Sample records for somatic cell cycle

  1. Non-stochastic reprogramming from a privileged somatic cell state

    PubMed Central

    Guo, Shangqin; Zi, Xiaoyuan; Schulz, Vincent P.; Cheng, Jijun; Zhong, Mei; Koochaki, Sebastian H.J.; Megyola, Cynthia M.; Pan, Xinghua; Heydari, Kartoosh; Weissman, Sherman M.; Gallagher, Patrick G.; Krause, Diane S.; Fan, Rong; Lu, Jun

    2014-01-01

    SUMMARY Reprogramming somatic cells to induced pluripotency by Yamanaka factors is usually slow and inefficient, and is thought to be a stochastic process. We identified a privileged somatic cell state, from which acquisition of pluripotency could occur in a non-stochastic manner. Subsets of murine hematopoietic progenitors are privileged, whose progeny cells predominantly adopt the pluripotent fate with activation of endogenous Oct4 locus after 4–5 divisions in reprogramming conditions. Privileged cells display an ultrafast cell cycle of ~8 hours. In fibroblasts, a subpopulation cycling at a similar ultrafast speed is observed after 6 days of factor expression, and is increased by p53-knockdown. This ultrafast-cycling population accounts for >99% of the bulk reprogramming activity in wildtype or p53-knockdown fibroblasts. Our data demonstrate that the stochastic nature of reprogramming can be overcome in a privileged somatic cell state, and suggest that cell cycle acceleration toward a critical threshold is an important bottleneck for reprogramming. PMID:24486105

  2. Birth of cloned mice from vaginal smear cells after somatic cell nuclear transfer.

    PubMed

    Kuwayama, Hiroki; Tanabe, Yoshiaki; Wakayama, Teruhiko; Kishigami, Satoshi

    2017-05-01

    Less invasive methods for donor cell collection will facilitate reproduction of wild animals using somatic-cell nuclear transfer. Stages of the estrous cycle in mice have long been studies using somatic cells that can be collected from vaginal walls using cotton tipped swabs in a relatively non-invasive manner. In this study, we examined the feasibility of these cells as sources of nuclei for somatic-cell cloning using nuclear transfer. Estrous cycles generally comprise proestrus, estrus, metestrus, and diestrus stages. In the present experiments, more than 60% of cells were nucleated in vaginal smears from all but the estrus stage. However, after somatic-cell nuclear transfer of cells from proestrus, metestrus, and diestrus stages, 66%, 50%, and 72% of cloned embryos developed to the morula/blastocyst, and cloned female mouse birth rates after embryo transfer were 1.5%, 0.3%, and 1%, respectively. These results show that noninvasively collected vaginal smears contain somatic cells that can be used to clone female mice. Copyright © 2017. Published by Elsevier Inc.

  3. Changes in cell-cycle kinetics responsible for limiting somatic growth in mice

    PubMed Central

    Chang, Maria; Parker, Elizabeth A.; Muller, Tessa J. M.; Haenen, Caroline; Mistry, Maanasi; Finkielstain, Gabriela P.; Murphy-Ryan, Maureen; Barnes, Kevin M.; Sundaram, Rajeshwari; Baron, Jeffrey

    2009-01-01

    In mammals, the rate of somatic growth is rapid in early postnatal life but then slows with age, approaching zero as the animal approaches adult body size. To investigate the underlying changes in cell-cycle kinetics, [methyl-3H]thymidine and 5’-bromo-2’deoxyuridine were used to double-label proliferating cells in 1-, 2-, and 3-week-old mice for four weeks. Proliferation of renal tubular epithelial cells and hepatocytes decreased with age. The average cell-cycle time did not increase in liver and increased only 1.7 fold in kidney. The fraction of cells in S-phase that will divide again declined approximately 10 fold with age. Concurrently, average cell area increased approximately 2 fold. The findings suggest that somatic growth deceleration primarily results not from an increase in cell-cycle time but from a decrease in growth fraction (fraction of cells that continue to proliferate). During the deceleration phase, cells appear to reach a proliferative limit and undergo their final cell divisions, staggered over time. Concomitantly, cells enlarge to a greater volume, perhaps because they are relieved of the size constraint imposed by cell division. In conclusion, a decline in growth fraction with age causes somatic growth deceleration and thus sets a fundamental limit on adult body size. PMID:18535488

  4. Factors affecting the development of somatic cell nuclear transfer embryos in Cattle.

    PubMed

    Akagi, Satoshi; Matsukawa, Kazutsugu; Takahashi, Seiya

    2014-01-01

    Nuclear transfer is a complex multistep procedure that includes oocyte maturation, cell cycle synchronization of donor cells, enucleation, cell fusion, oocyte activation and embryo culture. Therefore, many factors are believed to contribute to the success of embryo development following nuclear transfer. Numerous attempts to improve cloning efficiency have been conducted since the birth of the first sheep by somatic cell nuclear transfer. However, the efficiency of somatic cell cloning has remained low, and applications have been limited. In this review, we discuss some of the factors that affect the developmental ability of somatic cell nuclear transfer embryos in cattle.

  5. Factors Affecting the Development of Somatic Cell Nuclear Transfer Embryos in Cattle

    PubMed Central

    AKAGI, Satoshi; MATSUKAWA, Kazutsugu; TAKAHASHI, Seiya

    2014-01-01

    Nuclear transfer is a complex multistep procedure that includes oocyte maturation, cell cycle synchronization of donor cells, enucleation, cell fusion, oocyte activation and embryo culture. Therefore, many factors are believed to contribute to the success of embryo development following nuclear transfer. Numerous attempts to improve cloning efficiency have been conducted since the birth of the first sheep by somatic cell nuclear transfer. However, the efficiency of somatic cell cloning has remained low, and applications have been limited. In this review, we discuss some of the factors that affect the developmental ability of somatic cell nuclear transfer embryos in cattle. PMID:25341701

  6. Loss of l(3)mbt leads to acquisition of the ping-pong cycle in Drosophila ovarian somatic cells

    PubMed Central

    Sumiyoshi, Tetsutaro; Sato, Kaoru; Yamamoto, Hitomi; Iwasaki, Yuka W.; Siomi, Haruhiko; Siomi, Mikiko C.

    2016-01-01

    In Drosophila germ cells, PIWI-interacting RNAs (piRNAs) are amplified through a PIWI slicer-dependent feed-forward loop termed the ping-pong cycle, yielding secondary piRNAs. However, the detailed mechanism remains poorly understood, largely because an ex vivo model system amenable to biochemical analyses has not been available. Here, we show that CRISPR-mediated loss of function of lethal (3) malignant brain tumor [l(3)mbt] leads to ectopic activation of the germ-specific ping-pong cycle in ovarian somatic cells. Perinuclear foci resembling nuage, the ping-pong center, appeared following l(3)mbt mutation. This activation of the ping-pong machinery in cultured cells will greatly facilitate elucidation of the mechanism underlying secondary piRNA biogenesis in Drosophila. PMID:27474440

  7. A temporary immersion system improves in vitro regeneration of peach palm through secondary somatic embryogenesis

    PubMed Central

    Steinmacher, D. A.; Guerra, M. P.; Saare-Surminski, K.; Lieberei, R.

    2011-01-01

    Background and Aims Secondary somatic embryogenesis has been postulated to occur during induction of peach palm somatic embryogenesis. In the present study this morphogenetic pathway is described and a protocol for the establishment of cycling cultures using a temporary immersion system (TIS) is presented. Methods Zygotic embryos were used as explants, and induction of somatic embryogenesis and plantlet growth were compared in TIS and solid culture medium. Light microscopy, scanning electron microscopy (SEM) and transmission electron microscopy (TEM) were used to describe in vitro morphogenesis and accompany morpho-histological alterations during culture. Key Results The development of secondary somatic embryos occurs early during the induction of primary somatic embryos. Secondary somatic embryos were observed to develop continually in culture, resulting in non-synchronized development of these somatic embryos. Using these somatic embryos as explants allowed development of cycling cultures. Somatic embryos had high embryogenic potential (65·8 ± 3·0 to 86·2 ± 5·0 %) over the period tested. The use of a TIS greatly improved the number of somatic embryos obtained, as well as subsequent plantlet growth. Histological analyses showed that starch accumulation precedes the development of somatic embryos, and that these cells presented high nucleus/cytoplasm ratios and high mitotic indices, as evidenced by DAPI staining. Morphological and SEM observations revealed clusters of somatic embryos on one part of the explants, while other parts grew further, resulting in callus tissue. A multicellular origin of the secondary somatic embryos is hypothesized. Cells in the vicinity of callus accumulated large amounts of phenolic substances in their vacuoles. TEM revealed that these cells are metabolically very active, with the presence of numerous mitochondria and Golgi apparatuses. Light microscopy and TEM of the embryogenic sector revealed cells with numerous amyloplasts, large nuclei and nucleoli, and numerous plasmodesmata. Plantlets were obtained and after 3 months in culture their growth was significantly better in TIS than on solid culture medium. However, during acclimatization the survival rate of TIS-grown plantlets was lower. Conclusions The present study confirms the occurrence of secondary somatic embryos in peach palm and describes a feasible protocol for regeneration of peach palm in vitro. Further optimizations include the use of explants obtained from adult palms and improvement of somatic embryo conversion rates. PMID:21355009

  8. Keith's MAGIC: Cloning and the Cell Cycle.

    PubMed

    Wells, D N

    2013-10-01

    Abstract Professor Keith Campbell's critical contribution to the discovery that a somatic cell from an adult animal can be fully reprogrammed by oocyte factors to form a cloned individual following nuclear transfer (NT)(Wilmut et al., 1997 ) overturned a dogma concerning the reversibility of cell fate that many scientists had considered to be biologically impossible. This seminal experiment proved the totipotency of adult somatic nuclei and finally confirmed that adult cells could differentiate without irreversible changes to the genetic material.

  9. Prestin-based outer hair cell electromotility in knockin mice does not appear to adjust the operating point of a cilia-based amplifier

    PubMed Central

    Gao, Jiangang; Wang, Xiang; Wu, Xudong; Aguinaga, Sal; Huynh, Kristin; Jia, Shuping; Matsuda, Keiji; Patel, Manish; Zheng, Jing; Cheatham, MaryAnn; He, David Z.; Dallos, Peter; Zuo, Jian

    2007-01-01

    The remarkable sensitivity and frequency selectivity of the mammalian cochlea is attributed to a unique amplification process that resides in outer hair cells (OHCs). Although the mammalian-specific somatic motility is considered a substrate of cochlear amplification, it has also been proposed that somatic motility in mammals simply acts as an operating-point adjustment for the ubiquitous stereocilia-based amplifier. To address this issue, we created a mouse model in which a mutation (C1) was introduced into the OHC motor protein prestin, based on previous results in transfected cells. In C1/C1 knockin mice, localization of C1-prestin, as well as the length and number of OHCs, were all normal. In OHCs isolated from C1/C1 mice, nonlinear capacitance and somatic motility were both shifted toward hyperpolarization, so that, compared with WT controls, the amplitude of cycle-by-cycle (alternating, or AC) somatic motility remained the same, but the unidirectional (DC) component reversed polarity near the OHC's presumed in vivo resting membrane potential. No physiological defects in cochlear sensitivity or frequency selectivity were detected in C1/C1 or C1/+ mice. Hence, our results do not support the idea that OHC somatic motility adjusts the operating point of a stereocilia-based amplifier. However, they are consistent with the notion that the AC component of OHC somatic motility plays a dominant role in mammalian cochlear amplification. PMID:17640919

  10. Nuclear Reprogramming: Kinetics of Cell Cycle and Metabolic Progression as Determinants of Success

    PubMed Central

    Balbach, Sebastian Thomas; Esteves, Telma Cristina; Houghton, Franchesca Dawn; Siatkowski, Marcin; Pfeiffer, Martin Johannes; Tsurumi, Chizuko; Kanzler, Benoit; Fuellen, Georg; Boiani, Michele

    2012-01-01

    Establishment of totipotency after somatic cell nuclear transfer (NT) requires not only reprogramming of gene expression, but also conversion of the cell cycle from quiescence to the precisely timed sequence of embryonic cleavage. Inadequate adaptation of the somatic nucleus to the embryonic cell cycle regime may lay the foundation for NT embryo failure and their reported lower cell counts. We combined bright field and fluorescence imaging of histone H2b-GFP expressing mouse embryos, to record cell divisions up to the blastocyst stage. This allowed us to quantitatively analyze cleavage kinetics of cloned embryos and revealed an extended and inconstant duration of the second and third cell cycles compared to fertilized controls generated by intracytoplasmic sperm injection (ICSI). Compared to fertilized embryos, slow and fast cleaving NT embryos presented similar rates of errors in M phase, but were considerably less tolerant to mitotic errors and underwent cleavage arrest. Although NT embryos vary substantially in their speed of cell cycle progression, transcriptome analysis did not detect systematic differences between fast and slow NT embryos. Profiling of amino acid turnover during pre-implantation development revealed that NT embryos consume lower amounts of amino acids, in particular arginine, than fertilized embryos until morula stage. An increased arginine supplementation enhanced development to blastocyst and increased embryo cell numbers. We conclude that a cell cycle delay, which is independent of pluripotency marker reactivation, and metabolic restraints reduce cell counts of NT embryos and impede their development. PMID:22530006

  11. Frequent somatic transfer of mitochondrial DNA into the nuclear genome of human cancer cells.

    PubMed

    Ju, Young Seok; Tubio, Jose M C; Mifsud, William; Fu, Beiyuan; Davies, Helen R; Ramakrishna, Manasa; Li, Yilong; Yates, Lucy; Gundem, Gunes; Tarpey, Patrick S; Behjati, Sam; Papaemmanuil, Elli; Martin, Sancha; Fullam, Anthony; Gerstung, Moritz; Nangalia, Jyoti; Green, Anthony R; Caldas, Carlos; Borg, Åke; Tutt, Andrew; Lee, Ming Ta Michael; van't Veer, Laura J; Tan, Benita K T; Aparicio, Samuel; Span, Paul N; Martens, John W M; Knappskog, Stian; Vincent-Salomon, Anne; Børresen-Dale, Anne-Lise; Eyfjörd, Jórunn Erla; Myklebost, Ola; Flanagan, Adrienne M; Foster, Christopher; Neal, David E; Cooper, Colin; Eeles, Rosalind; Bova, Steven G; Lakhani, Sunil R; Desmedt, Christine; Thomas, Gilles; Richardson, Andrea L; Purdie, Colin A; Thompson, Alastair M; McDermott, Ultan; Yang, Fengtang; Nik-Zainal, Serena; Campbell, Peter J; Stratton, Michael R

    2015-06-01

    Mitochondrial genomes are separated from the nuclear genome for most of the cell cycle by the nuclear double membrane, intervening cytoplasm, and the mitochondrial double membrane. Despite these physical barriers, we show that somatically acquired mitochondrial-nuclear genome fusion sequences are present in cancer cells. Most occur in conjunction with intranuclear genomic rearrangements, and the features of the fusion fragments indicate that nonhomologous end joining and/or replication-dependent DNA double-strand break repair are the dominant mechanisms involved. Remarkably, mitochondrial-nuclear genome fusions occur at a similar rate per base pair of DNA as interchromosomal nuclear rearrangements, indicating the presence of a high frequency of contact between mitochondrial and nuclear DNA in some somatic cells. Transmission of mitochondrial DNA to the nuclear genome occurs in neoplastically transformed cells, but we do not exclude the possibility that some mitochondrial-nuclear DNA fusions observed in cancer occurred years earlier in normal somatic cells. © 2015 Ju et al.; Published by Cold Spring Harbor Laboratory Press.

  12. Frequent somatic transfer of mitochondrial DNA into the nuclear genome of human cancer cells

    PubMed Central

    Ju, Young Seok; Tubio, Jose M.C.; Mifsud, William; Fu, Beiyuan; Davies, Helen R.; Ramakrishna, Manasa; Li, Yilong; Yates, Lucy; Gundem, Gunes; Tarpey, Patrick S.; Behjati, Sam; Papaemmanuil, Elli; Martin, Sancha; Fullam, Anthony; Gerstung, Moritz; Nangalia, Jyoti; Green, Anthony R.; Caldas, Carlos; Borg, Åke; Tutt, Andrew; Lee, Ming Ta Michael; van't Veer, Laura J.; Tan, Benita K.T.; Aparicio, Samuel; Span, Paul N.; Martens, John W.M.; Knappskog, Stian; Vincent-Salomon, Anne; Børresen-Dale, Anne-Lise; Eyfjörd, Jórunn Erla; Flanagan, Adrienne M.; Foster, Christopher; Neal, David E.; Cooper, Colin; Eeles, Rosalind; Lakhani, Sunil R.; Desmedt, Christine; Thomas, Gilles; Richardson, Andrea L.; Purdie, Colin A.; Thompson, Alastair M.; McDermott, Ultan; Yang, Fengtang; Nik-Zainal, Serena; Campbell, Peter J.; Stratton, Michael R.

    2015-01-01

    Mitochondrial genomes are separated from the nuclear genome for most of the cell cycle by the nuclear double membrane, intervening cytoplasm, and the mitochondrial double membrane. Despite these physical barriers, we show that somatically acquired mitochondrial-nuclear genome fusion sequences are present in cancer cells. Most occur in conjunction with intranuclear genomic rearrangements, and the features of the fusion fragments indicate that nonhomologous end joining and/or replication-dependent DNA double-strand break repair are the dominant mechanisms involved. Remarkably, mitochondrial-nuclear genome fusions occur at a similar rate per base pair of DNA as interchromosomal nuclear rearrangements, indicating the presence of a high frequency of contact between mitochondrial and nuclear DNA in some somatic cells. Transmission of mitochondrial DNA to the nuclear genome occurs in neoplastically transformed cells, but we do not exclude the possibility that some mitochondrial-nuclear DNA fusions observed in cancer occurred years earlier in normal somatic cells. PMID:25963125

  13. Donor cell differentiation, reprogramming, and cloning efficiency: elusive or illusive correlation?

    PubMed

    Oback, B; Wells, D N

    2007-05-01

    Compared to other assisted reproductive technologies, mammalian nuclear transfer (NT) cloning is inefficient in generating viable offspring. It has been postulated that nuclear reprogramming and cloning efficiency can be increased by choosing less differentiated cell types as nuclear donors. This hypothesis is mainly supported by comparative mouse cloning experiments using early blastomeres, embryonic stem (ES) cells, and terminally differentiated somatic donor cells. We have re-evaluated these comparisons, taking into account different NT procedures, the use of donor cells from different genetic backgrounds, sex, cell cycle stages, and the lack of robust statistical significance when post-blastocyst development is compared. We argue that while the reprogrammability of early blastomeres appears to be much higher than that of somatic cells, it has so far not been conclusively determined whether differentiation status affects cloning efficiency within somatic donor cell lineages. Copyright (c) 2006 Wiley-Liss, Inc.

  14. Mps1 (Monopolar Spindle 1) Protein Inhibition Affects Cellular Growth and Pro-Embryogenic Masses Morphology in Embryogenic Cultures of Araucaria angustifolia (Araucariaceae).

    PubMed

    Douétts-Peres, Jackellinne C; Cruz, Marco Antônio L; Reis, Ricardo S; Heringer, Angelo S; de Oliveira, Eduardo A G; Elbl, Paula M; Floh, Eny I S; Silveira, Vanildo; Santa-Catarina, Claudete

    2016-01-01

    Somatic embryogenesis has been shown to be an efficient tool for studying processes based on cell growth and development. The fine regulation of the cell cycle is essential for proper embryo formation during the process of somatic embryogenesis. The aims of the present work were to identify and perform a structural and functional characterization of Mps1 and to analyze the effects of the inhibition of this protein on cellular growth and pro-embryogenic mass (PEM) morphology in embryogenic cultures of A. angustifolia. A single-copy Mps1 gene named AaMps1 was retrieved from the A. angustifolia transcriptome database, and through a mass spectrometry approach, AaMps1 was identified and quantified in embryogenic cultures. The Mps1 inhibitor SP600125 (10 μM) inhibited cellular growth and changed PEMs, and these effects were accompanied by a reduction in AaMps1 protein levels in embryogenic cultures. Our work has identified the Mps1 protein in a gymnosperm species for the first time, and we have shown that inhibiting Mps1 affects cellular growth and PEM differentiation during A. angustifolia somatic embryogenesis. These data will be useful for better understanding cell cycle control during somatic embryogenesis in plants.

  15. Mps1 (Monopolar Spindle 1) Protein Inhibition Affects Cellular Growth and Pro-Embryogenic Masses Morphology in Embryogenic Cultures of Araucaria angustifolia (Araucariaceae)

    PubMed Central

    Douétts-Peres, Jackellinne C.; Cruz, Marco Antônio L.; Reis, Ricardo S.; Heringer, Angelo S.; de Oliveira, Eduardo A. G.; Elbl, Paula M.; Floh, Eny I. S.; Silveira, Vanildo

    2016-01-01

    Somatic embryogenesis has been shown to be an efficient tool for studying processes based on cell growth and development. The fine regulation of the cell cycle is essential for proper embryo formation during the process of somatic embryogenesis. The aims of the present work were to identify and perform a structural and functional characterization of Mps1 and to analyze the effects of the inhibition of this protein on cellular growth and pro-embryogenic mass (PEM) morphology in embryogenic cultures of A. angustifolia. A single-copy Mps1 gene named AaMps1 was retrieved from the A. angustifolia transcriptome database, and through a mass spectrometry approach, AaMps1 was identified and quantified in embryogenic cultures. The Mps1 inhibitor SP600125 (10 μM) inhibited cellular growth and changed PEMs, and these effects were accompanied by a reduction in AaMps1 protein levels in embryogenic cultures. Our work has identified the Mps1 protein in a gymnosperm species for the first time, and we have shown that inhibiting Mps1 affects cellular growth and PEM differentiation during A. angustifolia somatic embryogenesis. These data will be useful for better understanding cell cycle control during somatic embryogenesis in plants. PMID:27064899

  16. Molecular Medicine II: Hormone Dependent Cancers

    DTIC Science & Technology

    2005-04-01

    multimode, live-cell videomicroscopy - we are analyzing the cycles of centrosome amplification in living S-phase arrested cells. Finally, we will directly...living cells by time-lapse multi-mode videomicroscopy . The key construct for our work is the generation of a mammalian somatic cell line stably expressing

  17. Chromatin remodeling in somatic cells injected into mature pig oocytes.

    PubMed

    Bui, Hong-Thuy; Van Thuan, Nguyen; Wakayama, Teruhiko; Miyano, Takashi

    2006-06-01

    We examined the involvement of histone H3 modifications in the chromosome condensation and decondensation of somatic cell nuclei injected into mature pig oocytes. Nuclei of pig granulosa cells were transferred into in vitro matured intact pig oocytes, and histone H3 phosphorylation, acetylation, and methylation were examined by immunostaining with specific antibodies in relation to changes in chromosome morphology. In the condensed chromosomes of pig oocytes at metaphase II, histone H3 was phosphorylated at serine 10 (H3-S10) and serine 28 (H3-S28), and methylated at lysine 9 (H3-K9), but was not acetylated at lysine 9, 14 and 18 (H3-K9, H3-K14 and H3-K18). During the first 2 h after nuclear transfer, a series of events were observed in the somatic nuclei: nuclear membrane disassembly; chromosome condensation to form a metaphase-like configuration; an increase in histone H3 phosphorylation levels (H3-S10 and H3-S28). Next, pig oocytes injected with nuclei of somatic cells were electroactivated and the chromosome morphology of oocytes and somatic cells was examined along with histone modifications. Generally, chromosomes of the somatic cells showed a similar progression of cell cycle stage to that of oocytes, through anaphase II- and telophase II-like stages then formed pronucleus-like structures, although the morphology of the spindles differed from that of oocyte spindles. The chromosomes of somatic cells also showed changes in histone H3 dephosphorylation and reacetylation, similar to oocytes. In contrast, histone H3 methylation (H3-K9) of somatic cell nuclei did not show any significant change after injection and electroactivation of the oocytes. These results suggest that nuclear remodeling including histone H3 phosphorylation and acetylation of injected somatic nuclei took place in the oocytes under regulation by the oocyte cytoplasm.

  18. Cell Cycle Regulates Nuclear Stability of AID and Determines the Cellular Response to AID

    PubMed Central

    Le, Quy; Maizels, Nancy

    2015-01-01

    AID (Activation Induced Deaminase) deaminates cytosines in DNA to initiate immunoglobulin gene diversification and to reprogram CpG methylation in early development. AID is potentially highly mutagenic, and it causes genomic instability evident as translocations in B cell malignancies. Here we show that AID is cell cycle regulated. By high content screening microscopy, we demonstrate that AID undergoes nuclear degradation more slowly in G1 phase than in S or G2-M phase, and that mutations that affect regulatory phosphorylation or catalytic activity can alter AID stability and abundance. We directly test the role of cell cycle regulation by fusing AID to tags that destabilize nuclear protein outside of G1 or S-G2/M phases. We show that enforced nuclear localization of AID in G1 phase accelerates somatic hypermutation and class switch recombination, and is well-tolerated; while nuclear AID compromises viability in S-G2/M phase cells. We identify AID derivatives that accelerate somatic hypermutation with minimal impact on viability, which will be useful tools for engineering genes and proteins by iterative mutagenesis and selection. Our results further suggest that use of cell cycle tags to regulate nuclear stability may be generally applicable to studying DNA repair and to engineering the genome. PMID:26355458

  19. Excessive Cellular Proliferation Negatively Impacts Reprogramming Efficiency of Human Fibroblasts

    PubMed Central

    Gupta, Manoj K.; Teo, Adrian Kee Keong; Rao, Tata Nageswara; Bhatt, Shweta; Kleinridders, Andre; Shirakawa, Jun; Takatani, Tomozumi; Hu, Jiang; De Jesus, Dario F.; Windmueller, Rebecca; Wagers, Amy J.

    2015-01-01

    The impact of somatic cell proliferation rate on induction of pluripotent stem cells remains controversial. Herein, we report that rapid proliferation of human somatic fibroblasts is detrimental to reprogramming efficiency when reprogrammed using a lentiviral vector expressing OCT4, SOX2, KLF4, and cMYC in insulin-rich defined medium. Human fibroblasts grown in this medium showed higher proliferation, enhanced expression of insulin signaling and cell cycle genes, and a switch from glycolytic to oxidative phosphorylation metabolism, but they displayed poor reprogramming efficiency compared with cells grown in normal medium. Thus, in contrast to previous studies, our work reveals an inverse correlation between the proliferation rate of somatic cells and reprogramming efficiency, and also suggests that upregulation of proteins in the growth factor signaling pathway limits the ability to induce pluripotency in human somatic fibroblasts. Significance The efficiency with which human cells can be reprogrammed is of interest to stem cell biology. In this study, human fibroblasts cultured in media containing different concentrations of growth factors such as insulin and insulin-like growth factor-1 exhibited variable abilities to proliferate, with consequences on pluripotency. This occurred in part because of changes in the expression of proteins involved in the growth factor signaling pathway, glycolysis, and oxidative phosphorylation. These findings have implications for efficient reprogramming of human cells. PMID:26253715

  20. Cell Cycle Regulation of Stem Cells by MicroRNAs.

    PubMed

    Mens, Michelle M J; Ghanbari, Mohsen

    2018-06-01

    MicroRNAs (miRNAs) are a class of small non-coding RNA molecules involved in the regulation of gene expression. They are involved in the fine-tuning of fundamental biological processes such as proliferation, differentiation, survival and apoptosis in many cell types. Emerging evidence suggests that miRNAs regulate critical pathways involved in stem cell function. Several miRNAs have been suggested to target transcripts that directly or indirectly coordinate the cell cycle progression of stem cells. Moreover, previous studies have shown that altered expression levels of miRNAs can contribute to pathological conditions, such as cancer, due to the loss of cell cycle regulation. However, the precise mechanism underlying miRNA-mediated regulation of cell cycle in stem cells is still incompletely understood. In this review, we discuss current knowledge of miRNAs regulatory role in cell cycle progression of stem cells. We describe how specific miRNAs may control cell cycle associated molecules and checkpoints in embryonic, somatic and cancer stem cells. We further outline how these miRNAs could be regulated to influence cell cycle progression in stem cells as a potential clinical application.

  1. Ovarian-Cell-Like Cells from Skin Stem Cells Restored Estradiol Production and Estrus Cycling in Ovariectomized Mice

    PubMed Central

    Park, Bong-Wook; Pan, Bo; Toms, Derek; Huynh, Evanna; Byun, June-Ho; Lee, Yeon-Mi; Shen, Wei

    2014-01-01

    Reduction of estradiol production and high serum concentrations of follicular stimulating hormone (FSH) are endocrine disorders associated with premature ovarian failure. Here, we report that transplantation of ovarian-like cells differentiated from stem cells restored endogenous serum estradiol levels. Stem cells were isolated from postnatal mouse skin and differentiated into ovarian-cell-like cells that are consistent with female germ, and ovarian follicle somatic cells. The ovarian-cell-like cells were transplanted into ovariectomized mice (Cell Trans), whereas control mice were subjected to bilateral ovariectomies without cell transplantation (OVX). Using vaginal cytology analysis, it was revealed that in 13 out of 19 Cell Trans mice, estrus cycles were restored around 8 weeks after cell transplantation and were maintained until 16 weeks post-transplantation, whereas in the OVX group, all mice were arrested at metestrus/diestrus of the estrus cycle. The uterine weight in the Cell Trans group was similar to sham operation mice (Sham OP), while severe uterine atrophy and a decreased uterine weight were observed in the OVX group. Histologically, ectopic follicle-like structures and blood vessels were found within and around the transplants. At 12–14 weeks after cell transplantation, mean serum estradiol level in Cell Trans mice (178.0±35 pg/mL) was comparable to that of the Sham OP group (188.9±29 pg/mL), whereas it was lower in the OVX group (59.0±4 pg/mL). Serum FSH concentration increased in the OVX group (1.62±0.32 ng/mL) compared with the Sham OP group (0.39±0.34 ng/mL). Cell Trans mice had a similar FSH level (0.94±0.23 ng/mL; P<0.05) to Sham OP mice. Our results suggest that ovarian somatic cells differentiated from stem cells are functional in vivo. In addition to providing insights into the function of ovarian somatic cells derived from stem cells, our study may offer potential therapeutic means for patients with hypo-estradiol levels like those encountered in premature ovarian failure. PMID:24593690

  2. Expression of the proliferation marker Ki-67 during early mouse development.

    PubMed

    Winking, H; Gerdes, J; Traut, W

    2004-01-01

    In somatic tissues, the mouse Ki-67 protein (pKi-67) is expressed in proliferating cells only. Depending on the stage of the cell cycle, pKi-67 is associated with different nuclear domains: with euchromatin as part of the perichromosomal layer, with centromeric heterochromatin, and with the nucleolus. In gametes, sex-specific expression is evident. Mature MII oocytes contain pKi-67, whereas pKi-67 is not detectable in mature sperm. We investigated the re-establishment of the cell cycle-dependent distribution of pKi-67 during early mouse development. After fertilization, male and female pronuclei exhibited very little or no pKi-67, while polar bodies were pKi-67 positive. Towards the end of the first cell cycle, prophase chromosomes of male and female pronuclei simultaneously got decorated with pKi-67. In 2-cell embryos, the distribution pattern changed, presumably depending on the progress of development of the embryo, from a distribution all over the nucleus to a preferential location in the nucleolus precursor bodies (NPBs). From the 4-cell stage onwards, pKi-67 showed the regular nuclear relocations known from somatic tissues: during mitosis the protein was found covering the chromosome arms as a constituent of the perichromosomal layer, in early G1 it was distributed in the whole nucleus, and for the rest of the cell cycle it was associated with NPBs or with the nucleolus. Copyright 2004 S. Karger AG, Basel

  3. Histone modifications in the male germ line of Drosophila.

    PubMed

    Hennig, Wolfgang; Weyrich, Alexandra

    2013-02-22

    In the male germ line of Drosophila chromatin remains decondensed and highly transcribed during meiotic prophase until it is rapidly compacted. A large proportion of the cell cycle-regulated histone H3.1 is replaced by H3.3, a histone variant encoded outside the histone repeat cluster and not subject to cell cycle controlled expression. We investigated histone modification patterns in testes of D. melanogaster and D. hydei. In somatic cells of the testis envelope and in germ cells these modification patterns differ from those typically seen in eu- and heterochromatin of other somatic cells. During the meiotic prophase some modifications expected in active chromatin are not found or are found at low level. The absence of H4K16ac suggests that dosage compensation does not take place. Certain histone modifications correspond to either the cell cycle-regulated histone H3.1 or to the testis-specific variant H3.3. In spermatogonia we found H3K9 methylation in cytoplasmic histones, most likely corresponding to the H3.3 histone variant. Most histone modifications persist throughout the meiotic divisions. The majority of modifications persist until the early spermatid nuclei, and only a minority further persist until the final chromatin compaction stages before individualization of the spermatozoa. Histone modification patterns in the male germ line differ from expected patterns. They are consistent with an absence of dosage compensation of the X chromosome during the male meiotic prophase. The cell cycle-regulated histone variant H3.1 and H3.3, expressed throughout the cell cycle, also vary in their modification patterns. Postmeiotically, we observed a highly complex pattern of the histone modifications until late spermatid nuclear elongation stages. This may be in part due to postmeiotic transcription and in part to differential histone replacement during chromatin condensation.

  4. Day-night cycles and the sleep-promoting factor, Sleepless, affect stem cell activity in the Drosophila testis.

    PubMed

    Tulina, Natalia M; Chen, Wen-Feng; Chen, Jung Hsuan; Sowcik, Mallory; Sehgal, Amita

    2014-02-25

    Adult stem cells maintain tissue integrity and function by renewing cellular content of the organism through regulated mitotic divisions. Previous studies showed that stem cell activity is affected by local, systemic, and environmental cues. Here, we explore a role of environmental day-night cycles in modulating cell cycle progression in populations of adult stem cells. Using a classic stem cell system, the Drosophila spermatogonial stem cell niche, we reveal daily rhythms in division frequencies of germ-line and somatic stem cells that act cooperatively to produce male gametes. We also examine whether behavioral sleep-wake cycles, which are driven by the environmental day-night cycles, regulate stem cell function. We find that flies lacking the sleep-promoting factor Sleepless, which maintains normal sleep in Drosophila, have increased germ-line stem cell (GSC) division rates, and this effect is mediated, in part, through a GABAergic signaling pathway. We suggest that alterations in sleep can influence the daily dynamics of GSC divisions.

  5. Reprogramming somatic cell differentiation and the Hayflick Limit: contrasting two modern molecular bioengineering aims and their impact on the future of mankind.

    PubMed

    Sills, E S; Takeuchi, T; Rosenwaks, Z; Palermo, G D

    2001-08-01

    The molecular biology of human cloning and aging research depend on the closely related laboratory techniques supported by a thorough understanding of cell-signaling processes. Unfortunately, the link between these two research fields has received only marginal attention in the lay press. Cloning is possible when somatic cell differentiation is successfully reprogrammed, and clinical control of cellular senescence depends on a proper reconfiguration of the predetermined number of divisions permitted during the cell life-cycle (the so-called "Hayflick Limit"). In this paper, we discuss these two concepts and compare the impact likely to be associated with bioengineering studies that facilitate both human cloning and longevity therapy.

  6. The Cell Cycle Timing of Centromeric Chromatin Assembly in Drosophila Meiosis Is Distinct from Mitosis Yet Requires CAL1 and CENP-C

    PubMed Central

    Gorgescu, Walter; Tang, Jonathan; Costes, Sylvain V.; Karpen, Gary H.

    2012-01-01

    CENP-A (CID in flies) is the histone H3 variant essential for centromere specification, kinetochore formation, and chromosome segregation during cell division. Recent studies have elucidated major cell cycle mechanisms and factors critical for CENP-A incorporation in mitosis, predominantly in cultured cells. However, we do not understand the roles, regulation, and cell cycle timing of CENP-A assembly in somatic tissues in multicellular organisms and in meiosis, the specialized cell division cycle that gives rise to haploid gametes. Here we investigate the timing and requirements for CID assembly in mitotic tissues and male and female meiosis in Drosophila melanogaster, using fixed and live imaging combined with genetic approaches. We find that CID assembly initiates at late telophase and continues during G1 phase in somatic tissues in the organism, later than the metaphase assembly observed in cultured cells. Furthermore, CID assembly occurs at two distinct cell cycle phases during male meiosis: prophase of meiosis I and after exit from meiosis II, in spermatids. CID assembly in prophase I is also conserved in female meiosis. Interestingly, we observe a novel decrease in CID levels after the end of meiosis I and before meiosis II, which correlates temporally with changes in kinetochore organization and orientation. We also demonstrate that CID is retained on mature sperm despite the gross chromatin remodeling that occurs during protamine exchange. Finally, we show that the centromere proteins CAL1 and CENP-C are both required for CID assembly in meiosis and normal progression through spermatogenesis. We conclude that the cell cycle timing of CID assembly in meiosis is different from mitosis and that the efficient propagation of CID through meiotic divisions and on sperm is likely to be important for centromere specification in the developing zygote. PMID:23300382

  7. Somatic cell nuclear transfer using transported in vitro-matured oocytes in cynomolgus monkey.

    PubMed

    Chen, N; Liow, S-L; Abdullah, R Bin; Embong, W Khadijah Wan; Yip, W-Y; Tan, L-G; Tong, G-Q; Ng, S-C

    2007-02-01

    Somatic cell nuclear transfer (SCNT) is not successful so far in non-human primates. The objective of this study was to investigate the effects of stimulation cycles (first and repeat) on oocyte retrieval and in vitro maturation (IVM) and to evaluate the effects of stimulation cycles and donor cell type (cumulus and fetal skin fibroblasts) on efficiency of SCNT with transported IVM oocytes. In this study, 369 immature oocytes were collected laparoscopically at 24 h following human chorionic gonadotrophin (hCG) treatment from 12 cynomolgus macaque (Macaca fascicularis) in 24 stimulation cycles, and shipped in pre-equilibrated IVM medium for a 5 h journey, placed in a dry portable incubator (37 degrees C) without CO(2) supplement. A total of 70.6% (247/350) of immature oocytes reached metaphase II (MII) stage at 36 h after hCG administration, MII spindle could be seen clearly in 80.6% (104/129) of matured IVM oocytes under polarized microscopy. A total of 50.0% (37/74) of reconstructive SCNT embryos cleaved after activation; after cleavage, 37.8% (14/37) developed to the 8-cell stage and 8.1% (3/37) developed to morula, but unfortunately none developed to the blastocyst stage. Many more oocytes could be retrieved per cycle from monkeys in the first cycle than in repeated cycles (19.1 vs. 11.7, p < 0.05). There were no significant differences in the maturation rate (70.0 vs. 71.4%, p > 0.05) and MII spindle rate under polarized microscopy (76.4 vs. 86.0%, p > 0.05) between the first and repeat cycles. There were also no significant differences in the cleavage rate, and the 4-cell, 8-cell and morula development rate of SCNT embryos between the first and repeat cycles. When fibroblast cells and cumulus cells were used as the donor cells for SCNT, first cleavage rate was not significantly different, but 4-cell (50.0 vs. 88.9%, p < 0.05) and 8-cell (0 vs. 51.9%, p < 0.01) development rate were significantly lower for the former. In conclusion, the number of stimulation cycles has a significant effect on oocyte retrieval, but has no effect on maturation and SCNT embryo development; however, different donor cell types (cumulus and fibroblast) resulted in different developmental potentials of SCNT embryos.

  8. DNMT1 maintains progenitor function in self-renewing somatic tissue.

    PubMed

    Sen, George L; Reuter, Jason A; Webster, Daniel E; Zhu, Lilly; Khavari, Paul A

    2010-01-28

    Progenitor cells maintain self-renewing tissues throughout life by sustaining their capacity for proliferation while suppressing cell cycle exit and terminal differentiation. DNA methylation provides a potential epigenetic mechanism for the cellular memory needed to preserve the somatic progenitor state through repeated cell divisions. DNA methyltransferase 1 (DNMT1) maintains DNA methylation patterns after cellular replication. Although dispensable for embryonic stem cell maintenance, the role for DNMT1 in maintaining the progenitor state in constantly replenished somatic tissues, such as mammalian epidermis, is unclear. Here we show that DNMT1 is essential for epidermal progenitor cell function. DNMT1 protein was found enriched in undifferentiated cells, where it was required to retain proliferative stamina and suppress differentiation. In tissue, DNMT1 depletion led to exit from the progenitor cell compartment, premature differentiation and eventual tissue loss. Genome-wide analysis showed that a significant portion of epidermal differentiation gene promoters were methylated in self-renewing conditions but were subsequently demethylated during differentiation. Furthermore, UHRF1 (refs 9, 10), a component of the DNA methylation machinery that targets DNMT1 to hemi-methylated DNA, is also necessary to suppress premature differentiation and sustain proliferation. In contrast, Gadd45A and B, which promote active DNA demethylation, are required for full epidermal differentiation gene induction. These data demonstrate that proteins involved in the dynamic regulation of DNA methylation patterns are required for progenitor maintenance and self-renewal in mammalian somatic tissue.

  9. Climbing Mount Efficiency--small steps, not giant leaps towards higher cloning success in farm animals.

    PubMed

    Oback, Björn

    2008-07-01

    Despite more than a decade of research efforts, farm animal cloning by somatic cell nuclear transfer (SCNT) is still frustratingly inefficient. Inefficiency manifests itself at different levels, which are currently not well integrated. At the molecular level, it leads to widespread genetic, epigenetic and transcriptional aberrations in cloned embryos. At the organismal level, these genome-wide abnormalities compromise development of cloned foetuses and offspring. Specific molecular defects need to be causally linked to specific cloned phenotypes, in order to design specific treatments to correct them. Cloning efficiency depends on the ability of the nuclear donor cell to be fully reprogrammed into an embryonic state and the ability of the enucleated recipient cell to carry out the reprogramming reactions. It has been postulated that reprogrammability of the somatic donor cell epigenome is influenced by its differentiation status. However, direct comparisons between cells of divergent differentiation status within several somatic lineages have found no conclusive evidence for this. Choosing somatic stem cells as donors has not improved cloning efficiency, indicating that donor cell type may be less critical for cloning success. Different recipient cells, on the other hand, vary in their reprogramming ability. In bovine, using zygotes instead of oocytes has increased cloning success. Other improvements in livestock cloning efficiency include better coordinating donor cell type with cell cycle stage and aggregating cloned embryos. In the future, it will be important to demonstrate if these small increases at every step are cumulative, adding up to an integrated cloning protocol with greatly improved efficiency.

  10. Technical note: Selection of suitable reference genes for studying gene expression in milk somatic cell of yak (Bos grunniens) during the lactation cycle.

    PubMed

    Bai, W L; Yin, R H; Zhao, S J; Jiang, W Q; Yin, R L; Ma, Z J; Wang, Z Y; Zhu, Y B; Luo, G B; Yang, R J; Zhao, Z H

    2014-02-01

    Quantitative real-time PCR is the most sensitive technique for gene expression analysis. Data normalization is essential to correct for potential errors incurred in all steps from RNA isolation to PCR amplification. The commonly accepted approach for normalization is the use of reference gene. Until now, no suitable reference genes have been available for data normalization of gene expression in milk somatic cells of lactating yaks across lactation. In the present study, we evaluated the transcriptional stability of 10 candidate reference genes in milk somatic cells of lactating yak, including ACTB, B2M, GAPDH, GTP, MRPL39, PPP1R11, RPS9, RPS15, UXT, and RN18S1. Four genes, RPS9, PPP1R11, UXT, and MRPL39, were identified as being the most stable genes in milk somatic cells of lactating yak. Using the combination of RPS9, PPP1R11, UXT, and MRPL39 as reference genes, we further assessed the relative expression of 4 genes of interest in milk somatic cells of yak across lactation, including ELF5, ABCG2, SREBF2, and DGAT1. Compared with expression in colostrum, the overall transcription levels of ELF5, ABCG2, and SREBF2 in milk were found to be significantly upregulated in early, peak, and late lactation, and significantly downregulated thereafter, before the dry period. A similar pattern was observed in the relative expression of DGAT1, but no significant difference was revealed in its expression in milk from late lactation compared with colostrum. Based on these results, we suggest that the geometric mean of RPS9, PPP1R11, UXT, and MRPL39 can be used for normalization of real-time PCR data in milk somatic cells of lactating yak, if similar experiments are performed. Copyright © 2014 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  11. DNMT1 Maintains Progenitor Function in Self-Renewing Somatic Tissue

    PubMed Central

    Sen, George L.; Reuter, Jason A.; Webster, Daniel E.; Zhu, Lilly; Khavari, Paul A.

    2010-01-01

    Progenitor cells maintain self-renewing tissues throughout life by sustaining their capacity for proliferation while suppressing cell cycle exit and terminal differentiation1,2. DNA methylation3,4,5 provides a potential epigenetic mechanism for the cellular memory needed to preserve the somatic progenitor state through repeated cell divisions. DNA methyltransferase 1 (DNMT1)6,7 maintains DNA methylation patterns after cellular replication. Although dispensable for embryonic stem cell maintenance,8 a clear role for DNMT1 in maintaining the progenitor state in constantly replenished somatic tissues, such as mammalian epidermis, is unknown. Here we show that DNMT1 is essential for epidermal progenitor cell function. DNMT1 protein was found enriched in undifferentiated cells, where it was required to retain proliferative stamina and suppress differentiation. In tissue, DNMT1 depletion led to exit from the progenitor cell compartment, premature differentiation and eventual tissue loss. Genome-wide analysis revealed that a significant portion of epidermal differentiation gene promoters were methylated in self-renewing conditions but were subsequently demethylated during differentiation. Furthermore, we show that UHRF1,9,10 a component of the DNA methylation machinery that targets DNMT1 to hemi-methylated DNA, is also necessary to suppress premature differentiation and sustain proliferation. In contrast, Gadd45A11,12 and B13, which promote active DNA demethylation, are required for full epidermal differentiation gene induction. These data demonstrate that proteins involved in the dynamic regulation of DNA methylation patterns are required for progenitor maintenance and self-renewal in mammalian somatic tissue. PMID:20081831

  12. P53 Suppression of Homologous Recombination and Tumorigenesis

    DTIC Science & Technology

    2013-07-01

    cell cycle [22] and is known to have an important role in responding to oxygen concentration, particularly hypoxia (,1% O2) [23] or hyperoxia (95% O2...appropriate oxygen tension for in vitro culture? Mol Hum Reprod 12: 653. 2. Csete M (2005) Oxygen in the cultivation of stem cells . Ann N Y Acad Sci 1049: 1...culture that were derived from somatic mesenchymal cells that display a reasonable level of clonality. Yet, given the highly proliferative nature

  13. Transcriptome Analysis of mRNA and miRNA in Somatic Embryos of Larix leptolepis Subjected to Hydrogen Treatment.

    PubMed

    Liu, Yali; Han, Suying; Ding, Xiangming; Li, Xinmin; Zhang, Lifeng; Li, Wanfeng; Xu, Haiyan; Li, Zhexin; Qi, Liwang

    2016-11-22

    Hydrogen is a therapeutic antioxidant that has been used extensively in clinical trials. It also acts as a bioactive molecule that can alleviate abiotic stress in plants. However, the biological effects of hydrogen in somatic embryos and the underlying molecular basis remain largely unknown. In this study, the morphological and physiological influence of exogenous H₂ treatment during somatic embryogenesis was characterized in Larix leptolepis Gordon. The results showed that exposure to hydrogen increased the proportions of active pro-embryogenic cells and normal somatic embryos. We sequenced mRNA and microRNA (miRNA) libraries to identify global transcriptome changes at different time points during H₂ treatment of larch pro-embryogenic masses (PEMs). A total of 45,393 mRNAs and 315 miRNAs were obtained. Among them, 4253 genes and 96 miRNAs were differentially expressed in the hydrogen-treated libraries compared with the control. Further, a large number of the differentially expressed mRNAs and miRNAs were related to reactive oxygen species (ROS) homeostasis and cell cycle regulation. We also identified 4399 potential target genes for 285 of the miRNAs. The differential expression data and the mRNA-miRNA interaction network described here provide new insights into the molecular mechanisms that determine the performance of PEMs exposed to H₂ during somatic embryogenesis.

  14. Transcriptome Analysis of mRNA and miRNA in Somatic Embryos of Larix leptolepis Subjected to Hydrogen Treatment

    PubMed Central

    Liu, Yali; Han, Suying; Ding, Xiangming; Li, Xinmin; Zhang, Lifeng; Li, Wanfeng; Xu, Haiyan; Li, Zhexin; Qi, Liwang

    2016-01-01

    Hydrogen is a therapeutic antioxidant that has been used extensively in clinical trials. It also acts as a bioactive molecule that can alleviate abiotic stress in plants. However, the biological effects of hydrogen in somatic embryos and the underlying molecular basis remain largely unknown. In this study, the morphological and physiological influence of exogenous H2 treatment during somatic embryogenesis was characterized in Larix leptolepis Gordon. The results showed that exposure to hydrogen increased the proportions of active pro-embryogenic cells and normal somatic embryos. We sequenced mRNA and microRNA (miRNA) libraries to identify global transcriptome changes at different time points during H2 treatment of larch pro-embryogenic masses (PEMs). A total of 45,393 mRNAs and 315 miRNAs were obtained. Among them, 4253 genes and 96 miRNAs were differentially expressed in the hydrogen-treated libraries compared with the control. Further, a large number of the differentially expressed mRNAs and miRNAs were related to reactive oxygen species (ROS) homeostasis and cell cycle regulation. We also identified 4399 potential target genes for 285 of the miRNAs. The differential expression data and the mRNA-miRNA interaction network described here provide new insights into the molecular mechanisms that determine the performance of PEMs exposed to H2 during somatic embryogenesis. PMID:27879674

  15. Genomic Copy Number Dictates a Gene-Independent Cell Response to CRISPR/Cas9 Targeting | Office of Cancer Genomics

    Cancer.gov

    The CRISPR/Cas9 system enables genome editing and somatic cell genetic screens in mammalian cells. We performed genome-scale loss-of-function screens in 33 cancer cell lines to identify genes essential for proliferation/survival and found a strong correlation between increased gene copy number and decreased cell viability after genome editing. Within regions of copy-number gain, CRISPR/Cas9 targeting of both expressed and unexpressed genes, as well as intergenic loci, led to significantly decreased cell proliferation through induction of a G2 cell-cycle arrest.

  16. Optimally achieving milk bulk tank somatic cell count thresholds.

    PubMed

    Troendle, Jason A; Tauer, Loren W; Gröhn, Yrjo T

    2017-01-01

    High somatic cell count in milk leads to reduced shelf life in fluid milk and lower processed yields in manufactured dairy products. As a result, farmers are often penalized for high bulk tank somatic cell count or paid a premium for low bulk tank somatic cell count. Many countries also require all milk from a farm to be lower than a specified regulated somatic cell count. Thus, farms often cull cows that have high somatic cell count to meet somatic cell count thresholds. Rather than naïvely cull the highest somatic cell count cows, a mathematical programming model was developed that determines the cows to be culled from the herd by maximizing the net present value of the herd, subject to meeting any specified bulk tank somatic cell count level. The model was applied to test-day cows on 2 New York State dairy farms. Results showed that the net present value of the herd was increased by using the model to meet the somatic cell count restriction compared with naïvely culling the highest somatic cell count cows. Implementation of the model would be straightforward in dairy management decision software. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  17. Somatic ACE regulates self-renewal of mouse spermatogonial stem cells via the MAPK signaling pathway.

    PubMed

    Gao, Tingting; Zhao, Xin; Liu, Chenchen; Shao, Binbin; Zhang, Xi; Li, Kai; Cai, Jinyang; Wang, Su; Huang, Xiaoyan

    2018-05-24

    Spermatogonial stem cell (SSC) self-renewal is an indispensable part of spermatogenesis. Angiotensin I-converting enzyme (ACE) is a zinc dipeptidyl carboxypeptidase that plays a critical role in regulation of the renin-angiotensin system. Here, we used RT-PCR and Western blot analysis to confirm that somatic ACE (sACE) but not testicular ACE (tACE) is highly expressed in mouse testis before postpartum day 7 and in cultured SSCs. Our results revealed that sACE is located on the membrane of SSCs. Treating cultured SSCs with the ACE competitive inhibitor captopril was found to inhibit sACE activity, and significantly reduced the proliferation rate of SSCs. Microarray analysis identified 651 genes with significant differential expression. KEGG pathway analysis showed that these differentially expressed genes are mainly involved in the mitogen-activated protein kinase (MAPK) signaling pathway and cell cycle. sACE was found to play an important role in SSC self-renewal via the regulation of MAPK-dependent cell proliferation.

  18. C. elegans MCM-4 is a general DNA replication and checkpoint component with an epidermis-specific requirement for growth and viability.

    PubMed

    Korzelius, Jerome; The, Inge; Ruijtenberg, Suzan; Portegijs, Vincent; Xu, Huihong; Horvitz, H Robert; van den Heuvel, Sander

    2011-02-15

    DNA replication and its connection to M phase restraint are studied extensively at the level of single cells but rarely in the context of a developing animal. C. elegans lin-6 mutants lack DNA synthesis in postembryonic somatic cell lineages, while entry into mitosis continues. These mutants grow slowly and either die during larval development or develop into sterile adults. We found that lin-6 corresponds to mcm-4 and encodes an evolutionarily conserved component of the MCM2-7 pre-RC and replicative helicase complex. The MCM-4 protein is expressed in all dividing cells during embryonic and postembryonic development and associates with chromatin in late anaphase. Induction of cell cycle entry and differentiation continues in developing mcm-4 larvae, even in cells that went through abortive division. In contrast to somatic cells in mcm-4 mutants, the gonad continues DNA replication and cell division until late larval development. Expression of MCM-4 in the epidermis (also known as hypodermis) is sufficient to rescue the growth retardation and lethality of mcm-4 mutants. While the somatic gonad and germline show substantial ability to cope with lack of zygotic mcm-4 function, mcm-4 is specifically required in the epidermis for growth and survival of the whole organism. Thus, C. elegans mcm-4 has conserved functions in DNA replication and replication checkpoint control but also shows unexpected tissue-specific requirements. Copyright © 2010 Elsevier Inc. All rights reserved.

  19. C. elegans MCM-4 is a general DNA replication and checkpoint component with an epidermis-specific requirement for growth and viability

    PubMed Central

    Korzelius, Jerome; The, Inge; Ruijtenberg, Suzan; Portegijs, Vincent; Xu, Huihong; Horvitz, H. Robert; van den Heuvel, Sander

    2012-01-01

    DNA replication and its connection to M phase restraint are studied extensively at the level of single cells but rarely in the context of a developing animal. C. elegans lin-6 mutants lack DNA synthesis in postembryonic somatic cell lineages, while entry into mitosis continues. These mutants grow slowly and either die during larval development or develop into sterile adults. We found that lin-6 corresponds to mcm-4 and encodes an evolutionarily conserved component of the MCM2-7 pre-RC and replicative helicase complex. The MCM-4 protein is expressed in all dividing cells during embryonic and postembryonic development and associates with chromatin in late anaphase. Induction of cell-cycle entry and differentiation continues in developing mcm-4 larvae, even in cells that went through abortive division. In contrast to somatic cells in mcm-4 mutants, the gonad continues DNA replication and cell division until late larval development. Expression of MCM-4 in the epidermis (also known as hypodermis) is sufficient to rescue the growth retardation and lethality of mcm-4 mutants. While the somatic gonad and germline show substantial ability to cope with lack of zygotic mcm-4 function, mcm-4 is specifically required in the epidermis for growth and survival of the whole organism. Thus, C. elegans mcm-4 has conserved functions in DNA replication and replication checkpoint control but also shows unexpected tissue-specific requirements. PMID:21146520

  20. Nuclear reprogramming by interphase cytoplasm of two-cell mouse embryos.

    PubMed

    Kang, Eunju; Wu, Guangming; Ma, Hong; Li, Ying; Tippner-Hedges, Rebecca; Tachibana, Masahito; Sparman, Michelle; Wolf, Don P; Schöler, Hans R; Mitalipov, Shoukhrat

    2014-05-01

    Successful mammalian cloning using somatic cell nuclear transfer (SCNT) into unfertilized, metaphase II (MII)-arrested oocytes attests to the cytoplasmic presence of reprogramming factors capable of inducing totipotency in somatic cell nuclei. However, these poorly defined maternal factors presumably decline sharply after fertilization, as the cytoplasm of pronuclear-stage zygotes is reportedly inactive. Recent evidence suggests that zygotic cytoplasm, if maintained at metaphase, can also support derivation of embryonic stem (ES) cells after SCNT, albeit at low efficiency. This led to the conclusion that critical oocyte reprogramming factors present in the metaphase but not in the interphase cytoplasm are 'trapped' inside the nucleus during interphase and effectively removed during enucleation. Here we investigated the presence of reprogramming activity in the cytoplasm of interphase two-cell mouse embryos (I2C). First, the presence of candidate reprogramming factors was documented in both intact and enucleated metaphase and interphase zygotes and two-cell embryos. Consequently, enucleation did not provide a likely explanation for the inability of interphase cytoplasm to induce reprogramming. Second, when we carefully synchronized the cell cycle stage between the transplanted nucleus (ES cell, fetal fibroblast or terminally differentiated cumulus cell) and the recipient I2C cytoplasm, the reconstructed SCNT embryos developed into blastocysts and ES cells capable of contributing to traditional germline and tetraploid chimaeras. Last, direct transfer of cloned embryos, reconstructed with ES cell nuclei, into recipients resulted in live offspring. Thus, the cytoplasm of I2C supports efficient reprogramming, with cell cycle synchronization between the donor nucleus and recipient cytoplasm as the most critical parameter determining success. The ability to use interphase cytoplasm in SCNT could aid efforts to generate autologous human ES cells for regenerative applications, as donated or discarded embryos are more accessible than unfertilized MII oocytes.

  1. Application of Somatic Embryogenesis in Woody Plants.

    PubMed Central

    Guan, Yuan; Li, Shui-Gen; Fan, Xiao-Fen; Su, Zhen-Hong

    2016-01-01

    Somatic embryogenesis is a developmental process where a plant somatic cell can dedifferentiate to a totipotent embryonic stem cell that has the ability to give rise to an embryo under appropriate conditions. This new embryo can further develop into a whole plant. In woody plants, somatic embryogenesis plays a critical role in clonal propagation and is a powerful tool for synthetic seed production, germplasm conservation, and cryopreservation. A key step in somatic embryogenesis is the transition of cell fate from a somatic cell to embryo cell. Although somatic embryogenesis has already been widely used in a number of woody species, propagating adult woody plants remains difficult. In this review, we focus on molecular mechanisms of somatic embryogenesis and its practical applications in economic woody plants. Furthermore, we propose a strategy to improve the process of somatic embryogenesis using molecular means. PMID:27446166

  2. Survival of ovarian somatic cells during sex change in the protogynous wrasse, Halichoeres trimaculatus.

    PubMed

    Nozu, Ryo; Horiguchi, Ryo; Murata, Ryosuke; Kobayashi, Yasuhisa; Nakamura, Masaru

    2013-02-01

    The three-spot wrasse (Halichoeres trimaculatus), which inhabits the coral reefs of Okinawa, changes sex from female to male. Sex change in this species is controlled by a social system. Oocytes disappear completely from the ovary, and male germ cells and somatic cells comprising testicular tissue arise a new during the sex change process. However, little is known of the fate and origin of the gonadal tissue-forming cells during sex change. In particular, the fate of ovarian somatic cells has not been determined, although the ovarian tissue regresses histologically. To approach this question, we analyzed apoptosis and cell proliferation in the sex-changing gonads. Unexpectedly, we found that few apoptotic somatic cells were present during sex change, suggesting that ovarian somatic cells might survive during the regression of the ovarian tissue. On the other hand, cell proliferation was detected in many granulosa cells surrounding the degenerating oocytes, a few epithelial cells covering ovigerous lamella and a few somatic cells associated with gonial germ cells at an early stage of sex change. Then, we found that proliferative ovarian somatic cells remained in the gonads late in the sex change process. Based on these results, we concluded that some functional somatic cells of the ovary are reused as testicular somatic cells during the gonadal sex change in the three-spot wrasse.

  3. Preimplantation development of somatic cell cloned embryos in the common marmoset (Callithrix jacchus).

    PubMed

    Sotomaru, Yusuke; Hirakawa, Reiko; Shimada, Akiko; Shiozawa, Seiji; Sugawara, Ayako; Oiwa, Ryo; Nobukiyo, Asako; Okano, Hideyuki; Tamaoki, Norikazu; Nomura, Tatsuji; Hiyama, Eiso; Sasaki, Erika

    2009-12-01

    The somatic cell nuclear transfer technique has been applied to various mammals to produce cloned animals; however, a standardized method is not applicable to all species. We aimed here to develop optimum procedures for somatic cell cloning in nonhuman primates, using common marmosets. First, we confirmed that parthenogenetic activation of in vitro matured oocytes was successfully induced by electrical stimulation (three cycles of 150 V/mm, 50 microsec x 2, 20 min intervals), and this condition was applied to the egg activation procedure in the subsequent experiments. Next, nuclear transfer to recipient enucleated oocytes was performed 1 h before, immediately after, or 1 h after egg activation treatment. The highest developmental rate was observed when nuclear transfer was performed 1 h before activation, but none of the cloned embryos developed beyond the eight-cell stage. To investigate the causes of the low developmental potential of cloned embryos, a study was performed to determine whether the presence of metaphase II (MII) chromosome in recipient ooplasm has an effect on developmental potential. As a result, only tetraploid cloned embryos produced by transferring a donor cell into a recipient bearing the MII chromosome developed into blastocysts (66.7%). In contrast, neither parthenogenetic embryos nor cloned embryos (whether diploid or tetraploid) produced using enucleated oocytes developed past the eight-cell stage. These results suggest that MII chromosome, or cytoplasm proximal to the MII chromosome, plays a major role in the development of cloned embryos in common marmosets.

  4. RNA-binding proteins ZFP36L1 and ZFP36L2 promote cell quiescence.

    PubMed

    Galloway, Alison; Saveliev, Alexander; Łukasiak, Sebastian; Hodson, Daniel J; Bolland, Daniel; Balmanno, Kathryn; Ahlfors, Helena; Monzón-Casanova, Elisa; Mannurita, Sara Ciullini; Bell, Lewis S; Andrews, Simon; Díaz-Muñoz, Manuel D; Cook, Simon J; Corcoran, Anne; Turner, Martin

    2016-04-22

    Progression through the stages of lymphocyte development requires coordination of the cell cycle. Such coordination ensures genomic integrity while cells somatically rearrange their antigen receptor genes [in a process called variable-diversity-joining (VDJ) recombination] and, upon successful rearrangement, expands the pools of progenitor lymphocytes. Here we show that in developing B lymphocytes, the RNA-binding proteins (RBPs) ZFP36L1 and ZFP36L2 are critical for maintaining quiescence before precursor B cell receptor (pre-BCR) expression and for reestablishing quiescence after pre-BCR-induced expansion. These RBPs suppress an evolutionarily conserved posttranscriptional regulon consisting of messenger RNAs whose protein products cooperatively promote transition into the S phase of the cell cycle. This mechanism promotes VDJ recombination and effective selection of cells expressing immunoglobulin-μ at the pre-BCR checkpoint. Copyright © 2016, American Association for the Advancement of Science.

  5. Production of cloned calves using roscovitine-treated adult somatic cells as donors.

    PubMed

    Miyoshi, Kazuchika; Arat, Sezen; Stice, Steven L

    2006-01-01

    The stage of the donor cell cycle is a major factor in the success of cloning. Quiescent cells arrested in the G0/G1 phases of the cell cycle by either serum starvation or growth arrest when cultured cells reach confluence have been used as donors to produce cloned animals. Recently, we have developed a novel and effective method using roscovitine to synchronize adult bovine granulosa cells in the G0/G1 cell cycle stage. The resulting fetal and calf survival after transfer of cloned embryos was enhanced in the roscovitine-treated group compared with serum-starved controls. The methods described in this chapter outline (1) the preparation of donor cells, (2) the preparation of recipient oocytes, and (3) the production of cloned embryos. The first section involves methods for the preparation of donor cell stocks from isolated granulosa cells and the roscovitine treatment of the cells before nuclear transfer. The second section explains procedures of in vitro maturation of recipient oocytes. The last section involves methods for the production of cell-oocyte complexes, the fusion of the complexes, and the activation, in vitro culture, and transfer into recipient females of cloned embryos.

  6. Maize histone H2B-mCherry: a new fluorescent chromatin marker for somatic and meiotic chromosome research.

    PubMed

    Howe, Elizabeth S; Clemente, Thomas E; Bass, Hank W

    2012-06-01

    Cytological studies of fluorescent proteins are rapidly yielding insights into chromatin structure and dynamics. Here we describe the production and cytological characterization of new transgenic maize lines expressing a fluorescent histone fusion protein, H2B-mCherry. The transgene is expressed under the control of the maize ubiquitin1 promoter, including its first exon and intron. Polymerase chain reaction-based genotyping and root-tip microscopy showed that most of the lines carrying the transgene also expressed it, producing bright uniform staining of nuclei. Further, plants showing expression in root tips at the seedling stage also showed expression during meiosis, late in the life cycle. Detailed high-resolution three-dimensional imaging of cells and nuclei from various somatic and meiotic cell types showed that H2B-mCherry produced remarkably clear images of chromatin and chromosome fiber morphology, as seen in somatic, male meiotic prophase, and early microgametophyte cells. H2B-mCherry also yielded distinct nucleolus staining and was shown to be compatible with fluorescence in situ hybridization. We found several instances where H2B-mCherry was superior to DAPI as a generalized chromatin stain. Our study establishes these histone H2B-mCherry lines as new biological reagents for visualizing chromatin structure, chromosome morphology, and nuclear dynamics in fixed and living cells in a model plant genetic system.

  7. Nuclear reprogramming: the strategy used in normal development is also used in somatic cell nuclear transfer and parthenogenesis.

    PubMed

    Gao, Tianlong; Zheng, Junke; Xing, Fengying; Fang, Haiyan; Sun, Feng; Yan, Ayong; Gong, Xun; Ding, Hui; Tang, Fan; Sheng, Hui Z

    2007-02-01

    Somatic cell nuclear transfer (SCNT) and parthenogenesis are alternative forms of reproduction and development, building new life cycles on differentiated somatic cell nuclei and duplicated maternal chromatin, respectively. In the preceding paper (Sun F, et al., Cell Res 2007; 17:117-134.), we showed that an "erase-and-rebuild" strategy is used in normal development to transform the maternal gene expression profile to a zygotic one. Here, we investigate if the same strategy also applies to SCNT and parthenogenesis. The relationship between chromatin and chromatin factors (CFs) during SCNT and parthenogenesis was examined using immunochemical and GFP-fusion protein assays. Results from these studies indicated that soon after nuclear transfer, a majority of CFs dissociated from somatic nuclei and were redistributed to the cytoplasm of the egg. The erasure process in oogenesis is recaptured during the initial phase in SCNT. Most CFs entered pseudo-pronuclei shortly after their formation. In parthenogenesis, all parthenogenotes underwent normal oogenesis, and thus had removed most CFs from chromosomes before the initiation of development. The CFs were subsequently re-associated with female pronuclei in time and sequence similar to that in fertilized embryos. Based on these data, we conclude that the "erase-and-rebuild" process observed in normal development also occurs in SCNT and in parthenogenesis, albeit in altered fashions. The process is responsible for transcription reprogramming in these procedures. The "erase" process in SCNT is compressed and the efficiency is compromised, which likely contribute to the developmental defects often observed in nuclear transfer (nt) embryos. Furthermore, results from this study indicated that the cytoplasm of an egg contains most, if not all, essential components for assembling the zygotic program and can assemble them onto appropriate diploid chromatin of distinct origins.

  8. Targeted Exome Sequencing of Krebs Cycle Genes Reveals Candidate Cancer-Predisposing Mutations in Pheochromocytomas and Paragangliomas.

    PubMed

    Remacha, Laura; Comino-Méndez, Iñaki; Richter, Susan; Contreras, Laura; Currás-Freixes, María; Pita, Guillermo; Letón, Rocío; Galarreta, Antonio; Torres-Pérez, Rafael; Honrado, Emiliano; Jiménez, Scherezade; Maestre, Lorena; Moran, Sebastian; Esteller, Manel; Satrústegui, Jorgina; Eisenhofer, Graeme; Robledo, Mercedes; Cascón, Alberto

    2017-10-15

    Purpose: Mutations in Krebs cycle genes are frequently found in patients with pheochromocytomas/paragangliomas. Disruption of SDH, FH or MDH2 enzymatic activities lead to accumulation of specific metabolites, which give rise to epigenetic changes in the genome that cause a characteristic hypermethylated phenotype. Tumors showing this phenotype, but no alterations in the known predisposing genes, could harbor mutations in other Krebs cycle genes. Experimental Design: We used downregulation and methylation of RBP1, as a marker of a hypermethylation phenotype, to select eleven pheochromocytomas and paragangliomas for targeted exome sequencing of a panel of Krebs cycle-related genes. Methylation profiling, metabolite assessment and additional analyses were also performed in selected cases. Results: One of the 11 tumors was found to carry a known cancer-predisposing somatic mutation in IDH1 A variant in GOT2 , c.357A>T, found in a patient with multiple tumors, was associated with higher tumor mRNA and protein expression levels, increased GOT2 enzymatic activity in lymphoblastic cells, and altered metabolite ratios both in tumors and in GOT2 knockdown HeLa cells transfected with the variant. Array methylation-based analysis uncovered a somatic epigenetic mutation in SDHC in a patient with multiple pheochromocytomas and a gastrointestinal stromal tumor. Finally, a truncating germline IDH3B mutation was found in a patient with a single paraganglioma showing an altered α-ketoglutarate/isocitrate ratio. Conclusions: This study further attests to the relevance of the Krebs cycle in the development of PCC and PGL, and points to a potential role of other metabolic enzymes involved in metabolite exchange between mitochondria and cytosol. Clin Cancer Res; 23(20); 6315-24. ©2017 AACR . ©2017 American Association for Cancer Research.

  9. Identification of somatic mutations in EGFR/KRAS/ALK-negative lung adenocarcinoma in never-smokers

    PubMed Central

    2014-01-01

    Background Lung adenocarcinoma is a highly heterogeneous disease with various etiologies, prognoses, and responses to therapy. Although genome-scale characterization of lung adenocarcinoma has been performed, a comprehensive somatic mutation analysis of EGFR/KRAS/ALK-negative lung adenocarcinoma in never-smokers has not been conducted. Methods We analyzed whole exome sequencing data from 16 EGFR/KRAS/ALK-negative lung adenocarcinomas and additional 54 tumors in two expansion cohort sets. Candidate loci were validated by target capture and Sanger sequencing. Gene set analysis was performed using Ingenuity Pathway Analysis. Results We identified 27 genes potentially implicated in the pathogenesis of lung adenocarcinoma. These included targetable genes involved in PI3K/mTOR signaling (TSC1, PIK3CA, AKT2) and receptor tyrosine kinase signaling (ERBB4) and genes not previously highlighted in lung adenocarcinomas, such as SETD2 and PBRM1 (chromatin remodeling), CHEK2 and CDC27 (cell cycle), CUL3 and SOD2 (oxidative stress), and CSMD3 and TFG (immune response). In the expansion cohort (N = 70), TP53 was the most frequently altered gene (11%), followed by SETD2 (6%), CSMD3 (6%), ERBB2 (6%), and CDH10 (4%). In pathway analysis, the majority of altered genes were involved in cell cycle/DNA repair (P <0.001) and cAMP-dependent protein kinase signaling (P <0.001). Conclusions The genomic makeup of EGFR/KRAS/ALK-negative lung adenocarcinomas in never-smokers is remarkably diverse. Genes involved in cell cycle regulation/DNA repair are implicated in tumorigenesis and represent potential therapeutic targets. PMID:24576404

  10. Reprogramming of Somatic Cells Towards Pluripotency by Cell Fusion.

    PubMed

    Malinowski, Andrzej R; Fisher, Amanda G

    2016-01-01

    Pluripotent reprogramming can be dominantly induced in a somatic nucleus upon fusion with a pluripotent cell such as embryonic stem (ES) cell. Cell fusion between ES cells and somatic cells results in the formation of heterokaryons, in which the somatic nuclei begin to acquire features of the pluripotent partner. The generation of interspecies heterokaryons between mouse ES- and human somatic cells allows an experimenter to distinguish the nuclear events occurring specifically within the reprogrammed nucleus. Therefore, cell fusion provides a simple and rapid approach to look at the early nuclear events underlying pluripotent reprogramming. Here, we describe a polyethylene glycol (PEG)-mediated cell fusion protocol to generate interspecies heterokaryons and intraspecies hybrids between ES cells and B lymphocytes or fibroblasts.

  11. Novel APC gene mutations associated with protein alteration in diffuse type gastric cancer.

    PubMed

    Ghatak, Souvik; Chakraborty, Payel; Sarkar, Sandeep Roy; Chowdhury, Biswajit; Bhaumik, Arup; Kumar, Nachimuthu Senthil

    2017-06-02

    The role of adenomatous polyposis coli (APC) gene in mitosis might be critical for regulation of genomic stability and chromosome segregation. APC gene mutations have been associated to have a role in colon cancer and since gastric and colon tumors share some common genetic lesions, it is relevant to investigate the role of APC tumor suppressor gene in gastric cancer. We investigated for somatic mutations in the Exons 14 and 15 of APC gene from 40 diffuse type gastric cancersamples. Rabbit polyclonal anti-APC antibody was used, which detects the wild-type APC protein and was recommended for detection of the respective protein in human tissues. Cell cycle analysis was done from tumor and adjacent normal tissue. APC immunoreactivity showed positive expression of the protein in stages I, II, III and negative expression in Stages III and IV. Two novel deleterious variations (g.127576C > A, g.127583C > T) in exon 14 sequence were found to generate stop codon (Y622* and Q625*)in the tumor samples. Due to the generation of stop codon, the APC protein might be truncated and all the regulatory features could be lost which has led to the down-regulation of protein expression. Our results indicate that aneuploidy might occurdue to the codon 622 and 625 APC-driven gastric tumorigenesis, in agreement with our cell cycle analysis. The APC gene function in mitosis and chromosomal stability might be lost and G1 might be arrested with high quantity of DNA in the S phase. Six missense somatic mutations in tumor samples were detected in exon 15 A-B, twoof which showed pathological and disease causing effects based on SIFT, Polyphen2 and SNPs & GO score and were not previously reported in the literature or the public mutation databases. The two novel pathological somatic mutations (g.127576C > A, g.127583C > T) in exon 14 might be altering the protein expression leading to development of gastric cancer in the study population. Our study showed that mutations in the APC gene alter the protein expression and cell cycle regulation in diffuse type gastric adenocarcinoma.

  12. A microdroplet cell culture based high frequency somatic embryogenesis system for pigeonpea, Cajanus cajan (L.) Millsp.

    PubMed

    Kumar, Nagan Udhaya; Gnanaraj, Muniraj; Sindhujaa, Vajravel; Viji, Maluventhen; Manoharan, Kumariah

    2015-09-01

    A protocol for high frequency production of somatic embryos was worked out in pigeonpea, Cajanus cajan (L.) Millsp. The protocol involved sequential employment of embryogenic callus cultures, low density cell suspension cultures and a novel microdroplet cell culture system. The microdroplet cell cultures involved culture of a single cell in 10 μI of Murashige and Skoog's medium supplemented with phytohormones, growth factors and phospholipid precursors. By employing the microdroplet cell cultures, single cells in isolation were grown into cell clones which developed somatic embryos. Further, 2,4-dichlorophenoxyacetic acid, kinetin, polyethylene glycol, putrescine, spermine, spermidine, choline chloride, ethanolamine and LiCl were supplemented to the low density cell suspension cultures and microdroplet cell cultures to screen for their cell division and somatic embryogenesis activity. Incubation of callus or the inoculum employed for low density cell suspension cultures and microdroplet cell cultures with polyethylene glycol was found critical for induction of somatic embryogenesis. Somatic embryogenesis at a frequency of 1.19, 3.16 and 6.51 per 10(6) cells was achieved in the callus, low density cell suspension cultures and microdroplet cell cultures, respectively. Advantages of employing microdroplet cell cultures for high frequency production of somatic embryos and its application in genetic transformation protocols are discussed.

  13. Persistent induction of somatic reversions of the pink-eyed unstable mutation in F1 mice born to fathers irradiated at the spermatozoa stage.

    PubMed

    Shiraishi, Kazunori; Shimura, Tsutomu; Taga, Masataka; Uematsu, Norio; Gondo, Yoichi; Ohtaki, Megu; Kominami, Ryo; Niwa, Ohtsura

    2002-06-01

    Untargeted mutation and delayed mutation are features of radiation-induced genomic instability and have been studied extensively in tissue culture cells. The mouse pink-eyed unstable (p(un)) mutation is due to an intragenic duplication of the pink-eyed dilution locus and frequently reverts back to the wild type in germ cells as well as in somatic cells. The reversion event can be detected in the retinal pigment epithelium as a cluster of pigmented cells (eye spot). We have investigated the reversion p(um) in F1 mice born to irradiated males. Spermatogonia-stage irradiation did not affect the frequency of the reversion in F1 mice. However, 6 Gy irradiation at the spermatozoa stage resulted in an approximately twofold increase in the number of eye spots in the retinal pigment epithelium of F1 mice. Somatic reversion occurred for the paternally derived p(un) alleles. In addition, the reversion also occurred for the maternally derived, unirradiated p(un) alleles at a frequency equal to that for the paternally derived allele. Detailed analyses of the number of pigmented cells per eye spot indicated that the frequency of reversion was persistently elevated during the proliferation cycle of the cells in the retinal pigment epithelium when the male parents were irradiated at the spermatozoa stage. The present study demonstrates the presence of a long-lasting memory of DNA damage and the persistent up-regulation of recombinogenic activity in the retinal pigment epithelium of the developing fetus.

  14. Effects of donor cell type and genotype on the efficiency of mouse somatic cell cloning.

    PubMed

    Inoue, Kimiko; Ogonuki, Narumi; Mochida, Keiji; Yamamoto, Yoshie; Takano, Kaoru; Kohda, Takashi; Ishino, Fumitoshi; Ogura, Atsuo

    2003-10-01

    Although it is widely assumed that the cell type and genotype of the donor cell affect the efficiency of somatic cell cloning, little systematic analysis has been done to verify this assumption. The present study was undertaken to examine whether donor cell type, donor genotype, or a combination thereof increased the efficiency of mouse cloning. Initially we assessed the developmental ability of embryos that were cloned from cumulus or immature Sertoli cells with six different genotypes (i.e., 2 x 6 factorial). Significantly better cleavage rates were obtained with cumulus cells than with Sertoli cells (P < 0.005, two-way ANOVA), which probably was due to the superior cell-cycle synchrony of cumulus cells at G0/G1. After embryo transfer, there was a significant effect of cell type on the birth rate, with Sertoli cells giving the better result (P < 0.005). Furthermore, there was a significant interaction (P < 0.05) between the cell type and genotype, which indicates that cloning efficiency is determined by a combination of these two factors. The highest mean birth rate (10.8 +/- 2.1%) was obtained with (B6 x 129)F1 Sertoli cells. In the second series of experiments, we examined whether the developmental ability of clones with the wild-type genotype (JF1) was improved when combined with the 129 genotype. Normal pups were cloned from cumulus and immature Sertoli cells of the (129 x JF1)F1 and (JF1 x 129)F1 genotypes, whereas no pups were born from cells with the (B6 x JF1)F1 genotype. The present study clearly demonstrates that the efficiency of somatic cell cloning, and in particular fetal survival after embryo transfer, may be improved significantly by choosing the appropriate combinations of cell type and genotype.

  15. Recent advancements in cloning by somatic cell nuclear transfer.

    PubMed

    Ogura, Atsuo; Inoue, Kimiko; Wakayama, Teruhiko

    2013-01-05

    Somatic cell nuclear transfer (SCNT) cloning is the sole reproductive engineering technology that endows the somatic cell genome with totipotency. Since the first report on the birth of a cloned sheep from adult somatic cells in 1997, many technical improvements in SCNT have been made by using different epigenetic approaches, including enhancement of the levels of histone acetylation in the chromatin of the reconstructed embryos. Although it will take a considerable time before we fully understand the nature of genomic programming and totipotency, we may expect that somatic cell cloning technology will soon become broadly applicable to practical purposes, including medicine, pharmaceutical manufacturing and agriculture. Here we review recent progress in somatic cell cloning, with a special emphasis on epigenetic studies using the laboratory mouse as a model.

  16. Recent advancements in cloning by somatic cell nuclear transfer

    PubMed Central

    Ogura, Atsuo; Inoue, Kimiko; Wakayama, Teruhiko

    2013-01-01

    Somatic cell nuclear transfer (SCNT) cloning is the sole reproductive engineering technology that endows the somatic cell genome with totipotency. Since the first report on the birth of a cloned sheep from adult somatic cells in 1997, many technical improvements in SCNT have been made by using different epigenetic approaches, including enhancement of the levels of histone acetylation in the chromatin of the reconstructed embryos. Although it will take a considerable time before we fully understand the nature of genomic programming and totipotency, we may expect that somatic cell cloning technology will soon become broadly applicable to practical purposes, including medicine, pharmaceutical manufacturing and agriculture. Here we review recent progress in somatic cell cloning, with a special emphasis on epigenetic studies using the laboratory mouse as a model. PMID:23166393

  17. Piezo- and Flexoelectric Membrane Materials Underlie Fast Biological Motors in the Ear

    PubMed Central

    Breneman, Kathryn D.; Rabbitt, Richard D.

    2010-01-01

    The mammalian inner ear is remarkably sensitive to quiet sounds, exhibits over 100dB dynamic range, and has the exquisite ability to discriminate closely spaced tones even in the presence of noise. This performance is achieved, in part, through active mechanical amplification of vibrations by sensory hair cells within the inner ear. All hair cells are endowed with a bundle of motile microvilli, stereocilia, located at the apical end of the cell, and the more specialized outer hair cells (OHC’s) are also endowed with somatic electromotility responsible for changes in cell length in response to perturbations in membrane potential. Both hair bundle and somatic motors are known to feed energy into the mechanical vibrations in the inner ear. The biophysical origin and relative significance of the motors remains a subject of intense research. Several biological motors have been identified in hair cells that might underlie the motor(s), including a cousin of the classical ATP driven actin-myosin motor found in skeletal muscle. Hydrolysis of ATP, however, is much too slow to be viable at audio frequencies on a cycle-by-cycle basis. Heuristically, the OHC somatic motor behaves as if the OHC lateral wall membrane were a piezoelectric material and the hair bundle motor behaves as if the plasma membrane were a flexoelectric material. We propose these observations from a continuum materials perspective are literally true. To examine this idea, we formulated mathematical models of the OHC lateral wall “piezoelectric” motor and the more ubiquitous “flexoelectric” hair bundle motor. Plausible biophysical mechanisms underlying piezo- and flexoelectricity were established. Model predictions were compared extensively to the available data. The models were then applied to study the power conversion efficiency of the motors. Results show that the material properties of the complex membranes in hair cells provide them with the ability to convert electrical power available in the inner ear cochlea into useful mechanical amplification of sound induced vibrations at auditory frequencies. We also examined how hair cell amplification might be controlled by the brain through efferent synaptic contacts on hair cells and found a simple mechanism to tune hearing to signals of interest to the listener by electrical control of these motors. PMID:21188296

  18. Photoperiod length paces the temporal orchestration of cell cycle and carbon-nitrogen metabolism in Crocosphaera watsonii.

    PubMed

    Dron, Anthony; Rabouille, Sophie; Claquin, Pascal; Talec, Amélie; Raimbault, Virginie; Sciandra, Antoine

    2013-12-01

    We analysed the effect of photoperiod length (PPL) (16:8 and 8:16 h of light-dark regime, named long and short PPL, respectively) on the temporal orchestration of the two antagonistic, carbon and nitrogen acquisitions in the unicellular, diazotrophic cyanobacterium Crocosphaera watsonii strain WH8501 growing diazotrophically. Carbon and nitrogen metabolism were monitored at high frequency, and their patterns were compared with the cell cycle progression. The oxygen-sensitive N2 fixation process occurred mainly during the dark period, where photosynthesis cannot take place, inducing a light-dark cycle of cellular C : N ratio. Examination of circadian patterns in the cell cycle revealed that cell division occurred during the midlight period, (8 h and 4 h into the light in the long and short PPL conditions, respectively), thus timely separated from the energy-intensive diazotrophic process. Results consistently show a nearly 5 h time lag between the end of cell division and the onset of N2 fixation. Shorter PPLs affected DNA compaction of C. watsonii cells and also led to a decrease in the cell division rate. Therefore, PPL paces the growth of C. watsonii: a long PPL enhances cell division while a short PPL favours somatic growth (biomass production) with higher carbon and nitrogen cell contents. © 2013 Society for Applied Microbiology and John Wiley & Sons Ltd.

  19. Hematopoietic stem cells are acutely sensitive to Acd shelterin gene inactivation

    PubMed Central

    Jones, Morgan; Osawa, Gail; Regal, Joshua A.; Weinberg, Daniel N.; Taggart, James; Kocak, Hande; Friedman, Ann; Ferguson, David O.; Keegan, Catherine E.; Maillard, Ivan

    2013-01-01

    The shelterin complex plays dual functions in telomere homeostasis by recruiting telomerase and preventing the activation of a DNA damage response at telomeric ends. Somatic stem cells require telomerase activity, as evidenced by progressive stem cell loss leading to bone marrow failure in hereditary dyskeratosis congenita. Recent work demonstrates that dyskeratosis congenita can also arise from mutations in specific shelterin genes, although little is known about shelterin functions in somatic stem cells. We found that mouse hematopoietic stem cells (HSCs) are acutely sensitive to inactivation of the shelterin gene Acd, encoding TPP1. Homozygosity for a hypomorphic acd allele preserved the emergence and expansion of fetal HSCs but led to profoundly defective function in transplantation assays. Upon complete Acd inactivation, HSCs expressed p53 target genes, underwent cell cycle arrest, and were severely depleted within days, leading to hematopoietic failure. TPP1 loss induced increased telomeric fusion events in bone marrow progenitors. However, unlike in epidermal stem cells, p53 deficiency did not rescue TPP1-deficient HSCs, indicating that shelterin dysfunction has unique effects in different stem cell populations. Because the consequences of telomere shortening are progressive and unsynchronized, acute loss of shelterin function represents an attractive alternative for studying telomere crisis in hematopoietic progenitors. PMID:24316971

  20. Somatic embryogenesis in forestry: A practical approach to cloning the best trees

    Treesearch

    Alex M. Diner

    1999-01-01

    Trees as well as humans have two basic cell types based on genetic content: somatic cells and gametic or reproductive cells. Somatic cells, such as skin cells or the sapwood cells in a tree, have at least twice (2n) the base set of chromosomes. The reproductive cells (gametic cells) have a single (n) set of chromosomes.

  1. The thiol compounds glutathione and homoglutathione differentially affect cell development in alfalfa (Medicago sativa L.).

    PubMed

    Pasternak, Taras; Asard, Han; Potters, Geert; Jansen, Marcel A K

    2014-01-01

    Glutathione (GSH) is an important scavenger of Reactive Oxygen Species (ROS), precursor of metal chelating phytochelatins, xenobiotic defence compound and regulator of cell proliferation. Homoglutathione (hGSH) is a GSH homologue that is present in several taxa in the family of Fabaceae. It is thought that hGSH performs many of the stress-defence roles typically ascribed to GSH, yet little is known about the potential involvement of hGSH in controlling cell proliferation. Here we show that hGSH/GSH ratios vary across organs and cells and that these changes in hGSH/GSH ratio occur during dedifferentiation and/or cell cycle activation events. The use of a GSH/hGSH biosynthesis inhibitor resulted in impaired cytokinesis in isolated protoplasts, showing the critical importance of these thiol-compounds for cell division. However, exposure of isolated protoplasts to exogenous GSH accelerated cytokinesis, while exogenous hGSH was found to inhibit the same process. We conclude that GSH and hGSH have distinct functional roles in cell cycle regulation in Medicago sativa L. GSH is associated with meristemic cells, and promotes cell cycle activation and induction of somatic embryogenesis, while hGSH is associated with differentiated cells and embryo proliferation. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  2. Energy Metabolism in Human Pluripotent Stem Cells and Their Differentiated Counterparts

    PubMed Central

    Moura, Michelle B.; Momcilovic, Olga; Easley, Charles A.; Ramalho-Santos, João; Van Houten, Bennett; Schatten, Gerald

    2011-01-01

    Background Human pluripotent stem cells have the ability to generate all cell types present in the adult organism, therefore harboring great potential for the in vitro study of differentiation and for the development of cell-based therapies. Nonetheless their use may prove challenging as incomplete differentiation of these cells might lead to tumoregenicity. Interestingly, many cancer types have been reported to display metabolic modifications with features that might be similar to stem cells. Understanding the metabolic properties of human pluripotent stem cells when compared to their differentiated counterparts can thus be of crucial importance. Furthermore recent data has stressed distinct features of different human pluripotent cells lines, namely when comparing embryo-derived human embryonic stem cells (hESCs) and induced pluripotent stem cells (IPSCs) reprogrammed from somatic cells. Methodology/Principal Findings We compared the energy metabolism of hESCs, IPSCs, and their somatic counterparts. Focusing on mitochondria, we tracked organelle localization and morphology. Furthermore we performed gene expression analysis of several pathways related to the glucose metabolism, including glycolysis, the pentose phosphate pathway and the tricarboxylic acid (TCA) cycle. In addition we determined oxygen consumption rates (OCR) using a metabolic extracellular flux analyzer, as well as total intracellular ATP levels by high performance liquid chromatography (HPLC). Finally we explored the expression of key proteins involved in the regulation of glucose metabolism. Conclusions/Findings Our results demonstrate that, although the metabolic signature of IPSCs is not identical to that of hESCs, nonetheless they cluster with hESCs rather than with their somatic counterparts. ATP levels, lactate production and OCR revealed that human pluripotent cells rely mostly on glycolysis to meet their energy demands. Furthermore, our work points to some of the strategies which human pluripotent stem cells may use to maintain high glycolytic rates, such as high levels of hexokinase II and inactive pyruvate dehydrogenase (PDH). PMID:21698063

  3. Establishment of a Somatic Cell Bank for Indian Buffalo Breeds and Assessing the Suitability of the Cryopreserved Cells for Somatic Cell Nuclear Transfer.

    PubMed

    Selokar, Naresh L; Sharma, Papori; Krishna, Ananth; Kumar, Deepak; Kumar, Dharmendra; Saini, Monika; Sharma, Arpna; Vijayalakshmy, Kennady; Yadav, Prem Singh

    2018-06-01

    Biobanks of cryopreserved gametes and embryos of domestic animals have been utilized to spread desired genotypes and to conserve the animal germplasm of endangered breeds. In principle, somatic cells can be used for the same purposes, and for reviving of animals, the somatic cells must be suitable for animal cloning techniques, such as somatic cell nuclear transfer. In the present study, we derived and cryopreserved somatic cells from three breeds of riverine and swamp-like type buffaloes and established a somatic cell bank. In total, 350 cryovials of 14 different individual animals (25 cryovials per animal) were cryopreserved and informative data such as breed value, origin, and others were documented. Immunostaining of the established cells against vimentin and cytokeratin suggested a commitment to the fibroblast lineage. In addition, microsatellite analysis was performed and documented for unambiguous parentage verification of clones in the future. Subsequently, the cryopreserved cells were tested for their suitability as nuclear donors (n = 7) using handmade cloning, and the reconstructed embryos were cultured in vitro. The cleavage rates (95.99% ± 2.17% vs. 82.18% ± 2.50%) and blastocyst rates (37.73% ± 1.54% vs. 24.31% ± 1.78%) were higher (p < 0.05) for riverine buffalo cells than that of swamp-like buffalo cells, whereas the total cell numbers of blastocysts (258.16 ± 36.25 vs. 198.16 ± 36.25, respectively) were similar. In conclusion, we demonstrated the feasibility of biobanking of buffalo somatic cells, and that the cryopreserved cells can be used to produce cloned embryos. This study encourages the development of somatic cell biobanks of domestic livestock, including endangered breeds of buffalo, to preserve valuable genotypes for future revitalization by animal cloning techniques.

  4. Abnormalities in human pluripotent cells due to reprogramming mechanisms

    PubMed Central

    Ma, Hong; Morey, Robert; O’Neil, Ryan C.; He, Yupeng; Daughtry, Brittany; Schultz, Matthew D.; Hariharan, Manoj; Nery, Joseph R.; Castanon, Rosa; Sabatini, Karen; Thiagarajan, Rathi D.; Tachibana, Masahito; Kang, Eunju; Tippner-Hedges, Rebecca; Ahmed, Riffat; Gutierrez, Nuria Marti; Van Dyken, Crystal; Polat, Alim; Sugawara, Atsushi; Sparman, Michelle; Gokhale, Sumita; Amato, Paula; Wolf, Don P.; Ecker, Joseph R.; Laurent, Louise C.; Mitalipov, Shoukhrat

    2016-01-01

    Human pluripotent stem cells hold potential for regenerative medicine, but available cell types have significant limitations. Although embryonic stem cells (ES cells) from in vitro fertilized embryos (IVF ES cells) represent the ‘gold standard’, they are allogeneic to patients. Autologous induced pluripotent stem cells (iPS cells) are prone to epigenetic and transcriptional aberrations. To determine whether such abnormalities are intrinsic to somatic cell reprogramming or secondary to the reprogramming method, genetically matched sets of human IVF ES cells, iPS cells and nuclear transfer ES cells (NT ES cells) derived by somatic cell nuclear transfer (SCNT) were subjected to genome-wide analyses. Both NT ES cells and iPS cells derived from the same somatic cells contained comparable numbers of de novo copy number variations. In contrast, DNA methylation and transcriptome profiles of NT ES cells corresponded closely to those of IVF ES cells, whereas iPS cells differed and retained residual DNA methylation patterns typical of parental somatic cells. Thus, human somatic cells can be faithfully reprogrammed to pluripotency by SCNT and are therefore ideal for cell replacement therapies. PMID:25008523

  5. Somatic cell counts in bulk milk and their importance for milk processing

    NASA Astrophysics Data System (ADS)

    Savić, N. R.; Mikulec, D. P.; Radovanović, R. S.

    2017-09-01

    Bulk tank milk somatic cell counts are the indicator of the mammary gland health in the dairy herds and may be regarded as an indirect measure of milk quality. Elevated somatic cell counts are correlated with changes in milk composition The aim of this study was to assess the somatic cell counts that significantly affect the quality of milk and dairy products. We examined the somatic cell counts in bulk tank milk samples from 38 farms during the period of 6 months, from December to the May of the next year. The flow cytometry, Fossomatic was used for determination of somatic cell counts. In the same samples content of total proteins and lactose was determined by Milcoscan. Our results showed that average values for bulk tank milk samples were 273,605/ml from morning milking and 292,895/ml from evening milking. The average values for total proteins content from morning and evening milking are 3,31 and 3,34%, respectively. The average values for lactose content from morning and evening milking are 4,56 and 4,63%, respectively. The highest somatic cell count (516,000/ml) was detected in bulk tank milk sample from evening milk in the Winter and the lowest content of lactose was 4,46%. Our results showed that obtained values for bulk tank milk somatic cell counts did not significantly affected the content of total proteins and lactose.

  6. Cell lineage analysis in human brain using endogenous retroelements

    PubMed Central

    Evrony, Gilad D.; Lee, Eunjung; Mehta, Bhaven K.; Benjamini, Yuval; Johnson, Robert M.; Cai, Xuyu; Yang, Lixing; Haseley, Psalm; Lehmann, Hillel S.; Park, Peter J.; Walsh, Christopher A.

    2015-01-01

    Summary Somatic mutations occur during brain development and are increasingly implicated as a cause of neurogenetic disease. However, the patterns in which somatic mutations distribute in the human brain are unknown. We used high-coverage whole-genome sequencing of single neurons from a normal individual to identify spontaneous somatic mutations as clonal marks to track cell lineages in human brain. Somatic mutation analyses in >30 locations throughout the nervous system identified multiple lineages and sub-lineages of cells marked by different LINE-1 (L1) retrotransposition events and subsequent mutation of poly-A microsatellites within L1. One clone contained thousands of cells limited to the left middle frontal gyrus, whereas a second distinct clone contained millions of cells distributed over the entire left hemisphere. These patterns mirror known somatic mutation disorders of brain development, and suggest that focally distributed mutations are also prevalent in normal brains. Single-cell analysis of somatic mutation enables tracing of cell lineage clones in human brain. PMID:25569347

  7. The large Maf factor Traffic Jam controls gonad morphogenesis in Drosophila.

    PubMed

    Li, Michelle A; Alls, Jeffrey D; Avancini, Rita M; Koo, Karen; Godt, Dorothea

    2003-11-01

    Interactions between somatic and germline cells are critical for the normal development of egg and sperm. Here we show that the gene traffic jam (tj) produces a soma-specific factor that controls gonad morphogenesis and is required for female and male fertility. tj encodes the only large Maf factor in Drosophila melanogaster, an orthologue of the atypical basic Leu zipper transcription factors c-Maf and MafB/Kreisler in vertebrates. Expression of tj occurs in somatic gonadal cells that are in direct contact with germline cells throughout development. In tj mutant gonads, somatic cells fail to inter-mingle and properly envelop germline cells, causing an early block in germ cell differentiation. In addition, tj mutant somatic cells show an increase in the level of expression for several adhesion molecules. We propose that tj is a critical modulator of the adhesive properties of somatic cells, facilitating germline-soma interactions that are essential for germ cell differentiation.

  8. Cloning of pigs from somatic cells and its prospects.

    PubMed

    Onishi, Akira

    2002-01-01

    The technology of somatic cell cloning in pigs is valuable for agricultural and therapeutic purposes. This paper will focus on the current methods of cloning pigs, including our successful microinjection#10; of somatic cell nuclei and its application. #10;

  9. Insights from Proteomic Studies into Plant Somatic Embryogenesis.

    PubMed

    Heringer, Angelo Schuabb; Santa-Catarina, Claudete; Silveira, Vanildo

    2018-03-01

    Somatic embryogenesis is a biotechnological approach mainly used for the clonal propagation of different plants worldwide. In somatic embryogenesis, embryos arise from somatic cells under appropriate culture conditions. This plasticity in plants is a demonstration of true cellular totipotency and is the best approach among the genetic transformation protocols used for plant regeneration. Despite the importance of somatic embryogenesis, knowledge regarding the control of the somatic embryogenesis process is limited. Therefore, the elucidation of both the biochemical and molecular processes is important for understanding the mechanisms by which a single somatic cell becomes a whole plant. Modern proteomic techniques rely on an alternative method for the identification and quantification of proteins with different abundances in embryogenic cell cultures or somatic embryos and enable the identification of specific proteins related to somatic embryogenesis development. This review focuses on somatic embryogenesis studies that use gel-free shotgun proteomic analyses to categorize proteins that could enhance our understanding of particular aspects of the somatic embryogenesis process and identify possible targets for future studies. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. A continuous culture system of direct somatic embryogenesis in microspore-derived embryos of Brassica juncea.

    PubMed

    Prabhudesai, V; Bhaskaran, S

    1993-03-01

    An efficient culture system has been developed for repeated cycles of somatic embryogenesis in microspore-derived embryos of Brassica juncea without a callus phase. Haploid embryos produced through anther culture showed a high propensity for direct production of somatic embryos in response to 2 mgL(-1) BA and 0.1 mgL(-1) NAA. The embryogenic cultures which comprised the elongated embryonal axis of microspore-derived embryos when explanted and grown on the medium of same composition produced a large number of secondary embryos. These somatic embryos in turn underwent axis elongation and produced more somatic embryos when explanted and cultured. This cycle of repetitive somatic embryogenesis continued with undiminished vigour passage after passage and was monitored for more than a year. Somatic embryos from any passage when isolated at cotyledonary stage and grown on auxin-free medium for 5 days and then on a medium containing NAA (0.1 mgL(-1)), developed into complete plants with a profuse root system and were easily established in the soil. The cytology of the root tips of these plants confirmed their haploid nature. The total absence of callus phase makes the system ideal for continuous cloning of androgenic lines, Agrobacterium-mediated transformation and mutation induction studies.

  11. Using sea urchin gametes and zygotes to investigate centrosome duplication.

    PubMed

    Sluder, Greenfield

    2016-01-01

    Centriole structure and function in the sea urchin zygote parallel those in mammalian somatic cells. Here, I briefly introduce the properties and attributes of the sea urchin system that make it an attractive platform for the study of centrosome and centriole duplication. These attributes apply to all echinoderms readily available from commercial suppliers: sea urchins, sand dollars, and starfish. I list some of the practical aspects of the system that make it a cost- and time-effective system for experimental work and then list properties that are a "tool kit" that can be used to conduct studies that would not be practical, or in some cases not possible, with mammalian somatic cells. Since centrioles organize and localize the pericentriolar material that nucleates the astral arrays of microtubules (Bobinnec et al. in J Cell Biol 143(6):1575-1589, 1998), the pattern of aster duplication over several cell cycles can be used as a reliable measure for centriole duplication (Sluder and Rieder in J Cell Biol 100(3):887-896, 1985). Descriptions of the methods my laboratory has used to handle and image echinoderm zygotes are reviewed in Sluder et al. (Methods Cell Biol 61:439-472, 1999). Also included is a bibliography of papers that describe additional methods.

  12. Cancer treatment in childhood and testicular function: the importance of the somatic environment.

    PubMed

    Stukenborg, Jan-Bernd; Jahnukainen, Kirsi; Hutka, Marsida; Mitchell, Rod T

    2018-02-01

    Testicular function and future fertility may be affected by cancer treatment during childhood. Whilst survival of the germ (stem) cells is critical for ensuring the potential for fertility in these patients, the somatic cell populations also play a crucial role in providing a suitable environment to support germ cell maintenance and subsequent development. Regulation of the spermatogonial germ-stem cell niche involves many signalling pathways with hormonal influence from the hypothalamo-pituitary-gonadal axis. In this review, we describe the somatic cell populations that comprise the testicular germ-stem cell niche in humans and how they may be affected by cancer treatment during childhood. We also discuss the experimental models that may be utilized to manipulate the somatic environment and report the results of studies that investigate the potential role of somatic cells in the protection of the germ cells in the testis from cancer treatment. © 2018 The authors.

  13. Cancer treatment in childhood and testicular function: the importance of the somatic environment

    PubMed Central

    Stukenborg, Jan-Bernd; Jahnukainen, Kirsi; Hutka, Marsida

    2018-01-01

    Testicular function and future fertility may be affected by cancer treatment during childhood. Whilst survival of the germ (stem) cells is critical for ensuring the potential for fertility in these patients, the somatic cell populations also play a crucial role in providing a suitable environment to support germ cell maintenance and subsequent development. Regulation of the spermatogonial germ-stem cell niche involves many signalling pathways with hormonal influence from the hypothalamo-pituitary-gonadal axis. In this review, we describe the somatic cell populations that comprise the testicular germ-stem cell niche in humans and how they may be affected by cancer treatment during childhood. We also discuss the experimental models that may be utilized to manipulate the somatic environment and report the results of studies that investigate the potential role of somatic cells in the protection of the germ cells in the testis from cancer treatment. PMID:29351905

  14. Behavior and function of paternally inherited centrioles in brown algal zygotes.

    PubMed

    Nagasato, Chikako

    2005-12-01

    In brown algal cells, the centrosome, consisting of a pair of centrioles and the pericentriolar material, is primarily involved in the organization of microtubules (MTs) throughout the cell cycle. In motile cells, the centrioles participate in the formation of flagellar axoneme as flagellar basal bodies, and in somatic cells they play a crucial role in many cellular activities as a part of the centrosome. With respect to the role of the centrosome as a microtubule organizing center (MTOC), brown algal cells resemble animal cells. In most animal fertilization processes, the sperm cell introduces centrioles, the core of the centrosome, into the egg cytoplasm. In this study, the behavior of centrioles from gametogenesis and fertilization to the first cell division of the zygote was examined in the three sexual reproduction patterns occurring in brown algae, i.e., oogamy, anisogamy and isogamy, by electron- and immunofluorescence-microscopy. The pair of centrioles contained in somatic cells was shown to be derived from the male gamete, irrespective of the sexual reproductive pattern. The paternally derived centrioles were duplicated before mitosis and were involved in spindle pole formation. Moreover, MTs from the centrosome play a crucial role in the process of cytokinesis, as the position of centrosomes accompanying daughter nuclei seems to determine the cytokinetic plane. A new approach to clarifying the mode of cytokinesis in brown algae is presented in this study.

  15. Characterization of somatic embryo attached structures in Feijoa sellowiana Berg. (Myrtaceae).

    PubMed

    Correia, Sandra M; Canhoto, Jorge M

    2010-06-01

    The presence of an attached organ to somatic embryos of angiosperms connecting the embryo to the supporting tissue has been a subject of controversy. This study shows that 67% of the morphologically normal somatic embryos of Feijoa sellowiana possess this type of organ and that its formation was not affected by culture media composition. Histological and ultrastructural analysis indicated that the attached structures of somatic embryos displayed a great morphological diversity ranging from a few cells to massive and columnar structures. This contrast with the simple suspensors observed in zygotic embryos which were only formed by five cells. As well as the suspensor of zygotic embryos, somatic embryo attached structures undergo a process of degeneration in later stages of embryo development. Other characteristic shared by zygotic suspensors and somatic embryo attached structures was the presence of thick cell walls surrounding the cells. Elongated thin filaments were often associated with the structures attached to somatic embryos, whereas in other cases, tubular cells containing starch grains connected the embryo to the supporting tissue. These characteristics associated with the presence of plasmodesmata in the cells of the attached structures seem to indicate a role on embryo nutrition. However, cell proliferation in the attached structures resulting into new somatic embryos may also suggest a more complex relationship between the embryo and the structures connecting it to the supporting tissue.

  16. Five classic articles in somatic cell reprogramming.

    PubMed

    Park, In-Hyun

    2010-09-01

    Research on somatic cell reprogramming has progressed significantly over the past few decades, from nuclear transfer into frogs' eggs in 1952 to the derivation of human-induced pluripotent stem (iPS) cells in the present day. In this article, I review five landmark papers that have laid the foundation for current efforts to apply somatic cell reprogramming in the clinic.

  17. Molecular Mechanisms of Induced Pluripotency

    PubMed Central

    Muchkaeva, I.A.; Dashinimaev, E.B.; Terskikh, V.V.; Sukhanov, Y.V.; Vasiliev, A.V.

    2012-01-01

    In this review the distinct aspects of somatic cell reprogramming are discussed. The molecular mechanisms of generation of induced pluripotent stem (iPS) cells from somatic cells via the introduction of transcription factors into adult somatic cells are considered. Particular attention is focused on the generation of iPS cells without genome modifications via the introduction of the mRNA of transcription factors or the use of small molecules. Furthermore, the strategy of direct reprogramming of somatic cells omitting the generation of iPS cells is considered. The data concerning the differences between ES and iPS cells and the problem of epigenetic memory are also discussed. In conclusion, the possibility of using iPS cells in regenerative medicine is considered. PMID:22708059

  18. Mouse cloning and somatic cell reprogramming using electrofused blastomeres.

    PubMed

    Riaz, Amjad; Zhao, Xiaoyang; Dai, Xiangpeng; Li, Wei; Liu, Lei; Wan, Haifeng; Yu, Yang; Wang, Liu; Zhou, Qi

    2011-05-01

    Mouse cloning from fertilized eggs can assist development of approaches for the production of "genetically tailored" human embryonic stem (ES) cell lines that are not constrained by the limitations of oocyte availability. However, to date only zygotes have been successfully used as recipients of nuclei from terminally differentiated somatic cell donors leading to ES cell lines. In fertility clinics, embryos of advanced embryonic stages are usually stored for future use, but their ability to support the derivation of ES cell lines via somatic nuclear transfer has not yet been proved. Here, we report that two-cell stage electrofused mouse embryos, arrested in mitosis, can support developmental reprogramming of nuclei from donor cells ranging from blastomeres to somatic cells. Live, full-term cloned pups from embryonic donors, as well as pluripotent ES cell lines from embryonic or somatic donors, were successfully generated from these reconstructed embryos. Advanced stage pre-implantation embryos were unable to develop normally to term after electrofusion and transfer of a somatic cell nucleus, indicating that discarded pre-implantation human embryos could be an important resource for research that minimizes the ethical concerns for human therapeutic cloning. Our approach provides an attractive and practical alternative to therapeutic cloning using donated oocytes for the generation of patient-specific human ES cell lines.

  19. Age-related Deterioration of Hematopoietic Stem Cells.

    PubMed

    Kim, Mi Jung; Kim, Min Hwan; Kim, Seung Ah; Chang, Jae Suk

    2008-11-01

    Aging is the process of system deterioration over time in the whole body. Stem cells are self-renewing and therefore have been considered exempt from the aging process. Earlier studies by Hayflick showed that there is an intrinsic limit to the number of divisions that mammalian somatic cells can undergo, and cycling kinetics and ontogeny-related studies strongly suggest that even the most primitive stem cell functions exhibit a certain degree of aging. Despite these findings, studies on the effects of aging on stem cell functions are inconclusive. Here we review the age-related properties of hematopoietic stem cells in terms of intrinsic and extrinsic alterations, proliferative potential, signaling molecules, telomere and telomerase, senescence and cancer issues, regenerative potential and other indications of stem cell aging are discussed in detail.

  20. Age-related Deterioration of Hematopoietic Stem Cells

    PubMed Central

    Kim, Mi Jung; Kim, Min Hwan; Kim, Seung Ah; Chang, Jae Suk

    2008-01-01

    Aging is the process of system deterioration over time in the whole body. Stem cells are self-renewing and therefore have been considered exempt from the aging process. Earlier studies by Hayflick showed that there is an intrinsic limit to the number of divisions that mammalian somatic cells can undergo, and cycling kinetics and ontogeny-related studies strongly suggest that even the most primitive stem cell functions exhibit a certain degree of aging. Despite these findings, studies on the effects of aging on stem cell functions are inconclusive. Here we review the age-related properties of hematopoietic stem cells in terms of intrinsic and extrinsic alterations, proliferative potential, signaling molecules, telomere and telomerase, senescence and cancer issues, regenerative potential and other indications of stem cell aging are discussed in detail. PMID:24855509

  1. Differential nuclear remodeling of mammalian somatic cells by Xenopus laevis oocyte and egg cytoplasm

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Alberio, Ramiro; Johnson, Andrew D.; Stick, Reimer

    2005-07-01

    The mechanisms governing nuclear reprogramming have not been fully elucidated yet; however, recent studies show a universally conserved ability of both oocyte and egg components to reprogram gene expression in somatic cells. The activation of genes associated with pluripotency by oocyte/egg components may require the remodeling of nuclear structures, such that they can acquire the features of early embryos and pluripotent cells. Here, we report on the remodeling of the nuclear lamina of mammalian cells by Xenopus oocyte and egg extracts. Lamin A/C is removed from somatic cells incubated in oocyte and egg extracts in an active process that requiresmore » permeable nuclear pores. Removal of lamin A/C is specific, since B-type lamins are not changed, and it is not dependent on the incorporation Xenopus egg specific lamin III. Moreover, transcriptional activity is differentially regulated in somatic cells incubated in the extracts. Pol I and II transcriptions are maintained in cells in oocyte extracts; however, both activities are abolished in egg extracts. Our study shows that components of oocyte and egg extracts can modify the nuclear lamina of somatic cells and that this nuclear remodeling induces a structural change in the nucleus which may have implications for transcriptional activity. These experiments suggest that modifications in the nuclear lamina structure by the removal of somatic proteins and the incorporation of oocyte/egg components may contribute to the reprogramming of somatic cell nuclei and may define a characteristic configuration of pluripotent cells.« less

  2. The Landscape of Somatic Genetic Alterations in Breast Cancers From ATM Germline Mutation Carriers.

    PubMed

    Weigelt, Britta; Bi, Rui; Kumar, Rahul; Blecua, Pedro; Mandelker, Diana L; Geyer, Felipe C; Pareja, Fresia; James, Paul A; Couch, Fergus J; Eccles, Diana M; Blows, Fiona; Pharoah, Paul; Li, Anqi; Selenica, Pier; Lim, Raymond S; Jayakumaran, Gowtham; Waddell, Nic; Shen, Ronglai; Norton, Larry; Wen, Hannah Y; Powell, Simon N; Riaz, Nadeem; Robson, Mark E; Reis-Filho, Jorge S; Chenevix-Trench, Georgia

    2018-02-28

    Pathogenic germline variants in ataxia-telangiectasia mutated (ATM), a gene that plays a role in DNA damage response and cell cycle checkpoints, confer an increased breast cancer (BC) risk. Here, we investigated the phenotypic characteristics and landscape of somatic genetic alterations in 24 BCs from ATM germline mutation carriers by whole-exome and targeted sequencing. ATM-associated BCs were consistently hormone receptor positive and largely displayed minimal immune infiltrate. Although 79.2% of these tumors exhibited loss of heterozygosity of the ATM wild-type allele, none displayed high activity of mutational signature 3 associated with defective homologous recombination DNA (HRD) repair. No TP53 mutations were found in the ATM-associated BCs. Analysis of an independent data set confirmed that germline ATM variants and TP53 somatic mutations are mutually exclusive. Our findings indicate that ATM-associated BCs often harbor bi-allelic inactivation of ATM, are phenotypically distinct from BRCA1/2-associated BCs, lack HRD-related mutational signatures, and that TP53 and ATM genetic alterations are likely epistatic.

  3. L1-Associated Genomic Regions are Deleted in Somatic Cells of the Healthy Human Brain

    PubMed Central

    Erwin, Jennifer A.; Paquola, Apuã C.M.; Singer, Tatjana; Gallina, Iryna; Novotny, Mark; Quayle, Carolina; Bedrosian, Tracy; Ivanio, Francisco; Butcher, Cheyenne R.; Herdy, Joseph R.; Sarkar, Anindita; Lasken, Roger S.; Muotri, Alysson R.; Gage, Fred H.

    2016-01-01

    The healthy human brain is a mosaic of varied genomes. L1 retrotransposition is known to create mosaicism by inserting L1 sequences into new locations of somatic cell genomes. Using a machine learning-based, single-cell sequencing approach, we discovered that Somatic L1-Associated Variants (SLAVs) are actually composed of two classes: L1 retrotransposition insertions and retrotransposition-independent L1-associated variants. We demonstrate that a subset of SLAVs are, in fact, somatic deletions generated by L1 endonuclease cutting activity. Retrotransposition- independent rearrangements within inherited L1s resulted in the deletion of proximal genomic regions. These rearrangements were resolved by microhomology-mediated repair, which suggests that L1-associated genomic regions are hotspots for somatic copy number variants in the brain and therefore a heritable genetic contributor to somatic mosaicism. We demonstrate that SLAVs are present in crucial neural genes, such as DLG2/PSD93, and affect between 44–63% of cells of the cells in the healthy brain. PMID:27618310

  4. Fibroblast growth factor signaling is required for early somatic gonad development in zebrafish.

    PubMed

    Leerberg, Dena M; Sano, Kaori; Draper, Bruce W

    2017-09-01

    The vertebrate ovary and testis develop from a sexually indifferent gonad. During early development of the organism, primordial germ cells (the gamete lineage) and somatic gonad cells coalesce and begin to undergo growth and morphogenesis to form this bipotential gonad. Although this aspect of development is requisite for a fertile adult, little is known about the genetic regulation of early gonadogenesis in any vertebrate. Here, we provide evidence that fibroblast growth factor (Fgf) signaling is required for the early growth phase of a vertebrate bipotential gonad. Based on mutational analysis in zebrafish, we show that the Fgf ligand 24 (Fgf24) is required for proliferation, differentiation, and morphogenesis of the early somatic gonad, and as a result, most fgf24 mutants are sterile as adults. Additionally, we describe the ultrastructural elements of the early zebrafish gonad and show that distinct somatic cell populations can be identified soon after the gonad forms. Specifically, we show that fgf24 is expressed in an epithelial population of early somatic gonad cells that surrounds an inner population of mesenchymal somatic gonad cells that are in direct contact with the germ cells, and that fgf24 is required for stratification of the somatic tissue. Furthermore, based on gene expression analysis, we find that differentiation of the inner mesenchymal somatic gonad cells into functional cell types in the larval and early juvenile-stage gonad is dependent on Fgf24 signaling. Finally, we argue that the role of Fgf24 in zebrafish is functionally analogous to the role of tetrapod FGF9 in early gonad development.

  5. Consequence of changing standards for somatic cell count on US Dairy Herd Improvement herds

    USDA-ARS?s Scientific Manuscript database

    Consequence of noncompliance with European Union (EU) and current US standards for somatic cell count (SCC) as well as SCC standards proposed by the National Milk Producers Federation was examined for US herds. Somatic cell scores (SCS) from 14,854 Dairy Herd Improvement (DHI) herds were analyzed. H...

  6. Somatic INK4a-ARF locus mutations: a significant mechanism of gene inactivation in squamous cell carcinomas of the head and neck.

    PubMed

    Poi, M J; Yen, T; Li, J; Song, H; Lang, J C; Schuller, D E; Pearl, D K; Casto, B C; Tsai, M D; Weghorst, C M

    2001-01-01

    The INK4a-ARF locus is located on human chromosome 9p21 and is known to encode two functionally distinct tumor-suppressor genes. The p16(INK4a) (p16) tumor-suppressor gene product is a negative regulator of cyclin-dependent kinases 4 and 6, which in turn positively regulate progression of mammalian cells through the cell cycle. The p14(ARF) tumor-suppressor gene product specifically interacts with human double minute 2, leading to the subsequent stabilization of p53 and G(1) arrest. Previous investigations analyzing the p16 gene in squamous cell carcinomas of the head and neck (SCCHNs) have suggested the predominate inactivating events to be homozygous gene deletions and hypermethylation of the p16 promoter. Somatic mutational inactivation of p16 has been reported to be low (0-10%, with a combined incidence of 25 of 279, or 9%) and to play only a minor role in the development of SCCHN. The present study examined whether this particular mechanism of INK4a/ARF inactivation, specifically somatic mutation, has been underestimated in SCCHN by determining the mutational status of the p16 and p14(ARF) genes in 100 primary SCCHNs with the use of polymerase chain reaction technology and a highly sensitive, nonradioactive modification of single-stranded conformational polymorphism (SSCP) analysis termed "cold" SSCP. Exons 1alpha, 1beta, and 2 of INK4a/ARF were amplified using intron-based primers or a combination of intron- and exon-based primers. A total of 27 SCCHNs (27%) exhibited sequence alterations in this locus, 22 (22%) of which were somatic sequence alterations and five (5%) of which were a single polymorphism in codon 148. Of the 22 somatic alterations, 20 (91%) directly or indirectly involved exon 2, and two (9%) were located within exon 1alpha. No mutations were found in exon 1beta. All 22 somatic mutations would be expected to yield altered p16 proteins, but only 15 of them should affect p14(ARF) proteins. Specific somatic alterations included microdeletions or insertions (nine of 22, 41%), a microrearrangement (one of 22, 5%), and single nucleotide substitutions (12 of 22, 56%). In addition, we analyzed the functional characteristics of seven unique mutant p16 proteins identified in this study by assessing their ability to inhibit cyclin-dependent kinase 4 activity. Six of the seven mutant proteins tested exhibited reduced function compared with wild-type p16, ranging from minor decreases of function (twofold to eightfold) in four samples to total loss of function (29- to 38-fold decrease) in two other samples. Overall, somatic mutation of the INK4a/ARF tumor suppressor locus, resulting in functionally deficient p16 and possibly p14(ARF) proteins, seems to be a prevalent event in the development of SCCHN. Mol. Carcinog. 30:26-36, 2001. Copyright 2001 Wiley-Liss, Inc.

  7. Cellular and molecular changes associated with somatic embryogenesis induction in Agave tequilana.

    PubMed

    Portillo, L; Olmedilla, A; Santacruz-Ruvalcaba, F

    2012-10-01

    In spite of the importance of somatic embryogenesis for basic research in plant embryology as well as for crop improvement and plant propagation, it is still unclear which mechanisms and cell signals are involved in acquiring embryogenic competence by a somatic cell. The aim of this work was to study cellular and molecular changes involved in the induction stage in calli of Agave tequilana Weber cultivar azul in order to gain more information on the initial stages of somatic embryogenesis in this species. Cytochemical and immunocytochemical techniques were used to identify differences between embryogenic and non-embryogenic cells from several genotypes. Presence of granular structures was detected after somatic embryogenesis induction in embryogenic cells; composition of these structures as well as changes in protein and polysaccharide distribution was studied using Coomassie brilliant blue and Periodic Acid-Schiff stains. Distribution of arabinogalactan proteins (AGPs) and pectins was investigated in embryogenic and non-embryogenic cells by immunolabelling using anti-AGP monoclonal antibodies (JIM4, JIM8 and JIM13) as well as an anti-methyl-esterified pectin-antibody (JIM7), in order to evaluate major modifications in cell wall composition in the initial stages of somatic embryogenesis. Our observations pointed out that induction of somatic embryogenesis produced accumulation of proteins and polysaccharides in embryogenic cells. Presence of JIM8, JIM13 and JIM7 epitopes were detected exclusively in embryogenic cells, which supports the idea that specific changes in cell wall are involved in the acquisition of embryogenic competence of A. tequilana.

  8. The contribution of mammary infections by coagulase-negative staphylococci to the herd bulk milk somatic cell count.

    PubMed

    Rainard, P; Ducelliez, M; Poutrel, B

    1990-01-01

    Quarter foremilk samples were taken at 2-3 weekly intervals for several years in an experimental herd comprising about 45 cows. The samples were submitted to bacteriological analysis and somatic cell counting. The most prevalent quarter infections from 1982 to 1988 were by coagulase-negative staphylococci (15-20% of all the quarters sampled). Most of these (75.6%) persisted until drying-off. Dry cow therapy eliminated 86.5% of these infections. Comparison of udder quarters within cows, involving 775 samples from pairs of non-infected quarters and quarters infected by coagulase-negative staphylococci, yielded geometric means of somatic cell counts of 210,000 and 420,000 cells/ml, respectively. The correlation (r = 0.87) between the herd bulk milk somatic cell count (SCC) and its estimation from the quarter milk somatic cell count performed on the same day allowed us to evaluate the contribution of the different categories of quarters, according to their infection status, to the herd bulk milk SCC. Quarters infected by a major pathogen (8.5% of samples) gave rise to 46.6% of the total number of cells, while quarters infected by coagulase-negative staphylococci (17.8% of samples) gave rise to 18.1%. Although coagulase-negative staphylococci represented only a secondary source of somatic cells as compared to major pathogens, they were not a negligible source considering the threshold of 300,000 somatic cells advocated for herd milk of good quality.

  9. Problems and potentialities of cultured plant cells in retrospect and prospect

    NASA Technical Reports Server (NTRS)

    Steward, F. C.; Krikorian, A. D.

    1979-01-01

    The past, present and expected future accomplishments and limitations of plant cell and tissue culture are reviewed. Consideration is given to the pioneering insights of Haberlandt in 1902, the development of culture techniques, and past work on cell division, cell and tissue growth and development, somatic embryogenesis, and metabolism and respiration. Current activity in culture media and technique development for plant regions, organs, tissues, cells, protoplasts, organelles and embryos, totipotency, somatic embryogenesis and clonal propagation under normal and space conditions, biochemical potentialities, and genetic engineering is surveyed. Prospects for the investigation of the induced control of somatic cell division, the division of isolated protoplasts, the improvement of haploid cell cultures, liquid cultures for somatic embryogenesis, and the genetic control of development are outlined.

  10. Retinoic acid signaling is dispensable for somatic development and function in the mammalian ovary.

    PubMed

    Minkina, Anna; Lindeman, Robin E; Gearhart, Micah D; Chassot, Anne-Amandine; Chaboissier, Marie-Christine; Ghyselinck, Norbert B; Bardwell, Vivian J; Zarkower, David

    2017-04-15

    Retinoic acid (RA) is a potent inducer of cell differentiation and plays an essential role in sex-specific germ cell development in the mammalian gonad. RA is essential for male gametogenesis and hence fertility. However, RA can also disrupt sexual cell fate in somatic cells of the testis, promoting transdifferentiation of male Sertoli cells to female granulosa-like cells when the male sexual regulator Dmrt1 is absent. The feminizing ability of RA in the Dmrt1 mutant somatic testis suggests that RA might normally play a role in somatic cell differentiation or cell fate maintenance in the ovary. To test for this possibility we disrupted RA signaling in somatic cells of the early fetal ovary using three genetic strategies and one pharmaceutical approach. We found that deleting all three RA receptors (RARs) in the XX somatic gonad at the time of sex determination did not significantly affect ovarian differentiation, follicle development, or female fertility. Transcriptome analysis of adult triple mutant ovaries revealed remarkably little effect on gene expression in the absence of somatic RAR function. Likewise, deletion of three RA synthesis enzymes (Aldh1a1-3) at the time of sex determination did not masculinize the ovary. A dominant-negative RAR transgene altered granulosa cell proliferation, likely due to interference with a non-RA signaling pathway, but did not prevent granulosa cell specification and oogenesis or abolish fertility. Finally, culture of fetal XX gonads with an RAR antagonist blocked germ cell meiotic initiation but did not disrupt sex-biased gene expression. We conclude that RA signaling, although crucial in the ovary for meiotic initiation, is not required for granulosa cell specification, differentiation, or reproductive function. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. [Direct and indirect somatic embryogenesis in Freesia refracta].

    PubMed

    Wang, L; Duan, X G; Hao, S

    1999-06-01

    Somatic embryogenesis can be induced in tissue cultures of Freesia refracta either directly from the epidermal cells of explant, or indirectly via intervening callus. In direct pathway, somatic embryos were in contact with maternal tissue in a suspensor-like structure. In indirect pathway, the explants first proliferacted to give rise to calluses before embryoids were induced. The two sorts of calluses were defined to embryogenic callus and non-embryogenic callus according to producing of somatic embryos. An indirect somatic embryo is developed from a pre-embryogenically determined cell. This kind of somatic embryo has no suspensor structure instead of a complex with maternal tissue. Somatic embryos have their own vascular tissues, and can develop new plantlets independently.

  12. BAF180 regulates cellular senescence and hematopoietic stem cell homeostasis through p21

    PubMed Central

    Lee, Hyemin; Dai, Fangyan; Zhuang, Li; Xiao, Zhen-Dong; Kim, Jongchan; Zhang, Yilei; Ma, Li; You, M. James; Wang, Zhong; Gan, Boyi

    2016-01-01

    BAF180 (also called PBRM1), a subunit of the SWI/SNF complex, plays critical roles in the regulation of chromatin remodeling and gene transcription, and is frequently mutated in several human cancers. However, the role of mammalian BAF180 in tumor suppression and tissue maintenance in vivo remains largely unknown. Here, using a conditional somatic knockout approach, we explored the cellular and organismal functions of BAF180 in mouse. BAF180 deletion in primary mouse embryonic fibroblasts (MEFs) triggers profound cell cycle arrest, premature cellular senescence, without affecting DNA damage response or chromosomal integrity. While somatic deletion of BAF180 in adult mice does not provoke tumor development, BAF180 deficient mice exhibit defects in hematopoietic system characterized by progressive reduction of hematopoietic stem cells (HSCs), defective long-term repopulating potential, and hematopoietic lineage developmental aberrations. BAF180 deletion results in elevated p21 expression in both MEFs and HSCs. Mechanistically, we showed that BAF180 binds to p21 promoter, and BAF180 deletion enhances the binding of modified histones associated with transcriptional activation on p21 promoter. Deletion of p21 rescues cell cycle arrest and premature senescence in BAF180 deficient MEFs, and partially rescues hematopoietic defects in BAF180 deficient mice. Together, our study identifies BAF180 as a critical regulator of cellular senescence and HSC homeostasis, which is at least partially regulated through BAF180-mediated suppression of p21 expression. Our results also suggest that senescence triggered by BAF180 inactivation may serve as a failsafe mechanism to restrain BAF180 deficiency-associated tumor development, providing a conceptual framework to further understand BAF180 function in tumor biology. PMID:26992241

  13. Innexin2 gap junctions in somatic support cells are required for cyst formation and for egg chamber formation in Drosophila.

    PubMed

    Mukai, Masanori; Kato, Hirotaka; Hira, Seiji; Nakamura, Katsuhiro; Kita, Hiroaki; Kobayashi, Satoru

    2011-01-01

    Germ cells require intimate associations with surrounding somatic cells during gametogenesis. During oogenesis, gap junctions mediate communication between germ cells and somatic support cells. However, the molecular mechanisms by which gap junctions regulate the developmental processes during oogenesis are poorly understood. We have identified a female sterile allele of innexin2 (inx2), which encodes a gap junction protein in Drosophila. In females bearing this inx2 allele, cyst formation and egg chamber formation are impaired. In wild-type germaria, Inx2 is strongly expressed in escort cells and follicle cells, both of which make close contact with germline cells. We show that inx2 function in germarial somatic cells is required for the survival of early germ cells and promotes cyst formation, probably downstream of EGFR pathway, and that inx2 function in follicle cells promotes egg chamber formation through the regulation of DE-cadherin and Bazooka (Baz) at the boundary between germ cells and follicle cells. Furthermore, genetic experiments demonstrate that inx2 interacts with the zero population growth (zpg) gene, which encodes a germline-specific gap junction protein. These results indicate a multifunctional role for Inx2 gap junctions in somatic support cells in the regulation of early germ cell survival, cyst formation and egg chamber formation. Inx2 gap junctions may mediate the transfer of nutrients and signal molecules between germ cells and somatic support cells, as well as play a role in the regulation of cell adhesion. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  14. BMP signalling in human fetal ovary somatic cells is modulated in a gene-specific fashion by GREM1 and GREM2

    PubMed Central

    Bayne, Rosemary A.; Donnachie, Douglas J.; Kinnell, Hazel L.; Childs, Andrew J.; Anderson, Richard A.

    2016-01-01

    STUDY QUESTION Do changes in the expression of bone morphogenetic proteins (BMPs) 2 and 4, and their antagonists Gremlin1 (GREM1) and Gremlin2 (GREM2) during human fetal ovarian development impact on BMP pathway activity and lead to changes in gene expression that may influence the fate and/or function of ovarian somatic cells? STUDY FINDING BMPs 2 and 4 differentially regulate gene expression in cultured human fetal ovarian somatic cells. Expression of some, but not all BMP target genes is antagonised by GREM1 and GREM2, indicating the existence of a mechanism to fine-tune BMP signal intensity in the ovary. Leucine-rich repeat-containing G-protein coupled receptor 5 (LGR5), a marker of immature ovarian somatic cells, is identified as a novel transcriptional target of BMP4. WHAT IS KNOWN ALREADY Extensive re-organisation of the germ and somatic cell populations in the feto-neonatal ovary culminates in the formation of primordial follicles, which provide the basis for a female's future fertility. BMP growth factors play important roles at many stages of ovarian development and function. GREM1, an extracellular antagonist of BMP signalling, regulates the timing of primordial follicle formation in the mouse ovary, and mRNA levels of BMP4 decrease while those of BMP2 increase prior to follicle formation in the human fetal ovary. STUDY DESIGN, SAMPLES/MATERIALS, METHODS Expression of genes encoding BMP pathway components, BMP antagonists and markers of ovarian somatic cells were determined by quantitative (q)RT-PCR in human fetal ovaries (from 8 to 21 weeks gestation) and fetal ovary-derived somatic cell cultures. Ovarian expression of GREM1 protein was confirmed by immunoblotting. Primary human fetal ovarian somatic cell cultures were derived from disaggregated ovaries by differential adhesion and cultured in the presence of recombinant human BMP2 or BMP4, with or without the addition of GREM1 or GREM2. MAIN RESULTS AND THE ROLE OF CHANCE We demonstrate that the expression of BMP antagonists GREM1, GREM2 and CHRD  increases in the lead-up to primordial follicle formation in the human fetal ovary, and that the BMP pathway is active in cultured ovarian somatic cells. This leads to differential changes in the expression of a number of genes, some of which are further modulated by GREM1 and/or GREM2. The positive transcriptional regulation of LGR5 (a marker of less differentiated somatic cells) by BMP4 in vitro suggests that increasing levels of GREM1 and reduced levels of BMP4 as the ovary develops in vivo may act to reduce LGR5 levels and allow pre-granulosa cell differentiation. LIMITATIONS, REASONS FOR CAUTION While we have demonstrated that markers of different somatic cell types are expressed in the cultured ovarian somatic cells, their proportions may not represent the same cells in the intact ovary which also contains germ cells. WIDER IMPLICATIONS OF THE FINDINGS This study extends previous work identifying germ cells as targets of ovarian BMP signalling, and suggests BMPs may regulate the development of both germ and somatic cells in the developing ovary around the time of follicle formation. LARGE SCALE DATA Not applicable. STUDY FUNDING/COMPETING INTERESTS This work was supported by The UK Medical Research Council (Grant No.: G1100357 to RAA), and Medical Research Scotland (Grant No. 345FRG to AJC). The authors have no competing interests to declare. PMID:27385727

  15. BMP signalling in human fetal ovary somatic cells is modulated in a gene-specific fashion by GREM1 and GREM2.

    PubMed

    Bayne, Rosemary A; Donnachie, Douglas J; Kinnell, Hazel L; Childs, Andrew J; Anderson, Richard A

    2016-09-01

    Do changes in the expression of bone morphogenetic proteins (BMPs) 2 and 4, and their antagonists Gremlin1 (GREM1) and Gremlin2 (GREM2) during human fetal ovarian development impact on BMP pathway activity and lead to changes in gene expression that may influence the fate and/or function of ovarian somatic cells? BMPs 2 and 4 differentially regulate gene expression in cultured human fetal ovarian somatic cells. Expression of some, but not all BMP target genes is antagonised by GREM1 and GREM2, indicating the existence of a mechanism to fine-tune BMP signal intensity in the ovary. Leucine-rich repeat-containing G-protein coupled receptor 5 (LGR5), a marker of immature ovarian somatic cells, is identified as a novel transcriptional target of BMP4. Extensive re-organisation of the germ and somatic cell populations in the feto-neonatal ovary culminates in the formation of primordial follicles, which provide the basis for a female's future fertility. BMP growth factors play important roles at many stages of ovarian development and function. GREM1, an extracellular antagonist of BMP signalling, regulates the timing of primordial follicle formation in the mouse ovary, and mRNA levels of BMP4 decrease while those of BMP2 increase prior to follicle formation in the human fetal ovary. Expression of genes encoding BMP pathway components, BMP antagonists and markers of ovarian somatic cells were determined by quantitative (q)RT-PCR in human fetal ovaries (from 8 to 21 weeks gestation) and fetal ovary-derived somatic cell cultures. Ovarian expression of GREM1 protein was confirmed by immunoblotting. Primary human fetal ovarian somatic cell cultures were derived from disaggregated ovaries by differential adhesion and cultured in the presence of recombinant human BMP2 or BMP4, with or without the addition of GREM1 or GREM2. We demonstrate that the expression of BMP antagonists GREM1, GREM2 and CHRD  increases in the lead-up to primordial follicle formation in the human fetal ovary, and that the BMP pathway is active in cultured ovarian somatic cells. This leads to differential changes in the expression of a number of genes, some of which are further modulated by GREM1 and/or GREM2. The positive transcriptional regulation of LGR5 (a marker of less differentiated somatic cells) by BMP4 in vitro suggests that increasing levels of GREM1 and reduced levels of BMP4 as the ovary develops in vivo may act to reduce LGR5 levels and allow pre-granulosa cell differentiation. While we have demonstrated that markers of different somatic cell types are expressed in the cultured ovarian somatic cells, their proportions may not represent the same cells in the intact ovary which also contains germ cells. This study extends previous work identifying germ cells as targets of ovarian BMP signalling, and suggests BMPs may regulate the development of both germ and somatic cells in the developing ovary around the time of follicle formation. Not applicable. This work was supported by The UK Medical Research Council (Grant No.: G1100357 to RAA), and Medical Research Scotland (Grant No. 345FRG to AJC). The authors have no competing interests to declare. © The Author 2016. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology.

  16. Multicellularity makes somatic differentiation evolutionarily stable

    PubMed Central

    Wahl, Mary E.; Murray, Andrew W.

    2016-01-01

    Many multicellular organisms produce two cell lineages: germ cells, whose descendants produce the next generation, and somatic cells, which support, protect, and disperse the germ cells. This germ-soma demarcation has evolved independently in dozens of multicellular taxa but is absent in unicellular species. A common explanation holds that in these organisms, inefficient intercellular nutrient exchange compels the fitness cost of producing nonreproductive somatic cells to outweigh any potential benefits. We propose instead that the absence of unicellular, soma-producing populations reflects their susceptibility to invasion by nondifferentiating mutants that ultimately eradicate the soma-producing lineage. We argue that multicellularity can prevent the victory of such mutants by giving germ cells preferential access to the benefits conferred by somatic cells. The absence of natural unicellular, soma-producing species previously prevented these hypotheses from being directly tested in vivo: to overcome this obstacle, we engineered strains of the budding yeast Saccharomyces cerevisiae that differ only in the presence or absence of multicellularity and somatic differentiation, permitting direct comparisons between organisms with different lifestyles. Our strains implement the essential features of irreversible conversion from germ line to soma, reproductive division of labor, and clonal multicellularity while maintaining sufficient generality to permit broad extension of our conclusions. Our somatic cells can provide fitness benefits that exceed the reproductive costs of their production, even in unicellular strains. We find that nondifferentiating mutants overtake unicellular populations but are outcompeted by multicellular, soma-producing strains, suggesting that multicellularity confers evolutionary stability to somatic differentiation. PMID:27402737

  17. Inflorescence proliferation for somatic embryogenesis induction and suspension-derived plant regeneration from banana (Musa AAA, cv. 'Dwarf Cavendish') male flowers.

    PubMed

    Pérez-Hernández, Juan Bernardo; Rosell-García, Purificación

    2008-06-01

    Availability of explants with adequate embryogenic competence is one of the most important limitations for the development of regenerable cell suspensions in banana. To increase the number and ease of accessibility to potentially embryogenic explants, a novel methodology is described by which young male flower clusters isolated from adult plants are induced to form new flower buds and proliferate in vitro. Different concentrations of the plant growth regulator thidiazuron (TDZ) induced inflorescence proliferation, which could be maintained over time as a continuous source of young flower buds. Intensity of proliferation was evaluated during successive subcultures. At the third cycle of proliferation, the highest multiplication rate (2.89) was obtained on the medium containing 5 microM TDZ. Newly generated floral tissues were assessed for embryogenic competence, resulting in an average embryogenic frequency of 12.5%. The observed embryogenic capacity, together with the recurrent availability of immature flowers, allowed for the direct initiation of cell suspensions from bulked explant cultures. Regular observation and regeneration tests during the development of suspended cell cultures confirmed their embryogenic condition. Produced embryos successfully matured and germinated to regenerate hundreds of somatic in vitro plants.

  18. Germ cell regeneration-mediated, enhanced mutagenesis in the ascidian Ciona intestinalis reveals flexible germ cell formation from different somatic cells.

    PubMed

    Yoshida, Keita; Hozumi, Akiko; Treen, Nicholas; Sakuma, Tetsushi; Yamamoto, Takashi; Shirae-Kurabayashi, Maki; Sasakura, Yasunori

    2017-03-15

    The ascidian Ciona intestinalis has a high regeneration capacity that enables the regeneration of artificially removed primordial germ cells (PGCs) from somatic cells. We utilized PGC regeneration to establish efficient methods of germ line mutagenesis with transcription activator-like effector nucleases (TALENs). When PGCs were artificially removed from animals in which a TALEN pair was expressed, somatic cells harboring mutations in the target gene were converted into germ cells, this germ cell population exhibited higher mutation rates than animals not subjected to PGC removal. PGC regeneration enables us to use TALEN expression vectors of specific somatic tissues for germ cell mutagenesis. Unexpectedly, cis elements for epidermis, neural tissue and muscle could be used for germ cell mutagenesis, indicating there are multiple sources of regenerated PGCs, suggesting a flexibility of differentiated Ciona somatic cells to regain totipotency. Sperm and eggs of a single hermaphroditic, PGC regenerated animal typically have different mutations, suggesting they arise from different cells. PGCs can be generated from somatic cells even though the maternal PGCs are not removed, suggesting that the PGC regeneration is not solely an artificial event but could have an endogenous function in Ciona. This study provides a technical innovation in the genome-editing methods, including easy establishment of mutant lines. Moreover, this study suggests cellular mechanisms and the potential evolutionary significance of PGC regeneration in Ciona. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. High stability of nuclear microsatellite loci during the early stages of somatic embryogenesis in Norway spruce.

    PubMed

    Helmersson, Andreas; von Arnold, Sara; Burg, Kornel; Bozhkov, Peter V

    2004-10-01

    Somatic embryos of Norway spruce (Picea abies (L.) Karst.) differentiate from proembryogenic masses (PEMs), which are subject to autodestruction through programmed cell death. In PEMs, somatic embryo formation and activation of programmed cell death are interrelated processes. We sought to determine if activation of programmed cell death in PEMs is caused by genetic aberrations during somatic embryogenesis. Based on the finding that withdrawal of auxin and cytokinin induces programmed cell death in PEMs, 1-week-old cell suspensions were cultured in medium either with or without auxin and cytokinin and then transferred to maturation medium containing abscisic acid. We analyzed the stability of three nuclear simple sequence repeat (SSR) microsatellite markers at successive stages of somatic embryogenesis in two cell lines. There were no mutations at the SSR loci at any of the successive developmental stages from PEMs to cotyledonary embryos, irrespective of whether or not the proliferation medium in which cell suspensions had been cultured contained auxin or cytokinin. The morphologies of plants regenerated from the cultures were similar, although withdrawal of auxin and cytokinin significantly stimulated the yield of both embryos and plants. We conclude, therefore, that the high genetic stability of somatic embryos in Norway spruce is unaffected by the induction of programmed cell death caused by withdrawal of auxin and cytokinin.

  20. Impact of Somatic Mutations in the D-Loop of Mitochondrial DNA on the Survival of Oral Squamous Cell Carcinoma Patients

    PubMed Central

    Lin, Jin-Ching; Wang, Chen-Chi; Jiang, Rong-San; Wang, Wen-Yi; Liu, Shih-An

    2015-01-01

    Objectives The aim of this study was to investigate somatic mutations in the D-loop of mitochondrial DNA (mtDNA) and their impact on survival in oral squamous cell carcinoma patients. Materials and Methods Surgical specimen confirmed by pathological examination and corresponding non-cancerous tissues were collected from 120 oral squamous cell carcinoma patients. The sequence in the D-loop of mtDNA from non-cancerous tissues was compared with that from paired cancer samples and any sequence differences were recognized as somatic mutations. Results Somatic mutations in the D-loop of mtDNA were identified in 75 (62.5%) oral squamous cell carcinoma patients and most of them occurred in the poly-C tract. Although there were no significant differences in demographic and tumor-related features between participants with and without somatic mutation, the mutation group had a better survival rate (5 year disease-specific survival rate: 64.0% vs. 43.0%, P = 0.0266). Conclusion Somatic mutation in D-loop of mtDNA was associated with a better survival in oral squamous cell carcinoma patients. PMID:25906372

  1. L1-associated genomic regions are deleted in somatic cells of the healthy human brain.

    PubMed

    Erwin, Jennifer A; Paquola, Apuã C M; Singer, Tatjana; Gallina, Iryna; Novotny, Mark; Quayle, Carolina; Bedrosian, Tracy A; Alves, Francisco I A; Butcher, Cheyenne R; Herdy, Joseph R; Sarkar, Anindita; Lasken, Roger S; Muotri, Alysson R; Gage, Fred H

    2016-12-01

    The healthy human brain is a mosaic of varied genomes. Long interspersed element-1 (LINE-1 or L1) retrotransposition is known to create mosaicism by inserting L1 sequences into new locations of somatic cell genomes. Using a machine learning-based, single-cell sequencing approach, we discovered that somatic L1-associated variants (SLAVs) are composed of two classes: L1 retrotransposition insertions and retrotransposition-independent L1-associated variants. We demonstrate that a subset of SLAVs comprises somatic deletions generated by L1 endonuclease cutting activity. Retrotransposition-independent rearrangements in inherited L1s resulted in the deletion of proximal genomic regions. These rearrangements were resolved by microhomology-mediated repair, which suggests that L1-associated genomic regions are hotspots for somatic copy number variants in the brain and therefore a heritable genetic contributor to somatic mosaicism. We demonstrate that SLAVs are present in crucial neural genes, such as DLG2 (also called PSD93), and affect 44-63% of cells of the cells in the healthy brain.

  2. Identification and structural characterization of a new pro-apoptotic cyclic octapeptide cyclosaplin from somatic seedlings of Santalum album L.

    PubMed

    Mishra, Abheepsa; Gauri, Samiran S; Mukhopadhyay, Sourav K; Chatterjee, Soumya; Das, Shibendu S; Mandal, Santi M; Dey, Satyahari

    2014-04-01

    Small cyclic peptides exhibiting potent biological activity have great potential for anticancer therapy. An antiproliferative cyclic octapeptide, cyclosaplin was purified from somatic seedlings of Santalum album L. (sandalwood) using gel filtration and RP-HPLC separation process. The molecular mass of purified peptide was found to be 858 Da and the sequence was determined by MALDI-ToF-PSD-MS as 'RLGDGCTR' (cyclic). The cytotoxic activity of the peptide was tested against human breast cancer (MDA-MB-231) cell line in a dose and time-dependent manner. The purified peptide exhibited significant antiproliferative activity with an IC50 2.06 μg/mL. In a mechanistic approach, apoptosis was observed in differential microscopic studies for peptide treated MDA-MB-231 cells, which was further confirmed by mitochondrial membrane potential, DNA fragmentation assay, cell cycle analysis and caspase 3 activities. The modeling and docking experiments revealed strong affinity (kcal/mol) of peptide toward EGFR and procaspase 3. The co-localization studies revealed that the peptide sensitizes MDA-MB-231 cells by possibly binding to EGFR and induces apoptosis. This unique cyclic octapeptide revealed to be a favorable candidate for development of anticancer agents. Copyright © 2014 Elsevier Inc. All rights reserved.

  3. Establishment and Characterization of a Testicular Cell Line from the Half-Smooth Tongue Sole, Cynoglossus semilaevis

    PubMed Central

    Zhang, Bo; Wang, Xianli; Sha, Zhenxia; Yang, Changgeng; Liu, Shanshan; Wang, Na; Chen, Song-Lin

    2011-01-01

    Spermatogenesis within the adult testis is an excellent system for studying stem cell renewal and differentiation, which is under the control of testicular somatic cells. In order to understanding spermatogenesis in the half-smooth tongue sole (Cynoglossus semilaevis) as a marine fish model of aquaculture importance, we established a cell line called CSGC from a juvenile gonad of this organism. CSGC is composed of fibroblast-like cells, retains a diploid karyotype of 42 chromosomes, lacks the heterogametic W chromosome, lacks a female specific marker and expresses the dmrt, a marker for testicular somatic cells. Therefore, CSGC appears to consist of testicular somatic cell cells. We show that this cell line is effective for infection by the turbot reddish body iridovirus and flounder lymphocystis disease virus as evidenced by the appearance of cytopathic effect and virus propagation in the virus-infected cells, and most convincingly, the observation of viral particles by electon microscopy, demonstrateing that CSGC is suitable to study interactions between virus and host cells. As a first fish testicular somatic cell line of the ZZ-ZW genetic sex determination system, CSGC will be a useful tool to study sex-related events and interactions between somatic cells and germ cells during spermatogenesis. PMID:21547062

  4. Cellular Mechanisms of Somatic Stem Cell Aging

    PubMed Central

    Jung, Yunjoon

    2014-01-01

    Tissue homeostasis and regenerative capacity rely on rare populations of somatic stem cells endowed with the potential to self-renew and differentiate. During aging, many tissues show a decline in regenerative potential coupled with a loss of stem cell function. Cells including somatic stem cells have evolved a series of checks and balances to sense and repair cellular damage to maximize tissue function. However, during aging the mechanisms that protect normal cell function begin to fail. In this review, we will discuss how common cellular mechanisms that maintain tissue fidelity and organismal lifespan impact somatic stem cell function. We will highlight context-dependent changes and commonalities that define aging, by focusing on three age-sensitive stem cell compartments: blood, neural, and muscle. Understanding the interaction between extrinsic regulators and intrinsic effectors that operate within different stem cell compartments is likely to have important implications for identifying strategies to improve health span and treat age-related degenerative diseases. PMID:24439814

  5. Oncogenic Signaling Pathways in The Cancer Genome Atlas.

    PubMed

    Sanchez-Vega, Francisco; Mina, Marco; Armenia, Joshua; Chatila, Walid K; Luna, Augustin; La, Konnor C; Dimitriadoy, Sofia; Liu, David L; Kantheti, Havish S; Saghafinia, Sadegh; Chakravarty, Debyani; Daian, Foysal; Gao, Qingsong; Bailey, Matthew H; Liang, Wen-Wei; Foltz, Steven M; Shmulevich, Ilya; Ding, Li; Heins, Zachary; Ochoa, Angelica; Gross, Benjamin; Gao, Jianjiong; Zhang, Hongxin; Kundra, Ritika; Kandoth, Cyriac; Bahceci, Istemi; Dervishi, Leonard; Dogrusoz, Ugur; Zhou, Wanding; Shen, Hui; Laird, Peter W; Way, Gregory P; Greene, Casey S; Liang, Han; Xiao, Yonghong; Wang, Chen; Iavarone, Antonio; Berger, Alice H; Bivona, Trever G; Lazar, Alexander J; Hammer, Gary D; Giordano, Thomas; Kwong, Lawrence N; McArthur, Grant; Huang, Chenfei; Tward, Aaron D; Frederick, Mitchell J; McCormick, Frank; Meyerson, Matthew; Van Allen, Eliezer M; Cherniack, Andrew D; Ciriello, Giovanni; Sander, Chris; Schultz, Nikolaus

    2018-04-05

    Genetic alterations in signaling pathways that control cell-cycle progression, apoptosis, and cell growth are common hallmarks of cancer, but the extent, mechanisms, and co-occurrence of alterations in these pathways differ between individual tumors and tumor types. Using mutations, copy-number changes, mRNA expression, gene fusions and DNA methylation in 9,125 tumors profiled by The Cancer Genome Atlas (TCGA), we analyzed the mechanisms and patterns of somatic alterations in ten canonical pathways: cell cycle, Hippo, Myc, Notch, Nrf2, PI-3-Kinase/Akt, RTK-RAS, TGFβ signaling, p53 and β-catenin/Wnt. We charted the detailed landscape of pathway alterations in 33 cancer types, stratified into 64 subtypes, and identified patterns of co-occurrence and mutual exclusivity. Eighty-nine percent of tumors had at least one driver alteration in these pathways, and 57% percent of tumors had at least one alteration potentially targetable by currently available drugs. Thirty percent of tumors had multiple targetable alterations, indicating opportunities for combination therapy. Copyright © 2018. Published by Elsevier Inc.

  6. Cell cycle arrest in plants: what distinguishes quiescence, dormancy and differentiated G1?

    PubMed

    Velappan, Yazhini; Signorelli, Santiago; Considine, Michael J

    2017-10-17

    Quiescence is a fundamental feature of plant life, which enables plasticity, renewal and fidelity of the somatic cell line. Cellular quiescence is defined by arrest in a particular phase of the cell cycle, typically G1 or G2; however, the regulation of quiescence and proliferation can also be considered across wider scales in space and time. As such, quiescence is a defining feature of plant development and phenology, from meristematic stem cell progenitors to terminally differentiated cells, as well as dormant or suppressed seeds and buds. While the physiology of each of these states differs considerably, each is referred to as 'cell cycle arrest' or 'G1 arrest'. Here the physiology and molecular regulation of (1) meristematic quiescence, (2) dormancy and (3) terminal differentiation (cell cycle exit) are considered in order to determine whether and how the molecular decisions guiding these nuclear states are distinct. A brief overview of the canonical cell cycle regulators is provided, and the genetic and genomic, as well as physiological, evidence is considered regarding two primary questions: (1) Are the canonical cell cycle regulators superior or subordinate in the regulation of quiescence? (2) Are these three modes of quiescence governed by distinct molecular controls? Meristematic quiescence, dormancy and terminal differentiation are each predominantly characterized by G1 arrest but regulated distinctly, at a level largely superior to the canonical cell cycle. Meristematic quiescence is intrinsically linked to non-cell-autonomous regulation of meristem cell identity, and particularly through the influence of ubiquitin-dependent proteolysis, in partnership with reactive oxygen species, abscisic acid and auxin. The regulation of terminal differentiation shares analogous features with meristematic quiescence, albeit with specific activators and a greater role for cytokinin signalling. Dormancy meanwhile appears to be regulated at the level of chromatin accessibility, by Polycomb group-type histone modifications of particular dormancy genes. © The Author 2017. Published by Oxford University Press on behalf of the Annals of Botany Company. All rights reserved. For Permissions, please email: journals.permissions@oup.com

  7. Cloning mice and ES cells by nuclear transfer from somatic stem cells and fully differentiated cells.

    PubMed

    Wang, Zhongde

    2011-01-01

    Cloning animals by nuclear transfer (NT) has been successful in several mammalian species. In addition to cloning live animals (reproductive cloning), this technique has also been used in several species to establish cloned embryonic stem (ntES) cell lines from somatic cells. It is the latter application of this technique that has been heralded as being the potential means to produce isogenic embryonic stem cells from patients for cell therapy (therapeutic cloning). These two types of cloning differ only in the steps after cloned embryos are produced: for reproductive cloning the cloned embryos are transferred to surrogate mothers to allow them to develop to full term and for therapeutic cloning the cloned embryos are used to derive ntES cells. In this chapter, a detailed NT protocol in mouse by using somatic stem cells (neuron and skin stem cells) and fully differentiated somatic cells (cumulus cells and fibroblast cells) as nuclear donors is described.

  8. Differentiated cells are more efficient than adult stem cells for cloning by somatic cell nuclear transfer.

    PubMed

    Sung, Li-Ying; Gao, Shaorong; Shen, Hongmei; Yu, Hui; Song, Yifang; Smith, Sadie L; Chang, Ching-Chien; Inoue, Kimiko; Kuo, Lynn; Lian, Jin; Li, Ao; Tian, X Cindy; Tuck, David P; Weissman, Sherman M; Yang, Xiangzhong; Cheng, Tao

    2006-11-01

    Since the creation of Dolly via somatic cell nuclear transfer (SCNT), more than a dozen species of mammals have been cloned using this technology. One hypothesis for the limited success of cloning via SCNT (1%-5%) is that the clones are likely to be derived from adult stem cells. Support for this hypothesis comes from the findings that the reproductive cloning efficiency for embryonic stem cells is five to ten times higher than that for somatic cells as donors and that cloned pups cannot be produced directly from cloned embryos derived from differentiated B and T cells or neuronal cells. The question remains as to whether SCNT-derived animal clones can be derived from truly differentiated somatic cells. We tested this hypothesis with mouse hematopoietic cells at different differentiation stages: hematopoietic stem cells, progenitor cells and granulocytes. We found that cloning efficiency increases over the differentiation hierarchy, and terminally differentiated postmitotic granulocytes yield cloned pups with the greatest cloning efficiency.

  9. Producing primate embryonic stem cells by somatic cell nuclear transfer.

    PubMed

    Byrne, J A; Pedersen, D A; Clepper, L L; Nelson, M; Sanger, W G; Gokhale, S; Wolf, D P; Mitalipov, S M

    2007-11-22

    Derivation of embryonic stem (ES) cells genetically identical to a patient by somatic cell nuclear transfer (SCNT) holds the potential to cure or alleviate the symptoms of many degenerative diseases while circumventing concerns regarding rejection by the host immune system. However, the concept has only been achieved in the mouse, whereas inefficient reprogramming and poor embryonic development characterizes the results obtained in primates. Here, we used a modified SCNT approach to produce rhesus macaque blastocysts from adult skin fibroblasts, and successfully isolated two ES cell lines from these embryos. DNA analysis confirmed that nuclear DNA was identical to donor somatic cells and that mitochondrial DNA originated from oocytes. Both cell lines exhibited normal ES cell morphology, expressed key stem-cell markers, were transcriptionally similar to control ES cells and differentiated into multiple cell types in vitro and in vivo. Our results represent successful nuclear reprogramming of adult somatic cells into pluripotent ES cells and demonstrate proof-of-concept for therapeutic cloning in primates.

  10. Axonal properties determine somatic firing in a model of in vitro CA1 hippocampal sharp wave/ripples and persistent gamma oscillations

    PubMed Central

    Traub, Roger D.; Schmitz, Dietmar; Maier, Nikolaus; Whittington, Miles A.; Draguhn, Andreas

    2012-01-01

    Evidence has been presented that CA1 pyramidal cells, during spontaneous in vitro sharp wave/ripple (SPW-R) complexes, generate somatic action potentials that originate in axons. ‘Participating’ (somatically firing) pyramidal cells fire (almost always) at most once during a particular SPW-R whereas non-participating cells virtually never fire during an SPW-R. Somatic spikelets were small or absent, while ripple-frequency EPSCs and IPSCs occurred during the SPW-R in pyramidal neurons. These experimental findings could be replicated with a network model in which electrical coupling was present between small pyramidal cell axonal branches. Here, we explore this model in more depth. Factors that influence somatic participation include: (i) the diameter of axonal branches that contain coupling sites to other axons, because firing in larger branches injects more current into the main axon, increasing antidromic firing probability; (ii) axonal K+ currents; and (iii) somatic hyperpolarization and shunting. We predict that portions of axons fire at high frequency during SPW-R, while somata fire much less. In the model, somatic firing can occur by occasional generation of full action potentials in proximal axonal branches, which are excited by high-frequency spikelets. When the network contains phasic synaptic inhibition, at the axonal gap junction site, gamma oscillations result, again with more frequent axonal firing than somatic firing. Combining the models, so as to generate gamma followed by sharp waves, leads to strong overlap between the population of cells firing during gamma the population of cells firing during a subsequent sharp wave, as observed in vivo. PMID:22697272

  11. Peptide promotes overcoming of the division limit in human somatic cell.

    PubMed

    Khavinson, V Kh; Bondarev, I E; Butyugov, A A; Smirnova, T D

    2004-05-01

    We previously showed that treatment of normal human diploid cells with Epithalon (Ala-Glu-Asp-Gly) induced expression of telomerase catalytic subunit, its enzymatic activity, and elongation of telomeres. Here we studied the effect of this peptide on proliferative potential of human fetal fibroblasts. Primary pulmonary fibroblasts derived from a 24-week fetus lost the proliferative potential at the 34th passage. The mean size of telomeres in these cells was appreciably lower than during early passages (passage 10). Addition of Epithalon to aging cells in culture induced elongation of telomeres to the size comparable to their length during early passages. Peptide-treated cells with elongated telomeres made 10 extra divisions (44 passages) in comparison with the control and continued dividing. Hence, Epithalon prolonged the vital cycle of normal human cells due to overcoming the Heyflick limit.

  12. Differential expression of conserved germ line markers and delayed segregation of male and female primordial germ cells in a hermaphrodite, the leech helobdella.

    PubMed

    Cho, Sung-Jin; Vallès, Yvonne; Weisblat, David A

    2014-02-01

    In sexually reproducing animals, primordial germ cells (PGCs) are often set aside early in embryogenesis, a strategy that minimizes the risk of genomic damage associated with replication and mitosis during the cell cycle. Here, we have used germ line markers (piwi, vasa, and nanos) and microinjected cell lineage tracers to show that PGC specification in the leech genus Helobdella follows a different scenario: in this hermaphrodite, the male and female PGCs segregate from somatic lineages only after more than 20 rounds of zygotic mitosis; the male and female PGCs share the same (mesodermal) cell lineage for 19 rounds of zygotic mitosis. Moreover, while all three markers are expressed in both male and female reproductive tissues of the adult, they are expressed differentially between the male and female PGCs of the developing embryo: piwi and vasa are expressed preferentially in female PGCs at a time when nanos is expressed preferentially in male PGCs. A priori, the delayed segregation of male and female PGCs from somatic tissues and from one another increases the probability of mutations affecting both male and female PGCs of a given individual. We speculate that this suite of features, combined with a capacity for self-fertilization, may contribute to the dramatically rearranged genome of Helobdella robusta relative to other animals.

  13. Differential Expression of Conserved Germ Line Markers and Delayed Segregation of Male and Female Primordial Germ Cells in a Hermaphrodite, the Leech Helobdella

    PubMed Central

    Cho, Sung-Jin; Vallès, Yvonne; Weisblat, David A.

    2014-01-01

    In sexually reproducing animals, primordial germ cells (PGCs) are often set aside early in embryogenesis, a strategy that minimizes the risk of genomic damage associated with replication and mitosis during the cell cycle. Here, we have used germ line markers (piwi, vasa, and nanos) and microinjected cell lineage tracers to show that PGC specification in the leech genus Helobdella follows a different scenario: in this hermaphrodite, the male and female PGCs segregate from somatic lineages only after more than 20 rounds of zygotic mitosis; the male and female PGCs share the same (mesodermal) cell lineage for 19 rounds of zygotic mitosis. Moreover, while all three markers are expressed in both male and female reproductive tissues of the adult, they are expressed differentially between the male and female PGCs of the developing embryo: piwi and vasa are expressed preferentially in female PGCs at a time when nanos is expressed preferentially in male PGCs. A priori, the delayed segregation of male and female PGCs from somatic tissues and from one another increases the probability of mutations affecting both male and female PGCs of a given individual. We speculate that this suite of features, combined with a capacity for self-fertilization, may contribute to the dramatically rearranged genome of Helobdella robusta relative to other animals. PMID:24217283

  14. Additional mitochondrial DNA influences the interactions between the nuclear and mitochondrial genomes in a bovine embryo model of nuclear transfer.

    PubMed

    Srirattana, Kanokwan; St John, Justin C

    2018-05-08

    We generated cattle embryos using mitochondrial supplementation and somatic cell nuclear transfer (SCNT), named miNT, to determine how additional mitochondrial DNA (mtDNA) modulates the nuclear genome. To eliminate any confounding effects from somatic cell mtDNA in intraspecies SCNT, donor cell mtDNA was depleted prior to embryo production. Additional oocyte mtDNA did not affect embryo development rates but increased mtDNA copy number in blastocyst stage embryos. Moreover, miNT-derived blastocysts had different gene expression profiles when compared with SCNT-derived blastocysts. Additional mtDNA increased expression levels of genes involved in oxidative phosphorylation, cell cycle and DNA repair. Supplementing the embryo culture media with a histone deacetylase inhibitor, Trichostatin A (TSA), had no beneficial effects on the development of miNT-derived embryos, unlike SCNT-derived embryos. When compared with SCNT-derived blastocysts cultured in the presence of TSA, additional mtDNA alone had beneficial effects as the activity of glycolysis may increase and embryonic cell death may decrease. However, these beneficial effects were not found with additional mtDNA and TSA together, suggesting that additional mtDNA alone enhances reprogramming. In conclusion, additional mtDNA increased mtDNA copy number and expression levels of genes involved in energy production and embryo development in blastocyst stage embryos emphasising the importance of nuclear-mitochondrial interactions.

  15. Expansion of Genes Encoding piRNA-Associated Argonaute Proteins in the Pea Aphid: Diversification of Expression Profiles in Different Plastic Morphs

    PubMed Central

    Lu, Hsiao-ling; Tanguy, Sylvie; Rispe, Claude; Gauthier, Jean-Pierre; Walsh, Tom; Gordon, Karl; Edwards, Owain; Tagu, Denis; Chang, Chun-che; Jaubert-Possamai, Stéphanie

    2011-01-01

    Piwi-interacting RNAs (piRNAs) are known to regulate transposon activity in germ cells of several animal models that propagate sexually. However, the role of piRNAs during asexual reproduction remains almost unknown. Aphids that can alternate sexual and asexual reproduction cycles in response to seasonal changes of photoperiod provide a unique opportunity to study piRNAs and the piRNA pathway in both reproductive modes. Taking advantage of the recently sequenced genome of the pea aphid Acyrthosiphon pisum, we found an unusually large lineage-specific expansion of genes encoding the Piwi sub-clade of Argonaute proteins. In situ hybridisation showed differential expressions between the duplicated piwi copies: while Api-piwi2 and Api-piwi6 are “specialised” in germ cells their most closely related copy, respectively Api-piwi5 and Api-piwi3, are expressed in the somatic cells. The differential expression was also identified in duplicated ago3: Api-ago3a in germ cells and Api-ago3b in somatic cells. Moreover, analyses of expression profiles of the expanded piwi and ago3 genes by semi-quantitative RT-PCR showed that expressions varied according to the reproductive types. These specific expression patterns suggest that expanded aphid piwi and ago3 genes have distinct roles in asexual and sexual reproduction. PMID:22162754

  16. The value of frozen cartilage tissues without cryoprotection for genetic conservation.

    PubMed

    Cetinkaya, Gaye; Hatipoglu, Ibrahim; Arat, Sezen

    2014-02-01

    Animal tissues frozen without cryoprotection are thought to be inappropriate for use as a donor for somatic cell nuclear transfer (SCNT) studies. Cells in tissues that have been frozen without a cryoprotectant are commonly thought to be dead or to have lost genomic integrity. However, in this study we show that the frozen auricular cartilage tissues of anatolian buffalo contain a considerable number of viable healthy cells. The cells in auricular cartilage tissues are resistant to cryo-injury at -80°C. Primary cell cultures were established from defrosted ear tissues which were frozen without cryoprotectant. The growth and functional characteristics of primary cell cultures are characterized according to cell growth curve, cell cycle analysis, karyotype and GAG synthesis. The results indicate that frozen cartilage tissues could be valuable materials for the conservation of species and SCNT technology. Copyright © 2013 Elsevier Inc. All rights reserved.

  17. The use of centrifugation to study early Drosophila embryogenesis

    NASA Technical Reports Server (NTRS)

    Abbott, M. K.; Spooner, B. S. (Principal Investigator)

    1993-01-01

    By the end of 10th nuclear cycle, the somatic nuclei of the Drosophila embryo have migrated to the periphery of the egg. Centrifugation of embryos did not result in the displacement of these nuclei, since cytoskeletal elements anchor them to the cortex. But, mild centrifugal forces displace the centrally located, nascent yolk nuclei. If this increased sensitivity to hypergravity occurs before the beginning of nuclear differentiation during cycle 8, when the nascent yolk and somatic nuclei physically separate, then it would mark the earliest functional difference between these two lineages.

  18. Hexavalent chromium induces apoptosis in male somatic and spermatogonial stem cells via redox imbalance

    PubMed Central

    Das, Joydeep; Kang, Min-Hee; Kim, Eunsu; Kwon, Deug-Nam; Choi, Yun-Jung; Kim, Jin-Hoi

    2015-01-01

    Hexavalent chromium [Cr(VI)], an environmental toxicant, causes severe male reproductive abnormalities. However, the actual mechanisms of toxicity are not clearly understood and have not been studied in detail. The present in vitro study aimed to investigate the mechanism of reproductive toxicity of Cr(VI) in male somatic cells (mouse TM3 Leydig cells and TM4 Sertoli cells) and spermatogonial stem cells (SSCs) because damage to or dysfunction of these cells can directly affect spermatogenesis, resulting in male infertility. Cr(VI) by inducing oxidative stress was cytotoxic to both male somatic cells and SSCs in a dose-dependent manner, and induced mitochondria-dependent apoptosis. Although the mechanism of Cr(VI)-induced cytotoxicity was similar in both somatic cells, the differences in sensitivity of TM3 and TM4 cells to Cr(VI) could be attributed, at least in part, to cell-specific regulation of P-AKT1, P-ERK1/2, and P-P53 proteins. Cr(VI) affected the differentiation and self-renewal mechanisms of SSCs, disrupted steroidogenesis in TM3 cells, while in TM4 cells, the expression of tight junction signaling and cell receptor molecules was affected as well as the secretory functions were impaired. In conclusion, our results show that Cr(VI) is cytotoxic and impairs the physiological functions of male somatic cells and SSCs. PMID:26355036

  19. Manipulation of a quasi-natural cell block for high-efficiency transplantation of adherent somatic cells

    PubMed Central

    Chung, H.J.; Hassan, M.M.; Park, J.O.; Kim, H.J.; Hong, S.T.

    2015-01-01

    Recent advances have raised hope that transplantation of adherent somatic cells could provide dramatic new therapies for various diseases. However, current methods for transplanting adherent somatic cells are not efficient enough for therapeutic applications. Here, we report the development of a novel method to generate quasi-natural cell blocks for high-efficiency transplantation of adherent somatic cells. The blocks were created by providing a unique environment in which cultured cells generated their own extracellular matrix. Initially, stromal cells isolated from mice were expanded in vitro in liquid cell culture medium followed by transferring the cells into a hydrogel shell. After incubation for 1 day with mechanical agitation, the encapsulated cell mass was perforated with a thin needle and then incubated for an additional 6 days to form a quasi-natural cell block. Allograft transplantation of the cell block into C57BL/6 mice resulted in perfect adaptation of the allograft and complete integration into the tissue of the recipient. This method could be widely applied for repairing damaged cells or tissues, stem cell transplantation, ex vivo gene therapy, or plastic surgery. PMID:25742639

  20. From fibroblasts and stem cells: implications for cell therapies and somatic cloning.

    PubMed

    Kues, Wilfried A; Carnwath, Joseph W; Niemann, Heiner

    2005-01-01

    Pluripotent embryonic stem cells (ESCs) from the inner cell mass of early murine and human embryos exhibit extensive self-renewal in culture and maintain their ability to differentiate into all cell lineages. These features make ESCs a suitable candidate for cell-replacement therapy. However, the use of early embryos has provoked considerable public debate based on ethical considerations. From this standpoint, stem cells derived from adult tissues are a more easily accepted alternative. Recent results suggest that adult stem cells have a broader range of potency than imagined initially. Although some claims have been called into question by the discovery that fusion between the stem cells and differentiated cells can occur spontaneously, in other cases somatic stem cells have been induced to commit to various lineages by the extra- or intracellular environment. Recent data from our laboratory suggest that changes in culture conditions can expand a subpopulation of cells with a pluripotent phenotype from primary fibroblast cultures. The present paper critically reviews recent data on the potency of somatic stem cells, methods to modify the potency of somatic cells and implications for cell-based therapies.

  1. Review of Chromium (VI) Apoptosis, Cell-Cycle-Arrest, and Carcinogenesis

    PubMed Central

    Chiu, A; Shi, J; Lee, WKP; Hill, R; Wakeman, TP; Katz, A; Xu, B; Dalal, NS; Robertson, JD; Chen, C; Chiu, N; Donehower, L

    2014-01-01

    Hexavalent chromium combines with glutathione in chloride intracellular channel carrier to form tetravalent and pentavelent chromium in plasma and organelle membranes. It also combines with NADH/NADPH to form pentavalent chromium in mitochondria. Tetravalent- and pentavalent- chromium (directly and indirectly) mediated DNA double strand breaks activate DNA damage signaling sensors: DNA-dependent-protein-kinase signals p53-dependent intrinsic mitochorndrial apoptosis, and ataxia-telangiectasia-mutated and ataxia-telangiectasia-Rad3-related signal cell-arrest for DNA repair. Tetravalent chromium may be the most potent species since it causes DNA breaks and somatic recombination, but not apoptosis. Upon further failure of apoptosis and senescence/DNA-repair, damaged cells may become immortal with loss-of-heterozygosity and genetic plasticity. PMID:20859824

  2. Privileged Communication Embryonic Development Following Somatic Cell Nuclear Transfer Impeded by Persisting Histone Methylation

    PubMed Central

    Matoba, Shogo; Liu, Yuting; Lu, Falong; Iwabuchi, Kumiko A.; Shen, Li; Inoue, Azusa; Zhang, Yi

    2014-01-01

    SUMMARY Mammalian oocytes can reprogram somatic cells into a totipotent state enabling animal cloning through somatic cell nuclear transfer (SCNT). However, the majority of SCNT embryos fail to develop to term due to undefined reprogramming defects. Here we identify histone H3 lysine 9 trimethylation (H3K9me3) of donor cell genome as a major epigenetic barrier for efficient reprogramming by SCNT. Comparative transcriptome analysis identified reprogramming resistant regions (RRRs) that are expressed normally at 2-cell mouse embryos generated by IVF but not SCNT. RRRs are enriched for H3K9me3 in donor somatic cells, and its removal by ectopic expression of the H3K9me3 demethylase Kdm4d not only reactivates the majority of RRRs, but also greatly improves SCNT efficiency. Furthermore, use of donor somatic nuclei depleted of H3K9 methyltransferases markedly improves SCNT efficiency. Our study thus identifies H3K9me3 as a critical epigenetic barrier in SCNT-mediated reprogramming and provides a promising approach for improving mammalian cloning efficiency. PMID:25417163

  3. Germ Cells Are Not Required to Establish the Female Pathway in Mouse Fetal Gonads

    PubMed Central

    Maatouk, Danielle M.; Mork, Lindsey; Hinson, Ashley; Kobayashi, Akio; McMahon, Andrew P.; Capel, Blanche

    2012-01-01

    The fetal gonad is composed of a mixture of somatic cell lineages and germ cells. The fate of the gonad, male or female, is determined by a population of somatic cells that differentiate into Sertoli or granulosa cells and direct testis or ovary development. It is well established that germ cells are not required for the establishment or maintenance of Sertoli cells or testis cords in the male gonad. However, in the agametic ovary, follicles do not form suggesting that germ cells may influence granulosa cell development. Prior investigations of ovaries in which pre-meiotic germ cells were ablated during fetal life reported no histological changes during stages prior to birth. However, whether granulosa cells underwent normal molecular differentiation was not investigated. In cases where germ cell loss occurred secondary to other mutations, transdifferentiation of granulosa cells towards a Sertoli cell fate was observed, raising questions about whether germ cells play an active role in establishing or maintaining the fate of granulosa cells. We developed a group of molecular markers associated with ovarian development, and show here that the loss of pre-meiotic germ cells does not disrupt the somatic ovarian differentiation program during fetal life, or cause transdifferentiation as defined by expression of Sertoli markers. Since we do not find defects in the ovarian somatic program, the subsequent failure to form follicles at perinatal stages is likely attributable to the absence of germ cells rather than to defects in the somatic cells. PMID:23091613

  4. Cell cycle accumulation of the proliferating cell nuclear antigen PCN-1 transitions from continuous in the adult germline to intermittent in the early embryo of C. elegans.

    PubMed

    Kocsisova, Zuzana; Kornfeld, Kerry; Schedl, Tim

    2018-05-30

    The proliferating cell nuclear antigen (PCNA or PCN-1 in C. elegans), an essential processivity factor for DNA polymerase δ, has been widely used as a marker of S-phase. In C. elegans early embryos, PCN-1 accumulation is cyclic, localizing to the nucleus during S-phase and the cytoplasm during the rest of the cell cycle. The C. elegans larval and adult germline is an important model systems for studying cell cycle regulation, and it was observed that the cell cycle regulator cyclin E (CYE-1 in C. elegans) displays a non-cyclic, continuous accumulation pattern in this tissue. The accumulation pattern of PCN-1 has not been well defined in the larval and adult germline, and the objective of this study was to determine if the accumulation pattern is cyclic, as in other cells and organisms, or continuous, similar to cyclin E. To study the larval and adult germline accumulation of PCN-1 expressed from its native locus, we used CRISPR/Cas9 technology to engineer a novel allele of pcn-1 that encodes an epitope-tagged protein. S-phase nuclei were labeled using EdU nucleotide incorporation, and FLAG::PCN-1 was detected by antibody staining. All progenitor zone nuclei, including those that were not in S-phase (as they were negative for EdU staining) showed PCN-1 accumulation, indicating that PCN-1 accumulated during all cell cycle phases in the germline progenitor zone. The same result was observed with a GFP::PCN-1 fusion protein expressed from a transgene. pcn-1 loss-of-function mutations were analyzed, and pcn-1 was necessary for robust fertility and embryonic development. In the C. elegans early embryo as well as other organisms, PCN-1 accumulates in nuclei only during S-phase. By contrast, in the progenitor zone of the germline of C. elegans, PCN-1 accumulated in nuclei during all cell cycle stages. This pattern is similar to accumulation pattern of cyclin E. These observations support the model that mitotic cell cycle regulation in the germline stem and progenitor cells is distinct from somatic cells, as it does not heavily rely on cyclic accumulation of classic cell cycle proteins.

  5. Evolutionary origins of germline segregation in Metazoa: evidence for a germ stem cell lineage in the coral Orbicella faveolata (Cnidaria, Anthozoa).

    PubMed

    Barfield, Sarah; Aglyamova, Galina V; Matz, Mikhail V

    2016-01-13

    The ability to segregate a committed germ stem cell (GSC) lineage distinct from somatic cell lineages is a characteristic of bilaterian Metazoans. However, the occurrence of GSC lineage specification in basally branching Metazoan phyla, such as Cnidaria, is uncertain. Without an independently segregated GSC lineage, germ cells and their precursors must be specified throughout adulthood from continuously dividing somatic stem cells, generating the risk of propagating somatic mutations within the individual and its gametes. To address the potential for existence of a GSC lineage in Anthozoa, the sister-group to all remaining Cnidaria, we identified moderate- to high-frequency somatic mutations and their potential for gametic transfer in the long-lived coral Orbicella faveolata (Anthozoa, Cnidaria) using a 2b-RAD sequencing approach. Our results demonstrate that somatic mutations can drift to high frequencies (up to 50%) and can also generate substantial intracolonial genetic diversity. However, these somatic mutations are not transferable to gametes, signifying the potential for an independently segregated GSC lineage in O. faveolata. In conjunction with previous research on germ cell development in other basally branching Metazoan species, our results suggest that the GSC system may be a Eumetazoan characteristic that evolved in association with the emergence of greater complexity in animal body plan organization and greater specificity of stem cell functions. © 2016 The Author(s).

  6. Evolutionary origins of germline segregation in Metazoa: evidence for a germ stem cell lineage in the coral Orbicella faveolata (Cnidaria, Anthozoa)

    PubMed Central

    Barfield, Sarah; Aglyamova, Galina V.; Matz, Mikhail V.

    2016-01-01

    The ability to segregate a committed germ stem cell (GSC) lineage distinct from somatic cell lineages is a characteristic of bilaterian Metazoans. However, the occurrence of GSC lineage specification in basally branching Metazoan phyla, such as Cnidaria, is uncertain. Without an independently segregated GSC lineage, germ cells and their precursors must be specified throughout adulthood from continuously dividing somatic stem cells, generating the risk of propagating somatic mutations within the individual and its gametes. To address the potential for existence of a GSC lineage in Anthozoa, the sister-group to all remaining Cnidaria, we identified moderate- to high-frequency somatic mutations and their potential for gametic transfer in the long-lived coral Orbicella faveolata (Anthozoa, Cnidaria) using a 2b-RAD sequencing approach. Our results demonstrate that somatic mutations can drift to high frequencies (up to 50%) and can also generate substantial intracolonial genetic diversity. However, these somatic mutations are not transferable to gametes, signifying the potential for an independently segregated GSC lineage in O. faveolata. In conjunction with previous research on germ cell development in other basally branching Metazoan species, our results suggest that the GSC system may be a Eumetazoan characteristic that evolved in association with the emergence of greater complexity in animal body plan organization and greater specificity of stem cell functions. PMID:26763699

  7. Cloning animals by somatic cell nuclear transfer – biological factors

    PubMed Central

    Tian, X Cindy; Kubota, Chikara; Enright, Brian; Yang, Xiangzhong

    2003-01-01

    Cloning by nuclear transfer using mammalian somatic cells has enormous potential application. However, somatic cloning has been inefficient in all species in which live clones have been produced. High abortion and fetal mortality rates are commonly observed. These developmental defects have been attributed to incomplete reprogramming of the somatic nuclei by the cloning process. Various strategies have been used to improve the efficiency of nuclear transfer, however, significant breakthroughs are yet to happen. In this review we will discuss studies conducted, in our laboratories and those of others, to gain a better understanding of nuclear reprogramming. Because cattle are a species widely used for nuclear transfer studies, and more laboratories have succeeded in cloning cattle than any other specie, this review will be focused on somatic cell cloning of cattle. PMID:14614770

  8. Cloning animals by somatic cell nuclear transfer--biological factors.

    PubMed

    Tian, X Cindy; Kubota, Chikara; Enright, Brian; Yang, Xiangzhong

    2003-11-13

    Cloning by nuclear transfer using mammalian somatic cells has enormous potential application. However, somatic cloning has been inefficient in all species in which live clones have been produced. High abortion and fetal mortality rates are commonly observed. These developmental defects have been attributed to incomplete reprogramming of the somatic nuclei by the cloning process. Various strategies have been used to improve the efficiency of nuclear transfer, however, significant breakthroughs are yet to happen. In this review we will discuss studies conducted, in our laboratories and those of others, to gain a better understanding of nuclear reprogramming. Because cattle are a species widely used for nuclear transfer studies, and more laboratories have succeeded in cloning cattle than any other species, this review will be focused on somatic cell cloning of cattle.

  9. Mapping mitochondrial heteroplasmy in a Leydig tumor by laser capture micro-dissection and cycling temperature capillary electrophoresis.

    PubMed

    Refinetti, Paulo; Arstad, Christian; Thilly, William G; Morgenthaler, Stephan; Ekstrøm, Per Olaf

    2017-01-01

    The growth of tumor cells is accompanied by mutations in nuclear and mitochondrial genomes creating marked genetic heterogeneity. Tumors also contain non-tumor cells of various origins. An observed somatic mitochondrial mutation would have occurred in a founding cell and spread through cell division. Micro-anatomical dissection of a tumor coupled with assays for mitochondrial point mutations permits new insights into this growth process. More generally, the ability to detect and trace, at a histological level, somatic mitochondrial mutations in human tissues and tumors, makes these mutations into markers for lineage tracing. A tumor was first sampled by a large punch biopsy and scanned for any significant degree of heteroplasmy in a set of sequences containing known mutational hotspots of the mitochondrial genome. A heteroplasmic tumor was sliced at a 12 μm thickness and placed on membranes. Laser capture micro-dissection was used to take 25000 μm 2 subsamples or spots. After DNA amplification, cycling temperature capillary electrophoresis (CTCE) was used on the laser captured samples to quantify mitochondrial mutant fractions. Of six testicular tumors studied, one, a Leydig tumor, was discovered to carry a detectable degree of heteroplasmy for two separate point mutations: a C → T mutation at bp 64 and a T → C mutation found at bp 152. From this tumor, 381 spots were sampled with laser capture micro-dissection. The ordered distribution of spots exhibited a wide range of fractions of the mutant sequences from 0 to 100% mutant copies. The two mutations co-distributed in the growing tumor indicating they were present on the same genome copies in the founding cell. Laser capture microdissection of sliced tumor samples coupled with CTCE-based point mutation assays provides an effective and practical means to obtain maps of mitochondrial mutational heteroplasmy within human tumors.

  10. vasa is expressed in somatic cells of the embryonic gonad in a sex-specific manner in Drosophila melanogaster.

    PubMed

    Renault, Andrew D

    2012-10-15

    Vasa is a DEAD box helicase expressed in the Drosophila germline at all stages of development. vasa homologs are found widely in animals and vasa has become the gene of choice in identifying germ cells. I now show that Drosophila vasa expression is not restricted to the germline but is also expressed in a somatic lineage, the embryonic somatic gonadal precursor cells. This expression is sexually dimorphic, being maintained specifically in males, and is regulated post-transcriptionally. Although somatic Vasa expression is not required for gonad coalescence, these data support the notion that Vasa is not solely a germline factor.

  11. Determining the Origin of Human Germinal Center B Cell-Derived Malignancies.

    PubMed

    Seifert, Marc; Küppers, Ralf

    2017-01-01

    Most human B cell lymphomas originate from germinal center (GC) B cells. This is partly caused by the high proliferative activity of GC B cells and the remodeling processes acting at the immunoglobulin (Ig) loci of these cells, i.e., somatic hypermutation and class-switching. Mistargeting of these processes can cause chromosomal translocations, and the hypermutation machinery may also target non-Ig genes. As somatic hypermutation is exclusively active in GC B cells, the presence of somatic mutations in rearranged IgV genes is a standard criterium for a GC or post-GC B cell origin of lymphomas. Beyond this, ongoing somatic hypermutation during lymphoma clone expansion indicates that the lymphoma has an active GC B cell differentiation program. The proto-oncogene BCL6 is specifically expressed in GC B cells and also acquires somatic mutations as a physiological by-product of the somatic hypermutation process, albeit at a lower level than IgV genes. Thus, detection of BCL6 mutations is a further genetic trait of a GC experience of a B cell lymphoma. Typically, B cell lymphomas retain key features of their specific cells of origin, including a differentiation stage-specific gene expression pattern. This is at least partly due to genetic lesions, which "freeze" the lymphoma cells at the differentiation stage at which the transformation occurred. Therefore, identification of the normal B cell subset with the most similar gene expression pattern to a particular type of B cell lymphoma has been instrumental to deduce the precise cell of origin of lymphomas.We present here protocols to analyze human B cell lymphomas for a potential origin from GC B cells by determining the presence of mutations in rearranged IgV genes and the BCL6 gene, and by comparing the gene expression pattern of lymphoma cells with those of normal B cell subsets by genechip or RNA-sequencing analysis.

  12. Regulation of Lysosomal Function by the DAF-16 Forkhead Transcription Factor Couples Reproduction to Aging in Caenorhabditis elegans.

    PubMed

    Baxi, Kunal; Ghavidel, Ata; Waddell, Brandon; Harkness, Troy A; de Carvalho, Carlos E

    2017-09-01

    Aging in eukaryotes is accompanied by widespread deterioration of the somatic tissue. Yet, abolishing germ cells delays the age-dependent somatic decline in Caenorhabditis elegans In adult worms lacking germ cells, the activation of the DAF-9/DAF-12 steroid signaling pathway in the gonad recruits DAF-16 activity in the intestine to promote longevity-associated phenotypes. However, the impact of this pathway on the fitness of normally reproducing animals is less clear. Here, we explore the link between progeny production and somatic aging and identify the loss of lysosomal acidity-a critical regulator of the proteolytic output of these organelles-as a novel biomarker of aging in C. elegans The increase in lysosomal pH in older worms is not a passive consequence of aging, but instead is timed with the cessation of reproduction, and correlates with the reduction in proteostasis in early adult life. Our results further implicate the steroid signaling pathway and DAF-16 in dynamically regulating lysosomal pH in the intestine of wild-type worms in response to the reproductive cycle. In the intestine of reproducing worms, DAF-16 promotes acidic lysosomes by upregulating the expression of v-ATPase genes. These findings support a model in which protein clearance in the soma is linked to reproduction in the gonad via the active regulation of lysosomal acidification. Copyright © 2017 by the Genetics Society of America.

  13. The cancer paradigms of mammalian regeneration: can mammals regenerate as amphibians?

    PubMed

    Sarig, Rachel; Tzahor, Eldad

    2017-04-01

    Regeneration in mammals is restricted to distinct tissues and occurs mainly by expansion and maturation of resident stem cells. During regeneration, even subtle mutations in the proliferating cells may cause a detrimental effect by eliciting abnormal differentiation or malignant transformation. Indeed, cancer in mammals has been shown to arise through deregulation of stem cells maturation, which often leads to a differentiation block and cell transformation. In contrast, lower organisms such as amphibians retain a remarkable regenerative capacity in various organs, which occurs via de- and re-differentiation of mature cells. Interestingly, regenerating amphibian cells are highly resistant to oncogenic transformation. Therapeutic approaches to improve mammalian regeneration mainly include stem-cell transplantations; but, these have proved unsuccessful in non-regenerating organs such as the heart. A recently developed approach is to induce de-differentiation of mature cardiomyocytes using factors that trigger their re-entry into the cell cycle. This novel approach raises numerous questions regarding the balance between transformation and regeneration induced by de-differentiation of mature mammalian somatic cells. Can this balance be controlled artificially? Do de-differentiated cells acquire the protection mechanisms seen in regenerating cells of lower organisms? Is this model unique to the cardiac tissue, which rarely develops tumors? This review describes regeneration processes in both mammals and lower organisms and, particularly, the ability of regenerating cells to avoid transformation. By comparing the characteristics of mammalian embryonic and somatic cells, we discuss therapeutic strategies of using various cell populations for regeneration. Finally, we describe a novel cardiac regeneration approach and its implications for regenerative medicine. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  14. Peripheral self-reactivity regulates antigen-specific CD8 T-cell responses and cell division under physiological conditions.

    PubMed

    Swee, Lee Kim; Tan, Zhen Wei; Sanecka, Anna; Yoshida, Nagisa; Patel, Harshil; Grotenbreg, Gijsbert; Frickel, Eva-Maria; Ploegh, Hidde L

    2016-11-01

    T-cell identity is established by the expression of a clonotypic T-cell receptor (TCR), generated by somatic rearrangement of TCRα and β genes. The properties of the TCR determine both the degree of self-reactivity and the repertoire of antigens that can be recognized. For CD8 T cells, the relationship between TCR identity-hence reactivity to self-and effector function(s) remains to be fully understood and has rarely been explored outside of the H-2 b haplotype. We measured the affinity of three structurally distinct CD8 T-cell-derived TCRs that recognize the identical H-2 L d -restricted epitope, derived from the Rop7 protein of Toxoplasma gondii We used CD8 T cells obtained from mice generated by somatic cell nuclear transfer as the closest approximation of primary T cells with physiological TCR rearrangements and TCR expression levels. First, we demonstrate the common occurrence of secondary rearrangements in endogenously rearranged loci. Furthermore, we characterized and compared the response of Rop7-specific CD8 T-cell clones upon Toxoplasma gondii infection as well as effector function and TCR signalling upon antigenic stimulation in vitro Antigen-independent TCR cross-linking in vitro uncovered profound intrinsic differences in the effector functions between T-cell clones. Finally, by assessing the degree of self-reactivity and comparing the transcriptomes of naive Rop7 CD8 T cells, we show that lower self-reactivity correlates with lower effector capacity, whereas higher self-reactivity is associated with enhanced effector function as well as cell cycle entry under physiological conditions. Altogether, our data show that potential effector functions and basal proliferation of CD8 T cells are set by self-reactivity thresholds. © 2016 The Authors.

  15. Testicular seminomatous mixed germ cell tumor with choriocarcinoma and teratoma with secondary somatic malignancy: a case report.

    PubMed

    Aneja, Amandeep; Bhattacharyya, Siddharth; Mydlo, Jack; Inniss, Susan

    2014-01-01

    Testicular tumors are a heterogeneous group of neoplasms exhibiting diverse histopathology and can be classified as seminomatous and non-seminomatous germ cell tumor types. Mixed germ cell tumors contain more than one germ cell component and various combinations have been reported. Here, we present a rare case of a mixed germ cell tumor composed of seminoma, choriocarcinoma and teratoma with a secondary somatic malignancy. A 31-year-old Caucasian man presented with splenic rupture to our hospital. A right-sided testicular swelling had been present for 6 months and his alpha-fetoprotein, beta-human chorionic gonadotropin, and lactose dehydrogenase were increased. An ultrasound of his scrotum revealed an enlarged right testis with heterogeneous echogenicity. Multiple hypervascular lesions were noted in his liver and spleen. He underwent transcatheter embolization therapy of his splenic artery followed by splenectomy and right-sided orchiectomy. A computed tomography scan also showed metastasis to both lungs. During his last follow up after four cycles of cisplatin-based chemotherapy, the level of tumor markers had decreased, decreases in the size of his liver and pulmonary lesions were noted but new sclerotic lesions were evident in his thoracolumbar region raising concern for bony metastasis. Prognosis of testicular tumor depends mainly on the clinical stage, but emergence of a sarcomatous component presents a challenge in the treatment of germ cell tumors and the histological subtype of this component can be used as a guide to specific chemotherapy in these patients.

  16. Intersection of diverse neuronal genomes and neuropsychiatric disease: The Brain Somatic Mosaicism Network.

    PubMed

    McConnell, Michael J; Moran, John V; Abyzov, Alexej; Akbarian, Schahram; Bae, Taejeong; Cortes-Ciriano, Isidro; Erwin, Jennifer A; Fasching, Liana; Flasch, Diane A; Freed, Donald; Ganz, Javier; Jaffe, Andrew E; Kwan, Kenneth Y; Kwon, Minseok; Lodato, Michael A; Mills, Ryan E; Paquola, Apua C M; Rodin, Rachel E; Rosenbluh, Chaggai; Sestan, Nenad; Sherman, Maxwell A; Shin, Joo Heon; Song, Saera; Straub, Richard E; Thorpe, Jeremy; Weinberger, Daniel R; Urban, Alexander E; Zhou, Bo; Gage, Fred H; Lehner, Thomas; Senthil, Geetha; Walsh, Christopher A; Chess, Andrew; Courchesne, Eric; Gleeson, Joseph G; Kidd, Jeffrey M; Park, Peter J; Pevsner, Jonathan; Vaccarino, Flora M

    2017-04-28

    Neuropsychiatric disorders have a complex genetic architecture. Human genetic population-based studies have identified numerous heritable sequence and structural genomic variants associated with susceptibility to neuropsychiatric disease. However, these germline variants do not fully account for disease risk. During brain development, progenitor cells undergo billions of cell divisions to generate the ~80 billion neurons in the brain. The failure to accurately repair DNA damage arising during replication, transcription, and cellular metabolism amid this dramatic cellular expansion can lead to somatic mutations. Somatic mutations that alter subsets of neuronal transcriptomes and proteomes can, in turn, affect cell proliferation and survival and lead to neurodevelopmental disorders. The long life span of individual neurons and the direct relationship between neural circuits and behavior suggest that somatic mutations in small populations of neurons can significantly affect individual neurodevelopment. The Brain Somatic Mosaicism Network has been founded to study somatic mosaicism both in neurotypical human brains and in the context of complex neuropsychiatric disorders. Copyright © 2017, American Association for the Advancement of Science.

  17. Retroperitoneal teratoma with somatic malignant transformation: a papillary renal cell carcinoma in a testicular germ cell tumour metastasis following platinum-based chemotherapy.

    PubMed

    Zeh, Nina; Wild, Peter J; Bode, Peter K; Kristiansen, Glen; Moch, Holger; Sulser, Tullio; Hermanns, Thomas

    2013-02-12

    Malignant transformation describes the phenomenon in which a somatic component of a germ cell teratoma undergoes malignant differentiation. A variety of different types of sarcoma and carcinoma, all non-germ cell, have been described as a result of malignant transformation. A 33-year-old man presented with a left testicular mass and elevated tumour markers. Staging investigations revealed retroperitoneal lymphadenopathy with obstruction of the left ureter and distant metastases. Histopathology from the left radical orchiectomy showed a mixed germ cell tumour (Stage III, poor prognosis). The ureter was stented and four cycles of cisplatin, etoposide and bleomycin chemotherapy administered. After initial remission, the patient recurred four years later with a large retroperitoneal mass involving the renal vessels and the left ureter. Left retroperitoneal lymph node dissection with en-bloc resection of the left kidney was performed.Histopathology revealed a germ cell tumour metastasis consisting mainly of mature teratoma. Additionally, within the teratoma a papillary renal cell carcinoma was found. The diagnosis was supported by immunohistochemistry showing positivity for AMACR, CD10 and focal expression of RCC and CK7. There was no radiological or histo-pathological evidence of a primary renal cell cancer. To the best of our knowledge, malignant transformation into a papillary renal cell carcinoma has not been reported in a testicular germ cell tumour metastasis following platinum-based chemotherapy. This histological diagnosis might have implications for potential future therapies. In the case of disease recurrence, renal cell cancer as origin of the recurrent tumour has to be excluded because renal cell carcinoma metastases would not respond well to the classical germ cell tumour chemotherapy regimens.

  18. The p53 inhibitor, pifithrin-{alpha}, suppresses self-renewal of embryonic stem cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Abdelalim, Essam Mohamed, E-mail: essam_abdelalim@yahoo.com; Department of Cytology and Histology, Faculty of Veterinary Medicine, Suez Canal University, Ismailia 41522; Tooyama, Ikuo

    2012-04-13

    Highlights: Black-Right-Pointing-Pointer We determine the role of p53 in ES cells under unstressful conditions. Black-Right-Pointing-Pointer PFT-{alpha} suppresses ES cell proliferation. Black-Right-Pointing-Pointer PFT-{alpha} induces ES cell cycle arrest. Black-Right-Pointing-Pointer PFT-{alpha} downregulates Nanog and cyclin D1. -- Abstract: Recent studies have reported the role of p53 in suppressing the pluripotency of embryonic stem (ES) cells after DNA damage and blocking the reprogramming of somatic cells into induced pluripotent stem (iPS) cells. However, to date no evidence has been presented to support the function of p53 in unstressed ES cells. In this study, we investigated the effect of pifithrin (PFT)-{alpha}, an inhibitor ofmore » p53-dependent transcriptional activation, on self-renewal of ES cells. Our results revealed that treatment of ES cells with PFT-{alpha} resulted in the inhibition of ES cell propagation in a dose-dependent manner, as indicated by a marked reduction in the cell number and colony size. Also, PFT-{alpha} caused a cell cycle arrest and significant reduction in DNA synthesis. In addition, inhibition of p53 activity reduced the expression levels of cyclin D1 and Nanog. These findings indicate that p53 pathway in ES cells rather than acting as an inactive gene, is required for ES cell proliferation and self-renewal under unstressful conditions.« less

  19. Mammalian nuclear transplantation to Germinal Vesicle stage Xenopus oocytes – A method for quantitative transcriptional reprogramming

    PubMed Central

    Halley-Stott, R.P.; Pasque, V.; Astrand, C.; Miyamoto, K.; Simeoni, I.; Jullien, J.; Gurdon, J.B.

    2010-01-01

    Full-grown Xenopus oocytes in first meiotic prophase contain an immensely enlarged nucleus, the Germinal Vesicle (GV), that can be injected with several hundred somatic cell nuclei. When the nuclei of mammalian somatic cells or cultured cell lines are injected into a GV, a wide range of genes that are not transcribed in the donor cells, including pluripotency genes, start to be transcriptionally activated, and synthesize primary transcripts continuously for several days. Because of the large size and abundance of Xenopus laevis oocytes, this experimental system offers an opportunity to understand the mechanisms by which somatic cell nuclei can be reprogrammed to transcribe genes characteristic of oocytes and early embryos. The use of mammalian nuclei ensures that there is no background of endogenous maternal transcripts of the kind that are induced. The induced gene transcription takes place in the absence of cell division or DNA synthesis and does not require protein synthesis. Here we summarize new as well as established results that characterize this experimental system. In particular, we describe optimal conditions for transplanting somatic nuclei to oocytes and for the efficient activation of transcription by transplanted nuclei. We make a quantitative determination of transcript numbers for pluripotency and housekeeping genes, comparing cultured somatic cell nuclei with those of embryonic stem cells. Surprisingly we find that the transcriptional activation of somatic nuclei differs substantially from one donor cell-type to another and in respect of different pluripotency genes. We also determine the efficiency of an injected mRNA translation into protein. PMID:20123126

  20. Somatic Embryogenesis in Lisianthus (Eustoma russellianum Griseb.).

    PubMed

    Ruffoni, Barbara; Bassolino, Laura

    2016-01-01

    Somatic embryogenesis is, for the main floricultural crops, a promising system for commercial scale-up, providing cloned material to be traded as seedlings. Somatic embryos, having the contemporary presence of root apical meristem and shoot apical meristem, can be readily acclimatized. For Lisianthus it is possible to induce embryogenic callus from leaf fragments of selected genotypes and to obtain embryos either in agarized substrate or in liquid suspension culture. The production of somatic embryos in liquid medium is high and can be modulated in order to synchronize the cycle and the size of the neoformed structures. The possibility to use the liquid substrate with high propagation rates reduces labor costs and could support the costs of eventual automation. In this paper we report a stepwise protocol for somatic embryogenesis in the species Eustoma russellianum.

  1. Global transcriptome analysis of the C57BL/6J mouse testis by SAGE: evidence for nonrandom gene order.

    PubMed

    Divina, Petr; Vlcek, Cestmír; Strnad, Petr; Paces, Václav; Forejt, Jirí

    2005-03-05

    We generated the gene expression profile of the total testis from the adult C57BL/6J male mice using serial analysis of gene expression (SAGE). Two high-quality SAGE libraries containing a total of 76 854 tags were constructed. An extensive bioinformatic analysis and comparison of SAGE transcriptomes of the total testis, testicular somatic cells and other mouse tissues was performed and the theory of male-biased gene accumulation on the X chromosome was tested. We sorted out 829 genes predominantly expressed from the germinal part and 944 genes from the somatic part of the testis. The genes preferentially and specifically expressed in total testis and testicular somatic cells were identified by comparing the testis SAGE transcriptomes to the available transcriptomes of seven non-testis tissues. We uncovered chromosomal clusters of adjacent genes with preferential expression in total testis and testicular somatic cells by a genome-wide search and found that the clusters encompassed a significantly higher number of genes than expected by chance. We observed a significant 3.2-fold enrichment of the proportion of X-linked genes specific for testicular somatic cells, while the proportions of X-linked genes specific for total testis and for other tissues were comparable. In contrast to the tissue-specific genes, an under-representation of X-linked genes in the total testis transcriptome but not in the transcriptomes of testicular somatic cells and other tissues was detected. Our results provide new evidence in favor of the theory of male-biased genes accumulation on the X chromosome in testicular somatic cells and indicate the opposite action of the meiotic X-inactivation in testicular germ cells.

  2. Global transcriptome analysis of the C57BL/6J mouse testis by SAGE: evidence for nonrandom gene order

    PubMed Central

    Divina, Petr; Vlček, Čestmír; Strnad, Petr; Pačes, Václav; Forejt, Jiří

    2005-01-01

    Background We generated the gene expression profile of the total testis from the adult C57BL/6J male mice using serial analysis of gene expression (SAGE). Two high-quality SAGE libraries containing a total of 76 854 tags were constructed. An extensive bioinformatic analysis and comparison of SAGE transcriptomes of the total testis, testicular somatic cells and other mouse tissues was performed and the theory of male-biased gene accumulation on the X chromosome was tested. Results We sorted out 829 genes predominantly expressed from the germinal part and 944 genes from the somatic part of the testis. The genes preferentially and specifically expressed in total testis and testicular somatic cells were identified by comparing the testis SAGE transcriptomes to the available transcriptomes of seven non-testis tissues. We uncovered chromosomal clusters of adjacent genes with preferential expression in total testis and testicular somatic cells by a genome-wide search and found that the clusters encompassed a significantly higher number of genes than expected by chance. We observed a significant 3.2-fold enrichment of the proportion of X-linked genes specific for testicular somatic cells, while the proportions of X-linked genes specific for total testis and for other tissues were comparable. In contrast to the tissue-specific genes, an under-representation of X-linked genes in the total testis transcriptome but not in the transcriptomes of testicular somatic cells and other tissues was detected. Conclusion Our results provide new evidence in favor of the theory of male-biased genes accumulation on the X chromosome in testicular somatic cells and indicate the opposite action of the meiotic X-inactivation in testicular germ cells. PMID:15748293

  3. Differentiation as symbiosis.

    PubMed

    Chigira, M; Watanabe, H

    1994-07-01

    Preservation of the identity of DNA is the ultimate goal of multicellular organisms. An abnormal DNA sequence in cells within an individual means its parasitic nature in cell society as shown in tumors. Somatic gene arrangement and gene mutation in development may be considered as de novo formation of parasites. It is likely that the developmental process with genetic alterations means symbiosis between altered cells and germ line cells preserving genetic information without alterations, when somatic alteration of DNA sequence is a major mechanism of differentiation. According to the selfish gene theory of Dawkins, germ line cells permit symbiosis when somatic cell society derives clear profit for the replication of original DNA copies.

  4. Totipotency, Pluripotency and Nuclear Reprogramming

    NASA Astrophysics Data System (ADS)

    Mitalipov, Shoukhrat; Wolf, Don

    Mammalian development commences with the totipotent zygote which is capable of developing into all the specialized cells that make up the adult animal. As development unfolds, cells of the early embryo proliferate and differentiate into the first two lineages, the pluripotent inner cell mass and the trophectoderm. Pluripotent cells can be isolated, adapted and propagated indefinitely in vitro in an undifferentiated state as embryonic stem cells (ESCs). ESCs retain their ability to differentiate into cells representing the three major germ layers: endoderm, mesoderm or ectoderm or any of the 200+ cell types present in the adult body. Since many human diseases result from defects in a single cell type, pluripotent human ESCs represent an unlimited source of any cell or tissue type for replacement therapy thus providing a possible cure for many devastating conditions. Pluripotent cells resembling ESCs can also be derived experimentally by the nuclear reprogramming of somatic cells. Reprogrammed somatic cells may have an even more important role in cell replacement therapies since the patient's own somatic cells can be used for reprogramming thereby eliminating immune based rejection of transplanted cells. In this review, we summarize two major approaches to reprogramming: (1) somatic cell nuclear transfer and (2) direct reprogramming using genetic manipulations.

  5. Control of Anther Cell Differentiation by the Small Protein Ligand TPD1 and Its Receptor EMS1 in Arabidopsis

    PubMed Central

    Huang, Jian; Zhang, Tianyu; Linstroth, Lisa; Tillman, Zachary; Otegui, Marisa S.; Owen, Heather A.

    2016-01-01

    A fundamental feature of sexual reproduction in plants and animals is the specification of reproductive cells that conduct meiosis to form gametes, and the associated somatic cells that provide nutrition and developmental cues to ensure successful gamete production. The anther, which is the male reproductive organ in seed plants, produces reproductive microsporocytes (pollen mother cells) and surrounding somatic cells. The microsporocytes yield pollen via meiosis, and the somatic cells, particularly the tapetum, are required for the normal development of pollen. It is not known how the reproductive cells affect the differentiation of these somatic cells, and vice versa. Here, we use molecular genetics, cell biological, and biochemical approaches to demonstrate that TPD1 (TAPETUM DETERMINANT1) is a small secreted cysteine-rich protein ligand that interacts with the LRR (Leucine-Rich Repeat) domain of the EMS1 (EXCESS MICROSPOROCYTES1) receptor kinase at two sites. Analyses of the expressions and localizations of TPD1 and EMS1, ectopic expression of TPD1, experimental missorting of TPD1, and ablation of microsporocytes yielded results suggesting that the precursors of microsporocyte/microsporocyte-derived TPD1 and pre-tapetal-cell-localized EMS1 initially promote the periclinal division of secondary parietal cells and then determine one of the two daughter cells as a functional tapetal cell. Our results also indicate that tapetal cells suppress microsporocyte proliferation. Collectively, our findings show that tapetal cell differentiation requires reproductive-cell-secreted TPD1, illuminating a novel mechanism whereby signals from reproductive cells determine somatic cell fate in plant sexual reproduction. PMID:27537183

  6. Role of Somatic Testicular Cells during Mouse Spermatogenesis in Three-Dimensional Collagen Gel Culture System

    PubMed Central

    Khajavi, Noushafarin; Akbari, Mohammad; Abolhassani, Farid; Dehpour, Ahmad Reza; Koruji, Morteza; Habibi Roudkenar, Mehryar

    2014-01-01

    Objective Spermatogonial stem cells (SSCs) are the only cell type that can restore fertility to an infertile recipient following transplantation. Much effort has been made to develop a protocol for differentiating isolated SSCs in vitro. Recently, three-dimensional (3D) culture system has been introduced as an appropriate microenvironment for clonal expansion and differentiation of SSCs. This system provides structural support and multiple options for several manipulation such as addition of different cells. Somatic cells have a critical role in stimulating spermatogenesis. They provide complex cell to cell interaction, transport proteins and produce enzymes and regulatory factors. This study aimed to optimize the culture condition by adding somatic testicular cells to the collagen gel culture system in order to induce spermatogenesis progression. Materials and Methods In this experimental study, the disassociation of SSCs was performed by using a two-step enzymatic digestion of type I collagenase, hyaluronidase and DNase. Somatic testicular cells including Sertoli cells and peritubular cells were obtained after the second digestion. SSCs were isolated by Magnetic Activated Cell Sorting (MACS) using GDNF family receptor alpha-1 (Gfrα-1) antibody. Two experimental designs were investigated. 1. Gfrα-1 positive SSCs were cultured in a collagen solution. 2. Somatic testicular cells were added to the Gfrα-1 positive SSCs in a collagen solution. Spermatogenesis progression was determined after three weeks by staining of synaptonemal complex protein 3 (SCP3)-positive cells. Semi-quantitative Reverse Transcription PCR was undertaken for SCP3 as a meiotic marker and, Crem and Thyroid transcription factor-1 (TTF1) as post meiotic markers. For statistical analysis student t test was performed. Results Testicular supporter cells increased the expression of meiotic and post meiotic markers and had a positive effect on extensive colony formation. Conclusion Collagen gel culture system supported by somatic testicular cells provides a microenvironment that mimics seminiferous epithelium and induces spermatogenesis in vitro. PMID:24518977

  7. vasa is expressed in somatic cells of the embryonic gonad in a sex-specific manner in Drosophila melanogaster

    PubMed Central

    Renault, Andrew D.

    2012-01-01

    Summary Vasa is a DEAD box helicase expressed in the Drosophila germline at all stages of development. vasa homologs are found widely in animals and vasa has become the gene of choice in identifying germ cells. I now show that Drosophila vasa expression is not restricted to the germline but is also expressed in a somatic lineage, the embryonic somatic gonadal precursor cells. This expression is sexually dimorphic, being maintained specifically in males, and is regulated post-transcriptionally. Although somatic Vasa expression is not required for gonad coalescence, these data support the notion that Vasa is not solely a germline factor. PMID:23213382

  8. Human somatic cell nuclear transfer and cloning.

    PubMed

    2012-10-01

    This document presents arguments that conclude that it is unethical to use somatic cell nuclear transfer (SCNT) for infertility treatment due to concerns about safety; the unknown impact of SCNT on children, families, and society; and the availability of other ethically acceptable means of assisted reproduction. This document replaces the ASRM Ethics Committee report titled, "Human somatic cell nuclear transfer (cloning)," last published in Fertil Steril 2000;74:873-6. Copyright © 2012 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  9. Integration of Genomic, Biologic, and Chemical Approaches to Target p53 Loss and Gain-of-Function in Triple Negative Breast Cancer

    DTIC Science & Technology

    2014-09-01

    in this renewal: p53 triple negative breast cancer subtypes gene expression somatic cell genetics CRISPR /Cas 3. OVERALL PROJECT SUMMARY...to the efficacy of the synthetic lethality screen. In addition, we have optimized the use of CRISPR /Cas, a novel somatic cell recombination...completing this stage of the research within the upcoming Year 2 of the award period. Figure 1. CRISPR /Cas-mediated in vitro somatic cell

  10. Microinjection of Follicle-Enclosed Mouse Oocytes

    NASA Astrophysics Data System (ADS)

    Jaffe, Laurinda A.; Norris, Rachael P.; Freudzon, Marina; Ratzan, William J.; Mehlmann, Lisa M.

    The mammalian oocyte develops within a complex of somatic cells known as a follicle, within which signals from the somatic cells regulate the oocyte, and signals from the oocyte regulate the somatic cells. Because isolation of the oocyte from the follicle disrupts these communication pathways, oocyte physiology is best studied within an intact follicle. Here we describe methods for quantitative microinjection of follicle-enclosed mouse oocytes, thus allowing the introduction of signaling molecules as well as optical probes into the oocyte within its physiological environment.

  11. Gravity separation of fat, somatic cells, and bacteria in raw and pasteurized milks.

    PubMed

    Caplan, Z; Melilli, C; Barbano, D M

    2013-04-01

    The objective of experiment 1 was to determine if the extent of gravity separation of milk fat, bacteria, and somatic cells is influenced by the time and temperature of gravity separation or the level of contaminating bacteria present in the raw milk. The objective of experiment 2 was to determine if different temperatures of milk heat treatment affected the gravity separation of milk fat, bacteria, and somatic cells. In raw milk, fat, bacteria, and somatic cells rose to the top of columns during gravity separation. About 50 to 80% of the fat and bacteria were present in the top 8% of the milk after gravity separation of raw milk. Gravity separation for 7h at 12°C or for 22h at 4°C produced equivalent separation of fat, bacteria, and somatic cells. The completeness of gravity separation of fat was influenced by the level of bacteria in the milk before separation. Milk with a high bacterial count had less (about 50 to 55%) gravity separation of fat than milk with low bacteria count (about 80%) in 22h at 4°C. Gravity separation caused fat, bacteria, and somatic cells to rise to the top of columns for raw whole milk and high temperature, short-time pasteurized (72.6°C, 25s) whole milk. Pasteurization at ≥76.9°C for 25s prevented all 3 components from rising, possibly due to denaturation of native bovine immunoglobulins that normally associate with fat, bacteria, and somatic cells during gravity separation. Gravity separation can be used to produce reduced-fat milk with decreased bacterial and somatic cell counts, and may be a critical factor in the history of safe and unique traditional Italian hard cheeses produced from gravity-separated raw milk. A better understanding of the mechanism of this natural process could lead to the development of new nonthermal thermal technology (that does not involve heating the milk to high temperatures) to remove bacteria and spores from milk or other liquids. Copyright © 2013 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  12. Analysis of expression profiles of selected genes associated with the regenerative property and the receptivity to gene transfer during somatic embryogenesis in Triticum aestivum L.

    PubMed

    Delporte, Fabienne; Muhovski, Yordan; Pretova, Anna; Watillon, Bernard

    2013-10-01

    The physiological, biochemical and molecular mechanisms regulating the initiation of a regenerative pathway remain partially unknown. Efforts to identify the biological features that confer transformation ability, or the tendency of some cells to induce transgene silencing, would help to improve plant genetic engineering. The objective of our study was to monitor the evolution of plant cell competencies in relation to both in vitro tissue culture regeneration and the genetic transformation properties. We used a simple wheat regeneration procedure as an experimental model for studying the regenerative capacity of plant cells and their receptivity to direct gene transfer over the successive steps of the regenerative pathway. Target gene profiling studies and biochemical assays were conducted to follow some of the mechanisms triggered during the somatic-to-embryogenic transition (i.e. dedifferentiation, cell division activation, redifferentiation) and affecting the accessibility of plant cells to receive and stably express the exogenous DNA introduced by bombardment. Our results seem to indicate that the control of cell-cycle (S-phase) and host defense strategies can be crucial determinants of genetic transformation efficiency. The results from studies conducted at macro-, micro- and molecular scales are then integrated into a holistic approach that addresses the question of tissue culture and transgenesis competencies more broadly. Through this multilevel analysis we try to establish functional links between both regenerative capacity and transformation receptiveness, and thereby to provide a more global and integrated vision of both processes, at the core of defense/adaptive mechanisms and survival, between undifferentiated cell proliferation and organization.

  13. Oocyte extract improves epigenetic reprogramming of yak fibroblast cells and cloned embryo development.

    PubMed

    Xiong, X R; Li, J; Fu, M; Gao, C; Wang, Y; Zhong, J C

    2013-02-01

    The objective was to investigate the effects of bovine oocyte extract (BOE) on epigenetic reprogramming of yak fibroblast cells, based on their cell cycle status, histone acetylation, DNA methylation, gene expression, and cloned blastocyst formation. Permeabilization of yak fibroblasts after treatment with 10 or 50 μL of BOE (treated-S and treated-L groups, respectively) for 24 hours increased (P < 0.05) the cell population at the G(0)/G(1) phase (85.2 ± 2.3% and 89.6 ± 1.5%, respectively) compared with controls (75.4 ± 1.1%). Acetylation at lysine 9 of histone H3 was also higher (26.1 ± 1.4 and 33.5 ± 2.1) than in the control group (15.3 ± 1.6; P < 0.05). Moreover, BOE reduced methylation of the promoter regions of Oct-4 and Nanog (76.4% and 72.2%; and 35.6% and 30.0%, respectively) compared with the control group (92.1% and 47.8%; P < 0.05). In addition, the relative expression levels of HDAC-1, HADC-2, Dnmt-1, and Dnmt-3a were downregulated (P < 0.05) after yak fibroblasts were treated with BOE. Furthermore, when yak fibroblasts were used for interspecies somatic cell nuclear transfer after BOE treatment, 8-cell and blastocyst formation rates significantly exceeded those of the control. In conclusion, BOE induced epigenetic reprogramming of yak fibroblasts, making them suitable donors for yak interspecies somatic cell nuclear transfer. Crown Copyright © 2013. Published by Elsevier Inc. All rights reserved.

  14. Ovine induced pluripotent stem cells are resistant to reprogramming after nuclear transfer.

    PubMed

    German, Sergio D; Campbell, Keith H S; Thornton, Elisabeth; McLachlan, Gerry; Sweetman, Dylan; Alberio, Ramiro

    2015-02-01

    Induced pluripotent stem cells (iPSCs) share similar characteristics of indefinite in vitro growth with embryonic stem cells (ESCs) and may therefore serve as a useful tool for the targeted genetic modification of farm animals via nuclear transfer (NT). Derivation of stable ESC lines from farm animals has not been possible, therefore, it is important to determine whether iPSCs can be used as substitutes for ESCs in generating genetically modified cloned farm animals. We generated ovine iPSCs by conventional retroviral transduction using the four Yamanaka factors. These cells were basic fibroblast growth factor (bFGF)- and activin A-dependent, showed persistent expression of the transgenes, acquired chromosomal abnormalities, and failed to activate endogenous NANOG. Nonetheless, iPSCs could differentiate into the three somatic germ layers in vitro. Because cloning of farm animals is best achieved with diploid cells (G1/G0), we synchronized the iPSCs in G1 prior to NT. Despite the cell cycle synchronization, preimplantation development of iPSC-NT embryos was lower than with somatic cells (2% vs. 10% blastocysts, p<0.01). Furthermore, analysis of the blastocysts produced demonstrated persistent expression of the transgenes, aberrant expression of endogenous SOX2, and a failure to activate NANOG consistently. In contrast, gene expression in blastocysts produced with the parental fetal fibroblasts was similar to those generated by in vitro fertilization. Taken together, our data suggest that the persistent expression of the exogenous factors and the acquisition of chromosomal abnormalities are incompatible with normal development of NT embryos produced with iPSCs.

  15. Developmental Localization and Methylesterification of Pectin Epitopes during Somatic Embryogenesis of Banana (Musa spp. AAA)

    PubMed Central

    Xu, Chunxiang; Zhao, Lu; Pan, Xiao; Šamaj, Jozef

    2011-01-01

    Background The plant cell walls play an important role in somatic embryogenesis and plant development. Pectins are major chemical components of primary cell walls while homogalacturonan (HG) is the most abundant pectin polysaccharide. Developmental regulation of HG methyl-esterification degree is important for cell adhesion, division and expansion, and in general for proper organ and plant development. Methodology/Principal Findings Developmental localization of pectic homogalacturonan (HG) epitopes and the (1→4)-β-D-galactan epitope of rhamnogalacturonan I (RG-I) and degree of pectin methyl-esterification (DM) were studied during somatic embryogenesis of banana (Musa spp. AAA). Histological analysis documented all major developmental stages including embryogenic cells (ECs), pre-globular, globular, pear-shaped and cotyledonary somatic embryos. Histochemical staining of extracellularly secreted pectins with ruthenium red showed the most intense staining at the surface of pre-globular, globular and pear-shaped somatic embryos. Biochemical analysis revealed developmental regulation of galacturonic acid content and DM in diverse embryogenic stages. Immunodots and immunolabeling on tissue sections revealed developmental regulation of highly methyl-esterified HG epitopes recognized by JIM7 and LM20 antibodies during somatic embryogenesis. Cell walls of pre-globular/globular and late-stage embryos contained both low methyl-esterified HG epitopes as well as partially and highly methyl-esterified ones. Extracellular matrix which covered surface of early developing embryos contained pectin epitopes recognized by 2F4, LM18, JIM5, JIM7 and LM5 antibodies. De-esterification of cell wall pectins by NaOH caused a decrease or an elimination of immunolabeling in the case of highly methyl-esterified HG epitopes. However, immunolabeling of some low methyl-esterified epitopes appeared stronger after this base treatment. Conclusions/Significance These data suggest that both low- and highly-methyl-esterified HG epitopes are developmentally regulated in diverse embryogenic stages during somatic embryogenesis. This study provides new information about pectin composition, HG methyl-esterification and developmental localization of pectin epitopes during somatic embryogenesis of banana. PMID:21826225

  16. Transcriptional Noise and Somatic Mutations in the Aging Pancreas.

    PubMed

    Swisa, Avital; Kaestner, Klaus H; Dor, Yuval

    2017-12-05

    The underlying mechanisms and functional significance of pancreatic β cell heterogeneity are an intensive area of investigation. In a recent Cell paper, Enge and colleagues (2017) performed single-cell RNA sequencing of human pancreatic cells and concluded that with age, pancreatic cells become transcriptionally noisy and accumulate somatic mutations. Copyright © 2017. Published by Elsevier Inc.

  17. Comparative whole genome DNA methylation profiling of cattle sperm and somatic tissues reveals striking hypomethylated patterns in sperm

    PubMed Central

    Zhou, Yang; Connor, Erin E; Bickhart, Derek M; Li, Congjun; Baldwin, Ransom L; Schroeder, Steven G; Rosen, Benjamin D; Yang, Liguo; Van Tassell, Curtis P

    2018-01-01

    Abstract Background Although sperm DNA methylation has been studied in humans and other species, its status in cattle is largely unknown. Results Using whole-genome bisulfite sequencing (WGBS), we profiled the DNA methylome of cattle sperm through comparison with three somatic tissues (mammary gland, brain, and blood). Large differences between cattle sperm and somatic cells were observed in the methylation patterns of global CpGs, pericentromeric satellites, partially methylated domains (PMDs), hypomethylated regions (HMRs), and common repeats. As expected, we observed low methylation in the promoter regions and high methylation in the bodies of active genes. We detected selective hypomethylation of megabase domains of centromeric satellite clusters, which may be related to chromosome segregation during meiosis and their rapid transcriptional activation upon fertilization. We found more PMDs in sperm cells than in somatic cells and identified meiosis-related genes such asKIF2B and REPIN1, which are hypomethylated in sperm but hypermethylated in somatic cells. In addition to the common HMRs around gene promoters, which showed substantial differences between sperm and somatic cells, the sperm-specific HMRs also targeted to distinct spermatogenesis-related genes, including BOLL, MAEL, ASZ1, SYCP3, CTCFL, MND1, SPATA22, PLD6, DDX4, RBBP8, FKBP6, and SYCE1. Although common repeats were heavily methylated in both sperm and somatic cells, some young Bov-A2 repeats, which belong to the SINE family, were hypomethylated in sperm and could affect the promoter structures by introducing new regulatory elements. Conclusions Our study provides a comprehensive resource for bovine sperm epigenomic research and enables new discoveries about DNA methylation and its role in male fertility. PMID:29635292

  18. Comparative whole genome DNA methylation profiling of cattle sperm and somatic tissues reveals striking hypomethylated patterns in sperm.

    PubMed

    Zhou, Yang; Connor, Erin E; Bickhart, Derek M; Li, Congjun; Baldwin, Ransom L; Schroeder, Steven G; Rosen, Benjamin D; Yang, Liguo; Van Tassell, Curtis P; Liu, George E

    2018-05-01

    Although sperm DNA methylation has been studied in humans and other species, its status in cattle is largely unknown. Using whole-genome bisulfite sequencing (WGBS), we profiled the DNA methylome of cattle sperm through comparison with three somatic tissues (mammary gland, brain, and blood). Large differences between cattle sperm and somatic cells were observed in the methylation patterns of global CpGs, pericentromeric satellites, partially methylated domains (PMDs), hypomethylated regions (HMRs), and common repeats. As expected, we observed low methylation in the promoter regions and high methylation in the bodies of active genes. We detected selective hypomethylation of megabase domains of centromeric satellite clusters, which may be related to chromosome segregation during meiosis and their rapid transcriptional activation upon fertilization. We found more PMDs in sperm cells than in somatic cells and identified meiosis-related genes such asKIF2B and REPIN1, which are hypomethylated in sperm but hypermethylated in somatic cells. In addition to the common HMRs around gene promoters, which showed substantial differences between sperm and somatic cells, the sperm-specific HMRs also targeted to distinct spermatogenesis-related genes, including BOLL, MAEL, ASZ1, SYCP3, CTCFL, MND1, SPATA22, PLD6, DDX4, RBBP8, FKBP6, and SYCE1. Although common repeats were heavily methylated in both sperm and somatic cells, some young Bov-A2 repeats, which belong to the SINE family, were hypomethylated in sperm and could affect the promoter structures by introducing new regulatory elements. Our study provides a comprehensive resource for bovine sperm epigenomic research and enables new discoveries about DNA methylation and its role in male fertility.

  19. Reprogramming of somatic cells induced by fusion of embryonic stem cells using hemagglutinating virus of Japan envelope (HVJ-E)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yue, Xiao-shan; Department of Biomolecular Engineering, Graduate School of Bioscience and Technology, Tokyo Institute of Technology, Nagatsuta-cho, Midori-ku, Yokohama-shi, Kanagawa 226-8501; Fujishiro, Masako

    In this research, hemagglutinating virus of Japan envelope (HVJ-E) was used to reprogram somatic cells by fusion with mouse embryonic stem (ES) cells. Neomycin-resistant mouse embryonic fibroblasts (MEFs) were used as somatic cells. Nanog-overexpressing puromycin-resistant EB3 cells were used as mouse ES cells. These two cells were fused by exposing to HVJ-E and the generated fusion cells were selected by puromycin and G418 to get the stable fusion cell line. The fusion cells form colonies in feeder-free culture system. Microsatellite analysis of the fusion cells showed that they possessed genes from both ES cells and fibroblasts. The fusion cells weremore » tetraploid, had alkali phosphatase activity, and expressed stem cell marker genes such as Pou5f1, Nanog, and Sox2, but not the fibroblast cell marker genes such as Col1a1 and Col1a2. The pluripotency of fusion cells was confirmed by their expression of marker genes for all the three germ layers after differentiation induction, and by their ability to form teratoma which contained all the three primary layers. Our results show that HVJ-E can be used as a fusion reagent for reprogramming of somatic cells.« less

  20. Somatic Embryogenesis: Still a Relevant Technique in Citrus Improvement.

    PubMed

    Omar, Ahmad A; Dutt, Manjul; Gmitter, Frederick G; Grosser, Jude W

    2016-01-01

    The genus Citrus contains numerous fresh and processed fruit cultivars that are economically important worldwide. New cultivars are needed to battle industry threatening diseases and to create new marketing opportunities. Citrus improvement by conventional methods alone has many limitations that can be overcome by applications of emerging biotechnologies, generally requiring cell to plant regeneration. Many citrus genotypes are amenable to somatic embryogenesis, which became a key regeneration pathway in many experimental approaches to cultivar improvement. This chapter provides a brief history of plant somatic embryogenesis with focus on citrus, followed by a discussion of proven applications in biotechnology-facilitated citrus improvement techniques, such as somatic hybridization, somatic cybridization, genetic transformation, and the exploitation of somaclonal variation. Finally, two important new protocols that feature plant regeneration via somatic embryogenesis are provided: protoplast transformation and Agrobacterium-mediated transformation of embryogenic cell suspension cultures.

  1. Inducible somatic embryogenesis in Theobroma cacao achieved using the DEX-activatable transcription factor-glucocorticoid receptor fusion.

    PubMed

    Shires, Morgan E; Florez, Sergio L; Lai, Tina S; Curtis, Wayne R

    2017-11-01

    To carry out mass propagation of superior plants to improve agricultural and silvicultural production though advancements in plant cell totipotency, or the ability of differentiated somatic plant cells to regenerate an entire plant. The first demonstration of a titratable control over somatic embryo formation in a commercially relevant plant, Theobroma cacao (Chocolate tree), was achieved using a dexamethasone activatable chimeric transcription factor. This four-fold enhancement in embryo production rate utilized a glucocorticoid receptor fused to an embryogenic transcription factor LEAFY COTYLEDON 2. Where previous T. cacao somatic embryogenesis has been restricted to dissected flower parts, this construct confers an unprecedented embryogenic potential to leaves. Activatable chimeric transcription factors provide a means for elucidating the regulatory cascade associated with plant somatic embryogenesis towards improving its use for somatic regeneration of transgenics and plant propagation.

  2. Bovine somatic cell nuclear transfer.

    PubMed

    Ross, Pablo J; Cibelli, Jose B

    2010-01-01

    Somatic cell nuclear transfer (SCNT) is a technique by which the nucleus of a differentiated cell is introduced into an oocyte from which its genetic material has been removed by a process called enucleation. In mammals, the reconstructed embryo is artificially induced to initiate embryonic development (activation). The oocyte turns the somatic cell nucleus into an embryonic nucleus. This process is called nuclear reprogramming and involves an important change of cell fate, by which the somatic cell nucleus becomes capable of generating all the cell types required for the formation of a new individual, including extraembryonic tissues. Therefore, after transfer of a cloned embryo to a surrogate mother, an offspring genetically identical to the animal from which the somatic cells where isolated, is born. Cloning by nuclear transfer has potential applications in agriculture and biomedicine, but is limited by low efficiency. Cattle were the second mammalian species to be cloned after Dolly the sheep, and it is probably the most widely used species for SCNT experiments. This is, in part due to the high availability of bovine oocytes and the relatively higher efficiency levels usually obtained in cattle. Given the wide utilization of this species for cloning, several alternatives to this basic protocol can be found in the literature. Here we describe a basic protocol for bovine SCNT currently being used in our laboratory, which is amenable for the use of the nuclear transplantation technique for research or commercial purposes.

  3. Chromosome microduplication in somatic cells decreases the genetic stability of human reprogrammed somatic cells and results in pluripotent stem cells.

    PubMed

    Yu, Yang; Chang, Liang; Zhao, Hongcui; Li, Rong; Fan, Yong; Qiao, Jie

    2015-05-12

    Human pluripotent stem cells, including cloned embryonic and induced pluripotent stem cells, offer a limitless cellular source for regenerative medicine. However, their derivation efficiency is limited, and a large proportion of cells are arrested during reprogramming. In the current study, we explored chromosome microdeletion/duplication in arrested and established reprogrammed cells. Our results show that aneuploidy induced by somatic cell nuclear transfer technology is a key factor in the developmental failure of cloned human embryos and primary colonies from implanted cloned blastocysts and that expression patterns of apoptosis-related genes are dynamically altered. Overall, ~20%-53% of arrested primary colonies in induced plurpotent stem cells displayed aneuploidy, and upregulation of P53 and Bax occurred in all arrested primary colonies. Interestingly, when somatic cells with pre-existing chromosomal mutations were used as donor cells, no cloned blastocysts were obtained, and additional chromosomal mutations were detected in the resulting iPS cells following long-term culture, which was not observed in the two iPS cell lines with normal karyotypes. In conclusion, aneuploidy induced by the reprogramming process restricts the derivation of pluripotent stem cells, and, more importantly, pre-existing chromosomal mutations enhance the risk of genome instability, which limits the clinical utility of these cells.

  4. Health status and productive performance of somatic cell cloned cattle and their offspring produced in Japan.

    PubMed

    Watanabe, Shinya; Nagai, Takashi

    2008-02-01

    Since the first somatic cell cloned calves were born in Japan in 1998, more than 500 cloned cattle have been produced by somatic cell nuclear transfer and many studies concerning cloned cattle and their offspring have been conducted in this country. However, most of the results have been published in Japanese; thus, the data produced in this country is not well utilized by researchers throughout the world. This article reviews the 65 reports produced by Japanese researchers (62 written in Japanese and 3 written in English), which employed 171 clones and 32 offspring, and categorizes them according to the following 7 categories: (1) genetic similarities and muzzle prints, (2) hematology and clinical chemistry findings, (3) pathology, (4) growth performance, (5) reproductive performance, (6) meat production performance and (7) milk production performance. No remarkable differences in health status or reproductive performance were found among conventionally bred cattle, somatic cell cloned cattle surviving to adulthood and offspring of somatic cell cloned cattle. Similarities in growth performance and meat quality were observed between nuclear donor cattle and their clones. The growth curves of the offspring resembled those of their full siblings.

  5. Estimation of Mineral and Trace Element Profile in Bubaline Milk Affected with Subclinical Mastitis.

    PubMed

    Singh, Mahavir; Yadav, Poonam; Sharma, Anshu; Garg, V K; Mittal, Dinesh

    2017-04-01

    The milk samples from buffaloes of Murrah breed at mid lactation stage, reared at an organised dairy farm, were screened for subclinical mastitis based on bacteriological examination and somatic cell count following International Dairy Federation criteria. Milk samples from subclinical mastitis infected and healthy buffaloes were analysed to evaluate physicochemical alterations in terms of protein, fat, pH, electrical conductivity, chloride, minerals (sodium, potassium and calcium) and trace elements (iron, zinc, copper and selenium). In the present study, protein, fat, zinc, iron, calcium and selenium content was significantly lower (P < 0.001), while pH and electrical conductivity were significantly higher in mastitic milk as compared to normal milk. Concentration of electrolytes mainly sodium and chloride significantly increased with higher somatic cell count in mastitic milk and to maintain osmolality; potassium levels decreased proportionately. Correlation matrix revealed significantly positive interdependences of somatic cell count with pH, electrical conductivity, sodium and chloride. However, protein, fat, calcium and potassium were correlated negatively with elevated somatic cell count in mastitic milk. It is concluded that udder infections resulting in elevated somatic cells may alter the mineral and trace element profile of milk, and magnitude of changes may have diagnostic and prognostic value.

  6. Inducing somatic meiosis-like reduction at high frequency by caffeine in root-tip cells of Vicia faba.

    PubMed

    Chen, Y; Zhang, L; Zhou, Y; Geng, Y; Chen, Z

    2000-07-20

    Germinated seeds of Vicia faba were treated in caffeine solutions of different concentration for different durations to establish the inducing system of somatic meiosis-like reduction. The highest frequency of somatic meiosis-like reduction could reach up to 54.0% by treating the root tips in 70 mmol/l caffeine solution for 2 h and restoring for 24 h. Two types of somatic meiosis-like reduction were observed. One was reductional grouping, in which the chromosomes in a cell usually separated into two groups, and the role of spindle fibers did not show. The other type was somatic meiosis, which was analogous to meiosis presenting in gametogenesis, and chromosome pairing and chiasmata were visualized.

  7. Stochastic modeling indicates that aging and somatic evolution in the hematopoetic system are driven by non-cell-autonomous processes.

    PubMed

    Rozhok, Andrii I; Salstrom, Jennifer L; DeGregori, James

    2014-12-01

    Age-dependent tissue decline and increased cancer incidence are widely accepted to be rate-limited by the accumulation of somatic mutations over time. Current models of carcinogenesis are dominated by the assumption that oncogenic mutations have defined advantageous fitness effects on recipient stem and progenitor cells, promoting and rate-limiting somatic evolution. However, this assumption is markedly discrepant with evolutionary theory, whereby fitness is a dynamic property of a phenotype imposed upon and widely modulated by environment. We computationally modeled dynamic microenvironment-dependent fitness alterations in hematopoietic stem cells (HSC) within the Sprengel-Liebig system known to govern evolution at the population level. Our model for the first time integrates real data on age-dependent dynamics of HSC division rates, pool size, and accumulation of genetic changes and demonstrates that somatic evolution is not rate-limited by the occurrence of mutations, but instead results from aged microenvironment-driven alterations in the selective/fitness value of previously accumulated genetic changes. Our results are also consistent with evolutionary models of aging and thus oppose both somatic mutation-centric paradigms of carcinogenesis and tissue functional decline. In total, we demonstrate that aging directly promotes HSC fitness decline and somatic evolution via non-cell-autonomous mechanisms.

  8. Recent advances in understanding of meiosis initiation and the apomictic pathway in plants.

    PubMed

    Wang, Chung-Ju R; Tseng, Ching-Chih

    2014-01-01

    Meiosis, a specialized cell division to produce haploid cells, marks the transition from a sporophytic to a gametophytic generation in the life cycle of plants. In angiosperms, meiosis takes place in sporogenous cells that develop de novo from somatic cells in anthers or ovules. A successful transition from the mitotic cycle to the meiotic program in sporogenous cells is crucial for sexual reproduction. By contrast, when meiosis is bypassed or a mitosis-like division occurs to produce unreduced cells, followed by the development of an embryo sac, clonal seeds can be produced by apomixis, an asexual reproduction pathway found in 400 species of flowering plants. An understanding of the regulation of entry into meiosis and molecular mechanisms of apomictic pathway will provide vital insight into reproduction for plant breeding. Recent findings suggest that AM1/SWI1 may be the key gene for entry into meiosis, and increasing evidence has shown that the apomictic pathway is epigenetically controlled. However, the mechanism for the initiation of meiosis during sexual reproduction or for its omission in the apomictic pathway still remains largely unknown. Here we review the current understanding of meiosis initiation and the apomictic pathway and raised several questions that are awaiting further investigation.

  9. Somatic and germinal cells' interrelationship in the course of seminiferous tubule maturation in man.

    PubMed

    Kula, K; Romer, T E; Wlodarczyk, W P

    1980-02-01

    Certain successive phases of seminiferous tubule maturation were observed in a transsection of a Leydig cell adenoma-bearing testis of a boy with precocious puberty. Massively accumulated Leydig cells may stimulate the maturation of Sertoli cells, as indicated by progressive replacement of Sertoli cell precursors by mature Sertoli cells at a distance closer to the adenoma. On the other hand, tubules less advanced in maturation contained a higher number of somatic cells than those more advanced in maturation. Leydig-cell-dependent maturation of Sertoli cells may be in competition with Certoli cell multiplication, or numerous undifferentiated somatic cells may undergo a natural elimination in the course of tubular maturation. An inverse relation between the number of Sertoli cell precursors and the number of meiotic spermatocytes suggests that quantitative reduction of Sertoli cell precursors may be important for the intratubular milieu necessary for the onset of the first meiosis in man.

  10. Knockout of exogenous EGFP gene in porcine somatic cells using zinc-finger nucleases

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Watanabe, Masahito; Department of Life Sciences, School of Agriculture, Meiji University, 1-1-1 Higashimita, Tama-ku, Kawasaki, Kanagawa 214-8571; Umeyama, Kazuhiro

    2010-11-05

    Research highlights: {yields} EGFP gene integrated in porcine somatic cells could be knocked out using the ZFN-KO system. {yields} ZFNs induced targeted mutations in porcine primary cultured cells. {yields} Complete absence of EGFP fluorescence was confirmed in ZFN-treated cells. -- Abstract: Zinc-finger nucleases (ZFNs) are expected as a powerful tool for generating gene knockouts in laboratory and domestic animals. Currently, it is unclear whether this technology can be utilized for knocking-out genes in pigs. Here, we investigated whether knockout (KO) events in which ZFNs recognize and cleave a target sequence occur in porcine primary cultured somatic cells that harbor themore » exogenous enhanced green fluorescent protein (EGFP) gene. ZFN-encoding mRNA designed to target the EGFP gene was introduced by electroporation into the cell. Using the Surveyor nuclease assay and flow cytometric analysis, we confirmed ZFN-induced cleavage of the target sequence and the disappearance of EGFP fluorescence expression in ZFN-treated cells. In addition, sequence analysis revealed that ZFN-induced mutations such as base substitution, deletion, or insertion were generated in the ZFN cleavage site of EGFP-expression negative cells that were cloned from ZFN-treated cells, thereby showing it was possible to disrupt (i.e., knock out) the function of the EGFP gene in porcine somatic cells. To our knowledge, this study provides the first evidence that the ZFN-KO system can be applied to pigs. These findings may open a new avenue to the creation of gene KO pigs using ZFN-treated cells and somatic cell nuclear transfer.« less

  11. Human somatic cell nuclear transfer and reproductive cloning: an Ethics Committee opinion.

    PubMed

    2016-04-01

    This document presents arguments that conclude that it is unethical to use somatic cell nuclear transfer (SCNT) for infertility treatment due to concerns about safety; the unknown impact of SCNT on children, families, and society; and the availability of other ethically acceptable means of assisted reproduction. This document replaces the ASRM Ethics Committee report titled, "Human somatic cell nuclear transfer and cloning," last published in Fertil Steril 2012;98:804-7. Copyright © 2016 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  12. Synchronization of Somatic Embryogenesis in Date Palm Suspension Culture Using Abscisic Acid.

    PubMed

    Alwael, Hussain A; Naik, Poornananda M; Al-Khayri, Jameel M

    2017-01-01

    Somatic embryogenesis is considered the most effective method for commercial propagation of date palm. However, the limitation of obtaining synchronized development of somatic embryos remains an impediment. The synchronization of somatic embryo development is ideal for the applications to produce artificial seeds. Abscisic acid (ABA) is associated with stress response and influences in vitro growth and development. This chapter describes an effective method to achieve synchronized development of somatic embryos in date palm cell suspension culture. Among the ABA concentrations tested (0, 1, 10, 50, 100 μM), the best synchronized growth was obtained in response to 50-100 μM. Here we provide a comprehensive protocol for in vitro plant regeneration of date palm starting with shoot-tip explant, callus initiation and growth, cell suspension establishment, embryogenesis synchronization with ABA treatment, somatic embryo germination, and rooting as well as acclimatized plantlet establishment.

  13. Somatic hybridization of sexually incompatible petunias: Petunia parodii, Petunia parviflora.

    PubMed

    Power, J B; Berry, S F; Chapman, J V; Cocking, E C

    1980-01-01

    Somatic hybrid plants were regenerated following the fusion of leaf mesophyll protoplasts of P. parodii with those isolated from a nuclear-albino mutant of P. parviflora. Attempts at sexual hybridization of these two species repeatedly failed thus confirming their previously established cross-incompatibility. Selection of somatic hybrid plants was possible since protoplasts of P. parodii would not develop beyond the cell colony stage, whilst those of the somatic hybrid and albino P. parviflora produced calluses. Green somatic hybrid calluses were visible against a background of albino cells/calluses, and upon transfer to regeneration media gave rise to shoots. Shoots and the resultant flowering plants were confirmed as somatic hybrids based on their growth habit, floral pigmentation and morphology, leaf hair structure, chromosome number and Fraction 1 protein profiles. The relevance of such hybrid material for the development of new, and extensively modified cultivars, is discussed.

  14. Notch Signaling Regulates Ovarian Follicle Formation and Coordinates Follicular Growth

    PubMed Central

    Vanorny, Dallas A.; Prasasya, Rexxi D.; Chalpe, Abha J.; Kilen, Signe M.

    2014-01-01

    Ovarian follicles form through a process in which somatic pregranulosa cells encapsulate individual germ cells from germ cell syncytia. Complementary expression of the Notch ligand, Jagged1, in germ cells and the Notch receptor, Notch2, in pregranulosa cells suggests a role for Notch signaling in mediating cellular interactions during follicle assembly. Using a Notch reporter mouse, we demonstrate that Notch signaling is active within somatic cells of the embryonic ovary, and these cells undergo dramatic reorganization during follicle histogenesis. This coincides with a significant increase in the expression of the ligands, Jagged1 and Jagged2; the receptor, Notch2; and the target genes, Hes1 and Hey2. Histological examination of ovaries from mice with conditional deletion of Jagged1 within germ cells (J1 knockout [J1KO]) or Notch2 within granulosa cells (N2 knockout [N2KO]) reveals changes in follicle dynamics, including perturbations in the primordial follicle pool and antral follicle development. J1KO and N2KO ovaries also contain multi-oocytic follicles, which represent a failure to resolve germ cell syncytia, and follicles with enlarged oocytes but lacking somatic cell growth, signifying a potential role of Notch signaling in follicle activation and the coordination of follicle development. We also observed decreased cell proliferation and increased apoptosis in the somatic cells of both conditional knockout lines. As a consequence of these defects, J1KO female mice are subfertile; however, N2KO female mice remain fertile. This study demonstrates important functions for Jagged1 and Notch2 in the resolution of germ cell syncytia and the coordination of somatic and germ cell growth within follicles of the mouse ovary. PMID:24552588

  15. Spontaneous generation of germline characteristics in mouse fibrosarcoma cells

    NASA Astrophysics Data System (ADS)

    Ma, Zhan; Hu, Yao; Jiang, Guoying; Hou, Jun; Liu, Ruilai; Lu, Yuan; Liu, Chunfang

    2012-10-01

    Germline/embryonic-specific genes have been found to be activated in somatic tumors. In this study, we further showed that cells functioning as germline could be present in mouse fibrosarcoma cells (L929 cell line). Early germline-like cells spontaneously appeared in L929 cells and further differentiated into oocyte-like cells. These germline-like cells can, in turn, develop into blastocyst-like structures in vitro and cause teratocarcinomas in vivo, which is consistent with natural germ cells in function. Generation of germline-like cells from somatic tumors might provide a novel way to understand why somatic cancer cells have strong features of embryonic/germline development. It is thought that the germline traits of tumors are associated with the central characteristics of malignancy, such as immortalization, invasion, migration and immune evasion. Therefore, germline-like cells in tumors might provide potential targets to tumor biology, diagnosis and therapy.

  16. [Product safety analysis of somatic cell cloned bovine].

    PubMed

    Hua, Song; Lan, Jie; Song, Yongli; Lu, Chenglong; Zhang, Yong

    2010-05-01

    Somatic cell cloning (nuclear transfer) is a technique through which the nucleus (DNA) of a somatic cell is transferred into an enucleated oocyte for the generation of a new individual, genetically identical to the somatic cell donor. It could be applied for the enhancement of reproduction rate and the improvement of food products involving quality, yield and nutrition. In recent years, the United States, Japan and Europe as well as other countries announced that meat and milk products made from cloned cattle are safe for human consumption. Yet, cloned animals are faced with a wide range of health problems, with a high death rate and a high incidence of disease. The precise causal mechanisms for the low efficiency of cloning remain unclear. Is it safe that any products from cloned animals were allowed into the food supply? This review focuses on the security of meat, milk and products from cloned cattle based on the available data.

  17. Advances in reprogramming somatic cells to induced pluripotent stem cells.

    PubMed

    Patel, Minal; Yang, Shuying

    2010-09-01

    Traditionally, nuclear reprogramming of cells has been performed by transferring somatic cell nuclei into oocytes, by combining somatic and pluripotent cells together through cell fusion and through genetic integration of factors through somatic cell chromatin. All of these techniques changes gene expression which further leads to a change in cell fate. Here we discuss recent advances in generating induced pluripotent stem cells, different reprogramming methods and clinical applications of iPS cells. Viral vectors have been used to transfer transcription factors (Oct4, Sox2, c-myc, Klf4, and nanog) to induce reprogramming of mouse fibroblasts, neural stem cells, neural progenitor cells, keratinocytes, B lymphocytes and meningeal membrane cells towards pluripotency. Human fibroblasts, neural cells, blood and keratinocytes have also been reprogrammed towards pluripotency. In this review we have discussed the use of viral vectors for reprogramming both animal and human stem cells. Currently, many studies are also involved in finding alternatives to using viral vectors carrying transcription factors for reprogramming cells. These include using plasmid transfection, piggyback transposon system and piggyback transposon system combined with a non viral vector system. Applications of these techniques have been discussed in detail including its advantages and disadvantages. Finally, current clinical applications of induced pluripotent stem cells and its limitations have also been reviewed. Thus, this review is a summary of current research advances in reprogramming cells into induced pluripotent stem cells.

  18. Somatic embryogenesis in ferns: a new experimental system.

    PubMed

    Mikuła, Anna; Pożoga, Mariusz; Tomiczak, Karolina; Rybczyński, Jan J

    2015-05-01

    Somatic embryogenesis has never been reported in ferns. The study showed that it is much easier to evoke the acquisition and expression of embryogenic competence in ferns than in spermatophytes. We discovered that the tree fern Cyathea delgadii offers an effective model for the reproducible and rapid formation of somatic embryos on hormone-free medium. Our study provides cyto-morphological evidence for the single cell origin and development of somatic embryos. Somatic embryogenesis (SE) in both primary and secondary explants was induced on half-strength micro- and macro-nutrients Murashige and Skoog medium without the application of exogenous plant growth regulators, in darkness. The early stage of SE was characterized by sequential perpendicular cell divisions of an individual epidermal cell of etiolated stipe explant. These resulted in the formation of a linear pro-embryo. Later their development resembled that of the zygotic embryo. We defined three morphogenetic stages of fern somatic embryo development: linear, early and late embryonic leaf stage. The transition from somatic embryo to juvenile sporophyte was quick and proceeded without interruption caused by dormancy. Following 9 weeks of culture the efficiency of somatic embryogenesis reached 12-13 embryos per responding explant. Spontaneous formation of somatic embryos and callus production, which improved the effectiveness of the process sevenfold in 10-month-long culture, occurred without subculturing. The tendency for C. delgadii to propagate by SE in vitro makes this species an excellent model for studies relating to asexual embryogenesis and the endogenous hormonal regulation of that process and opens new avenues of experimentation.

  19. Interspecies somatic cell nucleus transfer with porcine oocytes as recipients: A novel bioassay system for assessing the competence of canine somatic cells to develop into embryos.

    PubMed

    Sugimura, S; Narita, K; Yamashiro, H; Sugawara, A; Shoji, T; Terashita, Y; Nishimori, K; Konno, T; Yoshida, M; Sato, E

    2009-09-01

    Interspecies somatic cell nucleus transfer (iSCNT) could be a useful bioassay system for assessing the ability of mammalian somatic cells to develop into embryos. To examine this possibility, we performed canine iSCNT using porcine oocytes, allowed to mature in vitro, as recipients. Canine fibroblasts from the tail tips and dewclaws of a female poodle (Fp) and a male poodle (Mp) were used as donors. We demonstrated that the use of porcine oocytes induced blastocyst formation in the iSCNT embryos cultured in porcine zygote medium-3. In Fp and Mp, the rate of blastocyst formation from cleaved embryos (Fp: 6.3% vs. 22.4%; and Mp: 26.1% vs. 52.4%) and the number of cells at the blastocyst stage (Fp: 30.7 vs. 60.0; and Mp: 27.2 vs. 40.1) were higher in the embryos derived from dewclaw cells than in those derived from tail-tip cells (P<0.05). The use of donor cells of any type in later passages decreased the rate of blastocyst formation. Treatment with trichostatin-A did not improve the rate of blastocyst formation from cleaved dewclaw cell-derived embryos but did so in the embryos derived from the tail-tip cells of Fp. Only blastocysts derived from dewclaw cells of Mp developed outgrowths. However, outgrowth formation was retrieved in the embryos derived from dewclaw cells of Fp by aggregation at the 4-cell stage. We inferred that iSCNT performed using porcine oocytes as recipients could represent a novel bioassay system for evaluating the developmental competence of canine somatic cells.

  20. Genetic analysis of microglandular adenosis and acinic cell carcinomas of the breast provides evidence for the existence of a low-grade triple-negative breast neoplasia family.

    PubMed

    Geyer, Felipe C; Berman, Samuel H; Marchiò, Caterina; Burke, Kathleen A; Guerini-Rocco, Elena; Piscuoglio, Salvatore; Ng, Charlotte Ky; Pareja, Fresia; Wen, Hannah Y; Hodi, Zoltan; Schnitt, Stuart J; Rakha, Emad A; Ellis, Ian O; Norton, Larry; Weigelt, Britta; Reis-Filho, Jorge S

    2017-01-01

    Acinic cell carcinoma is an indolent form of invasive breast cancer, whereas microglandular adenosis has been shown to be a neoplastic proliferation. Both entities display a triple-negative phenotype, and may give rise to and display somatic genomic alterations typical of high-grade triple-negative breast cancers. Here we report on a comparison of previously published data on eight carcinoma-associated microglandular adenosis and eight acinic cell carcinomas subjected to targeted massively parallel sequencing targeting all exons of 236 genes recurrently mutated in breast cancer and/or DNA repair-related. Somatic mutations, insertions/ deletions, and copy number alterations were detected using state-of-the-art bioinformatic algorithms. All cases were of triple-negative phenotype. A median of 4.5 (1-13) and 4.0 (1-7) non-synonymous somatic mutations per carcinoma-associated microglandular adenosis and acinic cell carcinoma were identified, respectively. TP53 was the sole highly recurrently mutated gene (75% in microglandular adenosis versus 88% in acinic cell carcinomas), and TP53 mutations were consistently coupled with loss of heterozygosity of the wild-type allele. Additional somatic mutations shared by both groups included those in BRCA1, PIK3CA, and INPP4B. Recurrent (n=2) somatic mutations restricted to microglandular adenosis or acinic cell carcinomas included those affecting PTEN and MED12 or ERBB4, respectively. No significant differences in the repertoire of somatic mutations were detected between microglandular adenosis and acinic cell carcinomas, and between this group of lesions and 77 triple-negative carcinomas from The Cancer Genome Atlas. Microglandular adenosis and acinic cell carcinomas, however, were genetically distinct from estrogen receptor-positive and/or HER2-positive breast cancers from The Cancer Genome Atlas. Our findings support the contention that microglandular adenosis and acinic cell carcinoma are part of the same spectrum of lesions harboring frequent TP53 somatic mutations, and likely represent low-grade forms of triple-negative disease with no/minimal metastatic potential, of which a subset has the potential to progress to high-grade triple-negative breast cancer.

  1. Genetic Analysis of Microglandular Adenosis and Acinic Cell Carcinomas of the Breast Provides Evidence for the Existence of a Low-grade Triple-Negative Breast Neoplasia Family

    PubMed Central

    Geyer, Felipe C; Berman, Samuel H.; Marchiò, Caterina; Burke, Kathleen A; Guerini-Rocco, Elena; Piscuoglio, Salvatore; Ng, Charlotte K Y; Pareja, Fresia; Wen, Hannah Y; Hodi, Zoltan; Schnitt, Stuart J; Rakha, Emad A; Ellis, Ian O; Norton, Larry; Weigelt, Britta; Reis-Filho, Jorge S

    2016-01-01

    Acinic cell carcinoma is an indolent form of invasive breast cancer, whereas microglandular adenosis has been shown to be a neoplastic proliferation. Both entities display a triple-negative phenotype, and may give rise to and display somatic genomic alterations typical of high-grade triple-negative breast cancers. Here we report on a comparison of previously published data on eight carcinoma-associated microglandular adenosis and eight acinic cell carcinomas subjected to targeted massively parallel sequencing targeting all exons of 236 genes recurrently mutated in breast cancer and/or DNA repair-related. Somatic mutations, insertions/deletions and copy number alterations were detected using state-of-the-art bioinformatic algorithms. All cases were of triple-negative phenotype. A median of 4.5 (1–13) and 4.0 (1–7) non-synonymous somatic mutations per carcinoma-associated microglandular adenosis and acinic cell carcinoma were identified, respectively. TP53 was the sole highly recurrently mutated gene (75% in microglandular adenosis versus 88% in acinic cell carcinomas), and TP53 mutations were consistently coupled with loss of heterozygosity of the wild-type allele. Additional somatic mutations shared by both groups included those in BRCA1, PIK3CA and INPP4B. Recurrent (n=2) somatic mutations restricted to microglandular adenosis or acinic cell carcinomas included those affecting PTEN and MED12, or ERBB4, respectively. No significant differences in the repertoire of somatic mutations were detected between microglandular adenosis and acinic cell carcinomas, and between this group of lesions and 77 triple-negative carcinomas from The Cancer Genome Atlas. Microglandular adenosis and acinic cell carcinomas, however, were genetically distinct from estrogen receptor-positive and/or HER2-positive breast cancers from The Cancer Genome Atlas. Our findings support the contention that microglandular adenosis and acinic cell carcinoma are part of the same spectrum of lesions harboring frequent TP53 somatic mutations, and likely represent low-grade forms of triple-negative disease with no/minimal metastatic potential, of which a subset has the potential to progress to high-grade triple-negative breast cancer. PMID:27713419

  2. Relationship of milking rate to somatic cell count.

    PubMed

    Brown, C A; Rischette, S J; Schultz, L H

    1986-03-01

    Information on milking rate, monthly bucket somatic cell counts, mastitis treatment, and milk production was obtained from 284 lactations of Holstein cows separated into three lactation groups. Significant correlations between somatic cell count (linear score) and other parameters included production in lactation 1 (-.185), production in lactation 2 (-.267), and percent 2-min milk in lactation 2 (.251). Somatic cell count tended to increase with maximum milking rate in all lactations, but correlations were not statistically significant. Twenty-nine percent of cows with milking rate measurements were treated for clinical mastitis. Treated cows in each lactation group produced less milk than untreated cows. In the second and third lactation groups, treated cows had a shorter total milking time and a higher percent 2-min milk than untreated cows, but differences were not statistically significant. Overall, the data support the concept that faster milking cows tend to have higher cell counts and more mastitis treatments, particularly beyond first lactation. However, the magnitude of the relationship was small.

  3. SUMOylation is developmentally regulated and required for cell pairing during conjugation in Tetrahymena thermophila.

    PubMed

    Nasir, Amjad M; Yang, Qianyi; Chalker, Douglas L; Forney, James D

    2015-02-01

    The covalent attachment of small ubiquitin-like modifier (SUMO) to target proteins regulates numerous nuclear events in eukaryotes, including transcription, mitosis and meiosis, and DNA repair. Despite extensive interest in nuclear pathways within the field of ciliate molecular biology, there have been no investigations of the SUMO pathway in Tetrahymena. The developmental program of sexual reproduction of this organism includes cell pairing, micronuclear meiosis, and the formation of a new somatic macronucleus. We identified the Tetrahymena thermophila SMT3 (SUMO) and UBA2 (SUMO-activating enzyme) genes and demonstrated that the corresponding green fluorescent protein (GFP) tagged gene products are found predominantly in the somatic macronucleus during vegetative growth. Use of an anti-Smt3p antibody to perform immunoblot assays with whole-cell lysates during conjugation revealed a large increase in SUMOylation that peaked during formation of the new macronucleus. Immunofluorescence using the same antibody showed that the increase was localized primarily within the new macronucleus. To initiate functional analysis of the SUMO pathway, we created germ line knockout cell lines for both the SMT3 and UBA2 genes and found both are essential for cell viability. Conditional Smt3p and Uba2p cell lines were constructed by incorporation of the cadmium-inducible metallothionein promoter. Withdrawal of cadmium resulted in reduced cell growth and increased sensitivity to DNA-damaging agents. Interestingly, Smt3p and Uba2p conditional cell lines were unable to pair during sexual reproduction in the absence of cadmium, consistent with a function early in conjugation. Our studies are consistent with multiple roles for SUMOylation in Tetrahymena, including a dynamic regulation associated with the sexual life cycle. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  4. Human somatic cells subjected to genetic induction with six germ line-related factors display meiotic germ cell-like features

    PubMed Central

    Medrano, Jose V.; Martínez-Arroyo, Ana M.; Míguez, Jose M.; Moreno, Inmaculada; Martínez, Sebastián; Quiñonero, Alicia; Díaz-Gimeno, Patricia; Marqués-Marí, Ana I.; Pellicer, Antonio; Remohí, Jose; Simón, Carlos

    2016-01-01

    The in vitro derivation of human germ cells has attracted interest in the last years, but their direct conversion from human somatic cells has not yet been reported. Here we tested the ability of human male somatic cells to directly convert into a meiotic germ cell-like phenotype by inducing them with a combination of selected key germ cell developmental factors. We started with a pool of 12 candidates that were reduced to 6, demonstrating that ectopic expression of the germ line-related genes PRDM1, PRDM14, LIN28A, DAZL, VASA and SYCP3 induced direct conversion of somatic cells (hFSK (46, XY), and hMSC (46, XY)) into a germ cell-like phenotype in vitro. Induced germ cell-like cells showed a marked switch in their transcriptomic profile and expressed several post-meiotic germ line related markers, showed meiotic progression, evidence of epigenetic reprogramming, and approximately 1% were able to complete meiosis as demonstrated by their haploid status and the expression of several post-meiotic markers. Furthermore, xenotransplantation assays demonstrated that a subset of induced cells properly colonize the spermatogonial niche. Knowledge obtained from this work can be used to create in vitro models to study gamete-related diseases in humans. PMID:27112843

  5. Evolution of complexity in the volvocine algae: transitions in individuality through Darwin's eye.

    PubMed

    Herron, Matthew D; Michod, Richard E

    2008-02-01

    The transition from unicellular to differentiated multicellular organisms constitutes an increase in the level complexity, because previously existing individuals are combined to form a new, higher-level individual. The volvocine algae represent a unique opportunity to study this transition because they diverged relatively recently from unicellular relatives and because extant species display a range of intermediate grades between unicellular and multicellular, with functional specialization of cells. Following the approach Darwin used to understand "organs of extreme perfection" such as the vertebrate eye, this jump in complexity can be reduced to a series of small steps that cumulatively describe a gradual transition between the two levels. We use phylogenetic reconstructions of ancestral character states to trace the evolution of steps involved in this transition in volvocine algae. The history of these characters includes several well-supported instances of multiple origins and reversals. The inferred changes can be understood as components of cooperation-conflict-conflict mediation cycles as predicted by multilevel selection theory. One such cycle may have taken place early in volvocine evolution, leading to the highly integrated colonies seen in extant volvocine algae. A second cycle, in which the defection of somatic cells must be prevented, may still be in progress.

  6. Ultrastructural changes and the distribution of arabinogalactan proteins during somatic embryogenesis of banana (Musa spp. AAA cv. 'Yueyoukang 1').

    PubMed

    Pan, Xiao; Yang, Xiao; Lin, Guimei; Zou, Ru; Chen, Houbin; Samaj, Jozef; Xu, Chunxiang

    2011-08-01

    A better understanding of somatic embryogenesis in banana (Musa spp.) may provide a practical way to improve regeneration of banana plants. In this study, we applied scanning electron microscopy (SEM) and transmission electron microscopy (TEM) to visualize the ultrastructural changes during somatic embryogenesis of banana (Musa AAA cv. 'Yueyoukang 1'). We also used histological and immunohistochemical techniques with 16 monoclonal antibodies to study the spatial distribution and cellular/subcellular localization of different arabinogalactan protein (AGP) components of the cell wall during somatic embryogenesis. Histological study with periodic acid-Schiff staining documented diverse embryogenic stages from embryogenic cells (ECs) to the late embryos. SEM revealed a mesh-like structure on the surface of proembryos which represented an early structural marker of somatic embryogenesis. TEM showed that ECs were rich in juvenile mitochondria, endoplasmic reticulum and Golgi stacks. Cells in proembryos and early globular embryos resembled ECs, but they were more vacuolated, showed more regular nuclei and slightly more developed organelles. Immunocytochemical study revealed that the signal of most AGP epitopes was stronger in starch-rich cells when compared with typical ECs. The main AGP component in the extracellular matrix surface network of banana proembryos was the MAC204 epitope. Later, AGP immunolabelling patterns varied with the developmental stages of the embryos. These results about developmental regulation of AGP epitopes along with developmental changes in the ultrastructure of cells are providing new insights into the somatic embryogenesis of banana. Copyright © Physiologia Plantarum 2011.

  7. Analysis of allelic expression patterns in clonal somatic cells by single-cell RNA-seq.

    PubMed

    Reinius, Björn; Mold, Jeff E; Ramsköld, Daniel; Deng, Qiaolin; Johnsson, Per; Michaëlsson, Jakob; Frisén, Jonas; Sandberg, Rickard

    2016-11-01

    Cellular heterogeneity can emerge from the expression of only one parental allele. However, it has remained controversial whether, or to what degree, random monoallelic expression of autosomal genes (aRME) is mitotically inherited (clonal) or stochastic (dynamic) in somatic cells, particularly in vivo. Here we used allele-sensitive single-cell RNA-seq on clonal primary mouse fibroblasts and freshly isolated human CD8 + T cells to dissect clonal and dynamic monoallelic expression patterns. Dynamic aRME affected a considerable portion of the cells' transcriptomes, with levels dependent on the cells' transcriptional activity. Notably, clonal aRME was detected, but it was surprisingly scarce (<1% of genes) and mainly affected the most weakly expressed genes. Consequently, the overwhelming majority of aRME occurs transiently within individual cells, and patterns of aRME are thus primarily scattered throughout somatic cell populations rather than, as previously hypothesized, confined to patches of clonally related cells.

  8. The actin-binding protein profilin is required for germline stem cell maintenance and germ cell enclosure by somatic cyst cells

    PubMed Central

    Shields, Alicia R.; Spence, Allyson C.; Yamashita, Yukiko M.; Davies, Erin L.; Fuller, Margaret T.

    2014-01-01

    Specialized microenvironments, or niches, provide signaling cues that regulate stem cell behavior. In the Drosophila testis, the JAK-STAT signaling pathway regulates germline stem cell (GSC) attachment to the apical hub and somatic cyst stem cell (CySC) identity. Here, we demonstrate that chickadee, the Drosophila gene that encodes profilin, is required cell autonomously to maintain GSCs, possibly facilitating localization or maintenance of E-cadherin to the GSC-hub cell interface. Germline specific overexpression of Adenomatous Polyposis Coli 2 (APC2) rescued GSC loss in chic hypomorphs, suggesting an additive role of APC2 and F-actin in maintaining the adherens junctions that anchor GSCs to the niche. In addition, loss of chic function in the soma resulted in failure of somatic cyst cells to maintain germ cell enclosure and overproliferation of transit-amplifying spermatogonia. PMID:24346697

  9. Pancreatic Cancer

    PubMed Central

    Maitra, Anirban; Hruban, Ralph H.

    2009-01-01

    The past two decades have witnessed an explosion in our understanding of pancreatic cancer, and it is now clear that pancreatic cancer is a disease of inherited (germ-line) and somatic gene mutations. The genes mutated in pancreatic cancer include KRAS2, p16/CDKN2A, TP53, and SMAD4/DPC4, and these are accompanied by a substantial compendium of genomic and transcriptomic alterations that facilitate cell cycle deregulation, cell survival, invasion, and metastases. Pancreatic cancers do not arise de novo, and three distinct precursor lesions have been identified. Experimental models of pancreatic cancer have been developed in genetically engineered mice, which recapitulate the multistep progression of the cognate human disease. Although the putative cell of origin for pancreatic cancer remains elusive, minor populations of cells with stem-like properties have been identified that appear responsible for tumor initiation, metastases, and resistance of pancreatic cancer to conventional therapies. PMID:18039136

  10. Microautophagy in nutritive phagocytes of sea urchins.

    PubMed

    Kalachev, Alexander V; Yurchenko, Olga V

    2017-01-01

    Two types of cells were observed in germinative epithelium of male and female sea urchins: germ cells and somatic accessory cells; the latter referred to as nutritive phagocytes. At the onset of gametogenesis, nutritive phagocytes accumulate nutrients and greatly increase in their size. As gametogenesis progresses, the accumulated nutrients are transferred from nutritive phagocytes into developing gametes, and size of the nutritive phagocytes decreases. An electron microscopic study of nutritive phagocytes in sea urchins, Strongylocentrotus intermedius, at different stages of annual reproductive cycle showed for the first time that both macro- and microautophagy take place in nutritive phagocytes. Both processes occur simultaneously and regulate size and composition of nutritive phagocytes in male and female sea urchins. Nutritive phagocytes consume redundant cytoplasm via macroautophagy. Microautophagy is probably involved in consumption of redundant membranes that appear within nutritive phagocytes due to destruction of nutrient-storing globules, macroautophagy, and phagocytosis of germ cells or their remnants.

  11. Embryonic origin of adult stem cells required for tissue homeostasis and regeneration

    PubMed Central

    Davies, Erin L; Lei, Kai; Seidel, Christopher W; Kroesen, Amanda E; McKinney, Sean A; Guo, Longhua; Robb, Sofia MC; Ross, Eric J; Gotting, Kirsten; Alvarado, Alejandro Sánchez

    2017-01-01

    Planarian neoblasts are pluripotent, adult somatic stem cells and lineage-primed progenitors that are required for the production and maintenance of all differentiated cell types, including the germline. Neoblasts, originally defined as undifferentiated cells residing in the adult parenchyma, are frequently compared to embryonic stem cells yet their developmental origin remains obscure. We investigated the provenance of neoblasts during Schmidtea mediterranea embryogenesis, and report that neoblasts arise from an anarchic, cycling piwi-1+ population wholly responsible for production of all temporary and definitive organs during embryogenesis. Early embryonic piwi-1+ cells are molecularly and functionally distinct from neoblasts: they express unique cohorts of early embryo enriched transcripts and behave differently than neoblasts in cell transplantation assays. Neoblast lineages arise as organogenesis begins and are required for construction of all major organ systems during embryogenesis. These subpopulations are continuously generated during adulthood, where they act as agents of tissue homeostasis and regeneration. DOI: http://dx.doi.org/10.7554/eLife.21052.001 PMID:28072387

  12. Interaction between a pair of gypsy insulators or between heterologous gypsy and Wari insulators modulates Flp site-specific recombination in Drosophila melanogaster.

    PubMed

    Krivega, Margarita; Savitskaya, Ekaterina; Krivega, Ivan; Karakozova, Marina; Parshikov, Aleksander; Golovnin, Anton; Georgiev, Pavel

    2010-08-01

    Chromatin insulators block the action of transcriptional enhancers when interposed between an enhancer and a promoter. An Flp technology was used to examine interactions between Drosophila gypsy and Wari insulators in somatic and germ cells. The gypsy insulator consists of 12 binding sites for the Su(Hw) protein, while the endogenous Wari insulator, located on the 3' side of the white gene, is independent from the Su(Hw) protein. Insertion of the gypsy but not Wari insulator between FRT sites strongly blocks recombination between Flp dimers bound to FRT sites located on the same chromatid (recombination in cis) or in sister chromatids (unequal recombination in trans). At the same time, the interaction between Wari and gypsy insulators regulates the efficiency of Flp-mediated recombination. Thus, insulators may have a role in controlling interactions between distantly located protein complexes (not only those involved in transcriptional gene regulation) on the same chromosome or on sister chromatids in somatic and germ cells. We have also found that the frequency of Flp-mediated recombination between FRT sites is strongly dependent on the relative orientation of gypsy insulators. Taken together, our results indicate that the interactions between insulators can be visualized by Flp technology and that insulators may be involved in blocking undesirable interactions between proteins at the two-chromatid phase of the cell cycle.

  13. Distinct cellular pathways select germline-encoded and somatically mutated antibodies into immunological memory

    PubMed Central

    Kaji, Tomohiro; Ishige, Akiko; Hikida, Masaki; Taka, Junko; Hijikata, Atsushi; Kubo, Masato; Nagashima, Takeshi; Takahashi, Yoshimasa; Kurosaki, Tomohiro; Okada, Mariko; Ohara, Osamu

    2012-01-01

    One component of memory in the antibody system is long-lived memory B cells selected for the expression of somatically mutated, high-affinity antibodies in the T cell–dependent germinal center (GC) reaction. A puzzling observation has been that the memory B cell compartment also contains cells expressing unmutated, low-affinity antibodies. Using conditional Bcl6 ablation, we demonstrate that these cells are generated through proliferative expansion early after immunization in a T cell–dependent but GC-independent manner. They soon become resting and long-lived and display a novel distinct gene expression signature which distinguishes memory B cells from other classes of B cells. GC-independent memory B cells are later joined by somatically mutated GC descendants at roughly equal proportions and these two types of memory cells efficiently generate adoptive secondary antibody responses. Deletion of T follicular helper (Tfh) cells significantly reduces the generation of mutated, but not unmutated, memory cells early on in the response. Thus, B cell memory is generated along two fundamentally distinct cellular differentiation pathways. One pathway is dedicated to the generation of high-affinity somatic antibody mutants, whereas the other preserves germ line antibody specificities and may prepare the organism for rapid responses to antigenic variants of the invading pathogen. PMID:23027924

  14. Tumorigenicity assessment of human cell-processed therapeutic products.

    PubMed

    Yasuda, Satoshi; Sato, Yoji

    2015-09-01

    Human pluripotent stem cells (hPSCs) are expected to be sources of various cell types used for cell therapy, although hPSCs are intrinsically tumorigenic and form teratomas in immunodeficient animals after transplant. Despite the urgent need, no detailed guideline for the assessment of tumorigenicity of human cell-processed therapeutic products (hCTPs) has been issued. Here we describe our consideration on tumorigenicity and related tests of hCTPs. The purposes of those tests for hPSC-based products are classified into three categories: 1) quality control of raw materials; 2) quality control of intermediate/final products; and 3) safety assessment of final products. Appropriate types of tests need to be selected, taking the purpose(s) into consideration. In contrast, human somatic (and somatic stem) cells are believed to have little tumorigenicity. Therefore, GMP-compliant quality control is essential to avoid contamination of somatic cell-derived products with tumorigenic cells. Compared with in vivo tumorigenicity tests, in vitro cell proliferation assays may be more useful and reasonable for detecting immortalized cells that have a growth advantage in somatic cell-based products. The results obtained from tumorigenicity and related tests for hCTPs should meet the criteria for decisions on product development, manufacturing processes, and clinical applications. Copyright © 2015.

  15. Piwi Is Required in Multiple Cell Types to Control Germline Stem Cell Lineage Development in the Drosophila Ovary

    PubMed Central

    Ma, Xing; Wang, Su; Do, Trieu; Song, Xiaoqing; Inaba, Mayu; Nishimoto, Yoshiya; Liu, Lu-ping; Gao, Yuan; Mao, Ying; Li, Hui; McDowell, William; Park, Jungeun; Malanowski, Kate; Peak, Allison; Perera, Anoja; Li, Hua; Gaudenz, Karin; Haug, Jeff; Yamashita, Yukiko; Lin, Haifan; Ni, Jian-quan; Xie, Ting

    2014-01-01

    The piRNA pathway plays an important role in maintaining genome stability in the germ line by silencing transposable elements (TEs) from fly to mammals. As a highly conserved piRNA pathway component, Piwi is widely expressed in both germ cells and somatic cells in the Drosophila ovary and is required for piRNA production in both cell types. In addition to its known role in somatic cap cells to maintain germline stem cells (GSCs), this study has demonstrated that Piwi has novel functions in somatic cells and germ cells of the Drosophila ovary to promote germ cell differentiation. Piwi knockdown in escort cells causes a reduction in escort cell (EC) number and accumulation of undifferentiated germ cells, some of which show active BMP signaling, indicating that Piwi is required to maintain ECs and promote germ cell differentiation. Simultaneous knockdown of dpp, encoding a BMP, in ECs can partially rescue the germ cell differentiation defect, indicating that Piwi is required in ECs to repress dpp. Consistent with its key role in piRNA production, TE transcripts increase significantly and DNA damage is also elevated in the piwi knockdown somatic cells. Germ cell-specific knockdown of piwi surprisingly causes depletion of germ cells before adulthood, suggesting that Piwi might control primordial germ cell maintenance or GSC establishment. Finally, Piwi inactivation in the germ line of the adult ovary leads to gradual GSC loss and germ cell differentiation defects, indicating the intrinsic role of Piwi in adult GSC maintenance and differentiation. This study has revealed new germline requirement of Piwi in controlling GSC maintenance and lineage differentiation as well as its new somatic function in promoting germ cell differentiation. Therefore, Piwi is required in multiple cell types to control GSC lineage development in the Drosophila ovary. PMID:24658126

  16. Examination of a modified cell cycle synchronization method and bovine nuclear transfer using synchronized early G1 phase fibroblast cells.

    PubMed

    Urakawa, Manami; Ideta, Atsushi; Sawada, Tokihiko; Aoyagi, Yoshito

    2004-08-01

    Somatic cell nuclear transfer has a low success rate, due to a high incidence of fetal loss and increased perinatal morbidity/mortality. One factor that may affect the successful development of nuclear transfer embryos is the cell cycle stage of the donor cell. In order to establish a cell cycle synchronization method that can consistently produce cloned embryos and offspring, we examined the effects of different combinations of three cell treatments on the recovery rate of mitotic phase cells using bovine fetal fibroblasts. In the first experiment, we examined the recovery rate of mitotic phase cells by a combination of treatment with a metaphase arrestant (1 microM 2-methoxyestradiol), shaking the plate and selecting cells with a diameter of 20 microns. As a result, 99% of mitotic phase cells were recovered by repeating the combined treatment of metaphase arrestant and shaking, and collection of cells with a specific diameter. In the second experiment, nuclear transfer was carried out using early G1 phase cells by choosing pairs of bridged cells derived from mitotic phase cells recovered by the combined treatment of 1 microM 2-methoxyestradiol and shaking, and collection of cells with a diameter of 20 microns. The reconstructed embryos were transferred to recipient heifers to determine post-implantation development. Development of embryos reconstructed from early G1 phase cells from the >/=6 cells stage on Day 3 to the morula-blastocyst stage on Day 6 was 100%. Ten blastocysts constructed from two cell lines were transferred into 10 recipient heifers. Nine of the 10 recipients delivered single live calves. In conclusion, mitotic phase bovine fibroblast cells were easily recovered by the combined treatments of 1 microM 2-methoxyestradiol, shaking, and selecting cells of the appropriate diameter. Furthermore, nuclear transfer using cells in the early G1 phase as donor cells gave a high rate of offspring production.

  17. Protein Equilibration through Somatic Ring Canals in Drosophila

    PubMed Central

    McLean, Peter F.; Cooley, Lynn

    2013-01-01

    Although intercellular bridges resulting from incomplete cytokinesis were discovered in somatic Drosophila tissues decades ago, the impact of these structures on intercellular communication and tissue biology is largely unknown. In this work, we demonstrate that the ~250 nm diameter somatic ring canals permit diffusion of cytoplasmic contents between connected cells and across mitotic clone boundaries, and enable the equilibration of protein between transcriptionally mosaic follicle cells in the Drosophila ovary. We obtained similar, though more restricted, results in the larval imaginal discs. Our work illustrates the lack of cytoplasmic autonomy in these tissues and suggests a role for somatic ring canals in promoting homogeneous protein expression within the tissue. PMID:23704373

  18. Proteomic analysis of blastema formation in regenerating axolotl limbs

    PubMed Central

    2009-01-01

    Background Following amputation, urodele salamander limbs reprogram somatic cells to form a blastema that self-organizes into the missing limb parts to restore the structure and function of the limb. To help understand the molecular basis of blastema formation, we used quantitative label-free liquid chromatography-mass spectrometry/mass spectrometry (LC-MS/MS)-based methods to analyze changes in the proteome that occurred 1, 4 and 7 days post amputation (dpa) through the mid-tibia/fibula of axolotl hind limbs. Results We identified 309 unique proteins with significant fold change relative to controls (0 dpa), representing 10 biological process categories: (1) signaling, (2) Ca2+ binding and translocation, (3) transcription, (4) translation, (5) cytoskeleton, (6) extracellular matrix (ECM), (7) metabolism, (8) cell protection, (9) degradation, and (10) cell cycle. In all, 43 proteins exhibited exceptionally high fold changes. Of these, the ecotropic viral integrative factor 5 (EVI5), a cell cycle-related oncoprotein that prevents cells from entering the mitotic phase of the cell cycle prematurely, was of special interest because its fold change was exceptionally high throughout blastema formation. Conclusion Our data were consistent with previous studies indicating the importance of inositol triphosphate and Ca2+ signaling in initiating the ECM and cytoskeletal remodeling characteristic of histolysis and cell dedifferentiation. In addition, the data suggested that blastema formation requires several mechanisms to avoid apoptosis, including reduced metabolism, differential regulation of proapoptotic and antiapoptotic proteins, and initiation of an unfolded protein response (UPR). Since there is virtually no mitosis during blastema formation, we propose that high levels of EVI5 function to arrest dedifferentiated cells somewhere in the G1/S/G2 phases of the cell cycle until they have accumulated under the wound epidermis and enter mitosis in response to neural and epidermal factors. Our findings indicate the general value of quantitative proteomic analysis in understanding the regeneration of complex structures. PMID:19948009

  19. Somatic cell hybrid mapping on mouse chromosome 11 (MMU11): Assignment of markers relative to two breakpoints in band D

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Morris, D.J.; Robinson, T.J.; Adler, I.D.

    1993-02-01

    Mouse [times] rat somatic cell hybrids were generated by fusing mouse cell lines that are heterozygous for reciprocal translocations involving the T42H and T9Ad breakpoints on mouse chromosome 11 (MMU11) to a thymidine kinase-negative (Tk[sup [minus

  20. Dogs cloned from adult somatic cells.

    PubMed

    Lee, Byeong Chun; Kim, Min Kyu; Jang, Goo; Oh, Hyun Ju; Yuda, Fibrianto; Kim, Hye Jin; Hossein, M Shamim; Shamim, M Hossein; Kim, Jung Ju; Kang, Sung Keun; Schatten, Gerald; Hwang, Woo Suk

    2005-08-04

    Several mammals--including sheep, mice, cows, goats, pigs, rabbits, cats, a mule, a horse and a litter of three rats--have been cloned by transfer of a nucleus from a somatic cell into an egg cell (oocyte) that has had its nucleus removed. This technology has not so far been successful in dogs because of the difficulty of maturing canine oocytes in vitro. Here we describe the cloning of two Afghan hounds by nuclear transfer from adult skin cells into oocytes that had matured in vivo. Together with detailed sequence information generated by the canine-genome project, the ability to clone dogs by somatic-cell nuclear transfer should help to determine genetic and environmental contributions to the diverse biological and behavioural traits associated with the many different canine breeds.

  1. 76 FR 36078 - Milk for Manufacturing Purposes and Its Production and Processing; Requirements Recommended for...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-06-21

    ... that goats have a need for different regulatory limits for somatic cells than cows. DATES: Effective... producer herd goat milk. Due to inherent differences between cows and goats, goat milk with a somatic cell...

  2. [Nuclear transfer of goat somatic cells transgenic for human lactoferrin].

    PubMed

    Li, Lan; Shen, Wei; Pan, Qing-Yu; Min, Ling-Jiang; Sun, Yu-Jiang; Fang, Yong-Wei; Deng, Ji-Xian; Pan, Qing-Jie

    2006-12-01

    Transgenic animal mammary gland bioreactors are being used to produce recombinant proteins with appropriate post-translational modifications, and nuclear transfer of transgenic somatic cells is a more powerful method to produce mammary gland bioreactor. Here we describe efficient gene transfer and nuclear transfer in goat somatic cells. Gene targeting vector pGBC2LF was constructed by cloning human lactoferrin (LF) gene cDNA into exon 2 of the milk goat beta-casein gene, and the endogenous start condon was replaced by that of human LF gene. Goat fetal fibroblasts were transfected with linearized pGBC2LF and 14 cell lines were positive according to PCR and Southern blot. The transgenic cells were used as donor cells of nuclear transfer, and some of reconstructed embryos could develop to blastocyst in vitro.

  3. Stable transformation via particle bombardment in two different soybean regeneration systems.

    PubMed

    Sato, S; Newell, C; Kolacz, K; Tredo, L; Finer, J; Hinchee, M

    1993-05-01

    The Biolistics(®) particle delivery system for the transformation of soybean (Glycine max L. Merr.) was evaluated in two different regeneration systems. The first system was multiple shoot proliferation from shoot tips obtained from immature zygotic embryos of the cultivar Williams 82, and the second was somatic embryogenesis from a long term proliferative suspension culture of the cultivar Fayette. Bombardment of shoot tips with tungsten particles, coated with precipitated DNA containing the gene for β-glucuronidase (GUS), produced GUS-positive sectors in 30% of the regenerated shoots. However, none of the regenerants which developed into plants continued to produce GUS positive tissue. Bombardment of embryogenic suspension cultures produced GUS positive globular somatic embryos which proliferated into GUS positive somatic embryos and plants. An average of 4 independent transgenic lines were generated per bombarded flask of an embryogenic suspension. Particle bombardment delivered particles into the first two cell layers of either shoot tips or somatic embryos. Histological analysis indicated that shoot organogenesis appeared to involve more than the first two superficial cell layers of a shoot tip, while somatic embryo proliferation occurred from the first cell layer of existing somatic embryos. The different transformation results obtained with these two systems appeared to be directly related to differences in the cell types which were responsible for regeneration and their accessibility to particle penetration.

  4. Use of somatic cell banks in the conservation of wild felids.

    PubMed

    Praxedes, Érika A; Borges, Alana A; Santos, Maria V O; Pereira, Alexsandra F

    2018-05-03

    The conservation of biological resources is an interesting strategy for the maintenance of biodiversity, especially for wild felids who are constantly threatened with extinction. For this purpose, cryopreservation techniques have been used for the long-term storage of gametes, embryos, gonadal tissues, and somatic cells and tissues. The establishment of these banks has been suggested as a practical approach to the preservation of species and, when done in tandem with assisted reproductive techniques, could provide the means for reproducing endangered species. Somatic cell banks have been shown remarkable for the conservation of genetic material of felids; by merely obtaining skin samples, it is possible to sample a large group of individuals without being limited by factors such as gender or age. Thus, techniques for somatic tissue recovery, cryopreservation, and in vitro culture of different wild felids have been developed, resulting in a viable method for the conservation of species. One of the most notable conservation programs for wild felines using somatic samples was the one carried out for the Iberian lynx, the most endangered feline in the world. Other wild felids have also been studied in other continents, such as the jaguar in South America. This review aims to present the technical progress achieved in the conservation of somatic cells and tissues in different wild felids, as well address the progress that has been achieved in a few species. © 2018 Wiley Periodicals, Inc.

  5. Epstein-Barr virus-infected B cells expanding in germinal centers of infectious mononucleosis patients do not participate in the germinal center reaction.

    PubMed

    Kurth, Julia; Hansmann, Martin-Leo; Rajewsky, Klaus; Küppers, Ralf

    2003-04-15

    To assess the impact of the germinal center (GC) reaction on viral spread in Epstein-Barr virus (EBV) infection, we isolated EBV(+) GC B cells from the tonsils of two infectious mononucleosis patients, sequenced their rearranged V genes, and determined expression of the EBV latency genes EBV nuclear antigen 2 and latent membrane protein 1. Most EBV(+) GC B cells belonged to clones of cells harboring somatically mutated V gene rearrangements. Ongoing somatic hypermutation, the hallmark of the GC reaction, was seen only in uninfected GC B cell clones, not in EBV(+) B cell clones. Thus, in infectious mononucleosis, GC and/or memory B cells are directly infected by EBV and expand without somatic hypermutation, whereas the GC passage of EBV-infected naive B cells does not contribute detectably to the generation of infected memory B cells, the main reservoir of EBV during persistence. Most, if not all, EBV-infected cells in GCs exhibited an unusual EBV gene expression pattern in that they were positive for EBV nuclear antigen 2 but negative for latent membrane protein 1. Although the three main types of EBV-associated B cell lymphomas (Burkitt's, Hodgkin's, and posttransplant lymphomas) presumably are derived from GC B cells, EBV(+) GC B cells resembling these EBV(+) GC B cell lymphomas in terms of EBV gene expression and somatic hypermutation pattern could not be identified.

  6. The human Piwi protein Hiwi2 associates with tRNA-derived piRNAs in somatic cells

    PubMed Central

    Keam, Simon P.; Young, Paul E.; McCorkindale, Alexandra L.; Dang, Thurston H.Y.; Clancy, Jennifer L.; Humphreys, David T.; Preiss, Thomas; Hutvagner, Gyorgy; Martin, David I.K.; Cropley, Jennifer E.; Suter, Catherine M.

    2014-01-01

    The Piwi-piRNA pathway is active in animal germ cells where its functions are required for germ cell maintenance and gamete differentiation. Piwi proteins and piRNAs have been detected outside germline tissue in multiple phyla, but activity of the pathway in mammalian somatic cells has been little explored. In particular, Piwi expression has been observed in cancer cells, but nothing is known about the piRNA partners or the function of the system in these cells. We have surveyed the expression of the three human Piwi genes, Hiwi, Hili and Hiwi2, in multiple normal tissues and cancer cell lines. We find that Hiwi2 is ubiquitously expressed; in cancer cells the protein is largely restricted to the cytoplasm and is associated with translating ribosomes. Immunoprecipitation of Hiwi2 from MDAMB231 cancer cells enriches for piRNAs that are predominantly derived from processed tRNAs and expressed genes, species which can also be found in adult human testis. Our studies indicate that a Piwi-piRNA pathway is present in human somatic cells, with an uncharacterised function linked to translation. Taking this evidence together with evidence from primitive organisms, we propose that this somatic function of the pathway predates the germline functions of the pathway in modern animals. PMID:25038252

  7. Post-irradiation somatic mutation and clonal stabilisation time in the human colon.

    PubMed Central

    Campbell, F; Williams, G T; Appleton, M A; Dixon, M F; Harris, M; Williams, E D

    1996-01-01

    BACKGROUND: Colorectal crypts are clonal units in which somatic mutation of marker genes in stem cells leads to crypt restricted phenotypic conversion initially involving part of the crypt, later the whole crypt. Studies in mice show that the time taken for the great majority of mutated crypts to be completely converted, the clonal stabilisation time, is four weeks in the colon and 21 weeks in the ileum. Differences in the clonal stabilisation time between tissues and species are thought to reflect differences in stem cell organisation and crypt kinetics. AIM: To study the clonal stabilisation time in the human colorectum. METHODS: Stem cell mutation can lead to crypt restricted loss of O-acetylation of sialomucins in subjects heterozygous for O-acetyltransferase gene activity. mPAS histochemistry was used to visualise and quantify crypts partially or wholly involved by the mutant phenotype in 21 informative cases who had undergone colectomy up to 34 years after radiotherapy. RESULTS: Radiotherapy was followed by a considerable increase in the discordant crypt frequency that remained significantly increased for many years. The proportion of discordant crypts showing partial involvement was initially high but fell to normal levels about 12 months after irradiation. CONCLUSIONS: Crypts wholly involved by a mutant phenotype are stable and persistent while partially involved crypts are transient. The clonal stabilisation time is approximately one year in the human colon compared with four weeks in the mouse. The most likely reason for this is a difference in the number of stem cells in a crypt stem cell niche, although differences in stem cell cycle time and crypt fission may also contribute. These findings are of relevance to colorectal gene therapy and carcinogenesis in stem cell systems. PMID:8944567

  8. A stochastic model of cell replicative senescence based on telomere shortening, oxidative stress, and somatic mutations in nuclear and mitochondrial DNA.

    PubMed

    Sozou, P D; Kirkwood, T B

    2001-12-21

    Human diploid fibroblast cells can divide for only a limited number of times in vitro, a phenomenon known as replicative senescence or the Hayflick limit. Variability in doubling potential is observed within a clone of cells, and between two sister cells arising from a single mitotic division. This strongly suggests that the process by which cells become senescent is intrinsically stochastic. Among the various biochemical mechanisms that have been proposed to explain replicative senescence, particular interest has been focussed on the role of telomere reduction. In the absence of telomerase--an enzyme switched off in normal diploid fibro-blasts-cells lose telomeric DNA at each cell division. According to the telomere hypothesis of cell senescence, cells eventually reach a critically short telomere length and cell cycle arrest follows. In support of this concept, forced expression of telomerase in normal fibroblasts appears to prevent cell senescence. Nevertheless, the telomere hypothesis in its basic form has some difficulty in explaining the marked stochastic variations seen in the replicative lifespans of individual cells within a culture, and there is strong empirical and theoretical support for the concept that other kinds of damage may contribute to cellular ageing. We describe a stochastic network model of cell senescence in which a primary role is played by telomere reduction but in which other mechanisms (oxidative stress linked particularly to mitochondrial damage, and nuclear somatic mutations) also contribute. The model gives simulation results that are in good agreement with published data on intra-clonal variability in cell doubling potential and permits an analysis of how the various elements of the stochastic network interact. Such integrative models may aid in developing new experimental approaches aimed at unravelling the intrinsic complexity of the mechanisms contributing to human cell ageing. Copyright 2001 Academic Press.

  9. Nucleosome organizations in induced pluripotent stem cells reprogrammed from somatic cells belonging to three different germ layers.

    PubMed

    Tao, Yu; Zheng, Weisheng; Jiang, Yonghua; Ding, Guitao; Hou, Xinfeng; Tang, Yitao; Li, Yueying; Gao, Shuai; Chang, Gang; Zhang, Xiaobai; Liu, Wenqiang; Kou, Xiaochen; Wang, Hong; Jiang, Cizhong; Gao, Shaorong

    2014-12-21

    Nucleosome organization determines the chromatin state, which in turn controls gene expression or silencing. Nucleosome remodeling occurs during somatic cell reprogramming, but it is still unclear to what degree the re-established nucleosome organization of induced pluripotent stem cells (iPSCs) resembles embryonic stem cells (ESCs), and whether the iPSCs inherit some residual gene expression from the parental fibroblast cells. We generated genome-wide nucleosome maps in mouse ESCs and in iPSCs reprogrammed from somatic cells belonging to three different germ layers using a secondary reprogramming system. Pairwise comparisons showed that the nucleosome organizations in the iPSCs, regardless of the iPSCs' tissue of origin, were nearly identical to the ESCs, but distinct from mouse embryonic fibroblasts (MEF). There is a canonical nucleosome arrangement of -1, nucleosome depletion region, +1, +2, +3, and so on nucleosomes around the transcription start sites of active genes whereas only a nucleosome occupies silent transcriptional units. Transcription factor binding sites possessed characteristic nucleosomal architecture, such that their access was governed by the rotational and translational settings of the nucleosome. Interestingly, the tissue-specific genes were highly expressed only in the parental somatic cells of the corresponding iPS cell line before reprogramming, but had a similar expression level in all the resultant iPSCs and ESCs. The re-established nucleosome landscape during nuclear reprogramming provides a conserved setting for accessibility of DNA sequences in mouse pluripotent stem cells. No persistent residual expression program or nucleosome positioning of the parental somatic cells that reflected their tissue of origin was passed on to the resulting mouse iPSCs.

  10. Hippo pathway regulates somatic development and cell proliferation of silkworm.

    PubMed

    Li, Niannian; Tong, Xiaoling; Zeng, Jie; Meng, Gang; Sun, Fuze; Hu, Hai; Song, Jiangbo; Lu, Cheng; Dai, Fangyin

    2018-03-01

    Hippo signaling pathway (signaling pathway Hippo, hereinafter referred to as the Hippo pathway) was the earliest found in Drosophila (Schneck [1]), which can regulate the development of tissues and organs, even some components of the pathway were identified as tumor suppressor [2]. The pathway was more concerned in fruit flies and mice (Schneck [1]), but little attention has been given in silkworm, an important economic and lepidopteran model insect. In this manuscript, we identified major Hippo pathway related genes (Hippo, Salvador, Warts, Mats, Yorkie) in silkworm and named BmHpo, BmSav, BmWts, BmMats, BmYki. The domain organization of these genes was highly conserved in silkworm and other organisms suggesting that they could use similar protein-protein interactions to construct the Hippo kinase cascades. The expression profiles of these genes in silkworm during embryonic, larval, wandering, pupal and adult stages were analyzed, 14 tissues/organs of the day 3, 5th instar larvae (L5D3) as well. Experimental results showed that the expression of Hippo pathway had some influence on the development of silkworm. In order to find out the mechanism of Hippo pathway affecting silkworm development, BmHpo and BmYki were up-regulated and de-regulated in the cell line of Bombyx mori-BmN-SWU1(NS), and the changes of cell proliferation activity and cell cycle were detected. The distribution of BmYki was detected by immunofluorescence technique. This study provides insights into the genes of Hippo pathway which have a certain effect on somatic development and cell proliferation in silkworm. Copyright © 2018 Elsevier Inc. All rights reserved.

  11. Simple Monitoring of Gene Targeting Efficiency in Human Somatic Cell Lines Using the PIGA Gene

    PubMed Central

    Karnan, Sivasundaram; Konishi, Yuko; Ota, Akinobu; Takahashi, Miyuki; Damdindorj, Lkhagvasuren; Hosokawa, Yoshitaka; Konishi, Hiroyuki

    2012-01-01

    Gene targeting in most of human somatic cell lines has been labor-intensive because of low homologous recombination efficiency. The development of an experimental system that permits a facile evaluation of gene targeting efficiency in human somatic cell lines is the first step towards the improvement of this technology and its application to a broad range of cell lines. In this study, we utilized phosphatidylinositol glycan anchor biosynthesis class A (PIGA), a gene essential for the synthesis of glycosylphosphatidyl inositol (GPI) anchors, as a reporter of gene targeting events in human somatic cell lines. Targeted disruption of PIGA was quantitatively detected with FLAER, a reagent that specifically binds to GPI anchors. Using this PIGA-based reporter system, we successfully detected adeno-associated virus (AAV)-mediated gene targeting events both with and without promoter-trap enrichment of gene-targeted cell population. The PIGA-based reporter system was also capable of reproducing previous findings that an AAV-mediated gene targeting achieves a remarkably higher ratio of homologous versus random integration (H/R ratio) of targeting vectors than a plasmid-mediated gene targeting. The PIGA-based system also detected an approximately 2-fold increase in the H/R ratio achieved by a small negative selection cassette introduced at the end of the AAV-based targeting vector with a promoter-trap system. Thus, our PIGA-based system is useful for monitoring AAV-mediated gene targeting and will assist in improving gene targeting technology in human somatic cell lines. PMID:23056640

  12. Postnatal changes in somatic gamma-aminobutyric acid signalling in the rat hippocampus.

    PubMed

    Tyzio, Roman; Minlebaev, Marat; Rheims, Sylvain; Ivanov, Anton; Jorquera, Isabelle; Holmes, Gregory L; Zilberter, Yuri; Ben-Ari, Yehezkiel; Khazipov, Rustem

    2008-05-01

    During postnatal development of the rat hippocampus, gamma-aminobutyric acid (GABA) switches its action on CA3 pyramidal cells from excitatory to inhibitory. To characterize the underlying changes in the GABA reversal potential, we used somatic cell-attached recordings of GABA(A) and N-methyl-D-aspartate channels to monitor the GABA driving force and resting membrane potential, respectively. We found that the GABA driving force is strongly depolarizing during the first postnatal week. The strength of this depolarization rapidly declines with age, although GABA remains slightly depolarizing, by a few millivolts, even in adult neurons. Reduction in the depolarizing GABA driving force was due to a progressive negative shift of the reversal potential of GABA currents. Similar postnatal changes in GABA signalling were also observed using the superfused hippocampus preparation in vivo, and in the hippocampal interneurons in vitro. We also found that in adult pyramidal cells, somatic GABA reversal potential is maintained at a slightly depolarizing level by bicarbonate conductance, chloride-extrusion and chloride-loading systems. Thus, the postnatal excitatory-to-inhibitory switch in somatic GABA signalling is associated with a negative shift of the GABA reversal potential but without a hyperpolarizing switch in the polarity of GABA responses. These results also suggest that in adult CA3 pyramidal cells, somatic GABAergic inhibition takes place essentially through shunting rather than hyperpolarization. Apparent hyperpolarizing GABA responses previously reported in the soma of CA3 pyramidal cells are probably due to cell depolarization during intracellular or whole-cell recordings.

  13. 29 CFR 1990.103 - Definitions.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... Health and Human Services, or designee. Director of NCI means the Director of the National Cancer... means the induction of heritable changes in the genetic material of either somatic or germinal cells..., Neurospora or Drosophila melanogaster; (3) Mutagenesis in mammalian somatic cells; (4) Mutagenesis in...

  14. 29 CFR 1990.103 - Definitions.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... Health and Human Services, or designee. Director of NCI means the Director of the National Cancer... means the induction of heritable changes in the genetic material of either somatic or germinal cells..., Neurospora or Drosophila melanogaster; (3) Mutagenesis in mammalian somatic cells; (4) Mutagenesis in...

  15. 29 CFR 1990.103 - Definitions.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... Health and Human Services, or designee. Director of NCI means the Director of the National Cancer... means the induction of heritable changes in the genetic material of either somatic or germinal cells..., Neurospora or Drosophila melanogaster; (3) Mutagenesis in mammalian somatic cells; (4) Mutagenesis in...

  16. 29 CFR 1990.103 - Definitions.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... Health and Human Services, or designee. Director of NCI means the Director of the National Cancer... means the induction of heritable changes in the genetic material of either somatic or germinal cells..., Neurospora or Drosophila melanogaster; (3) Mutagenesis in mammalian somatic cells; (4) Mutagenesis in...

  17. Consequence for dairy herds in the United States of imposing different standards for somatic cell count

    USDA-ARS?s Scientific Manuscript database

    New European Union (E.U.) regulations may require that a somatic cell count (SCC) limit of 400,000 cells/mL for milk be met by every farm that contributes to pooled milk exported to Europe. In the United States, the standard is 750,000 cells/mL. Because bulk tank SCC is not readily available through...

  18. Analysis of allelic expression patterns in clonal somatic cells by single-cell RNA-seq

    PubMed Central

    Ramsköld, Daniel; Deng, Qiaolin; Johnsson, Per; Michaëlsson, Jakob; Frisén, Jonas; Sandberg, Rickard

    2016-01-01

    Cellular heterogeneity can emerge from the expression of only one parental allele. However, it has remained controversial whether, or to what degree, random monoallelic expression of autosomal genes (aRME) is mitotically inherited (clonal) or stochastic (dynamic) in somatic cells, particularly in vivo. Here, we used allele-sensitive single-cell RNA-seq on clonal primary mouse fibroblasts and in vivo human CD8+ T-cells to dissect clonal and dynamic monoallelic expression patterns. Dynamic aRME affected a considerable portion of the cells’ transcriptomes, with levels dependent on the cells’ transcriptional activity. Importantly, clonal aRME was detected but was surprisingly scarce (<1% of genes) and affected mainly the most low-expressed genes. Consequently, the overwhelming portion of aRME occurs transiently within individual cells and patterns of aRME are thus primarily scattered throughout somatic cell populations rather than, as previously hypothesized, confined to patches of clonally related cells. PMID:27668657

  19. Clock-like mutational processes in human somatic cells

    DOE PAGES

    Alexandrov, Ludmil B.; Jones, Philip H.; Wedge, David C.; ...

    2015-11-09

    During the course of a lifetime, somatic cells acquire mutations. Different mutational processes may contribute to the mutations accumulated in a cell, with each imprinting a mutational signature on the cell's genome. Some processes generate mutations throughout life at a constant rate in all individuals, and the number of mutations in a cell attributable to these processes will be proportional to the chronological age of the person. Using mutations from 10,250 cancer genomes across 36 cancer types, we investigated clock-like mutational processes that have been operating in normal human cells. Two mutational signatures show clock-like properties. Both exhibit different mutationmore » rates in different tissues. However, their mutation rates are not correlated, indicating that the underlying processes are subject to different biological influences. For one signature, the rate of cell division may influence its mutation rate. This paper provides the first survey of clock-like mutational processes operating in human somatic cells.« less

  20. Somatic cell cloning: the ultimate form of nuclear reprogramming?

    PubMed

    Piedrahita, Jorge A; Mir, Bashir; Dindot, Scott; Walker, Shawn

    2004-05-01

    With the increasing difficulties associated with meeting the required needs for organs used in transplantation, alternative approaches need to be considered. These include the use of stem cells as potential sources of specialized cells, the ability to transdifferentiate cell types in culture, and the development of complete organs that can be used in humans. All of the above goals will require a complete understanding of the factors affecting cell differentiation and nuclear reprogramming. To make this a reality, however, techniques associated with cloning and genetic modifications in somatic cells need to be continued to be developed and optimized. This includes not only an enhancement of the rate of homologous recombination in somatic cells, but also a thorough understanding of the nuclear reprogramming process taking place during nuclear transfer. The understanding of this process is likely to have an effect beyond the area of nuclear transfer and assist with better methods for transdifferentiation of mammalian cells.

  1. Small organelle, big responsibility: the role of centrosomes in development and disease

    PubMed Central

    Chavali, Pavithra L.; Pütz, Monika; Gergely, Fanni

    2014-01-01

    The centrosome, a key microtubule organizing centre, is composed of centrioles, embedded in a protein-rich matrix. Centrosomes control the internal spatial organization of somatic cells, and as such contribute to cell division, cell polarity and migration. Upon exiting the cell cycle, most cell types in the human body convert their centrioles into basal bodies, which drive the assembly of primary cilia, involved in sensing and signal transduction at the cell surface. Centrosomal genes are targeted by mutations in numerous human developmental disorders, ranging from diseases exclusively affecting brain development, through global growth failure syndromes to diverse pathologies associated with ciliary malfunction. Despite our much-improved understanding of centrosome function in cellular processes, we know remarkably little of its role in the organismal context, especially in mammals. In this review, we examine how centrosome dysfunction impacts on complex physiological processes and speculate on the challenges we face when applying knowledge generated from in vitro and in vivo model systems to human development. PMID:25047622

  2. Somatization in the conceptualization of sickle cell disease.

    PubMed

    Wellington, Chanté; Edwards, Christopher L; McNeil, Janice; Wood, Mary; Crisp, Benjamin; Feliu, Miriam; Byrd, Goldie; McDougald, Camela; Edwards, Lekisha; Whitfield, Keith E

    2010-11-01

    The unpredictable nature of sickle cell disease (SCD) and its social and environmental consequences can produce an unhealthy and almost exclusive focus on physical functioning. At the upper range of this focus on health concerns is somatization. In the current study, using 156 adult patients (55.13% female, 86) with SCD, mean age 35.59 +/- 12.73, we explored the relationship of somatization to pain. We found somatization to be predictive of pain severity and current pain intensity as well as a range of averaged indices of pain over time (p < .0001). We further found somatization to be predictive of a range of negative psychological experiences to include depression, anxiety, and hostility (p < .0001). We interpret these data to suggest that patients with SCD who have a propensity to focus exclusively on their health or are more sensitive to minor changes in their health status (somatization) may also be more likely to report greater concerns about their health and higher ratings of pain.

  3. Pre-screening method for somatic cell contamination in human sperm epigenetic studies.

    PubMed

    Jenkins, Timothy G; Liu, Lihua; Aston, Kenneth I; Carrell, Douglas T

    2018-04-01

    Sperm epigenetic profiles are frequently studied and are of great interest in many fields. One major technical concern when assessing these marks is the potential for somatic cell contamination. Because somatic cells have dramatically different epigenetic signatures, even small levels of contamination can result in significant problems in analysis and interpretation of data. In this study we evaluate an assay, which we designed to offer a reliable 'pre-screen' for somatic cell contamination that directly assesses the DNA being used in the study to determine tissue purity. In brief, we designed an inexpensive and simple assay that utilizes the strong differential methylation between sperm and somatic cells at four genomic loci to assess the general purity of samples prior to performing expensive and time intensive assays. The assay is able to reliably detect contamination qualitatively by running the sample on an agarose gel, or quantitatively with the use of a bioanalyzer. With this technique we have found that we can detect potentially contaminating signals in samples of many different types, including those from patients with poor sperm phenotypes (oligozoospermia, asthenozoospermia, and teratozoospermia). We also have found that the use of multiple sites to determine potential contamination is key, as some conditions (asthenozoospermia specifically) appear at one site to reflect a somatic-like profile, while at all other sites it appears to have very typical sperm DNA methylation signatures. Taken together, the use of the assay described herein was effective at identifying contamination and could be implemented in many labs to quickly and inexpensively pre-screen samples prior to performing far more expensive and labor intensive procedures. Additionally, the principles applied to the development of this assay could be easily adapted for the development of other assays to pre-screen different tissue/cell types or model organisms.

  4. Epithalon peptide induces telomerase activity and telomere elongation in human somatic cells.

    PubMed

    Khavinson, V Kh; Bondarev, I E; Butyugov, A A

    2003-06-01

    Addition of Epithalon peptide in telomerase-negative human fetal fibroblast culture induced expression of the catalytical subunit, enzymatic activity of telomerase, and telomere elongation, which can be due to reactivation of telomerase gene in somatic cells and indicates the possibility of prolonging life span of a cell population and of the whole organism.

  5. Somatic cells initiate primordial follicle activation and govern the development of dormant oocytes in mice.

    PubMed

    Zhang, Hua; Risal, Sanjiv; Gorre, Nagaraju; Busayavalasa, Kiran; Li, Xin; Shen, Yan; Bosbach, Benedikt; Brännström, Mats; Liu, Kui

    2014-11-03

    The majority of oocytes in the mammalian ovary are dormant oocytes that are enclosed in primordial follicles by several somatic cells, which we refer to as primordial follicle granulosa cells (pfGCs). Very little is known, however, about how the pfGCs control the activation of primordial follicles and the developmental fates of dormant oocytes. By targeting molecules in pfGCs with several mutant mouse models, we demonstrate that the somatic pfGCs initiate the activation of primordial follicles and govern the quiescence or awakening of dormant oocytes. Inhibition of mTORC1 signaling in pfGCs prevents the differentiation of pfGCs into granulosa cells, and this arrests the dormant oocytes in their quiescent states, leading to oocyte death. Overactivation of mTORC1 signaling in pfGCs accelerates the differentiation of pfGCs into granulosa cells and causes premature activation of all dormant oocytes and primordial follicles. We further show that pfGCs trigger the awakening of dormant oocytes through KIT ligand (KITL), and we present an essential communication network between the somatic cells and germ cells that is based on signaling between the mTORC1-KITL cascade in pfGCs and KIT-PI3K signaling in oocytes. Our findings provide a relatively complete picture of how mammalian primordial follicles are activated. The microenvironment surrounding primordial follicles can activate mTORC1-KITL signaling in pfGCs, and these cells trigger the awakening of dormant oocytes and complete the process of follicular activation. Such communication between the microenvironment, somatic cells, and germ cells is essential to maintaining the proper reproductive lifespan in mammals. Copyright © 2014 Elsevier Ltd. All rights reserved.

  6. PRC2 Represses Hormone-Induced Somatic Embryogenesis in Vegetative Tissue of Arabidopsis thaliana

    PubMed Central

    Mozgová, Iva

    2017-01-01

    Many plant cells can be reprogrammed into a pluripotent state that allows ectopic organ development. Inducing totipotent states to stimulate somatic embryo (SE) development is, however, challenging due to insufficient understanding of molecular barriers that prevent somatic cell dedifferentiation. Here we show that Polycomb repressive complex 2 (PRC2)-activity imposes a barrier to hormone-mediated transcriptional reprogramming towards somatic embryogenesis in vegetative tissue of Arabidopsis thaliana. We identify factors that enable SE development in PRC2-depleted shoot and root tissue and demonstrate that the establishment of embryogenic potential is marked by ectopic co-activation of crucial developmental regulators that specify shoot, root and embryo identity. Using inducible activation of PRC2 in PRC2-depleted cells, we demonstrate that transient reduction of PRC2 activity is sufficient for SE formation. We suggest that modulation of PRC2 activity in plant vegetative tissue combined with targeted activation of developmental pathways will open possibilities for novel approaches to cell reprogramming. PMID:28095419

  7. Genetic improvement of mastitis resistance: validation of somatic cell score and clinical mastitis as selection criteria.

    PubMed

    Odegård, J; Klemetsdal, G; Heringstad, B

    2003-12-01

    Mean daughter deviations for clinical mastitis among second-crop daughters were regressed on predicted transmitting abilities for clinical mastitis and lactation mean somatic cell score in first-crop daughters to validate the predictive ability of these traits as selection criteria for reduced incidence of clinical mastitis. A total of 321 sires had 684,897 second-crop daughters, while predicted transmitting abilities were calculated for 2159 sires, based on 495,681 records of first-crop daughters. Predictive ability, as a measure of efficiency of selection, was 23 to 43% higher for clinical mastitis than for lactation mean somatic cell score. Compared to single-trait selection, predictive ability improved 8 to 13% from utilizing information on both traits. The relative weight that should be assigned to standardized predicted transmitting abilities from univariate genetic analyses were 60 to 67% for clinical mastitis and 33 to 40% for lactation mean somatic cell score. No significant nonlinear genetic relationship between the two traits was found.

  8. Effects of copper and arsenic stress on the development of Norway spruce somatic embryos and their visualization with the environmental scanning electron microscope.

    PubMed

    Đorđević, Biljana; Neděla, Vilém; Tihlaříková, Eva; Trojan, Václav; Havel, Ladislav

    2018-05-18

    Somatic embryogenesis is an important biotechnological technique which can be used in studies associated with environmental stress. Four embryogenic cell lines of Norway spruce were grown on media enriched with copper and arsenic in concentration ranges 50-500 μM and 10-50 μM, respectively. The effects were observed during subsequent stages of somatic embryogenesis, the characteristics evaluated being proliferation potential, average number of somatic embryos obtained per g/fresh weight, morphology of developed somatic embryos, metal uptake, and microanalysis of macro- and micronutrients uptake. Copper and arsenic at higher concentrations significantly reduced the growth of early somatic embryos. In almost all treatments, the cell line V-1-3 showed the best performance compared with the other lines tested. Environmental scanning electron microscopy was used to visualize and identify morphological abnormalities in the development of somatic embryos. Abnormalities observed were classified into several categories: meristemless somatic embryos, somatic embryos with disrupted meristem, reduced number of cotyledons, single cotyledon and fused cotyledons. With the application of a low temperature method for the environmental scanning electron microscope, samples were stabilized and whole meristems could be investigated in their native state. As far as we are aware, this is the first report of the effect of copper and arsenic during the process of somatic embryogenesis and the first to evaluate the content of macro and micronutrients uptake in Norway spruce. Copyright © 2018 Elsevier B.V. All rights reserved.

  9. Somatic Cell Nuclear Transfer in the Mouse

    NASA Astrophysics Data System (ADS)

    Kishigami, Satoshi; Wakayama, Teruhiko

    Somatic cell nuclear transfer (SCNT) has become a unique and powerful tool for epigenetic reprogramming research and gene manipulation in animals since “Dolly,” the first animal cloned from an adult cell was reported in 1997. Although the success rates of somatic cloning have been inefficient and the mechanism of reprogramming is still largely unknown, this technique has been proven to work in more than 10 mammalian species. Among them, the mouse provides the best model for both basic and applied research of somatic cloning because of its abounding genetic resources, rapid sexual maturity and propagation, minimal requirements for housing, etc. This chapter describes a basic protocol for mouse cloning using cumulus cells, the most popular cell type for NT, in which donor nuclei are directly injected into the oocyte using a piezo-actuated micromanipulator. In particular, we focus on a new, more efficient mouse cloning protocol using trichostatin A (TSA), a histone deacetylase (HDAC) inhibitor, which increases both in vitro and in vivo developmental rates from twofold to fivefold. This new method including TSA will be helpful to establish mouse cloning in many laboratories.

  10. The Xenopus Maternal-to-Zygotic Transition from the Perspective of the Germline.

    PubMed

    Yang, Jing; Aguero, Tristan; King, Mary Lou

    2015-01-01

    In Xenopus, the germline is specified by the inheritance of germ-plasm components synthesized at the beginning of oogenesis. Only the cells in the early embryo that receive germ plasm, the primordial germ cells (PGCs), are competent to give rise to the gametes. Thus, germ-plasm components continue the totipotent potential exhibited by the oocyte into the developing embryo at a time when most cells are preprogrammed for somatic differentiation as dictated by localized maternal determinants. When zygotic transcription begins at the mid-blastula transition, the maternally set program for somatic differentiation is realized. At this time, genetic control is ceded to the zygotic genome, and developmental potential gradually becomes more restricted within the primary germ layers. PGCs are a notable exception to this paradigm and remain transcriptionally silent until the late gastrula. How the germ-cell lineage retains full potential while somatic cells become fate restricted is a tale of translational repression, selective degradation of somatic maternal determinants, and delayed activation of zygotic transcription. © 2015 Elsevier Inc. All rights reserved.

  11. EG-07CELL CYCLE SIGNATURE AND TUMOR PHYLOGENY ARE ENCODED IN THE EVOLUTIONARY DYNAMICS OF DNA METHYLATION IN GLIOMA

    PubMed Central

    Mazor, Tali; Pankov, Aleksandr; Johnson, Brett E.; Hong, Chibo; Bell, Robert J.A.; Smirnov, Ivan V.; Reis, Gerald F.; Phillips, Joanna J.; Barnes, Michael; Bollen, Andrew W.; Taylor, Barry S.; Molinaro, Annette M.; Olshen, Adam B.; Song, Jun S.; Berger, Mitchel S.; Chang, Susan M.; Costello, Joseph F.

    2014-01-01

    The clonal evolution of tumor cell populations can be reconstructed from patterns of genetic alterations. In contrast, tumor epigenetic states, including DNA methylation, are reversible and sensitive to the tumor microenvironment, presumably precluding the use of epigenetics to discover tumor phylogeny. Here we examined the spatial and temporal dynamics of DNA methylation in a clinically and genetically characterized cohort of IDH1-mutant low-grade gliomas and their patient-matched recurrences. WHO grade II gliomas are diffuse, infiltrative tumors that frequently recur and may undergo malignant progression to a higher grade with a worse prognosis. The extent to which epigenetic alterations contribute to the evolution of low-grade gliomas, including malignant progression, is unknown. While all gliomas in the cohort exhibited the hypermethylation signature associated with IDH1 mutation, low-grade gliomas that underwent malignant progression to high-grade glioblastoma (GBM) had a unique signature of DNA hypomethylation enriched for active enhancers, as well as sites of age-related hypermethylation in the brain. Genes with promoter hypomethylation and concordant transcriptional upregulation during evolution to GBM were enriched in cell cycle function, evolving in concert with genetic alterations that deregulate the G1/S cell cycle checkpoint. Despite the plasticity of tumor epigenetic states, phyloepigenetic trees robustly recapitulated phylogenetic trees derived from somatic mutations in the same patients. These findings highlight widespread co-dependency of genetic and epigenetic events throughout the clonal evolution of initial and recurrent glioma.

  12. Clock-like mutational processes in human somatic cells

    PubMed Central

    Alexandrov, Ludmil B.; Jones, Philip H.; Wedge, David C.; Sale, Julian E.; Campbell, Peter J.; Nik-Zainal, Serena; Stratton, Michael R.

    2016-01-01

    During the course of a lifetime somatic cells acquire mutations. Different mutational processes may contribute to the mutations accumulated in a cell, with each imprinting a mutational signature on the cell’s genome. Some processes generate mutations throughout life at a constant rate in all individuals and the number of mutations in a cell attributable to these processes will be proportional to the chronological age of the person. Using mutations from 10,250 cancer genomes across 36 cancer types, we investigated clock-like mutational processes that have been operating in normal human cells. Two mutational signatures show clock-like properties. Both exhibit different mutation rates in different tissues. However, their mutation rates are not correlated indicating that the underlying processes are subject to different biological influences. For one signature, the rate of cell division may influence its mutation rate. This study provides the first survey of clock-like mutational processes operative in human somatic cells. PMID:26551669

  13. Carbohydrate-mediated responses during zygotic and early somatic embryogenesis in the endangered conifer, Araucaria angustifolia

    PubMed Central

    Elbl, Paula; De Souza, Amanda P.; Jardim, Vinicius; de Oliveira, Leandro F.; Macedo, Amanda F.; dos Santos, André L. W.; Buckeridge, Marcos S.; Floh, Eny I. S.

    2017-01-01

    Three zygotic developmental stages and two somatic Araucaria angustifolia cell lines with contrasting embryogenic potential were analyzed to identify the carbohydrate-mediated responses associated with embryo formation. Using a comparison between zygotic and somatic embryogenesis systems, the non-structural carbohydrate content, cell wall sugar composition and expression of genes involved in sugar sensing were analyzed, and a network analysis was used to identify coordinated features during embryogenesis. We observed that carbohydrate-mediated responses occur mainly during the early stages of zygotic embryo formation, and that during seed development there are coordinated changes that affect the development of the different structures (embryo and megagametophyte). Furthermore, sucrose and starch accumulation were associated with the responsiveness of the cell lines. This study sheds light on how carbohydrate metabolism is influenced during zygotic and somatic embryogenesis in the endangered conifer species, A. angustifolia. PMID:28678868

  14. Clonal Architecture of Secondary Acute Myeloid Leukemia

    PubMed Central

    Walter, Matthew J.; Shen, Dong; Ding, Li; Shao, Jin; Koboldt, Daniel C.; Chen, Ken; Larson, David E.; McLellan, Michael D.; Dooling, David; Abbott, Rachel; Fulton, Robert; Magrini, Vincent; Schmidt, Heather; Kalicki-Veizer, Joelle; O’Laughlin, Michelle; Fan, Xian; Grillot, Marcus; Witowski, Sarah; Heath, Sharon; Frater, John L.; Eades, William; Tomasson, Michael; Westervelt, Peter; DiPersio, John F.; Link, Daniel C.; Mardis, Elaine R.; Ley, Timothy J.; Wilson, Richard K.; Graubert, Timothy A.

    2012-01-01

    BACKGROUND The myelodysplastic syndromes are a group of hematologic disorders that often evolve into secondary acute myeloid leukemia (AML). The genetic changes that underlie progression from the myelodysplastic syndromes to secondary AML are not well understood. METHODS We performed whole-genome sequencing of seven paired samples of skin and bone marrow in seven subjects with secondary AML to identify somatic mutations specific to secondary AML. We then genotyped a bone marrow sample obtained during the antecedent myelodysplastic-syndrome stage from each subject to determine the presence or absence of the specific somatic mutations. We identified recurrent mutations in coding genes and defined the clonal architecture of each pair of samples from the myelodysplastic-syndrome stage and the secondary-AML stage, using the allele burden of hundreds of mutations. RESULTS Approximately 85% of bone marrow cells were clonal in the myelodysplastic-syndrome and secondary-AML samples, regardless of the myeloblast count. The secondary-AML samples contained mutations in 11 recurrently mutated genes, including 4 genes that have not been previously implicated in the myelodysplastic syndromes or AML. In every case, progression to acute leukemia was defined by the persistence of an antecedent founding clone containing 182 to 660 somatic mutations and the outgrowth or emergence of at least one subclone, harboring dozens to hundreds of new mutations. All founding clones and subclones contained at least one mutation in a coding gene. CONCLUSIONS Nearly all the bone marrow cells in patients with myelodysplastic syndromes and secondary AML are clonally derived. Genetic evolution of secondary AML is a dynamic process shaped by multiple cycles of mutation acquisition and clonal selection. Recurrent gene mutations are found in both founding clones and daughter subclones. (Funded by the National Institutes of Health and others.) PMID:22417201

  15. Identifying Candidate Reprogramming Genes in Mouse Induced Pluripotent Stem Cells.

    PubMed

    Gao, Fang; Li, Jingyu; Zhang, Heng; Yang, Xu; An, Tiezhu

    2017-08-01

    Factor-based induced reprogramming approaches have tremendous potential for human regenerative medicine, but the efficiencies of these approaches are still low. In this study, we analyzed the global transcriptional profiles of mouse induced pluripotent stem cells (miPSCs) and mouse embryonic stem cells (mESCs) from seven different labs and present here the first successful clustering according to cell type, not by lab of origin. We identified 2131 different expression genes (DEs) as candidate pluripotency-associated genes by comparing mESCs/miPSCs with somatic cells and 720 DEs between miPSCs and mESCs. Interestingly, there was a significant overlap between the two DE sets. Therefore, we defined the overlap DEs as "consensus DEs" including 313 miPSC-specific genes expressed at a higher level in miPSCs versus mESCs and 184 mESC-specific genes in total and reasoned that these may contribute to the differences in pluripotency between mESCs and miPSCs. A classification of "consensus DEs" according to their different expression levels between somatic cells and mESCs/miPSCs shows that 86% of the miPSC-specific genes are more highly expressed in somatic cells, while 73% of mESC-specific genes are highly expressed in mESCs/miPSCs, indicating that the miPSCs have not efficiently silenced the expression pattern of the somatic cells from which they are derived and failed to completely induce the genes with high expression levels in mESCs. We further revealed a strong correlation between oocyte-enriched factors and insufficiently induced mESC-specific genes and identified 11 hub genes via network analysis. In light of these findings, we postulated that these key hub genes might not only drive somatic cell nuclear transfer (SCNT) reprogramming but also augment the efficiency and quality of miPSC reprogramming.

  16. Genome engineering in cattle: recent technological advancements.

    PubMed

    Wang, Zhongde

    2015-02-01

    Great strides in technological advancements have been made in the past decade in cattle genome engineering. First, the success of cloning cattle by somatic cell nuclear transfer (SCNT) or chromatin transfer (CT) is a significant advancement that has made obsolete the need for using embryonic stem (ES) cells to conduct cell-mediated genome engineering, whereby site-specific genetic modifications can be conducted in bovine somatic cells via DNA homologous recombination (HR) and whereby genetically engineered cattle can subsequently be produced by animal cloning from the genetically modified cells. With this approach, a chosen bovine genomic locus can be precisely modified in somatic cells, such as to knock out (KO) or knock in (KI) a gene via HR, a gene-targeting strategy that had almost exclusively been used in mouse ES cells. Furthermore, by the creative application of embryonic cloning to rejuvenate somatic cells, cattle genome can be sequentially modified in the same line of somatic cells and complex genetic modifications have been achieved in cattle. Very recently, the development of designer nucleases-such as zinc finger nucleases (ZFNs) and transcription activator-like effector nuclease (TALENs), and clustered regularly interspaced short palindromic repeats/CRISPR-associated protein 9 (CRISPR/Cas9)-has enabled highly efficient and more facile genome engineering in cattle. Most notably, by employing such designer nucleases, genomes can be engineered at single-nucleotide precision; this process is now often referred to as genome or gene editing. The above achievements are a drastic departure from the traditional methods of creating genetically modified cattle, where foreign DNAs are randomly integrated into the animal genome, most often along with the integrations of bacterial or viral DNAs. Here, I review the most recent technological developments in cattle genome engineering by highlighting some of the major achievements in creating genetically engineered cattle for agricultural and biomedical applications.

  17. Can Metabolic Mechanisms of Stem Cell Maintenance Explain Aging and the Immortal Germline?

    PubMed

    Snoeck, Hans-Willem

    2015-06-04

    The mechanisms underlying the aging process are not understood. Even tissues endowed with somatic stem cells age while the germline appears immortal. I propose that this paradox may be explained by the pervasive use of glycolysis by somatic stem cells as opposed to the predominance of mitochondrial respiration in gametes. Copyright © 2015 Elsevier Inc. All rights reserved.

  18. Simultaneous Identification of Multiple Driver Pathways in Cancer

    PubMed Central

    Leiserson, Mark D. M.; Blokh, Dima

    2013-01-01

    Distinguishing the somatic mutations responsible for cancer (driver mutations) from random, passenger mutations is a key challenge in cancer genomics. Driver mutations generally target cellular signaling and regulatory pathways consisting of multiple genes. This heterogeneity complicates the identification of driver mutations by their recurrence across samples, as different combinations of mutations in driver pathways are observed in different samples. We introduce the Multi-Dendrix algorithm for the simultaneous identification of multiple driver pathways de novo in somatic mutation data from a cohort of cancer samples. The algorithm relies on two combinatorial properties of mutations in a driver pathway: high coverage and mutual exclusivity. We derive an integer linear program that finds set of mutations exhibiting these properties. We apply Multi-Dendrix to somatic mutations from glioblastoma, breast cancer, and lung cancer samples. Multi-Dendrix identifies sets of mutations in genes that overlap with known pathways – including Rb, p53, PI(3)K, and cell cycle pathways – and also novel sets of mutually exclusive mutations, including mutations in several transcription factors or other genes involved in transcriptional regulation. These sets are discovered directly from mutation data with no prior knowledge of pathways or gene interactions. We show that Multi-Dendrix outperforms other algorithms for identifying combinations of mutations and is also orders of magnitude faster on genome-scale data. Software available at: http://compbio.cs.brown.edu/software. PMID:23717195

  19. Identification of differentially accumulated proteins associated with embryogenic and non-embryogenic calli in saffron (Crocus sativus L.)

    PubMed Central

    2012-01-01

    Background Somatic embryogenesis (SE) is a complex biological process that occurs under inductive conditions and causes fully differentiated cells to be reprogrammed to an embryo like state. In order to get a better insight about molecular basis of the SE in Crocus sativus L. and to characterize differentially accumulated proteins during the process, a proteomic study based on two-dimensional gel electrophoresis and matrix-assisted laser desorption/ionization time of flight mass spectrometry has been carried out. Results We have compared proteome profiles of non-embryogenic and embryogenic calli with native corm explants. Total soluble proteins were phenol-extracted and loaded on 18 cm IPG strips for the first dimension and 11.5% sodium dodecyl sulfate-polyacrylamide gels for the second dimension. Fifty spots with more than 1.5-fold change in abundance were subjected to mass spectrometry analysis for further characterization. Among them 36 proteins could be identified, which are classified into defense and stress response, protein synthesis and processing, carbohydrate and energy metabolism, secondary metabolism, and nitrogen metabolism. Conclusion Our results showed that diverse cellular and molecular processes were affected during somatic to embryogenic transition. Differential proteomic analysis suggests a key role for ascorbate metabolism during early stage of SE, and points to the possible role of ascorbate-glutathione cycle in establishing somatic embryos. PMID:22243837

  20. The human Piwi protein Hiwi2 associates with tRNA-derived piRNAs in somatic cells.

    PubMed

    Keam, Simon P; Young, Paul E; McCorkindale, Alexandra L; Dang, Thurston H Y; Clancy, Jennifer L; Humphreys, David T; Preiss, Thomas; Hutvagner, Gyorgy; Martin, David I K; Cropley, Jennifer E; Suter, Catherine M

    2014-08-01

    The Piwi-piRNA pathway is active in animal germ cells where its functions are required for germ cell maintenance and gamete differentiation. Piwi proteins and piRNAs have been detected outside germline tissue in multiple phyla, but activity of the pathway in mammalian somatic cells has been little explored. In particular, Piwi expression has been observed in cancer cells, but nothing is known about the piRNA partners or the function of the system in these cells. We have surveyed the expression of the three human Piwi genes, Hiwi, Hili and Hiwi2, in multiple normal tissues and cancer cell lines. We find that Hiwi2 is ubiquitously expressed; in cancer cells the protein is largely restricted to the cytoplasm and is associated with translating ribosomes. Immunoprecipitation of Hiwi2 from MDAMB231 cancer cells enriches for piRNAs that are predominantly derived from processed tRNAs and expressed genes, species which can also be found in adult human testis. Our studies indicate that a Piwi-piRNA pathway is present in human somatic cells, with an uncharacterised function linked to translation. Taking this evidence together with evidence from primitive organisms, we propose that this somatic function of the pathway predates the germline functions of the pathway in modern animals. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  1. Amplitude Normalization of Dendritic EPSPs at the Soma of Binaural Coincidence Detector Neurons of the Medial Superior Olive

    PubMed Central

    Winters, Bradley D.; Jin, Shan-Xue; Ledford, Kenneth R.

    2017-01-01

    The principal neurons of the medial superior olive (MSO) encode cues for horizontal sound localization through comparisons of the relative timing of EPSPs. To understand how the timing and amplitude of EPSPs are maintained during propagation in the dendrites, we made dendritic and somatic whole-cell recordings from MSO principal neurons in brain slices from Mongolian gerbils. In somatic recordings, EPSP amplitudes were largely uniform following minimal stimulation of excitatory synapses at visualized locations along the dendrites. Similar results were obtained when excitatory synaptic transmission was eliminated in a low calcium solution and then restored at specific dendritic sites by pairing input stimulation and focal application of a higher calcium solution. We performed dual dendritic and somatic whole-cell recordings to measure spontaneous EPSPs using a dual-channel template-matching algorithm to separate out those events initiated at or distal to the dendritic recording location. Local dendritic spontaneous EPSP amplitudes increased sharply in the dendrite with distance from the soma (length constant, 53.6 μm), but their attenuation during propagation resulted in a uniform amplitude of ∼0.2 mV at the soma. The amplitude gradient of dendritic EPSPs was also apparent in responses to injections of identical simulated excitatory synaptic currents in the dendrites. Compartmental models support the view that these results extensively reflect the influence of dendritic cable properties. With relatively few excitatory axons innervating MSO neurons, the normalization of dendritic EPSPs at the soma would increase the importance of input timing versus location during the processing of interaural time difference cues in vivo. SIGNIFICANCE STATEMENT The neurons of the medial superior olive analyze cues for sound localization by detecting the coincidence of binaural excitatory synaptic inputs distributed along the dendrites. Previous studies have shown that dendritic voltages undergo severe attenuation as they propagate to the soma, potentially reducing the influence of distal inputs. However, using dendritic and somatic patch recordings, we found that dendritic EPSP amplitude increased with distance from the soma, compensating for dendritic attenuation and normalizing EPSP amplitude at the soma. Much of this normalization reflected the influence of dendritic morphology. As different combinations of presynaptic axons may be active during consecutive cycles of sound stimuli, somatic EPSP normalization renders spike initiation more sensitive to synapse timing than dendritic location. PMID:28213442

  2. Plant germline formation: common concepts and developmental flexibility in sexual and asexual reproduction.

    PubMed

    Schmidt, Anja; Schmid, Marc W; Grossniklaus, Ueli

    2015-01-15

    The life cycle of flowering plants alternates between two heteromorphic generations: a diploid sporophytic generation and a haploid gametophytic generation. During the development of the plant reproductive lineages - the germlines - typically, single sporophytic (somatic) cells in the flower become committed to undergo meiosis. The resulting spores subsequently develop into highly polarized and differentiated haploid gametophytes that harbour the gametes. Recent studies have provided insights into the genetic basis and regulatory programs underlying cell specification and the acquisition of reproductive fate during both sexual reproduction and asexual (apomictic) reproduction. As we review here, these recent advances emphasize the importance of transcriptional, translational and post-transcriptional regulation, and the role of epigenetic regulatory pathways and hormonal activity. © 2015. Published by The Company of Biologists Ltd.

  3. 40 CFR 799.4360 - Tributyl phosphate.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... in somatic cells in culture test shall be conducted with TBP in accordance with § 798.5300 of this... requirements. (A) The somatic cells in culture assay shall be completed and the final report submitted to EPA...) Required testing. (A) An in vitro mammalian cytogenetics test shall be conducted with TBP in accordance...

  4. 40 CFR 799.4360 - Tributyl phosphate.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... in somatic cells in culture test shall be conducted with TBP in accordance with § 798.5300 of this... requirements. (A) The somatic cells in culture assay shall be completed and the final report submitted to EPA...) Required testing. (A) An in vitro mammalian cytogenetics test shall be conducted with TBP in accordance...

  5. 40 CFR 799.4360 - Tributyl phosphate.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... in somatic cells in culture test shall be conducted with TBP in accordance with § 798.5300 of this... requirements. (A) The somatic cells in culture assay shall be completed and the final report submitted to EPA...) Required testing. (A) An in vitro mammalian cytogenetics test shall be conducted with TBP in accordance...

  6. An Overview of Direct Somatic Reprogramming: The Ins and Outs of iPSCs

    PubMed Central

    Menon, Siddharth; Shailendra, Siny; Renda, Andrea; Longaker, Michael; Quarto, Natalina

    2016-01-01

    Stem cells are classified into embryonic stem cells and adult stem cells. An evolving alternative to conventional stem cell therapies is induced pluripotent stem cells (iPSCs), which have a multi-lineage potential comparable to conventionally acquired embryonic stem cells with the additional benefits of being less immunoreactive and avoiding many of the ethical concerns raised with the use of embryonic material. The ability to generate iPSCs from somatic cells provides tremendous promise for regenerative medicine. The breakthrough of iPSCs has raised the possibility that patient-specific iPSCs can provide autologous cells for cell therapy without the concern for immune rejection. iPSCs are also relevant tools for modeling human diseases and drugs screening. However, there are still several hurdles to overcome before iPSCs can be used for translational purposes. Here, we review the recent advances in somatic reprogramming and the challenges that must be overcome to move this strategy closer to clinical application. PMID:26805822

  7. Receptor tyrosine kinase mutations in developmental syndromes and cancer: two sides of the same coin

    PubMed Central

    McDonell, Laura M.; Kernohan, Kristin D.; Boycott, Kym M.; Sawyer, Sarah L.

    2015-01-01

    Receptor tyrosine kinases (RTKs) are a family of ligand-binding cell surface receptors that regulate a wide range of essential cellular activities, including proliferation, differentiation, cell-cycle progression, survival and apoptosis. As such, these proteins play an important role during development and throughout life; germline mutations in genes encoding RTKs cause several developmental syndromes, while somatic alterations contribute to the pathogenesis of many aggressive cancers. This creates an interesting paradigm in which mutation timing, type and location in a gene leads to different cell signaling and biological responses, and ultimately phenotypic outcomes. In this review, we highlight the roles of RTKs in developmental disorders and cancer. The multifaceted roles of these receptors, their genetic signatures and their signaling during developmental morphogenesis and oncogenesis are discussed. Additionally, we propose that comparative analysis of RTK mutations responsible for developmental syndromes may shed light on those driving tumorigenesis. PMID:26152202

  8. The Amphimedon queenslandica genome and the evolution of animal complexity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Srivastava, Mansi; Simakov, Oleg; Chapman, Jarrod

    2010-07-01

    Sponges are an ancient group of animals that diverged from other metazoans over 600 million years ago. Here we present the draft genome sequence of Amphimedon queenslandica, a demosponge from the Great Barrier Reef, and show that it is remarkably similar to other animal genomes in content, structure and organization. Comparative analysis enabled by the sponge sequence reveals genomic events linked to the origin and early evolution of animals, including the appearance, expansion, and diversification of pan-metazoan transcription factor, signaling pathway, and structural genes. This diverse 'toolkit' of genes correlates with critical aspects of all metazoan body plans, and comprisesmore » cell cycle control and growth, development, somatic and germ cell specification, cell adhesion, innate immunity, and allorecognition. Notably, many of the genes associated with the emergence of animals are also implicated in cancer, which arises from defects in basic processes associated with metazoan multicellularity.« less

  9. Bovine oocytes with the potential to reprogram somatic cell nuclei have a unique 23-kDa protein, phosphorylated transcriptionally controlled tumor protein (TCTP).

    PubMed

    Tani, Tetsuya; Shimada, Hiroaki; Kato, Yoko; Tsunoda, Yukio

    2007-01-01

    Despite the long-held assumption that reprogramming factors are present in mammalian oocytes at the second metaphase stage, the molecular nature of these factors is not known. Here, we demonstrated that oocytes with the potential to reprogram somatic cell nuclei have a unique 23-kDa protein, phosphorylated transcriptionally controlled tumor protein (TCTP). Injection of TCTP double-stranded RNA into germinal vesicle oocytes decreased the potential of nuclear-transferred (NT) oocytes, but not in vitro fertilized oocytes, to develop into blastocysts. Phosphorylated TCTP is considered to facilitate the first step of somatic cell reprogramming. After transfer of blastocysts that developed from NT oocytes fused with cumulus cells in which phosphorylated TCTP peptide was previously incorporated, the recipient pregnancy rate (47%) increased and the abortion rate (13%) decreased. Moreover, all seven cloned calves survived for at least 1 month after parturition, and had no morphologic abnormalities. The present study demonstrated that pretreatment of donor cells with phosphorylated TCTP peptide has a beneficial effect on the potential of bovine somatic cell nuclei to develop into normal cloned calves. Before widespread application of TCTP for bovine cloning, however, a large-scale embryo transfer study using different donor cell lines of various origins is necessary.

  10. Direct reprogramming of somatic cells into neural stem cells or neurons for neurological disorders.

    PubMed

    Hou, Shaoping; Lu, Paul

    2016-01-01

    Direct reprogramming of somatic cells into neurons or neural stem cells is one of the most important frontier fields in current neuroscience research. Without undergoing the pluripotency stage, induced neurons or induced neural stem cells are a safer and timelier manner resource in comparison to those derived from induced pluripotent stem cells. In this prospective, we review the recent advances in generation of induced neurons and induced neural stem cells in vitro and in vivo and their potential treatments of neurological disorders.

  11. Relationships Among Microbial Communities, Maternal Cells, Oligosaccharides, and Macronutrients in Human Milk.

    PubMed

    Williams, Janet E; Price, William J; Shafii, Bahman; Yahvah, Katherine M; Bode, Lars; McGuire, Mark A; McGuire, Michelle K

    2017-08-01

    Human milk provides all essential nutrients necessary for early life and is rich in nonnutrients, maternally derived (host) cells, and bacteria, but almost nothing is known about the interplay among these components. Research aim: The primary objective of this research was to characterize relationships among macronutrients, maternal cells, and bacteria in milk. Milk samples were collected from 16 women and analyzed for protein, lipid, fatty acid, lactose, and human milk oligosaccharide concentrations. Concentrations of maternal cells were determined using microscopy, and somatic cell counts were enumerated. Microbial ecologies were characterized using culture-independent methods. Absolute and relative concentrations of maternal cells were mostly consistent within each woman as were relative abundances of bacterial genera, and there were many apparent relationships between these factors. For instance, relative abundance of Serratia was negatively associated with somatic cell counts ( r = -.47, p < .0001) and neutrophil concentration ( r = -.38, p < .0006). Concentrations of several oligosaccharides were correlated with maternally derived cell types as well as somatic cell counts; for example, lacto-N-tetraose and lacto-N-neotetraose were inversely correlated with somatic cell counts ( r = -.64, p = .0082; r = -.52, p = .0387, respectively), and relative abundance of Staphylococcus was positively associated with total oligosaccharide concentration ( r = .69, p = .0034). Complex relationships between milk nutrients and bacterial community profile, maternal cells, and milk oligosaccharides were also apparent. These data support the possibility that profiles of maternally derived cells, nutrient concentrations, and the microbiome of human milk might be interrelated.

  12. Defined three-dimensional microenvironments boost induction of pluripotency

    NASA Astrophysics Data System (ADS)

    Caiazzo, Massimiliano; Okawa, Yuya; Ranga, Adrian; Piersigilli, Alessandra; Tabata, Yoji; Lutolf, Matthias P.

    2016-03-01

    Since the discovery of induced pluripotent stem cells (iPSCs), numerous approaches have been explored to improve the original protocol, which is based on a two-dimensional (2D) cell-culture system. Surprisingly, nothing is known about the effect of a more biologically faithful 3D environment on somatic-cell reprogramming. Here, we report a systematic analysis of how reprogramming of somatic cells occurs within engineered 3D extracellular matrices. By modulating microenvironmental stiffness, degradability and biochemical composition, we have identified a previously unknown role for biophysical effectors in the promotion of iPSC generation. We find that the physical cell confinement imposed by the 3D microenvironment boosts reprogramming through an accelerated mesenchymal-to-epithelial transition and increased epigenetic remodelling. We conclude that 3D microenvironmental signals act synergistically with reprogramming transcription factors to increase somatic plasticity.

  13. Large-scale Chromosomal Movements During Interphase Progression in Drosophila

    PubMed Central

    Csink, Amy K.; Henikoff, Steven

    1998-01-01

    We examined the effect of cell cycle progression on various levels of chromosome organization in Drosophila. Using bromodeoxyuridine incorporation and DNA quantitation in combination with fluorescence in situ hybridization, we detected gross chromosomal movements in diploid interphase nuclei of larvae. At the onset of S-phase, an increased separation was seen between proximal and distal positions of a long chromsome arm. Progression through S-phase disrupted heterochromatic associations that have been correlated with gene silencing. Additionally, we have found that large-scale G1 nuclear architecture is continually dynamic. Nuclei display a Rabl configuration for only ∼2 h after mitosis, and with further progression of G1-phase can establish heterochromatic interactions between distal and proximal parts of the chromosome arm. We also find evidence that somatic pairing of homologous chromosomes is disrupted during S-phase more rapidly for a euchromatic than for a heterochromatic region. Such interphase chromosome movements suggest a possible mechanism that links gene regulation via nuclear positioning to the cell cycle: delayed maturation of heterochromatin during G1-phase delays establishment of a silent chromatin state. PMID:9763417

  14. Induced pluripotent stem cells derived from rabbits exhibit some characteristics of naïve pluripotency

    PubMed Central

    Osteil, Pierre; Tapponnier, Yann; Markossian, Suzy; Godet, Murielle; Schmaltz-Panneau, Barbara; Jouneau, Luc; Cabau, Cédric; Joly, Thierry; Blachère, Thierry; Gócza, Elen; Bernat, Agnieszka; Yerle, Martine; Acloque, Hervé; Hidot, Sullivan; Bosze, Zsuzsanna; Duranthon, Véronique; Savatier, Pierre; Afanassieff, Marielle

    2013-01-01

    Summary Not much is known about the molecular and functional features of pluripotent stem cells (PSCs) in rabbits. To address this, we derived and characterized 2 types of rabbit PSCs from the same breed of New Zealand White rabbits: 4 lines of embryonic stem cells (rbESCs), and 3 lines of induced PSCs (rbiPSCs) that were obtained by reprogramming adult skin fibroblasts. All cell lines required fibroblast growth factor 2 for their growth and proliferation. All rbESC lines showed molecular and functional properties typically associated with primed pluripotency. The cell cycle of rbESCs had a prolonged G1 phase and a DNA damage checkpoint before entry into the S phase, which are the 2 features typically associated with the somatic cell cycle. In contrast, the rbiPSC lines exhibited some characteristics of naïve pluripotency, including resistance to single-cell dissociation by trypsin, robust activity of the distal enhancer of the mouse Oct4 gene, and expression of naïve pluripotency-specific genes, as defined in rodents. According to gene expression profiles, rbiPSCs were closer to the rabbit inner cell mass (ICM) than rbESCs. Furthermore, rbiPSCs were capable of colonizing the ICM after aggregation with morulas. Therefore, we propose that rbiPSCs self-renew in an intermediate state between naïve and primed pluripotency, which represents a key step toward the generation of bona fide naïve PSC lines in rabbits. PMID:23789112

  15. Stem cell fusion as an ultimate line of defense against xenobiotics.

    PubMed

    Padron Velazquez, Julio Lazaro

    2006-01-01

    There are several indications that the potential of stem cells to fuse with somatic cells is extremely high and, what's more exciting, in some instances goes as far as reprogramming and/or rescuing altered cells. It remains unclear, however, how frequent this mechanism is and what patho-physiological role it might play in nature. A plausible hypothesis, discussed in this paper, suggests that stem cell niches might provide a safeguard for the intact genome and epigenome. By fusing with somatic de-differentiated cells, stem cells might consent epigenetic reprogramming and/or genetic recovery of genes which otherwise could drive altered cells to malignancy. If the many sophisticated mechanisms of metabolism, cell repair, programmed cell death and tissue regeneration should fail, stem cells might represent a final attempt to recover dedifferentiated cells to avoid inflowing in cancer. In the current reappraisal of the different mechanisms of defense against xenobiotics, even the incidence of cancer itself is considered an evolving mechanism which, through a kind of programmed death of individuals exhibiting defective mutations, favors advancement of the phenotypes which adapt best. Additionally, with regard to the mechanisms of transmitting somatic mutations, based on stem cells' capacity to migrate and to fuse, here it is speculated that stem cells might be capable of carrying acquired somatic mutations from peripheral tissues to the gonads, and transmit that information into the germinal line. If appropriately demonstrated, these mechanisms might delineate a novel therapeutic area to be explored. The use of stem cells to reprogram/recover irreversibly damaged cells or to transmit beneficial mutations might be a valuable therapeutic approach in the future.

  16. Is the replication of somatic coliphages in water environments significant?

    PubMed

    Jofre, J

    2009-04-01

    Somatic coliphages are amid several groups of bacteriophages that have been suggested as indicators in water quality assessment. One of the limitations frequently endorsed to somatic coliphages as indicators is that they can replicate in the water environment. This review intends to evaluate the significance of this potential replication. In view of: the threshold densities of somatic coliphages and host bacteria needed for productive infection to occur, the densities of both host cells supporting somatic coliphages replication and these phages in water environments, and the poor contribution of lysogenic induction to the free somatic coliphage numbers in water, it can be concluded that replication of somatic coliphages in waters is very unlikely. Consequently, the contribution of replication in the environment of somatic coliphages is expected to have a non-noticeable influence on the numbers of somatic coliphages detected in water environments. Thus, the replication in the environment should not be argued as a limitation to the use of somatic coliphages as indicators.

  17. A soma-to-germline transformation in long-lived C. elegans mutants

    PubMed Central

    Curran, Sean P.; Wu, Xiaoyun; Riedel, Christian G.; Ruvkun, Gary

    2009-01-01

    Unlike the soma which ages during the lifespan of multicellular organisms, the germline traces an essentially immortal lineage. Genomic instability in somatic cells increases with age, and this decline in somatic maintenance might be regulated to facilitate resource reallocation toward reproduction at the expense of cellular senescence. We report here that C. elegans mutants with increased longevity exhibit a soma-to-germline transformation of gene expression programs normally limited to the germline. Decreased insulin-like signaling causes the somatic misexpression of germline-limited pie-1 and pgl family of genes in intestinal and ectodermal tissues. DAF-16/FoxO, the major transcriptional effector of insulin-like signaling, regulates pie-1 expression by directly binding to the pie-1 promoter. The somatic tissues of insulin-like mutants are more germline-like and protected from genotoxic stress. Gene inactivation of components of the cytosolic chaperonin complex that induce increased longevity also cause somatic misexpression of PGL-1. These results suggest that the acquisition of germline characteristics by the somatic cells of C. elegans mutants with increased longevity contributes to their increased health and survival. PMID:19506556

  18. The genomic landscape of diffuse intrinsic pontine glioma and pediatric non-brainstem high-grade glioma

    PubMed Central

    Paugh, Barbara S; Rankin, Sherri L; Ju, Bensheng; Li, Yongjin; Zhu, Xiaoyan; Qu, Chunxu; Chen, Xiang; Zhang, Junyuan; Easton, John; Edmonson, Michael; Ma, Xiaotu; Lu, Charles; Nagahawatte, Panduka; Hedlund, Erin; Rusch, Michael; Pounds, Stanley; Lin, Tong; Onar-Thomas, Arzu; Huether, Robert; Kriwacki, Richard; Parker, Matthew; Gupta, Pankaj; Becksfort, Jared; Wei, Lei; Mulder, Heather L; Boggs, Kristy; Vadodaria, Bhavin; Yergeau, Donald; Russell, Jake C; Ochoa, Kerri; Fulton, Robert S; Fulton, Lucinda L; Jones, Chris; Boop, Frederick A; Broniscer, Alberto; Wetmore, Cynthia; Gajjar, Amar; Ding, Li; Mardis, Elaine R; Wilson, Richard K; Taylor, Michael R; Downing, James R; Ellison, David W; Zhang, Jinghui; Baker, Suzanne J

    2014-01-01

    Pediatric high-grade glioma (HGG) is a devastating disease with a two-year survival of less than 20%1. We analyzed 127 pediatric HGGs, including diffuse intrinsic pontine gliomas (DIPGs) and non-brainstem HGGs (NBS-HGGs) by whole genome, whole exome, and/or transcriptome sequencing. We identified recurrent somatic mutations in ACVR1 exclusively in DIPG (32%), in addition to the previously reported frequent somatic mutations in histone H3, TP53 and ATRX in both DIPG and NBS-HGGs2-5. Structural variants generating fusion genes were found in 47% of DIPGs and NBS-HGGs, with recurrent fusions involving the neurotrophin receptor genes NTRK1, 2, or 3 in 40% of NBS-HGGs in infants. Mutations targeting receptor tyrosine kinase/RAS/PI3K signaling, histone modification or chromatin remodeling, and cell cycle regulation were found in 68%, 73% and 59%, respectively, of pediatric HGGs, including DIPGs and NBS-HGGs. This comprehensive analysis provides insights into the unique and shared pathways driving pediatric HGG within and outside the brainstem. PMID:24705251

  19. A framework for evaluating developmental defects at the cellular level: An example from ten maize anther mutants using morphological and molecular data.

    PubMed

    Egger, Rachel L; Walbot, Virginia

    2016-11-01

    In seed plants, anthers are critical for sexual reproduction, because they foster both meiosis and subsequent pollen development of male germinal cells. Male-sterile mutants are analyzed to define steps in anther development. Historically the major topics in these studies are meiotic arrest and post-meiotic gametophyte failure, while relatively few studies focus on pre-meiotic defects of anther somatic cells. Utilizing morphometric analysis we demonstrate that pre-meiotic mutants can be impaired in anticlinal or periclinal cell division patterns and that final cell number in the pre-meiotic anther lobe is independent of cell number changes of individual differentiated somatic cell types. Data derived from microarrays and from cell wall NMR analyses allow us to further refine our understanding of the onset of phenotypes. Collectively the data highlight that even minor deviations from the correct spatiotemporal pattern of somatic cell proliferation can result in male sterility in Zea mays. Copyright © 2016 Elsevier Inc. All rights reserved.

  20. Transient acquisition of pluripotency during somatic cell transdifferentiation with iPSC reprogramming factors.

    PubMed

    Maza, Itay; Caspi, Inbal; Zviran, Asaf; Chomsky, Elad; Rais, Yoach; Viukov, Sergey; Geula, Shay; Buenrostro, Jason D; Weinberger, Leehee; Krupalnik, Vladislav; Hanna, Suhair; Zerbib, Mirie; Dutton, James R; Greenleaf, William J; Massarwa, Rada; Novershtern, Noa; Hanna, Jacob H

    2015-07-01

    Somatic cells can be transdifferentiated to other cell types without passing through a pluripotent state by ectopic expression of appropriate transcription factors. Recent reports have proposed an alternative transdifferentiation method in which fibroblasts are directly converted to various mature somatic cell types by brief expression of the induced pluripotent stem cell (iPSC) reprogramming factors Oct4, Sox2, Klf4 and c-Myc (OSKM) followed by cell expansion in media that promote lineage differentiation. Here we test this method using genetic lineage tracing for expression of endogenous Nanog and Oct4 and for X chromosome reactivation, as these events mark acquisition of pluripotency. We show that the vast majority of reprogrammed cardiomyocytes or neural stem cells obtained from mouse fibroblasts by OSKM-induced 'transdifferentiation' pass through a transient pluripotent state, and that their derivation is molecularly coupled to iPSC formation mechanisms. Our findings underscore the importance of defining trajectories during cell reprogramming by various methods.

  1. Transient Acquisition of Pluripotency During Somatic Cell Transdifferentiation with iPSC Reprogramming Factors

    PubMed Central

    Maza, Itay; Caspi, Inbal; Zviran, Asaf; Chomsky, Elad; Rais, Yoach; Viukov, Sergey; Geula, Shay; Buenrostro, Jason D.; Weinberger, Leehee; Krupalnik, Vladislav; Hanna, Suhair; Zerbib, Mirie; Dutton, James R.; Greenleaf, William J.; Massarwa, Rada; Novershtern, Noa; Hanna, Jacob H.

    2015-01-01

    Somatic cells can be transdifferentiated to other cell types without passing through a pluripotent state by ectopic expression of appropriate transcription factors1,2. Recent reports have proposed an alternative transdifferentiation method in which fibroblasts are directly converted to various mature somatic cell types by brief expression of the induced pluripotent stem cell (iPSC) reprogramming factors Oct4, Sox2, Klf4 and c-Myc (OSKM) followed by cell expansion in media that promote lineage differentiation3–6. Here we test this method using genetic lineage tracing for expression of endogenous Nanog and Oct4 and for X chromosome reactivation, as these events mark acquisition of pluripotency. We show that the vast majority of reprogrammed cardiomyocytes or neural stem cells obtained from mouse fibroblasts by OSKM-induced transdifferentiation pass through a transient pluripotent state, and that their derivation is molecularly coupled to iPSC formation mechanisms. Our findings underscore the importance of defining trajectories during cell reprogramming by different methods. PMID:26098448

  2. Predatory stem cells in the non-zebrafish chordate, Botryllus schlosseri.

    PubMed

    Laird, Diana J; De Tomaso, Anthony W

    2005-01-01

    Botryllus schlosseri is a primitive marine chordate which provides a new model organism to study stem cell biology for several reasons. First, B. schlosseri is a colonial organism that undergoes continuous and regular asexual development. Botryllus adults regenerate themselves, including all somatic tissues and the germline, every week. Second, under natural conditions the cells responsible can mobilize and transplant between two individuals. Once transplanted, these cells can proliferate, differentiate, and often completely replace the cells of the host in both the germline and/or somatic tissues. These processes are called germ cell parasitism (gcp), or somatic cell parasitism (scp), respectively, and we have shown that there are winners and losers in this process, implying that the competitive ability of stem cells is a genetically-determined trait. Fundamental characteristics of stem cell biology, such as self-renewal capacity, homing, or differentiation kinetics must underlie the ability of a stem cell of one genotype to out-compete a stem cell of another genotype, and we are using this system prospectively to isolate the cells responsible and to analyze the molecular mechanisms underlying gcp and scp phenotypes.

  3. A New, Dynamic Era for Somatic Cell Nuclear Transfer?

    PubMed

    Loi, Pasqualino; Iuso, Domenico; Czernik, Marta; Ogura, Atsuo

    2016-10-01

    Cloning animals by somatic cell nuclear transfer (SCNT) has remained an uncontrollable process for many years. High rates of embryonic losses, stillbirths, and postnatal mortality have been typical outcomes. These developmental problems arise from abnormal genomic reprogramming: the capacity of the oocyte to reset the differentiated memory of a somatic cell. However, effective reprogramming strategies are now available. These target the whole genome or single domains such as the Xist gene, and their effectiveness has been validated with the ability of experimental animals to develop to term. Thus, SCNT has become a controllable process that can be used to 'rescue' endangered species, and for biomedical research such as therapeutic cloning and the isolation of induced pluripotent stem cells (iPSCs). Copyright © 2016 Elsevier Ltd. All rights reserved.

  4. Cell cycle synchronization and analysis of apoptosis-related gene in skin fibroblasts from domestic cat (Felis silvestris catus) and kodkod (Leopardus guigna).

    PubMed

    Veraguas, D; Gallegos, P F; Castro, F O; Rodriguez-Alvarez, L

    2017-10-01

    The kodkod population is in constant decrease and the somatic cell nuclear transfer (SCNT) might help to preserve the genetic pool of this species. The cell cycle synchronization of donor cells plays a crucial role in SCNT. The objective of this research was to evaluate two different methods for quiescence induction, serum starvation (SS) and contact inhibition (CI), both for 1, 3 and 5 days, on skin fibroblast from domestic cat and kodkod. Flow cytometry analysis revealed that in domestic cat, SS and CI, both at 3 and 5 days, increased the percentage of fibroblasts in G0/G1 compared to growing cells (GC) (p < .05). In kodkod, only SS for 3 and 5 days and CI for 1 and 3 days increased the percentage of fibroblasts in G0/G1 compared to GC (p < .05). Viability analysis by differential staining revealed that SS for 5 days decreased the proportion of live fibroblasts in domestic cat and kodkod (p < .05). Regarding gene expression analysis, in domestic cat fibroblasts, no differences were found in the BAX/BCL2 ratio in SS and CI (both at 1, 3 and 5 days) compared to GC. In kodkod fibroblasts, BAX/BCL2 ratio was increased in CI at 3 and 5 days compared to SS at 3 and 5 days (p < .05). In conclusion, in kodkod fibroblasts SS for 5 days and CI after 3 days might have a negative impact on cellular viability. According to these results, we suggest SS for 3 days for cell cycle synchronization in kodkod fibroblasts. © 2017 Blackwell Verlag GmbH.

  5. Somatic Point Mutation Calling in Low Cellularity Tumors

    PubMed Central

    Kassahn, Karin S.; Holmes, Oliver; Nones, Katia; Patch, Ann-Marie; Miller, David K.; Christ, Angelika N.; Harliwong, Ivon; Bruxner, Timothy J.; Xu, Qinying; Anderson, Matthew; Wood, Scott; Leonard, Conrad; Taylor, Darrin; Newell, Felicity; Song, Sarah; Idrisoglu, Senel; Nourse, Craig; Nourbakhsh, Ehsan; Manning, Suzanne; Wani, Shivangi; Steptoe, Anita; Pajic, Marina; Cowley, Mark J.; Pinese, Mark; Chang, David K.; Gill, Anthony J.; Johns, Amber L.; Wu, Jianmin; Wilson, Peter J.; Fink, Lynn; Biankin, Andrew V.; Waddell, Nicola; Grimmond, Sean M.; Pearson, John V.

    2013-01-01

    Somatic mutation calling from next-generation sequencing data remains a challenge due to the difficulties of distinguishing true somatic events from artifacts arising from PCR, sequencing errors or mis-mapping. Tumor cellularity or purity, sub-clonality and copy number changes also confound the identification of true somatic events against a background of germline variants. We have developed a heuristic strategy and software (http://www.qcmg.org/bioinformatics/qsnp/) for somatic mutation calling in samples with low tumor content and we show the superior sensitivity and precision of our approach using a previously sequenced cell line, a series of tumor/normal admixtures, and 3,253 putative somatic SNVs verified on an orthogonal platform. PMID:24250782

  6. Highly Precise and Developmentally Programmed Genome Assembly in Paramecium Requires Ligase IV–Dependent End Joining

    PubMed Central

    Marmignon, Antoine; Ku, Michael; Silve, Aude; Meyer, Eric; Forney, James D.; Malinsky, Sophie; Bétermier, Mireille

    2011-01-01

    During the sexual cycle of the ciliate Paramecium, assembly of the somatic genome includes the precise excision of tens of thousands of short, non-coding germline sequences (Internal Eliminated Sequences or IESs), each one flanked by two TA dinucleotides. It has been reported previously that these genome rearrangements are initiated by the introduction of developmentally programmed DNA double-strand breaks (DSBs), which depend on the domesticated transposase PiggyMac. These DSBs all exhibit a characteristic geometry, with 4-base 5′ overhangs centered on the conserved TA, and may readily align and undergo ligation with minimal processing. However, the molecular steps and actors involved in the final and precise assembly of somatic genes have remained unknown. We demonstrate here that Ligase IV and Xrcc4p, core components of the non-homologous end-joining pathway (NHEJ), are required both for the repair of IES excision sites and for the circularization of excised IESs. The transcription of LIG4 and XRCC4 is induced early during the sexual cycle and a Lig4p-GFP fusion protein accumulates in the developing somatic nucleus by the time IES excision takes place. RNAi–mediated silencing of either gene results in the persistence of free broken DNA ends, apparently protected against extensive resection. At the nucleotide level, controlled removal of the 5′-terminal nucleotide occurs normally in LIG4-silenced cells, while nucleotide addition to the 3′ ends of the breaks is blocked, together with the final joining step, indicative of a coupling between NHEJ polymerase and ligase activities. Taken together, our data indicate that IES excision is a “cut-and-close” mechanism, which involves the introduction of initiating double-strand cleavages at both ends of each IES, followed by DSB repair via highly precise end joining. This work broadens our current view on how the cellular NHEJ pathway has cooperated with domesticated transposases for the emergence of new mechanisms involved in genome dynamics. PMID:21533177

  7. Highly precise and developmentally programmed genome assembly in Paramecium requires ligase IV-dependent end joining.

    PubMed

    Kapusta, Aurélie; Matsuda, Atsushi; Marmignon, Antoine; Ku, Michael; Silve, Aude; Meyer, Eric; Forney, James D; Malinsky, Sophie; Bétermier, Mireille

    2011-04-01

    During the sexual cycle of the ciliate Paramecium, assembly of the somatic genome includes the precise excision of tens of thousands of short, non-coding germline sequences (Internal Eliminated Sequences or IESs), each one flanked by two TA dinucleotides. It has been reported previously that these genome rearrangements are initiated by the introduction of developmentally programmed DNA double-strand breaks (DSBs), which depend on the domesticated transposase PiggyMac. These DSBs all exhibit a characteristic geometry, with 4-base 5' overhangs centered on the conserved TA, and may readily align and undergo ligation with minimal processing. However, the molecular steps and actors involved in the final and precise assembly of somatic genes have remained unknown. We demonstrate here that Ligase IV and Xrcc4p, core components of the non-homologous end-joining pathway (NHEJ), are required both for the repair of IES excision sites and for the circularization of excised IESs. The transcription of LIG4 and XRCC4 is induced early during the sexual cycle and a Lig4p-GFP fusion protein accumulates in the developing somatic nucleus by the time IES excision takes place. RNAi-mediated silencing of either gene results in the persistence of free broken DNA ends, apparently protected against extensive resection. At the nucleotide level, controlled removal of the 5'-terminal nucleotide occurs normally in LIG4-silenced cells, while nucleotide addition to the 3' ends of the breaks is blocked, together with the final joining step, indicative of a coupling between NHEJ polymerase and ligase activities. Taken together, our data indicate that IES excision is a "cut-and-close" mechanism, which involves the introduction of initiating double-strand cleavages at both ends of each IES, followed by DSB repair via highly precise end joining. This work broadens our current view on how the cellular NHEJ pathway has cooperated with domesticated transposases for the emergence of new mechanisms involved in genome dynamics.

  8. Selfish cells in altruistic cell society - a theoretical oncology.

    PubMed

    Chigira, M

    1993-09-01

    In multicellular organisms, internal evolution of individual cells is strictly forbidden and 'evolutional' DNA replication should be performed only by the sexual reproduction system. Wholistic negative control system called 'homeostasis' serves all service to germ line cells. All somatic cells are altruistic to the germ line cells. However, in malignant tumors, it seems that individual cells replicate and behave 'selfishly' and evolve against the internal microenvironment. Tumor cells only express the occult selfishness which is programmed in normal cells a priori. This phenomenon is based on the failure of identical DNA replication, and results in 'autonomy' and 'anomie' of cellular society as shown in tumor cells. Genetic programs of normal cells connote this cellular autonomy and anomie introduced by the deletion of regulators on structure genes. It is rather paradoxical that the somatic cells get their freedom from wholistic negative regulation programmed internally. However, this is not a true paradox, since multicellular organisms have clearly been evolved from 'monads' in which cells proliferate without wholistic regulation. Somatic cells revolt against germ cell DNA, called 'selfish replicator' by Dawkins. It is an inevitable destiny that the 'selfishness' coded in genome should be revenged by itself. Selfish replicator in germ cell line should be revolted by its selfishness in the expansion of somatic cells, since they have an orthogenesis to get more selfishness in order to increase their genome. Tumor heterogeneity and progression can be fully explained by this self-contradictory process which produces heterogeneous gene copies different from the original clone in the tumor, although 'selfish' gene replication is the final target of being. Furthermore, we have to discard the concept of clonality of tumor cells since genetic instability is a fundamental feature of tumors. Finally, tumor cells and proto-oncogenes can be considered as the ultimate parasite to germ line cells.

  9. The Kinetics of G2 and M Transitions Regulated by B Cyclins

    PubMed Central

    Huang, Yehong; Sramkoski, R. Michael; Jacobberger, James W.

    2013-01-01

    B cyclins regulate G2-M transition. Because human somatic cells continue to cycle after reduction of cyclin B1 (cycB1) or cyclin B2 (cycB2) by RNA interference (RNAi), and because cycB2 knockout mice are viable, the existence of two genes should be an optimization. To explore this idea, we generated HeLa BD™ Tet-Off cell lines with inducible cyclin B1- or B2-EGFP that were RNAi resistant. Cultures were treated with RNAi and/or doxycycline (Dox) and bromodeoxyuridine. We measured G2 and M transit times and 4C cell accumulation. In the absence of ectopic B cyclin expression, knockdown (kd) of either cyclin increased G2 transit. M transit was increased by cycB1 kd but decreased by cycB2 depletion. This novel difference was further supported by time-lapse microscopy. This suggests that cycB2 tunes mitotic timing, and we speculate that this is through regulation of a Golgi checkpoint. In the presence of endogenous cyclins, expression of active B cyclin-EGFPs did not affect G2 or M phase times. As previously shown, B cyclin co-depletion induced G2 arrest. Expression of either B cyclin-EGFP completely rescued knockdown of the respective endogenous cyclin in single kd experiments, and either cyclin-EGFP completely rescued endogenous cyclin co-depletion. Most of the rescue occurred at relatively low levels of exogenous cyclin expression. Therefore, cycB1 and cycB2 are interchangeable for ability to promote G2 and M transition in this experimental setting. Cyclin B1 is thought to be required for the mammalian somatic cell cycle, while cyclin B2 is thought to be dispensable. However, residual levels of cyclin B1 or cyclin B2 in double knockdown experiments are not sufficient to promote successful mitosis, yet residual levels are sufficient to promote mitosis in the presence of the dispensible cyclin B2. We discuss a simple model that would explain most data if cyclin B1 is necessary. PMID:24324638

  10. Consequence of alternative standards for bulk tank somatic cell count of dairy herds in the United States

    USDA-ARS?s Scientific Manuscript database

    Comparison of dairy operations failing compliance with current US and European Union (EU) standards for bulk-tank somatic cell count (BTSCC) as well as BTSCC standards proposed by 3 national organizations were evaluated using 2 populations of US dairy herds: Dairy Herd Improvement Association (DHI) ...

  11. Multitrait modeling of first vs. later parities for US yield, somatic cell score, and fertility traits

    USDA-ARS?s Scientific Manuscript database

    Genetic merits in first vs. later parity with correlations <1 were compared to official repeatability models using 88 million lactation records of 34 million cows for yield traits and fewer records for somatic cell score (SCS) and 2 cow fertility traits. Estimated genetic correlations of first with ...

  12. [Investigations on the pathogenesis of changes in somatic growth of Lymnaea stagnalis (Gastropoda: Pulmonata) experimentally infected with parthenites Opisthioglyphe ranae (Digenea: Plagiorchiida). I. Relative weight of accessory sex organs and synthetic activity of neurosecretory cells].

    PubMed

    Pokora, Z

    1996-01-01

    In the paper an attempt to define pathogenesis of changes in somatic growth of juvenile individuals of the popular freshwater snail Lymnaea stagnalis experimentally infected with parthenites of the trematode Opisthioglyphe ranae was undertaken. Significant enlargement of relative wet weight of examined accessory sex organs (albumen gland, oothecal gland, prostate, male copulatory organ) observed in infected snails permits to explain increase of their somatic growth basing on the hypothesis of disturbances in energetistic budget of the host-as a consequence of reduction by the parasite activity of the snail's reproductive system. Pathogenesis of this phenomenon has probably a complicated character, including also effect of parthenites on activity of the neurosecretory cells that control somatic growth in examined species of the snail. An argument for this standpoint is, observed in infected snails, increase of amount of neurosecretory material and RNA in cytoplasm of these cells (the light green cells of cerebral ganglia), as well as amount of the loose fraction of chromatine in their nuclei.

  13. Resolving rates of mutation in the brain using single-neuron genomics

    PubMed Central

    Evrony, Gilad D; Lee, Eunjung; Park, Peter J; Walsh, Christopher A

    2016-01-01

    Whether somatic mutations contribute functional diversity to brain cells is a long-standing question. Single-neuron genomics enables direct measurement of somatic mutation rates in human brain and promises to answer this question. A recent study (Upton et al., 2015) reported high rates of somatic LINE-1 element (L1) retrotransposition in the hippocampus and cerebral cortex that would have major implications for normal brain function, and suggested that these events preferentially impact genes important for neuronal function. We identify aspects of the single-cell sequencing approach, bioinformatic analysis, and validation methods that led to thousands of artifacts being interpreted as somatic mutation events. Our reanalysis supports a mutation frequency of approximately 0.2 events per cell, which is about fifty-fold lower than reported, confirming that L1 elements mobilize in some human neurons but indicating that L1 mosaicism is not ubiquitous. Through consideration of the challenges identified, we provide a foundation and framework for designing single-cell genomics studies. DOI: http://dx.doi.org/10.7554/eLife.12966.001 PMID:26901440

  14. Prestin and the cholinergic receptor of hair cells: positively-selected proteins in mammals

    PubMed Central

    Elgoyhen, Ana Belén; Franchini, Lucía F.

    2010-01-01

    The hair cells of the vertebrate inner ear posses active mechanical processes to amplify their inputs. The stereocilia bundle of various vertebrate animals can produce active movements. Though standard stereocilia-based mechanisms to promote amplification persist in mammals, an additional radically different mechanism evolved: the so called somatic electromotility which refers to the elongation/contraction of the outer hair cells’ (OHC) cylindrical cell body in response to membrane voltage changes. Somatic electromotility in OHCs, as the basis for cochlear amplification, is a mammalian novelty and it is largely dependent upon the properties of the unique motor protein prestin. We review recent literature which has demonstrated that although the gene encoding prestin is present in all vertebrate species, mammalian prestin has been under positive selective pressure to acquire motor properties, probably rendering it fit to serve somatic motility in outer hair cells. Moreover, we discuss data which indicates that a modified α10 nicotinic cholinergic receptor subunit has coevolved in mammals, most likely to give the auditory feedback system the capability to control somatic electromotility. PMID:20056140

  15. Perspectives for induced pluripotent stem cell technology: new insights into human physiology involved in somatic mosaicism.

    PubMed

    Nagata, Naoki; Yamanaka, Shinya

    2014-01-31

    Induced pluripotent stem cell technology makes in vitro reprogramming of somatic cells from individuals with various genetic backgrounds possible. By applying this technology, it is possible to produce pluripotent stem cells from biopsy samples of arbitrarily selected individuals with various genetic backgrounds and to subsequently maintain, expand, and stock these cells. From these induced pluripotent stem cells, target cells and tissues can be generated after certain differentiation processes. These target cells/tissues are expected to be useful in regenerative medicine, disease modeling, drug screening, toxicology testing, and proof-of-concept studies in drug development. Therefore, the number of publications concerning induced pluripotent stem cells has recently been increasing rapidly, demonstrating that this technology has begun to infiltrate many aspects of stem cell biology and medical applications. In this review, we discuss the perspectives of induced pluripotent stem cell technology for modeling human diseases. In particular, we focus on the cloning event occurring through the reprogramming process and its ability to let us analyze the development of complex disease-harboring somatic mosaicism.

  16. Cloned embryos from semen. Part 2: Intergeneric nuclear transfer of semen-derived eland (Taurotragus oryx) epithelial cells into bovine oocytes

    USGS Publications Warehouse

    Nel-Themaat, L.; Gomez, M.C.; Pope, C.E.; Lopez, M.; Wirtu, G.; Jenkins, J.A.; Cole, A.; Dresser, B.L.; Bondioli, K.R.; Godke, R.A.

    2008-01-01

    The production of cloned offspring by nuclear transfer (NT) of semen-derived somatic cells holds considerable potential for the incorporation of novel genes into endangered species populations. Because oocytes from endangered species are scarce, domestic species oocytes are often used as cytoplasts for interspecies NT. In the present study, epithelial cells isolated from eland semen were used for intergeneric transfer (IgNT) into enucleated bovine oocytes and compared with bovine NT embryos. Cleavage rates of bovine NT and eland IgNT embryos were similar (80 vs. 83%, respectively; p > 0.05); however, development to the morula and blastocyst stage was higher for bovine NT embryos (38 and 21%, respectively; p < 0.0001), than for eland IgNT embryos (0.5 and 0%, respectively). DNA synthesis was not observed in either bovine NT or eland IgNT cybrids before activation, but in 75 and 70% of bovine NT and eland igNT embryos, respectively, cell-cycle resumption was observed at 16 h postactivation (hpa). For eland IgNT embryos, 13% had ???8 cells at 84 hpa, while 32% of the bovine NT embryos had ???8 cells at the same interval. However, 100 and 66% of bovine NT and eland IgNT embryos, respectively, that had ???8 cells synthesized DNA. From these results we concluded that (1) semen-derived epithelial cell nuclei can interact and be transcriptionally controlled by bovine cytoplast, (2) the first cell-cycle occurred in IgNT embryos, (3) a high frequency of developmental arrest occurs before the eight-cell stage in IgNT embryos, and (4) IgNT embryos that progress through the early cleavage stage arrest can (a) synthesize DNA, (b) progress through subsequent cell cycles, and (c) may have the potential to develop further. ?? 2008 Mary Ann Liebert, Inc.

  17. Reproductive cycles of Mugil cephalus, Liza ramada and Liza aurata (Teleostei: Mugilidae).

    PubMed

    Bartulović, V; Dulčić, J; Matić-Skoko, S; Glamuzina, B

    2011-06-01

    The reproductive cycles of three mullet species from the Eastern Adriatic coast were described using several biological parameters (gonado-somatic index, oocyte diameter and sex ratio) to improve knowledge about their reproduction. © 2011 The Authors. Journal of Fish Biology © 2011 The Fisheries Society of the British Isles.

  18. Cloning endangered gray wolves (Canis lupus) from somatic cells collected postmortem.

    PubMed

    Oh, H J; Kim, M K; Jang, G; Kim, H J; Hong, S G; Park, J E; Park, K; Park, C; Sohn, S H; Kim, D Y; Shin, N S; Lee, B C

    2008-09-01

    The objective of the present study was to investigate whether nuclear transfer of postmortem wolf somatic cells into enucleated dog oocytes, is a feasible method to produce a cloned wolf. In vivo-matured oocytes (from domestic dogs) were enucleated and fused with somatic cells derived from culture of tissue obtained from a male gray wolf 6h after death. The reconstructed embryos were activated and transferred into the oviducts of naturally synchronous domestic bitches. Overall, 372 reconstructed embryos were transferred to 17 recipient dogs; four recipients (23.5%) were confirmed pregnant (ultrasonographically) 23-25 d after embryo transfer. One recipient spontaneously delivered two dead pups and three recipients delivered, by cesarean section, four cloned wolf pups, weighing 450, 190, 300, and 490g, respectively. The pup that weighed 190g died within 12h after birth. The six cloned wolf pups were genetically identical to the donor wolf, and their mitochondrial DNA originated from the oocyte donors. The three live wolf pups had a normal wolf karyotype (78, XY), and the amount of telomeric DNA, assessed by quantitative fluorescence in situ hybridization, was similar to, or lower than, that of the nuclear donor. In conclusion, the present study demonstrated the successful cloning of an endangered male gray wolf via interspecies transfer of somatic cells, isolated postmortem from a wolf, and transferred into enucleated dog oocytes. Therefore, somatic cell nuclear transfer has potential for preservation of canine species in extreme situations, including sudden death.

  19. The cell agglutination agent, phytohemagglutinin-L, improves the efficiency of somatic nuclear transfer cloning in cattle (Bos taurus).

    PubMed

    Du, Fuliang; Shen, Perng-Chih; Xu, Jie; Sung, Li-Ying; Jeong, B-Seon; Lucky Nedambale, Tshimangadzo; Riesen, John; Cindy Tian, X; Cheng, Winston T K; Lee, Shan-Nan; Yang, Xiangzhong

    2006-02-01

    One of the several factors that contribute to the low efficiency of mammalian somatic cloning is poor fusion between the small somatic donor cell and the large recipient oocyte. This study was designed to test phytohemagglutinin (PHA) agglutination activity on fusion rate, and subsequent developmental potential of cloned bovine embryos. The toxicity of PHA was established by examining its effects on the development of parthenogenetic bovine oocytes treated with different doses (Experiment 1), and for different durations (Experiment 2). The effective dose and duration of PHA treatment (150 microg/mL, 20 min incubation) was selected and used to compare membrane fusion efficiency and embryo development following somatic cell nuclear transfer (Experiment 3). Cloning with somatic donor fibroblasts versus cumulus cells was also compared, both with and without PHA treatment (150 microg/mL, 20 min). Fusion rate of nuclear donor fibroblasts, after phytohemagglutinin treatment, was increased from 33 to 61% (P < 0.05), and from 59 to 88% (P < 0.05) with cumulus cell nuclear donors. The nuclear transfer (NT) efficiency per oocyte used was improved following PHA treatment, for both fibroblast (13% versus 22%) as well as cumulus cells (17% versus 34%; P < 0.05). The cloned embryos, both with and without PHA treatment, were subjected to vitrification and embryo transfer testing, and resulted in similar survival (approximately 90% hatching) and pregnancy rates (17-25%). Three calves were born following vitrification and embryo transfer of these embryos; two from the PHA-treated group, and one from non-PHA control group. We concluded that PHA treatment significantly improved the fusion efficiency of somatic NT in cattle, and therefore, increased the development of cloned blastocysts. Furthermore, within a determined range of dose and duration, PHA had no detrimental effect on embryo survival post-vitrification, nor on pregnancy or calving rates following embryo transfer.

  20. Cells Comprising the Prostate Cancer Microenvironment Lack Recurrent Clonal Somatic Genomic Aberrations

    PubMed Central

    Bianchi-Frias, Daniella; Basom, Ryan; Delrow, Jeffrey J; Coleman, Ilsa M; Dakhova, Olga; Qu, Xiaoyu; Fang, Min; Franco, Omar E.; Ericson, Nolan G.; Bielas, Jason H.; Hayward, Simon W.; True, Lawrence; Morrissey, Colm; Brown, Lisha; Bhowmick, Neil A.; Rowley, David; Ittmann, Michael; Nelson, Peter S.

    2017-01-01

    Prostate cancer-associated stroma (CAS) plays an active role in malignant transformation, tumor progression, and metastasis. Molecular analyses of CAS have demonstrated significant changes in gene expression; however, conflicting evidence exists on whether genomic alterations in benign cells comprising the tumor microenvironment (TME) underlie gene expression changes and oncogenic phenotypes. This study evaluates the nuclear and mitochondrial DNA integrity of prostate carcinoma cells, CAS, matched benign epithelium and benign epithelium-associated stroma by whole genome copy number analyses, targeted sequencing of TP53, and fluorescence in situ hybridization. Comparative genomic hybridization (aCGH) of CAS revealed a copy-neutral diploid genome with only rare and small somatic copy number aberrations (SCNAs). In contrast, several expected recurrent SCNAs were evident in the adjacent prostate carcinoma cells, including gains at 3q, 7p, and 8q, and losses at 8p and 10q. No somatic TP53 mutations were observed in CAS. Mitochondrial DNA (mtDNA) extracted from carcinoma cells and stroma identified 23 somatic mtDNA mutations in neoplastic epithelial cells but only one mutation in stroma. Finally, genomic analyses identified no SCNAs, no loss of heterozygosity (LOH) or copy-neutral LOH in cultured cancer-associated fibroblasts (CAFs), which are known to promote prostate cancer progression in vivo. PMID:26753621

  1. Mitochondrial DNA transmission and confounding mitochondrial influences in cloned cattle and pigs.

    PubMed

    Takeda, Kumiko

    2013-04-01

    Although somatic cell nuclear transfer (SCNT) is a powerful tool for production of cloned animals, SCNT embryos generally have low developmental competency and many abnormalities. The interaction between the donor nucleus and the enucleated ooplasm plays an important role in early embryonic development, but the underlying mechanisms that negatively impact developmental competency remain unclear. Mitochondria have a broad range of critical functions in cellular energy supply, cell signaling, and programmed cell death; thus, affect embryonic and fetal development. This review focuses on mitochondrial considerations influencing SCNT techniques in farm animals. Donor somatic cell mitochondrial DNA (mtDNA) can be transmitted through what has been considered a "bottleneck" in mitochondrial genetics via the SCNT maternal lineage. This indicates that donor somatic cell mitochondria have a role in the reconstructed cytoplasm. However, foreign somatic cell mitochondria may affect the early development of SCNT embryos. Nuclear-mitochondrial interactions in interspecies/intergeneric SCNT (iSCNT) result in severe problems. A major biological selective pressure exists against survival of exogenous mtDNA in iSCNT. Yet, mtDNA differences in SCNT animals did not reflect transfer of proteomic components following proteomic analysis. Further study of nuclear-cytoplasmic interactions is needed to illuminate key developmental characteristics of SCNT animals associated with mitochondrial biology.

  2. Parthenogenesis and somatic cell nuclear transfer in sheep oocytes using Polscope.

    PubMed

    Nandedkar, Pandit; Chohan, Parul; Patwardhan, Archana; Gaikwad, Santosh; Bhartiya, Deepa

    2009-07-01

    Parthenogenesis and Somatic cell nuclear transfer (SCNT) techniques, offer a unique approach to manipulate the genetic composition of derived human embryonic stem cells - an essential step if the full opportunities for disease modeling, drug discovery or individualized stem cell therapy are to be realized. The present study describes the use of sheep oocytes to acquire expertise and establish methods to reconstruct embryos for obtaining blastocysts before venturing into human SCNT where the oocytes are a very precious starting material. Maturation of sheep eggs in vitro for 20-24 hr resulted in 65% metaphase II (MII) eggs which were either parthenogenetically activated using calcium ionomycin or ethanol or subjected to SCNT using cumulus cell as somatic cell. Sixteen blastocysts were produced by parthenogenetic activation of 350 eggs whereas reconstructed embryos, after SCNT carried out in 139 eggs, progressed only up to morula stage. The procedure of parthenogenesis and SCNT will be useful to generate autologous ES cells using human eggs.

  3. Overexpression of Tet3 in donor cells enhances goat somatic cell nuclear transfer efficiency.

    PubMed

    Han, Chengquan; Deng, Ruizhi; Mao, Tingchao; Luo, Yan; Wei, Biao; Meng, Peng; Zhao, Lu; Zhang, Qing; Quan, Fusheng; Liu, Jun; Zhang, Yong

    2018-05-23

    Ten-eleven translocation 3 (TET3) mediates active DNA demethylation of paternal genomes during mouse embryonic development. However, the mechanism of DNA demethylation in goat embryos remains unknown. In addition, aberrant DNA methylation reprogramming prevalently occurs in embryos cloned by somatic cell nuclear transfer (SCNT). In this study, we reported that TET3 is a key factor in DNA demethylation in goat pre-implantation embryos. Knockdown of Tet3 hindered DNA demethylation at the two- to four-cell stage in goat embryos and decreased Nanog expression in blastocysts. Overexpression of Tet3 in somatic cells can initiate DNA demethylation, reduce 5-methylcytosine level, increase 5-hydroxymethylcytosine level and promote the expression of key pluripotency genes. After SCNT, overexpression of Tet3 in donor cells corrected abnormal DNA hypermethylation of cloned embryos and significantly enhanced in vitro and in vivo developmental rate (P < 0.05). We conclude that overexpression of Tet3 in donor cells significantly improves goat SCNT efficiency. © 2018 Federation of European Biochemical Societies.

  4. EZH2 is required for germinal center formation and somatic EZH2 mutations promote lymphoid transformation

    PubMed Central

    Béguelin, Wendy; Popovic, Relja; Teater, Matt; Jiang, Yanwen; Bunting, Karen L.; Rosen, Monica; Shen, Hao; Yang, Shao Ning; Wang, Ling; Ezponda, Teresa; Martinez-Garcia, Eva; Zhang, Haikuo; Zhang, Yupeng; Verma, Sharad K.; McCabe, Michael T.; Ott, Heidi M.; Van Aller, Glenn S.; Kruger, Ryan G.; Liu, Yan; McHugh, Charles F.; Scott, David W.; Chung, Young Rock; Kelleher, Neil; Shaknovich, Rita; Creasy, Caretha L.; Gascoyne, Randy D.; Wong, Kwok-Kin; Cerchietti, Leandro C.; Levine, Ross L.; Abdel-Wahab, Omar; Licht, Jonathan D.; Elemento, Olivier; Melnick, Ari M.

    2013-01-01

    The EZH2 histone methyltransferase is highly expressed in germinal center (GC) B-cells and targeted by somatic mutations in B-cell lymphomas. Here we find that EZH2 deletion or pharmacologic inhibition suppresses GC formation and functions in mice. EZH2 represses proliferation checkpoint genes and helps establish bivalent chromatin domains at key regulatory loci to transiently suppress GC B-cell differentiation. Somatic mutations reinforce these physiological effects through enhanced silencing of EZH2 targets in B-cells, and in human B-cell lymphomas. Conditional expression of mutant EZH2 in mice induces GC hyperplasia and accelerated lymphomagenesis in cooperation with BCL2. GCB-type DLBCLs are mostly addicted to EZH2, regardless of mutation status, but not the more differentiated ABC-type DLBCLs, thus clarifying the therapeutic scope of EZH2 targeting. PMID:23680150

  5. Genotype x environment interactions in milk yield and quality in Angus, Brahman, and reciprocal-cross cows on different forage systems.

    PubMed

    Brown, M A; Brown, A H; Jackson, W G; Miesner, J R

    2001-07-01

    Milk yield and quality were observed on 93 Angus, Brahman, and reciprocal-cross cows over 3 yr to evaluate the interactions of direct and maternal breed effects and heterosis with forage environment. Forage environments were common bermudagrass (BG), endophyte-infected tall fescue (E+), and a rotational system (ROT) of both forages, in which each forage (BG or E+) was grazed during its appropriate season, usually June through October for BG and November through May for E+. Milk yield was estimated each of 6 mo (April through September) via milking machine and converted to a 24-h basis. Milk fat, milk protein, and somatic cell count were analyzed by a commercial laboratory. Heterosis for milk yield was similar among forages, averaging 2.4 kg (P < 0.01). Expressed as percentages of purebred means, heterosis for milk yield was largest on E+ (52.8%), intermediate on ROT (39.3%), and smallest on BG (23.7%). Direct breed effects for milk yield favored Brahman, and they were similar among forages but tended to be larger for E+ (2.5 kg) and ROT (2.8 kg) than for BG (1.3 kg). Direct breed effects for milk fat favored Brahman and were similar among forages but tended to be larger for E+ (1.0%) and ROT (1.0%) than for BG (0.6%). Purebred cows exceeded crossbreds in milk protein by 0.1% on ROT (P < 0.10). Crossbred cows had lower somatic cell counts than purebreds on BG (P < 0.05), E+ (P < 0.01), or ROT (P > 0.30). Heterosis for somatic cell counts as percentages of purebred means was similar for BG (-68.3%) and E+ (-68.9%) and less favorable for ROT (-31.6%). Maternal breed effects for somatic cell count favored Angus on ROT (P < 0.10) with a similar nonsignificant trend on BG and E+. Direct breed effects for somatic cell count favored Brahman on ROT (P < 0.10) with similar nonsignificant trends on BG and E+. These results suggested that a rotation of cows from E+ to BG in the summer can partially alleviate negative effects of E+ on milk yield. Conclusions also indicated an advantage to crossbred cows in somatic cell count and provided evidence of both direct and maternal breed effects for this trait. The results also suggested that direct breed effects for milk yield, milk fat, and somatic cell count and heterosis for milk yield and somatic cell count (as percentages of purebred means) tended to vary with forage environment, indicating a potential for genotype x environment interaction for these traits.

  6. [New possibilities will open up in human gene therapy].

    PubMed

    Portin, Petter

    2016-01-01

    Gene therapy is divided into somatic and germ line therapy. The latter involves reproductive cells or their stem cells, and its results are heritable. The effects of somatic gene therapy are generally restricted to a single tissue of the patient in question. Until now, all gene therapies in the world have belonged to the regime of somatic therapy, germ line therapy having been a theoretical possibility only. Very recently, however, a method has been developed which is applicable to germ line therapy as well. In addition to technical challenges, severe ethical problems are associated with germ line therapy, demanding opinion statement.

  7. Comparative transcriptome analysis in induced neural stem cells reveals defined neural cell identities in vitro and after transplantation into the adult rodent brain.

    PubMed

    Hallmann, Anna-Lena; Araúzo-Bravo, Marcos J; Zerfass, Christina; Senner, Volker; Ehrlich, Marc; Psathaki, Olympia E; Han, Dong Wook; Tapia, Natalia; Zaehres, Holm; Schöler, Hans R; Kuhlmann, Tanja; Hargus, Gunnar

    2016-05-01

    Reprogramming technology enables the production of neural progenitor cells (NPCs) from somatic cells by direct transdifferentiation. However, little is known on how neural programs in these induced neural stem cells (iNSCs) differ from those of alternative stem cell populations in vitro and in vivo. Here, we performed transcriptome analyses on murine iNSCs in comparison to brain-derived neural stem cells (NSCs) and pluripotent stem cell-derived NPCs, which revealed distinct global, neural, metabolic and cell cycle-associated marks in these populations. iNSCs carried a hindbrain/posterior cell identity, which could be shifted towards caudal, partially to rostral but not towards ventral fates in vitro. iNSCs survived after transplantation into the rodent brain and exhibited in vivo-characteristics, neural and metabolic programs similar to transplanted NSCs. However, iNSCs vastly retained caudal identities demonstrating cell-autonomy of regional programs in vivo. These data could have significant implications for a variety of in vitro- and in vivo-applications using iNSCs. Copyright © 2016 Roslin Cells Ltd. Published by Elsevier B.V. All rights reserved.

  8. Fungal Infection Increases the Rate of Somatic Mutation in Scots Pine (Pinus sylvestris L.).

    PubMed

    Ranade, Sonali Sachin; Ganea, Laura-Stefana; Razzak, Abdur M; García Gil, M R

    2015-01-01

    Somatic mutations are transmitted during mitosis in developing somatic tissue. Somatic cells bearing the mutations can develop into reproductive (germ) cells and the somatic mutations are then passed on to the next generation of plants. Somatic mutations are a source of variation essential to evolve new defense strategies and adapt to the environment. Stem rust disease in Scots pine has a negative effect on wood quality, and thus adversely affects the economy. It is caused by the 2 most destructive fungal species in Scandinavia: Peridermium pini and Cronartium flaccidum. We studied nuclear genome stability in Scots pine under biotic stress (fungus-infected, 22 trees) compared to a control population (plantation, 20 trees). Stability was assessed as accumulation of new somatic mutations in 10 microsatellite loci selected for genotyping. Microsatellites are widely used as molecular markers in population genetics studies of plants, and are particularly used for detection of somatic mutations as their rate of mutation is of a much higher magnitude when compared with other DNA markers. We report double the rate of somatic mutation per locus in the fungus-infected trees (4.8×10(-3) mutations per locus), as compared to the controls (2.0×10(-3) mutations per locus) when individual samples were analyzed at 10 different microsatellite markers. Pearson's chi-squared test indicated a significant effect of the fungal infection which increased the number of mutations in the fungus-infected trees (χ(2) = 12.9883, df = 1, P = 0.0003134). © The American Genetic Association 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  9. UV-induced somatic mutations elicit a functional T cell response in the YUMMER1.7 mouse melanoma model.

    PubMed

    Wang, Jake; Perry, Curtis J; Meeth, Katrina; Thakral, Durga; Damsky, William; Micevic, Goran; Kaech, Susan; Blenman, Kim; Bosenberg, Marcus

    2017-07-01

    Human melanomas exhibit relatively high somatic mutation burden compared to other malignancies. These somatic mutations may produce neoantigens that are recognized by the immune system, leading to an antitumor response. By irradiating a parental mouse melanoma cell line carrying three driver mutations with UVB and expanding a single-cell clone, we generated a mutagenized model that exhibits high somatic mutation burden. When inoculated at low cell numbers in immunocompetent C57BL/6J mice, YUMMER1.7 (Yale University Mouse Melanoma Exposed to Radiation) regresses after a brief period of growth. This regression phenotype is dependent on T cells as YUMMER1.7 tumors grow significantly faster in immunodeficient Rag1 -/- mice and C57BL/6J mice depleted of CD4 and CD8 T cells. Interestingly, regression can be overcome by injecting higher cell numbers of YUMMER1.7, which results in tumors that grow without effective rejection. Mice that have previously rejected YUMMER1.7 tumors develop immunity against higher doses of YUMMER1.7 tumor challenge. In addition, escaping YUMMER1.7 tumors are sensitive to anti-CTLA-4 and anti-PD-1 therapy, establishing a new model for the evaluation of immune checkpoint inhibition and antitumor immune responses. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  10. Control of female gamete formation by a small RNA pathway in Arabidopsis.

    PubMed

    Olmedo-Monfil, Vianey; Durán-Figueroa, Noé; Arteaga-Vázquez, Mario; Demesa-Arévalo, Edgar; Autran, Daphné; Grimanelli, Daniel; Slotkin, R Keith; Martienssen, Robert A; Vielle-Calzada, Jean-Philippe

    2010-03-25

    In the ovules of most sexual flowering plants female gametogenesis is initiated from a single surviving gametic cell, the functional megaspore, formed after meiosis of the somatically derived megaspore mother cell (MMC). Because some mutants and certain sexual species exhibit more than one MMC, and many others are able to form gametes without meiosis (by apomixis), it has been suggested that somatic cells in the ovule are competent to respond to a local signal likely to have an important function in determination. Here we show that the Arabidopsis protein ARGONAUTE 9 (AGO9) controls female gamete formation by restricting the specification of gametophyte precursors in a dosage-dependent, non-cell-autonomous manner. Mutations in AGO9 lead to the differentiation of multiple gametic cells that are able to initiate gametogenesis. The AGO9 protein is not expressed in the gamete lineage; instead, it is expressed in cytoplasmic foci of somatic companion cells. Mutations in SUPPRESSOR OF GENE SILENCING 3 and RNA-DEPENDENT RNA POLYMERASE 6 exhibit an identical defect to ago9 mutants, indicating that the movement of small RNA (sRNAs) silencing out of somatic companion cells is necessary for controlling the specification of gametic cells. AGO9 preferentially interacts with 24-nucleotide sRNAs derived from transposable elements (TEs), and its activity is necessary to silence TEs in female gametes and their accessory cells. Our results show that AGO9-dependent sRNA silencing is crucial to specify cell fate in the Arabidopsis ovule, and that epigenetic reprogramming in companion cells is necessary for sRNA-dependent silencing in plant gametes.

  11. Production of cloned mice and ES cells from adult somatic cells by nuclear transfer: how to improve cloning efficiency?

    PubMed

    Wakayama, Teruhiko

    2007-02-01

    Although it has now been 10 years since the first cloned mammals were generated from somatic cells using nuclear transfer (NT), most cloned embryos usually undergo developmental arrest prior to or soon after implantation, and the success rate for producing live offspring by cloning remains below 5%. The low success rate is believed to be associated with epigenetic errors, including abnormal DNA hypermethylation, but the mechanism of "reprogramming" is unclear. We have been able to develop a stable NT method in the mouse in which donor nuclei are directly injected into the oocyte using a piezo-actuated micromanipulator. Especially in the mouse, only a few laboratories can make clones from adult somatic cells, and cloned mice are never successfully produced from most mouse strains. However, this technique promises to be an important tool for future research in basic biology. For example, NT can be used to generate embryonic stem (NT-ES) cell lines from a patient's own somatic cells. We have shown that NT-ES cells are equivalent to ES cells derived from fertilized embryos and that they can be generated relatively easily from a variety of mouse genotypes and cell types of both sexes, even though it may be more difficult to generate clones directly. In general, NT-ES cell techniques are expected to be applied to regenerative medicine; however, this technique can also be applied to the preservation of genetic resources of mouse strain instead of embryos, oocytes and spermatozoa. This review describes how to improve cloning efficiency and NT-ES cell establishment and further applications.

  12. Intrinsic and extrinsic molecular determinants or modulators for epigenetic remodeling and reprogramming of somatic cell-derived genome in mammalian nuclear-transferred oocytes and resultant embryos.

    PubMed

    Samiec, M; Skrzyszowska, M

    2018-03-01

    The efficiency of somatic cell cloning in mammals remains disappointingly low. Incomplete and aberrant reprogramming of epigenetic memory of somatic cell nuclei in preimplantation nuclear- transferred (NT) embryos is one of the most important factors that limit the cloning effectiveness. The extent of epigenetic genome-wide alterations, involving histone or DNA methylation and histone deacetylation, that are mediated by histone-lysine methyltransferases (HMTs) or DNA methyltransferases (DNMTs) and histone deacetylases (HDACs) can be modulated/reversed via exogenous inhibitors of these enzymes throughout in vitro culture of nuclear donor cells, nuclear recipient oocytes and/or cloned embryos. The use of the artificial modifiers of epigenomically-conditioned gene expression leads to inhibition of both chromatin condensation and transcriptional silencing the genomic DNA of somatic cells that provide a source of nuclear donors for reconstruction of enucleated oocytes and generation of cloned embryos. The onset of chromatin decondensation and gene transcriptional activity is evoked both through specific/selective inactivating HMTs by BIX-01294 and through non-specific/non-selective blocking the activity of either DNMTs by 5-aza-2'-deoxycytidine, zebularine, S-adenosylhomocysteine or HDACs by trichostatin A, valproic acid, scriptaid, oxamflatin, sodium butyrate, m-carboxycinnamic acid bishydroxamide, panobinostat, abexinostat, quisinostat, dacinostat, belinostat and psammaplin A. Epigenomic modulation of nuclear donor cells, nuclear recipient cells and/or cloned embryos may facilitate and accelerate the reprogrammability for gene expression of donor cell nuclei that have been transplanted into a host ooplasm and subsequently underwent dedifferentiating and re-establishing the epigenetically dependent status of their transcriptional activity during pre- and postimplantation development of NT embryos. Nevertheless, a comprehensive additional work is necessary to determine whether failures in the early-stage reprogramming of somatic cell-inherited genome are magnified downstream in development of cloned conceptuses and neonates. Copyright© by the Polish Academy of Sciences.

  13. Small organelle, big responsibility: the role of centrosomes in development and disease.

    PubMed

    Chavali, Pavithra L; Pütz, Monika; Gergely, Fanni

    2014-09-05

    The centrosome, a key microtubule organizing centre, is composed of centrioles, embedded in a protein-rich matrix. Centrosomes control the internal spatial organization of somatic cells, and as such contribute to cell division, cell polarity and migration. Upon exiting the cell cycle, most cell types in the human body convert their centrioles into basal bodies, which drive the assembly of primary cilia, involved in sensing and signal transduction at the cell surface. Centrosomal genes are targeted by mutations in numerous human developmental disorders, ranging from diseases exclusively affecting brain development, through global growth failure syndromes to diverse pathologies associated with ciliary malfunction. Despite our much-improved understanding of centrosome function in cellular processes, we know remarkably little of its role in the organismal context, especially in mammals. In this review, we examine how centrosome dysfunction impacts on complex physiological processes and speculate on the challenges we face when applying knowledge generated from in vitro and in vivo model systems to human development. © 2014 The Author(s) Published by the Royal Society. All rights reserved.

  14. Genomic profiling of Sézary Syndrome identifies alterations of key T-cell signaling and differentiation genes

    PubMed Central

    Wang, Linghua; Ni, Xiao; Covington, Kyle R.; Yang, Betty Y.; Shiu, Jessica; Zhang, Xiang; Xi, Liu; Meng, Qingchang; Langridge, Timothy; Drummond, Jennifer; Donehower, Lawrence A.; Doddapaneni, Harshavardhan; Muzny, Donna M.; Gibbs, Richard A.; Wheeler, David A.; Duvic, Madeleine

    2016-01-01

    Sézary Syndrome is a rare leukemic form of cutaneous T-cell lymphoma defined as erythroderma, adenopathy, and circulating atypical T-lymphocytes. It is rarely curable with poor prognosis. Here we present a multi-platform genomic analysis of 37 Sézary Syndrome patients that implicates dysregulation of the cell cycle checkpoint and T-cell signaling. Frequent somatic alterations were identified in TP53, CARD11, CCR4, PLCG1, CDKN2A, ARID1A, RPS6KA1, and ZEB1. Activating CCR4 and CARD11 mutations were detected in nearly a third of patients. ZEB1, a transcription repressor essential for T-cell differentiation, was deleted in over half of patients. IL32 and IL2RG were over-expressed in nearly all cases. Analysis of T-cell receptor Vβ and Vα expression revealed ongoing rearrangement of the receptors after the expansion of a malignant clone in one third of subjects. Our results demonstrate profound disruption of key signaling pathways in Sézary Syndrome and suggest potential targets for novel therapies. PMID:26551670

  15. Flow cytometric and morphological analyses of Pinus pinaster somatic embryogenesis.

    PubMed

    Marum, Liliana; Loureiro, João; Rodriguez, Eleazar; Santos, Conceição; Oliveira, M Margarida; Miguel, Célia

    2009-09-25

    An approach combining morphological profiling and flow cytometric analysis was used to assess genetic stability during the several steps of somatic embryogenesis in Pinus pinaster. Embryogenic cell lines of P. pinaster were established from immature zygotic embryos excised from seeds obtained from open-pollinated trees. During the maturation stage, phenotype of somatic embryos was characterized as being either normal or abnormal. Based upon the prevalent morphological traits, different types of abnormal embryos underwent further classification and quantification. Nuclear DNA content of maritime pine using the zygotic embryos was estimated to be 57.04 pg/2C, using propidium iodide flow cytometry. According to the same methodology, no significant differences (P< or =0.01) in DNA ploidy were detected among the most frequently observed abnormal phenotypes, embryogenic cell lines, zygotic and normal somatic embryos, and somatic embryogenesis-derived plantlets. Although the differences in DNA ploidy level do not exclude the occurrence of a low level of aneuploidy, the results obtained point to the absence of major changes in ploidy level during the somatic embryogenesis process of this economically important species. Therefore, our primary goal of true-to-typeness was assured at this level.

  16. Somatic Host Cell Alterations in HPV Carcinogenesis

    PubMed Central

    Litwin, Tamara R.; Clarke, Megan A.; Dean, Michael; Wentzensen, Nicolas

    2017-01-01

    High-risk human papilloma virus (HPV) infections cause cancers in different organ sites, most commonly cervical and head and neck cancers. While carcinogenesis is initiated by two viral oncoproteins, E6 and E7, increasing evidence shows the importance of specific somatic events in host cells for malignant transformation. HPV-driven cancers share characteristic somatic changes, including apolipoprotein B mRNA editing catalytic polypeptide-like (APOBEC)-driven mutations and genomic instability leading to copy number variations and large chromosomal rearrangements. HPV-associated cancers have recurrent somatic mutations in phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit alpha (PIK3CA) and phosphatase and tensin homolog (PTEN), human leukocyte antigen A and B (HLA-A and HLA-B)-A/B, and the transforming growth factor beta (TGFβ) pathway, and rarely have mutations in the tumor protein p53 (TP53) and RB transcriptional corepressor 1 (RB1) tumor suppressor genes. There are some variations by tumor site, such as NOTCH1 mutations which are primarily found in head and neck cancers. Understanding the somatic events following HPV infection and persistence can aid the development of early detection biomarkers, particularly when mutations in precancers are characterized. Somatic mutations may also influence prognosis and treatment decisions. PMID:28771191

  17. Somatic Host Cell Alterations in HPV Carcinogenesis.

    PubMed

    Litwin, Tamara R; Clarke, Megan A; Dean, Michael; Wentzensen, Nicolas

    2017-08-03

    High-risk human papilloma virus (HPV) infections cause cancers in different organ sites, most commonly cervical and head and neck cancers. While carcinogenesis is initiated by two viral oncoproteins, E6 and E7, increasing evidence shows the importance of specific somatic events in host cells for malignant transformation. HPV-driven cancers share characteristic somatic changes, including apolipoprotein B mRNA editing catalytic polypeptide-like (APOBEC)-driven mutations and genomic instability leading to copy number variations and large chromosomal rearrangements. HPV-associated cancers have recurrent somatic mutations in phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit alpha ( PIK3CA ) and phosphatase and tensin homolog ( PTEN ), human leukocyte antigen A and B ( HLA-A and HLA-B ) -A/B , and the transforming growth factor beta (TGFβ) pathway, and rarely have mutations in the tumor protein p53 ( TP53 ) and RB transcriptional corepressor 1 ( RB1 ) tumor suppressor genes. There are some variations by tumor site, such as NOTCH1 mutations which are primarily found in head and neck cancers. Understanding the somatic events following HPV infection and persistence can aid the development of early detection biomarkers, particularly when mutations in precancers are characterized. Somatic mutations may also influence prognosis and treatment decisions.

  18. Milk somatic cells, factors influencing their release, future prospects, and practical utility in dairy animals: An overview

    PubMed Central

    Alhussien, Mohanned Naif; Dang, Ajay Kumar

    2018-01-01

    Milk somatic cells (SCs) are a mixture of milk-producing cells and immune cells. These cells are secreted in milk during the normal course of milking and are used as an index for estimating mammary health and milk quality of dairy animals worldwide. Milk SC is influenced by cow productivity, health, parity, lactation stage, and breed of an animal. Any change in environmental conditions, poor management practices, and also stressful conditions significantly increases the amount of SC coming in milk. Better hygiene and proper nutrition help in reducing milk SC. Milk with low SC means better milk products with a longer shelf life. The present review describes the role of SCs (both secretory and immune) in milk, their role in maintaining the integrity of the mammary gland, and factors affecting their release in milk. This information may help to reduce milk somatic cell counts (SCCs) and to establish differential SCC standards. PMID:29915493

  19. Somatic cell nuclear transfer in Oregon: expanding the pluripotent space and informing research ethics.

    PubMed

    Lomax, Geoffrey P; DeWitt, Natalie D

    2013-12-01

    In May, Oregon Health and Science University (OHSU) announced the successful derivation, by the Mitalipov laboratory, of embryonic stem cells by somatic cell nuclear transfer. This experiment was recognized as a "formidable technical feat" and potentially a key step toward developing cell-based therapies. The OHSU report is also an example of how a scientific breakthrough can inform research ethics. This article suggests ways that nuclear transfer embryonic stem cell lines may contribute to research ethics by adding rigor to studies addressing pressing research questions important to the development of cell-based therapies.

  20. Somatic cell reprogramming informed by the oocyte.

    PubMed

    Gonzalez-Munoz, Elena; Cibelli, Jose B

    2018-05-08

    The successful production of animals and embryonic stem cells (ESCs) using somatic cell nuclear transfer (SCNT) has demonstrated the unmatched nuclear reprogramming capacity of the oocyte and helped prove the degree of plasticity of differentiated cells. The introduction of transcription factors to generate induced pluripotent stem cells (iPSCs) displaced SCNT and, due to its ease of implementation, became the method of choice for cell reprogramming. Nonetheless, iPSC derivation remains inefficient and stochastic. This review article focuses on using the oocyte as a source of reprogramming factors, comparing the SCNT and iPSC mechanisms for remodeling chromatin and acquiring pluripotency.

  1. Stem Cells in Mammalian Gonads.

    PubMed

    Wu, Ji; Ding, Xinbao; Wang, Jian

    Stem cells have great value in clinical application because of their ability to self-renew and their potential to differentiate into many different cell types. Mammalian gonads, including testes for males and ovaries for females, are composed of germline and somatic cells. In male mammals, spermatogonial stem cells maintain spermatogenesis which occurs continuously in adult testis. Likewise, a growing body of evidence demonstrated that female germline stem cells could be found in mammalian ovaries. Meanwhile, prior studies have shown that somatic stem cells exist in both testes and ovaries. In this chapter, we focus on mammalian gonad stem cells and discuss their characteristics as well as differentiation potentials.

  2. CENH3-GFP: a visual marker for gametophytic and somatic ploidy determination in Arabidopsis thaliana.

    PubMed

    De Storme, Nico; Keçeli, Burcu Nur; Zamariola, Linda; Angenon, Geert; Geelen, Danny

    2016-01-05

    The in vivo determination of the cell-specific chromosome number provides a valuable tool in several aspects of plant research. However, current techniques to determine the endosystemic ploidy level do not allow non-destructive, cell-specific chromosome quantification. Particularly in the gametophytic cell lineages, which are physically encapsulated in the reproductive organ structures, direct in vivo ploidy determination has been proven very challenging. Using Arabidopsis thaliana as a model, we here assess the applicability of recombinant CENH3-GFP reporters for the labeling of the cell's chromocenters and for the monitoring of the gametophytic and somatic chromosome number in vivo. By modulating expression of a CENH3-GFP reporter cassette using different promoters, we isolated two reporter lines that allow for a clear and highly specific labeling of centromeric chromosome regions in somatic and gametophytic cells respectively. Using polyploid plant series and reproductive mutants, we demonstrate that the pWOX2-CENH3-GFP recombinant fusion protein allows for the determination of the gametophytic chromosome number in both male and female gametophytic cells, and additionally labels centromeric regions in early embryo development. Somatic centromere labeling through p35S-CENH3-GFP shows a maximum of ten centromeric dots in young dividing tissues, reflecting the diploid chromosome number (2x = 10), and reveals a progressive decrease in GFP foci frequency throughout plant development. Moreover, using chemical and genetic induction of endomitosis, we demonstrate that CENH3-mediated chromosome labeling provides an easy and valuable tool for the detection and characterization of endomitotic polyploidization events. This study demonstrates that the introgression of the pWOX2-CENH3-GFP reporter construct in Arabidopsis thaliana provides an easy and reliable methodology for determining the chromosome number in developing male and female gametes, and during early embryo development. Somatically expressed CENH3-GFP reporters, on the other hand, constitute a valuable tool to quickly determine the basic somatic ploidy level in young seedlings at the individual cell level and to detect and to quantify endomitotic polyploidization events in a non-destructive, microscopy-based manner.

  3. Chinmo prevents transformer alternative splicing to maintain male sex identity.

    PubMed

    Grmai, Lydia; Hudry, Bruno; Miguel-Aliaga, Irene; Bach, Erika A

    2018-02-01

    Reproduction in sexually dimorphic animals relies on successful gamete production, executed by the germline and aided by somatic support cells. Somatic sex identity in Drosophila is instructed by sex-specific isoforms of the DMRT1 ortholog Doublesex (Dsx). Female-specific expression of Sex-lethal (Sxl) causes alternative splicing of transformer (tra) to the female isoform traF. In turn, TraF alternatively splices dsx to the female isoform dsxF. Loss of the transcriptional repressor Chinmo in male somatic stem cells (CySCs) of the testis causes them to "feminize", resembling female somatic stem cells in the ovary. This somatic sex transformation causes a collapse of germline differentiation and male infertility. We demonstrate this feminization occurs by transcriptional and post-transcriptional regulation of traF. We find that chinmo-deficient CySCs upregulate tra mRNA as well as transcripts encoding tra-splice factors Virilizer (Vir) and Female lethal (2)d (Fl(2)d). traF splicing in chinmo-deficient CySCs leads to the production of DsxF at the expense of the male isoform DsxM, and both TraF and DsxF are required for CySC sex transformation. Surprisingly, CySC feminization upon loss of chinmo does not require Sxl but does require Vir and Fl(2)d. Consistent with this, we show that both Vir and Fl(2)d are required for tra alternative splicing in the female somatic gonad. Our work reveals the need for transcriptional regulation of tra in adult male stem cells and highlights a previously unobserved Sxl-independent mechanism of traF production in vivo. In sum, transcriptional control of the sex determination hierarchy by Chinmo is critical for sex maintenance in sexually dimorphic tissues and is vital in the preservation of fertility.

  4. Chinmo prevents transformer alternative splicing to maintain male sex identity

    PubMed Central

    Hudry, Bruno; Miguel-Aliaga, Irene

    2018-01-01

    Reproduction in sexually dimorphic animals relies on successful gamete production, executed by the germline and aided by somatic support cells. Somatic sex identity in Drosophila is instructed by sex-specific isoforms of the DMRT1 ortholog Doublesex (Dsx). Female-specific expression of Sex-lethal (Sxl) causes alternative splicing of transformer (tra) to the female isoform traF. In turn, TraF alternatively splices dsx to the female isoform dsxF. Loss of the transcriptional repressor Chinmo in male somatic stem cells (CySCs) of the testis causes them to “feminize”, resembling female somatic stem cells in the ovary. This somatic sex transformation causes a collapse of germline differentiation and male infertility. We demonstrate this feminization occurs by transcriptional and post-transcriptional regulation of traF. We find that chinmo-deficient CySCs upregulate tra mRNA as well as transcripts encoding tra-splice factors Virilizer (Vir) and Female lethal (2)d (Fl(2)d). traF splicing in chinmo-deficient CySCs leads to the production of DsxF at the expense of the male isoform DsxM, and both TraF and DsxF are required for CySC sex transformation. Surprisingly, CySC feminization upon loss of chinmo does not require Sxl but does require Vir and Fl(2)d. Consistent with this, we show that both Vir and Fl(2)d are required for tra alternative splicing in the female somatic gonad. Our work reveals the need for transcriptional regulation of tra in adult male stem cells and highlights a previously unobserved Sxl-independent mechanism of traF production in vivo. In sum, transcriptional control of the sex determination hierarchy by Chinmo is critical for sex maintenance in sexually dimorphic tissues and is vital in the preservation of fertility. PMID:29389999

  5. A Novel Class of Somatic Small RNAs Similar to Germ Cell Pachytene PIWI-interacting Small RNAs*

    PubMed Central

    Ortogero, Nicole; Schuster, Andrew S.; Oliver, Daniel K.; Riordan, Connor R.; Hong, Annie S.; Hennig, Grant W.; Luong, Dickson; Bao, Jianqiang; Bhetwal, Bhupal P.; Ro, Seungil; McCarrey, John R.; Yan, Wei

    2014-01-01

    PIWI-interacting RNAs (piRNAs) are small noncoding RNAs that bind PIWI family proteins exclusively expressed in the germ cells of mammalian gonads. MIWI2-associated piRNAs are essential for silencing transposons during primordial germ cell development, and MIWI-bound piRNAs are required for normal spermatogenesis during adulthood in mice. Although piRNAs have long been regarded as germ cell-specific, increasing lines of evidence suggest that somatic cells also express piRNA-like RNAs (pilRNAs). Here, we report the detection of abundant pilRNAs in somatic cells, which are similar to MIWI-associated piRNAs mainly expressed in pachytene spermatocytes and round spermatids in the testis. Based on small RNA deep sequencing and quantitative PCR analyses, pilRNA expression is dynamic and displays tissue specificity. Although pilRNAs are similar to pachytene piRNAs in both size and genomic origins, they have a distinct ping-pong signature. Furthermore, pilRNA biogenesis appears to utilize a yet to be identified pathway, which is different from all currently known small RNA biogenetic pathways. In addition, pilRNAs appear to preferentially target the 3′-UTRs of mRNAs in a partially complementary manner. Our data suggest that pilRNAs, as an integral component of the small RNA transcriptome in somatic cell lineages, represent a distinct population of small RNAs that may have functions similar to germ cell piRNAs. PMID:25320077

  6. Potential role of centrioles in determining the morphogenetic status of animal somatic cells.

    PubMed

    Tkemaladze, J; Chichinadze, K

    2005-05-01

    Irreversible differentiation (change of morphogenetic status) and programmed death (apoptosis) are observed only in somatic cells. Cell division is the only way by which the morphogenetic status of the offspring cells may be modified. It is known that there is a fixed limit to the number of possible cell divisions, the so-called 'Hayflick limit'. Existing links between cell division, differentiation and apoptosis make it possible to conclude that all these processes could be controlled by a single self-reproducing structure. Potential candidates for this replicable structure in a somatic cell are chromosomes, mitochondria (both contain DNA), and centrioles. Centrioles (diplosome) are the most likely unit that can fully regulate the processes of irreversible differentiation, determination and modification of the morphogenetic status. It may contain differently encoded RNA molecules stacked in a definite order. During mitosis, these RNA molecules are released one by one into the cytoplasm. In the presence of reverse transcriptase and endonuclease, RNA can be embedded in nuclear DNA. This process presumably changes the status of repressed and potentially active genes and, subsequently, the morphogenetic status of a cell.

  7. The VIP/VPACR system in the reproductive cycle of male lizard Podarcis sicula.

    PubMed

    Agnese, Marisa; Rosati, Luigi; Prisco, Marina; Coraggio, Francesca; Valiante, Salvatore; Scudiero, Rosaria; Laforgia, Vincenza; Andreuccetti, Piero

    2014-09-01

    Starting from the knowledge that in the reproductive period the Vasoactive Intestinal Peptide (VIP) is widely distributed in Podarcis sicula testis, we studied VIP expression and the localization of the neuropeptide and its receptors in the testis of the Italian wall lizard P. sicula in the other phases of its reproductive cycle (summer stasis, autumnal resumption, winter stasis, spring resumption). By Real Time-PCR, we demonstrated that testicular VIP mRNA levels change during the reproductive cycle, showing a cyclic trend with two peaks, one in the mid-autumnal resumption and the other in the reproductive period. By in situ hybridization and immunohistochemistry, we demonstrated that both VIP mRNA and protein were widely distributed in the testis in almost all the phases of the cycle, except in the early autumnal resumption. As regards the receptors, the VPAC1R was localized mainly in Leydig cells, while the VPAC2R showed the same distribution of VIP. Our results demonstrate that, differently from mammals, where VIP is present only in nerve fibres innerving the testis, an endotesticular synthesis takes place in the lizard and the VIP synthesis changes throughout the reproductive cycle. Moreover, the VIP/VPAC receptor system distribution observed in germ and somatic cells in various phases of the cycle, and particularly in the autumnal resumption and the reproductive period, strongly suggests its involvement in both spermatogenesis and steroidogenesis. Finally, the wider distribution of VIP in lizards with respect to mammals leads us to hypothesize that during the evolution the synthesis sites have been transferred from the testis to other districts, such as the brain. Copyright © 2014 Elsevier Inc. All rights reserved.

  8. Two Classes of Gap Junction Channels Mediate Soma-Germline Interactions Essential for Germline Proliferation and Gametogenesis in Caenorhabditis elegans

    PubMed Central

    Starich, Todd A.; Hall, David H.; Greenstein, David

    2014-01-01

    In all animals examined, somatic cells of the gonad control multiple biological processes essential for germline development. Gap junction channels, composed of connexins in vertebrates and innexins in invertebrates, permit direct intercellular communication between cells and frequently form between somatic gonadal cells and germ cells. Gap junctions comprise hexameric hemichannels in apposing cells that dock to form channels for the exchange of small molecules. Here we report essential roles for two classes of gap junction channels, composed of five innexin proteins, in supporting the proliferation of germline stem cells and gametogenesis in the nematode Caenorhabditis elegans. Transmission electron microscopy of freeze-fracture replicas and fluorescence microscopy show that gap junctions between somatic cells and germ cells are more extensive than previously appreciated and are found throughout the gonad. One class of gap junctions, composed of INX-8 and INX-9 in the soma and INX-14 and INX-21 in the germ line, is required for the proliferation and differentiation of germline stem cells. Genetic epistasis experiments establish a role for these gap junction channels in germline proliferation independent of the glp-1/Notch pathway. A second class of gap junctions, composed of somatic INX-8 and INX-9 and germline INX-14 and INX-22, is required for the negative regulation of oocyte meiotic maturation. Rescue of gap junction channel formation in the stem cell niche rescues germline proliferation and uncovers a later channel requirement for embryonic viability. This analysis reveals gap junctions as a central organizing feature of many soma–germline interactions in C. elegans. PMID:25195067

  9. Transcript levels of several epigenome regulatory genes in bovine somatic donor cells are not correlated with their cloning efficiency.

    PubMed

    Zhou, Wenli; Sadeghieh, Sanaz; Abruzzese, Ronald; Uppada, Subhadra; Meredith, Justin; Ohlrichs, Charletta; Broek, Diane; Polejaeva, Irina

    2009-09-01

    Among many factors that potentially affect somatic cell nuclear transfer (SCNT) embryo development is the donor cell itself. Cloning potentials of somatic donor cells vary greatly, possibly because the cells have different capacities to be reprogrammed by ooplasma. It is therefore intriguing to identify factors that regulate the reprogrammability of somatic donor cells. Gene expression analysis is a widely used tool to investigate underlying mechanisms of various phenotypes. In this study, we conducted a retrospective analysis investigating whether donor cell lines with distinct cloning efficiencies express different levels of genes involved in epigenetic reprogramming including histone deacetylase-1 (HDAC1), -2 (HDAC2); DNA methyltransferase-1 (DNMT1), -3a (DNMT3a),-3b (DNMT3b), and the bovine homolog of yeast sucrose nonfermenting-2 (SNF2L), a SWI/SNF family of ATPases. Cell samples from 12 bovine donor cell lines were collected at the time of nuclear transfer experiments and expression levels of the genes were measured using quantitative polymerase chain reaction (PCR). Our results show that there are no significant differences in expression levels of these genes between donor cell lines of high and low cloning efficiency defined as live calving rates, although inverse correlations are observed between in vitro embryo developmental rates and expression levels of HDAC2 and SNF2L. We also show that selection of stable reference genes is important for relative quantification, and different batches of cells can have different gene expression patterns. In summary, we demonstrate that expression levels of these epigenome regulatory genes in bovine donor cells are not correlated with cloning potential. The experimental design and data analysis method reported here can be applied to study any genes expressed in donor cells.

  10. Measurement of telomerase activity in dog tumors.

    PubMed

    Yazawa, M; Okuda, M; Setoguchi, A; Nishimura, R; Sasaki, N; Hasegawa, A; Watari, T; Tsujimoto, H

    1999-10-01

    Telomeres are specific structures present at the end of liner chromosomes. DNA polymerase can not synthesize the end of liner DNA and, as a result, the telomeres become progressively shortened by successive cell divisions. To overcome the end replication problem, telomerase adds new telomeric sequences to the end of chromosomal DNA. The enzyme activity is undetectable in most normal human adult somatic cells, in which shortening of the telomere is thought to limit the somatic-cell life span. In contrast to normal somatic cells, many human tumors possess telomerase activity. The present study looked at whether telomerase activity might serve as a marker for canine tumors. Telomerase activity was measured using the telomeric repeat amplification protocol assay. Normal dog somatic tissues showed little or no telomerase activity, while normal testis exhibited a high level of telomerase activity. We measured telomerase activity in tumor samples from 45 dogs; 21 mammary gland tumors, 16 tumors developed in the skin and oral cavity, 7 vascular tumors and 1 Sertoli cell tumor. Greater than 95% of the tumor samples contained telomerase activity (3-924 U/2 micrograms protein). The results obtained in this study indicated that telomerase should be a useful diagnostic marker for a variety of dog tumors, and it may serve as a target for antitumor chemotherapy.

  11. [PIWI protein as a nucleolus visitor in Drosophila melanogaster].

    PubMed

    Mikhaleva, E A; Iakushev, E Iu; Stoliarenko, A D; Klenov, M S; Pozovskiĭ, Ia M; Gvozdev, V A

    2015-01-01

    The evolutionarily conserved nuclear Piwi protein of Drosophila melanogaster is a representative of the Argonaute small RNA binding protein family. Guided by small piRNAs, Piwi functions in transposon silencing in somatic and germ cells of the gonad. We found that in ovarian somatic and germ cells, as well as in the established ovarian somatic cell line, Piwi is concentrated predominantly in the nucleolus--the main nuclear compartment, participating not only in rRNA synthesis, but also in various cell stress responses. We demonstrated the colocalization of Piwi with nucleolar marker proteins--fibrillarin and Nopp140. A mutation preventing Piwi transport to the nucleus and disturbing transposon silencing (piwi(Nt)) leads to 6-8-fold upregulation of rRNA genes expression, as evaluated by the level of transcripts of transposon insertions in 28S rRNA genes. RNase treatment of live cultured ovarian somatic cells depletes Piwi from the nucleolus. The same effect is observed upon inhibiting RNA polymerase I which transcribes rRNA, but not RNA polymerase II. In contrast, upon heat shock Piwi is concentrated in the nucleolus and is depleted from the nucleoplasm. These results implicate Piwi in RNA polymerase activity modulation and stress response in the nucleolus. We discuss possible noncanonical Piwi functions along with its canonical role in transposon silencing by piRNAs.

  12. Somatic cell nuclear transfer cloning: practical applications and current legislation.

    PubMed

    Niemann, H; Lucas-Hahn, A

    2012-08-01

    Somatic cloning is emerging as a new biotechnology by which the opportunities arising from the advances in molecular genetics and genome analysis can be implemented in animal breeding. Significant improvements have been made in SCNT protocols in the past years which now allow to embarking on practical applications. The main areas of application of SCNT are: Reproductive cloning, therapeutic cloning and basic research. A great application potential of SCNT based cloning is the production of genetically modified (transgenic) animals. Somatic cell nuclear transfer based transgenic animal production has significant advances over the previously employed microinjection of foreign DNA into pronuclei of zygotes. This cell based transgenesis is compatible with gene targeting and allows both, the addition of a specific gene and the deletion of an endogenous gene. Efficient transgenic animal production provides numerous opportunities for agriculture and biomedicine. Regulatory agencies around the world have agreed that food derived from cloned animals and their offspring is safe and there is no scientific basis for questioning this. Commercial application of somatic cloning within the EU is via the Novel Food regulation EC No. 258/97. Somatic cloning raises novel questions regarding the ethical and moral status of animals and their welfare which has prompted a controversial discussion in Europe which has not yet been resolved. © 2012 Blackwell Verlag GmbH.

  13. Polyamine and ethylene biosynthesis in relation to somatic embryogenesis in carrot (Daucus carota L.) cell cultures

    Treesearch

    Subhash C. Minocha; Cheryl A. Robie; Akhtar J. Khan; Nancy S. Papa; Andrew I. Samuelsen; Rakesh Minocha

    1990-01-01

    Carrot cell cultures provide a model experimental system for the analysis of biochemical and molecular events associated with morphogenesis in plants (3, 4, 5, 14). Among the biochemical changes accompanying somatic embryogenesis in this tissue is an increased biosynthesis ofpolyamines (1, 2, 7, 10, 11, 13). A variety of inhibitors of polyamine biosynthetic enzymes...

  14. The BABY BOOM Transcription Factor Activates the LEC1-ABI3-FUS3-LEC2 Network to Induce Somatic Embryogenesis1[OPEN

    PubMed Central

    Weemen, Mieke

    2017-01-01

    Somatic embryogenesis is an example of induced cellular totipotency, where embryos develop from vegetative cells rather than from gamete fusion. Somatic embryogenesis can be induced in vitro by exposing explants to growth regulators and/or stress treatments. The BABY BOOM (BBM) and LEAFY COTYLEDON1 (LEC1) and LEC2 transcription factors are key regulators of plant cell totipotency, as ectopic overexpression of either transcription factor induces somatic embryo formation from Arabidopsis (Arabidopsis thaliana) seedlings without exogenous growth regulators or stress treatments. Although LEC and BBM proteins regulate the same developmental process, it is not known whether they function in the same molecular pathway. We show that BBM transcriptionally regulates LEC1 and LEC2, as well as the two other LAFL genes, FUSCA3 (FUS3) and ABSCISIC ACID INSENSITIVE3 (ABI3). LEC2 and ABI3 quantitatively regulate BBM-mediated somatic embryogenesis, while FUS3 and LEC1 are essential for this process. BBM-mediated somatic embryogenesis is dose and context dependent, and the context-dependent phenotypes are associated with differential LAFL expression. We also uncover functional redundancy for somatic embryogenesis among other Arabidopsis BBM-like proteins and show that one of these proteins, PLETHORA2, also regulates LAFL gene expression. Our data place BBM upstream of other major regulators of plant embryo identity and totipotency. PMID:28830937

  15. Uncoupling the Trade-Off between Somatic Proteostasis and Reproduction in Caenorhabditis elegans Models of Polyglutamine Diseases

    PubMed Central

    Shemesh, Netta; Shai, Nadav; Meshnik, Lana; Katalan, Rotem; Ben-Zvi, Anat

    2017-01-01

    Caenorhabditis elegans somatic protein homeostasis (proteostasis) is actively remodeled at the onset of reproduction. This proteostatic collapse is regulated cell-nonautonomously by signals from the reproductive system that transmit the commitment to reproduction to somatic cells. Here, we asked whether the link between the reproductive system and somatic proteostasis could be uncoupled by activating downstream effectors in the gonadal longevity cascade. Specifically, we examined whether over-expression of lipl-4 (lipl-4(oe)), a target gene of the gonadal longevity pathway, or increase in arachidonic acid (AA) levels, associated with lipl-4(oe), modulated proteostasis and reproduction. We found that lipl-4(oe) rescued somatic proteostasis and postponed the onset of aggregation and toxicity in C. elegans models of polyglutamine (polyQ) diseases. However, lipl-4(oe) also disrupted fatty acid transport into developing oocytes and reduced reproductive success. In contrast, diet supplementation of AA recapitulated lipl-4(oe)-mediated proteostasis enhancement in wild type animals but did not affect the reproductive system. Thus, the gonadal longevity pathway mediates a trade-off between somatic maintenance and reproduction, in part by regulating the expression of genes, such as lipl-4, with inverse effects on somatic maintenance and reproduction. We propose that AA could uncouple such germline to soma crosstalk, with beneficial implications protein misfolding diseases. PMID:28503130

  16. Effects of Histone Deacetylase Inhibitor Oxamflatin on In Vitro Porcine Somatic Cell Nuclear Transfer Embryos

    PubMed Central

    Hou, Liming; Ma, Fanhua; Yang, Jinzeng; Riaz, Hasan; Wang, Yongliang; Wu, Wangjun; Xia, Xiaoliang; Ma, Zhiyuan; Zhou, Ying; Zhang, Lin; Ying, Wenqin; Xu, Dequan; Zuo, Bo; Ren, Zhuqing

    2014-01-01

    Abstract Low cloning efficiency is considered to be caused by the incomplete or aberrant epigenetic reprogramming of differentiated donor cells in somatic cell nuclear transfer (SCNT) embryos. Oxamflatin, a novel class of histone deacetylase inhibitor (HDACi), has been found to improve the in vitro and full-term developmental potential of SCNT embryos. In the present study, we studied the effects of oxamflatin treatment on in vitro porcine SCNT embryos. Our results indicated that the rate of in vitro blastocyst formation of SCNT embryos treated with 1 μM oxamflatin for 15 h postactivation was significantly higher than all other treatments. Treatment of oxamflatin decreased the relative histone deacetylase (HDAC) activity in cloned embryos and resulted in hyperacetylation levels of histone H3 at lysine 9 (AcH3K9) and histone H4 at lysine 5 (AcH4K5) at pronuclear, two-cell, and four-cell stages partly through downregulating HDAC1. The suppression of HDAC6 through oxamflatin increased the nonhistone acetylation level of α-tubulin during the mitotic cell cycle of early SCNT embryos. In addition, we demonstrated that oxamflatin downregulated DNA methyltransferase 1 (DNMT1) expression and global DNA methylation level (5-methylcytosine) in two-cell-stage porcine SCNT embryos. The pluripotency-related gene POU5F1 was found to be upregulated in the oxamflatin-treated group with a decreased DNA methylation tendency in its promoter regions. Treatment of oxamflatin did not change the locus-specific DNA methylation levels of Sus scrofa heterochromatic satellite DNA sequences at the blastocyst stage. Meanwhile, our findings suggest that treatment with HDACi may contribute to maintaining the stable status of cytoskeleton-associated elements, such as acetylated α-tubulin, which may be the crucial determinants of donor nuclear reprogramming in early SCNT embryos. In summary, oxamflatin treatment improves the developmental potential of porcine SCNT embryos in vitro. PMID:24960409

  17. Epigenetic rejuvenation.

    PubMed

    Manukyan, Maria; Singh, Prim B

    2012-05-01

    Induced pluripotent stem (iPS) cells have provided a rational means of obtaining histo-compatible tissues for 'patient-specific' regenerative therapies (Hanna et al. 2010; Yamanaka & Blau 2010). Despite the obvious potential of iPS cell-based therapies, there are certain problems that must be overcome before these therapies can become safe and routine (Ohi et al. 2011; Pera 2011). As an alternative, we have recently explored the possibility of using 'epigenetic rejuvenation', where the specialized functions of an old cell are rejuvenated in the absence of any change in its differentiated state (Singh & Zacouto 2010). The mechanism(s) that underpin 'epigenetic rejuvenation' are unknown and here we discuss model systems, using key epigenetic modifiers, which might shed light on the processes involved. Epigenetic rejuvenation has advantages over iPS cell techniques that are currently being pursued. First, the genetic and epigenetic abnormalities that arise through the cycle of dedifferentiation of somatic cells to iPS cells followed by redifferentiation of iPS cells into the desired cell type are avoided (Gore et al. 2011; Hussein et al. 2011; Pera 2011): epigenetic rejuvenation does not require passage through the de-/redifferentiation cycle. Second, because the aim of epigenetic rejuvenation is to ensure that the differentiated cell type retains its specialized function it makes redundant the question of transcriptional memory that is inimical to iPS cell-based therapies (Ohi et al. 2011). Third, to produce unrelated cell types using the iPS technology takes a long time, around three weeks, whereas epigenetic rejuvenation of old cells will take only a matter of days. Epigenetic rejuvenation provides the most safe, rapid and cheap route to successful regenerative medicine. © 2012 The Authors. Journal compilation © 2012 by the Molecular Biology Society of Japan/Blackwell Publishing Ltd.

  18. Induced adult stem (iAS) cells and induced transit amplifying progenitor (iTAP) cells-a possible alternative to induced pluripotent stem (iPS) cells?

    PubMed

    Heng, Boon Chin; Richards, Mark; Ge, Zigang; Shu, Yimin

    2010-02-01

    The successful derivation of iPSC lines effectively demonstrates that it is possible to reset the 'developmental clock' of somatic cells all the way back to the initial embryonic state. Hence, it is plausible that this clock may instead be turned back half-way to a less immature developmental stage that is more directly applicable to clinical therapeutic applications or for in vitro pharmacology/toxicology screening assays. Such a suitable developmental state is postulated to be either the putative transit amplifying progenitor stage or adult stem cell stage. It is hypothetically possible to reprogram mature and terminally differentiated somatic cells back to the adult stem cell or transit amplifying progenitor stage, in a manner similar to the derivation of iPSC. It is proposed that the terminology 'Induced Adult Stem Cells' (iASC) or 'Induced Transit Amplifying Progenitor Cells' (iTAPC) be used to described such reprogrammed somatic cells. Of particular interest, is the possibility of resetting the developmental clock of mature differentiated somatic cells of the mesenchymal lineage, explanted from adipose tissue, bone marrow and cartilage. The putative adult stem cell sub-population from which these cells are derived, commonly referred to as 'mesenchymal stem cells', are highly versatile and hold much therapeutic promise in regenerative medicine, as attested to by numerous human clinical trials and animal studies. Perhaps it may be appropriate to term such reprogrammed cells as 'Induced Mesenchymal Stem Cells' (iMSC) or as 'Induced Mesenchumal Progenitor Cells' (iMPC). Given that cells from the same organ/tissue will share some commonalities in gene expression, we hypothesize that the generation of iASC or iTAPC would be more efficient as compared to iPSC generation, since a common epigenetic program must exist between the reprogrammed cells, adult stem cell or progenitor cell types and terminally differentiated cell types from the same organ/tissue.

  19. Clinical study report on milk production in the offspring of a somatic cell cloned Holstein cow.

    PubMed

    Takahashi, Masahiro; Tsuchiya, Hideki; Hamano, Seizo; Inaba, Toshio; Kawate, Noritoshi; Tamada, Hiromichi

    2013-12-17

    This study examined two female offspring of a somatic cell cloned Holstein cow that had reproduction problems and milk production performance issues. The two offspring heifers, which showed healthy appearances and normal reproductive characteristics, calved on two separate occasions. The mean milk yields of the heifers in the first lactation period were 9,037 kg and 7,228 kg. The relative mean milk yields of these cows were 111.2% and 88.9%, respectively, when compared with that of the control group. No particular clinical abnormalities were revealed in milk yields and milk composition rate [e.g., fat, protein and solids-not-fat (SNF)], and reproductive characteristics of the offspring of the somatic cell cloned Holstein cow suggested that the cloned offspring had normal milk production.

  20. Cell-free extract from porcine induced pluripotent stem cells can affect porcine somatic cell nuclear reprogramming.

    PubMed

    No, Jin-Gu; Choi, Mi-Kyung; Kwon, Dae-Jin; Yoo, Jae Gyu; Yang, Byoung-Chul; Park, Jin-Ki; Kim, Dong-Hoon

    2015-01-01

    Pretreatment of somatic cells with undifferentiated cell extracts, such as embryonic stem cells and mammalian oocytes, is an attractive alternative method for reprogramming control. The properties of induced pluripotent stem cells (iPSCs) are similar to those of embryonic stem cells; however, no studies have reported somatic cell nuclear reprogramming using iPSC extracts. Therefore, this study aimed to evaluate the effects of porcine iPSC extracts treatment on porcine ear fibroblasts and early development of porcine cloned embryos produced from porcine ear skin fibroblasts pretreated with the porcine iPSC extracts. The Chariot(TM) reagent system was used to deliver the iPSC extracts into cultured porcine ear skin fibroblasts. The iPSC extracts-treated cells (iPSC-treated cells) were cultured for 3 days and used for analyzing histone modification and somatic cell nuclear transfer. Compared to the results for nontreated cells, the trimethylation status of histone H3 lysine residue 9 (H3K9) in the iPSC-treated cells significantly decreased. The expression of Jmjd2b, the H3K9 trimethylation-specific demethylase gene, significantly increased in the iPSC-treated cells; conversely, the expression of the proapoptotic genes, Bax and p53, significantly decreased. When the iPSC-treated cells were transferred into enucleated porcine oocytes, no differences were observed in blastocyst development and total cell number in blastocysts compared with the results for control cells. However, H3K9 trimethylation of pronuclear-stage-cloned embryos significantly decreased in the iPSC-treated cells. Additionally, Bax and p53 gene expression in the blastocysts was significantly lower in iPSC-treated cells than in control cells. To our knowledge, this study is the first to show that an extracts of porcine iPSCs can affect histone modification and gene expression in porcine ear skin fibroblasts and cloned embryos.

  1. Germline Proliferation Is Regulated by Somatic Endocytic Genes via JNK and BMP Signaling in Drosophila.

    PubMed

    Tang, Yaning; Geng, Qing; Chen, Di; Zhao, Shaowei; Liu, Xian; Wang, Zhaohui

    2017-05-01

    Signals derived from the microenvironment contribute greatly to tumorigenesis . The underlying mechanism requires thorough investigation. Here, we use Drosophila testis as a model system to address this question, taking the advantage of the ease to distinguish germline and somatic cells and to track the cell numbers. In an EMS mutagenesis screen, we identified Rab5 , a key factor in endocytosis, for its nonautonomous role in germline proliferation. The disruption of Rab5 in somatic cyst cells, which escort the development of germline lineage, induced the overproliferation of underdifferentiated but genetically wild-type germ cells. We demonstrated that this nonautonomous effect was mediated by the transcriptional activation of Dpp [the fly homolog of bone morphogenetic protein (BMP)] by examining the Dpp-reporter expression and knocking down Dpp to block germline overgrowth. Consistently, the protein levels of Bam, the germline prodifferentiation factor normally accumulated in the absence of BMP/Dpp signaling, decreased in the overproliferating germ cells. Further, we discovered that the JNK signaling pathway operated between Rab5 and Dpp, because simultaneously inhibiting the JNK pathway and Rab5 in cyst cells prevented both dpp transcription and germline tumor growth. Additionally, we found that multiple endocytic genes, such as avl , TSG101 , Vps25 , or Cdc42 , were required in the somatic cyst cells to restrict germline amplification. These findings indicate that when the endocytic state of the surrounding cells is impaired, genetically wild-type germ cells overgrow. This nonautonomous model of tumorigenesis provides a simple system to dissect the relation between tumor and its niche. Copyright © 2017 by the Genetics Society of America.

  2. Production of cloned mice by somatic cell nuclear transfer.

    PubMed

    Kishigami, Satoshi; Wakayama, Sayaka; Thuan, Nguyen Van; Ohta, Hiroshi; Mizutani, Eiji; Hikichi, Takafusa; Bui, Hong-Thuy; Balbach, Sebastian; Ogura, Atsuo; Boiani, Michele; Wakayama, Teruhiko

    2006-01-01

    Although it has now been 10 years since the first cloned mammals were generated from somatic cells using nuclear transfer (NT), the success rate for producing live offspring by cloning remains < 5%. Nevertheless, the techniques have potential as important tools for future research in basic biology. We have been able to develop a stable NT method in the mouse, in which donor nuclei are directly injected into the oocyte using a piezo-actuated micromanipulator. Although manipulation of the piezo unit is complex, once mastered it is of great help not only in NT experiments but also in almost all other forms of micromanipulation. In addition to this technique, embryonic stem (ES) cell lines established from somatic cell nuclei by NT can be generated relatively easily from a variety of mouse genotypes and cell types. Such NT-ES cells can be used not only for experimental models of human therapeutic cloning but also as a backup of the donor cell's genome. Our most recent protocols for mouse cloning, as described here, will allow the production of cloned mice in > or = 3 months.

  3. Amplitude Normalization of Dendritic EPSPs at the Soma of Binaural Coincidence Detector Neurons of the Medial Superior Olive.

    PubMed

    Winters, Bradley D; Jin, Shan-Xue; Ledford, Kenneth R; Golding, Nace L

    2017-03-22

    The principal neurons of the medial superior olive (MSO) encode cues for horizontal sound localization through comparisons of the relative timing of EPSPs. To understand how the timing and amplitude of EPSPs are maintained during propagation in the dendrites, we made dendritic and somatic whole-cell recordings from MSO principal neurons in brain slices from Mongolian gerbils. In somatic recordings, EPSP amplitudes were largely uniform following minimal stimulation of excitatory synapses at visualized locations along the dendrites. Similar results were obtained when excitatory synaptic transmission was eliminated in a low calcium solution and then restored at specific dendritic sites by pairing input stimulation and focal application of a higher calcium solution. We performed dual dendritic and somatic whole-cell recordings to measure spontaneous EPSPs using a dual-channel template-matching algorithm to separate out those events initiated at or distal to the dendritic recording location. Local dendritic spontaneous EPSP amplitudes increased sharply in the dendrite with distance from the soma (length constant, 53.6 μm), but their attenuation during propagation resulted in a uniform amplitude of ∼0.2 mV at the soma. The amplitude gradient of dendritic EPSPs was also apparent in responses to injections of identical simulated excitatory synaptic currents in the dendrites. Compartmental models support the view that these results extensively reflect the influence of dendritic cable properties. With relatively few excitatory axons innervating MSO neurons, the normalization of dendritic EPSPs at the soma would increase the importance of input timing versus location during the processing of interaural time difference cues in vivo SIGNIFICANCE STATEMENT The neurons of the medial superior olive analyze cues for sound localization by detecting the coincidence of binaural excitatory synaptic inputs distributed along the dendrites. Previous studies have shown that dendritic voltages undergo severe attenuation as they propagate to the soma, potentially reducing the influence of distal inputs. However, using dendritic and somatic patch recordings, we found that dendritic EPSP amplitude increased with distance from the soma, compensating for dendritic attenuation and normalizing EPSP amplitude at the soma. Much of this normalization reflected the influence of dendritic morphology. As different combinations of presynaptic axons may be active during consecutive cycles of sound stimuli, somatic EPSP normalization renders spike initiation more sensitive to synapse timing than dendritic location. Copyright © 2017 the authors 0270-6474/17/373138-12$15.00/0.

  4. Morphological analyses and variation in carbohydrate content during the maturation of somatic embryos of Carica papaya.

    PubMed

    Vale, Ellen Moura; Reis, Ricardo Souza; Passamani, Lucas Zanchetta; Santa-Catarina, Claudete; Silveira, Vanildo

    2018-03-01

    Efficient protocols for somatic embryogenesis of papaya ( Carica papaya L.) have great potential for selecting elite hybrid genotypes. Addition of polyethylene glycol (PEG), a nonplasmolyzing osmotic agent, to a maturation medium increases the production of somatic embryos in C . papaya . To study the effects of PEG on somatic embryogenesis of C . papaya , we analyzed somatic embryo development and carbohydrate profile changes during maturation treatments with PEG (6%) or without PEG (control). PEG treatment (6%) increased the number of normal mature somatic embryos followed by somatic plantlet production. In both control and PEG treatments, pro-embryogenic differentiation to the cotyledonary stage was observed and was significantly higher with PEG treatment. Histomorphological analysis of embryonic cultures with PEG revealed meristematic centers containing small isodiametric cells with dense cytoplasm and evident nuclei. Concomitant with the increase in the differentiation of somatic embryos in PEG cultures, there was an increase in the endogenous content of sucrose and starch, which appears to be related to a rising demand for energy, a key point in the conversion of C . papaya somatic embryos. The endogenous carbohydrate profile may be a valuable parameter for developing optimized protocols for the maturation of somatic embryos in papaya.

  5. Bridging the divide

    PubMed Central

    McLean, Peter F; Cooley, Lynn

    2014-01-01

    Ring canals are made from arrested cleavage furrows, and provide direct cytoplasmic connections among sibling cells. They are well documented for their participation in Drosophila oogenesis, but little is known about their role in several somatic tissues in which they are also found. Using a variety of genetic tools in live and fixed tissue, we recently demonstrated that rapid intercellular exchange occurs through somatic ring canals by diffusion, and presented evidence that ring canals permit equilibration of protein among transcriptionally mosaic cells. We also used a novel combination of markers to evaluate the extent of protein movement within and across mitotic clones in follicle cells and imaginal discs, providing evidence of robust movement of GFP between the 2 sides of mitotic clones and frequently into non-recombined cells. These data suggest that, depending on the experimental setup and proteins of interest, inter-clonal diffusion of protein may alter the interpretation of clonal data in follicle cells. Here, we discuss these results and provide additional insight into the impact of ring canals in Drosophila somatic tissues. PMID:24406334

  6. Review: the Contribution of both Nature and Nurture to Carcinogenesis and Progression in Solid Tumours.

    PubMed

    Hyndman, Iain Joseph

    2016-04-01

    Cancer is a leading cause of mortality worldwide. Cancer arises due to a series of somatic mutations that accumulate within the nucleus of a cell which enable the cell to proliferate in an unregulated manner. These mutations arise as a result of both endogenous and exogenous factors. Genes that are commonly mutated in cancer cells are involved in cell cycle regulation, growth and proliferation. It is known that both nature and nurture play important roles in cancer development through complex gene-environment interactions; however, the exact mechanism of these interactions in carcinogenesis is presently unclear. Key environmental factors that play a role in carcinogenesis include smoking, UV light and oncoviruses. Angiogenesis, inflammation and altered cell metabolism are important factors in carcinogenesis and are influenced by both genetic and environmental factors. Although the exact mechanism of nature-nurture interactions in solid tumour formation are not yet fully understood, it is evident that neither nature nor nurture can be considered in isolation. By understanding more about gene-environment interactions, it is possible that cancer mortality could be reduced.

  7. Variation of mutational burden in healthy human tissues suggests non-random strand segregation and allows measuring somatic mutation rates.

    PubMed

    Werner, Benjamin; Sottoriva, Andrea

    2018-06-01

    The immortal strand hypothesis poses that stem cells could produce differentiated progeny while conserving the original template strand, thus avoiding accumulating somatic mutations. However, quantitating the extent of non-random DNA strand segregation in human stem cells remains difficult in vivo. Here we show that the change of the mean and variance of the mutational burden with age in healthy human tissues allows estimating strand segregation probabilities and somatic mutation rates. We analysed deep sequencing data from healthy human colon, small intestine, liver, skin and brain. We found highly effective non-random DNA strand segregation in all adult tissues (mean strand segregation probability: 0.98, standard error bounds (0.97,0.99)). In contrast, non-random strand segregation efficiency is reduced to 0.87 (0.78,0.88) in neural tissue during early development, suggesting stem cell pool expansions due to symmetric self-renewal. Healthy somatic mutation rates differed across tissue types, ranging from 3.5 × 10-9/bp/division in small intestine to 1.6 × 10-7/bp/division in skin.

  8. Somatic Nucleus Reprogramming Is Significantly Improved by m-Carboxycinnamic Acid Bishydroxamide, a Histone Deacetylase Inhibitor*

    PubMed Central

    Dai, Xiangpeng; Hao, Jie; Hou, Xiao-jun; Hai, Tang; Fan, Yong; Yu, Yang; Jouneau, Alice; Wang, Liu; Zhou, Qi

    2010-01-01

    Somatic cell nuclear transfer (SCNT) has shown tremendous potential for understanding the mechanisms of reprogramming and creating applications in the realms of agriculture, therapeutics, and regenerative medicine, although the efficiency of reprogramming is still low. Somatic nucleus reprogramming is triggered in the short time after transfer into recipient cytoplasm, and therefore, this period is regarded as a key stage for optimizing SCNT. Here we report that CBHA, a histone deacetylase inhibitor, modifies the acetylation status of somatic nuclei and increases the developmental potential of mouse cloned embryos to reach pre- and post-implantation stages. Furthermore, the cloned embryos treated by CBHA displayed higher efficiency in the derivation of nuclear transfer embryonic stem cell lines by promoting outgrowths. More importantly, CBHA increased blastocyst quality compared with trichostatin A, another prevalent histone deacetylase inhibitor reported previously. Use of CBHA should improve the productivity of SCNT for a variety of research and clinical applications, and comparisons of cells with different levels of pluripotency and treated with CBHA versus trichostatin A will facilitate studies of the mechanisms of reprogramming. PMID:20566633

  9. Bloom syndrome: a mendelian prototype of somatic mutational disease.

    PubMed

    German, J

    1993-11-01

    Spontaneous mutations in human somatic cells occur far more often than normal in individuals with Bloom syndrome. The basis for understanding these mutations and their developmental consequences emerges from examination of BS at the molecular, cellular, and clinical levels. The major clinical feature of BS, proportional dwarfism, as well as its major clinical complication, an exceptionally early emergence of neoplasia of the types and sites that affect the general population, are attributable to the excessive occurrence of mutations in somatic cells. Here, the following aspects of BS are discussed: (i) the BS phenotype; (ii) neoplasia in BS, including the means--the Bloom's Syndrome Registry--by which the significant risk for diverse sites and types of cancer in these patients was revealed; (iii) the biological basis for the cancer proneness of BS; and, finally, (iv) the significance for both basic human biology and clinical medicine of BS as the prototype of somatic mutational disease.

  10. Single inverted terminal repeats of the Junonia coenia Densovirus promotes somatic chromosomal integration of vector plasmids in insect cells and supports high efficiency expression

    USDA-ARS?s Scientific Manuscript database

    Plasmids that contain a disrupted genome of the Junonia coenia densovirus (JcDNV) integrate into the chromosomes of the somatic cells of insects. When subcloned individually, both the P9 inverted terminal repeat (P9-ITR) and the P93-ITR promote the chromosomal integration of vector plasmids in insec...

  11. Adult Mammalian Neural Stem Cells and Neurogenesis: Five Decades Later

    PubMed Central

    Bond, Allison M.; Ming, Guo-li; Song, Hongjun

    2015-01-01

    Summary Adult somatic stem cells in various organs maintain homeostatic tissue regeneration and enhance plasticity. Since its initial discovery five decades ago, investigations of adult neurogenesis and neural stem cells have led to an established and expanding field that has significantly influenced many facets of neuroscience, developmental biology and regenerative medicine. Here we review recent progress and focus on questions related to adult mammalian neural stem cells that also apply to other somatic stem cells. We further discuss emerging topics that are guiding the field toward better understanding adult neural stem cells and ultimately applying these principles to improve human health. PMID:26431181

  12. Commentary: "re-programming or selecting adult stem cells?".

    PubMed

    Trosko, James E

    2008-01-01

    The recent observations that embryonic stemness-associated genes could assist in the "de-differentiation" of adult skin fibroblast cells to "embryonic-like stem cells", using the "somatic cell nuclear transfer" techniques, have been interpreted as indicating a "re-programming" of genes. These reports have demonstrated a "proof of principle" approach to by-pass many, but not all, of the ethical, scientific and medical limitations of the "therapeutic cloning" of embryonic stem cells from embryos. However, while the interpretation that real "re-programming" of all those somatic fibroblastic differentiation genes might be correct, there does exists an alternative hypothesis of these exciting results. Based on the fact that multipotent adult stem cells exist in most, if not all, adult organs, the possibility exists that all these recent "re-programming" results, using the somatic nuclear transfer techniques, actually were the results of transferred rare nuclear material from the adult stem cells residing in the skin of the mouse, monkey and human samples. An examination of the rationale for this challenging hypothesis has been drawn from the hypothesis of the "stem cell theory of cancer", as well as from the field of human adult stem cells research.

  13. Cloning Endangered Felids by Interspecies Somatic Cell Nuclear Transfer.

    PubMed

    Gómez, Martha C; Pope, C Earle

    2015-01-01

    In 2003, the first wild felid was produced by interspecies somatic cell nuclear transfer. Since then other wild felid clone offspring have been produced by using the same technique with minor modifications. This chapter describes detailed protocols used in our laboratory for (1) the isolation, culture, and preparation of fibroblast cells as donor nucleus, and (2) embryo reconstruction with domestic cat enucleated oocytes to produce cloned embryos that develop to the blastocyst stage in vitro and, after transfer into synchronized recipients, establish successful pregnancies.

  14. Elevated Levels of Somatic Mutation as a Biomarker of Environmental Effects Contributing to Breast Carcinogenesis

    DTIC Science & Technology

    2001-07-01

    and hepatocellular carcinoma patients have been shown to exhibit elevated somatic mutation frequencies with the GPA assay (Okada et al., 1997...T, Kyogoku A, Yoshimori M (1997) Evidence for increased somatic cell mutations in patients with hepatocellular carcinoma . Carcinogenesis 18: 445-449...significant increase in mutation at the GPA locus has been reported for a population of hepatocellular carcinoma patients (Okada et al., 1997

  15. Photoperiod, temperature, and food availability as drivers of the annual reproductive cycle of the sea urchin Echinometra sp. from the Gulf of Aqaba (Red Sea)

    NASA Astrophysics Data System (ADS)

    Bronstein, Omri; Loya, Yossi

    2015-03-01

    In spite of the efforts invested in the search for the environmental factors that regulate discrete breeding periods in marine invertebrates, they remain poorly understood. Here, we present the first account of the annual reproductive cycle of the pantropical sea urchin Echinometra sp. from the Gulf of Aqaba/Eilat (Red Sea) and explore some of the main environmental variables that drive echinoid reproduction. Monthly measurements of gonado-somatic indexes and histological observations of 20 specimens revealed a single seasonal reproductive cycle, with gametogenesis in males and females being highly synchronized. Gametogenesis commenced in June and peak spawning occurred between September and October. Gonado-somatic indexes were significantly correlated with seawater temperatures but not with photoperiod. The latter cycle lagged behind the gonado-somatic cycle by two months, suggesting that the onset of gametogenesis corresponds to shortening day length, while spawning may be driven by warming seawater temperatures. Gonads remained quiescent throughout the winter and spring (January through May) when temperatures were at their lowest. Chlorophyll- a concentrations increased significantly in the months following spawning (October through January). These high concentrations are indicative of high phytoplankton abundance and may reflect the increase in food availability for the developing larvae. Of the external test dimensions, length presented the highest correlation to body weight, indicating length as the best predictor for body size in Echinometra. Neither sexual dimorphism nor size differences between males and females were detected, and the sex ratios were approximately 1:1 in three distant Echinometra populations. Environmentally regulated reproduction, as occurs in sea urchins, might face severe outcomes due to anthropogenic disturbances to the marine environment. Consequently, there is a need to deepen our understanding of the mechanisms that drive and regulate this process in broadcast-spawning species.

  16. Genomic individuality and its biological implications.

    PubMed

    Zhao, J

    1996-06-01

    It is a widely accepted fundamental concept that all somatic genomes of a human individual are identical to each other. The theoretical basis of this concept is that all of these somatic genomes are the descendants of the genome of a single fertilized cell as well as the simple replicated products of asexual reproduction, thus not forming any new recombined genomes. The question here is whether such a concept might only represent one side of somatic genome biology and, even worse, whether it has perhaps already led to a very prevalent misconception that within the organism body, there exists no variability among individual somatic genomes. A hypothesis, called genomic individuality, is proposed, simply saying that every individual somatic genome, perhaps with rare exceptions, has its own unique or individual 'genetic identity' or 'fingerprint', which is characterized by its distinctive sequences or patterns of deoxyribonucleic acid molecules, or both. Thus, no two somatic genomes can be identical to each other in every or all aspects, and consequently, there must be a great deal of genomic variation present within the body of any multicellular organism. The concept or hypothesis of genomic individuality would not only provide a more complete understanding of genome biology, but also suggest a new insight into the studies of the biology of cells and organisms.

  17. Plant regeneration via direct somatic embryogenesis from leaf explants of Tolumnia Louise Elmore 'Elsa'.

    PubMed

    Shen, Hui-Ju; Chen, Jen-Tsung; Chung, Hsiao-Hang; Chang, Wei-Chin

    2018-01-22

    Tolumnia genus (equitant Oncidium) is a group of small orchids with vivid flower color. Thousands of hybrids have been registered on Royal Horticulture Society and showed great potential for ornamental plant market. The aim of this study is to establish an efficient method for in vitro propagation. Leaf explants taken from in vitro-grown plants were used to induce direct somatic embryogenesis on a modified 1/2 MS medium supplemented with five kinds of cytokinins, 2iP, BA, kinetin, TDZ and zeatin at 0.3, 1 and 3 mg l -1 in darkness. TDZ at 3 mg l -1 gave the highest percentage of explants with somatic globular embryos after 90 days of culture. It was found that 2,4-D and light regime highly retarded direct somatic embryogenesis and showed 95-100% of explant browning. Histological observations revealed that the leaf cells divided into meristematic cells firstly, followed by somatic proembryos, and then somatic globular embryos. Eventually, somatic embryos developed a bipolar structure with the shoot apical meristem and the root meristem. Scanning electron microscopy observations showed that the direct somatic embryogenesis from leaf explants was asynchronously. The somatic embryos were found on the leaf tip, the adaxial surface and also the mesophyll through a cleft, and it reflected the heterogeneity of the explant. The 90-day-old globular embryos were detached from the parent explants and transferred onto a hormone-free 1/2 MS medium in light condition for about 1 month to obtain 1-cm-height plantlets. After another 3 months for growth, the plantlets were potted with Sphagnum moss and were acclimatized in a shaded greenhouse. After 1 month of culture, the survival rate was 100%. In this report, a protocol for efficient regenerating a Tolumnia orchid, Louise Elmore 'Elsa', was established via direct somatic embryogenesis and might reveal an alternative approach for mass propagation of Tolumnia genus in orchid industry.

  18. Somatic mutations and affinity maturation are impaired by excessive numbers of T follicular helper cells and restored by Treg cells or memory T cells.

    PubMed

    Preite, Silvia; Baumjohann, Dirk; Foglierini, Mathilde; Basso, Camilla; Ronchi, Francesca; Fernandez Rodriguez, Blanca M; Corti, Davide; Lanzavecchia, Antonio; Sallusto, Federica

    2015-11-01

    We previously reported that Cd3e-deficient mice adoptively transferred with CD4(+) T cells generate high numbers of T follicular helper (Tfh) cells, which go on to induce a strong B-cell and germinal center (GC) reaction. Here, we show that in this system, GC B cells display an altered distribution between the dark and light zones, and express low levels of activation-induced cytidine deaminase. Furthermore, GC B cells from Cd3e(-/-) mice accumulate fewer somatic mutations as compared with GC B cells from wild-type mice, and exhibit impaired affinity maturation and reduced differentiation into long-lived plasma cells. Reconstitution of Cd3e(-/-) mice with regulatory T (Treg) cells restored Tfh-cell numbers, GC B-cell numbers and B-cell distribution within dark and light zones, and the rate of antibody somatic mutations. Tfh-cell numbers and GC B-cell numbers and dynamics were also restored by pre-reconstitution of Cd3e(-/-) mice with Cxcr5(-/-) Treg cells or non-regulatory, memory CD4(+) T cells. Taken together, these findings underline the importance of a quantitatively regulated Tfh-cell response for an efficient and long-lasting serological response. © 2015 The Authors. European Journal of Immunology published by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Two classes of gap junction channels mediate soma-germline interactions essential for germline proliferation and gametogenesis in Caenorhabditis elegans.

    PubMed

    Starich, Todd A; Hall, David H; Greenstein, David

    2014-11-01

    In all animals examined, somatic cells of the gonad control multiple biological processes essential for germline development. Gap junction channels, composed of connexins in vertebrates and innexins in invertebrates, permit direct intercellular communication between cells and frequently form between somatic gonadal cells and germ cells. Gap junctions comprise hexameric hemichannels in apposing cells that dock to form channels for the exchange of small molecules. Here we report essential roles for two classes of gap junction channels, composed of five innexin proteins, in supporting the proliferation of germline stem cells and gametogenesis in the nematode Caenorhabditis elegans. Transmission electron microscopy of freeze-fracture replicas and fluorescence microscopy show that gap junctions between somatic cells and germ cells are more extensive than previously appreciated and are found throughout the gonad. One class of gap junctions, composed of INX-8 and INX-9 in the soma and INX-14 and INX-21 in the germ line, is required for the proliferation and differentiation of germline stem cells. Genetic epistasis experiments establish a role for these gap junction channels in germline proliferation independent of the glp-1/Notch pathway. A second class of gap junctions, composed of somatic INX-8 and INX-9 and germline INX-14 and INX-22, is required for the negative regulation of oocyte meiotic maturation. Rescue of gap junction channel formation in the stem cell niche rescues germline proliferation and uncovers a later channel requirement for embryonic viability. This analysis reveals gap junctions as a central organizing feature of many soma-germline interactions in C. elegans. Copyright © 2014 by the Genetics Society of America.

  20. Analyses of spontaneous pink mutant events in the stamen hairs of Tradescantia clone BNL 4430 cultivated in a nutrient solution circulating growth chamber.

    PubMed

    Ichikawa, S; Wushur, S

    2000-12-20

    In order to obtain more fundamental data on Tradescantia clone BNL 4430, one of the most suitable testers for environmental mutagens, the occurrences of spontaneous somatic pink mutations in the stamen hairs were scored for 52 weeks from 12 December 1998 to 10 December 1999, cultivating the young inflorescence-bearing shoots with roots in a nutrient solution circulating (NSC) growth chamber. The environmental conditions in the chamber were 22.0+/-0.5 degrees C during the 16h day with the light intensity of 7.5klx from white fluorescent tubes, and 20.0+/-0.5 degrees C at night. During the scoring period, 697,443 stamen hairs with an average cell number of 25.36 were observed and 2642 pink mutant events (PMEs) were detected. The overall spontaneous mutation frequency was 1.56+/-0.03 PMEs per 10(4) hair-cell divisions, and the frequency was significantly lower in May, July and August and significantly higher in November and December. By analyzing the sectoring patterns of 1856 PMEs (70.25% of PMEs detected), the most of 172 cases of multiple (two to five) pink sectors observed in the same hairs (scored as 232 PMEs for calculating mutation frequency) were found to be the results of events involving somatic recombinations occurred in single cells or cell lineages, rather than those of two or more independent somatic mutations occurred in different cells. This finding clearly shows the significance of somatic recombinations in producing such multiple sectors (382 sectors in total) which occupied 19.0% of the 2006 pink sectors in total analyzed. Somatic recombinations were considered to be playing a significant role also in producing single PMEs in the stamen hairs.

  1. The effect of season on somatic cell count and the incidence of clinical mastitis.

    PubMed

    Olde Riekerink, R G M; Barkema, H W; Stryhn, H

    2007-04-01

    Bulk milk somatic cell count (BMSCC), individual cow somatic cell count (ICSCC), and incidence rate of clinical mastitis (IRCM) are all udder health parameters. So far, no studies have been reported on the effect of season on BMSCC, IRCM, and ICSCC in the same herds and period over multiple years. The objectives of this study were to determine the seasonal pattern over a 4-yr period of 1) BMSCC, 2) elevated ICSCC, 3) IRCM, and 4) pathogen-specific IRCM. Bulk milk somatic cell count, ICSCC, and pathogen-specific clinical mastitis data were recorded in 300 Dutch dairy farms. For the analyses of BMSCC, ICSCC, and IRCM, a mixed, a transitional, and a discrete time survival analysis model were used, respectively. Sine and cosine were included in the models to investigate seasonal patterns in the data. For all parameters, a seasonal effect was present. Bulk milk somatic cell count peaked in August to September in all 4 years. The probability of cows getting or maintaining a high ICSCC was highest in August and May, respectively. Older and late-lactation cows were more likely to develop or maintain a high ICSCC. Incidence rate of clinical mastitis was highest in December to January, except for Streptococcus uberis IRCM, which was highest in August. Totally confined herds had a higher Escherichia coli IRCM in summer than in winter. Compared with the major mastitis pathogens, the seasonal differences in IRCM were smaller for the minor pathogens. Distinguishing between Strep. uberis, Streptococcus dysgalactiae, Streptococcus agalactiae, and other streptococci is essential when identifying Streptococcus spp. because each of them has a unique epidemiology. Streptococcus uberis IRCM seemed to be associated with being on pasture, whereas E. coli IRCM was more housing-related.

  2. Cyclin D regulation of a sexually dimorphic asymmetric cell division

    PubMed Central

    Tilmann, Christopher; Kimble, Judith

    2006-01-01

    SUMMARY The C. elegans somatic gonadal precursor cell (SGP) divides asymmetrically to establish gonad-specific coordinates in both sexes. In addition, the SGP division is sexually dimorphic and initiates sex-specific programs of gonadogenesis. Wnt/MAPK signaling determines the gonadal axes, and the FKH-6 transcription factor specifies the male mode of SGP division. In this paper, we demonstrate that C. elegans cyclin D controls POP-1/TCF asymmetry in the SGP daughters as well as fkh-6 and rnr expression in the SGPs. Although cyclin D mutants have delayed SGP divisions, the cyclin D defects are not mimicked by other methods of retarding the SGP division. We find that EFL-1/E2F has an antagonistic effect on fkh-6 expression and gonadogenesis, which is relieved by cyclin D activity. We propose that cyclin D and other canonical regulators of the G1/S transition coordinate key regulators of axis formation and sex determination with cell cycle progression to achieve the sexually dimorphic SGP asymmetric division. PMID:16198291

  3. Studies on Somatic Embryogenesis in Sweetpotato

    NASA Technical Reports Server (NTRS)

    Bennett, J. Rasheed; Prakash, C. S.

    1997-01-01

    The purpose of this study was to improve the somatic embryo (SE) system for plant production of sweetpotato Ipomoea batatas L.(Lam)l. Explants isolated from SE-derived sweet potato plants were compared with control (non SE-derived) plants for their competency for SE production. Leaf explants were cultured on Murashige-Skoog (MS) medium with 2,4-dichlorophenoxy acetic acid (0.2 mg/L) and 6-benzylaminopurine (2.5 mg/L) for 2 weeks in darkness and transferred to MS medium with abscisic acid (2.5 Explants isolated from those plants developed through somatic embryo-genesis produced new somatic embryos rapidly and in higher frequency than those isolated from control plants. They also appeared to grow faster in tissue culture than the control plants. Current studies in the laboratory are examining whether plants derived from a cyclical embryogenesis system (five cycles) would have any further positive impact on the rapidity and frequency of somatic embryo development. More detailed studies using electron microscopy are expected to show the point of origin of the embryos and to allow determination of their quality throughout the cyclical process. This study may facilitate improved plant micropropagation, gene transfer and germplasm conservation in sweet potato.

  4. Studies for Somatic Embryogenesis in Sweet Potato

    NASA Technical Reports Server (NTRS)

    Bennett, J. Rasheed; Prakash, C. S.

    1997-01-01

    The purpose of this study was to improve the somatic embryo (SE) system for plant production of sweet potato (Ipomoea batatas L(Lam)). Explants isolated from SE-derived sweet potato plants were compared with control (non SE-derived) plants for their competency for SE production. Leaf explants were cultured on Murashige-Skoog (MS) medium with 2,4-dichlorophenoxy acetic acid (0.2 mg/L) and 6-benzylaminopurine (2.5 mg/L) for 2 weeks in darkness and transferred to MS medium with abscisic acid (2.5 mg/L). Explants isolated from those plants developed through somatic embryogenesis produced new somatic embryos rapidly and in higher frequency than those isolated from control plants They also appeared to grow faster in tissue culture than the control plants. Current studies in the laboratory are examining whether plants derived from a cyclical embryogenesis system (five cycles) would have any further positive impact on the rapidity and frequency of somatic embryo development. More detailed studies using electron microscopy are expected to show the point of origin of the embryos and to allow determination of their quality throughout the cyclical process. This study may facilitate improved plant micropropagation, gene transfer and germplasm conservation in sweet potato.

  5. Headspace volatile markers for sensitivity of cocoa (Theobroma cacao L.) somatic embryos to cryopreservation.

    PubMed

    Fang, Jong-Yi; Wetten, Andrew; Johnston, Jason

    2008-03-01

    The mechanisms that reduce the viability of plant somatic embryos following cryopreservation are not known. The objective of the present study was to evaluate the sensitivity of cocoa (Theobroma cacao L.) somatic embryos at different stages of an encapsulation-dehydration protocol using stress-related volatile hydrocarbons as markers of injury and recovery. The plant stress hormone ethylene and volatile hydrocarbons derived from hydroxyl radicals (methane) and lipid peroxidation (ethane) were determined using gas chromatography headspace analysis. Ethylene and methane were the only volatiles detected, with both being produced after each step of the cryogenic protocol. Ethylene production was significantly reduced following exposure to liquid nitrogen, but then increased in parallel with embryo recovery. In contrast, the production of methane was cyclic during recovery, with the first cycle occurring earlier for embryos recovered from liquid nitrogen and desiccation than those recovered from earlier steps in the protocol. These results suggest that loss of somatic embryo viability during cryopreservation may be related to the oxidative status of the tissue, and its capacity to produce ethylene. This study has demonstrated that headspace volatile analysis provides a robust non-destructive analytical approach for assessing the survival and recovery of plant somatic embryos following cryopreservation.

  6. In-vivo genotoxicity of the alkaloid drug pilocarpine nitrate in bone marrow cells and male germ cells of mice.

    PubMed

    Hegde, M J; Sujatha, T V

    1995-10-01

    Pilocarpine nitrate, an alkaloid drug of plant origin induces spindle disfunction in bone marrow cells of mice. Further studies were carried out to investigate its mutagenic effects in somatic and germ cells of mice by assessing chromosome aberrations at mitotic metaphase and as micronuclei in bone marrow cells and sperm-shape abnormality in cauda epididymides. The dose and time yield effects of the drug were investigated. The statistically significant results that were obtained for both chromosomal aberrations and micronucleus test but not for the sperm-shape abnormality test, indicated the genotoxicity of this compound in somatic cells but not in germ cells.

  7. Sequencing thousands of single-cell genomes with combinatorial indexing.

    PubMed

    Vitak, Sarah A; Torkenczy, Kristof A; Rosenkrantz, Jimi L; Fields, Andrew J; Christiansen, Lena; Wong, Melissa H; Carbone, Lucia; Steemers, Frank J; Adey, Andrew

    2017-03-01

    Single-cell genome sequencing has proven valuable for the detection of somatic variation, particularly in the context of tumor evolution. Current technologies suffer from high library construction costs, which restrict the number of cells that can be assessed and thus impose limitations on the ability to measure heterogeneity within a tissue. Here, we present single-cell combinatorial indexed sequencing (SCI-seq) as a means of simultaneously generating thousands of low-pass single-cell libraries for detection of somatic copy-number variants. We constructed libraries for 16,698 single cells from a combination of cultured cell lines, primate frontal cortex tissue and two human adenocarcinomas, and obtained a detailed assessment of subclonal variation within a pancreatic tumor.

  8. Efficient modification of the myostatin gene in porcine somatic cells and generation of knockout piglets.

    PubMed

    Rao, Shengbin; Fujimura, Tatsuya; Matsunari, Hitomi; Sakuma, Tetsushi; Nakano, Kazuaki; Watanabe, Masahito; Asano, Yoshinori; Kitagawa, Eri; Yamamoto, Takashi; Nagashima, Hiroshi

    2016-01-01

    Myostatin (MSTN) is a negative regulator of myogenesis, and disruption of its function causes increased muscle mass in various species. Here, we report the generation of MSTN-knockout (KO) pigs using genome editing technology combined with somatic-cell nuclear transfer (SCNT). Transcription activator-like effector nuclease (TALEN) with non-repeat-variable di-residue variations, called Platinum TALEN, was highly efficient in modifying genes in porcine somatic cells, which were then used for SCNT to create MSTN KO piglets. These piglets exhibited a double-muscled phenotype, possessing a higher body weight and longissimus muscle mass measuring 170% that of wild-type piglets, with double the number of muscle fibers. These results demonstrate that loss of MSTN increases muscle mass in pigs, which may help increase pork production for consumption in the future. © 2015 Wiley Periodicals, Inc.

  9. Arabidopsis HAP2/GCS1 is a gamete fusion protein homologous to somatic and viral fusogens

    PubMed Central

    Valansi, Clari; Moi, David; Leikina, Evgenia; Matveev, Elena; Chernomordik, Leonid V.

    2017-01-01

    Cell–cell fusion is inherent to sexual reproduction. Loss of HAPLESS 2/GENERATIVE CELL SPECIFIC 1 (HAP2/GCS1) proteins results in gamete fusion failure in diverse organisms, but their exact role is unclear. In this study, we show that Arabidopsis thaliana HAP2/GCS1 is sufficient to promote mammalian cell–cell fusion. Hemifusion and complete fusion depend on HAP2/GCS1 presence in both fusing cells. Furthermore, expression of HAP2 on the surface of pseudotyped vesicular stomatitis virus results in homotypic virus–cell fusion. We demonstrate that the Caenorhabditis elegans Epithelial Fusion Failure 1 (EFF-1) somatic cell fusogen can replace HAP2/GCS1 in one of the fusing membranes, indicating that HAP2/GCS1 and EFF-1 share a similar fusion mechanism. Structural modeling of the HAP2/GCS1 protein family predicts that they are homologous to EFF-1 and viral class II fusion proteins (e.g., Zika virus). We name this superfamily Fusexins: fusion proteins essential for sexual reproduction and exoplasmic merger of plasma membranes. We suggest a common origin and evolution of sexual reproduction, enveloped virus entry into cells, and somatic cell fusion. PMID:28137780

  10. Composition, proteolysis indices and coagulating properties of ewe milk as affected by bulk tank somatic cell count.

    PubMed

    Martí-De Olives, Ana; Navarro-Ríos, María Jesús; Rubert-Alemán, Joaquín; Fernández, Nemesio; Molina, Maria Pilar

    2015-08-01

    The aim of this study was to assess the effect of ovine bulk tank somatic cell count (BTSCC) on composition, proteose-peptone (p-p) content and casein fractions as indicating parameters for proteolysis and coagulating properties of milk. A total of 97 samples of bulk tank milk from Manchega breed ewe flocks were grouped according to somatic cell count (SCC) into four classes: fewer than 500,000 cells/ml, from 500,000 to 10,00000 cells/ml, from 10,00000 to 15,00000 and more than 15,00000 cells/ml. The casein : protein ratio and lactose content decreased with BTSCC. Proteolysis increased with BTSCC, causing a drop in β-casein and an increase in the γ-caseins from a concentration of 500,000 cells/ml. Regarding coagulation behaviour, the rennet clotting time (RCT) and firming time (k20) rose from 10,00000-15,00000 cells/ml of milk. The results showed that the impairment of milk quality and milk ability to make cheese as affected by intramammary infection (IMI) can be inferred from the bulk tank milk of flocks with poor udder health.

  11. Metabolome Profiling of Partial and Fully Reprogrammed Induced Pluripotent Stem Cells.

    PubMed

    Park, Soon-Jung; Lee, Sang A; Prasain, Nutan; Bae, Daekyeong; Kang, Hyunsu; Ha, Taewon; Kim, Jong Soo; Hong, Ki-Sung; Mantel, Charlie; Moon, Sung-Hwan; Broxmeyer, Hal E; Lee, Man Ryul

    2017-05-15

    Acquisition of proper metabolomic fate is required to convert somatic cells toward fully reprogrammed pluripotent stem cells. The majority of induced pluripotent stem cells (iPSCs) are partially reprogrammed and have a transcriptome different from that of the pluripotent stem cells. The metabolomic profile and mitochondrial metabolic functions required to achieve full reprogramming of somatic cells to iPSC status have not yet been elucidated. Clarification of the metabolites underlying reprogramming mechanisms should enable further optimization to enhance the efficiency of obtaining fully reprogrammed iPSCs. In this study, we characterized the metabolites of human fully reprogrammed iPSCs, partially reprogrammed iPSCs, and embryonic stem cells (ESCs). Using capillary electrophoresis time-of-flight mass spectrometry-based metabolomics, we found that 89% of analyzed metabolites were similarly expressed in fully reprogrammed iPSCs and human ESCs (hESCs), whereas partially reprogrammed iPSCs shared only 74% similarly expressed metabolites with hESCs. Metabolomic profiling analysis suggested that converting mitochondrial respiration to glycolytic flux is critical for reprogramming of somatic cells into fully reprogrammed iPSCs. This characterization of metabolic reprogramming in iPSCs may enable the development of new reprogramming parameters for enhancing the generation of fully reprogrammed human iPSCs.

  12. A regulatory circuit for piwi by the large Maf gene traffic jam in Drosophila.

    PubMed

    Saito, Kuniaki; Inagaki, Sachi; Mituyama, Toutai; Kawamura, Yoshinori; Ono, Yukiteru; Sakota, Eri; Kotani, Hazuki; Asai, Kiyoshi; Siomi, Haruhiko; Siomi, Mikiko C

    2009-10-29

    PIWI-interacting RNAs (piRNAs) silence retrotransposons in Drosophila germ lines by associating with the PIWI proteins Argonaute 3 (AGO3), Aubergine (Aub) and Piwi. piRNAs in Drosophila are produced from intergenic repetitive genes and piRNA clusters by two systems: the primary processing pathway and the amplification loop. The amplification loop occurs in a Dicer-independent, PIWI-Slicer-dependent manner. However, primary piRNA processing remains elusive. Here we analysed piRNA processing in a Drosophila ovarian somatic cell line where Piwi, but not Aub or AGO3, is expressed; thus, only the primary piRNAs exist. In addition to flamenco, a Piwi-specific piRNA cluster, traffic jam (tj), a large Maf gene, was determined as a new piRNA cluster. piRNAs arising from tj correspond to the untranslated regions of tj messenger RNA and are sense-oriented. piRNA loading on to Piwi may occur in the cytoplasm. zucchini, a gene encoding a putative cytoplasmic nuclease, is required for tj-derived piRNA production. In tj and piwi mutant ovaries, somatic cells fail to intermingle with germ cells and Fasciclin III is overexpressed. Loss of tj abolishes Piwi expression in gonadal somatic cells. Thus, in gonadal somatic cells, tj gives rise simultaneously to two different molecules: the TJ protein, which activates Piwi expression, and piRNAs, which define the Piwi targets for silencing.

  13. Induction of pluripotency by defined factors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Okita, Keisuke, E-mail: okita@cira.kyoto-u.ac.jp; Yamanaka, Shinya; Department of Stem Cell Biology, Institute for Frontier Medical Sciences, Kyoto University, Kyoto 606-8507

    2010-10-01

    Somatic cells can be reprogrammed into pluripotent stem cells by introducing a combination of several transcription factors. The induced pluripotent stem (iPS) cells from a patient's somatic cells could be useful source of cells for drug discovery and cell transplantation therapies. However, most human iPS cells are made by viral vectors, such as retrovirus and lentivirus, which integrate the reprogramming factors into host genomes and may increase the risk of tumor formation. Studies of the mechanisms underlying the reprogramming and establishment of non-integration methods contribute evidence to resolve the safety concerns associated with iPS cells. On the other hand, patient-specificmore » iPS cells have already been established and used for recapitulating disease pathology.« less

  14. Genotoxicity testing of different types of beverages in the Drosophila wing Somatic Mutation And Recombination Test.

    PubMed

    Graf, U; Moraga, A A; Castro, R; Díaz Carrillo, E

    1994-05-01

    Five wines and one brandy of Spanish origin as well as three herbal teas and ordinary black tea were tested for genotoxicity in the wing Somatic Mutation And Recombination Test (SMART) which makes use of the two recessive wing cell markers multiple wing hairs (mwh) and flare (flr3) on the left arm of chromosome 3 of Drosophila melanogaster. 3-day-old larvae trans-heterozygous for these two markers were fed the beverages at different concentrations and for different feeding periods using Drosophila instant medium. Somatic mutations or mitotic recombinations induced in the cells of the wing imaginal discs give rise to mutant single or twin spots on the wing blade of the emerging adult flies showing either the mwh phenotype or/and the flr phenotype. One of the red wines showed a clear genotoxic activity that was not due to its ethanol content. Two herbal teas (Urtica dioica, Achillea millefolium) and black tea (Camellia sinensis) proved to be weakly genotoxic as well. Furthermore, it was shown that quercetin and rutin, two flavonols present in beverages of plant origin, also exhibited weak genotoxic activity in the somatic cells of Drosophila. These results demonstrate that Drosophila in vivo somatic assays can detect the genotoxicity of complex mixtures such as beverages. In particular, it is possible to administer these test materials in the same form as that in which they are normally consumed.

  15. In vitro development of cloned bovine embryos produced by handmade cloning using somatic cells from distinct levels of cell culture confluence.

    PubMed

    Gerger, R P C; Ribeiro, E S; Forell, F; Bertolini, L R; Rodrigues, J L; Ambrósio, C E; Miglino, M A; Mezzalira, A; Bertolini, M

    2010-02-18

    The relationship between the level of cell confluence near the plateau phase of growth and blastocyst yield following somatic cell cloning is not well understood. We examined the effect of distinct cell culture confluence levels on in vitro development of cloned bovine embryos. In vitro-matured bovine oocytes were manually bisected and selected by DNA staining. One or two enucleated hemi-cytoplasts were paired and fused with an adult skin somatic cell. Cultured skin cells from an adult Nellore cow harvested at three distinct culture confluence levels (70-80, 80-90, and >95%) were used for construction of embryos and hemi-embryos. After activation, structures were cultured in vitro as one embryo (1 x 100%) or as aggregates of two hemi-embryos (2 x 50%) per microwell. Fusion, cleavage and blastocyst rates were compared using the chi(2) test. The fusion rate for hemi-embryos (51.4%) was lower than for embryos (67.6%), with no influence of degree of cell confluence. However, blastocyst rates improved linearly (7.0, 17.5, and 29.4%) with increases in cell confluence. We conclude that degree of cell culture confluence significantly influences subsequent embryo development; use of a cell population in high confluence (>90%) for nuclear transfer significantly improved blastocyst yield after cloning.

  16. Biogenesis pathways of piRNAs loaded onto AGO3 in the Drosophila testis.

    PubMed

    Nagao, Akihiro; Mituyama, Toutai; Huang, Haidong; Chen, Dahua; Siomi, Mikiko C; Siomi, Haruhiko

    2010-12-01

    PIWI-interacting RNAs (piRNAs) silence transposable elements in animal germ cells. In Drosophila ovaries, piRNAs are produced by two distinct pathways: the "ping-pong" amplification cycle that operates in germ cells and a ping-pong-independent pathway termed the primary pathway that mainly operates in somatic cells. AGO3, one of three PIWI proteins in flies, is involved in the ping-pong cycle in ovaries. We characterized AGO3-associated piRNAs in fly testes and found that like in ovaries, AGO3 functions in the ping-pong cycle with Aubergine (Aub) for piRNA production from transposon transcripts. In contrast, most AGO3-associated piRNAs corresponding to Suppressor of Stellate [Su(Ste)] genes are antisense-oriented and bound to Aub. In addition, the vast majority of AGO3-bound piRNAs derived from the AT-chX locus on chromosome X are antisense-oriented and are also found among Aub-associated piRNAs. The presence of very few sense Su(Ste) and AT-chX piRNAs suggests that biogenesis of both Su(Ste) and AT-chX piRNAs by a ping-pong mechanism only is highly unlikely. Nevertheless, the mutual interdependence of AGO3 and Aub for the accumulation of these piRNAs shows that their production relies on both AGO3 and Aub. Analysis of piRNA pathway mutants revealed that although the requirements for piRNA factors for Su(Ste)- and AT-chX-piRNA levels mostly overlap and resemble those for the ping-pong mechanism in the ovaries, Armitage (armi) is not required for the accumulation of AT-chX-1 piRNA. These findings suggest that the impacts of armi mutants on the operation of the piRNA pathway are variable in germ cells of fly testes.

  17. Functional Study of Genes Essential for Autogamy and Nuclear Reorganization in Paramecium▿§

    PubMed Central

    Nowak, Jacek K.; Gromadka, Robert; Juszczuk, Marek; Jerka-Dziadosz, Maria; Maliszewska, Kamila; Mucchielli, Marie-Hélène; Gout, Jean-François; Arnaiz, Olivier; Agier, Nicolas; Tang, Thomas; Aggerbeck, Lawrence P.; Cohen, Jean; Delacroix, Hervé; Sperling, Linda; Herbert, Christopher J.; Zagulski, Marek; Bétermier, Mireille

    2011-01-01

    Like all ciliates, Paramecium tetraurelia is a unicellular eukaryote that harbors two kinds of nuclei within its cytoplasm. At each sexual cycle, a new somatic macronucleus (MAC) develops from the germ line micronucleus (MIC) through a sequence of complex events, which includes meiosis, karyogamy, and assembly of the MAC genome from MIC sequences. The latter process involves developmentally programmed genome rearrangements controlled by noncoding RNAs and a specialized RNA interference machinery. We describe our first attempts to identify genes and biological processes that contribute to the progression of the sexual cycle. Given the high percentage of unknown genes annotated in the P. tetraurelia genome, we applied a global strategy to monitor gene expression profiles during autogamy, a self-fertilization process. We focused this pilot study on the genes carried by the largest somatic chromosome and designed dedicated DNA arrays covering 484 genes from this chromosome (1.2% of all genes annotated in the genome). Transcriptome analysis revealed four major patterns of gene expression, including two successive waves of gene induction. Functional analysis of 15 upregulated genes revealed four that are essential for vegetative growth, one of which is involved in the maintenance of MAC integrity and another in cell division or membrane trafficking. Two additional genes, encoding a MIC-specific protein and a putative RNA helicase localizing to the old and then to the new MAC, are specifically required during sexual processes. Our work provides a proof of principle that genes essential for meiosis and nuclear reorganization can be uncovered following genome-wide transcriptome analysis. PMID:21257794

  18. Coordinated tissue-specific regulation of adjacent alternative 3′ splice sites in C. elegans

    PubMed Central

    Ragle, James Matthew; Katzman, Sol; Akers, Taylor F.; Barberan-Soler, Sergio; Zahler, Alan M.

    2015-01-01

    Adjacent alternative 3′ splice sites, those separated by ≤18 nucleotides, provide a unique problem in the study of alternative splicing regulation; there is overlap of the cis-elements that define the adjacent sites. Identification of the intron's 3′ end depends upon sequence elements that define the branchpoint, polypyrimidine tract, and terminal AG dinucleotide. Starting with RNA-seq data from germline-enriched and somatic cell-enriched Caenorhabditis elegans samples, we identify hundreds of introns with adjacent alternative 3′ splice sites. We identify 203 events that undergo tissue-specific alternative splicing. For these, the regulation is monodirectional, with somatic cells preferring to splice at the distal 3′ splice site (furthest from the 5′ end of the intron) and germline cells showing a distinct shift toward usage of the adjacent proximal 3′ splice site (closer to the 5′ end of the intron). Splicing patterns in somatic cells follow C. elegans consensus rules of 3′ splice site definition; a short stretch of pyrimidines preceding an AG dinucleotide. Splicing in germline cells occurs at proximal 3′ splice sites that lack a preceding polypyrimidine tract, and in three instances the germline-specific site lacks the AG dinucleotide. We provide evidence that use of germline-specific proximal 3′ splice sites is conserved across Caenorhabditis species. We propose that there are differences between germline and somatic cells in the way that the basal splicing machinery functions to determine the intron terminus. PMID:25922281

  19. Evaluation of porcine stem cell competence for somatic cell nuclear transfer and production of cloned animals.

    PubMed

    Secher, Jan O; Liu, Ying; Petkov, Stoyan; Luo, Yonglun; Li, Dong; Hall, Vanessa J; Schmidt, Mette; Callesen, Henrik; Bentzon, Jacob F; Sørensen, Charlotte B; Freude, Kristine K; Hyttel, Poul

    2017-03-01

    Porcine somatic cell nuclear transfer (SCNT) has been used extensively to create genetically modified pigs, but the efficiency of the methodology is still low. It has been hypothesized that pluripotent or multipotent stem cells might result in increased SCNT efficacy as these cells are closer than somatic cells to the epigenetic state found in the blastomeres and therefore need less reprogramming. Our group has worked with porcine SCNT during the last 20 years and here we describe our experience with SCNT of 3 different stem cell lines. The porcine stem cells used were: Induced pluripotent stem cells (iPSCs) created by lentiviral doxycycline-dependent reprogramming and cultered with a GSK3β- and MEK-inhibitor (2i) and leukemia inhibitor factor (LIF) (2i LIF DOX-iPSCs), iPSCs created by a plasmid-based reprogramming and cultured with 2i and fibroblast growth factor (FGF) (2i FGF Pl-iPSCs) and embryonic germ cells (EGCs), which have earlier been characterized as being multipotent. The SCNT efficiencies of these stem cell lines were compared with that of the two fibroblast cell lines from which the iPSC lines were derived. The blastocyst rates for the 2i LIF DOX-iPSCs were 14.7%, for the 2i FGF Pl-iPSC 10.1%, and for the EGCs 34.5% compared with the fibroblast lines yielding 36.7% and 25.2%. The fibroblast- and EGC-derived embryos were used for embryo transfer and produced live offspring at similar low rates of efficiency (3.2 and 4.0%, respectively) and with several instances of malformations. In conclusion, potentially pluripotent porcine stem cells resulted in lower rates of embryonic development upon SCNT than multipotent stem cells and differentiated somatic cells. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Cow's milk quality and energy value during different lactation stages.

    PubMed

    Salamończyk, Ewa

    2013-01-01

    The quality of dairy products, raw milk in particular, depends on many factors. Low bacterial and somatic cell counts are basic determinants of the appropriate raw milk quality. The objective of the work was to assess the effect of selected factors, that is, the age of cows and their daily milk performance, on cytological quality (somatic cell count) and energy value of milk produced at individual stages of lactation. Somatic cell count and energy value of cow's milk were assessed. A total of 229 792 milk samples were examined. Data for analysis were taken from milk records of 350 dairy herds. It was demonstrated that, of all the lactations studied, the fi rst lactation (from calving to the 100th day of lactation) was characterised by the highest daily milk performance (25.1 kg) and the lowest somatic cell count (356 thous./1 ml), fat, protein and dry matter contents (4.06, 2.96 and 12.41%, respectively) and milk calorific value (732 kcal/kg). The highest energy value was recorded in cow's milk produced towards the end of lactation, that is from day 300 till the end of lactation (842 kcal/kg). High milk calorific value in late lactation and high fat and protein contents were accompanied by low raw milk quality.

  1. Localization of alkali-labile sites in donkey (Equus asinus) and stallion (Equus caballus) spermatozoa.

    PubMed

    Cortés-Gutiérrez, Elva I; Dávila-Rodríguez, Martha I; López-Fernández, Carmen; Fernández, José Luis; Crespo, Francisco; Gosálvez, Jaime

    2014-01-15

    The presence of constitutive alkali-labile sites (ALS) has been investigated using a protocol of DNA breakage detection-fluorescence in situ hybridization and comet assay in spermatozoa of donkey (Equus asinus) and stallion (Equus caballus). These results were compared with those obtained using a similar experimental approach using somatic cells. The relative abundance of ALS was of the order of four times more in spermatozoa than in somatic cells. Alkali-labile sites showed a tendency to cluster localized at the equatorial-distal regions of the sperm. The amount of hybridized signal in the ALS in the sperm of donkey (Equus asinus) was 1.3 times greater than in stallion (Equus caballus), and the length of the comet tail obtained in donkey sperm was 1.6 times longer than that observed in stallion (P < 0.05); however, these differences were not appreciated in somatic cells. In conclusion, ALS localization in sperm is not a randomized event and a different pattern of ALS distribution occurs for each species. These results suggest that ALS represents a species-specific issue related to chromatin organization in sperm and somatic cells in mammalian species, and they might diverge even with very short phylogenetic distances. Copyright © 2014 Elsevier Inc. All rights reserved.

  2. Primary cutaneous B-cell lymphoma is associated with somatically hypermutated immunoglobulin variable genes and frequent use of VH1-69 and VH4-59 segments.

    PubMed

    Perez, M; Pacchiarotti, A; Frontani, M; Pescarmona, E; Caprini, E; Lombardo, G A; Russo, G; Faraggiana, T

    2010-03-01

    Accurate assessment of the somatic mutational status of clonal immunoglobulin variable region (IgV) genes is relevant in elucidating tumour cell origin in B-cell lymphoma; virgin B cells bear unmutated IgV genes, while germinal centre and postfollicular B cells carry mutated IgV genes. Furthermore, biases in the IgV repertoire and distribution pattern of somatic mutations indicate a possible antigen role in the pathogenesis of B-cell malignancies. This work investigates the cellular origin and antigenic selection in primary cutaneous B-cell lymphoma (PCBCL). We analysed the nucleotide sequence of clonal IgV heavy-chain gene (IgVH) rearrangements in 51 cases of PCBCL (25 follicle centre, 19 marginal zone and seven diffuse large B-cell lymphoma, leg-type) and compared IgVH sequences with their closest germline segment in the GenBank database. Molecular data were then correlated with histopathological features. We showed that all but one of the 51 IgVH sequences analysed exhibited extensive somatic hypermutations. The detected mutation rate ranged from 1.6% to 21%, with a median rate of 9.8% and was independent of PCBCL histotype. Calculation of antigen-selection pressure showed that 39% of the mutated IgVH genes displayed a number of replacement mutations and silent mutations in a pattern consistent with antigenic selection. Furthermore, two segments, VH1-69 (12%) and VH4-59 (14%), were preferentially used in our case series. Data indicate that neoplastic B cells of PBCBL have experienced germinal centre reaction and also suggest that the involvement of IgVH genes is not entirely random in PCBCL and that common antigen epitopes could be pathologically relevant in cutaneous lymphomagenesis.

  3. Chemical compound-based direct reprogramming for future clinical applications

    PubMed Central

    Takeda, Yukimasa; Harada, Yoshinori; Yoshikawa, Toshikazu; Dai, Ping

    2018-01-01

    Recent studies have revealed that a combination of chemical compounds enables direct reprogramming from one somatic cell type into another without the use of transgenes by regulating cellular signaling pathways and epigenetic modifications. The generation of induced pluripotent stem (iPS) cells generally requires virus vector-mediated expression of multiple transcription factors, which might disrupt genomic integrity and proper cell functions. The direct reprogramming is a promising alternative to rapidly prepare different cell types by bypassing the pluripotent state. Because the strategy also depends on forced expression of exogenous lineage-specific transcription factors, the direct reprogramming in a chemical compound-based manner is an ideal approach to further reduce the risk for tumorigenesis. So far, a number of reported research efforts have revealed that combinations of chemical compounds and cell-type specific medium transdifferentiate somatic cells into desired cell types including neuronal cells, glial cells, neural stem cells, brown adipocytes, cardiomyocytes, somatic progenitor cells, and pluripotent stem cells. These desired cells rapidly converted from patient-derived autologous fibroblasts can be applied for their own transplantation therapy to avoid immune rejection. However, complete chemical compound-induced conversions remain challenging particularly in adult human-derived fibroblasts compared with mouse embryonic fibroblasts (MEFs). This review summarizes up-to-date progress in each specific cell type and discusses prospects for future clinical application toward cell transplantation therapy. PMID:29739872

  4. Expression profile of senescence-associated beta-galactosidase and activation of telomerase in human ovarian surface epithelial cells undergoing immortalization.

    PubMed

    Litaker, J R; Pan, J; Cheung, Y; Zhang, D K; Liu, Y; Wong, S C; Wan, T S; Tsao, S W

    1998-11-01

    Senescence is a specific physiological stage of cells characterized by long population doubling time. It accounts for the inability of normal somatic cells to undergo indefinite cell division. As the number of population doublings increase, cell cycle regulatory mechanisms come into play and signal cells to exit the cell cycle and become senescent. Senescence has been implicated in the aging process and may function as a tumor suppressor mechanism in human cells. The ability to measure the degree of cellular senescence is important in understanding the biological processes regulating cell aging and immortalization. Senescent cells exhibit an enzyme termed senescence-associated histochemical staining. Cells immortalized by viral oncogenes often enter a stage of crisis at the early phase of immortalization. The cells at crisis have a long population doubling time. Cells at the crisis stage resemble senescent cells and the expression of SA- beta-Gal may be used to monitor the process of immortalization. In this study the expression profile of SA-beta-Gal was examined in human ovarian surface epithelial cells (HOSE 6-3) undergoing immortalization by the human papilloma viral oncogene E6 and E7 (HPV E6 and E7). Our results showed a low percentage (12.0%) of HOSE 6-3 cells expressing SA-beta-Gal activity at the pre-crisis stage. The percentage of HOSE 6-3 cells expressing SA-beta-Gal activity was highest (39.2%) at the crisis stage. When HOSE 6-3 cells achieved immortalized status there was a sharp decrease in cells (1. 3%) expressing SA-beta-Gal activity. In addition, an inverse relationship between the expression of SA-beta-Gal activity and telomerase activity was noted in cells undergoing immortalization. The results confirm that the SA-beta-Gal enzyme is a good marker for monitoring the population of cells undergoing senescence at different stages of immortalization and that telomerase activation is a characteristic feature of post-crisis cells.

  5. Cloned ferrets produced by somatic cell nuclear transfer.

    PubMed

    Li, Ziyi; Sun, Xingshen; Chen, Juan; Liu, Xiaoming; Wisely, Samantha M; Zhou, Qi; Renard, Jean-Paul; Leno, Gregory H; Engelhardt, John F

    2006-05-15

    Somatic cell nuclear transfer (SCNT) offers great potential for developing better animal models of human disease. The domestic ferret (Mustela putorius furo) is an ideal animal model for influenza infections and potentially other human respiratory diseases such as cystic fibrosis, where mouse models have failed to reproduce the human disease phenotype. Here, we report the successful production of live cloned, reproductively competent, ferrets using species-specific SCNT methodologies. Critical to developing a successful SCNT protocol for the ferret was the finding that hormonal treatment, normally used for superovulation, adversely affected the developmental potential of recipient oocytes. The onset of Oct4 expression was delayed and incomplete in parthenogenetically activated oocytes collected from hormone-treated females relative to oocytes collected from females naturally mated with vasectomized males. Stimulation induced by mating and in vitro oocyte maturation produced the optimal oocyte recipient for SCNT. Although nuclear injection and cell fusion produced mid-term fetuses at equivalent rates (approximately 3-4%), only cell fusion gave rise to healthy surviving clones. Single cell fusion rates and the efficiency of SCNT were also enhanced by placing two somatic cells into the perivitelline space. These species-specific modifications facilitated the birth of live, healthy, and fertile cloned ferrets. The development of microsatellite genotyping for domestic ferrets confirmed that ferret clones were genetically derived from their respective somatic cells and unrelated to their surrogate mother. With this technology, it is now feasible to begin generating genetically defined ferrets for studying transmissible and inherited human lung diseases. Cloning of the domestic ferret may also aid in recovery and conservation of the endangered black-footed ferret and European mink.

  6. Separation of somatic and germ cells is required to establish primate spermatogonial cultures.

    PubMed

    Langenstroth, Daniel; Kossack, Nina; Westernströer, Birgit; Wistuba, Joachim; Behr, Rüdiger; Gromoll, Jörg; Schlatt, Stefan

    2014-09-01

    Can primate spermatogonial cultures be optimized by application of separation steps and well defined culture conditions? We identified the cell fraction which provides the best source for primate spermatogonia when prolonged culture is desired. Man and marmoset show similar characteristics in regard to germ cell development and function. Several protocols for isolation and culture of human testis-derived germline stem cells have been described. Subsequent analysis revealed doubts on the germline origin of these cells and characterized them as mesenchymal stem cells or fibroblasts. Studies using marmosets as preclinical model confirmed that the published isolation protocols did not lead to propagation of germline cells. Testicular cells derived from nine adult marmoset monkeys (Callithrix jacchus) were cultured for 1, 3, 6 and 11 days and consecutively analyzed for the presence of spermatogonia, differentiating germ cells and testicular somatic cells. Testicular tissue of nine adult marmoset monkeys was enzymatically dissociated and subjected to two different cell culture approaches. In the first approach all cells were kept in the same dish (non-separate culture, n = 5). In the second approach the supernatant cells were transferred into a new dish 24 h after seeding and subsequently supernatant and attached cells were cultured separately (separate culture, n = 4). Real-time quantitative PCR and immunofluorescence were used to analyze the expression of reliable germ cell and somatic markers throughout the culture period. Germ cell transplantation assays and subsequent wholemount analyses were performed to functionally evaluate the colonization of spermatogonial cells. This is the first report revealing an efficient isolation and culture of putative marmoset spermatogonial stem cells with colonization ability. Our results indicate that a separation of spermatogonia from testicular somatic cells is a crucial step during cell preparation. We identified the overgrowth of more rapidly expanding somatic cells to be a major problem when establishing spermatogonial cultures. Initiating germ cell cultures from the supernatant and maintaining germ cells in suspension cultures minimized the somatic cell contamination and provided enriched germ cell fractions which displayed after 11 days of culture a significantly higher expression of germ cell markers genes (DDX-4, MAGE A-4; P < 0.05) compared with separately cultured attached cells. Additionally, germ cell transplantation experiments demonstrated a significantly higher absolute number of cells with colonization ability (P < 0.001) in supernatant cells after 11 days of separate culture. This study presents a relevant aspect for the successful setup of spermatogonial cultures but provides limited data regarding the question of whether the long-term maintenance of spermatogonia can be achieved. Transfer of these preclinical data to man may require modifications of the protocol. Spermatogonial cultures from rodents have become important and innovative tools for basic and applied research in reproductive biology and veterinary medicine. It is expected that spermatogonia-based strategies will be transformed into clinical applications for the treatment of male infertility. Our data in the marmoset monkey may be highly relevant to establish spermatogonial cultures of human testes. Funding was provided by the DFG-Research Unit FOR 1041 Germ Cell Potential (SCHL394/11-2) and by the Graduate Program Cell Dynamics and Disease (CEDAD) together with the International Max Planck Research School - Molecular Biomedicine (IMPRS-MBM). The authors declare that there is no conflict of interest. Not applicable. © The Author 2014. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  7. Compartmentalized beta subunit distribution determines characteristics and ethanol sensitivity of somatic, dendritic, and terminal large-conductance calcium-activated potassium channels in the rat central nervous system.

    PubMed

    Wynne, P M; Puig, S I; Martin, G E; Treistman, S N

    2009-06-01

    Neurons are highly differentiated and polarized cells, whose various functions depend upon the compartmentalization of ion channels. The rat hypothalamic-neurohypophysial system (HNS), in which cell bodies and dendrites reside in the hypothalamus, physically separated from their nerve terminals in the neurohypophysis, provides a particularly powerful preparation in which to study the distribution and regional properties of ion channel proteins. Using electrophysiological and immunohistochemical techniques, we characterized the large-conductance calcium-activated potassium (BK) channel in each of the three primary compartments (soma, dendrite, and terminal) of HNS neurons. We found that dendritic BK channels, in common with somatic channels but in contrast to nerve terminal channels, are insensitive to iberiotoxin. Furthermore, analysis of dendritic BK channel gating kinetics indicates that they, like somatic channels, have fast activation kinetics, in contrast to the slow gating of terminal channels. Dendritic and somatic channels are also more sensitive to calcium and have a greater conductance than terminal channels. Finally, although terminal BK channels are highly potentiated by ethanol, somatic and dendritic channels are insensitive to the drug. The biophysical and pharmacological properties of somatic and dendritic versus nerve terminal channels are consistent with the characteristics of exogenously expressed alphabeta1 versus alphabeta4 channels, respectively. Therefore, one possible explanation for our findings is a selective distribution of auxiliary beta1 subunits to the somatic and dendritic compartments and beta4 to the terminal compartment. This hypothesis is supported immunohistochemically by the appearance of distinct punctate beta1 or beta4 channel clusters in the membrane of somatic and dendritic or nerve terminal compartments, respectively.

  8. Whole-exome sequencing of primary plasma cell leukemia discloses heterogeneous mutational patterns.

    PubMed

    Cifola, Ingrid; Lionetti, Marta; Pinatel, Eva; Todoerti, Katia; Mangano, Eleonora; Pietrelli, Alessandro; Fabris, Sonia; Mosca, Laura; Simeon, Vittorio; Petrucci, Maria Teresa; Morabito, Fortunato; Offidani, Massimo; Di Raimondo, Francesco; Falcone, Antonietta; Caravita, Tommaso; Battaglia, Cristina; De Bellis, Gianluca; Palumbo, Antonio; Musto, Pellegrino; Neri, Antonino

    2015-07-10

    Primary plasma cell leukemia (pPCL) is a rare and aggressive form of plasma cell dyscrasia and may represent a valid model for high-risk multiple myeloma (MM). To provide novel information concerning the mutational profile of this disease, we performed the whole-exome sequencing of a prospective series of 12 pPCL cases included in a Phase II multicenter clinical trial and previously characterized at clinical and molecular levels. We identified 1, 928 coding somatic non-silent variants on 1, 643 genes, with a mean of 166 variants per sample, and only few variants and genes recurrent in two or more samples. An excess of C > T transitions and the presence of two main mutational signatures (related to APOBEC over-activity and aging) occurring in different translocation groups were observed. We identified 14 candidate cancer driver genes, mainly involved in cell-matrix adhesion, cell cycle, genome stability, RNA metabolism and protein folding. Furthermore, integration of mutation data with copy number alteration profiles evidenced biallelically disrupted genes with potential tumor suppressor functions. Globally, cadherin/Wnt signaling, extracellular matrix and cell cycle checkpoint resulted the most affected functional pathways. Sequencing results were finally combined with gene expression data to better elucidate the biological relevance of mutated genes. This study represents the first whole-exome sequencing screen of pPCL and evidenced a remarkable genetic heterogeneity of mutational patterns. This may provide a contribution to the comprehension of the pathogenetic mechanisms associated with this aggressive form of PC dyscrasia and potentially with high-risk MM.

  9. Ovarian folliculogenesis: detrimental effect of prenatal exposure to cyclophosphamide: a preliminary study.

    PubMed

    Ray, B; Potu, B K

    2010-01-01

    To investigate whether cyclophosphamide interferes with ovarian folliculogenesis. In this experiment, pregnant rats (n=12) were randomly assigned into two groups, control group (n=6) and cyclophosphamide treatment group (n=6). In the cyclophosphamide treatment group cyclophosphamide was injected intraperitoneally from day 10 of gestation till 20th day, at 2 mg/kg of body weight. The pregnant rats were sacrificed on gestation day 20 and the fetus was collected. The collected fetuses were processed for sectioning and stained with haematoxyline and eosin for microscopic observation of the ovaries. A meshwork-like appearance of mesenchyme with decreased number of somatic cells and absence of the majority of the germ cells in the ovarian follicles were found in treated fetus. Non-availability of primordial germ cells stopped the interaction between primordial germ cells and somatic supporting cells leading to nonproliferation and degeneration of somatic cells and fluid-filled vacant spaces in the meshwork -like arrangement of mesenchymal cells. We conclude that cyclophosphamide exposure prevents folliculogenesis by causing anovulation and results in infertility. The same detrimental effect might be seen in human fertility with environmental pollutants which are also metabolites of the drug (Fig. 2, Ref. 25).

  10. [Construction and characterization of liposomal magnetofection system in pig kidney cells].

    PubMed

    Chen, Wenjie; Cui, Haixin; Zhao, Xiang; Cui, Jinhui; Wang, Yan; Sun, Changjiao

    2014-06-01

    Magnetic nano gene vector is one of the non-viral gene vectors, modified by functional group to bind cationic transfect reagents. Coupling magnetofection with the universal lipofection we developed a novel somatic cell transfection method as the so-called liposomal magnetofection (LMF). This approach is potential to provide somatic cell cloning with stable genetic cell lines to cultivate transgenic animals. In order to construct such liposomal magnetic gene vectors complexes system, we used nano magnetic gene vector to combine with liposomal cationic transfect reagents by molecular self-assembly. This vectors system successfully carried exogenous gene and then transfected animal somatic cells. Here, we conducted atomic force microscopy (AFM), zeta potential-diameter analysis and other characterization experiments to investegate the size distribution and morphology of magnetic nanoparticles, the way of the vectors to load and concentrate DNA molecules. Our data reveal that, the LMF of Pig Kidney cells exhibited higher transfection efficiency comparing with the transfection mediated by the commercial lipofectamine2000. Moreover, LMF method overcomes the constraint of transient expression mediated by lipofection. Meanwhile, MTT assay showed low cytotoxicity of LMF. Hence, LMF is a feasible, low cytotoxic and effective method of cell transfection.

  11. Role of human oocyte-enriched factors in somatic cell reprograming.

    PubMed

    El-Gammal, Zaynab; AlOkda, Abdelrahman; El-Badri, Nagwa

    2018-06-08

    Cellular reprograming paves the way for creating functional patient-specific tissues to eliminate immune rejection responses by applying the same genetic profile. However, the epigenetic memory of a cell remains a challenge facing the current reprograming methods and does not allow transcription factors to bind properly. Because somatic cells can be reprogramed by transferring their nuclear contents into oocytes, introducing specific oocyte factors into differentiated cells is considered a promising approach for mimicking the reprograming process that occurs during fertilization. Mammalian metaphase II oocyte possesses a superior capacity to epigenetically reprogram somatic cell nuclei towards an embryonic stem cell-like state than the current factor-based reprograming approaches. This may be due to the presence of specific factors that are lacking in the current factor-based reprograming approaches. In this review, we focus on studies identifying human oocyte-enriched factors aiming to understand the molecular mechanisms mediating cellular reprograming. We describe the role of oocyte-enriched factors in metabolic switch, chromatin remodelling, and global epigenetic transformation. This is critical for improving the quality of resulting reprogramed cells, which is crucial for therapeutic applications. Copyright © 2018 Elsevier B.V. All rights reserved.

  12. Induction of pluripotent stem cells from fibroblast cultures.

    PubMed

    Takahashi, Kazutoshi; Okita, Keisuke; Nakagawa, Masato; Yamanaka, Shinya

    2007-01-01

    Clinical application of embryonic stem (ES) cells faces difficulties regarding use of embryos, as well as tissue rejection after implantation. One way to circumvent these issues is to generate pluripotent stem cells directly from somatic cells. Somatic cells can be reprogrammed to an embryonic-like state by the injection of a nucleus into an enucleated oocyte or by fusion with ES cells. However, little is known about the mechanisms underlying these processes. We have recently shown that the combination of four transcription factors can generate ES-like pluripotent stem cells directly from mouse fibroblast cultures. The cells, named induced pluripotent stem (iPS) cells, can be differentiated into three germ layers and committed to chimeric mice. Here we describe detailed methods and tips for the generation of iPS cells.

  13. The Drosophila BCL6 homolog Ken and Barbie promotes somatic stem cell self-renewal in the testis niche.

    PubMed

    Issigonis, Melanie; Matunis, Erika

    2012-08-15

    Stem cells sustain tissue regeneration by their remarkable ability to replenish the stem cell pool and to generate differentiating progeny. Signals from local microenvironments, or niches, control stem cell behavior. In the Drosophila testis, a group of somatic support cells called the hub creates a stem cell niche by locally activating the Janus Kinase-Signal Transducer and Activator of Transcription (JAK-STAT) pathway in two adjacent types of stem cells: germline stem cells (GSCs) and somatic cyst stem cells (CySCs). Here, we find that ken and barbie (ken) is autonomously required for the self-renewal of CySCs but not GSCs. Furthermore, Ken misexpression in the CySC lineage induces the cell-autonomous self-renewal of somatic cells as well as the nonautonomous self-renewal of germ cells outside the niche. Thus, Ken, like Stat92E and its targets ZFH1 (Leatherman and Dinardo, 2008) and Chinmo (Flaherty et al., 2010), is necessary and sufficient for CySC renewal. However, ken is not a JAK-STAT target in the testis, but instead acts in parallel to Stat92E to ensure CySC self-renewal. Ken represses a subset of Stat92E targets in the embryo (Arbouzova et al., 2006) suggesting that Ken maintains CySCs by repressing differentiation factors. In support of this hypothesis, we find that the global JAK-STAT inhibitor Protein tyrosine phosphatase 61F (Ptp61F) is a JAK-STAT target in the testis that is repressed by Ken. Together, our work demonstrates that Ken has an important role in the inhibition of CySC differentiation. Studies of ken may inform our understanding of its vertebrate orthologue B-Cell Lymphoma 6 (BCL6) and how misregulation of this oncogene leads to human lymphomas. Copyright © 2012 Elsevier Inc. All rights reserved.

  14. Somatic Embryogenesis in Peach Palm Using the Thin Cell Layer Technique: Induction, Morpho-histological Aspects and AFLP Analysis of Somaclonal Variation

    PubMed Central

    Steinmacher, D. A.; Krohn, N. G.; Dantas, A. C. M.; Stefenon, V. M.; Clement, C. R.; Guerra, M. P.

    2007-01-01

    Background and Aims The thin cell layer (TCL) technique is based on the use of very small explants and has allowed enhanced in vitro morphogenesis in several plant species. The present study evaluated the TCL technique as a procedure for somatic embryo production and plantlet regeneration of peach palm. Methods TCL explants from different positions in the shoot apex and leaf sheath of peach palm were cultivated in MS culture medium supplemented with 0–600 µm Picloram in the presence of activated charcoal. The production of primary calli and embryogenic calli was evaluated in these different conditions. Histological and amplified fragment length polymorphism (AFLP) analyses were conducted to study in vitro morphogenetic responses and genetic stability, respectively, of the regenerated plantlets. Key Results Abundant primary callus induction was observed from TCLs of the shoot meristem in culture media supplemented with 150–600 µm Picloram (83–97 %, respectively). The production of embryogenic calli depends on Picloram concentration and explant position. The best response observed was 43 % embryogenic callus production from shoot meristem TCL on 300 µm Picloram. In maturation conditions, 34 ± 4 somatic embryos per embryogenic callus were obtained, and 45·0 ± 3·4 % of these fully developed somatic embryos were converted, resulting in plantlets ready for acclimatization, of which 80 % survived. Histological studies revealed that the first cellular division events occurred in cells adjacent to vascular tissue, resulting in primary calli, whose growth was ensured by a meristematic zone. A multicellular origin of the resulting somatic embryos arising from the meristematic zone is suggested. During maturation, histological analyses revealed bipolarization of the somatic embryos, as well as the development of new somatic embryos. AFLP analyses revealed that 92 % of the regenerated plantlets were true to type. The use of TCL explants considerably improves the number of calli and somatic embryos produced in comparison with previously described protocols for in vitro regeneration of peach palm. Conclusions The present study suggests that the TCL somatic embryogenesis protocol developed is feasible, although it still requires further optimization for in vitro multiplication of peach palm, especially the use of similar explants obtained from adult palm trees. PMID:17670751

  15. Growth and development of cultured carrot cells and embryos under spaceflight conditions

    NASA Technical Reports Server (NTRS)

    Krikorian, A. D.; Dutcher, F. R.; Quinn, C. E.; Steward, F. C.

    1981-01-01

    Morphogenetically competent proembryonic cells and well-developed somatic embryos of carrot at two levels of organization were exposed for 18.5 days to a hypogravity environment aboard the Soviet Biosatellite Cosmos 1129. It was confirmed that cultured totipotent cells of carrot can give rise to embryos with well-developed roots and minimally developed shoots. It was also shown that the space hypogravity environment could support the further growth of already-organized, later somatic embryonic stages and give rise to fully developed embryo-plantlets with roots and shoots.

  16. Cell cycle-regulated proteolysis of mitotic target proteins.

    PubMed

    Bastians, H; Topper, L M; Gorbsky, G L; Ruderman, J V

    1999-11-01

    The ubiquitin-dependent proteolysis of mitotic cyclin B, which is catalyzed by the anaphase-promoting complex/cyclosome (APC/C) and ubiquitin-conjugating enzyme H10 (UbcH10), begins around the time of the metaphase-anaphase transition and continues through G1 phase of the next cell cycle. We have used cell-free systems from mammalian somatic cells collected at different cell cycle stages (G0, G1, S, G2, and M) to investigate the regulated degradation of four targets of the mitotic destruction machinery: cyclins A and B, geminin H (an inhibitor of S phase identified in Xenopus), and Cut2p (an inhibitor of anaphase onset identified in fission yeast). All four are degraded by G1 extracts but not by extracts of S phase cells. Maintenance of destruction during G1 requires the activity of a PP2A-like phosphatase. Destruction of each target is dependent on the presence of an N-terminal destruction box motif, is accelerated by additional wild-type UbcH10 and is blocked by dominant negative UbcH10. Destruction of each is terminated by a dominant activity that appears in nuclei near the start of S phase. Previous work indicates that the APC/C-dependent destruction of anaphase inhibitors is activated after chromosome alignment at the metaphase plate. In support of this, we show that addition of dominant negative UbcH10 to G1 extracts blocks destruction of the yeast anaphase inhibitor Cut2p in vitro, and injection of dominant negative UbcH10 blocks anaphase onset in vivo. Finally, we report that injection of dominant negative Ubc3/Cdc34, whose role in G1-S control is well established and has been implicated in kinetochore function during mitosis in yeast, dramatically interferes with congression of chromosomes to the metaphase plate. These results demonstrate that the regulated ubiquitination and destruction of critical mitotic proteins is highly conserved from yeast to humans.

  17. Assignment of electron transfer flavoprotein-ubiquinone oxidoreductase (ETF-QO) to human chromosome 4q33 by fluorescence in situ hybridization and somatic cell hybridization.

    PubMed

    Spector, E B; Seltzer, W K; Goodman, S I

    1999-08-01

    Electron transfer flavoprotein-ubiquinone oxidoreductase (ETF-QO) is a nuclear-encoded protein located in the inner mitochondrial membrane. Inherited defects of ETF-QO cause glutaric acidemia type II. We here describe the localization of the ETF-QO gene to human chromosome 4q33 by somatic cell hybridization and fluorescence in situ hybridization. Copyright 1999 Academic Press.

  18. Somatic mosaicism caused by monoallelic reversion of a mutation in T cells of a patient with ADA-SCID and the effects of enzyme replacement therapy on the revertant phenotype.

    PubMed

    Moncada-Vélez, M; Vélez-Ortega, A; Orrego, J; Santisteban, I; Jagadeesh, J; Olivares, M; Olaya, N; Hershfield, M; Candotti, F; Franco, J

    2011-11-01

    Patients with adenosine deaminase (ADA) deficiency exhibit spontaneous and partial clinical remission associated with somatic reversion of inherited mutations. We report a child with severe combined immunodeficiency (T-B- SCID) due to ADA deficiency diagnosed at the age of 1 month, whose lymphocyte counts including CD4+ and CD8+ T and NK cells began to improve after several months with normalization of ADA activity in Peripheral blood lymphocytes (PBL), as a result of somatic mosaicism caused by monoallelic reversion of the causative mutation in the ADA gene. He was not eligible for haematopoietic stem cell transplantation (HSCT) or gene therapy (GT); therefore he was placed on enzyme replacement therapy (ERT) with bovine PEG-ADA. The follow-up of metabolic and immunologic responses to ERT included gradual improvement in ADA activity in erythrocytes and transient expansion of most lymphocyte subsets, followed by gradual stabilization of CD4+ and CD8+ T (with naïve phenotype) and NK cells, and sustained expansion of TCRγδ+ T cells. This was accompanied by the disappearance of the revertant T cells as shown by DNA sequencing from PBL. Although the patient's clinical condition improved marginally, he later developed a germinal cell tumour and eventually died at the age of 67 months from sepsis. This case adds to our current knowledge of spontaneous reversion of mutations in ADA deficiency and shows that the effects of the ERT may vary among these patients, suggesting that it could depend on the cell and type in which the somatic mosaicism is established upon reversion. © 2011 The Authors. Scandinavian Journal of Immunology © 2011 Blackwell Publishing Ltd.

  19. Somatic mosaicism due to monoallelic reversion of a mutation in T cells of an ADA-SCID patient and the effects of enzyme replacement therapy on the revertant phenotype

    PubMed Central

    Moncada-Vélez, Marcela; Vélez-Ortega, Alejandra C.; Orrego, Julio C.; Santisteban, Inés; Jagadeesh, Jayashree; Olivares, Margarita; Olaya, Natalia; Hershfield, Michael S.; Candotti, Fabio; Franco, Jose L.

    2011-01-01

    Patients with adenosine deaminase (ADA) deficiency exhibit spontaneous and partial clinical remission associated with somatic reversion of inherited mutations. We report a child with severe combined immunodeficiency (T-B-NK- SCID) due to ADA deficiency diagnosed at the age of 1 month, whose lymphocyte counts including CD4+ and CD8+ T and NK cells began to improve after several months with normalization of ADA activity in PBL, as a result of somatic mosaicism due to monoallelic reversion of the causative mutation in the ADA gene. Our patient was not eligible for hematopoietic stem cell transplantation (HSCT) or gene therapy (GT); therefore enzyme replacement therapy (ERT) with bovine PEG-ADA was initiated. The follow up of metabolic and immunologic responses to ERT included gradual improvement in ADA activity in erythrocytes and transient expansion of most lymphocyte subsets, followed by gradual stabilization of CD4+ and CD8+ T (with naïve phenotype) and NK cells, with sustained expansion of TCRγδ+ T cells. This was accompanied by disappearance of the revertant T cells as shown by DNA sequencing from PBL. Although the patient’s clinical condition improved marginally, he later developed a germinal cell tumor and eventually died at the age of 67 months from sepsis. This case adds to our current knowledge of spontaneous reversion of mutations in ADA deficiency and shows that the effects of the ERT may vary among these patients, suggesting that it could depend on the cell and type in which the somatic mosaicism is established upon reversion. PMID:21671975

  20. Transmissible [corrected] dog cancer genome reveals the origin and history of an ancient cell lineage.

    PubMed

    Murchison, Elizabeth P; Wedge, David C; Alexandrov, Ludmil B; Fu, Beiyuan; Martincorena, Inigo; Ning, Zemin; Tubio, Jose M C; Werner, Emma I; Allen, Jan; De Nardi, Andrigo Barboza; Donelan, Edward M; Marino, Gabriele; Fassati, Ariberto; Campbell, Peter J; Yang, Fengtang; Burt, Austin; Weiss, Robin A; Stratton, Michael R

    2014-01-24

    Canine transmissible venereal tumor (CTVT) is the oldest known somatic cell lineage. It is a transmissible cancer that propagates naturally in dogs. We sequenced the genomes of two CTVT tumors and found that CTVT has acquired 1.9 million somatic substitution mutations and bears evidence of exposure to ultraviolet light. CTVT is remarkably stable and lacks subclonal heterogeneity despite thousands of rearrangements, copy-number changes, and retrotransposon insertions. More than 10,000 genes carry nonsynonymous variants, and 646 genes have been lost. CTVT first arose in a dog with low genomic heterozygosity that may have lived about 11,000 years ago. The cancer spawned by this individual dispersed across continents about 500 years ago. Our results provide a genetic identikit of an ancient dog and demonstrate the robustness of mammalian somatic cells to survive for millennia despite a massive mutation burden.

  1. Analysis of a four generation family reveals the widespread sequence-dependent maintenance of allelic DNA methylation in somatic and germ cells

    PubMed Central

    Tang, Aifa; Huang, Yi; Li, Zesong; Wan, Shengqing; Mou, Lisha; Yin, Guangliang; Li, Ning; Xie, Jun; Xia, Yudong; Li, Xianxin; Luo, Liya; Zhang, Junwen; Chen, Shen; Wu, Song; Sun, Jihua; Sun, Xiaojuan; Jiang, Zhimao; Chen, Jing; Li, Yingrui; Wang, Jian; Wang, Jun; Cai, Zhiming; Gui, Yaoting

    2016-01-01

    Differential methylation of the homologous chromosomes, a well-known mechanism leading to genomic imprinting and X-chromosome inactivation, is widely reported at the non-imprinted regions on autosomes. To evaluate the transgenerational DNA methylation patterns in human, we analyzed the DNA methylomes of somatic and germ cells in a four-generation family. We found that allelic asymmetry of DNA methylation was pervasive at the non-imprinted loci and was likely regulated by cis-acting genetic variants. We also observed that the allelic methylation patterns for the vast majority of the cis-regulated loci were shared between the somatic and germ cells from the same individual. These results demonstrated the interaction between genetic and epigenetic variations and suggested the possibility of widespread sequence-dependent transmission of DNA methylation during spermatogenesis. PMID:26758766

  2. Sexual Fate Change of XX Germ Cells Caused by the Deletion of SMAD4 and STRA8 Independent of Somatic Sex Reprogramming

    PubMed Central

    Wu, Quan; Fukuda, Kurumi; Kato, Yuzuru; Zhou, Zhi; Deng, Chu-Xia; Saga, Yumiko

    2016-01-01

    The differential programming of sperm and eggs in gonads is a fundamental topic in reproductive biology. Although the sexual fate of germ cells is believed to be determined by signaling factors from sexually differentiated somatic cells in fetal gonads, the molecular mechanism that determines germ cell fate is poorly understood. Herein, we show that mothers against decapentaplegic homolog 4 (SMAD4) in germ cells is required for female-type differentiation. Germ cells in Smad4-deficient ovaries respond to retinoic acid signaling but fail to undergo meiotic prophase I, which coincides with the weaker expression of genes required for follicular formation, indicating that SMAD4 signaling is essential for oocyte differentiation and meiotic progression. Intriguingly, germline-specific deletion of Smad4 in Stra8-null female germ cells resulted in the up-regulation of genes required for male gonocyte differentiation, including Nanos2 and PLZF, suggesting the initiation of male-type differentiation in ovaries. Moreover, our transcriptome analyses of mutant ovaries revealed that the sex change phenotype is achieved without global gene expression changes in somatic cells. Our results demonstrate that SMAD4 and STRA8 are essential factors that regulate the female fate of germ cells. PMID:27606421

  3. A novel method for the production of transgenic cloned pigs: electroporation-mediated gene transfer to non-cultured cells and subsequent selection with puromycin.

    PubMed

    Watanabe, Satoshi; Iwamoto, Masaki; Suzuki, Shun-ichi; Fuchimoto, Daiichiro; Honma, Daisuke; Nagai, Takashi; Hashimoto, Michiko; Yazaki, Satoko; Sato, Masahiro; Onishi, Akira

    2005-02-01

    Puromycin N-acetyl transferase gene (pac), of which the gene product catalyzes antibiotic puromycin (an effective inhibitor of protein synthesis), has been widely used as a dominant selection marker in embryonic stem (ES) cell-mediated transgenesis. The present study is the first to report on the usefulness of puromycin for production of enhanced green fluorescent protein (EGFP) transgenic piglets after somatic cell cloning and embryo transfer. Somatic cells isolated from porcine fetuses at 73 days of gestation were immediately electroporated with a transgene (pCAG-EGFPac) carrying both EGFP cDNA and pac. This procedure aims to avoid aging effects thought to be generated during cell culture. The recombinant cells were selected with puromycin at a low concentration (2 microg/ml), cultured for 7 days, and then screened for EGFP expression before somatic cell cloning. The manipulated embryos were transplanted into the oviducts of 14 foster mother sows. Four of the foster sows became pregnant and nine piglets were delivered. Of the nine piglets, eight died shortly after birth and one grew healthy after weaning. Results indicate that puromycin can be used for the selection of recombinant cells from noncultured cells, and moreover, may confer the production of genetically engineered newborns via nuclear transfer techniques in pigs.

  4. Expansion of somatically reverted memory CD8+ T cells in patients with X-linked lymphoproliferative disease caused by selective pressure from Epstein-Barr virus

    PubMed Central

    Low, Carol; Bell, Andrew I.; Abbott, Rachel J.M.; Phan, Tri Giang; Riminton, D. Sean; Choo, Sharon; Smart, Joanne M.; Lougaris, Vassilios; Giliani, Silvia; Buckley, Rebecca H.; Grimbacher, Bodo; Alvaro, Frank; Klion, Amy D.; Nichols, Kim E.; Adelstein, Stephen; Rickinson, Alan B.

    2012-01-01

    Patients with the primary immunodeficiency X-linked lymphoproliferative disease (XLP), which is caused by mutations in SH2D1A, are highly susceptible to Epstein-Barr virus (EBV) infection. Nonetheless, some XLP patients demonstrate less severe clinical manifestations after primary infection. SH2D1A encodes the adaptor molecule SLAM-associated protein (SAP), which is expressed in T and natural killer cells and is required for cytotoxicity against B cells, the reservoir for EBV. It is not known why the clinical presentation of XLP is so variable. In this study, we report for the first time the occurrence of somatic reversion in XLP. Reverted SAP-expressing cells resided exclusively within the CD8+ T cell subset, displayed a CD45RA−CCR7− effector memory phenotype, and were maintained at a stable level over time. Importantly, revertant CD8+ SAP+ T cells, but not SAP− cells, proliferated in response to EBV and killed EBV-infected B cells. As somatic reversion correlated with EBV infection, we propose that the virus exerts a selective pressure on the reverted cells, resulting in their expansion in vivo and host protection against ongoing infection. PMID:22493517

  5. Sexual Fate Change of XX Germ Cells Caused by the Deletion of SMAD4 and STRA8 Independent of Somatic Sex Reprogramming.

    PubMed

    Wu, Quan; Fukuda, Kurumi; Kato, Yuzuru; Zhou, Zhi; Deng, Chu-Xia; Saga, Yumiko

    2016-09-01

    The differential programming of sperm and eggs in gonads is a fundamental topic in reproductive biology. Although the sexual fate of germ cells is believed to be determined by signaling factors from sexually differentiated somatic cells in fetal gonads, the molecular mechanism that determines germ cell fate is poorly understood. Herein, we show that mothers against decapentaplegic homolog 4 (SMAD4) in germ cells is required for female-type differentiation. Germ cells in Smad4-deficient ovaries respond to retinoic acid signaling but fail to undergo meiotic prophase I, which coincides with the weaker expression of genes required for follicular formation, indicating that SMAD4 signaling is essential for oocyte differentiation and meiotic progression. Intriguingly, germline-specific deletion of Smad4 in Stra8-null female germ cells resulted in the up-regulation of genes required for male gonocyte differentiation, including Nanos2 and PLZF, suggesting the initiation of male-type differentiation in ovaries. Moreover, our transcriptome analyses of mutant ovaries revealed that the sex change phenotype is achieved without global gene expression changes in somatic cells. Our results demonstrate that SMAD4 and STRA8 are essential factors that regulate the female fate of germ cells.

  6. Release of somatic embryogenic potential from excised zygotic embryos of carrot and maintenance of proembryonic cultures in hormone-free medium.

    PubMed

    Smith, D L; Krikorian, A D

    1989-01-01

    Excised zygotic embryos, mericarps ("seeds") and hypocotyls of seedlings of cultivated carrot Daucus carota cv. Scarlet Nantes were evaluated for their ability to generate somatic embryos on a semisolid hormone-free nutrient medium. Neither intact zygotic embryos nor hypocotyls ever produced somatic embryos. However, mericarps and broken zygotic embryos were excellent sources for somatic embryo production (response levels as high as 86%). Somatic embryo formation was highest from cotyledons, but was also observed on isolated hypocotyls and root tips of mature zygotic embryos. On media containing unreduced nitrogen, somatic embryo formation led to the generation of vigorous cultures comprised entirely of somatic embryos at various stages of development which in turn proliferated still other somatic embryos. However, a medium was devised which when 1-5 mM NH4+ was the sole nitrogen source, led only to a proliferation of globular proembryos. Sustained subculturing of these proembryos at 2-3 week intervals enabled establishment of highly uniform cultures in which no further development into more mature stages of embryonic development occurred. These have been maintained, without decline, as morphogenetically competent proembryonic globules for over ten months. A basal medium containing from 1-5 mM NH4+ as the sole nitrogen source appears not to be inductive to somatic proembryo formation. Instead, such a medium is best thought of as permissive to the expression of embryogenically determined cells within zygotic embryos. By excising and breaking or wounding zygotic embryos, constituent cells are probably released from positional or chemical restraints and thus are able to express their innate embryogenic potential. Once a proembryonic culture is established, this medium containing 1-5 mM NH4+ as the sole nitrogen source provides a nonpermissive environment to the development and growth of later embryonic stages, but it does allow the continued formation and multiplication of globular somatic proembryos. The sequence of events leading from excised broken zygotic embryos to the formation of somatic embryos and the maintenance of somatic proembryos are demonstrated by scanning electron microscopy and histological preparations. Germination levels from intact zygotic embryos on media with varying levels and ratios of unreduced vs. reduced inorganic nitrogen were determined as well and provided baseline or control data on the type of response obtained from nonwounded material.

  7. Release of somatic embryogenic potential from excised zygotic embryos of carrot and maintenance of proembryonic cultures in hormone-free medium

    NASA Technical Reports Server (NTRS)

    Smith, D. L.; Krikorian, A. D.

    1989-01-01

    Excised zygotic embryos, mericarps ("seeds") and hypocotyls of seedlings of cultivated carrot Daucus carota cv. Scarlet Nantes were evaluated for their ability to generate somatic embryos on a semisolid hormone-free nutrient medium. Neither intact zygotic embryos nor hypocotyls ever produced somatic embryos. However, mericarps and broken zygotic embryos were excellent sources for somatic embryo production (response levels as high as 86%). Somatic embryo formation was highest from cotyledons, but was also observed on isolated hypocotyls and root tips of mature zygotic embryos. On media containing unreduced nitrogen, somatic embryo formation led to the generation of vigorous cultures comprised entirely of somatic embryos at various stages of development which in turn proliferated still other somatic embryos. However, a medium was devised which when 1-5 mM NH4+ was the sole nitrogen source, led only to a proliferation of globular proembryos. Sustained subculturing of these proembryos at 2-3 week intervals enabled establishment of highly uniform cultures in which no further development into more mature stages of embryonic development occurred. These have been maintained, without decline, as morphogenetically competent proembryonic globules for over ten months. A basal medium containing from 1-5 mM NH4+ as the sole nitrogen source appears not to be inductive to somatic proembryo formation. Instead, such a medium is best thought of as permissive to the expression of embryogenically determined cells within zygotic embryos. By excising and breaking or wounding zygotic embryos, constituent cells are probably released from positional or chemical restraints and thus are able to express their innate embryogenic potential. Once a proembryonic culture is established, this medium containing 1-5 mM NH4+ as the sole nitrogen source provides a nonpermissive environment to the development and growth of later embryonic stages, but it does allow the continued formation and multiplication of globular somatic proembryos. The sequence of events leading from excised broken zygotic embryos to the formation of somatic embryos and the maintenance of somatic proembryos are demonstrated by scanning electron microscopy and histological preparations. Germination levels from intact zygotic embryos on media with varying levels and ratios of unreduced vs. reduced inorganic nitrogen were determined as well and provided baseline or control data on the type of response obtained from nonwounded material.

  8. Prevalence of somatic mitochondrial mutations and spatial distribution of mitochondria in non-small cell lung cancer.

    PubMed

    Kazdal, Daniel; Harms, Alexander; Endris, Volker; Penzel, Roland; Kriegsmann, Mark; Eichhorn, Florian; Muley, Thomas; Stenzinger, Albrecht; Pfarr, Nicole; Weichert, Wilko; Warth, Arne

    2017-07-11

    Mitochondria are considered relevant players in many tumour entities and first data indicate beneficial effects of mitochondria-targeted antioxidants in both cancer prevention and anticancer therapies. To further dissect the potential roles of mitochondria in NSCLC we comprehensively analysed somatic mitochondrial mutations, determined the spatial distribution of mitochondrial DNA within complete tumour sections and investigated the mitochondrial load in a large-scale approach. Whole mitochondrial genome sequencing of 26 matched tumour and non-neoplastic tissue samples extended by reviewing published data of 326 cases. Systematical stepwise real-time PCR quantification of mitochondrial DNA covering 16 whole surgical tumour sections. Immunohistochemical determination of the mitochondrial load in 171 adenocarcinoma and 145 squamous cell carcinoma. Our results demonstrate very low recurrences (max. 1.7%) and a broad distribution of 456 different somatic mitochondrial mutations. Large inter- and intra-tumour heterogeneity were seen for mitochondrial DNA copy numbers in conjunction with a correlation to the predominant histological growth pattern. Furthermore, tumour cells had significantly higher mitochondrial level compared to adjacent stroma, whereas differences between tumour entities were negligible. Non-evident somatic mitochondrial mutations and highly varying mitochondrial DNA level delineate challenges for the approach of mitochondria-targeted anticancer therapies in NSCLC.

  9. Multiple independent second-site mutations in two siblings with somatic mosaicism for Wiskott-Aldrich syndrome.

    PubMed

    Boztug, K; Germeshausen, M; Avedillo Díez, I; Gulacsy, V; Diestelhorst, J; Ballmaier, M; Welte, K; Maródi, L; Chernyshova, Li; Klein, C

    2008-07-01

    Wiskott-Aldrich syndrome (WAS) is an X-linked primary immunodeficiency disorder associated with microthrombocytopenia, eczema, autoimmunity and predisposition to malignant lymphoma. Although rare, few cases of somatic mosaicism have been published in WAS patients to date. We here report on two Ukrainian siblings who were referred to us at the age of 3 and 4 years, respectively. Both patients suffered from severe WAS caused by a nonsense mutation in exon 1 of the WAS gene. In both siblings, flow cytometric analysis revealed the presence of Wiskott-Aldrich syndrome protein (WASp)-positive and WASp-negative cell populations among T and B lymphocytes as well as natural killer (NK) cells. In contrast to previously described cases of revertant mosaicism in WAS, molecular analyses in both children showed that the WASp-positive T cells, B cells, and NK cells carried multiple different second-site mutations, resulting in different missense mutations. To our knowledge, this is the first report describing somatic mosaicism in WAS patients caused by several independent second-site mutations in the WAS gene.

  10. Activation of individual L1 retrotransposon instances is restricted to cell-type dependent permissive loci

    PubMed Central

    Philippe, Claude; Vargas-Landin, Dulce B; Doucet, Aurélien J; van Essen, Dominic; Vera-Otarola, Jorge; Kuciak, Monika; Corbin, Antoine; Nigumann, Pilvi; Cristofari, Gaël

    2016-01-01

    LINE-1 (L1) retrotransposons represent approximately one sixth of the human genome, but only the human-specific L1HS-Ta subfamily acts as an endogenous mutagen in modern humans, reshaping both somatic and germline genomes. Due to their high levels of sequence identity and the existence of many polymorphic insertions absent from the reference genome, the transcriptional activation of individual genomic L1HS-Ta copies remains poorly understood. Here we comprehensively mapped fixed and polymorphic L1HS-Ta copies in 12 commonly-used somatic cell lines, and identified transcriptional and epigenetic signatures allowing the unambiguous identification of active L1HS-Ta copies in their genomic context. Strikingly, only a very restricted subset of L1HS-Ta loci - some being polymorphic among individuals - significantly contributes to the bulk of L1 expression, and these loci are differentially regulated among distinct cell lines. Thus, our data support a local model of L1 transcriptional activation in somatic cells, governed by individual-, locus-, and cell-type-specific determinants. DOI: http://dx.doi.org/10.7554/eLife.13926.001 PMID:27016617

  11. Transient translational quiescence in primordial germ cells

    PubMed Central

    Oulhen, Nathalie; Swartz, S. Zachary; Laird, Jessica; Mascaro, Alexandra

    2017-01-01

    Stem cells in animals often exhibit a slow cell cycle and/or low transcriptional activity referred to as quiescence. Here, we report that the translational activity in the primordial germ cells (PGCs) of the sea urchin embryo (Strongylocentrotus purpuratus) is quiescent. We measured new protein synthesis with O-propargyl-puromycin and L-homopropargylglycine Click-iT technologies, and determined that these cells synthesize protein at only 6% the level of their adjacent somatic cells. Knockdown of translation of the RNA-binding protein Nanos2 by morpholino antisense oligonucleotides, or knockout of the Nanos2 gene by CRISPR/Cas9 resulted in a significant, but partial, increase (47%) in general translation specifically in the PGCs. We found that the mRNA of the translation factor eEF1A is excluded from the PGCs in a Nanos2-dependent manner, a consequence of a Nanos/Pumilio response element (PRE) in its 3′UTR. In addition to eEF1A, the cytoplasmic pH of the PGCs appears to repress translation and simply increasing the pH also significantly restores translation selectively in the PGCs. We conclude that the PGCs of this sea urchin institute parallel pathways to quiesce translation thoroughly but transiently. PMID:28235822

  12. Bottlenecks in bog pine multiplication by somatic embryogenesis and their visualization with the environmental scanning electron microscope.

    PubMed

    Vlašínová, Helena; Neděla, Vilem; Đorđević, Biljana; Havel, Ladislav

    2017-07-01

    Somatic embryogenesis (SE) is an important biotechnological technique used for the propagation of many pine species in vitro. However, in bog pine, one of the most endangered tree species in the Czech Republic, limitations were observed, which negatively influenced the development and further germination of somatic embryos. Although initiation frequency was very low-0.95 %, all obtained cell lines were subjected to maturation. The best responding cell line (BC1) was used and subjected to six different variants of the maturation media. The media on which the highest number of early-precotyledonary/cotyledonary somatic embryos was formed was supplemented with 121 μM abscisic acid (ABA) and with 6 % maltose. In the end of maturation experiments, different abnormalities in formation of somatic embryos were observed. For visualization and identification of abnormalities in meristem development during proliferation and maturation processes, the environmental scanning electron microscope was used. In comparison to the classical light microscope, the non-commercial environmental scanning electron microscope AQUASEM II has been found as a very useful tool for the quick recognition of apical meristem disruption and abnormal development. To our knowledge, this is the first report discussing somatic embryogenesis in bog pine. Based on this observation, the cultivation procedure could be enhanced and the method for SE of bog pine optimized.

  13. Somatic stem cell heterogeneity: diversity in the blood, skin and intestinal stem cell compartments

    PubMed Central

    Goodell, Margaret A.; Nguyen, Hoang; Shroyer, Noah

    2017-01-01

    Somatic stem cells replenish many tissues throughout life to repair damage and to maintain tissue homeostasis. Stem cell function is frequently described as following a hierarchical model in which a single master cell undergoes self-renewal and differentiation into multiple cell types and is responsible for most regenerative activity. However, recent data from studies on blood, skin and intestinal epithelium all point to the concomitant action of multiple types of stem cells with distinct everyday roles. Under stress conditions such as acute injury, the surprising developmental flexibility of these stem cells enables them to adapt to diverse roles and to acquire different regeneration capabilities. This paradigm shift raises many new questions about the developmental origins, inter-relationships and molecular regulation of these multiple stem cell types. PMID:25907613

  14. Somatic hybrid plants from sexually incompatible woody species: Citrus reticulata and Citropsis gilletiana.

    PubMed

    Grosser, J W; Gmitter, F G; Tusa, N; Chandler, J L

    1990-04-01

    Allotetraploid intergeneric somatic hybrid plants between Citrus reticulata Blanco cv. Cleopatra mandarin and Citropsis gilletiana Swing. & M. Kell. (common name Gillet's cherry orange) were regenerated following protoplast fusion. Cleopatra protoplasts were isolated from an ovule-derived embryogenic suspension culture and fused chemically with leaf-derived protoplasts of Citropsis gilletiana. Cleopatra mandarin and somatic hybrid plants were regenerated via somatic embryogenesis. Hybrid plant identification was based on differential leaf morphology, root-tip cell chromosome number, and electrophoretic analyses of phosphoglucose mutase (PGM) and phosphohexose isomerase (PHI) isozyme banding patterns. This is the first somatic hybrid within the Rutaceae reported that does not have Citrus sinensis (sweet orange) as a parent, and the first produced with a commercially important citrus rootstock and a complementary but sexually incompatible, related species.

  15. Pre-procambial cells are niches for pluripotent and totipotent stem-like cells for organogenesis and somatic embryogenesis in the peach palm: a histological study.

    PubMed

    de Almeida, Marcilio; de Almeida, Cristina Vieira; Mendes Graner, Erika; Ebling Brondani, Gilvano; Fiori de Abreu-Tarazi, Monita

    2012-08-01

    The direct induction of adventitious buds and somatic embryos from explants is a morphogenetic process that is under the influence of exogenous plant growth regulators and its interactions with endogenous phytohormones. We performed an in vitro histological analysis in peach palm (Bactris gasipaes Kunth) shoot apexes and determined that the positioning of competent cells and their interaction with neighboring cells, under the influence of combinations of exogenously applied growth regulators (NAA/BAP and NAA/TDZ), allows the pre-procambial cells (PPCs) to act in different morphogenic pathways to establish niche competent cells. It is likely that there has been a habituation phenomenon during the regeneration and development of the microplants. This includes promoting the tillering of primary or secondary buds due to culturing in the absence of NAA/BAP or NAA/TDZ after a period in the presence of these growth regulators. Histological analyses determined that the adventitious roots were derived from the dedifferentiation of the parenchymal cells located in the basal region of the adventitious buds, with the establishment of rooting pole, due to an auxin gradient. Furthermore, histological and histochemical analyses allowed us to characterize how the PPCs provide niches for multipotent, pluripotent and totipotent stem-like cells for vascular differentiation, organogenesis and somatic embryogenesis in the peach palm. The histological and histochemical analyses also allowed us to detect the unicellular or multicellular origin of somatic embryogenesis. Therefore, our results indicate that the use of growth regulators in microplants can lead to habituation and to different morphogenic pathways leading to potential niche establishment, depending on the positioning of the competent cells and their interaction with neighboring cells. Our results indicate that the use of growth regulators in microplants can lead to habituation and to different morphogenic pathways leading to potential niche establishment, depending on the positioning of the competent cells and their interaction with neighboring cells.

  16. Germline contamination and leakage in whole genome somatic single nucleotide variant detection.

    PubMed

    Sendorek, Dorota H; Caloian, Cristian; Ellrott, Kyle; Bare, J Christopher; Yamaguchi, Takafumi N; Ewing, Adam D; Houlahan, Kathleen E; Norman, Thea C; Margolin, Adam A; Stuart, Joshua M; Boutros, Paul C

    2018-01-31

    The clinical sequencing of cancer genomes to personalize therapy is becoming routine across the world. However, concerns over patient re-identification from these data lead to questions about how tightly access should be controlled. It is not thought to be possible to re-identify patients from somatic variant data. However, somatic variant detection pipelines can mistakenly identify germline variants as somatic ones, a process called "germline leakage". The rate of germline leakage across different somatic variant detection pipelines is not well-understood, and it is uncertain whether or not somatic variant calls should be considered re-identifiable. To fill this gap, we quantified germline leakage across 259 sets of whole-genome somatic single nucleotide variant (SNVs) predictions made by 21 teams as part of the ICGC-TCGA DREAM Somatic Mutation Calling Challenge. The median somatic SNV prediction set contained 4325 somatic SNVs and leaked one germline polymorphism. The level of germline leakage was inversely correlated with somatic SNV prediction accuracy and positively correlated with the amount of infiltrating normal cells. The specific germline variants leaked differed by tumour and algorithm. To aid in quantitation and correction of leakage, we created a tool, called GermlineFilter, for use in public-facing somatic SNV databases. The potential for patient re-identification from leaked germline variants in somatic SNV predictions has led to divergent open data access policies, based on different assessments of the risks. Indeed, a single, well-publicized re-identification event could reshape public perceptions of the values of genomic data sharing. We find that modern somatic SNV prediction pipelines have low germline-leakage rates, which can be further reduced, especially for cloud-sharing, using pre-filtering software.

  17. Developmental localization and the role of hydroxyproline rich glycoproteins during somatic embryogenesis of banana (Musa spp. AAA)

    PubMed Central

    2011-01-01

    Background Hydroxyproline rich glycoproteins (HRGPs) are implicated to have a role in many aspects of plant growth and development but there is limited knowledge about their localization and function during somatic embryogenesis of higher plants. In this study, the localization and function of hydroxyproline rich glycoproteins in embryogenic cells (ECs) and somatic embryos of banana were investigated by using immunobloting and immunocytochemistry with monoclonal JIM11 and JIM20 antibodies as well as by treatment with 3,4-dehydro-L-proline (3,4-DHP, an inhibitor of extensin biosynthesis), and by immunomodulation with the JIM11 antibody. Results Immunofluorescence labelling of JIM11 and JIM20 hydroxyproline rich glycoprotein epitopes was relatively weak in non-embryogenic cells (NECs), mainly on the edge of small cell aggregates. On the other hand, hydroxyproline rich glycoprotein epitopes were found to be enriched in early embryogenic cells as well as in various developmental stages of somatic embryos. Embryogenic cells (ECs), proembryos and globular embryos showed strong labelling of hydroxyproline rich glycoprotein epitopes, especially in their cell walls and outer surface layer, so-called extracellular matrix (ECM). This hydroxyproline rich glycoprotein signal at embryo surfaces decreased and/or fully disappeared during later developmental stages (e.g. pear-shaped and cotyledonary stages) of embryos. In these later developmental embryogenic stages, however, new prominent hydroxyproline rich glycoprotein labelling appeared in tri-cellular junctions among parenchymatic cells inside these embryos. Overall immunofluorescence labelling of late stage embryos with JIM20 antibody was weaker than that of JIM11. Western blot analysis supported the above immunolocalization data. The treatment with 3,4-DHP inhibited the development of embryogenic cells and decreased the rate of embryo germination. Embryo-like structures, which developed after 3,4-DHP treatment showed aberrant non-compact epidermis with discontinuous ECM at the outer surface as well as much less immunolabelling with the JIM11 antibody. This treatment also decreased the plant regeneration capacity in embryogenic banana cultures. Finally, immunomodulation of surface hydroxyproline rich glycoproteins by co-culture of embryos with the JIM11 antibody resulted in a much lower germination capacity of these embryos. Conclusions These results suggest that hydroxyproline rich glycoproteins play an important developmental role, especially in the process of regeneration and germination of embryos during plant regeneration via somatic embryogenesis. Proper content and localization of hydroxyproline rich glycoproteins seem to be essential for the formation and regeneration of banana somatic embryos. PMID:21349190

  18. Distinct Responses of Stem Cells to Telomere Uncapping-A Potential Strategy to Improve the Safety of Cell Therapy.

    PubMed

    Liu, Chang Ching; Ma, Dong Liang; Yan, Ting-Dong; Fan, XiuBo; Poon, Zhiyong; Poon, Lai-Fong; Goh, Su-Ann; Rozen, Steve G; Hwang, William Ying Khee; Tergaonkar, Vinay; Tan, Patrick; Ghosh, Sujoy; Virshup, David M; Goh, Eyleen L K; Li, Shang

    2016-10-01

    In most human somatic cells, the lack of telomerase activity results in progressive telomere shortening during each cell division. Eventually, DNA damage responses triggered by critically short telomeres induce an irreversible cell cycle arrest termed replicative senescence. However, the cellular responses of human pluripotent stem cells to telomere uncapping remain unknown. We generated telomerase knockout human embryonic stem (ES) cells through gene targeting. Telomerase inactivation in ES cells results in progressive telomere shortening. Telomere DNA damage in ES cells and neural progenitor cells induces rapid apoptosis when telomeres are uncapped, in contrast to fibroblast cells that enter a state of replicative senescence. Significantly, telomerase inactivation limits the proliferation capacity of human ES cells without affecting their pluripotency. By targeting telomerase activity, we can functionally separate the two unique properties of human pluripotent stem cells, namely unlimited self-renewal and pluripotency. We show that the potential of ES cells to form teratomas in vivo is dictated by their telomere length. By controlling telomere length of ES cells through telomerase inactivation, we can inhibit teratoma formation and potentially improve the safety of cell therapies involving terminally differentiated cells as well as specific progenitor cells that do not require sustained cellular proliferation in vivo, and thus sustained telomerase activity. Stem Cells 2016;34:2471-2484. © 2016 AlphaMed Press.

  19. MAP kinase dependent cyclinE/cdk2 activity promotes DNA replication in early sea urchin embryos

    PubMed Central

    Kisielewska, J.; Philipova, R.; Huang, J.-Y.; Whitaker, M.

    2009-01-01

    Sea urchins provide an excellent model for studying cell cycle control mechanisms governing DNA replication in vivo. Fertilization and cell cycle progression are tightly coordinated by Ca2+ signals, but the mechanisms underlying the onset of DNA replication after fertilization remain less clear. In this study we demonstrate that calcium-dependent activation of ERK1 promotes accumulation of cyclinE/cdk2 into the male and female pronucleus and entry into first S-phase. We show that cdk2 activity rises quickly after fertilization to a maximum at 4 min, corresponding in timing to the early ERK1 activity peak. Abolishing MAP kinase activity after fertilization with MEK inhibitor, U0126, substantially reduces the early peak of cdk2 activity and prevents cyclinE and cdk2 accumulation in both sperm pronucleus and zygote nucleus in vivo. Both p27kip1 and roscovitine, cdk2 inhibitors, prevented DNA replication suggesting cdk2 involvement in this process in sea urchin. Inhibition of cdk2 activity using p27kip1 had no effect on the phosphorylation of MBP by ERK, but completely abolished phosphorylation of retinoblastoma protein, a cdk2 substrate, indicating that cdk2 activity is downstream of ERK1 activation. This pattern of regulation of DNA synthesis conforms to the pattern observed in mammalian somatic cells. PMID:19665013

  20. Histopathological analysis of aggressive renal cell carcinoma harboring a unique germline mutation in fumarate hydratase.

    PubMed

    Matsumoto, Kana; Udaka, Naoko; Hasumi, Hisashi; Nakaigawa, Noboru; Nagashima, Yoji; Tanaka, Reiko; Kato, Ikuma; Yao, Masahiro; Furuya, Mitsuko

    2018-05-24

    Hereditary leiomyomatosis and renal cell cancer (HLRCC) is a rare genetic disorder characterized by cutaneous and uterine leiomyomatosis with RCC. This disorder is caused by a germline mutation in the fumarate hydratase (FH) gene, which encodes an important enzyme of the tricarboxylic acid (TCA) cycle. This mutation distinguishes HLRCC from sporadic RCCs. Herein, we investigated a case of HLRCC in a 32-year-old man who underwent nephrectomy for treatment of a solid-cystic tumor in the left kidney. Histopathology demonstrated a variegated architecture of papillary, tubulocystic and cribriform patterns composed of high-grade tumor cells with enlarged nuclei and eosinophilic nucleoli. Immunostaining and western blotting revealed no FH expression in the tumor. Genomic DNA sequencing identified a heterozygous mutation involving deletion of the 3' end of exon 2 and intron 2 of the FH gene (c.251_267+7delTGACAGAACGCATGCCAGTAAGTG), and RT-PCR confirmed exon 2 skipping in FH mRNA. The somatic FH gene status of the tumor showed only the mutated allele, indicating loss of heterozygosity as the "second hit" of tumor suppressor gene inactivation. These data support that an FH mutation involving the splice site causes exon skipping, changing the conformation of the protein and accelerating carcinogenic cascades under impaired FH functioning in the TCA cycle. © 2018 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.

  1. Spermatogonial stem cells and progenitors are refractory to reprogramming to pluripotency by the transcription factors Oct3/4, c-Myc, Sox2 and Klf4

    PubMed Central

    Corbineau, Sébastien; Lassalle, Bruno; Givelet, Maelle; Souissi-Sarahoui, Inès; Firlej, Virginie; Romeo, Paul Henri; Allemand, Isabelle; Riou, Lydia; Fouchet, Pierre

    2017-01-01

    The male germinal lineage, which is defined as unipotent, produces sperm through spermatogenesis. However, embryonic primordial germ cells and postnatal spermatogonial stem cells (SSCs) can change their fate and convert to pluripotency in culture when they are not controlled by the testicular microenvironment. The mechanisms underlying these reprogramming processes are poorly understood. Testicular germ cell tumors, including teratoma, share some molecular characteristics with pluripotent cells, suggesting that cancer could result from an abnormal differentiation of primordial germ cells or from an abnormal conversion of SCCs to pluripotency in the testis. Here, we investigated whether the somatic reprogramming factors Oct3/4, Sox2, Klf4 and c-Myc (OSKM) could play a role in SSCs reprogramming and induce pluripotency using a doxycycline-inducible transgenic Col1a1-4F2A-OSKM mouse model. We showed that, in contrast to somatic cells, SSCs from adult mice are resistant to this reprogramming strategy, even in combination with small molecules, hypoxia, or p53 deficiency, which were previously described to favour the conversion of somatic cells to pluripotency. This finding suggests that adult SSCs have developed specific mechanisms to repress reprogramming by OSKM factors, contributing to circumvent testicular cancer initiation events. PMID:28052023

  2. Interspecies Somatic Cell Nuclear Transfer: Advancements and Problems

    PubMed Central

    Lagutina, Irina; Fulka, Helena; Lazzari, Giovanna

    2013-01-01

    Abstract Embryologists working with livestock species were the pioneers in the field of reprogramming by somatic cell nuclear transfer (SCNT). Without the “Dolly experiment,” the field of cellular reprogramming would have been slow and induced plutipotent cells (iPSCs) would not have been conceived. The major drive of the work in mammalian cloning was the interest of the breeding industry to propagate superior genotypes. Soon it was realized that the properties of oocytes could be used also to clone endangered mammalian species or to reprogram the genomes of unrelated species through what is known as interspecies (i) SCNT, using easily available oocytes of livestock species. iSCNT for cloning animals works only for species that can interbreed, and experiments with taxonomically distant species have not been successful in obtaining live births or deriving embryonic stem cell (ESC) lines to be used for regenerative medicine. There are controversial reports in the literature, but in most cases these experiments have underlined some of the cellular and molecular mechanisms that are incomplete during cell nucleus reprogramming, including the failure to organize nucleoli, silence somatic cell genes, activate the embryonic genome, and resume mitochondrial replication and function, thus indicating nucleus–cytoplasmic incompatibility. PMID:24033141

  3. Somatic mutations of the histone H3K27 demethylase gene UTX in human cancer.

    PubMed

    van Haaften, Gijs; Dalgliesh, Gillian L; Davies, Helen; Chen, Lina; Bignell, Graham; Greenman, Chris; Edkins, Sarah; Hardy, Claire; O'Meara, Sarah; Teague, Jon; Butler, Adam; Hinton, Jonathan; Latimer, Calli; Andrews, Jenny; Barthorpe, Syd; Beare, Dave; Buck, Gemma; Campbell, Peter J; Cole, Jennifer; Forbes, Simon; Jia, Mingming; Jones, David; Kok, Chai Yin; Leroy, Catherine; Lin, Meng-Lay; McBride, David J; Maddison, Mark; Maquire, Simon; McLay, Kirsten; Menzies, Andrew; Mironenko, Tatiana; Mulderrig, Lee; Mudie, Laura; Pleasance, Erin; Shepherd, Rebecca; Smith, Raffaella; Stebbings, Lucy; Stephens, Philip; Tang, Gurpreet; Tarpey, Patrick S; Turner, Rachel; Turrell, Kelly; Varian, Jennifer; West, Sofie; Widaa, Sara; Wray, Paul; Collins, V Peter; Ichimura, Koichi; Law, Simon; Wong, John; Yuen, Siu Tsan; Leung, Suet Yi; Tonon, Giovanni; DePinho, Ronald A; Tai, Yu-Tzu; Anderson, Kenneth C; Kahnoski, Richard J; Massie, Aaron; Khoo, Sok Kean; Teh, Bin Tean; Stratton, Michael R; Futreal, P Andrew

    2009-05-01

    Somatically acquired epigenetic changes are present in many cancers. Epigenetic regulation is maintained via post-translational modifications of core histones. Here, we describe inactivating somatic mutations in the histone lysine demethylase gene UTX, pointing to histone H3 lysine methylation deregulation in multiple tumor types. UTX reintroduction into cancer cells with inactivating UTX mutations resulted in slowing of proliferation and marked transcriptional changes. These data identify UTX as a new human cancer gene.

  4. Somatic mutations of the histone H3K27 demethylase, UTX, in human cancer

    PubMed Central

    van Haaften, Gijs; Dalgliesh, Gillian L; Davies, Helen; Chen, Lina; Bignell, Graham; Greenman, Chris; Edkins, Sarah; Hardy, Claire; O’Meara, Sarah; Teague, Jon; Butler, Adam; Hinton, Jonathan; Latimer, Calli; Andrews, Jenny; Barthorpe, Syd; Beare, Dave; Buck, Gemma; Campbell, Peter J; Cole, Jennifer; Dunmore, Rebecca; Forbes, Simon; Jia, Mingming; Jones, David; Kok, Chai Yin; Leroy, Catherine; Lin, Meng-Lay; McBride, David J; Maddison, Mark; Maquire, Simon; McLay, Kirsten; Menzies, Andrew; Mironenko, Tatiana; Lee, Mulderrig; Mudie, Laura; Pleasance, Erin; Shepherd, Rebecca; Smith, Raffaella; Stebbings, Lucy; Stephens, Philip; Tang, Gurpreet; Tarpey, Patrick S; Turner, Rachel; Turrell, Kelly; Varian, Jennifer; West, Sofie; Widaa, Sara; Wray, Paul; Collins, V Peter; Ichimura, Koichi; Law, Simon; Wong, John; Yuen, Siu Tsan; Leung, Suet Yi; Tonon, Giovanni; DePinho, Ronald A; Tai, Yu-Tzu; Anderson, Kenneth C; Kahnoski, Richard J.; Massie, Aaron; Khoo, Sok Kean; Teh, Bin Tean; Stratton, Michael R; Futreal, P Andrew

    2010-01-01

    Somatically acquired epigenetic changes are present in many cancers. Epigenetic regulation is maintained via post-translational modifications of core histones. Here, we describe inactivating somatic mutations in the histone lysine demethylase, UTX, pointing to histone H3 lysine methylation deregulation in multiple tumour types. UTX reintroduction into cancer cells with inactivating UTX mutations resulted in slowing of proliferation and marked transcriptional changes. These data identify UTX as a new human cancer gene. PMID:19330029

  5. Study of the association of atmospheric temperature and relative humidity with bulk tank milk somatic cell count in dairy herds using Generalized additive mixed models.

    PubMed

    Testa, Francesco; Marano, Giuseppe; Ambrogi, Federico; Boracchi, Patrizia; Casula, Antonio; Biganzoli, Elia; Moroni, Paolo

    2017-10-01

    Elevated bulk tank milk somatic cell count (BMSCC) has a negative impact on milk production, milk quality, and animal health. Seasonal increases in herd level somatic cell count (SCC) are commonly associated with elevated environmental temperature and humidity. The Temperature Humidity Index (THI) has been developed to measure general environmental stress in dairy cattle; however, additional work is needed to determine a specific effect of the heat stress index on herd-level SCC. Generalized Additive Model methods were used for a flexible exploration of the relationships between daily temperature, relative humidity, and bulk milk somatic cell count. The data consist of BMSCC and meteorological recordings collected between March 2009 and October 2011 of 10 dairy farms. The results indicate that, an average increase of 0.16% of BMSCC is expected for an increase of 1°C degree of temperature. A complex relationship was found for relative humidity. For example, increase of 0.099%, 0.037% and 0.020% are expected in correspondence to an increase of relative humidity from 50% to 51%, 80% to 81%; and 90% to 91%, respectively. Using this model, it will be possible to provide evidence-based advice to dairy farmers for the use of THI control charts created on the basis of our statistical model. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Whole exome sequencing reveals recurrent mutations in BRCA2 and FAT genes in acinar cell carcinomas of the pancreas.

    PubMed

    Furukawa, Toru; Sakamoto, Hitomi; Takeuchi, Shoko; Ameri, Mitra; Kuboki, Yuko; Yamamoto, Toshiyuki; Hatori, Takashi; Yamamoto, Masakazu; Sugiyama, Masanori; Ohike, Nobuyuki; Yamaguchi, Hiroshi; Shimizu, Michio; Shibata, Noriyuki; Shimizu, Kyoko; Shiratori, Keiko

    2015-03-06

    Acinar cell carcinoma of the pancreas is a rare tumor with a poor prognosis. Compared to pancreatic ductal adenocarcinoma, its molecular features are poorly known. We studied a total of 11 acinar cell carcinomas, including 3 by exome and 4 by target sequencing. Exome sequencing revealed 65 nonsynonymous mutations and 22 indels with a mutation rate of 3.4 mutations/Mb per tumor, on average. By accounting for not only somatic but also germline mutations with loss of the wild-type allele, we identified recurrent mutations of BRCA2 and FAT genes. BRCA2 showed somatic or germline premature termination mutations, with loss of the wild-type allele in 3 of 7 tumors. FAT1, FAT3, and FAT4 showed somatic or germline missense mutations in 4 of 7 tumors. The germline FAT mutations were with loss of the wild-type allele. Loss of BRCA2 expression was observed in 5 of 11 tumors. One patient with a BRCA2-mutated tumor experienced complete remission of liver metastasis following cisplatinum chemotherapy. In conclusion, acinar cell carcinomas show a distinct mutation pattern and often harbor somatic or germline mutations of BRCA2 and FAT genes. This result may warrant assessment of BRCA2 abrogation in patients with the carcinoma to determine their sensitivity to chemotherapy.

  7. De novo generation of HSCs from somatic and pluripotent stem cell sources

    PubMed Central

    Vo, Linda T.

    2015-01-01

    Generating human hematopoietic stem cells (HSCs) from autologous tissues, when coupled with genome editing technologies, is a promising approach for cellular transplantation therapy and for in vitro disease modeling, drug discovery, and toxicology studies. Human pluripotent stem cells (hPSCs) represent a potentially inexhaustible supply of autologous tissue; however, to date, directed differentiation from hPSCs has yielded hematopoietic cells that lack robust and sustained multilineage potential. Cellular reprogramming technologies represent an alternative platform for the de novo generation of HSCs via direct conversion from heterologous cell types. In this review, we discuss the latest advancements in HSC generation by directed differentiation from hPSCs or direct conversion from somatic cells, and highlight their applications in research and prospects for therapy. PMID:25762177

  8. Circadian gene expression regulates pulsatile gonadotropin-releasing hormone (GnRH) secretory patterns in the hypothalamic GnRH-secreting GT1-7 cell line.

    PubMed

    Chappell, Patrick E; White, Rachel S; Mellon, Pamela L

    2003-12-03

    Although it has long been established that episodic secretion of gonadotropin-releasing hormone (GnRH) from the hypothalamus is required for normal gonadotropin release, the molecular and cellular mechanisms underlying the synchronous release of GnRH are primarily unknown. We used the GT1-7 mouse hypothalamic cell line as a model for GnRH secretion, because these cells release GnRH in a pulsatile pattern similar to that observed in vivo. To explore possible molecular mechanisms governing secretory timing, we investigated the role of the molecular circadian clock in regulation of GnRH secretion. GT1-7 cells express many known core circadian clock genes, and we demonstrate that oscillations of these components can be induced by stimuli such as serum and the adenylyl cyclase activator forskolin, similar to effects observed in fibroblasts. Strikingly, perturbation of circadian clock function in GT1-7 cells by transient expression of the dominant-negative Clock-Delta19 gene disrupts normal ultradian patterns of GnRH secretion, significantly decreasing mean pulse frequency. Additionally, overexpression of the negative limb clock gene mCry1 in GT1-7 cells substantially increases GnRH pulse amplitude without a commensurate change in pulse frequency, demonstrating that an endogenous biological clock is coupled to the mechanism of neurosecretion in these cells and can regulate multiple secretory parameters. Finally, mice harboring a somatic mutation in the Clock gene are subfertile and exhibit a substantial increase in estrous cycle duration as revealed by examination of vaginal cytology. This effect persists in normal light/dark (LD) cycles, suggesting that a suprachiasmatic nucleus-independent endogenous clock in GnRH neurons is required for eliciting normal pulsatile patterns of GnRH secretion.

  9. Cloned ferrets produced by somatic cell nuclear transfer

    PubMed Central

    Li, Ziyi; Sun, Xingshen; Chen, Juan; Liu, Xiaoming; Wisely, Samantha M.; Zhou, Qi; Renard, Jean-Paul; Leno, Gregory H.; Engelhardt, John F.

    2007-01-01

    Somatic cell nuclear transfer (SCNT) offers great potential for developing better animal models of human disease. The domestic ferret (Mustela putorius furo) is an ideal animal model for influenza infections and potentially other human respiratory diseases such as cystic fibrosis, where mouse models have failed to reproduce the human disease phenotype. Here, we report the successful production of live cloned, reproductively competent, ferrets using species-specific SCNT methodologies. Critical to developing a successful SCNT protocol for the ferret was the finding that hormonal treatment, normally used for superovulation, adversely affected the developmental potential of recipient oocytes. The onset of Oct4 expression was delayed and incomplete in parthenogenetically activated oocytes collected from hormone-treated females relative to oocytes collected from females naturally mated with vasectomized males. Stimulation induced by mating and in vitro oocyte maturation produced the optimal oocyte recipient for SCNT. Although nuclear injection and cell fusion produced mid-term fetuses at equivalent rates (~3–4%), only cell fusion gave rise to healthy surviving clones. Single cell fusion rates and the efficiency of SCNT were also enhanced by placing two somatic cells into the perivitelline space. These species-specific modifications facilitated the birth of live, healthy, and fertile cloned ferrets. The development of microsatellite genotyping for domestic ferrets confirmed that ferret clones were genetically derived from their respective somatic cells and unrelated to their surrogate mother. With this technology, it is now feasible to begin generating genetically defined ferrets for studying transmissible and inherited human lung diseases. Cloning of the domestic ferret may also aid in recovery and conservation of the endangered black-footed ferret and European mink. PMID:16584722

  10. Factors affecting the electrofusion of mouse and ferret oocytes with ferret somatic cells.

    PubMed

    Li, Ziyi; Sun, Xingshen; Chen, Juan; Leno, Gregory H; Engelhardt, John F

    2005-09-01

    The domestic ferret, Mustela putorius furos, holds great promise as a genetic model for human lung disease, provided that key technologies for somatic cell nuclear transfer (SCNT) are developed. In this report, we extend our understanding of SCNT in this species by defining conditions for efficient cell fusion by electrical pulse. Two experimental systems were employed in this study. First, in vivo-matured mouse oocytes and ferret somatic cells were used to establish general parameters for fusion. One fibroblast, or cumulus cell, was agglutinated to nucleate, zona pellucida-free, mouse oocytes, and subjected to an electrical pulse. Similar electrical pulse conditions were also tested with 1 or 2 somatic cells inserted into the perivitelline space (PVS) of intact mouse oocytes. The fusion rate for a single fibroblast with a zona-free oocyte was 80.2%, significantly higher (P < 0.05) than that observed for 1, or 2, fibroblasts placed in the PVS (52.0% and 63.8%, respectively). The fusion rate (44.1%) following insertion of two cumulus cells was significantly higher (P < 0.05) than that following insertion of one cumulus cell (25.1%). Second, in vitro-matured ferret oocytes were enucleated, and one to three fibroblasts or cumulus cells were inserted into the PVS. Zona pellucida-free ferret oocytes were fragile and excluded from the study. The fusion rates with two or three fibroblasts were 71.4% and 76.8%, respectively; significantly higher (P < 0.05) than that for one fibroblast (48.6%). This cell number-dependent difference in fusion efficiency was also observed with cumulus cells. Fusion-derived (ferret-ferret) NT embryos cleaved, formed blastocysts in vitro, and underwent early-stage fetal development following embryo transfer. The rate of development was cell type-independent, in contrast to the cell type-dependent differences observed in fusion efficiency. In conclusion, fibroblasts fused more efficiently than cumulus cells and the efficiency of single cell fusions was improved when two or more cells were inserted into the PVS. These studies define conditions for efficient cell fusion with ferret oocytes and should facilitate SCNT and the development of genetically defined animal models in this species.

  11. [Breakthrough in research on pluripotent stem cells and their application in medicine].

    PubMed

    Valdimarsdóttir, Guðrún; Richter, Anne

    2015-12-01

    Embryonic stem cells are, as the name indicates, isolated from embryos. They are pluripotent cells which can be maintained undifferentiated or induced to differentiate into any cell type of the body. In 1998 the first isolation of human embryonic stem cells was successful and they became an interesting source for stem cell regenerative medicine. Only 8 years later pluripotent stem cells were generated by reprogramming somatic cells into induced pluripotent stem cells (iPSCs). This was a revolution in the way people thought of cell commitment during development. Since then, a lot of research has been done in understanding the molecular biology of pluripotent stem cells. iPSCs can be generated from somatic cells of a patient and therefore have the same genome. Hence, iPSCs have great potential application in medicine, as they can be utilized in disease modelling, drug screening and cell replacement therapy.

  12. Increased radial glia quiescence, decreased reactivation upon injury and unaltered neuroblast behavior underlie decreased neurogenesis in the aging zebrafish telencephalon.

    PubMed

    Edelmann, Kathrin; Glashauser, Lena; Sprungala, Susanne; Hesl, Birgit; Fritschle, Maike; Ninkovic, Jovica; Godinho, Leanne; Chapouton, Prisca

    2013-09-01

    The zebrafish has recently become a source of new data on the mechanisms of neural stem cell (NSC) maintenance and ongoing neurogenesis in adult brains. In this vertebrate, neurogenesis occurs at high levels in all ventricular regions of the brain, and brain injuries recover successfully, owing to the recruitment of radial glia, which function as NSCs. This new vertebrate model of adult neurogenesis is thus advancing our knowledge of the molecular cues in use for the activation of NSCs and fate of their progeny. Because the regenerative potential of somatic stem cells generally weakens with increasing age, it is important to assess the extent to which zebrafish NSC potential decreases or remains unaltered with age. We found that neurogenesis in the ventricular zone, in the olfactory bulb, and in a newly identified parenchymal zone of the telencephalon indeed declines as the fish ages and that oligodendrogenesis also declines. In the ventricular zone, the radial glial cell population remains largely unaltered morphologically but enters less frequently into the cell cycle and hence produces fewer neuroblasts. The neuroblasts themselves do not change their behavior with age and produce the same number of postmitotic neurons. Thus, decreased neurogenesis in the physiologically aging zebrafish brain is correlated with an increasing quiescence of radial glia. After injuries, radial glia in aged brains are reactivated, and the percentage of cell cycle entry is increased in the radial glia population. However, this reaction is far less pronounced than in younger animals, pointing to irreversible changes in aging zebrafish radial glia. Copyright © 2013 Wiley Periodicals, Inc.

  13. Mechanisms of nuclear lamina growth in interphase.

    PubMed

    Zhironkina, Oxana A; Kurchashova, Svetlana Yu; Pozharskaia, Vasilisa A; Cherepanynets, Varvara D; Strelkova, Olga S; Hozak, Pavel; Kireev, Igor I

    2016-04-01

    The nuclear lamina represents a multifunctional platform involved in such diverse yet interconnected processes as spatial organization of the genome, maintenance of mechanical stability of the nucleus, regulation of transcription and replication. Most of lamina activities are exerted through tethering of lamina-associated chromatin domains (LADs) to the nuclear periphery. Yet, the lamina is a dynamic structure demonstrating considerable expansion during the cell cycle to accommodate increased number of LADs formed during DNA replication. We analyzed dynamics of nuclear growth during interphase and changes in lamina structure as a function of cell cycle progression. The nuclear lamina demonstrates steady growth from G1 till G2, while quantitative analysis of lamina meshwork by super-resolution microscopy revealed that microdomain organization of the lamina is maintained, with lamin A and lamin B microdomain periodicity and interdomain gap sizes unchanged. FRAP analysis, in contrast, demonstrated differences in lamin A and B1 exchange rates; the latter showing higher recovery rate in S-phase cells. In order to further analyze the mechanism of lamina growth in interphase, we generated a lamina-free nuclear envelope in living interphase cells by reversible hypotonic shock. The nuclear envelope in nuclear buds formed after such a treatment initially lacked lamins, and analysis of lamina formation revealed striking difference in lamin A and B1 assembly: lamin A reassembled within 30 min post-treatment, whereas lamin B1 did not incorporate into the newly formed lamina at all. We suggest that in somatic cells lamin B1 meshwork growth is coordinated with replication of LADs, and lamin A meshwork assembly seems to be chromatin-independent process.

  14. Secondary immunization generates clonally related antigen-specific plasma cells and memory B cells.

    PubMed

    Frölich, Daniela; Giesecke, Claudia; Mei, Henrik E; Reiter, Karin; Daridon, Capucine; Lipsky, Peter E; Dörner, Thomas

    2010-09-01

    Rechallenge with T cell-dependent Ags induces memory B cells to re-enter germinal centers (GCs) and undergo further expansion and differentiation into plasma cells (PCs) and secondary memory B cells. It is currently not known whether the expanded population of memory B cells and PCs generated in secondary GCs are clonally related, nor has the extent of proliferation and somatic hypermutation of their precursors been delineated. In this study, after secondary tetanus toxoid (TT) immunization, TT-specific PCs increased 17- to 80-fold on days 6-7, whereas TT-specific memory B cells peaked (delayed) on day 14 with a 2- to 22-fold increase. Molecular analyses of V(H)DJ(H) rearrangements of individual cells revealed no major differences of gene usage and CDR3 length between TT-specific PCs and memory B cells, and both contained extensive evidence of somatic hypermutation with a pattern consistent with GC reactions. This analysis identified clonally related TT-specific memory B cells and PCs. Within clusters of clonally related cells, sequences shared a number of mutations but also could contain additional base pair changes. The data indicate that although following secondary immunization PCs can derive from memory B cells without further somatic hypermutation, in some circumstances, likely within GC reactions, asymmetric mutation can occur. These results suggest that after the fate decision to differentiate into secondary memory B cells or PCs, some committed precursors continue to proliferate and mutate their V(H) genes.

  15. The Drosophila ovarian and testis stem cell niches: similar somatic stem cells and signals.

    PubMed

    Decotto, Eva; Spradling, Allan C

    2005-10-01

    The stem cell niches at the apex of Drosophila ovaries and testes have been viewed as distinct in two major respects. While both contain germline stem cells, the testis niche also contains "cyst progenitor" stem cells, which divide to produce somatic cells that encase developing germ cells. Moreover, while both niches utilize BMP signaling, the testis niche requires a key JAK/STAT signal. We now show, by lineage marking, that the ovarian niche also contains a second type of stem cell. These "escort stem cells" morphologically resemble testis cyst progenitor cells and their daughters encase developing cysts before undergoing apoptosis at the time of follicle formation. In addition, we show that JAK/STAT signaling also plays a critical role in ovarian niche function, and acts within escort cells. These observations reveal striking similarities in the stem cell niches of male and female gonads, and suggest that they are largely governed by common mechanisms.

  16. Sperm quality assays: How good are they? The horse perspective.

    PubMed

    Love, Charles C

    2018-04-22

    Sperm quality assays have increased in number in the last 10 years. Most of these assays are flow cytometry based in application and are modified from assays that have been developed to measure somatic cell function. The goal of any sperm quality assay should be to advance the clinicians/researchers understanding of sperm cell function and the relationship to fertility. While these assays appear to measure somatic cell-like functions in sperm there tends to be little understanding how the results of these assays relate to fertility. Copyright © 2018. Published by Elsevier B.V.

  17. Regulation of AID, the B-cell genome mutator

    PubMed Central

    Keim, Celia; Kazadi, David; Rothschild, Gerson; Basu, Uttiya

    2013-01-01

    The mechanisms by which B cells somatically engineer their genomes to generate the vast diversity of antibodies required to challenge the nearly infinite number of antigens that immune systems encounter are of tremendous clinical and academic interest. The DNA cytidine deaminase activation-induced deaminase (AID) catalyzes two of these mechanisms: class switch recombination (CSR) and somatic hypermutation (SHM). Recent discoveries indicate a significant promiscuous targeting of this B-cell mutator enzyme genome-wide. Here we discuss the various regulatory elements that control AID activity and prevent AID from inducing genomic instability and thereby initiating oncogenesis. PMID:23307864

  18. Effect of somatic cell count and mastitis pathogens on milk composition in Gyr cows

    PubMed Central

    2013-01-01

    Background Gyr cows are well adapted to tropical conditions, resistant to some tropical diseases and have satisfactory milk production. However, Gyr dairy herds have a high prevalence of subclinical mastitis, which negatively affects their milk yield and composition. The objectives of this study were (i) to evaluate the effects of seasonality, mammary quarter location (rear x front), mastitis-causing pathogen species, and somatic cell count (SCC) on milk composition in Gyr cows with mammary quarters as the experimental units and (ii) to evaluate the effects of seasonality and somatic cell count (SCC) on milk composition in Gyr cows with cows as the experimental units. A total of 221 lactating Gyr cows from three commercial dairy farms were selected for this study. Individual foremilk quarter samples and composite milk samples were collected once a month over one year from all lactating cows for analysis of SCC, milk composition, and bacteriological culture. Results Subclinical mastitis reduced lactose, nonfat solids and total solids content, but no difference was found in the protein and fat content between infected and uninfected quarters. Seasonality influenced milk composition both in mammary quarters and composite milk samples. Nevertheless, there was no effect of mammary quarter position on milk composition. Mastitis-causing pathogens affected protein, lactose, nonfat solids, and total solids content, but not milk fat content. Somatic cell count levels affected milk composition in both mammary quarters and composite samples of milk. Conclusions Intramammary infections in Gyr cows alter milk composition; however, the degree of change depends on the mastitis-causing pathogen. Somatic cell count is negatively associated with reduced lactose and nonfat solids content in milk. Seasonality significantly affects milk composition, in which the concentration of lactose, fat, protein, nonfat solids and total solids differs between dry and wet seasons in Gyr cows. PMID:23566405

  19. Telomere lengthening early in development.

    PubMed

    Liu, Lin; Bailey, Susan M; Okuka, Maja; Muñoz, Purificación; Li, Chao; Zhou, Lingjun; Wu, Chao; Czerwiec, Eva; Sandler, Laurel; Seyfang, Andreas; Blasco, Maria A; Keefe, David L

    2007-12-01

    Stem cells and cancer cells maintain telomere length mostly through telomerase. Telomerase activity is high in male germ line and stem cells, but is low or absent in mature oocytes and cleavage stage embryos, and then high again in blastocysts. How early embryos reset telomere length remains poorly understood. Here, we show that oocytes actually have shorter telomeres than somatic cells, but their telomeres lengthen remarkably during early cleavage development. Moreover, parthenogenetically activated oocytes also lengthen their telomeres, thus the capacity to elongate telomeres must reside within oocytes themselves. Notably, telomeres also elongate in the early cleavage embryos of telomerase-null mice, demonstrating that telomerase is unlikely to be responsible for the abrupt lengthening of telomeres in these cells. Coincident with telomere lengthening, extensive telomere sister-chromatid exchange (T-SCE) and colocalization of the DNA recombination proteins Rad50 and TRF1 were observed in early cleavage embryos. Both T-SCE and DNA recombination proteins decrease in blastocyst stage embryos, whereas telomerase activity increases and telomeres elongate only slowly. We suggest that telomeres lengthen during the early cleavage cycles following fertilization through a recombination-based mechanism, and that from the blastocyst stage onwards, telomerase only maintains the telomere length established by this alternative mechanism.

  20. Somatic Embryogenesis in Two Orchid Genera (Cymbidium, Dendrobium).

    PubMed

    da Silva, Jaime A Teixeira; Winarto, Budi

    2016-01-01

    The protocorm-like body (PLB) is the de facto somatic embryo in orchids. Here we describe detailed protocols for two orchid genera (hybrid Cymbidium Twilight Moon 'Day Light' and Dendrobium 'Jayakarta', D. 'Gradita 31', and D. 'Zahra FR 62') for generating PLBs. These protocols will most likely have to be tweaked for different cultivars as the response of orchids in vitro tends to be dependent on genotype. In addition to primary somatic embryogenesis, secondary (or repetitive) somatic embryogenesis is also described for both genera. The use of thin cell layers as a sensitive tissue assay is outlined for hybrid Cymbidium while the protocol outlined is suitable for bioreactor culture of D. 'Zahra FR 62'.

  1. Isolation, culture and characterisation of somatic cells derived from semen and milk of endangered sheep and eland antelope.

    PubMed

    Nel-Themaat, L; Gómez, M C; Damiani, P; Wirtu, G; Dresser, B L; Bondioli, K R; Lyons, L A; Pope, C E; Godke, R A

    2007-01-01

    Semen and milk are potential sources of somatic cells for genome banks. In the present study, we cultured and characterised cells from: (1) cooled sheep milk; (2) fresh, cooled and frozen-thawed semen from Gulf Coast native (GCN) sheep (Ovis aries); and (3) fresh eland (Taurotragus oryx) semen. Cells attached to the culture surface from fresh (29%), cooled (43%) and slow-frozen (1 degrees C/min; 14%) ram semen, whereas no attachment occurred in the fast-frozen (10 degrees C/min) group. Proliferation occurred in fresh (50%) and cooled (100%) groups, but no cells proliferated after passage 1 (P1). Eland semen yielded cell lines (100%) that were cryopreserved at P1. In samples from GCN and cross-bred milk, cell attachment (83% and 95%, respectively) and proliferation (60% and 37%, respectively) were observed. Immunocytochemical detection of cytokeratin indicated an epithelial origin of semen-derived cells, whereas milk yielded either fibroblasts, epithelial or a mixture of cell types. Deoxyribonucleic acid microsatellite analysis using cattle-derived markers confirmed that eland cells were from the semen donor. Eland epithelial cells were transferred into eland oocytes and 12 (71%), six (35%) and two (12%) embryos cleaved and developed to morulae or blastocyst stages, respectively. In conclusion, we have developed a technique for obtaining somatic cells from semen. We have also demonstrated that semen-derived cells can serve as karyoplast donors for nuclear transfer.

  2. The 19q12 bladder cancer GWAS signal: association with cyclin E function and aggressive disease

    PubMed Central

    Fu, Yi-Ping; Kohaar, Indu; Moore, Lee E.; Lenz, Petra; Figueroa, Jonine D.; Tang, Wei; Porter-Gill, Patricia; Chatterjee, Nilanjan; Scott-Johnson, Alexandra; Garcia-Closas, Montserrat; Muchmore, Brian; Baris, Dalsu; Paquin, Ashley; Ylaya, Kris; Schwenn, Molly; Apolo, Andrea B.; Karagas, Margaret R.; Tarway, McAnthony; Johnson, Alison; Mumy, Adam; Schned, Alan; Guedez, Liliana; Jones, Michael A.; Kida, Masatoshi; Monawar Hosain, GM; Malats, Nuria; Kogevinas, Manolis; Tardon, Adonina; Serra, Consol; Carrato, Alfredo; Garcia-Closas, Reina; Lloreta, Josep; Wu, Xifeng; Purdue, Mark; Andriole, Gerald L.; Grubb, Robert L.; Black, Amanda; Landi, Maria T.; Caporaso, Neil E.; Vineis, Paolo; Siddiq, Afshan; Bueno-de-Mesquita, H. Bas; Trichopoulos, Dimitrios; Ljungberg, Börje; Severi, Gianluca; Weiderpass, Elisabete; Krogh, Vittorio; Dorronsoro, Miren; Travis, Ruth C.; Tjønneland, Anne; Brennan, Paul; Chang-Claude, Jenny; Riboli, Elio; Prescott, Jennifer; Chen, Constance; De Vivo, Immaculata; Govannucci, Edward; Hunter, David; Kraft, Peter; Lindstrom, Sara; Gapstur, Susan M.; Jacobs, Eric J.; Diver, W. Ryan; Albanes, Demetrius; Weinstein, Stephanie J.; Virtamo, Jarmo; Kooperberg, Charles; Hohensee, Chancellor; Rodabough, Rebecca J.; Cortessis, Victoria K.; Conti, David V.; Gago-Dominguez, Manuela; Stern, Mariana C.; Pike, Malcolm C.; Van Den Berg, David; Yuan, Jian-Min; Haiman, Christopher A.; Cussenot, Olivier; Cancel-Tassin, Geraldine; Roupret, Morgan; Comperat, Eva; Porru, Stefano; Carta, Angela; Pavanello, Sofia; Arici, Cecilia; Mastrangelo, Giuseppe; Grossman, H. Barton; Wang, Zhaoming; Deng, Xiang; Chung, Charles C.; Hutchinson, Amy; Burdette, Laurie; Wheeler, William; Fraumeni, Joseph; Chanock, Stephen J.; Hewitt, Stephen M.; Silverman, Debra T.; Rothman, Nathaniel; Prokunina-Olsson, Ludmila

    2014-01-01

    A genome-wide association study (GWAS) of bladder cancer identified a genetic marker rs8102137 within the 19q12 region as a novel susceptibility variant. This marker is located upstream of the CCNE1 gene, which encodes cyclin E, a cell cycle protein. We performed genetic fine mapping analysis of the CCNE1 region using data from two bladder cancer GWAS (5,942 cases and 10,857 controls). We found that the original GWAS marker rs8102137 represents a group of 47 linked SNPs (with r2≥0.7) associated with increased bladder cancer risk. From this group we selected a functional promoter variant rs7257330, which showed strong allele-specific binding of nuclear proteins in several cell lines. In both GWAS, rs7257330 was associated only with aggressive bladder cancer, with a combined per-allele odds ratio (OR) =1.18 (95%CI=1.09-1.27, p=4.67×10−5 vs. OR =1.01 (95%CI=0.93-1.10, p=0.79) for non-aggressive disease, with p=0.0015 for case-only analysis. Cyclin E protein expression analyzed in 265 bladder tumors was increased in aggressive tumors (p=0.013) and, independently, with each rs7257330-A risk allele (ptrend=0.024). Over-expression of recombinant cyclin E in cell lines caused significant acceleration of cell cycle. In conclusion, we defined the 19q12 signal as the first GWAS signal specific for aggressive bladder cancer. Molecular mechanisms of this genetic association may be related to cyclin E over-expression and alteration of cell cycle in carriers of CCNE1 risk variants. In combination with established bladder cancer risk factors and other somatic and germline genetic markers, the CCNE1 variants could be useful for inclusion into bladder cancer risk prediction models. PMID:25320178

  3. Possible role of HIWI2 in modulating tight junction proteins in retinal pigment epithelial cells through Akt signaling pathway.

    PubMed

    Sivagurunathan, Suganya; Palanisamy, Karthikka; Arunachalam, Jayamuruga Pandian; Chidambaram, Subbulakshmi

    2017-03-01

    PIWI subfamily of proteins is shown to be primarily expressed in germline cells. They maintain the genomic integrity by silencing the transposable elements. Although the role of PIWI proteins in germ cells has been documented, their presence and function in somatic cells remains unclear. Intriguingly, we detected all four members of PIWI-like proteins in human ocular tissues and somatic cell lines. When HIWI2 was knocked down in retinal pigment epithelial cells, the typical honeycomb morphology was affected. Further analysis showed that the expression of tight junction (TJ) proteins, CLDN1, and TJP1 were altered in HIWI2 knockdown. Moreover, confocal imaging revealed disrupted TJP1 assembly at the TJ. Previous studies report the role of GSK3β in regulating TJ proteins. Accordingly, phospho-kinase proteome profiler array indicated increased phosphorylation of Akt and GSK3α/β in HIWI2 knockdown, suggesting that HIWI2 might affect TJ proteins through Akt-GSK3α/β signaling axis. Moreover, treating the HIWI2 knockdown cells with wortmannin increased the levels of TJP1 and CLDN1. Taken together, our study demonstrates the presence of PIWI-like proteins in somatic cells and the possible role of HIWI2 in preserving the functional integrity of epithelial cells probably by modulating the phosphorylation status of Akt.

  4. Seasonal variability in somatic and reproductive investment of the bivalve Scrobicularia plana (da Costa, 1778) along a latitudinal gradient

    NASA Astrophysics Data System (ADS)

    Santos, Sílvia; Cardoso, Joana F. M. F.; Carvalho, Célia; Luttikhuizen, Pieternella C.; van der Veer, Henk W.

    2011-03-01

    Monthly investment in soma and gonads in the bivalve Scrobicularia plana is described for three populations along its distributional range: Minho estuary, Portugal; Westerschelde estuary, The Netherlands and Buvika estuary, Norway. Seasonal cycles in body mass (BMI), somatic mass (SMI) and gonadal mass (GMI) indices were observed for all populations. In Portugal, BMI and SMI peaked in mid-autumn, while in The Netherlands both indices were at their highest in mid-spring. Norway showed a different pattern with two distinct peaks: one in mid-autumn and a second peak in spring. GMI reached maximum values in July in Portugal and Netherlands and in June in Norway. Overall, mean BMI and SMI were lower in Portugal while mean GMI was lower in Norway. The spawning period lasted the whole summer in Portugal, but was shorter (only two months) in The Netherlands and Norway. The reproductive investment in The Netherlands was significantly higher than in Portugal and Norway, with the lowest values being observed in Norway. Differences in annual cycles between populations were attributed to environmental factors, namely temperature and food availability. Temperature seems important in shaping the reproductive pattern with more northern populations showing shorter reproductive periods starting later in the year, and a lower reproductive output. In addition, winter water temperatures can explain the lower mean body and somatic mass values observed in Portugal. Food availability influenced the physiological performance of the species with peaks in somatic mass coinciding with phytoplankton blooms. This relation between physiological performance and environmental factors influences S. plana distribution, densities and even survival, with natural consequences on its commercial importance.

  5. Nuclear transfer of synchronized African wild cat somatic cells into enucleated domestic cat oocytes

    USGS Publications Warehouse

    Gomez, M.C.; Jenkins, J.A.; Giraldo, A.; Harris, R.F.; King, A.; Dresser, B.L.; Pope, C.E.

    2003-01-01

    The African wild cat is one of the smallest wild cats and its future is threatened by hybridization with domestic cats. Nuclear transfer, a valuable tool for retaining genetic variability, offers the possibility of species continuation rather than extinction. The aim of this study was to investigate the ability of somatic cell nuclei of the African wild cat (AWC) to dedifferentiate within domestic cat (DSH) cytoplasts and to support early development after nuclear transplantation. In experiment 1, distributions of AWC and DSH fibroblasts in each cell-cycle phase were assessed by flow cytometry using cells cultured to confluency and disaggregated with pronase, trypsin, or mechanical separation. Trypsin (89.0%) and pronase (93.0%) yielded higher proportions of AWC nuclei in the G0/G1 phase than mechanical separation (82.0%). In contrast, mechanical separation yielded higher percentages of DSH nuclei in the G0/G1 phase (86.6%) than pronase (79.7%) or trypsin (74.2%) treatments. In both species, pronase induced less DNA damage than trypsin. In experiment 2, the effects of serum starvation, culture to confluency, and exposure to roscovitine on the distribution of AWC and DSH fibroblasts in various phases of the cell cycle were determined. Flow cytometry analyses revealed that the dynamics of the cell cycle varied as culture conditions were modified. Specifically, a higher percentage of AWC and DSH nuclei were in the G0/G1 phase after cells were serum starved (83% vs. 96%) than were present in cycling cells (50% vs. 64%), after contact inhibition (61% vs. 88%), or after roscovitine (56% vs. 84%) treatment, respectively. In experiment 3, we evaluated the effects of cell synchronization and oocyte maturation (in vivo vs. in vitro) on the reconstruction and development of AWC-DSH- and DSH-DSH-cloned embryos. The method of cell synchronization did not affect the fusion and cleavage rate because only a slightly higher percentage of fused couplets cleaved when donor nuclei were synchronized by serum starvation (83.0%) than after roscovitine (80.0%) or contact-inhibition (80.0%). The fusion efficiency of in vivo and in vitro matured oocytes used as recipient cytoplasts of AWC donor nuclei (86.6% vs. 85.2%) was similar to the rates obtained with DSH donor nuclei, 83.7% vs. 73.0%, respectively. The only significant effect of source of donor nucleus (AWC vs. DSH) was on the rate of blastocyst formation in vitro. A higher percentage of the embryos derived from AWC nuclei developed to the blastocyst stage than did embryos produced from DSH nuclei, 24.2% vs. 3.3%, respectively (P < 0.05). In experiment 4, the effect of calcium in the fusion medium on induction of oocyte activation and development of AWC-DSH-cloned embryos was determined. The presence of calcium in the fusion medium induced a high incidence of cleavage of DSH oocytes (54.3%), while oocyte cleavage frequency was much lower in the absence of calcium (16.6%). The presence or absence of calcium in the fusion medium did not affect the fusion, cleavage, and blastocyst development of AWC-DSH-cloned embryos. In experiment 5, AWC-DSH-cloned embryos were transferred to the uteri of 11 synchronized domestic cat recipients on Day 6 or 7 after oocyte aspiration. Recipients were assessed by ultrasonography on Day 21 postovulation, but no pregnancies were observed. In the present study, after NT, AWC donor nuclei were able to dedifferentiate in DSH cytoplasts and support high rates of blastocyst development in vitro. Incomplete reprogramming of the differentiated nucleus may be a major constraint to the in vivo developmental potential of the embryos.

  6. Retrotransposon Capture Sequencing (RC-Seq): A Targeted, High-Throughput Approach to Resolve Somatic L1 Retrotransposition in Humans.

    PubMed

    Sanchez-Luque, Francisco J; Richardson, Sandra R; Faulkner, Geoffrey J

    2016-01-01

    Mobile genetic elements (MGEs) are of critical importance in genomics and developmental biology. Polymorphic and somatic MGE insertions have the potential to impact the phenotype of an individual, depending on their genomic locations and functional consequences. However, the identification of polymorphic and somatic insertions among the plethora of copies residing in the genome presents a formidable technical challenge. Whole genome sequencing has the potential to address this problem; however, its efficacy depends on the abundance of cells carrying the new insertion. Robust detection of somatic insertions present in only a subset of cells within a given sample can also be prohibitively expensive due to a requirement for high sequencing depth. Here, we describe retrotransposon capture sequencing (RC-seq), a sequence capture approach in which Illumina libraries are enriched for fragments containing the 5' and 3' termini of specific MGEs. RC-seq allows the detection of known polymorphic insertions present in an individual, as well as the identification of rare or private germline insertions not previously described. Furthermore, RC-seq can be used to detect and characterize somatic insertions, providing a valuable tool to elucidate the extent and characteristics of MGE activity in healthy tissues and in various disease states.

  7. Erythroid differentiation of human induced pluripotent stem cells is independent of donor cell type of origin.

    PubMed

    Dorn, Isabel; Klich, Katharina; Arauzo-Bravo, Marcos J; Radstaak, Martina; Santourlidis, Simeon; Ghanjati, Foued; Radke, Teja F; Psathaki, Olympia E; Hargus, Gunnar; Kramer, Jan; Einhaus, Martin; Kim, Jeong Beom; Kögler, Gesine; Wernet, Peter; Schöler, Hans R; Schlenke, Peter; Zaehres, Holm

    2015-01-01

    Epigenetic memory in induced pluripotent stem cells, which is related to the somatic cell type of origin of the stem cells, might lead to variations in the differentiation capacities of the pluripotent stem cells. In this context, induced pluripotent stem cells from human CD34(+) hematopoietic stem cells might be more suitable for hematopoietic differentiation than the commonly used fibroblast-derived induced pluripotent stem cells. To investigate the influence of an epigenetic memory on the ex vivo expansion of induced pluripotent stem cells into erythroid cells, we compared induced pluripotent stem cells from human neural stem cells and human cord blood-derived CD34(+) hematopoietic stem cells and evaluated their potential for differentiation into hematopoietic progenitor and mature red blood cells. Although genome-wide DNA methylation profiling at all promoter regions demonstrates that the epigenetic memory of induced pluripotent stem cells is influenced by the somatic cell type of origin of the stem cells, we found a similar hematopoietic induction potential and erythroid differentiation pattern of induced pluripotent stem cells of different somatic cell origin. All human induced pluripotent stem cell lines showed terminal maturation into normoblasts and enucleated reticulocytes, producing predominantly fetal hemoglobin. Differences were only observed in the growth rate of erythroid cells, which was slightly higher in the induced pluripotent stem cells derived from CD34(+) hematopoietic stem cells. More detailed methylation analysis of the hematopoietic and erythroid promoters identified similar CpG methylation levels in the induced pluripotent stem cell lines derived from CD34(+) cells and those derived from neural stem cells, which confirms their comparable erythroid differentiation potential. Copyright© Ferrata Storti Foundation.

  8. Cloning Mice.

    PubMed

    Ogura, Atsuo

    2017-08-01

    Viable and fertile mice can be generated by somatic nuclear transfer into enucleated oocytes, presumably because the transplanted somatic cell genome becomes reprogrammed by factors in the oocyte. The first somatic cloned offspring of mice were obtained by directly injecting donor nuclei into recipient enucleated oocytes. When this method is used (the so-called Honolulu method of somatic cell nuclear transfer [SCNT]), the donor nuclei readily and completely condense within the enucleated metaphase II-arrested oocytes, which contain high levels of M-phase-promoting factor (MPF). It is believed that the condensation of the donor chromosomes promotes complete reprogramming of the donor genome within the mouse oocytes. Another key to the success of mouse cloning is the use of blunt micropipettes attached to a piezo impact-driving micromanipulation device. This system saves a significant amount of time during the micromanipulation of oocytes and thus minimizes the loss of oocyte viability in vitro. For example, a group of 20 oocytes can be enucleated within 10 min by an experienced operator. This protocol is composed of seven parts: (1) preparing micropipettes, (2) setting up the enucleation and injection micropipettes, (3) collecting and enucleating oocytes, (4) preparing nucleus donor cells, (5) injecting donor nuclei, (6) activating embryos and culturing, and (7) transferring cloned embryos. © 2017 Cold Spring Harbor Laboratory Press.

  9. Engineered LINE-1 retrotransposition in nondividing human neurons

    PubMed Central

    Macia, Angela; Widmann, Thomas J.; Heras, Sara R.; Ayllon, Veronica; Sanchez, Laura; Benkaddour-Boumzaouad, Meriem; Muñoz-Lopez, Martin; Rubio, Alejandro; Amador-Cubero, Suyapa; Blanco-Jimenez, Eva; Garcia-Castro, Javier; Menendez, Pablo; Ng, Philip; Muotri, Alysson R.; Goodier, John L.; Garcia-Perez, Jose L.

    2017-01-01

    Half the human genome is made of transposable elements (TEs), whose ongoing activity continues to impact our genome. LINE-1 (or L1) is an autonomous non-LTR retrotransposon in the human genome, comprising 17% of its genomic mass and containing an average of 80–100 active L1s per average genome that provide a source of inter-individual variation. New LINE-1 insertions are thought to accumulate mostly during human embryogenesis. Surprisingly, the activity of L1s can further impact the somatic human brain genome. However, it is currently unknown whether L1 can retrotranspose in other somatic healthy tissues or if L1 mobilization is restricted to neuronal precursor cells (NPCs) in the human brain. Here, we took advantage of an engineered L1 retrotransposition assay to analyze L1 mobilization rates in human mesenchymal (MSCs) and hematopoietic (HSCs) somatic stem cells. Notably, we have observed that L1 expression and engineered retrotransposition is much lower in both MSCs and HSCs when compared to NPCs. Remarkably, we have further demonstrated for the first time that engineered L1s can retrotranspose efficiently in mature nondividing neuronal cells. Thus, these findings suggest that the degree of somatic mosaicism and the impact of L1 retrotransposition in the human brain is likely much higher than previously thought. PMID:27965292

  10. Irreversible barrier to the reprogramming of donor cells in cloning with mouse embryos and embryonic stem cells.

    PubMed

    Ono, Yukiko; Kono, Tomohiro

    2006-08-01

    Somatic cloning does not always result in ontogeny in mammals, and development is often associated with various abnormalities and embryo loss with a high frequency. This is considered to be due to aberrant gene expression resulting from epigenetic reprogramming errors. However, a fundamental question in this context is whether the developmental abnormalities reported to date are specific to somatic cloning. The aim of this study was to determine the stage of nuclear differentiation during development that leads to developmental abnormalities associated with embryo cloning. In order to address this issue, we reconstructed cloned embryos using four- and eight-cell embryos, morula embryos, inner cell mass (ICM) cells, and embryonic stem cells as donor nuclei and determined the occurrence of abnormalities such as developmental arrest and placentomegaly, which are common characteristics of all mouse somatic cell clones. The present analysis revealed that an acute decline in the full-term developmental competence of cloned embryos occurred with the use of four- and eight-cell donor nuclei (22.7% vs. 1.8%) in cases of standard embryo cloning and with morula and ICM donor nuclei (11.4% vs. 6.6%) in serial nuclear transfer. Histological observation showed abnormal differentiation and proliferation of trophoblastic giant cells in the placentae of cloned concepti derived from four-cell to ICM cell donor nuclei. Enlargement of placenta along with excessive proliferation of the spongiotrophoblast layer and glycogen cells was observed in the clones derived from morula embryos and ICM cells. These results revealed that irreversible epigenetic events had already started to occur at the four-cell stage. In addition, the expression of genes involved in placentomegaly is regulated at the blastocyst stage by irreversible epigenetic events, and it could not be reprogrammed by the fusion of nuclei with unfertilized oocytes. Hence, developmental abnormalities such as placentomegaly as well as embryo loss during development may occur even in cloned embryos reconstructed with nuclei from preimplantation-stage embryos, and these abnormalities are not specific to somatic cloning.

  11. Mitochondrial-Associated Cell Death Mechanisms Are Reset to an Embryonic-Like State in Aged Donor-Derived iPS Cells Harboring Chromosomal Aberrations

    PubMed Central

    Prigione, Alessandro; Hossini, Amir M.; Lichtner, Björn; Serin, Akdes; Fauler, Beatrix; Megges, Matthias; Lurz, Rudi; Lehrach, Hans; Zouboulis, Christos C.

    2011-01-01

    Somatic cells reprogrammed into induced pluripotent stem cells (iPSCs) acquire features of human embryonic stem cells (hESCs) and thus represent a promising source for cellular therapy of debilitating diseases, such as age-related disorders. However, reprogrammed cell lines have been found to harbor various genomic alterations. In addition, we recently discovered that the mitochondrial DNA of human fibroblasts also undergoes random mutational events upon reprogramming. Aged somatic cells might possess high susceptibility to nuclear and mitochondrial genome instability. Hence, concerns over the oncogenic potential of reprogrammed cells due to the lack of genomic integrity may hinder the applicability of iPSC-based therapies for age-associated conditions. Here, we investigated whether aged reprogrammed cells harboring chromosomal abnormalities show resistance to apoptotic cell death or mitochondrial-associated oxidative stress, both hallmarks of cancer transformation. Four iPSC lines were generated from dermal fibroblasts derived from an 84-year-old woman, representing the oldest human donor so far reprogrammed to pluripotency. Despite the presence of karyotype aberrations, all aged-iPSCs were able to differentiate into neurons, re-establish telomerase activity, and reconfigure mitochondrial ultra-structure and functionality to a hESC-like state. Importantly, aged-iPSCs exhibited high sensitivity to drug-induced apoptosis and low levels of oxidative stress and DNA damage, in a similar fashion as iPSCs derived from young donors and hESCs. Thus, the occurrence of chromosomal abnormalities within aged reprogrammed cells might not be sufficient to over-ride the cellular surveillance machinery and induce malignant transformation through the alteration of mitochondrial-associated cell death. Taken together, we unveiled that cellular reprogramming is capable of reversing aging-related features in somatic cells from a very old subject, despite the presence of genomic alterations. Nevertheless, we believe it will be essential to develop reprogramming protocols capable of safeguarding the integrity of the genome of aged somatic cells, before employing iPSC-based therapy for age-associated disorders. PMID:22110631

  12. A highly efficient method for generation of therapeutic quality human pluripotent stem cells by using naive induced pluripotent stem cells nucleus for nuclear transfer.

    PubMed

    Sanal, Madhusudana Girija

    2014-01-01

    Even after several years since the discovery of human embryonic stem cells and induced pluripotent stem cells (iPSC), we are still unable to make any significant therapeutic benefits out of them such as cell therapy or generation of organs for transplantation. Recent success in somatic cell nuclear transfer (SCNT) made it possible to generate diploid embryonic stem cells, which opens up the way to make high-quality pluripotent stem cells. However, the process is highly inefficient and hence expensive compared to the generation of iPSC. Even with the latest SCNT technology, we are not sure whether one can make therapeutic quality pluripotent stem cell from any patient's somatic cells or by using oocytes from any donor. Combining iPSC technology with SCNT, that is, by using the nucleus of the candidate somatic cell which got reprogrammed to pluripotent state instead that of the unmodified nucleus of the candidate somatic cell, would boost the efficiency of the technique, and we would be able to generate therapeutic quality pluripotent stem cells. Induced pluripotent stem cell nuclear transfer (iPSCNT) combines the efficiency of iPSC generation with the speed and natural reprogramming environment of SCNT. The new technique may be called iPSCNT. This technique could prove to have very revolutionary benefits for humankind. This could be useful in generating organs for transplantation for patients and for reproductive cloning, especially for childless men and women who cannot have children by any other techniques. When combined with advanced gene editing techniques (such as CRISPR-Cas system) this technique might also prove useful to those who want to have healthy children but suffer from inherited diseases. The current code of ethics may be against reproductive cloning. However, this will change with time as it happened with most of the revolutionary scientific breakthroughs. After all, it is the right of every human to have healthy offspring and it is the question of reproductive freedom and existence.

  13. Current reprogramming systems in regenerative medicine: from somatic cells to induced pluripotent stem cells.

    PubMed

    Hu, Chenxia; Li, Lanjuan

    2016-01-01

    Induced pluripotent stem cells (iPSCs) paved the way for research fields including cell therapy, drug screening, disease modeling and the mechanism of embryonic development. Although iPSC technology has been improved by various delivery systems, direct transduction and small molecule regulation, low reprogramming efficiency and genomic modification steps still inhibit its clinical use. Improvements in current vectors and the exploration of novel vectors are required to balance efficiency and genomic modification for reprogramming. Herein, we set out a comprehensive analysis of current reprogramming systems for the generation of iPSCs from somatic cells. By clarifying advantages and disadvantages of the current reprogramming systems, we are striding toward an effective route to generate clinical grade iPSCs.

  14. Mammalian cell display technology coupling with AID induced SHM in vitro: an ideal approach to the production of therapeutic antibodies.

    PubMed

    Qin, Chang-Fei; Li, Guan-Cheng

    2014-12-01

    Traditional antibody production technology within non-mammalian cell expression systems has shown many unsatisfactory properties for the development of therapeutic antibodies. Nevertheless, mammalian cell display technology reaps the benefits of producing full-length all human antibodies. Together with the developed cytidine deaminase induced in vitro somatic hypermutation technology, mammalian cell display technology provides the opportunity to produce high affinity antibodies that might be ideal for therapeutic application. This review was concentrated on the development of the mammalian cell display technology as well as the activation-induced cytidine deaminase induced in vitro somatic hypermutation technology and their applications for the production of therapeutic antibodies. Copyright © 2014 Elsevier B.V. All rights reserved.

  15. Hemoglobins, programmed cell death and somatic embryogenesis.

    PubMed

    Hill, Robert D; Huang, Shuanglong; Stasolla, Claudio

    2013-10-01

    Programmed cell death (PCD) is a universal process in all multicellular organisms. It is a critical component in a diverse number of processes ranging from growth and differentiation to response to stress. Somatic embryogenesis is one such process where PCD is significantly involved. Nitric oxide is increasingly being recognized as playing a significant role in regulating PCD in both mammalian and plant systems. Plant hemoglobins scavenge NO, and evidence is accumulating that events that modify NO levels in plants also affect hemoglobin expression. Here, we review the process of PCD, describing the involvement of NO and plant hemoglobins in the process. NO is an effector of cell death in both plants and vertebrates, triggering the cascade of events leading to targeted cell death that is a part of an organism's response to stress or to tissue differentiation and development. Expression of specific hemoglobins can alter this response in plants by scavenging the NO, thus, interrupting the death process. Somatic embryogenesis is used as a model system to demonstrate how cell-specific expression of different classes of hemoglobins can alter the embryogenic process, affecting hormone synthesis, cell metabolite levels and genes associated with PCD and embryogenic competence. We propose that plant hemoglobins influence somatic embryogenesis and PCD through cell-specific expression of a distinct plant hemoglobin. It is based on the premise that both embryogenic competence and PCD are strongly influenced by cellular NO levels. Increases in cellular NO levels result in elevated Zn(2+) and reactive-oxygen species associated with PCD, but they also result in decreased expression of MYC2, a transcription factor that is a negative effector of indoleacetic acid synthesis, a hormone that positively influences embryogenic competence. Cell-specific hemoglobin expression reduces NO levels as a result of NO scavenging, resulting in cell survival. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  16. Stem cells--clinical application and perspectives.

    PubMed

    Brehm, Michael; Zeus, Tobias; Strauer, Bodo Eckehard

    2002-11-01

    Augmentation of myocardial performance in experimental models of therapeutic infarction and heart failure has been achieved by transplantation of exogenous cells into damaged myocardium. The quest for suitable donor cells has prompted research into the use of both embryonic stem cells and adult somatic stem cells. Recently, there has been a growing body of evidence that multipotent somatic stem cells in adult bone marrow exhibit tremendous functional plasticity and can reprogram in a new environmental tissue niche to give rise to cell lineages specific for new organ site. This phenomenon has made huge impact on myocardial biology, while multipotent adult bone marrow hematopoeitic stem cells and mesechymal stem cells can repopulate infarcted rodent myocardium and differentiate into both cardiomyocytes and new blood vessels. These data, coupled with the identification of a putative primitive cardiac stem cell population in the adult human heart, may open the way for novel therapeutic modalities for enhancing myocardial performance and treating heart failure.

  17. Fluorescence photon migration techniques for the on-farm measurement of somatic cell count in fresh cow's milk

    NASA Astrophysics Data System (ADS)

    Khoo, Geoffrey; Kuennemeyer, Rainer; Claycomb, Rod W.

    2005-04-01

    Currently, the state of the art of mastitis detection in dairy cows is the laboratory-based measurement of somatic cell count (SCC), which is time consuming and expensive. Alternative, rapid, and reliable on-farm measurement methods are required for effective farm management. We have investigated whether fluorescence lifetime measurements can determine SCC in fresh, unprocessed milk. The method is based on the change in fluorescence lifetime of ethidium bromide when it binds to DNA from the somatic cells. Milk samples were obtained from a Fullwood Merlin Automated Milking System and analysed within a twenty-four hour period, over which the SCC does not change appreciably. For reference, the milk samples were also sent to a testing laboratory where the SCC was determined by traditional methods. The results show that we can quantify SCC using the fluorescence photon migration method from a lower bound of 4x105 cells mL-1 to an upper bound of 1 x 107 cells mL-1. The upper bound is due to the reference method used while the cause of the lower boundary is unknown, yet.

  18. Dynamic and static maintenance of epigenetic memory in pluripotent and somatic cells.

    PubMed

    Shipony, Zohar; Mukamel, Zohar; Cohen, Netta Mendelson; Landan, Gilad; Chomsky, Elad; Zeliger, Shlomit Reich; Fried, Yael Chagit; Ainbinder, Elena; Friedman, Nir; Tanay, Amos

    2014-09-04

    Stable maintenance of gene regulatory programs is essential for normal function in multicellular organisms. Epigenetic mechanisms, and DNA methylation in particular, are hypothesized to facilitate such maintenance by creating cellular memory that can be written during embryonic development and then guide cell-type-specific gene expression. Here we develop new methods for quantitative inference of DNA methylation turnover rates, and show that human embryonic stem cells preserve their epigenetic state by balancing antagonistic processes that add and remove methylation marks rather than by copying epigenetic information from mother to daughter cells. In contrast, somatic cells transmit considerable epigenetic information to progenies. Paradoxically, the persistence of the somatic epigenome makes it more vulnerable to noise, since random epimutations can accumulate to massively perturb the epigenomic ground state. The rate of epigenetic perturbation depends on the genomic context, and, in particular, DNA methylation loss is coupled to late DNA replication dynamics. Epigenetic perturbation is not observed in the pluripotent state, because the rapid turnover-based equilibrium continuously reinforces the canonical state. This dynamic epigenetic equilibrium also explains how the epigenome can be reprogrammed quickly and to near perfection after induced pluripotency.

  19. Zygotic and somatic embryo morphogenesis in Pinus pinaster: comparative histological and histochemical study.

    PubMed

    Tereso, Susana; Zoglauer, Kurt; Milhinhos, Ana; Miguel, Célia; Oliveira, M Margarida

    2007-05-01

    We compared morphogenesis and accumulation of storage proteins and starch in Pinus pinaster Ait. zygotic embryos with those in somatic embryos grown with different carbohydrate sources. The maturation medium for somatic embryos included 80 microM abscisic acid (ABA), 9 g l(-1) gellam gum and either glucose, sucrose or maltose at 44, 88, 175 or 263 mM in the presence or absence of 6% (w/v) polyethylene glycol (PEG) 4000 MW. Maturation medium containing 44 or 88 mM of a carbohydrate source produced only one or no cotyledonary somatic embryos per 0.6 g fresh mass of culture. The addition of PEG to the basal maturation medium resulted in a low yield of cotyledonary somatic embryos that generally showed incomplete development and anatomical abnormalities such as large intercellular spaces and large vacuoles. High concentrations of maltose also induced large intercellular spaces in the somatic embryonic cells, and 263 mM sucrose produced fewer and less developed cotyledonary somatic embryos compared with 175 mM sucrose, indicating that the effect of carbohydrate source is partially osmotic. Zygotic embryos had a lower dry mass than somatic embryos at the same stage of development. Starch granules followed a similar accumulation pattern in zygotic and somatic embryos. A low starch content was found in cotyledonary zygotic embryos and in somatic embryos developed in the presence of 175 mM maltose or 263 mM glucose. In zygotic embryos and in PEG-treated somatic embryos, protein bodies appeared later and were smaller and fewer than in well-developed somatic embryos grown without PEG. We propose that storage protein concentration might be a marker of embryo quality.

  20. RNA splicing and its connection with other regulatory layers in somatic cell reprogramming.

    PubMed

    Zavolan, Mihaela; Kanitz, Alexander

    2018-06-01

    Understanding how cell identity is established and maintained is one of the most exciting challenges of molecular biology today. Recent work has added a conserved layer of RNA splicing and other post-transcriptional regulatory processes to the transcriptional and epigenetic networks already known to cooperate in the establishment and maintenance of cell identity. Here we summarize these findings, highlighting specifically the multitude of splicing factors that can modulate the efficiency of somatic cell reprogramming. Distinct patterns of gene expression dynamics of these factors during reprogramming suggest that further improvements in efficiency could be obtained through optimal timing of overexpression or knockdown of individual regulators. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Transcriptional reprogramming of gene expression in bovine somatic cell chromatin transfer embryos

    PubMed Central

    Rodriguez-Osorio, Nelida; Wang, Zhongde; Kasinathan, Poothappillai; Page, Grier P; Robl, James M; Memili, Erdogan

    2009-01-01

    Background Successful reprogramming of a somatic genome to produce a healthy clone by somatic cells nuclear transfer (SCNT) is a rare event and the mechanisms involved in this process are poorly defined. When serial or successive rounds of cloning are performed, blastocyst and full term development rates decline even further with the increasing rounds of cloning. Identifying the "cumulative errors" could reveal the epigenetic reprogramming blocks in animal cloning. Results Bovine clones from up to four generations of successive cloning were produced by chromatin transfer (CT). Using Affymetrix bovine microarrays we determined that the transcriptomes of blastocysts derived from the first and the fourth rounds of cloning (CT1 and CT4 respectively) have undergone an extensive reprogramming and were more similar to blastocysts derived from in vitro fertilization (IVF) than to the donor cells used for the first and the fourth rounds of chromatin transfer (DC1 and DC4 respectively). However a set of transcripts in the cloned embryos showed a misregulated pattern when compared to IVF embryos. Among the genes consistently upregulated in both CT groups compared to the IVF embryos were genes involved in regulation of cytoskeleton and cell shape. Among the genes consistently upregulated in IVF embryos compared to both CT groups were genes involved in chromatin remodelling and stress coping. Conclusion The present study provides a data set that could contribute in our understanding of epigenetic errors in somatic cell chromatin transfer. Identifying "cumulative errors" after serial cloning could reveal some of the epigenetic reprogramming blocks shedding light on the reprogramming process, important for both basic and applied research. PMID:19393066

  2. DNA methylation at a bovine alpha satellite I repeat CpG site during development following fertilization and somatic cell nuclear transfer.

    PubMed

    Couldrey, Christine; Wells, David N

    2013-01-01

    Incomplete epigenetic reprogramming is postulated to contribute to the low developmental success following somatic cell nuclear transfer (SCNT). Here, we describe the epigenetic reprogramming of DNA methylation at an alpha satellite I CpG site (αsatI-5) during development of cattle generated either by artificial insemination (AI) or in vitro fertilization (IVF) and SCNT. Quantitative methylation analysis identified that SCNT donor cells were highly methylated at αsatI-5 and resulting SCNT blastocysts showed significantly more methylation than IVF blastocysts. At implantation, no difference in methylation was observed between SCNT and AI in trophoblast tissue at αsatI-5, however, SCNT embryos were significantly hyper-methylated compared to AI controls at this time point. Following implantation, DNA methylation at αsatI-5 decreased in AI but not SCNT placental tissues. In contrast to placenta, the proportion of methylation at αsatI-5 remained high in adrenal, kidney and muscle tissues during development. Differences in the average proportion of methylation were smaller in somatic tissues than placental tissues but, on average, SCNT somatic tissues were hyper-methylated at αsatI-5. Although sperm from all bulls was less methylated than somatic tissues at αsatI-5, on average this site remained hyper-methylated in sperm from cloned bulls compared with control bulls. This developmental time course confirms that epigenetic reprogramming does occur, at least to some extent, following SCNT. However, the elevated methylation levels observed in SCNT blastocysts and cellular derivatives implies that there is either insufficient time or abundance of appropriate reprogramming factors in oocytes to ensure complete reprogramming. Incomplete reprogramming at this CpG site may be a contributing factor to low SCNT success rates, but more likely represents the tip of the iceberg in terms of incompletely reprogramming. Until protocols ensure the epigenetic signature of a differentiated somatic cell is reset to a state resembling totipotency, the efficiency of SCNT is likely to remain low.

  3. DNA Methylation at a Bovine Alpha Satellite I Repeat CpG Site during Development following Fertilization and Somatic Cell Nuclear Transfer

    PubMed Central

    Couldrey, Christine; Wells, David N.

    2013-01-01

    Incomplete epigenetic reprogramming is postulated to contribute to the low developmental success following somatic cell nuclear transfer (SCNT). Here, we describe the epigenetic reprogramming of DNA methylation at an alpha satellite I CpG site (αsatI-5) during development of cattle generated either by artificial insemination (AI) or in vitro fertilization (IVF) and SCNT. Quantitative methylation analysis identified that SCNT donor cells were highly methylated at αsatI-5 and resulting SCNT blastocysts showed significantly more methylation than IVF blastocysts. At implantation, no difference in methylation was observed between SCNT and AI in trophoblast tissue at αsatI-5, however, SCNT embryos were significantly hyper-methylated compared to AI controls at this time point. Following implantation, DNA methylation at αsatI-5 decreased in AI but not SCNT placental tissues. In contrast to placenta, the proportion of methylation at αsatI-5 remained high in adrenal, kidney and muscle tissues during development. Differences in the average proportion of methylation were smaller in somatic tissues than placental tissues but, on average, SCNT somatic tissues were hyper-methylated at αsatI-5. Although sperm from all bulls was less methylated than somatic tissues at αsatI-5, on average this site remained hyper-methylated in sperm from cloned bulls compared with control bulls. This developmental time course confirms that epigenetic reprogramming does occur, at least to some extent, following SCNT. However, the elevated methylation levels observed in SCNT blastocysts and cellular derivatives implies that there is either insufficient time or abundance of appropriate reprogramming factors in oocytes to ensure complete reprogramming. Incomplete reprogramming at this CpG site may be a contributing factor to low SCNT success rates, but more likely represents the tip of the iceberg in terms of incompletely reprogramming. Until protocols ensure the epigenetic signature of a differentiated somatic cell is reset to a state resembling totipotency, the efficiency of SCNT is likely to remain low. PMID:23383311

  4. Correlation of physical and genetic maps of human chromosome 16

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sutherland, G.R.

    1991-01-01

    This project aimed to divide chromosome 16 into approximately 50 intervals of {approximately}2Mb in size by constructing a series of mouse/human somatic cell hybrids each containing a rearranged chromosome 16. Using these hybrids, DNA probes would be regionally mapped by Southern blot or PCR analysis. Preference would be given to mapping probes which demonstrated polymorphisms for which the CEPH panel of families had been typed. This would allow a correlation of the physical and linkage maps of this chromosome. The aims have been substantially achieved. 49 somatic cell hybrids have been constructed which have allowed definition of 46, and potentiallymore » 57, different physical intervals on the chromosome. 164 loci have been fully mapped into these intervals. A correlation of the physical and genetic maps of the chromosome is in an advanced stage of preparation. The somatic cell hybrids constructed have been widely distributed to groups working on chromosome 16 and other genome projects.« less

  5. Correlation of physical and genetic maps of human chromosome 16. Annual progress report, October 1, 1990--July 31, 1991

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sutherland, G.R.

    1991-12-31

    This project aimed to divide chromosome 16 into approximately 50 intervals of {approximately}2Mb in size by constructing a series of mouse/human somatic cell hybrids each containing a rearranged chromosome 16. Using these hybrids, DNA probes would be regionally mapped by Southern blot or PCR analysis. Preference would be given to mapping probes which demonstrated polymorphisms for which the CEPH panel of families had been typed. This would allow a correlation of the physical and linkage maps of this chromosome. The aims have been substantially achieved. 49 somatic cell hybrids have been constructed which have allowed definition of 46, and potentiallymore » 57, different physical intervals on the chromosome. 164 loci have been fully mapped into these intervals. A correlation of the physical and genetic maps of the chromosome is in an advanced stage of preparation. The somatic cell hybrids constructed have been widely distributed to groups working on chromosome 16 and other genome projects.« less

  6. Aberrant Expression of Xist in Aborted Porcine Fetuses Derived from Somatic Cell Nuclear Transfer Embryos

    PubMed Central

    Yuan, Lin; Wang, Anfeng; Yao, Chaogang; Huang, Yongye; Duan, Feifei; Lv, Qinyan; Wang, Dongxu; Ouyang, Hongsheng; Li, Zhanjun; Lai, Liangxue

    2014-01-01

    Cloned pigs generated by somatic cell nuclear transfer (SCNT) show a greater ratio of early abortion during mid-gestation than normal controls. X-linked genes have been demonstrated to be important for the development of cloned embryos. To determine the relationship between the expression of X-linked genes and abortion of cloned porcine fetuses, the expression of X-linked genes were investigated by quantitative real-time polymerase chain reaction (q-PCR) and the methylation status of Xist DMR was performed by bisulfate-specific PCR (BSP). q-PCR analysis indicated that there was aberrant expression of X-linked genes, especially the upregulated expression of Xist in both female and male aborted fetuses compared to control fetuses. Results of BSP suggested that hypomethylation of Xist occurred in aborted fetuses, whether male or female. These results suggest that the abnormal expression of Xist may be associated with the abortion of fetuses derived from somatic cell nuclear transfer embryos. PMID:25429426

  7. Neurobiology of Caenorhabditis elegans Locomotion: Where Do We Stand?

    PubMed Central

    Gjorgjieva, Julijana; Biron, David; Haspel, Gal

    2014-01-01

    Animals use a nervous system for locomotion in some stage of their life cycle. The nematode Caenorhabditis elegans, a major animal model for almost all fields of experimental biology, has long been used for detailed studies of genetic and physiological locomotion mechanisms. Of its 959 somatic cells, 302 are neurons that are identifiable by lineage, location, morphology, and neurochemistry in every adult hermaphrodite. Of those, 75 motoneurons innervate body wall muscles that provide the thrust during locomotion. In this Overview, we concentrate on the generation of either forward- or backward-directed motion during crawling and swimming. We describe locomotion behavior, the parts constituting the locomotion system, and the relevant neuronal connectivity. Because it is not yet fully understood how these components combine to generate locomotion, we discuss competing hypotheses and models. PMID:26955070

  8. Somatic embryogenesis and polyamines in woody plants

    Treesearch

    Rakesh Minocha; Subhash C. Minocha; Liisa Kaarina Simola

    1995-01-01

    The formation of whole plants from cultured cells is interesting not only because of its applications for mass propagation but also as a prime example of the process of controlled development and differentiation in plants. Cultures capable of producing somatic embryos with high frequency provide ideal experimental systems to study and understand the biochemical basis...

  9. Osmotic measurements in whole megagametophytes and embryos of loblolly pine (Pinus taeda) during seed development.

    PubMed

    Pullman, Gerald S; Johnson, Shannon

    2009-06-01

    Water potential (Psi) and osmotic potential (Psis) were measured weekly through the sequence of seed development in megagametophytes of loblolly pine (Pinus taeda L.). A Wescor 5500XRS vapor pressure osmometer, modified with a cycle hold switch, was used to measure Psi for whole megagametophytes containing embryos. The Psi measurements for megagametophytes with embryos removed were also attempted but readings were distorted due to cell lysates from the cut surfaces. Six seasonal sets of megagametophyte Psi profiles were generated. Megagametophytes from most of the trees examined showed a consistent Psi pattern: low measurements of -1.0 to -0.75 MPa during early embryo development in late June to early July when embryo Stages 1-2 occur; an increase for one to several weeks to levels of -0.5 to -0.75 MPa, beginning at Stages 3-5 when apical dome formation occurs; followed by a steady drop from -0.85 to -1.7 to -2.0 MPa from Stage 6 onward from late August until just before cone seed release. The Psis was measured for supernatant from centrifuged frozen-thawed megagametophyte tissue (embryos removed). Megagametophyte Psis profiles were similar for seeds analyzed from two trees and resembled Psi observations starting low, rising around Stages 4-7 and then undergoing a major reduction indicating a strong solute accumulation beginning at Stages 7-9.1. Somatic embryos stop growth prematurely in vitro at Stages 8-9.1. The major change in the accumulation of megagametophyte solutes at Stages 8-9.1 correlates with the halt in somatic embryo maturation and suggests that identifying, quantifying and using the major natural soluble compounds that accumulate during mid- to late-stage seed development may be important to improve conifer somatic embryo maturation.

  10. In vitro oocyte culture and somatic cell nuclear transfer used to produce a live-born cloned goat.

    PubMed

    Ohkoshi, Katsuhiro; Takahashi, Seiya; Koyama, Shin-Ichiro; Akagi, Satoshi; Adachi, Noritaka; Furusawa, Tadashi; Fujimoto, Jun-Ichiro; Takeda, Kumiko; Kubo, Masanori; Izaike, Yoshiaki; Tokunaga, Tomoyuki

    2003-01-01

    The use of an in vitro culture system was examined for production of somatic cells suitable for nuclear transfer in the goat. Goat cumulus-oocyte complexes were incubated in tissue culture medium TCM-199 supplemented with 10% fetal bovine serum (FBS) for 20 h. In vitro matured (IVM) oocytes were enucleated and used as karyoplast recipients. Donor cells obtained from the anterior pituitary of an adult male were introduced into the perivitelline space of enucleated IVM oocytes and fused by an electrical pulse. Reconstituted oocytes were cultured in chemically defined medium for 9 days. Two hundred and twenty-eight oocytes (70%) were fused with donor cells. After in vitro culture, seven somatic cell nuclear transfer (SCNT) oocytes (3%) developed to the blastocyst stage. SCNT embryos were transferred to the oviducts of recipient females (four 8-cell embryos per female) or uterine horn (two blastocysts per female). One male clone (NT1) was produced at day 153 from an SCNT blastocyst and died 16 days after birth. This study demonstrates that nuclear transferred goat oocytes produced using an in vitro culture system could develop to term and that donor anterior pituitary cells have the developmental potential to produce term offspring. In this study, it suggested that the artificial control of endocrine system in domestic animal might become possible by the genetic modification to anterior pituitary cells.

  11. Germline regeneration: the worms' turn.

    PubMed

    Weisblat, David A

    2006-06-20

    Asexual reproduction in the annelid Enchytraeus japonensis entails the regeneration of primordial germ cells from body parts that lack gonads. New primordial germ cells arise from piwi-expressing germline stem cells that are distinct from somatic stem cells.

  12. Targeting DDX3 with a small molecule inhibitor for lung cancer therapy

    PubMed Central

    Bol, Guus M; Vesuna, Farhad; Xie, Min; Zeng, Jing; Aziz, Khaled; Gandhi, Nishant; Levine, Anne; Irving, Ashley; Korz, Dorian; Tantravedi, Saritha; Heerma van Voss, Marise R; Gabrielson, Kathleen; Bordt, Evan A; Polster, Brian M; Cope, Leslie; van der Groep, Petra; Kondaskar, Atul; Rudek, Michelle A; Hosmane, Ramachandra S; van der Wall, Elsken; van Diest, Paul J; Tran, Phuoc T; Raman, Venu

    2015-01-01

    Lung cancer is the most common malignancy worldwide and is a focus for developing targeted therapies due to its refractory nature to current treatment. We identified a RNA helicase, DDX3, which is overexpressed in many cancer types including lung cancer and is associated with lower survival in lung cancer patients. We designed a first-in-class small molecule inhibitor, RK-33, which binds to DDX3 and abrogates its activity. Inhibition of DDX3 by RK-33 caused G1 cell cycle arrest, induced apoptosis, and promoted radiation sensitization in DDX3-overexpressing cells. Importantly, RK-33 in combination with radiation induced tumor regression in multiple mouse models of lung cancer. Mechanistically, loss of DDX3 function either by shRNA or by RK-33 impaired Wnt signaling through disruption of the DDX3–β-catenin axis and inhibited non-homologous end joining—the major DNA repair pathway in mammalian somatic cells. Overall, inhibition of DDX3 by RK-33 promotes tumor regression, thus providing a compelling argument to develop DDX3 inhibitors for lung cancer therapy. PMID:25820276

  13. Production of Viable Gametes without Meiosis in Maize Deficient for an ARGONAUTE Protein[W

    PubMed Central

    Singh, Manjit; Goel, Shalendra; Meeley, Robert B.; Dantec, Christelle; Parrinello, Hugues; Michaud, Caroline; Leblanc, Olivier; Grimanelli, Daniel

    2011-01-01

    Apomixis is a form of asexual reproduction through seeds in angiosperms. Apomictic plants bypass meiosis and fertilization, developing offspring that are genetically identical to their mother. In a genetic screen for maize (Zea mays) mutants mimicking aspects of apomixis, we identified a dominant mutation resulting in the formation of functional unreduced gametes. The mutant shows defects in chromatin condensation during meiosis and subsequent failure to segregate chromosomes. The mutated locus codes for AGO104, a member of the ARGONAUTE family of proteins. AGO104 accumulates specifically in somatic cells surrounding the female meiocyte, suggesting a mobile signal rather than cell-autonomous control. AGO104 is necessary for non-CG methylation of centromeric and knob-repeat DNA. Digital gene expression tag profiling experiments using high-throughput sequencing show that AGO104 influences the transcription of many targets in the ovaries, with a strong effect on centromeric repeats. AGO104 is related to Arabidopsis thaliana AGO9, but while AGO9 acts to repress germ cell fate in somatic tissues, AGO104 acts to repress somatic fate in germ cells. Our findings show that female germ cell development in maize is dependent upon conserved small RNA pathways acting non-cell-autonomously in the ovule. Interfering with this repression leads to apomixis-like phenotypes in maize. PMID:21325139

  14. IgV gene intraclonal diversification and clonal evolution in B-cell chronic lymphocytic leukaemia.

    PubMed

    Bagnara, Davide; Callea, Vincenzo; Stelitano, Caterina; Morabito, Fortunato; Fabris, Sonia; Neri, Antonino; Zanardi, Sabrina; Ghiotto, Fabio; Ciccone, Ermanno; Grossi, Carlo Enrico; Fais, Franco

    2006-04-01

    Intraclonal diversification of immunoglobulin (Ig) variable (V) genes was evaluated in leukaemic cells from a B-cell chronic lymphocytic leukaemia (B-CLL) case over a 2-year period at four time points. Intraclonal heterogeneity was analysed by sequencing 305 molecular clones derived from polymerase chain reaction amplification of B-CLL cell IgV heavy (H) and light (C) chain gene rearrangements. Sequences were compared with evaluating intraclonal variation and the nature of somatic mutations. Although IgV intraclonal variation was detected at all time points, its level decreased with time and a parallel emergence of two more represented V(H)DJ(H) clones was observed. They differed by nine nucleotide substitutions one of which only caused a conservative replacement aminoacid change. In addition, one V(L)J(L) rearrangement became more represented over time. Analyses of somatic mutations suggest antigen selection and impairment of negative selection of neoplastic cells. In addition, a genealogical tree representing a model of clonal evolution of the neoplastic cells was created. It is of note that, during the period of study, the patient showed clinical progression of disease. We conclude that antigen stimulation and somatic hypermutation may participate in disease progression through the selection and expansion of neoplastic subclone(s).

  15. Health and reproductive profiles of malaria antigen-producing transgenic goats derived by somatic cell nuclear transfer.

    PubMed

    Behboodi, E; Ayres, S L; Memili, E; O'Coin, M; Chen, L H; Reggio, B C; Landry, A M; Gavin, W G; Meade, H M; Godke, R A; Echelard, Y

    2005-01-01

    Nuclear transfer (NT) using transfected primary cells is an efficient approach for the generation of transgenic goats. However, reprogramming abnormalities associated with this process might result in compromised animals. We examined the health, reproductive performance, and milk production of four transgenic does derived from somatic cell NT. Goats were derived from two fetal cell lines, each transfected with a transgene expressing a different version of the MSP-1(42) malaria antigen, either glycosylated or non-glycosylated. Two female kids were produced per cell line. Health and growth of these NT animals were monitored and compared with four age-matched control does. There were no differences in birth and weaning weights between NT and control animals. The NT does were bred and produced a total of nine kids. The control does delivered five kids. The NT does expressing the glycosylated antigen lactated only briefly, probably as a result of over-expression of the MSP-1(42) protein. However, NT does expressing the non-glycosylated antigen had normal milk yields and produced the recombinant protein. These data demonstrated that the production of healthy transgenic founder goats by somatic cell NT is readily achievable and that these animals can be used successfully for the production of a candidate Malaria vaccine.

  16. Generation of biallelic knock-out sheep via gene-editing and somatic cell nuclear transfer

    PubMed Central

    Li, Honghui; Wang, Gui; Hao, Zhiqiang; Zhang, Guozhong; Qing, Yubo; Liu, Shuanghui; Qing, Lili; Pan, Weirong; Chen, Lei; Liu, Guichun; Zhao, Ruoping; Jia, Baoyu; Zeng, Luyao; Guo, Jianxiong; Zhao, Lixiao; Zhao, Heng; Lv, Chaoxiang; Xu, Kaixiang; Cheng, Wenmin; Li, Hushan; Zhao, Hong-Ye; Wang, Wen; Wei, Hong-Jiang

    2016-01-01

    Transgenic sheep can be used to achieve genetic improvements in breeds and as an important large-animal model for biomedical research. In this study, we generated a TALEN plasmid specific for ovine MSTN and transfected it into fetal fibroblast cells of STH sheep. MSTN biallelic-KO somatic cells were selected as nuclear donor cells for SCNT. In total, cloned embryos were transferred into 37 recipient gilts, 28 (75.7%) becoming pregnant and 15 delivering, resulting in 23 lambs, 12 of which were alive. Mutations in the lambs were verified via sequencing and T7EI assay, and the gene mutation site was consistent with that in the donor cells. Off-target analysis was performed, and no off-target mutations were detected. MSTN KO affected the mRNA expression of MSTN relative genes. The growth curve for the resulting sheep suggested that MSTN KO caused a remarkable increase in body weight compared with those of wild-type sheep. Histological analyses revealed that MSTN KO resulted in muscle fiber hypertrophy. These findings demonstrate the successful generation of MSTN biallelic-KO STH sheep via gene editing in somatic cells using TALEN technology and SCNT. These MSTN mutant sheep developed and grew normally, and exhibited increased body weight and muscle growth. PMID:27654750

  17. Expression profiling and pathway analysis of Krüppel-like factor 4 in mouse embryonic fibroblasts

    PubMed Central

    Hagos, Engda G; Ghaleb, Amr M; Kumar, Amrita; Neish, Andrew S; Yang, Vincent W

    2011-01-01

    Background: Krüppel-like factor 4 (KLF4) is a zinc-finger transcription factor with diverse regulatory functions in proliferation, differentiation, and development. KLF4 also plays a role in inflammation, tumorigenesis, and reprogramming of somatic cells to induced pluripotent stem (iPS) cells. To gain insight into the mechanisms by which KLF4 regulates these processes, we conducted DNA microarray analyses to identify differentially expressed genes in mouse embryonic fibroblasts (MEFs) wild type and null for Klf4. Methods: Expression profiles of fibroblasts isolated from mouse embryos wild type or null for the Klf4 alleles were examined by DNA microarrays. Differentially expressed genes were subjected to the Database for Annotation, Visualization and Integrated Discovery (DAVID). The microarray data were also interrogated with the Ingenuity Pathway Analysis (IPA) and Gene Set Enrichment Analysis (GSEA) for pathway identification. Results obtained from the microarray analysis were confirmed by Western blotting for select genes with biological relevance to determine the correlation between mRNA and protein levels. Results: One hundred and sixty three up-regulated and 88 down-regulated genes were identified that demonstrated a fold-change of at least 1.5 and a P-value < 0.05 in Klf4-null MEFs compared to wild type MEFs. Many of the up-regulated genes in Klf4-null MEFs encode proto-oncogenes, growth factors, extracellular matrix, and cell cycle activators. In contrast, genes encoding tumor suppressors and those involved in JAK-STAT signaling pathways are down-regulated in Klf4-null MEFs. IPA and GSEA also identified various pathways that are regulated by KLF4. Lastly, Western blotting of select target genes confirmed the changes revealed by microarray data. Conclusions: These data are not only consistent with previous functional studies of KLF4's role in tumor suppression and somatic cell reprogramming, but also revealed novel target genes that mediate KLF4's functions. PMID:21892412

  18. Creation of Mice Bearing a Partial Duplication of HPRT Gene Marked with a GFP Gene and Detection of Revertant Cells In Situ as GFP-Positive Somatic Cells.

    PubMed

    Noda, Asao; Suemori, Hirofumi; Hirai, Yuko; Hamasaki, Kanya; Kodama, Yoshiaki; Mitani, Hiroshi; Landes, Reid D; Nakamura, Nori

    2015-01-01

    It is becoming clear that apparently normal somatic cells accumulate mutations. Such accumulations or propagations of mutant cells are thought to be related to certain diseases such as cancer. To better understand the nature of somatic mutations, we developed a mouse model that enables in vivo detection of rare genetically altered cells via GFP positive cells. The mouse model carries a partial duplication of 3' portion of X-chromosomal HPRT gene and a GFP gene at the end of the last exon. In addition, although HPRT gene expression was thought ubiquitous, the expression level was found insufficient in vivo to make the revertant cells detectable by GFP positivity. To overcome the problem, we replaced the natural HPRT-gene promoter with a CAG promoter. In such animals, termed HPRT-dup-GFP mouse, losing one duplicated segment by crossover between the two sister chromatids or within a single molecule of DNA reactivates gene function, producing hybrid HPRT-GFP proteins which, in turn, cause the revertant cells to be detected as GFP-positive cells in various tissues. Frequencies of green mutant cells were measured using fixed and frozen sections (liver and pancreas), fixed whole mount (small intestine), or by means of flow cytometry (unfixed splenocytes). The results showed that the frequencies varied extensively among individuals as well as among tissues. X-ray exposure (3 Gy) increased the frequency moderately (~2 times) in the liver and small intestine. Further, in two animals out of 278 examined, some solid tissues showed too many GFP-positive cells to score (termed extreme jackpot mutation). Present results illustrated a complex nature of somatic mutations occurring in vivo. While the HPRT-dup-GFP mouse may have a potential for detecting tissue-specific environmental mutagens, large inter-individual variations of mutant cell frequency cause the results unstable and hence have to be reduced. This future challenge will likely involve lowering the background mutation frequency, thus reducing inter-individual variation.

  19. Enhanced somatic embryogenesis in Theobroma cacao using the homologous BABY BOOM transcription factor.

    PubMed

    Florez, Sergio L; Erwin, Rachel L; Maximova, Siela N; Guiltinan, Mark J; Curtis, Wayne R

    2015-05-16

    Theobroma cacao, the chocolate tree, is an important economic crop in East Africa, South East Asia, and South and Central America. Propagation of elite varieties has been achieved through somatic embryogenesis (SE) but low efficiencies and genotype dependence still presents a significant limitation for its propagation at commercial scales. Manipulation of transcription factors has been used to enhance the formation of SEs in several other plant species. This work describes the use of the transcription factor Baby Boom (BBM) to promote the transition of somatic cacao cells from the vegetative to embryonic state. An ortholog of the Arabidopsis thaliana BBM gene (AtBBM) was characterized in T. cacao (TcBBM). TcBBM expression was observed throughout embryo development and was expressed at higher levels during SE as compared to zygotic embryogenesis (ZE). TcBBM overexpression in A. thaliana and T. cacao led to phenotypes associated with SE that did not require exogenous hormones. While transient ectopic expression of TcBBM provided only moderate enhancements in embryogenic potential, constitutive overexpression dramatically increased SE proliferation but also appeared to inhibit subsequent development. Our work provides validation that TcBBM is an ortholog to AtBBM and has a specific role in both somatic and zygotic embryogenesis. Furthermore, our studies revealed that TcBBM transcript levels could serve as a biomarker for embryogenesis in cacao tissue. Results from transient expression of TcBBM provide confirmation that transcription factors can be used to enhance SE without compromising plant development and avoiding GMO plant production. This strategy could compliment a hormone-based method of reprogramming somatic cells and lead to more precise manipulation of SE at the regulatory level of transcription factors. The technology would benefit the propagation of elite varieties with low regeneration potential as well as the production of transgenic plants, which similarly requires somatic cell reprogramming.

  20. Somatic mutations reveal asymmetric cellular dynamics in the early human embryo

    DOE PAGES

    Ju, Young Seok; Martincorena, Inigo; Gerstung, Moritz; ...

    2017-03-22

    Somatic cells acquire mutations throughout the course of an individual’s life. Mutations occurring early in embryogenesis are often present in a substantial proportion of, but not all, cells in postnatal humans and thus have particular characteristics and effects. Depending on their location in the genome and the proportion of cells they are present in, these mosaic mutations can cause a wide range of genetic disease syndromes and predispose carriers to cancer. They have a high chance of being transmitted to offspring as de novo germline mutations and, in principle, can provide insights into early human embryonic cell lineages and theirmore » contributions to adult tissues. Although it is known that gross chromosomal abnormalities are remarkably common in early human embryos, our understanding of early embryonic somatic mutations is very limited. Here we use whole-genome sequences of normal blood from 241 adults to identify 163 early embryonic mutations. We estimate that approximately three base substitution mutations occur per cell per cell-doubling event in early human embryogenesis and these are mainly attributable to two known mutational signatures. We used the mutations to reconstruct developmental lineages of adult cells and demonstrate that the two daughter cells of many early embryonic cell-doubling events contribute asymmetrically to adult blood at an approximately 2:1 ratio. As a result, this study therefore provides insights into the mutation rates, mutational processes and developmental outcomes of cell dynamics that operate during early human embryogenesis.« less

  1. Somatic mutations reveal asymmetric cellular dynamics in the early human embryo

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ju, Young Seok; Martincorena, Inigo; Gerstung, Moritz

    Somatic cells acquire mutations throughout the course of an individual’s life. Mutations occurring early in embryogenesis are often present in a substantial proportion of, but not all, cells in postnatal humans and thus have particular characteristics and effects. Depending on their location in the genome and the proportion of cells they are present in, these mosaic mutations can cause a wide range of genetic disease syndromes and predispose carriers to cancer. They have a high chance of being transmitted to offspring as de novo germline mutations and, in principle, can provide insights into early human embryonic cell lineages and theirmore » contributions to adult tissues. Although it is known that gross chromosomal abnormalities are remarkably common in early human embryos, our understanding of early embryonic somatic mutations is very limited. Here we use whole-genome sequences of normal blood from 241 adults to identify 163 early embryonic mutations. We estimate that approximately three base substitution mutations occur per cell per cell-doubling event in early human embryogenesis and these are mainly attributable to two known mutational signatures. We used the mutations to reconstruct developmental lineages of adult cells and demonstrate that the two daughter cells of many early embryonic cell-doubling events contribute asymmetrically to adult blood at an approximately 2:1 ratio. As a result, this study therefore provides insights into the mutation rates, mutational processes and developmental outcomes of cell dynamics that operate during early human embryogenesis.« less

  2. Production of nuclear transfer embryos by using somatic cells isolated from milk in buffalo (Bubalus bubalis).

    PubMed

    Golla, K; Selokar, N L; Saini, M; Chauhan, M S; Manik, R S; Palta, P; Singla, S K

    2012-10-01

    Somatic cells in milk are a potential source of nuclei for nuclear transfer to produce genetically identical animals; this is especially important in animals that are susceptible to risks of bacterial infection on biopsy collection. In this study, a minimum of 10 milk samples were collected from each of the three buffaloes representing Murrah breed. All the samples were processed immediately and cell colonies were obtained. Cell colonies from one buffalo (MU-442) survived beyond 10 passages and were evaluated by fluorescence microscopy and used in nuclear transfer experiments. In culture, these cells expressed vimentin, indicating they were of fibroblast origin similar to ear cells. We compared the effectiveness of cloning using those milk-derived fibroblast (MDF) cells and fibroblast cells derived from the ear derived fibroblast (EDF). Fusion and cleavage rates of MDF-NT and EDF-NT embryos were found to be similar (92.43 ± 1.28% vs 94.98 ± 1.24%, and 80.27 ± 1.75% vs 84.56 ± 3.73%, respectively; p > 0.01); however, development to blastocyst stage and total cell number was higher for EDF-NT embryos (50.24 ± 2.54%, 227.14 ± 13.04, respectively, p < 0.01), than for MDF-NT embryos (16.44 ± 0.75%, 170.57 ± 4.50 respectively). We conclude that somatic cells from milk can be cultured effectively and used as nucleus donor to produce cloned blastocyst-stage embryos. © 2012 Blackwell Verlag GmbH.

  3. The union of somatic gonad precursors and primordial germ cells during C. elegans embryogenesis

    PubMed Central

    Rohrschneider, Monica R.; Nance, Jeremy

    2013-01-01

    Somatic gonadal niche cells control the survival, differentiation, and proliferation of germline stem cells. The establishment of this niche-stem cell relationship is critical, and yet the precursors to these two cell types are often born at a distance from one another. The simple C. elegans gonadal primordium, which contains two somatic gonad precursors (SGPs) and two primordial germ cells (PGCs), provides an accessible model for determining how stem cell and niche cell precursors first assemble during development. To visualize the morphogenetic events that lead to formation of the gonadal primordium, we generated transgenic strains to label the cell membranes of the SGPs and PGCs and captured time-lapse movies as the gonadal primordium formed. We identify three distinct phases of SGP behavior: posterior migration along the endoderm towards the PGCs, extension of a single long projection around the adjacent PGC, and a dramatic wrapping over the PGC surfaces. We show that the endoderm and PGCs are dispensable for SGP posterior migration and initiation of projections. However, both tissues are required for the final positioning of the SGPs and the morphology of their projections, and PGCs are absolutely required for SGP wrapping behaviors. Finally, we demonstrate that the basement membrane component laminin, which localizes adjacent to the developing gonadal primordium, is required to prevent the SGPs from over-extending past the PGCs. Our findings provide a foundation for understanding the cellular and molecular regulation of the establishment of a niche-stem cell relationship. PMID:23562590

  4. Impeding Xist expression from the active X chromosome improves mouse somatic cell nuclear transfer.

    PubMed

    Inoue, Kimiko; Kohda, Takashi; Sugimoto, Michihiko; Sado, Takashi; Ogonuki, Narumi; Matoba, Shogo; Shiura, Hirosuke; Ikeda, Rieko; Mochida, Keiji; Fujii, Takashi; Sawai, Ken; Otte, Arie P; Tian, X Cindy; Yang, Xiangzhong; Ishino, Fumitoshi; Abe, Kuniya; Ogura, Atsuo

    2010-10-22

    Cloning mammals by means of somatic cell nuclear transfer (SCNT) is highly inefficient because of erroneous reprogramming of the donor genome. Reprogramming errors appear to arise randomly, but the nature of nonrandom, SCNT-specific errors remains elusive. We found that Xist, a noncoding RNA that inactivates one of the two X chromosomes in females, was ectopically expressed from the active X (Xa) chromosome in cloned mouse embryos of both sexes. Deletion of Xist on Xa showed normal global gene expression and resulted in about an eight- to ninefold increase in cloning efficiency. We also identified an Xist-independent mechanism that specifically down-regulated a subset of X-linked genes through somatic-type repressive histone blocks. Thus, we have identified nonrandom reprogramming errors in mouse cloning that can be altered to improve the efficiency of SCNT methods.

  5. [In vitro regeneration and applications using vegetable cell and tissue culture].

    PubMed

    Jordán, M

    1990-10-01

    Plant cells by means of their totipotency and aided by in vitro culture techniques can be induced to perform morphogenesis leading to somatic embryoids and massive clonal multiplication; microspores or pollen can be triggered to recover haploid plants, then characters expressed via haploidy can be selected and fixed. Protoplasts from different species can lead to recombinations. We report here work done on Carica pubescens, where somatic embryoids were obtained from cells; in Prunus avium androgenesis leading to pollen calli was triggered, while plants were recovered from Nicotiana tabacum anthers. Fusion products were obtained using C. pubescens and C. papaya protoplasts, leading up to calli and shoots.

  6. Use of a Novel Cell Adhesion Method and Digital Measurement to Show Stimulus-dependent Variation in Somatic and Oral Ciliary Beat Frequency in Paramecium

    PubMed Central

    Bell, Wade E.; Hallworth, Richard; Wyatt, Todd A.; Sisson, Joseph H.

    2015-01-01

    When Paramecium encounters positive stimuli, the membrane hyperpolarizes and ciliary beat frequency increases. We adapted an established immobilization protocol using a biological adhesive and a novel digital analysis system to quantify beat frequency in immobilized Paramecium. Cells showed low mortality and demonstrated beat frequencies consistent with previous studies. Chemoattractant molecules, reduction in external potassium, and posterior stimulation all increased somatic beat frequency. In all cases, the oral groove cilia maintained a higher beat frequency than mid-body cilia, but only oral cilia from cells stimulated with chemoattactants showed an increase from basal levels. PMID:25066640

  7. Defect in IgV gene somatic hypermutation in common variable immuno-deficiency syndrome.

    PubMed

    Levy, Y; Gupta, N; Le Deist, F; Garcia, C; Fischer, A; Weill, J C; Reynaud, C A

    1998-10-27

    Common Variable Immuno-Deficiency (CVID) is the most common symptomatic primary antibody-deficiency syndrome, but the basic immunologic defects underlying this syndrome are not well defined. We report here that among eight patients studied (six CVID and two hypogammaglobulinemic patients with recurrent infections), there is in two CVID patients a dramatic reduction in Ig V gene somatic hypermutation with 40-75% of IgG transcripts totally devoid of mutations in the circulating memory B cell compartment. Functional assays of the T cell compartment point to an intrinsic B cell defect in the process of antibody affinity maturation in these two cases.

  8. Recent Advances in Preclinical Developments Using Adenovirus Hybrid Vectors.

    PubMed

    Ehrke-Schulz, Eric; Zhang, Wenli; Gao, Jian; Ehrhardt, Anja

    2017-10-01

    Adenovirus (Ad)-based vectors are efficient gene-transfer vehicles to deliver foreign DNA into living organisms, offering large cargo capacity and low immunogenicity and genotoxicity. As Ad shows low integration rates of their genomes into host chromosomes, vector-derived gene expression decreases due to continuous cell cycling in regenerating tissues and dividing cell populations. To overcome this hurdle, adenoviral delivery can be combined with mechanisms leading to maintenance of therapeutic DNA and long-term effects of the desired treatment. Several hybrid Ad vectors (AdV) exploiting various strategies for long-term treatment have been developed and characterized. This review summarizes recent developments of preclinical approaches using hybrid AdVs utilizing either the Sleeping Beauty transposase system for somatic integration into host chromosomes or designer nucleases, including transcription activator-like effector nucleases and clustered regularly interspaced short palindromic repeats/CRISPR-associated protein-9 nuclease for permanent gene editing. Further options on how to optimize these vectors further are discussed, which may lead to future clinical applications of these versatile gene-therapy tools.

  9. Influence of oil-related environmental pollutants on female reproduction.

    PubMed

    Sirotkin, Alexander V; Harrath, Abdul Halim

    2017-08-01

    The petroleum low-weight aromatic hydrocarbons benzene, toluene, ethylbenzene, m/p-xylene, and o-xylene, also known as BTEX, are among the most common hazardous sources of environmental contamination. This paper reviews the available data concerning the effects of BTEX on different aspects of female reproduction, including the fecundity, ovaries, central nervous system (CNS), oocytes, embryos, oviducts, cytogenetics of somatic and generative cells, intracellular signaling systems, and hypothalamic, pituitary and peripheral reproductive hormones. Analysis of the available literature demonstrates that BTEX can exert negative effects on various female reproductive sites, including the CNS-pituitary-ovarian axis, their signaling molecules and receptors, ovarian follicles, corpora lutea, oocytes, embryos, oviducts, ovarian cycles, fertility, and the viability of offspring. These effects could be due to the ability of BTEX to destroy chromosomes, to affect cell metabolism, including the accumulation of free radicals, and to affect the release of hormonal regulators of reproductive processes and intracellular protein kinases. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. Breast cancer genome and transcriptome integration implicates specific mutational signatures with immune cell infiltration

    PubMed Central

    Smid, Marcel; Rodríguez-González, F. Germán; Sieuwerts, Anieta M.; Salgado, Roberto; Prager-Van der Smissen, Wendy J. C.; Vlugt-Daane, Michelle van der; van Galen, Anne; Nik-Zainal, Serena; Staaf, Johan; Brinkman, Arie B.; van de Vijver, Marc J.; Richardson, Andrea L.; Fatima, Aquila; Berentsen, Kim; Butler, Adam; Martin, Sancha; Davies, Helen R.; Debets, Reno; Gelder, Marion E. Meijer-Van; van Deurzen, Carolien H. M.; MacGrogan, Gaëtan; Van den Eynden, Gert G. G. M.; Purdie, Colin; Thompson, Alastair M.; Caldas, Carlos; Span, Paul N.; Simpson, Peter T.; Lakhani, Sunil R.; Van Laere, Steven; Desmedt, Christine; Ringnér, Markus; Tommasi, Stefania; Eyford, Jorunn; Broeks, Annegien; Vincent-Salomon, Anne; Futreal, P. Andrew; Knappskog, Stian; King, Tari; Thomas, Gilles; Viari, Alain; Langerød, Anita; Børresen-Dale, Anne-Lise; Birney, Ewan; Stunnenberg, Hendrik G.; Stratton, Mike; Foekens, John A.; Martens, John W. M.

    2016-01-01

    A recent comprehensive whole genome analysis of a large breast cancer cohort was used to link known and novel drivers and substitution signatures to the transcriptome of 266 cases. Here, we validate that subtype-specific aberrations show concordant expression changes for, for example, TP53, PIK3CA, PTEN, CCND1 and CDH1. We find that CCND3 expression levels do not correlate with amplification, while increased GATA3 expression in mutant GATA3 cancers suggests GATA3 is an oncogene. In luminal cases the total number of substitutions, irrespective of type, associates with cell cycle gene expression and adverse outcome, whereas the number of mutations of signatures 3 and 13 associates with immune-response specific gene expression, increased numbers of tumour-infiltrating lymphocytes and better outcome. Thus, while earlier reports imply that the sheer number of somatic aberrations could trigger an immune-response, our data suggests that substitutions of a particular type are more effective in doing so than others. PMID:27666519

  11. FcRn Rescues Recombinant Factor VIII Fc Fusion Protein from a VWF Independent FVIII Clearance Pathway in Mouse Hepatocytes

    PubMed Central

    van der Flier, Arjan; Liu, Zhan; Tan, Siyuan; Chen, Kai; Drager, Douglas; Liu, Tongyao; Patarroyo-White, Susannah; Jiang, Haiyan; Light, David R.

    2015-01-01

    We recently developed a longer lasting recombinant factor VIII-Fc fusion protein, rFVIIIFc, to extend the half-life of replacement FVIII for the treatment of people with hemophilia A. In order to elucidate the biological mechanism for the elongated half-life of rFVIIIFc at a cellular level we delineated the roles of VWF and the tissue-specific expression of the neonatal Fc receptor (FcRn) in the biodistribution, clearance and cycling of rFVIIIFc. We find the tissue biodistribution is similar for rFVIIIFc and rFVIII and that liver is the major clearance organ for both molecules. VWF reduces the clearance and the initial liver uptake of rFVIIIFc. Pharmacokinetic studies in FcRn chimeric mice show that FcRn expressed in somatic cells (hepatocytes or liver sinusoidal endothelial cells) mediates the decreased clearance of rFVIIIFc, but FcRn in hematopoietic cells (Kupffer cells) does not affect clearance. Immunohistochemical studies show that when rFVIII or rFVIIIFc is in dynamic equilibrium binding with VWF, they mostly co localize with VWF in Kupffer cells and macrophages, confirming a major role for liver macrophages in the internalization and clearance of the VWF-FVIII complex. In the absence of VWF a clear difference in cellular localization of VWF-free rFVIII and rFVIIIFc is observed and neither molecule is detected in Kupffer cells. Instead, rFVIII is observed in hepatocytes, indicating that free rFVIII is cleared by hepatocytes, while rFVIIIFc is observed as a diffuse liver sinusoidal staining, suggesting recycling of free-rFVIIIFc out of hepatocytes. These studies reveal two parallel linked clearance pathways, with a dominant pathway in which both rFVIIIFc and rFVIII complexed with VWF are cleared mainly by Kupffer cells without FcRn cycling. In contrast, the free fraction of rFVIII or rFVIIIFc unbound by VWF enters hepatocytes, where FcRn reduces the degradation and clearance of rFVIIIFc relative to rFVIII by cycling rFVIIIFc back to the liver sinusoid and into circulation, enabling the elongated half-life of rFVIIIFc. PMID:25905473

  12. Histone Deacetylase Inhibitors in Cell Pluripotency, Differentiation, and Reprogramming

    PubMed Central

    Kretsovali, Androniki; Hadjimichael, Christiana; Charmpilas, Nikolaos

    2012-01-01

    Histone deacetylase inhibitors (HDACi) are small molecules that have important and pleiotropic effects on cell homeostasis. Under distinct developmental conditions, they can promote either self-renewal or differentiation of embryonic stem cells. In addition, they can promote directed differentiation of embryonic and tissue-specific stem cells along the neuronal, cardiomyocytic, and hepatic lineages. They have been used to facilitate embryo development following somatic cell nuclear transfer and induced pluripotent stem cell derivation by ectopic expression of pluripotency factors. In the latter method, these molecules not only increase effectiveness, but can also render the induction independent of the oncogenes c-Myc and Klf4. Here we review the molecular pathways that are involved in the functions of HDAC inhibitors on stem cell differentiation and reprogramming of somatic cells into pluripotency. Deciphering the mechanisms of HDAC inhibitor actions is very important to enable their exploitation for efficient and simple tissue regeneration therapies. PMID:22550500

  13. Ultrastructural analyses of somatic embryo initiation, development and polarity establishment from mesophyll cells of Dactylis glomerata

    NASA Technical Reports Server (NTRS)

    Vasilenko, A.; McDaniel, J. K.; Conger, B. V.

    2000-01-01

    Somatic embryos initiate and develop directly from single mesophyll cells in in vitro-cultured leaf segments of orchardgrass (Dactylis glomerata L.). Embryogenic cells establish themselves in the predivision stage by formation of thicker cell walls and dense cytoplasm. Electron microscopy observations for embryos ranging from the pre-cell-division stage to 20-cell proembryos confirm previous light microscopy studies showing a single cell origin. They also confirm that the first division is predominantly periclinal and that this division plane is important in establishing embryo polarity and in determining the embryo axis. If the first division is anticlinal or if divisions are in random planes after the first division, divisions may not continue to produce an embryo. This result may produce an embryogenic cell mass, callus formation, or no structure at all. Grant numbers: NAGW-3141, NAG10-0221.

  14. Induced pluripotent stem cells: advances to applications

    PubMed Central

    Nelson, Timothy J; Martinez-Fernandez, Almudena; Yamada, Satsuki; Ikeda, Yasuhiro; Perez-Terzic, Carmen; Terzic, Andre

    2010-01-01

    Induced pluripotent stem cell (iPS) technology has enriched the armamentarium of regenerative medicine by introducing autologous pluripotent progenitor pools bioengineered from ordinary somatic tissue. Through nuclear reprogramming, patient-specific iPS cells have been derived and validated. Optimizing iPS-based methodology will ensure robust applications across discovery science, offering opportunities for the development of personalized diagnostics and targeted therapeutics. Here, we highlight the process of nuclear reprogramming of somatic tissues that, when forced to ectopically express stemness factors, are converted into bona fide pluripotent stem cells. Bioengineered stem cells acquire the genuine ability to generate replacement tissues for a wide-spectrum of diseased conditions, and have so far demonstrated therapeutic benefit upon transplantation in model systems of sickle cell anemia, Parkinson’s disease, hemophilia A, and ischemic heart disease. The field of regenerative medicine is therefore primed to adopt and incorporate iPS cell-based advancements as a next generation stem cell platforms. PMID:21165156

  15. Piwi and potency: PIWI proteins in animal stem cells and regeneration.

    PubMed

    van Wolfswinkel, Josien C

    2014-10-01

    PIWI proteins are well known for their roles in the animal germline. They are essential for germline development and maintenance, and together with their binding partners, the piRNAs, they mediate transposon silencing. More recently, PIWI proteins have also been identified in somatic stem cells in diverse animals. The expression of PIWI proteins in these cells could be related to the ability of such cells to contribute to the germline. However, evaluation of stem cell systems across many different animal phyla suggests that PIWI proteins have an ancestral role in somatic stem cells, irrespective of their contribution to the germ cell lineage. Moreover, the data currently available reveal a possible correlation between the differentiation potential of a cell and its PIWI levels. © The Author 2014. Published by Oxford University Press on behalf of the Society for Integrative and Comparative Biology. All rights reserved. For permissions please email: journals.permissions@oup.com.

  16. Depletion of UBC9 Causes Nuclear Defects during the Vegetative and Sexual Life Cycles in Tetrahymena thermophila.

    PubMed

    Yang, Qianyi; Nasir, Amjad M; Coyne, Robert S; Forney, James D

    2015-12-01

    Ubc9p is the sole E2-conjugating enzyme for SUMOylation, and its proper function is required for regulating key nuclear events such as transcription, DNA repair, and mitosis. In Tetrahymena thermophila, the genome is separated into a diploid germ line micronucleus (MIC) that divides by mitosis and a polyploid somatic macronucleus (MAC) that divides amitotically. This unusual nuclear organization provides novel opportunities for the study of SUMOylation and Ubc9p function. We identified the UBC9 gene and demonstrated that its complete deletion from both MIC and MAC genomes is lethal. Rescue of the lethal phenotype with a GFP-UBC9 fusion gene driven by a metallothionein promoter generated a cell line with CdCl2-dependent expression of green fluorescent protein (GFP)-Ubc9p. Depletion of Ubc9p in vegetative cells resulted in the loss of MICs, but MACs continued to divide. In contrast, expression of catalytically inactive Ubc9p resulted in the accumulation of multiple MICs. Critical roles for Ubc9p were also identified during the sexual life cycle of Tetrahymena. Cell lines that were depleted for Ubc9p did not form mating pairs and therefore could not complete any of the subsequent stages of conjugation, including meiosis and macronuclear development. Mating between cells expressing catalytically inactive Ubc9p resulted in arrest during macronuclear development, consistent with our observation that Ubc9p accumulates in the developing macronucleus. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  17. Molecular Characterization of Growth Hormone-producing Tumors in the GC Rat Model of Acromegaly.

    PubMed

    Martín-Rodríguez, Juan F; Muñoz-Bravo, Jose L; Ibañez-Costa, Alejandro; Fernandez-Maza, Laura; Balcerzyk, Marcin; Leal-Campanario, Rocío; Luque, Raúl M; Castaño, Justo P; Venegas-Moreno, Eva; Soto-Moreno, Alfonso; Leal-Cerro, Alfonso; Cano, David A

    2015-11-09

    Acromegaly is a disorder resulting from excessive production of growth hormone (GH) and consequent increase of insulin-like growth factor 1 (IGF-I), most frequently caused by pituitary adenomas. Elevated GH and IGF-I levels results in wide range of somatic, cardiovascular, endocrine, metabolic, and gastrointestinal morbidities. Subcutaneous implantation of the GH-secreting GC cell line in rats leads to the formation of tumors. GC tumor-bearing rats develop characteristics that resemble human acromegaly including gigantism and visceromegaly. However, GC tumors remain poorly characterized at a molecular level. In the present work, we report a detailed histological and molecular characterization of GC tumors using immunohistochemistry, molecular biology and imaging techniques. GC tumors display histopathological and molecular features of human GH-producing tumors, including hormone production, cell architecture, senescence activation and alterations in cell cycle gene expression. Furthermore, GC tumors cells displayed sensitivity to somatostatin analogues, drugs that are currently used in the treatment of human GH-producing adenomas, thus supporting the GC tumor model as a translational tool to evaluate therapeutic agents. The information obtained would help to maximize the usefulness of the GC rat model for research and preclinical studies in GH-secreting tumors.

  18. Molecular Characterization of Growth Hormone-producing Tumors in the GC Rat Model of Acromegaly

    PubMed Central

    Martín-Rodríguez, Juan F.; Muñoz-Bravo, Jose L.; Ibañez-Costa, Alejandro; Fernandez-Maza, Laura; Balcerzyk, Marcin; Leal-Campanario, Rocío; Luque, Raúl M.; Castaño, Justo P.; Venegas-Moreno, Eva; Soto-Moreno, Alfonso; Leal-Cerro, Alfonso; Cano, David A.

    2015-01-01

    Acromegaly is a disorder resulting from excessive production of growth hormone (GH) and consequent increase of insulin-like growth factor 1 (IGF-I), most frequently caused by pituitary adenomas. Elevated GH and IGF-I levels results in wide range of somatic, cardiovascular, endocrine, metabolic, and gastrointestinal morbidities. Subcutaneous implantation of the GH-secreting GC cell line in rats leads to the formation of tumors. GC tumor-bearing rats develop characteristics that resemble human acromegaly including gigantism and visceromegaly. However, GC tumors remain poorly characterized at a molecular level. In the present work, we report a detailed histological and molecular characterization of GC tumors using immunohistochemistry, molecular biology and imaging techniques. GC tumors display histopathological and molecular features of human GH-producing tumors, including hormone production, cell architecture, senescence activation and alterations in cell cycle gene expression. Furthermore, GC tumors cells displayed sensitivity to somatostatin analogues, drugs that are currently used in the treatment of human GH-producing adenomas, thus supporting the GC tumor model as a translational tool to evaluate therapeutic agents. The information obtained would help to maximize the usefulness of the GC rat model for research and preclinical studies in GH-secreting tumors. PMID:26549306

  19. The role of telomere dynamics in aging and cancer

    NASA Astrophysics Data System (ADS)

    Blagoev, Krastan; Goodwin, Edwin

    2006-03-01

    Telomere length changes are far more dynamic than previously thought. In addition to a gradual loss of ˜100 base pairs per telomere in each cell division, losses as well as gains may occur within a single cell cycle. We are investigating how telomere exchange, extension, and deletion affect the proliferative potential of telomerase-negative somatic cells. Experimental techniques are being devised to detect dynamic telomere processes and quantify both the frequency and length changes of each. In parallel, a ``dynamic telomere model'' is being used that incorporates telomere dynamics to study how the telomere size distribution evolves with time. This is an essential step towards understanding the role that telomere dynamics play in the normal aging of tissues and organisms. The model casts light on relationships not otherwise easily explained by a deterministic ``mitotic clock,'' or to what extent the shortest initial telomere determines the onset of senescence. We also expect to identify biomarkers that will correlate with aging better than average telomere length and to shed light on the transition to unlimited growth found in telomerase-negative tumor cells having the ALT (alternative lengthening of telomeres) phenotype, and to evaluate strategies to suppress the growth of these tumors.

  20. Fusion with stem cell makes the hepatocellular carcinoma cells similar to liver tumor-initiating cells.

    PubMed

    Wang, Ran; Chen, Shuxun; Li, Changxian; Ng, Kevin Tak Pan; Kong, Chi-wing; Cheng, Jinping; Cheng, Shuk Han; Li, Ronald A; Lo, Chung Mau; Man, Kwan; Sun, Dong

    2016-02-04

    Cell fusion is a fast and highly efficient technique for cells to acquire new properties. The fusion of somatic cells with stem cells can reprogram somatic cells to a pluripotent state. Our research on the fusion of stem cells and cancer cells demonstrates that the fused cells can exhibit stemness and cancer cell-like characteristics. Thus, tumor-initiating cell-like cells are generated. We employed laser-induced single-cell fusion technique to fuse the hepatocellular carcinoma cells and human embryonic stem cells (hESC). Real-time RT-PCR, flow cytometry and in vivo tumorigenicity assay were adopted to identify the gene expression difference. We successfully produced a fused cell line that coalesces the gene expression information of hepatocellular carcinoma cells and stem cells. Experimental results showed that the fused cells expressed cancer and stemness markers as well as exhibited increased resistance to drug treatment and enhanced tumorigenesis. Fusion with stem cells transforms liver cancer cells into tumor initiating-like cells. Results indicate that fusion between cancer cell and stem cell may generate tumor initiating-like cells.

  1. Production of cloned mice from somatic cells, ES cells, and frozen bodies.

    PubMed

    Wakayama, Sayaka; Mizutani, Eiji; Wakayama, Teruhiko

    2010-01-01

    Somatic cell nuclear transfer (SCNT) has become a unique and powerful tool for epigenetic reprogramming research and gene manipulation in animals. Although the success rates of somatic cloning have been inefficient and the mechanism of reprogramming is still largely unknown, therefore, the nuclear transfer (NT) method has been thought of as a "black box approach" and inadequate to determine the detail of how genomic reprogramming occurs. However, only the NT approach can reveal dynamic and global modifications in the epigenome without using genetic modification, as well as can create live animals. At present, this is the only technique available for the preservation and propagation of valuable genetic resources from mutant mice that are infertile or too old, or recovered from carcasses, without the use of germ cells. This chapter describes a basic protocol for mouse cloning and embryonic stem (ES) cell establishment from cloned embryo using a piezo-actuated micromanipulator. This technique will greatly help not only in mouse cloning but also in other forms of micromanipulation such as intracytoplasmic sperm injection (ICSI) into oocytes or ES cell injection into blastocysts. In addition, we describe a new, more efficient mouse cloning protocol using histone deacetylase inhibitor (HDACi), which increases the success rates of cloned mice or establish rate of ES cells to fivefold. Copyright (c) 2010 Elsevier Inc. All rights reserved.

  2. Development and spindle formation in rat somatic cell nuclear transfer (SCNT) embryos in vitro using porcine recipient oocytes.

    PubMed

    Sugawara, Atsushi; Sugimura, Satoshi; Hoshino, Yumi; Sato, Eimei

    2009-08-01

    Cloning that uses somatic cell nuclear transfer (SCNT) technology with gene targeting could be a potential alternative approach to obtain valuable rat models. In the present study, we determined the developmental competence of rat SCNT embryos constructed using murine and porcine oocytes at metaphase II (MII). Further, we assessed the effects of certain factors, such as: (i) the donor cell type (fetal fibroblasts or cumulus cells); and (ii) premature chromosome condensation (PCC) with normal spindle formation, on the developmental competence of rat interspecies SCNT (iSCNT) embryos. iSCNT embryos that had been constructed using porcine oocytes developed to the blastocyst stage, while those embryos made using murine MII oocytes did not. Rat iSCNT embryos constructed with green fluorescent protein (GFP)-expressing fetal fibroblasts injected into porcine oocytes showed considerable PCC with a normal bipolar spindle formation. The total cell number of iSCNT blastocyst derived from GFP-expressing fetal fibroblasts was higher than the number derived from cumulus cells. In addition, these embryos expressed GFP at the blastocyst stage. This paper is the first report to show that rat SCNT embryos constructed using porcine MII oocytes have the potential to develop to the blastocyst stage in vitro. Thus the iSCNT technique, when performed using porcine MII oocytes, could provide a new bioassay system for the evaluatation of the developmental competence of rat somatic cells.

  3. Production of Prnp-/- goats by gene targeting in adult fibroblasts.

    PubMed

    Zhu, Caihong; Li, Bei; Yu, Guohua; Chen, Jianquan; Yu, Huiqing; Chen, Juan; Xu, Xujun; Wu, Youbing; Zhang, Aimin; Cheng, Guoxiang

    2009-04-01

    Homozygous mice devoid of functional Prnp are resistant to scrapie and prion propagation, but heterozygous mice for Prnp disruption still suffer from prion disease and prion deposition. We have previously generated heterozygous cloned goats with one allele of Prnp functional disruption. To obtain goats with both alleles of Prnp be disrupted which would be resistant to scrapie completely, a second-round gene targeting was applied to disrupt the wild type allele of Prnp in the heterozygous goats. By second-round gene targeting, we successfully disrupted the wild type allele of Prnp in primary Prnp (+/-) goat skin fibroblasts and obtained a Prnp (-/-) cell line without Prnp expression. This is the first report on successful targeting modification in primary adult somatic cells of animals. These cells were used as nuclear donors for somatic cell cloning to produce Prnp (-/-) goats. A total of 57 morulae or blastocytes developed from the reconstructed embryos were transferred to 31 recipients, which produced 7 pregnancies at day 35. At 73 days of gestation, we obtained one cloned fetus with Prnp (-/-) genotype. Our research not only indicated that multiple genetic modifications could be accomplished by multi-round gene targeting in primary somatic cells, but also provided strong evidence that gene targeting in adult cells other than fetal cells could be applied to introduce precise genetic modifications in animals without destroying the embryos.

  4. Programmable genetic switches to control transcriptional machinery of pluripotency.

    PubMed

    Pandian, Ganesh N; Sugiyama, Hiroshi

    2012-06-01

    Transcriptional activators play a central role in the regulation of gene expression and have the ability to manipulate the specification of cell fate. Pluripotency is a transient state where a cell has the potential to develop into more than one type of mature cell. The induction of pluripotency in differentiated cells requires extensive chromatin reorganization regulated by core transcriptional machinery. Several small molecules have been shown to enhance the efficiency of somatic cell reprogramming into pluripotent stem cells. However, entirely chemical-based reprogramming remains elusive. Recently, we reported that selective DNA-binding hairpin pyrrole-imidazole polyamides conjugated with histone deacetylase inhibitor could mimic natural transcription factors and epigenetically activate certain pluripotency-associated genes. Here, we review the need to develop selective chromatin-modifying transcriptional activators for somatic genome reprogramming. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Variation, "evolution", immortality and genetic instabilities in tumour cells.

    PubMed

    Bignold, L P

    2007-08-18

    The pathological characteristics of tumour cells often include variation of their histopathological features (i.e. "degrees of de-differentiation") between cases of the same tumour type and between different foci within individual tumours. Usually, only a few cell lines from tumours are immortal. Currently, somatic mutation, replicative infidelity of DNA and aneuploidy are suggested as alternative mechanisms of genomic disturbance underlying tumours. Nevertheless, apart from Hansemann's ideas of "anaplasia" and "de-differentiation" (proposed in the 1890s), and supposed "evolutionary themes" in cancer cell biology, little has been published concerning how histopathologic variation and immortality in tumour cells might arise. This paper reviews applications of the concepts of "variation" to tumours, including concepts of "evolution" and "cellular Darwinism". It is proposed that combinations of somatic mutation, DNA replicative infidelity and aneuploidy may explain the variabilities in tumours, and provide immortality in occasional tumour cells. A possible model involves (i) an initial somatic mutation causing reduced replicative fidelity of DNA, which could be variable in intensity, and thus give rise to variations between cases; (ii) a phase of replicative infidelity of DNA causing daughter cells lines to develop various abnormalities to different degrees, and hence provide for variation between areas of the same tumour. As a last event (iii) occasional asymmetric chromosomal distributions (aneuploidy) might "refresh" the ability of a daughter cell to replicate DNA faithfully causing them to become immortal. Thus extensively mutant and variable, hyperploid, and occasionally immortal cells might arise.

  6. GPCRs Direct Germline Development and Somatic Gonad Function in Planarians

    PubMed Central

    Saberi, Amir; Beets, Isabel; Schoofs, Liliane; Newmark, Phillip A.

    2016-01-01

    Planarians display remarkable plasticity in maintenance of their germline, with the ability to develop or dismantle reproductive tissues in response to systemic and environmental cues. Here, we investigated the role of G protein-coupled receptors (GPCRs) in this dynamic germline regulation. By genome-enabled receptor mining, we identified 566 putative planarian GPCRs and classified them into conserved and phylum-specific subfamilies. We performed a functional screen to identify NPYR-1 as the cognate receptor for NPY-8, a neuropeptide required for sexual maturation and germ cell differentiation. Similar to NPY-8, knockdown of this receptor results in loss of differentiated germ cells and sexual maturity. NPYR-1 is expressed in neuroendocrine cells of the central nervous system and can be activated specifically by NPY-8 in cell-based assays. Additionally, we screened the complement of GPCRs with expression enriched in sexually reproducing planarians, and identified an orphan chemoreceptor family member, ophis, that controls differentiation of germline stem cells (GSCs). ophis is expressed in somatic cells of male and female gonads, as well as in accessory reproductive tissues. We have previously shown that somatic gonadal cells are required for male GSC specification and maintenance in planarians. However, ophis is not essential for GSC specification or maintenance and, therefore, defines a secondary role for planarian gonadal niche cells in promoting GSC differentiation. Our studies uncover the complement of planarian GPCRs and reveal previously unappreciated roles for these receptors in systemic and local (i.e., niche) regulation of germ cell development. PMID:27163480

  7. GPCRs Direct Germline Development and Somatic Gonad Function in Planarians.

    PubMed

    Saberi, Amir; Jamal, Ayana; Beets, Isabel; Schoofs, Liliane; Newmark, Phillip A

    2016-05-01

    Planarians display remarkable plasticity in maintenance of their germline, with the ability to develop or dismantle reproductive tissues in response to systemic and environmental cues. Here, we investigated the role of G protein-coupled receptors (GPCRs) in this dynamic germline regulation. By genome-enabled receptor mining, we identified 566 putative planarian GPCRs and classified them into conserved and phylum-specific subfamilies. We performed a functional screen to identify NPYR-1 as the cognate receptor for NPY-8, a neuropeptide required for sexual maturation and germ cell differentiation. Similar to NPY-8, knockdown of this receptor results in loss of differentiated germ cells and sexual maturity. NPYR-1 is expressed in neuroendocrine cells of the central nervous system and can be activated specifically by NPY-8 in cell-based assays. Additionally, we screened the complement of GPCRs with expression enriched in sexually reproducing planarians, and identified an orphan chemoreceptor family member, ophis, that controls differentiation of germline stem cells (GSCs). ophis is expressed in somatic cells of male and female gonads, as well as in accessory reproductive tissues. We have previously shown that somatic gonadal cells are required for male GSC specification and maintenance in planarians. However, ophis is not essential for GSC specification or maintenance and, therefore, defines a secondary role for planarian gonadal niche cells in promoting GSC differentiation. Our studies uncover the complement of planarian GPCRs and reveal previously unappreciated roles for these receptors in systemic and local (i.e., niche) regulation of germ cell development.

  8. Method for somatic cell nuclear transfer in zebrafish.

    PubMed

    Siripattarapravat, Kannika; Cibelli, Jose B

    2011-01-01

    Somatic cell nuclear transfer (SCNT) has been a well-known technique for decades and widely applied to generate identical animals, including ones with genetic alterations. The system has been demonstrated successfully in zebrafish. The elaborated requirements of SCNT, however, limit reproducibility of the established model to a few groups in zebrafish research community. In this chapter, we meticulously outline each step of the published protocol as well as preparations of equipments and reagents used in zebrafish SCNT. All describable detailed-tips are elaborated in texts and figures. Copyright © 2011 Elsevier Inc. All rights reserved.

  9. Legal basis of the Advanced Therapies Regulation.

    PubMed

    Jekerle, V; Schröder, C; Pedone, E

    2010-01-01

    Advanced therapy medicinal products consist of gene therapy, somatic cell therapy and tissue engineered products. Due to their specific manufacturing process and mode of action these products require specially tailored legislation. With Regulation (EC) No. 1394/2007, these needs have been met. Definitions of gene therapy, somatic cell therapy and tissue engineered products were laid down. A new committee, the Committee for Advanced Therapies, was founded, special procedures such as the certification procedure for small- and medium-sized enterprises were established and the technical requirements for Marketing Authorisation Applications (quality, non-clinical and clinical) were revised.

  10. Stable knockdown of PASG enhances DNA demethylation but does not accelerate cellular senescence in TIG-7 human fibroblasts

    PubMed Central

    Suzuki, Toshikazu; Farrar, Jason E.; Yegnasubramanian, Srinivasan; Zahed, Muhammed; Suzuki, Nobuo; Arceci, Robert J.

    2009-01-01

    Demethylation of 5-methylcytosine in genomic DNA is believed to be one of the mechanisms underlying replicative life-span of mammalian cells. Both proliferation associated SNF2-like gene (PASG, also termed Lsh) and DNA methyltransferase 3B (Dnmt3b) knockout mice result in embryonic genomic hypomethylation and a replicative senescent phenotype. However, it is unclear whether gradual demethylation of DNA during somatic cell division is directly involved in senescence. In this study, we retrovirally transduced TIG-7 human fibroblasts with a shRNA against PASG and compared the rate of change in DNA methylation as well as the replicative life-span to control cells under low (3%) and ambient (20%) oxygen. Expression of PASG protein was decreased by approximately 80% compared to control cells following transduction of PASG shRNA gene. The rate of cell growth was the same in both control and PASG-suppressed cells. The rate of demethylation of DNA was significantly increased in PASG-suppressed cells as compared control cells. However, decreased PASG expression did not shorten the replicative life-span of TIG-7 cells. Culture under low oxygen extended the life-span of TIG-7 cells but did not alter the rate of DNA demethylation. While knockout of PASG during development results in genomic hypomethylation and premature senescence, our results show that while downregulation of PASG expression in a somatic cell also leads to DNA hypomethylation, there is no associated senescent phenotype. These results suggest differences in cellular consequences of hypomethylation mediated by PASG during development compared to that in somatic cells. PMID:18948754

  11. Stable knockdown of PASG enhances DNA demethylation but does not accelerate cellular senescence in TIG-7 human fibroblasts.

    PubMed

    Suzuki, Toshikazu; Farrar, Jason E; Yegnasubramanian, Srinivasan; Zahed, Muhammed; Suzuki, Nobuo; Arceci, Robert J

    2008-09-01

    Demethylation of 5-methylcytosine in genomic DNA is believed to be one of the mechanisms underlying replicative life-span of mammalian cells. Both proliferation associated SNF2-like gene (PASG, also termed Lsh) and DNA methyltransferase 3B (Dnmt3b) knockout mice result in embryonic genomic hypomethylation and a replicative senescent phenotype. However, it is unclear whether gradual demethylation of DNA during somatic cell division is directly involved in senescence. In this study, we retrovirally transduced TIG-7 human fibroblasts with a shRNA against PASG and compared the rate of change in DNA methylation as well as the replicative life-span to control cells under low (3%) and ambient (20%) oxygen. Expression of PASG protein was decreased by approximately 80% compared to control cells following transduction of PASG shRNA gene. The rate of cell growth was the same in both control and PASG-suppressed cells. The rate of demethylation of DNA was significantly increased in PASG-suppressed cells as compared control cells. However, decreased PASG expression did not shorten the replicative life-span of TIG-7 cells. Culture under low oxygen extended the life-span of TIG-7 cells but did not alter the rate of DNA demethylation. While knockout of PASG during development results in genomic hypomethylation and premature senescence, our results show that while downregulation of PASG expression in a somatic cell also leads to DNA hypomethylation, there is no associated senescent phenotype. These results suggest differences in cellular consequences of hypomethylation mediated by PASG during development compared to that in somatic cells.

  12. Somatic embryogenesis, scanning electron microscopy, histology and biochemical analysis at different developing stages of embryogenesis in six date palm (Phoenix dactylifera L.) cultivars.

    PubMed

    Aslam, Junaid; Khan, Saeed Ahmad; Cheruth, Abdul Jaleel; Mujib, Abdul; Sharma, Maheshwar Pershad; Srivastava, Prem Shanker

    2011-10-01

    An efficient somatic embryogenesis system has been established in six date palm (Phoenix dactylifera L.) cultivars (Barhee, Zardai, Khalasah, Muzati, Shishi and Zart). Somatic embryogenesis (SE) was growth regulators and cultivars dependent. Friable embryogenic callus was induced from excised shoot tips on MS medium supplemented with various auxins particularly 2,4-dichlorophenoxyacetic acid (2,4-D, 1.5 mg 1(-l)). Suspension culture increased embryogenesis potentiality. Only a-naphthaleneacetic acid (NAA, 0.5 mg 1(-1)) produced somatic embryos in culture. Somatic embryos germinated and converted into plantlets in N(6)-benzyladenine (BAP, 0.75 mg 1(-l)) added medium following a treatment with thidiazuron (TDZ, 1.0 mg 1(-l)) for maturation. Scanning electron microscopy showed early stages of somatic embryo particularly, globular types, and was in masses. Different developing stages of embryogenesis (heart, torpedo and cotyledonary) were observed under histological preparation of embryogenic callus. Biochemical screening at various stages of somatic embryogenesis (embryogenic callus, somatic embryos, matured, germinated embryos and converted plantlets) of date palm cultivars has been conducted and discussed in detail. The result discussed in this paper indicates that somatic embryos were produced in numbers and converted plantlets can be used as a good source of alternative propagation. Genetic modification to the embryo precursor cell may improve the fruit quality and yield further.

  13. Somatic embryogenesis, scanning electron microscopy, histology and biochemical analysis at different developing stages of embryogenesis in six date palm (Phoenix dactylifera L.) cultivars

    PubMed Central

    Aslam, Junaid; Khan, Saeed Ahmad; Cheruth, Abdul Jaleel; Mujib, Abdul; Sharma, Maheshwar Pershad; Srivastava, Prem Shanker

    2011-01-01

    An efficient somatic embryogenesis system has been established in six date palm (Phoenix dactylifera L.) cultivars (Barhee, Zardai, Khalasah, Muzati, Shishi and Zart). Somatic embryogenesis (SE) was growth regulators and cultivars dependent. Friable embryogenic callus was induced from excised shoot tips on MS medium supplemented with various auxins particularly 2,4-dichlorophenoxyacetic acid (2,4-D, 1.5 mg 1−l). Suspension culture increased embryogenesis potentiality. Only a-naphthaleneacetic acid (NAA, 0.5 mg 1−1) produced somatic embryos in culture. Somatic embryos germinated and converted into plantlets in N6-benzyladenine (BAP, 0.75 mg 1−l) added medium following a treatment with thidiazuron (TDZ, 1.0 mg 1−l) for maturation. Scanning electron microscopy showed early stages of somatic embryo particularly, globular types, and was in masses. Different developing stages of embryogenesis (heart, torpedo and cotyledonary) were observed under histological preparation of embryogenic callus. Biochemical screening at various stages of somatic embryogenesis (embryogenic callus, somatic embryos, matured, germinated embryos and converted plantlets) of date palm cultivars has been conducted and discussed in detail. The result discussed in this paper indicates that somatic embryos were produced in numbers and converted plantlets can be used as a good source of alternative propagation. Genetic modification to the embryo precursor cell may improve the fruit quality and yield further. PMID:23961149

  14. Methods for engineering polypeptide variants via somatic hypermutation and polypeptide made thereby

    DOEpatents

    Tsien, Roger Y; Wang, Lei

    2015-01-13

    Methods using somatic hypermutation (SHM) for producing polypeptide and nucleic acid variants, and nucleic acids encoding such polypeptide variants are disclosed. Such variants may have desired properties. Also disclosed are novel polypeptides, such as improved fluorescent proteins, produced by the novel methods, and nucleic acids, vectors, and host cells comprising such vectors.

  15. Does telomere elongation lead to a longer lifespan if cancer is considered?

    NASA Astrophysics Data System (ADS)

    Masa, Michael; Cebrat, Stanisław; Stauffer, Dietrich

    2006-05-01

    As cell proliferation is limited due to the loss of telomere repeats in DNA of normal somatic cells during division, telomere attrition can possibly play an important role in determining the maximum life span of organisms as well as contribute to the process of biological ageing. With computer simulations of cell culture development in organisms, which consist of tissues of normal somatic cells with finite growth, we obtain an increase of life span and life expectancy for longer telomeric DNA in the zygote. By additionally considering a two-mutation model for carcinogenesis and indefinite proliferation by the activation of telomerase, we demonstrate that the risk of dying due to cancer can outweigh the positive effect of longer telomeres on the longevity.

  16. Cryopyrin-associated Periodic Syndrome Caused by a Myeloid-Restricted Somatic NLRP3 Mutation

    PubMed Central

    Zhou, Qing; Aksentijevich, Ivona; Wood, Geryl M.; Walts, Avram D.; Hoffmann, Patrycja; Remmers, Elaine F.; Kastner, Daniel L.; Ombrello, Amanda K.

    2015-01-01

    Objective To identify the cause of disease in an adult patient presenting with recent onset fevers, chills, urticaria, fatigue, and profound myalgia, who was negative for cryopyrin-associated periodic syndrome (CAPS) NLRP3 mutations by conventional Sanger DNA sequencing. Methods We performed whole-exome sequencing and targeted deep sequencing using DNA from the patient’s whole blood to identify a possible NLRP3 somatic mutation. We then screened for this mutation in subcloned NLRP3 amplicons from fibroblasts, buccal cells, granulocytes, negatively-selected monocytes, and T and B lymphocytes and further confirmed the somatic mutation by targeted sequencing of exon 3. Results We identified a previously reported CAPS-associated mutation, p.Tyr570Cys, with a mutant allele frequency of 15% based on exome data. Targeted sequencing and subcloning of NLRP3 amplicons confirmed the presence of the somatic mutation in whole blood at a ratio similar to the exome data. The mutant allele frequency was in the range of 13.3%–16.8% in monocytes and 15.2%–18% in granulocytes; Notably, this mutation was either absent or present at a very low frequency in B and T lymphocytes, buccal cells, and in the patient’s cultured fibroblasts. Conclusion These data document the possibility of myeloid-restricted somatic mosaicism in the pathogenesis of CAPS, underscoring the emerging role of massively-parallel sequencing in clinical diagnosis. PMID:25988971

  17. Flow cytometry sorting of nuclei enables the first global characterization of Paramecium germline DNA and transposable elements.

    PubMed

    Guérin, Frédéric; Arnaiz, Olivier; Boggetto, Nicole; Denby Wilkes, Cyril; Meyer, Eric; Sperling, Linda; Duharcourt, Sandra

    2017-04-26

    DNA elimination is developmentally programmed in a wide variety of eukaryotes, including unicellular ciliates, and leads to the generation of distinct germline and somatic genomes. The ciliate Paramecium tetraurelia harbors two types of nuclei with different functions and genome structures. The transcriptionally inactive micronucleus contains the complete germline genome, while the somatic macronucleus contains a reduced genome streamlined for gene expression. During development of the somatic macronucleus, the germline genome undergoes massive and reproducible DNA elimination events. Availability of both the somatic and germline genomes is essential to examine the genome changes that occur during programmed DNA elimination and ultimately decipher the mechanisms underlying the specific removal of germline-limited sequences. We developed a novel experimental approach that uses flow cell imaging and flow cytometry to sort subpopulations of nuclei to high purity. We sorted vegetative micronuclei and macronuclei during development of P. tetraurelia. We validated the method by flow cell imaging and by high throughput DNA sequencing. Our work establishes the proof of principle that developing somatic macronuclei can be sorted from a complex biological sample to high purity based on their size, shape and DNA content. This method enabled us to sequence, for the first time, the germline DNA from pure micronuclei and to identify novel transposable elements. Sequencing the germline DNA confirms that the Pgm domesticated transposase is required for the excision of all ~45,000 Internal Eliminated Sequences. Comparison of the germline DNA and unrearranged DNA obtained from PGM-silenced cells reveals that the latter does not provide a faithful representation of the germline genome. We developed a flow cytometry-based method to purify P. tetraurelia nuclei to high purity and provided quality control with flow cell imaging and high throughput DNA sequencing. We identified 61 germline transposable elements including the first Paramecium retrotransposons. This approach paves the way to sequence the germline genomes of P. aurelia sibling species for future comparative genomic studies.

  18. Multipotent human stromal cells isolated from cord blood, term placenta and adult bone marrow show distinct differences in gene expression pattern

    PubMed Central

    Matigian, Nicholas; Brooke, Gary; Zaibak, Faten; Rossetti, Tony; Kollar, Katarina; Pelekanos, Rebecca; Heazlewood, Celena; Mackay-Sim, Alan; Wells, Christine A.; Atkinson, Kerry

    2014-01-01

    Multipotent mesenchymal stromal cells derived from human placenta (pMSCs), and unrestricted somatic stem cells (USSCs) derived from cord blood share many properties with human bone marrow-derived mesenchymal stromal cells (bmMSCs) and are currently in clinical trials for a wide range of clinical settings. Here we present gene expression profiles of human cord blood-derived unrestricted somatic stem cells (USSCs), human placental-derived mesenchymal stem cells (hpMSCs), and human bone marrow-derived mesenchymal stromal cells (bmMSCs), all derived from four different donors. The microarray data are available on the ArrayExpress database (www.ebi.ac.uk/arrayexpress) under accession number E-TABM-880. Additionally, the data has been integrated into a public portal, www.stemformatics.org. Our data provide a resource for understanding the differences in MSCs derived from different tissues. PMID:26484151

  19. Socializing with MYC: cell competition in development and as a model for premalignant cancer.

    PubMed

    Johnston, Laura A

    2014-04-01

    Studies in Drosophila and mammals have made it clear that genetic mutations that arise in somatic tissues are rapidly recognized and eliminated, suggesting that cellular fitness is tightly monitored. During development, damaged, mutant, or otherwise unfit cells are prevented from contributing to the tissue and are instructed to die, whereas healthy cells benefit and populate the animal. This cell selection process, known as cell competition, eliminates somatic genetic heterogeneity and promotes tissue fitness during development. Yet cell competition also has a dark side. Super competition can be exploited by incipient cancers to subvert cellular cooperation and promote selfish behavior. Evidence is accumulating that MYC plays a key role in regulation of social behavior within tissues. Given the high number of tumors with deregulated MYC, studies of cell competition promise to yield insight into how the local environment yields to and participates in the early stages of tumor formation.

  20. Genetic and Epigenetic Regulation of Human Cardiac Reprogramming and Differentiation in Regenerative Medicine

    PubMed Central

    Burridge, Paul W.; Sharma, Arun; Wu, Joseph C.

    2016-01-01

    Regeneration or replacement of lost cardiomyocytes within the heart has the potential to revolutionize cardiovascular medicine. Numerous methodologies have been used to achieve this aim, including the engraftment of bone marrow- and heart-derived cells as well as the identification of modulators of adult cardiomyocyte proliferation. Recently, the conversion of human somatic cells into induced pluripotent stem cells and induced cardiomyocyte-like cells has transformed potential approaches toward this goal, and the engraftment of cardiac progenitors derived from human embryonic stem cells into patients is now feasible. Here we review recent advances in our understanding of the genetic and epigenetic control of human cardiogenesis, cardiac differentiation, and the induced reprogramming of somatic cells to cardiomyocytes. We also cover genetic programs for inducing the proliferation of endogenous cardiomyocytes and discuss the genetic state of cells used in cardiac regenerative medicine. PMID:26631515

Top