receptor, as analysed by BN electrophoresis. Finally, whereas transfected P2Y(4) and P2Y(6) proteins homo-interact and posses the appropriate domains to associate with all P2Y(1,2,4,6,11) subtypes, in naive PC12 cells the endogenous P2Y(4) forms hetero-oligomers only with the P2Y(6) subunit. In conclusion, our results indicate that quaternary structure distinguishing P2Y(4) from P2Y(6) receptors might be crucial for specific ligand activation, membrane partitioning and consequent functional regulation.

  13. An examination of deoxyadenosine 5'(alpha-thio)triphosphate as a ligand to define P2Y receptors and its selectivity as a low potency partial agonist of the P2Y1 receptor.


    Schachter, J B; Harden, T K


    1. The functional activity of deoxyadenosine 5'(alpha-thio)triphosphate (dATP alpha S) was assessed at the cloned human P2Y1 receptor stably expressed in 1321N1 human astrocytoma cells and transiently expressed in Cos-7 cells. 2. Cells expressing the receptor responded to adenine nucleotides with an increase in [3H]-inositol phosphate accumulation. Half-maximal responses were obtained at approximately 30 nM for 2-methylthioadenosine-5'-triphosphate (2MeSATP), 300 nM for dATP alpha S, and 1000 nM for adenosine 5'-triphosphate (ATP). dATP alpha S produced a maximal response that was only 37 +/- 4% of that produced by ATP or 2MeSATP. dATP alpha S also competitively antagonized the phospholipase C response to 2MeSATP with a KB of 644 +/- 14 nM. Thus dATP alpha S acts as a low potency partial agonist at P2Y1 receptors. 3. The selectivity of dATP alpha S for P2Y1 receptors was determined by examining its capacity to activate P2Y2, P2Y4 and P2Y6 receptors also stably expressed in 1321N1 cells. Although dATP alpha S was a partial agonist at P2Y1 receptors it was a full agonist at P2Y2 receptors, albeit with a potency that was two orders of magnitude lower than at P2Y1 receptors. No agonist or antagonist activity was observed at P2Y4 and P2Y6 receptors. 4. Although [35S]-dATP alpha S bound to a relatively high density (ca 10 pmol mg-1 protein) of binding sites in membranes from 1321N1 or Cos-7 cells expressing the P2Y1 receptor, no difference in the total density of sites was observed between membranes from wild-type, empty vector-transfected, or P2Y1 receptor-expressing cells. Moreover, adenine nucleotide analogues inhibited [35S]-dATP alpha S binding with an order of potency that differed markedly from that for the accumulation of inositol phosphates in intact transfected P2Y1 receptor-expressing cells. Saturation binding experiments demonstrated multiple affinity states for [35S]-dATP alpha S binding in wild-type Cos-7 cell membranes. These data from 1321N1 and Cos-7

  14. Quantitation of the P2Y1 Receptor with a High Affinity Radiolabeled Antagonist

    PubMed Central

    Waldo, Gary L.; Corbitt, James; Boyer, José L.; Ravi, Gnana; Kim, Hak Sung; Ji, Xiao-Duo; Lacy, James; Jacobson, Kenneth A.; Harden, T. Kendall


    2-Chloro-N6-methyl-(N)-methanocarba-2′-deoxyadenosine-3′,5′-bisphosphate (MRS2279) was developed previously as a selective high-affinity, non-nucleotide P2Y1 receptor (P2Y1-R) antagonist (J Med Chem 43:829–842, 2002; Br J Pharmacol 135:2004–2010, 2002). We have taken advantage of the N6-methyl substitution in the adenine base to incorporate [3H]methylamine into the synthesis of [3H]MRS2279 to high (89 Ci/mmol) specific radioactivity and have used this molecule as a radioligand for the P2Y1-R. [3H]MRS2279 bound to membranes from Sf9 insect cells expressing recombinant human P2Y1-R but not to membranes from wild-type Sf9 cells or Sf9 cells expressing high levels of recombinant P2Y2 or P2Y12 receptors. Equilibrium binding of [3H]MRS2279 to P2Y1-R expressed in Sf9 membranes was with a high affinity (Kd = 8 nM) essentially identical to the apparent affinity of MRS2279 determined previously in studies of P2Y1-R–promoted inositol phosphate accumulation or platelet aggregation. A kinetically derived Kd calculated from independent determinations of the rate constants of association (7.15 × 107 M−1 min−1) and dissociation (0.72 min−1) of [3H]MRS2279 also was in good agreement with the Kd derived from equilibrium binding studies. Competition binding assays with [3H]MRS2279 and P2Y1-R expressing Sf9 cell membranes revealed Ki values for the P2Y1-R antagonists MRS2279 (Ki = 13 nM), N6-methyl-2′-deoxyadenosine-3′,5′-bisphosphate (MRS2179; Ki = 84 nM), adenosine-3′, 5′-bisphosphate (Ki = 900 nM), and pyridoxal phosphate-6-azophenyl-2′,4′-disulfonic acid (Ki = 6 µM) that were in good agreement with antagonist activities of these molecules previously determined at the P2Y1-R in intact tissues. Moreover, [3H]MRS2279 also bound with high affinity (Kd = 4–8 nM) to Chinese hamster ovary (CHO) or 1321N1 human astrocytoma cells stably expressing the human P2Y1-R, but specific binding was not observed in wild-type CHO or 1321N1 cells. [3H]MRS2279 bound

  15. A hydrophilic cation-binding protein of Arabidopsis thaliana, AtPCaP1, is localized to plasma membrane via N-myristoylation and interacts with calmodulin and the phosphatidylinositol phosphates PtdIns(3,4,5)P(3) and PtdIns(3,5)P(2).


    Nagasaki, Nahoko; Tomioka, Rie; Maeshima, Masayoshi


    A hydrophilic cation-binding protein, PCaP1, was found to be stably bound to the plasma membrane in Arabidopsis thaliana. PCaP1 was quantified to account for 0.03-0.08% of the crude membrane fractions from roots and shoots. Its homologous protein was detected in several plant species. We investigated the mechanism of membrane association of PCaP1 by transient expression of fusion protein with green fluorescent protein. The amino-terminal sequence of 27 residues of PCaP1 had a potential to localize the fusion protein with green fluorescent protein to the plasma membrane, and the substitution of Gly at position 2 with Ala resulted in the cytoplasmic localization of PCaP1. When PCaP1 was expressed in the in vitro transcription/translation system with [(3)H]myristic acid, the label was incorporated into PCaP1, but not into a mutant PCaP1 with Gly2 replaced by Ala. These results indicate that PCaP1 tightly binds to the plasma membrane via N-myristoylation at Gly2. We examined the binding capacity with phosphatidylinositol phosphates (PtdInsPs), and found that PCaP1 selectively interacts with phosphatidylinositol 3,5-bisphosphate and phosphatidylinositol 3,4,5-triphosphate. Competition assay with the N-terminal peptide and mutational analysis revealed that PCaP1 interacts with these two PtdInsPs at the N-terminal part. Interaction of PCaP1 with the membrane and PtdInsPs was not altered in the presence of Ca(2+) at physiological concentrations. Furthermore, calmodulin associated with PCaP1 in a Ca(2+)-dependent manner, and its association weakened the interaction of PCaP1 with PtdInsPs. These results indicate that the N-terminal part is essential for both N-myristoylation and interaction with PtdInsPs, and that PCaP1 may be involved in intracellular signalling through interaction with PtdInsPs and calmodulin.

  16. Structural and functional evolution of the P2Y12-like receptor group

    PubMed Central

    Hermsdorf, Thomas; Engemaier, Eva; Engel, Kathrin; Liebscher, Ines; Thor, Doreen; Zierau, Klaas; Römpler, Holger; Schulz, Angela


    Metabotropic pyrimidine and purine nucleotide receptors (P2Y receptors) belong to the superfamily of G protein-coupled receptors (GPCR). They are distinguishable from adenosine receptors (P1) as they bind adenine and/or uracil nucleotide triphosphates or diphosphates depending on the subtype. Over the past decade, P2Y receptors have been cloned from a variety of tissues and species, and as many as eight functional subtypes have been characterized. Most recently, several members of the P2Y12-like receptor group, which includes the clopidogrel-sensitive ADP receptor P2Y12, have been deorphanized. The P2Y12-like receptor group comprises several structurally related GPCR which, however, display heterogeneous agonist specificity including nucleotides, their derivatives, and lipids. Besides the established function of P2Y12 in platelet activation, expression in macrophages, neuronal and glial cells as well as recent results from functional studies implicate that several members of this group may have specific functions in neurotransmission, inflammation, chemotaxis, and response to tissue injury. This review focuses specifically on the structure-function relation and shortly summarizes some aspects of the physiological relevance of P2Y12-like receptor members. PMID:18404440

  17. Transition strategies from cangrelor to oral platelet P2Y12 receptor antagonists.


    Schneider, David J


    Cangrelor is the first parenteral antagonist of the platelet P2Y12 receptor. This direct-acting antagonist of the platelet P2Y12 receptor should be considered an adjunct to a percutaneous coronary intervention in patients who have not been adequately pretreated with platelet P2Y12 receptor antagonists at the time of the procedure. The use of cangrelor requires transition to an oral platelet P2Y12 receptor antagonist. Transition strategies have been developed on the basis of pharmacologic characteristics of platelet P2Y12 receptor antagonists, results of pharmacodynamic studies, and results from clinical trials. Cangrelor blocks the binding to the platelet P2Y12 receptor of the active metabolite of the thienopyridines, clopidogrel and prasugrel. The active metabolite of thienopyridines is present in blood for a short interval after administration. For this reason, clopidogrel should be administered after cangrelor is stopped. Prasugrel can be administered at the end of the cangrelor infusion or up to 30 min before cangrelor is stopped. Ticagrelor is also a reversible direct-acting antagonist of the platelet P2Y12 receptor. Because there is no interaction between ticagrelor and cangrelor, ticagrelor can be administered before or during the infusion of cangrelor.

  18. Transcription factor IRF5 drives P2X4R+-reactive microglia gating neuropathic pain

    PubMed Central

    Masuda, Takahiro; Iwamoto, Shosuke; Yoshinaga, Ryohei; Tozaki-Saitoh, Hidetoshi; Nishiyama, Akira; Mak, Tak W.; Tamura, Tomohiko; Tsuda, Makoto; Inoue, Kazuhide


    In response to neuronal injury or disease, microglia adopt distinct reactive phenotypes via the expression of different sets of genes. Spinal microglia expressing the purinergic P2X4 receptor (P2X4R) after peripheral nerve injury (PNI) are implicated in neuropathic pain. Here we show that interferon regulatory factor-5 (IRF5), which is induced in spinal microglia after PNI, is responsible for direct transcriptional control of P2X4R. Upon stimulation of microglia by fibronectin, IRF5 induced de novo expression of P2X4R by directly binding to the promoter region of the P2rx4 gene. Mice lacking Irf5 did not upregulate spinal P2X4R after PNI, and also exhibited substantial resistance to pain hypersensitivity. Furthermore, we found that expression of IRF5 in microglia is regulated by IRF8. Thus, an IRF8-IRF5 transcriptional axis may contribute to shifting spinal microglia toward a P2X4R-expressing reactive state after PNI. These results may provide a new target for treating neuropathic pain. PMID:24818655

  19. Differential expression of porins OmpP2A and OmpP2B of Haemophilus ducreyi.


    Prather, Derrick T; Bains, Manjeet; Hancock, Robert E W; Filiatrault, Melanie J; Campagnari, Anthony A


    Haemophilus ducreyi is a strict human pathogen and the causative agent of the sexually transmitted disease chancroid. The genome of the human-passaged strain of H. ducreyi (35000HP) contains two homologous genes whose protein products have estimated molecular masses of 46 and 43 kDa. A comparative analysis of the deduced amino acid sequences revealed that these proteins share 27 to 33% identity to the outer membrane protein P2 (OmpP2), a major porin of Haemophilus influenzae. Therefore, these proteins have been designated OmpP2A and OmpP2B, respectively. The detection of ompP2A and ompP2B transcripts by reverse transcriptase PCR indicated that these genes were independently transcribed in H. ducreyi 35000HP. Western blot analysis of outer membrane proteins isolated from a geographically diverse collection of H. ducreyi clinical isolates revealed that OmpP2A and OmpP2B were differentially expressed among these strains. Although PCR analysis suggested that ompP2A and ompP2B were conserved among the strains tested, the differential expression observed was due to nucleotide additions and partial gene deletions. Purified OmpP2A and OmpP2B were isolated under nondenaturing conditions, and subsequent analysis demonstrated that these two proteins exhibited porin activity. OmpP2A and OmpP2B are the first porins described for H. ducreyi.

  20. Structural and Molecular Modeling Features of P2X Receptors

    PubMed Central

    Alves, Luiz Anastacio; da Silva, João Herminio Martins; Ferreira, Dinarte Neto Moreira; Fidalgo-Neto, Antonio Augusto; Teixeira, Pedro Celso Nogueira; de Souza, Cristina Alves Magalhães; Caffarena, Ernesto Raúl; de Freitas, Mônica Santos


    Currently, adenosine 5′-triphosphate (ATP) is recognized as the extracellular messenger that acts through P2 receptors. P2 receptors are divided into two subtypes: P2Y metabotropic receptors and P2X ionotropic receptors, both of which are found in virtually all mammalian cell types studied. Due to the difficulty in studying membrane protein structures by X-ray crystallography or NMR techniques, there is little information about these structures available in the literature. Two structures of the P2X4 receptor in truncated form have been solved by crystallography. Molecular modeling has proven to be an excellent tool for studying ionotropic receptors. Recently, modeling studies carried out on P2X receptors have advanced our knowledge of the P2X receptor structure-function relationships. This review presents a brief history of ion channel structural studies and shows how modeling approaches can be used to address relevant questions about P2X receptors. PMID:24637936

  1. Collecting and Reporting P2 Results: Regional Measurement Guidance

    EPA Pesticide Factsheets

    Measuring results is an essential component of any successful P2 program and is one way to determine the success of a technical assistance or training effort. This PDF defines some terms of P2 measurement.

  2. Atomic resolution view into the structure–function relationships of the human myelin peripheral membrane protein P2

    PubMed Central

    Ruskamo, Salla; Yadav, Ravi P.; Sharma, Satyan; Lehtimäki, Mari; Laulumaa, Saara; Aggarwal, Shweta; Simons, Mikael; Bürck, Jochen; Ulrich, Anne S.; Juffer, André H.; Kursula, Inari; Kursula, Petri


    P2 is a fatty acid-binding protein expressed in vertebrate peripheral nerve myelin, where it may function in bilayer stacking and lipid transport. P2 binds to phospholipid membranes through its positively charged surface and a hydrophobic tip, and accommodates fatty acids inside its barrel structure. The structure of human P2 refined at the ultrahigh resolution of 0.93 Å allows detailed structural analyses, including the full organization of an internal hydrogen-bonding network. The orientation of the bound fatty-acid carboxyl group is linked to the protonation states of two coordinating arginine residues. An anion-binding site in the portal region is suggested to be relevant for membrane interactions and conformational changes. When bound to membrane multilayers, P2 has a preferred orientation and is stabilized, and the repeat distance indicates a single layer of P2 between membranes. Simulations show the formation of a double bilayer in the presence of P2, and in cultured cells wild-type P2 induces membrane-domain formation. Here, the most accurate structural and functional view to date on P2, a major component of peripheral nerve myelin, is presented, showing how it can interact with two membranes simultaneously while going through conformational changes at its portal region enabling ligand transfer. PMID:24419389

  3. Modeling ligand recognition at the P2Y12 receptor in light of X-ray structural information

    NASA Astrophysics Data System (ADS)

    Paoletta, Silvia; Sabbadin, Davide; von Kügelgen, Ivar; Hinz, Sonja; Katritch, Vsevolod; Hoffmann, Kristina; Abdelrahman, Aliaa; Straßburger, Jens; Baqi, Younis; Zhao, Qiang; Stevens, Raymond C.; Moro, Stefano; Müller, Christa E.; Jacobson, Kenneth A.


    The G protein-coupled P2Y12 receptor (P2Y12R) is an important antithrombotic target and of great interest for pharmaceutical discovery. Its recently solved, highly divergent crystallographic structures in complex either with nucleotides (full or partial agonist) or with a nonnucleotide antagonist raise the question of which structure is more useful to understand ligand recognition. Therefore, we performed extensive molecular modeling studies based on these structures and mutagenesis, to predict the binding modes of major classes of P2Y12R ligands previously reported. Various nucleotide derivatives docked readily to the agonist-bound P2Y12R, but uncharged nucleotide-like antagonist ticagrelor required a hybrid receptor resembling the agonist-bound P2Y12R except for the top portion of TM6. Supervised molecular dynamics (SuMD) of ticagrelor binding indicated interactions with the extracellular regions of P2Y12R, defining possible meta-binding sites. Ureas, sulfonylureas, sulfonamides, anthraquinones and glutamic acid piperazines docked readily to the antagonist-bound P2Y12R. Docking dinucleotides at both agonist- and antagonist-bound structures suggested interactions with two P2Y12R pockets. Thus, our structure-based approach consistently rationalized the main structure-activity relationships within each ligand class, giving useful information for designing improved ligands.

  4. Identification of chikungunya virus nsP2 protease inhibitors using structure-base approaches.


    Nguyen, Phuong T V; Yu, Haibo; Keller, Paul A


    The nsP2 protease of chikungunya virus (CHIKV) is one of the essential components of viral replication and it plays a crucial role in the cleavage of polyprotein precursors for the viral replication process. Therefore, it is gaining attention as a potential drug design target against CHIKV. Based on the recently determined crystal structure of the nsP2 protease of CHIKV, this study identified potential inhibitors of the virus using structure-based approaches with a combination of molecular docking, virtual screening and molecular dynamics (MD) simulations. The top hit compounds from database searching, using the NCI Diversity Set II, with targeting at five potential binding sites of the nsP2 protease, were identified by blind dockings and focused dockings. These complexes were then subjected to MD simulations to investigate the stability and flexibility of the complexes and to gain a more detailed insight into the interactions between the compounds and the enzyme. The hydrogen bonds and hydrophobic contacts were characterized for the complexes. Through structural alignment, the catalytic residues Cys1013 and His1083 were identified in the N-terminal region of the nsP2 protease. The absolute binding free energies were estimated by the linear interaction energy approach and compared with the binding affinities predicted with docking. The results provide valuable information for the development of inhibitors for CHIKV.

  5. Identification of a new dysfunctional platelet P2Y12 receptor variant associated with bleeding diathesis

    PubMed Central

    Lecchi, Anna; Razzari, Cristina; Paoletta, Silvia; Dupuis, Arnaud; Nakamura, Lea; Ohlmann, Philippe; Gachet, Christian; Jacobson, Kenneth A.; Zieger, Barbara


    Defects of the platelet P2Y12 receptor (P2Y12R) for adenosine diphosphate (ADP) are associated with increased bleeding risk. The study of molecular abnormalities associated with inherited qualitative defects of the P2Y12R protein is useful to unravel structure-function relationships of the receptor. We describe the case of 2 brothers, sons of first cousins, with lifelong history of abnormal bleeding, associated with dysfunctional P2Y12R and a previously undescribed missense mutation in the encoding gene. ADP (4-20 µM)–induced aggregation of patients’ platelets was markedly reduced and rapidly reversible. Other agonists induced borderline-normal aggregation. Inhibition of vasodilator-stimulated phosphoprotein phosphorylation and prostaglandin E1–induced increase in cyclic adenosine monophosphate (cAMP) by ADP was impaired, whereas inhibition of cAMP increase by epinephrine was normal. [3H]PSB-0413, a selective P2Y12R antagonist, bound to a normal number of binding sites; however, its affinity, and that of the agonists ADP and 2-methylthio-adenosine-5′-diphosphate, was reduced. Patients’ DNA showed a homozygous c.847T>A substitution that changed the codon for His-187 to Gln (p.His187Gln). Crystallographic data and molecular modeling studies indicated that His187 in transmembrane 5 is important for agonist and nucleotide antagonist binding and located in a region undergoing conformational changes. These studies delineate a region of P2Y12R required for normal function after ADP binding. PMID:25428217

  6. Providing VoD Streaming Using P2P Networks

    NASA Astrophysics Data System (ADS)

    Pedro Muñoz-Gea, Juan; Malgosa-Sanahuja, Josemaria; Manzanares-Lopez, Pilar; Carlos Sanchez-Aarnoutse, Juan

    Overlays and P2P systems, initially developed to support IP multicast and file-sharing, have moved beyond that functionality. They are also proving to be key technologies for the delivery of video streaming. Recently, there have been a number of successful deployments for "live" P2P streaming. However, the question remains open whether similar P2P technologies can be used to provide VoD (Video-On-Demand) services. A P2P VoD service is more challenging to design than a P2P live streaming system because the system should allow users arriving at arbitrary times to watch (arbitrary parts of) the video.

  7. P2Y Receptors Sensitize Mouse and Human Colonic Nociceptors

    PubMed Central

    Hockley, James R. F.; Tranter, Michael M.; McGuire, Cian; Boundouki, George; Cibert-Goton, Vincent; Thaha, Mohamed A.; Blackshaw, L. Ashley; Michael, Gregory J.; Baker, Mark D.; Knowles, Charles H.; Winchester, Wendy J.


    Activation of visceral nociceptors by inflammatory mediators contributes to visceral hypersensitivity and abdominal pain associated with many gastrointestinal disorders. Purine and pyrimidine nucleotides (e.g., ATP and UTP) are strongly implicated in this process following their release from epithelial cells during mechanical stimulation of the gut, and from immune cells during inflammation. Actions of ATP are mediated through both ionotropic P2X receptors and metabotropic P2Y receptors. P2X receptor activation causes excitation of visceral afferents; however, the impact of P2Y receptor activation on visceral afferents innervating the gut is unclear. Here we investigate the effects of stimulating P2Y receptors in isolated mouse colonic sensory neurons, and visceral nociceptor fibers in mouse and human nerve-gut preparations. Additionally, we investigate the role of Nav1.9 in mediating murine responses. The application of UTP (P2Y2 and P2Y4 agonist) sensitized colonic sensory neurons by increasing action potential firing to current injection and depolarizing the membrane potential. The application of ADP (P2Y1, P2Y12, and P2Y13 agonist) also increased action potential firing, an effect blocked by the selective P2Y1 receptor antagonist MRS2500. UTP or ADP stimulated afferents, including mouse and human visceral nociceptors, in nerve-gut preparations. P2Y1 and P2Y2 transcripts were detected in 80% and 56% of retrogradely labeled colonic neurons, respectively. Nav1.9 transcripts colocalized in 86% of P2Y1-positive and 100% of P2Y2-positive colonic neurons, consistent with reduced afferent fiber responses to UTP and ADP in Nav1.9−/− mice. These data demonstrate that P2Y receptor activation stimulates mouse and human visceral nociceptors, highlighting P2Y-dependent mechanisms in the generation of visceral pain during gastrointestinal disease. SIGNIFICANCE STATEMENT Chronic visceral pain is a debilitating symptom of many gastrointestinal disorders. The activation of

  8. aP2-Cre-Mediated Inactivation of Estrogen Receptor Alpha Causes Hydrometra

    PubMed Central

    Antonson, Per; Matic, Marko; Portwood, Neil; Kuiper, Raoul V.; Bryzgalova, Galyna; Gao, Hui; Windahl, Sara H.; Humire, Patricia; Ohlsson, Claes; Berggren, Per-Olof; Gustafsson, Jan-Åke; Dahlman-Wright, Karin


    In this study we describe the reproductive phenotypes of a novel mouse model in which Cre-mediated deletion of ERα is regulated by the aP2 (fatty acid binding protein 4) promoter. ERα-floxed mice were crossed with transgenic mice expressing Cre-recombinase under the control of the aP2 promoter to generate aP2-Cre/ERαflox/flox mice. As expected, ERα mRNA levels were reduced in adipose tissue, but in addition we also detected an 80% reduction of ERα levels in the hypothalamus of aP2-Cre/ERαflox/flox mice. Phenotypic analysis revealed that aP2-Cre/ERαflox/flox female mice were infertile. In line with this, aP2-Cre/ERαflox/flox female mice did not cycle and presented 3.8-fold elevated estrogen levels. That elevated estrogen levels were associated with increased estrogen signaling was evidenced by increased mRNA levels of the estrogen-regulated genes lactoferrin and aquaporin 5 in the uterus. Furthermore, aP2-Cre/ERαflox/flox female mice showed an accumulation of intra-uterine fluid, hydrometra, without overt indications for causative anatomical anomalies. However, the vagina and cervix displayed advanced keratosis with abnormal quantities of accumulating squamous epithelial cells suggesting functional obstruction by keratin plugs. Importantly, treatment of aP2-Cre/ERαflox/flox mice with the aromatase inhibitor Letrozole caused regression of the hydrometra phenotype linking increased estrogen levels to the observed phenotype. We propose that in aP2-Cre/ERαflox/flox mice, increased serum estrogen levels cause over-stimulation in the uterus and genital tracts resulting in hydrometra and vaginal obstruction. PMID:24416430

  9. P2X3 Receptors and Sensory Transduction

    NASA Astrophysics Data System (ADS)

    Kennedy, Charles

    It has been known for many years that exogenously administered adenosine 5 -triphosphate (ATP) evokes acute pain, but the physiological and pathophysiological roles of endogenous ATP in nociceptive signalling are only now becoming clear. ATP produces its effects through P2X and P2Y receptors, and the P2X3 receptor is of notable importance. It shows a selective expression, at high levels in nociceptive sensory neurons, where it forms functional receptors on its own and in combination with the P2X2 receptor. Recent studies have used gene knockout methods, antisense oligonucleotides, small interfering RNA technologies, and a novel selective P2X3 antagonist, A-317491, to show that P2X3 receptors play a prominent role in both chronic inflammatory and neuropathic pain. Several other P2X subunits also appear to be expressed in sensory neurons and there is evidence for functional P2X1/5 or P2X2/6 heteromers in some of these. These data indicate that P2X receptors, particularly the P2X3 subtype, could be targetted in the search for new, effective analgesics.

  10. P2X receptors: targets for novel analgesics?


    Kennedy, Charles


    The ability of adenosine 5'-triphosphate (ATP) to evoke acute pain has been known for many years, but its role in nociceptive signaling is only now becoming clear. ATP acts via P2X and P2Y receptors, and of particular importance here is the P2X(3) receptor. It is expressed selectively at high levels in nociceptive sensory neurons, where it forms functional receptors on its own and in combination with the P2X(2) receptor. Recent reports using gene knockout methods; antisense oligonucleotide and small, interfering RNA technologies; and a novel, selective P2X(3) antagonist, A-317491, show that P2X(3) receptors are involved in chronic inflammatory and neuropathic pain. The mRNA for other P2X subunits is also found in sensory neurons, and there is evidence for functional P2X(1/5) or P2X(2/6) heteromers in some of these. These data support the possibility that P2X receptors, particularly the P2X(3) subtype, could be targeted in the search for new, effective analgesics.

  11. Risk Management of P2P Internet Financing Service Platform

    NASA Astrophysics Data System (ADS)

    Yalei, Li


    Since 2005, the world’s first P2P Internet financing service platform Zopa in UK was introduced, in the development of “Internet +” trend, P2P Internet financing service platform has been developed rapidly. In 2007, China’s first P2P platform “filming loan” was established, marking the P2P Internet financing service platform to enter China and the rapid development. At the same time, China’s P2P Internet financing service platform also appeared in different forms of risk. This paper focuses on the analysis of the causes of risk of P2P Internet financing service platform and the performance of risk management process. It provides a solution to the Internet risk management plan, and explains the risk management system of the whole P2P Internet financing service platform and the future development direction.

  12. Ion access pathway to the transmembrane pore in P2X receptor channels

    PubMed Central

    Robertson, Janice L.; Li, Mufeng; Silberberg, Shai D.


    P2X receptors are trimeric cation channels that open in response to the binding of adenosine triphosphate (ATP) to a large extracellular domain. The x-ray structure of the P2X4 receptor from zebrafish (zfP2X4) receptor reveals that the extracellular vestibule above the gate opens to the outside through lateral fenestrations, providing a potential pathway for ions to enter and exit the pore. The extracellular region also contains a void at the central axis, providing a second potential pathway. To investigate the energetics of each potential ion permeation pathway, we calculated the electrostatic free energy by solving the Poisson-Boltzmann equation along each of these pathways in the zfP2X4 crystal structure and a homology model of rat P2X2 (rP2X2). We found that the lateral fenestrations are energetically favorable for monovalent cations even in the closed-state structure, whereas the central pathway presents strong electrostatic barriers that would require structural rearrangements to allow for ion accessibility. To probe ion accessibility along these pathways in the rP2X2 receptor, we investigated the modification of introduced Cys residues by methanethiosulfonate (MTS) reagents and constrained structural changes by introducing disulfide bridges. Our results show that MTS reagents can permeate the lateral fenestrations, and that these become larger after ATP binding. Although relatively small MTS reagents can access residues in one of the vestibules within the central pathway, no reactive positions were identified in the upper region of this pathway, and disulfide bridges that constrain movements in that region do not prevent ion conduction. Collectively, these results suggest that ions access the pore using the lateral fenestrations, and that these breathe as the channel opens. The accessibility of ions to one of the chambers in the central pathway likely serves a regulatory function. PMID:21624948

  13. ATP induces P2X7 receptor-independent cytokine and chemokine expression through P2X1 and P2X3 receptors in murine mast cells.


    Bulanova, Elena; Budagian, Vadim; Orinska, Zane; Koch-Nolte, Friedrich; Haag, Friedrich; Bulfone-Paus, Silvia


    Extracellular ATP mediates a diverse array of biological responses in many cell types and tissues, including immune cells. We have demonstrated that ATP induces purinergic receptor P2X(7) mediated membrane permeabilization, apoptosis, and cytokine expression in murine mast cells (MCs). Here, we report that MCs deficient in the expression of the P2X(7) receptor are resistant to the ATP-induced membrane permeabilization and apoptosis. However, ATP affects the tyrosine phosphorylation pattern of P2X(7)knockout cells, leading to the activation of ERK1/2. Furthermore, ATP induces expression of several cytokines and chemokines in these cells, including IL-4, IL-6, IFN-gamma, TNF-alpha, RANTES, and MIP-2, at the mRNA level. In addition, the release of IL-6 and IL-13 to cell-conditioned medium was confirmed by ELISA. The ligand selectivity and pharmacological profile indicate the involvement of two P2X family receptors, P2X(1) and P2X(3). Thus, depending on genetic background, particular tissue microenvironment, and ATP concentration, MCs can presumably engage different P2X receptor subtypes, which may result in functionally distinct biological responses to extracellular nucleotides. This finding highlights a novel level of complexity in the sophisticated biology of MCs and may facilitate the development of new therapeutic approaches to modulate MC activities.

  14. Mechanism of action of species-selective P2X7 receptor antagonists

    PubMed Central

    Michel, Anton D; Ng, Sin-Wei; Roman, Shilina; Clay, William C; Dean, David K; Walter, Daryl S


    Background and purpose: AZ11645373 and N-{2-methyl-5-[(1R, 5S)-9-oxa-3,7-diazabicyclo[3.3.1]non-3-ylcarbonyl]phenyl}-2-tricyclo[,7]dec-1-ylacetamide hydrochloride (compound-22) are recently described P2X7 receptor antagonists. In this study we have further characterized these compounds to determine their mechanism of action and interaction with other species orthologues. Experimental approach: Antagonist effects at recombinant and chimeric P2X7 receptors were assessed by ethidium accumulation and radioligand-binding studies. Key results: AZ11645373 and compound-22 were confirmed as selective non-competitive antagonists of human or rat P2X7 receptors respectively. Both compounds were weak antagonists of the mouse and guinea-pig P2X7 receptors and, for each compound, their potency estimates at human and dog P2X7 receptors were similar. The potency of compound-22 was moderately temperature-dependent while that of AZ11645373 was not. The antagonist effects of both compounds were slowly reversible and were not prevented by decavanadate, suggesting that they were allosteric antagonists. Indeed, the compounds competed for binding sites labelled by an allosteric radio-labelled P2X7 receptor antagonist. The species selectivity of AZ11645373, but not compound-22, was influenced by the nature of the amino acid at position 95 of the P2X7 receptor. N2-(3,4-difluorophenyl)-N1-[2-methyl-5-(1-piperazinylmethyl)phenyl]glycinamide dihydrochloride, a positive allosteric modulator of the rat receptor, reduced the potency of compound-22 at the rat receptor but had little effect on the actions of AZ11645373. Conclusions: AZ11645373 and compound-22 are allosteric antagonists of human and rat P2X7 receptors respectively. The differential interaction of the two compounds with the receptor suggests there may be more than one allosteric regulatory site on the P2X7 receptor at which antagonists can bind and affect receptor function. PMID:19309360

  15. P2Y2 receptors regulate osteoblast mechanosensitivity during fluid flow.


    Gardinier, Joseph; Yang, Weidong; Madden, Gregory R; Kronbergs, Andris; Gangadharan, Vimal; Adams, Elizabeth; Czymmek, Kirk; Duncan, Randall L


    Mechanical stimulation of osteoblasts activates many cellular mechanisms including the release of ATP. Binding of ATP to purinergic receptors is key to load-induced osteogenesis. Osteoblasts also respond to fluid shear stress (FSS) with increased actin stress fiber formation (ASFF) that we postulate is in response to activation of the P2Y2 receptor (P2Y2R). Furthermore, we predict that ASFF increases cell stiffness and reduces the sensitivity to further mechanical stimulation. We found that small interfering RNA (siRNA) suppression of P2Y2R attenuated ASFF in response to FSS and ATP treatment. In addition, RhoA GTPase was activated within 15 min after the onset of FSS or ATP treatment and mediated ASFF following P2Y2R activation via the Rho kinase (ROCK)1/LIM kinase 2/cofilin pathway. We also observed that ASFF in response to FSS or ATP treatment increased the cell stiffness and was prevented by knocking down P2Y2R. Finally, we confirmed that the enhanced cell stiffness and ASFF in response to RhoA GTPase activation during FSS drastically reduced the mechanosensitivity of the osteoblasts based on the intracellular Ca(2+) concentration ([Ca(2+)]i) response to consecutive bouts of FSS. These data suggest that osteoblasts can regulate their mechanosensitivity to continued load through P2Y2R activation of the RhoA GTPase signaling cascade, leading to ASFF and increased cell stiffness. Copyright © 2014 the American Physiological Society.

  16. P2Y2 receptors regulate osteoblast mechanosensitivity during fluid flow

    PubMed Central

    Gardinier, Joseph; Yang, Weidong; Madden, Gregory R.; Kronbergs, Andris; Gangadharan, Vimal; Adams, Elizabeth; Czymmek, Kirk


    Mechanical stimulation of osteoblasts activates many cellular mechanisms including the release of ATP. Binding of ATP to purinergic receptors is key to load-induced osteogenesis. Osteoblasts also respond to fluid shear stress (FSS) with increased actin stress fiber formation (ASFF) that we postulate is in response to activation of the P2Y2 receptor (P2Y2R). Furthermore, we predict that ASFF increases cell stiffness and reduces the sensitivity to further mechanical stimulation. We found that small interfering RNA (siRNA) suppression of P2Y2R attenuated ASFF in response to FSS and ATP treatment. In addition, RhoA GTPase was activated within 15 min after the onset of FSS or ATP treatment and mediated ASFF following P2Y2R activation via the Rho kinase (ROCK)1/LIM kinase 2/cofilin pathway. We also observed that ASFF in response to FSS or ATP treatment increased the cell stiffness and was prevented by knocking down P2Y2R. Finally, we confirmed that the enhanced cell stiffness and ASFF in response to RhoA GTPase activation during FSS drastically reduced the mechanosensitivity of the osteoblasts based on the intracellular Ca2+ concentration ([Ca2+]i) response to consecutive bouts of FSS. These data suggest that osteoblasts can regulate their mechanosensitivity to continued load through P2Y2R activation of the RhoA GTPase signaling cascade, leading to ASFF and increased cell stiffness. PMID:24696143

  17. Imaging P2X4 receptor subcellular distribution, trafficking, and regulation using P2X4-pHluorin.


    Xu, Ji; Chai, Hua; Ehinger, Konstantin; Egan, Terrance M; Srinivasan, Rahul; Frick, Manfred; Khakh, Baljit S


    P2X4 receptors are adenosine triphosphate (ATP)-gated cation channels present on the plasma membrane (PM) and also within intracellular compartments such as vesicles, vacuoles, lamellar bodies (LBs), and lysosomes. P2X4 receptors in microglia are up-regulated in epilepsy and in neuropathic pain; that is to say, their total and/or PM expression levels increase. However, the mechanisms underlying up-regulation of microglial P2X4 receptors remain unclear, in part because it has not been possible to image P2X4 receptor distribution within, or trafficking between, cellular compartments. Here, we report the generation of pH-sensitive fluorescently tagged P2X4 receptors that permit evaluations of cell surface and total receptor pools. Capitalizing on information gained from zebrafish P2X4.1 crystal structures, we designed a series of mouse P2X4 constructs in which a pH-sensitive green fluorescent protein, superecliptic pHluorin (pHluorin), was inserted into nonconserved regions located within flexible loops of the P2X4 receptor extracellular domain. One of these constructs, in which pHluorin was inserted after lysine 122 (P2X4-pHluorin123), functioned like wild-type P2X4 in terms of its peak ATP-evoked responses, macroscopic kinetics, calcium flux, current-voltage relationship, and sensitivity to ATP. P2X4-pHluorin123 also showed pH-dependent fluorescence changes, and was robustly expressed on the membrane and within intracellular compartments. P2X4-pHluorin123 identified cell surface and intracellular fractions of receptors in HEK-293 cells, hippocampal neurons, C8-B4 microglia, and alveolar type II (ATII) cells. Furthermore, it showed that the subcellular fractions of P2X4-pHluorin123 receptors were cell and compartment specific, for example, being larger in hippocampal neuron somata than in C8-B4 cell somata, and larger in C8-B4 microglial processes than in their somata. In ATII cells, P2X4-pHluorin123 showed that P2X4 receptors were secreted onto the PM when LBs

  18. Purinergic P2 receptors as targets for novel analgesics.


    Burnstock, Geoffrey


    Following hints in the early literature about adenosine 5'-triphosphate (ATP) injections producing pain, an ion-channel nucleotide receptor was cloned in 1995, P2X3 subtype, which was shown to be localized predominantly on small nociceptive sensory nerves. Since then, there has been an increasing number of papers exploring the role of P2X3 homomultimer and P2X2/3 heteromultimer receptors on sensory nerves in a wide range of organs, including skin, tongue, tooth pulp, intestine, bladder, and ureter that mediate the initiation of pain. Purinergic mechanosensory transduction has been proposed for visceral pain, where ATP released from epithelial cells lining the bladder, ureter, and intestine during distension acts on P2X3 and P2X2/3, and possibly P2Y, receptors on subepithelial sensory nerve fibers to send messages to the pain centers in the brain as well as initiating local reflexes. P1, P2X, and P2Y receptors also appear to be involved in nociceptive neural pathways in the spinal cord. P2X4 receptors on spinal microglia have been implicated in allodynia. The involvement of purinergic signaling in long-term neuropathic pain and inflammation as well as acute pain is discussed as well as the development of P2 receptor antagonists as novel analgesics.

  19. P2 receptor subtypes in the cardiovascular system.

    PubMed Central

    Kunapuli, S P; Daniel, J L


    Extracellular nucleotides have been implicated in a number of physiological functions. Nucleotides act on cell-surface receptors known as P2 receptors, of which several subtypes have been cloned. Both ATP and ADP are stored in platelets and are released upon platelet activation. Furthermore, nucleotides are also released from damaged or broken cells. Thus during vascular injury nucleotides play an important role in haemostasis through activation of platelets, modulation of vascular tone, recruitment of neutrophils and monocytes to the site of injury, and facilitation of adhesion of leucocytes to the endothelium. Nucleotides also moderate these functions by generating nitric oxide and prostaglandin I2 through activation of endothelial cells, and by activating different receptor subtypes on vascular smooth muscle cells. In the heart, P2 receptors regulate contractility through modulation of L-type Ca2+ channels, although the molecular mechanisms involved are still under investigation. Classical pharmacological studies have identified several P2 receptor subtypes in the cardiovascular system. Molecular pharmacological studies have clarified the nature of some of these receptors, but have complicated the picture with others. In platelets, the classical P2T receptor has now been resolved into three P2 receptor subtypes: the P2Y1, P2X1 and P2TAC receptors (the last of these, which is coupled to the inhibition of adenylate cyclase, is yet to be cloned). In peripheral blood leucocytes, endothelial cells, vascular smooth muscle cells and cardiomyocytes, the effects of classical P2X, P2Y and P2U receptors have been found to be mediated by more than one P2 receptor subtype. However, the exact functions of these multiple receptor subtypes remain to be understood, as P2-receptor-selective agonists and antagonists are still under development. PMID:9841859

  20. Collisional quenching of Pb 6p2 3P1 and 6p2 3P2 metastables by ground state Pb atoms

    NASA Astrophysics Data System (ADS)

    Reiser, C.; Djeu, N.; Burnham, R.


    Collisional quenching of the two lowest Pb atom metastable levels, 6p2 3P1 and 6p2 3P2, has been studied at Pb vapor densities of (1-20)×1016 cm-3. The metastable atoms were created in a heat pipe oven by stimulated Raman scattering using an XeCl laser pump. Their subsequent decay was then probed with tunable, single-frequency UV on the 266.3 and 261.4 nm Pb resonance lines. The observed rate constants are 2.0×10-13 cm3 sec-1 for 3P1 and 3.2×10-13 cm3 sec-1 for 3P2.

  1. Hypoallergenic Der p 1/Der p 2 combination vaccines for immunotherapy of house dust mite allergy.


    Chen, Kuan-Wei; Blatt, Katharina; Thomas, Wayne R; Swoboda, Ines; Valent, Peter; Valenta, Rudolf; Vrtala, Susanne


    More than 50% of allergic patients have house dust mite (HDM) allergy. Group 1 and 2 allergens are the major HDM allergens. We sought to produce and perform preclinical characterization of a recombinant hypoallergenic combination vaccine for specific immunotherapy of HDM allergy. Synthetic genes coding for 2 hybrid proteins consisting of reassembled Der p 1 and Der p 2 fragments with (recombinant Der p 2 [rDer p 2]/1C) and without (rDer p 2/1S) cysteines were expressed in Escherichia coli and purified to homogeneity by means of affinity chromatography. Protein fold was determined by using circular dichroism analysis, allergenic activity was determined by testing IgE reactivity and using basophil activation assays, and the presence of T-cell epitopes was determined based on lymphoproliferation in allergic patients. Mice and rabbits were immunized to study the molecules' ability to induce an allergic response and whether they induce allergen-specific IgG capable of inhibiting allergic patients' IgE binding to the allergens, respectively. rDer p 2/1C and rDer p 2/1S were expressed in large amounts in E coli as soluble and folded proteins. Because of the lack of disulfide bonds, rDer p 2/1S did not form aggregates and was obtained as a monomeric protein, whereas rDer p 2/1C did form aggregates. Both hypoallergens lacked relevant IgE reactivity and had reduced ability to induce allergic inflammation and allergic responses but induced similar T-cell proliferation as the wild-type allergens. Immunization with the hypoallergens (rDer p 2/1S > rDer p 2/1C) induced IgG antibodies in rabbits that inhibited the IgE reactivity of patients with HDM allergy to Der p 1 and Der p 2. The preclinical characterization indicates that particularly rDer p 2/1S can be used as a safe hypoallergenic molecule for both tolerance and vaccination approaches to treat HDM allergy. Copyright © 2012 American Academy of Allergy, Asthma & Immunology. Published by Mosby, Inc. All rights reserved.

  2. Sprouty2 Regulates PI(4,5)P2/Ca2+ Signaling and HIV-1 Gag Release

    PubMed Central

    Ehrlich, Lorna S.; Medina, Gisselle N.; Carter, Carol A.


    We recently reported that activation of the inositol 1,4,5-triphosphate receptor (IP3R) is required for efficient HIV-1 Gag trafficking and viral particle release (Ehrlich 2010). IP3R activation requires phospholipase C (PLC)-catalyzed hydrolysis of PI(4,5)P2 to IP3 and diacylglycerol. Here we show that Sprouty2 (Spry2), which binds PI(4,5)P2 and PLCγ, interfered with PI(4,5)P2 in a manner similar to U73122, an inhibitor of PI(4,5)P2 hydrolysis, suggesting that Spry2 may negatively regulate IP3R by preventing formation of its activating ligand, IP3. Mutation to Asp of R252, a critical determinant of PI(4,5)P2 binding in the C-terminal domain of Spry2, prevented the interference completely, indicating that binding to the phospholipid is required. In contrast, deletion of the PLCγ binding region or mutation of a critical Tyr residue in the region did not prevent the interference but Spry2-PI(4,5)P2 colocalization was not detected, suggesting that PLC binding is required for their stable association. Like U73122, Spry2 over-expression inhibited WT Gag release as virus-like particles. The inhibition was relieved by disrupting either binding determinant. IP3R-mediated Ca2+ signaling, in turn, was found to influence Spry2 subcellular distribution and ERK, a Spry2 regulator. Our findings suggest that Spry2 influences IP3R function through control of PI(4,5)P2 and IP3R influences Spry2 function by controlling its distribution and ERK activation. PMID:21762810

  3. A Scalable P2P Video Streaming Framework

    NASA Astrophysics Data System (ADS)

    Lee, Ivan

    Peer-to-peer (P2P) networking technique represents a vast potential to overcome many constraints in the conventional content distribution networks, especially for the real-time applications such as P2P streaming. In this chapter, a P2P streaming system is examined, and the proposed system combines multiple-description source coding technique and a scalable streaming infrastructure. The proposed system aims to gradually offload congested traffic from a centralized bottleneck to the under-utilized P2P networks and hence, provides seamless transitions from client/server streaming to centralized P2P streaming and to decentralized P2P streaming. The performance of the proposed framework is evaluated in terms of video frame loss rate, which reflects the probability of freeze video frames.

  4. Enhanced Allergic Inflammation of Der p 2 Affected by Polymorphisms of MD-2 Promoter

    PubMed Central

    Liao, En-Chih; Hsieh, Chia-Wei; Chang, Ching-Yun; Yu, Sheng-Jie; Sheu, Meei-Ling; Wu, Sheng-Mao


    Purpose Myeloid differentiation-2 (MD-2) has been associated with endotoxin and inflammatory disorders because it can recognize lipopolysaccharide (LPS) binding and attenuate Toll-like receptor 4 (TLR4)-mediated signaling. However, its role in allergic inflammation has yet to be clarified. We examined whether single nucleotide polymorphisms (SNPs) in MD-2 promoter can affect MD-2 expression and aimed to clarify the relationship between Der p 2 allergy and SNPs of MD-2 promoter. Methods The function of SNPs of MD-2 promoter and the effects of cytokines and immunoglobulin on the secretion and mRNA expression were investigated in 73 allergic subjects with different MD-2 gene promoter variants. Peripheral blood mononuclear cells were cultured with or without LPS in the presence of Dermatophagoides pteronyssinus group 2 allergen (Der p 2), followed by mRNA extraction and cytokine expression analysis. The culture supernatants were collected for cytokine measurement. Results Patients with the MD-2 promoter SNPs (rs1809441/rs1809442) had increased mRNA expressions of MD-2, ε heavy chain of IgE (Cε), and interleukin (IL)-8; however, only MD-2 and IL-8 were further up-regulated after Der p 2 stimulation. Patients with SNPs of MD-2 promoter tended to have high levels of IL-1β, IL-6, IL-8, IL-10, and tumor necrosis factor (TNF)-α after Der p 2 and LPS stimulation. Increased secretions of IL-6, IL-8, and IL-10 were found to be up-regulated by Der p 2 stimulation, and an increased secretion of IFN-γ and decreased secretion of IL-4 were noted after LPS stimulation. Conclusions The high levels of proinflammatory cytokines secreted by Der p 2 were predetermined by MD-2 promoter SNPs (rs1809441/rs1809442). Through cytokine secretion by Der p 2 and LPS, these SNPs may serve as an indicator of the pathological phenotype of Der p 2-induced allergic inflammation. PMID:26122509

  5. Supporting Collaboration and Creativity Through Mobile P2P Computing

    NASA Astrophysics Data System (ADS)

    Wierzbicki, Adam; Datta, Anwitaman; Żaczek, Łukasz; Rzadca, Krzysztof

    Among many potential applications of mobile P2P systems, collaboration applications are among the most prominent. Examples of applications such as Groove (although not intended for mobile networks), collaboration tools for disaster recovery (the WORKPAD project), and Skype's collaboration extensions, all demonstrate the potential of P2P collaborative applications. Yet, the development of such applications for mobile P2P systems is still difficult because of the lack of middleware.

  6. Synthesis and P2Y2 Receptor Agonist Activities of Uridine 5’-Phosphonate Analogues

    PubMed Central

    Van Poecke, Sara; Barrett, Matthew O.; Kumar, T. Santhosh; Sinnaeve, Davy; Martins, José C.; Jacobson, Kenneth A.; Harden, T. Kendall; Van Calenbergh, Serge


    We explored the influence of modifications of uridine 5’-methylenephosphonate on biological activity at the human P2Y2 receptor. Key steps in the synthesis of a series of 5-substituted uridine 5’-methylenephosphonates were the reaction of a suitably protected uridine 5’-aldehyde with [(diethoxyphosphinyl)methylidene]triphenylphosphorane, C-5 bromination and a Suzuki–Miyaura coupling. These analogues behaved as selective agonists at the P2Y2 receptor, with three analogues exhibiting potencies in the submicromolar range. Although maximal activities observed with the phosphonate analogues were much less than observed with UTP, high concentrations of the phosphonates had no effect on the stimulatory effect of UTP. These results suggest that these phosphonates bind to an allosteric site of the P2Y2 receptor. PMID:22386981

  7. Neutron scattering studies on protein dynamics using the human myelin peripheral membrane protein P2

    NASA Astrophysics Data System (ADS)

    Laulumaa, Saara; Kursula, Petri; Natali, Francesca


    Myelin is a multilayered proteolipid membrane structure surrounding selected axons in the vertebrate nervous system, which allows the rapid saltatory conduction of nerve impulses. Deficits in myelin formation and maintenance may lead to chronic neurological disease. P2 is an abundant myelin protein from peripheral nerves, binding between two apposing lipid bilayers. We studied the dynamics of the human myelin protein P2 and its mutated P38G variant in hydrated powders using elastic incoherent neutron scattering. The local harmonic vibrations at low temperatures were very similar for both samples, but the mutant protein had increased flexibility and softness close to physiological temperatures. The results indicate that a drastic mutation of proline to glycine at a functional site can affect protein dynamics, and in the case of P2, they may explain functional differences between the two proteins.

  8. P2X1 Receptor Antagonists Inhibit HIV-1 Fusion by Blocking Virus-Coreceptor Interactions

    PubMed Central

    Giroud, Charline; Marin, Mariana; Hammonds, Jason; Spearman, Paul


    ABSTRACT HIV-1 Env glycoprotein-mediated fusion is initiated upon sequential binding of Env to CD4 and the coreceptor CXCR4 or CCR5. Whereas these interactions are thought to be necessary and sufficient to promote HIV-1 fusion, other host factors can modulate this process. Previous studies reported potent inhibition of HIV-1 fusion by selective P2X1 receptor antagonists, including NF279, and suggested that these receptors play a role in HIV-1 entry. Here we investigated the mechanism of antiviral activity of NF279 and found that this compound does not inhibit HIV-1 fusion by preventing the activation of P2X1 channels but effectively blocks the binding of the virus to CXCR4 or CCR5. The notion of an off-target effect of NF279 on HIV-1 fusion is supported by the lack of detectable expression of P2X1 receptors in cells used in fusion experiments and by the fact that the addition of ATP or the enzymatic depletion of ATP in culture medium does not modulate viral fusion. Importantly, NF279 fails to inhibit HIV-1 fusion with cell lines and primary macrophages when added at an intermediate stage downstream of Env-CD4-coreceptor engagement. Conversely, in the presence of NF279, HIV-1 fusion is arrested downstream of CD4 binding but prior to coreceptor engagement. NF279 also antagonizes the signaling function of CCR5, CXCR4, and another chemokine receptor, as evidenced by the suppression of calcium responses elicited by specific ligands and by recombinant gp120. Collectively, our results demonstrate that NF279 is a dual HIV-1 coreceptor inhibitor that interferes with the functional engagement of CCR5 and CXCR4 by Env. IMPORTANCE Inhibition of P2X receptor activity suppresses HIV-1 fusion and replication, suggesting that P2X signaling is involved in HIV-1 entry. However, mechanistic experiments conducted in this study imply that P2X1 receptor is not expressed in target cells or involved in viral fusion. Instead, we found that inhibition of HIV-1 fusion by a specific P2X1

  9. Atomic resolution view into the structure–function relationships of the human myelin peripheral membrane protein P2

    SciTech Connect

    Ruskamo, Salla; Yadav, Ravi P.; Sharma, Satyan; Lehtimäki, Mari; Laulumaa, Saara; Aggarwal, Shweta; Simons, Mikael; Bürck, Jochen; Ulrich, Anne S.; Juffer, André H.; Kursula, Inari; Kursula, Petri


    The structure of the human myelin peripheral membrane protein P2 has been refined at 0.93 Å resolution. In combination with functional experiments in vitro, in vivo and in silico, the fine details of the structure–function relationships in P2 are emerging. P2 is a fatty acid-binding protein expressed in vertebrate peripheral nerve myelin, where it may function in bilayer stacking and lipid transport. P2 binds to phospholipid membranes through its positively charged surface and a hydrophobic tip, and accommodates fatty acids inside its barrel structure. The structure of human P2 refined at the ultrahigh resolution of 0.93 Å allows detailed structural analyses, including the full organization of an internal hydrogen-bonding network. The orientation of the bound fatty-acid carboxyl group is linked to the protonation states of two coordinating arginine residues. An anion-binding site in the portal region is suggested to be relevant for membrane interactions and conformational changes. When bound to membrane multilayers, P2 has a preferred orientation and is stabilized, and the repeat distance indicates a single layer of P2 between membranes. Simulations show the formation of a double bilayer in the presence of P2, and in cultured cells wild-type P2 induces membrane-domain formation. Here, the most accurate structural and functional view to date on P2, a major component of peripheral nerve myelin, is presented, showing how it can interact with two membranes simultaneously while going through conformational changes at its portal region enabling ligand transfer.

  10. FoxP2 regulates neurogenesis during embryonic cortical development.


    Tsui, David; Vessey, John P; Tomita, Hideaki; Kaplan, David R; Miller, Freda D


    The transcription factor FoxP2 has been associated with the development of human speech but the underlying cellular function of FoxP2 is still unclear. Here we provide evidence that FoxP2 regulates genesis of some intermediate progenitors and neurons in the mammalian cortex, one of the key centers for human speech. Specifically, knockdown of FoxP2 in embryonic cortical precursors inhibits neurogenesis, at least in part by inhibiting the transition from radial glial precursors to neurogenic intermediate progenitors. Moreover, overexpression of human, but not mouse, FoxP2 enhances the genesis of intermediate progenitors and neurons. In contrast, expression of a human FoxP2 mutant that causes vocalization deficits decreases neurogenesis, suggesting that in the murine system human FoxP2 acts as a gain-of-function protein, while a human FoxP2 mutant acts as a dominant-inhibitory protein. These results support the idea that FoxP2 regulates the transition from neural precursors to transit-amplifying progenitors and ultimately neurons, and shed light upon the molecular changes that might contribute to evolution of the mammalian cortex.

  11. The P2X7/P2X4 interaction shapes the purinergic response in murine macrophages.


    Pérez-Flores, Gabriela; Lévesque, Sébastien A; Pacheco, Jonathan; Vaca, Luis; Lacroix, Steve; Pérez-Cornejo, Patricia; Arreola, Jorge


    The ATP-gated P2X4 and P2X7 receptors are cation channels, co-expressed in excitable and non-excitable cells and play important roles in pain, bone development, cytokine release and cell death. Although these receptors interact the interacting domains are unknown and the functional consequences of this interaction remain unclear. Here we show by co-immunoprecipitation that P2X4 interacts with the C-terminus of P2X7 and by fluorescence resonance energy transfer experiments that this receptor-receptor interaction is driven by ATP. Furthermore, disrupting the ATP-driven interaction by knocking-out P2X4R provoked an attenuation of P2X7-induced cell death, dye uptake and IL-1β release in macrophages. Thus, P2X7 interacts with P2X4 via its C-terminus and disrupting the P2X7/P2X4 interaction hinders physiological responses in immune cells.

  12. Differential frequency dependence of P2Y1- and P2Y2- mediated Ca 2+ signaling in astrocytes.


    Fam, Sami R; Gallagher, Conor J; Kalia, Lorraine V; Salter, Michael W


    ATP is a key extracellular messenger that mediates the propagation of Ca 2+ waves in astrocyte networks in various regions of the CNS. ATP-mediated Ca 2+ signals play critical roles in astrocyte proliferation and differentiation and in modulating neuronal activity. The actions of ATP on astrocytes are via two distinct subtypes of P2Y purinoceptors, P2Y1 and P2Y2 receptors (P2Y1Rs and P2Y2Rs), G-protein coupled receptors that stimulate mobilization of intracellular Ca 2+ ([Ca 2+]i) via the phospholipase Cbeta-IP3 pathway. We report here that P2Y1R-mediated and P2Y2R-mediated Ca 2+ responses differentially show two forms of activity-dependent negative feedback. First, Ca 2+ responses mediated by either receptor exhibit slow depression that is independent of stimulation frequency. Second, responses mediated by P2Y1Rs, but not those mediated by P2Y2Rs, show rapid oscillations after high-frequency stimulation. We demonstrate that the oscillations are mediated by recruiting negative feedback by protein kinase C, and we map the site responsible for the effect of protein kinase C to Thr339 in the C terminus of P2Y1R. We propose that frequency-dependent changes in ATP-mediated Ca 2+ signaling pathways may modulate astrocyte function and astrocyte-neuron signaling in the CNS.

  13. Vibrational properties of the Pt(111)- p(2 × 2)-K surface superstructure

    NASA Astrophysics Data System (ADS)

    Rusina, G. G.; Eremeev, S. V.; Borisova, S. D.; Chulkov, E. V.


    The vibrational spectra of the Pt(111)- p(2 × 2)-K ordered surface superstructure formed on the platinum surface upon adsorption of 0.25 potassium monolayer are calculated using the interatomic interaction potentials obtained within the tight-binding approximation. The surface relaxation, the dispersion of surface phonons, the local density of surface vibrational states, and the polarization of vibrational modes of adatoms and substrate atoms are discussed. The theoretical results are in good agreement with the recently obtained experimental data.

  14. Purinergic P2X receptors: structural models and analysis of ligand-target interaction.


    Dal Ben, Diego; Buccioni, Michela; Lambertucci, Catia; Marucci, Gabriella; Thomas, Ajiroghene; Volpini, Rosaria


    The purinergic P2X receptors are ligand-gated cation channels activated by the endogenous ligand ATP. They assemble as homo- or heterotrimers from seven cloned subtypes (P2X1-7) and all trimer subunits present a common topology consisting in intracellular N- and C- termini, two transmembrane domains and a large extracellular domain. These membrane proteins are present in virtually all mammalian tissues and regulate a large variety of responses in physio- and pathological conditions. The development of ligands that selectively activate or block specific P2X receptor subtypes hence represents a promising strategy to obtain novel pharmacological tools for the treatment of pain, cancer, inflammation, and neurological, cardiovascular, and endocrine diseases. The publication of the crystal structures of zebrafish P2X4 receptor in inactive and ATP-bound active forms provided structural data for the analysis of the receptor structure, the interpretation of mutagenesis data, and the depiction of ligand binding and receptor activation mechanism. In addition, the availability of ATP-competitive ligands presenting selectivity for P2X receptor subtypes supports the design of new potent and selective ligands with possibly improved pharmacokinetic profiles, with the final aim to obtain new drugs. This study describes molecular modelling studies performed to develop structural models of the human and rat P2X receptors in inactive and active states. These models allowed to analyse the role of some non-conserved residues at ATP binding site and to study the receptor interaction with some non-specific or subtype selective agonists and antagonists.

  15. The Cellular Prion Protein Prevents Copper-Induced Inhibition of P2X4 Receptors

    PubMed Central

    Lorca, Ramón A.; Varela-Nallar, Lorena; Inestrosa, Nibaldo C.; Huidobro-Toro, J. Pablo


    Although the physiological function of the cellular prion protein (PrPC) remains unknown, several evidences support the notion of its role in copper homeostasis. PrPC binds Cu2+ through a domain composed by four to five repeats of eight amino acids. Previously, we have shown that the perfusion of this domain prevents and reverses the inhibition by Cu2+ of the adenosine triphosphate (ATP)-evoked currents in the P2X4 receptor subtype, highlighting a modulatory role for PrPC in synaptic transmission through regulation of Cu2+ levels. Here, we study the effect of full-length PrPC in Cu2+ inhibition of P2X4 receptor when both are coexpressed. PrPC expression does not significantly change the ATP concentration-response curve in oocytes expressing P2X4 receptors. However, the presence of PrPC reduces the inhibition by Cu2+ of the ATP-elicited currents in these oocytes, confirming our previous observations with the Cu2+ binding domain. Thus, our observations suggest a role for PrPC in modulating synaptic activity through binding of extracellular Cu2+. PMID:22114745

  16. P2X7 Receptors in Neurological and Cardiovascular Disorders

    PubMed Central

    Skaper, Stephen D.; Debetto, Patrizia; Giusti, Pietro


    P2X receptors are ATP-gated cation channels that mediate fast excitatory transmission in diverse regions of the brain and spinal cord. Several P2X receptor subtypes, including P2X7, have the unusual property of changing their ion selectivity during prolonged exposure to ATP, which results in a channel pore permeable to molecules as large as 900 daltons. The P2X7 receptor was originally described in cells of hematopoietic origin, and mediates the influx of Ca2+ and Na+ and Ca2+ and Na+ ions as well as the release of proinflammatory cytokines. P2X7 receptors may affect neuronal cell death through their ability to regulate the processing and release of interleukin-1β, a key mediator in neurodegeneration, chronic inflammation, and chronic pain. Activation of P2X7, a key mediator in neurodegeneration, chronic inflammation, and chronic pain. Activation of P2X7 receptors provides an inflammatory stimulus, and P2X7 receptor-deficient mice have substantially attenuated inflammatory responses, including models of neuropathic and chronic inflammatory pain. Moreover, P2X7 receptor activity, by regulating the release of proinflammatory cytokines, may be involved in the pathophysiology of depression. Apoptotic cell death occurs in a number of vascular diseases, including atherosclerosis, restenosis, and hypertension, and may be linked to the release of ATP from endothelial cells, P2X7 receptor activation, proinflammatory cytokine production, and endothelial cell apoptosis. In this context, the P2X7 receptor may be viewed as a gateway of communication between the nervous, immune, and cardiovascular systems. PMID:20029634

  17. Interaction of Sla2p's ANTH Domain with PtdIns(4,5)P2 Is Important for Actin-dependent Endocytic InternalizationV⃞

    PubMed Central

    Sun, Yidi; Kaksonen, Marko; Madden, David T.; Schekman, Randy; Drubin, David G.


    A variety of studies have implicated the lipid PtdIns(4,5)P2 in endocytic internalization, but how this lipid mediates its effects is not known. The AP180 N-terminal homology (ANTH) domain is a PtdIns(4,5)P2-binding module found in several proteins that participate in receptor-mediated endocytosis. One such protein is yeast Sla2p, a highly conserved actin-binding protein essential for actin organization and endocytic internalization. To better understand how PtdIns(4,5)P2 binding regulates actin-dependent endocytosis, we investigated the functions of Sla2p's ANTH domain. A liposome-binding assay revealed that Sla2p binds to PtdIns(4,5)P2 specifically through its ANTH domain and identified specific lysine residues required for this interaction. Mutants of Sla2p deficient in PtdIns(4,5)P2 binding showed significant defects in cell growth, actin organization, and endocytic internalization. These defects could be rescued by increasing PtdIns(4,5)P2 levels in vivo. Strikingly, mutant Sla2p defective in PtdIns(4,5)P2 binding localized with the endocytic machinery at the cell cortex, establishing that the ANTH-PtdIns(4,5)P2 interaction is not necessary for this association. In contrast, multicolor real-time fluorescence microscopy and particle-tracking analysis demonstrated that PtdIns(4,5)P2 binding is required during endocytic internalization. These results demonstrate that the interaction of Sla2p's ANTH domain with PtdIns(4,5)P2 plays a key role in regulation of the dynamics of actin-dependent endocytic internalization. PMID:15574875

  18. Neuropharmacology of Purinergic Receptors in Human Submucous Plexus: Involvement of P2X1, P2X2, P2X3 Channels, P2Y and A3 Metabotropic Receptors in Neurotransmission

    PubMed Central

    Liñán-Rico, A.; Wunderlich, JE.; Enneking, JT.; Tso, DR.; Grants, I.; Williams, KC.; Otey, A.; Michel, K.; Schemann, M.; Needleman, B.; Harzman, A.; Christofi, FL.


    Rationale The role of purinergic signaling in the human ENS is not well understood. We sought to further characterize the neuropharmacology of purinergic receptors in human ENS and test the hypothesis that endogenous purines are critical regulators of neurotransmission. Experimental Approach LSCM-Fluo-4-(Ca2+)-imaging of postsynaptic Ca2+ transients (PSCaTs) was used as a reporter of neural activity. Synaptic transmission was evoked by fiber tract electrical stimulation in human SMP surgical preparations. Pharmacological analysis of purinergic signaling was done in 1,556 neurons from 234 separate ganglia 107 patients; immunochemical labeling for P2XRs of neurons in ganglia from 19 patients. Real-time MSORT (Di-8-ANEPPS) imaging was used to test effects of adenosine on fast excitatory synaptic potentials (fEPSPs). Results Synaptic transmission is sensitive to pharmacological manipulations that alter accumulation of extracellular purines. Apyrase blocks PSCaTs in a majority of neurons. An ecto-NTPDase-inhibitor 6-N,N-diethyl-D-β,γ-dibromomethyleneATP or adenosine deaminase augments PSCaTs. Blockade of reuptake/deamination of eADO inhibits PSCaTs. Adenosine inhibits fEPSPs and PSCaTs (IC50=25μM), sensitive to MRS1220-antagonism (A3AR). A P2Y agonist ADPβS inhibits PSCaTs (IC50=111nM) in neurons without stimulatory ADPβS responses (EC50=960nM). ATP or a P2X1,2,2/3 (α,β-MeATP) agonist evokes fast, slow, biphasic Ca2+ transients or Ca2+ oscillations (EC50=400μM). PSCaTs are sensitive to P2X1 antagonist NF279. Low (20nM) or high (5μM) concentrations of P2X antagonist TNP-ATP block PSCaTs in different neurons; proportions of neurons with P2XR-ir follow the order P2X2>P2X1≫P2X3; P2X1+ P2X2 and P2X3+P2X2 are co-localized. RT-PCR identified mRNA-transcripts for P2X1-7,P2Y1,2,12-14R. Responsive neurons were also identified by HuC/D-ir. Conclusions Purines are critical regulators of neurotransmission in the human enteric nervous system. Purinergic signaling involves

  19. A Remedy for Network Operators against Increasing P2P Traffic: Enabling Packet Cache for P2P Applications

    NASA Astrophysics Data System (ADS)

    Nakao, Akihiro; Sasaki, Kengo; Yamamoto, Shu

    We observe that P2P traffic has peculiar characteristics as opposed to the other type of traffic such as web browsing and file transfer. Since they exploit swarm effect — a multitude of end points downloading the same content piece by piece nearly at the same time, thus, increasing the effectiveness of caching — the same pieces of data end up traversing the network over and over again within mostly a short time window. In the light of this observation, we propose a network layer packet-level caching for reducing the volume of emerging P2P traffic, transparently to the P2P applications — without affecting operations of the P2P applications at all — rather than banning it, restricting it, or modifying P2P systems themselves. Unlike the other caching techniques, we aim to provide as generic a caching mechanism as possible at network layer — without knowing much detail of P2P application protocols — to extend applicability to arbitrary P2P protocols. Our preliminary evaluation shows that our approach is expected to reduce a significant amount of P2P traffic transparently to P2P applications.

  20. P2×7 targeting inhibits growth of human mesothelioma

    PubMed Central

    Amoroso, Francesca; Salaro, Erica; Falzoni, Simonetta; Chiozzi, Paola; Giuliani, Anna Lisa; Cavallesco, Giorgio; Maniscalco, Pio; Puozzo, Andrea; Bononi, Ilaria; Martini, Fernanda; Tognon, Mauro; Virgilio, Francesco Di


    Malignant pleural mesothelioma (MPM) is an aggressive tumor refractory to anti-blastic therapy. MPM cells show several genetic and biochemical defects, e.g. overexpression of oncogenes, downregulation of onco-suppressor genes, dysregulation of microRNA, or alteration of intracellular Ca2+ homeostasis and of apoptosis. No information is as yet available on purinergic signalling in this tumor. Signalling via the P2×7 (P2RX7 or P2×7R) purinergic receptor is attracting increasing attention as a pathway involved in cancer cell death or proliferation. In this report we show that the P2×7R is expressed by three MPM cell lines established from MPM patients but not by mesothelial cells from healthy subjects (healthy mesothelial cells, HMCs). MPM cell proliferation was inhibited by in vitro incubation in the presence of selective P2×7R antagonists, as well as by stimulation with the P2×7R agonist BzATP. Systemic administration of the selective P2×7R blocker AZ10606120 inhibited in vivo growth of MPM tumors whether implanted subcutaneously (s.c.) or intraperitoneally (i.p.). Our findings suggest that the P2×7R might be a novel target for the therapy of mesothelioma. PMID:27391069

  1. Structure-function relationship of Chikungunya nsP2 protease: A comparative study with papain.


    Ramakrishnan, Chandrasekaran; Kutumbarao, Nidamarthi H V; Suhitha, Sivasubramanian; Velmurugan, Devadasan


    Chikungunya virus is a growing human pathogen transmitted by mosquito bite. It causes fever, chills, nausea, vomiting, joint pain, headache, and swelling in the joints. Its replication and propagation depend on the protease activity of the Chikungunya virus-nsP2 protein, which cleaves the nsP1234 polyprotein replication complex into individual functional units. The N-terminal segment of papain is structurally identical with the Chikungunya virus-nsP2 protease. Hence, molecular dynamics simulations were performed to compare molecular mechanism of these proteases. The Chikungunya virus-snP2 protease shows more conformational changes and adopts an alternate conformation. However, N-terminal segment of these two proteases has identical active site scaffold with the conserved catalytic diad. Hence, some of the non-peptide inhibitors of papain were used for induced fit docking at the active site of the nsP2 to assess the binding mode. In addition, the peptides that connect different domains/protein in Chikungunya virus poly-protein were also subjected for docking. The overall results suggest that the active site scaffold is the same in both the proteases and a possibility exists to experimentally assess the efficacy of some of the papain inhibitors to inhibit the Chikungunya virus-nsP2.

  2. Immune-reactivity of recombinant isoforms of the major house dust mite allergen Der p 2.


    Hakkaart, G A; Chapman, M D; Aalberse, R C; van Ree, R


    Recombinant Der p 2, expressed in yeast, lacked reactivity with 5 monoclonal antibodies against natural Der p 2. The aim of this study was to investigate whether the lack of reactivity with recombinant Der p 2 can be explained by the existence of isoforms. By site-directed mutagenesis three recombinant isoforms of Der p 2 were produced. Reactivity with monoclonal antibodies and human IgE was analysed by means of RAST and RAST-inhibition. All five monoclonals that lacked reactivity with the originally selected isoform, showed reactivity upon replacement of aspartic acid by asparagine at position 114. The other two substitutions (at position 26 and 47) had no effect. Binding of human IgE (n = 10) was not significantly influenced by the isogenetic variation at position 114. Monoclonal antibodies raised against natural Der p 2 can sometimes discriminate between different isoforms, allowing the study of the natural occurrence of isoforms. For application in allergen-measurement assays, non-discriminating monoclonal antibodies should be selected.

  3. Porin OmpP2 of Haemophilus influenzae shows specificity for nicotinamide-derived nucleotide substrates.


    Andersen, Christian; Maier, Elke; Kemmer, Gabrielle; Blass, Julia; Hilpert, Anna-Karina; Benz, Roland; Reidl, Joachim


    Haemophilus influenzae has an absolute requirement for NAD (factor V) because it lacks all biosynthetic enzymes necessary for de novo synthesis of that cofactor. Therefore, growth in vitro requires the presence of NAD itself, NMN, or nicotinamide riboside (NR). To address uptake abilities of these compounds, we investigated outer membrane proteins. By analyzing ompP2 knockout mutants, we found that NAD and NMN uptake was prevented, whereas NR uptake was not. Through investigation of the properties of purified OmpP2 in artificial lipid membrane systems, the substrate specificity of OmpP2 for NAD and NMN was determined, with KS values of approximately 8 and 4mm, respectively, in 0.1 m KCl, whereas no interaction was detected for the nucleoside NR and other purine or pyrimidine nucleotide or nucleoside species. Based on our analysis, we assume that an intrinsic binding site within OmpP2 exists that facilitates diffusion of these compounds across the outer membrane, recognizing carbonyl and exposed phosphate groups. Because OmpP2 was formerly described as a general diffusion porin, an additional property of acting as a facilitator for nicotinamide-based nucleotide transport may have evolved to support and optimize utilization of the essential cofactor sources NAD and NMN in H. influenzae.

  4. P2Y receptors in health and disease.


    Erlinge, David


    The purine- and pyrimidine-sensitive P2Y receptors belong to the large group of G-protein-coupled receptors that are the target of approximately one-third of the pharmaceutical drugs used in the clinic today. It is therefore not unexpected that the P2Y receptors could be useful targets for drug development. This chapter will discuss P2Y receptor-based therapies currently used, in development and possible future developments. The platelet inhibitors blocking the ADP-receptor P2Y(12) reduce myocardial infarction, stroke, and mortality in patients with cardiovascular disease. Clopidogrel (Plavix) was for many years the second most selling drug in the world. The improved P2Y(12) inhibitors prasugrel, ticagrelor, and elinogrel are now entering the clinic with even more pronounced protective effects. The UTP-activated P2Y(2) receptor stimulates ciliary movement and secretion from epithelial cells. Cystic fibrosis is a monogenetic disease where reduced chloride ion secretion results in a severe lung disease and early death. No specific treatment has been available, but the P2Y(2) agonist Denufosol has been shown to improve lung function and is expected to be introduced as treatment for cystic fibrosis soon. In preclinical studies, there are indications that P2Y receptors can be important for diabetes, osteoporosis, cardiovascular, and atherosclerotic disease. In conclusion, P2Y receptors are important for the health of humans for many diseases, and we can expect even more beneficial drugs targeting P2Y receptors in the future.

  5. P2X7 receptors stimulate AKT phosphorylation in astrocytes

    PubMed Central

    Jacques-Silva, Maria C; Rodnight, Richard; Lenz, Guido; Liao, Zhongji; Kong, Qiongman; Tran, Minh; Kang, Yuan; Gonzalez, Fernando A; Weisman, Gary A; Neary, Joseph T


    Emerging evidence indicates that nucleotide receptors are widely expressed in the nervous system. Here, we present evidence that P2Y and P2X receptors, particularly the P2X7 subtype, are coupled to the phosphoinositide 3-kinase (PI3K)/Akt pathway in astrocytes. P2Y and P2X receptor agonists ATP, uridine 5′-triphosphate (UTP) and 2′,3′-O-(4-benzoyl)-benzoyl ATP (BzATP) stimulated Akt phosphorylation in primary cultures of rat cortical astrocytes. BzATP induced Akt phosphorylation in a concentration- and time-dependent manner, similar to the effect of BzATP on Akt phosphorylation in 1321N1 astrocytoma cells stably transfected with the rat P2X7 receptor. Activation was maximal at 5 – 10 min and was sustained for 60 min; the EC50 for BzATP was approximately 50 μM. In rat cortical astrocytes, the positive effect of BzATP on Akt phosphorylation was independent of glutamate release. The effect of BzATP on Akt phosphorylation in rat cortical astrocytes was significantly reduced by the P2X7 receptor antagonist Brilliant Blue G and the P2X receptor antagonist iso-pyridoxal-5′-phosphate-6-azophenyl-2′,4′-disulfonic acid, but was unaffected by trinitrophenyl-ATP, oxidized ATP, suramin and reactive blue 2. Results with specific inhibitors of signal transduction pathways suggest that extracellular and intracellular calcium, PI3K and a Src family kinase are involved in the BzATP-induced Akt phosphorylation pathway. In conclusion, our data indicate that stimulation of astrocytic P2X7 receptors, as well as other P2 receptors, leads to Akt activation. Thus, signaling by nucleotide receptors in astrocytes may be important in several cellular downstream effects related to the Akt pathway, such as cell cycle and apoptosis regulation, protein synthesis, differentiation and glucose metabolism. PMID:15023862

  6. A P2X receptor from the tardigrade species Hypsibius dujardini with fast kinetics and sensitivity to zinc and copper.


    Bavan, Selvan; Straub, Volko A; Blaxter, Mark L; Ennion, Steven J


    Orthologs of the vertebrate ATP gated P2X channels have been identified in Dictyostelium and green algae, demonstrating that the emergence of ionotropic purinergic signalling was an early event in eukaryotic evolution. However, the genomes of a number of animals including Drosophila melanogaster and Caenorhabditis elegans, both members of the Ecdysozoa superphylum, lack P2X-like proteins, whilst other species such as the flatworm Schistosoma mansoni have P2X proteins making it unclear as to what stages in evolution P2X receptors were lost. Here we describe the functional characterisation of a P2X receptor (HdP2X) from the tardigrade Hypsibius dujardini demonstrating that purinergic signalling is preserved in some ecdysozoa. ATP (EC50 approximately 44.5 microM) evoked transient inward currents in HdP2X with millisecond rates of activation and desensitisation. HdP2X is antagonised by pyridoxal-phosphate-6-azophenyl-2',4' disulfonic acid (IC50 15.0 microM) and suramin (IC50 22.6 microM) and zinc and copper inhibit ATP-evoked currents with IC50 values of 62.8 microM and 19.9 microM respectively. Site-directed mutagenesis showed that unlike vertebrate P2X receptors, extracellular histidines do not play a major role in coordinating metal binding in HdP2X. However, H306 was identified as playing a minor role in the actions of copper but not zinc. Ivermectin potentiated responses to ATP with no effect on the rates of current activation or decay. The presence of a P2X receptor in a tardigrade species suggests that both nematodes and arthropods lost their P2X genes independently, as both traditional and molecular phylogenies place the divergence between Nematoda and Arthropoda before their divergence from Tardigrada. The phylogenetic analysis performed in our study also clearly demonstrates that the emergence of the family of seven P2X channels in human and other mammalian species was a relatively recent evolutionary event that occurred subsequent to the split between

  7. A P2X receptor from the tardigrade species Hypsibius dujardini with fast kinetics and sensitivity to zinc and copper

    PubMed Central

    Bavan, Selvan; Straub, Volko A; Blaxter, Mark L; Ennion, Steven J


    Background Orthologs of the vertebrate ATP gated P2X channels have been identified in Dictyostelium and green algae, demonstrating that the emergence of ionotropic purinergic signalling was an early event in eukaryotic evolution. However, the genomes of a number of animals including Drosophila melanogaster and Caenorhabditis elegans, both members of the Ecdysozoa superphylum, lack P2X-like proteins, whilst other species such as the flatworm Schistosoma mansoni have P2X proteins making it unclear as to what stages in evolution P2X receptors were lost. Here we describe the functional characterisation of a P2X receptor (HdP2X) from the tardigrade Hypsibius dujardini demonstrating that purinergic signalling is preserved in some ecdysozoa. Results ATP (EC50 ~44.5 μM) evoked transient inward currents in HdP2X with millisecond rates of activation and desensitisation. HdP2X is antagonised by pyridoxal-phosphate-6-azophenyl-2',4' disulfonic acid (IC50 15.0 μM) and suramin (IC50 22.6 μM) and zinc and copper inhibit ATP-evoked currents with IC50 values of 62.8 μM and 19.9 μM respectively. Site-directed mutagenesis showed that unlike vertebrate P2X receptors, extracellular histidines do not play a major role in coordinating metal binding in HdP2X. However, H306 was identified as playing a minor role in the actions of copper but not zinc. Ivermectin potentiated responses to ATP with no effect on the rates of current activation or decay. Conclusion The presence of a P2X receptor in a tardigrade species suggests that both nematodes and arthropods lost their P2X genes independently, as both traditional and molecular phylogenies place the divergence between Nematoda and Arthropoda before their divergence from Tardigrada. The phylogenetic analysis performed in our study also clearly demonstrates that the emergence of the family of seven P2X channels in human and other mammalian species was a relatively recent evolutionary event that occurred subsequent to the split between

  8. p53-independent mechanisms regulate the P2-MDM2 promoter in adult astrocytic tumours.


    Dimitriadi, M; Poulogiannis, G; Liu, L; Bäcklund, L M; Pearson, D M; Ichimura, K; Collins, V P


    The MDM2 gene is amplified and/or overexpressed in about 10% of glioblastomas and constitutes one of a number of ways the p53 pathway is disrupted in these tumours. MDM2 encodes a nuclear phosphoprotein that regulates several cell proteins by binding and/or ubiquitinating them, with p53 being a well-established partner. MDM2 has two promoters, P1 and P2 that give rise to transcripts with distinct 5' untranslated regions. Transcription from P2 is believed to be controlled by p53 and a single-nucleotide polymorphism (SNP309, T>G) in P2 is reported to be associated with increased risk for, and early development of, malignancies. The use of P1 and P2 has not been investigated in gliomas. We used RT-PCR to study P1- and P2-MDM2 transcript expression in astrocytic tumours, xenografts and cell lines with known MDM2, TP53 and p14(ARF) gene status. Both promoters were used in all genetic backgrounds including the use of the P2 promoter in TP53 null cells, indicating a p53-independent induction of transcription. Transcripts from the P1 promoter formed a greater proportion of the total MDM2 transcripts in tumours with MDM2 amplification, despite these tumours having two wild-type TP53 alleles. Examination of SNP309 in glioblastoma patients showed a borderline association with survival but no apparent correlation with age at diagnosis nor with TP53 and p14(ARF) status of their tumours. Our findings also indicate that elevated MDM2 mRNA levels in tumours with MDM2 amplification are preferentially driven by the P1 promoter and that the P2 promoter is not only regulated by p53 but also by other transcription factor(s).

  9. Characterization of a Novel Function-Blocking Antibody Targeted Against The Platelet P2Y1 Receptor

    PubMed Central

    Karim, Zubair A.; Vemana, Hari Priya; Alshbool, Fatima Z.; Lin, Olivia A.; Alshehri, Abdullah M.; Javaherizadeh, Payam; Paez Espinosa, Enma V.; Khasawneh, Fadi T.


    Objective Platelet hyperactivity is associated with vascular disease and contributes to the genesis of thrombotic disorders. ADP plays an important role in platelet activation, and activates platelets through two G-Protein Coupled Receptors, the Gq-coupled P2Y1 receptor (P2Y1R), and the Gi-coupled P2Y12 receptor (P2Y12R). While the involvement of the P2Y1R in thrombogenesis is well established, there are no antagonists that are currently available for clinical use. Approach and Results Our goal is to determine whether a novel antibody targeting the ligand binding domain, i.e., second extracellular loop (EL2) of the P2Y1R [abbreviated as EL2Ab] could inhibit platelet function and protect against thrombogenesis. Our results revealed that the EL2Ab does indeed inhibit ADP-induced platelet aggregation, in a dose-dependent manner. Furthermore, EL2Ab was found to inhibit integrin GPIIb-IIIa activation, dense and alpha granule secretion and phosphatidylserine exposure. These inhibitory effects translated into protection against thrombus formation, as evident by a prolonged time for occlusion in a FeCl3 induced thrombosis model, but this was accompanied by a prolonged tail bleeding time. We also observed a dose dependent displacement of the radiolabelled P2Y1R antagonist [3H]MRS25000 from its ligand binding site by EL2Ab. Conclusions Collectively, our findings demonstrate that EL2Ab binds to and exhibits P2Y1R-dependent function-blocking activity in the context of platelets. These results add further evidence for a role of the P2Y1R in thrombosis and validate the concept that targeting it is a relevant alternative or complement to current antiplatelet strategies. PMID:25593131

  10. P2MP MPLS-Based Hierarchical Service Management System

    NASA Astrophysics Data System (ADS)

    Kumaki, Kenji; Nakagawa, Ikuo; Nagami, Kenichi; Ogishi, Tomohiko; Ano, Shigehiro

    This paper proposes a point-to-multipoint (P2MP) Multi-Protocol Label Switching (MPLS) based hierarchical service management system. Traditionally, general management systems deployed in some service providers control MPLS Label Switched Paths (LSPs) (e.g., RSVP-TE and LDP) and services (e.g., L2VPN, L3VPN and IP) separately. In order for dedicated management systems for MPLS LSPs and services to cooperate with each other automatically, a hierarchical service management system has been proposed with the main focus on point-to-point (P2P) TE LSPs in MPLS path management. In the case where P2MP TE LSPs and services are deployed in MPLS networks, the dedicated management systems for P2MP TE LSPs and services must work together automatically. Therefore, this paper proposes a new algorithm that uses a correlation between P2MP TE LSPs and multicast VPN services based on a P2MP MPLS-based hierarchical service management architecture. Also, the capacity and performance of the proposed algorithm are evaluated by simulations, which are actually based on certain real MPLS production networks, and are compared to that of the algorithm for P2P TE LSPs. Results show this system is very scalable within real MPLS production networks. This system, with the automatic correlation, appears to be deployable in real MPLS production networks.

  11. Role of P2Y12 Receptor in Thrombosis.


    Zhang, Yaqi; Zhang, Si; Ding, Zhongren


    P2Y12 receptor is a 342 amino acid Gi-coupled receptor predominantly expressed on platelets. P2Y12 receptor is physiologically activated by ADP and inhibits adenyl cyclase (AC) to decrease cyclic AMP (cAMP) level, resulting in platelet aggregation. It also activates PI3 kinase (PI3K) pathway leading to fibrinogen receptor activation, and may protect platelets from apoptosis. Abnormalities of P2Y12 receptor include congenital deficiencies or high activity in diseases like diabetes mellitus (DM) and chronic kidney disease (CKD), exposing such patients to a prothrombotic condition. A series of clinical antiplatelet drugs, such as clopidogrel and ticagrelor, are designed as indirect or direct antagonists of P2Y12 receptor to reduce incidence of thrombosis mainly for patients of acute coronary syndrome (ACS) who are at high risk of thrombotic events. Studies on novel dual-/multi-target antiplatelet agents consider P2Y12 receptor as a promising part in combined targets. However, the clinical practical phenomena, such as "clopidogrel resistance" due to gene variations of cytochrome P450 or P2Y12 receptor constitutive activation, call for better antiplatelet agents. Researches also showed inverse agonist of P2Y12 receptor could play a better role over neutral antagonists. Personalized antiplatelet therapy is the most ideal destination for antiplatelet therapy in ACS patients with or without other underlying diseases like DM or CKD, however, there is still a long way to go.

  12. P2X7 receptor antagonism: Implications in diabetic retinopathy.


    Platania, Chiara Bianca Maria; Giurdanella, Giovanni; Di Paola, Luisa; Leggio, Gian Marco; Drago, Filippo; Salomone, Salvatore; Bucolo, Claudio


    Diabetic retinopathy (DR) is the most frequent complication of diabetes and one of leading causes of blindness worldwide. Early phases of DR are characterized by retinal pericyte loss mainly related to concurrent inflammatory process. Recently, an important link between P2X7 receptor (P2X7R) and inflammation has been demonstrated indicating this receptor as potential pharmacological target in DR. Here we first carried out an in silico molecular modeling study in order to characterize the allosteric pocket in P2X7R, and identify a suitable P2X7R antagonist through molecular docking. JNJ47965567 was identified as the hit compound in docking calculations, as well as for its absorption, distribution, metabolism and excretion (ADME) profile. As an in vitro model of early diabetic retinopathy, human retinal pericytes were exposed to high glucose (25mM, 48h) that caused a significant (p<0.05) release of IL-1β and LDH. The block of P2X7R by JNJ47965567 significantly (p<0.05) reverted the damage elicited by high glucose, detected as IL-1β and LDH release. Overall, our findings suggest that the P2X7R represents an attractive pharmacological target to manage the early phase of diabetic retinopathy, and the compound JNJ47965567 is a good template to discover other P2X7R selective antagonists. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. Incorporation of scaffolding protein gpO in bacteriophages P2 and P4.


    Chang, Jenny R; Poliakov, Anton; Prevelige, Peter E; Mobley, James A; Dokland, Terje


    Scaffolding proteins act as chaperones for the assembly of numerous viruses, including most double-stranded DNA bacteriophages. In bacteriophage P2, an internal scaffolding protein, gpO, is required for the assembly of correctly formed viral capsids. Bacteriophage P4 is a satellite phage that has acquired the ability to take control of the P2 genome and use the P2 capsid protein gpN to assemble a capsid that is smaller than the normal P2 capsid. This size determination is dependent on the P4 external scaffolding protein Sid. Although Sid is sufficient to form morphologically correct P4-size capsids, the P2 internal scaffolding protein gpO is required for the formation of viable capsids of both P2 and P4. In most bacteriophages, the scaffolding protein is either proteolytically degraded or exits intact from the capsid after assembly. In the P2/P4 system, however, gpO is cleaved to an N-terminal fragment, O(*), that remains inside the mature capsid after DNA packaging. We previously showed that gpO exhibits autoproteolytic activity, which is abolished by removal of the first 25 amino acids. Co-expression of gpN with this N-terminally truncated version of gpO leads to the production of immature P2 procapsid shells. Here, we use protein analysis and mass spectroscopy to show that P2 and P4 virions as well as procapsids isolated from viral infections contain O(*) and that cleavage occurs between residues 141 and 142 of gpO. By co-expression of gpN with truncated gpO proteins, we show that O(*) binds to gpN and retains the proteolytic activity of gpO and that the C-terminal 90 residues of gpO (residues 195-284) are sufficient to promote the formation of P2-size procapsids. Using mass spectrometry, we have also identified the head completion protein gpL in the virions.

  14. Incorporation of scaffolding protein gpO in bacteriophages P2 and P4

    PubMed Central

    Chang, Jenny R.; Poliakov, Anton; Prevelige, Peter E.; Mobley, James A.; Dokland, Terje


    Scaffolding proteins act as chaperones for the assembly of numerous viruses, including most double-stranded DNA bacteriophages. In bacteriophage P2, an internal scaffolding protein, gpO, is required for the assembly of correctly formed viral capsids. Bacteriophage P4 is a satellite phage that has acquired the ability to take control of the P2 genome and use the P2 capsid protein gpN to assemble a capsid that is smaller than the normal P2 capsid. This size determination is dependent on the P4 external scaffolding protein Sid. Although Sid is sufficient to form morphologically correct P4-size capsids, the P2 internal scaffolding protein gpO is required for the formation of viable capsids of both P2 and P4. In most bacteriophages, the scaffolding protein is either proteolytically degraded or exits intact from the capsid after assembly. In the P2/P4 system, however, gpO is cleaved to an N-terminal fragment, O*, that remains inside the mature capsid after DNA packaging. We previously showed that gpO exhibits autoproteolytic activity, which is abolished by removal of the first 25 amino acids. Co-expression of gpN with this N-terminally truncated version of gpO leads to the production of immature P2 procapsid shells. Here, we use protein analysis and mass spectroscopy to show that P2 and P4 virions as well as procapsids isolated from viral infections contain O* and that cleavage occurs between residues 141 and 142 of gpO. By co-expression of gpN with truncated gpO proteins, we show that O* binds to gpN and retains the proteolytic activity of gpO and that the C-terminal 90 residues of gpO (residues 195–284) are sufficient to promote the formation of P2-size procapsids. Using mass spectrometry we have also identified the head completion protein gpL in the virions. PMID:17931675

  15. Calcium-dependent block of P2X7 receptor channel function is allosteric.


    Yan, Zonghe; Khadra, Anmar; Sherman, Arthur; Stojilkovic, Stanko S


    Among purinergic P2X receptor (P2XR) channels, the P2X7R exhibits the most complex gating kinetics; the binding of orthosteric agonists at the ectodomain induces a conformational change in the receptor complex that favors a gating transition from closed to open and dilated states. Bath Ca(2+) affects P2X7R gating through a still uncharacterized mechanism: it could act by reducing the adenosine triphosphate(4-) (ATP(4-)) concentration (a form proposed to be the P2X7R orthosteric agonist), as an allosteric modulator, and/or by directly altering the selectivity of pore to cations. In this study, we combined biophysical and mathematical approaches to clarify the role of calcium in P2X7R gating. In naive receptors, bath calcium affected the activation permeability dynamics indirectly by decreasing the potency of orthosteric agonists in a concentration-dependent manner and independently of the concentrations of the free acid form of agonists and status of pannexin-1 (Panx1) channels. Bath calcium also facilitated the rates of receptor deactivation in a concentration-dependent manner but did not affect a progressive delay in receptor deactivation caused by repetitive agonist application. The effects of calcium on the kinetics of receptor deactivation were rapid and reversible. A438079, a potent orthosteric competitive antagonist, protected the rebinding effect of 2'(3')-O-4-benzoylbenzoyl)ATP on the kinetics of current decay during the washout period, but in the presence of A438079, calcium also increased the rate of receptor deactivation. The corresponding kinetic (Markov state) model indicated that the decrease in binding affinity leads to a decrease in current amplitudes and facilitation of receptor deactivation, both in an extracellular calcium concentration-dependent manner expressed as a Hill function. The results indicate that calcium in physiological concentrations acts as a negative allosteric modulator of P2X7R by decreasing the affinity of receptors for

  16. NTPase and 5'-RNA triphosphatase activities of Chikungunya virus nsP2 protein.


    Karpe, Yogesh A; Aher, Pankaj P; Lole, Kavita S


    Chikungunya virus (CHIKV) is an insect borne virus (genus: Alphavirus) which causes acute febrile illness in humans followed by a prolonged arthralgic disease that affects the joints of the extremities. Re-emergence of the virus in the form of outbreaks in last 6-7 years has posed a serious public health problem. CHIKV has a positive sense single stranded RNA genome of about 12,000 nt. Open reading frame 1 of the viral genome encodes a polyprotein precursor, nsP1234, which is processed further into different non structural proteins (nsP1, nsP2, nsP3 and nsP4). Sequence based analyses have shown helicase domain at the N-terminus and protease domain at C-terminus of nsP2. A detailed biochemical analysis of NTPase/RNA helicase and 5'-RNA phosphatase activities of recombinant CHIKV-nsP2T protein (containing conserved NTPase/helicase motifs in the N-terminus and partial papain like protease domain at the C-terminus) was carried out. The protein could hydrolyze all NTPs except dTTP and showed better efficiency for ATP, dATP, GTP and dGTP hydrolysis. ATP was the most preferred substrate by the enzyme. CHIKV-nsP2T also showed 5'-triphosphatase (RTPase) activity that specifically removes the γ-phosphate from the 5' end of RNA. Both NTPase and RTPase activities of the protein were completely dependent on Mg(2+) ions. RTPase activity was inhibited by ATP showing sharing of the binding motif by NTP and RNA. Both enzymatic activities were drastically reduced by mutations in the NTP binding motif (GKT) and co-factor, Mg(2+) ion binding motif (DEXX) suggesting that they have a common catalytic site.

  17. Mechanism of ivermectin facilitation of human P2X4 receptor channels.


    Priel, Avi; Silberberg, Shai D


    Ivermectin (IVM), a widely used antiparasitic agent in human and veterinary medicine, was recently shown to augment macroscopic currents through rat P2X(4) receptor channels. In the present study, the effects of IVM on the human P2X(4) (hP2X(4)) receptor channel stably transfected in HEK293 cells were investigated by recording membrane currents using the patch clamp technique. In whole-cell recordings, IVM (< or =10 microM) applied from outside the cell (but not from inside) increased the maximum current activated by ATP, and slowed the rate of current deactivation. These two phenomena likely result from the binding of IVM to separate sites. A higher affinity site (EC(50) 0.25 microM) increased the maximal current activated by saturating concentrations of ATP without significantly changing the rate of current deactivation or the EC(50) and Hill slope of the ATP concentration-response relationship. A lower affinity site (EC(50) 2 microM) slowed the rate of current deactivation, and increased the apparent affinity for ATP. In cell-attached patch recordings, P2X(4) receptor channels exhibited complex kinetics, with multiple components in both the open and shut distributions. IVM (0.3 microM) increased the number of openings per burst, without significantly changing the mean open or mean shut time within a burst. At higher concentrations (1.5 microM) of IVM, two additional open time components of long duration were observed that gave rise to long-lasting bursts of channel activity. Together, the results suggest that the binding of IVM to the higher affinity site increases current amplitude by reducing channel desensitization, whereas the binding of IVM to the lower affinity site slows the deactivation of the current predominantly by stabilizing the open conformation of the channel.

  18. Inhibition of adenylyl cyclase by neuronal P2Y receptors

    PubMed Central

    Unterberger, Ursula; Moskvina, Eugenia; Scholze, Thomas; Freissmuth, Michael; Boehm, Stefan


    P2Y receptors inhibiting adenylyl cyclase have been found in blood platelets, glioma cells, and endothelial cells. In platelets and glioma cells, these receptors were identified as P2Y12. Here, we have used PC12 cells to search for adenylyl cyclase inhibiting P2Y receptors in a neuronal cellular environment.ADP and ATP (0.1 – 100 μM) left basal cyclic AMP accumulation unaltered, but reduced cyclic AMP synthesis stimulated by activation of endogenous A2A or recombinant β2 receptors. Forskolin-dependent cyclic AMP production was reduced by ⩽1 μM and enhanced by 10 – 100 μM ADP; this latter effect was turned into an inhibition when A2A receptors were blocked.The nucleotide inhibition of cyclic AMP synthesis was not altered when P2X receptors were blocked, but abolished by pertussis toxin.The rank order of agonist potencies for the reduction of cyclic AMP was (IC50 values): 2-methylthio-ADP (0.12 nM)=2-methylthio-ATP (0.13 nM)>ADPβS (71 nM)>ATP (164 nM)=ADP (244 nM). The inhibition by ADP was not antagonized by suramin, pyridoxal-phosphate-6-azophenyl-2′,4′-disulphonic acid, or adenosine-3′-phosphate-5′-phosphate, but attenuated by reactive blue 2, ATPαS, and 2-methylthio-AMP.RT – PCR demonstrated the expression of P2Y2, P2Y4, P2Y6, and P2Y12, but not P2Y1, receptors in PC12 cells. In Northern blots, only P2Y2 and P2Y12 were detectable. Differentiation with NGF did not alter these hybridization signals and left the nucleotide inhibition of adenylyl cyclase unchanged.We conclude that P2Y12 receptors are expressed in neuronal cells and inhibit adenylyl cyclase activity. PMID:11834615

  19. Identification of amino acids related to catalytic function of Sulfolobus solfataricus P1 carboxylesterase by site-directed mutagenesis and molecular modeling

    PubMed Central

    Choi, Yun-Ho; Lee, Ye-Na; Park, Young-Jun; Yoon, Sung-Jin; Lee, Hee-Bong


    The archaeon Sulfolobus solfataricus P1 carboxylesterase is a thermostable enzyme with a molecular mass of 33.5 kDa belonging to the mammalian hormone-sensitive lipase (HSL) family. In our previous study, we purified the enzyme and suggested the expected amino acids related to its catalysis by chemical modification and a sequence homology search. For further validating these amino acids in this study, we modified them using site-directed mutagenesis and examined the activity of the mutant enzymes using spectrophotometric analysis and then estimated by homology modeling and fluorescence analysis. As a result, it was identified that Ser151, Asp244, and His274 consist of a catalytic triad, and Gly80, Gly81, and Ala152 compose an oxyanion hole of the enzyme. In addition, it was also determined that the cysteine residues are located near the active site or at the positions inducing any conformational changes of the enzyme by their replacement with serine residues. [BMB Reports 2016; 49(6): 349-354] PMID:27222124

  20. Discovering Antioxidant Molecules in the Archaea Domain: Peroxiredoxin Bcp1 from Sulfolobus solfataricus Protects H9c2 Cardiomyoblasts from Oxidative Stress

    PubMed Central

    Sarcinelli, Carmen; Pizzo, Elio


    Peroxiredoxins (Prxs) are ubiquitous thiol peroxidases that are involved in the reduction of peroxides. It has been reported that prokaryotic Prxs generally show greater structural robustness than their eukaryotic counterparts, making them less prone to inactivation by overoxidation. This difference has inspired the search for new antioxidants from prokaryotic sources that can be used as possible therapeutic biodrugs. Bacterioferritin comigratory proteins (Bcps) of the hyperthermophilic archaeon Sulfolobus solfataricus that belong to the Prx family have recently been characterized. One of these proteins, Bcp1, was chosen to determine its antioxidant effects in H9c2 rat cardiomyoblast cells. Bcp1 activity was measured in vitro under physiological temperature and pH conditions that are typical of mammalian cells; the yeast thioredoxin reductase (yTrxR)/thioredoxin (yTrx) reducing system was used to evaluate enzyme activity. A TAT-Bcp1 fusion protein was constructed to allow its internalization and verify the effect of Bcp1 on H9c2 rat cardiomyoblasts subjected to oxidative stress. The results reveal that TAT-Bcp1 is not cytotoxic and inhibits H2O2-induced apoptosis in H9c2 cells by reducing the H2O2 content inside these cells. PMID:27752237

  1. Activation of Distinct P2Y Receptor Subtypes Stimulates Insulin Secretion in MIN6 Mouse Pancreatic β Cells

    PubMed Central

    Balasubramanian, Ramachandran; de Azua, Inigo Ruiz; Wess, Jürgen; Jacobson, Kenneth A.


    Extracellular nucleotides and their receptor antagonists have therapeutic potential in disorders such as inflammation, brain disorders, and cardiovascular diseases. Pancreatic β cells express several purinergic receptors, and reported nucleotide effects on insulin secretion are contradictory. We studied the effect of P2Y receptors on insulin secretion and cell death in MIN6, mouse pancreatic β cells. Expression of P2Y1 and P2Y6 receptors was revealed by total mRNA analysis using RT-PCR. MIN6 cells were stimulated in the presence of 16.7 mM glucose with or without P2Y1 and P2Y6 agonists, 2-MeSADP and Up3U, respectively. Both the agonists increased insulin secretion with EC50 values of 44.6±7.0 nM and 30.7±12.7 nM respectively. The insulin secretion by P2Y1 and P2Y6 agonists was blocked by their selective antagonists MRS2179 and MRS2578, respectively. Binding of the selective P2Y1 receptor antagonist radioligand [125I]MRS2500 in MIN6 cell membranes was saturable (KD 4.74±0.47 nM), and known P2Y1 ligands competed with high affinities. Inflammation and glucose toxicity leads to pancreatic β cell death in diabetes. Flow cytometric analysis revealed that Up3U but not 2-MeSADP protected MIN6 cells against TNF-α induced apoptosis. Overall, the results demonstrate that selective stimulation of P2Y1 and P2Y6 receptors increases insulin secretion that accompanies intracellular calcium release, suggesting potential application of P2Y receptor ligands in the treatment of diabetes. PMID:20067775

  2. P2Y2 receptor agonist with enhanced stability protects the heart from ischemic damage in vitro and in vivo.


    Hochhauser, Edith; Cohen, Ronit; Waldman, Maayan; Maksin, Anna; Isak, Ahuva; Aravot, Dan; Jayasekara, P Suresh; Müller, Christa E; Jacobson, Kenneth A; Shainberg, Asher


    Extracellular nucleotides acting via P2 receptors play important roles in cardiovascular physiology/pathophysiology. Pyrimidine nucleotides activate four G protein-coupled P2Y receptors (P2YRs): P2Y2 and P2Y4 (UTP-activated), P2Y6, and P2Y14. Previously, we showed that uridine 5'-triphosphate (UTP) activating P2Y2R reduced infarct size and improved mouse heart function after myocardial infarct (MI). Here, we examined the cardioprotective role of P2Y2R in vitro and in vivo following MI using uridine-5'-tetraphosphate δ-phenyl ester tetrasodium salt (MRS2768), a selective and more stable P2Y2R agonist. Cultured rat cardiomyocytes pretreated with MRS2768 displayed protection from hypoxia [as revealed by lactate dehydrogenase (LDH) release and propidium iodide (PI) binding], which was reduced by P2Y2R antagonist, AR-C118925 (5-((5-(2,8-dimethyl-5H-dibenzo[a,d][7]annulen-5-yl)-2-oxo-4-thioxo-3,4-dihydropyrimidin-1(2H)-yl)methyl)-N-(1H-tetrazol-5-yl)furan-2-carboxamide). In vivo, echocardiography and infarct size staining of triphenyltetrazolium chloride (TTC) in 3 groups of mice 24 h post-MI: sham, MI, and MI+MRS2768 indicated protection. Fractional shortening (FS) was higher in MRS2768-treated mice than in MI alone (40.0 ± 3.1 % vs. 33.4 ± 2.7 %, p < 0.001). Troponin T and tumor necrosis factor-α (TNF-α) measurements demonstrated that MRS2768 pretreatment reduced myocardial damage (p < 0.05) and c-Jun phosphorylation increased. Thus, P2Y2R activation protects cardiomyocytes from hypoxia in vitro and reduces post-ischemic myocardial damage in vivo.

  3. P2RY14 — EDRN Public Portal

    P2RY14, or GPR105, is a G-protein coupled receptor that responds to extracellular purine and pyrimidine nucleotides. P2RY14 is not activated by ATP, ADP, UTP or ATP, but is a receptor for UDP-glucose and other UDP-sugars coupled to G-proteins. P2RY14 is thought to be involved in extending the known immune system functions of P2Y receptors by participating in the regulation of the stem cell compartment, and it may also play a role in neuroimmune function. Two transcript variants encoding the same protein have been identified for this gene. There are two transcript variants for this gene that result in the same protein.

  4. Control of bone development by P2X and P2Y receptors expressed in mesenchymal and hematopoietic cells

    PubMed Central

    Lenertz, Lisa Y.; Baughman, Cory J.; Waldschmidt, Noelle V.; Thaler, Roman; van Wijnen, Andre J.


    Bone development and homeostasis require the interplay between several cell types, including mesenchymal osteoblasts and osteocytes, as well as hematopoietic osteoclasts. Recent evidence suggests that cell proliferation, differentiation and apoptosis of both mesenchymal and hematopoietic stem cells, which are fundamental for tissue regeneration and treatment of degenerative diseases, is controlled by P2 receptors (i.e., P2X and P2Y receptors). Both types of P2 receptors are versatile transducers of diverse signals activated by extracellular nucleotides like ATP that are released in response to tissue injury, infection or shear stress. The P2X family of receptors has been shown to mediate multiple signaling events including the influx of calcium, activation of mitogen activated protein kinases (MAPKs) and induction of AP-1 family members known to regulate bone development. Support for the significance of P2X7 in regulating bone development and homeostasis has been provided by several studies focusing on animal models and single nucleotide polymorphisms. P2 receptors are functionally expressed in both bone forming osteoblasts and bone resorbing osteoclasts, while recent findings also suggest that these receptors translate mechanical stimuli in osteocytes. Their ability to respond to external nucleotide analogs renders these cell surface proteins excellent targets for skeletal regenerative therapies. This overview summarizes mechanisms by which nucleotide receptors control skeletal cells and contribute to bone tissue development remodeling and repair. PMID:26079571

  5. Accelerated FoxP2 Evolution in Echolocating Bats

    PubMed Central

    Li, Gang; Wang, Jinhong; Rossiter, Stephen J.; Jones, Gareth; Zhang, Shuyi


    FOXP2 is a transcription factor implicated in the development and neural control of orofacial coordination, particularly with respect to vocalisation. Observations that orthologues show almost no variation across vertebrates yet differ by two amino acids between humans and chimpanzees have led to speculation that recent evolutionary changes might relate to the emergence of language. Echolocating bats face especially challenging sensorimotor demands, using vocal signals for orientation and often for prey capture. To determine whether mutations in the FoxP2 gene could be associated with echolocation, we sequenced FoxP2 from echolocating and non-echolocating bats as well as a range of other mammal species. We found that contrary to previous reports, FoxP2 is not highly conserved across all nonhuman mammals but is extremely diverse in echolocating bats. We detected divergent selection (a change in selective pressure) at FoxP2 between bats with contrasting sonar systems, suggesting the intriguing possibility of a role for FoxP2 in the evolution and development of echolocation. We speculate that observed accelerated evolution of FoxP2 in bats supports a previously proposed function in sensorimotor coordination. PMID:17878935

  6. Network Awareness in P2P-TV Applications

    NASA Astrophysics Data System (ADS)

    Traverso, Stefano; Leonardi, Emilio; Mellia, Marco; Meo, Michela

    The increasing popularity of applications for video-streaming based on P2P paradigm (P2P-TV) is raising the interest of both broadcasters and network operators. The former see a promising technology to reduce the cost of streaming content over the Internet, while offering a world-wide service. The latter instead fear that the traffic offered by these applications can grow without control, affecting other services, and possibly causing network congestion and collapse. The “Network-Aware P2P-TV Application over Wise Networks” FP7 project aims at studying and developing a novel P2P-TV application offering the chance to broadcast high definition video to broadcasters and to carefully manage the traffic offered by peers to the network, therefore avoiding worries to Internet providers about network overload. In such context, we design a simulator to evaluate performance of different P2P-TV solutions, to compare them both considering end-users’ and network providers’ perspectives, such as quality of service perceived by subscribers and link utilization. In this paper, we provide some results that show how effective can be a network aware P2P-TV system.

  7. Improving P2P live-content delivery using SVC

    NASA Astrophysics Data System (ADS)

    Schierl, T.; Sánchez, Y.; Hellge, C.; Wiegand, T.


    P2P content delivery techniques for video transmission have become of high interest in the last years. With the involvement of client into the delivery process, P2P approaches can significantly reduce the load and cost on servers, especially for popular services. However, previous studies have already pointed out the unreliability of P2P-based live streaming approaches due to peer churn, where peers may ungracefully leave the P2P infrastructure, typically an overlay networks. Peers ungracefully leaving the system cause connection losses in the overlay, which require repair operations. During such repair operations, which typically take a few roundtrip times, no data is received from the lost connection. While taking low delay for fast-channel tune-in into account as a key feature for broadcast-like streaming applications, the P2P live streaming approach can only rely on a certain media pre-buffer during such repair operations. In this paper, multi-tree based Application Layer Multicast as a P2P overlay technique for live streaming is considered. The use of Flow Forwarding (FF), a.k.a. Retransmission, or Forward Error Correction (FEC) in combination with Scalable video Coding (SVC) for concealment during overlay repair operations is shown. Furthermore the benefits of using SVC over the use of AVC single layer transmission are presented.

  8. Replication Bypass of the trans-4-Hydroxynonenal-Derived (6S,8R,11S)-1,N[superscript 2]-Deoxyguanosine DNA Adduct by the Sulfolobus solfataricus DNA Polymerase IV

    SciTech Connect

    Banerjee, Surajit; Christov, Plamen P.; Kozekova, Albena; Rizzo, Carmelo J.; Egli, Martin; Stone, Michael P.


    trans-4-Hydroxynonenal (HNE) is the major peroxidation product of {omega}-6 polyunsaturated fatty acids in vivo. Michael addition of the N{sub 2}-amino group of dGuo to HNE followed by ring closure of N1 onto the aldehyde results in four diastereomeric 1,N{sub 2}-dGuo (1,N{sub 2}-HNE-dGuo) adducts. The (6S,8R,11S)-HNE-1,N{sub 2}-dGuo adduct was incorporated into the 18-mer templates 5'-d(TCATXGAATCCTTCCCCC)-3' and d(TCACXGAATCCTTCCCCC)-3', where X = (6S,8R,11S)-HNE-1,N{sub 2}-dGuo adduct. These differed in the identity of the template 5'-neighbor base, which was either Thy or Cyt, respectively. Each of these templates was annealed with either a 13-mer primer 5'-d(GGGGGAAGGATTC)-3' or a 14-mer primer 5'-d(GGGGGAAGGATTCC)-3'. The addition of dNTPs to the 13-mer primer allowed analysis of dNTP insertion opposite to the (6S,8R,11S)-HNE-1,N{sub 2}-dGuo adduct, whereas the 14-mer primer allowed analysis of dNTP extension past a primed (6S,8R,11S)-HNE-1,N{sub 2}-dGuo:dCyd pair. The Sulfolobus solfataricus P2 DNA polymerase IV (Dpo4) belongs to the Y-family of error-prone polymerases. Replication bypass studies in vitro reveal that this polymerase inserted dNTPs opposite the (6S,8R,11S)-HNE-1,N{sub 2}-dGuo adduct in a sequence-specific manner. If the template 5'-neighbor base was dCyt, the polymerase inserted primarily dGTP, whereas if the template 5'-neighbor base was dThy, the polymerase inserted primarily dATP. The latter event would predict low levels of Gua {yields} Thy mutations during replication bypass when the template 5'-neighbor base is dThy. When presented with a primed (6S,8R,11S)-HNE-1,N{sub 2}-dGuo:dCyd pair, the polymerase conducted full-length primer extension. Structures for ternary (Dpo4-DNA-dNTP) complexes with all four template-primers were obtained. For the 18-mer:13-mer template-primers in which the polymerase was confronted with the (6S,8R,11S)-HNE-1,N{sub 2}-dGuo adduct, the (6S,8R,11S)-1,N{sub 2}-dGuo lesion remained in the ring

  9. Uridine Triphosphate Thio Analogues Inhibit Platelet P2Y12 Receptor and Aggregation

    PubMed Central

    Gündüz, Dursun; Tanislav, Christian; Sedding, Daniel; Parahuleva, Mariana; Santoso, Sentot; Troidl, Christian; Hamm, Christian W.; Aslam, Muhammad


    Platelet P2Y12 is an important adenosine diphosphate (ADP) receptor that is involved in agonist-induced platelet aggregation and is a valuable target for the development of anti-platelet drugs. Here we characterise the effects of thio analogues of uridine triphosphate (UTP) on ADP-induced platelet aggregation. Using human platelet-rich plasma, we demonstrate that UTP inhibits P2Y12 but not P2Y1 receptors and antagonises 10 µM ADP-induced platelet aggregation in a concentration-dependent manner with an IC50 value of ~250 µM. An eight-fold higher platelet inhibitory activity was observed with a 2-thio analogue of UTP (2S-UTP), with an IC50 of 30 µM. The 4-thio analogue (4S-UTP) with an IC50 of 7.5 µM was 33-fold more effective. A three-fold decrease in inhibitory activity, however, was observed by introducing an isobutyl group at the 4S- position. A complete loss of inhibition was observed with thio-modification of the γ phosphate of the sugar moiety, which yields an enzymatically stable analogue. The interaction of UTP analogues with P2Y12 receptor was verified by P2Y12 receptor binding and cyclic AMP (cAMP) assays. These novel data demonstrate for the first time that 2- and 4-thio analogues of UTP are potent P2Y12 receptor antagonists that may be useful for therapeutic intervention. PMID:28146050

  10. Structural insights into the nucleotide base specificity of P2X receptors

    PubMed Central

    Kasuya, Go; Fujiwara, Yuichiro; Tsukamoto, Hisao; Morinaga, Satoshi; Ryu, Satoshi; Touhara, Kazushige; Ishitani, Ryuichiro; Furutani, Yuji; Hattori, Motoyuki; Nureki, Osamu


    P2X receptors are trimeric ATP-gated cation channels involved in diverse physiological processes, ranging from muscle contraction to nociception. Despite the recent structure determination of the ATP-bound P2X receptors, the molecular mechanism of the nucleotide base specificity has remained elusive. Here, we present the crystal structure of zebrafish P2X4 in complex with a weak affinity agonist, CTP, together with structure-based electrophysiological and spectroscopic analyses. The CTP-bound structure revealed a hydrogen bond, between the cytosine base and the side chain of the basic residue in the agonist binding site, which mediates the weak but significant affinity for CTP. The cytosine base is further recognized by two main chain atoms, as in the ATP-bound structure, but their bond lengths seem to be extended in the CTP-bound structure, also possibly contributing to the weaker affinity for CTP over ATP. This work provides the structural insights for the nucleotide base specificity of P2X receptors. PMID:28332633

  11. Two different P2Y receptors linked to steroidogenesis in bovine adrenocortical cells.


    Nishi, H


    Both extracellular adenosine 5'-triphosphate (ATP) and uridine 5'-triphosphate (UTP) induced corticoid production (steroidogenesis) concentration-dependently in bovine adrenocortical cells (BA cells). Pertussis toxin (PTX, approx. 2 microg/ml) partially inhibited (approx. 55% inhibition) extracellular ATP (100 microM)-induced steroidogenesis in BA cells. However, PTX did not inhibit extracellular UTP (100 microM)-induced steroidogenesis. Both ATP- and UTP-induced steroidogeneses were significantly inhibited by suramin (50-200 microM). These effects were inhibited significantly by reactive blue-2 (more than 100 microM) and pyridoxal-phosphate-6-azophenyl-2',4'-disulphonic acid (more than 100 microM). Both nucleotides (1-100 microM) induced inositol phosphates accumulation and intracellular Ca2+ mobilization, but PTX did not inhibit them. The RT-PCR procedure identified only P2Y2-receptor mRNA in BA cells. These results suggest that extracellular ATP induces steroidogenesis via a unique P2 receptor linked to PTX-sensitive guanine nucleotide-binding protein (G-protein), while extracellular UTP induces steroidogenesis via P2 receptor linked to PTX-insensitive G-protein. Thus, it was concluded that at least two different P2Y-like receptors linking to steroidogenesis exist in BA cells.

  12. Synergistic activation of G protein-gated inwardly rectifying potassium channels by cholesterol and PI(4,5)P2.


    Bukiya, Anna N; Rosenhouse-Dantsker, Avia


    G-protein gated inwardly rectifying potassium (GIRK or Kir3) channels play a major role in the control of the heart rate, and require the membrane phospholipid phosphatidylinositol-bis-phosphate (PI(4,5)P2) for activation. Recently, we have shown that the activity of the heterotetrameric Kir3.1/Kir3.4 channel that underlies atrial KACh currents was enhanced by cholesterol. Similarly, the activities of both the Kir3.4 homomer and its active pore mutant Kir3.4* (Kir3.4_S143T) were also enhanced by cholesterol. Here we employ planar lipid bilayers to investigate the crosstalk between PI(4,5)P2 and cholesterol, and demonstrate that these two lipids act synergistically to activate Kir3.4* currents. Further studies using the Xenopus oocytes heterologous expression system suggest that PI(4,5)P2 and cholesterol act via distinct binding sites. Whereas PI(4,5)P2 binds to the cytosolic domain of the channel, the putative binding region of cholesterol is located at the center of the transmembrane domain overlapping the central glycine hinge region of the channel. Together, our data suggest that changes in the levels of two key membrane lipids - cholesterol and PI(4,5)P2 - could act in concert to provide fine-tuning of Kir3 channel function. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. P2Y2 purinergic receptor activation is essential for efficient hepatocyte proliferation in response to partial hepatectomy

    PubMed Central

    Tackett, Bryan C.; Sun, Hongdan; Mei, Yu; Maynard, Janielle P.; Cheruvu, Sayuri; Mani, Arunmani; Hernandez-Garcia, Andres; Vigneswaran, Nadarajah; Karpen, Saul J.


    Extracellular nucleotides via activation of P2 purinergic receptors influence hepatocyte proliferation and liver regeneration in response to 70% partial hepatectomy (PH). Adult hepatocytes express multiple P2Y (G protein-coupled) and P2X (ligand-gated ion channels) purinergic receptor subtypes. However, the identity of key receptor subtype(s) important for efficient hepatocyte proliferation in regenerating livers remains unknown. To evaluate the impact of P2Y2 purinergic receptor-mediated signaling on hepatocyte proliferation in regenerating livers, wild-type (WT) and P2Y2 purinergic receptor knockout (P2Y2−/−) mice were subjected to 70% PH. Liver tissues were analyzed for activation of early events critical for hepatocyte priming and subsequent cell cycle progression. Our findings suggest that early activation of p42/44 ERK MAPK (5 min), early growth response-1 (Egr-1) and activator protein-1 (AP-1) DNA-binding activity (30 min), and subsequent hepatocyte proliferation (24–72 h) in response to 70% PH were impaired in P2Y2−/− mice. Interestingly, early induction of cytokines (TNF-α, IL-6) and cytokine-mediated signaling (NF-κB, STAT-3) were intact in P2Y2−/− remnant livers, uncovering the importance of cytokine-independent and nucleotide-dependent early priming events critical for subsequent hepatocyte proliferation in regenerating livers. Hepatocytes isolated from the WT and P2Y2−/− mice were treated with ATP or ATPγS for 5–120 min and 12–24 h. Extracellular ATP alone, via activation of P2Y2 purinergic receptors, was sufficient to induce ERK phosphorylation, Egr-1 protein expression, and key cyclins and cell cycle progression of hepatocytes in vitro. Collectively, these findings highlight the functional significance of P2Y2 purinergic receptor activation for efficient hepatocyte priming and proliferation in response to PH. PMID:25301185

  14. Protective Role of P2Y2 Receptor against Lung Infection Induced by Pneumonia Virus of Mice

    PubMed Central

    Vanderstocken, Gilles; Van de Paar, Els; Robaye, Bernard; di Pietrantonio, Larissa; Bondue, Benjamin; Boeynaems, Jean-Marie; Desmecht, Daniel; Communi, Didier


    ATP released in the early inflammatory processes acts as a danger signal by binding to purinergic receptors expressed on immune cells. A major contribution of the P2Y2 receptor of ATP/UTP to dendritic cell function and Th2 lymphocyte recruitment during asthmatic airway inflammation was previously reported. We investigated here the involvement of P2Y2 receptor in lung inflammation initiated by pneumonia virus of mice infection. We demonstrated that P2Y2−/− mice display a severe increase in morbidity and mortality rate in response to the virus. Lower survival of P2Y2−/− mice was not significantly correlated with excessive inflammation despite the higher level of neutrophil recruiters in their bronchoalveolar fluids. Interestingly, we observed reduced ATP level and lower numbers of dendritic cells, CD4+ T cells and CD8+ T cells in P2Y2−/− compared to P2Y2+/+ infected lungs. Lower level of IL-12 and higher level of IL-6 in bronchoalveolar fluid support an inhibition of Th1 response in P2Y2−/− infected mice. Quantification of DC recruiter expression revealed comparable IP-10 and MIP-3α levels but a reduced BRAK level in P2Y2−/− compared to P2Y2+/+ bronchoalveolar fluids. The increased morbidity and mortality of P2Y2−/− mice could be the consequence of a lower viral clearance leading to a more persistent viral load correlated with the observed higher viral titer. The decreased viral clearance could result from the defective Th1 response to PVM with a lack of DC and T cell infiltration. In conclusion, P2Y2 receptor, previously described as a target in cystic fibrosis therapy and as a mediator of Th2 response in asthma, may also regulate Th1 response protecting mice against lung viral infection. PMID:23185614

  15. P2Y2 purinergic receptor activation is essential for efficient hepatocyte proliferation in response to partial hepatectomy.


    Tackett, Bryan C; Sun, Hongdan; Mei, Yu; Maynard, Janielle P; Cheruvu, Sayuri; Mani, Arunmani; Hernandez-Garcia, Andres; Vigneswaran, Nadarajah; Karpen, Saul J; Thevananther, Sundararajah


    Extracellular nucleotides via activation of P2 purinergic receptors influence hepatocyte proliferation and liver regeneration in response to 70% partial hepatectomy (PH). Adult hepatocytes express multiple P2Y (G protein-coupled) and P2X (ligand-gated ion channels) purinergic receptor subtypes. However, the identity of key receptor subtype(s) important for efficient hepatocyte proliferation in regenerating livers remains unknown. To evaluate the impact of P2Y2 purinergic receptor-mediated signaling on hepatocyte proliferation in regenerating livers, wild-type (WT) and P2Y2 purinergic receptor knockout (P2Y2-/-) mice were subjected to 70% PH. Liver tissues were analyzed for activation of early events critical for hepatocyte priming and subsequent cell cycle progression. Our findings suggest that early activation of p42/44 ERK MAPK (5 min), early growth response-1 (Egr-1) and activator protein-1 (AP-1) DNA-binding activity (30 min), and subsequent hepatocyte proliferation (24-72 h) in response to 70% PH were impaired in P2Y2-/- mice. Interestingly, early induction of cytokines (TNF-α, IL-6) and cytokine-mediated signaling (NF-κB, STAT-3) were intact in P2Y2-/- remnant livers, uncovering the importance of cytokine-independent and nucleotide-dependent early priming events critical for subsequent hepatocyte proliferation in regenerating livers. Hepatocytes isolated from the WT and P2Y2-/- mice were treated with ATP or ATPγS for 5-120 min and 12-24 h. Extracellular ATP alone, via activation of P2Y2 purinergic receptors, was sufficient to induce ERK phosphorylation, Egr-1 protein expression, and key cyclins and cell cycle progression of hepatocytes in vitro. Collectively, these findings highlight the functional significance of P2Y2 purinergic receptor activation for efficient hepatocyte priming and proliferation in response to PH. Copyright © 2014 the American Physiological Society.

  16. Protective role of P2Y2 receptor against lung infection induced by pneumonia virus of mice.


    Vanderstocken, Gilles; Van de Paar, Els; Robaye, Bernard; di Pietrantonio, Larissa; Bondue, Benjamin; Boeynaems, Jean-Marie; Desmecht, Daniel; Communi, Didier


    ATP released in the early inflammatory processes acts as a danger signal by binding to purinergic receptors expressed on immune cells. A major contribution of the P2Y(2) receptor of ATP/UTP to dendritic cell function and Th2 lymphocyte recruitment during asthmatic airway inflammation was previously reported. We investigated here the involvement of P2Y(2) receptor in lung inflammation initiated by pneumonia virus of mice infection. We demonstrated that P2Y(2) (-/-) mice display a severe increase in morbidity and mortality rate in response to the virus. Lower survival of P2Y(2) (-/-) mice was not significantly correlated with excessive inflammation despite the higher level of neutrophil recruiters in their bronchoalveolar fluids. Interestingly, we observed reduced ATP level and lower numbers of dendritic cells, CD4(+) T cells and CD8(+) T cells in P2Y(2) (-/-) compared to P2Y(2) (+/+) infected lungs. Lower level of IL-12 and higher level of IL-6 in bronchoalveolar fluid support an inhibition of Th1 response in P2Y(2) (-/-) infected mice. Quantification of DC recruiter expression revealed comparable IP-10 and MIP-3α levels but a reduced BRAK level in P2Y(2) (-/-) compared to P2Y(2) (+/+) bronchoalveolar fluids. The increased morbidity and mortality of P2Y(2) (-/-) mice could be the consequence of a lower viral clearance leading to a more persistent viral load correlated with the observed higher viral titer. The decreased viral clearance could result from the defective Th1 response to PVM with a lack of DC and T cell infiltration. In conclusion, P2Y(2) receptor, previously described as a target in cystic fibrosis therapy and as a mediator of Th2 response in asthma, may also regulate Th1 response protecting mice against lung viral infection.

  17. P2-receptor modulation of noradrenergic neurotransmission in rat kidney

    PubMed Central

    Bohmann, Christine; von Kügelgen, Ivar; Christian Rump, L


    ATP has previously been shown to act as a sympathetic cotransmitter in the rat kidney. The present study analyses the question of whether postganglionic sympathetic nerve endings in the kidney possess P2-receptors which modulate noradrenaline release. Rat kidneys were perfused with Krebs-Henseleit solution containing the noradrenaline uptake blockers cocaine and corticosterone and the α2-adrenoceptor antagonist rauwolscine. The renal nerves were electrically stimulated, in most experiments by 30 pulses applied at 1 Hz. The outflow of endogenous noradrenaline (or, in some experiments, of ATP and lactate dehydrogenase) as well as the perfusion pressure were measured simultaneously. The P2-receptor agonist adenosine-5′-O-(3-thiotriphosphate) (ATPγS, 3–30 μM) reduced the renal nerve stimulation (RNS)-induced outflow of noradrenaline (estimated EC50=8 μM). The P2-receptor antagonist cibacron blue 3GA (30 μM) shifted the concentration-inhibition curve for ATPγS to the right (apparent pKB value 4.7). Cibacron blue 3GA (3–30 μM) and its isomer reactive blue 2 (3–30 μM) significantly increased RNS-induced outflow of noradrenaline in the presence of the P1-receptor antagonist 8-(p-sulphophenyl)theophylline (8-SPT, 100 μM) by about 70% and 90%, respectively. The P2-receptor antagonist suramin (30–300 μM) only tended to enhance RNS-induced outflow of noradrenaline. When the nerves were stimulated by short pulse trains consisting of 6 pulses applied at 100 Hz (conditions under which autoinhibition is inoperative), reactive blue 2 did not affect the RNS-induced outflow of noradrenaline. RNS (120 pulses applied at 4 Hz) induced the outflow of ATP but not of the cytoplasmatic enzyme lactate dehydrogenase. ATPγS (3–30 μM) concentration-dependently reduced pressor responses to RNS at 1 Hz. Cibacron blue 3GA, reactive blue 2 as well as suramin also reduced pressor responses to RNS (maximally by 50 to 70%). This study in rat isolated

  18. Determinants of Default in P2P Lending

    PubMed Central


    This paper studies P2P lending and the factors explaining loan default. This is an important issue because in P2P lending individual investors bear the credit risk, instead of financial institutions, which are experts in dealing with this risk. P2P lenders suffer a severe problem of information asymmetry, because they are at a disadvantage facing the borrower. For this reason, P2P lending sites provide potential lenders with information about borrowers and their loan purpose. They also assign a grade to each loan. The empirical study is based on loans’ data collected from Lending Club (N = 24,449) from 2008 to 2014 that are first analyzed by using univariate means tests and survival analysis. Factors explaining default are loan purpose, annual income, current housing situation, credit history and indebtedness. Secondly, a logistic regression model is developed to predict defaults. The grade assigned by the P2P lending site is the most predictive factor of default, but the accuracy of the model is improved by adding other information, especially the borrower’s debt level. PMID:26425854

  19. Managing Linguistic Data Summaries in Advanced P2P Applications

    NASA Astrophysics Data System (ADS)

    Hayek, Rabab; Raschia, Guillaume; Valduriez, Patrick; Mouaddib, Noureddine

    As the amount of stored data increases, data localization techniques become no longer sufficient in P2P systems. A practical approach is to rely on compact database summaries rather than raw database records, whose access is costly in large P2P systems. In this chapter, we describe a solution for managing linguistic data summaries in advanced P2P applications which are dealing with semantically rich data. The produced summaries are synthetic, multidimensional views over relational tables. The novelty of this proposal relies on the double summary exploitation in distributed P2P systems. First, as semantic indexes, they support locating relevant nodes based on their data descriptions. Second, due to their intelligibility, these summaries can be directly queried and thus approximately answer a query without the need for exploring original data. The proposed solution consists first in defining a summary model for hierarchical P2P systems. Second, appropriate algorithms for summary creation and maintenance are presented. A query processing mechanism, which relies on summary querying, is then proposed to demonstrate the benefits that might be obtained from summary exploitation.

  20. Protecting Data Privacy in Structured P2P Networks

    NASA Astrophysics Data System (ADS)

    Jawad, Mohamed; Serrano-Alvarado, Patricia; Valduriez, Patrick

    P2P systems are increasingly used for efficient, scalable data sharing. Popular applications focus on massive file sharing. However, advanced applications such as online communities (e.g., medical or research communities) need to share private or sensitive data. Currently, in P2P systems, untrusted peers can easily violate data privacy by using data for malicious purposes (e.g., fraudulence, profiling). To prevent such behavior, the well accepted Hippocratic database principle states that data owners should specify the purpose for which their data will be collected. In this paper, we apply such principles as well as reputation techniques to support purpose and trust in structured P2P systems. Hippocratic databases enforce purpose-based privacy while reputation techniques guarantee trust. We propose a P2P data privacy model which combines the Hippocratic principles and the trust notions. We also present the algorithms of PriServ, a DHT-based P2P privacy service which supports this model and prevents data privacy violation. We show, in a performance evaluation, that PriServ introduces a small overhead.

  1. An efficient query mechanism base on P2P networks

    NASA Astrophysics Data System (ADS)

    Wang, Xiaohua; Mu, Aiqin; Zhao, Defang


    How to implement the efficient query is the key problem deployed on P2P networks. This paper analyses the shortage of several query algorithm, and presents a new algorithm DDI, which means distributed searching with double indices. It discusses the popularity of documents and the linking status of the networks, and calculates the availability of the nodes in whole network, determines the route of the query process. It compares the items of time using, the quantity of requests and update information by the emulate experiments. Along with the rapid development of computer network technology, peer-to-peer (referred to as P2P) network research has gradually become mature, and it is widely used in different fields, some large P2P computing project has entered the implementation stage. At present, many more popular software systems such as Gnutella, Freenet, Napster are deployed based on P2P technology. How to achieve effective information query has become one of the key problems of P2P research.

  2. Determinants of Default in P2P Lending.


    Serrano-Cinca, Carlos; Gutiérrez-Nieto, Begoña; López-Palacios, Luz


    This paper studies P2P lending and the factors explaining loan default. This is an important issue because in P2P lending individual investors bear the credit risk, instead of financial institutions, which are experts in dealing with this risk. P2P lenders suffer a severe problem of information asymmetry, because they are at a disadvantage facing the borrower. For this reason, P2P lending sites provide potential lenders with information about borrowers and their loan purpose. They also assign a grade to each loan. The empirical study is based on loans' data collected from Lending Club (N = 24,449) from 2008 to 2014 that are first analyzed by using univariate means tests and survival analysis. Factors explaining default are loan purpose, annual income, current housing situation, credit history and indebtedness. Secondly, a logistic regression model is developed to predict defaults. The grade assigned by the P2P lending site is the most predictive factor of default, but the accuracy of the model is improved by adding other information, especially the borrower's debt level.

  3. Identification of high-affinity P2Y₁₂ antagonists based on a phenylpyrazole glutamic acid piperazine backbone.


    Zech, Gernot; Hessler, Gerhard; Evers, Andreas; Weiss, Tilo; Florian, Peter; Just, Melitta; Czech, Jörg; Czechtizky, Werngard; Görlitzer, Jochen; Ruf, Sven; Kohlmann, Markus; Nazaré, Marc


    A series of novel, highly potent P2Y₁₂ antagonists as inhibitors of platelet aggregation based on a phenylpyrazole glutamic acid piperazine backbone is described. Exploration of the structural requirements of the substituents by probing the structure-activity relationship along this backbone led to the discovery of the N-acetyl-(S)-proline cyclobutyl amide moiety as a highly privileged motif. Combining the most favorable substituents led to remarkably potent P2Y₁₂ antagonists displaying not only low nanomolar binding affinity to the P2Y₁₂ receptor but also a low nanomolar inhibition of platelet aggregation in the human platelet rich plasma assay with IC₅₀ values below 50 nM. Using a homology and a three-dimensional quantitative structure-activity relationship model, a binding hypothesis elucidating the impact of several structural features was developed.

  4. The P2Y2 receptor mediates uptake of matrix-retained and aggregated low density lipoprotein in primary vascular smooth muscle cells

    PubMed Central

    Dissmore, Tixieanna; Seye, Cheikh I.; Medeiros, Denis M.; Weisman, Gary A.; Bardford, Barry; Mamedova, Laman


    Background and aims The internalization of aggregated low-density lipoproteins (agLDL) mediated by low-density lipoprotein receptor related protein (LRP1) may involve the actin cytoskeleton in ways that differ from the endocytosis of soluble LDL by the LDL receptor (LDLR). This study aims to define novel mechanisms of agLDL uptake through modulation of the actin cytoskeleton, to identify molecular targets involved in foam cell formation in vascular smooth muscle cells (VSMCs). The critical observation that formed the basis for these studies is that under pathophysiological conditions, nucleotide release from blood-derived and vascular cells activates SMC P2Y2 receptors (P2Y2Rs) leading to rearrangement of the actin cytoskeleton and cell motility. Therefore, we tested the hypothesis that P2Y2R activation mediates agLDL uptake by VSMCs. Methods Primary VSMCs were isolated from aortas of wild type (WT) C57BL/6 and.P2Y2R−/− mice to investigate whether P2Y2R activation modulates LRP1 expression. Cells were transiently transfected with cDNA encoding a hemagglutinin-tagged (HA-tagged) WT P2Y2R, or a mutant P2Y2R that unlike the WT P2Y2R does not bind the cytoskeletal actin-binding protein filamin-A (FLN-A). Results P2Y2R activation significantly increased agLDL uptake, and LRP1 mRNA expression decreased in P2Y2R−/− VSMCs versus WT. SMCs, expressing P2Y2R defective in FLN-A binding, exhibit 3-fold lower LDLR expression levels than SMCs expressing WT P2Y2R, while cells transfected with WT P2Y2R show greater agLDL uptake in both WT and P2Y2R−/− VSMCs versus cells transfected with the mutant P2Y2R. Conclusions Together, these results show that both LRP1 and LDLR expression and agLDL uptake are regulated by P2Y2R in VSMCs, and that agLDL uptake due to P2Y2R activation is dependent upon cytoskeletal reorganization mediated by P2Y2R binding to FLN-A. PMID:27522265

  5. The P2Y2 receptor mediates uptake of matrix-retained and aggregated low density lipoprotein in primary vascular smooth muscle cells.


    Dissmore, Tixieanna; Seye, Cheikh I; Medeiros, Denis M; Weisman, Gary A; Bardford, Barry; Mamedova, Laman


    The internalization of aggregated low-density lipoproteins (agLDL) mediated by low-density lipoprotein receptor related protein (LRP1) may involve the actin cytoskeleton in ways that differ from the endocytosis of soluble LDL by the LDL receptor (LDLR). This study aims to define novel mechanisms of agLDL uptake through modulation of the actin cytoskeleton, to identify molecular targets involved in foam cell formation in vascular smooth muscle cells (VSMCs). The critical observation that formed the basis for these studies is that under pathophysiological conditions, nucleotide release from blood-derived and vascular cells activates SMC P2Y2 receptors (P2Y2Rs) leading to rearrangement of the actin cytoskeleton and cell motility. Therefore, we tested the hypothesis that P2Y2R activation mediates agLDL uptake by VSMCs. Primary VSMCs were isolated from aortas of wild type (WT) C57BL/6 and.P2Y2R-/- mice to investigate whether P2Y2R activation modulates LRP1 expression. Cells were transiently transfected with cDNA encoding a hemagglutinin-tagged (HA-tagged) WT P2Y2R, or a mutant P2Y2R that unlike the WT P2Y2R does not bind the cytoskeletal actin-binding protein filamin-A (FLN-A). P2Y2R activation significantly increased agLDL uptake, and LRP1 mRNA expression decreased in P2Y2R-/- VSMCs versus WT. SMCs, expressing P2Y2R defective in FLN-A binding, exhibit 3-fold lower LDLR expression levels than SMCs expressing WT P2Y2R, while cells transfected with WT P2Y2R show greater agLDL uptake in both WT and P2Y2R-/- VSMCs versus cells transfected with the mutant P2Y2R. Together, these results show that both LRP1 and LDLR expression and agLDL uptake are regulated by P2Y2R in VSMCs, and that agLDL uptake due to P2Y2R activation is dependent upon cytoskeletal reorganization mediated by P2Y2R binding to FLN-A. Published by Elsevier Ireland Ltd.

  6. Market Design for a P2P Backup System

    NASA Astrophysics Data System (ADS)

    Seuken, Sven; Charles, Denis; Chickering, Max; Puri, Sidd

    Peer-to-peer (P2P) backup systems are an attractive alternative to server-based systems because the immense costs of large data centers can be saved by using idle resources on millions of private computers instead. This paper presents the design and theoretical analysis of a market for a P2P backup system. While our long-term goal is an open resource exchange market using real money, here we consider a system where monetary transfers are prohibited. A user who wants to backup his data must in return supply some of his resources (storage space, upload and download bandwidth) to the system.We propose a hybrid P2P architecture where all backup data is transferred directly between peers, but a dedicated server coordinates all operations and maintains meta-data. We achieve high reliability guarantees while keeping our data replication factor low by adopting sophisticated erasure coding technology (cf., [2]).

  7. P2 receptor-mediated signaling in mast cell biology.


    Bulanova, Elena; Bulfone-Paus, Silvia


    Mast cells are widely recognized as effector cells of allergic inflammatory reactions. They contribute to the pathogenesis of different chronic inflammatory diseases, wound healing, fibrosis, thrombosis/fibrinolysis, and anti-tumor immune responses. In this paper, we summarized the role of P2X and P2Y receptors in mast cell activation and effector functions. Mast cells are an abundant source of ATP which is stored in their granules and secreted upon activation. We discuss the contribution of mast cells to the extracellular ATP release and to the maintenance of extracellular nucleotides pool. Recent publications highlight the importance of purinergic signaling for the pathogenesis of chronic airway inflammation. Therefore, the role of ATP and P2 receptors in allergic inflammation with focus on mast cells was analyzed. Finally, ATP functions as mast cell autocrine/paracrine factor and as messenger in intercellular communication between mast cells, nerves, and glia in the central nervous system.

  8. CysLT1 leukotriene receptor antagonists inhibit the effects of nucleotides acting at P2Y receptors

    PubMed Central

    Mamedova, Liaman; Capra, Valérie; Accomazzo, Maria Rosa; Gao, Zhan-Guo; Ferrario, Silvia; Fumagalli, Marta; Abbracchio, Maria P.; Rovati, G. Enrico; Jacobson, Kenneth A.


    Montelukast and pranlukast are orally active leukotriene receptor antagonists selective for the CysLT1 receptor. Conversely, the hP2Y1,2,4,6,11,12,13,14 receptors represent a large family of GPCRs responding to either adenine or uracil nucleotides, or to sugar-nucleotides. Montelukast and pranlukast were found to inhibit nucleotide-induced calcium mobilization in a human monocyte-macrophage like cell line, DMSO-differentiated U937 (dU937). Montelukast and pranlukast inhibited the effects of UTP with IC50 values of 7.7 and 4.3 μM, respectively, and inhibited the effects of UDP with IC50 values of 4.5 and 1.6 μM, respectively, in an insurmountable manner. Furthermore, ligand binding studies using [3H]LTD4 excluded the possibility of orthosteric nucleotide binding to the CysLT1 receptor. dU937 cells were shown to express P2Y2, P2Y4, P2Y6, P2Y11, P2Y13 and P2Y14 receptors. Therefore, these antagonists were studied functionally in a heterologous expression system for the human P2Y receptors. In 1321N1 astrocytoma cells stably expressing human P2Y1,2,4,6 receptors, CysLT1 antagonists inhibited both the P2Y agonist-induced activation of phospholipase C and intracellular Ca2+ mobilization. IC50 values at P2Y1 and P2Y6 receptors were <1 μM. In control astrocytoma cells expressing an endogenous M3 muscarinic receptor, 10 μM montelukast had no effect on the carbachol-induced rise in intracellular Ca2+. These data demonstrated that CysLT1 receptor antagonists interact functionally with signaling pathways of P2Y receptors, and this should foster the study of possible implications for the clinical use of these compounds in asthma or in other inflammatory conditions. PMID:16280122

  9. Effect of P2X4 and P2X7 receptor antagonism on the pressure diuresis relationship in rats

    PubMed Central

    Menzies, Robert I.; Unwin, Robert J.; Dash, Ranjan K.; Beard, Daniel A.; Cowley Jr., Allen W.; Carlson, Brian E.; Mullins, John J.; Bailey, Matthew A.


    Reduced glomerular filtration, hypertension and renal microvascular injury are hallmarks of chronic kidney disease, which has a global prevalence of ~10%. We have shown previously that the Fischer (F344) rat has lower GFR than the Lewis rat, and is more susceptible to renal injury induced by hypertension. In the early stages this injury is limited to the pre-glomerular vasculature. We hypothesized that poor renal hemodynamic function and vulnerability to vascular injury are causally linked and genetically determined. In the present study, normotensive F344 rats had a blunted pressure diuresis relationship, compared with Lewis rats. A kidney microarray was then interrogated using the Endeavour enrichment tool to rank candidate genes for impaired blood pressure control. Two novel candidate genes, P2rx7 and P2rx4, were identified, having a 7− and 3− fold increased expression in F344 rats. Immunohistochemistry localized P2X4 and P2X7 receptor expression to the endothelium of the pre-glomerular vasculature. Expression of both receptors was also found in the renal tubule; however there was no difference in expression profile between strains. Brilliant Blue G (BBG), a relatively selective P2X7 antagonist suitable for use in vivo, was administered to both rat strains. In Lewis rats, BBG had no effect on blood pressure, but increased renal vascular resistance, consistent with inhibition of some basal vasodilatory tone. In F344 rats BBG caused a significant reduction in blood pressure and a decrease in renal vascular resistance, suggesting that P2X7 receptor activation may enhance vasoconstrictor tone in this rat strain. BBG also reduced the pressure diuresis threshold in F344 rats, but did not alter its slope. These preliminary findings suggest a physiological and potential pathophysiological role for P2X7 in controlling renal and/or systemic vascular function, which could in turn affect susceptibility to hypertension-related kidney damage. PMID:24187541

  10. Faraday effect in Sn2P2S6 crystals.


    Krupych, Oleh; Adamenko, Dmytro; Mys, Oksana; Grabar, Aleksandr; Vlokh, Rostyslav


    We have revealed a large Faraday rotation in tin thiohypodiphosphate (Sn(2)P(2)S(6)) crystals, which makes this material promising for magneto-optics. The effective Faraday tensor component and the Verdet constant for the direction of the optic axis have been determined by measuring the pure Faraday rotation in Sn(2)P(2)S(6) crystals with both the single-ray and small-angular polarimetric methods at the normal conditions and a wavelength of 632.8 nm. The effective Verdet constant is found to be equal to 115 rad/T x m.

  11. P2Y nucleotide receptors: Promise of therapeutic applications

    PubMed Central

    Jacobson, Kenneth A.; Boeynaems, Jean-Marie


    Extracellular nucleotides, such as ATP and UTP, have distinct signaling roles through a class of G protein-coupled receptors, termed P2Y. However, the receptor ligands are typically charged molecules of low bioavailability and stability in vivo. Recent progress in the development of selective agonists and antagonists for P2Y receptors and study of knockout mice have led to new drug concepts based on these receptors. The rapidly accelerating progress in this field has already resulted in drug candidates for cystic fibrosis, dry eye disease, and thrombosis. On the horizon are novel treatments of cardiovascular diseases, inflammatory diseases, and neurodegeneration. PMID:20594935

  12. Mini Magnetospheric Plasma Propulsion (M2P2)

    NASA Technical Reports Server (NTRS)

    Gallagher, Dennis; Winglee, Robert


    The M2P2 concept is based on the transfer of momentum from the solar wind to an artificial magnetic field structure like that naturally occurs at all magnetized planets in the Solar System, called the magnetosphere. The objectives of this program include the following: (1) Demonstrate artificial magnetospheric inflation through cold plasma filling in vacuum; (2) Demonstrate deflection of a surrogate solar wind by an artificial magnetosphere in the laboratory vacuum chamber; (3) Compare theoretical calculations for thrust forces with laboratory measurements; (4) Develop flight control algorithms for planning mission specific trajectories; and (5) Develop M2P2 system concept.

  13. The Social Impact of P2P Systems

    NASA Astrophysics Data System (ADS)

    Glorioso, Andrea; Pagallo, Ugo; Ruffo, Giancarlo

    The chapter deals with the social impact of P2P systems in light of a bidirectional connection by which technological developments influence, in a complex and often unpredictable way, the social environment whereas the dynamic evolution of the latter does affect technological progress. From this perspective, the aim is to deepen legal issues, sociological trends, economical aspects, and political dimensions of P2P technology, along with some of its next possible outputs, in order to assess one of the most compelling alternatives to the traditional frame of highly centralized human interaction.

  14. Homology modeling, molecular dynamics, e-pharmacophore mapping and docking study of Chikungunya virus nsP2 protease.


    Singh, Kh Dhanachandra; Kirubakaran, Palani; Nagarajan, Shanthi; Sakkiah, Sugunadevi; Muthusamy, Karthikeyan; Velmurgan, Devadasan; Jeyakanthan, Jeyaraman


    To date, no suitable vaccine or specific antiviral drug is available to treat Chikungunya viral (CHIKV) fever. Hence, it is essential to identify drug candidates that could potentially impede CHIKV infection. Here, we present the development of a homology model of nsP2 protein based on the crystal structure of the nsP2 protein of Venezuelan equine encephalitis virus (VEEV). The protein modeled was optimized using molecular dynamics simulation; the junction peptides of a nonstructural protein complex were then docked in order to investigate the possible protein-protein interactions between nsP2 and the proteins cleaved by nsP2. The modeling studies conducted shed light on the binding modes, and the critical interactions with the peptides provide insight into the chemical features needed to inhibit the CHIK virus infection. Energy-optimized pharmacophore mapping was performed using the junction peptides. Based on the results, we propose the pharmacophore features that must be present in an inhibitor of nsP2 protease. The resulting pharmacophore model contained an aromatic ring, a hydrophobic and three hydrogen-bond donor sites. Using these pharmacophore features, we screened a large public library of compounds (Asinex, Maybridge, TOSLab, Binding Database) to find a potential ligand that could inhibit the nsP2 protein. The compounds that yielded a fitness score of more than 1.0 were further subjected to Glide HTVS and Glide XP. Here, we report the best four compounds based on their docking scores; these compounds have IDs of 27943, 21362, ASN 01107557 and ASN 01541696. We propose that these compounds could bind to the active site of nsP2 protease and inhibit this enzyme. Furthermore, the backbone structural scaffolds of these four lead compounds could serve as building blocks when designing drug-like molecules for the treatment of Chikungunya viral fever.

  15. Short-acting P2Y12 blockade to reduce platelet dysfunction and coagulopathy during experimental extracorporeal circulation and hypothermia.


    Krajewski, S; Kurz, J; Neumann, B; Greiner, T O; Stolz, A; Balkau, B; Peter, K; Unertl, K; Wendel, H P; Straub, A


    Extracorporeal circulation (ECC) and hypothermia are routinely used in cardiac surgery to maintain stable circulatory parameters and to increase the ischaemic tolerance of the patient. However, ECC and hypothermia cause platelet activation and dysfunction possibly followed by a devastating coagulopathy. Stimulation of the adenosinediphosphate (ADP) receptor P(2)Y(12) plays a pivotal role in platelet activation. This experimental study tested P(2)Y(12) receptor blockade as an approach to protect platelets during ECC. Human blood was treated with the short-acting P(2)Y(12) blocker cangrelor (1 µM, t(1/2)<5 min) or the P(2)Y(12) inhibitor 2-MeSAMP (100 µM) and circulated in an ex vivo ECC model at normothermia (37°C) and hypothermia (28°C). Before and after circulation, markers of platelet activation and of coagulation (thrombin-antithrombin complex generation) were analysed. During hypothermic ECC in pigs, the effect of reversible P(2)Y(12) blockade on platelet function was evaluated by cangrelor infusion (0.075 µg kg(-1) min(-1)). During ex vivo hypothermic ECC, P(2)Y(12) blockade inhibited platelet granule release (P<0.01), platelet-granulocyte binding (P<0.05), and platelet loss (P<0.001), whereas no effects on platelet-ECC binding, platelet CD42bα expression, glycoprotein IIb/IIIa activation, or thrombin-antithrombin complex generation were observed. During hypothermic ECC in pigs, cangrelor inhibited platelet-fibrinogen binding (P<0.05) and ADP-induced platelet aggregation (P<0.001). Platelet function was rapidly restored after termination of cangrelor infusion. P(2)Y(12) blockade by cangrelor prevents platelet activation during ECC and hypothermia. Owing to its short half-life, platelet inhibition can be well controlled, thus potentially reducing bleeding complications. This novel pharmacological strategy has the potential to reduce complications associated with ECC and hypothermia.

  16. P2X and P2Y Receptors—Role in the Pathophysiology of the Nervous System

    PubMed Central

    Puchałowicz, Kamila; Tarnowski, Maciej; Baranowska-Bosiacka, Irena; Chlubek, Dariusz; Dziedziejko, Violetta


    Purinergic signalling plays a crucial role in proper functioning of the nervous system. Mechanisms depending on extracellular nucleotides and their P2 receptors also underlie a number of nervous system dysfunctions. This review aims to present the role of purinergic signalling, with particular focus devoted to role of P2 family receptors, in epilepsy, depression, neuropathic pain, nervous system neoplasms, such as glioma and neuroblastoma, neurodegenerative diseases like Parkinson’s disease, Alzheimer’s disease and multiple sclerosis. The above-mentioned conditions are associated with changes in expression of extracellular ectonucleotidases, P2X and P2Y receptors in neurons and glial cells, as well as releasing considerable amounts of nucleotides from activated or damaged nervous tissue cells into the extracellular space, which contributes to disturbance in purinergic signalling. The numerous studies indicate a potential possibility of using synthetic agonists/antagonists of P2 receptors in treatment of selected nervous system diseases. This is of particular significance, since numerous available agents reveal a low effectiveness and often produce side effects. PMID:25530618

  17. Maltodextrin and fat preference deficits in "taste-blind" P2X2/P2X3 knockout mice.


    Sclafani, Anthony; Ackroff, Karen


    Adenosine triphosphate is a critical neurotransmitter in the gustatory response to the 5 primary tastes in mice. Genetic deletion of the purinergic P2X2/P2X3 receptor greatly reduces the neural and behavioral response to prototypical primary taste stimuli. In this study, we examined the behavioral response of P2X double knockout mice to maltodextrin and fat stimuli, which appear to activate additional taste channels. P2X double knockout and wild-type mice were given 24-h choice tests (vs. water) with ascending concentrations of Polycose and Intralipid. In Experiment 1, naive double knockout mice, unlike wild-type mice, were indifferent to dilute (0.5-4%) Polycose solutions but preferred concentrated (8-32%) Polycose to water. In a retest, the Polycose-experienced double knockout mice, like wild-type mice, preferred all Polycose concentrations. In Experiment 2, naive double knockout mice, unlike wild-type mice, were indifferent to dilute (0.313-2.5%) Intralipid emulsions but preferred concentrated (5-20%) Intralipid to water. In a retest, the fat-experienced double knockout mice, like wild-type mice, strongly preferred 0.313-5% Intralipid to water. These results indicate that the inherent preferences of mice for maltodextrin and fat are dependent upon adenosine triphosphate taste cell signaling. With experience, however, P2X double knockout mice develop strong preferences for the nontaste flavor qualities of maltodextrin and fat conditioned by the postoral actions of these nutrients.

  18. P2TF: a comprehensive resource for analysis of prokaryotic transcription factors.


    Ortet, Philippe; De Luca, Gilles; Whitworth, David E; Barakat, Mohamed


    Transcription factors (TFs) are DNA-binding proteins that regulate gene expression by activating or repressing transcription. Some have housekeeping roles, while others regulate the expression of specific genes in response to environmental change. The majority of TFs are multi-domain proteins, and they can be divided into families according to their domain organisation. There is a need for user-friendly, rigorous and consistent databases to allow researchers to overcome the inherent variability in annotation between genome sequences. P2TF (Predicted Prokaryotic Transcription Factors) is an integrated and comprehensive database relating to transcription factor proteins. The current version of the database contains 372,877 TFs from 1,987 completely sequenced prokaryotic genomes and 43 metagenomes. The database provides annotation, classification and visualisation of TF genes and their genetic context, providing researchers with a one-stop shop in which to investigate TFs. The P2TF database analyses TFs in both predicted proteomes and reconstituted ORFeomes, recovering approximately 3% more TF proteins than just screening predicted proteomes. Users are able to search the database with sequence or domain architecture queries, and resulting hits can be aligned to investigate evolutionary relationships and conservation of residues. To increase utility, all searches can be filtered by taxonomy, TF genes can be added to the P2TF cart, and gene lists can be exported for external analysis in a variety of formats. P2TF is an open resource for biologists, allowing exploration of all TFs within prokaryotic genomes and metagenomes. The database enables a variety of analyses, and results are presented for user exploration as an interactive web interface, which provides different ways to access and download the data. The database is freely available at

  19. P2TF: a comprehensive resource for analysis of prokaryotic transcription factors

    PubMed Central


    Background Transcription factors (TFs) are DNA-binding proteins that regulate gene expression by activating or repressing transcription. Some have housekeeping roles, while others regulate the expression of specific genes in response to environmental change. The majority of TFs are multi-domain proteins, and they can be divided into families according to their domain organisation. There is a need for user-friendly, rigorous and consistent databases to allow researchers to overcome the inherent variability in annotation between genome sequences. Description P2TF (Predicted Prokaryotic Transcription Factors) is an integrated and comprehensive database relating to transcription factor proteins. The current version of the database contains 372,877 TFs from 1,987 completely sequenced prokaryotic genomes and 43 metagenomes. The database provides annotation, classification and visualisation of TF genes and their genetic context, providing researchers with a one-stop shop in which to investigate TFs. The P2TF database analyses TFs in both predicted proteomes and reconstituted ORFeomes, recovering approximately 3% more TF proteins than just screening predicted proteomes. Users are able to search the database with sequence or domain architecture queries, and resulting hits can be aligned to investigate evolutionary relationships and conservation of residues. To increase utility, all searches can be filtered by taxonomy, TF genes can be added to the P2TF cart, and gene lists can be exported for external analysis in a variety of formats. Conclusions P2TF is an open resource for biologists, allowing exploration of all TFs within prokaryotic genomes and metagenomes. The database enables a variety of analyses, and results are presented for user exploration as an interactive web interface, which provides different ways to access and download the data. The database is freely available at PMID:23153078

  20. Critical role of P2X7 receptors in the neuroinflammation and cognitive dysfunction after surgery.


    Zheng, Bin; Lai, Renchun; Li, Jun; Zuo, Zhiyi


    Postoperative cognitive dysfunction worsens patient outcome after surgery. Neuroinflammation is a critical neuropathological process for it. We determined the role of P2X7 receptors, proteins that participate in inflammatory response, in the neuroinflammation induction after surgery, and whether the choice of volatile anesthetics affects its occurrence. Eight-week old C57BL/6J or P2X7 receptor knockout male mice were subjected to right carotid arterial exposure under anesthesia with 1.8% isoflurane, 2.5% sevoflurane or 10% desflurane. They were tested by Barnes maze and fear conditioning from 2weeks after the surgery. Hippocampus was harvested 6h, 24h and 7days after the surgery for immunohistochemical staining and Western blotting. Mice with surgery under anesthesia with isoflurane, sevoflurane or desflurane took longer than control mice to identify the target box 1 or 8days after the training sessions in Barnes maze. Mice anesthetized by isoflurane or sevoflurane, but not by desflurane, had less freezing behavior than control mice in fear conditioning test. Mice with surgery and anesthesia had increased ionized calcium binding adapter molecule 1 and interleukin 1β in the hippocampus but this increase was smaller in mice anesthetized with desflurane than mice anesthetized with isoflurane. Mice with surgery had increased P2X7 receptors and its downstream molecule caspase 1. Inhibition or knockout of P2X7 receptors attenuated surgery and anesthesia-induced neuroinflammation and cognitive impairment. We conclude that surgery under desflurane anesthesia may have reduced neuroinflammation and cognitive impairment compared with surgery under isoflurane anesthesia. P2X7 receptors may mediate the neuroinflammation and cognitive impairment after surgery.

  1. The P2X7 Receptor-Interleukin-1 Liaison.


    Giuliani, Anna Lisa; Sarti, Alba C; Falzoni, Simonetta; Di Virgilio, Francesco


    Interleukin-1β (IL-1β) plays a central role in stimulation of innate immune system and inflammation and in several chronic inflammatory diseases. These include rare hereditary conditions, e.g., auto-inflammatory syndromes, as well as common pathologies, such as type II diabetes, gout and atherosclerosis. A better understanding of IL-1β synthesis and release is particularly relevant for the design of novel anti-inflammatory drugs. One of the molecules mainly involved in IL-1β maturation is the P2X7 receptor (P2X7R), an ATP-gated ion channel that chiefly acts through the recruitment of the NLRP3 inflammasome-caspase-1 complex. In this review, we will summarize evidence supporting the key role of the P2X7R in IL-1β production, with special emphasis on the mechanism of release, a process that is still a matter of controversy. Four different models have been proposed: (i) exocytosis via secretory lysosomes, (ii) microvesicles shedding from plasma membrane, (iii) release of exosomes, and (iv) passive efflux across a leaky plasma membrane during pyroptotic cell death. All these models involve the P2X7R.

  2. Pollution Prevention Successes Database (P2SDb) user guide

    SciTech Connect


    When Pollution Prevention Opportunity Assessments (P2OAs) were launched at the Hanford Site during the summer of 1994, the first comment received from those using them expressed the desire for a method to report assessments electronically. As a temporary measure, macros were developed for use on word processing systems, but a more formal database was obviously needed. Additionally, increased DOE and Washington state reporting requirements for pollution prevention suggested that a database system would streamline the reporting process. The Pollution Prevention Group of Westinghouse Hanford Company (WHC) contracted with the Data Automation Engineering Department from ICF Kaiser Hanford Company (ICFKH) to develop the system. The scope was to develop a database that will track P2OAs conducted by the facilities and contractors at the Hanford Site. It will also track pollution prevention accomplishments that are not the result of P2OAs and document a portion of the Process Waste Assessments conducted in the past. To accommodate the above criteria, yet complete the system in a timely manner, the Pollution Prevention Successes Database (P2SDb) is being implemented in three phases. The first phase will automate the worksheets to provide both input and output of the data associated with the worksheets. The second phase will automate standard summary reports and ad hoc reports. The third phase will provide automated searching of the database to facilitate the sharing of pollution prevention experiences among various users. This User`s Guide addresses only the Phase 1 system.

  3. The P2X7 Receptor-Interleukin-1 Liaison

    PubMed Central

    Giuliani, Anna Lisa; Sarti, Alba C.; Falzoni, Simonetta; Di Virgilio, Francesco


    Interleukin-1β (IL-1β) plays a central role in stimulation of innate immune system and inflammation and in several chronic inflammatory diseases. These include rare hereditary conditions, e.g., auto-inflammatory syndromes, as well as common pathologies, such as type II diabetes, gout and atherosclerosis. A better understanding of IL-1β synthesis and release is particularly relevant for the design of novel anti-inflammatory drugs. One of the molecules mainly involved in IL-1β maturation is the P2X7 receptor (P2X7R), an ATP-gated ion channel that chiefly acts through the recruitment of the NLRP3 inflammasome-caspase-1 complex. In this review, we will summarize evidence supporting the key role of the P2X7R in IL-1β production, with special emphasis on the mechanism of release, a process that is still a matter of controversy. Four different models have been proposed: (i) exocytosis via secretory lysosomes, (ii) microvesicles shedding from plasma membrane, (iii) release of exosomes, and (iv) passive efflux across a leaky plasma membrane during pyroptotic cell death. All these models involve the P2X7R. PMID:28360855

  4. Measurement and Analysis of P2P IPTV Program Resource

    PubMed Central

    Chen, Xingshu; Wang, Haizhou; Zhang, Qi


    With the rapid development of P2P technology, P2P IPTV applications have received more and more attention. And program resource distribution is very important to P2P IPTV applications. In order to collect IPTV program resources, a distributed multi-protocol crawler is proposed. And the crawler has collected more than 13 million pieces of information of IPTV programs from 2009 to 2012. In addition, the distribution of IPTV programs is independent and incompact, resulting in chaos of program names, which obstructs searching and organizing programs. Thus, we focus on characteristic analysis of program resources, including the distributions of length of program names, the entropy of the character types, and hierarchy depth of programs. These analyses reveal the disorderly naming conventions of P2P IPTV programs. The analysis results can help to purify and extract useful information from chaotic names for better retrieval and accelerate automatic sorting of program and establishment of IPTV repository. In order to represent popularity of programs and to predict user behavior and popularity of hot programs over a period, we also put forward an analytical model of hot programs. PMID:24772008

  5. Spectroscopy of Pionic Atoms Via (p, 2He) Reaction

    NASA Astrophysics Data System (ADS)

    Watanabe, Yuni N.; Adachi, Satoshi; Aoi, Nori; Ashikaga, Sakiko; Fujioka, Hiroyuki; Furuno, Tatsuya; Geissel, Hans; Guillaume, Gey; Hashimoto, Takashi; Hatanaka, Kichiji; Hayano, Ryugo S.; Heguri, Katsuyoshi; Inaba, Kento; Inoue, Azusa; Itahashi, Kenta; Iwamoto, Chihiro; Kawabata, Takahiro; Matsuda, Yohei; Matsumoto, Shota; Morimoto, Takahiro; Murata, Motoki; Nishi, Takahiro; Noji, Shunpei; Ong, Hooi J.; Sakaue, Akane; Takahashi, Yu; Tamii, Atsushi; Tanaka, Yoshiki K.; Tang, Tsz L.; Terashima, Satoru; Tsumura, Miho; Watanabe, Ken

    We are planning to perform a spectroscopy experiment of pionic atoms via the (p, 2He) reaction in RCNP. Novel techniques such as Xe gas target and dispersion matching may lead to the better understanding of the partial restoration of chiral symmetry at finite density. The results of the feasibility study and the plan of the first experiment are reported.

  6. Measurement and analysis of P2P IPTV program resource.


    Wang, Wenxian; Chen, Xingshu; Wang, Haizhou; Zhang, Qi; Wang, Cheng


    With the rapid development of P2P technology, P2P IPTV applications have received more and more attention. And program resource distribution is very important to P2P IPTV applications. In order to collect IPTV program resources, a distributed multi-protocol crawler is proposed. And the crawler has collected more than 13 million pieces of information of IPTV programs from 2009 to 2012. In addition, the distribution of IPTV programs is independent and incompact, resulting in chaos of program names, which obstructs searching and organizing programs. Thus, we focus on characteristic analysis of program resources, including the distributions of length of program names, the entropy of the character types, and hierarchy depth of programs. These analyses reveal the disorderly naming conventions of P2P IPTV programs. The analysis results can help to purify and extract useful information from chaotic names for better retrieval and accelerate automatic sorting of program and establishment of IPTV repository. In order to represent popularity of programs and to predict user behavior and popularity of hot programs over a period, we also put forward an analytical model of hot programs.

  7. On Numbers of the Form p + 2n - n

    DTIC Science & Technology


    p+2n−n∗ Florian Luca1,† and Pantelimon Stănică2, ‡ 1School of Mathematics,University of the Witwatersrand , P. O. Box Wits 2050, South Africa; and...the School of Mathematics of the University of the Witwatersrand . This author thanks this institution for hospitality. †E-mail address: florian.luca

  8. Compound K Production from Red Ginseng Extract by β-Glycosidase from Sulfolobus solfataricus Supplemented with α-L-Arabinofuranosidase from Caldicellulosiruptor saccharolyticus

    PubMed Central

    Shin, Kyung-Chul; Choi, Hye-Yeon; Seo, Min-Ju; Oh, Deok-Kun


    Ginsenoside compound K (C-K) is attracting a lot of interest because of its biological and pharmaceutical activities, including hepatoprotective, antitumor, anti-wrinkling, and anti-skin aging activities. C-K has been used as the principal ingredient in skin care products. For the effective application of ginseng extracts to the manufacture of cosmetics, the PPD-type ginsenosides in ginseng extracts should be converted to C-K by enzymatic conversion. For increased yield of C-K from the protopanaxadiol (PPD)-type ginsenosides in red-ginseng extract (RGE), the α-l-arabinofuranoside-hydrolyzing α-l-arabinofuranosidase from Caldicellulosiruptor saccharolyticus (CS-abf) was used along with the β-d-glucopyranoside/α-l-arabinopyranoside-hydrolyzing β-glycosidase from Sulfolobus solfataricus (SS-bgly) because SS-bgly showed very low hydrolytic activity on the α-l-arabinofuranoside linkage in ginsenosides. The optimal reaction conditions for C-K production were as follows: pH 6.0, 80°C, 2 U/mL SS-bgly, 3 U/mL CS-abf, and 7.5 g/L PPD-type ginsenosides in RGE. Under these optimized conditions, SS-bgly supplemented with CS-abf produced 4.2 g/L C-K from 7.5 g/L PPD-type ginsenosides in 12 h without other ginsenosides, with a molar yield of 100% and a productivity of 348 mg/L/h. To the best of our knowledge, this is the highest concentration and productivity of C-K from ginseng extract ever published in literature. PMID:26710074

  9. Identification of Determinants Required for Agonistic and Inverse Agonistic Ligand Properties at the ADP Receptor P2Y12

    PubMed Central

    Schmidt, Philipp; Ritscher, Lars; Dong, Elizabeth N.; Hermsdorf, Thomas; Cöster, Maxi; Wittkopf, Doreen; Meiler, Jens


    The ADP receptor P2Y12 belongs to the superfamily of G protein–coupled receptors (GPCRs), and its activation triggers platelet aggregation. Therefore, potent antagonists, such as clopidogrel, are of high clinical relevance in prophylaxis and treatment of thromboembolic events. P2Y12 displays an elevated basal activity in vitro, and as such, inverse agonists may be therapeutically beneficial compared with antagonists. Only a few inverse agonists of P2Y12 have been described. To expand this limited chemical space and improve understanding of structural determinants of inverse agonist-receptor interaction, this study screened a purine compound library for lead structures using wild-type (WT) human P2Y12 and 28 constitutively active mutants. Results showed that ATP and ATP derivatives are agonists at P2Y12. The potency at P2Y12 was 2-(methylthio)-ADP > 2-(methylthio)-ATP > ADP > ATP. Determinants required for agonistic ligand activity were identified. Molecular docking studies revealed a binding pocket for the ATP derivatives that is bordered by transmembrane helices 3, 5, 6, and 7 in human P2Y12, with Y105, E188, R256, Y259, and K280 playing a particularly important role in ligand interaction. N-Methyl-anthraniloyl modification at the 3′-OH of the 2′-deoxyribose leads to ligands (mant-deoxy-ATP [dATP], mant-deoxy-ADP) with inverse agonist activity. Inverse agonist activity of mant-dATP was found at the WT human P2Y12 and half of the constitutive active P2Y12 mutants. This study showed that, in addition to ADP and ATP, other ATP derivatives are not only ligands of P2Y12 but also agonists. Modification of the ribose within ATP can result in inverse activity of ATP-derived ligands. PMID:23093496

  10. The P2Y2 nucleotide receptor requires interaction with alpha v integrins to access and activate G12.


    Liao, Zhongji; Seye, Cheikh I; Weisman, Gary A; Erb, Laurie


    The P2Y2 nucleotide receptor (P2Y2R) interacts with alpha v integrins to activate G(o) and induce chemotaxis in human 1321N1 astrocytoma cells. In this study, it was determined that the P2Y2R also requires interaction with alpha v integrins to activate G12 and associated signaling pathways that control chemotaxis in 1321N1 cells. Mutation of the Arg-Gly-Asp (RGD) integrin-binding sequence in the first extracellular loop of the human P2Y2R to Arg-Gly-Glu (RGE), which prevents integrin interaction, did not inhibit G(q) or ERK1/2 signaling by the P2Y2R agonist UTP but completely inhibited activation of G12 and G12-mediated events, including Rho activation, cofilin and myosin light chain-2 phosphorylation, stress fiber formation and chemotaxis towards UTP. The involvement of G12 in all these events was verified by using a dominant negative G alpha12 construct. G12 activation by the P2Y2R also was inhibited by anti-alpha v beta5 integrin antibodies and alpha v integrin antisense oligonucleotides, suggesting that alpha v integrin activity and expression are required for the P2Y2R to activate G12. Co-immunoprecipitation experiments confirmed that G alpha12 protein associates with the wild-type P2Y2R and with alpha v integrins but not with the RGE mutant P2Y2R or with alpha3 integrins. Collectively, these results suggest that alpha v integrin complexes provide the P2Y2R with access to G12, thereby allowing activation of this heterotrimeric G protein that controls actin cytoskeletal rearrangements required for chemotaxis.

  11. The P2Y2 nucleotide receptor requires interaction with αv integrins to access and activate G12

    PubMed Central

    Liao, Zhongji; Seye, Cheikh I.; Weisman, Gary A.; Erb, Laurie


    Summary The P2Y2 nucleotide receptor (P2Y2R) interacts with αv integrins to activate Go and induce chemotaxis in human 1321N1 astrocytoma cells. In this study, it was determined that the P2Y2R also requires interaction with αv integrins to activate G12 and associated signaling pathways that control chemotaxis in 1321N1 cells. Mutation of the Arg-Gly-Asp (RGD) integrin-binding sequence in the first extracellular loop of the human P2Y2R to Arg-Gly-Glu (RGE), which prevents integrin interaction, did not inhibit Gq or ERK1/2 signaling by the P2Y2R agonist UTP but completely inhibited activation of G12 and G12-mediated events, including Rho activation, cofilin and myosin light chain-2 phosphorylation, stress fiber formation and chemotaxis towards UTP. The involvement of G12 in all these events was verified by using a dominant negative Gα12 construct. G12 activation by the P2Y2R also was inhibited by anti-αvβ5 integrin antibodies and αv integrin antisense oligonucleotides, suggesting that αv integrin activity and expression are required for the P2Y2R to activate G12. Coimmunoprecipitation experiments confirmed that Gα12 protein associates with the wild-type P2Y2R and with αv integrins but not with the RGE mutant P2Y2R or with α3 integrins. Collectively, these results suggest that αv integrin complexes provide the P2Y2R with access to G12, thereby allowing activation of this heterotrimeric G protein that controls actin cytoskeletal rearrangements required for chemotaxis. PMID:17452627

  12. P2Y Purinergic Regulation of the Glycine Neurotransmitter Transporters*

    PubMed Central

    Jiménez, Esperanza; Zafra, Francisco; Pérez-Sen, Raquel; Delicado, Esmerilda G.; Miras-Portugal, Maria Teresa; Aragón, Carmen; López-Corcuera, Beatriz


    The sodium- and chloride-coupled glycine neurotransmitter transporters (GLYTs) control the availability of glycine at glycine-mediated synapses. The mainly glial GLYT1 is the key regulator of the glycine levels in glycinergic and glutamatergic pathways, whereas the neuronal GLYT2 is involved in the recycling of synaptic glycine from the inhibitory synaptic cleft. In this study, we report that stimulation of P2Y purinergic receptors with 2-methylthioadenosine 5′-diphosphate in rat brainstem/spinal cord primary neuronal cultures and adult rat synaptosomes leads to the inhibition of GLYT2 and the stimulation of GLYT1 by a paracrine regulation. These effects are mainly mediated by the ADP-preferring subtypes P2Y1 and P2Y13 because the effects are partially reversed by the specific antagonists N6-methyl-2′-deoxyadenosine-3′,5′-bisphosphate and pyridoxal-5′-phosphate-6-azo(2-chloro-5-nitrophenyl)-2,4-disulfonate and are totally blocked by suramin. P2Y12 receptor is additionally involved in GLYT1 stimulation. Using pharmacological approaches and siRNA-mediated protein knockdown methodology, we elucidate the molecular mechanisms of GLYT regulation. Modulation takes place through a signaling cascade involving phospholipase C activation, inositol 1,4,5-trisphosphate production, intracellular Ca2+ mobilization, protein kinase C stimulation, nitric oxide formation, cyclic guanosine monophosphate production, and protein kinase G-I (PKG-I) activation. GLYT1 and GLYT2 are differentially sensitive to NO/cGMP/PKG-I both in brain-derived preparations and in heterologous systems expressing the recombinant transporters and P2Y1 receptor. Sensitivity to 2-methylthioadenosine 5′-diphosphate by GLYT1 and GLYT2 was abolished by small interfering RNA (siRNA)-mediated knockdown of nitric-oxide synthase. Our data may help define the role of GLYTs in nociception and pain sensitization. PMID:21245148

  13. PI(4,5)P2 regulates myoblast fusion through Arp2/3 regulator localization at the fusion site

    PubMed Central

    Bothe, Ingo; Deng, Su; Baylies, Mary


    Cell-cell fusion is a regulated process that requires merging of the opposing membranes and underlying cytoskeletons. However, the integration between membrane and cytoskeleton signaling during fusion is not known. Using Drosophila, we demonstrate that the membrane phosphoinositide PI(4,5)P2 is a crucial regulator of F-actin dynamics during myoblast fusion. PI(4,5)P2 is locally enriched and colocalizes spatially and temporally with the F-actin focus that defines the fusion site. PI(4,5)P2 enrichment depends on receptor engagement but is upstream or parallel to actin remodeling. Regulators of actin branching via Arp2/3 colocalize with PI(4,5)P2 in vivo and bind PI(4,5)P2 in vitro. Manipulation of PI(4,5)P2 availability leads to impaired fusion, with a reduction in the F-actin focus size and altered focus morphology. Mechanistically, the changes in the actin focus are due to a failure in the enrichment of actin regulators at the fusion site. Moreover, improper localization of these regulators hinders expansion of the fusion interface. Thus, PI(4,5)P2 enrichment at the fusion site encodes spatial and temporal information that regulates fusion progression through the localization of activators of actin polymerization. PMID:24821989

  14. Interplay between Rab5 and PtdIns(4,5)P2 controls early endocytosis in the Drosophila germline.


    Compagnon, Julien; Gervais, Louis; Roman, Mabel San; Chamot-Boeuf, Sophy; Guichet, Antoine


    Phosphoinositides have emerged as key regulators of membrane traffic through their control of the localization and activity of several effector proteins. Both Rab5 and phosphatidylinositol (4,5)-bisphosphate [PtdIns(4,5)P(2)] are involved in the early steps of the clathrin-dependent endocytic pathway, but little is known about how their functions are coordinated. We have studied the role of PtdIns(4,5)P(2) and Rab5 in the Drosophila germline during oogenesis. We found that Rab5 is required for the maturation of early endocytic vesicles. We show that PtdIns(4,5)P(2) is required for endocytic-vesicle formation, for Rab5 recruitment to endosomes and, consistently, for endocytosis. Furthermore, we reveal a previously undescribed role of Rab5 in releasing PtdIns(4,5)P(2), PtdIns(4,5)P(2)-binding budding factors and F-actin from early endocytic vesicles. Finally, we show that overexpressing the PtdIns(4,5)P(2)-synthesizing enzyme Skittles leads to an endocytic defect that is similar to that seen in rab5 loss-of-function mutants. Hence, our results argue strongly in favor of the hypothesis that the Rab5-dependant release of PtdIns(4,5)P(2) from endosomes that we discovered in this study is crucial for endocytosis to proceed.

  15. Nucleotide analogues containing 2-oxa-bicyclo[2.2.1]heptane and L-α-threofuranosyl ring systems: interactions with P2Y receptors

    PubMed Central

    Ohno, Michihiro; Costanzi, Stefano; Kim, Hak Sung; Kempeneers, Veerle; Vastmans, Karen; Herdewijn, Piet; Maddileti, Savitri; Gao, Zhan-Guo; Harden, T. Kendall; Jacobson, Kenneth A.


    The ribose moiety of adenine nucleotide 3′,5′-bisphosphate antagonists of the P2Y1 receptor has been successfully substituted with a rigid methanocarba ring system, leading to the conclusion that the North (N) ring conformation is preferred in receptor binding. Similarly, at P2Y2 and P2Y4 receptors, nucleotides constrained in the (N) conformation interact equipotently with the corresponding ribosides. We now have synthesized and examined as P2Y receptor ligands nucleotide analogues substituted with two novel ring systems: (1) a (N) locked-carbocyclic (cLNA) derivative containing the oxabicyclo[2.2.1]heptane ring system and (2) L-α-threofuranosyl derivatives. We have also compared potencies and preferred conformations of these nucleotides with the known anhydrohexitol-containing P2Y1 receptor antagonist MRS2283. A cLNA bisphosphate derivative MRS2584 21 displayed a Ki value of 22.5nM in binding to the human P2Y1 receptor, and antagonized the stimulation of PLC by the potent P2Y1 receptor agonist 2-methylthio-ADP (30nM) with an IC50 of 650nM. The parent cLNA nucleoside bound only weakly to an adenosine receptor (A3). Thus, this ring system afforded some P2Y receptor selectivity. A L-α-threofuranosyl bisphosphate derivative 9 displayed an IC50 of 15.3μM for inhibition of 2-methylthio-ADP-stimulated PLC activity. L-α-Threofuranosyl-UTP 13 was a P2Y receptor agonist with a preference for P2Y2 (EC50 = 9.9μM) versus P2Y4 receptors. The P2Y1 receptor binding modes, including rotational angles, were estimated using molecular modeling and receptor docking. PMID:15465340

  16. Tanshinone II A sulfonate, but not tanshinone II A, acts as potent negative allosteric modulator of the human purinergic receptor P2X7.


    Kaiser, M; Sobottka, H; Fischer, W; Schaefer, M; Nörenberg, W


    Tanshinone II A sulfonate (TIIAS) was identified as a potent, selective blocker of purinergic receptor P2X7 in a compound library screen. In this study, a detailed characterization of the pharmacologic effects of TIIAS on P2X7 is provided. Because TIIAS is a derivative of tanshinone II A (TIIA) and both compounds have been used interchangeably, TIIA was included in some assays. Fluorometric and electrophysiologic assays were used to characterize effects of TIIAS and TIIA on recombinantly expressed human, rat, and mouse P2X7. Results were confirmed in human monocyte-derived macrophages expressing native P2X7. In all experiments, involvement of P2X7 was verified using established P2X7 antagonists. TIIAS, but not TIIA, reduces Ca(2+) influx via human P2X7 (hP2X7) with an IC50 of 4.3 µM. TIIAS was less potent at mouse P2X7 and poorly inhibited rat P2X7. Monitoring of YO-PRO-1 uptake confirmed these findings, indicating that formation of the hP2X7 pore is also suppressed by TIIAS. Electrophysiologic experiments revealed a noncompetitive mode of action. TIIAS time-dependently inhibits hP2X7 gating, possibly by binding to the intracellular domain of the receptor. Inhibition of native P2X7 in macrophages by TIIAS was confirmed by monitoring Ca(2+) influx, YO-PRO-1 uptake, and release of the proinflammatory cytokine interleukin-1β. Fluorometric experiments involving recombinantly expressed rat P2X2 and human P2X4 were conducted and verified the compound's selectivity. Our data suggest that hP2X7 is a molecular target of TIIAS, but not of TIIA, a compound with different pharmacologic properties.

  17. The high-pressure compressibility of B12P2

    NASA Astrophysics Data System (ADS)

    Gao, Yang; Zhou, Mi; Wang, Haiyan; Ji, Cheng; Whiteley, C. E.; Edgar, J. H.; Liu, Haozhe; Ma, Yanzhang


    In situ high pressure synchrotron X-ray diffraction measurements were performed on icosahedral boron phosphide (B12P2) to 43.2 GPa. No structural phase transition occurs over this pressure range. The bulk modulus of B12P2 is KOT = 207 ± 7 GPa with pressure derivative of K'OT = 6.6 ± 0.8 . The structure is most compressible along the chain formed by phosphorus and boron atoms in the crystal structure. It is believed that the compressibility of boron-rich compounds at close to ambient pressure is determined by the boron icosahedral structure, while the inclusive atoms (both boron and non-boron) between the icosahedra determine the high-pressure compressibility and structure stability.

  18. Cangrelor: a novel P2Y12 receptor antagonist.


    Norgard, Nicholas B


    Antiplatelet therapy is critical in the prevention of thrombotic complications of acute coronary syndrome and percutaneous coronary interventions. Current antiplatelet agents (aspirin, clopidogrel and glycoprotein IIb/IIIa antagonists) have demonstrated the capacity to reduce major adverse cardiac events. However, these agents have limitations that compromise their clinical utility. The platelet P2Y12 receptor plays a central role in platelet function and is a focus in the development of antiplatelet therapies. Cangrelor is a potent, competitive inhibitor of the P2Y12 receptor that is administered by intravenous infusion and rapidly achieves near complete inhibition of ADP-induced platelet aggregation. This investigational drug has been studied for use during coronary procedures and the management of patients experiencing acute coronary syndrome and is undergoing evaluation for use in the prevention of perioperative stent thrombosis.

  19. Supporting seamless mobility for P2P live streaming.


    Kim, Eunsam; Kim, Sangjin; Lee, Choonhwa


    With advent of various mobile devices with powerful networking and computing capabilities, the users' demand to enjoy live video streaming services such as IPTV with mobile devices has been increasing rapidly. However, it is challenging to get over the degradation of service quality due to data loss caused by the handover. Although many handover schemes were proposed at protocol layers below the application layer, they inherently suffer from data loss while the network is being disconnected during the handover. We therefore propose an efficient application-layer handover scheme to support seamless mobility for P2P live streaming. By simulation experiments, we show that the P2P live streaming system with our proposed handover scheme can improve the playback continuity significantly compared to that without our scheme.

  20. Supporting Seamless Mobility for P2P Live Streaming

    PubMed Central

    Kim, Eunsam; Kim, Sangjin; Lee, Choonhwa


    With advent of various mobile devices with powerful networking and computing capabilities, the users' demand to enjoy live video streaming services such as IPTV with mobile devices has been increasing rapidly. However, it is challenging to get over the degradation of service quality due to data loss caused by the handover. Although many handover schemes were proposed at protocol layers below the application layer, they inherently suffer from data loss while the network is being disconnected during the handover. We therefore propose an efficient application-layer handover scheme to support seamless mobility for P2P live streaming. By simulation experiments, we show that the P2P live streaming system with our proposed handover scheme can improve the playback continuity significantly compared to that without our scheme. PMID:24977171

  1. A phenotypic assay to identify Chikungunya virus inhibitors targeting the nonstructural protein nsP2.


    Lucas-Hourani, Marianne; Lupan, Alexandru; Desprès, Philippe; Thoret, Sylviane; Pamlard, Olivier; Dubois, Joëlle; Guillou, Catherine; Tangy, Frédéric; Vidalain, Pierre-Olivier; Munier-Lehmann, Hélène


    Chikungunya virus (CHIKV) is a mosquito-transmitted pathogen responsible for an acute infection of abrupt onset, characterized by high fever, polyarthralgia, myalgia, headaches, chills, and rash. In 2006, CHIKV was responsible for an epidemic outbreak of unprecedented magnitude in the Indian Ocean, stressing the need for therapeutic approaches. Since then, we have acquired a better understanding of CHIKV biology, but we are still missing active molecules against this reemerging pathogen. We recently reported that the nonstructural nsP2 protein of CHIKV induces a transcriptional shutoff that allows the virus to block cellular antiviral response. This was demonstrated using various luciferase-based reporter gene assays, including a trans-reporter system where Gal4 DNA binding domain is fused to Fos transcription factor. Here, we turned this assay into a high-throughput screening system to identify small molecules targeting nsP2-mediated shutoff. Among 3040 molecules tested, we identified one natural compound that partially blocks nsP2 activity and inhibits CHIKV replication in vitro. This proof of concept suggests that similar functional assays could be developed to target other viral proteins mediating a cellular shutoff and identify innovative therapeutic molecules.

  2. Peptide length variants p2Ca and QL9 present distinct conformations to L(d)-specific T cells.


    Hornell, T M; Martin, S M; Myers, N B; Connolly, J M


    Recent advances have provided insights into how the TCR interacts with MHC/peptide complexes and a rationale to predict optimal epitopes for MHC binding and T cell recognition. For example, peptides of nine residues are predicted to be optimal for binding to H2-L(d), although 8 mer epitopes have also been identified. It has been predicted that 8 mer and 9 mer length variant peptides bound to L(d) present identical epitopes to T cells. However, in contrast to this prediction, we demonstrate here that the 8 mer peptide p2Ca and its 9 mer length variant QL9, extended by an N-terminal glutamine, assume distinct conformations when bound to L(d). We generated self-L(d)-restricted CTL clones specific for p2Ca that recognize L(d)/QL9 poorly if at all. This result is in sharp contrast to what has been observed with L(d)-alloreactive T cells that possess a much higher affinity for L(d)/QL9 than for L(d)/p2Ca. Alanine substitutions of the N-terminal residues of the QL9 peptide rescue detection by these self-L(d)/p2Ca-specific T cells, but decrease recognition by the L(d)-alloreactive 2C T cell clone. In addition, 2C T cell recognition of the p2Ca peptide is affected by different alanine substitutions compared with 2C T cell recognition of the QL9 peptide. These data clearly demonstrate that the p2Ca and QL9 peptides assume distinct conformations when bound to L(d) and, furthermore, demonstrate that there is flexibility in peptide binding within the MHC class I cleft.

  3. 77AESW/EEV Emerging Technologies and P2 Efforts

    DTIC Science & Technology


    2010 to 00-00-2010 4. TITLE AND SUBTITLE 77AESW/EEV Emerging Technologies and P2 Efforts 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM...Response Program Initiative (R2PI) AFRL/ML ManTech < 18 Mo Ref: mil/ mlm /r2pi.html ~$6M /yr RRF- Rapid Response Funds PB

  4. P2X4R+ microglia drive neuropathic pain

    PubMed Central

    Beggs, Simon; Trang, Tuan; Salter, Michael W


    Neuropathic pain, the most debilitating of all clinical pain syndromes, may be a consequence of trauma, infection or pathology from diseases that affect peripheral nerves. Here we provide a framework for understanding the spinal mechanisms of neuropathic pain as distinct from those of acute pain or inflammatory pain. Recent work suggests that a specific microglia response phenotype characterized by de novo expression of the purinergic receptor P2X4 is critical for the pathogenesis of pain hypersensitivity caused by injury to peripheral nerves. Stimulating P2X4 receptors initiates a core pain signaling pathway mediated by release of brain-derived neurotrophic factor, which produces a disinhibitory increase in intracellular chloride in nociceptive (pain-transmitting) neurons in the spinal dorsal horn. The changes caused by signaling from P2X4R+ microglia to nociceptive transmission neurons may account for the main symptoms of neuropathic pain in humans, and they point to specific interventions to alleviate this debilitating condition. PMID:22837036

  5. Pure P2P mediation system: A mappings discovery approach

    NASA Astrophysics Data System (ADS)

    selma, El yahyaoui El idrissi; Zellou, Ahmed; Idri, Ali


    The information integration systems consist in offering a uniform interface to provide access to a set of autonomous and distributed information sources. The most important advantage of this system is that it allows users to specify what they want, rather than thinking about how to get the responses. The works realized in this area have particular leads to two major classes of integration systems: the mediation systems based on the paradigm mediator / adapter and peer to peer systems (P2P). The combination of both systems has led to a third type; is the mediation P2P systems. The P2P systems are large-scale systems, self-organized and distributed. They allow the resource management in a completely decentralized way. However, the integration of structured information sources, heterogeneous and distributed proves to be a complex problem. The objective of this work is to propose an approach to resolve conflicts and establish a mapping between the heterogeneous elements. This approach is based on clustering; the latter is to group similar Peers that share common information in the same subnet. Thus, to facilitate the heterogeneity, we introduced three additional layers of our hierarchy of peers: internal schema, external schema and Schema directory peer. We used linguistic techniques, and precisely the name correspondence technique, that is based on the similarity of names to propose a correspondence.

  6. Load Balancing in Structured P2P Networks

    NASA Astrophysics Data System (ADS)

    Zhu, Yingwu

    In this chapter we start by addressing the importance and necessity of load balancing in structured P2P networks, due to three main reasons. First, structured P2P networks assume uniform peer capacities while peer capacities are heterogeneous in deployed P2P networks. Second, resorting to pseudo-uniformity of the hash function used to generate node IDs and data item keys leads to imbalanced overlay address space and item distribution. Lastly, placement of data items cannot be randomized in some applications (e.g., range searching). We then present an overview of load aggregation and dissemination techniques that are required by many load balancing algorithms. Two techniques are discussed including tree structure-based approach and gossip-based approach. They make different tradeoffs between estimate/aggregate accuracy and failure resilience. To address the issue of load imbalance, three main solutions are described: virtual server-based approach, power of two choices, and address-space and item balancing. While different in their designs, they all aim to improve balance on the address space and data item distribution. As a case study, the chapter discusses a virtual server-based load balancing algorithm that strives to ensure fair load distribution among nodes and minimize load balancing cost in bandwidth. Finally, the chapter concludes with future research and a summary.

  7. Uniform Sampling for Directed P2P Networks

    NASA Astrophysics Data System (ADS)

    Hall, Cyrus; Carzaniga, Antonio

    Selecting a random peer with uniform probability across a peer-to-peer (P2P) network is a fundamental function for unstructured search, data replication, and monitoring algorithms. Such uniform sampling is supported by several techniques. However, current techniques suffer from sample bias and limited applicability. In this paper, we present a sampling algorithm that achieves a desired uniformity while making essentially no assumptions about the underlying P2P network. This algorithm, called doubly stochastic converge (DSC), iteratively adjusts the probabilities of crossing each link in the network during a random walk, such that the resulting transition matrix is doubly stochastic. DSC is fully decentralized and is designed to work on both directed and undirected topologies, making it suitable for virtually any P2P network. Our simulations show that DSC converges quickly on a wide variety of topologies, and that the random walks needed for sampling are short for most topologies. In simulation studies with FreePastry, we show that DSC is resilient to high levels of churn, while incurring a minimal sample bias.

  8. An Overlapping Structured P2P for REIK Overlay Network

    NASA Astrophysics Data System (ADS)

    Liu, Wenjun; Song, Jingjing; Yu, Jiguo

    REIK is based on a ring which embedded an inverse Kautz digraph, to enable multi-path P2P routing. It has the constant degree and the logarithmic diameter DHT scheme with constant congestion and Byzantine fault tolerance. However, REIK did not consider the interconnection of many independent smaller networks. In this paper, we propose a new approach to build overlay network, OLS-REIK which is an overlapping structured P2P for REIK overlay network. It is a more flexible interconnecting different REIK network. Peers can belong to several rings, allowing this interconnection. By connecting smaller structured overlay networks in an unstructured way, it provides a cost effective alternative to hierarchical structured P2P systems requiring costly merging. Routing of lookup messages is performed as in REIK within one ring, but a peer belonging to several rings forwards the request to the different rings it belongs to. Furthermore a small number of across point is enough to ensure a high exhaustiveness level.

  9. The Specificity Protein Factor Sp1 Mediates Transcriptional Regulation of P2X7 Receptors in the Nervous System*

    PubMed Central

    García-Huerta, Paula; Díaz-Hernandez, Miguel; Delicado, Esmerilda G.; Pimentel-Santillana, María; Miras-Portugal, Mª Teresa; Gómez-Villafuertes, Rosa


    P2X7 receptors are involved not only in physiological functions but also in pathological brain processes. Although an increasing number of findings indicate that altered receptor expression has a causative role in neurodegenerative diseases and cancer, little is known about how expression of P2rx7 gene is controlled. Here we reported the first molecular and functional evidence that Specificity protein 1 (Sp1) transcription factor plays a pivotal role in the transcriptional regulation of P2X7 receptor. We delimited a minimal region in the murine P2rx7 promoter containing four SP1 sites, two of them being highly conserved in mammals. The functionality of these SP1 sites was confirmed by site-directed mutagenesis and Sp1 overexpression/down-regulation in neuroblastoma cells. Inhibition of Sp1-mediated transcriptional activation by mithramycin A reduced endogenous P2X7 receptor levels in primary cultures of cortical neurons and astrocytes. Using P2rx7-EGFP transgenic mice that express enhanced green fluorescent protein under the control of P2rx7 promoter, we found a high correlation between reporter expression and Sp1 levels in the brain, demonstrating that Sp1 is a key element in the transcriptional regulation of P2X7 receptor in the nervous system. Finally, we found that Sp1 mediates P2X7 receptor up-regulation in neuroblastoma cells cultured in the absence of serum, a condition that enhances chromatin accessibility and facilitates the exposure of SP1 binding sites. PMID:23139414

  10. Optimization of ketone-based P2Y(12) receptor antagonists as antithrombotic agents: pharmacodynamics and receptor kinetics considerations.


    Giordanetto, Fabrizio; Bach, Peter; Zetterberg, Fredrik; Antonsson, Thomas; Bylund, Ruth; Johansson, Johan; Sellén, Mikael; Brown, David; Hideståhl, Lotta; Berntsson, Pia; Hovdal, Daniel; Zachrisson, Helen; Björkman, Jan-Arne; van Giezen, J J J


    Modification of a series of P2Y12 receptor antagonists by replacement of the ester functionality was aimed at minimizing the risk of in vivo metabolic instability and pharmacokinetic variability. The resulting ketones were then optimized for their P2Y12 antagonistic and anticoagulation effects in combination with their physicochemical and absorption profiles. The most promising compound showed very potent antiplatelet action in vivo. However, pharmacodynamic-pharmacokinetic analysis did not reveal a significant separation between its anti-platelet and bleeding effects. The relevance of receptor binding kinetics to the in vivo profile is described. Copyright © 2014 Elsevier Ltd. All rights reserved.

  11. Purinergic P2Y2 Receptor Control of Tissue Factor Transcription in Human Coronary Artery Endothelial Cells

    PubMed Central

    Liu, Yiwei; Zhang, Lingxin; Wang, Chuan; Roy, Shama; Shen, Jianzhong


    We recently reported that the P2Y2 receptor (P2Y2R) is the predominant nucleotide receptor expressed in human coronary artery endothelial cells (HCAEC) and that P2Y2R activation by ATP or UTP induces dramatic up-regulation of tissue factor (TF), a key initiator of the coagulation cascade. However, the molecular mechanism of this P2Y2R-TF axis remains unclear. Here, we report the role of a newly identified AP-1 consensus sequence in the TF gene promoter and its original binding components in P2Y2R regulation of TF transcription. Using bioinformatics tools, we found that a novel AP-1 site at −1363 bp of the human TF promoter region is highly conserved across multiple species. Activation of P2Y2R increased TF promoter activity and mRNA expression in HCAEC. Truncation, deletion, and mutation of this distal AP-1 site all significantly suppressed TF promoter activity in response to P2Y2R activation. EMSA and ChIP assays further confirmed that upon P2Y2R activation, c-Jun, ATF-2, and Fra-1, but not the typical c-Fos, bound to the new AP-1 site. In addition, loss-of-function studies using siRNAs confirmed a positive transactivation role of c-Jun and ATF-2 but unexpectedly revealed a strong negative role of Fra-1 in P2Y2R-induced TF up-regulation. Furthermore, we found that P2Y2R activation promoted ERK1/2 phosphorylation through Src, leading to Fra-1 activation, whereas Rho/JNK mediated P2Y2R-induced activation of c-Jun and ATF-2. These findings reveal the molecular basis for P2Y G protein-coupled receptor control of endothelial TF expression and indicate that targeting the P2Y2R-Fra-1-TF pathway may be an attractive new strategy for controlling vascular inflammation and thrombogenicity associated with endothelial dysfunction. PMID:26631725

  12. Farnesyl pyrophosphate is an endogenous antagonist to ADP-stimulated P2Y12 receptor-mediated platelet aggregation

    PubMed Central

    Högberg, Carl; Gidlöf, Olof; Deflorian, Francesca; Jacobson, Kenneth A.; Abdelrahman, Aliaa; Miüller, Christa E.; Olde, Björn; Erlinge, David


    Summary Farnesyl pyrophosphate (FPP) is an intermediate in cholesterol biosynthesis, and it has also been reported to activate platelet LPA (lysophosphatidic acid) receptors. The aim of this study was to investigate the role of extracellular FPP in platelet aggregation. Human platelets were studied with light transmission aggregometry, flow cytometry and [35S]GTPγS binding assays. As shown previously, FPP could potentiate LPA-stimulated shape change. Surprisingly, FPP also acted as a selective insurmountable antagonist to ADP-induced platelet aggregation. FPP inhibited ADP-induced expression of P-selectin and the activated glycoprotein (Gp)llb/llla receptor. FPP blocked ADP-induced inhibition of cAMP accumulation and [35S]GTPγS binding in platelets. In Chinese hamster ovary cells expressing the P2Y12 receptor, FPP caused a right-ward shift of the [35S]GTPγS binding curve. In Sf9 insect cells expressing the human P2Y12 receptor, FPP showed a concentration-dependent, although incomplete inhibition of [3H]PSB-0413 binding. Docking of FPP in a P2Y12 receptor model revealed molecular similarities with ADP and a good fit into the binding pocket for ADP. In conclusion, FPP is an insurmountable antagonist of ADP-induced platelet aggregation mediated by the P2Y12 receptor. It could be an endogenous antithrombotic factor modulating the strong platelet aggregatory effects of ADP in a manner similar to the use of clopidogrel, prasugrel or ticagrelor in the treatment of ischaemic heart disease. PMID:22628078

  13. Farnesyl pyrophosphate is an endogenous antagonist to ADP-stimulated P2Y₁₂ receptor-mediated platelet aggregation.


    Högberg, Carl; Gidlöf, Olof; Deflorian, Francesca; Jacobson, Kenneth A; Abdelrahman, Aliaa; Müller, Christa E; Olde, Björn; Erlinge, David


    Farnesyl pyrophosphate (FPP) is an intermediate in cholesterol biosynthesis, and it has also been reported to activate platelet LPA (lysophosphatidic acid) receptors. The aim of this study was to investigate the role of extracellular FPP in platelet aggregation. Human platelets were studied with light transmission aggregometry, flow cytometry and [³⁵S]GTPγS binding assays. As shown previously, FPP could potentiate LPA-stimulated shape change. Surprisingly, FPP also acted as a selective insurmountable antagonist to ADP-induced platelet aggregation. FPP inhibited ADP-induced expression of P-selectin and the activated glycoprotein (Gp)IIb/IIIa receptor. FPP blocked ADP-induced inhibition of cAMP accumulation and [³⁵S]GTPγS binding in platelets. In Chinese hamster ovary cells expressing the P2Y₁₂ receptor, FPP caused a rightward shift of the [³⁵S]GTPγS binding curve. In Sf9 insect cells expressing the human P2Y₁₂ receptor, FPP showed a concentration-dependent, although incomplete inhibition of [³H]PSB-0413 binding. Docking of FPP in a P2Y₁₂ receptor model revealed molecular similarities with ADP and a good fit into the binding pocket for ADP. In conclusion, FPP is an insurmountable antagonist of ADP-induced platelet aggregation mediated by the P2Y₁₂ receptor. It could be an endogenous antithrombotic factor modulating the strong platelet aggregatory effects of ADP in a manner similar to the use of clopidogrel, prasugrel or ticagrelor in the treatment of ischaemic heart disease.

  14. In silico Approach for Anti-Thrombosis Drug Discovery: P2Y1R Structure-Based TCMs Screening

    PubMed Central

    Yi, Fan; Sun, Le; Xu, Li-jia; Peng, Yong; Liu, Hai-bo; He, Chun-nian; Xiao, Pei-gen


    Cardiovascular diseases (CVDs), including thrombosis, which is induced by platelet aggregation, are the leading cause of mortality worldwide. The P2Y1 receptor (P2Y1R) facilitates platelet aggregation and is thus an important potential anti-thrombotic drug target. The P2Y1R protein structure contains a binding site for receptor antagonist MRS2500 within its seven-transmembrane bundle, which also provides suitable pockets for numerous other ligands to act as nucleotide antagonists of P2Y1R. The Traditional Chinese Medicine Systems Pharmacology Database and Analysis Platform (TCMSP) comprises 499 Chinese Pharmacopoeia-registered herbs and the structure information for 29,384 ingredients. In silico docking of these compounds into the P2Y1R protein structure within the MRS2500 pocket can identify potential antithrombotic drugs from natural medicinal plants. Docking studies were performed and scored to evaluate ligand-binding affinities. In this study, a total of 8987 compounds from Traditional Chinese Medicine (TCM) were filtered by Lipinski's rule of five, and their ideal oral-intake properties were evaluated. Of these, 1656 compounds distributed in 443 herbs docked into the P2Y1R-MRS2500 structure in 16,317 poses. A total of 38 compounds were ranked with a DockScore above 70, and these may have significant potential for development into anti-thrombosis drugs. These computational results suggested that licorice (Glycyrrhiza uralensis Fisch), cimicifugae (Cimicifuga foetida L.), and ganoderma (Ganoderma lucidum Karst) and their chemical constituents, which have not previously been widely used for anti-thrombosis, may have unexpected effects on platelet aggregation. Moreover, two types of triterpene scaffolds summarized from 10 compounds were distributed in these three herbs and also docked into P2Y1R. These scaffold structures may be utilized for the development of drugs to inhibit platelet aggregation. PMID:28119608

  15. Contribution of the P2Y12 receptor-mediated pathway to platelet hyperreactivity in hypercholesterolemia

    PubMed Central

    Nagy, Béla; Jin, Jianguo; Ashby, Barrie; Reilly, Michael P.; Kunapuli, Satya P.


    Summary Background In hypercholesterolemia, platelets demonstrate increased reactivity and promote the development of cardiovascular disease. Objective This study was carried out to investigate the contribution of the ADP receptor P2Y12-mediated pathway in platelet hyperreactivity due to hypercholesterolemia. Methods Low-density lipoprotein receptor deficient mice and C57Bl/6 wild type mice were fed on normal chow and high-fat (Western or Paigen) diets for 8 weeks to generate differently elevated cholesterol levels. P2Y12 receptor induced functional responses via Gi signaling were studied ex vivo when washed murine platelets were activated by 2MeSADP and PAR4 agonist AYPGKF in the presence and absence of indomethacin. Platelet aggregation, secretion, αIIbβ3 receptor activation and the phosphorylation of extracellular signal-regulated protein kinase (ERK) and Akt were analyzed. Results Plasma cholesterol levels ranged from 69±10 to 1011±185 mg/dl depending on diet in mice with different genotypes. Agonist-dependent aggregation, dense and α-granule secretion and JON/A binding were gradually and significantly (P < 0.05) augmented at low agonist concentration in correlation with the increasing plasma cholesterol levels even if elevated thromboxane generation was blocked. These functional responses were induced via increased level of Gi mediated ERK and Akt phosphorylation in hypercholesterolemic mice versus normocholesterolemic animals. In addition, blocking of the P2Y12 receptor by AR-C69931MX (Cangrelor) resulted in strongly reduced platelet aggregation in mice with elevated cholesterol levels compared to normocholesterolemic controls. Conclusions These data revealed that the P2Y12 receptor pathway was substantially involved in platelet hyperreactivity associated with mild and severe hypercholesterolemia. PMID:21261805

  16. Ca3P2 and other topological semimetals with line nodes and drumhead surface states

    NASA Astrophysics Data System (ADS)

    Chan, Y.-H.; Chiu, Ching-Kai; Chou, M. Y.; Schnyder, Andreas P.


    As opposed to ordinary metals, whose Fermi surfaces are two dimensional, topological (semi)metals can exhibit protected one-dimensional Fermi lines or zero-dimensional Fermi points, which arise due to an intricate interplay between symmetry and topology of the electronic wave functions. Here, we study how reflection symmetry, time-reversal symmetry, SU(2) spin-rotation symmetry, and inversion symmetry lead to the topological protection of line nodes in three-dimensional semimetals. We obtain the crystalline invariants that guarantee the stability of the line nodes in the bulk and show that a quantized Berry phase leads to the appearance of protected surfaces states, which take the shape of a drumhead. By deriving a relation between the crystalline invariants and the Berry phase, we establish a direct connection between the stability of the line nodes and the drumhead surface states. Furthermore, we show that the dispersion minimum of the drumhead state leads to a Van Hove singularity in the surface density of states, which can serve as an experimental fingerprint of the topological surface state. As a representative example of a topological semimetal, we consider Ca3P2 , which has a line of Dirac nodes near the Fermi energy. The topological properties of Ca3P2 are discussed in terms of a low-energy effective theory and a tight-binding model, derived from ab initio DFT calculations. Our microscopic model for Ca3P2 shows that the drumhead surface states have a rather weak dispersion, which implies that correlation effects are enhanced at the surface of Ca3P2 .

  17. Evidence for associations between the purinergic receptor P2X7 (P2RX7) and toxoplasmosis

    PubMed Central

    Jamieson, Sarra E.; Peixoto-Rangel, Alba L.; Hargrave, Aubrey C.; de Roubaix, Lee-Anne; Mui, Ernest J.; Boulter, Nicola R.; Miller, E. Nancy; Fuller, Stephen J.; Wiley, James S.; Castellucci, Léa; Boyer, Kenneth; Peixe, Ricardo Guerra; Kirisits, Michael J.; de Souza Elias, Liliani; Coyne, Jessica J.; Correa-Oliveira, Rodrigo; Sautter, Mari; Smith, Nicholas C.; Lees, Michael P.; Swisher, Charles N.; Heydemann, Peter; Noble, A. Gwendolyn; Patel, Dushyant; Bardo, Dianna; Burrowes, Delilah; McLone, David; Roizen, Nancy; Withers, Shawn; Bahia-Oliveira, Lílian M. G.; McLeod, Rima; Blackwell, Jenefer M.


    Congenital Toxoplasma gondii infection can result in intracranial calcification, hydrocephalus, and retinochoroiditis. Acquired infection is commonly associated with ocular disease. Pathology is characterized by strong pro-inflammatory responses. Ligation of ATP by purinergic receptor P2X7, encoded by P2RX7, stimulates pro-inflammatory cytokines and can lead directly to killing of intracellular pathogens. To determine whether P2X7 plays a role in susceptibility to congenital toxoplasmosis, we examined polymorphisms at P2RX7 in 149 child/parent trios from North America. We found association (FBAT Z scores ±2.429; P= 0.015) between the derived C(+)G(−) allele (f= 0.68; OR= 2.06; 95% CI: 1.14–3.75) at SNP rs1718119 (1068T>C; Thr-348-Ala), and a second synonymous variant rs1621388 in linkage disequilibrium with it, and clinical signs of disease per se. Analysis of clinical sub-groups showed no association with hydrocephalus, with effect sizes for associations with retinal disease and brain calcifications enhanced (OR=3.0 to 4.25; 0.004

  18. Motor Learning: The FoxP2 Puzzle Piece

    PubMed Central

    Teramitsu, Ikuko; White, Stephanie A.


    Mutation of the DNA-binding region of the FOXP2 protein causes an inherited language disorder. A recent study provides the first data on mice with this mutation, which exhibit deficits in motor-skill learning and abnormal properties of neural circuits that contribute to these skills. PMID:18430631

  19. The G Protein-coupled Receptor P2Y14 Influences Insulin Release and Smooth Muscle Function in Mice*

    PubMed Central

    Meister, Jaroslawna; Le Duc, Diana; Ricken, Albert; Burkhardt, Ralph; Thiery, Joachim; Pfannkuche, Helga; Polte, Tobias; Grosse, Johannes; Schöneberg, Torsten; Schulz, Angela


    UDP sugars were identified as extracellular signaling molecules, assigning a new function to these compounds in addition to their well defined role in intracellular substrate metabolism and storage. Previously regarded as an orphan receptor, the G protein-coupled receptor P2Y14 (GPR105) was found to bind extracellular UDP and UDP sugars. Little is known about the physiological functions of this G protein-coupled receptor. To study its physiological role, we used a gene-deficient mouse strain expressing the bacterial LacZ reporter gene to monitor the physiological expression pattern of P2Y14. We found that P2Y14 is mainly expressed in pancreas and salivary glands and in subpopulations of smooth muscle cells of the gastrointestinal tract, blood vessels, lung, and uterus. Among other phenotypical differences, knock-out mice showed a significantly impaired glucose tolerance following oral and intraperitoneal glucose application. An unchanged insulin tolerance suggested altered pancreatic islet function. Transcriptome analysis of pancreatic islets showed that P2Y14 deficiency significantly changed expression of components involved in insulin secretion. Insulin secretion tests revealed a reduced insulin release from P2Y14-deficient islets, highlighting P2Y14 as a new modulator of proper insulin secretion. PMID:24993824

  20. Distribution of P2Y2 receptors in the guinea pig enteric nervous system and its coexistence with P2X2 and P2X3 receptors, neuropeptide Y, nitric oxide synthase and calretinin.


    Xiang, Zhenghua; Burnstock, Geoffrey


    The distribution of P2Y2 receptor-immunoreactive (ir) neurons and fibers and coexistence of P2Y2 with P2X2 and P2X3 receptors, neuropeptide Y (NPY), calretinin (CR), calbindin (CB) and nitric oxide synthase (NOS) was investigated with immunostaining methods. The results showed that P2Y2-ir neurons and fibers were distributed widely in myenteric and submucous plexuses of the guinea pig stomach corpus, jejunum, ileum and colon. The typical morphology of P2Y2-ir neurons was a long process with strong positive staining on the same side of the cell body. The P2Y2-ir neurons could be Dogiel type 1. About 40-60% P2X3-ir neurons were immunoreactive for P2Y2 in the myenteric plexus and all the P2X3-ir neurons expressed the P2Y2 receptor in the submucosal plexus; almost all the NPY-ir neurons and the majority of CR-ir neurons were also immunoreactive for P2Y2, especially in the myenteric plexus of the small intestine; no P2Y2-ir neurons were immunoreactive for P2X2 receptors, CB and NOS. It is shown for the first time that S type/Dogiel type 1 neurons with fast P2X and slow P2Y receptor-mediated depolarizations could be those neurons expressing both P2Y2-ir and P2X3-ir and that they are widely distributed in myenteric and submucosal plexuses of guinea pig gut.

  1. The AEDC P2 program: A quality approach

    SciTech Connect

    Brandon, C.; Fitzgerald, M.


    Arnold Engineering Development Center (AEDC), a world-renowned aerodynamic and space systems testing facility, has been actively involved in waste reduction efforts for a number of years. As is typical of most new endeavors, the early years were characterized by the harvesting of the low-hanging fruit. By capitalizing on these obvious reduction opportunities, the base was able to achieve significant decreases in hazardous material usage and the generation of hazardous and non-hazardous wastes. However, it became apparent that a more structured, systematic approach was needed to achieve further reductions. A key step in the evolution of its pollution prevention (P2) program was the adoption of an effective P2 process methodology. As the program has matured, AEDC has traversed the continuous improvement cycle several times. Each pass has resulted in a refinement of the efforts associated with each process phase. Once these obvious reduction opportunities had been adequately addressed, attention was focused on specific Air Force protocol areas having the highest environmental risk or financial payback. At this point, AEDC began to assess opportunities in a more systematic manner, using the process methodology. These efforts resulted in additional reductions and also identified specific base processes and activities that would benefit from a more focused assessment. Similar refinements have been incorporated into the other phases of the AEDC methodology. This paper provides an overview of the AEDC P2 Program, including a discussion of the continuous improvement methodology employed and an historical perspective describing how the program has been continually refined through this iterative process. As a means to convey this material in an organized and logical manner, information is presented in a chronological fashion around the four quadrants of the continuous improvement cycle.

  2. Final Design of the SLAC P2 Marx Klystron Modulator

    SciTech Connect

    Kemp, M.A.; Benwell, A.; Burkhart, C.; Larsen, R.; MacNair, D.; Nguyen, M.; Olsen, J.; /SLAC


    The SLAC P2 Marx has been under development for two years, and follows on the P1 Marx as an alternative to the baseline klystron modulator for the International Linear Collider. The P2 Marx utilizes a redundant architecture, air-insulation, a control system with abundant diagnostic access, and a novel nested droop correction scheme. This paper is an overview of the design of this modulator. There are several points of emphasis for the P2 Marx design. First, the modulator must be compatible with the ILC two-tunnel design. In this scheme, the modulator and klystron are located within a service tunnel with limited access and available footprint for a modulator. Access to the modulator is only practical from one side. Second, the modulator must have high availability. Robust components are not sufficient alone to achieve availability much higher than 99%. Therefore, redundant architectures are necessary. Third, the modulator must be relatively low cost. Because of the large number of stations in the ILC, the investment needed for the modulator components is significant. High-volume construction techniques which take advantage of an economy of scale must be utilized. Fourth, the modulator must be simple and efficient to maintain. If a modulator does become inoperable, the MTTR must be small. Fifth, even though the present application for the modulator is for the ILC, future accelerators can also take advantage of this development effort. The hardware, software, and concepts developed in this project should be designed such that further development time necessary for other applications is minimal.

  3. Nucleus of the active Centaur C/2011 P2 (PANSTARRS)

    NASA Astrophysics Data System (ADS)

    Mazzotta Epifani, E.; Perna, D.; Dotto, E.; Palumbo, P.; Dall'Ora, M.; Micheli, M.; Ieva, S.; Perozzi, E.


    Aims: In this paper we present observations of the active Centaur C/2011 P2 (PANSTARRS), showing a compact comet-like coma at the heliocentric distance of rh = 9 au. The observations were obtained in the framework of a wider program on Centaurs aimed at searching for comet-like activity in several targets outside Jupiter's aphelion. Methods: We analysed visible images of the Centaur taken at the TNG telescope in the R filter to investigate the level of coma contributing to the target brightness and to derive information on its nucleus size. Results: Centaur C/2011 P2 (PANSTARRS) shows a faint but still detectable comet-like activity, which accounts for more than 50% to the observed brightness. The coma contribution has been subtracted in order to derive an estimate for the Centaur's diameter of D 16 km, assuming an albedo of A = 0.07 (average of albedo measured within the Centaur group). The results for Centaur C/2011 P2 (PANSTARRS) fit in the general picture of the group: Centaurs with smaller perihelion distance q and semi-major axis a are smaller than those remaining farther from the Sun during their orbital path, thus reinforcing the idea that active Centaurs are "comets in fieri". Based on observations collected at the Telescopio Nazionale Galileo (TNG), operated on the island of La Palma by the Centro Galileo Galilei of the INAF (Istituto Nazionale di Astrofisica) at the Spanish Observatorio del Roque de los Muchachos of the Instituto de Astrofísica de Canarias.

  4. Broadband terahertz pulse emission from ZnGeP_2

    NASA Astrophysics Data System (ADS)

    Rowley, J. D.; Pierce, J. K.; Brant, A. T.; Halliburton, L. E.; Giles, N. C.; Schunemann, P. G.; Bristow, A. D.


    Optical rectification is demonstrated in (110)-cut ZnGeP_2 (ZGP) providing broadband terahertz (THz) generation. The source is compared to both GaP and GaAs over a wavelength range of 1150 nm to 1600 nm and peak intensity range of 0.5 GW/cm^2 to 40 GW/cm^2. ZGP peak-to-peak field amplitude is larger than in the other materials due to either lower nonlinear absorption or larger second order nonlinearity. This material is well suited for broadband THz generation across a wide range of infrared excitation wavelengths.

  5. P2X7 receptors in satellite glial cells mediate high functional expression of P2X3 receptors in immature dorsal root ganglion neurons.


    Chen, Yong; Li, Guangwen; Huang, Li-Yen Mae


    The purinergic P2X3 receptor (P2X3R) expressed in the dorsal root ganglion (DRG) sensory neuron and the P2X7 receptor (P2X7R) expressed in the surrounding satellite glial cell (SGC) are two major receptors participating in neuron-SGC communication in adult DRGs. Activation of P2X7Rs was found to tonically reduce the expression of P2X3Rs in DRGs, thus inhibiting the abnormal pain behaviors in adult rats. P2X receptors are also actively involved in sensory signaling in developing rodents. However, very little is known about the developmental change of P2X7Rs in DRGs and the interaction between P2X7Rs and P2X3Rs in those animals. We therefore examined the expression of P2X3Rs and P2X7Rs in postnatal rats and determined if P2X7R-P2X3R control exists in developing rats. We immunostained DRGs of immature rats and found that P2X3Rs were expressed only in neurons and P2X7Rs were expressed only in SGCs. Western blot analyses indicated that P2X3R expression decreased while P2X7R expression increased with the age of rats. Electrophysiological studies showed that the number of DRG neurons responding to the stimulation of the P2XR agonist, α,β-meATP, was higher and the amplitudes of α,β-meATP-induced depolarizations were larger in immature DRG neurons. As a result, P2X3R-mediated flinching responses were much more pronounced in immature rats than those found in adult rats. When we reduced P2X7R expression with P2X7R-siRNA in postnatal and adult rats, P2X3R-mediated flinch responses were greatly enhanced in both rat populations. These results show that the P2X7R expression increases as rats age. In addition, P2X7Rs in SGCs exert inhibitory control on the P2X3R expression and function in sensory neurons of immature rats, just as observed in adult rats. Regulation of P2X7R expression is likely an effective way to control P2X3R activity and manage pain relief in infants.

  6. Characterization of recombinantly expressed dihydroxy-acid dehydratase from Sulfobus solfataricus-A key enzyme for the conversion of carbohydrates into chemicals.


    Carsten, Jörg M; Schmidt, Anja; Sieber, Volker


    Dihydroxyacid dehydratases (DHADs) are excellent biocatalysts for the defunctionalization of biomass. Here, we report on the recombinant production of DHAD from Sulfolobus solfataricus (SsDHAD) in E. coli and its characterization with special focus on activity toward non-natural substrates, thermo-stability, thermo-inactivation kinetics and activation capabilities and its application within multi-step cascades for chemicals production. Using a simple heat treatment of cell lysate as major purification step we achieved a specific activity of 4.4 units per gram cell mass toward the substrate d-gluconate. The optimal temperature and pH value for this reaction are 77°C and pH 6.2. The inhibitory concentration (IC50, 50% residual activity) of different alcohols was determined to be 15% (v/v) for ethanol, 4.5% (v/v) for butanol and 4% (v/v) for isobutanol. Besides d-gluconate and the natural substrate 2,3-dihydroxyisovalerate (DHIV) SsDHAD is able to convert the C3-sugar-acid d-glycerate to pyruvate, a reaction, which does not occur in natural metabolic pathways, with a specific activity of 10.7±0.4mU/mg. The specific activity of the enzyme can be increased 3-fold by incubation with 2-mercaptoethanol. The activation has no impact on temperature dependence, but modulates the thermo-inactivation tolerance at 50°C. The total turnover numbers for all of the three reactions was found to be 35.5×10(3)±1.0×10(3) for the conversion of d-gluconate to 2-keto-3-deoxygluconate (KDG), 28.2×10(3)±0.8×10(3) for DHIV to 2-ketovalerate (KIV) and 943±0.28×10(2) for d-glycerate to pyruvate. With activated SsDHAD these values could be further increased 5- and 4-fold for the d-gluconate and d-glycerate conversion, respectively. Copyright © 2015 Elsevier B.V. All rights reserved.

  7. Versatility of Y-family Sulfolobus solfataricus DNA Polymerase Dpo4 in Translesion Synthesis Past Bulky N[superscript 2]-Alkylguanine Adducts

    SciTech Connect

    Zhang, Huidong; Eoff, Robert L.; Kozekov, Ivan D.; Rizzo, Carmelo J.; Egli, Martin; Guengerich, F. Peter


    In contrast to replicative DNA polymerases, Sulfolobus solfataricus Dpo4 showed a limited decrease in catalytic efficiency (k{sub cat}/K{sub m}) for insertion of dCTP opposite a series of N{sup 2}-alkylguanine templates of increasing size from (methyl (Me) to (9-anthracenyl)-Me (Anth)). Fidelity was maintained with increasing size up to (2-naphthyl)-Me (Naph). The catalytic efficiency increased slightly going from the N{sup 2}-NaphG to the N{sup 2}-AnthG substrate, at the cost of fidelity. Pre-steady-state kinetic bursts were observed for dCTP incorporation throughout the series (N{sup 2}-MeG to N{sup 2}-AnthG), with a decrease in the burst amplitude and k{sub pol}, the rate of single-turnover incorporation. The pre-steady-state kinetic courses with G and all of the six N{sup 2}-alkyl G adducts could be fit to a general DNA polymerase scheme to which was added an inactive complex in equilibrium with the active ternary Dpo4 {center_dot} DNA {center_dot} dNTP complex, and only the rates of equilibrium with the inactive complex and phosphodiester bond formation were altered. Two crystal structures of Dpo4 with a template N{sup 2}-NaphG (in a post-insertion register opposite a 3'-terminal C in the primer) were solved. One showed N{sup 2}-NaphG in a syn conformation, with the naphthyl group located between the template and the Dpo4 'little finger' domain. The Hoogsteen face was within hydrogen bonding distance of the N4 atoms of the cytosine opposite N{sup 2}-NaphG and the cytosine at the -2 position. The second structure showed N{sup 2}-Naph G in an anti conformation with the primer terminus largely disordered. Collectively these results explain the versatility of Dpo4 in bypassing bulky G lesions.

  8. Ring-Opening of the γ-OH-PdG Adduct Promotes Error-Free Bypass by the Sulfolobus solfataricus DNA Polymerase Dpo4

    PubMed Central


    Acrolein, a mutagenic aldehyde, reacts with deoxyguanosine (dG) to form 3-(2′-deoxy-β-d-erythro-pentofuranosyl)-5,6,7,8-tetrahydro-8-hydroxypyrimido[1,2-a] purin-10(3H)-one (γ-OH-PdG). When placed opposite deoxycytosine (dC) in DNA, γ-OH-PdG undergoes ring-opening to the N2-(3-oxopropyl)-dG. Ring-opening of the adduct has been hypothesized to facilitate nonmutagenic bypass, particularly by DNA polymerases of the Y family. This study examined the bypass of γ-OH-PdG by Sulfolobus solfataricus Dpo4, the prototypic Y-family DNA polymerase, using templates that contained the adduct in either the 5′-CXG-3′ or the 5′-TXG-3′ sequence context. Although γ-OH-PdG partially blocked Dpo4-catalyzed DNA synthesis, full primer extension was observed, and the majority of bypass products were error-free. Conversion of the adduct into an irreversibly ring-opened derivative prior to reaction facilitated bypass and further improved the fidelity. Structures of ternary Dpo4·DNA·dNTP complexes were determined with primers that either were positioned immediately upstream of the lesion (preinsertion complexes) or had a 3′-terminal dC opposite the lesion (postinsertion complexes); the incoming nucleotides, either dGTP or dATP, were complementary to the template 5′-neighbor nucleotide. In both postinsertion complexes, the adduct existed as ring-opened species, and the resulting base-pair featured Watson–Crick hydrogen bonding. The incoming nucleotide paired with the 5′-neighbor template, while the primer 3′-hydroxyl was positioned to facilitate extension. In contrast, γ-OH-PdG was in the ring-closed form in both preinsertion complexes, and the overall structure did not favor catalysis. These data provide insights into γ-OH-PdG chemistry during replication bypass by the Dpo4 DNA polymerase and may explain why γ-OH-PdG-induced mutations due to primer–template misalignment are uncommon. PMID:23947567

  9. PLC-mediated PI(4,5)P2 hydrolysis regulates activation and inactivation of TRPC6/7 channels.


    Itsuki, Kyohei; Imai, Yuko; Hase, Hideharu; Okamura, Yasushi; Inoue, Ryuji; Mori, Masayuki X


    Transient receptor potential classical (or canonical) (TRPC)3, TRPC6, and TRPC7 are a subfamily of TRPC channels activated by diacylglycerol (DAG) produced through the hydrolysis of phosphatidylinositol 4,5-bisphosphate (PI(4,5)P2) by phospholipase C (PLC). PI(4,5)P2 depletion by a heterologously expressed phosphatase inhibits TRPC3, TRPC6, and TRPC7 activity independently of DAG; however, the physiological role of PI(4,5)P2 reduction on channel activity remains unclear. We used Förster resonance energy transfer (FRET) to measure PI(4,5)P2 or DAG dynamics concurrently with TRPC6 or TRPC7 currents after agonist stimulation of receptors that couple to Gq and thereby activate PLC. Measurements made at different levels of receptor activation revealed a correlation between the kinetics of PI(4,5)P2 reduction and those of receptor-operated TRPC6 and TRPC7 current activation and inactivation. In contrast, DAG production correlated with channel activation but not inactivation; moreover, the time course of channel inactivation was unchanged in protein kinase C-insensitive mutants. These results suggest that inactivation of receptor-operated TRPC currents is primarily mediated by the dissociation of PI(4,5)P2. We determined the functional dissociation constant of PI(4,5)P2 to TRPC channels using FRET of the PLCδ Pleckstrin homology domain (PHd), which binds PI(4,5)P2, and used this constant to fit our experimental data to a model in which channel gating is controlled by PI(4,5)P2 and DAG. This model predicted similar FRET dynamics of the PHd to measured FRET in either human embryonic kidney cells or smooth muscle cells, whereas a model lacking PI(4,5)P2 regulation failed to reproduce the experimental data, confirming the inhibitory role of PI(4,5)P2 depletion on TRPC currents. Our model also explains various PLC-dependent characteristics of channel activity, including limitation of maximum open probability, shortening of the peak time, and the bell-shaped response of total

  10. An Rgd Sequence in the P2y2 Receptor Interacts with αVβ3 Integrins and Is Required for Go-Mediated Signal Transduction

    PubMed Central

    Erb, Laurie; Liu, Jun; Ockerhausen, Jonathan; Kong, Qiongman; Garrad, Richard C.; Griffin, Korey; Neal, Chris; Krugh, Brent; Santiago-Pérez, Laura I.; González, Fernando A.; Gresham, Hattie D.; Turner, John T.; Weisman, Gary A.


    The P2Y2 nucleotide receptor (P2Y2R) contains the integrin-binding domain arginine-glycine-aspartic acid (RGD) in its first extracellular loop, raising the possibility that this G protein–coupled receptor interacts directly with an integrin. Binding of a peptide corresponding to the first extracellular loop of the P2Y2R to K562 erythroleukemia cells was inhibited by antibodies against αVβ3/β5 integrins and the integrin-associated thrombospondin receptor, CD47. Immunofluorescence of cells transfected with epitope-tagged P2Y2Rs indicated that αV integrins colocalized 10-fold better with the wild-type P2Y2R than with a mutant P2Y2R in which the RGD sequence was replaced with RGE. Compared with the wild-type P2Y2R, the RGE mutant required 1,000-fold higher agonist concentrations to phosphorylate focal adhesion kinase, activate extracellular signal–regulated kinases, and initiate the PLC-dependent mobilization of intracellular Ca2+. Furthermore, an anti-αV integrin antibody partially inhibited these signaling events mediated by the wild-type P2Y2R. Pertussis toxin, an inhibitor of Gi/o proteins, partially inhibited Ca2+ mobilization mediated by the wild-type P2Y2R, but not by the RGE mutant, suggesting that the RGD sequence is required for P2Y2R-mediated activation of Go, but not Gq. Since CD47 has been shown to associate directly with Gi/o family proteins, these results suggest that interactions between P2Y2Rs, integrins, and CD47 may be important for coupling the P2Y2R to Go. PMID:11331301

  11. P2P Reputation Management Through Social Networking

    NASA Astrophysics Data System (ADS)

    Despotovic, Zoran

    Reputation systems offer a viable solution to the problem of risk reduction in online communities, in situation in which other mechanism such as litigation or security cannot help. Building on the assumption that its participating entities engage in repeated interactions, a reputation system can either signal what happened in the past or aggregate the past feedback in such a way as to influence the future actions of the concerned entity. In the former case, the concerned entity's behavior is seen as static, while the sent signal is expected to be indicative of the entity's future actions. In the latter case, behavior is dynamic in the sense that the entity can adjust it given the observed feedback, while the purpose of the reputation system is to induce adjustments according to the designer's needs. In this chapter, we discuss these two classes of solutions in detail. In particular, we investigate how they apply to P2P networks, what additional problems and difficulties the P2P environment introduces and what scalable solutions to these problems the current research offers.

  12. P2X receptors in cochlear Deiters' cells.


    Chen, C; Bobbin, R P


    1. The ionotropic purinoceptors in isolated Deiters' cells of guinea-pig cochlea were characterized by use of the whole-cell variant of the patch-clamp technique. 2. Extracellular application of adenosine 5'-triphosphate (ATP) induced a dose-dependent inward current when the cells were voltage-clamped at -80 mV. The ATP-induced current showed desensitization and had a reversal potential around -4 mV. 3. Increasing intracellular free Ca2+ by decreasing the concentration of EGTA in the pipette solution reduced the amplitude of the ATP-gated current. 4. The order of agonist potency was: 2-methylthioATP (2-meSATP)>ATP>benzoylbenzoyl-ATP (BzATP)>alpha,beta-methyleneATP (alpha,beta,meATP>adenosine 5'-diphosphate (ADP)>uridine 5'-triphosphate (UTP)>adenosine 5'-monophosphate (AMP)=adenosine (Ad). 5. Pretreatment with forskolin (10 microM), 8-bromoadenosine-3',5'-cyclophosphate (8-Br-cyclic AMP, 1 mM), 3-isobutyl-1-methylxanthine (IBMX, 1 mM) or phorbol-12-myristate-13-acetate (PMA, 1 microM) reversibly reduced the ATP-induced peak current. 6. The results are consistent with molecular biological data which indicate that P2X2 purinoceptors are present in Deiters' cells. In addition, the reduction of the ATP-gated current by activators of protein kinase A and protein kinase C indicates that these P2X2 purinoceptors can be functionally modulated by receptor phosphorylation.

  13. P2Y Receptors in Alzheimer’s Disease

    PubMed Central

    Erb, Laurie; Cao, Chen; Ajit, Deepa; Weisman, Gary A.


    Alzheimer’s disease (AD) is the most common cause of dementia, affecting more than 10% of people over the age of 65. Age is the greatest risk factor for AD, although a combination of genetic, lifestyle and environmental factors also contribute to disease development. Common features of AD are the formation of plaques composed of beta-amyloid peptides (Aβ) and neuronal death in brain regions involved in learning and memory. Although Aβ is neurotoxic, the primary mechanisms by which Aβ affects AD development remain uncertain and controversial. Mouse models overexpressing amyloid precursor protein and Aβ have revealed that Aβ has potent effects on neuroinflammation and cerebral blood flow that contribute to AD progression. Therefore, it is important to consider how endogenous signaling in the brain responds to Aβ and contributes to AD pathology. In recent years, Aβ has been shown to affect ATP release from brain and blood cells and alter the expression of G protein-coupled P2Y receptors that respond to ATP and other nucleotides. Accumulating evidence reveals a prominent role for P2Y receptors in AD pathology, including Aβ production and elimination, neuroinflammation, neuronal function and cerebral blood flow. PMID:25179475

  14. Birefringence and band structure of CdP2 crystals

    NASA Astrophysics Data System (ADS)

    Beril, S. I.; Stamov, I. G.; Syrbu, N. N.; Zalamai, V. V.


    The spatial dispersion in CdP2 crystals was investigated. The dispersion is positive (nk||с>nk||у) at λ>λ0 and negative (nk||сP2 crystals are isotropic for wavelength λо=896 nm. Indirect transitions in excitonic region Еgx are nonpolarized due to one pair of bands. Minimal direct energy intervals correspond to transitions Г1→Г1 for Е||с and Г2→Г1 for Е⊥с. The temperature coefficient of energy gap sifting in the case of temperature changing between 2 and 4.2 K equals to 10.6 meV/K and 3.2 mev/K for Г1→Г1 and Г2→Г1 band gap correspondingly. Reflectivity spectra were measured for energy interval 1.5-10 eV and optical functions (n, k, ε1, ε2,d2ε1/dE2 and d2ε2/dE2) were calculated by using Kramers-Kronig analyses. All features were interpreted as optical transitions on the basis of both theoretical calculations of band structure.

  15. Functional analysis of a class I holin, P2 Y.


    To, Kam H; Dewey, Jill; Weaver, Jeremy; Park, Taehyun; Young, Ry


    Y is the putative holin gene of the paradigm coliphage P2 and encodes a 93-amino-acid protein. Y is predicted to be an integral membrane protein that adopts an N-out C-in membrane topology with 3 transmembrane domains (TMDs) and a highly charged C-terminal cytoplasmic tail. The same features are observed in the canonical class I lambda holin, the S105 protein of phage lambda, which controls lysis by forming holes in the plasma membrane at a programmed time. S105 has been the subject of intensive genetic, cellular, and biochemical analyses. Although Y is not related to S105 in its primary structure, its characterization might prove useful in discerning the essential traits for holin function. Here, we used physiological and genetic approaches to show that Y exhibits the essential holin functional criteria, namely, allele-specific delayed-onset lethality and sensitivity to the energization of the membrane. Taken together, these results suggest that class I holins share a set of unusual features that are needed for their remarkable ability to program the end of the phage infection cycle with precise timing. However, Y holin function requires the integrity of its short cytoplasmic C-terminal domain, unlike for S105. Finally, instead of encoding a second translational product of Y as an antiholin, as shown for lambda S107, the P2 lysis cassette encodes another predicted membrane protein, LysA, which is shown here to have a Y-specific antiholin character.

  16. Parameterization-based tracking for the P2 experiment

    NASA Astrophysics Data System (ADS)

    Sorokin, Iurii


    The P2 experiment in Mainz aims to determine the weak mixing angle θW at low momentum transfer by measuring the parity-violating asymmetry of elastic electronproton scattering. In order to achieve the intended precision of Δ(sin2 θW)/sin2θW = 0:13% within the planned 10 000 hours of running the experiment has to operate at the rate of 1011 detected electrons per second. Although it is not required to measure the kinematic parameters of each individual electron, every attempt is made to achieve the highest possible throughput in the track reconstruction chain. In the present work a parameterization-based track reconstruction method is described. It is a variation of track following, where the results of the computation-heavy steps, namely the propagation of a track to the further detector plane, and the fitting, are pre-calculated, and expressed in terms of parametric analytic functions. This makes the algorithm extremely fast, and well-suited for an implementation on an FPGA. The method also takes implicitly into account the actual phase space distribution of the tracks already at the stage of candidate construction. Compared to a simple algorithm, that does not use such information, this allows reducing the combinatorial background by many orders of magnitude, down to O(1) background candidate per one signal track. The method is developed specifically for the P2 experiment in Mainz, and the presented implementation is tightly coupled to the experimental conditions.

  17. Leukotriene B4 modulates P2X7 receptor-mediated Leishmania amazonensis elimination in murine macrophages.


    Chaves, Mariana M; Marques-da-Silva, Camila; Monteiro, Ana Paula T; Canetti, Cláudio; Coutinho-Silva, Robson


    ATP is an important signaling molecule in the immune system, and it is able to bind the P2X7 purinergic receptor. Recently, our group showed that ATP-treated macrophages eliminate Leishmania amazonensis. It has been reported that leukotriene B4 (LTB4) reduces the parasitic load of infected macrophages. Additionally, it has been demonstrated that the P2X7 receptor can induce PLA2 activation and arachidonic acid mobilization. Based on these findings, we investigated whether LTB4 is produced upon P2X7 receptor activation and examined whether LTB4 modulates parasite elimination. Using macrophages lacking the P2X7 receptor, we observed that ATP was not able to reduce L. amazonensis load. This result suggests a role of the P2X7 purinergic receptor in parasite elimination. In addition, ATP was sufficient to induce LTB4 release from infected control macrophages but not from macrophages lacking the P2X7 receptor. Moreover, we found that ATP failed to decrease the parasitic load in 5-lipoxygenase (LO)-deficient macrophages. Treatment with the 5-LO inhibitor AA861 also impairs the ATP effect on parasitic loads. Furthermore, macrophages from 5-LO knockout mice eliminated L. amazonensis in the presence of exogenous LTB4, and macrophages obtained from P2X7 receptor knockout mice eliminated L. amazonensis when incubated with ionomycin. Finally, we demonstrated that in the presence of CP105696, an antagonist for LTB4 high-affinity receptor, ATP was not able to reduce parasitic load. These results indicate that P2X7 receptor activation leads to LTB4 formation, which is required for L. amazonensis elimination.

  18. Molecular recognition of modified adenine nucleotides by the P2Y(1)-receptor. 1. A synthetic, biochemical, and NMR approach.


    Halbfinger, E; Major, D T; Ritzmann, M; Ubl, J; Reiser, G; Boyer, J L; Harden, K T; Fischer, B


    The remarkably high potencies of 2-thioether-adenine nucleotides regarding the activation of the P2Y(1)-receptor (P2Y(1)-R) in turkey erythrocyte membranes represent some of the largest substitution-promoted increases in potencies over that of a natural receptor ligand. This paper describes the investigation regarding the origin of the high potency of these P2Y(1)-R ligands over that of ATP. For this study, an integrated approach was employed combining the synthesis of new ATP analogues, their biochemical evaluation, and their SAR analysis involving NMR experiments and theoretical calculations. These experiments and calculations were performed to elucidate the conformation and to evaluate the electronic nature of the investigated P2Y(1)-R ligands. ATP analogues synthesized included derivatives where C2 or C8 positions were substituted with electron-donating groups such as ethers, thioethers, or amines. The compounds were tested for their potency to induce P2Y(1)-R-mediated activation of phospholipase C in turkey erythrocytes and Ca(2+) response in rat astrocytes. 8-Substituted ATP and AMP derivatives had little or no effect on phospholipase C or on calcium levels, whereas the corresponding 2-substituted ATP analogues potently increased the levels of inositol phosphates and ¿Ca(2+)(i). AMP analogues were ineffective except for 2-butylthio-AMP which induced a small Ca(2+) response. P2Y(1)-R activity of these compounds was demonstrated by testing these ligands also on NG108-15 neuroblastoma x glioma hybrid cells. NMR data together with theoretical calculations imply that steric, rather than electronic, effects play a major role in ligand binding to the P2Y(1)-R. Hydrophobic interactions and H-bonds of the C2 substituent appear to be important determinants of a P2Y(1)-R ligand affinity.

  19. Platelet collagen receptor integrin alpha2beta1 activation involves differential participation of ADP-receptor subtypes P2Y1 and P2Y12 but not intracellular calcium change.


    Jung, S M; Moroi, M


    In agonist-induced platelet activation, the collagen platelet receptor integrin alpha2beta1 is activated to high-affinity states through ADP involvement [Jung, S.M. & Moroi, M. (2000) J. Biol. Chem. 275, 8016-8026]. Here we determined the ADP-receptor subtypes involved and their relative contributions to alpha2beta1 activation (assessed by soluble-collagen binding) using the P2Y12 antagonist AR-C69931MX and P2Y1 antagonists adenosine 3',5'-diphosphate (Ado(3,5)PP) and adenosine 3'-phosphate 5'-phosphosulfate (AdoPPS). All three inhibited alpha2beta1 activation induced by low or high ADP, low thrombin, or low collagen-related peptide (CRP) concentrations; however, AR-C69931MX was markedly more inhibitory than the P2Y1 antagonists, suggesting the greater contribution of P2Y12. Inhibition patterns by various combinations of AR-C69931MX, AdoPPS, and wortmannin suggested that P2Y1 and P2Y12 mediate alpha2beta1 activation through different pathways, with possible involvement of phosphoinositide 3-kinase in both. Low concentrations of the acetoxy-methyl derivative of 1,2-bis(o-aminophenoxy) ethane-N,N,N',N'-tetra-acetic acid (calcium chelator) markedly decreased alpha2beta1 activation by low thrombin or CRP, but did not affect that by low or high ADP. Measurements of intracellular Ca2+ level (fluorimetric method) and alpha2beta1 activation (soluble-collagen binding) in the same platelet preparation indicated that alpha2beta1 activation via ADP receptors was independent of intracellular Ca2+ release. Our data indicate that integrin alpha2beta1 activation by ADP occurs through an inside-out signaling mechanism involving differential contributions by P2Y1 and P2Y12 wherein each contributes to some portion of the activation, with the stronger contribution of P2Y12. Furthermore, intracellular Ca2+ increase is not directly related to integrin alpha2beta1 activation, meaning that it is separate from the calcium mobilization pathways that these two ADP receptors are involved in.

  20. Conductance simulation of the purinergic P2X2, P2X4, and P2X7 ionic channels using a combined Brownian dynamics and molecular dynamics approach.


    Turchenkov, Dmitry A; Bystrov, Vladimir S


    This paper investigates the application of an original combined approach of molecular and Brownian dynamic methods with quantum chemistry calculations for modeling the process of conductance of ion channels using purinergic P2X family receptors P2X2, P2X4, and P2X7 as a case study. A simplified model of the ionic channel in the lipid bilayer has been developed. A high level of conductance (30 pS) of P2X2 ionic channel together with the key role of Asp349 in forming the selectivity filter of P2X2 has been shown by using this approach. Calculated P2X2 permeability to monovalent cations Li(+), Na(+), and K(+) conforms to the free diffusion coefficient of these ions, which shows the low selectivity of P2X2 ionic channel.

  1. Structure-Based Design of 3-(4-Aryl-1H-1,2,3-triazol-1-yl)-Biphenyl Derivatives as P2Y14 Receptor Antagonists

    PubMed Central


    UDP and UDP-glucose activate the P2Y14 receptor (P2Y14R) to modulate processes related to inflammation, diabetes, and asthma. A computational pipeline suggested alternatives to naphthalene of a previously reported P2Y14R antagonist (3, PPTN) using docking and molecular dynamics simulations on a hP2Y14R homology model based on P2Y12R structures. By reevaluating the binding of 3 to P2Y14R computationally, two alternatives, i.e., alkynyl and triazolyl derivatives, were identified. Improved synthesis of fluorescent antagonist 4 enabled affinity quantification (IC50s, nM) using flow cytometry of P2Y14R-expressing CHO cells. p-F3C-phenyl-triazole 65 (32) was more potent than a corresponding alkyne 11. Thus, additional triazolyl derivatives were prepared, as guided by docking simulations, with nonpolar aryl substituents favored. Although triazoles were less potent than 3 (6), simpler synthesis facilitated further structural optimization. Additionally, relative P2Y14R affinities agreed with predicted binding of alkynyl and triazole analogues. These triazoles, designed through a structure-based approach, can be assessed in disease models. PMID:27331270

  2. P2Y1, P2Y2, and TRPV1 Receptors Are Increased in Diarrhea-Predominant Irritable Bowel Syndrome and P2Y2 Correlates with Abdominal Pain.


    Luo, Yumei; Feng, Cheng; Wu, Jing; Wu, Yongxing; Liu, Dong; Wu, Jie; Dai, Fei; Zhang, Jun


    Previous studies indicated that P2Y1 and P2Y2 receptors, which are widely distributed in the enteric nervous system, are related to pain, while TRPV1 may contribute to visceral pain and hypersensitivity states in irritable bowel syndrome (IBS). Other studies showed that ATP activates the capsaicin-sensitive TRPV1 channel via P2Y receptors. To detect the expression of P2Y1, P2Y2, and TRPV1 receptors in diarrhea-predominant IBS (IBS-D) patients and analyze any correlations with abdominal pain and to investigate interactions between P2Y receptors and the TRPV1 receptor in IBS-D patients. Rectosigmoid biopsies were collected from patients with IBS-D (n = 36) and healthy controls (n = 15). Abdominal pain was scored using a 10-cm visual analogue scale. Expression levels of P2Y1, P2Y2, and TRPV1 receptors in rectosigmoid biopsies were determined by real-time PCR and double-labeling immunofluorescence with specific antibodies. Both mRNA and protein expression levels of P2Y1, P2Y2, and TRPV1 receptors were increased in IBS-D compared with controls. Of these receptors, P2Y2 expression correlated with the maximum pain scores (p = 0.02, r = 0.63, Spearman correlation) in IBS-D patients. However, no relationships were detected between P2Y receptors and the TRPV1 receptor. In the present study, we identified an increased expression of P2Y1 and P2Y2 receptors in the rectosigmoid mucosa of IBS-D patients, and P2Y2 correlated with abdominal pain. Furthermore, we identified an increase in TRPV1 expression; however, there were no correlations found between P2Y receptors and the TRPV1 receptor.

  3. Molecular recognition of agonists and antagonists by the nucleotide-activated G protein-coupled P2Y2 receptor.


    Rafehi, Muhammad; Neumann, Alexander; Baqi, Younis; Malik, Enas M; Wiese, Michael; Namasivayam, Vigneshwaran; Müller, Christa E


    A homology model of the nucleotide-activated P2Y2R was created based on the X-ray structures of the P2Y1 and P2Y12 receptors. Docking studies were performed, and receptor mutants were created to probe the identified binding interactions. Mutation of residues predicted to interact with the ribose (Arg110) and the phosphates of the nucleotide agonists (Arg265, Arg292) or that contribute indirectly to binding (Tyr288) abolished activity. The Y114F, R194A, and F261A mutations led to inactivity of diadenosine tetraphosphate and to a reduced response of UTP. Significant reduction in agonist potency was observed for all other receptor mutants (Phe111, His184, Ser193, Phe261, Tyr268, Tyr269) predicted to be involved in agonist recognition. An ionic lock between Asp185 and Arg292 that is probably involved in receptor activation interacts with the phosphate groups. The antagonist AR C118925 and anthraquinones likely bind to the orthosteric site. The updated homology models will be useful for virtual screening and drug design.

  4. P2P Approach for Web Services Publishing and Discovery

    NASA Astrophysics Data System (ADS)

    Islam, Mohmammad Towhidul; Akon, Mursalin; Shen, Xuemin (Sherman)

    Web service is an emerging paradigm for distributing business applications from different platforms to a wide variety of clients. The critical factor in seamlessly accessing web services is to discover the appropriate service and the related service providers. Unfortunately, current web service technologies use centralized directory to keep the service index, which is not scalable and at the same time vulnerable to single point of failure. Peer to peer system is a popular decentralized architecture which can be used for key look up service with scalability and self organization. Thus there is an opportunity to intersect the P2P framework with web services to provide the scalable solution. In this chapter, we discuss the key methods to deploy web services using the peer-to-peer technology.

  5. P2X7R is involved in the progression of atherosclerosis by promoting NLRP3 inflammasome activation

    PubMed Central



    Purinergic 2X7 receptor (P2X7R) and nucleotide-binding oligomerization domain-like receptor protein 3 (NLRP3) are expressed in macrophages in atherosclerotic lesions. However, the mechanisms through which P2X7R participates in the inflammatory response in atherosclerosis remain largely unknown. The aim of the present study was to investigate the role of P2X7R in atherosclerosis and the mechanisms of action of the NLRP3 inflammasome following stimulation with oxidized low-density lipoprotein (oxLDL). We observed the expression and distribution of P2X7R in the atherosclerotic plaque in the coronary arteries from an autopsy specimen and in that of the aortic sinuses of apoE−/− mice by immunohistochemistry and immunofluorescence staining. The specificity of short interfering RNA (siRNA) was used to suppress P2X7R and NLRP3 mRNA expression. RT-qPCR and western blot analysis were used to analyze mRNA and protein expression, respectively. Co-immunoprecipitation was used to examine the interaction between protein kinase R (PKR) phosphorylation and NLRP3. P2X7R and NLRP3 were expressed at high levels in the atherosclerotic plaque in the coronary arteries. Stimulation with oxLDL upregulated P2X7R, NLRP3 and interleukin (IL)-1β expression. P2X7R knockdown by siRNA suppressed NLRP3 inflammasome activation by inhibiting the PKR phosphorylation mediated by oxLDL. In the atherosclerotic lesions in the aortic sinuses of apoE−/− mice, P2X7R expression was found at high levels. Moreover, P2X7R siRNA attenuated the development of atherosclerosis in the apoE−/− mice. In conclusion, our results demonstrate that P2X7R plays a significant role in the development of atherosclerosis and regulates NLRP3 inflammasome activation by promoting PKR phosphorylation. PMID:25761252

  6. P2X receptors in cochlear Deiters' cells

    PubMed Central

    Chen, Chu; Bobbin, Richard P


    The ionotropic purinoceptors in isolated Deiters' cells of guinea-pig cochlea were characterized by use of the whole-cell variant of the patch-clamp technique.Extracellular application of adenosine 5′-triphosphate (ATP) induced a dose-dependent inward current when the cells were voltage-clamped at −80 mV. The ATP-induced current showed desensitization and had a reversal potential around −4 mV.Increasing intracellular free Ca2+ by decreasing the concentration of EGTA in the pipette solution reduced the amplitude of the ATP-gated current.The order of agonist potency was: 2-methylthioATP (2-meSATP)>ATP>benzoylbenzoyl-ATP (BzATP)>α,β-methyleneATP (α,β,meATP>adenosine 5′-diphosphate (ADP)>uridine 5′-triphosphate (UTP)>adenosine 5′-monophosphate (AMP)=adenosine (Ad).Pretreatment with forskolin (10 μM), 8-bromoadenosine-3′,5′-cyclophosphate (8-Br-cyclic AMP, 1 mM), 3-isobutyl-1-methylxanthine (IBMX, 1 mM) or phorbol-12-myristate-13-acetate (PMA, 1 μM) reversibly reduced the ATP-induced peak current.The results are consistent with molecular biological data which indicate that P2X2 purinoceptors are present in Deiters' cells. In addition, the reduction of the ATP-gated current by activators of protein kinase A and protein kinase C indicates that these P2X2 purinoceptors can be functionally modulated by receptor phosphorylation. PMID:9641551

  7. P2C-Type ATPases and Their Regulation.


    Retamales-Ortega, Rocío; Vio, Carlos P; Inestrosa, Nibaldo C


    P2C-type ATPases are a subfamily of P-type ATPases comprising Na(+)/K(+)-ATPase and H(+)/K(+)-ATPase. Na(+)/K(+)-ATPase is ubiquitously expressed and has been implicated in several neurological diseases, whereas H(+)/K(+)-ATPase is found principally in the colon, stomach, and kidney. Both ATPases have two subunits, α and β, but Na(+)/K(+)-ATPase also has a regulatory subunit called FXYD, which has an important role in cancer. The most important functions of these ATPases are homeostasis, potassium regulation, and maintaining a gradient in different cell types, like epithelial cells. Na(+)/K(+)-ATPase has become a center of attention ever since it was proposed that it might play a crucial role in neurological disorders such as bipolar disorder, mania, depression, familial hemiplegic migraine, rapid-onset dystonia parkinsonism, chronic stress, epileptogenesis, and Alzheimer's disease. On the other hand, it has been reported that lithium could have a neuroprotective effect against ouabain, which is the best known Na(+)/K(+)-ATPase inhibitor, but and high concentrations of lithium could affect negatively H(+)/K(+)-ATPase activity, that has a key role in regulating acidosis and potassium deficiencies. Finally, potassium homeostasis regulation is composed of two main mechanisms, extrarenal and renal. Extrarenal mechanism controls plasma levels, shifting potassium from the extracellular to the intracellular, whereas renal mechanism concerns with body balance and is influenced by potassium intake and its urinary excretion. In this article, we discuss the functions, isoforms, and localization of P2C-type ATPases, describe some of their modulators, and discuss their implications in some diseases.

  8. Functional Analysis of a Class I Holin, P2 Y

    PubMed Central

    To, Kam H.; Dewey, Jill; Weaver, Jeremy; Park, Taehyun


    Y is the putative holin gene of the paradigm coliphage P2 and encodes a 93-amino-acid protein. Y is predicted to be an integral membrane protein that adopts an N-out C-in membrane topology with 3 transmembrane domains (TMDs) and a highly charged C-terminal cytoplasmic tail. The same features are observed in the canonical class I lambda holin, the S105 protein of phage lambda, which controls lysis by forming holes in the plasma membrane at a programmed time. S105 has been the subject of intensive genetic, cellular, and biochemical analyses. Although Y is not related to S105 in its primary structure, its characterization might prove useful in discerning the essential traits for holin function. Here, we used physiological and genetic approaches to show that Y exhibits the essential holin functional criteria, namely, allele-specific delayed-onset lethality and sensitivity to the energization of the membrane. Taken together, these results suggest that class I holins share a set of unusual features that are needed for their remarkable ability to program the end of the phage infection cycle with precise timing. However, Y holin function requires the integrity of its short cytoplasmic C-terminal domain, unlike for S105. Finally, instead of encoding a second translational product of Y as an antiholin, as shown for lambda S107, the P2 lysis cassette encodes another predicted membrane protein, LysA, which is shown here to have a Y-specific antiholin character. PMID:23335412

  9. Expression of P2X3 and P2X 5 myenteric receptors varies during the intestinal postnatal development in the guinea pig.


    Loera-Valencia, Raúl; Jiménez-Vargas, Néstor N; Villalobos, Egina C; Juárez, Esri H; Lomas-Ramos, Telma Liliana; Espinosa-Luna, Rosa; Montaño, Luis M; Huizinga, Jan D; Barajas-López, Carlos


    P2X3 receptor expression in various tissues appears to be modulated by age. In the present study, we used single cell RT-PCR to determine the number of P2X3 positive myenteric neurons at different stages of guinea pig postnatal development, and we tested if similar changes also occur to other myenteric P2X receptors. Moreover, we carried out whole-cell recordings using Patch Clamp techniques to determine possible changes in P2X receptors sensitivity to ATP and α,β-methylene ATP (α,β-meATP) between newborn and adult animals. Our data indicate that P2X3 subunit transcripts are present in a larger number of myenteric neurons from newborn guinea pigs whereas P2X5 mRNA is found more frequently in adults. Expression of P2X2 and P2X4 transcripts does not change during postnatal development. In newborn animals, virtually all neurons expressing P2X3 also expressed P2X2 transcripts. This is important because these two subunits are known to form heteromeric channels. ATP potency to activate P2X receptors in neurons of both newborn and adult animals was the same. α,β-meATP, a known P2X3 receptor agonist, induces only a marginal current despite the fact of the higher presence of P2X3 subunits in newborns. These findings imply that P2X3 subunits are mainly forming heteromeric, α,β-meATP insensitive channels perhaps because P2X3 contributes with only one subunit to the heterotrimers while the other subunits could be P2X2, P2X4, or P2X5.

  10. Ent3p Is a PtdIns(3,5)P2 eff