Sample records for somatic second-hit mutations

  1. Sun exposure causes somatic second-hit mutations and angiofibroma development in tuberous sclerosis complex

    PubMed Central

    Tyburczy, Magdalena E.; Wang, Ji-an; Li, Shaowei; Thangapazham, Rajesh; Chekaluk, Yvonne; Moss, Joel; Kwiatkowski, David J.; Darling, Thomas N.

    2014-01-01

    Tuberous sclerosis complex (TSC) is characterized by the formation of tumors in multiple organs and is caused by germline mutation in one of two tumor suppressor genes, TSC1 and TSC2. As for other tumor suppressor gene syndromes, the mechanism of somatic second-hit events in TSC tumors is unknown. We grew fibroblast-like cells from 29 TSC skin tumors from 22 TSC subjects and identified germline and second-hit mutations in TSC1/TSC2 using next-generation sequencing. Eighteen of 22 (82%) subjects had a mutation identified, and 8 of the 18 (44%) subjects were mosaic with mutant allele frequencies of 0 to 19% in normal tissue DNA. Multiple tumors were available from four patients, and in each case, second-hit mutations in TSC2 were distinct indicating they arose independently. Most remarkably, 7 (50%) of the 14 somatic point mutations were CC>TT ultraviolet ‘signature’ mutations, never seen as a TSC germline mutation. These occurred exclusively in facial angiofibroma tumors from sun-exposed sites. These results implicate UV-induced DNA damage as a cause of second-hit mutations and development of TSC facial angiofibromas and suggest that measures to limit UV exposure in TSC children and adults should reduce the frequency and severity of these lesions. PMID:24271014

  2. DEPDC5 takes a second hit in familial focal epilepsy.

    PubMed

    Anderson, Matthew P

    2018-04-30

    Loss-of-function mutations in a single allele of the gene encoding DEP domain-containing 5 protein (DEPDC5) are commonly linked to familial focal epilepsy with variable foci; however, a subset of patients presents with focal cortical dysplasia that is proposed to result from a second-hit somatic mutation. In this issue of the JCI, Ribierre and colleagues provide several lines of evidence to support second-hit DEPDC5 mutations in this disorder. Moreover, the authors use in vivo, in utero electroporation combined with CRISPR-Cas9 technology to generate a murine model of the disease that recapitulates human manifestations, including cortical dysplasia-like changes, focal seizures, and sudden unexpected death. This study provides important insights into familial focal epilepsy and provides a preclinical model for evaluating potential therapies.

  3. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Peltomaeki, Paeivi, E-mail: Paivi.Peltomaki@Helsinki.Fi

    Cancer is traditionally viewed as a disease of abnormal cell proliferation controlled by a series of mutations. Mutations typically affect oncogenes or tumor suppressor genes thereby conferring growth advantage. Genomic instability facilitates mutation accumulation. Recent findings demonstrate that activation of oncogenes and inactivation of tumor suppressor genes, as well as genomic instability, can be achieved by epigenetic mechanisms as well. Unlike genetic mutations, epimutations do not change the base sequence of DNA and are potentially reversible. Similar to genetic mutations, epimutations are associated with specific patterns of gene expression that are heritable through cell divisions. Knudson's hypothesis postulates that inactivationmore » of tumor suppressor genes requires two hits, with the first hit occurring either in somatic cells (sporadic cancer) or in the germline (hereditary cancer) and the second one always being somatic. Studies on hereditary and sporadic forms of colorectal carcinoma have made it evident that, apart from genetic mutations, epimutations may serve as either hit or both. Furthermore, recent next-generation sequencing studies show that epigenetic genes, such as those encoding histone modifying enzymes and subunits for chromatin remodeling systems, are themselves frequent targets of somatic mutations in cancer and can act like tumor suppressor genes or oncogenes. This review discusses genetic vs. epigenetic origin of cancer, including cancer susceptibility, in light of recent discoveries. Situations in which mutations and epimutations occur to serve analogous purposes are highlighted.« less

  4. PTT analysis of polyps from FAP patients reveals a great majority of APC truncating mutations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Luijt, R.B. van der; Khan, P.M.; Tops, C.M.J.

    The adenomatous polyposis coli (APC) gene plays an important role in colorectal carcinogenesis. Germline APC mutations are associated with familial adenomatous polyposis (FAP), an autosomal dominantly inherited predisposition to colorectal cancer, characterized by the development of numerous adenomatous polyps in the large intestine. In order to investigate whether somatic inactivation of the remaining APC allele is necessary for adenoma formation, we collected multiple adenomatous polyps from individual FAP patients and investigated the presence of somatic mutations in the APC gene. The analysis of somatic APC mutations in these tumor samples was performed using a rapid and sensitive assay, called themore » protein truncation test (PTT). Chain-terminating somatic APC mutations were detected in the great majority of the tumor samples investigated. As expected, these mutations were mainly located in the mutation cluster region (MCR) in exon 15. Our results confirm that somatic mutation of the second APC allele is required for adenoma formation in FAP. Interestingly, in the polyps investigated in our study, the second APC allele is somatically inactivated through point mutation leading to a stop codon rather than by loss of heterozygosity. The observation that somatic second hits in APC are required for tumor development in FAP is in apparent accordance with the Knudson hypothesis for classical tumor suppressor genes. However, it is yet unknown whether chain-terminating APC mutations lead to a truncated protein exerting a dominant-negative effect or whether these mutations result in a null allele. Further investigation of this important issue will hopefully provide a better understanding of the mechanism of action of the mutated APC alleles in colorectal carcinogenesis.« less

  5. A novel mutation of the glomulin gene in an Italian family with autosomal dominant cutaneous glomuvenous malformations.

    PubMed

    Borroni, Riccardo G; Narula, Nupoor; Diegoli, Marta; Grasso, Maurizia; Concardi, Monica; Rosso, Renato; Cerica, Alessandra; Brazzelli, Valeria; Arbustini, Eloisa

    2011-12-01

    Glomuvenous malformations (GVM) are hamartomas characterized histologically by glomus cells, which should be distinguished from glomus tumors. Familial GVM are rare, often present as multiple lesions, and exhibit familial aggregation, with autosomal dominant transmission. GVM are caused by mutations of the glomulin (GLMN) gene on chromosome 1p21-p22. Their development is thought to follow the 'two-hit' hypothesis, with a somatic mutation required in addition to the inherited germline mutation. We describe a novel GLMN mutation in an Italian family with GVM in which some members present with the less commonly observed phenotype of solitary lesions. A second somatic 'hit' mutation in GLMN was not discovered in our family. We further provide histological, immunohistochemical and electron microscopic data exhibiting the classic features of GVM. The diagnosis of GVM is critical because of distinction from venous malformations and blue rubber bleb nevus syndrome, which may demonstrate clinical similarities but require different treatment. © 2011 John Wiley & Sons A/S.

  6. Second-hit mosaic mutation in mTORC1 repressor DEPDC5 causes focal cortical dysplasia-associated epilepsy.

    PubMed

    Ribierre, Théo; Deleuze, Charlotte; Bacq, Alexandre; Baldassari, Sara; Marsan, Elise; Chipaux, Mathilde; Muraca, Giuseppe; Roussel, Delphine; Navarro, Vincent; Leguern, Eric; Miles, Richard; Baulac, Stéphanie

    2018-04-30

    DEP domain-containing 5 protein (DEPDC5) is a repressor of the recently recognized amino acid-sensing branch of the mTORC1 pathway. So far, its function in the brain remains largely unknown. Germline loss-of-function mutations in DEPDC5 have emerged as a major cause of familial refractory focal epilepsies, with case reports of sudden unexpected death in epilepsy (SUDEP). Remarkably, a fraction of patients also develop focal cortical dysplasia (FCD), a neurodevelopmental cortical malformation. We therefore hypothesized that a somatic second-hit mutation arising during brain development may support the focal nature of the dysplasia. Here, using postoperative human tissue, we provide the proof of concept that a biallelic 2-hit - brain somatic and germline - mutational mechanism in DEPDC5 causes focal epilepsy with FCD. We discovered a mutation gradient with a higher rate of mosaicism in the seizure-onset zone than in the surrounding epileptogenic zone. Furthermore, we demonstrate the causality of a Depdc5 brain mosaic inactivation using CRISPR-Cas9 editing and in utero electroporation in a mouse model recapitulating focal epilepsy with FCD and SUDEP-like events. We further unveil a key role of Depdc5 in shaping dendrite and spine morphology of excitatory neurons. This study reveals promising therapeutic avenues for treating drug-resistant focal epilepsies with mTORC1-targeting molecules.

  7. Evidence of a four-hit mechanism involving SMARCB1 and NF2 in schwannomatosis-associated schwannomas.

    PubMed

    Sestini, Roberta; Bacci, Costanza; Provenzano, Aldesia; Genuardi, Maurizio; Papi, Laura

    2008-02-01

    Schwannomatosis is characterized by the onset of multiple intracranial, spinal, or peripheral schwannomas, without involvement of the vestibular nerve, which is instead pathognomonic of neurofibromatosis type 2 (NF2). Recently, a schwannomatosis family with a germline mutation of the SMARCB1 gene on chromosome 22 has been described. We report on the molecular analysis of the SMARCB1 and NF2 genes in a series of 21 patients with schwannomatosis and in eight schwannomatosis-associated tumors from four different patients. A novel germline SMARCB1 mutation was found in one patient; inactivating somatic mutations of NF2, associated with loss of heterozygosity (LOH) of 22q, were found in two schwannomas of this patient. This is the second report of a germline SMARCB1 mutation in patients affected by schwannomatosis and the first report of SMARCB1 mutations associated with somatic NF2 mutations in schwannomatosis-associated tumors. The latter observation suggests that a four-hit mechanism involving the SMARCB1 and NF2 genes may be implicated in schwannomatosis-related tumorigenesis. (c) 2007 Wiley-Liss, Inc.

  8. A shower of second hit events as the cause of multifocal renal cell carcinoma in tuberous sclerosis complex

    PubMed Central

    Tyburczy, Magdalena E.; Jozwiak, Sergiusz; Malinowska, Izabela A.; Chekaluk, Yvonne; Pugh, Trevor J.; Wu, Chin-Lee; Nussbaum, Robert L.; Seepo, Sara; Dzik, Tomasz; Kotulska, Katarzyna; Kwiatkowski, David J.

    2015-01-01

    Tuberous sclerosis complex (TSC) is a genetic disorder characterized by seizures and tumor formation in multiple organs, mainly in the brain, skin, kidney, lung and heart. Renal cell carcinoma (RCC) occurs in ∼3% of TSC patients, and typically develops at age <50. Here we describe genetic findings in two TSC patients with multiple renal tumors, each of whom had the germline mutation TSC2 p.R905Q. The first (female) TSC patient had a left followed by a right nephrectomy at ages 24 and 27. Both kidneys showed multifocal TSC-associated papillary RCC (PRCC). Targeted, next-generation sequencing (NGS) analysis of TSC2 in five tumors (four from the left kidney, one from the right) showed loss of heterozygosity in one tumor, and four different TSC2 point mutations (p.E1351*, p.R1032*, p.R1713H, c.4178_4179delCT) in the other four samples. Only one of the 11 other tumors available from this patient had one of the TSC2 second hit mutations identified. Whole-exome analysis of the five tumors identified a very small number of additional mutated genes, with an average of 3.4 nonsilent coding, somatic mutations per tumor, none of which were seen in >1 tumor. The second (male) TSC patient had bilateral partial nephrectomies (both at age 36), with similar findings of multifocal PRCC. NGS analysis of TSC2 in two of these tumors identified a second hit mutation c.2355+1G>T in one sample that was not seen in other tumors. In conclusion, we report the first detailed genetic analysis of RCCs in TSC patients. Molecular studies indicate that tumors developed independently due to various second hit events, suggesting that these patients experienced a ‘shower’ of second hit mutations in TSC2 during kidney development leading to this severe phenotype. PMID:25432535

  9. Molecular and clinical evidence for an ARMC5 tumor syndrome: concurrent inactivating germline and somatic mutations are associated with both primary macronodular adrenal hyperplasia and meningioma.

    PubMed

    Elbelt, Ulf; Trovato, Alessia; Kloth, Michael; Gentz, Enno; Finke, Reinhard; Spranger, Joachim; Galas, David; Weber, Susanne; Wolf, Cristina; König, Katharina; Arlt, Wiebke; Büttner, Reinhard; May, Patrick; Allolio, Bruno; Schneider, Jochen G

    2015-01-01

    Primary macronodular adrenal hyperplasia (PMAH) is a rare cause of Cushing's syndrome, which may present in the context of different familial multitumor syndromes. Heterozygous inactivating germline mutations of armadillo repeat containing 5 (ARMC5) have very recently been described as cause for sporadic PMAH. Whether this genetic condition also causes familial PMAH in association with other neoplasias is unclear. The aim of the present study was to delineate the molecular cause in a large family with PMAH and other neoplasias. Whole-genome sequencing and comprehensive clinical and biochemical phenotyping was performed in members of a PMAH affected family. Nodules derived from adrenal surgery and pancreatic and meningeal tumor tissue were analyzed for accompanying somatic mutations in the identified target genes. PMAH presenting either as overt or subclinical Cushing's syndrome was accompanied by a heterozygous germline mutation in ARMC5 (p.A110fs*9) located on chromosome 16. Analysis of tumor tissue showed different somatic ARMC5 mutations in adrenal nodules supporting a second hit hypothesis with inactivation of a tumor suppressor gene. A damaging somatic ARMC5 mutation was also found in a concomitant meningioma (p.R502fs) but not in a pancreatic tumor, suggesting biallelic inactivation of ARMC5 as causal also for the intracranial meningioma. Our analysis further confirms inherited inactivating ARMC5 mutations as a cause of familial PMAH and suggests an additional role for the development of concomitant intracranial meningiomas.

  10. Development of breast tumors in CHEK2, NBN/NBS1 and BLM mutation carriers does not commonly involve somatic inactivation of the wild-type allele.

    PubMed

    Suspitsin, Evgeny N; Yanus, Grigory A; Sokolenko, Anna P; Yatsuk, Olga S; Zaitseva, Olga A; Bessonov, Alexandr A; Ivantsov, Alexandr O; Heinstein, Valeria A; Klimashevskiy, Valery F; Togo, Alexandr V; Imyanitov, Evgeny N

    2014-02-01

    Somatic inactivation of the remaining allele is a characteristic feature of cancers arising in BRCA1 and BRCA2 mutation carriers, which determines their unprecedented sensitivity to some DNA-damaging agents. Data on tumor-specific status of the involved gene in novel varieties of hereditary breast cancer (BC) remain incomplete. We analyzed 32 tumors obtained from 30 patients with non-BRCA1/2 BC-associated germ-line mutations: 25 women were single mutation carriers (7 BLM, 15 CHEK2 and 3 NBN/NBS1) and 5 were double mutation carriers (2 BLM/BRCA1, 1 CHEK2/BLM, 1 CHEK2/BRCA1 and 1 NBN/BLM). Losses of heterozygosity affecting the wild-type allele were detected in none of the tumors from BLM mutation carriers, 3/18 (17 %) CHEK2-associated BC and 1/4 (25 %) NBN/NBS1-driven tumors. The remaining 28 BC were subjected to the sequence analysis of entire coding region of the involved gene; no somatic mutations were identified. We conclude that the tumor-specific loss of the wild-type allele is not characteristic for BC arising in CHEK2, NBN/NBS1 and BLM mutation carriers. Rarity of "second-hit" inactivation of the involved gene in CHEK2-, NBN/NBS1- and BLM-associated BC demonstrates their substantial biological difference from BRCA1/2-driven cancers and makes them poorly suitable for the clinical trials with cisplatin and PARP inhibitors.

  11. Gorlin syndrome with an ovarian leiomyoma associated with a PTCH1 second hit.

    PubMed

    Akizawa, Yoshika; Miyashita, Toshiyuki; Sasaki, Ryo; Nagata, Reiko; Aoki, Ryoko; Ishitani, Ken; Nagashima, Yoji; Matsui, Hideo; Saito, Kayoko

    2016-04-01

    We describe a Gorlin syndrome (GS) case with two different second hit mutations of PTCH1, one in a keratocystic odontogenic tumor (KCOT) and the other in an ovarian leiomyoma. GS is a rare genetic condition manifesting as multiple basal cell nevi associated with other features such as medulloblastomas, skeletal abnormalities, and ovarian fibromas. A 21-year-old Japanese woman with a history of two KCOTs was diagnosed with GS according to clinical criteria. A PTCH1 mutation, c.1427del T, was detected in peripheral blood. A novel PTCH1 mutation, c.264_265insAATA, had been found in the maxillary KCOT as a second hit mutation. More recently, the ovarian tumor was detected during a gynecological examination. Laparoscopic adnexectomy was performed, and the pathological diagnosis of the ovarian tumor was leiomyoma. Interestingly, another novel mutation, loss of heterozygosity spanning from 9q22.32 to 9q31.2, including PTCH1 and 89 other genes, was detected in this ovarian tumor, providing evidence of a second hit mutation. This is the first report describing a GS-associated ovarian tumor carrying a second hit in the PTCH1 region. We anticipate that accumulation of more cases will clarify the importance of second hit mutations in ovarian tumor formation in GS. © 2016 Wiley Periodicals, Inc.

  12. A case of neuroblastoma in DICER1 syndrome: Chance finding or noncanonical causation?

    PubMed

    Saskin, Avi; de Kock, Leanne; Sabbaghian, Nelly; Apellaniz-Ruiz, Maria; Bozkurt, Ceyhun; Bouron-Dal Soglio, Dorothée; Foulkes, William D

    2018-01-01

    DICER1 syndrome is an inherited disorder associated with at least a dozen rare, mainly pediatric-onset tumors. Its characterization remains incomplete. Some studies suggested that neuroblastoma (NB) may be involved in this syndrome. Here, we describe the case of a 14-year-old female presenting with a multinodular goiter (MNG) and a collision tumor composed of NB and cystic nephroma (CN). She is a carrier of a deleterious germline mutation in exon 23 of DICER1 and harbored different somatic mutations in the CN and MNG. However, no second hit was found in the NB, questioning its status as a DICER1-related tumor. © 2017 Wiley Periodicals, Inc.

  13. Molecular characterisation of SMARCB1 and NF2 in familial and sporadic schwannomatosis.

    PubMed

    Hadfield, K D; Newman, W G; Bowers, N L; Wallace, A; Bolger, C; Colley, A; McCann, E; Trump, D; Prescott, T; Evans, D G R

    2008-06-01

    Schwannomatosis is a rare condition characterised by multiple schwannomas and lack of involvement of the vestibular nerve. A recent report identified bi-allelic mutations in the SMARCB1/INI1 gene in a single family with schwannomatosis. We aimed to establish the contribution of the SMARCB1 and the NF2 genes to sporadic and familial schwannomatosis in our cohort. We performed DNA sequence and dosage analysis of SMARCB1 and NF2 in 28 sporadic cases and 15 families with schwannomatosis. We identified germline mutations in SMARCB1 in 5 of 15 (33.3%) families with schwannomatosis and 2 of 28 (7.1%) individuals with sporadic schwannomatosis. In all individuals with a germline mutation in SMARCB1 in whom tumour tissue was available, we detected a second hit with loss of SMARCB1. In addition, in all affected individuals with SMARCB1 mutations and available tumour tissue, we detected bi-allelic somatic inactivation of the NF2 gene. SMARCB1 mutations were associated with a higher number of spinal tumours in patients with a positive family history (p = 0.004). In contrast to the recent report where no NF2 mutations were identified in a schwannomatosis family with SMARCB1 mutations, in our cohort, a four hit model with mutations in both SMARCB1 and NF2 define a subset of patients with schwannomatosis.

  14. Knudson's hypothesis revisited in Indian retinoblastoma patients.

    PubMed

    Gaikwad, Namrata; Vanniarajan, Ayyasamy; Husain, Akram; Jeyaram, Illaiyaraja; Thirumalairaj, Kannan; Santhi, Radhakrishnan; Muthukkaruppan, Veerappan; Kim, Usha

    2015-12-01

    Retinoblastoma (RB) is the most common primary intraocular malignancy affecting children under 5 years of age. This study aims to correlate the clinical parameters with RB1 mutation in the light of Knudson's two-hit hypothesis in Indian RB patients. We analyzed the clinical details of 73 RB patients visiting Aravind Eye Hospital, Madurai, India, between January and October 2012. Data on gender, presenting age and sign, laterality, number of tumors in each eye and family history were collected. A semi log plot was derived based on Knudson's two-hit hypothesis. Genetic analysis of RB1 was carried out to identify the two hits. The mean age at diagnosis for unilateral and bilateral cases was 24.0 ± 15.1 and 9.8 ± 11.5 months, respectively. Familial RB was seen in 13 (17.8%) patients of whom 11 were bilateral. Multiple tumors were observed more frequently in bilateral than in unilateral cases. All unilateral and bilateral patients followed the two-hit and one-hit curves, respectively, confirming Knudson's hypothesis in Indian patients. Genetic analysis identified two somatic mutations in tumor samples of sporadic unilateral cases. Among the two bilateral patients, one received the first hit from her father and the other patient developed a de novo germline mutation during early development. The two-hit hypothesis has been reestablished in Indian patients. Genetic analysis of tumor samples has also complemented the statistical analysis to reaffirm the two hits in tumor development. © 2015 Wiley Publishing Asia Pty Ltd.

  15. Frameshift mutational target gene analysis identifies similarities and differences in constitutional mismatch repair-deficiency and Lynch syndrome.

    PubMed

    Maletzki, Claudia; Huehns, Maja; Bauer, Ingrid; Ripperger, Tim; Mork, Maureen M; Vilar, Eduardo; Klöcking, Sabine; Zettl, Heike; Prall, Friedrich; Linnebacher, Michael

    2017-07-01

    Mismatch-repair deficient (MMR-D) malignancies include Lynch Syndrome (LS), which is secondary to germline mutations in one of the MMR genes, and the rare childhood-form of constitutional mismatch repair-deficiency (CMMR-D); caused by bi-allelic MMR gene mutations. A hallmark of LS-associated cancers is microsatellite instability (MSI), characterized by coding frameshift mutations (cFSM) in target genes. By contrast, tumors arising in CMMR-D patients are thought to display a somatic mutation pattern differing from LS. This study has the main goal to identify cFSM in MSI target genes relevant in CMMR-D and to compare the spectrum of common somatic mutations, including alterations in DNA polymerases POLE and D1 between LS and CMMR-D. CMMR-D-associated tumors harbored more somatic mutations compared to LS cases, especially in the TP53 gene and in POLE and POLD1, where novel mutations were additionally identified. Strikingly, MSI in classical mononucleotide markers BAT40 and CAT25 was frequent in CMMR-D cases. MSI-target gene analysis revealed mutations in CMMR-D-associated tumors, some of them known to be frequently hit in LS, such as RNaseT2, HT001, and TGFβR2. Our results imply a general role for these cFSM as potential new drivers of MMR-D tumorigenesis. © 2017 Wiley Periodicals, Inc.

  16. Cell lineage analysis in human brain using endogenous retroelements

    PubMed Central

    Evrony, Gilad D.; Lee, Eunjung; Mehta, Bhaven K.; Benjamini, Yuval; Johnson, Robert M.; Cai, Xuyu; Yang, Lixing; Haseley, Psalm; Lehmann, Hillel S.; Park, Peter J.; Walsh, Christopher A.

    2015-01-01

    Summary Somatic mutations occur during brain development and are increasingly implicated as a cause of neurogenetic disease. However, the patterns in which somatic mutations distribute in the human brain are unknown. We used high-coverage whole-genome sequencing of single neurons from a normal individual to identify spontaneous somatic mutations as clonal marks to track cell lineages in human brain. Somatic mutation analyses in >30 locations throughout the nervous system identified multiple lineages and sub-lineages of cells marked by different LINE-1 (L1) retrotransposition events and subsequent mutation of poly-A microsatellites within L1. One clone contained thousands of cells limited to the left middle frontal gyrus, whereas a second distinct clone contained millions of cells distributed over the entire left hemisphere. These patterns mirror known somatic mutation disorders of brain development, and suggest that focally distributed mutations are also prevalent in normal brains. Single-cell analysis of somatic mutation enables tracing of cell lineage clones in human brain. PMID:25569347

  17. The prognosis of MYC translocation positive diffuse large B-cell lymphoma depends on the second hit.

    PubMed

    Clipson, Alexandra; Barrans, Sharon; Zeng, Naiyan; Crouch, Simon; Grigoropoulos, Nicholas F; Liu, Hongxiang; Kocialkowski, Sylvia; Wang, Ming; Huang, Yuanxue; Worrillow, Lisa; Goodlad, John; Buxton, Jenny; Neat, Michael; Fields, Paul; Wilkins, Bridget; Grant, John W; Wright, Penny; Ei-Daly, Hesham; Follows, George A; Roman, Eve; Watkins, A James; Johnson, Peter W M; Jack, Andrew; Du, Ming-Qing

    2015-07-01

    A proportion of MYC translocation positive diffuse large B-cell lymphomas (DLBCL) harbour a BCL2 and/or BCL6 translocation, known as double-hit DLBCL, and are clinically aggressive. It is unknown whether there are other genetic abnormalities that cooperate with MYC translocation and form double-hit DLBCL, and whether there is a difference in clinical outcome between the double-hit DLBCL and those with an isolated MYC translocation. We investigated TP53 gene mutations along with BCL2 and BCL6 translocations in a total of 234 cases of DLBCL, including 81 with MYC translocation. TP53 mutations were investigated by PCR and sequencing, while BCL2 and BCL6 translocation was studied by interphase fluorescence in situ hybridization. The majority of MYC translocation positive DLBCLs (60/81 = 74%) had at least one additional genetic hit. In MYC translocation positive DLBCL treated by R-CHOP ( n  = 67), TP53 mutation and BCL2, but not BCL6 translocation had an adverse effect on patient overall survival. In comparison with DLBCL with an isolated MYC translocation, cases with MYC/TP53 double-hits had the worst overall survival, followed by those with MYC/BCL2 double-hits. In MYC translocation negative DLBCL treated by R-CHOP ( n  = 101), TP53 mutation, BCL2 and BCL6 translocation had no impact on patient survival. The prognosis of MYC translocation positive DLBCL critically depends on the second hit, with TP53 mutations and BCL2 translocation contributing to an adverse prognosis. It is pivotal to investigate both TP53 mutations and BCL2 translocations in MYC translocation positive DLBCL, and to distinguish double-hit DLBCLs from those with an isolated MYC translocation.

  18. Biology of vascular malformations of the brain.

    PubMed

    Leblanc, Gabrielle G; Golanov, Eugene; Awad, Issam A; Young, William L

    2009-12-01

    This review discusses recent research on the genetic, molecular, cellular, and developmental mechanisms underlying the etiology of vascular malformations of the brain (VMBs), including cerebral cavernous malformation, sporadic brain arteriovenous malformation, and the arteriovenous malformations of hereditary hemorrhagic telangiectasia. Summary of Review- The identification of gene mutations and genetic risk factors associated with cerebral cavernous malformation, hereditary hemorrhagic telangiectasia, and sporadic arteriovenous malformation has enabled the development of animal models for these diseases and provided new insights into their etiology. All of the genes associated with VMBs to date have known or plausible roles in angiogenesis and vascular remodeling. Recent work suggests that the angiogenic process most severely disrupted by VMB gene mutation is that of vascular stabilization, the process whereby vascular endothelial cells form capillary tubes, strengthen their intercellular junctions, and recruit smooth muscle cells to the vessel wall. In addition, there is now good evidence that in some cases, cerebral cavernous malformation lesion formation involves a genetic 2-hit mechanism in which a germline mutation in one copy of a cerebral cavernous malformation gene is followed by a somatic mutation in the other copy. There is also increasing evidence that environmental second hits can produce lesions when there is a mutation to a single allele of a VMB gene. Recent findings begin to explain how mutations in VMB genes render vessels vulnerable to rupture when challenged with other inauspicious genetic or environmental factors and have suggested candidate therapeutics. Understanding of the cellular mechanisms of VMB formation and progression in humans has lagged behind that in animal models. New knowledge of lesion biology will spur new translational work. Several well-established clinical and genetic database efforts are already in place, and further progress will be facilitated by collaborative expansion and standardization of these.

  19. Multiple independent second-site mutations in two siblings with somatic mosaicism for Wiskott-Aldrich syndrome.

    PubMed

    Boztug, K; Germeshausen, M; Avedillo Díez, I; Gulacsy, V; Diestelhorst, J; Ballmaier, M; Welte, K; Maródi, L; Chernyshova, Li; Klein, C

    2008-07-01

    Wiskott-Aldrich syndrome (WAS) is an X-linked primary immunodeficiency disorder associated with microthrombocytopenia, eczema, autoimmunity and predisposition to malignant lymphoma. Although rare, few cases of somatic mosaicism have been published in WAS patients to date. We here report on two Ukrainian siblings who were referred to us at the age of 3 and 4 years, respectively. Both patients suffered from severe WAS caused by a nonsense mutation in exon 1 of the WAS gene. In both siblings, flow cytometric analysis revealed the presence of Wiskott-Aldrich syndrome protein (WASp)-positive and WASp-negative cell populations among T and B lymphocytes as well as natural killer (NK) cells. In contrast to previously described cases of revertant mosaicism in WAS, molecular analyses in both children showed that the WASp-positive T cells, B cells, and NK cells carried multiple different second-site mutations, resulting in different missense mutations. To our knowledge, this is the first report describing somatic mosaicism in WAS patients caused by several independent second-site mutations in the WAS gene.

  20. Histopathological analysis of aggressive renal cell carcinoma harboring a unique germline mutation in fumarate hydratase.

    PubMed

    Matsumoto, Kana; Udaka, Naoko; Hasumi, Hisashi; Nakaigawa, Noboru; Nagashima, Yoji; Tanaka, Reiko; Kato, Ikuma; Yao, Masahiro; Furuya, Mitsuko

    2018-05-24

    Hereditary leiomyomatosis and renal cell cancer (HLRCC) is a rare genetic disorder characterized by cutaneous and uterine leiomyomatosis with RCC. This disorder is caused by a germline mutation in the fumarate hydratase (FH) gene, which encodes an important enzyme of the tricarboxylic acid (TCA) cycle. This mutation distinguishes HLRCC from sporadic RCCs. Herein, we investigated a case of HLRCC in a 32-year-old man who underwent nephrectomy for treatment of a solid-cystic tumor in the left kidney. Histopathology demonstrated a variegated architecture of papillary, tubulocystic and cribriform patterns composed of high-grade tumor cells with enlarged nuclei and eosinophilic nucleoli. Immunostaining and western blotting revealed no FH expression in the tumor. Genomic DNA sequencing identified a heterozygous mutation involving deletion of the 3' end of exon 2 and intron 2 of the FH gene (c.251_267+7delTGACAGAACGCATGCCAGTAAGTG), and RT-PCR confirmed exon 2 skipping in FH mRNA. The somatic FH gene status of the tumor showed only the mutated allele, indicating loss of heterozygosity as the "second hit" of tumor suppressor gene inactivation. These data support that an FH mutation involving the splice site causes exon skipping, changing the conformation of the protein and accelerating carcinogenic cascades under impaired FH functioning in the TCA cycle. © 2018 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.

  1. Rhabdoid tumor predisposition syndrome caused by SMARCB1 constitutional deletion: prenatal detection of new case of recurrence in siblings due to gonadal mosaicism.

    PubMed

    Gigante, Laura; Paganini, Irene; Frontali, Marina; Ciabattoni, Serena; Sangiuolo, Federica Carla; Papi, Laura

    2016-01-01

    Rhabdoid tumors are aggressive malignancies that show loss-of-function mutations of SMARCB1 gene, a member of the SWI/SNF chromatin-remodeling complex controlling gene transcription. One-third of patients affected by rhabdoid tumor harbor a germ-line mutation of SMARCB1 defining a rhabdoid tumor predisposition syndrome. The occurrence of a second somatic mutation determines the development of neoplasia in a two-hit model. Most germ-line mutations occur de novo, and few cases of recurrence in a sibship have been described. Here we report on a new Italian family with recurrence of SMARCB1 germ-line deletion in two siblings due to gonadal mosaicism. The deletion was identified in the 9-month-old proband with malignant rhabdoid tumor of the right kidney and disseminated metastases. Testing of both parents confirmed the de novo origin of the mutation, but recurrence was then detected prenatally in a new pregnancy. This is the sixth family with malignant rhabdoid tumor predisposition syndrome with the recurrence of the same germ-line SMARCB1 mutation in the sibship but not in healthy parents, suggesting that gonadal mosaicism is a less rare event than supposed. The clinical outcome in our patient confirms previous data of poorer outcome in patients with rhabdoid tumor predisposition syndrome.

  2. Deep Sequencing Reveals Spatially Distributed Distinct Hot Spot Mutations in DICER1-Related Multinodular Goiter.

    PubMed

    de Kock, Leanne; Bah, Ismaël; Revil, Timothée; Bérubé, Pierre; Wu, Mona K; Sabbaghian, Nelly; Priest, John R; Ragoussis, Jiannis; Foulkes, William D

    2016-10-01

    Nontoxic multinodular goiter (MNG) occurs frequently, but its genetic etiology is not well established. Familial MNG and MNG occurring with ovarian Sertoli-Leydig cell tumor are associated with germline DICER1 mutations. We recently identified second somatic DICER1 ribonuclease (RNase) IIIb mutations in two MNGs. The objective of the study was to investigate the occurrence of somatic DICER1 mutations and mutational clonality in MNG. MNGs from 15 patients (10 with and five without germline DICER1 mutations) were selected based on tissue availability. Core biopsies/scrapings (n = 70) were obtained, sampling areas of follicular hyperplasia, hyperplasia within colloid pools, unremarkable thyroid parenchyma, and areas of thyroid parenchyma, not classified. After capture with a Fluidigm access array, the coding sequence of DICER1 was deep sequenced using DNA from each core/scraping. All germline DICER1-mutated cases were found to harbor at least one RNase III mutation. Specifically, we identified 12 individually distinct DICER1 RNase IIIb hot spot mutations in 32 of the follicular hyperplasia or hyperplasia within colloid pools cores/scrapings. These mutations are predicted to affect the metal-ion binding residues at positions p.Glu1705, p.Asp1709, p.Gly1809, p.Asp1810, and p.Glu1813. Somatic RNase IIIb mutations were identified in the 10 DICER1 germline mutated MNGs as follows: two cases contained one somatic mutation, five cases contained two mutations, and three cases contained three distinct somatic hot spot mutations. No RNase IIIb mutations were identified in the MNGs from individuals without germline DICER1 mutations. This study demonstrates that nodules within MNG occurring in DICER1 syndrome are associated with spatially distributed somatic DICER1 RNase IIIb mutations.

  3. Colon and Endometrial Cancers with Mismatch Repair Deficiency can Arise from Somatic, Rather Than Germline, Mutations

    PubMed Central

    Haraldsdottir, Sigurdis; Hampel, Heather; Tomsic, Jerneja; Frankel, Wendy L.; Pearlman, Rachel; de la Chapelle, Albert; Pritchard, Colin C.

    2014-01-01

    Background & Aims Patients with Lynch syndrome carry germline mutations in single alleles of genes encoding the MMR proteins MLH1, MSH2, MSH6 and PMS2; when the second allele becomes mutated, cancer can develop. Increased screening for Lynch syndrome has identified patients with tumors that have deficiency in MMR, but no germline mutations in genes encoding MMR proteins. We investigated whether tumors with deficient MMR had acquired somatic mutations in patients without germline mutations in MMR genes using next-generation sequencing. Methods We analyzed blood and tumor samples from 32 patients with colorectal or endometrial cancer who participated in Lynch syndrome screening studies in Ohio and were found to have tumors with MMR deficiency (based on microsatellite instability and/or absence of MMR proteins in immunohistochemical analysis, without hypermethylation of MLH1), but no germline mutations in MMR genes. Tumor DNA was sequenced for MLH1, MSH2, MSH6, PMS2, EPCAM, POLE and POLD1 with ColoSeq and mutation frequencies were established. Results Twenty-two of 32 patients (69%) were found to have two somatic (tumor) mutations in MMR genes encoding proteins that were lost from tumor samples, based on immunohistochemistry. Of the 10 tumors without somatic mutations in MMR genes, 3 had somatic mutations with possible loss of heterozygosity that could lead to MMR deficiency, 6 were found to be false-positive results (19%), and 1 had no mutations known to be associated with MMR deficiency. All of the tumors found to have somatic MMR mutations were of the hypermutated phenotype (>12 mutations/Mb); 6 had mutation frequencies >200 per Mb, and 5 of these had somatic mutations in POLE, which encodes a DNA polymerase. Conclusions Some patients are found to have tumors with MMR deficiency during screening for Lynch syndrome, yet have no identifiable germline mutations in MMR genes. We found that almost 70% of these patients acquire somatic mutations in MMR genes, leading to a hypermutated phenotype of tumor cells. Patients with colon or endometrial cancers with MMR deficiency not explained by germline mutations might undergo analysis for tumor mutations in MMR genes, to guide future surveillance guidelines. PMID:25194673

  4. De novo constitutional MLH1 epimutations confer early-onset colorectal cancer in two new sporadic Lynch syndrome cases, with derivation of the epimutation on the paternal allele in one.

    PubMed

    Goel, Ajay; Nguyen, Thuy-Phuong; Leung, Hon-Chiu E; Nagasaka, Takeshi; Rhees, Jennifer; Hotchkiss, Erin; Arnold, Mildred; Banerji, Pia; Koi, Minoru; Kwok, Chau-To; Packham, Deborah; Lipton, Lara; Boland, C Richard; Ward, Robyn L; Hitchins, Megan P

    2011-02-15

    Lynch syndrome is an autosomal dominant cancer predisposition syndrome classically caused by germline mutations of the mismatch repair genes, MLH1, MSH2, MSH6 and PMS2. Constitutional epimutations of the MLH1 gene, characterized by soma-wide methylation of a single allele of the promoter and allelic transcriptional silencing, have been identified in a subset of Lynch syndrome cases lacking a sequence mutation in MLH1. We report two individuals with no family history of colorectal cancer who developed that disease at age 18 and 20 years. In both cases, cancer had arisen because of the de novo occurrence of a constitutional MLH1 epimutation and somatic loss-of-heterozygosity of the functional allele in the tumors. We show for the first time that the epimutation in one case arose on the paternally inherited allele. Analysis of 13 tumors from seven individuals with constitutional MLH1 epimutations showed eight tumors had lost the second MLH1 allele, two tumors had a novel pathogenic missense mutation and three had retained heterozygosity. Only 1 of 12 tumors demonstrated the BRAF V600E mutation and 3 of 11 tumors harbored a mutation in KRAS. The finding that epimutations can originate on the paternal allele provides important new insights into the mechanism of origin of epimutations. It is clear that the second hit in MLH1 epimutation-associated tumors typically has a genetic not epigenetic basis. Individuals with mismatch repair-deficient cancers without the BRAF V600E mutation are candidates for germline screening for sequence or methylation changes in MLH1. Copyright © 2010 UICC.

  5. De novo constitutional MLH1 epimutations confer early-onset colorectal cancer in two new sporadic Lynch syndrome cases, with derivation of the epimutation on the paternal allele in one

    PubMed Central

    Goel, Ajay; Nguyen, Thuy-Phuong; Leung, Hon-Chiu E.; Nagasaka, Takeshi; Rhees, Jennifer; Hotchkiss, Erin; Arnold, Mildred; Banerji, Pia; Koi, Minoru; Kwok, Chau-To; Packham, Deborah; Lipton, Lara; Boland, C. Richard; Ward, Robyn L.; Hitchins, Megan P.

    2013-01-01

    Lynch syndrome is an autosomal dominant cancer predisposition syndrome classically caused by germline mutations of the mismatch repair genes, MLH1, MSH2, MSH6 and PMS2. Constitutional epimutations of the MLH1 gene, characterized by soma-wide methylation of a single allele of the promoter and allelic transcriptional silencing, have been identified in a subset of Lynch syndrome cases lacking a sequence mutation in MLH1. We report two individuals with no family history of colorectal cancer who developed that disease at age 18 and 20 years. In both cases, cancer had arisen because of the de novo occurrence of a constitutional MLH1 epimutation and somatic loss-of-heterozygosity of the functional allele in the tumors. We show for the first time that the epimutation in one case arose on the paternally inherited allele. Analysis of 13 tumors from seven individuals with constitutional MLH1 epimutations showed eight tumors had lost the second MLH1 allele, two tumors had a novel pathogenic missense mutation and three had retained heterozygosity. Only 1 of 12 tumors demonstrated the BRAF V600E mutation and 3 of 11 tumors harbored a mutation in KRAS. The finding that epimutations can originate on the paternal allele provides important new insights into the mechanism of origin of epimutations. It is clear that the second hit in MLH1 epimutation-associated tumors typically has a genetic not epigenetic basis. Individuals with mismatch repair–deficient cancers without the BRAF V600E mutation are candidates for germline screening for sequence or methylation changes in MLH1. PMID:20473912

  6. Association of a novel point mutation in MSH2 gene with familial multiple primary cancers.

    PubMed

    Hu, Hai; Li, Hong; Jiao, Feng; Han, Ting; Zhuo, Meng; Cui, Jiujie; Li, Yixue; Wang, Liwei

    2017-10-03

    Multiple primary cancers (MPC) have been identified as two or more cancers without any subordinate relationship that occur either simultaneously or metachronously in the same or different organs of an individual. Lynch syndrome is an autosomal dominant genetic disorder that increases the risk of many types of cancers. Lynch syndrome patients who suffer more than two cancers can also be considered as MPC; patients of this kind provide unique resources to learn how genetic mutation causes MPC in different tissues. We performed a whole genome sequencing on blood cells and two tumor samples of a Lynch syndrome patient who was diagnosed with five primary cancers. The mutational landscape of the tumors, including somatic point mutations and copy number alternations, was characterized. We also compared Lynch syndrome with sporadic cancers and proposed a model to illustrate the mutational process by which Lynch syndrome progresses to MPC. We revealed a novel pathologic mutation on the MSH2 gene (G504 splicing) that associates with Lynch syndrome. Systematical comparison of the mutation landscape revealed that multiple cancers in the proband were evolutionarily independent. Integrative analysis showed that truncating mutations of DNA mismatch repair (MMR) genes were significantly enriched in the patient. A mutation progress model that included germline mutations of MMR genes, double hits of MMR system, mutations in tissue-specific driver genes, and rapid accumulation of additional passenger mutations was proposed to illustrate how MPC occurs in Lynch syndrome patients. Our findings demonstrate that both germline and somatic alterations are driving forces of carcinogenesis, which may resolve the carcinogenic theory of Lynch syndrome.

  7. Coexistence of EGFR with KRAS, or BRAF, or PIK3CA somatic mutations in lung cancer: a comprehensive mutation profiling from 5125 Chinese cohorts

    PubMed Central

    Li, S; Li, L; Zhu, Y; Huang, C; Qin, Y; Liu, H; Ren-Heidenreich, L; Shi, B; Ren, H; Chu, X; Kang, J; Wang, W; Xu, J; Tang, K; Yang, H; Zheng, Y; He, J; Yu, G; Liang, N

    2014-01-01

    Background: Determining the somatic mutations of epidermal growth factor receptor (EGFR)-pathway networks is the key to effective treatment for non-small cell lung cancer (NSCLC) with tyrosine kinase inhibitors (TKIs).The somatic mutation frequencies and their association with gender, smoking history and histology was analysed and reported in this study. Methods: Five thousand one hundred and twenty-five NSCLC patients' pathology samples were collected, and EGFR, KRAS, BRAF and PIK3CA mutations were detected by multiplex testing. The mutation status of EGFR, KRAS, BRAF and PIK3CA and their association with gender, age, smoking history and histological type were evaluated by appropriate statistical analysis. Results: EGFR, KRAS, BRAF and PIK3CA mutation rates revealed 36.2%, 8.4%, 0.5% and 3.3%, respectively, across the 5125 pathology samples. For the first time, evidence of KRAS mutations were detected in two female, non-smoking patients, age 5 and 14, with NSCLC. Furthermore, we identified 153 double and coexisting mutations and 7 triple mutations. Interestingly, the second drug-resistant mutations, T790M or E545K, were found in 44 samples from patients who had never received TKI treatments. Conclusions: EGFR exons 19, 20 and 21, and BRAF mutations tend to happen in females and non-smokers, whereas KRAS mutations were more inclined to males and smokers. Activating and resistant mutations to EGFR-TKI drugs can coexist and ‘second drug-resistant mutations', T790M or E545K, may be primary mutations in some patients. These results will help oncologists to decide candidates for mutation testing and EGFR-TKI treatment. PMID:24743704

  8. Chromatin modifiers and the promise of epigenetic therapy in acute leukemia

    PubMed Central

    Greenblatt, Sarah M.; Nimer, Stephen D.

    2017-01-01

    Hematopoiesis is a tightly regulated process involving the control of gene expression that directs the transition from hematopoietic stem and progenitor cells to terminally differentiated blood cells. In leukemia, the processes directing self-renewal, differentiation, and progenitor cell expansion are disrupted, leading to the accumulation of immature, non-functioning malignant cells. Insights into these processes have come in stages, based upon technological advances in genetic analyses, bioinformatics, and biological sciences. The first cytogenetic studies of leukemic cells identified chromosomal translocations that generate oncogenic fusion proteins, and most commonly affect regulators of transcription. This was followed by the discovery of recurrent somatic mutations in genes encoding regulators of the signal transduction pathways that control cell proliferation and survival. Recently, studies of global changes in methylation and gene expression have led to the understanding that the output of transcriptional regulators and the proliferative signaling pathways, are ultimately influenced by chromatin structure. Candidate gene, whole genome, and whole exome sequencing studies have identified recurrent somatic mutations in genes encoding epigenetic modifiers in both acute myeloid leukemia (AML) and acute lymphoid leukemia (ALL). In contrast to the two hit model of leukemogenesis, emerging evidence suggests that these epigenetic modifiers represent a class of mutations that are critical to the development of leukemia and affect the regulation of various other oncogenic pathways. In this review, we discuss the range of recurrent, somatic mutations in epigenetic modifiers found in leukemia and how these modifiers relate to the classical leukemogenic pathways that lead to impaired cell differentiation and aberrant self-renewal and proliferation. PMID:24609046

  9. Germline PMS2 and somatic POLE exonuclease mutations cause hypermutability of the leading DNA strand in biallelic mismatch repair deficiency syndrome brain tumours.

    PubMed

    Andrianova, Maria A; Chetan, Ghati Kasturirangan; Sibin, Madathan Kandi; Mckee, Thomas; Merkler, Doron; Narasinga, Rao Kvl; Ribaux, Pascale; Blouin, Jean-Louis; Makrythanasis, Periklis; Seplyarskiy, Vladimir B; Antonarakis, Stylianos E; Nikolaev, Sergey I

    2017-11-01

    Biallelic mismatch repair deficiency (bMMRD) in tumours is frequently associated with somatic mutations in the exonuclease domains of DNA polymerases POLE or POLD1, and results in a characteristic mutational profile. In this article, we describe the genetic basis of ultramutated high-grade brain tumours in the context of bMMRD. We performed exome sequencing of two second-cousin patients from a large consanguineous family of Indian origin with early onset of high-grade glioblastoma and astrocytoma. We identified a germline homozygous nonsense variant, p.R802*, in the PMS2 gene. Additionally, by genome sequencing of these tumours, we found extremely high somatic mutation rates (237/Mb and 123/Mb), as well as somatic mutations in the proofreading domain of POLE polymerase (p.P436H and p.L424V), which replicates the leading DNA strand. Most interestingly, we found, in both cancers, that the vast majority of mutations were consistent with the signature of POLE exo - , i.e. an abundance of C>A and C>T mutations, particularly in special contexts, on the leading strand. We showed that the fraction of mutations under positive selection among mutations in tumour suppressor genes is more than two-fold lower in ultramutated tumours than in other glioblastomas. Genetic analyses enabled the diagnosis of the two consanguineous childhood brain tumours as being due to a combination of PMS2 germline and POLE somatic variants, and confirmed them as bMMRD/POLE exo - disorders. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

  10. Preleukemic and second-hit mutational events in an acute myeloid leukemia patient with a novel germline RUNX1 mutation.

    PubMed

    Ng, Isaac Ks; Lee, Joanne; Ng, Christopher; Kosmo, Bustamin; Chiu, Lily; Seah, Elaine; Mok, Michelle Meng Huang; Tan, Karen; Osato, Motomi; Chng, Wee-Joo; Yan, Benedict; Tan, Lip Kun

    2018-01-01

    Germline mutations in the RUNX1 transcription factor give rise to a rare autosomal dominant genetic condition classified under the entity: Familial Platelet Disorders with predisposition to Acute Myeloid Leukaemia (FPD/AML). While several studies have identified a myriad of germline RUNX1 mutations implicated in this disorder, second-hit mutational events are necessary for patients with hereditary thrombocytopenia to develop full-blown AML. The molecular picture behind this process remains unclear. We describe a patient of Malay descent with an unreported 7-bp germline RUNX1 frameshift deletion, who developed second-hit mutations that could have brought about the leukaemic transformation from a pre-leukaemic state. These mutations were charted through the course of the treatment and stem cell transplant, showing a clear correlation between her clinical presentation and the mutations present. The patient was a 27-year-old Malay woman who presented with AML on the background of hereditary thrombocytopenia affecting her father and 3 brothers. Initial molecular testing revealed the same novel RUNX1 mutation in all 5 individuals. The patient received standard induction, consolidation chemotherapy, and a haploidentical stem cell transplant from her mother with normal RUNX1 profile. Comprehensive genomic analyses were performed at diagnosis, post-chemotherapy and post-transplant. A total of 8 mutations ( RUNX1 , GATA2 , DNMT3A , BCORL1 , BCOR , 2 PHF6 and CDKN2A ) were identified in the pre-induction sample, of which 5 remained ( RUNX1 , DNMT3A , BCORL1 , BCOR and 1 out of 2 PHF6 ) in the post-treatment sample and none were present post-transplant. In brief, the 3 mutations which were lost along with the leukemic cells at complete morphological remission were most likely acquired leukemic driver mutations that were responsible for the AML transformation from a pre-leukemic germline RUNX1 -mutated state. On the contrary, the 5 mutations that persisted post-treatment, including the germline RUNX1 mutation, were likely to be part of the preleukemic clone. Further studies are necessary to assess the prevalence of these preleukemic and secondary mutations in the larger FPD/AML patient cohort and establish their prognostic significance. Given the molecular heterogeneity of FPD/AML and other AML subtypes, a better understanding of mutational classes and their involvement in AML pathogenesis can improve risk stratification of patients for more effective and targeted therapy.

  11. Frequent and Rare HABP2 Variants Are Not Associated with Increased Susceptibility to Familial Nonmedullary Thyroid Carcinoma in the Spanish Population.

    PubMed

    de Randamie, Rajdee; Martos-Moreno, Gabriel Ángel; Lumbreras, César; Chueca, Maria; Donnay, Sergio; Luque, Manuel; Regojo, Rita María; Mendiola, Marta; Hardisson, David; Argente, Jesús; Moreno, José C

    2018-06-12

    A genomic HABP2 variant was proposed to be responsible for familial nonmedullary thyroid carcinoma (FNMTC). However, its involvement has been questioned in subsequent studies. We aimed to identify genetic HABP2 mutations in a series of FNMTC patients and investigate their involvement in the disease. HABP2 was sequenced from 6 index patients. Presence of the variants was investigated in all members of one family. Somatic BRAF and RAS "hotspot" mutations were investigated by the IdyllaTM BRAF Mutation Test and/or Sanger sequencing. Two HABP2 variants (p.E393Q and p.G534E) were identified in the index patient from one family with papillary thyroid carcinoma (PTC) (follicular variant). The prevalence of p.E393Q in Spanish control alleles was 0.5% and that of p.G534E was 5.1%. However, neither change cosegregated with the phenotype in 3 affected members and 5 healthy members of the kindred. Interestingly, all 3 members affected by PTC harbored the p.V600E somatic mutation in BRAF. The variant G534E is prevalent in the Spanish population (5.1%); however, p.E393Q is rare (< 1%) and none cosegregated with the FNMTC phenotype. The presence of the noninheritable V600E BRAF mutation in this family supports Knudson's "double-hit" hypothesis for cancer development and suggests the involvement of more than 1 gene in the clinical expression of FNMTC. © 2018 S. Karger AG, Basel.

  12. DeepGene: an advanced cancer type classifier based on deep learning and somatic point mutations.

    PubMed

    Yuan, Yuchen; Shi, Yi; Li, Changyang; Kim, Jinman; Cai, Weidong; Han, Zeguang; Feng, David Dagan

    2016-12-23

    With the developments of DNA sequencing technology, large amounts of sequencing data have become available in recent years and provide unprecedented opportunities for advanced association studies between somatic point mutations and cancer types/subtypes, which may contribute to more accurate somatic point mutation based cancer classification (SMCC). However in existing SMCC methods, issues like high data sparsity, small volume of sample size, and the application of simple linear classifiers, are major obstacles in improving the classification performance. To address the obstacles in existing SMCC studies, we propose DeepGene, an advanced deep neural network (DNN) based classifier, that consists of three steps: firstly, the clustered gene filtering (CGF) concentrates the gene data by mutation occurrence frequency, filtering out the majority of irrelevant genes; secondly, the indexed sparsity reduction (ISR) converts the gene data into indexes of its non-zero elements, thereby significantly suppressing the impact of data sparsity; finally, the data after CGF and ISR is fed into a DNN classifier, which extracts high-level features for accurate classification. Experimental results on our curated TCGA-DeepGene dataset, which is a reformulated subset of the TCGA dataset containing 12 selected types of cancer, show that CGF, ISR and DNN all contribute in improving the overall classification performance. We further compare DeepGene with three widely adopted classifiers and demonstrate that DeepGene has at least 24% performance improvement in terms of testing accuracy. Based on deep learning and somatic point mutation data, we devise DeepGene, an advanced cancer type classifier, which addresses the obstacles in existing SMCC studies. Experiments indicate that DeepGene outperforms three widely adopted existing classifiers, which is mainly attributed to its deep learning module that is able to extract the high level features between combinatorial somatic point mutations and cancer types.

  13. Revertant mosaicism repairs skin lesions in a patient with keratitis-ichthyosis-deafness syndrome by second-site mutations in connexin 26

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gudmundsson, Sanna; Wilbe, Maria; Ekvall, Sara

    Revertant mosaicism (RM) is a naturally occurring phenomenon where the pathogenic effect of a germline mutation is corrected by a second somatic event. Development of healthy-looking skin due to RM has been observed in patients with various inherited skin disorders, but not in connexin-related disease. We aimed to clarify the underlying molecular mechanisms of suspected RM in the skin of a patient with keratitis-ichthyosis-deafness (KID) syndrome. The patient was diagnosed with KID syndrome due to characteristic skin lesions, hearing deficiency and keratitis. Investigation of GJB2 encoding connexin (Cx) 26 revealed heterozygosity for the recurrent de novo germline mutation, c.148G >more » A, p.Asp50Asn. At age 20, the patient developed spots of healthy-looking skin that grew in size and number within widespread erythrokeratodermic lesions. Ultra-deep sequencing of two healthy-looking skin biopsies identified five somatic nonsynonymous mutations, independently present in cis with the p.Asp50Asn mutation. Functional studies of Cx26 in HeLa cells revealed co-expression of Cx26-Asp50Asn and wild-type Cx26 in gap junction channel plaques. However, Cx26-Asp50Asn with the second-site mutations identified in the patient displayed no formation of gap junction channel plaques. We argue that the second-site mutations independently inhibit Cx26-Asp50Asn expression in gap junction channels, reverting the dominant negative effect of the p.Asp50Asn mutation. Finally to our knowledge, this is the first time RM has been reported to result in the development of healthy-looking skin in a patient with KID syndrome.« less

  14. Revertant mosaicism repairs skin lesions in a patient with keratitis-ichthyosis-deafness syndrome by second-site mutations in connexin 26

    DOE PAGES

    Gudmundsson, Sanna; Wilbe, Maria; Ekvall, Sara; ...

    2017-02-01

    Revertant mosaicism (RM) is a naturally occurring phenomenon where the pathogenic effect of a germline mutation is corrected by a second somatic event. Development of healthy-looking skin due to RM has been observed in patients with various inherited skin disorders, but not in connexin-related disease. We aimed to clarify the underlying molecular mechanisms of suspected RM in the skin of a patient with keratitis-ichthyosis-deafness (KID) syndrome. The patient was diagnosed with KID syndrome due to characteristic skin lesions, hearing deficiency and keratitis. Investigation of GJB2 encoding connexin (Cx) 26 revealed heterozygosity for the recurrent de novo germline mutation, c.148G >more » A, p.Asp50Asn. At age 20, the patient developed spots of healthy-looking skin that grew in size and number within widespread erythrokeratodermic lesions. Ultra-deep sequencing of two healthy-looking skin biopsies identified five somatic nonsynonymous mutations, independently present in cis with the p.Asp50Asn mutation. Functional studies of Cx26 in HeLa cells revealed co-expression of Cx26-Asp50Asn and wild-type Cx26 in gap junction channel plaques. However, Cx26-Asp50Asn with the second-site mutations identified in the patient displayed no formation of gap junction channel plaques. We argue that the second-site mutations independently inhibit Cx26-Asp50Asn expression in gap junction channels, reverting the dominant negative effect of the p.Asp50Asn mutation. Finally to our knowledge, this is the first time RM has been reported to result in the development of healthy-looking skin in a patient with KID syndrome.« less

  15. Molecular profiling and sequential somatic mutation shift in hypermutator tumours harbouring POLE mutations.

    PubMed

    Hatakeyama, Keiichi; Ohshima, Keiichi; Nagashima, Takeshi; Ohnami, Shumpei; Ohnami, Sumiko; Serizawa, Masakuni; Shimoda, Yuji; Maruyama, Koji; Akiyama, Yasuto; Urakami, Kenichi; Kusuhara, Masatoshi; Mochizuki, Tohru; Yamaguchi, Ken

    2018-06-07

    Defective DNA polymerase ε (POLE) proofreading leads to extensive somatic mutations that exhibit biased mutational properties; however, the characteristics of POLE-mutated tumours remain unclear. In the present study, we describe a molecular profile using whole exome sequencing based on the transition of somatic mutations in 10 POLE-mutated solid tumours that were obtained from 2,042 Japanese patients. The bias of accumulated variations in these mutants was quantified to follow a pattern of somatic mutations, thereby classifying the sequential mutation shift into three periods. During the period prior to occurrence of the aberrant POLE, bare accumulation of mutations in cancer-related genes was observed, whereas PTEN was highly mutated in conjunction with or subsequent to the event, suggesting that POLE and PTEN mutations were responsible for the development of POLE-mutated tumours. Furthermore, homologous recombination was restored following the occurrence of PTEN mutations. Our strategy for estimation of the footprint of somatic mutations may provide new insight towards the understanding of mutation-driven tumourigenesis.

  16. Fungal Infection Increases the Rate of Somatic Mutation in Scots Pine (Pinus sylvestris L.).

    PubMed

    Ranade, Sonali Sachin; Ganea, Laura-Stefana; Razzak, Abdur M; García Gil, M R

    2015-01-01

    Somatic mutations are transmitted during mitosis in developing somatic tissue. Somatic cells bearing the mutations can develop into reproductive (germ) cells and the somatic mutations are then passed on to the next generation of plants. Somatic mutations are a source of variation essential to evolve new defense strategies and adapt to the environment. Stem rust disease in Scots pine has a negative effect on wood quality, and thus adversely affects the economy. It is caused by the 2 most destructive fungal species in Scandinavia: Peridermium pini and Cronartium flaccidum. We studied nuclear genome stability in Scots pine under biotic stress (fungus-infected, 22 trees) compared to a control population (plantation, 20 trees). Stability was assessed as accumulation of new somatic mutations in 10 microsatellite loci selected for genotyping. Microsatellites are widely used as molecular markers in population genetics studies of plants, and are particularly used for detection of somatic mutations as their rate of mutation is of a much higher magnitude when compared with other DNA markers. We report double the rate of somatic mutation per locus in the fungus-infected trees (4.8×10(-3) mutations per locus), as compared to the controls (2.0×10(-3) mutations per locus) when individual samples were analyzed at 10 different microsatellite markers. Pearson's chi-squared test indicated a significant effect of the fungal infection which increased the number of mutations in the fungus-infected trees (χ(2) = 12.9883, df = 1, P = 0.0003134). © The American Genetic Association 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  17. Mutalisk: a web-based somatic MUTation AnaLyIS toolKit for genomic, transcriptional and epigenomic signatures.

    PubMed

    Lee, Jongkeun; Lee, Andy Jinseok; Lee, June-Koo; Park, Jongkeun; Kwon, Youngoh; Park, Seongyeol; Chun, Hyonho; Ju, Young Seok; Hong, Dongwan

    2018-05-22

    Somatic genome mutations occur due to combinations of various intrinsic/extrinsic mutational processes and DNA repair mechanisms. Different molecular processes frequently generate different signatures of somatic mutations in their own favored contexts. As a result, the regional somatic mutation rate is dependent on the local DNA sequence, the DNA replication/RNA transcription dynamics and epigenomic chromatin organization landscape in the genome. Here, we propose an online computational framework, termed Mutalisk, which correlates somatic mutations with various genomic, transcriptional and epigenomic features in order to understand mutational processes that contribute to the generation of the mutations. This user-friendly tool explores the presence of localized hypermutations (kataegis), dissects the spectrum of mutations into the maximum likelihood combination of known mutational signatures and associates the mutation density with numerous regulatory elements in the genome. As a result, global patterns of somatic mutations in any query sample can be efficiently screened, thus enabling a deeper understanding of various mutagenic factors. This tool will facilitate more effective downstream analyses of cancer genome sequences to elucidate the diversity of mutational processes underlying the development and clonal evolution of cancer cells. Mutalisk is freely available at http://mutalisk.org.

  18. DNA polymerase ι functions in the generation of tandem mutations during somatic hypermutation of antibody genes.

    PubMed

    Maul, Robert W; MacCarthy, Thomas; Frank, Ekaterina G; Donigan, Katherine A; McLenigan, Mary P; Yang, William; Saribasak, Huseyin; Huston, Donald E; Lange, Sabine S; Woodgate, Roger; Gearhart, Patricia J

    2016-08-22

    DNA polymerase ι (Pol ι) is an attractive candidate for somatic hypermutation in antibody genes because of its low fidelity. To identify a role for Pol ι, we analyzed mutations in two strains of mice with deficiencies in the enzyme: 129 mice with negligible expression of truncated Pol ι, and knock-in mice that express full-length Pol ι that is catalytically inactive. Both strains had normal frequencies and spectra of mutations in the variable region, indicating that loss of Pol ι did not change overall mutagenesis. We next examined if Pol ι affected tandem mutations generated by another error-prone polymerase, Pol ζ. The frequency of contiguous mutations was analyzed using a novel computational model to determine if they occur during a single DNA transaction or during two independent events. Analyses of 2,000 mutations from both strains indicated that Pol ι-compromised mice lost the tandem signature, whereas C57BL/6 mice accumulated significant amounts of double mutations. The results support a model where Pol ι occasionally accesses the replication fork to generate a first mutation, and Pol ζ extends the mismatch with a second mutation. @2016.

  19. DNA polymerase ι functions in the generation of tandem mutations during somatic hypermutation of antibody genes

    PubMed Central

    Donigan, Katherine A.; Huston, Donald E.; Lange, Sabine S.

    2016-01-01

    DNA polymerase ι (Pol ι) is an attractive candidate for somatic hypermutation in antibody genes because of its low fidelity. To identify a role for Pol ι, we analyzed mutations in two strains of mice with deficiencies in the enzyme: 129 mice with negligible expression of truncated Pol ι, and knock-in mice that express full-length Pol ι that is catalytically inactive. Both strains had normal frequencies and spectra of mutations in the variable region, indicating that loss of Pol ι did not change overall mutagenesis. We next examined if Pol ι affected tandem mutations generated by another error-prone polymerase, Pol ζ. The frequency of contiguous mutations was analyzed using a novel computational model to determine if they occur during a single DNA transaction or during two independent events. Analyses of 2,000 mutations from both strains indicated that Pol ι–compromised mice lost the tandem signature, whereas C57BL/6 mice accumulated significant amounts of double mutations. The results support a model where Pol ι occasionally accesses the replication fork to generate a first mutation, and Pol ζ extends the mismatch with a second mutation. PMID:27455952

  20. In-depth comparison of somatic point mutation callers based on different tumor next-generation sequencing depth data

    NASA Astrophysics Data System (ADS)

    Cai, Lei; Yuan, Wei; Zhang, Zhou; He, Lin; Chou, Kuo-Chen

    2016-11-01

    Four popular somatic single nucleotide variant (SNV) calling methods (Varscan, SomaticSniper, Strelka and MuTect2) were carefully evaluated on the real whole exome sequencing (WES, depth of ~50X) and ultra-deep targeted sequencing (UDT-Seq, depth of ~370X) data. The four tools returned poor consensus on candidates (only 20% of calls were with multiple hits by the callers). For both WES and UDT-Seq, MuTect2 and Strelka obtained the largest proportion of COSMIC entries as well as the lowest rate of dbSNP presence and high-alternative-alleles-in-control calls, demonstrating their superior sensitivity and accuracy. Combining different callers does increase reliability of candidates, but narrows the list down to very limited range of tumor read depth and variant allele frequency. Calling SNV on UDT-Seq data, which were of much higher read-depth, discovered additional true-positive variations, despite an even more tremendous growth in false positive predictions. Our findings not only provide valuable benchmark for state-of-the-art SNV calling methods, but also shed light on the access to more accurate SNV identification in the future.

  1. Olaparib In Metastatic Breast Cancer

    ClinicalTrials.gov

    2018-03-27

    Metastatic Breast Cancer; Invasive Breast Cancer; Somatic Mutation Breast Cancer (BRCA1); Somatic Mutation Breast Cancer (BRCA2); CHEK2 Gene Mutation; ATM Gene Mutation; PALB2 Gene Mutation; RAD51 Gene Mutation; BRIP1 Gene Mutation; NBN Gene Mutation

  2. E2F1 somatic mutation within miRNA target site impairs gene regulation in colorectal cancer.

    PubMed

    Lopes-Ramos, Camila M; Barros, Bruna P; Koyama, Fernanda C; Carpinetti, Paola A; Pezuk, Julia; Doimo, Nayara T S; Habr-Gama, Angelita; Perez, Rodrigo O; Parmigiani, Raphael B

    2017-01-01

    Genetic studies have largely concentrated on the impact of somatic mutations found in coding regions, and have neglected mutations outside of these. However, 3' untranslated regions (3' UTR) mutations can also disrupt or create miRNA target sites, and trigger oncogene activation or tumor suppressor inactivation. We used next-generation sequencing to widely screen for genetic alterations within predicted miRNA target sites of oncogenes associated with colorectal cancer, and evaluated the functional impact of a new somatic mutation. Target sequencing of 47 genes was performed for 29 primary colorectal tumor samples. For 71 independent samples, Sanger methodology was used to screen for E2F1 mutations in miRNA predicted target sites, and the functional impact of these mutations was evaluated by luciferase reporter assays. We identified germline and somatic alterations in E2F1. Of the 100 samples evaluated, 3 had germline alterations at the MIR205-5p target site, while one had a somatic mutation at MIR136-5p target site. E2F1 gene expression was similar between normal and tumor tissues bearing the germline alteration; however, expression was increased 4-fold in tumor tissue that harbored a somatic mutation compared to that in normal tissue. Luciferase reporter assays revealed both germline and somatic alterations increased E2F1 activity relative to wild-type E2F1. We demonstrated that somatic mutation within E2F1:MIR136-5p target site impairs miRNA-mediated regulation and leads to increased gene activity. We conclude that somatic mutations that disrupt miRNA target sites have the potential to impact gene regulation, highlighting an important mechanism of oncogene activation.

  3. Frequent PIK3CA Mutations in Colorectal and Endometrial Cancer with Double Somatic Mismatch Repair Mutations

    PubMed Central

    Cohen, Stacey A.; Turner, Emily H.; Beightol, Mallory B.; Jacobson, Angela; Gooley, Ted A.; Salipante, Stephen J.; Haraldsdottir, Sigurdis; Smith, Christina; Scroggins, Sheena; Tait, Jonathan F.; Grady, William M.; Lin, Edward H.; Cohn, David E.; Goodfellow, Paul J.; Arnold, Mark W.; de la Chapelle, Albert; Pearlman, Rachel; Hampel, Heather; Pritchard, Colin C.

    2016-01-01

    Background & Aims Double somatic mutations in mismatch repair (MMR) genes have recently been described in colorectal and endometrial cancers with microsatellite instability (MSI) not attributable to MLH1 hypermethylation or germline mutation. We sought to define the molecular phenotype of this newly recognized tumor subtype. Methods From two prospective Lynch syndrome screening studies, we identified patients with colorectal and endometrial tumors harboring ≥2 somatic MMR mutations, but normal germline MMR testing (“double somatic”). We determined the frequencies of tumor PIK3CA, BRAF, KRAS, NRAS, and PTEN mutations by targeted next-generation sequencing and used logistic-regression models to compare them to: Lynch syndrome, MLH1 hypermethylated, and microsatellite stable (MSS) tumors. We validated our findings using independent datasets from The Cancer Genome Atlas (TCGA). Results Among colorectal cancer cases, we found that 14/21 (67%) of double somatic cases had PIK3CA mutations vs. 4/18 (22%) Lynch syndrome, 2/10 (20%) MLH1 hypermethylated, and 12/78 (15%) MSS tumors; p<0.0001. PIK3CA mutations were detected in 100% of 13 double somatic endometrial cancers (p=0.04). BRAF mutations were absent in double somatic and Lynch syndrome colorectal tumors. We found highly similar results in a validation cohort from TCGA (113 colorectal, 178 endometrial cancer), with 100% of double somatic cases harboring a PIK3CA mutation (p<0.0001). Conclusions PIK3CA mutations are present in double somatic mutated colorectal and endometrial cancers at substantially higher frequencies than other MSI subgroups. PIK3CA mutation status may better define an emerging molecular entity in colorectal and endometrial cancers, with the potential to inform screening and therapeutic decision making. PMID:27302833

  4. Deletion of thyrotropin receptor residue Asp403 in a hyperfunctioning thyroid nodule provides insight into the role of the ectodomain in ligand-induced receptor activation.

    PubMed

    Nishihara, E; Chen, C-R; Mizutori-Sasai, Y; Ito, M; Kubota, S; Amino, N; Miyauchi, A; Rapoport, B

    2012-01-01

    Somatic mutations of the TSH receptor (TSHR) gene are the main cause of autonomously functioning thyroid nodules. Except for mutations in ectodomain residue S281, all of the numerous reported activating mutations are in the TSHR membrane-spanning region. Here, we describe a patient with a toxic adenoma with a novel heterozygous somatic mutation caused by deletion of ectodomain residue Asp403 (Del-D403). Subsequent in vitro functional studies of the Del-D403 TSHR mutation demonstrated greatly increased ligand-independent constitutive activity, 8-fold above that of the wild-type TSHR. TSH stimulation had little further effect, indicating that the mutation produced near maximal activation of the receptor. In summary, we report only the second TSHR ectodomain activating mutation (and the first ectodomain deletion mutation) responsible for development of a thyroid toxic adenoma. Because Del-D403 causes near maximal activation, our finding provides novel insight into TSHR structure and function; residue D403 is more likely to be involved in the ligand-mediated activating pathway than in the ectodomain inverse agonist property.

  5. Implications of Mutation Profiling in Myeloid Malignancies-PART 2: Myeloproliferative Neoplasms and Other Myeloid Malignancies.

    PubMed

    Sokol, Kelsey; Tremblay, Douglas; Bhalla, Sheena; Rampal, Raajit; Mascarenhas, John O

    2018-05-15

    Myeloid malignancies arise from the acquisition of somatic mutations among various genes implicated in essential functioning of hematopoietic stem cells and progenitor cells. In this second part of our two-part review, we discuss the use of mutation profiling in the diagnosis, prognosis, and treatment of patients with myeloproliferative neoplasms and other myeloid diseases. We also discuss the entity known as clonal hematopoiesis of indeterminate potential, awareness of which is a result of the increasing availability and improved quality of mutation profiling.

  6. Somatic and germline mosaicism for a mutation of the PHEX gene can lead to genetic transmission of X-linked hypophosphatemic rickets that mimics an autosomal dominant trait.

    PubMed

    Goji, Katsumi; Ozaki, Kayo; Sadewa, Ahmad H; Nishio, Hisahide; Matsuo, Masafumi

    2006-02-01

    Familial hypophosphatemic rickets is usually transmitted as an X-linked dominant disorder (XLH), although autosomal dominant forms have also been observed. Genetic studies of these disorders have identified mutations in PHEX and FGF23 as the causes of X-linked dominant disorder and autosomal dominant forms, respectively. The objective of the study was to describe the molecular genetic findings in a family affected by hypophosphatemic rickets with presumed autosomal dominant inheritance. We studied a family in which the father and the elder of his two daughters, but not the second daughter, were affected by hypophosphatemic rickets. The pedigree interpretation of the family suggested that genetic transmission of the disorder occurred as an autosomal dominant trait. Direct nucleotide sequencing of FGF23 and PHEX revealed that the elder daughter was heterozygous for an R567X mutation in PHEX, rather than FGF23, suggesting that the genetic transmission occurred as an X-linked dominant trait. Unexpectedly, the father was heterozygous for this mutation. Single-nucleotide primer extension and denaturing HPLC analysis of the father using DNA from single hair roots revealed that he was a somatic mosaic for the mutation. Haplotype analysis confirmed that the father transmitted the genotypes for 18 markers on the X chromosome equally to his two daughters. The fact that the father transmitted the mutation to only one of his two daughters indicated that he was a germline mosaic for the mutation. Somatic and germline mosaicism for an X-linked dominant mutation in PHEX may mimic autosomal dominant inheritance.

  7. Update from the 2011 International Schwannomatosis Workshop: From genetics to diagnostic criteria.

    PubMed

    Plotkin, Scott R; Blakeley, Jaishri O; Evans, D Gareth; Hanemann, C Oliver; Hulsebos, Theo J M; Hunter-Schaedle, Kim; Kalpana, Ganjam V; Korf, Bruce; Messiaen, Ludwine; Papi, Laura; Ratner, Nancy; Sherman, Larry S; Smith, Miriam J; Stemmer-Rachamimov, Anat O; Vitte, Jeremie; Giovannini, Marco

    2013-03-01

    Schwannomatosis is the third major form of neurofibromatosis and is characterized by the development of multiple schwannomas in the absence of bilateral vestibular schwannomas. The 2011 Schwannomatosis Update was organized by the Children's Tumor Foundation (www.ctf.org) and held in Los Angeles, CA, from June 5-8, 2011. This article summarizes the highlights presented at the Conference and represents the "state-of-the-field" in 2011. Genetic studies indicate that constitutional mutations in the SMARCB1 tumor suppressor gene occur in 40-50% of familial cases and in 8-10% of sporadic cases of schwannomatosis. Tumorigenesis is thought to occur through a four-hit, three-step model, beginning with a germline mutation in SMARCB1 (hit 1), followed by loss of a portion of chromosome 22 that contains the second SMARCB1 allele and one NF2 allele (hits 2 and 3), followed by mutation of the remaining wild-type NF2 allele (hit 4). Insights from research on HIV and pediatric rhabdoid tumors have shed light on potential molecular pathways that are dysregulated in schwannomatosis-related schwannomas. Mouse models of schwannomatosis have been developed and promise to further expand our understanding of tumorigenesis and the tumor microenvironment. Clinical reports have described the occurrence of intracranial meningiomas in schwannomatosis patients and in families with germline SMARCB1 mutations. The authors propose updated diagnostic criteria to incorporate new clinical and genetic findings since 2005. In the next 5 years, the authors expect that advances in basic research in the pathogenesis of schwannomatosis will lead toward clinical investigations of potential drug therapies. Copyright © 2013 Wiley Periodicals, Inc.

  8. Somatic USP8 Gene Mutations Are a Common Cause of Pediatric Cushing Disease.

    PubMed

    Faucz, Fabio R; Tirosh, Amit; Tatsi, Christina; Berthon, Annabel; Hernández-Ramírez, Laura C; Settas, Nikolaos; Angelousi, Anna; Correa, Ricardo; Papadakis, Georgios Z; Chittiboina, Prashant; Quezado, Martha; Pankratz, Nathan; Lane, John; Dimopoulos, Aggeliki; Mills, James L; Lodish, Maya; Stratakis, Constantine A

    2017-08-01

    Somatic mutations in the ubiquitin-specific protease 8 (USP8) gene have been recently identified as the most common genetic alteration in patients with Cushing disease (CD). However, the frequency of these mutations in the pediatric population has not been extensively assessed. We investigated the status of the USP8 gene at the somatic level in a cohort of pediatric patients with corticotroph adenomas. The USP8 gene was fully sequenced in both germline and tumor DNA samples from 42 pediatric patients with CD. Clinical, biochemical, and imaging data were compared between patients with and without somatic USP8 mutations. Five different USP8 mutations (three missense, one frameshift, and one in-frame deletion) were identified in 13 patients (31%), all of them located in exon 14 at the previously described mutational hotspot, affecting the 14-3-3 binding motif of the protein. Patients with somatic mutations were older at disease presentation [mean 5.1 ± 2.1 standard deviation (SD) vs 13.1 ± 3.6 years, P = 0.03]. Levels of urinary free cortisol, midnight serum cortisol, and adrenocorticotropic hormone, as well as tumor size and frequency of invasion of the cavernous sinus, were not significantly different between the two groups. However, patients harboring somatic USP8 mutations had a higher likelihood of recurrence compared with patients without mutations (46.2% vs 10.3%, P = 0.009). Somatic USP8 gene mutations are a common cause of pediatric CD. Patients harboring a somatic mutation had a higher likelihood of tumor recurrence, highlighting the potential importance of this molecular defect for the disease prognosis and the development of targeted therapeutic options. Copyright © 2017 Endocrine Society

  9. Somatic mutations in histiocytic sarcoma identified by next generation sequencing.

    PubMed

    Liu, Qingqing; Tomaszewicz, Keith; Hutchinson, Lloyd; Hornick, Jason L; Woda, Bruce; Yu, Hongbo

    2016-08-01

    Histiocytic sarcoma is a rare malignant neoplasm of presumed hematopoietic origin showing morphologic and immunophenotypic evidence of histiocytic differentiation. Somatic mutation importance in the pathogenesis or disease progression of histiocytic sarcoma was largely unknown. To identify somatic mutations in histiocytic sarcoma, we studied 5 histiocytic sarcomas [3 female and 2 male patients; mean age 54.8 (20-72), anatomic sites include lymph node, uterus, and pleura] and matched normal tissues from each patient as germ line controls. Somatic mutations in 50 "Hotspot" oncogenes and tumor suppressor genes were examined using next generation sequencing. Three (out of five) histiocytic sarcoma cases carried somatic mutations in BRAF. Among them, G464V [variant frequency (VF) of 43.6 %] and G466R (VF of 29.6 %) located at the P loop potentially interfere with the hydrophobic interaction between P and activating loops and ultimately activation of BRAF. Also detected was BRAF somatic mutation N581S (VF of 7.4 %), which was located at the catalytic loop of BRAF kinase domain: its role in modifying kinase activity was unclear. A similar mutational analysis was also performed on nine acute monocytic/monoblastic leukemia cases, which did not identify any BRAF somatic mutations. Our study detected several BRAF mutations in histiocytic sarcomas, which may be important in understanding the tumorigenesis of this rare neoplasm and providing mechanisms for potential therapeutical opportunities.

  10. New Insight Into the Biology, Risk Stratification, and Targeted Treatment of Myelodysplastic Syndromes.

    PubMed

    Haider, Mintallah; Duncavage, Eric J; Afaneh, Khalid F; Bejar, Rafael; List, Alan F

    2017-01-01

    In myelodysplastic syndromes (MDS), somatic mutations occur in five major categories: RNA splicing, DNA methylation, activated cell signaling, myeloid transcription factors, and chromatin modifiers. Although many MDS cases harbor more than one somatic mutation, in general, there is mutual exclusivity of mutated genes within a class. In addition to the prognostic significance of individual somatic mutations, more somatic mutations in MDS have been associated with poor prognosis. Prognostic assessment remains a critical component of the personalization of care for patient with MDS because treatment is highly risk adapted. Multiple methods for risk stratification are available with the revised International Prognostic Scoring System (IPSS-R), currently considered the gold standard. Increasing access to myeloid gene panels and greater evidence for the diagnostic and predictive value of somatic mutations will soon make sequencing part of the standard evaluation of patients with MDS. In the absence of formal guidelines for their prognostic use, well-validated mutations can still refine estimates of risk made with the IPSS-R. Not only are somatic gene mutations advantageous in understanding the biology of MDS and prognosis, they also offer potential as biomarkers and targets for the treatment of patients with MDS. Examples include deletion 5q, spliceosome complex gene mutations, and TP53 mutations.

  11. Impact of Somatic Mutations in the D-Loop of Mitochondrial DNA on the Survival of Oral Squamous Cell Carcinoma Patients

    PubMed Central

    Lin, Jin-Ching; Wang, Chen-Chi; Jiang, Rong-San; Wang, Wen-Yi; Liu, Shih-An

    2015-01-01

    Objectives The aim of this study was to investigate somatic mutations in the D-loop of mitochondrial DNA (mtDNA) and their impact on survival in oral squamous cell carcinoma patients. Materials and Methods Surgical specimen confirmed by pathological examination and corresponding non-cancerous tissues were collected from 120 oral squamous cell carcinoma patients. The sequence in the D-loop of mtDNA from non-cancerous tissues was compared with that from paired cancer samples and any sequence differences were recognized as somatic mutations. Results Somatic mutations in the D-loop of mtDNA were identified in 75 (62.5%) oral squamous cell carcinoma patients and most of them occurred in the poly-C tract. Although there were no significant differences in demographic and tumor-related features between participants with and without somatic mutation, the mutation group had a better survival rate (5 year disease-specific survival rate: 64.0% vs. 43.0%, P = 0.0266). Conclusion Somatic mutation in D-loop of mtDNA was associated with a better survival in oral squamous cell carcinoma patients. PMID:25906372

  12. Somatic deleterious mutation rate in a woody plant: estimation from phenotypic data

    PubMed Central

    Bobiwash, K; Schultz, S T; Schoen, D J

    2013-01-01

    We conducted controlled crosses in populations of the long-lived clonal shrub, Vaccinium angustifolium (lowbush blueberry) to estimate inbreeding depression and mutation parameters associated with somatic deleterious mutation. Inbreeding depression level was high, with many plants failing to set fruit after self-pollination. We also compared fruit set from autogamous pollinations (pollen collected from within the same inflorescence) with fruit set from geitonogamous pollinations (pollen collected from the same plant but from inflorescences separated by several meters of branch growth). The difference between geitonogamous versus autogamous fitness within single plants is referred to as ‘autogamy depression' (AD). AD can be caused by somatic deleterious mutation. AD was significantly different from zero for fruit set. We developed a maximum-likelihood procedure to estimate somatic mutation parameters from AD, and applied it to geitonogamous and autogamous fruit set data from this experiment. We infer that, on average, approximately three sublethal, partially dominant somatic mutations exist within the crowns of the plants studied. We conclude that somatic mutation in this woody plant results in an overall genomic deleterious mutation rate that exceeds the rate measured to date for annual plants. Some implications of this result for evolutionary biology and agriculture are discussed. PMID:23778990

  13. Exome sequencing identifies putative drivers of progression of transient myeloproliferative disorder to AMKL in infants with Down syndrome.

    PubMed

    Nikolaev, Sergey I; Santoni, Federico; Vannier, Anne; Falconnet, Emilie; Giarin, Emanuela; Basso, Giuseppe; Hoischen, Alexander; Veltman, Joris A; Groet, Jurgen; Nizetic, Dean; Antonarakis, Stylianos E

    2013-07-25

    Some neonates with Down syndrome (DS) are diagnosed with self-regressing transient myeloproliferative disorder (TMD), and 20% to 30% of those progress to acute megakaryoblastic leukemia (AMKL). We performed exome sequencing in 7 TMD/AMKL cases and copy-number analysis in these and 10 additional cases. All TMD/AMKL samples contained GATA1 mutations. No exome-sequenced TMD/AMKL sample had other recurrently mutated genes. However, 2 of 5 TMD cases, and all AMKL cases, showed mutations/deletions other than GATA1, in genes proven as transformation drivers in non-DS leukemia (EZH2, APC, FLT3, JAK1, PARK2-PACRG, EXT1, DLEC1, and SMC3). One patient at the TMD stage revealed 2 clonal expansions with different GATA1 mutations, of which 1 clone had an additional driver mutation. Interestingly, it was the other clone that gave rise to AMKL after accumulating mutations in 7 other genes. Data suggest that GATA1 mutations alone are sufficient for clonal expansions, and additional driver mutations at the TMD stage do not necessarily predict AMKL progression. Later in infancy, leukemic progression requires "third-hit driver" mutations/somatic copy-number alterations found in non-DS leukemias. Putative driver mutations affecting WNT (wingless-related integration site), JAK-STAT (Janus kinase/signal transducer and activator of transcription), or MAPK/PI3K (mitogen-activated kinase/phosphatidylinositol-3 kinase) pathways were found in all cases, aberrant activation of which converges on overexpression of MYC.

  14. Appraising the relevance of DNA copy number loss and gain in prostate cancer using whole genome DNA sequence data

    PubMed Central

    Van Loo, Peter; Kay, Jonathan D.; Matthews, Lucy; Haase, Kerstin; Clark, Jeremy; Thomas, Sarah; Butler, Adam P.; Gundem, Gunes; Merson, Sue; Luxton, Hayley; Hawkins, Steve; Ghori, Mohammed; Marsden, Luke; Lambert, Adam; Pelvender, Gill; Massie, Charlie E.; Hazell, Steven; Livni, Naomi; Fisher, Cyril; Ogden, Christopher; Kumar, Pardeep; Thompson, Alan; Nicol, David; Yu, Yongwei; Zhang, Hongwei; Isaacs, William; Visakorpi, Tapio; Verrill, Clare; Lynch, Andrew G.; Lu, Yong Jie; Whitaker, Hayley C.; Neal, David E.; Cooper, Colin S.

    2017-01-01

    A variety of models have been proposed to explain regions of recurrent somatic copy number alteration (SCNA) in human cancer. Our study employs Whole Genome DNA Sequence (WGS) data from tumor samples (n = 103) to comprehensively assess the role of the Knudson two hit genetic model in SCNA generation in prostate cancer. 64 recurrent regions of loss and gain were detected, of which 28 were novel, including regions of loss with more than 15% frequency at Chr4p15.2-p15.1 (15.53%), Chr6q27 (16.50%) and Chr18q12.3 (17.48%). Comprehensive mutation screens of genes, lincRNA encoding sequences, control regions and conserved domains within SCNAs demonstrated that a two-hit genetic model was supported in only a minor proportion of recurrent SCNA losses examined (15/40). We found that recurrent breakpoints and regions of inversion often occur within Knudson model SCNAs, leading to the identification of ZNF292 as a target gene for the deletion at 6q14.3-q15 and NKX3.1 as a two-hit target at 8p21.3-p21.2. The importance of alterations of lincRNA sequences was illustrated by the identification of a novel mutational hotspot at the KCCAT42, FENDRR, CAT1886 and STCAT2 loci at the 16q23.1-q24.3 loss. Our data confirm that the burden of SCNAs is predictive of biochemical recurrence, define nine individual regions that are associated with relapse, and highlight the possible importance of ion channel and G-protein coupled-receptor (GPCR) pathways in cancer development. We concluded that a two-hit genetic model accounts for about one third of SCNA indicating that mechanisms, such haploinsufficiency and epigenetic inactivation, account for the remaining SCNA losses. PMID:28945760

  15. Appraising the relevance of DNA copy number loss and gain in prostate cancer using whole genome DNA sequence data.

    PubMed

    Camacho, Niedzica; Van Loo, Peter; Edwards, Sandra; Kay, Jonathan D; Matthews, Lucy; Haase, Kerstin; Clark, Jeremy; Dennis, Nening; Thomas, Sarah; Kremeyer, Barbara; Zamora, Jorge; Butler, Adam P; Gundem, Gunes; Merson, Sue; Luxton, Hayley; Hawkins, Steve; Ghori, Mohammed; Marsden, Luke; Lambert, Adam; Karaszi, Katalin; Pelvender, Gill; Massie, Charlie E; Kote-Jarai, Zsofia; Raine, Keiran; Jones, David; Howat, William J; Hazell, Steven; Livni, Naomi; Fisher, Cyril; Ogden, Christopher; Kumar, Pardeep; Thompson, Alan; Nicol, David; Mayer, Erik; Dudderidge, Tim; Yu, Yongwei; Zhang, Hongwei; Shah, Nimish C; Gnanapragasam, Vincent J; Isaacs, William; Visakorpi, Tapio; Hamdy, Freddie; Berney, Dan; Verrill, Clare; Warren, Anne Y; Wedge, David C; Lynch, Andrew G; Foster, Christopher S; Lu, Yong Jie; Bova, G Steven; Whitaker, Hayley C; McDermott, Ultan; Neal, David E; Eeles, Rosalind; Cooper, Colin S; Brewer, Daniel S

    2017-09-01

    A variety of models have been proposed to explain regions of recurrent somatic copy number alteration (SCNA) in human cancer. Our study employs Whole Genome DNA Sequence (WGS) data from tumor samples (n = 103) to comprehensively assess the role of the Knudson two hit genetic model in SCNA generation in prostate cancer. 64 recurrent regions of loss and gain were detected, of which 28 were novel, including regions of loss with more than 15% frequency at Chr4p15.2-p15.1 (15.53%), Chr6q27 (16.50%) and Chr18q12.3 (17.48%). Comprehensive mutation screens of genes, lincRNA encoding sequences, control regions and conserved domains within SCNAs demonstrated that a two-hit genetic model was supported in only a minor proportion of recurrent SCNA losses examined (15/40). We found that recurrent breakpoints and regions of inversion often occur within Knudson model SCNAs, leading to the identification of ZNF292 as a target gene for the deletion at 6q14.3-q15 and NKX3.1 as a two-hit target at 8p21.3-p21.2. The importance of alterations of lincRNA sequences was illustrated by the identification of a novel mutational hotspot at the KCCAT42, FENDRR, CAT1886 and STCAT2 loci at the 16q23.1-q24.3 loss. Our data confirm that the burden of SCNAs is predictive of biochemical recurrence, define nine individual regions that are associated with relapse, and highlight the possible importance of ion channel and G-protein coupled-receptor (GPCR) pathways in cancer development. We concluded that a two-hit genetic model accounts for about one third of SCNA indicating that mechanisms, such haploinsufficiency and epigenetic inactivation, account for the remaining SCNA losses.

  16. Combining molecular and immunohistochemical analyses of key drivers in primary melanomas: interplay between germline and somatic variations.

    PubMed

    Bruno, William; Martinuzzi, Claudia; Dalmasso, Bruna; Andreotti, Virginia; Pastorino, Lorenza; Cabiddu, Francesco; Gualco, Marina; Spagnolo, Francesco; Ballestrero, Alberto; Queirolo, Paola; Grillo, Federica; Mastracci, Luca; Ghiorzo, Paola

    2018-01-19

    Due to the high mutational somatic burden of Cutaneous Malignant Melanoma (CMM) a thorough profiling of the driver mutations and their interplay is necessary to explain the timing of tumorigenesis or for the identification of actionable genetic events. The aim of this study was to establish the mutation rate of some of the key drivers in melanoma tumorigenesis combining molecular analyses and/or immunohistochemistry in 93 primary CMMs from an Italian cohort also characterized for germline status, and to investigate an interplay between germline and somatic variants. BRAF mutations were present in 68% of cases, while CDKN2A germline mutations were found in 16 % and p16 loss in tissue was found in 63%. TERT promoter somatic mutations were detected in 38% of cases while the TERT -245T>C polymorphism was found in 51% of cases. NRAS mutations were found in 39% of BRAF negative or undetermined cases. NF1 was expressed in all cases analysed. MC1R variations were both considered as a dichotomous variable or scored. While a positive, although not significant association between CDKN2A germline mutations, but not MC1R variants, and BRAF somatic mutation was found, we did not observe other associations between germline and somatic events. A yet undescribed inverse correlation between TERT -245T>C polymorphism and the presence of BRAF mutation was found. It is possible to hypothesize that -245T>C polymorphism could be included in those genotypes which may influence the occurrence of BRAF mutations. Further studies are needed to investigate the role of -245T>C polymorphism as a germline predictor of BRAF somatic mutation status.

  17. A deletion affecting an LRR-RLK gene co-segregates with the fruit flat shape trait in peach.

    PubMed

    López-Girona, Elena; Zhang, Yu; Eduardo, Iban; Mora, José Ramón Hernández; Alexiou, Konstantinos G; Arús, Pere; Aranzana, María José

    2017-07-27

    In peach, the flat phenotype is caused by a partially dominant allele in heterozygosis (Ss), fruits from homozygous trees (SS) abort a few weeks after fruit setting. Previous research has identified a SSR marker (UDP98-412) highly associated with the trait, found suitable for marker assisted selection (MAS). Here we report a ∼10 Kb deletion affecting the gene PRUPE.6G281100, 400 Kb upstream of UDP98-412, co-segregating with the trait. This gene is a leucine-rich repeat receptor-like kinase (LRR-RLK) orthologous to the Brassinosteroid insensitive 1-associated receptor kinase 1 (BAK1) group. PCR markers suitable for MAS confirmed its strong association with the trait in a collection of 246 cultivars. They were used to evaluate the DNA from a round fruit derived from a somatic mutation of the flat variety 'UFO-4', revealing that the mutation affected the flat associated allele (S). Protein BLAST alignment identified significant hits with genes involved in different biological processes. Best protein hit occurred with AtRLP12, which may functionally complement CLAVATA2, a key regulator that controls the stem cell population size. RT-PCR analysis revealed the absence of transcription of the partially deleted allele. The data support PRUPE.6G281100 as a candidate gene for flat shape in peach.

  18. Landscape of somatic mutations in 560 breast cancer whole-genome sequences

    DOE PAGES

    Nik-Zainal, Serena; Davies, Helen; Staaf, Johan; ...

    2016-05-02

    Here, we analysed whole-genome sequences of 560 breast cancers to advance understanding of the driver mutations conferring clonal advantage and the mutational processes generating somatic mutations. We found that 93 protein-coding cancer genes carried probable driver mutations. Some non-coding regions exhibited high mutation frequencies, but most have distinctive structural features probably causing elevated mutation rates and do not contain driver mutations. Mutational signature analysis was extended to genome rearrangements and revealed twelve base substitution and six rearrangement signatures. Three rearrangement signatures, characterized by tandem duplications or deletions, appear associated with defective homologous-recombination-based DNA repair: one with deficient BRCA1 function, anothermore » with deficient BRCA1 or BRCA2 function, the cause of the third is unknown. This analysis of all classes of somatic mutation across exons, introns and intergenic regions highlights the repertoire of cancer genes and mutational processes operating, and progresses towards a comprehensive account of the somatic genetic basis of breast cancer.« less

  19. Landscape of somatic mutations in 560 breast cancer whole-genome sequences

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nik-Zainal, Serena; Davies, Helen; Staaf, Johan

    Here, we analysed whole-genome sequences of 560 breast cancers to advance understanding of the driver mutations conferring clonal advantage and the mutational processes generating somatic mutations. We found that 93 protein-coding cancer genes carried probable driver mutations. Some non-coding regions exhibited high mutation frequencies, but most have distinctive structural features probably causing elevated mutation rates and do not contain driver mutations. Mutational signature analysis was extended to genome rearrangements and revealed twelve base substitution and six rearrangement signatures. Three rearrangement signatures, characterized by tandem duplications or deletions, appear associated with defective homologous-recombination-based DNA repair: one with deficient BRCA1 function, anothermore » with deficient BRCA1 or BRCA2 function, the cause of the third is unknown. This analysis of all classes of somatic mutation across exons, introns and intergenic regions highlights the repertoire of cancer genes and mutational processes operating, and progresses towards a comprehensive account of the somatic genetic basis of breast cancer.« less

  20. Landscape of somatic mutations in 560 breast cancer whole genome sequences

    PubMed Central

    Nik-Zainal, Serena; Davies, Helen; Staaf, Johan; Ramakrishna, Manasa; Glodzik, Dominik; Zou, Xueqing; Martincorena, Inigo; Alexandrov, Ludmil B.; Martin, Sancha; Wedge, David C.; Van Loo, Peter; Ju, Young Seok; Smid, Marcel; Brinkman, Arie B; Morganella, Sandro; Aure, Miriam R.; Lingjærde, Ole Christian; Langerød, Anita; Ringnér, Markus; Ahn, Sung-Min; Boyault, Sandrine; Brock, Jane E.; Broeks, Annegien; Butler, Adam; Desmedt, Christine; Dirix, Luc; Dronov, Serge; Fatima, Aquila; Foekens, John A.; Gerstung, Moritz; Hooijer, Gerrit KJ; Jang, Se Jin; Jones, David R.; Kim, Hyung-Yong; King, Tari A.; Krishnamurthy, Savitri; Lee, Hee Jin; Lee, Jeong-Yeon; Li, Yilong; McLaren, Stuart; Menzies, Andrew; Mustonen, Ville; O’Meara, Sarah; Pauporté, Iris; Pivot, Xavier; Purdie, Colin A.; Raine, Keiran; Ramakrishnan, Kamna; Rodríguez-González, F. Germán; Romieu, Gilles; Sieuwerts, Anieta M.; Simpson, Peter T; Shepherd, Rebecca; Stebbings, Lucy; Stefansson, Olafur A; Teague, Jon; Tommasi, Stefania; Treilleux, Isabelle; Van den Eynden, Gert G.; Vermeulen, Peter; Vincent-Salomon, Anne; Yates, Lucy; Caldas, Carlos; van’t Veer, Laura; Tutt, Andrew; Knappskog, Stian; Tan, Benita Kiat Tee; Jonkers, Jos; Borg, Åke; Ueno, Naoto T; Sotiriou, Christos; Viari, Alain; Futreal, P. Andrew; Campbell, Peter J; Span, Paul N.; Van Laere, Steven; Lakhani, Sunil R; Eyfjord, Jorunn E.; Thompson, Alastair M.; Birney, Ewan; Stunnenberg, Hendrik G; van de Vijver, Marc J; Martens, John W.M.; Børresen-Dale, Anne-Lise; Richardson, Andrea L.; Kong, Gu; Thomas, Gilles; Stratton, Michael R.

    2016-01-01

    We analysed whole genome sequences of 560 breast cancers to advance understanding of the driver mutations conferring clonal advantage and the mutational processes generating somatic mutations. 93 protein-coding cancer genes carried likely driver mutations. Some non-coding regions exhibited high mutation frequencies but most have distinctive structural features probably causing elevated mutation rates and do not harbour driver mutations. Mutational signature analysis was extended to genome rearrangements and revealed 12 base substitution and six rearrangement signatures. Three rearrangement signatures, characterised by tandem duplications or deletions, appear associated with defective homologous recombination based DNA repair: one with deficient BRCA1 function; another with deficient BRCA1 or BRCA2 function; the cause of the third is unknown. This analysis of all classes of somatic mutation across exons, introns and intergenic regions highlights the repertoire of cancer genes and mutational processes operative, and progresses towards a comprehensive account of the somatic genetic basis of breast cancer. PMID:27135926

  1. Dissecting Loss of Heterozygosity (LOH) in Neurofibromatosis Type 1-Associated Neurofibromas: Importance of Copy Neutral LOH

    PubMed Central

    Garcia-Linares, Carles; Fernández-Rodríguez, Juana; Terribas, Ernest; Mercadé, Jaume; Pros, Eva; Benito, Llúcia; Benavente, Yolanda; Capellà, Gabriel; Ravella, Anna; Blanco, Ignacio; Kehrer-Sawatzki, Hildegard; Lázaro, Conxi; Serra, Eduard

    2011-01-01

    Dermal neurofibromas (dNFs) are benign tumors of the peripheral nervous system typically associated with Neurofibromatosis type 1 (NF1) patients. Genes controlling the integrity of the DNA are likely to influence the number of neurofibromas developed because dNFs are caused by somatic mutational inactivation of the NF1 gene, frequently evidenced by loss of heterozygosity (LOH). We performed a comprehensive analysis of the prevalence and mechanisms of LOH in dNFs. Our study included 518 dNFs from 113 patients. LOH was detected in 25% of the dNFs (N = 129). The most frequent mechanism causing LOH was mitotic recombination, which was observed in 62% of LOH-tumors (N = 80), and which does not reduce the number of NF1 gene copies. All events were generated by a single crossover located between the centromere and the NF1 gene, resulting in isodisomy of 17q. LOH due to the loss of the NF1 gene accounted for a 38% of dNFs with LOH (N = 49), with deletions ranging in size from ∼80 kb to ∼8 Mb within 17q. In one tumor we identified the first example of a neurofibroma-associated second-hit type-2 NF1 deletion. Analysis of the prevalence of mechanisms causing LOH in dNFs in individual patients (possibly under genetic control) will elucidate whether there exist interindividual variation. Hum Mutat 32:78–90, 2011. © 2010 Wiley-Liss, Inc. PMID:21031597

  2. Elevated Levels of Somatic Mutation as a Biomarker of Environmental Effects Contributing to Breast Carcinogenesis

    DTIC Science & Technology

    2001-07-01

    and hepatocellular carcinoma patients have been shown to exhibit elevated somatic mutation frequencies with the GPA assay (Okada et al., 1997...T, Kyogoku A, Yoshimori M (1997) Evidence for increased somatic cell mutations in patients with hepatocellular carcinoma . Carcinogenesis 18: 445-449...significant increase in mutation at the GPA locus has been reported for a population of hepatocellular carcinoma patients (Okada et al., 1997

  3. Evaluation of Nine Somatic Variant Callers for Detection of Somatic Mutations in Exome and Targeted Deep Sequencing Data.

    PubMed

    Krøigård, Anne Bruun; Thomassen, Mads; Lænkholm, Anne-Vibeke; Kruse, Torben A; Larsen, Martin Jakob

    2016-01-01

    Next generation sequencing is extensively applied to catalogue somatic mutations in cancer, in research settings and increasingly in clinical settings for molecular diagnostics, guiding therapy decisions. Somatic variant callers perform paired comparisons of sequencing data from cancer tissue and matched normal tissue in order to detect somatic mutations. The advent of many new somatic variant callers creates a need for comparison and validation of the tools, as no de facto standard for detection of somatic mutations exists and only limited comparisons have been reported. We have performed a comprehensive evaluation using exome sequencing and targeted deep sequencing data of paired tumor-normal samples from five breast cancer patients to evaluate the performance of nine publicly available somatic variant callers: EBCall, Mutect, Seurat, Shimmer, Indelocator, Somatic Sniper, Strelka, VarScan 2 and Virmid for the detection of single nucleotide mutations and small deletions and insertions. We report a large variation in the number of calls from the nine somatic variant callers on the same sequencing data and highly variable agreement. Sequencing depth had markedly diverse impact on individual callers, as for some callers, increased sequencing depth highly improved sensitivity. For SNV calling, we report EBCall, Mutect, Virmid and Strelka to be the most reliable somatic variant callers for both exome sequencing and targeted deep sequencing. For indel calling, EBCall is superior due to high sensitivity and robustness to changes in sequencing depths.

  4. Evaluation of Nine Somatic Variant Callers for Detection of Somatic Mutations in Exome and Targeted Deep Sequencing Data

    PubMed Central

    Krøigård, Anne Bruun; Thomassen, Mads; Lænkholm, Anne-Vibeke; Kruse, Torben A.; Larsen, Martin Jakob

    2016-01-01

    Next generation sequencing is extensively applied to catalogue somatic mutations in cancer, in research settings and increasingly in clinical settings for molecular diagnostics, guiding therapy decisions. Somatic variant callers perform paired comparisons of sequencing data from cancer tissue and matched normal tissue in order to detect somatic mutations. The advent of many new somatic variant callers creates a need for comparison and validation of the tools, as no de facto standard for detection of somatic mutations exists and only limited comparisons have been reported. We have performed a comprehensive evaluation using exome sequencing and targeted deep sequencing data of paired tumor-normal samples from five breast cancer patients to evaluate the performance of nine publicly available somatic variant callers: EBCall, Mutect, Seurat, Shimmer, Indelocator, Somatic Sniper, Strelka, VarScan 2 and Virmid for the detection of single nucleotide mutations and small deletions and insertions. We report a large variation in the number of calls from the nine somatic variant callers on the same sequencing data and highly variable agreement. Sequencing depth had markedly diverse impact on individual callers, as for some callers, increased sequencing depth highly improved sensitivity. For SNV calling, we report EBCall, Mutect, Virmid and Strelka to be the most reliable somatic variant callers for both exome sequencing and targeted deep sequencing. For indel calling, EBCall is superior due to high sensitivity and robustness to changes in sequencing depths. PMID:27002637

  5. Update From the 2011 International Schwannomatosis Workshop: From Genetics to Diagnostic Criteria

    PubMed Central

    Plotkin, Scott R.; Blakeley, Jaishri O.; Evans, D. Gareth; Hanemann, C. Oliver; Hulsebos, Theo J.M.; Hunter-Schaedle, Kim; Kalpana, Ganjam V.; Korf, Bruce; Messiaen, Ludwine; Papi, Laura; Ratner, Nancy; Sherman, Larry S.; Smith, Miriam J.; Stemmer-Rachamimov, Anat O.; Vitte, Jeremie; Giovannini, Marco

    2014-01-01

    Schwannomatosis is the third major form of neurofibromatosis and is characterized by the development of multiple schwannomas in the absence of bilateral vestibular schwannomas. The 2011 Schwannomatosis Update was organized by the Children’s Tumor Foundation (www.ctf.org) and held in Los Angeles, CA, from June 5–8, 2011. This article summarizes the highlights presented at the Conference and represents the “state-of-the-field” in 2011. Genetic studies indicate that constitutional mutations in the SMARCB1 tumor suppressor gene occur in 40–50% of familial cases and in 8–10% of sporadic cases of schwannomatosis. Tumorigenesis is thought to occur through a four-hit, three-step model, beginning with a germline mutation in SMARCB1 (hit 1), followed by loss of a portion of chromosome 22 that contains the second SMARCB1 allele and one NF2 allele (hits 2 and 3), followed by mutation of the remaining wild-type NF2 allele (hit 4). Insights from research on HIV and pediatric rhabdoid tumors have shed light on potential molecular pathways that are dysregulated in schwannomatosis-related schwannomas. Mouse models of schwannomatosis have been developed and promise to further expand our understanding of tumorigenesis and the tumor microenvironment. Clinical reports have described the occurrence of intracranial meningiomas in schwannomatosis patients and in families with germline SMARCB1 mutations. The authors propose updated diagnostic criteria to incorporate new clinical and genetic findings since 2005. In the next 5 years, the authors expect that advances in basic research in the pathogenesis of schwannomatosis will lead toward clinical investigations of potential drug therapies. PMID:23401320

  6. Clinicopathological analysis of endometrial carcinomas harboring somatic POLE exonuclease domain mutations.

    PubMed

    Hussein, Yaser R; Weigelt, Britta; Levine, Douglas A; Schoolmeester, J Kenneth; Dao, Linda N; Balzer, Bonnie L; Liles, Georgia; Karlan, Beth; Köbel, Martin; Lee, Cheng-Han; Soslow, Robert A

    2015-04-01

    The Cancer Genome Atlas described four major genomic groups of endometrial carcinomas, including a POLE ultramutated subtype comprising ∼10% of endometrioid adenocarcinoma, characterized by POLE exonuclease domain mutations, ultrahigh somatic mutation rates, and favorable outcome. Our aim was to examine the morphological and clinicopathological features of ultramutated endometrial carcinomas harboring somatic POLE exonuclease domain mutations. Hematoxylin and eosin slides and pathology reports for 8/17 POLE-mutated endometrial carcinomas described in the Cancer Genome Atlas study were studied; for the remaining cases, virtual whole slide images publicly available at cBioPortal (www.cbioportal.org) were examined. A second cohort of eight POLE mutated endometrial carcinomas from University of Calgary was also studied. Median age was 55 years (range 33-87 years). Nineteen patients presented as stage I, 1 stage II, and 5 stage III. The majority of cases (24 of the 25) demonstrated defining morphological features of endometrioid differentiation. The studied cases were frequently high grade (60%) and rich in tumor-infiltrating lymphocytes and/or peri-tumoral lymphocytes (84%); many tumors showed morphological heterogeneity (52%) and ambiguity (16%). Foci demonstrating severe nuclear atypia led to concern for serous carcinoma in 28% of cases. At the molecular level, the majority of the Cancer Genome Atlas POLE-mutated tumors were microsatellite stable (65%), and TP53 mutations were present in 35% of cases. They also harbored mutations in PTEN (94%), FBXW7 (82%), ARID1A (76%), and PIK3CA (71%). All patients from both cohorts were alive without disease, and none of the patients developed recurrence at the time of follow-up (median 33 months; range 2-102 months). In conclusion, the recognition of ultramutated endometrial carcinomas with POLE exonuclease domain mutation is important given their favorable outcome. Our histopathological review revealed that these tumors are commonly high grade, have obvious lymphocytic infiltrates, and can show ambiguous morphology. As they frequently harbor TP53 mutations, it is important not to misclassify them as serous carcinoma.

  7. The somatic FAH C.1061C>A change counteracts the frequent FAH c.1062+5G>A mutation and permits U1snRNA-based splicing correction.

    PubMed

    Scalet, Daniela; Sacchetto, Claudia; Bernardi, Francesco; Pinotti, Mirko; van de Graaf, Stan F J; Balestra, Dario

    2018-05-01

    In tyrosinaemia type 1(HT1), a mosaic pattern of fumarylacetoacetase (FAH) immunopositive or immunonegative nodules in liver tissue has been reported in many patients. This aspect is generally explained by a spontaneous reversion of the mutation into a normal genotype. In one HT1 patient carrying the frequent FAH c.1062+5G>A mutation, a second somatic change (c.1061C>A) has been reported in the same allele, and found in immunopositive nodules. Here, we demonstrated that the c.1062+5G>A prevents usage of the exon 12 5' splice site (ss), even when forced by an engineered U1snRNA specifically designed on the FAH 5'ss to strengthen its recognition. Noticeably the new somatic c.1061C>A change, in linkage with the c.1062+5G>A mutation, partially rescues the defective 5'ss and is associated to trace level (~5%) of correct transcripts. Interestingly, this combined genetic condition strongly favored the rescue by the engineered U1snRNA, with correct transcripts reaching up to 60%. Altogether, these findings elucidate the molecular basis of HT1 caused by the frequent FAH c.1062+5G>A mutation, and demonstrate the compensatory effect of the c.1061C>A change in promoting exon definition, thus unraveling a rare mechanism leading to FAH immune-reactive mosaicism.

  8. Unmasking an autosomal recessive disorder by a deletion in the DiGeorge/Velo-cardio-facial chromosome region (DGCR) in 22q11.2

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Budarf, M.L.; Michaud, D.; Emanuel, B.

    Unmasking an autosomal recessive disorder by constitutional hemizygosity is well documented for the embryonal tumors RB and WAGR, where the second hit is a somatic event. Few deletion-mediated recessive conditions have been reported in patients with germline mutations. The major platelet receptor for von Willebrand factor, Glycoprotein Ib (GpIb), is a complex of two plasma membrane glycoproteins, Ib{alpha} and Ib{beta}, covalently linked by disulfide bonds. Defects in this receptor have been associated with the rare congenital autosomal recessive bleeding disorder, Bernard-Soulier syndrome (BSS). BSS is characterized by prolonged bleeding times, thrombocytopenia and very large platelets. The GpIb{beta} gene has beenmore » cloned and we have mapped it within the DGCR. We have identified a patient with phenotypic features of both BSS and VCFS. The patient was referred for 22q11-deletion FISH studies because of a conventricular VSD and mild dysmorphia. FISH with the N25 DiGeorge cosmid demonstrated a deletion in 22q11.2. Western blot analysis of the patient`s platelet proteins demonstrates a complete absence of GpIb{beta}. We suggest that haploinsufficiency for the DGCR in this patient unmasks a mutation in the remaining GpIb{beta} allele, resulting in manifestations of BSS. This mechanism, haploinsufficiency coupled with a mutation of the {open_quotes}normal{close_quotes} chromosome, might explain some of the phenotypic variability seen amongst patients with 22q11.2 microdeletions. These results further suggest that patients with contiguous gene deletion syndromes are at increased risk for autosomal recessive disorders and that they provide the opportunity to {open_quotes}map{close_quotes}disease loci.« less

  9. Environmental modulation of somatic mutations: nature of interactions. Final report, 1 June 1974--31 May 1977. [Effects of diurnal temperature changes in Tradescantia

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mericle, L.W.

    1977-05-01

    Research on this project has had as a major goal a combined ecologic-genetic investigation of somatic mutations in order to evaluate the impacts of certain changing environmental parameters. The ultimate aim, to better understand how such environmental-mutation interactions operate and to assure the information obtained be extrapolatable to conditions and events in nature. Higher plants delineate reproductive tissues late in development from meristematic, somatic tissues. Moreover, the prevailing method of reproduction may be without sexual fusion of gametes and/or wholly asexual (vegetative). Therefore, somatic mutations can have as far-reaching genetic significance for a plant population as when germ cells, themselves,more » are directly affected. Our data show diurnal temperature differences (DTD) of greater than or equal to 22.2 C-degrees to be very effective mutagenic agents in the Tradescantia somatic mutation system. Further, these ranges of DTD were found to occur often in important seed production areas. A DTD of 22.2 in magnitude can increase mutations 10-fold. And, durations short as 1-day can induce significant increases in mutation rate. Whether interaction of 22.2 DTD with low-level radiation (800 mR/day) is synergistic or attenuative is still debatable. We believe, however, that spontaneous, and 22.2 DTD induced, mutations occur mainly via the genetic mechanism of somatic crossing-over; mutations from acute ionizing radiation (e.g., 30-60 R ..gamma..) via chromosome breakage, producing micronuclei. Requirements for maximizing the Discriminatory Response Capability (DRC) in the Tradescantia somatic mutation system are set forth.« less

  10. Decoding the genetic basis of Cushing's disease: USP8 in the spotlight.

    PubMed

    Theodoropoulou, Marily; Reincke, Martin; Fassnacht, Martin; Komada, Masayuki

    2015-10-01

    Cushing's disease (CD) arises from pituitary-dependent glucocorticoid excess due to an ACTH-secreting corticotroph tumor. Genetic hits in oncogenes and tumor suppressor genes that afflict other pituitary tumor subtypes are not found in corticotrophinomas. Recently, a somatic mutational hotspot was found in up to half of corticotrophinomas in the USP8 gene that encodes a protein that impairs the downregulation of the epidermal growth factor receptor (EGFR) and enables its constitutive signaling. EGF is an important regulator of corticotroph function and its receptor is highly expressed in Cushing's pituitary tumors, where it leads to increased ACTH synthesis in vitro and in vivo. The mutational hotspot found in corticotrophinomas hyper-activates USP8, enabling it to rescue EGFR from lysosomal degradation and ensure its stimulatory signaling. This review presents new developments in the study of the genetics of CD and focuses on the USP8-EGFR system as trigger and target of corticotroph tumorigenesis. © 2015 European Society of Endocrinology.

  11. Somatic Point Mutation Calling in Low Cellularity Tumors

    PubMed Central

    Kassahn, Karin S.; Holmes, Oliver; Nones, Katia; Patch, Ann-Marie; Miller, David K.; Christ, Angelika N.; Harliwong, Ivon; Bruxner, Timothy J.; Xu, Qinying; Anderson, Matthew; Wood, Scott; Leonard, Conrad; Taylor, Darrin; Newell, Felicity; Song, Sarah; Idrisoglu, Senel; Nourse, Craig; Nourbakhsh, Ehsan; Manning, Suzanne; Wani, Shivangi; Steptoe, Anita; Pajic, Marina; Cowley, Mark J.; Pinese, Mark; Chang, David K.; Gill, Anthony J.; Johns, Amber L.; Wu, Jianmin; Wilson, Peter J.; Fink, Lynn; Biankin, Andrew V.; Waddell, Nicola; Grimmond, Sean M.; Pearson, John V.

    2013-01-01

    Somatic mutation calling from next-generation sequencing data remains a challenge due to the difficulties of distinguishing true somatic events from artifacts arising from PCR, sequencing errors or mis-mapping. Tumor cellularity or purity, sub-clonality and copy number changes also confound the identification of true somatic events against a background of germline variants. We have developed a heuristic strategy and software (http://www.qcmg.org/bioinformatics/qsnp/) for somatic mutation calling in samples with low tumor content and we show the superior sensitivity and precision of our approach using a previously sequenced cell line, a series of tumor/normal admixtures, and 3,253 putative somatic SNVs verified on an orthogonal platform. PMID:24250782

  12. NetNorM: Capturing cancer-relevant information in somatic exome mutation data with gene networks for cancer stratification and prognosis.

    PubMed

    Le Morvan, Marine; Zinovyev, Andrei; Vert, Jean-Philippe

    2017-06-01

    Genome-wide somatic mutation profiles of tumours can now be assessed efficiently and promise to move precision medicine forward. Statistical analysis of mutation profiles is however challenging due to the low frequency of most mutations, the varying mutation rates across tumours, and the presence of a majority of passenger events that hide the contribution of driver events. Here we propose a method, NetNorM, to represent whole-exome somatic mutation data in a form that enhances cancer-relevant information using a gene network as background knowledge. We evaluate its relevance for two tasks: survival prediction and unsupervised patient stratification. Using data from 8 cancer types from The Cancer Genome Atlas (TCGA), we show that it improves over the raw binary mutation data and network diffusion for these two tasks. In doing so, we also provide a thorough assessment of somatic mutations prognostic power which has been overlooked by previous studies because of the sparse and binary nature of mutations.

  13. NetNorM: Capturing cancer-relevant information in somatic exome mutation data with gene networks for cancer stratification and prognosis

    PubMed Central

    2017-01-01

    Genome-wide somatic mutation profiles of tumours can now be assessed efficiently and promise to move precision medicine forward. Statistical analysis of mutation profiles is however challenging due to the low frequency of most mutations, the varying mutation rates across tumours, and the presence of a majority of passenger events that hide the contribution of driver events. Here we propose a method, NetNorM, to represent whole-exome somatic mutation data in a form that enhances cancer-relevant information using a gene network as background knowledge. We evaluate its relevance for two tasks: survival prediction and unsupervised patient stratification. Using data from 8 cancer types from The Cancer Genome Atlas (TCGA), we show that it improves over the raw binary mutation data and network diffusion for these two tasks. In doing so, we also provide a thorough assessment of somatic mutations prognostic power which has been overlooked by previous studies because of the sparse and binary nature of mutations. PMID:28650955

  14. POLE somatic mutations in advanced colorectal cancer.

    PubMed

    Guerra, Joana; Pinto, Carla; Pinto, Diana; Pinheiro, Manuela; Silva, Romina; Peixoto, Ana; Rocha, Patrícia; Veiga, Isabel; Santos, Catarina; Santos, Rui; Cabreira, Verónica; Lopes, Paula; Henrique, Rui; Teixeira, Manuel R

    2017-12-01

    Despite all the knowledge already gathered, the picture of somatic genetic changes in colorectal tumorigenesis is far from complete. Recently, germline and somatic mutations in the exonuclease domain of polymerase epsilon, catalytic subunit (POLE) gene have been reported in a small subset of microsatellite-stable and hypermutated colorectal carcinomas (CRCs), affecting the proofreading activity of the enzyme and leading to misincorporation of bases during DNA replication. To evaluate the role of POLE mutations in colorectal carcinogenesis, namely in advanced CRC, we searched for somatic mutations by Sanger sequencing in tumor DNA samples from 307 cases. Microsatellite instability and mutation analyses of a panel of oncogenes were performed in the tumors harboring POLE mutations. Three heterozygous mutations were found in two tumors, the c.857C>G, p.Pro286Arg, the c.901G>A, p.Asp301Asn, and the c.1376C>T, p.Ser459Phe. Of the POLE-mutated CRCs, one tumor was microsatellite-stable and the other had low microsatellite instability, whereas KRAS and PIK3CA mutations were found in one tumor each. We conclude that POLE somatic mutations exist but are rare in advanced CRC, with further larger studies being necessary to evaluate its biological and clinical implications. © 2017 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

  15. Clinical significance of somatic mutation in unexplained blood cytopenia

    PubMed Central

    Gallì, Anna; Travaglino, Erica; Ambaglio, Ilaria; Rizzo, Ettore; Molteni, Elisabetta; Elena, Chiara; Ferretti, Virginia Valeria; Catricalà, Silvia; Bono, Elisa; Todisco, Gabriele; Bianchessi, Antonio; Rumi, Elisa; Zibellini, Silvia; Pietra, Daniela; Boveri, Emanuela; Camaschella, Clara; Toniolo, Daniela; Papaemmanuil, Elli; Ogawa, Seishi; Cazzola, Mario

    2017-01-01

    Unexplained blood cytopenias, in particular anemia, are often found in older persons. The relationship between these cytopenias and myeloid neoplasms like myelodysplastic syndromes is currently poorly defined. We studied a prospective cohort of patients with unexplained cytopenia with the aim to estimate the predictive value of somatic mutations for identifying subjects with, or at risk of, developing a myeloid neoplasm. The study included a learning cohort of 683 consecutive patients investigated for unexplained cytopenia, and a validation cohort of 190 patients referred for suspected myeloid neoplasm. Using granulocyte DNA, we looked for somatic mutations in 40 genes that are recurrently mutated in myeloid malignancies. Overall, 435/683 patients carried a somatic mutation in at least 1 of these genes. Carrying a somatic mutation with a variant allele frequency ≥0.10, or carrying 2 or more mutations, had a positive predictive value for diagnosis of myeloid neoplasm equal to 0.86 and 0.88, respectively. Spliceosome gene mutations and comutation patterns involving TET2, DNMT3A, or ASXL1 had positive predictive values for myeloid neoplasm ranging from 0.86 to 1.0. Within subjects with inconclusive diagnostic findings, carrying 1 or more somatic mutations was associated with a high probability of developing a myeloid neoplasm during follow-up (hazard ratio = 13.9, P < .001). The predictive values of mutation analysis were confirmed in the independent validation cohort. The findings of this study indicate that mutation analysis on peripheral blood granulocytes may significantly improve the current diagnostic approach to unexplained cytopenia and more generally the diagnostic accuracy of myeloid neoplasms. PMID:28424163

  16. Somatic Mutations and Neoepitope Homology in Melanomas Treated with CTLA-4 Blockade.

    PubMed

    Nathanson, Tavi; Ahuja, Arun; Rubinsteyn, Alexander; Aksoy, Bulent Arman; Hellmann, Matthew D; Miao, Diana; Van Allen, Eliezer; Merghoub, Taha; Wolchok, Jedd D; Snyder, Alexandra; Hammerbacher, Jeff

    2017-01-01

    Immune checkpoint inhibitors are promising treatments for patients with a variety of malignancies. Toward understanding the determinants of response to immune checkpoint inhibitors, it was previously demonstrated that the presence of somatic mutations is associated with benefit from checkpoint inhibition. A hypothesis was posited that neoantigen homology to pathogens may in part explain the link between somatic mutations and response. To further examine this hypothesis, we reanalyzed cancer exome data obtained from our previously published study of 64 melanoma patients treated with CTLA-4 blockade and a new dataset of RNA-Seq data from 24 of these patients. We found that the ability to accurately predict patient benefit did not increase as the analysis narrowed from somatic mutation burden, to inclusion of only those mutations predicted to be MHC class I neoantigens, to only including those neoantigens that were expressed or that had homology to pathogens. The only association between somatic mutation burden and response was found when examining samples obtained prior to treatment. Neoantigen and expressed neoantigen burden were also associated with response, but neither was more predictive than somatic mutation burden. Neither the previously described tetrapeptide signature nor an updated method to evaluate neoepitope homology to pathogens was more predictive than mutation burden. Cancer Immunol Res; 5(1); 84-91. ©2016 AACR. ©2016 American Association for Cancer Research.

  17. Somatic Host Cell Alterations in HPV Carcinogenesis

    PubMed Central

    Litwin, Tamara R.; Clarke, Megan A.; Dean, Michael; Wentzensen, Nicolas

    2017-01-01

    High-risk human papilloma virus (HPV) infections cause cancers in different organ sites, most commonly cervical and head and neck cancers. While carcinogenesis is initiated by two viral oncoproteins, E6 and E7, increasing evidence shows the importance of specific somatic events in host cells for malignant transformation. HPV-driven cancers share characteristic somatic changes, including apolipoprotein B mRNA editing catalytic polypeptide-like (APOBEC)-driven mutations and genomic instability leading to copy number variations and large chromosomal rearrangements. HPV-associated cancers have recurrent somatic mutations in phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit alpha (PIK3CA) and phosphatase and tensin homolog (PTEN), human leukocyte antigen A and B (HLA-A and HLA-B)-A/B, and the transforming growth factor beta (TGFβ) pathway, and rarely have mutations in the tumor protein p53 (TP53) and RB transcriptional corepressor 1 (RB1) tumor suppressor genes. There are some variations by tumor site, such as NOTCH1 mutations which are primarily found in head and neck cancers. Understanding the somatic events following HPV infection and persistence can aid the development of early detection biomarkers, particularly when mutations in precancers are characterized. Somatic mutations may also influence prognosis and treatment decisions. PMID:28771191

  18. Somatic Host Cell Alterations in HPV Carcinogenesis.

    PubMed

    Litwin, Tamara R; Clarke, Megan A; Dean, Michael; Wentzensen, Nicolas

    2017-08-03

    High-risk human papilloma virus (HPV) infections cause cancers in different organ sites, most commonly cervical and head and neck cancers. While carcinogenesis is initiated by two viral oncoproteins, E6 and E7, increasing evidence shows the importance of specific somatic events in host cells for malignant transformation. HPV-driven cancers share characteristic somatic changes, including apolipoprotein B mRNA editing catalytic polypeptide-like (APOBEC)-driven mutations and genomic instability leading to copy number variations and large chromosomal rearrangements. HPV-associated cancers have recurrent somatic mutations in phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit alpha ( PIK3CA ) and phosphatase and tensin homolog ( PTEN ), human leukocyte antigen A and B ( HLA-A and HLA-B ) -A/B , and the transforming growth factor beta (TGFβ) pathway, and rarely have mutations in the tumor protein p53 ( TP53 ) and RB transcriptional corepressor 1 ( RB1 ) tumor suppressor genes. There are some variations by tumor site, such as NOTCH1 mutations which are primarily found in head and neck cancers. Understanding the somatic events following HPV infection and persistence can aid the development of early detection biomarkers, particularly when mutations in precancers are characterized. Somatic mutations may also influence prognosis and treatment decisions.

  19. Multiple mechanisms of MYCN dysregulation in Wilms tumour

    PubMed Central

    Williams, Richard D.; Chagtai, Tasnim; Alcaide-German, Marisa; Apps, John; Wegert, Jenny; Popov, Sergey; Vujanic, Gordan; van Tinteren, Harm; van den Heuvel-Eibrink, Marry M.; Kool, Marcel; de Kraker, Jan; Gisselsson, David; Graf, Norbert; Gessler, Manfred; Pritchard-Jones, Kathy

    2015-01-01

    Genomic gain of the proto-oncogene transcription factor gene MYCN is associated with poor prognosis in several childhood cancers. Here we present a comprehensive copy number analysis of MYCN in Wilms tumour (WT), demonstrating that gain of this gene is associated with anaplasia and with poorer relapse-free and overall survival, independent of histology. Using whole exome and gene-specific sequencing, together with methylation and expression profiling, we show that MYCN is targeted by other mechanisms, including a recurrent somatic mutation, P44L, and specific DNA hypomethylation events associated with MYCN overexpression in tumours with high risk histologies. We describe parallel evolution of genomic copy number gain and point mutation of MYCN in the contralateral tumours of a remarkable bilateral case in which independent contralateral mutations of TP53 also evolve over time. We report a second bilateral case in which MYCN gain is a germline aberration. Our results suggest a significant role for MYCN dysregulation in the molecular biology of Wilms tumour. We conclude that MYCN gain is prognostically significant, and suggest that the novel P44L somatic variant is likely to be an activating mutation. PMID:25749049

  20. Clock-like mutational processes in human somatic cells

    PubMed Central

    Alexandrov, Ludmil B.; Jones, Philip H.; Wedge, David C.; Sale, Julian E.; Campbell, Peter J.; Nik-Zainal, Serena; Stratton, Michael R.

    2016-01-01

    During the course of a lifetime somatic cells acquire mutations. Different mutational processes may contribute to the mutations accumulated in a cell, with each imprinting a mutational signature on the cell’s genome. Some processes generate mutations throughout life at a constant rate in all individuals and the number of mutations in a cell attributable to these processes will be proportional to the chronological age of the person. Using mutations from 10,250 cancer genomes across 36 cancer types, we investigated clock-like mutational processes that have been operating in normal human cells. Two mutational signatures show clock-like properties. Both exhibit different mutation rates in different tissues. However, their mutation rates are not correlated indicating that the underlying processes are subject to different biological influences. For one signature, the rate of cell division may influence its mutation rate. This study provides the first survey of clock-like mutational processes operative in human somatic cells. PMID:26551669

  1. LRH-1 May Rescue SF-1 Deficiency for Steroidogenesis: An in vitro and in vivo Study.

    PubMed

    Camats, Núria; Audí, Laura; Fernández-Cancio, Mónica; Andaluz, Pilar; Mullis, Primus E; Carrascosa, Antonio; Flück, Christa E

    2015-01-01

    Steroidogenic factor 1 (NR5A1/SF-1) mutations usually manifest in 46,XY individuals with variable degrees of disordered sex development and in 46,XX women with ovarian insufficiency. So far, there is no genotype-phenotype correlation. The broad spectrum of phenotype with NR5A1 mutations may be due to a second hit in a gene with similar function to NR5A1/SF-1. Liver receptor homologue-1 (LRH-1/NR5A2) might be a good candidate. We performed in vitro studies for the interplay between SF-1, LRH-1 and DAX-1, expression profiles in human steroidogenic tissues, and NR5A2 genetic studies in a cohort (11 patients, 8 relatives, 11 families) harboring heterozygote NR5A1/SF-1 mutations. LRH-1 isoforms transactivate the CYP17A1 and HSD3B2 promoters similarly to SF-1 and compensate for SF-1 deficiency. DAX-1 inhibits SF-1- and LRH-1-mediated transactivation. LRH-1 is found expressed in human adult and fetal adrenals and testes. However, no NR5A2/LRH-1 mutations were detected in 14 individuals with heterozygote NR5A1/SF-1 mutations. These findings demonstrate that in vitro LRH-1 can act like SF-1 and compensate for its deficiency. Expression of LRH-1 in fetal testis suggests a role in male gonadal development. However, as we found no NR5A2/LRH-1 mutations, the 'second genetic hit' in SF-1 patients explaining the broad phenotypic variability remains elusive. © 2015 S. Karger AG, Basel.

  2. Clock-like mutational processes in human somatic cells

    DOE PAGES

    Alexandrov, Ludmil B.; Jones, Philip H.; Wedge, David C.; ...

    2015-11-09

    During the course of a lifetime, somatic cells acquire mutations. Different mutational processes may contribute to the mutations accumulated in a cell, with each imprinting a mutational signature on the cell's genome. Some processes generate mutations throughout life at a constant rate in all individuals, and the number of mutations in a cell attributable to these processes will be proportional to the chronological age of the person. Using mutations from 10,250 cancer genomes across 36 cancer types, we investigated clock-like mutational processes that have been operating in normal human cells. Two mutational signatures show clock-like properties. Both exhibit different mutationmore » rates in different tissues. However, their mutation rates are not correlated, indicating that the underlying processes are subject to different biological influences. For one signature, the rate of cell division may influence its mutation rate. This paper provides the first survey of clock-like mutational processes operating in human somatic cells.« less

  3. Familial Mediterranean fever with a single MEFV mutation: where is the second hit?

    PubMed

    Booty, Matthew G; Chae, Jae Jin; Masters, Seth L; Remmers, Elaine F; Barham, Beverly; Le, Julie M; Barron, Karyl S; Holland, Steve M; Kastner, Daniel L; Aksentijevich, Ivona

    2009-06-01

    Familial Mediterranean fever (FMF) has traditionally been considered an autosomal-recessive disease; however, it has been observed that a substantial number of patients with clinical FMF possess only 1 demonstrable MEFV mutation. The purpose of this study was to perform an extensive search for a second MEFV mutation in 46 patients diagnosed clinically as having FMF and carrying only 1 high-penetrance FMF mutation. MEFV and other candidate genes were sequenced by standard capillary electrophoresis. In 10 patients, the entire 15-kb MEFV genomic region was resequenced using hybridization-based chip technology. MEFV gene expression levels were determined by quantitative reverse transcription-polymerase chain reaction. Pyrin protein levels were examined by Western blotting. A second MEFV mutation was not identified in any of the patients who were screened. Haplotype analysis did not identify a common haplotype that might be associated with the transmission of a second FMF allele. Western blots did not demonstrate a significant difference in pyrin levels between patients with a single mutation and those with a double mutation; however, FMF patients of both types showed higher protein expression as compared with controls and with non-FMF patients with active inflammation. Screening of genes encoding pyrin-interacting proteins identified rare mutations in a small number of patients, suggesting the possibility of digenic inheritance. Our data underscore the existence of a significant subset of FMF patients who are carriers of only 1 MEFV mutation and demonstrate that complete MEFV sequencing is not likely to yield a second mutation. Screening for the set of the most common mutations and detection of a single mutation appears to be sufficient in the presence of clinical symptoms for the diagnosis of FMF and the initiation of a trial of colchicine.

  4. Defects in Histone H3.3 Phosphorylation and ATRX Recruitment to Misaligned Chromosomes during Mitosis Contribute to the Development of Pediatric Glioblastomas

    DTIC Science & Technology

    2015-09-01

    somatic mutations leading to single amino acid substitutions in four genes : the p53 tumor suppressor, the histone variant H3.3, ATRX, and DAXX. As...pending minor revision. The second major impact of our work is the discovery that mutations in the H3.3 gene (K27M and G34R) – found to be driver...heterozygous mutations in this region of the H3.3 gene are particularly dangerous, and provides insights into how they drive cancer progression. b

  5. Molecular methods for somatic mutation testing in lung adenocarcinoma: EGFR and beyond

    PubMed Central

    Rogers, Toni-Maree; Fellowes, Andrew; Bell, Anthony; Fox, Stephen

    2015-01-01

    Somatic mutational profiling in cancer has revolutionized the practice of clinical oncology. The discovery of driver mutations in non-small cell lung cancer (NSCLC) is an example of this. Molecular testing of lung adenocarcinoma is now considered standard of care and part of the diagnostic algorithm. This article provides an overview of the workflow of molecular testing in a clinical diagnostic laboratory discussing in particular novel assays that are currently in use for somatic mutation detection in NSCLC focussing on epidermal growth factor receptor (EGFR) mutations and anaplastic lymphoma kinase (ALK), ROS1 and RET rearrangements. PMID:25870795

  6. Unique mutation portraits and frequent COL2A1 gene alteration in chondrosarcoma

    PubMed Central

    Totoki, Yasushi; Yoshida, Akihiko; Hosoda, Fumie; Nakamura, Hiromi; Hama, Natsuko; Ogura, Koichi; Yoshida, Aki; Fujiwara, Tomohiro; Arai, Yasuhito; Toguchida, Junya; Tsuda, Hitoshi; Miyano, Satoru; Kawai, Akira

    2014-01-01

    Chondrosarcoma is the second most frequent malignant bone tumor. However, the etiological background of chondrosarcomagenesis remains largely unknown, along with details on molecular alterations and potential therapeutic targets. Massively parallel paired-end sequencing of whole genomes of 10 primary chondrosarcomas revealed that the process of accumulation of somatic mutations is homogeneous irrespective of the pathological subtype or the presence of IDH1 mutations, is unique among a range of cancer types, and shares significant commonalities with that of prostate cancer. Clusters of structural alterations localized within a single chromosome were observed in four cases. Combined with targeted resequencing of additional cartilaginous tumor cohorts, we identified somatic alterations of the COL2A1 gene, which encodes an essential extracellular matrix protein in chondroskeletal development, in 19.3% of chondrosarcoma and 31.7% of enchondroma cases. Epigenetic regulators (IDH1 and YEATS2) and an activin/BMP signal component (ACVR2A) were recurrently altered. Furthermore, a novel FN1-ACVR2A fusion transcript was observed in both chondrosarcoma and osteochondromatosis cases. With the characteristic accumulative process of somatic changes as a background, molecular defects in chondrogenesis and aberrant epigenetic control are primarily causative of both benign and malignant cartilaginous tumors. PMID:25024164

  7. Discordance of somatic mutations between Asian and Caucasian patient populations with gastric cancer

    PubMed Central

    Jia, Feifei; Teer, Jamie K.; Knepper, Todd C.; Lee, Jae K.; Zhou, Hong-Hao; He, Yi-Jing; McLeod, Howard L.

    2017-01-01

    Background Differences in response to cancer treatments have been observed among racially and ethnically diverse gastric cancer patient populations. In the era of targeted therapy, mutation profiling of cancer is a crucial aspect of making therapeutic decisions. Mapping driver gene mutations for the gastric cancer patient population as a whole has significant potential to advance precision therapy. Methods Gastric cancer patient cases with sequencing data (total n=473) were obtained from The Cancer Genome Atlas (TCGA; n=295), Moffitt Cancer Center Total Cancer Care™ (TCC; n=33), and three published studies (n=145). Relevant somatic mutation frequency data were obtained from cBioPortal, TCC database and in-house analysis tool, and relevant publication Results We have found somatic mutation rates of several driver genes significantly vary between gastric cancer patients of Asian and Caucasian descent, with substantial variation across different geographic regions. Non-parametric statistical tests were performed to examine significant differences in protein-altering somatic mutations between Asian and Caucasian gastric cancer patient groups. Frequencies of somatic mutations of 5 genes were APC(Asian: Caucasian 6.06% vs. 14.40%, p=0.0076) ARIDIA(20.7% vs. 32.1%, p=0.01) KMT2A(4.04% vs. 12.35%, p=0.003) PIK3CA(9.6% vs. 18.52%, p=0.01) PTEN(2.52% vs. 9.05%, p=0.008), showing significant differences between Asian and Caucasian gastric cancer patients. Conclusions Our study has found significant differences in protein-altering somatic mutation frequencies in diverse geographic populations. In particular, we found that the somatic patterns may offer better insight and important opportunities for both targeted drug development and precision therapeutic strategies between Asian and Caucasian gastric cancer patients. PMID:28039579

  8. Discordance of Somatic Mutations Between Asian and Caucasian Patient Populations with Gastric Cancer.

    PubMed

    Jia, Feifei; Teer, Jamie K; Knepper, Todd C; Lee, Jae K; Zhou, Hong-Hao; He, Yi-Jing; McLeod, Howard L

    2017-04-01

    Differences in response to cancer treatments have been observed among racially and ethnically diverse gastric cancer (GC) patient populations. In the era of targeted therapy, mutation profiling of cancer is a crucial aspect of making therapeutic decisions. Mapping driver gene mutations for the GC patient population as a whole has significant potential to advance precision therapy. GC patients with sequencing data (N = 473) were obtained from The Cancer Genome Atlas (TCGA; n = 295), Moffitt Cancer Center Total Cancer Care™ (TCC; n = 33), and three published studies (n = 145). In addition, relevant somatic mutation frequency data were obtained from cBioPortal, the TCC database, and an in-house analysis tool, as well as relevant publications. We found that the somatic mutation rates of several driver genes vary significantly between GC patients of Asian and Caucasian descent, with substantial variation across different geographic regions. Non-parametric statistical tests were performed to examine the significant differences in protein-altering somatic mutations between Asian and Caucasian GC patient groups. The frequencies of somatic mutations of five genes were: APC (Asian: Caucasian 6.06 vs. 14.40%, p = 0.0076), ARIDIA (20.7 vs. 32.1%, p = 0.01), KMT2A (4.04 vs. 12.35%, p = 0.003), PIK3CA (9.6 vs. 18.52%, p = 0.01), and PTEN (2.52 vs. 9.05%, p = 0.008), showing significant differences between Asian and Caucasian GC patients. Our study found significant differences in protein-altering somatic mutation frequencies in diverse geographic populations. In particular, we found that the somatic patterns may offer better insight and important opportunities for both targeted drug development and precision therapeutic strategies between Asian and Caucasian GC patients.

  9. DNA polymerase η mutational signatures are found in a variety of different types of cancer.

    PubMed

    Rogozin, Igor B; Goncearenco, Alexander; Lada, Artem G; De, Subhajyoti; Yurchenko, Vyacheslav; Nudelman, German; Panchenko, Anna R; Cooper, David N; Pavlov, Youri I

    2018-01-01

    DNA polymerase (pol) η is a specialized error-prone polymerase with at least two quite different and contrasting cellular roles: to mitigate the genetic consequences of solar UV irradiation, and promote somatic hypermutation in the variable regions of immunoglobulin genes. Misregulation and mistargeting of pol η can compromise genome integrity. We explored whether the mutational signature of pol η could be found in datasets of human somatic mutations derived from normal and cancer cells. A substantial excess of single and tandem somatic mutations within known pol η mutable motifs was noted in skin cancer as well as in many other types of human cancer, suggesting that somatic mutations in A:T bases generated by DNA polymerase η are a common feature of tumorigenesis. Another peculiarity of pol ηmutational signatures, mutations in YCG motifs, led us to speculate that error-prone DNA synthesis opposite methylated CpG dinucleotides by misregulated pol η in tumors might constitute an additional mechanism of cytosine demethylation in this hypermutable dinucleotide.

  10. Differential analysis between somatic mutation and germline variation profiles reveals cancer-related genes.

    PubMed

    Przytycki, Pawel F; Singh, Mona

    2017-08-25

    A major aim of cancer genomics is to pinpoint which somatically mutated genes are involved in tumor initiation and progression. We introduce a new framework for uncovering cancer genes, differential mutation analysis, which compares the mutational profiles of genes across cancer genomes with their natural germline variation across healthy individuals. We present DiffMut, a fast and simple approach for differential mutational analysis, and demonstrate that it is more effective in discovering cancer genes than considerably more sophisticated approaches. We conclude that germline variation across healthy human genomes provides a powerful means for characterizing somatic mutation frequency and identifying cancer driver genes. DiffMut is available at https://github.com/Singh-Lab/Differential-Mutation-Analysis .

  11. SETD2 is recurrently mutated in whole-exome sequenced canine osteosarcoma.

    PubMed

    Sakthikumar, Sharadha; Elvers, Ingegerd; Kim, Jaegil; Arendt, Maja L; Thomas, Rachael; Turner-Maier, Jason; Swofford, Ross; Johnson, Jeremy; Schumacher, Steven E; Alföldi, Jessica; Axelsson, Erik; Couto, Guillermo; Kisseberth, William; Pettersson, Mats E; Getz, Gad; Meadows, Jennifer R S; Modiano, Jaime F; Breen, Matthew; Kierczak, Marcin; Forsberg-Nilsson, Karin; Marinescu, Voichita D; Lindblad-Toh, Kerstin

    2018-05-03

    Osteosarcoma (OSA) is a debilitating bone cancer that affects humans, especially children and adolescents. A homologous form of OSA spontaneously occurs in dogs, and its differential incidence observed across breeds allows for the investigation of tumor mutations in the context of multiple genetic backgrounds. Using whole-exome sequencing and dogs from three susceptible breeds (22 golden retrievers, 21 Rottweilers, and 23 greyhounds), we found that OSA tumors show a high frequency of somatic copy number alterations (SCNA) affecting key oncogenes and tumor suppressor genes. The across-breed results are similar to what has been observed for human OSA, but the disease frequency and somatic mutation counts vary in the three breeds. For all breeds, three mutational signatures (one of which has not been previously reported), and eleven significantly mutated genes were identified. TP53 was the most frequently altered gene (83% of dogs have either mutations or SCNA in TP53), recapitulating observations in human OSA. The second most frequently mutated gene, histone methyltransferase SETD2, has known roles in multiple cancers, but has not previously been strongly implicated in OSA. This study points to the likely importance of histone modifications in OSA and highlights the strong genetic similarities between human and dog OSA, suggesting that canine OSA may serve as an excellent model for developing treatment strategies in both species. Copyright ©2018, American Association for Cancer Research.

  12. Somatic mosaicism containing double mutations in PTCH1 revealed by generation of induced pluripotent stem cells from nevoid basal cell carcinoma syndrome.

    PubMed

    Ikemoto, Yu; Takayama, Yoshinaga; Fujii, Katsunori; Masuda, Mokuri; Kato, Chise; Hatsuse, Hiromi; Fujitani, Kazuko; Nagao, Kazuaki; Kameyama, Kohzoh; Ikehara, Hajime; Toyoda, Masashi; Umezawa, Akihiro; Miyashita, Toshiyuki

    2017-08-01

    Nevoid basal cell carcinoma syndrome (NBCCS) is an autosomal dominant disorder characterised by developmental defects and tumorigenesis, such as medulloblastomas and basal cell carcinomas, caused by mutations of the patched-1 ( PTCH1 ) gene. In this article, we seek to demonstrate a mosaicism containing double mutations in PTCH1 in an individual with NBCCS. A de novo germline mutation of PTCH1 (c.272delG) was detected in a 31-year-old woman with NBCCS. Gene analysis of two out of four induced pluripotent stem cell (iPSC) clones established from the patient unexpectedly revealed an additional mutation, c.274delT. Deep sequencing confirmed a low-prevalence somatic mutation (5.5%-15.6% depending on the tissue) identical to the one found in iPSC clones. This is the first case of mosaicism unequivocally demonstrated in NBCCS. Furthermore, the mosaicism is unique in that the patient carries one normal and two mutant alleles. Because these mutations are located in close proximity, reversion error is likely to be involved in this event rather than a spontaneous mutation. In addition, this study indicates that gene analysis of iPSC clones can contribute to the detection of mosaicism containing a minor population carrying a second mutation. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  13. A mouse model for the cystic fibrosis delta F508 mutation.

    PubMed Central

    van Doorninck, J H; French, P J; Verbeek, E; Peters, R H; Morreau, H; Bijman, J; Scholte, B J

    1995-01-01

    Most cystic fibrosis (CF) patients produce a mutant form (delta F508) of the cystic fibrosis transmembrane conductance regulator (CFTR), which is not properly processed in normal cells but is active as a chloride channel in several experimental systems. We used a double homologous recombination ('Hit and Run') procedure to generate a mouse model for the delta F508 mutation. Targeted embryonic stem (ES) cells (Hit clones) were found; of these either 80 or 20% of the clones had lost the delta F508 mutation, depending on the distance between the linearization site in the targeting construct and the delta F508 mutation. Correctly targeted clones underwent a second selection step resulting in ES cell clones (Run clones) heterozygous for the delta F508 mutation with an efficiency of 2-7%. Chimeric mice were generated and offspring homozygous for the delta F508 mutation showed electrophysiological abnormalities in nasal epithelium, gallbladder and in the intestine, and histological abnormalities in the intestine, typical of CF. Our data suggest that the delta F508 mice have residual delta F508 CFTR activity which would explain the mild pathology of the delta F508 mice. The delta F508 mouse may provide a useful model for the study of the processing defect of delta F508 CFTR and for the development of novel therapeutic approaches based on circumvention of the processing block. Images PMID:7556083

  14. A mathematical model of breast cancer development, local treatment and recurrence.

    PubMed

    Enderling, Heiko; Chaplain, Mark A J; Anderson, Alexander R A; Vaidya, Jayant S

    2007-05-21

    Cancer development is a stepwise process through which normal somatic cells acquire mutations which enable them to escape their normal function in the tissue and become self-sufficient in survival. The number of mutations depends on the patient's age, genetic susceptibility and on the exposure of the patient to carcinogens throughout their life. It is believed that in every malignancy 4-6 crucial similar mutations have to occur on cancer-related genes. These genes are classified as oncogenes and tumour suppressor genes (TSGs) which gain or lose their function respectively, after they have received one mutative hit or both of their alleles have been knocked out. With the acquisition of each of the necessary mutations the transformed cell gains a selective advantage over normal cells, and the mutation will spread throughout the tissue via clonal expansion. We present a simplified model of this mutation and expansion process, in which we assume that the loss of two TSGs is sufficient to give rise to a cancer. Our mathematical model of the stepwise development of breast cancer verifies the idea that the normal mutation rate in genes is only sufficient to give rise to a tumour within a clinically observable time if a high number of breast stem cells and TSGs exist or genetic instability is involved as a driving force of the mutation pathway. Furthermore, our model shows that if a mutation occurred in stem cells pre-puberty, and formed a field of cells with this mutation through clonal formation of the breast, it is most likely that a tumour will arise from within this area. We then apply different treatment strategies, namely surgery and adjuvant external beam radiotherapy and targeted intraoperative radiotherapy (TARGIT) and use the model to identify different sources of local recurrence and analyse their prevention.

  15. Familial Mediterranean fever with a single MEFV mutation: Where is the second hit?

    PubMed Central

    Booty, Matthew G.; Chae, Jae Jin; Masters, Seth L.; Remmers, Elaine F.; Barham, Beverly; Lee, Julie M.; Barron, Karyl S.; Holland, Steve; Kastner, Daniel L.; Aksentijevich, Ivona

    2009-01-01

    Objective FMF has traditionally been considered an autosomal recessive disease; however, it has been observed that a substantial number of patients with clinical FMF possess only one demonstrable MEFV mutation. Here, an extensive search for a second MEFV mutation was performed in 46 patients clinically diagnosed with FMF and carrying only one high-penetrance FMF mutation. Methods MEFV and other candidate genes were sequenced by standard capillary electrophoresis. The entire 15 kb MEFV genomic region was re-sequenced in 10 patients using a hybridization-based chip technology. MEFV gene expression levels were determined by qRT-PCR and pyrin protein levels were examined by Western blotting. Results A second MEFV mutation was not identified in any of the screened patients. Haplotype analysis did not identify a common haplotype that might be associated with the transmission of a second FMF allele. Western blots did not demonstrate a significant difference in pyrin levels between single and double variant patients; however, FMF patients of both types showed higher protein expression compared to controls and non-FMF patients with active inflammation. Screening of genes encoding pyrin-interacting proteins identified rare variants in a small number of patients, suggesting the possibility of digenic inheritance. Conclusion Our data underscore the existence of a significant subset of FMF patients who are carriers of only one MEFV mutation and demonstrate that complete MEFV sequencing is not likely to yield a second mutation. Screening for the set of most common mutations appears sufficient in the presence of clinical symptoms to diagnose FMF and initiate a trial of colchicine. PMID:19479870

  16. Cryopyrin-associated Periodic Syndrome Caused by a Myeloid-Restricted Somatic NLRP3 Mutation

    PubMed Central

    Zhou, Qing; Aksentijevich, Ivona; Wood, Geryl M.; Walts, Avram D.; Hoffmann, Patrycja; Remmers, Elaine F.; Kastner, Daniel L.; Ombrello, Amanda K.

    2015-01-01

    Objective To identify the cause of disease in an adult patient presenting with recent onset fevers, chills, urticaria, fatigue, and profound myalgia, who was negative for cryopyrin-associated periodic syndrome (CAPS) NLRP3 mutations by conventional Sanger DNA sequencing. Methods We performed whole-exome sequencing and targeted deep sequencing using DNA from the patient’s whole blood to identify a possible NLRP3 somatic mutation. We then screened for this mutation in subcloned NLRP3 amplicons from fibroblasts, buccal cells, granulocytes, negatively-selected monocytes, and T and B lymphocytes and further confirmed the somatic mutation by targeted sequencing of exon 3. Results We identified a previously reported CAPS-associated mutation, p.Tyr570Cys, with a mutant allele frequency of 15% based on exome data. Targeted sequencing and subcloning of NLRP3 amplicons confirmed the presence of the somatic mutation in whole blood at a ratio similar to the exome data. The mutant allele frequency was in the range of 13.3%–16.8% in monocytes and 15.2%–18% in granulocytes; Notably, this mutation was either absent or present at a very low frequency in B and T lymphocytes, buccal cells, and in the patient’s cultured fibroblasts. Conclusion These data document the possibility of myeloid-restricted somatic mosaicism in the pathogenesis of CAPS, underscoring the emerging role of massively-parallel sequencing in clinical diagnosis. PMID:25988971

  17. Bloom syndrome: a mendelian prototype of somatic mutational disease.

    PubMed

    German, J

    1993-11-01

    Spontaneous mutations in human somatic cells occur far more often than normal in individuals with Bloom syndrome. The basis for understanding these mutations and their developmental consequences emerges from examination of BS at the molecular, cellular, and clinical levels. The major clinical feature of BS, proportional dwarfism, as well as its major clinical complication, an exceptionally early emergence of neoplasia of the types and sites that affect the general population, are attributable to the excessive occurrence of mutations in somatic cells. Here, the following aspects of BS are discussed: (i) the BS phenotype; (ii) neoplasia in BS, including the means--the Bloom's Syndrome Registry--by which the significant risk for diverse sites and types of cancer in these patients was revealed; (iii) the biological basis for the cancer proneness of BS; and, finally, (iv) the significance for both basic human biology and clinical medicine of BS as the prototype of somatic mutational disease.

  18. A recurrent 16p12.1 microdeletion suggests a two-hit model for severe developmental delay

    PubMed Central

    Girirajan, Santhosh; Rosenfeld, Jill A.; Cooper, Gregory M.; Antonacci, Francesca; Siswara, Priscillia; Itsara, Andy; Vives, Laura; Walsh, Tom; McCarthy, Shane E.; Baker, Carl; Mefford, Heather C.; Kidd, Jeffrey M.; Browning, Sharon R.; Browning, Brian L.; Dickel, Diane E.; Levy, Deborah L.; Ballif, Blake C.; Platky, Kathryn; Farber, Darren M.; Gowans, Gordon C.; Wetherbee, Jessica J.; Asamoah, Alexander; Weaver, David D.; Mark, Paul R.; Dickerson, Jennifer; Garg, Bhuwan P.; Ellingwood, Sara A.; Smith, Rosemarie; Banks, Valerie C.; Smith, Wendy; McDonald, Marie T.; Hoo, Joe J.; French, Beatrice N.; Hudson, Cindy; Johnson, John P.; Ozmore, Jillian R.; Moeschler, John B.; Surti, Urvashi; Escobar, Luis F.; El-Kechen, Dima; Gorski, Jerome L.; Kussman, Jennifer; Salbert, Bonnie; Lacassie, Yves; Biser, Alisha; McDonald-McGinn, Donna M.; Zackai, Elaine H.; Deardorff, Matthew A.; Shaikh, Tamim H.; Haan, Eric; Friend, Kathryn L.; Fichera, Marco; Romano, Corrado; Gécz, Jozef; deLisi, Lynn E.; Sebat, Jonathan; King, Mary-Claire; Shaffer, Lisa G.; Eichler, Evan E.

    2010-01-01

    We report the identification of a recurrent 520-kbp 16p12.1 microdeletion significantly associated with childhood developmental delay. The microdeletion was detected in 20/11,873 cases vs. 2/8,540 controls (p=0.0009, OR=7.2) and replicated in a second series of 22/9,254 cases vs. 6/6,299 controls (p=0.028, OR=2.5). Most deletions were inherited with carrier parents likely to manifest neuropsychiatric phenotypes (p=0.037, OR=6). Probands were more likely to carry an additional large CNV when compared to matched controls (10/42 cases, p=5.7×10-5, OR=6.65). Clinical features of cases with two mutations were distinct from and/or more severe than clinical features of patients carrying only the co-occurring mutation. Our data suggest a two-hit model in which the 16p12.1 microdeletion both predisposes to neuropsychiatric phenotypes as a single event and exacerbates neurodevelopmental phenotypes in association with other large deletions or duplications. Analysis of other microdeletions with variable expressivity suggests that this two-hit model may be more generally applicable to neuropsychiatric disease. PMID:20154674

  19. Exome-wide Sequencing Shows Low Mutation Rates and Identifies Novel Mutated Genes in Seminomas.

    PubMed

    Cutcutache, Ioana; Suzuki, Yuka; Tan, Iain Beehuat; Ramgopal, Subhashini; Zhang, Shenli; Ramnarayanan, Kalpana; Gan, Anna; Lee, Heng Hong; Tay, Su Ting; Ooi, Aikseng; Ong, Choon Kiat; Bolthouse, Jonathan T; Lane, Brian R; Anema, John G; Kahnoski, Richard J; Tan, Patrick; Teh, Bin Tean; Rozen, Steven G

    2015-07-01

    Testicular germ cell tumors are the most common cancer diagnosed in young men, and seminomas are the most common type of these cancers. There have been no exome-wide examinations of genes mutated in seminomas or of overall rates of nonsilent somatic mutations in these tumors. The objective was to analyze somatic mutations in seminomas to determine which genes are affected and to determine rates of nonsilent mutations. Eight seminomas and matched normal samples were surgically obtained from eight patients. DNA was extracted from tissue samples and exome sequenced on massively parallel Illumina DNA sequencers. Single-nucleotide polymorphism chip-based copy number analysis was also performed to assess copy number alterations. The DNA sequencing read data were analyzed to detect somatic mutations including single-nucleotide substitutions and short insertions and deletions. The detected mutations were validated by independent sequencing and further checked for subclonality. The rate of nonsynonymous somatic mutations averaged 0.31 mutations/Mb. We detected nonsilent somatic mutations in 96 genes that were not previously known to be mutated in seminomas, of which some may be driver mutations. Many of the mutations appear to have been present in subclonal populations. In addition, two genes, KIT and KRAS, were affected in two tumors each with mutations that were previously observed in other cancers and are presumably oncogenic. Our study, the first report on exome sequencing of seminomas, detected somatic mutations in 96 new genes, several of which may be targetable drivers. Furthermore, our results show that seminoma mutation rates are five times higher than previously thought, but are nevertheless low compared to other common cancers. Similar low rates are seen in other cancers that also have excellent rates of remission achieved with chemotherapy. We examined the DNA sequences of seminomas, the most common type of testicular germ cell cancer. Our study identified 96 new genes in which mutations occurred during seminoma development, some of which might contribute to cancer development or progression. The study also showed that the rates of DNA mutations during seminoma development are higher than previously thought, but still lower than for other common solid-organ cancers. Such low rates are also observed among other cancers that, like seminomas, show excellent rates of disease remission after chemotherapy. Copyright © 2015 European Association of Urology. Published by Elsevier B.V. All rights reserved.

  20. Next-Generation Sequencing of Matched Primary and Metastatic Rectal Adenocarcinomas Demonstrates Minimal Mutation Gain and Concordance to Colonic Adenocarcinomas.

    PubMed

    Crumley, Suzanne M; Pepper, Kristi L; Phan, Alexandria T; Olsen, Randall J; Schwartz, Mary R; Portier, Bryce P

    2016-06-01

    -Colorectal carcinoma is the third most common cause of cancer death in males and females in the United States. Rectal adenocarcinoma can have distinct therapeutic and surgical management from colonic adenocarcinoma owing to its location and anatomic considerations. -To determine the oncologic driver mutations and better understand the molecular pathogenesis of rectal adenocarcinoma in relation to colon adenocarcinoma. -Next-generation sequencing was performed on 20 cases of primary rectal adenocarcinoma with a paired lymph node or solid organ metastasis by using an amplicon-based assay of more than 2800 Catalogue of Somatic Mutations in Cancer (COSMIC)-identified somatic mutations. -Next-generation sequencing data were obtained on both the primary tumor and metastasis from 16 patients. Most rectal adenocarcinoma cases demonstrated identical mutations in the primary tumor and metastasis (13 of 16, 81%). The mutations identified, listed in order of frequency, included TP53, KRAS, APC, FBXW7, GNAS, FGFR3, BRAF, NRAS, PIK3CA, and SMAD4. -The somatic mutations identified in our rectal adenocarcinoma cohort showed a strong correlation to those previously characterized in colonic adenocarcinoma. In addition, most rectal adenocarcinomas harbored identical somatic mutations in both the primary tumor and metastasis. These findings demonstrate evidence that rectal adenocarcinoma follows a similar molecular pathogenesis as colonic adenocarcinoma and that sampling either the primary or metastatic lesion is valid for initial evaluation of somatic mutations and selection of possible targeted therapy.

  1. Coherent Somatic Mutation in Autoimmune Disease

    PubMed Central

    Ross, Kenneth Andrew

    2014-01-01

    Background Many aspects of autoimmune disease are not well understood, including the specificities of autoimmune targets, and patterns of co-morbidity and cross-heritability across diseases. Prior work has provided evidence that somatic mutation caused by gene conversion and deletion at segmentally duplicated loci is relevant to several diseases. Simple tandem repeat (STR) sequence is highly mutable, both somatically and in the germ-line, and somatic STR mutations are observed under inflammation. Results Protein-coding genes spanning STRs having markers of mutability, including germ-line variability, high total length, repeat count and/or repeat similarity, are evaluated in the context of autoimmunity. For the initiation of autoimmune disease, antigens whose autoantibodies are the first observed in a disease, termed primary autoantigens, are informative. Three primary autoantigens, thyroid peroxidase (TPO), phogrin (PTPRN2) and filaggrin (FLG), include STRs that are among the eleven longest STRs spanned by protein-coding genes. This association of primary autoantigens with long STR sequence is highly significant (). Long STRs occur within twenty genes that are associated with sixteen common autoimmune diseases and atherosclerosis. The repeat within the TTC34 gene is an outlier in terms of length and a link with systemic lupus erythematosus is proposed. Conclusions The results support the hypothesis that many autoimmune diseases are triggered by immune responses to proteins whose DNA sequence mutates somatically in a coherent, consistent fashion. Other autoimmune diseases may be caused by coherent somatic mutations in immune cells. The coherent somatic mutation hypothesis has the potential to be a comprehensive explanation for the initiation of many autoimmune diseases. PMID:24988487

  2. Emerging patterns of somatic mutations in cancer

    PubMed Central

    Watson, Ian R.; Takahashi, Koichi; Futreal, P. Andrew; Chin, Lynda

    2014-01-01

    The advance in technological tools for massively parallel, high-throughput sequencing of DNA has enabled the comprehensive characterization of somatic mutations in large number of tumor samples. Here, we review recent cancer genomic studies that have assembled emerging views of the landscapes of somatic mutations through deep sequencing analyses of the coding exomes and whole genomes in various cancer types. We discuss the comparative genomics of different cancers, including mutation rates, spectrums, and roles of environmental insults that influence these processes. We highlight the developing statistical approaches used to identify significantly mutated genes, and discuss the emerging biological and clinical insights from such analyses as well as the challenges ahead translating these genomic data into clinical impacts. PMID:24022702

  3. The Genomic Evolution of Prostate Cancer

    DTIC Science & Technology

    2014-10-01

    Mutation characteristics. (a) Number of high-confidence somatic mutations across all foci. Non- silent , non- silent mutations; Unique, number of unique...genes harboring a non- silent mutation; Reported, gene reported to be mutated in references 9–12 and 14. (b) Spectrum of unique high confidence somatic...epigenetic and micr- oRNA-mediated inactivation of LRP1B, a modulator of the extracellular environment of thyroid cancer cells. Oncogene 2011; 30

  4. Brooke-Spiegler syndrome: report of 10 patients from 8 families with novel germline mutations: evidence of diverse somatic mutations in the same patient regardless of tumor type.

    PubMed

    Sima, Radek; Vanecek, Tomas; Kacerovska, Denisa; Trubac, Pavel; Cribier, Bernard; Rutten, Arno; Vazmitel, Marina; Spagnolo, Dominic V; Litvik, Radek; Vantuchova, Yvetta; Weyers, Wolfgang; Pearce, Robert L; Pearn, John; Michal, Michal; Kazakov, Dmitry V

    2010-06-01

    Brooke-Spiegler syndrome (BSS) is an inherited autosomal dominant disease characterized by the development of multiple adnexal cutaneous neoplasms including spiradenoma, cylindroma, spiradenocylindroma, and trichoepithelioma (cribriform trichoblastoma). BSS patients have various mutations in the CYLD gene, a tumor suppressor gene located on chromosome 16q. Our search of the literature revealed 51 germline CYLD mutations reported to date. Somatic CYLD mutations have rarely been investigated. We studied 10 patients from 8 families with BSS. Analysis of germline mutations of the CYLD gene was performed using either peripheral blood or nontumorous tissue. In addition, 19 formalin-fixed paraffin-embedded tumor samples were analyzed for somatic mutations, including loss of heterozygosity studies. A total of 38 tumors were available for histopathologic review. We have identified 8 novel germline mutations, all of which consisted of substitutions, deletions, and insertions/duplications and all except one led to premature stop codons. The substitution mutation in a single case was also predicted to disrupt protein function and seems causally implicated in tumor formation. We demonstrate for the first time that somatic events, loss of heterozygosity, or sequence mutations may differ among multiple neoplasms even of the same histologic type, occurring in the same patient.

  5. Somatic mutations of the histone H3K27 demethylase gene UTX in human cancer.

    PubMed

    van Haaften, Gijs; Dalgliesh, Gillian L; Davies, Helen; Chen, Lina; Bignell, Graham; Greenman, Chris; Edkins, Sarah; Hardy, Claire; O'Meara, Sarah; Teague, Jon; Butler, Adam; Hinton, Jonathan; Latimer, Calli; Andrews, Jenny; Barthorpe, Syd; Beare, Dave; Buck, Gemma; Campbell, Peter J; Cole, Jennifer; Forbes, Simon; Jia, Mingming; Jones, David; Kok, Chai Yin; Leroy, Catherine; Lin, Meng-Lay; McBride, David J; Maddison, Mark; Maquire, Simon; McLay, Kirsten; Menzies, Andrew; Mironenko, Tatiana; Mulderrig, Lee; Mudie, Laura; Pleasance, Erin; Shepherd, Rebecca; Smith, Raffaella; Stebbings, Lucy; Stephens, Philip; Tang, Gurpreet; Tarpey, Patrick S; Turner, Rachel; Turrell, Kelly; Varian, Jennifer; West, Sofie; Widaa, Sara; Wray, Paul; Collins, V Peter; Ichimura, Koichi; Law, Simon; Wong, John; Yuen, Siu Tsan; Leung, Suet Yi; Tonon, Giovanni; DePinho, Ronald A; Tai, Yu-Tzu; Anderson, Kenneth C; Kahnoski, Richard J; Massie, Aaron; Khoo, Sok Kean; Teh, Bin Tean; Stratton, Michael R; Futreal, P Andrew

    2009-05-01

    Somatically acquired epigenetic changes are present in many cancers. Epigenetic regulation is maintained via post-translational modifications of core histones. Here, we describe inactivating somatic mutations in the histone lysine demethylase gene UTX, pointing to histone H3 lysine methylation deregulation in multiple tumor types. UTX reintroduction into cancer cells with inactivating UTX mutations resulted in slowing of proliferation and marked transcriptional changes. These data identify UTX as a new human cancer gene.

  6. Somatic mutations of the histone H3K27 demethylase, UTX, in human cancer

    PubMed Central

    van Haaften, Gijs; Dalgliesh, Gillian L; Davies, Helen; Chen, Lina; Bignell, Graham; Greenman, Chris; Edkins, Sarah; Hardy, Claire; O’Meara, Sarah; Teague, Jon; Butler, Adam; Hinton, Jonathan; Latimer, Calli; Andrews, Jenny; Barthorpe, Syd; Beare, Dave; Buck, Gemma; Campbell, Peter J; Cole, Jennifer; Dunmore, Rebecca; Forbes, Simon; Jia, Mingming; Jones, David; Kok, Chai Yin; Leroy, Catherine; Lin, Meng-Lay; McBride, David J; Maddison, Mark; Maquire, Simon; McLay, Kirsten; Menzies, Andrew; Mironenko, Tatiana; Lee, Mulderrig; Mudie, Laura; Pleasance, Erin; Shepherd, Rebecca; Smith, Raffaella; Stebbings, Lucy; Stephens, Philip; Tang, Gurpreet; Tarpey, Patrick S; Turner, Rachel; Turrell, Kelly; Varian, Jennifer; West, Sofie; Widaa, Sara; Wray, Paul; Collins, V Peter; Ichimura, Koichi; Law, Simon; Wong, John; Yuen, Siu Tsan; Leung, Suet Yi; Tonon, Giovanni; DePinho, Ronald A; Tai, Yu-Tzu; Anderson, Kenneth C; Kahnoski, Richard J.; Massie, Aaron; Khoo, Sok Kean; Teh, Bin Tean; Stratton, Michael R; Futreal, P Andrew

    2010-01-01

    Somatically acquired epigenetic changes are present in many cancers. Epigenetic regulation is maintained via post-translational modifications of core histones. Here, we describe inactivating somatic mutations in the histone lysine demethylase, UTX, pointing to histone H3 lysine methylation deregulation in multiple tumour types. UTX reintroduction into cancer cells with inactivating UTX mutations resulted in slowing of proliferation and marked transcriptional changes. These data identify UTX as a new human cancer gene. PMID:19330029

  7. Whole exome sequencing reveals recurrent mutations in BRCA2 and FAT genes in acinar cell carcinomas of the pancreas.

    PubMed

    Furukawa, Toru; Sakamoto, Hitomi; Takeuchi, Shoko; Ameri, Mitra; Kuboki, Yuko; Yamamoto, Toshiyuki; Hatori, Takashi; Yamamoto, Masakazu; Sugiyama, Masanori; Ohike, Nobuyuki; Yamaguchi, Hiroshi; Shimizu, Michio; Shibata, Noriyuki; Shimizu, Kyoko; Shiratori, Keiko

    2015-03-06

    Acinar cell carcinoma of the pancreas is a rare tumor with a poor prognosis. Compared to pancreatic ductal adenocarcinoma, its molecular features are poorly known. We studied a total of 11 acinar cell carcinomas, including 3 by exome and 4 by target sequencing. Exome sequencing revealed 65 nonsynonymous mutations and 22 indels with a mutation rate of 3.4 mutations/Mb per tumor, on average. By accounting for not only somatic but also germline mutations with loss of the wild-type allele, we identified recurrent mutations of BRCA2 and FAT genes. BRCA2 showed somatic or germline premature termination mutations, with loss of the wild-type allele in 3 of 7 tumors. FAT1, FAT3, and FAT4 showed somatic or germline missense mutations in 4 of 7 tumors. The germline FAT mutations were with loss of the wild-type allele. Loss of BRCA2 expression was observed in 5 of 11 tumors. One patient with a BRCA2-mutated tumor experienced complete remission of liver metastasis following cisplatinum chemotherapy. In conclusion, acinar cell carcinomas show a distinct mutation pattern and often harbor somatic or germline mutations of BRCA2 and FAT genes. This result may warrant assessment of BRCA2 abrogation in patients with the carcinoma to determine their sensitivity to chemotherapy.

  8. TumorNext: A comprehensive tumor profiling assay that incorporates high resolution copy number analysis and germline status to improve testing accuracy

    PubMed Central

    Gray, Phillip N.; Vuong, Huy; Tsai, Pei; Lu, Hsaio-Mei; Mu, Wenbo; Hsuan, Vickie; Hoo, Jayne; Shah, Swati; Uyeda, Lisa; Fox, Susanne; Patel, Harshil; Janicek, Mike; Brown, Sandra; Dobrea, Lavinia; Wagman, Lawrence; Plimack, Elizabeth; Mehra, Ranee; Golemis, Erica A.; Bilusic, Marijo; Zibelman, Matthew; Elliott, Aaron

    2016-01-01

    The development of targeted therapies for both germline and somatic DNA mutations has increased the need for molecular profiling assays to determine the mutational status of specific genes. Moreover, the potential of off-label prescription of targeted therapies favors classifying tumors based on DNA alterations rather than traditional tissue pathology. Here we describe the analytical validation of a custom probe-based NGS tumor panel, TumorNext, which can detect single nucleotide variants, small insertions and deletions in 142 genes that are frequently mutated in somatic and/or germline cancers. TumorNext also detects gene fusions and structural variants, such as tandem duplications and inversions, in 15 frequently disrupted oncogenes and tumor suppressors. The assay uses a matched control and custom bioinformatics pipeline to differentiate between somatic and germline mutations, allowing precise variant classification. We tested 170 previously characterized samples, of which > 95% were formalin-fixed paraffin embedded tissue from 8 different cancer types, and highlight examples where lack of germline status may have led to the inappropriate prescription of therapy. We also describe the validation of the Affymetrix OncoScan platform, an array technology for high resolution copy number variant detection for use in parallel with the NGS panel that can detect single copy amplifications and hemizygous deletions. We analyzed 80 previously characterized formalin-fixed paraffin-embedded specimens and provide examples of hemizygous deletion detection in samples with known pathogenic germline mutations. Thus, the TumorNext combined approach of NGS and OncoScan potentially allows for the identification of the “second hit” in hereditary cancer patients. PMID:27626691

  9. Wide spetcrum mutational analysis of metastatic renal cell cancer: a retrospective next generation sequencing approach

    PubMed Central

    Fiorentino, Michelangelo; Gruppioni, Elisa; Massari, Francesco; Giunchi, Francesca; Altimari, Annalisa; Ciccarese, Chiara; Bimbatti, Davide; Scarpa, Aldo; Iacovelli, Roberto; Porta, Camillo; Virinder, Sarhadi; Tortora, Giampaolo; Artibani, Walter; Schiavina, Riccardo; Ardizzoni, Andrea; Brunelli, Matteo; Knuutila, Sakari; Martignoni, Guido

    2017-01-01

    Renal cell cancer (RCC) is characterized by histological and molecular heterogeneity that may account for variable response to targeted therapies. We evaluated retrospectively with a next generation sequencing (NGS) approach using a pre-designed cancer panel the mutation burden of 32 lesions from 22 metastatic RCC patients treated with at least one tyrosine kinase or mTOR inhibitor. We identified mutations in the VHL, PTEN, JAK3, MET, ERBB4, APC, CDKN2A, FGFR3, EGFR, RB1, TP53 genes. Somatic alterations were correlated with response to therapy. Most mutations hit VHL1 (31,8%) followed by PTEN (13,6%), JAK3, FGFR and TP53 (9% each). Eight (36%) patients were wild-type at least for the genes included in the panel. A genotype concordance between primary RCC and its secondary lesion was found in 3/6 cases. Patients were treated with Sorafenib, Sunitinib and Temsirolimus with partial responses in 4 (18,2%) and disease stabilization in 7 (31,8%). Among the 4 partial responders, 1 (25%) was wild-type and 3 (75%) harbored different VHL1 variants. Among the 7 patients with disease stabilization 2 (29%) were wild-type, 2 (29%) PTEN mutated, and single patients (14% each) displayed mutations in VHL1, JAK3 and APC/CDKN2A. Among the 11 non-responders 7 (64%) were wild-type, 2 (18%) were p53 mutated and 2 (18%) VHL1 mutated. No significant associations were found among RCC histotype, mutation variants and response to therapies. In the absence of predictive biomarkers for metastatic RCC treatment, a NGS approach may address single patients to basket clinical trials according to actionable molecular specific alterations. PMID:27741505

  10. Abnormal Expressions of DNA Glycosylase Genes NEIL1, NEIL2, and NEIL3 Are Associated with Somatic Mutation Loads in Human Cancer.

    PubMed

    Shinmura, Kazuya; Kato, Hisami; Kawanishi, Yuichi; Igarashi, Hisaki; Goto, Masanori; Tao, Hong; Inoue, Yusuke; Nakamura, Satoki; Misawa, Kiyoshi; Mineta, Hiroyuki; Sugimura, Haruhiko

    2016-01-01

    The effects of abnormalities in the DNA glycosylases NEIL1, NEIL2, and NEIL3 on human cancer have not been fully elucidated. In this paper, we found that the median somatic total mutation loads and the median somatic single nucleotide mutation loads exhibited significant inverse correlations with the median NEIL1 and NEIL2 expression levels and a significant positive correlation with the median NEIL3 expression level using data for 13 cancer types from the Cancer Genome Atlas (TCGA) database. A subset of the cancer types exhibited reduced NEIL1 and NEIL2 expressions and elevated NEIL3 expression, and such abnormal expressions of NEIL1, NEIL2, and NEIL3 were also significantly associated with the mutation loads in cancer. As a mechanism underlying the reduced expression of NEIL1 in cancer, the epigenetic silencing of NEIL1 through promoter hypermethylation was found. Finally, we investigated the reason why an elevated NEIL3 expression level was associated with an increased number of somatic mutations in cancer and found that NEIL3 expression was positively correlated with the expression of APOBEC3B, a potent inducer of mutations, in diverse cancers. These results suggested that the abnormal expressions of NEIL1, NEIL2, and NEIL3 are involved in cancer through their association with the somatic mutation load.

  11. Brief Report: Cryopyrin-Associated Periodic Syndrome Caused by a Myeloid-Restricted Somatic NLRP3 Mutation.

    PubMed

    Zhou, Qing; Aksentijevich, Ivona; Wood, Geryl M; Walts, Avram D; Hoffmann, Patrycja; Remmers, Elaine F; Kastner, Daniel L; Ombrello, Amanda K

    2015-09-01

    To identify the cause of disease in an adult patient presenting with recent-onset fevers, chills, urticaria, fatigue, and profound myalgia, who was found to be negative for cryopyrin-associated periodic syndrome (CAPS) NLRP3 mutations by conventional Sanger DNA sequencing. We performed whole-exome sequencing and targeted deep sequencing using DNA from the patient's whole blood to identify a possible NLRP3 somatic mutation. We then screened for this mutation in subcloned NLRP3 amplicons from fibroblasts, buccal cells, granulocytes, negatively selected monocytes, and T and B lymphocytes and further confirmed the somatic mutation by targeted sequencing of exon 3. We identified a previously reported CAPS-associated mutation, p.Tyr570Cys, with a mutant allele frequency of 15% based on exome data. Targeted sequencing and subcloning of NLRP3 amplicons confirmed the presence of the somatic mutation in whole blood at a ratio similar to the exome data. The mutant allele frequency was in the range of 13.3-16.8% in monocytes and 15.2-18% in granulocytes. Notably, this mutation was either absent or present at a very low frequency in B and T lymphocytes, in buccal cells, and in the patient's cultured fibroblasts. Our findings indicate the possibility of myeloid-restricted somatic mosaicism in the pathogenesis of CAPS, underscoring the emerging role of massively parallel sequencing in clinical diagnosis. Published 2015. This article is a U.S. Government work and is in the public domain in the USA.

  12. Activating HER2 mutations in HER2 gene amplification negative breast cancer.

    PubMed

    Bose, Ron; Kavuri, Shyam M; Searleman, Adam C; Shen, Wei; Shen, Dong; Koboldt, Daniel C; Monsey, John; Goel, Nicholas; Aronson, Adam B; Li, Shunqiang; Ma, Cynthia X; Ding, Li; Mardis, Elaine R; Ellis, Matthew J

    2013-02-01

    Data from 8 breast cancer genome-sequencing projects identified 25 patients with HER2 somatic mutations in cancers lacking HER2 gene amplification. To determine the phenotype of these mutations, we functionally characterized 13 HER2 mutations using in vitro kinase assays, protein structure analysis, cell culture, and xenograft experiments. Seven of these mutations are activating mutations, including G309A, D769H, D769Y, V777L, P780ins, V842I, and R896C. HER2 in-frame deletion 755-759, which is homologous to EGF receptor (EGFR) exon 19 in-frame deletions, had a neomorphic phenotype with increased phosphorylation of EGFR or HER3. L755S produced lapatinib resistance, but was not an activating mutation in our experimental systems. All of these mutations were sensitive to the irreversible kinase inhibitor, neratinib. These findings show that HER2 somatic mutation is an alternative mechanism to activate HER2 in breast cancer and they validate HER2 somatic mutations as drug targets for breast cancer treatment. We show that the majority of HER2 somatic mutations in breast cancer patients are activating mutations that likely drive tumorigenesis. Several patients had mutations that are resistant to the reversible HER2 inhibitor lapatinib, but are sensitive to the irreversible HER2 inhibitor, neratinib. Our results suggest that patients with HER2 mutation–positive breast cancers could benefit from existing HER2-targeted drugs.

  13. Rare transformation to double hit lymphoma in Waldenstrom's macroglobulinemia.

    PubMed

    Okolo, Onyemaechi N; Johnson, Ariel C; Yun, Seongseok; Arnold, Stacy J; Anwer, Faiz

    2017-08-01

    Waldenström macroglobulinemia (WM) is a lymphoproliferative lymphoma that is characterized by monoclonal immunoglobulin M (IgM) protein and bone marrow infiltration. Its incidence is rare and rarer still is its ability to transform to a B-cell lymphoma, particularly the aggressive diffuse large B-cell lymphoma, which bodes a poor prognosis. When transformation includes mutations of MYC, BCL-2 and/or BCL-6, it is known as a 'double hit' or 'triple hit' lymphoma respectively. This paper presents a rare case of WM with mutations positive for MYC and BCL2, making it a case of double hit B-cell lymphoplasmacytic lymphoma with plasmatic differentiation without morphological transformation to aggressive histology like DLBCL. The paper also broadens to include discussions on current topics in the classification, diagnosis, possible causes of transformation, and treatment of WM, including transformation to double hit lymphoma. The significance of this case lies in that the presence of double hit lymphoma-like genetic mutations in WM have not been previously described in the literature and potentially such changes are harbinger of extra-nodal presentation, aggressive growth, and possibly poor prognosis, if data from other double-hit lymphoma are extrapolated.

  14. Paternal Somatic Mosaicism of a Novel Frameshift Mutation in ELANE Causing Severe Congenital Neutropenia.

    PubMed

    Kim, Hee-Jung; Song, Min-Jung; Lee, Ki-O; Kim, Sun-Hee; Kim, Hee-Jin

    2015-12-01

    Severe congenital neutropenia (SCN) is a bone marrow failure disease with an autosomal dominant inheritance from mutations in ELANE. Here, we report a 7-week-old Korean male with SCN. His elder sister died from pneumonia at 2 years. Direct sequencing of ELANE in the proband identified a heterozygous novel frameshift mutation: c.658delC (p.Arg220Glyfs20*). Family study involving his asymptomatic parents with normal cell counts revealed that his father had the same mutation, but at a lower burden than expected in a typical heterozygous state. Further molecular investigation demonstrated somatic mosaicism with ~18% mutant alleles. We concluded the proband inherited the mutation from his somatic mosaic father. © 2015 Wiley Periodicals, Inc.

  15. Genetic analysis of microglandular adenosis and acinic cell carcinomas of the breast provides evidence for the existence of a low-grade triple-negative breast neoplasia family.

    PubMed

    Geyer, Felipe C; Berman, Samuel H; Marchiò, Caterina; Burke, Kathleen A; Guerini-Rocco, Elena; Piscuoglio, Salvatore; Ng, Charlotte Ky; Pareja, Fresia; Wen, Hannah Y; Hodi, Zoltan; Schnitt, Stuart J; Rakha, Emad A; Ellis, Ian O; Norton, Larry; Weigelt, Britta; Reis-Filho, Jorge S

    2017-01-01

    Acinic cell carcinoma is an indolent form of invasive breast cancer, whereas microglandular adenosis has been shown to be a neoplastic proliferation. Both entities display a triple-negative phenotype, and may give rise to and display somatic genomic alterations typical of high-grade triple-negative breast cancers. Here we report on a comparison of previously published data on eight carcinoma-associated microglandular adenosis and eight acinic cell carcinomas subjected to targeted massively parallel sequencing targeting all exons of 236 genes recurrently mutated in breast cancer and/or DNA repair-related. Somatic mutations, insertions/ deletions, and copy number alterations were detected using state-of-the-art bioinformatic algorithms. All cases were of triple-negative phenotype. A median of 4.5 (1-13) and 4.0 (1-7) non-synonymous somatic mutations per carcinoma-associated microglandular adenosis and acinic cell carcinoma were identified, respectively. TP53 was the sole highly recurrently mutated gene (75% in microglandular adenosis versus 88% in acinic cell carcinomas), and TP53 mutations were consistently coupled with loss of heterozygosity of the wild-type allele. Additional somatic mutations shared by both groups included those in BRCA1, PIK3CA, and INPP4B. Recurrent (n=2) somatic mutations restricted to microglandular adenosis or acinic cell carcinomas included those affecting PTEN and MED12 or ERBB4, respectively. No significant differences in the repertoire of somatic mutations were detected between microglandular adenosis and acinic cell carcinomas, and between this group of lesions and 77 triple-negative carcinomas from The Cancer Genome Atlas. Microglandular adenosis and acinic cell carcinomas, however, were genetically distinct from estrogen receptor-positive and/or HER2-positive breast cancers from The Cancer Genome Atlas. Our findings support the contention that microglandular adenosis and acinic cell carcinoma are part of the same spectrum of lesions harboring frequent TP53 somatic mutations, and likely represent low-grade forms of triple-negative disease with no/minimal metastatic potential, of which a subset has the potential to progress to high-grade triple-negative breast cancer.

  16. Genetic Analysis of Microglandular Adenosis and Acinic Cell Carcinomas of the Breast Provides Evidence for the Existence of a Low-grade Triple-Negative Breast Neoplasia Family

    PubMed Central

    Geyer, Felipe C; Berman, Samuel H.; Marchiò, Caterina; Burke, Kathleen A; Guerini-Rocco, Elena; Piscuoglio, Salvatore; Ng, Charlotte K Y; Pareja, Fresia; Wen, Hannah Y; Hodi, Zoltan; Schnitt, Stuart J; Rakha, Emad A; Ellis, Ian O; Norton, Larry; Weigelt, Britta; Reis-Filho, Jorge S

    2016-01-01

    Acinic cell carcinoma is an indolent form of invasive breast cancer, whereas microglandular adenosis has been shown to be a neoplastic proliferation. Both entities display a triple-negative phenotype, and may give rise to and display somatic genomic alterations typical of high-grade triple-negative breast cancers. Here we report on a comparison of previously published data on eight carcinoma-associated microglandular adenosis and eight acinic cell carcinomas subjected to targeted massively parallel sequencing targeting all exons of 236 genes recurrently mutated in breast cancer and/or DNA repair-related. Somatic mutations, insertions/deletions and copy number alterations were detected using state-of-the-art bioinformatic algorithms. All cases were of triple-negative phenotype. A median of 4.5 (1–13) and 4.0 (1–7) non-synonymous somatic mutations per carcinoma-associated microglandular adenosis and acinic cell carcinoma were identified, respectively. TP53 was the sole highly recurrently mutated gene (75% in microglandular adenosis versus 88% in acinic cell carcinomas), and TP53 mutations were consistently coupled with loss of heterozygosity of the wild-type allele. Additional somatic mutations shared by both groups included those in BRCA1, PIK3CA and INPP4B. Recurrent (n=2) somatic mutations restricted to microglandular adenosis or acinic cell carcinomas included those affecting PTEN and MED12, or ERBB4, respectively. No significant differences in the repertoire of somatic mutations were detected between microglandular adenosis and acinic cell carcinomas, and between this group of lesions and 77 triple-negative carcinomas from The Cancer Genome Atlas. Microglandular adenosis and acinic cell carcinomas, however, were genetically distinct from estrogen receptor-positive and/or HER2-positive breast cancers from The Cancer Genome Atlas. Our findings support the contention that microglandular adenosis and acinic cell carcinoma are part of the same spectrum of lesions harboring frequent TP53 somatic mutations, and likely represent low-grade forms of triple-negative disease with no/minimal metastatic potential, of which a subset has the potential to progress to high-grade triple-negative breast cancer. PMID:27713419

  17. Deep sequencing detects very-low-grade somatic mosaicism in the unaffected mother of siblings with nemaline myopathy.

    PubMed

    Miyatake, Satoko; Koshimizu, Eriko; Hayashi, Yukiko K; Miya, Kazushi; Shiina, Masaaki; Nakashima, Mitsuko; Tsurusaki, Yoshinori; Miyake, Noriko; Saitsu, Hirotomo; Ogata, Kazuhiro; Nishino, Ichizo; Matsumoto, Naomichi

    2014-07-01

    When an expected mutation in a particular disease-causing gene is not identified in a suspected carrier, it is usually assumed to be due to germline mosaicism. We report here very-low-grade somatic mosaicism in ACTA1 in an unaffected mother of two siblings affected with a neonatal form of nemaline myopathy. The mosaicism was detected by deep resequencing using a next-generation sequencer. We identified a novel heterozygous mutation in ACTA1, c.448A>G (p.Thr150Ala), in the affected siblings. Three-dimensional structural modeling suggested that this mutation may affect polymerization and/or actin's interactions with other proteins. In this family, we expected autosomal dominant inheritance with either parent demonstrating germline or somatic mosaicism. Sanger sequencing identified no mutation. However, further deep resequencing of this mutation on a next-generation sequencer identified very-low-grade somatic mosaicism in the mother: 0.4%, 1.1%, and 8.3% in the saliva, blood leukocytes, and nails, respectively. Our study demonstrates the possibility of very-low-grade somatic mosaicism in suspected carriers, rather than germline mosaicism. Copyright © 2014 Elsevier B.V. All rights reserved.

  18. Variation of mutational burden in healthy human tissues suggests non-random strand segregation and allows measuring somatic mutation rates.

    PubMed

    Werner, Benjamin; Sottoriva, Andrea

    2018-06-01

    The immortal strand hypothesis poses that stem cells could produce differentiated progeny while conserving the original template strand, thus avoiding accumulating somatic mutations. However, quantitating the extent of non-random DNA strand segregation in human stem cells remains difficult in vivo. Here we show that the change of the mean and variance of the mutational burden with age in healthy human tissues allows estimating strand segregation probabilities and somatic mutation rates. We analysed deep sequencing data from healthy human colon, small intestine, liver, skin and brain. We found highly effective non-random DNA strand segregation in all adult tissues (mean strand segregation probability: 0.98, standard error bounds (0.97,0.99)). In contrast, non-random strand segregation efficiency is reduced to 0.87 (0.78,0.88) in neural tissue during early development, suggesting stem cell pool expansions due to symmetric self-renewal. Healthy somatic mutation rates differed across tissue types, ranging from 3.5 × 10-9/bp/division in small intestine to 1.6 × 10-7/bp/division in skin.

  19. Somatic mutations affect key pathways in lung adenocarcinoma

    PubMed Central

    Ding, Li; Getz, Gad; Wheeler, David A.; Mardis, Elaine R.; McLellan, Michael D.; Cibulskis, Kristian; Sougnez, Carrie; Greulich, Heidi; Muzny, Donna M.; Morgan, Margaret B.; Fulton, Lucinda; Fulton, Robert S.; Zhang, Qunyuan; Wendl, Michael C.; Lawrence, Michael S.; Larson, David E.; Chen, Ken; Dooling, David J.; Sabo, Aniko; Hawes, Alicia C.; Shen, Hua; Jhangiani, Shalini N.; Lewis, Lora R.; Hall, Otis; Zhu, Yiming; Mathew, Tittu; Ren, Yanru; Yao, Jiqiang; Scherer, Steven E.; Clerc, Kerstin; Metcalf, Ginger A.; Ng, Brian; Milosavljevic, Aleksandar; Gonzalez-Garay, Manuel L.; Osborne, John R.; Meyer, Rick; Shi, Xiaoqi; Tang, Yuzhu; Koboldt, Daniel C.; Lin, Ling; Abbott, Rachel; Miner, Tracie L.; Pohl, Craig; Fewell, Ginger; Haipek, Carrie; Schmidt, Heather; Dunford-Shore, Brian H.; Kraja, Aldi; Crosby, Seth D.; Sawyer, Christopher S.; Vickery, Tammi; Sander, Sacha; Robinson, Jody; Winckler, Wendy; Baldwin, Jennifer; Chirieac, Lucian R.; Dutt, Amit; Fennell, Tim; Hanna, Megan; Johnson, Bruce E.; Onofrio, Robert C.; Thomas, Roman K.; Tonon, Giovanni; Weir, Barbara A.; Zhao, Xiaojun; Ziaugra, Liuda; Zody, Michael C.; Giordano, Thomas; Orringer, Mark B.; Roth, Jack A.; Spitz, Margaret R.; Wistuba, Ignacio I.; Ozenberger, Bradley; Good, Peter J.; Chang, Andrew C.; Beer, David G.; Watson, Mark A.; Ladanyi, Marc; Broderick, Stephen; Yoshizawa, Akihiko; Travis, William D.; Pao, William; Province, Michael A.; Weinstock, George M.; Varmus, Harold E.; Gabriel, Stacey B.; Lander, Eric S.; Gibbs, Richard A.; Meyerson, Matthew; Wilson, Richard K.

    2009-01-01

    Determining the genetic basis of cancer requires comprehensive analyses of large collections of histopathologically well-classified primary tumours. Here we report the results of a collaborative study to discover somatic mutations in 188 human lung adenocarcinomas. DNA sequencing of 623 genes with known or potential relationships to cancer revealed more than 1,000 somatic mutations across the samples. Our analysis identified 26 genes that are mutated at significantly high frequencies and thus are probably involved in carcinogenesis. The frequently mutated genes include tyrosine kinases, among them the EGFR homologue ERBB4; multiple ephrin receptor genes, notably EPHA3; vascular endothelial growth factor receptor KDR; and NTRK genes. These data provide evidence of somatic mutations in primary lung adenocarcinoma for several tumour suppressor genes involved in other cancers—including NF1, APC, RB1 and ATM—and for sequence changes in PTPRD as well as the frequently deleted gene LRP1B. The observed mutational profiles correlate with clinical features, smoking status and DNA repair defects. These results are reinforced by data integration including single nucleotide polymorphism array and gene expression array. Our findings shed further light on several important signalling pathways involved in lung adenocarcinoma, and suggest new molecular targets for treatment. PMID:18948947

  20. Whole-exome sequencing identifies novel MPL and JAK2 mutations in triple-negative myeloproliferative neoplasms

    PubMed Central

    Milosevic Feenstra, Jelena D.; Nivarthi, Harini; Gisslinger, Heinz; Leroy, Emilie; Rumi, Elisa; Chachoua, Ilyas; Bagienski, Klaudia; Kubesova, Blanka; Pietra, Daniela; Gisslinger, Bettina; Milanesi, Chiara; Jäger, Roland; Chen, Doris; Berg, Tiina; Schalling, Martin; Schuster, Michael; Bock, Christoph; Constantinescu, Stefan N.; Cazzola, Mario

    2016-01-01

    Essential thrombocythemia (ET) and primary myelofibrosis (PMF) are chronic diseases characterized by clonal hematopoiesis and hyperproliferation of terminally differentiated myeloid cells. The disease is driven by somatic mutations in exon 9 of CALR or exon 10 of MPL or JAK2-V617F in >90% of the cases, whereas the remaining cases are termed “triple negative.” We aimed to identify the disease-causing mutations in the triple-negative cases of ET and PMF by applying whole-exome sequencing (WES) on paired tumor and control samples from 8 patients. We found evidence of clonal hematopoiesis in 5 of 8 studied cases based on clonality analysis and presence of somatic genetic aberrations. WES identified somatic mutations in 3 of 8 cases. We did not detect any novel recurrent somatic mutations. In 3 patients with clonal hematopoiesis analyzed by WES, we identified a somatic MPL-S204P, a germline MPL-V285E mutation, and a germline JAK2-G571S variant. We performed Sanger sequencing of the entire coding region of MPL in 62, and of JAK2 in 49 additional triple-negative cases of ET or PMF. New somatic (T119I, S204F, E230G, Y591D) and 1 germline (R321W) MPL mutation were detected. All of the identified MPL mutations were gain-of-function when analyzed in functional assays. JAK2 variants were identified in 5 of 57 triple-negative cases analyzed by WES and Sanger sequencing combined. We could demonstrate that JAK2-V625F and JAK2-F556V are gain-of-function mutations. Our results suggest that triple-negative cases of ET and PMF do not represent a homogenous disease entity. Cases with polyclonal hematopoiesis might represent hereditary disorders. PMID:26423830

  1. Whole-exome sequencing identifies novel MPL and JAK2 mutations in triple-negative myeloproliferative neoplasms.

    PubMed

    Milosevic Feenstra, Jelena D; Nivarthi, Harini; Gisslinger, Heinz; Leroy, Emilie; Rumi, Elisa; Chachoua, Ilyas; Bagienski, Klaudia; Kubesova, Blanka; Pietra, Daniela; Gisslinger, Bettina; Milanesi, Chiara; Jäger, Roland; Chen, Doris; Berg, Tiina; Schalling, Martin; Schuster, Michael; Bock, Christoph; Constantinescu, Stefan N; Cazzola, Mario; Kralovics, Robert

    2016-01-21

    Essential thrombocythemia (ET) and primary myelofibrosis (PMF) are chronic diseases characterized by clonal hematopoiesis and hyperproliferation of terminally differentiated myeloid cells. The disease is driven by somatic mutations in exon 9 of CALR or exon 10 of MPL or JAK2-V617F in >90% of the cases, whereas the remaining cases are termed "triple negative." We aimed to identify the disease-causing mutations in the triple-negative cases of ET and PMF by applying whole-exome sequencing (WES) on paired tumor and control samples from 8 patients. We found evidence of clonal hematopoiesis in 5 of 8 studied cases based on clonality analysis and presence of somatic genetic aberrations. WES identified somatic mutations in 3 of 8 cases. We did not detect any novel recurrent somatic mutations. In 3 patients with clonal hematopoiesis analyzed by WES, we identified a somatic MPL-S204P, a germline MPL-V285E mutation, and a germline JAK2-G571S variant. We performed Sanger sequencing of the entire coding region of MPL in 62, and of JAK2 in 49 additional triple-negative cases of ET or PMF. New somatic (T119I, S204F, E230G, Y591D) and 1 germline (R321W) MPL mutation were detected. All of the identified MPL mutations were gain-of-function when analyzed in functional assays. JAK2 variants were identified in 5 of 57 triple-negative cases analyzed by WES and Sanger sequencing combined. We could demonstrate that JAK2-V625F and JAK2-F556V are gain-of-function mutations. Our results suggest that triple-negative cases of ET and PMF do not represent a homogenous disease entity. Cases with polyclonal hematopoiesis might represent hereditary disorders. © 2016 by The American Society of Hematology.

  2. Intersection of diverse neuronal genomes and neuropsychiatric disease: The Brain Somatic Mosaicism Network.

    PubMed

    McConnell, Michael J; Moran, John V; Abyzov, Alexej; Akbarian, Schahram; Bae, Taejeong; Cortes-Ciriano, Isidro; Erwin, Jennifer A; Fasching, Liana; Flasch, Diane A; Freed, Donald; Ganz, Javier; Jaffe, Andrew E; Kwan, Kenneth Y; Kwon, Minseok; Lodato, Michael A; Mills, Ryan E; Paquola, Apua C M; Rodin, Rachel E; Rosenbluh, Chaggai; Sestan, Nenad; Sherman, Maxwell A; Shin, Joo Heon; Song, Saera; Straub, Richard E; Thorpe, Jeremy; Weinberger, Daniel R; Urban, Alexander E; Zhou, Bo; Gage, Fred H; Lehner, Thomas; Senthil, Geetha; Walsh, Christopher A; Chess, Andrew; Courchesne, Eric; Gleeson, Joseph G; Kidd, Jeffrey M; Park, Peter J; Pevsner, Jonathan; Vaccarino, Flora M

    2017-04-28

    Neuropsychiatric disorders have a complex genetic architecture. Human genetic population-based studies have identified numerous heritable sequence and structural genomic variants associated with susceptibility to neuropsychiatric disease. However, these germline variants do not fully account for disease risk. During brain development, progenitor cells undergo billions of cell divisions to generate the ~80 billion neurons in the brain. The failure to accurately repair DNA damage arising during replication, transcription, and cellular metabolism amid this dramatic cellular expansion can lead to somatic mutations. Somatic mutations that alter subsets of neuronal transcriptomes and proteomes can, in turn, affect cell proliferation and survival and lead to neurodevelopmental disorders. The long life span of individual neurons and the direct relationship between neural circuits and behavior suggest that somatic mutations in small populations of neurons can significantly affect individual neurodevelopment. The Brain Somatic Mosaicism Network has been founded to study somatic mosaicism both in neurotypical human brains and in the context of complex neuropsychiatric disorders. Copyright © 2017, American Association for the Advancement of Science.

  3. Global Characterization of Protein Altering Mutations in Prostate Cancer

    DTIC Science & Technology

    2011-08-01

    prevalence of candidate cancer genes observed here in prostate cancer. (3) Perform integrative analyses of somatic mutation with gene expression and copy...analyses of somatic mutation with gene expression and copy number change data collected on the same samples. Body This is a “synergy” project between...However, to perform initial verification/validation studies, we have evaluated the mutation calls for several genes discovered initially by the

  4. Oncodomains: A protein domain-centric framework for analyzing rare variants in tumor samples

    PubMed Central

    Peterson, Thomas A.; Park, Junyong

    2017-01-01

    The fight against cancer is hindered by its highly heterogeneous nature. Genome-wide sequencing studies have shown that individual malignancies contain many mutations that range from those commonly found in tumor genomes to rare somatic variants present only in a small fraction of lesions. Such rare somatic variants dominate the landscape of genomic mutations in cancer, yet efforts to correlate somatic mutations found in one or few individuals with functional roles have been largely unsuccessful. Traditional methods for identifying somatic variants that drive cancer are ‘gene-centric’ in that they consider only somatic variants within a particular gene and make no comparison to other similar genes in the same family that may play a similar role in cancer. In this work, we present oncodomain hotspots, a new ‘domain-centric’ method for identifying clusters of somatic mutations across entire gene families using protein domain models. Our analysis confirms that our approach creates a framework for leveraging structural and functional information encapsulated by protein domains into the analysis of somatic variants in cancer, enabling the assessment of even rare somatic variants by comparison to similar genes. Our results reveal a vast landscape of somatic variants that act at the level of domain families altering pathways known to be involved with cancer such as protein phosphorylation, signaling, gene regulation, and cell metabolism. Due to oncodomain hotspots’ unique ability to assess rare variants, we expect our method to become an important tool for the analysis of sequenced tumor genomes, complementing existing methods. PMID:28426665

  5. The landscape of cancer genes and mutational processes in breast cancer

    PubMed Central

    Stephens, Philip J.; Tarpey, Patrick S.; Davies, Helen; Loo, Peter Van; Greenman, Chris; Wedge, David C.; Nik-Zainal, Serena; Martin, Sancha; Varela, Ignacio; Bignell, Graham R.; Yates, Lucy R.; Papaemmanuil, Elli; Beare, David; Butler, Adam; Cheverton, Angela; Gamble, John; Hinton, Jonathan; Jia, Mingming; Jayakumar, Alagu; Jones, David; Latimer, Calli; Lau, King Wai; McLaren, Stuart; McBride, David J.; Menzies, Andrew; Mudie, Laura; Raine, Keiran; Rad, Roland; Chapman, Michael Spencer; Teague, Jon; Easton, Douglas; Langerød, Anita; OSBREAC; Lee, Ming Ta Michael; Shen, Chen-Yang; Tee, Benita Tan Kiat; Huimin, Bernice Wong; Broeks, Annegien; Vargas, Ana Cristina; Turashvili, Gulisa; Martens, John; Fatima, Aquila; Miron, Penelope; Chin, Suet-Feung; Thomas, Gilles; Boyault, Sandrine; Mariani, Odette; Lakhani, Sunil R.; van de Vijver, Marc; van ’t Veer, Laura; Foekens, John; Desmedt, Christine; Sotiriou, Christos; Tutt, Andrew; Caldas, Carlos; Reis-Filho, Jorge S.; Aparicio, Samuel A. J. R.; Salomon, Anne Vincent; Børresen-Dale, Anne-Lise; Richardson, Andrea L.; Campbell, Peter J.; Futreal, P. Andrew; Stratton, Michael R.

    2012-01-01

    All cancers carry somatic mutations in their genomes. A subset, known as driver mutations, confer clonal selective advantage on cancer cells and are causally implicated in oncogenesis1, and the remainder are passenger mutations. The driver mutations and mutational processes operative in breast cancer have not yet been comprehensively explored. Here we examine the genomes of 100 tumours for somatic copy number changes and mutations in the coding exons of protein-coding genes. The number of somatic mutations varied markedly between individual tumours. We found strong correlations between mutation number, age at which cancer was diagnosed and cancer histological grade, and observed multiple mutational signatures, including one present in about ten per cent of tumours characterized by numerous mutations of cytosine at TpC dinucleotides. Driver mutations were identified in several new cancer genes including AKT2, ARID1B, CASP8, CDKN1B, MAP3K1, MAP3K13, NCOR1, SMARCD1 and TBX3. Among the 100 tumours, we found driver mutations in at least 40 cancer genes and 73 different combinations of mutated cancer genes. The results highlight the substantial genetic diversity underlying this common disease. PMID:22722201

  6. Accurate clinical genetic testing for autoinflammatory diseases using the next-generation sequencing platform MiSeq.

    PubMed

    Nakayama, Manabu; Oda, Hirotsugu; Nakagawa, Kenji; Yasumi, Takahiro; Kawai, Tomoki; Izawa, Kazushi; Nishikomori, Ryuta; Heike, Toshio; Ohara, Osamu

    2017-03-01

    Autoinflammatory diseases occupy one of a group of primary immunodeficiency diseases that are generally thought to be caused by mutation of genes responsible for innate immunity, rather than by acquired immunity. Mutations related to autoinflammatory diseases occur in 12 genes. For example, low-level somatic mosaic NLRP3 mutations underlie chronic infantile neurologic, cutaneous, articular syndrome (CINCA), also known as neonatal-onset multisystem inflammatory disease (NOMID). In current clinical practice, clinical genetic testing plays an important role in providing patients with quick, definite diagnoses. To increase the availability of such testing, low-cost high-throughput gene-analysis systems are required, ones that not only have the sensitivity to detect even low-level somatic mosaic mutations, but also can operate simply in a clinical setting. To this end, we developed a simple method that employs two-step tailed PCR and an NGS system, MiSeq platform, to detect mutations in all coding exons of the 12 genes responsible for autoinflammatory diseases. Using this amplicon sequencing system, we amplified a total of 234 amplicons derived from the 12 genes with multiplex PCR. This was done simultaneously and in one test tube. Each sample was distinguished by an index sequence of second PCR primers following PCR amplification. With our procedure and tips for reducing PCR amplification bias, we were able to analyze 12 genes from 25 clinical samples in one MiSeq run. Moreover, with the certified primers designed by our short program-which detects and avoids common SNPs in gene-specific PCR primers-we used this system for routine genetic testing. Our optimized procedure uses a simple protocol, which can easily be followed by virtually any office medical staff. Because of the small PCR amplification bias, we can analyze simultaneously several clinical DNA samples with low cost and can obtain sufficient read numbers to detect a low level of somatic mosaic mutations.

  7. Mutational pattern of the nurse shark antigen receptor gene (NAR) is similar to that of mammalian Ig genes and to spontaneous mutations in evolution: the translesion synthesis model of somatic hypermutation.

    PubMed

    Diaz, M; Velez, J; Singh, M; Cerny, J; Flajnik, M F

    1999-05-01

    The pattern of somatic mutations of shark and frog Ig is distinct from somatic hypermutation of Ig in mammals in that there is a bias to mutate GC base pairs and a low frequency of mutations. Previous analysis of the new antigen receptor gene in nurse sharks (NAR), however, revealed no bias to mutate GC base pairs and the frequency of mutation was comparable to that of mammalian IgG. Here, we analyzed 1023 mutations in NAR and found no targeting of the mechanism to any particular nucleotide but did obtain strong evidence for a transition bias and for strand polarity. As seen for all species studied to date, the serine codon AGC/T in NAR was a mutational hotspot. The NAR mutational pattern is most similar to that of mammalian IgG and furthermore both are strikingly akin to mutations acquired during the neutral evolution of nuclear pseudogenes, suggesting that a similar mechanism is at work for both processes. In yeast, most spontaneous mutations are introduced by the translesion synthesis DNA polymerase zeta (REV3) and in various DNA repair-deficient backgrounds transitions were more often REV3-dependent than were transversions. Therefore, we propose a model of somatic hypermutation where DNA polymerase zeta is recruited to the Ig locus. An excess of DNA glycosylases in germinal center reactions may further enhance the mutation frequency by a REV3-dependent mutagenic process known as imbalanced base excision repair.

  8. Activating HER2 mutations in HER2 gene amplification negative breast cancer

    PubMed Central

    Bose, Ron; Kavuri, Shyam M.; Searleman, Adam C.; Shen, Wei; Shen, Dong; Koboldt, Daniel C.; Monsey, John; Goel, Nicholas; Aronson, Adam B.; Li, Shunqiang; Ma, Cynthia X.; Ding, Li; Mardis, Elaine R.; Ellis, Matthew J.

    2012-01-01

    Data from eight breast cancer genome sequencing projects identified 25 patients with HER2 somatic mutations in cancers lacking HER2 gene amplification. To determine the phenotype of these mutations, we functionally characterized thirteen HER2 mutations using in vitro kinase assays, protein structure analysis, cell culture and xenograft experiments. Seven of these mutations are activating mutations, including G309A, D769H, D769Y, V777L, P780ins, V842I, and R896C. HER2 in-frame deletion 755-759, which is homologous to EGFR exon 19 in-frame deletions, had a neomorphic phenotype with increased phosphorylation of EGFR or HER3. L755S produced lapatinib resistance, but was not an activating mutation in our experimental systems. All of these mutations were sensitive to the irreversible kinase inhibitor, neratinib. These findings demonstrate that HER2 somatic mutation is an alternative mechanism to activate HER2 in breast cancer and they validate HER2 somatic mutations as drug targets for breast cancer treatment. PMID:23220880

  9. Advances in computational approaches for prioritizing driver mutations and significantly mutated genes in cancer genomes.

    PubMed

    Cheng, Feixiong; Zhao, Junfei; Zhao, Zhongming

    2016-07-01

    Cancer is often driven by the accumulation of genetic alterations, including single nucleotide variants, small insertions or deletions, gene fusions, copy-number variations, and large chromosomal rearrangements. Recent advances in next-generation sequencing technologies have helped investigators generate massive amounts of cancer genomic data and catalog somatic mutations in both common and rare cancer types. So far, the somatic mutation landscapes and signatures of >10 major cancer types have been reported; however, pinpointing driver mutations and cancer genes from millions of available cancer somatic mutations remains a monumental challenge. To tackle this important task, many methods and computational tools have been developed during the past several years and, thus, a review of its advances is urgently needed. Here, we first summarize the main features of these methods and tools for whole-exome, whole-genome and whole-transcriptome sequencing data. Then, we discuss major challenges like tumor intra-heterogeneity, tumor sample saturation and functionality of synonymous mutations in cancer, all of which may result in false-positive discoveries. Finally, we highlight new directions in studying regulatory roles of noncoding somatic mutations and quantitatively measuring circulating tumor DNA in cancer. This review may help investigators find an appropriate tool for detecting potential driver or actionable mutations in rapidly emerging precision cancer medicine. © The Author 2015. Published by Oxford University Press. For Permissions, please email: journals.permissions@oup.com.

  10. Global Characterization of Protein Altering Mutations in Prostate Cancer

    DTIC Science & Technology

    2011-08-01

    integrative analyses of somatic mutation with gene expression and copy number change data collected on the same samples. To date, we have performed...implications for resistance to cancer therapeutics. We have also identified a subset of genes that appear to be recurrently mutated in our discovery set, and...integrative analyses of somatic mutation with gene expression and copy number change data collected on the same samples. Body This is a “synergy” project

  11. Cancer Modeling: From Optimal Cell Renewal to Immunotherapy

    NASA Astrophysics Data System (ADS)

    Alvarado Alvarado, Cesar Leonardo

    Cancer is a disease caused by mutations in normal cells. According to the National Cancer Institute, in 2016, an estimated 1.6 million people were diagnosed and approximately 0.5 million people died from the disease in the United States. There are many factors that shape cancer at the cellular and organismal level, including genetic, immunological, and environmental components. In this thesis, we show how mathematical modeling can be used to provide insight into some of the key mechanisms underlying cancer dynamics. First, we use mathematical modeling to investigate optimal homeostatic cell renewal in tissues such as the small intestine with an emphasis on division patterns and tissue architecture. We find that the division patterns that delay the accumulation of mutations are strictly associated with the population sizes of the tissue. In particular, patterns with long chains of differentiation delay the time to observe a second-hit mutant, which is important given that for many cancers two mutations are enough to initiate a tumor. We also investigated homeostatic cell renewal under a selective pressure and find that hierarchically organized tissues act as suppressors of selection; we find that an architecture with a small number of stem cells and larger pools of transit amplifying cells and mature differentiated cells, together with long chains of differentiation, form a robust evolutionary strategy to delay the time to observe a second-hit mutant when mutations acquire a fitness advantage or disadvantage. We also formulate a model of the immune response to cancer in the presence of costimulatory and inhibitory signals. We demonstrate that the coordination of such signals is crucial to initiate an effective immune response, and while immunotherapy has become a promising cancer treatment over the past decade, these results offer some explanations for why it can fail.

  12. SDHAF2 mutations in familial and sporadic paraganglioma and phaeochromocytoma.

    PubMed

    Bayley, Jean-Pierre; Kunst, Henricus P M; Cascon, Alberto; Sampietro, Maria Lourdes; Gaal, José; Korpershoek, Esther; Hinojar-Gutierrez, Adolfo; Timmers, Henri J L M; Hoefsloot, Lies H; Hermsen, Mario A; Suárez, Carlos; Hussain, A Karim; Vriends, Annette H J T; Hes, Frederik J; Jansen, Jeroen C; Tops, Carli M; Corssmit, Eleonora P; de Knijff, Peter; Lenders, Jacques W M; Cremers, Cor W R J; Devilee, Peter; Dinjens, Winand N M; de Krijger, Ronald R; Robledo, Mercedes

    2010-04-01

    Paragangliomas and phaeochromocytomas are neuroendocrine tumours associated frequently with germline mutations of SDHD, SDHC, and SDHB. Previous studies have shown the imprinted SDHAF2 gene to be mutated in a large Dutch kindred with paragangliomas. We aimed to identify SDHAF2 mutation carriers, assess the clinical genetic significance of SDHAF2, and describe the associated clinical phenotype. We undertook a multicentre study in Spain and The Netherlands in 443 apparently sporadic patients with paragangliomas and phaeochromocytomas who did not have mutations in SDHD, SDHC, or SDHB. We analysed DNA of 315 patients for germline mutations of SDHAF2; a subset (n=200) was investigated for gross gene deletions. DNA from a group of 128 tumours was studied for somatic mutations. We also examined a Spanish family with head and neck paragangliomas with a young age of onset for the presence of SDHAF2 mutations, undertook haplotype analysis in this kindred, and assessed their clinical phenotype. We did not identify any germline or somatic mutations of SDHAF2, and no gross gene deletions were noted in the subset of apparently sporadic patients analysed. Investigation of the Spanish family identified a pathogenic germline DNA mutation of SDHAF2, 232G-->A (Gly78Arg), identical to the Dutch kindred. SDHAF2 mutations do not have an important role in phaeochromocytoma and are rare in head and neck paraganglioma. Identification of a second family with the Gly78Arg mutation suggests that this is a crucial residue for the function of SDHAF2. We conclude that SDHAF2 mutation analysis is justified in very young patients with isolated head and neck paraganglioma without mutations in SDHD, SDHC, or SDHB, and in individuals with familial antecedents who are negative for mutations in all other risk genes. Dutch Cancer Society, European Union 6th Framework Program, Fondo Investigaciones Sanitarias, Fundación Mutua Madrileña, and Red Temática de Investigación Cooperativa en Cáncer. 2010 Elsevier Ltd. All rights reserved.

  13. Somatic mutations in salivary duct carcinoma and potential therapeutic targets

    PubMed Central

    Smith, Joel A.; Clarke, Angus J.; Luk, Peter P.; Selinger, Christina I.; Mahon, Kate L.; Kraitsek, Spiridoula; Palme, Carsten; Boyer, Michael J.; Dinger, Marcel E.; Cowley, Mark J.; O’Toole, Sandra A.

    2017-01-01

    Background Salivary duct carcinomas (SDCa) are rare highly aggressive malignancies. Most patients die from distant metastatic disease within three years of diagnosis. There are limited therapeutic options for disseminated disease. Results 11 cases showed androgen receptor expression and 6 cases showed HER2 amplification. 6 Somatic mutations with additional available targeted therapies were identified: EGFR (p.G721A: Gefitinib), PDGFRA (p.H845Y: Imatinib and Crenolanib), PIK3CA (p.H1047R: Everolimus), ERBB2 (p.V842I: Lapatinib), HRAS (p.Q61R: Selumetinib) and KIT (p.T670I: Sorafenib). Furthermore, alterations in PTEN, PIK3CA and HRAS that alter response to androgen deprivation therapy and HER2 inhibition were also seen. Materials and Methods Somatic mutation analysis was performed on DNA extracted from 15 archival cases of SDCa using the targeted Illumina TruSeq Amplicon Cancer Panel. Potential targetable genetic alterations were identified using extensive literature and international somatic mutation database (COSMIC, KEGG) search. Immunohistochemistry for androgen receptor and immunohistochemistry and fluorescent in situ hybridization for HER2 were also performed. Conclusions SDCa show multiple somatic mutations, some that are amenable to pharmacologic manipulation and others that confer resistance to treatments currently under investigation. These findings emphasize the need to develop testing and treatment strategies for SDCa. PMID:29100278

  14. Flaws in the LNT single-hit model for cancer risk: An historical assessment.

    PubMed

    Calabrese, Edward J

    2017-10-01

    The LNT single-hit model was derived from the Nobel Prize-winning research of Herman J. Muller who showed that x-rays could induce gene mutations in Drosophila and that the dose response for these so-called mutational events was linear. Lewis J. Stadler, another well-known and respected geneticist at the time, strongly disagreed with and challenged Muller's claims. Detailed evaluations by Stadler over a prolonged series of investigations revealed that Muller's experiments had induced gross heritable chromosomal damage instead of specific gene mutations as had been claimed by Muller at his Nobel Lecture. These X-ray-induced alterations became progressively more frequent and were of larger magnitude (more destructive) with increasing doses. Thus, Muller's claim of having induced discrete gene mutations represented a substantial speculative overreach and was, in fact, without proof. The post hoc arguments of Muller to support his gene mutation hypothesis were significantly challenged and weakened by a series of new findings in the areas of cytogenetics, reverse mutation, adaptive and repair processes, and modern molecular methods for estimating induced genetic damage. These findings represented critical and substantial limitations to Muller's hypothesis of X-ray-induced gene mutations. Furthermore, they challenged the scientific foundations used in support of the LNT single-hit model by severing the logical nexus between Muller's data on radiation-induced inheritable alterations and the LNT single-hit model. These findings exposed fundamental scientific flaws that undermined not only the seminal recommendation of the 1956 BEAR I Genetics Panel to adopt the LNT single-hit Model for risk assessment but also any rationale for its continued use in the present day. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. Stochastic modeling indicates that aging and somatic evolution in the hematopoetic system are driven by non-cell-autonomous processes.

    PubMed

    Rozhok, Andrii I; Salstrom, Jennifer L; DeGregori, James

    2014-12-01

    Age-dependent tissue decline and increased cancer incidence are widely accepted to be rate-limited by the accumulation of somatic mutations over time. Current models of carcinogenesis are dominated by the assumption that oncogenic mutations have defined advantageous fitness effects on recipient stem and progenitor cells, promoting and rate-limiting somatic evolution. However, this assumption is markedly discrepant with evolutionary theory, whereby fitness is a dynamic property of a phenotype imposed upon and widely modulated by environment. We computationally modeled dynamic microenvironment-dependent fitness alterations in hematopoietic stem cells (HSC) within the Sprengel-Liebig system known to govern evolution at the population level. Our model for the first time integrates real data on age-dependent dynamics of HSC division rates, pool size, and accumulation of genetic changes and demonstrates that somatic evolution is not rate-limited by the occurrence of mutations, but instead results from aged microenvironment-driven alterations in the selective/fitness value of previously accumulated genetic changes. Our results are also consistent with evolutionary models of aging and thus oppose both somatic mutation-centric paradigms of carcinogenesis and tissue functional decline. In total, we demonstrate that aging directly promotes HSC fitness decline and somatic evolution via non-cell-autonomous mechanisms.

  16. Resolving rates of mutation in the brain using single-neuron genomics

    PubMed Central

    Evrony, Gilad D; Lee, Eunjung; Park, Peter J; Walsh, Christopher A

    2016-01-01

    Whether somatic mutations contribute functional diversity to brain cells is a long-standing question. Single-neuron genomics enables direct measurement of somatic mutation rates in human brain and promises to answer this question. A recent study (Upton et al., 2015) reported high rates of somatic LINE-1 element (L1) retrotransposition in the hippocampus and cerebral cortex that would have major implications for normal brain function, and suggested that these events preferentially impact genes important for neuronal function. We identify aspects of the single-cell sequencing approach, bioinformatic analysis, and validation methods that led to thousands of artifacts being interpreted as somatic mutation events. Our reanalysis supports a mutation frequency of approximately 0.2 events per cell, which is about fifty-fold lower than reported, confirming that L1 elements mobilize in some human neurons but indicating that L1 mosaicism is not ubiquitous. Through consideration of the challenges identified, we provide a foundation and framework for designing single-cell genomics studies. DOI: http://dx.doi.org/10.7554/eLife.12966.001 PMID:26901440

  17. Genetic features of myelodysplastic syndrome and aplastic anemia in pediatric and young adult patients

    PubMed Central

    Keel, Siobán B.; Scott, Angela; Sanchez-Bonilla, Marilyn; Ho, Phoenix A.; Gulsuner, Suleyman; Pritchard, Colin C.; Abkowitz, Janis L.; King, Mary-Claire; Walsh, Tom; Shimamura, Akiko

    2016-01-01

    The clinical and histopathological distinctions between inherited versus acquired bone marrow failure and myelodysplastic syndromes are challenging. The identification of inherited bone marrow failure/myelodysplastic syndromes is critical to inform appropriate clinical management. To investigate whether a subset of pediatric and young adults undergoing transplant for aplastic anemia or myelodysplastic syndrome have germline mutations in bone marrow failure/myelodysplastic syndrome genes, we performed a targeted genetic screen of samples obtained between 1990–2012 from children and young adults with aplastic anemia or myelodysplastic syndrome transplanted at the Fred Hutchinson Cancer Research Center. Mutations in inherited bone marrow failure/myelodysplastic syndrome genes were found in 5.1% (5/98) of aplastic anemia patients and 13.6% (15/110) of myelodysplastic syndrome patients. While the majority of mutations were constitutional, a RUNX1 mutation present in the peripheral blood at a 51% variant allele fraction was confirmed to be somatically acquired in one myelodysplastic syndrome patient. This highlights the importance of distinguishing germline versus somatic mutations by sequencing DNA from a second tissue or from parents. Pathological mutations were present in DKC1, MPL, and TP53 among the aplastic anemia cohort, and in FANCA, GATA2, MPL, RTEL1, RUNX1, SBDS, TERT, TINF2, and TP53 among the myelodysplastic syndrome cohort. Family history or physical examination failed to reliably predict the presence of germline mutations. This study shows that while any single specific bone marrow failure/myelodysplastic syndrome genetic disorder is rare, screening for these disorders in aggregate identifies a significant subset of patients with inherited bone marrow failure/myelodysplastic syndrome. PMID:27418648

  18. A Gene Gravity Model for the Evolution of Cancer Genomes: A Study of 3,000 Cancer Genomes across 9 Cancer Types.

    PubMed

    Cheng, Feixiong; Liu, Chuang; Lin, Chen-Ching; Zhao, Junfei; Jia, Peilin; Li, Wen-Hsiung; Zhao, Zhongming

    2015-09-01

    Cancer development and progression result from somatic evolution by an accumulation of genomic alterations. The effects of those alterations on the fitness of somatic cells lead to evolutionary adaptations such as increased cell proliferation, angiogenesis, and altered anticancer drug responses. However, there are few general mathematical models to quantitatively examine how perturbations of a single gene shape subsequent evolution of the cancer genome. In this study, we proposed the gene gravity model to study the evolution of cancer genomes by incorporating the genome-wide transcription and somatic mutation profiles of ~3,000 tumors across 9 cancer types from The Cancer Genome Atlas into a broad gene network. We found that somatic mutations of a cancer driver gene may drive cancer genome evolution by inducing mutations in other genes. This functional consequence is often generated by the combined effect of genetic and epigenetic (e.g., chromatin regulation) alterations. By quantifying cancer genome evolution using the gene gravity model, we identified six putative cancer genes (AHNAK, COL11A1, DDX3X, FAT4, STAG2, and SYNE1). The tumor genomes harboring the nonsynonymous somatic mutations in these genes had a higher mutation density at the genome level compared to the wild-type groups. Furthermore, we provided statistical evidence that hypermutation of cancer driver genes on inactive X chromosomes is a general feature in female cancer genomes. In summary, this study sheds light on the functional consequences and evolutionary characteristics of somatic mutations during tumorigenesis by propelling adaptive cancer genome evolution, which would provide new perspectives for cancer research and therapeutics.

  19. A Gene Gravity Model for the Evolution of Cancer Genomes: A Study of 3,000 Cancer Genomes across 9 Cancer Types

    PubMed Central

    Lin, Chen-Ching; Zhao, Junfei; Jia, Peilin; Li, Wen-Hsiung; Zhao, Zhongming

    2015-01-01

    Cancer development and progression result from somatic evolution by an accumulation of genomic alterations. The effects of those alterations on the fitness of somatic cells lead to evolutionary adaptations such as increased cell proliferation, angiogenesis, and altered anticancer drug responses. However, there are few general mathematical models to quantitatively examine how perturbations of a single gene shape subsequent evolution of the cancer genome. In this study, we proposed the gene gravity model to study the evolution of cancer genomes by incorporating the genome-wide transcription and somatic mutation profiles of ~3,000 tumors across 9 cancer types from The Cancer Genome Atlas into a broad gene network. We found that somatic mutations of a cancer driver gene may drive cancer genome evolution by inducing mutations in other genes. This functional consequence is often generated by the combined effect of genetic and epigenetic (e.g., chromatin regulation) alterations. By quantifying cancer genome evolution using the gene gravity model, we identified six putative cancer genes (AHNAK, COL11A1, DDX3X, FAT4, STAG2, and SYNE1). The tumor genomes harboring the nonsynonymous somatic mutations in these genes had a higher mutation density at the genome level compared to the wild-type groups. Furthermore, we provided statistical evidence that hypermutation of cancer driver genes on inactive X chromosomes is a general feature in female cancer genomes. In summary, this study sheds light on the functional consequences and evolutionary characteristics of somatic mutations during tumorigenesis by propelling adaptive cancer genome evolution, which would provide new perspectives for cancer research and therapeutics. PMID:26352260

  20. Somatic mutations contribute to genotypic diversity in sterile and fertile populations of the threatened shrub, Grevillea rhizomatosa (Proteaceae).

    PubMed

    Gross, C L; Nelson, Penelope A; Haddadchi, Azadeh; Fatemi, Mohammad

    2012-02-01

    Grevillea rhizomatosa is a spreading shrub which exhibits multiple breeding strategies within a narrow area in the fire-prone heathlands of eastern Australia. Reproductive strategies include self-compatibility, self-incompatibility and clonality (with and without sterility). The close proximity of contrasting breeding systems provides an opportunity to explore the evolution of sterility and to compare and contrast the origins of genotypic diversity (recombinant or somatic) against degrees of sexual expression. ISSR markers for 120 band positions (putative loci) were used to compare genetic diversity among five populations at a macro-scale of 5 m between samples (n = 244 shrubs), and at a micro-scale of nearest neighbours for all plants in five 25-m(2) quadrats with contrasting fertilities (n = 162 shrubs). Nearest-neighbour sampling included several clusters of connected ramets. Matrix incompatibility (MIC) analyses were used to evaluate the relative contribution of recombination and somatic mutation to genotype diversity. High levels of genotypic diversity were found in all populations regardless of fertilities (fertile populations, G/N ≥ 0·94; sterile populations, G/N ≥ 0·97) and most sterile populations had a unique genetic profile. Somatic mutations were detected along connected ramets in ten out of 42 ramet clusters. MIC analyses showed that somatic mutations have contributed to diversity in all populations and particularly so in sterile populations. Somatic mutations contribute significantly to gene diversity in sterile populations of Grevillea rhizomatosa, the accumulation of which is the likely cause of male and female sterility. High levels of genetic diversity therefore may not always be synonymous with sexual fitness and genetic health. We hypothesize that frequent fires drive selection for clonal reproduction, at the cost of flowering such that sexual functions are not maintained through selection, and the build-up of somatic mutations in meristems results in high genotype diversity at the cost of pollen and ovule fertilities.

  1. Spliceosomal gene aberrations are rare, coexist with oncogenic mutations, and are unlikely to exert a driver effect in childhood MDS and JMML.

    PubMed

    Hirabayashi, Shinsuke; Flotho, Christian; Moetter, Jessica; Heuser, Michael; Hasle, Henrik; Gruhn, Bernd; Klingebiel, Thomas; Thol, Felicitas; Schlegelberger, Brigitte; Baumann, Irith; Strahm, Brigitte; Stary, Jan; Locatelli, Franco; Zecca, Marco; Bergstraesser, Eva; Dworzak, Michael; van den Heuvel-Eibrink, Marry M; De Moerloose, Barbara; Ogawa, Seishi; Niemeyer, Charlotte M; Wlodarski, Marcin W

    2012-03-15

    Somatic mutations of the spliceosomal machinery occur frequently in adult patients with myelodysplastic syndrome (MDS). We resequenced SF3B1, U2AF35, and SRSF2 in 371 children with MDS or juvenile myelomonocytic leukemia. We found missense mutations in 2 juvenile myelomonocytic leukemia cases and in 1 child with systemic mastocytosis with MDS. In 1 juvenile myelomonocytic leukemia patient, the SRSF2 mutation that initially coexisted with an oncogenic NRAS mutation was absent at relapse, whereas the NRAS mutation persisted and a second, concomitant NRAS mutation later emerged. The patient with systemic mastocytosis and MDS carried both mutated U2AF35 and KIT in a single clone as confirmed by clonal sequencing. In the adult MDS patients sequenced for control purposes, we detected previously reported mutations in 7/30 and a novel SRSF2 deletion (c.284_307del) in 3 of 30 patients. These findings implicate that spliceosome mutations are rare in pediatric MDS and juvenile myelomonocytic leukemia and are unlikely to operate as driver mutations.

  2. Somatic profiling of the epidermal growth factor receptor pathway in tumours from patients with advanced colorectal cancer, treated with chemotherapy ± cetuximab

    PubMed Central

    Smith, Christopher G.; Fisher, David; Claes, Bart; Maughan, Timothy S.; Idziaszczyk, Shelley; Peuteman, Gilian; Harris, Rebecca; James, Michelle D.; Meade, Angela; Jasani, Bharat; Adams, Richard A.; Kenny, Sarah; Kaplan, Richard; Lambrechts, Diether; Cheadle, Jeremy P.

    2013-01-01

    Purpose To study the somatic molecular profile of the epidermal growth factor receptor (EGFR) pathway in advanced CRC (aCRC), its relationship to prognosis, the site of the primary and metastases, and response to cetuximab. Experimental Design We used Sequenom and Pyrosequencing for high-throughput somatic profiling the EGFR pathway in 1,976 tumours from patients with aCRC from the COIN trial (oxaliplatin and fluoropyrimidine chemotherapy ±cetuximab). Correlations between mutations, clinico-pathological, response and survival data were carried out. Results Sequenom and Pyrosequencing had 99.0% (9961/10063) genotype concordance. We identified thirteen different KRAS mutations in 42.3% of aCRCs, two BRAF mutations in 9.0%, four NRAS mutations in 3.6% and five PIK3CA mutations in 12.7%. 4.2% of aCRCs had microsatellite instability (MSI). KRAS and PIK3CA exon 9, but not exon 20, mutations co-occurred (P=8.9×10−4) as did MSI and BRAF mutations (P=5.3×10−10). KRAS mutations were associated with right colon cancers (P=5.2×10−5) and BRAF mutations with right (P=7.2×10−5) and transverse colon (P=9.8×10−6) cancers. KRAS mutations were associated with lung-only metastases (P=2.3×10−4), BRAF mutations with peritoneal (P=9.2×10−4) and nodal-only (P=3.7×10−5) metastases, and MSI (BRAFWT) with nodal-only metastases (P=2.9×10−4). MSI (BRAFWT) was associated with worse survival (HR=1.89, 95% CI 1.30-2.76, P=8.5×10−4). No mutations, subsets of mutations, or MSI-status were associated with response to cetuximab. Conclusions Our data support a functional co-operation between KRAS and PIK3CA in colorectal tumourigenesis and link somatic profiles to the sites of metastases. MSI was associated with poor prognosis in advanced disease, and no individual somatic profile was associated with response to cetuximab in COIN. PMID:23741067

  3. The effect of age at exposure on the inactivating mechanisms and relative contributions of key tumor suppressor genes in radiation-induced mouse T-cell lymphomas.

    PubMed

    Sunaoshi, Masaaki; Amasaki, Yoshiko; Hirano-Sakairi, Shinobu; Blyth, Benjamin J; Morioka, Takamitsu; Kaminishi, Mutsumi; Shang, Yi; Nishimura, Mayumi; Shimada, Yoshiya; Tachibana, Akira; Kakinuma, Shizuko

    2015-09-01

    Children are considered more sensitive to radiation-induced cancer than adults, yet any differences in genomic alterations associated with age-at-exposure and their underlying mechanisms remain unclear. We assessed genome-wide DNA copy number and mutation of key tumor suppressor genes in T-cell lymphomas arising after weekly irradiation of female B6C3F1 mice with 1.2Gy X-rays for 4 consecutive weeks starting during infancy (1 week old), adolescence (4 weeks old) or as young adults (8 weeks old). Although T-cell lymphoma incidence was similar, loss of heterozygosity at Cdkn2a on chromosome 4 and at Ikaros on chromosome 11 was more frequent in the two older groups, while loss at the Pten locus on chromosome 19 was more frequent in the infant-irradiated group. Cdkn2a and Ikaros mutation/loss was a common feature of the young adult-irradiation group, with Ikaros frequently (50%) incurring multiple independent hits (including deletions and mutations) or suffering a single hit predicted to result in a dominant negative protein (such as those lacking exon 4, an isoform we have designated Ik12, which lacks two DNA binding zinc-finger domains). Conversely, Pten mutations were more frequent after early irradiation (60%) than after young adult-irradiation (30%). Homozygous Pten mutations occurred without DNA copy number change after irradiation starting in infancy, suggesting duplication of the mutated allele by chromosome mis-segregation or mitotic recombination. Our findings demonstrate that while deletions on chromosomes 4 and 11 affecting Cdkn2a and Ikaros are a prominent feature of young adult irradiation-induced T-cell lymphoma, tumors arising after irradiation from infancy suffer a second hit in Pten by mis-segregation or recombination. This is the first report showing an influence of age-at-exposure on genomic alterations of tumor suppressor genes and their relative involvement in radiation-induced T-cell lymphoma. These data are important for considering the risks associated with childhood exposure to radiation. Copyright © 2015 Elsevier B.V. All rights reserved.

  4. Discovery and prioritization of somatic mutations in diffuse large B-cell lymphoma (DLBCL) by whole-exome sequencing

    PubMed Central

    Lohr, Jens G.; Stojanov, Petar; Lawrence, Michael S.; Auclair, Daniel; Chapuy, Bjoern; Sougnez, Carrie; Cruz-Gordillo, Peter; Knoechel, Birgit; Asmann, Yan W.; Slager, Susan L.; Novak, Anne J.; Dogan, Ahmet; Ansell, Stephen M.; Zou, Lihua; Gould, Joshua; Saksena, Gordon; Stransky, Nicolas; Rangel-Escareño, Claudia; Fernandez-Lopez, Juan Carlos; Hidalgo-Miranda, Alfredo; Melendez-Zajgla, Jorge; Hernández-Lemus, Enrique; Schwarz-Cruz y Celis, Angela; Imaz-Rosshandler, Ivan; Ojesina, Akinyemi I.; Jung, Joonil; Pedamallu, Chandra S.; Lander, Eric S.; Habermann, Thomas M.; Cerhan, James R.; Shipp, Margaret A.; Getz, Gad; Golub, Todd R.

    2012-01-01

    To gain insight into the genomic basis of diffuse large B-cell lymphoma (DLBCL), we performed massively parallel whole-exome sequencing of 55 primary tumor samples from patients with DLBCL and matched normal tissue. We identified recurrent mutations in genes that are well known to be functionally relevant in DLBCL, including MYD88, CARD11, EZH2, and CREBBP. We also identified somatic mutations in genes for which a functional role in DLBCL has not been previously suspected. These genes include MEF2B, MLL2, BTG1, GNA13, ACTB, P2RY8, PCLO, and TNFRSF14. Further, we show that BCL2 mutations commonly occur in patients with BCL2/IgH rearrangements as a result of somatic hypermutation normally occurring at the IgH locus. The BCL2 point mutations are primarily synonymous, and likely caused by activation-induced cytidine deaminase–mediated somatic hypermutation, as shown by comprehensive analysis of enrichment of mutations in WRCY target motifs. Those nonsynonymous mutations that are observed tend to be found outside of the functionally important BH domains of the protein, suggesting that strong negative selection against BCL2 loss-of-function mutations is at play. Last, by using an algorithm designed to identify likely functionally relevant but infrequent mutations, we identify KRAS, BRAF, and NOTCH1 as likely drivers of DLBCL pathogenesis in some patients. Our data provide an unbiased view of the landscape of mutations in DLBCL, and this in turn may point toward new therapeutic strategies for the disease. PMID:22343534

  5. Mutational Signatures in Cancer (MuSiCa): a web application to implement mutational signatures analysis in cancer samples.

    PubMed

    Díaz-Gay, Marcos; Vila-Casadesús, Maria; Franch-Expósito, Sebastià; Hernández-Illán, Eva; Lozano, Juan José; Castellví-Bel, Sergi

    2018-06-14

    Mutational signatures have been proved as a valuable pattern in somatic genomics, mainly regarding cancer, with a potential application as a biomarker in clinical practice. Up to now, several bioinformatic packages to address this topic have been developed in different languages/platforms. MutationalPatterns has arisen as the most efficient tool for the comparison with the signatures currently reported in the Catalogue of Somatic Mutations in Cancer (COSMIC) database. However, the analysis of mutational signatures is nowadays restricted to a small community of bioinformatic experts. In this work we present Mutational Signatures in Cancer (MuSiCa), a new web tool based on MutationalPatterns and built using the Shiny framework in R language. By means of a simple interface suited to non-specialized researchers, it provides a comprehensive analysis of the somatic mutational status of the supplied cancer samples. It permits characterizing the profile and burden of mutations, as well as quantifying COSMIC-reported mutational signatures. It also allows classifying samples according to the above signature contributions. MuSiCa is a helpful web application to characterize mutational signatures in cancer samples. It is accessible online at http://bioinfo.ciberehd.org/GPtoCRC/en/tools.html and source code is freely available at https://github.com/marcos-diazg/musica .

  6. Evolutionary origins of germline segregation in Metazoa: evidence for a germ stem cell lineage in the coral Orbicella faveolata (Cnidaria, Anthozoa).

    PubMed

    Barfield, Sarah; Aglyamova, Galina V; Matz, Mikhail V

    2016-01-13

    The ability to segregate a committed germ stem cell (GSC) lineage distinct from somatic cell lineages is a characteristic of bilaterian Metazoans. However, the occurrence of GSC lineage specification in basally branching Metazoan phyla, such as Cnidaria, is uncertain. Without an independently segregated GSC lineage, germ cells and their precursors must be specified throughout adulthood from continuously dividing somatic stem cells, generating the risk of propagating somatic mutations within the individual and its gametes. To address the potential for existence of a GSC lineage in Anthozoa, the sister-group to all remaining Cnidaria, we identified moderate- to high-frequency somatic mutations and their potential for gametic transfer in the long-lived coral Orbicella faveolata (Anthozoa, Cnidaria) using a 2b-RAD sequencing approach. Our results demonstrate that somatic mutations can drift to high frequencies (up to 50%) and can also generate substantial intracolonial genetic diversity. However, these somatic mutations are not transferable to gametes, signifying the potential for an independently segregated GSC lineage in O. faveolata. In conjunction with previous research on germ cell development in other basally branching Metazoan species, our results suggest that the GSC system may be a Eumetazoan characteristic that evolved in association with the emergence of greater complexity in animal body plan organization and greater specificity of stem cell functions. © 2016 The Author(s).

  7. Evolutionary origins of germline segregation in Metazoa: evidence for a germ stem cell lineage in the coral Orbicella faveolata (Cnidaria, Anthozoa)

    PubMed Central

    Barfield, Sarah; Aglyamova, Galina V.; Matz, Mikhail V.

    2016-01-01

    The ability to segregate a committed germ stem cell (GSC) lineage distinct from somatic cell lineages is a characteristic of bilaterian Metazoans. However, the occurrence of GSC lineage specification in basally branching Metazoan phyla, such as Cnidaria, is uncertain. Without an independently segregated GSC lineage, germ cells and their precursors must be specified throughout adulthood from continuously dividing somatic stem cells, generating the risk of propagating somatic mutations within the individual and its gametes. To address the potential for existence of a GSC lineage in Anthozoa, the sister-group to all remaining Cnidaria, we identified moderate- to high-frequency somatic mutations and their potential for gametic transfer in the long-lived coral Orbicella faveolata (Anthozoa, Cnidaria) using a 2b-RAD sequencing approach. Our results demonstrate that somatic mutations can drift to high frequencies (up to 50%) and can also generate substantial intracolonial genetic diversity. However, these somatic mutations are not transferable to gametes, signifying the potential for an independently segregated GSC lineage in O. faveolata. In conjunction with previous research on germ cell development in other basally branching Metazoan species, our results suggest that the GSC system may be a Eumetazoan characteristic that evolved in association with the emergence of greater complexity in animal body plan organization and greater specificity of stem cell functions. PMID:26763699

  8. Simultaneous Identification of Multiple Driver Pathways in Cancer

    PubMed Central

    Leiserson, Mark D. M.; Blokh, Dima

    2013-01-01

    Distinguishing the somatic mutations responsible for cancer (driver mutations) from random, passenger mutations is a key challenge in cancer genomics. Driver mutations generally target cellular signaling and regulatory pathways consisting of multiple genes. This heterogeneity complicates the identification of driver mutations by their recurrence across samples, as different combinations of mutations in driver pathways are observed in different samples. We introduce the Multi-Dendrix algorithm for the simultaneous identification of multiple driver pathways de novo in somatic mutation data from a cohort of cancer samples. The algorithm relies on two combinatorial properties of mutations in a driver pathway: high coverage and mutual exclusivity. We derive an integer linear program that finds set of mutations exhibiting these properties. We apply Multi-Dendrix to somatic mutations from glioblastoma, breast cancer, and lung cancer samples. Multi-Dendrix identifies sets of mutations in genes that overlap with known pathways – including Rb, p53, PI(3)K, and cell cycle pathways – and also novel sets of mutually exclusive mutations, including mutations in several transcription factors or other genes involved in transcriptional regulation. These sets are discovered directly from mutation data with no prior knowledge of pathways or gene interactions. We show that Multi-Dendrix outperforms other algorithms for identifying combinations of mutations and is also orders of magnitude faster on genome-scale data. Software available at: http://compbio.cs.brown.edu/software. PMID:23717195

  9. A somatic T15091C mutation in the Cytb gene of mouse mitochondrial DNA dominantly induces respiration defects.

    PubMed

    Hayashi, Chisato; Takibuchi, Gaku; Shimizu, Akinori; Mito, Takayuki; Ishikawa, Kaori; Nakada, Kazuto; Hayashi, Jun-Ichi

    2015-08-07

    Our previous studies provided evidence that mammalian mitochondrial DNA (mtDNA) mutations that cause mitochondrial respiration defects behave in a recessive manner, because the induction of respiration defects could be prevented with the help of a small proportion (10%-20%) of mtDNA without the mutations. However, subsequent studies found the induction of respiration defects by the accelerated accumulation of a small proportion of mtDNA with various somatic mutations, indicating the presence of mtDNA mutations that behave in a dominant manner. Here, to provide the evidence for the presence of dominant mutations in mtDNA, we used mouse lung carcinoma P29 cells and examined whether some mtDNA molecules possess somatic mutations that dominantly induce respiration defects. Cloning and sequence analysis of 40-48 mtDNA molecules from P29 cells was carried out to screen for somatic mutations in protein-coding genes, because mutations in these genes could dominantly regulate respiration defects by formation of abnormal polypeptides. We found 108 missense mutations existing in one or more of 40-48 mtDNA molecules. Of these missense mutations, a T15091C mutation in the Cytb gene was expected to be pathogenic due to the presence of its orthologous mutation in mtDNA from a patient with cardiomyopathy. After isolation of many subclones from parental P29 cells, we obtained subclones with various proportions of T15091C mtDNA, and showed that the respiration defects were induced in a subclone with only 49% T15091C mtDNA. Because the induction of respiration defects could not be prevented with the help of the remaining 51% mtDNA without the T15091C mutation, the results indicate that the T15091C mutation in mtDNA dominantly induced the respiration defects. Copyright © 2015 Elsevier Inc. All rights reserved.

  10. Melorheostosis in a family with autosomal dominant osteopoikilosis: report of a third family.

    PubMed

    Debeer, Philippe; Pykels, E; Lammens, J; Devriendt, K; Fryns, J-P

    2003-06-01

    We describe a three-generation family with clinical and radiological findings of osteopoikilosis in five and melorheostosis in one individual. The co-occurrence of both rare bone disorders suggests that both conditions might be related as suggested previously by Butkus et al. [1997: Am J Med Genet 72:43-46] and Nevin et al. [1999: Am J Med Genet 82:409-414]. The findings in this family strengthen the hypothesis that osteopoikilosis is an autosomal dominant condition and that an early postzygotic second hit mutation in the second allele results in melorheostosis. Copyright 2003 Wiley-Liss, Inc.

  11. Somatic diversification of chicken immunoglobulin light chains by point mutations.

    PubMed

    Parvari, R; Ziv, E; Lantner, F; Heller, D; Schechter, I

    1990-04-01

    The light-chain locus of chicken has 1 functional V lambda 1 gene, 1 J gene, and 25 pseudo-V lambda-genes (where V = variable and J = joining). A major problem is which somatic mechanisms expand this extremely limited germ-line information to generate many different antibodies. Weill's group [Reynaud, C. A., Anquez, V., Grimal, H. & Weill, J. C. (1987) Cell 48, 379-388] has shown that the pseudo-V lambda-genes diversify the rearranged V lambda 1 by gene conversion. Here we demonstrate that chicken light chains are further diversified by somatic point mutations and by V lambda 1-J flexible joining. Somatic point mutations were identified in the J and 3' noncoding DNA of rearranged light-chain genes of chicken. These regions were analyzed because point mutations in V lambda 1 are obscured by gene conversion; the J and 3' noncoding DNA are presented in one copy per haploid genome and are not subject to gene conversion. In rodents point mutations occur as frequently in the V-J coding regions as in the adjacent flanking DNA. Therefore, we conclude that somatic point mutations diversify the V lambda 1 of chicken. The frequency (0-1%) and distribution of the mutations (decreasing in number with increased distance from the V lambda 1 segment) in chicken were as observed in rodents. Sequence variability at the V lambda 1-J junctions could be attributed to imprecise joining of the V lambda 1 and J genes. The modification by gene conversion of rearranged V lambda 1 genes in the bursa was similar in chicken aged 3 months (9.5%) or 3 weeks (9.1%)--i.e., gene conversion that generates the preimmune repertoire in the bursa seems to level off around 3 weeks of age. This preimmune repertoire can be further diversified by somatic point mutations that presumably lead to the formation of antibodies with increased affinity. A segment with structural features of a matrix association region [(A + T)-rich and four topoisomerase II binding sites] was identified in the middle of the J-C lambda intron (where C = constant).

  12. The Landscape of Somatic Genetic Alterations in Breast Cancers From ATM Germline Mutation Carriers.

    PubMed

    Weigelt, Britta; Bi, Rui; Kumar, Rahul; Blecua, Pedro; Mandelker, Diana L; Geyer, Felipe C; Pareja, Fresia; James, Paul A; Couch, Fergus J; Eccles, Diana M; Blows, Fiona; Pharoah, Paul; Li, Anqi; Selenica, Pier; Lim, Raymond S; Jayakumaran, Gowtham; Waddell, Nic; Shen, Ronglai; Norton, Larry; Wen, Hannah Y; Powell, Simon N; Riaz, Nadeem; Robson, Mark E; Reis-Filho, Jorge S; Chenevix-Trench, Georgia

    2018-02-28

    Pathogenic germline variants in ataxia-telangiectasia mutated (ATM), a gene that plays a role in DNA damage response and cell cycle checkpoints, confer an increased breast cancer (BC) risk. Here, we investigated the phenotypic characteristics and landscape of somatic genetic alterations in 24 BCs from ATM germline mutation carriers by whole-exome and targeted sequencing. ATM-associated BCs were consistently hormone receptor positive and largely displayed minimal immune infiltrate. Although 79.2% of these tumors exhibited loss of heterozygosity of the ATM wild-type allele, none displayed high activity of mutational signature 3 associated with defective homologous recombination DNA (HRD) repair. No TP53 mutations were found in the ATM-associated BCs. Analysis of an independent data set confirmed that germline ATM variants and TP53 somatic mutations are mutually exclusive. Our findings indicate that ATM-associated BCs often harbor bi-allelic inactivation of ATM, are phenotypically distinct from BRCA1/2-associated BCs, lack HRD-related mutational signatures, and that TP53 and ATM genetic alterations are likely epistatic.

  13. Solid Tumor Second Primary Neoplasms: Who is at Risk, What Can We Do?

    PubMed Central

    Oeffinger, Kevin C.; Baxi, Shrujal S.; Friedman, Danielle Novetsky; Moskowitz, Chaya S.

    2014-01-01

    Eighteen percent of incident malignancies in the U.S. are a second (or subsequent) cancer. Second primary neoplasms (SPN), particularly solid tumors, are a major cause of mortality and serious morbidity among cancer survivors successfully cured of their first cancer. Multiple etiologies may lead to a cancer survivor subsequently being diagnosed with an SPN, including radiotherapy for the first cancer, unhealthy lifestyle behaviors, germline and somatic mutations, aging, or an interaction between any of these factors. In this article, we discuss these factors and synthesize this information for use in clinical practice, including preventive strategies and screening recommendations for SPNs. PMID:24331190

  14. Somatic mutation load of estrogen receptor-positive breast tumors predicts overall survival: an analysis of genome sequence data.

    PubMed

    Haricharan, Svasti; Bainbridge, Matthew N; Scheet, Paul; Brown, Powel H

    2014-07-01

    Breast cancer is one of the most commonly diagnosed cancers in women. While there are several effective therapies for breast cancer and important single gene prognostic/predictive markers, more than 40,000 women die from this disease every year. The increasing availability of large-scale genomic datasets provides opportunities for identifying factors that influence breast cancer survival in smaller, well-defined subsets. The purpose of this study was to investigate the genomic landscape of various breast cancer subtypes and its potential associations with clinical outcomes. We used statistical analysis of sequence data generated by the Cancer Genome Atlas initiative including somatic mutation load (SML) analysis, Kaplan-Meier survival curves, gene mutational frequency, and mutational enrichment evaluation to study the genomic landscape of breast cancer. We show that ER(+), but not ER(-), tumors with high SML associate with poor overall survival (HR = 2.02). Further, these high mutation load tumors are enriched for coincident mutations in both DNA damage repair and ER signature genes. While it is known that somatic mutations in specific genes affect breast cancer survival, this study is the first to identify that SML may constitute an important global signature for a subset of ER(+) tumors prone to high mortality. Moreover, although somatic mutations in individual DNA damage genes affect clinical outcome, our results indicate that coincident mutations in DNA damage response and signature ER genes may prove more informative for ER(+) breast cancer survival. Next generation sequencing may prove an essential tool for identifying pathways underlying poor outcomes and for tailoring therapeutic strategies.

  15. Novel DNA variants and mutation frequencies of hMLH1 and hMSH2 genes in colorectal cancer in the Northeast China population.

    PubMed

    Hu, Fulan; Li, Dandan; Wang, Yibaina; Yao, Xiaoping; Zhang, Wencui; Liang, Jing; Lin, Chunqing; Ren, Jiaojiao; Zhu, Lin; Wu, Zhiwei; Li, Shuying; Li, Ye; Zhao, Xiaojuan; Cui, Binbin; Dong, Xinshu; Tian, Suli; Zhao, Yashuang

    2013-01-01

    Research on hMLH1 and hMSH2 mutations tend to focus on Lynch syndrome (LS) and LS-like colorectal cancer (CRC). No studies to date have assessed the role of hMLH1 and hMSH2 genes in mass sporadic CRC (without preselection by MSI or early age of onset). We aimed to identify novel hMLH1 and hMSH2 DNA variants, to determine the mutation frequencies and sites in both sporadic and LS CRC and their relationships with clinicopathological characteristics of CRC in Northeast of China. 452 sporadic and 21 LS CRC patients were screened for germline and somatic mutations in hMLH1 and hMSH2 genes with PCR-SSCP sequencing. We identified 11 hMLH1 and seven hMSH2 DNA variants in our study cohort. Six of them were novel: four in hMLH1 gene (IVS8-16 A>T, c.644 GAT>GTT, c.1529 CAG>CGG and c.1831 ATT>TTT) and two in hMSH2 gene (-39 C>T, insertion AACAACA at c.1127 and deletion AAG at c.1129). In sporadic CRC, germline and somatic mutation frequencies of hMLH1/hMSH2 gene were 15.59% and 17.54%, respectively (p = 0.52). Germline mutations present in hMLH1 and hMSH2 genes were 5.28% and 10.78%, respectively (p<0.01). Somatic mutations in hMLH1 and hMSH2 genes were 6.73% and 11.70%, respectively (p = 0.02). In LS CRC, both germline and somatic mutation frequencies of hMLH1/hMSH2 gene were 28.57%. The most prevalent germline mutation site in hMSH2 gene was c.1168 CTT>TTT (3.90%), a polymorphism. Somatic mutation frequency of hMLH1/hMSH2 gene was significantly different in proximal, distal colon and rectal cancer (p = 0.03). Our findings elucidate the mutation spectrum and frequency of hMLH1 and hMSH2 genes in sporadic and LS CRC, and their relationships with clinicopathological characteristics of CRC.

  16. Identification of mutations in the PI3K-AKT-mTOR signalling pathway in patients with macrocephaly and developmental delay and/or autism.

    PubMed

    Yeung, Kit San; Tso, Winnie Wan Yee; Ip, Janice Jing Kun; Mak, Christopher Chun Yu; Leung, Gordon Ka Chun; Tsang, Mandy Ho Yin; Ying, Dingge; Pei, Steven Lim Cho; Lee, So Lun; Yang, Wanling; Chung, Brian Hon-Yin

    2017-01-01

    Macrocephaly, which is defined as a head circumference greater than or equal to + 2 standard deviations, is a feature commonly observed in children with developmental delay and/or autism spectrum disorder. Although PTEN is a well-known gene identified in patients with this syndromic presentation, other genes in the PI3K-AKT-mTOR signalling pathway have also recently been suggested to have important roles. The aim of this study is to characterise the mutation spectrum of this group of patients. We performed whole-exome sequencing of 21 patients with macrocephaly and developmental delay/autism spectrum disorder. Sources of genomic DNA included blood, buccal mucosa and saliva. Germline mutations were validated by Sanger sequencing, whereas somatic mutations were validated by droplet digital PCR. We identified ten pathogenic/likely pathogenic mutations in PTEN ( n  = 4), PIK3CA ( n  = 3), MTOR ( n  = 1) and PPP2R5D ( n  = 2) in ten patients. An additional PTEN mutation, which was classified as variant of unknown significance, was identified in a patient with a pathogenic PTEN mutation, making him harbour bi-allelic germline PTEN mutations. Two patients harboured somatic PIK3CA mutations, and the level of somatic mosaicism in blood DNA was low. Patients who tested positive for mutations in the PI3K-AKT-mTOR pathway had a lower developmental quotient than the rest of the cohort (DQ = 62.8 vs. 76.1, p = 0.021). Their dysmorphic features were non-specific, except for macrocephaly. Among the ten patients with identified mutations, brain magnetic resonance imaging was performed in nine, all of whom showed megalencephaly. We identified mutations in the PI3K-AKT-mTOR signalling pathway in nearly half of our patients with macrocephaly and developmental delay/autism spectrum disorder. These patients have subtle dysmorphic features and mild developmental issues. Clinically, patients with germline mutations are difficult to distinguish from patients with somatic mutations, and therefore, sequencing of buccal or saliva DNA is important to identify somatic mosaicism. Given the high diagnostic yield and the management implications, we suggest implementing comprehensive genetic testing in the PI3K-AKT-mTOR pathway in the clinical evaluation of patients with macrocephaly and developmental delay and/or autism spectrum disorder.

  17. Prevalence and Characterization of Somatic Mutations in Chinese Aldosterone-Producing Adenoma Patients

    PubMed Central

    Wang, Baojun; Li, Xintao; Zhang, Xu; Ma, Xin; Chen, Luyao; Zhang, Yu; Lyu, Xiangjun; Tang, Yuzhe; Huang, Qingbo; Gao, Yu; Fan, Yang; Ouyang, Jinzhi

    2015-01-01

    Abstract Recently somatic mutations of KCNJ5, ATP1A1, ATP2B3, and CACNA1D have been identified in patients with aldosterone-producing adenoma (APA). The present study sequenced the DNA in the tissues and blood samples from Chinese patients with APA for KCNJ5, ATP1A1, ATP2B3, and CACNA1D gene mutations. Among the 114 patients, 86 (75.4%) were identified with KCNJ5 somatic mutations, including 3 previously reported (G151R, L168R, T158A) and 2 other unreported mutations. One patient presented with both a point mutation (E147) and an insertion mutation, whereas another had a 36-base duplication, G153_G164dup. No mutation of ATP1A1 and ATP2B3 in the known hotspots was identified and only 1 male patient was detected with a novel CACNA1D mutation, V748I. Unlike other studies, male and female patients had similar KCNJ5 mutation rates (76.9% vs 74.2%). Mutation carriers were younger and had lower preoperative potassium level, whereas male (but not female) mutation carriers had higher preoperative plasma aldosterone concentration and preoperative blood pressures. Mutation carriers also had higher LV mass index (LVMI) than nonmutation carriers. After surgery, LVMI improved significantly in the KCNJ5 mutation group but not in the nonmutation group. The mRNA expression of KCNJ5, CYP11B2, and ATP2B3 was higher in the KCNJ5-mutated APA tissues. Functional characterization of the 2 novel KCNJ5 mutations showed that they were associated with decreased proliferation, membrane depolarization, elevated secretion of aldosterone, and increased expression of CYP11B1 and CYP11B2. In conclusion, Chinese APA patients appear to have a high frequency of somatic KCNJ5 mutation. Mutation prevalence rates are similar among men and women and 2 novel mutations are identified. KCNJ5-mutated patients benefit more from surgical resection of APA than nonmutated patients. PMID:25906099

  18. Somatic CALR Mutations in Myeloproliferative Neoplasms with Nonmutated JAK2

    PubMed Central

    Baxter, E.J.; Nice, F.L.; Gundem, G.; Wedge, D.C.; Avezov, E.; Li, J.; Kollmann, K.; Kent, D.G.; Aziz, A.; Godfrey, A.L.; Hinton, J.; Martincorena, I.; Van Loo, P.; Jones, A.V.; Guglielmelli, P.; Tarpey, P.; Harding, H.P.; Fitzpatrick, J.D.; Goudie, C.T.; Ortmann, C.A.; Loughran, S.J.; Raine, K.; Jones, D.R.; Butler, A.P.; Teague, J.W.; O’Meara, S.; McLaren, S.; Bianchi, M.; Silber, Y.; Dimitropoulou, D.; Bloxham, D.; Mudie, L.; Maddison, M.; Robinson, B.; Keohane, C.; Maclean, C.; Hill, K.; Orchard, K.; Tauro, S.; Du, M.-Q.; Greaves, M.; Bowen, D.; Huntly, B.J.P.; Harrison, C.N.; Cross, N.C.P.; Ron, D.; Vannucchi, A.M.; Papaemmanuil, E.; Campbell, P.J.; Green, A.R.

    2014-01-01

    BACKGROUND Somatic mutations in the Janus kinase 2 gene (JAK2) occur in many myeloproliferative neoplasms, but the molecular pathogenesis of myeloproliferative neoplasms with nonmutated JAK2 is obscure, and the diagnosis of these neoplasms remains a challenge. METHODS We performed exome sequencing of samples obtained from 151 patients with myeloproliferative neoplasms. The mutation status of the gene encoding calreticulin (CALR) was assessed in an additional 1345 hematologic cancers, 1517 other cancers, and 550 controls. We established phylogenetic trees using hematopoietic colonies. We assessed calreticulin subcellular localization using immunofluorescence and flow cytometry. RESULTS Exome sequencing identified 1498 mutations in 151 patients, with medians of 6.5, 6.5, and 13.0 mutations per patient in samples of polycythemia vera, essential thrombocythemia, and myelofibrosis, respectively. Somatic CALR mutations were found in 70 to 84% of samples of myeloproliferative neoplasms with nonmutated JAK2, in 8% of myelodysplasia samples, in occasional samples of other myeloid cancers, and in none of the other cancers. A total of 148 CALR mutations were identified with 19 distinct variants. Mutations were located in exon 9 and generated a +1 base-pair frameshift, which would result in a mutant protein with a novel C-terminal. Mutant calreticulin was observed in the endoplasmic reticulum without increased cell-surface or Golgi accumulation. Patients with myeloproliferative neoplasms carrying CALR mutations presented with higher platelet counts and lower hemoglobin levels than patients with mutated JAK2. Mutation of CALR was detected in hematopoietic stem and progenitor cells. Clonal analyses showed CALR mutations in the earliest phylogenetic node, a finding consistent with its role as an initiating mutation in some patients. CONCLUSIONS Somatic mutations in the endoplasmic reticulum chaperone CALR were found in a majority of patients with myeloproliferative neoplasms with nonmutated JAK2. (Funded by the Kay Kendall Leukaemia Fund and others.) PMID:24325359

  19. Personalized Oncology Through Integrative High-Throughput Sequencing: A Pilot Study

    PubMed Central

    Roychowdhury, Sameek; Iyer, Matthew K.; Robinson, Dan R.; Lonigro, Robert J.; Wu, Yi-Mi; Cao, Xuhong; Kalyana-Sundaram, Shanker; Sam, Lee; Balbin, O. Alejandro; Quist, Michael J.; Barrette, Terrence; Everett, Jessica; Siddiqui, Javed; Kunju, Lakshmi P.; Navone, Nora; Araujo, John C.; Troncoso, Patricia; Logothetis, Christopher J.; Innis, Jeffrey W.; Smith, David C.; Lao, Christopher D.; Kim, Scott Y.; Roberts, J. Scott; Gruber, Stephen B.; Pienta, Kenneth J.; Talpaz, Moshe; Chinnaiyan, Arul M.

    2012-01-01

    Individual cancers harbor a set of genetic aberrations that can be informative for identifying rational therapies currently available or in clinical trials. We implemented a pilot study to explore the practical challenges of applying high-throughput sequencing in clinical oncology. We enrolled patients with advanced or refractory cancer who were eligible for clinical trials. For each patient, we performed whole-genome sequencing of the tumor, targeted whole-exome sequencing of tumor and normal DNA, and transcriptome sequencing (RNA-Seq) of the tumor to identify potentially informative mutations in a clinically relevant time frame of 3 to 4 weeks. With this approach, we detected several classes of cancer mutations including structural rearrangements, copy number alterations, point mutations, and gene expression alterations. A multidisciplinary Sequencing Tumor Board (STB) deliberated on the clinical interpretation of the sequencing results obtained. We tested our sequencing strategy on human prostate cancer xenografts. Next, we enrolled two patients into the clinical protocol and were able to review the results at our STB within 24 days of biopsy. The first patient had metastatic colorectal cancer in which we identified somatic point mutations in NRAS, TP53, AURKA, FAS, and MYH11, plus amplification and overexpression of cyclin-dependent kinase 8 (CDK8). The second patient had malignant melanoma, in which we identified a somatic point mutation in HRAS and a structural rearrangement affecting CDKN2C. The STB identified the CDK8 amplification and Ras mutation as providing a rationale for clinical trials with CDK inhibitors or MEK (mitogenactivated or extracellular signal–regulated protein kinase kinase) and PI3K (phosphatidylinositol 3-kinase) inhibitors, respectively. Integrative high-throughput sequencing of patients with advanced cancer generates a comprehensive, individual mutational landscape to facilitate biomarker-driven clinical trials in oncology. PMID:22133722

  20. Human mitochondrial DNA: roles of inherited and somatic mutations

    PubMed Central

    Schon, Eric A.; DiMauro, Salvatore; Hirano, Michio

    2014-01-01

    Mutations in the human mitochondrial genome are known to cause an array of diverse disorders, most of which are maternally inherited, and all of which are associated with defects in oxidative energy metabolism. It is now emerging that somatic mutations in mitochondrial DNA (mtDNA) are also linked to other complex traits, including neurodegenerative diseases, ageing and cancer. Here we discuss insights into the roles of mtDNA mutations in a wide variety of diseases, highlighting the interesting genetic characteristics of the mitochondrial genome and challenges in studying its contribution to pathogenesis. PMID:23154810

  1. A study of the mutational landscape of pediatric-type follicular lymphoma and pediatric nodal marginal zone lymphoma.

    PubMed

    Ozawa, Michael G; Bhaduri, Aparna; Chisholm, Karen M; Baker, Steven A; Ma, Lisa; Zehnder, James L; Luna-Fineman, Sandra; Link, Michael P; Merker, Jason D; Arber, Daniel A; Ohgami, Robert S

    2016-10-01

    Pediatric-type follicular lymphoma and pediatric marginal zone lymphoma are two of the rarest B-cell lymphomas. These lymphomas occur predominantly in the pediatric population and show features distinct from their more common counterparts in adults: adult-type follicular lymphoma and adult-type nodal marginal zone lymphoma. Here we report a detailed whole-exome deep sequencing analysis of a cohort of pediatric-type follicular lymphomas and pediatric marginal zone lymphomas. This analysis revealed a recurrent somatic variant encoding p.Lys66Arg in the transcription factor interferon regulatory factor 8 (IRF8) in 3 of 6 cases (50%) of pediatric-type follicular lymphoma. This specific point mutation was not detected in pediatric marginal zone lymphoma or in adult-type follicular lymphoma. Additional somatic point mutations in pediatric-type follicular lymphoma were observed in genes involved in transcription, intracellular signaling, and cell proliferation. In pediatric marginal zone lymphoma, no recurrent mutation was identified; however, somatic point mutations were observed in genes involved in cellular adhesion, cytokine regulatory elements, and cellular proliferation. A somatic variant in AMOTL1, a recurrently mutated gene in splenic marginal zone lymphoma, was also identified in a case of pediatric marginal zone lymphoma. The overall non-synonymous mutational burden was low in both pediatric-type follicular lymphoma and pediatric marginal zone lymphoma (4.6 mutations per exome). Altogether, these findings support a distinctive genetic basis for pediatric-type follicular lymphoma and pediatric marginal zone lymphoma when compared with adult subtypes and to one another. Moreover, identification of a recurrent point mutation in IRF8 provides insight into a potential driver mutation in the pathogenesis of pediatric-type follicular lymphoma with implications for novel diagnostic or therapeutic strategies.

  2. A study of the mutational landscape of pediatric-type follicular lymphoma and pediatric nodal marginal zone lymphoma

    PubMed Central

    Ozawa, Michael G; Bhaduri, Aparna; Chisholm, Karen M; Baker, Steven A; Ma, Lisa; Zehnder, James L; Luna-Fineman, Sandra; Link, Michael P; Merker, Jason D; Arber, Daniel A; Ohgami, Robert S

    2016-01-01

    Pediatric-type follicular lymphoma and pediatric marginal zone lymphoma are two of the rarest B-cell lymphomas. These lymphomas occur predominantly in the pediatric population and show features distinct from their more common counterparts in adults: adult-type follicular lymphoma and adult-type nodal marginal zone lymphoma. Here we report a detailed whole-exome deep sequencing analysis of a cohort of pediatric-type follicular lymphomas and pediatric marginal zone lymphomas. This analysis revealed a recurrent somatic variant encoding p.Lys66Arg in the transcription factor interferon regulatory factor 8 (IRF8) in 3 of 6 cases (50%) of pediatric-type follicular lymphoma. This specific point mutation was not detected in pediatric marginal zone lymphoma or in adult-type follicular lymphoma. Additional somatic point mutations in pediatric-type follicular lymphoma were observed in genes involved in transcription, intracellular signaling, and cell proliferation. In pediatric marginal zone lymphoma, no recurrent mutation was identified; however, somatic point mutations were observed in genes involved in cellular adhesion, cytokine regulatory elements, and cellular proliferation. A somatic variant in AMOTL1, a recurrently mutated gene in splenic marginal zone lymphoma, was also identified in a case of pediatric marginal zone lymphoma. The overall non-synonymous mutational burden was low in both pediatric-type follicular lymphoma and pediatric marginal zone lymphoma (4.6 mutations per exome). Altogether, these findings support a distinctive genetic basis for pediatric-type follicular lymphoma and pediatric marginal zone lymphoma when compared with adult subtypes and to one another. Moreover, identification of a recurrent point mutation in IRF8 provides insight into a potential driver mutation in the pathogenesis of pediatric-type follicular lymphoma with implications for novel diagnostic or therapeutic strategies. PMID:27338637

  3. Polycythemia and paraganglioma with a novel somatic HIF2A mutation in a male.

    PubMed

    Toyoda, Hidemi; Hirayama, Jyunya; Sugimoto, Yuka; Uchida, Keiichi; Ohishi, Kohshi; Hirayama, Masahiro; Komada, Yoshihiro

    2014-06-01

    Recently, a new syndrome of paraganglioma, somatostatinoma, and polycythemia has been discovered (known as Pacak-Zhuang syndrome). This new syndrome, with somatic HIF2A gain-of-function mutations, has never been reported in male patients. We describe a male patient with Pacak-Zhuang syndrome who carries a newly discovered HIF2A mutation. Congenital polycythemias have diverse etiologies, including germline mutations in the oxygen-sensing pathway. These include von Hippel-Lindau (Chuvash polycythemia), prolyl hydroxylase domain-containing protein-2, and hypoxia-inducible factor-2α (HIF-2α). Somatic gain-of-function mutations in the gene encoding HIF-2α were reported in patients with paraganglioma and polycythemia and have been found exclusively in female patients. Through sequencing of the HIF2A using DNA from paraganglioma in 15-year-old male patient, we identified a novel mutation of HIF2A: a heterozygous C to A substitution at base 1589 in exon 12 of HIF2A. The mutation was not found in germline DNA from leukocytes. The C1589A mutations resulted in substitution of alanine 530 in the HIF-2α protein with glutamic acid. This mutation is undoubtedly associated with increased HIF-2α activity and increased protein half-life, because it affects the vicinity of the prolyl hydroxylase target residue, proline 531. To our knowledge, this is the first report describing Pacak-Zhuang syndrome with somatic gain-of-function mutation in HIF2A in a male patient. Congenital polycythemia of unknown origin should raise suspicion for the novel disorder Pacak-Zhuang syndrome, even in male patients. Copyright © 2014 by the American Academy of Pediatrics.

  4. Bone Metastasis in Prostate Cancer: Recurring Mitochondrial DNA Mutation Reveals Selective Pressure Exerted by the Bone Microenvironment

    PubMed Central

    Arnold, Rebecca S.; Fedewa, Stacey A.; Goodman, Michael; Osunkoya, Adeboye O.; Kissick, Haydn T.; Morrissey, Colm; True, Lawrence D.; Petros, John A.

    2015-01-01

    Background Cancer progression and metastasis occurs such that cells with acquired mutations enhancing growth and survival (or inhibiting cell death) increase in number, a concept that has been recognized as analogous to Darwinian evolution of species since Peter C. Nowell’s description in 1976. Selective forces include those intrinsic to the host (including metastatic site) as well as those resulting from anti-cancer therapies. By examining the mutational status of multiple tumor sites within an individual patient some insight may be gained into those genetic variants that enhance site-specific metastasis. By comparing these data across multiple individuals, recurrent patterns may identify alterations that are fundamental to successful site-specific metastasis. Methods We sequenced the mitochondrial genome in 10 prostate cancer patients with bone metastases enrolled in a rapid autopsy program. Patients had late stage disease and received androgen ablation and frequently other systemic therapies. For each of 9 patients, 4 separate tissues were sequenced: the primary prostate cancer, a soft tissue metastasis, a bone metastasis and an uninvolved normal tissue that served as the non-cancerous control. An additional (10th) patient had no primary prostate available for sequencing but had both metastatic sites (and control DNA) sequenced. We then examined the number and location of somatically acquired mitochondrial DNA (mtDNA) mutations in the primary and two metastatic sites in each individual patient. Finally, we compared patients with each other to determine any common patterns of somatic mutation. Results Somatic mutations were significantly more numerous in bone compared to either the primary tumor or soft tissue metastases. A missense mutation at nucleotide position (np) 10398 (A10398G; Thr114Ala) in the respiratory complex I gene ND3 was the most common (7 of 10 patients) and was detected only in bone. Other notable somatic mutations that occurred in more than one patient include a tRNA Arg mutation at np 10436 and a tRNA Thr mutation at np 15928. The tRNA Arg mutation was restricted to bone metastases and occurred in three of 10 patients (30%). Somatic mutation at 15928 was not restricted to bone and also occurred in three patients. Conclusions Mitochondrial genomic variation was greater in metastatic sites than the primary tumor and bone metastases had statistically significantly greater numbers of somatic mutations than either the primary or the soft tissue metastases. The genome was not mutated randomly. At least one mutational “hot-spot” was identified at the individual base level (nucleotide position 10398 in bone metastases) indicating a pervasive selective pressure for bone metastatic cells that had acquired the 10398 mtDNA mutation. Two additional recurrent mutations (tRNA Arg and tRNA Thr) support the concept of bone site-specific “survival of the fittest” as revealed by variation in the mitochondrial genome and selective pressure exerted by the metastatic site. PMID:25952970

  5. Bone metastasis in prostate cancer: Recurring mitochondrial DNA mutation reveals selective pressure exerted by the bone microenvironment.

    PubMed

    Arnold, Rebecca S; Fedewa, Stacey A; Goodman, Michael; Osunkoya, Adeboye O; Kissick, Haydn T; Morrissey, Colm; True, Lawrence D; Petros, John A

    2015-09-01

    Cancer progression and metastasis occur such that cells with acquired mutations enhancing growth and survival (or inhibiting cell death) increase in number, a concept that has been recognized as analogous to Darwinian evolution of species since Peter C. Nowell's description in 1976. Selective forces include those intrinsic to the host (including metastatic site) as well as those resulting from anti-cancer therapies. By examining the mutational status of multiple tumor sites within an individual patient some insight may be gained into those genetic variants that enhance site-specific metastasis. By comparing these data across multiple individuals, recurrent patterns may identify alterations that are fundamental to successful site-specific metastasis. We sequenced the mitochondrial genome in 10 prostate cancer patients with bone metastases enrolled in a rapid autopsy program. Patients had late stage disease and received androgen ablation and frequently other systemic therapies. For each of 9 patients, 4 separate tissues were sequenced: the primary prostate cancer, a soft tissue metastasis, a bone metastasis and an uninvolved normal tissue that served as the non-cancerous control. An additional (10th) patient had no primary prostate available for sequencing but had both metastatic sites (and control DNA) sequenced. We then examined the number and location of somatically acquired mitochondrial DNA (mtDNA) mutations in the primary tumor and two metastatic sites in each individual patient. Finally, we compared patients with each other to determine any common patterns of somatic mutation. Somatic mutations were significantly more numerous in the bone compared to either the primary tumor or soft tissue metastases. A missense mutation at nucleotide position (n.p.) 10398 (A10398G; Thr114Ala) in the respiratory complex I gene ND3 was the most common (7 of 10 patients) and was detected only in the bone. Other notable somatic mutations that occurred in more than one patient include a tRNA Arg mutation at n.p. 10436 and a tRNA Thr mutation at n.p. 15928. The tRNA Arg mutation was restricted to bone metastases and occurred in three of 10 patients (30%). Somatic mutation at 15928 was not restricted to the bone and also occurred in three patients. Mitochondrial genomic variation was greater in metastatic sites than in the primary tumor and bone metastases had statistically significantly greater numbers of somatic mutations than either the primary or the soft tissue metastases. The genome was not mutated randomly. At least one mutational "hot-spot" was identified at the individual base level (nucleotide position 10398 in bone metastases) indicating a pervasive selective pressure for bone metastatic cells that had acquired the 10398 mtDNA mutation. Two additional recurrent mutations (tRNA Arg and tRNA Thr) support the concept of bone site-specific "survival of the fittest" as revealed by variation in the mitochondrial genome and selective pressure exerted by the metastatic site. Published by Elsevier Inc.

  6. Systematic reconstruction of autism biology from massive genetic mutation profiles

    PubMed Central

    Zhang, Chaolin; Jiang, Yong-hui

    2018-01-01

    Autism spectrum disorder (ASD) affects 1% of world population and has become a pressing medical and social problem worldwide. As a paradigmatic complex genetic disease, ASD has been intensively studied and thousands of gene mutations have been reported. Because these mutations rarely recur, it is difficult to (i) pinpoint the fewer disease-causing versus majority random events and (ii) replicate or verify independent studies. A coherent and systematic understanding of autism biology has not been achieved. We analyzed 3392 and 4792 autism-related mutations from two large-scale whole-exome studies across multiple resolution levels, that is, variants (single-nucleotide), genes (protein-coding unit), and pathways (molecular module). These mutations do not recur or replicate at the variant level, but significantly and increasingly do so at gene and pathway levels. Genetic association reveals a novel gene + pathway dual-hit model, where the mutation burden becomes less relevant. In multiple independent analyses, hundreds of variants or genes repeatedly converge to several canonical pathways, either novel or literature-supported. These pathways define recurrent and systematic ASD biology, distinct from previously reported gene groups or networks. They also present a catalog of novel ASD risk factors including 118 variants and 72 genes. At a subpathway level, most variants disrupt the pathway-related gene functions, and in the same gene, they tend to hit residues extremely close to each other and in the same domain. Multiple interacting variants spotlight key modules, including the cAMP (adenosine 3′,5′-monophosphate) second-messenger system and mGluR (metabotropic glutamate receptor) signaling regulation by GRKs (G protein–coupled receptor kinases). At a superpathway level, distinct pathways further interconnect and converge to three biology themes: synaptic function, morphology, and plasticity. PMID:29651456

  7. Systematic reconstruction of autism biology from massive genetic mutation profiles.

    PubMed

    Luo, Weijun; Zhang, Chaolin; Jiang, Yong-Hui; Brouwer, Cory R

    2018-04-01

    Autism spectrum disorder (ASD) affects 1% of world population and has become a pressing medical and social problem worldwide. As a paradigmatic complex genetic disease, ASD has been intensively studied and thousands of gene mutations have been reported. Because these mutations rarely recur, it is difficult to (i) pinpoint the fewer disease-causing versus majority random events and (ii) replicate or verify independent studies. A coherent and systematic understanding of autism biology has not been achieved. We analyzed 3392 and 4792 autism-related mutations from two large-scale whole-exome studies across multiple resolution levels, that is, variants (single-nucleotide), genes (protein-coding unit), and pathways (molecular module). These mutations do not recur or replicate at the variant level, but significantly and increasingly do so at gene and pathway levels. Genetic association reveals a novel gene + pathway dual-hit model, where the mutation burden becomes less relevant. In multiple independent analyses, hundreds of variants or genes repeatedly converge to several canonical pathways, either novel or literature-supported. These pathways define recurrent and systematic ASD biology, distinct from previously reported gene groups or networks. They also present a catalog of novel ASD risk factors including 118 variants and 72 genes. At a subpathway level, most variants disrupt the pathway-related gene functions, and in the same gene, they tend to hit residues extremely close to each other and in the same domain. Multiple interacting variants spotlight key modules, including the cAMP (adenosine 3',5'-monophosphate) second-messenger system and mGluR (metabotropic glutamate receptor) signaling regulation by GRKs (G protein-coupled receptor kinases). At a superpathway level, distinct pathways further interconnect and converge to three biology themes: synaptic function, morphology, and plasticity.

  8. Cancer genes mutation profiling in calcifying epithelial odontogenic tumour.

    PubMed

    de Sousa, Sílvia Ferreira; Diniz, Marina Gonçalves; França, Josiane Alves; Fontes Pereira, Thaís Dos Santos; Moreira, Rennan Garcias; Santos, Jean Nunes Dos; Gomez, Ricardo Santiago; Gomes, Carolina Cavalieri

    2018-03-01

    To identify calcifying epithelial odontogenic tumour (CEOT) mutations in oncogenes and tumour suppressor genes. A panel of 50 genes commonly mutated in cancer was sequenced in CEOT by next-generation sequencing. Sanger sequencing was used to cover the region of the frameshift deletion identified in one sample. Missense single nucleotide variants (SNVs) with minor allele frequency (MAF) <1% were detected in PTEN , MET and JAK3 . A frameshift deletion in CDKN2A occurred in association with a missense mutation in the same gene region, suggesting a second hit in the inactivation of this gene. APC, KDR, KIT, PIK3CA and TP53 missense SNVs were identified; however, these are common SNVs, showing MAF >1%. CEOT harbours mutations in the tumour suppressor PTEN and CDKN2A and in the oncogenes JAK3 and MET . As these mutations occurred in only one case each, they are probably not driver mutations for these tumours. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  9. B cell Variable genes have evolved their codon usage to focus the targeted patterns of somatic mutation on the complementarity determining regions

    PubMed Central

    Saini, Jasmine; Hershberg, Uri

    2015-01-01

    The exceptional ability of B cells to diversify through somatic mutation and improve affinity of the repertoire towards the antigens is the cornerstone of adaptive immunity. Somatic mutation is not evenly distributed and exhibits certain micro-sequence specificities. We show here that the combination of somatic mutation targeting and the codon usage in human B cell receptor (BCR) Variable (V) genes create expected patterns of mutation and post mutation changes that are focused on their complementarity determining regions (CDR). T cell V genes are also skewed in targeting mutations but to a lesser extent and are lacking the codon usage bias observed in BCRs. This suggests that the observed skew in T cell receptors is due to their amino acid usage, which is similar to that of BCRs. The mutation targeting and the codon bias allow B cell CDRs to diversify by specifically accumulating nonconservative changes. We counted the distribution of mutations to CDR in 4 different human datasets. In all four cases we found that the number of actual mutations in the CDR correlated significantly with the V gene mutation biases to the CDR predicted by our models. Finally, it appears that the mutation bias in V genes indeed relates to their long-term survival in actual human repertoires. We observed that resting repertoires of B cells overexpressed V genes that were especially biased towards focused mutation and change in the CDR. This bias in V gene usage was somewhat relaxed at the height of the immune response to a vaccine, presumably because of the need for a wider diversity in a primary response. However, older patients did not retain this flexibility and were biased towards using only highly skewed V genes at all stages of their response. PMID:25660968

  10. B cell variable genes have evolved their codon usage to focus the targeted patterns of somatic mutation on the complementarity determining regions.

    PubMed

    Saini, Jasmine; Hershberg, Uri

    2015-05-01

    The exceptional ability of B cells to diversify through somatic mutation and improve affinity of the repertoire toward the antigens is the cornerstone of adaptive immunity. Somatic mutation is not evenly distributed and exhibits certain micro-sequence specificities. We show here that the combination of somatic mutation targeting and the codon usage in human B cell receptor (BCR) Variable (V) genes create expected patterns of mutation and post mutation changes that are focused on their complementarity determining regions (CDR). T cell V genes are also skewed in targeting mutations but to a lesser extent and are lacking the codon usage bias observed in BCRs. This suggests that the observed skew in T cell receptors is due to their amino acid usage, which is similar to that of BCRs. The mutation targeting and the codon bias allow B cell CDRs to diversify by specifically accumulating nonconservative changes. We counted the distribution of mutations to CDR in 4 different human datasets. In all four cases we found that the number of actual mutations in the CDR correlated significantly with the V gene mutation biases to the CDR predicted by our models. Finally, it appears that the mutation bias in V genes indeed relates to their long-term survival in actual human repertoires. We observed that resting repertoires of B cells overexpressed V genes that were especially biased toward focused mutation and change in the CDR. This bias in V gene usage was somewhat relaxed at the height of the immune response to a vaccine, presumably because of the need for a wider diversity in a primary response. However, older patients did not retain this flexibility and were biased toward using only highly skewed V genes at all stages of their response. Copyright © 2015 Elsevier Ltd. All rights reserved.

  11. Detection of somatic mutations by high-resolution DNA melting (HRM) analysis in multiple cancers.

    PubMed

    Gonzalez-Bosquet, Jesus; Calcei, Jacob; Wei, Jun S; Garcia-Closas, Montserrat; Sherman, Mark E; Hewitt, Stephen; Vockley, Joseph; Lissowska, Jolanta; Yang, Hannah P; Khan, Javed; Chanock, Stephen

    2011-01-17

    Identification of somatic mutations in cancer is a major goal for understanding and monitoring the events related to cancer initiation and progression. High resolution melting (HRM) curve analysis represents a fast, post-PCR high-throughput method for scanning somatic sequence alterations in target genes. The aim of this study was to assess the sensitivity and specificity of HRM analysis for tumor mutation screening in a range of tumor samples, which included 216 frozen pediatric small rounded blue-cell tumors as well as 180 paraffin-embedded tumors from breast, endometrial and ovarian cancers (60 of each). HRM analysis was performed in exons of the following candidate genes known to harbor established commonly observed mutations: PIK3CA, ERBB2, KRAS, TP53, EGFR, BRAF, GATA3, and FGFR3. Bi-directional sequencing analysis was used to determine the accuracy of the HRM analysis. For the 39 mutations observed in frozen samples, the sensitivity and specificity of HRM analysis were 97% and 87%, respectively. There were 67 mutation/variants in the paraffin-embedded samples, and the sensitivity and specificity for the HRM analysis were 88% and 80%, respectively. Paraffin-embedded samples require higher quantity of purified DNA for high performance. In summary, HRM analysis is a promising moderate-throughput screening test for mutations among known candidate genomic regions. Although the overall accuracy appears to be better in frozen specimens, somatic alterations were detected in DNA extracted from paraffin-embedded samples.

  12. Detection of Somatic Mutations by High-Resolution DNA Melting (HRM) Analysis in Multiple Cancers

    PubMed Central

    Gonzalez-Bosquet, Jesus; Calcei, Jacob; Wei, Jun S.; Garcia-Closas, Montserrat; Sherman, Mark E.; Hewitt, Stephen; Vockley, Joseph; Lissowska, Jolanta; Yang, Hannah P.; Khan, Javed; Chanock, Stephen

    2011-01-01

    Identification of somatic mutations in cancer is a major goal for understanding and monitoring the events related to cancer initiation and progression. High resolution melting (HRM) curve analysis represents a fast, post-PCR high-throughput method for scanning somatic sequence alterations in target genes. The aim of this study was to assess the sensitivity and specificity of HRM analysis for tumor mutation screening in a range of tumor samples, which included 216 frozen pediatric small rounded blue-cell tumors as well as 180 paraffin-embedded tumors from breast, endometrial and ovarian cancers (60 of each). HRM analysis was performed in exons of the following candidate genes known to harbor established commonly observed mutations: PIK3CA, ERBB2, KRAS, TP53, EGFR, BRAF, GATA3, and FGFR3. Bi-directional sequencing analysis was used to determine the accuracy of the HRM analysis. For the 39 mutations observed in frozen samples, the sensitivity and specificity of HRM analysis were 97% and 87%, respectively. There were 67 mutation/variants in the paraffin-embedded samples, and the sensitivity and specificity for the HRM analysis were 88% and 80%, respectively. Paraffin-embedded samples require higher quantity of purified DNA for high performance. In summary, HRM analysis is a promising moderate-throughput screening test for mutations among known candidate genomic regions. Although the overall accuracy appears to be better in frozen specimens, somatic alterations were detected in DNA extracted from paraffin-embedded samples. PMID:21264207

  13. Somatic mutation of EZH2 (Y641) in follicular and diffuse large B-cell lymphomas of germinal center origin | Office of Cancer Genomics

    Cancer.gov

    Morin et al. describe recurrent somatic mutations in EZH2, a polycomb group oncogene. The mutation, found in the SET domain of this gene encoding a histone methyltransferase, is found only in a subset of lymphoma samples. Specifically, EZH2 mutations are found in about 12% of follicular lymphomas (FL) and almost 23% of diffuse large B-cell lymphomas (DLBCL) of germinal center origin. This paper goes on to demonstrate that altered EZH2 proteins, corresponding to the most frequent mutations found in human lymphomas, have reduced activity using in vitro histone methylation assays.

  14. PIE-1 is a bifunctional protein that regulates maternal and zygotic gene expression in the embryonic germ line of Caenorhabditis elegans

    PubMed Central

    Tenenhaus, Christina; Subramaniam, Kuppuswamy; Dunn, Melanie A.; Seydoux, Geraldine

    2001-01-01

    The CCCH zinc finger protein PIE-1 is an essential regulator of germ cell fate that segregates with the germ lineage during the first cleavages of the Caenorhabditis elegans embryo. We have shown previously that one function of PIE-1 is to inhibit mRNA transcription. Here we show that PIE-1 has a second function in germ cells; it is required for efficient expression of the maternally encoded Nanos homolog NOS-2. This second function is genetically separable from PIE-1's inhibitory effect on transcription. A mutation in PIE-1's second CCCH finger reduces NOS-2 expression without affecting transcriptional repression and causes primordial germ cells to stray away from the somatic gonad, occasionally exiting the embryo entirely. Our results indicate that PIE-1 promotes germ cell fate by two independent mechanisms as follows: (1) inhibition of transcription, which blocks zygotic programs that drive somatic development, and (2) activation of protein expression from nos-2 and possibly other maternal RNAs, which promotes primordial germ cell development. PMID:11316796

  15. Germline mutations and somatic inactivation of TRIM28 in Wilms tumour

    PubMed Central

    Halliday, Benjamin J.; Markie, David M.; Grundy, Richard G.; Ludgate, Jackie L.; Black, Michael A.; Weeks, Robert J.; Catchpoole, Daniel R.; Reeve, Anthony E.

    2018-01-01

    Wilms tumour is a childhood tumour that arises as a consequence of somatic and rare germline mutations, the characterisation of which has refined our understanding of nephrogenesis and carcinogenesis. Here we report that germline loss of function mutations in TRIM28 predispose children to Wilms tumour. Loss of function of this transcriptional co-repressor, which has a role in nephrogenesis, has not previously been associated with cancer. Inactivation of TRIM28, either germline or somatic, occurred through inactivating mutations, loss of heterozygosity or epigenetic silencing. TRIM28-mutated tumours had a monomorphic epithelial histology that is uncommon for Wilms tumour. Critically, these tumours were negative for TRIM28 immunohistochemical staining whereas the epithelial component in normal tissue and other Wilms tumours stained positively. These data, together with a characteristic gene expression profile, suggest that inactivation of TRIM28 provides the molecular basis for defining a previously described subtype of Wilms tumour, that has early age of onset and excellent prognosis. PMID:29912901

  16. Somatic mutation profiles of clear cell endometrial tumors revealed by whole exome and targeted gene sequencing.

    PubMed

    Le Gallo, Matthieu; Rudd, Meghan L; Urick, Mary Ellen; Hansen, Nancy F; Zhang, Suiyuan; Lozy, Fred; Sgroi, Dennis C; Vidal Bel, August; Matias-Guiu, Xavier; Broaddus, Russell R; Lu, Karen H; Levine, Douglas A; Mutch, David G; Goodfellow, Paul J; Salvesen, Helga B; Mullikin, James C; Bell, Daphne W

    2017-09-01

    The molecular pathogenesis of clear cell endometrial cancer (CCEC), a tumor type with a relatively unfavorable prognosis, is not well defined. We searched exome-wide for novel somatically mutated genes in CCEC and assessed the mutational spectrum of known and candidate driver genes in a large cohort of cases. We conducted whole exome sequencing of paired tumor-normal DNAs from 16 cases of CCEC (12 CCECs and the CCEC components of 4 mixed histology tumors). Twenty-two genes-of-interest were Sanger-sequenced from another 47 cases of CCEC. Microsatellite instability (MSI) and microsatellite stability (MSS) were determined by genotyping 5 mononucleotide repeats. Two tumor exomes had relatively high mutational loads and MSI. The other 14 tumor exomes were MSS and had 236 validated nonsynonymous or splice junction somatic mutations among 222 protein-encoding genes. Among the 63 cases of CCEC in this study, we identified frequent somatic mutations in TP53 (39.7%), PIK3CA (23.8%), PIK3R1 (15.9%), ARID1A (15.9%), PPP2R1A (15.9%), SPOP (14.3%), and TAF1 (9.5%), as well as MSI (11.3%). Five of 8 mutations in TAF1, a gene with no known role in CCEC, localized to the putative histone acetyltransferase domain and included 2 recurrently mutated residues. Based on patterns of MSI and mutations in 7 genes, CCEC subsets molecularly resembled serous endometrial cancer (SEC) or endometrioid endometrial cancer (EEC). Our findings demonstrate molecular similarities between CCEC and SEC and EEC and implicate TAF1 as a novel candidate CCEC driver gene. Cancer 2017;123:3261-8. © 2017 American Cancer Society. © 2017 American Cancer Society.

  17. Cancer heterogeneity: converting a limitation into a source of biologic information.

    PubMed

    Rübben, Albert; Araujo, Arturo

    2017-09-08

    Analysis of spatial and temporal genetic heterogeneity in human cancers has revealed that somatic cancer evolution in most cancers is not a simple linear process composed of a few sequential steps of mutation acquisitions and clonal expansions. Parallel evolution has been observed in many early human cancers resulting in genetic heterogeneity as well as multilineage progression. Moreover, aneuploidy as well as structural chromosomal aberrations seems to be acquired in a non-linear, punctuated mode where most aberrations occur at early stages of somatic cancer evolution. At later stages, the cancer genomes seem to get stabilized and acquire only few additional rearrangements. While parallel evolution suggests positive selection of driver mutations at early stages of somatic cancer evolution, stabilization of structural aberrations at later stages suggests that negative selection takes effect when cancer cells progressively lose their tolerance towards additional mutation acquisition. Mixing of genetically heterogeneous subclones in cancer samples reduces sensitivity of mutation detection. Moreover, driver mutations present only in a fraction of cancer cells are more likely to be mistaken for passenger mutations. Therefore, genetic heterogeneity may be considered a limitation negatively affecting detection sensitivity of driver mutations. On the other hand, identification of subclones and subclone lineages in human cancers may lead to a more profound understanding of the selective forces which shape somatic cancer evolution in human cancers. Identification of parallel evolution by analyzing spatial heterogeneity may hint to driver mutations which might represent additional therapeutic targets besides driver mutations present in a monoclonal state. Likewise, stabilization of cancer genomes which can be identified by analyzing temporal genetic heterogeneity might hint to genes and pathways which have become essential for survival of cancer cell lineages at later stages of cancer evolution. These genes and pathways might also constitute patient specific therapeutic targets.

  18. An integrative somatic mutation analysis to identify pathways linked with survival outcomes across 19 cancer types

    PubMed Central

    Park, Sunho; Kim, Seung-Jun; Yu, Donghyeon; Peña-Llopis, Samuel; Gao, Jianjiong; Park, Jin Suk; Chen, Beibei; Norris, Jessie; Wang, Xinlei; Chen, Min; Kim, Minsoo; Yong, Jeongsik; Wardak, Zabi; Choe, Kevin; Story, Michael; Starr, Timothy; Cheong, Jae-Ho; Hwang, Tae Hyun

    2016-01-01

    Motivation: Identification of altered pathways that are clinically relevant across human cancers is a key challenge in cancer genomics. Precise identification and understanding of these altered pathways may provide novel insights into patient stratification, therapeutic strategies and the development of new drugs. However, a challenge remains in accurately identifying pathways altered by somatic mutations across human cancers, due to the diverse mutation spectrum. We developed an innovative approach to integrate somatic mutation data with gene networks and pathways, in order to identify pathways altered by somatic mutations across cancers. Results: We applied our approach to The Cancer Genome Atlas (TCGA) dataset of somatic mutations in 4790 cancer patients with 19 different types of tumors. Our analysis identified cancer-type-specific altered pathways enriched with known cancer-relevant genes and targets of currently available drugs. To investigate the clinical significance of these altered pathways, we performed consensus clustering for patient stratification using member genes in the altered pathways coupled with gene expression datasets from 4870 patients from TCGA, and multiple independent cohorts confirmed that the altered pathways could be used to stratify patients into subgroups with significantly different clinical outcomes. Of particular significance, certain patient subpopulations with poor prognosis were identified because they had specific altered pathways for which there are available targeted therapies. These findings could be used to tailor and intensify therapy in these patients, for whom current therapy is suboptimal. Availability and implementation: The code is available at: http://www.taehyunlab.org. Contact: jhcheong@yuhs.ac or taehyun.hwang@utsouthwestern.edu or taehyun.cs@gmail.com Supplementary information: Supplementary data are available at Bioinformatics online. PMID:26635139

  19. Lung Cancer: One Disease or Many.

    PubMed

    O'Brien, Timothy D; Jia, Peilin; Aldrich, Melinda C; Zhao, Zhongming

    2018-06-05

    Lung cancer is classified as a single entity comprised of multiple histological subtypes. But how similar are these subtypes on a genetic level? This paper aims to address this question through a concise overview of germline and somatic differences between small cell lung cancer, lung adenocarcinoma, and lung squamous cell carcinoma. We reveal the weak overlap found between these 3 lung cancer subtypes using published data from one of the largest germline genetic studies on lung cancer to date and somatic mutation data from Catalogue of Somatic Mutations in Cancer (COSMIC). These data indicate that these 3 subtypes share very little with each other at the genetic level. At the germline SNP level, only 24 independent SNPs from 2 chromosomes were shared across all 3 subtypes. We also demonstrate that only 30 unique cancer-specific mutations overlap the 3 subtypes from COSMIC, and that this is fewer than overlapping mutations chosen at random. Finally, we show that only 3 somatic mutational signatures are shared between these 3 subtypes. This paper highlights that these 3 lung cancer subtypes may be distinct diseases at the genetic level. In the era of precision medicine, we feel that these genomic differences will be of utmost importance in the choice of lung cancer therapy in the future. © 2018 S. Karger AG, Basel.

  20. Transcriptional Noise and Somatic Mutations in the Aging Pancreas.

    PubMed

    Swisa, Avital; Kaestner, Klaus H; Dor, Yuval

    2017-12-05

    The underlying mechanisms and functional significance of pancreatic β cell heterogeneity are an intensive area of investigation. In a recent Cell paper, Enge and colleagues (2017) performed single-cell RNA sequencing of human pancreatic cells and concluded that with age, pancreatic cells become transcriptionally noisy and accumulate somatic mutations. Copyright © 2017. Published by Elsevier Inc.

  1. Somatic mutations of GUCY2F, EPHA3, and NTRK3 in human cancers.

    PubMed

    Wood, Laura D; Calhoun, Eric S; Silliman, Natalie; Ptak, Janine; Szabo, Steve; Powell, Steve M; Riggins, Gregory J; Wang, Tian-Li; Yan, Hai; Gazdar, Adi; Kern, Scott E; Pennacchio, Len; Kinzler, Kenneth W; Vogelstein, Bert; Velculescu, Victor E

    2006-10-01

    Tyrosine kinases are major regulators of signal transduction cascades involved in cellular proliferation and have important roles in tumorigenesis. We have recently analyzed the tyrosine kinase gene family for alterations in human colorectal cancers and identified somatic mutations in seven members of this gene family. In this study we have used high-throughput sequencing approaches to further evaluate this subset of genes for genetic alterations in other human tumors. We identified somatic mutations in GUCY2F, EPHA3, and NTRK3 in breast, lung, and pancreatic cancers. Our results implicate these tyrosine kinase genes in the pathogenesis of other tumor types and suggest that they may be useful targets for diagnostic and therapeutic intervention in selected patients.

  2. EZH2 is required for germinal center formation and somatic EZH2 mutations promote lymphoid transformation

    PubMed Central

    Béguelin, Wendy; Popovic, Relja; Teater, Matt; Jiang, Yanwen; Bunting, Karen L.; Rosen, Monica; Shen, Hao; Yang, Shao Ning; Wang, Ling; Ezponda, Teresa; Martinez-Garcia, Eva; Zhang, Haikuo; Zhang, Yupeng; Verma, Sharad K.; McCabe, Michael T.; Ott, Heidi M.; Van Aller, Glenn S.; Kruger, Ryan G.; Liu, Yan; McHugh, Charles F.; Scott, David W.; Chung, Young Rock; Kelleher, Neil; Shaknovich, Rita; Creasy, Caretha L.; Gascoyne, Randy D.; Wong, Kwok-Kin; Cerchietti, Leandro C.; Levine, Ross L.; Abdel-Wahab, Omar; Licht, Jonathan D.; Elemento, Olivier; Melnick, Ari M.

    2013-01-01

    The EZH2 histone methyltransferase is highly expressed in germinal center (GC) B-cells and targeted by somatic mutations in B-cell lymphomas. Here we find that EZH2 deletion or pharmacologic inhibition suppresses GC formation and functions in mice. EZH2 represses proliferation checkpoint genes and helps establish bivalent chromatin domains at key regulatory loci to transiently suppress GC B-cell differentiation. Somatic mutations reinforce these physiological effects through enhanced silencing of EZH2 targets in B-cells, and in human B-cell lymphomas. Conditional expression of mutant EZH2 in mice induces GC hyperplasia and accelerated lymphomagenesis in cooperation with BCL2. GCB-type DLBCLs are mostly addicted to EZH2, regardless of mutation status, but not the more differentiated ABC-type DLBCLs, thus clarifying the therapeutic scope of EZH2 targeting. PMID:23680150

  3. Detection and Identification of Ciprofloxacin-Resistant Yersinia pestis Denaturing High-Performance Liquid Chromatography

    DTIC Science & Technology

    2003-07-01

    analysis in hereditary breast and ovarian cancers . Hum. Mutat. 14:333– 339. 2. Bauer, A. W., W. M. Kirby, J. C. Sherris, and M. Turck. 1966. Antibiotic...Listeria monocytogenes lineage group classification by MAMA -PCR of the listeriolysin gene. Curr. Microbiol. 43:129–133. 17. Klein, B., G. Weirich...Germline and somatic mutation anal- yses in the DNA mismatch repair gene MLH3: evidence for somatic muta- tion in colorectal cancers . Hum. Mutat. 17:389–396

  4. Construction of a combinatorial pipeline using two somatic variant  calling  methods  for whole exome sequence data of gastric cancer.

    PubMed

    Kohmoto, Tomohiro; Masuda, Kiyoshi; Naruto, Takuya; Tange, Shoichiro; Shoda, Katsutoshi; Hamada, Junichi; Saito, Masako; Ichikawa, Daisuke; Tajima, Atsushi; Otsuji, Eigo; Imoto, Issei

    2017-01-01

    High-throughput next-generation sequencing is a powerful tool to identify the genotypic landscapes of somatic variants and therapeutic targets in various cancers including gastric cancer, forming the basis for personalized medicine in the clinical setting. Although the advent of many computational algorithms leads to higher accuracy in somatic variant calling, no standard method exists due to the limitations of each method. Here, we constructed a new pipeline. We combined two different somatic variant callers with different algorithms, Strelka and VarScan 2, and evaluated performance using whole exome sequencing data obtained from 19 Japanese cases with gastric cancer (GC); then, we characterized these tumors based on identified driver molecular alterations. More single nucleotide variants (SNVs) and small insertions/deletions were detected by Strelka and VarScan 2, respectively. SNVs detected by both tools showed higher accuracy for estimating somatic variants compared with those detected by only one of the two tools and accurately showed the mutation signature and mutations of driver genes reported for GC. Our combinatorial pipeline may have an advantage in detection of somatic mutations in GC and may be useful for further genomic characterization of Japanese patients with GC to improve the efficacy of GC treatments. J. Med. Invest. 64: 233-240, August, 2017.

  5. Genetic Progression of High Grade Prostatic Intraepithelial Neoplasia to Prostate Cancer.

    PubMed

    Jung, Seung-Hyun; Shin, Sun; Kim, Min Sung; Baek, In-Pyo; Lee, Ji Youl; Lee, Sung Hak; Kim, Tae-Min; Lee, Sug Hyung; Chung, Yeun-Jun

    2016-05-01

    Although high grade prostatic intraepithelial neoplasia (HGPIN) is considered a neoplastic lesion that precedes prostate cancer (PCA), the genomic structures of HGPIN remain unknown. Identification of the genomic landscape of HGPIN and the genomic differences between HGPIN and PCA that may drive the progression to PCA. We analyzed 20 regions of paired HGPIN and PCA from six patients using whole-exome sequencing and array-comparative genomic hybridization. Somatic mutation and copy number alteration (CNA) profiles of paired HGPIN and PCA were measured and compared. The number of total mutations and CNAs of HGPINs were significantly fewer than those of PCAs. Mutations in FOXA1 and CNAs (1q and 8q gains) were detected in both HGPIN and PCA ('common'), suggesting their roles in early PCA development. Mutations in SPOP, KDM6A, and KMT2D were 'PCA-specific', suggesting their roles in HGPIN progression to PCA. The 8p loss was either 'common' or 'PCA-specific'. In-silico estimation of evolutionary ages predicted that HGPIN genomes were much younger than PCA genomes. Our data show that PCAs are direct descendants of HGPINs in most cases that require more genomic alterations to progress to PCA. The nature of heterogeneous HGPIN population that might attenuate genomic signals should further be studied. HGPIN genomes harbor relatively fewer mutations and CNAs than PCA but require additional hits for the progression. In this study, we suggest a systemic diagram from high grade prostatic intraepithelial neoplasia (HGPIN) to prostate cancer (PCA). Our results provide a clue to explain the long latency from HGPIN to PCA and provide useful information for the genetic diagnosis of HGPIN and PCA. Copyright © 2015 European Association of Urology. Published by Elsevier B.V. All rights reserved.

  6. Whole-genome sequencing identifies recurrent mutations in chronic lymphocytic leukaemia

    PubMed Central

    Puente, Xose S.; Pinyol, Magda; Quesada, Víctor; Conde, Laura; Ordóñez, Gonzalo R.; Villamor, Neus; Escaramis, Georgia; Jares, Pedro; Beà, Sílvia; González-Díaz, Marcos; Bassaganyas, Laia; Baumann, Tycho; Juan, Manel; López-Guerra, Mónica; Colomer, Dolors; Tubío, José M. C.; López, Cristina; Navarro, Alba; Tornador, Cristian; Aymerich, Marta; Rozman, María; Hernández, Jesús M.; Puente, Diana A.; Freije, José M. P.; Velasco, Gloria; Gutiérrez-Fernández, Ana; Costa, Dolors; Carrió, Anna; Guijarro, Sara; Enjuanes, Anna; Hernández, Lluís; Yagüe, Jordi; Nicolás, Pilar; Romeo-Casabona, Carlos M.; Himmelbauer, Heinz; Castillo, Ester; Dohm, Juliane C.; de Sanjosé, Silvia; Piris, Miguel A.; de Alava, Enrique; Miguel, Jesús San; Royo, Romina; Gelpí, Josep L.; Torrents, David; Orozco, Modesto; Pisano, David G.; Valencia, Alfonso; Guigó, Roderic; Bayés, Mónica; Heath, Simon; Gut, Marta; Klatt, Peter; Marshall, John; Raine, Keiran; Stebbings, Lucy A.; Futreal, P. Andrew; Stratton, Michael R.; Campbell, Peter J.; Gut, Ivo; López-Guillermo, Armando; Estivill, Xavier; Montserrat, Emili; López-Otín, Carlos; Campo, Elías

    2012-01-01

    Chronic lymphocytic leukaemia (CLL), the most frequent leukaemia in adults in Western countries, is a heterogeneous disease with variable clinical presentation and evolution1,2. Two major molecular subtypes can be distinguished, characterized respectively by a high or low number of somatic hypermutations in the variable region of immunoglobulin genes3,4. The molecular changes leading to the pathogenesis of the disease are still poorly understood. Here we performed whole-genome sequencing of four cases of CLL and identified 46 somatic mutations that potentially affect gene function. Further analysis of these mutations in 363 patients with CLL identified four genes that are recurrently mutated: notch 1 (NOTCH1), exportin 1 (XPO1), myeloid differentiation primary response gene 88 (MYD88) and kelch-like 6 (KLHL6). Mutations in MYD88 and KLHL6 are predominant in cases of CLL with mutated immunoglobulin genes, whereas NOTCH1 and XPO1 mutations are mainly detected in patients with unmutated immunoglobulins. The patterns of somatic mutation, supported by functional and clinical analyses, strongly indicate that the recurrent NOTCH1, MYD88 and XPO1 mutations are oncogenic changes that contribute to the clinical evolution of the disease. To our knowledge, this is the first comprehensive analysis of CLL combining whole-genome sequencing with clinical characteristics and clinical outcomes. It highlights the usefulness of this approach for the identification of clinically relevant mutations in cancer. PMID:21642962

  7. Mutations in epigenetic regulators including SETD2 are gained during relapse in paediatric acute lymphoblastic leukaemia.

    PubMed

    Mar, Brenton G; Bullinger, Lars B; McLean, Kathleen M; Grauman, Peter V; Harris, Marian H; Stevenson, Kristen; Neuberg, Donna S; Sinha, Amit U; Sallan, Stephen E; Silverman, Lewis B; Kung, Andrew L; Lo Nigro, Luca; Ebert, Benjamin L; Armstrong, Scott A

    2014-03-24

    Relapsed paediatric acute lymphoblastic leukaemia (ALL) has high rates of treatment failure. Epigenetic regulators have been proposed as modulators of chemoresistance, here, we sequence genes encoding epigenetic regulators in matched diagnosis-remission-relapse ALL samples. We find significant enrichment of mutations in epigenetic regulators at relapse with recurrent somatic mutations in SETD2, CREBBP, MSH6, KDM6A and MLL2, mutations in signalling factors are not enriched. Somatic alterations in SETD2, including frameshift and nonsense mutations, are present at 12% in a large de novo ALL patient cohort. We conclude that the enrichment of mutations in epigenetic regulators at relapse is consistent with a role in mediating therapy resistance.

  8. Cis-regulatory somatic mutations and gene-expression alteration in B-cell lymphomas.

    PubMed

    Mathelier, Anthony; Lefebvre, Calvin; Zhang, Allen W; Arenillas, David J; Ding, Jiarui; Wasserman, Wyeth W; Shah, Sohrab P

    2015-04-23

    With the rapid increase of whole-genome sequencing of human cancers, an important opportunity to analyze and characterize somatic mutations lying within cis-regulatory regions has emerged. A focus on protein-coding regions to identify nonsense or missense mutations disruptive to protein structure and/or function has led to important insights; however, the impact on gene expression of mutations lying within cis-regulatory regions remains under-explored. We analyzed somatic mutations from 84 matched tumor-normal whole genomes from B-cell lymphomas with accompanying gene expression measurements to elucidate the extent to which these cancers are disrupted by cis-regulatory mutations. We characterize mutations overlapping a high quality set of well-annotated transcription factor binding sites (TFBSs), covering a similar portion of the genome as protein-coding exons. Our results indicate that cis-regulatory mutations overlapping predicted TFBSs are enriched in promoter regions of genes involved in apoptosis or growth/proliferation. By integrating gene expression data with mutation data, our computational approach culminates with identification of cis-regulatory mutations most likely to participate in dysregulation of the gene expression program. The impact can be measured along with protein-coding mutations to highlight key mutations disrupting gene expression and pathways in cancer. Our study yields specific genes with disrupted expression triggered by genomic mutations in either the coding or the regulatory space. It implies that mutated regulatory components of the genome contribute substantially to cancer pathways. Our analyses demonstrate that identifying genomically altered cis-regulatory elements coupled with analysis of gene expression data will augment biological interpretation of mutational landscapes of cancers.

  9. Somatic mutations reveal asymmetric cellular dynamics in the early human embryo

    DOE PAGES

    Ju, Young Seok; Martincorena, Inigo; Gerstung, Moritz; ...

    2017-03-22

    Somatic cells acquire mutations throughout the course of an individual’s life. Mutations occurring early in embryogenesis are often present in a substantial proportion of, but not all, cells in postnatal humans and thus have particular characteristics and effects. Depending on their location in the genome and the proportion of cells they are present in, these mosaic mutations can cause a wide range of genetic disease syndromes and predispose carriers to cancer. They have a high chance of being transmitted to offspring as de novo germline mutations and, in principle, can provide insights into early human embryonic cell lineages and theirmore » contributions to adult tissues. Although it is known that gross chromosomal abnormalities are remarkably common in early human embryos, our understanding of early embryonic somatic mutations is very limited. Here we use whole-genome sequences of normal blood from 241 adults to identify 163 early embryonic mutations. We estimate that approximately three base substitution mutations occur per cell per cell-doubling event in early human embryogenesis and these are mainly attributable to two known mutational signatures. We used the mutations to reconstruct developmental lineages of adult cells and demonstrate that the two daughter cells of many early embryonic cell-doubling events contribute asymmetrically to adult blood at an approximately 2:1 ratio. As a result, this study therefore provides insights into the mutation rates, mutational processes and developmental outcomes of cell dynamics that operate during early human embryogenesis.« less

  10. Somatic mutations reveal asymmetric cellular dynamics in the early human embryo

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ju, Young Seok; Martincorena, Inigo; Gerstung, Moritz

    Somatic cells acquire mutations throughout the course of an individual’s life. Mutations occurring early in embryogenesis are often present in a substantial proportion of, but not all, cells in postnatal humans and thus have particular characteristics and effects. Depending on their location in the genome and the proportion of cells they are present in, these mosaic mutations can cause a wide range of genetic disease syndromes and predispose carriers to cancer. They have a high chance of being transmitted to offspring as de novo germline mutations and, in principle, can provide insights into early human embryonic cell lineages and theirmore » contributions to adult tissues. Although it is known that gross chromosomal abnormalities are remarkably common in early human embryos, our understanding of early embryonic somatic mutations is very limited. Here we use whole-genome sequences of normal blood from 241 adults to identify 163 early embryonic mutations. We estimate that approximately three base substitution mutations occur per cell per cell-doubling event in early human embryogenesis and these are mainly attributable to two known mutational signatures. We used the mutations to reconstruct developmental lineages of adult cells and demonstrate that the two daughter cells of many early embryonic cell-doubling events contribute asymmetrically to adult blood at an approximately 2:1 ratio. As a result, this study therefore provides insights into the mutation rates, mutational processes and developmental outcomes of cell dynamics that operate during early human embryogenesis.« less

  11. Maturation of Shark Single-Domain (IgNAR) Antibodies: Evidence for Induced-Fit Binding

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stanfield, R.L.; Dooley, H.; Verdino, P.

    2007-07-13

    Sharks express an unusual heavy-chain isotype called IgNAR, whose variable regions bind antigen as independent soluble domains. To further probe affinity maturation of the IgNAR response, we structurally characterized the germline and somatically matured versions of a type II variable (V) region, both in the presence and absence of its antigen, hen egg-white lysozyme. Despite a disulfide bond linking complementarity determining regions (CDRs) 1 and 3, both germline and somatically matured V regions displayed significant structural changes in these CDRs upon complex formation with antigen. Somatic mutations in the IgNAR V region serve to increase the number of contacts withmore » antigen, as reflected by a tenfold increase in affinity, and one of these mutations appears to stabilize the CDR3 region. In addition, a residue in the HV4 loop plays an important role in antibody-antigen interaction, consistent with the high rate of somatic mutations in this non-CDR loop.« less

  12. Somatic mutations in the transcriptional corepressor gene BCORL1 in adult acute myelogenous leukemia.

    PubMed

    Li, Meng; Collins, Roxane; Jiao, Yuchen; Ouillette, Peter; Bixby, Dale; Erba, Harry; Vogelstein, Bert; Kinzler, Kenneth W; Papadopoulos, Nickolas; Malek, Sami N

    2011-11-24

    To further our understanding of the genetic basis of acute myelogenous leukemia (AML), we determined the coding exon sequences of ∼ 18 000 protein-encoding genes in 8 patients with secondary AML. Here we report the discovery of novel somatic mutations in the transcriptional corepressor gene BCORL1 that is located on the X-chromosome. Analysis of BCORL1 in an unselected cohort of 173 AML patients identified a total of 10 mutated cases (6%) with BCORL1 mutations, whereas analysis of 19 AML cell lines uncovered 4 (21%) BCORL1 mutated cell lines. The majority (87%) of the mutations in BCORL1 were predicted to inactivate the gene product as a result of nonsense mutations, splice site mutation, or out-of-frame insertions or deletions. These results indicate that BCORL1 by genetic criteria is a novel candidate tumor suppressor gene, joining the growing list of genes recurrently mutated in AML.

  13. The topography of mutational processes in breast cancer genomes.

    PubMed

    Morganella, Sandro; Alexandrov, Ludmil B; Glodzik, Dominik; Zou, Xueqing; Davies, Helen; Staaf, Johan; Sieuwerts, Anieta M; Brinkman, Arie B; Martin, Sancha; Ramakrishna, Manasa; Butler, Adam; Kim, Hyung-Yong; Borg, Åke; Sotiriou, Christos; Futreal, P Andrew; Campbell, Peter J; Span, Paul N; Van Laere, Steven; Lakhani, Sunil R; Eyfjord, Jorunn E; Thompson, Alastair M; Stunnenberg, Hendrik G; van de Vijver, Marc J; Martens, John W M; Børresen-Dale, Anne-Lise; Richardson, Andrea L; Kong, Gu; Thomas, Gilles; Sale, Julian; Rada, Cristina; Stratton, Michael R; Birney, Ewan; Nik-Zainal, Serena

    2016-05-02

    Somatic mutations in human cancers show unevenness in genomic distribution that correlate with aspects of genome structure and function. These mutations are, however, generated by multiple mutational processes operating through the cellular lineage between the fertilized egg and the cancer cell, each composed of specific DNA damage and repair components and leaving its own characteristic mutational signature on the genome. Using somatic mutation catalogues from 560 breast cancer whole-genome sequences, here we show that each of 12 base substitution, 2 insertion/deletion (indel) and 6 rearrangement mutational signatures present in breast tissue, exhibit distinct relationships with genomic features relating to transcription, DNA replication and chromatin organization. This signature-based approach permits visualization of the genomic distribution of mutational processes associated with APOBEC enzymes, mismatch repair deficiency and homologous recombinational repair deficiency, as well as mutational processes of unknown aetiology. Furthermore, it highlights mechanistic insights including a putative replication-dependent mechanism of APOBEC-related mutagenesis.

  14. Whole-Exome Sequencing Study of Thyrotropin-Secreting Pituitary Adenomas.

    PubMed

    Sapkota, Santosh; Horiguchi, Kazuhiko; Tosaka, Masahiko; Yamada, Syozo; Yamada, Masanobu

    2017-02-01

    Thyrotropin (TSH)-secreting pituitary adenomas (TSHomas) are a rare cause of hyperthyroidism, and the genetic aberrations responsible remain unknown. To identify somatic genetic abnormalities in TSHomas. A single-nucleotide polymorphism (SNP) array analysis was performed on 8 TSHomas. Four tumors with no allelic losses or limited loss of heterozygosity were selected, and whole-exome sequencing was performed, including their corresponding blood samples. Somatic variants were confirmed by Sanger sequencing. A set of 8 tumors was also assessed to validate candidate genes. Twelve patients with sporadic TSHomas were examined. The overall performance of whole-exome sequencing was good, with an average coverage of each base in the targeted region of 97.6%. Six DNA variants were confirmed as candidate driver mutations, with an average of 1.5 somatic mutations per tumor. No mutations were recurrent. Two of these mutations were found in genes with an established role in malignant tumorigenesis (SMOX and SYTL3), and 4 had unknown roles (ZSCAN23, ASTN2, R3HDM2, and CWH43). Similarly, an SNP array analysis revealed frequent chromosomal regions of copy number gains, including recurrent gains at loci harboring 4 of these 6 genes. Several candidate somatic mutations and changes in copy numbers for TSHomas were identified. The results showed no recurrence of mutations in the tumors studied but a low number of mutations, thereby highlighting their benign nature. Further studies on a larger cohort of TSHomas, along with the use of epigenetic and transcriptomic approaches, may reveal the underlying genetic lesions. Copyright © 2017 by the Endocrine Society

  15. Germline and somatic polymerase ε and δ mutations define a new class of hypermutated colorectal and endometrial cancers

    PubMed Central

    Briggs, Sarah; Tomlinson, Ian

    2013-01-01

    Polymerases ϵ and δ are the main enzymes that replicate eukaryotic DNA. Accurate replication occurs through Watson–Crick base pairing and also through the action of the polymerases' exonuclease (proofreading) domains. We have recently shown that germline exonuclease domain mutations (EDMs) of POLE and POLD1 confer a high risk of multiple colorectal adenomas and carcinoma (CRC). POLD1 mutations also predispose to endometrial cancer (EC). These mutations are associated with high penetrance and dominant inheritance, although the phenotype can be variable. We have named the condition polymerase proofreading-associated polyposis (PPAP). Somatic POLE EDMs have also been found in sporadic CRCs and ECs, although very few somatic POLD1 EDMs have been detected. Both the germline and the somatic DNA polymerase EDMs cause an ‘ultramutated’, apparently microsatellite-stable, type of cancer, sometimes leading to over a million base substitutions per tumour. Here, we present the evidence for POLE and POLD1 as important contributors to the pathogenesis of CRC and EC, and highlight some of the key questions in this emerging field. Copyright © 2013 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd PMID:23447401

  16. Neurofibromin Deficiency-Associated Transcriptional Dysregulation Suggests a Novel Therapy for Tibial Pseudoarthrosis in NF1

    PubMed Central

    Paria, Nandina; Cho, Tae-Joon; Choi, In Ho; Kamiya, Nobuhiro; Kayembe, Kay; Mao, Rong; Margraf, Rebecca L.; Obermosser, Gerlinde; Oxendine, Ila; Sant, David W.; Song, Mi Hyun; Stevenson, David A.; Viskochil, David H.; Wise, Carol A.; Kim, Harry K.W.; Rios, Jonathan J

    2014-01-01

    Neurofibromatosis type 1 (NF1) is an autosomal dominant disease caused by mutations in NF1. Among the earliest manifestations is tibial pseudoarthrosis and persistent nonunion after fracture. To further understand the pathogenesis of pseudoarthrosis and the underlying bone remodeling defect, pseudoarthrosis tissue and cells cultured from surgically resected pseudoarthrosis tissue from NF1 individuals were analyzed using whole-exome and whole-transcriptome sequencing as well as genomewide microarray analysis. Genomewide analysis identified multiple genetic mechanisms resulting in somatic bi-allelic NF1 inactivation; no other genes with recurring somatic mutations were identified. Gene expression profiling identified dysregulated pathways associated with neurofibromin deficiency, including phosphoinosital-3-kinase (PI3K) and mitogen-activated protein kinase (MAPK) signaling pathways. Unlike aggressive NF1-associated malignancies, tibial pseudoarthrosis tissue does not harbor a high frequency of somatic mutations in oncogenes or other tumor-suppressor genes, such as p53. However, gene expression profiling indicates pseudoarthrosis tissue has a tumor-promoting transcriptional pattern, despite lacking tumorigenic somatic mutations. Significant over-expression of specific cancer-associated genes in pseudoarthrosis highlights a potential for receptor tyrosine kinase inhibitors to target neurofibromin-deficient pseudoarthrosis and promote proper bone remodeling and fracture healing. PMID:24932921

  17. Prevalence of somatic mitochondrial mutations and spatial distribution of mitochondria in non-small cell lung cancer.

    PubMed

    Kazdal, Daniel; Harms, Alexander; Endris, Volker; Penzel, Roland; Kriegsmann, Mark; Eichhorn, Florian; Muley, Thomas; Stenzinger, Albrecht; Pfarr, Nicole; Weichert, Wilko; Warth, Arne

    2017-07-11

    Mitochondria are considered relevant players in many tumour entities and first data indicate beneficial effects of mitochondria-targeted antioxidants in both cancer prevention and anticancer therapies. To further dissect the potential roles of mitochondria in NSCLC we comprehensively analysed somatic mitochondrial mutations, determined the spatial distribution of mitochondrial DNA within complete tumour sections and investigated the mitochondrial load in a large-scale approach. Whole mitochondrial genome sequencing of 26 matched tumour and non-neoplastic tissue samples extended by reviewing published data of 326 cases. Systematical stepwise real-time PCR quantification of mitochondrial DNA covering 16 whole surgical tumour sections. Immunohistochemical determination of the mitochondrial load in 171 adenocarcinoma and 145 squamous cell carcinoma. Our results demonstrate very low recurrences (max. 1.7%) and a broad distribution of 456 different somatic mitochondrial mutations. Large inter- and intra-tumour heterogeneity were seen for mitochondrial DNA copy numbers in conjunction with a correlation to the predominant histological growth pattern. Furthermore, tumour cells had significantly higher mitochondrial level compared to adjacent stroma, whereas differences between tumour entities were negligible. Non-evident somatic mitochondrial mutations and highly varying mitochondrial DNA level delineate challenges for the approach of mitochondria-targeted anticancer therapies in NSCLC.

  18. Recurrent Somatic PDGFRB Mutations in Sporadic Infantile/Solitary Adult Myofibromas But Not in Angioleiomyomas and Myopericytomas.

    PubMed

    Agaimy, Abbas; Bieg, Matthias; Michal, Michael; Geddert, Helene; Märkl, Bruno; Seitz, Jan; Moskalev, Evgeny A; Schlesner, Matthias; Metzler, Markus; Hartmann, Arndt; Wiemann, Stefan; Michal, Michal; Mentzel, Thomas; Haller, Florian

    2017-02-01

    Infantile myofibroma (MF) is an uncommon benign myofibroblastic tumor of infancy and childhood. Solitary adult MF shares similar features with infantile MF. The lesions occur in 3 clinicopathologic settings: solitary, multicentric, and generalized and can be either sporadic or familial. Traditionally, infantile MF has been included in the spectrum of infantile hemangiopericytoma. The recent World Health Organization classification listed MF, angioleiomyoma, and myopericytoma under the general heading of perivascular tumors in the sense of a morphologic spectrum of perivascular myoid cell neoplasms. Although activating germline PDGFRB mutations have recently been linked to familial infantile MF, the molecular pathogenesis of sporadic infantile and adult solitary MF remained unclear. In this study, we analyzed 25 solitary MFs without evidence of familial disease (9 infantile and 16 adult MFs) to address the question whether somatic PDGFRB mutations might be responsible for the sporadic form of the disease. Given the presumed histogenetic link of MF to myopericytoma and angioleiomyoma, we additionally analyzed a control group of 6 myopericytomas and 9 angioleiomyomas for PDGFRB mutations. We detected PDGFRB mutations in 6/8 (75%) analyzable infantile and in 11/16 (69%) adult MFs but in none of the angioleiomyomas or myopericytomas. In 2 infantile MFs, additional sequencing of the germline confirmed the somatic nature of PDGFRB mutations. To our knowledge, this is the first study reporting apparently somatic recurrent PDGFRB mutations as molecular driver events in the majority of sporadic infantile and adult solitary MFs. Our results suggest molecular distinctness of MF as compared with angioleiomyoma/myopericytoma. Investigation of more cases including those with atypical and worrisome features, as well as other mimickers in the heterogenous morphologic spectrum of MF, is mandatory for validating the potential diagnostic value of PDGFRB mutation testing as a possible surrogate in difficult-to-classify lesions.

  19. Oncogenetic tree model of somatic mutations and DNA methylation in colon tumors.

    PubMed

    Sweeney, Carol; Boucher, Kenneth M; Samowitz, Wade S; Wolff, Roger K; Albertsen, Hans; Curtin, Karen; Caan, Bette J; Slattery, Martha L

    2009-01-01

    Our understanding of somatic alterations in colon cancer has evolved from a concept of a series of events taking place in a single sequence to a recognition of multiple pathways. An oncogenetic tree is a model intended to describe the pathways and sequence of somatic alterations in carcinogenesis without assuming that tumors will fall in mutually exclusive categories. We applied this model to data on colon tumor somatic alterations. An oncogenetic tree model was built using data on mutations of TP53, KRAS2, APC, and BRAF genes, methylation at CpG sites of MLH1 and TP16 genes, methylation in tumor (MINT) markers, and microsatellite instability (MSI) for 971 colon tumors from a population-based series. Oncogenetic tree analysis resulted in a reproducible tree with three branches. The model represents methylation of MINT markers as initiating a branch and predisposing to MSI, methylation of MHL1 and TP16, and BRAF mutation. APC mutation is the first alteration in an independent branch and is followed by TP53 mutation. KRAS2 mutation was placed a third independent branch, implying that it neither depends on, nor predisposes to, the other alterations. Individual tumors were observed to have alteration patterns representing every combination of one, two, or all three branches. The oncogenetic tree model assumptions are appropriate for the observed heterogeneity of colon tumors, and the model produces a useful visual schematic of the sequence of events in pathways of colon carcinogenesis.

  20. The clonal and mutational evolution spectrum of primary triple-negative breast cancers.

    PubMed

    Shah, Sohrab P; Roth, Andrew; Goya, Rodrigo; Oloumi, Arusha; Ha, Gavin; Zhao, Yongjun; Turashvili, Gulisa; Ding, Jiarui; Tse, Kane; Haffari, Gholamreza; Bashashati, Ali; Prentice, Leah M; Khattra, Jaswinder; Burleigh, Angela; Yap, Damian; Bernard, Virginie; McPherson, Andrew; Shumansky, Karey; Crisan, Anamaria; Giuliany, Ryan; Heravi-Moussavi, Alireza; Rosner, Jamie; Lai, Daniel; Birol, Inanc; Varhol, Richard; Tam, Angela; Dhalla, Noreen; Zeng, Thomas; Ma, Kevin; Chan, Simon K; Griffith, Malachi; Moradian, Annie; Cheng, S-W Grace; Morin, Gregg B; Watson, Peter; Gelmon, Karen; Chia, Stephen; Chin, Suet-Feung; Curtis, Christina; Rueda, Oscar M; Pharoah, Paul D; Damaraju, Sambasivarao; Mackey, John; Hoon, Kelly; Harkins, Timothy; Tadigotla, Vasisht; Sigaroudinia, Mahvash; Gascard, Philippe; Tlsty, Thea; Costello, Joseph F; Meyer, Irmtraud M; Eaves, Connie J; Wasserman, Wyeth W; Jones, Steven; Huntsman, David; Hirst, Martin; Caldas, Carlos; Marra, Marco A; Aparicio, Samuel

    2012-04-04

    Primary triple-negative breast cancers (TNBCs), a tumour type defined by lack of oestrogen receptor, progesterone receptor and ERBB2 gene amplification, represent approximately 16% of all breast cancers. Here we show in 104 TNBC cases that at the time of diagnosis these cancers exhibit a wide and continuous spectrum of genomic evolution, with some having only a handful of coding somatic aberrations in a few pathways, whereas others contain hundreds of coding somatic mutations. High-throughput RNA sequencing (RNA-seq) revealed that only approximately 36% of mutations are expressed. Using deep re-sequencing measurements of allelic abundance for 2,414 somatic mutations, we determine for the first time-to our knowledge-in an epithelial tumour subtype, the relative abundance of clonal frequencies among cases representative of the population. We show that TNBCs vary widely in their clonal frequencies at the time of diagnosis, with the basal subtype of TNBC showing more variation than non-basal TNBC. Although p53 (also known as TP53), PIK3CA and PTEN somatic mutations seem to be clonally dominant compared to other genes, in some tumours their clonal frequencies are incompatible with founder status. Mutations in cytoskeletal, cell shape and motility proteins occurred at lower clonal frequencies, suggesting that they occurred later during tumour progression. Taken together, our results show that understanding the biology and therapeutic responses of patients with TNBC will require the determination of individual tumour clonal genotypes.

  1. Multilineage somatic activating mutations in HRAS and NRAS cause mosaic cutaneous and skeletal lesions, elevated FGF23 and hypophosphatemia

    PubMed Central

    Lim, Young H.; Ovejero, Diana; Sugarman, Jeffrey S.; DeKlotz, Cynthia M.C.; Maruri, Ann; Eichenfield, Lawrence F.; Kelley, Patrick K.; Jüppner, Harald; Gottschalk, Michael; Tifft, Cynthia J.; Gafni, Rachel I.; Boyce, Alison M.; Cowen, Edward W.; Bhattacharyya, Nisan; Guthrie, Lori C.; Gahl, William A.; Golas, Gretchen; Loring, Erin C.; Overton, John D.; Mane, Shrikant M.; Lifton, Richard P.; Levy, Moise L.; Collins, Michael T.; Choate, Keith A.

    2014-01-01

    Pathologically elevated serum levels of fibroblast growth factor-23 (FGF23), a bone-derived hormone that regulates phosphorus homeostasis, result in renal phosphate wasting and lead to rickets or osteomalacia. Rarely, elevated serum FGF23 levels are found in association with mosaic cutaneous disorders that affect large proportions of the skin and appear in patterns corresponding to the migration of ectodermal progenitors. The cause and source of elevated serum FGF23 is unknown. In those conditions, such as epidermal and large congenital melanocytic nevi, skin lesions are variably associated with other abnormalities in the eye, brain and vasculature. The wide distribution of involved tissues and the appearance of multiple segmental skin and bone lesions suggest that these conditions result from early embryonic somatic mutations. We report five such cases with elevated serum FGF23 and bone lesions, four with large epidermal nevi and one with a giant congenital melanocytic nevus. Exome sequencing of blood and affected skin tissue identified somatic activating mutations of HRAS or NRAS in each case without recurrent secondary mutation, and we further found that the same mutation is present in dysplastic bone. Our finding of somatic activating RAS mutation in bone, the endogenous source of FGF23, provides the first evidence that elevated serum FGF23 levels, hypophosphatemia and osteomalacia are associated with pathologic Ras activation and may provide insight in the heretofore limited understanding of the regulation of FGF23. PMID:24006476

  2. Multilineage somatic activating mutations in HRAS and NRAS cause mosaic cutaneous and skeletal lesions, elevated FGF23 and hypophosphatemia.

    PubMed

    Lim, Young H; Ovejero, Diana; Sugarman, Jeffrey S; Deklotz, Cynthia M C; Maruri, Ann; Eichenfield, Lawrence F; Kelley, Patrick K; Jüppner, Harald; Gottschalk, Michael; Tifft, Cynthia J; Gafni, Rachel I; Boyce, Alison M; Cowen, Edward W; Bhattacharyya, Nisan; Guthrie, Lori C; Gahl, William A; Golas, Gretchen; Loring, Erin C; Overton, John D; Mane, Shrikant M; Lifton, Richard P; Levy, Moise L; Collins, Michael T; Choate, Keith A

    2014-01-15

    Pathologically elevated serum levels of fibroblast growth factor-23 (FGF23), a bone-derived hormone that regulates phosphorus homeostasis, result in renal phosphate wasting and lead to rickets or osteomalacia. Rarely, elevated serum FGF23 levels are found in association with mosaic cutaneous disorders that affect large proportions of the skin and appear in patterns corresponding to the migration of ectodermal progenitors. The cause and source of elevated serum FGF23 is unknown. In those conditions, such as epidermal and large congenital melanocytic nevi, skin lesions are variably associated with other abnormalities in the eye, brain and vasculature. The wide distribution of involved tissues and the appearance of multiple segmental skin and bone lesions suggest that these conditions result from early embryonic somatic mutations. We report five such cases with elevated serum FGF23 and bone lesions, four with large epidermal nevi and one with a giant congenital melanocytic nevus. Exome sequencing of blood and affected skin tissue identified somatic activating mutations of HRAS or NRAS in each case without recurrent secondary mutation, and we further found that the same mutation is present in dysplastic bone. Our finding of somatic activating RAS mutation in bone, the endogenous source of FGF23, provides the first evidence that elevated serum FGF23 levels, hypophosphatemia and osteomalacia are associated with pathologic Ras activation and may provide insight in the heretofore limited understanding of the regulation of FGF23.

  3. Novel somatic KIT exon 8 mutation with dramatic response to imatinib in a patient with mucosal melanoma: a case report.

    PubMed

    Rapisuwon, Suthee; Parks, Kellie; Al-Refaie, Waddah; Atkins, Michael B

    2014-10-01

    Primary mucosal melanomas represent ∼1.3% of all cases of melanoma diagnosed in the USA. The sinonasal location is the most common primary site. Mutations in the KIT gene occur in 10-22% of mucosal melanomas. Tumor response to imatinib mesylate has been reported in about half of the patients with tumors harboring KIT mutations. Responses are almost exclusively restricted to tumors with mutations in KIT exon 9 or 11. We report a case of a patient with a sinonasal mucosal melanoma with a novel exon 8 mutation (C443S) who had marked initial response to imatinib. Somatic exon 8 KIT mutations have not been previously reported in mucosal melanoma or in other human solid tumors; however, such mutations have been reported in canine and feline mast cell tumors. Protein transcripts from exon 8 play an important role in the structural and functional integrity of the extracellular domain of KIT. In preclinical studies, a mutation in exon 8 led to autophosphorylation, independent of KIT ligand, and constitutive activation of the tyrosine kinase. This biology may explain the successful application of imatinib in animals with tumors harboring exon 8 KIT mutations and in our patient with mucosal melanoma. This report expands the population of patients with melanoma who might benefit from imatinib to those with somatic exon 8 KIT mutations. Such mutations should be looked for in patients with mucosal melanoma.

  4. Correlation of RET somatic mutations with clinicopathological features in sporadic medullary thyroid carcinomas

    PubMed Central

    Moura, M M; Cavaco, B M; Pinto, A E; Domingues, R; Santos, J R; Cid, M O; Bugalho, M J; Leite, V

    2009-01-01

    Screening of REarranged during Transfection (RET) gene mutations has been carried out in different series of sporadic medullary thyroid carcinomas (MTC). RET-positive tumours seem to be associated to a worse clinical outcome. However, the correlation between the type of RET mutation and the patients' clinicopathological data has not been evaluated yet. We analysed RET exons 5, 8, 10–16 in fifty-one sporadic MTC, and found somatic mutations in thirty-three (64.7%) tumours. Among the RET-positive cases, exon 16 was the most frequently affected (60.6%). Two novel somatic mutations (Cys630Gly, c.1881del18) were identified. MTC patients were divided into three groups: group 1, with mutations in RET exons 15 and 16; group 2, with other RET mutations; group 3, having no RET mutations. Group 1 had higher prevalence (P=0.0051) and number of lymph node metastases (P=0.0017), and presented more often multifocal tumours (P=0.037) and persistent disease at last control (P=0.0242) than group 2. Detectable serum calcitonin levels at last screening (P=0.0119) and stage IV disease (P=0.0145) were more frequent in group 1, than in the other groups. Our results suggest that, among the sporadic MTC, cases with RET mutations in exons 15 and 16 are associated with the worst prognosis. Cases with other RET mutations have the most indolent course, and those with no RET mutations have an intermediate risk. PMID:19401695

  5. IgV(H) and bcl6 somatic mutation analysis reveals the heterogeneity of cutaneous B-cell lymphoma, and indicates the presence of undisclosed local antigens.

    PubMed

    Franco, Renato; Camacho, Francisca I; Fernández-Vázquez, Amalia; Algara, Patrocinio; Rodríguez-Peralto, José L; De Rosa, Gaetano; Piris, Miguel A

    2004-06-01

    Our understanding of the ontology of B-cell lymphomas (BCL) has been improved by the study of mutational status of IgV(H) and bcl6 genes, but only a few cases of cutaneous BCL have been examined for this status. We analyzed IgV(H) and bcl6 somatic mutations in 10 cutaneous BCL, classified as follicular (three primary and one secondary), primary marginal zone (two cases), and diffuse large BCL (three primary and one secondary). We observed a lower rate (<2%) of IgV(H) mutation in all marginal zone lymphomas, and a preferential usage of V(H)2-70 (one primary follicular and two primary diffuse large BCL). Fewer than expected replacement mutations in framework regions (FR) were observed in three primary follicular lymphomas (FLs) and in all diffuse large BCL, indicating a negative antigen selection pressure. Ongoing mutations were observed in eight of 10 cases. Only two primary FLs and two diffuse large BCL showed bcl6 somatic mutation. These data support the heterogeneous nature of the different cutaneous BCL, and specifically the distinction between cutaneous follicular and marginal zone lymphomas. The biased usage of V(H)2-70, the low rate of replacement mutation in the FR, and the presence of ongoing mutation imply that local antigens could modulate the growth of primary cutaneous BCL.

  6. DNA polymerase θ contributes to the generation of C/G mutations during somatic hypermutation of Ig genes

    PubMed Central

    Masuda, Keiji; Ouchida, Rika; Takeuchi, Arata; Saito, Takashi; Koseki, Haruhiko; Kawamura, Kiyoko; Tagawa, Masatoshi; Tokuhisa, Takeshi; Azuma, Takachika; O-Wang, Jiyang

    2005-01-01

    Somatic hypermutation of Ig variable region genes is initiated by activation-induced cytidine deaminase; however, the activity of multiple DNA polymerases is required to ultimately introduce mutations. DNA polymerase η (Polη) has been implicated in mutations at A/T, but polymerases involved in C/G mutations have not been identified. We have generated mutant mice expressing DNA polymerase (Polθ) specifically devoid of polymerase activity. Compared with WT mice, Polq-inactive (Polq, the gene encoding Polθ) mice exhibited a reduced level of serum IgM and IgG1. The mutant mice mounted relatively normal primary and secondary immune responses to a T-dependent antigen, but the production of high-affinity specific antibodies was partially impaired. Analysis of the JH4 intronic sequences revealed a slight reduction in the overall mutation frequency in Polq-inactive mice. Remarkably, although mutations at A/T were unaffected, mutations at C/G were significantly decreased, indicating an important, albeit not exclusive, role for Polθ activity. The reduction of C/G mutations was particularly focused on the intrinsic somatic hypermutation hotspots and both transitions and transversions were similarly reduced. These findings, together with the recent observation that Polθ efficiently catalyzes the bypass of abasic sites, lead us to propose that Polθ introduces mutations at C/G by replicating over abasic sites generated via uracil-DNA glycosylase. PMID:16172387

  7. Molecular characterization of circulating colorectal tumor cells defines genetic signatures for individualized cancer care.

    PubMed

    Kong, Say Li; Liu, Xingliang; Suhaimi, Nur-Afidah Mohamed; Koh, Kenneth Jia Hao; Hu, Min; Lee, Daniel Yoke San; Cima, Igor; Phyo, Wai Min; Lee, Esther Xing Wei; Tai, Joyce A; Foong, Yu Miin; Vo, Jess Honganh; Koh, Poh Koon; Zhang, Tong; Ying, Jackie Y; Lim, Bing; Tan, Min-Han; Hillmer, Axel M

    2017-09-15

    Studies on circulating tumor cells (CTCs) have largely focused on platform development and CTC enumeration rather than on the genomic characterization of CTCs. To address this, we performed targeted sequencing of CTCs of colorectal cancer patients and compared the mutations with the matched primary tumors. We collected preoperative blood and matched primary tumor samples from 48 colorectal cancer patients. CTCs were isolated using a label-free microfiltration device on a silicon microsieve. Upon whole genome amplification, we performed amplicon-based targeted sequencing on a panel of 39 druggable and frequently mutated genes on both CTCs and fresh-frozen tumor samples. We developed an analysis pipeline to minimize false-positive detection of somatic mutations in amplified DNA. In 60% of the CTC-enriched blood samples, we detected primary tumor matching mutations. We found a significant positive correlation between the allele frequencies of somatic mutations detected in CTCs and abnormal CEA serum level. Strikingly, we found driver mutations and amplifications in cancer and druggable genes such as APC, KRAS, TP53, ERBB3 , FBXW7 and ERBB2 . In addition, we found that CTCs carried mutation signatures that resembled the signatures of their primary tumors. Cumulatively, our study defined genetic signatures and somatic mutation frequency of colorectal CTCs. The identification of druggable mutations in CTCs of preoperative colorectal cancer patients could lead to more timely and focused therapeutic interventions.

  8. Molecular characterization of circulating colorectal tumor cells defines genetic signatures for individualized cancer care

    PubMed Central

    Kong, Say Li; Liu, Xingliang; Suhaimi, Nur-Afidah Mohamed; Koh, Kenneth Jia Hao; Hu, Min; Lee, Daniel Yoke San; Cima, Igor; Phyo, Wai Min; Lee, Esther Xing Wei; Tai, Joyce A.; Foong, Yu Miin; Vo, Jess Honganh; Koh, Poh Koon; Zhang, Tong; Ying, Jackie Y.; Lim, Bing; Tan, Min-Han; Hillmer, Axel M.

    2017-01-01

    Studies on circulating tumor cells (CTCs) have largely focused on platform development and CTC enumeration rather than on the genomic characterization of CTCs. To address this, we performed targeted sequencing of CTCs of colorectal cancer patients and compared the mutations with the matched primary tumors. We collected preoperative blood and matched primary tumor samples from 48 colorectal cancer patients. CTCs were isolated using a label-free microfiltration device on a silicon microsieve. Upon whole genome amplification, we performed amplicon-based targeted sequencing on a panel of 39 druggable and frequently mutated genes on both CTCs and fresh-frozen tumor samples. We developed an analysis pipeline to minimize false-positive detection of somatic mutations in amplified DNA. In 60% of the CTC-enriched blood samples, we detected primary tumor matching mutations. We found a significant positive correlation between the allele frequencies of somatic mutations detected in CTCs and abnormal CEA serum level. Strikingly, we found driver mutations and amplifications in cancer and druggable genes such as APC, KRAS, TP53, ERBB3, FBXW7 and ERBB2. In addition, we found that CTCs carried mutation signatures that resembled the signatures of their primary tumors. Cumulatively, our study defined genetic signatures and somatic mutation frequency of colorectal CTCs. The identification of druggable mutations in CTCs of preoperative colorectal cancer patients could lead to more timely and focused therapeutic interventions. PMID:28978093

  9. Characterization of Somatic Mutations in Air Pollution-Related Lung Cancer.

    PubMed

    Yu, Xian-Jun; Yang, Min-Jun; Zhou, Bo; Wang, Gui-Zhen; Huang, Yun-Chao; Wu, Li-Chuan; Cheng, Xin; Wen, Zhe-Sheng; Huang, Jin-Yan; Zhang, Yun-Dong; Gao, Xiao-Hong; Li, Gao-Feng; He, Shui-Wang; Gu, Zhao-Hui; Ma, Liang; Pan, Chun-Ming; Wang, Ping; Chen, Hao-Bin; Hong, Zhi-Peng; Wang, Xiao-Lu; Mao, Wen-Jing; Jin, Xiao-Long; Kang, Hui; Chen, Shu-Ting; Zhu, Yong-Qiang; Gu, Wen-Yi; Liu, Zi; Dong, Hui; Tian, Lin-Wei; Chen, Sai-Juan; Cao, Yi; Wang, Sheng-Yue; Zhou, Guang-Biao

    2015-06-01

    Air pollution has been classified as Group 1 carcinogenic to humans, but the underlying tumorigenesis remains unclear. In Xuanwei City of Yunnan Province, the lung cancer incidence is among the highest in China attributed to severe air pollution generated by combustion of smoky coal, providing a unique opportunity to dissect lung carcinogenesis of air pollution. Here we analyzed the somatic mutations of 164 non-small cell lung cancers (NSCLCs) from Xuanwei and control regions (CR) where smoky coal was not used. Whole genome sequencing revealed a mean of 289 somatic exonic mutations per tumor and the frequent C:G → A:T nucleotide substitutions in Xuanwei NSCLCs. Exome sequencing of 2010 genes showed that Xuanwei and CR NSCLCs had a mean of 68 and 22 mutated genes per tumor, respectively (p < 0.0001). We found 167 genes (including TP53, RYR2, KRAS, CACNA1E) which had significantly higher mutation frequencies in Xuanwei than CR patients, and mutations in most genes in Xuanwei NSCLCs differed from those in CR cases. The mutation rates of 70 genes (e.g., RYR2, MYH3, GPR144, CACNA1E) were associated with patients' lifetime benzo(a)pyrene exposure. This study uncovers the mutation spectrum of air pollution-related lung cancers, and provides evidence for pollution exposure-genomic mutation relationship at a large scale.

  10. Isolation and characterization of gallium resistant Pseudomonas aeruginosa mutants.

    PubMed

    García-Contreras, Rodolfo; Lira-Silva, Elizabeth; Jasso-Chávez, Ricardo; Hernández-González, Ismael L; Maeda, Toshinari; Hashimoto, Takahiro; Boogerd, Fred C; Sheng, Lili; Wood, Thomas K; Moreno-Sánchez, Rafael

    2013-12-01

    Pseudomonas aeruginosa PA14 cells resistant to the novel antimicrobial gallium nitrate (Ga) were developed using transposon mutagenesis and by selecting spontaneous mutants. The mutants showing the highest growth in the presence of Ga were selected for further characterization. These mutants showed 4- to 12-fold higher Ga minimal inhibitory growth concentrations and a greater than 8-fold increase in the minimum biofilm eliminating Ga concentration. Both types of mutants produced Ga resistant biofilms whereas the formation of wild-type biofilms was strongly inhibited by Ga. The gene interrupted in the transposon mutant was hitA, which encodes a periplasmic iron binding protein that delivers Fe³⁺ to the HitB iron permease; complementation of the mutant with the hitA gene restored the Ga sensitivity. This hitA mutant showed a 14-fold decrease in Ga internalization versus the wild-type strain, indicating that the HitAB system is also involved in the Ga uptake. Ga uptake in the spontaneous mutant was also lower, although no mutations were found in the hitAB genes. Instead, this mutant harbored 64 non-silent mutations in several genes including those of the phenazine pyocyanin biosynthesis. The spontaneous mutant produced 2-fold higher pyocyanin basal levels than the wild-type; the addition of this phenazine to wild-type cultures protected them from the Ga bacteriostatic effect. The present data indicate that mutations affecting Ga transport and probably pyocyanin biosynthesis enable cells to develop resistance to Ga. Copyright © 2013 Elsevier GmbH. All rights reserved.

  11. UV-induced somatic mutations elicit a functional T cell response in the YUMMER1.7 mouse melanoma model.

    PubMed

    Wang, Jake; Perry, Curtis J; Meeth, Katrina; Thakral, Durga; Damsky, William; Micevic, Goran; Kaech, Susan; Blenman, Kim; Bosenberg, Marcus

    2017-07-01

    Human melanomas exhibit relatively high somatic mutation burden compared to other malignancies. These somatic mutations may produce neoantigens that are recognized by the immune system, leading to an antitumor response. By irradiating a parental mouse melanoma cell line carrying three driver mutations with UVB and expanding a single-cell clone, we generated a mutagenized model that exhibits high somatic mutation burden. When inoculated at low cell numbers in immunocompetent C57BL/6J mice, YUMMER1.7 (Yale University Mouse Melanoma Exposed to Radiation) regresses after a brief period of growth. This regression phenotype is dependent on T cells as YUMMER1.7 tumors grow significantly faster in immunodeficient Rag1 -/- mice and C57BL/6J mice depleted of CD4 and CD8 T cells. Interestingly, regression can be overcome by injecting higher cell numbers of YUMMER1.7, which results in tumors that grow without effective rejection. Mice that have previously rejected YUMMER1.7 tumors develop immunity against higher doses of YUMMER1.7 tumor challenge. In addition, escaping YUMMER1.7 tumors are sensitive to anti-CTLA-4 and anti-PD-1 therapy, establishing a new model for the evaluation of immune checkpoint inhibition and antitumor immune responses. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  12. Low frequency of broadly neutralizing HIV antibodies during chronic infection even in quaternary epitope targeting antibodies containing large numbers of somatic mutations.

    PubMed

    Hicar, Mark D; Chen, Xuemin; Kalams, Spyros A; Sojar, Hakimuddin; Landucci, Gary; Forthal, Donald N; Spearman, Paul; Crowe, James E

    2016-02-01

    Neutralizing antibodies (Abs) are thought to be a critical component of an appropriate HIV vaccine response. It has been proposed that Abs recognizing conformationally dependent quaternary epitopes on the HIV envelope (Env) trimer may be necessary to neutralize diverse HIV strains. A number of recently described broadly neutralizing monoclonal Abs (mAbs) recognize complex and quaternary epitopes. Generally, many such Abs exhibit extensive numbers of somatic mutations and unique structural characteristics. We sought to characterize the native antibody (Ab) response against circulating HIV focusing on such conformational responses, without a prior selection based on neutralization. Using a capture system based on VLPs incorporating cleaved envelope protein, we identified a selection of B cells that produce quaternary epitope targeting Abs (QtAbs). Similar to a number of broadly neutralizing Abs, the Ab genes encoding these QtAbs showed extensive numbers of somatic mutations. However, when expressed as recombinant molecules, these Abs failed to neutralize virus or mediate ADCVI activity. Molecular analysis showed unusually high numbers of mutations in the Ab heavy chain framework 3 region of the variable genes. The analysis suggests that large numbers of somatic mutations occur in Ab genes encoding HIV Abs in chronically infected individuals in a non-directed, stochastic, manner. Copyright © 2015 Elsevier Ltd. All rights reserved.

  13. Genomic profiles of lung cancer associated with idiopathic pulmonary fibrosis.

    PubMed

    Hwang, Ji An; Kim, Deokhoon; Chun, Sung-Min; Bae, SooHyun; Song, Joon Seon; Kim, Mi Young; Koo, Hyun Jung; Song, Jin Woo; Kim, Woo Sung; Lee, Jae Cheol; Kim, Hyeong Ryul; Choi, Chang-Min; Jang, Se Jin

    2018-01-01

    Little is known about the pathogenesis or molecular profiles of idiopathic pulmonary fibrosis-associated lung cancer (IPF-LC). This study was performed to investigate the genomic profiles of IPF-LC and to explore the possibility of defining potential therapeutic targets in IPF-LC. We assessed genomic profiles of IPF-LC by using targeted exome sequencing (OncoPanel version 2) in 35 matched tumour/normal pairs surgically resected between 2004 and 2014. Germline and somatic variant calling was performed with GATK HaplotypeCaller and MuTect with GATK SomaticIndelocator, respectively. Copy number analysis was conducted with CNVkit, with focal events determined by Genomic Identification of Significant Targets in Cancer 2.0, and pathway analysis (KEGG) with DAVID. Germline mutations in TERT (rs2736100, n = 33) and CDKN1A (rs2395655, n = 27) associated with idiopathic pulmonary fibrosis risk were detected in most samples. A total of 410 somatic mutations were identified, with an average of 11.7 per tumour, including 69 synonymous, 177 missense, 17 nonsense, 1 nonstop and 11 splice-site mutations, and 135 small coding indels. Spectra of the somatic mutations revealed predominant C > T transitions despite an extensive smoking history in most patients, suggesting a potential association between APOBEC-related mutagenesis and the development of IPF-LC. TP53 (22/35, 62.9%) and BRAF (6/35, 17.1%) were found to be significantly mutated in IPF-LC. Recurrent focal amplifications in three chromosomal loci (3q26.33, 7q31.2, and 12q14.3) and 9p21.3 deletion were identified, and genes associated with the JAK-STAT signalling pathway were significantly amplified in IPF-LC (P = 0.012). This study demonstrates that IPF-LC is genetically characterized by the presence of somatic mutations reflecting a variety of environmental exposures on the background of specific germline mutations, and is associated with potentially targetable alterations such as BRAF mutations. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

  14. Fibroblast growth factor receptors, developmental corruption and malignant disease.

    PubMed

    Kelleher, Fergal C; O'Sullivan, Hazel; Smyth, Elizabeth; McDermott, Ray; Viterbo, Antonella

    2013-10-01

    Fibroblast growth factors (FGF) are a family of ligands that bind to four different types of cell surface receptor entitled, FGFR1, FGFR2, FGFR3 and FGFR4. These receptors differ in their ligand binding affinity and tissue distribution. The prototypical receptor structure is that of an extracellular region comprising three immunoglobulin (Ig)-like domains, a hydrophobic transmembrane segment and a split intracellular tyrosine kinase domain. Alternative gene splicing affecting the extracellular third Ig loop also creates different receptor isoforms entitled FGFRIIIb and FGFRIIIc. Somatic fibroblast growth factor receptor (FGFR) mutations are implicated in different types of cancer and germline FGFR mutations occur in developmental syndromes particularly those in which craniosynostosis is a feature. The mutations found in both conditions are often identical. Many somatic FGFR mutations in cancer are gain-of-function mutations of established preclinical oncogenic potential. Gene amplification can also occur with 19-22% of squamous cell lung cancers for example having amplification of FGFR1. Ontologic comparators can be informative such as aberrant spermatogenesis being implicated in both spermatocytic seminomas and Apert syndrome. The former arises from somatic FGFR3 mutations and Apert syndrome arises from germline FGFR2 mutations. Finally, therapeutics directed at inhibiting the FGF/FGFR interaction are a promising subject for clinical trials.

  15. Clonal hematopoiesis, with and without candidate driver mutations, is common in the elderly

    PubMed Central

    Zink, Florian; Stacey, Simon N.; Norddahl, Gudmundur L.; Frigge, Michael L.; Magnusson, Olafur T.; Jonsdottir, Ingileif; Thorgeirsson, Thorgeir E.; Sigurdsson, Asgeir; Gudjonsson, Sigurjon A.; Gudmundsson, Julius; Jonasson, Jon G.; Tryggvadottir, Laufey; Jonsson, Thorvaldur; Helgason, Agnar; Gylfason, Arnaldur; Sulem, Patrick; Rafnar, Thorunn; Thorsteinsdottir, Unnur; Gudbjartsson, Daniel F.; Masson, Gisli; Kong, Augustine

    2017-01-01

    Clonal hematopoiesis (CH) arises when a substantial proportion of mature blood cells is derived from a single dominant hematopoietic stem cell lineage. Somatic mutations in candidate driver (CD) genes are thought to be responsible for at least some cases of CH. Using whole-genome sequencing of 11 262 Icelanders, we found 1403 cases of CH by using barcodes of mosaic somatic mutations in peripheral blood, whether or not they have a mutation in a CD gene. We find that CH is very common in the elderly, trending toward inevitability. We show that somatic mutations in TET2, DNMT3A, ASXL1, and PPM1D are associated with CH at high significance. However, known CD mutations were evident in only a fraction of CH cases. Nevertheless, the highly prevalent CH we detect associates with increased mortality rates, risk for hematological malignancy, smoking behavior, telomere length, Y-chromosome loss, and other phenotypic characteristics. Modeling suggests some CH cases could arise in the absence of CD mutations as a result of neutral drift acting on a small population of active hematopoietic stem cells. Finally, we find a germline deletion in intron 3 of the telomerase reverse transcriptase (TERT) gene that predisposes to CH (rs34002450; P = 7.4 × 10−12; odds ratio, 1.37). PMID:28483762

  16. Effect of actionable somatic mutations on racial/ethnic disparities in head and neck cancer prognosis.

    PubMed

    Wu, Evan S; Park, Jong Y; Zeitouni, Joseph A; Gomez, Carmen R; Reis, Isildinha M; Zhao, Wei; Kwon, Deukwoo; Lee, Eunkyung; Nelson, Omar L; Lin, Hui-Yi; Franzmann, Elizabeth J; Savell, Jason; McCaffrey, Thomas V; Goodwin, W Jarrard; Hu, Jennifer J

    2016-08-01

    Head and neck squamous cell carcinoma (HNSCC) is the sixth most common cancer worldwide and minorities have the worst survival. However, the molecular mechanisms underlying survival disparities have not been elucidated. In a retrospective study, we assessed association between HNSCC early death (<2 years) and 208 somatic mutations of 10 cancer-related genes in 214 patients: 98 non-Hispanic whites (46%), 72 Hispanic whites (34%), and 44 African Americans (20%). Hispanic whites and African Americans had significantly higher mutation rates for EGFR, HRAS, KRAS, and TP53. HNSCC early death was significantly associated with 3+ mutations (odds ratio [OR] = 2.78, 95% confidence interval [CI] = 1.16, 6.69), NOTCH1 mutations in non-Hispanic whites (OR = 5.51; 95% CI = 1.22-24.83) and TP53 mutations in Hispanic whites (OR = 3.84; 95% CI = 1.08-13.68) in multivariable analysis adjusted for age, sex, tumor site, and tumor stage. We have provided the proof-of-principal data to link racial/ethnic-specific somatic mutations and HNSCC prognosis and pave the way for precision medicine to overcome HNSCC survival disparities. © 2016 Wiley Periodicals, Inc. Head Neck 38:1234-1241, 2016. © 2016 Wiley Periodicals, Inc.

  17. Ovarian Tumors related to Intronic Mutations in DICER1: A Report from the International Ovarian and Testicular Stromal Tumor Registry

    PubMed Central

    Schultz, Kris Ann; Harris, Anne; Messinger, Yoav; Sencer, Susan; Baldinger, Shari; Dehner, Louis P.; Hill, D. Ashley

    2015-01-01

    Germline DICER1 mutations have been described in individuals with pleuropulmonary blastoma (PPB), ovarian Sertoli-Leydig cell tumor (SLCT), sarcomas, multinodular goiter, thyroid carcinoma, cystic nephroma and other neoplastic conditions. Early results from the International Ovarian and Testicular Stromal Tumor Registry show germline DICER1 mutations in 48% of girls and women with SLCT. In this report, a young woman presented with ovarian undifferentiated sarcoma. Four years later, she presented with SLCT. She was successfully treated for both malignancies. Sequence results showed a germline intronic mutation in DICER1. This mutation results in an exact duplication of the six bases at the splice site at the intron 23 and exon 24 junction. Predicted improper splicing leads to inclusion of 10 bases of intronic sequence, frameshift and premature truncation of the protein disrupting the RNase IIIb domain. A second individual with SLCT was found to have an identical germline mutation. In each of the ovarian tumors, an additional somatic mutation in the RNase IIIb domain of DICER1 was found. In rare patients, germline intronic mutations in DICER1 that are predicted to cause incorrect splicing can also contribute to the pathogenesis of SLCT. PMID:26289771

  18. TumorNext-Lynch-MMR: a comprehensive next generation sequencing assay for the detection of germline and somatic mutations in genes associated with mismatch repair deficiency and Lynch syndrome.

    PubMed

    Gray, Phillip N; Tsai, Pei; Chen, Daniel; Wu, Sitao; Hoo, Jayne; Mu, Wenbo; Li, Bing; Vuong, Huy; Lu, Hsiao-Mei; Batth, Navanjot; Willett, Sara; Uyeda, Lisa; Shah, Swati; Gau, Chia-Ling; Umali, Monalyn; Espenschied, Carin; Janicek, Mike; Brown, Sandra; Margileth, David; Dobrea, Lavinia; Wagman, Lawrence; Rana, Huma; Hall, Michael J; Ross, Theodora; Terdiman, Jonathan; Cullinane, Carey; Ries, Savita; Totten, Ellen; Elliott, Aaron M

    2018-04-17

    The current algorithm for Lynch syndrome diagnosis is highly complex with multiple steps which can result in an extended time to diagnosis while depleting precious tumor specimens. Here we describe the analytical validation of a custom probe-based NGS tumor panel, TumorNext-Lynch-MMR, which generates a comprehensive genetic profile of both germline and somatic mutations that can accelerate and streamline the time to diagnosis and preserve specimen. TumorNext-Lynch-MMR can detect single nucleotide variants, small insertions and deletions in 39 genes that are frequently mutated in Lynch syndrome and colorectal cancer. Moreover, the panel provides microsatellite instability status and detects loss of heterozygosity in the five Lynch genes; MSH2 , MSH6 , MLH1 , PMS2 and EPCAM . Clinical cases are described that highlight the assays ability to differentiate between somatic and germline mutations, precisely classify variants and resolve discordant cases.

  19. TumorNext-Lynch-MMR: a comprehensive next generation sequencing assay for the detection of germline and somatic mutations in genes associated with mismatch repair deficiency and Lynch syndrome

    PubMed Central

    Gray, Phillip N.; Tsai, Pei; Chen, Daniel; Wu, Sitao; Hoo, Jayne; Mu, Wenbo; Li, Bing; Vuong, Huy; Lu, Hsiao-Mei; Batth, Navanjot; Willett, Sara; Uyeda, Lisa; Shah, Swati; Gau, Chia-Ling; Umali, Monalyn; Espenschied, Carin; Janicek, Mike; Brown, Sandra; Margileth, David; Dobrea, Lavinia; Wagman, Lawrence; Rana, Huma; Hall, Michael J.; Ross, Theodora; Terdiman, Jonathan; Cullinane, Carey; Ries, Savita; Totten, Ellen; Elliott, Aaron M.

    2018-01-01

    The current algorithm for Lynch syndrome diagnosis is highly complex with multiple steps which can result in an extended time to diagnosis while depleting precious tumor specimens. Here we describe the analytical validation of a custom probe-based NGS tumor panel, TumorNext-Lynch-MMR, which generates a comprehensive genetic profile of both germline and somatic mutations that can accelerate and streamline the time to diagnosis and preserve specimen. TumorNext-Lynch-MMR can detect single nucleotide variants, small insertions and deletions in 39 genes that are frequently mutated in Lynch syndrome and colorectal cancer. Moreover, the panel provides microsatellite instability status and detects loss of heterozygosity in the five Lynch genes; MSH2, MSH6, MLH1, PMS2 and EPCAM. Clinical cases are described that highlight the assays ability to differentiate between somatic and germline mutations, precisely classify variants and resolve discordant cases. PMID:29755653

  20. Coats' disease of the retina (unilateral retinal telangiectasis) caused by somatic mutation in the NDP gene: a role for norrin in retinal angiogenesis.

    PubMed

    Black, G C; Perveen, R; Bonshek, R; Cahill, M; Clayton-Smith, J; Lloyd, I C; McLeod, D

    1999-10-01

    Coats' disease is characterized by abnormal retinal vascular development (so-called 'retinal telangiectasis') which results in massive intraretinal and subretinal lipid accumulation (exudative retinal detachment). The classical form of Coats' disease is almost invariably isolated, unilateral and seen in males. A female with a unilateral variant of Coats' disease gave birth to a son affected by Norrie disease. Both carried a missense mutation within the NDP gene on chromosome Xp11.2. Subsequently analysis of the retinas of nine enucleated eyes from males with Coats' disease demonstrated in one a somatic mutation in the NDP gene which was not present within non-retinal tissue. We suggest that Coats' telangiectasis is secondary to somatic mutation in the NDP gene which results in a deficiency of norrin (the protein product of the NDP gene) within the developing retina. This supports recent observations that the protein is critical for normal retinal vasculogenesis.

  1. Identification of somatic mutations in cancer through Bayesian-based analysis of sequenced genome pairs

    PubMed Central

    2013-01-01

    Background The field of cancer genomics has rapidly adopted next-generation sequencing (NGS) in order to study and characterize malignant tumors with unprecedented resolution. In particular for cancer, one is often trying to identify somatic mutations – changes specific to a tumor and not within an individual’s germline. However, false positive and false negative detections often result from lack of sufficient variant evidence, contamination of the biopsy by stromal tissue, sequencing errors, and the erroneous classification of germline variation as tumor-specific. Results We have developed a generalized Bayesian analysis framework for matched tumor/normal samples with the purpose of identifying tumor-specific alterations such as single nucleotide mutations, small insertions/deletions, and structural variation. We describe our methodology, and discuss its application to other types of paired-tissue analysis such as the detection of loss of heterozygosity as well as allelic imbalance. We also demonstrate the high level of sensitivity and specificity in discovering simulated somatic mutations, for various combinations of a) genomic coverage and b) emulated heterogeneity. Conclusion We present a Java-based implementation of our methods named Seurat, which is made available for free academic use. We have demonstrated and reported on the discovery of different types of somatic change by applying Seurat to an experimentally-derived cancer dataset using our methods; and have discussed considerations and practices regarding the accurate detection of somatic events in cancer genomes. Seurat is available at https://sites.google.com/site/seuratsomatic. PMID:23642077

  2. Identification of somatic mutations in cancer through Bayesian-based analysis of sequenced genome pairs.

    PubMed

    Christoforides, Alexis; Carpten, John D; Weiss, Glen J; Demeure, Michael J; Von Hoff, Daniel D; Craig, David W

    2013-05-04

    The field of cancer genomics has rapidly adopted next-generation sequencing (NGS) in order to study and characterize malignant tumors with unprecedented resolution. In particular for cancer, one is often trying to identify somatic mutations--changes specific to a tumor and not within an individual's germline. However, false positive and false negative detections often result from lack of sufficient variant evidence, contamination of the biopsy by stromal tissue, sequencing errors, and the erroneous classification of germline variation as tumor-specific. We have developed a generalized Bayesian analysis framework for matched tumor/normal samples with the purpose of identifying tumor-specific alterations such as single nucleotide mutations, small insertions/deletions, and structural variation. We describe our methodology, and discuss its application to other types of paired-tissue analysis such as the detection of loss of heterozygosity as well as allelic imbalance. We also demonstrate the high level of sensitivity and specificity in discovering simulated somatic mutations, for various combinations of a) genomic coverage and b) emulated heterogeneity. We present a Java-based implementation of our methods named Seurat, which is made available for free academic use. We have demonstrated and reported on the discovery of different types of somatic change by applying Seurat to an experimentally-derived cancer dataset using our methods; and have discussed considerations and practices regarding the accurate detection of somatic events in cancer genomes. Seurat is available at https://sites.google.com/site/seuratsomatic.

  3. Clonal hematopoiesis as determined by the HUMARA assay is a marker for acquired mutations in epigenetic regulators in older women.

    PubMed

    Wiedmeier, Julia Erin; Kato, Catherine; Zhang, Zhenzhen; Lee, Hyunjung; Dunlap, Jennifer; Nutt, Eric; Rattray, Rogan; McKay, Sarah; Eide, Christopher; Press, Richard; Mori, Motomi; Druker, Brian; Dao, Kim-Hien

    2016-09-01

    Recent large cohort studies revealed that healthy older individuals harbor somatic mutations that increase their risk for hematologic malignancy and all-cause cardiovascular deaths. The majority of these mutations are in chromatin and epigenetic regulatory genes (CERGs). CERGs play a key role in regulation of DNA methylation (DNMT3A and TET2) and histone function (ASXL1) and in clonal proliferation of hematopoietic stem cells. We hypothesize that older women manifesting clonal hematopoiesis, defined here as a functional phenomenon in which a hematopoietic stem cell has acquired a survival and proliferative advantage, harbor a higher frequency of somatic mutations in CERGs. The human androgen receptor gene (HUMARA) assay was used in our study to detect the presence of nonrandom X inactivation in women, a marker for clonal hematopoiesis. In our pilot study, we tested 127 blood samples from women ≥65 years old without a history of invasive cancer or hematologic malignancies. Applying stringent qualitative criteria, we found that 26% displayed clonal hematopoiesis; 52.8% displayed polyclonal hematopoiesis; and 21.3% had indeterminate patterns (too close to call by qualitative assessment). Using Illumina MiSeq next-generation sequencing, we identified somatic mutations in CERGs in 15.2% of subjects displaying clonal hematopoiesis (three ASXL1 and two DNMT3A mutations with an average variant allele frequency of 15.7%, range: 6.3%-23.3%). In a more limited sequencing analysis, we evaluated the frequency of ASXL1 mutations by Sanger sequencing and found mutations in 9.7% of the clonal samples and 0% of the polyclonal samples. By comparing several recent studies (with some caveats as described), we determined the fold enrichment of detecting CERG mutations by using the HUMARA assay as a functional screen for clonal hematopoiesis. We conclude that a functional assay of clonal hematopoiesis is enriching for older women with somatic mutations in CERGs, particularly for ASXL1 and TET2 mutations and less so for DNMT3A mutations. Copyright © 2016 ISEH - International Society for Experimental Hematology. Published by Elsevier Inc. All rights reserved.

  4. Recurrent ETNK1 mutations in atypical chronic myeloid leukemia.

    PubMed

    Gambacorti-Passerini, Carlo B; Donadoni, Carla; Parmiani, Andrea; Pirola, Alessandra; Redaelli, Sara; Signore, Giovanni; Piazza, Vincenzo; Malcovati, Luca; Fontana, Diletta; Spinelli, Roberta; Magistroni, Vera; Gaipa, Giuseppe; Peronaci, Marco; Morotti, Alessandro; Panuzzo, Cristina; Saglio, Giuseppe; Usala, Emilio; Kim, Dong-Wook; Rea, Delphine; Zervakis, Konstantinos; Viniou, Nora; Symeonidis, Argiris; Becker, Heiko; Boultwood, Jacqueline; Campiotti, Leonardo; Carrabba, Matteo; Elli, Elena; Bignell, Graham R; Papaemmanuil, Elli; Campbell, Peter J; Cazzola, Mario; Piazza, Rocco

    2015-01-15

    Despite the recent identification of recurrent SETBP1 mutations in atypical chronic myeloid leukemia (aCML), a complete description of the somatic lesions responsible for the onset of this disorder is still lacking. To find additional somatic abnormalities in aCML, we performed whole-exome sequencing on 15 aCML cases. In 2 cases (13.3%), we identified somatic missense mutations in the ETNK1 gene. Targeted resequencing on 515 hematological clonal disorders revealed the presence of ETNK1 variants in 6 (8.8%) of 68 aCML and 2 (2.6%) of 77 chronic myelomonocytic leukemia samples. These mutations clustered in a small region of the kinase domain, encoding for H243Y and N244S (1/8 H243Y; 7/8 N244S). They were all heterozygous and present in the dominant clone. The intracellular phosphoethanolamine/phosphocholine ratio was, on average, 5.2-fold lower in ETNK1-mutated samples (P < .05). Similar results were obtained using myeloid TF1 cells transduced with ETNK1 wild type, ETNK1-N244S, and ETNK1-H243Y, where the intracellular phosphoethanolamine/phosphocholine ratio was significantly lower in ETNK1-N244S (0.76 ± 0.07) and ETNK1-H243Y (0.37 ± 0.02) than in ETNK1-WT (1.37 ± 0.32; P = .01 and P = .0008, respectively), suggesting that ETNK1 mutations may inhibit the catalytic activity of the enzyme. In summary, our study shows for the first time the evidence of recurrent somatic ETNK1 mutations in the context of myeloproliferative/myelodysplastic disorders. © 2015 by The American Society of Hematology.

  5. Primary cutaneous B-cell lymphoma is associated with somatically hypermutated immunoglobulin variable genes and frequent use of VH1-69 and VH4-59 segments.

    PubMed

    Perez, M; Pacchiarotti, A; Frontani, M; Pescarmona, E; Caprini, E; Lombardo, G A; Russo, G; Faraggiana, T

    2010-03-01

    Accurate assessment of the somatic mutational status of clonal immunoglobulin variable region (IgV) genes is relevant in elucidating tumour cell origin in B-cell lymphoma; virgin B cells bear unmutated IgV genes, while germinal centre and postfollicular B cells carry mutated IgV genes. Furthermore, biases in the IgV repertoire and distribution pattern of somatic mutations indicate a possible antigen role in the pathogenesis of B-cell malignancies. This work investigates the cellular origin and antigenic selection in primary cutaneous B-cell lymphoma (PCBCL). We analysed the nucleotide sequence of clonal IgV heavy-chain gene (IgVH) rearrangements in 51 cases of PCBCL (25 follicle centre, 19 marginal zone and seven diffuse large B-cell lymphoma, leg-type) and compared IgVH sequences with their closest germline segment in the GenBank database. Molecular data were then correlated with histopathological features. We showed that all but one of the 51 IgVH sequences analysed exhibited extensive somatic hypermutations. The detected mutation rate ranged from 1.6% to 21%, with a median rate of 9.8% and was independent of PCBCL histotype. Calculation of antigen-selection pressure showed that 39% of the mutated IgVH genes displayed a number of replacement mutations and silent mutations in a pattern consistent with antigenic selection. Furthermore, two segments, VH1-69 (12%) and VH4-59 (14%), were preferentially used in our case series. Data indicate that neoplastic B cells of PBCBL have experienced germinal centre reaction and also suggest that the involvement of IgVH genes is not entirely random in PCBCL and that common antigen epitopes could be pathologically relevant in cutaneous lymphomagenesis.

  6. Somatic HLA Mutations Expose the Role of Class I-Mediated Autoimmunity in Aplastic Anemia and its Clonal Complications.

    PubMed

    Babushok, Daria V; Duke, Jamie L; Xie, Hongbo M; Stanley, Natasha; Atienza, Jamie; Perdigones, Nieves; Nicholas, Peter; Ferriola, Deborah; Li, Yimei; Huang, Hugh; Ye, Wenda; Morrissette, Jennifer J D; Kearns, Jane; Porter, David L; Podsakoff, Gregory M; Eisenlohr, Laurence C; Biegel, Jaclyn A; Chou, Stella T; Monos, Dimitrios S; Bessler, Monica; Olson, Timothy S

    2017-10-10

    Acquired aplastic anemia (aAA) is an acquired deficiency of early hematopoietic cells, characterized by inadequate blood production, and a predisposition to myelodysplastic syndrome (MDS) and leukemia. Although its exact pathogenesis is unknown, aAA is thought to be driven by Human Leukocyte Antigen (HLA)-restricted T cell immunity, with earlier studies favoring HLA class II-mediated pathways. Using whole exome sequencing (WES), we recently identified two aAA patients with somatic mutations in HLA class I genes. We hypothesized that HLA class I mutations are pathognomonic for autoimmunity in aAA, but were previously underappreciated because the Major Histocompatibility Complex (MHC) region is notoriously difficult to analyze by WES. Using a combination of targeted deep sequencing of HLA class I genes and single nucleotide polymorphism array (SNP-A) genotyping we screened 66 aAA patients for somatic HLA class I loss. We found somatic HLA loss in eleven patients (17%), with thirteen loss-of-function mutations in HLA-A *33:03, HLA-A *68:01, HLA-B *14:02 and HLA-B *40:02 alleles. Three patients had more than one mutation targeting the same HLA allele. Interestingly, HLA-B *14:02 and HLA-B *40:02 were significantly overrepresented in aAA patients, compared to ethnicity-matched controls. Patients who inherited the targeted HLA alleles, regardless of HLA mutation status, had a more severe disease course with more frequent clonal complications as assessed by WES, SNP-A, and metaphase cytogenetics, and more frequent secondary MDS. The finding of recurrent HLA class I mutations provides compelling evidence for a predominant HLA class I-driven autoimmunity in aAA, and establishes a novel link between aAA patients' immunogenetics and clonal evolution.

  7. Somatic HLA mutations expose the role of class I–mediated autoimmunity in aplastic anemia and its clonal complications

    PubMed Central

    Duke, Jamie L.; Xie, Hongbo M.; Stanley, Natasha; Atienza, Jamie; Perdigones, Nieves; Nicholas, Peter; Ferriola, Deborah; Li, Yimei; Huang, Hugh; Ye, Wenda; Morrissette, Jennifer J. D.; Kearns, Jane; Porter, David L.; Podsakoff, Gregory M.; Eisenlohr, Laurence C.; Biegel, Jaclyn A.; Chou, Stella T.; Monos, Dimitrios S.; Bessler, Monica; Olson, Timothy S.

    2017-01-01

    Acquired aplastic anemia (aAA) is an acquired deficiency of early hematopoietic cells, characterized by inadequate blood production, and a predisposition to myelodysplastic syndrome (MDS) and leukemia. Although its exact pathogenesis is unknown, aAA is thought to be driven by human leukocyte antigen (HLA)–restricted T cell immunity, with earlier studies favoring HLA class II-mediated pathways. Using whole-exome sequencing (WES), we recently identified 2 patients with aAA with somatic mutations in HLA class I genes. We hypothesized that HLA class I mutations are pathognomonic for autoimmunity in aAA, but were previously underappreciated because the major histocompatibility complex (MHC) region is notoriously difficult to analyze by WES. Using a combination of targeted deep sequencing of HLA class I genes and single nucleotide polymorphism array (SNP-A) genotyping, we screened 66 patients with aAA for somatic HLA class I loss. We found somatic HLA loss in 11 patients (17%), with 13 loss-of-function mutations in HLA-A*33:03, HLA-A*68:01, HLA-B*14:02, and HLA-B*40:02 alleles. Three patients had more than 1 mutation targeting the same HLA allele. Interestingly, HLA-B*14:02 and HLA-B*40:02 were significantly overrepresented in patients with aAA compared with ethnicity-matched controls. Patients who inherited the targeted HLA alleles, regardless of HLA mutation status, had a more severe disease course with more frequent clonal complications as assessed by WES, SNP-A, and metaphase cytogenetics, and more frequent secondary MDS. The finding of recurrent HLA class I mutations provides compelling evidence for a predominant HLA class I-driven autoimmunity in aAA and establishes a novel link between immunogenetics and clonal evolution of patients with aAA. PMID:28971166

  8. Novel somatic mutations in the catalytic subunit of the protein kinase A as a cause of adrenal Cushing's syndrome: a European multicentric study.

    PubMed

    Di Dalmazi, Guido; Kisker, Caroline; Calebiro, Davide; Mannelli, Massimo; Canu, Letizia; Arnaldi, Giorgio; Quinkler, Marcus; Rayes, Nada; Tabarin, Antoine; Laure Jullié, Marie; Mantero, Franco; Rubin, Beatrice; Waldmann, Jens; Bartsch, Detlef K; Pasquali, Renato; Lohse, Martin; Allolio, Bruno; Fassnacht, Martin; Beuschlein, Felix; Reincke, Martin

    2014-10-01

    Somatic mutations in PRKACA gene, encoding the catalytic subunit of protein kinase A (PKA), have been recently found in a high proportion of sporadic adenomas associated with Cushing's syndrome. The aim was to analyze the PRKACA mutation in a large cohort of patients with adrenocortical masses. Samples from nine European centers were included (Germany, n = 4; Italy, n = 4; France, n = 1). Samples were drawn from 149 patients with nonsecreting adenomas (n = 32 + 2 peritumoral), subclinical hypercortisolism (n = 36), Cushing's syndrome (n = 64 + 2 peritumoral), androgen-producing tumors (n = 4), adrenocortical carcinomas (n = 5 + 2 peritumoral), and primary bilateral macronodular adrenal hyperplasias (n = 8). Blood samples were available from patients with nonsecreting adenomas (n = 15), subclinical hypercortisolism (n = 10), and Cushing's syndrome (n = 35). Clinical and hormonal data were collected. DNA amplification by PCR of exons 6 and 7 of the PRKACA gene and direct sequencing were performed. PRKACA heterozygous mutations were found in 22/64 samples of Cushing's syndrome patients (34%). No mutations were found in peritumoral tissue and blood samples or in other tumors examined. The c.617A>C (p.Leu206Arg) occurred in 18/22 patients. Furthermore, two novel mutations were identified: c.600_601insGTG/p.Cys200_Gly201insVal in three patients and c.639C>G+c.638_640insATTATCCTGAGG/p.Ser213Arg+p.Leu212_Lys214insIle-Ile-Leu-Arg) in one. All the mutations involved a region implicated in interaction between PKA regulatory and catalytic subunits. Patients with somatic PRKACA mutations showed higher levels of cortisol after dexamethasone test and a smaller adenoma size, compared with nonmutated subjects. These data confirm and extend previous observations that somatic PRKACA mutations are specific for adrenocortical adenomas causing Cushing's syndrome.

  9. Characterization of conservative somatic instability of the CAG repeat region in Huntington`s disease

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schaefer, F.V.; Calikoglu, A.S.; Whetsell, L.H.

    1994-09-01

    Instability and enlargement of a CAG repeat region at the beginning of the huntingtin gene (IT-15) has been linked with Huntington`s disease. The CAG repeat size shows a highly significant correlation with age-of-onset of clinicial features in individuals with 40 or more repeats who have Huntington disease. The clinical status of nonsymptomatic individuals with 30 to 39 CAG repeats is considered ambiguous. In order to define more carefully the nature of the HD expansion instability, we examined patients in our HD population using a discriminating fluorescence-based PCR approach. The degree of somatic mutation increases with both earlier age of onsetmore » and the size of the inherited allele. A single prominent band one repeat larger than the index peak was typical in individuals with 40-41 CAG repeats. Three to four larger bands are typically discerned in individuals with 50 or more repeats. In an extreme example, an individual with approximately 95 repeats had at least 8 prominent bands. Plotting the degree of somatic mutation relative to the size of the HD allele shows somatic mutation activity increases with size. By this approach 40-60% of the alleles in a 40-41 CAG repeat HD loci is represented in the primary allele. In contrast, the primary allele represents a relatively minor proportion of the total alleles for expansions greater than 50 CAG repeats (10-20%). The limited range of somatic mutation suggest that the instability is restricted to very early stages of embryogenesis before tissue development diverges or that persistent somatic instability occurs at a slow rate. Therefore, the properties of somatic instability in Huntington`s disease have aspects that are both in common but also different from that found in other trinucleotide repeat expanding diseases such as myotonic muscular dystrophy and fragile X syndrome.« less

  10. Pulmonary Neoplasms in Patients with Birt-Hogg-Dubé Syndrome: Histopathological Features and Genetic and Somatic Events.

    PubMed

    Furuya, Mitsuko; Tanaka, Reiko; Okudela, Koji; Nakamura, Satoko; Yoshioka, Hiromu; Tsuzuki, Toyonori; Shibuya, Ryo; Yatera, Kazuhiro; Shirasaki, Hiroki; Sudo, Yoshiko; Kimura, Naoko; Yamada, Kazuaki; Uematsu, Shugo; Kunimura, Toshiaki; Kato, Ikuma; Nakatani, Yukio

    2016-01-01

    Birt-Hogg-Dubé syndrome (BHD) is an inherited disorder caused by genetic mutations in the folliculin (FLCN) gene. Individuals with BHD have multiple pulmonary cysts and are at a high risk for developing renal cell carcinomas (RCCs). Currently, little information is available about whether pulmonary cysts are absolutely benign or if the lungs are at an increased risk for developing neoplasms. Herein, we describe 14 pulmonary neoplastic lesions in 7 patients with BHD. All patients were confirmed to have germline FLCN mutations. Neoplasm histologies included adenocarcinoma in situ (n = 2), minimally invasive adenocarcinoma (n = 1), papillary adenocarcinoma (n = 1), micropapillary adenocarcinoma (n = 1), atypical adenomatous hyperplasia (n = 8), and micronodular pneumocyte hyperplasia (MPH)-like lesion (n = 1). Five of the six adenocarcinoma/MPH-like lesions (83.3%) demonstrated a loss of heterozygosity (LOH) of FLCN. All of these lesions lacked mutant alleles and preserved wild-type alleles. Three invasive adenocarcinomas possessed additional somatic events: 2 had a somatic mutation in the epidermal growth factor receptor gene (EGFR) and another had a somatic mutation in KRAS. Immunohistochemical analysis revealed that most of the lesions were immunostained for phospho-mammalian target of rapamycin (p-mTOR) and phospho-S6. Collective data indicated that pulmonary neoplasms of peripheral adenocarcinomatous lineage in BHD patients frequently exhibit LOH of FLCN with mTOR pathway signaling. Additional driver gene mutations were detected only in invasive cases, suggesting that FLCN LOH may be an underlying abnormality that cooperates with major driver gene mutations in the progression of pulmonary adenocarcinomas in BHD patients.

  11. Somatic POLE mutations cause an ultramutated giant cell high-grade glioma subtype with better prognosis

    PubMed Central

    Erson-Omay, E. Zeynep; Çağlayan, Ahmet Okay; Schultz, Nikolaus; Weinhold, Nils; Omay, S. Bülent; Özduman, Koray; Köksal, Yavuz; Li, Jie; Serin Harmancı, Akdes; Clark, Victoria; Carrión-Grant, Geneive; Baranoski, Jacob; Çağlar, Caner; Barak, Tanyeri; Coşkun, Süleyman; Baran, Burçin; Köse, Doğan; Sun, Jia; Bakırcıoğlu, Mehmet; Moliterno Günel, Jennifer; Pamir, M. Necmettin; Mishra-Gorur, Ketu; Bilguvar, Kaya; Yasuno, Katsuhito; Vortmeyer, Alexander; Huttner, Anita J.; Sander, Chris; Günel, Murat

    2015-01-01

    Background Malignant high-grade gliomas (HGGs), including the most aggressive form, glioblastoma multiforme, show significant clinical and genomic heterogeneity. Despite recent advances, the overall survival of HGGs and their response to treatment remain poor. In order to gain further insight into disease pathophysiology by correlating genomic landscape with clinical behavior, thereby identifying distinct HGG molecular subgroups associated with improved prognosis, we performed a comprehensive genomic analysis. Methods We analyzed and compared 720 exome-sequenced gliomas (136 from Yale, 584 from The Cancer Genome Atlas) based on their genomic, histological, and clinical features. Results We identified a subgroup of HGGs (6 total, 4 adults and 2 children) that harbored a statistically significantly increased number of somatic mutations (mean = 9257.3 vs 76.2, P = .002). All of these “ultramutated” tumors harbored somatic mutations in the exonuclease domain of the polymerase epsilon gene (POLE), displaying a distinctive genetic profile, characterized by genomic stability and increased C-to-A transversions. Histologically, they all harbored multinucleated giant or bizarre cells, some with predominant infiltrating immune cells. One adult and both pediatric patients carried homozygous germline mutations in the mutS homolog 6 (MSH6) gene. In adults, POLE mutations were observed in patients younger than 40 years and were associated with a longer progression-free survival. Conclusions We identified a genomically, histologically, and clinically distinct subgroup of HGGs that harbored somatic POLE mutations and carried an improved prognosis. Identification of distinctive molecular and pathological HGG phenotypes has implications not only for improved classification but also for potential targeted treatments. PMID:25740784

  12. Somatic mutation detection in human biomonitoring.

    PubMed

    Olsen, L S; Nielsen, L R; Nexø, B A; Wassermann, K

    1996-06-01

    Somatic cell gene mutation arising in vivo may be considered to be a biomarker for genotoxicity. Assays detecting mutations of the haemoglobin and glycophorin A genes in red blood cells and of the hypoxanthine-guanine phosphoribosyltransferase and human leucocyte antigenes in T-lymphocytes are available in humans. This MiniReview describes these assays and their application to studies of individuals exposed to genotoxic agents. Moreover, with the implementation of techniques of molecular biology mutation spectra can now be defined in addition to the quantitation of in vivo mutant frequencies. We describe current screening methods for unknown mutations, including the denaturing gradient gel electrophoresis, single strand conformation polymorphism analysis, heteroduplex analysis, chemical modification techniques and enzymatic cleavage methods. The advantage of mutation detection as a biomarker is that it integrates exposure and sensitivity in one measurement. With the analysis of mutation spectra it may thus be possible to identify the causative genotoxic agent.

  13. Distinct cellular pathways select germline-encoded and somatically mutated antibodies into immunological memory

    PubMed Central

    Kaji, Tomohiro; Ishige, Akiko; Hikida, Masaki; Taka, Junko; Hijikata, Atsushi; Kubo, Masato; Nagashima, Takeshi; Takahashi, Yoshimasa; Kurosaki, Tomohiro; Okada, Mariko; Ohara, Osamu

    2012-01-01

    One component of memory in the antibody system is long-lived memory B cells selected for the expression of somatically mutated, high-affinity antibodies in the T cell–dependent germinal center (GC) reaction. A puzzling observation has been that the memory B cell compartment also contains cells expressing unmutated, low-affinity antibodies. Using conditional Bcl6 ablation, we demonstrate that these cells are generated through proliferative expansion early after immunization in a T cell–dependent but GC-independent manner. They soon become resting and long-lived and display a novel distinct gene expression signature which distinguishes memory B cells from other classes of B cells. GC-independent memory B cells are later joined by somatically mutated GC descendants at roughly equal proportions and these two types of memory cells efficiently generate adoptive secondary antibody responses. Deletion of T follicular helper (Tfh) cells significantly reduces the generation of mutated, but not unmutated, memory cells early on in the response. Thus, B cell memory is generated along two fundamentally distinct cellular differentiation pathways. One pathway is dedicated to the generation of high-affinity somatic antibody mutants, whereas the other preserves germ line antibody specificities and may prepare the organism for rapid responses to antigenic variants of the invading pathogen. PMID:23027924

  14. Developmental genes significantly afflicted by aberrant promoter methylation and somatic mutation predict overall survival of late-stage colorectal cancer

    PubMed Central

    An, Ning; Yang, Xue; Cheng, Shujun; Wang, Guiqi; Zhang, Kaitai

    2015-01-01

    Carcinogenesis is an exceedingly complicated process, which involves multi-level dysregulations, including genomics (majorly caused by somatic mutation and copy number variation), DNA methylomics, and transcriptomics. Therefore, only looking into one molecular level of cancer is not sufficient to uncover the intricate underlying mechanisms. With the abundant resources of public available data in the Cancer Genome Atlas (TCGA) database, an integrative strategy was conducted to systematically analyze the aberrant patterns of colorectal cancer on the basis of DNA copy number, promoter methylation, somatic mutation and gene expression. In this study, paired samples in each genomic level were retrieved to identify differentially expressed genes with corresponding genetic or epigenetic dysregulations. Notably, the result of gene ontology enrichment analysis indicated that the differentially expressed genes with corresponding aberrant promoter methylation or somatic mutation were both functionally concentrated upon developmental process, suggesting the intimate association between development and carcinogenesis. Thus, by means of random walk with restart, 37 significant development-related genes were retrieved from a priori-knowledge based biological network. In five independent microarray datasets, Kaplan–Meier survival and Cox regression analyses both confirmed that the expression of these genes was significantly associated with overall survival of Stage III/IV colorectal cancer patients. PMID:26691761

  15. Developmental genes significantly afflicted by aberrant promoter methylation and somatic mutation predict overall survival of late-stage colorectal cancer.

    PubMed

    An, Ning; Yang, Xue; Cheng, Shujun; Wang, Guiqi; Zhang, Kaitai

    2015-12-22

    Carcinogenesis is an exceedingly complicated process, which involves multi-level dysregulations, including genomics (majorly caused by somatic mutation and copy number variation), DNA methylomics, and transcriptomics. Therefore, only looking into one molecular level of cancer is not sufficient to uncover the intricate underlying mechanisms. With the abundant resources of public available data in the Cancer Genome Atlas (TCGA) database, an integrative strategy was conducted to systematically analyze the aberrant patterns of colorectal cancer on the basis of DNA copy number, promoter methylation, somatic mutation and gene expression. In this study, paired samples in each genomic level were retrieved to identify differentially expressed genes with corresponding genetic or epigenetic dysregulations. Notably, the result of gene ontology enrichment analysis indicated that the differentially expressed genes with corresponding aberrant promoter methylation or somatic mutation were both functionally concentrated upon developmental process, suggesting the intimate association between development and carcinogenesis. Thus, by means of random walk with restart, 37 significant development-related genes were retrieved from a priori-knowledge based biological network. In five independent microarray datasets, Kaplan-Meier survival and Cox regression analyses both confirmed that the expression of these genes was significantly associated with overall survival of Stage III/IV colorectal cancer patients.

  16. The somatic POLE P286R mutation defines a unique subclass of colorectal cancer featuring hypermutation, representing a potential genomic biomarker for immunotherapy

    PubMed Central

    Kim, Jihun; Kim, Deokhoon; Chun, Sung-Min; Kim, Jiyun; Kim, Tae Won; Park, Inja; Yu, Chang-Sik; Jang, Se Jin

    2016-01-01

    Early-onset colorectal cancers (EOCRCs) may have biological or genomic features distinct from late-onset CRCs (LOCRCs). Previous studies have mostly focused on the germline predisposition conditions of EOCRCs, but we hypothesized that EOCRCs may have distinct somatic aberrations that accelerate cancer development. To identify the somatic aberrations that accelerate cancer development at an early age, we conducted whole exome sequencing for 28 polyposis-unrelated, microsatellite stable (MSS) EOCRCs with no known germline predisposition conditions. Surprisingly, we found two distinct groups in the context of mutational burden: 6 hypermutated cases with 2325 to 10973 mutations and 22 nonhypermutated cases with 47 to 154 mutations. Further analysis revealed that four of the six hypermutated cases had the same POLE P286R mutation. We validated this finding in 83 MSS EOCRCs and 27 MSS LOCRCs, which revealed that 7.2% of EOCRCs (6/83) had the POLE P286R mutation, which was not found in LOCRCs. Clinicopathologically, EOCRCs with POLE mutations occurred far more frequently in the right colon than in the left colon, affecting men more frequently than women. In summary, we have identified a unique subclass of colon cancer characterized by a hypermutation associated with the POLE mutation. The acquisition of the POLE mutation leading to hypermutation can accelerate cancer development. Clinically, this subset with hypermutation may be susceptible to immune checkpoint blockade. PMID:27612425

  17. PTEN/MMAC1 Mutations in Hepatocellular Carcinomas: Somatic Inactivation of Both Alleles in Tumors

    PubMed Central

    Kawamura, Naoki; Nagai, Hisaki; Bando, Koichi; Koyama, Masaaki; Matsumoto, Satoshi; Tajiri, Takashi; Onda, Masahiko; Fujimoto, Jiro; Ueki, Takahiro; Konishi, Noboru; Shiba, Tadayoshi

    1999-01-01

    Allelic loss of loci on chromosome 10q occurs frequently in hepatocellular carcinomas. Somatic mutations of the PTEN/MMAC1 gene on this chromosome at 10q23 were recently identified in sporadic cancers of the uterus, brain, prostate and breast. To investigate the potential role of PTEN/MMAC1 gene in the genesis of hepatocellular carcinomas, we examined 96 tumors for allelic loss on 10q and also for subtle mutations anywhere within the coding region of PTEN/MMAC1 gene. Allelic loss was identified in 25 of the 89 (27%) tumors that were informative for polymorphic markers in the region. Somatic mutations were identified in five of those tumors: three frameshift mutations, a 1‐bp insertion at codon 83–84 in exon 4 and two 4‐bp deletions, both at codon 318–319 in exon 8; two C‐to‐G transversion mutation, both at ‐9 bp from the initiation codon in the 5’non‐coding region of exon 1. No missense mutation was observed in this panel of tumors. In most of the informative tumors carrying intragenic mutations of one allele, we were able to detect loss of heterozygosity as well. These findings suggest that two alleles of the PTEN/MMAC1 gene may be inactivated by a combination of intragenic point mutation on one allele and loss of chromosomal material on the other allele in some of these tumors. PMID:10363579

  18. Somatic Mutations and Clonal Hematopoiesis in Aplastic Anemia.

    PubMed

    Yoshizato, Tetsuichi; Dumitriu, Bogdan; Hosokawa, Kohei; Makishima, Hideki; Yoshida, Kenichi; Townsley, Danielle; Sato-Otsubo, Aiko; Sato, Yusuke; Liu, Delong; Suzuki, Hiromichi; Wu, Colin O; Shiraishi, Yuichi; Clemente, Michael J; Kataoka, Keisuke; Shiozawa, Yusuke; Okuno, Yusuke; Chiba, Kenichi; Tanaka, Hiroko; Nagata, Yasunobu; Katagiri, Takamasa; Kon, Ayana; Sanada, Masashi; Scheinberg, Phillip; Miyano, Satoru; Maciejewski, Jaroslaw P; Nakao, Shinji; Young, Neal S; Ogawa, Seishi

    2015-07-02

    In patients with acquired aplastic anemia, destruction of hematopoietic cells by the immune system leads to pancytopenia. Patients have a response to immunosuppressive therapy, but myelodysplastic syndromes and acute myeloid leukemia develop in about 15% of the patients, usually many months to years after the diagnosis of aplastic anemia. We performed next-generation sequencing and array-based karyotyping using 668 blood samples obtained from 439 patients with aplastic anemia. We analyzed serial samples obtained from 82 patients. Somatic mutations in myeloid cancer candidate genes were present in one third of the patients, in a limited number of genes and at low initial variant allele frequency. Clonal hematopoiesis was detected in 47% of the patients, most frequently as acquired mutations. The prevalence of the mutations increased with age, and mutations had an age-related signature. DNMT3A-mutated and ASXL1-mutated clones tended to increase in size over time; the size of BCOR- and BCORL1-mutated and PIGA-mutated clones decreased or remained stable. Mutations in PIGA and BCOR and BCORL1 correlated with a better response to immunosuppressive therapy and longer and a higher rate of overall and progression-free survival; mutations in a subgroup of genes that included DNMT3A and ASXL1 were associated with worse outcomes. However, clonal dynamics were highly variable and might not necessarily have predicted the response to therapy and long-term survival among individual patients. Clonal hematopoiesis was prevalent in aplastic anemia. Some mutations were related to clinical outcomes. A highly biased set of mutations is evidence of Darwinian selection in the failed bone marrow environment. The pattern of somatic clones in individual patients over time was variable and frequently unpredictable. (Funded by Grant-in-Aid for Scientific Research and others.).

  19. Somatic mutations in the transcriptional corepressor gene BCORL1 in adult acute myelogenous leukemia

    PubMed Central

    Li, Meng; Collins, Roxane; Jiao, Yuchen; Ouillette, Peter; Bixby, Dale; Erba, Harry; Vogelstein, Bert; Kinzler, Kenneth W.

    2011-01-01

    To further our understanding of the genetic basis of acute myelogenous leukemia (AML), we determined the coding exon sequences of ∼ 18 000 protein-encoding genes in 8 patients with secondary AML. Here we report the discovery of novel somatic mutations in the transcriptional corepressor gene BCORL1 that is located on the X-chromosome. Analysis of BCORL1 in an unselected cohort of 173 AML patients identified a total of 10 mutated cases (6%) with BCORL1 mutations, whereas analysis of 19 AML cell lines uncovered 4 (21%) BCORL1 mutated cell lines. The majority (87%) of the mutations in BCORL1 were predicted to inactivate the gene product as a result of nonsense mutations, splice site mutation, or out-of-frame insertions or deletions. These results indicate that BCORL1 by genetic criteria is a novel candidate tumor suppressor gene, joining the growing list of genes recurrently mutated in AML. PMID:21989985

  20. The topography of mutational processes in breast cancer genomes

    DOE PAGES

    Morganella, Sandro; Alexandrov, Ludmil B.; Glodzik, Dominik; ...

    2016-01-01

    Somatic mutations in human cancers show unevenness in genomic distribution that correlate with aspects of genome structure and function. These mutations are, however, generated by multiple mutational processes operating through the cellular lineage between the fertilized egg and the cancer cell, each composed of specific DNA damage and repair components and leaving its own characteristic mutational signature on the genome. Using somatic mutation catalogues from 560 breast cancer whole-genome sequences, here we show that each of 12 base substitution, 2 insertion/deletion (indel) and 6 rearrangement mutational signatures present in breast tissue, exhibit distinct relationships with genomic features relating to transcription,more » DNA replication and chromatin organization. This signature-based approach permits visualization of the genomic distribution of mutational processes associated with APOBEC enzymes, mismatch repair deficiency and homologous recombinational repair deficiency, as well as mutational processes of unknown aetiology. Lastly, it highlights mechanistic insights including a putative replication-dependent mechanism of APOBEC-related mutagenesis.« less

  1. Mutational landscape of antibody variable domains reveals a switch modulating the interdomain conformational dynamics and antigen binding

    PubMed Central

    Koenig, Patrick; Lee, Chingwei V.; Walters, Benjamin T.; Janakiraman, Vasantharajan; Stinson, Jeremy; Patapoff, Thomas W.; Fuh, Germaine

    2017-01-01

    Somatic mutations within the antibody variable domains are critical to the immense capacity of the immune repertoire. Here, via a deep mutational scan, we dissect how mutations at all positions of the variable domains of a high-affinity anti-VEGF antibody G6.31 impact its antigen-binding function. The resulting mutational landscape demonstrates that large portions of antibody variable domain positions are open to mutation, and that beneficial mutations can be found throughout the variable domains. We determine the role of one antigen-distal light chain position 83, demonstrating that mutation at this site optimizes both antigen affinity and thermostability by modulating the interdomain conformational dynamics of the antigen-binding fragment. Furthermore, by analyzing a large number of human antibody sequences and structures, we demonstrate that somatic mutations occur frequently at position 83, with corresponding domain conformations observed for G6.31. Therefore, the modulation of interdomain dynamics represents an important mechanism during antibody maturation in vivo. PMID:28057863

  2. Mosaic generalized neurofibromatosis 1: report of two cases.

    PubMed

    Hardin, Jori; Behm, Allan; Haber, Richard M

    2014-01-01

    We report two cases of mosaic generalized neurofibromatosis 1 (NF1) and review the history of the classification of segmental neurofibromatosis (SNF; Ricardi type NF-V). Somatic mutations giving rise to limited disease, such as segmental neurofibromatosis are manifestations of mosaicism. If the mutation occurs before tissue differentiation, the clinical phenotype will be generalized disease. Mutations that occur later in development give rise to disease that is confined to a single region. Segmental neurofibromatosis is caused by a somatic mutation of neurofibromatosis type 1, and should not be regarded as a distinct entity from neurofibromatosis 1. Cases previously referred to as unilateral or bilateral segmental neurofibromatosis are now best referred to as mosaic generalized or mosaic localized neurofibromatosis 1.

  3. Cryopyrin-associated Periodic Syndromes in Italian Patients: Evaluation of the Rate of Somatic NLRP3 Mosaicism and Phenotypic Characterization.

    PubMed

    Lasigliè, Denise; Mensa-Vilaro, Anna; Ferrera, Denise; Caorsi, Roberta; Penco, Federica; Santamaria, Giuseppe; Di Duca, Marco; Amico, Giulia; Nakagawa, Kenji; Antonini, Francesca; Tommasini, Alberto; Consolini, Rita; Insalaco, Antonella; Cattalini, Marco; Obici, Laura; Gallizzi, Romina; Santarelli, Francesca; Del Zotto, Genny; Severino, Mariasavina; Rubartelli, Anna; Ravazzolo, Roberto; Martini, Alberto; Ceccherini, Isabella; Nishikomori, Ryuta; Gattorno, Marco; Arostegui, Juan I; Borghini, Silvia

    2017-11-01

    To evaluate the rate of somatic NLRP3 mosaicism in an Italian cohort of mutation-negative patients with cryopyrin-associated periodic syndrome (CAPS). The study enrolled 14 patients with a clinical phenotype consistent with CAPS in whom Sanger sequencing of the NLRP3 gene yielded negative results. Patients' DNA were subjected to amplicon-based NLRP3 deep sequencing. Low-level somatic NLRP3 mosaicism has been detected in 4 patients, 3 affected with chronic infantile neurological cutaneous and articular syndrome and 1 with Muckle-Wells syndrome. Identified nucleotide substitutions encode for 4 different amino acid exchanges, with 2 of them being novel (p.Y563C and p.G564S). In vitro functional studies confirmed the deleterious behavior of the 4 somatic NLRP3 mutations. Among the different neurological manifestations detected, 1 patient displayed mild loss of white matter volume on brain magnetic resonance imaging. The allele frequency of somatic NLRP3 mutations occurs generally under 15%, considered the threshold of detectability using the Sanger method of DNA sequencing. Consequently, routine genetic diagnostic of CAPS should be currently performed by next-generation techniques ensuring high coverage to identify also low-level mosaicism, whose actual frequency is yet unknown and probably underestimated.

  4. Rare splicing defects of FAS underly severe recessive autoimmune lymphoproliferative syndrome.

    PubMed

    Agrebi, N; Ben-Mustapha, I; Matoussi, N; Dhouib, N; Ben-Ali, M; Mekki, N; Ben-Ahmed, M; Larguèche, B; Ben Becher, S; Béjaoui, M; Barbouche, M R

    2017-10-01

    Autoimmune lymphoproliferative syndrome (ALPS) is a prototypic disorder of impaired apoptosis characterized by autoimmune features and lymphoproliferation. Heterozygous germline or somatic FAS mutations associated with preserved protein expression have been described. Very rare cases of homozygous germline FAS mutations causing severe autosomal recessive form of ALPS with a complete defect of Fas expression have been reported. We report two unrelated patients from highly inbred North African population showing a severe ALPS phenotype and an undetectable Fas surface expression. Two novel homozygous mutations have been identified underlying rare splicing defects mechanisms. The first mutation breaks a branch point sequence and the second alters a regulatory exonic splicing site. These splicing defects induce the skipping of exon 6 encoding the transmembrane domain of CD95. Our findings highlight the requirement of tight regulation of FAS exon 6 splicing for balanced alternative splicing and illustrate the importance of such studies in highly consanguineous populations. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. Somatic INK4a-ARF locus mutations: a significant mechanism of gene inactivation in squamous cell carcinomas of the head and neck.

    PubMed

    Poi, M J; Yen, T; Li, J; Song, H; Lang, J C; Schuller, D E; Pearl, D K; Casto, B C; Tsai, M D; Weghorst, C M

    2001-01-01

    The INK4a-ARF locus is located on human chromosome 9p21 and is known to encode two functionally distinct tumor-suppressor genes. The p16(INK4a) (p16) tumor-suppressor gene product is a negative regulator of cyclin-dependent kinases 4 and 6, which in turn positively regulate progression of mammalian cells through the cell cycle. The p14(ARF) tumor-suppressor gene product specifically interacts with human double minute 2, leading to the subsequent stabilization of p53 and G(1) arrest. Previous investigations analyzing the p16 gene in squamous cell carcinomas of the head and neck (SCCHNs) have suggested the predominate inactivating events to be homozygous gene deletions and hypermethylation of the p16 promoter. Somatic mutational inactivation of p16 has been reported to be low (0-10%, with a combined incidence of 25 of 279, or 9%) and to play only a minor role in the development of SCCHN. The present study examined whether this particular mechanism of INK4a/ARF inactivation, specifically somatic mutation, has been underestimated in SCCHN by determining the mutational status of the p16 and p14(ARF) genes in 100 primary SCCHNs with the use of polymerase chain reaction technology and a highly sensitive, nonradioactive modification of single-stranded conformational polymorphism (SSCP) analysis termed "cold" SSCP. Exons 1alpha, 1beta, and 2 of INK4a/ARF were amplified using intron-based primers or a combination of intron- and exon-based primers. A total of 27 SCCHNs (27%) exhibited sequence alterations in this locus, 22 (22%) of which were somatic sequence alterations and five (5%) of which were a single polymorphism in codon 148. Of the 22 somatic alterations, 20 (91%) directly or indirectly involved exon 2, and two (9%) were located within exon 1alpha. No mutations were found in exon 1beta. All 22 somatic mutations would be expected to yield altered p16 proteins, but only 15 of them should affect p14(ARF) proteins. Specific somatic alterations included microdeletions or insertions (nine of 22, 41%), a microrearrangement (one of 22, 5%), and single nucleotide substitutions (12 of 22, 56%). In addition, we analyzed the functional characteristics of seven unique mutant p16 proteins identified in this study by assessing their ability to inhibit cyclin-dependent kinase 4 activity. Six of the seven mutant proteins tested exhibited reduced function compared with wild-type p16, ranging from minor decreases of function (twofold to eightfold) in four samples to total loss of function (29- to 38-fold decrease) in two other samples. Overall, somatic mutation of the INK4a/ARF tumor suppressor locus, resulting in functionally deficient p16 and possibly p14(ARF) proteins, seems to be a prevalent event in the development of SCCHN. Mol. Carcinog. 30:26-36, 2001. Copyright 2001 Wiley-Liss, Inc.

  6. The driver landscape of sporadic chordoma

    DOE PAGES

    Tarpey, Patrick S.; Behjati, Sam; Young, Matthew D.; ...

    2017-10-12

    Chordoma is a malignant, often incurable bone tumour showing notochordal differentiation. Here, we defined the somatic driver landscape of 104 cases of sporadic chordoma. We reveal somatic duplications of the notochordal transcription factor brachyury (T) in up to 27% of cases. These variants recapitulate the rearrangement architecture of the pathogenic germline duplications of T that underlie familial chordoma. In addition, we find potentially clinically actionable PI3K signalling mutations in 16% of cases. Intriguingly, one of the most frequently altered genes, mutated exclusively by inactivating mutation, was LYST (10%), which may represent a novel cancer gene in chordoma.

  7. The driver landscape of sporadic chordoma

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tarpey, Patrick S.; Behjati, Sam; Young, Matthew D.

    Chordoma is a malignant, often incurable bone tumour showing notochordal differentiation. Here, we defined the somatic driver landscape of 104 cases of sporadic chordoma. We reveal somatic duplications of the notochordal transcription factor brachyury (T) in up to 27% of cases. These variants recapitulate the rearrangement architecture of the pathogenic germline duplications of T that underlie familial chordoma. In addition, we find potentially clinically actionable PI3K signalling mutations in 16% of cases. Intriguingly, one of the most frequently altered genes, mutated exclusively by inactivating mutation, was LYST (10%), which may represent a novel cancer gene in chordoma.

  8. Evidence that the oxygen enhancement ratio for pink somatic mutations in Tradescantia stamen hairs may approach unity at very low x-ray doses

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Underbrink, A.G.; Woch, B.

    1980-11-01

    Experimental evidence was found that the oxygen enhancement ratio (OER) for pink somatic mutations in the stamen hairs of Tradescantia clone 02 appears to reach unity at X-ray doses of 2 to 3 rad. There is also a small segment on the dose-response curves from about 3 to 10 rad where the OER appears to be dose-dependent. At higher doses the aerated and hypoxic curves are parallel, and the OER is 3.2 up to doses where the mutation frequency reaches a plateau.

  9. Cancer-Associated Mutations in Endometriosis without Cancer

    PubMed Central

    Anglesio, M.S.; Papadopoulos, N.; Ayhan, A.; Nazeran, T.M.; Noë, M.; Horlings, H.M.; Lum, A.; Jones, S.; Senz, J.; Seckin, T.; Ho, J.; Wu, R.-C.; Lac, V.; Ogawa, H.; Tessier-Cloutier, B.; Alhassan, R.; Wang, A.; Wang, Y.; Cohen, J.D.; Wong, F.; Hasanovic, A.; Orr, N.; Zhang, M.; Popoli, M.; McMahon, W.; Wood, L.D.; Mattox, A.; Allaire, C.; Segars, J.; Williams, C.; Tomasetti, C.; Boyd, N.; Kinzler, K.W.; Gilks, C.B.; Diaz, L.; Wang, T.-L.; Vogelstein, B.; Yong, P.J.; Huntsman, D.G.; Shih, I.-M.

    2017-01-01

    BACKGROUND Endometriosis, defined as the presence of ectopic endometrial stroma and epithelium, affects approximately 10% of reproductive-age women and can cause pelvic pain and infertility. Endometriotic lesions are considered to be benign inflammatory lesions but have cancerlike features such as local invasion and resistance to apoptosis. METHODS We analyzed deeply infiltrating endometriotic lesions from 27 patients by means of exomewide sequencing (24 patients) or cancer-driver targeted sequencing (3 patients). Mutations were validated with the use of digital genomic methods in micro-dissected epithelium and stroma. Epithelial and stromal components of lesions from an additional 12 patients were analyzed by means of a droplet digital polymerase-chain-reaction (PCR) assay for recurrent activating KRAS mutations. RESULTS Exome sequencing revealed somatic mutations in 19 of 24 patients (79%). Five patients harbored known cancer driver mutations in ARID1A, PIK3CA, KRAS, or PPP2R1A, which were validated by Safe-Sequencing System or immunohistochemical analysis. The likelihood of driver genes being affected at this rate in the absence of selection was estimated at P = 0.001 (binomial test). Targeted sequencing and a droplet digital PCR assay identified KRAS mutations in 2 of 3 patients and 3 of 12 patients, respectively, with mutations in the epithelium but not the stroma. One patient harbored two different KRAS mutations, c.35G→T and c.35G→C, and another carried identical KRAS c.35G→A mutations in three distinct lesions. CONCLUSIONS We found that lesions in deep infiltrating endometriosis, which are associated with virtually no risk of malignant transformation, harbor somatic cancer driver mutations. Ten of 39 deep infiltrating lesions (26%) carried driver mutations; all the tested somatic mutations appeared to be confined to the epithelial compartment of endometriotic lesions. PMID:28489996

  10. Acute myeloid leukemia-associated DNMT3A p.Arg882His mutation in a patient with Tatton-Brown-Rahman overgrowth syndrome as a constitutional mutation.

    PubMed

    Kosaki, Rika; Terashima, Hiroshi; Kubota, Masaya; Kosaki, Kenjiro

    2017-01-01

    DNA methylation plays a critical role in both embryonic development and tumorigenesis and is mediated through various DNA methyltransferases. Constitutional mutations in the de novo DNA methyltransferase DNMT3A cause a recently identified Tatton-Brown-Rahman overgrowth syndrome (TBRS). Somatically acquired mutations in DNMT3A are causally associated with acute myeloid leukemia (AML), and p.Arg882His represents the most prevalent hotspot. So far, no patients with TBRS have been reported to have subsequently developed AML. Here, we report a live birth and the survival of a female with the TBRS phenotype who had a heterozygous constitutional DNMT3A mutation at the AML somatic mutation hotspot p.Arg882His in her DNA from peripheral blood and buccal tissue. Her characteristic features at birth included hypotonia, narrow palpebral fissures, ventricular septal defect, umbilical hernia, sacral cyst, Chiari type I anomaly. At the age of 6 years, she exhibited overgrowth (> 3 SD) and round face and intellectual disability. This report represents the first documentation of the same variant (DNMT3A p.Arg882His) as both the constitutional mutation associated with TBRS and the somatic mutation hotspot of AML. The observation neither confirms nor denies the notion that mutations responsible for TBRS and those for AML might share the same mode of action. Larger data sets are required to determine whether TBRS patients with constitutional DNMT3A mutations are at an increased risk for AML. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  11. SomInaClust: detection of cancer genes based on somatic mutation patterns of inactivation and clustering.

    PubMed

    Van den Eynden, Jimmy; Fierro, Ana Carolina; Verbeke, Lieven P C; Marchal, Kathleen

    2015-04-23

    With the advances in high throughput technologies, increasing amounts of cancer somatic mutation data are being generated and made available. Only a small number of (driver) mutations occur in driver genes and are responsible for carcinogenesis, while the majority of (passenger) mutations do not influence tumour biology. In this study, SomInaClust is introduced, a method that accurately identifies driver genes based on their mutation pattern across tumour samples and then classifies them into oncogenes or tumour suppressor genes respectively. SomInaClust starts from the observation that oncogenes mainly contain mutations that, due to positive selection, cluster at similar positions in a gene across patient samples, whereas tumour suppressor genes contain a high number of protein-truncating mutations throughout the entire gene length. The method was shown to prioritize driver genes in 9 different solid cancers. Furthermore it was found to be complementary to existing similar-purpose methods with the additional advantages that it has a higher sensitivity, also for rare mutations (occurring in less than 1% of all samples), and it accurately classifies candidate driver genes in putative oncogenes and tumour suppressor genes. Pathway enrichment analysis showed that the identified genes belong to known cancer signalling pathways, and that the distinction between oncogenes and tumour suppressor genes is biologically relevant. SomInaClust was shown to detect candidate driver genes based on somatic mutation patterns of inactivation and clustering and to distinguish oncogenes from tumour suppressor genes. The method could be used for the identification of new cancer genes or to filter mutation data for further data-integration purposes.

  12. Novel homozygous FANCL mutation and somatic heterozygous SETBP1 mutation in a Chinese girl with Fanconi Anemia.

    PubMed

    Wu, Weiqing; Liu, Yang; Zhou, Qinghua; Wang, Qin; Luo, Fuwei; Xu, Zhiyong; Geng, Qian; Li, Peining; Zhang, Hui Z; Xie, Jiansheng

    2017-07-01

    Fanconi Anemia (FA) is a rare genetically heterogeneous disorder with 17 known complement groups caused by mutations in different genes. FA complementation group L (FA-L, OMIM #608111) occurred in 0.2% of all FA and only eight mutant variants in the FANCL gene were documented. Phenotype and genotype correlation in FANCL associated FA is still obscure. Here we describe a Chinese girl with FA-L caused by a novel homozygous mutation c.822_823insCTTTCAGG (p.Asp275LeufsX13) in the FANCL gene. The patient's clinical course was typical for FA with progression to bone marrow failure, and death from acute myelomonocytic leukemia (AML-M4) at 9 years of age. Mutation analysis also detected a likely somatic c.2608G > A (p.Gly870Ser) in the SETBP1 gene. Consistent copy number losses of 7q and 18p and gains of 3q and 21q and accumulated non-clonal single cell chromosomal abnormalities were detected in blood leukocytes as her FA progressed. This is the first Chinese FA-L case caused by a novel FANCL mutation. The somatic gene mutation and copy number aberrations could be used to monitor disease progression and the clinical findings provide further information for genotype-phenotype correlation for FA-L. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  13. Germ cell regeneration-mediated, enhanced mutagenesis in the ascidian Ciona intestinalis reveals flexible germ cell formation from different somatic cells.

    PubMed

    Yoshida, Keita; Hozumi, Akiko; Treen, Nicholas; Sakuma, Tetsushi; Yamamoto, Takashi; Shirae-Kurabayashi, Maki; Sasakura, Yasunori

    2017-03-15

    The ascidian Ciona intestinalis has a high regeneration capacity that enables the regeneration of artificially removed primordial germ cells (PGCs) from somatic cells. We utilized PGC regeneration to establish efficient methods of germ line mutagenesis with transcription activator-like effector nucleases (TALENs). When PGCs were artificially removed from animals in which a TALEN pair was expressed, somatic cells harboring mutations in the target gene were converted into germ cells, this germ cell population exhibited higher mutation rates than animals not subjected to PGC removal. PGC regeneration enables us to use TALEN expression vectors of specific somatic tissues for germ cell mutagenesis. Unexpectedly, cis elements for epidermis, neural tissue and muscle could be used for germ cell mutagenesis, indicating there are multiple sources of regenerated PGCs, suggesting a flexibility of differentiated Ciona somatic cells to regain totipotency. Sperm and eggs of a single hermaphroditic, PGC regenerated animal typically have different mutations, suggesting they arise from different cells. PGCs can be generated from somatic cells even though the maternal PGCs are not removed, suggesting that the PGC regeneration is not solely an artificial event but could have an endogenous function in Ciona. This study provides a technical innovation in the genome-editing methods, including easy establishment of mutant lines. Moreover, this study suggests cellular mechanisms and the potential evolutionary significance of PGC regeneration in Ciona. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Novel approaches to diagnosis and treatment of Juvenile Myelomonocytic Leukemia.

    PubMed

    Locatelli, Franco; Algeri, Mattia; Merli, Pietro; Strocchio, Luisa

    2018-02-01

    Juvenile myelomonocytic leukemia (JMML) is a clonal hematopoietic disorder of infancy/early childhood, resulting from oncogenic mutations in genes involved in the Ras pathway. As JMML often exhibits an aggressive course, the timing of diagnosis and treatment is critical to outcome. Areas covered: This review summarizes current approaches to diagnosis and treatment of JMML, highlighting most recent insights into genetic and epigenetic mechanisms underlying the disease, and providing an overview of novel potential therapeutic strategies. Expert commentary: At present, allogeneic HSCT remains the only potentially effective therapy, being able to cure more than 50% of patients, relapse representing the main cause of treatment failure. Prompt HSCT is recommended for all children with NF1, somatic PTPN11 and KRAS mutations, and for most children with somatic NRAS mutations. Conversely, a 'watch and wait' strategy should be adopted in children with germline CBL mutations, specific somatic NRAS mutation, and in Noonan syndrome patients, since spontaneous resolution has been reported to occur. Novel drugs targeting relevant nodes of JMML leukemogenesis have been explored in pre-HSCT window or at relapse. The use of 5-azacytidine, a DNA-hypomethylating agent reported to induce hematologic and molecular remission in some JMML children, is currently being investigated in clinical trials.

  15. A comprehensive characterization of rare mitochondrial DNA variants in neuroblastoma.

    PubMed

    Calabrese, Francesco Maria; Clima, Rosanna; Pignataro, Piero; Lasorsa, Vito Alessandro; Hogarty, Michael D; Castellano, Aurora; Conte, Massimo; Tonini, Gian Paolo; Iolascon, Achille; Gasparre, Giuseppe; Capasso, Mario

    2016-08-02

    Neuroblastoma, a tumor of the developing sympathetic nervous system, is a common childhood neoplasm that is often lethal. Mitochondrial DNA (mtDNA) mutations have been found in most tumors including neuroblastoma. We extracted mtDNA data from a cohort of neuroblastoma samples that had undergone Whole Exome Sequencing (WES) and also used snap-frozen samples in which mtDNA was entirely sequenced by Sanger technology. We next undertook the challenge of determining those mutations that are relevant to, or arisen during tumor development. The bioinformatics pipeline used to extract mitochondrial variants from matched tumor/blood samples was enriched by a set of filters inclusive of heteroplasmic fraction, nucleotide variability, and in silico prediction of pathogenicity. Our in silico multistep workflow applied both on WES and Sanger-sequenced neuroblastoma samples, allowed us to identify a limited burden of somatic and germline mitochondrial mutations with a potential pathogenic impact. The few singleton germline and somatic mitochondrial mutations emerged, according to our in silico analysis, do not appear to impact on the development of neuroblastoma. Our findings are consistent with the hypothesis that most mitochondrial somatic mutations can be considered as 'passengers' and consequently have no discernible effect in this type of cancer.

  16. University of Texas MD Anderson Cancer Center: High-Throughput Screening Identifying Driving Mutations in Endometrial Cancer | Office of Cancer Genomics

    Cancer.gov

    Recent advances in next-generation sequencing technology have enabled the unprecedented characterization of a full spectrum of somatic alterations in cancer genomes. Given the large numbers of somatic mutations typically detected by this approach, a key challenge in the downstream analysis is to distinguish “drivers” that functionally contribute to tumorigenesis from “passengers” that occur as the consequence of genomic instability.

  17. Comparison against 186 canid whole-genome sequences reveals survival strategies of an ancient clonally transmissible canine tumor

    PubMed Central

    Decker, Brennan; Davis, Brian W.; Rimbault, Maud; Long, Adrienne H.; Karlins, Eric; Jagannathan, Vidhya; Reiman, Rebecca; Parker, Heidi G.; Drögemüller, Cord; Corneveaux, Jason J.; Chapman, Erica S.; Trent, Jeffery M.; Leeb, Tosso; Huentelman, Matthew J.; Wayne, Robert K.; Karyadi, Danielle M.; Ostrander, Elaine A.

    2015-01-01

    Canine transmissible venereal tumor (CTVT) is a parasitic cancer clone that has propagated for thousands of years via sexual transfer of malignant cells. Little is understood about the mechanisms that converted an ancient tumor into the world's oldest known continuously propagating somatic cell lineage. We created the largest existing catalog of canine genome-wide variation and compared it against two CTVT genome sequences, thereby separating alleles derived from the founder's genome from somatic mutations that must drive clonal transmissibility. We show that CTVT has undergone continuous adaptation to its transmissible allograft niche, with overlapping mutations at every step of immunosurveillance, particularly self-antigen presentation and apoptosis. We also identified chronologically early somatic mutations in oncogenesis- and immune-related genes that may represent key initiators of clonal transmissibility. Thus, we provide the first insights into the specific genomic aberrations that underlie CTVT's dogged perseverance in canids around the world. PMID:26232412

  18. Somatic mitochondrial mutation in gastric cancer.

    PubMed Central

    Burgart, L. J.; Zheng, J.; Shu, Q.; Strickler, J. G.; Shibata, D.

    1995-01-01

    Likely hot spots for mutations are mitochondrial sequences as there is less repair and more damage by carcinogens compared with nuclear sequences. A somatic 50-bp mitochondrial D-loop deletion was detected in four gastric adenocarcinomas. The deletion included the CSB2 region and was flanked by 9-bp direct repeats. The deletion was more frequent in adenocarcinomas arising from the gastroesophageal junction (4/32, 12.5%) compared with more distal tumors (0/45). Topographical analysis revealed the absence of the deletion from normal tissues except in focal portions of smooth muscle in one case. In two cases, apparent mutant homoplasmy was present throughout two tumors, including their metastases. In the two other cases, the mutation was present in only minor focal portions ( < 5%) of their primary tumors. These findings document the presence of somatic mitochondrial alterations in gastric cancer, which may reflect the environmental and genetic influences operative during tumor progression. Images Figure 3 Figure 4 Figure 5 PMID:7573355

  19. The Mutational Landscape of Adenoid Cystic Carcinoma

    PubMed Central

    Ho, Allen S.; Kannan, Kasthuri; Roy, David M.; Morris, Luc G.T.; Ganly, Ian; Katabi, Nora; Ramaswami, Deepa; Walsh, Logan A.; Eng, Stephanie; Huse, Jason T.; Zhang, Jianan; Dolgalev, Igor; Huberman, Kety; Heguy, Adriana; Viale, Agnes; Drobnjak, Marija; Leversha, Margaret A.; Rice, Christine E.; Singh, Bhuvanesh; Iyer, N. Gopalakrishna; Leemans, C. Rene; Bloemena, Elisabeth; Ferris, Robert L.; Seethala, Raja R.; Gross, Benjamin E.; Liang, Yupu; Sinha, Rileen; Peng, Luke; Raphael, Benjamin J.; Turcan, Sevin; Gong, Yongxing; Schultz, Nikolaus; Kim, Seungwon; Chiosea, Simion; Shah, Jatin P.; Sander, Chris; Lee, William; Chan, Timothy A.

    2013-01-01

    Adenoid cystic carcinomas (ACCs) are among the most enigmatic of human malignancies. These aggressive salivary cancers frequently recur and metastasize despite definitive treatment, with no known effective chemotherapy regimen. Here, we determined the ACC mutational landscape and report the exome or whole genome sequences of 60 ACC tumor/normal pairs. These analyses revealed a low exonic somatic mutation rate (0.31 non-silent events/megabase) and wide mutational diversity. Interestingly, mutations selectively involved chromatin state regulators, such as SMARCA2, CREBBP, and KDM6A, suggesting aberrant epigenetic regulation in ACC oncogenesis. Mutations in genes central to DNA damage and protein kinase A signaling also implicate these processes. We observed MYB-NFIB translocations and somatic mutations in MYB-associated genes, solidifying these aberrations as critical events. Lastly, we identified recurrent mutations in the FGF/IGF/PI3K pathway that may potentially offer new avenues for therapy (30%). Collectively, our observations establish a molecular foundation for understanding and exploring new treatments for ACC. PMID:23685749

  20. Whole-genome sequencing of asian lung cancers: second-hand smoke unlikely to be responsible for higher incidence of lung cancer among Asian never-smokers.

    PubMed

    Krishnan, Vidhya G; Ebert, Philip J; Ting, Jason C; Lim, Elaine; Wong, Swee-Seong; Teo, Audrey S M; Yue, Yong G; Chua, Hui-Hoon; Ma, Xiwen; Loh, Gary S L; Lin, Yuhao; Tan, Joanna H J; Yu, Kun; Zhang, Shenli; Reinhard, Christoph; Tan, Daniel S W; Peters, Brock A; Lincoln, Stephen E; Ballinger, Dennis G; Laramie, Jason M; Nilsen, Geoffrey B; Barber, Thomas D; Tan, Patrick; Hillmer, Axel M; Ng, Pauline C

    2014-11-01

    Asian nonsmoking populations have a higher incidence of lung cancer compared with their European counterparts. There is a long-standing hypothesis that the increase of lung cancer in Asian never-smokers is due to environmental factors such as second-hand smoke. We analyzed whole-genome sequencing of 30 Asian lung cancers. Unsupervised clustering of mutational signatures separated the patients into two categories of either all the never-smokers or all the smokers or ex-smokers. In addition, nearly one third of the ex-smokers and smokers classified with the never-smoker-like cluster. The somatic variant profiles of Asian lung cancers were similar to that of European origin with G.C>T.A being predominant in smokers. We found EGFR and TP53 to be the most frequently mutated genes with mutations in 50% and 27% of individuals, respectively. Among the 16 never-smokers, 69% had an EGFR mutation compared with 29% of 14 smokers/ex-smokers. Asian never-smokers had lung cancer signatures distinct from the smoker signature and their mutation profiles were similar to European never-smokers. The profiles of Asian and European smokers are also similar. Taken together, these results suggested that the same mutational mechanisms underlie the etiology for both ethnic groups. Thus, the high incidence of lung cancer in Asian never-smokers seems unlikely to be due to second-hand smoke or other carcinogens that cause oxidative DNA damage, implying that routine EGFR testing is warranted in the Asian population regardless of smoking status. ©2014 American Association for Cancer Research.

  1. Spectrum of somatic EGFR, KRAS, BRAF, PTEN mutations and TTF-1 expression in Brazilian lung cancer patients.

    PubMed

    Carneiro, Juliana G; Couto, Patricia G; Bastos-Rodrigues, Luciana; Bicalho, Maria Aparecida C; Vidigal, Paula V; Vilhena, Alyne; Amaral, Nilson F; Bale, Allen E; Friedman, Eitan; De Marco, Luiz

    2014-01-01

    Lung cancer is the leading global cause of cancer-related mortality. Inter-individual variability in treatment response and prognosis has been associated with genetic polymorphisms in specific genes: EGFR, KRAS, BRAF, PTEN and TTF-1. Somatic mutations in EGFR and KRAS genes are reported at rates of 15-40% in non-small cell lung cancer (NSCLC) in ethnically diverse populations. BRAF and PTEN are commonly mutated genes in various cancer types, including NSCLC, with PTEN mutations exerting an effect on the therapeutic response of EGFR/AKT/PI3K pathway inhibitors. TTF-1 is expressed in approximately 80% of lung adenocarcinomas and its positivity correlates with higher prevalence of EGFR mutation in this cancer type. To determine molecular markers for lung cancer in Brazilian patients, the rate of the predominant EGFR, KRAS, BRAF and PTEN mutations, as well as TTF-1 expression, was assessed in 88 Brazilian NSCLC patients. EGFR exon 19 deletions (del746-750) were detected in 3/88 (3·4%) patients. Activating KRAS mutations in codons 12 and 61 were noted in five (5·7%) and two (2·3%) patients, respectively. None of the common somatic mutations were detected in either the BRAF or PTEN genes. TTF-1 was overexpressed in 40·7% of squamous-cell carcinoma (SCC). Our findings add to a growing body of data that highlights the genetic heterogeneity of the abnormal EGFR pathway in lung cancer among ethnically diverse populations.

  2. Mutational signatures associated with tobacco smoking in human cancer

    DOE PAGES

    Alexandrov, Ludmil B.; Ju, Young Seok; Haase, Kerstin; ...

    2016-11-04

    Tobacco smoking increases the risk of at least 17 classes of cancer. Here, we analyzed somatic mutations and DNA methylation in 5,243 cancers of types for which tobacco smoking confers an elevated risk. Smoking is associated with increased mutation burdens of multiple distinct mutational signatures, which contribute to different extents in different cancers. One of these signatures, mainly found in cancers derived from tissues directly exposed to tobacco smoke, is attributable to misreplication of DNA damage caused by tobacco carcinogens. Others likely reflect indirect activation of DNA edi ting by APOBEC cytidine deaminases and of an endogenous clock-like mutational process.more » Smoking is associated with limited differences in methylation. The results are consistent with the proposition that smoking increases cancer risk by increasing the somatic mutation load, although direct evidence for this mechanism is lacking in some smoking-related cancer types.« less

  3. Mutational signatures associated with tobacco smoking in human cancer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Alexandrov, Ludmil B.; Ju, Young Seok; Haase, Kerstin

    Tobacco smoking increases the risk of at least 17 classes of cancer. Here, we analyzed somatic mutations and DNA methylation in 5,243 cancers of types for which tobacco smoking confers an elevated risk. Smoking is associated with increased mutation burdens of multiple distinct mutational signatures, which contribute to different extents in different cancers. One of these signatures, mainly found in cancers derived from tissues directly exposed to tobacco smoke, is attributable to misreplication of DNA damage caused by tobacco carcinogens. Others likely reflect indirect activation of DNA edi ting by APOBEC cytidine deaminases and of an endogenous clock-like mutational process.more » Smoking is associated with limited differences in methylation. The results are consistent with the proposition that smoking increases cancer risk by increasing the somatic mutation load, although direct evidence for this mechanism is lacking in some smoking-related cancer types.« less

  4. Evidence that human immunoglobulin M rheumatoid factors can Be derived from the natural autoantibody pool and undergo an antigen driven immune response in which somatically mutated rheumatoid factors have lower affinities for immunoglobulin G Fc than their germline counterparts.

    PubMed

    Carayannopoulos, M O; Potter, K N; Li, Y; Natvig, J B; Capra, J D

    2000-04-01

    The question of whether immunoglobulin (Ig)M rheumatoid factors (RF) arise as the result of an abnormal expansion of already existing clones producing natural autoantibodies or emerge as new clones that are somatically mutated owing to an antigen driven immune response has never been conclusively answered. In this study, an inhibition ELISA was utilized to measure the affinities of recombinant antibodies using VH segments reverted back to their closest germline counterparts (germline revertants). In all cases, the somatically mutated parental RFs had a decreased affinity for immunoglobulin (Ig)G Fc compared to the germline revertant, indicating that the antibodies in the germline configuration had the higher affinities. This demonstrates that somatic mutation is not a prerequisite to generate disease associated antibodies. The presence of mutations in the parental IgM RFS suggests that these cells had been involved in a germinal centre reaction. As the germinal centre is the conventional site of the acquisition of mutations during an antigen driven response, these data suggest a role for germinal centres in the generation of the antibody diversity in addition to the selection of higher affinity antibodies. Assuming that only antigen selected cells survive deletion, these data support the hypothesis that IgM RFS can be derived from the natural autoantibody repertoire and result from an antigen driven response. Mechanisms controlling the survival of B cells based on the affinity/avidity of the immunoglobulin receptor are shown to be functional in patients with rheumatoid arthritis.

  5. Biallelic germline and somatic mutations in malignant mesothelioma: multiple mutations in transcription regulators including mSWI/SNF genes.

    PubMed

    Yoshikawa, Yoshie; Sato, Ayuko; Tsujimura, Tohru; Otsuki, Taiichiro; Fukuoka, Kazuya; Hasegawa, Seiki; Nakano, Takashi; Hashimoto-Tamaoki, Tomoko

    2015-02-01

    We detected low levels of acetylation for histone H3 tail lysines in malignant mesothelioma (MM) cell lines resistant to histone deacetylase inhibitors. To identify the possible genetic causes related to the low histone acetylation levels, whole-exome sequencing was conducted with MM cell lines established from eight patients. A mono-allelic variant of BRD1 was common to two MM cell lines with very low acetylation levels. We identified 318 homozygous protein-damaging variants/mutations (18-78 variants/mutations per patient); annotation analysis showed enrichment of the molecules associated with mammalian SWI/SNF (mSWI/SNF) chromatin remodeling complexes and co-activators that facilitate initiation of transcription. In seven of the patients, we detected a combination of variants in histone modifiers or transcription factors/co-factors, in addition to variants in mSWI/SNF. Direct sequencing showed that homozygous mutations in SMARCA4, PBRM1 and ARID2 were somatic. In one patient, homozygous germline variants were observed for SMARCC1 and SETD2 in chr3p22.1-3p14.2. These exhibited extended germline homozygosity and were in regions containing somatic mutations, leading to a loss of BAP1 and PBRM1 expression in MM cell line. Most protein-damaging variants were heterozygous in normal tissues. Heterozygous germline variants were often converted into hemizygous variants by mono-allelic deletion, and were rarely homozygous because of acquired uniparental disomy. Our findings imply that MM might develop through the somatic inactivation of mSWI/SNF complex subunits and/or histone modifiers, including BAP1, in subjects that have rare germline variants of these transcription regulators and/or transcription factors/co-factors, and in regions prone to mono-allelic deletion during oncogenesis. © 2014 UICC.

  6. Ultra-sensitive Sequencing Identifies High Prevalence of Clonal Hematopoiesis-Associated Mutations throughout Adult Life.

    PubMed

    Acuna-Hidalgo, Rocio; Sengul, Hilal; Steehouwer, Marloes; van de Vorst, Maartje; Vermeulen, Sita H; Kiemeney, Lambertus A L M; Veltman, Joris A; Gilissen, Christian; Hoischen, Alexander

    2017-07-06

    Clonal hematopoiesis results from somatic mutations in hematopoietic stem cells, which give an advantage to mutant cells, driving their clonal expansion and potentially leading to leukemia. The acquisition of clonal hematopoiesis-driver mutations (CHDMs) occurs with normal aging and these mutations have been detected in more than 10% of individuals ≥65 years. We aimed to examine the prevalence and characteristics of CHDMs throughout adult life. We developed a targeted re-sequencing assay combining high-throughput with ultra-high sensitivity based on single-molecule molecular inversion probes (smMIPs). Using smMIPs, we screened more than 100 loci for CHDMs in more than 2,000 blood DNA samples from population controls between 20 and 69 years of age. Loci screened included 40 regions known to drive clonal hematopoiesis when mutated and 64 novel candidate loci. We identified 224 somatic mutations throughout our cohort, of which 216 were coding mutations in known driver genes (DNMT3A, JAK2, GNAS, TET2, and ASXL1), including 196 point mutations and 20 indels. Our assay's improved sensitivity allowed us to detect mutations with variant allele frequencies as low as 0.001. CHDMs were identified in more than 20% of individuals 60 to 69 years of age and in 3% of individuals 20 to 29 years of age, approximately double the previously reported prevalence despite screening a limited set of loci. Our findings support the occurrence of clonal hematopoiesis-associated mutations as a widespread mechanism linked with aging, suggesting that mosaicism as a result of clonal evolution of cells harboring somatic mutations is a universal mechanism occurring at all ages in healthy humans. Copyright © 2017 American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  7. Clonal Architecture of Secondary Acute Myeloid Leukemia

    PubMed Central

    Walter, Matthew J.; Shen, Dong; Ding, Li; Shao, Jin; Koboldt, Daniel C.; Chen, Ken; Larson, David E.; McLellan, Michael D.; Dooling, David; Abbott, Rachel; Fulton, Robert; Magrini, Vincent; Schmidt, Heather; Kalicki-Veizer, Joelle; O’Laughlin, Michelle; Fan, Xian; Grillot, Marcus; Witowski, Sarah; Heath, Sharon; Frater, John L.; Eades, William; Tomasson, Michael; Westervelt, Peter; DiPersio, John F.; Link, Daniel C.; Mardis, Elaine R.; Ley, Timothy J.; Wilson, Richard K.; Graubert, Timothy A.

    2012-01-01

    BACKGROUND The myelodysplastic syndromes are a group of hematologic disorders that often evolve into secondary acute myeloid leukemia (AML). The genetic changes that underlie progression from the myelodysplastic syndromes to secondary AML are not well understood. METHODS We performed whole-genome sequencing of seven paired samples of skin and bone marrow in seven subjects with secondary AML to identify somatic mutations specific to secondary AML. We then genotyped a bone marrow sample obtained during the antecedent myelodysplastic-syndrome stage from each subject to determine the presence or absence of the specific somatic mutations. We identified recurrent mutations in coding genes and defined the clonal architecture of each pair of samples from the myelodysplastic-syndrome stage and the secondary-AML stage, using the allele burden of hundreds of mutations. RESULTS Approximately 85% of bone marrow cells were clonal in the myelodysplastic-syndrome and secondary-AML samples, regardless of the myeloblast count. The secondary-AML samples contained mutations in 11 recurrently mutated genes, including 4 genes that have not been previously implicated in the myelodysplastic syndromes or AML. In every case, progression to acute leukemia was defined by the persistence of an antecedent founding clone containing 182 to 660 somatic mutations and the outgrowth or emergence of at least one subclone, harboring dozens to hundreds of new mutations. All founding clones and subclones contained at least one mutation in a coding gene. CONCLUSIONS Nearly all the bone marrow cells in patients with myelodysplastic syndromes and secondary AML are clonally derived. Genetic evolution of secondary AML is a dynamic process shaped by multiple cycles of mutation acquisition and clonal selection. Recurrent gene mutations are found in both founding clones and daughter subclones. (Funded by the National Institutes of Health and others.) PMID:22417201

  8. Recurrent gain-of-function USP8 mutations in Cushing's disease

    PubMed Central

    Ma, Zeng-Yi; Song, Zhi-Jian; Chen, Jian-Hua; Wang, Yong-Fei; Li, Shi-Qi; Zhou, Liang-Fu; Mao, Ying; Li, Yi-Ming; Hu, Rong-Gui; Zhang, Zhao-Yun; Ye, Hong-Ying; Shen, Ming; Shou, Xue-Fei; Li, Zhi-Qiang; Peng, Hong; Wang, Qing-Zhong; Zhou, Dai-Zhan; Qin, Xiao-Lan; Ji, Jue; Zheng, Jie; Chen, Hong; Wang, Yin; Geng, Dao-Ying; Tang, Wei-Jun; Fu, Chao-Wei; Shi, Zhi-Feng; Zhang, Yi-Chao; Ye, Zhao; He, Wen-Qiang; Zhang, Qi-Lin; Tang, Qi-Sheng; Xie, Rong; Shen, Jia-Wei; Wen, Zu-Jia; Zhou, Juan; Wang, Tao; Huang, Shan; Qiu, Hui-Jia; Qiao, Ni-Dan; Zhang, Yi; Pan, Li; Bao, Wei-Min; Liu, Ying-Chao; Huang, Chuan-Xin; Shi, Yong-Yong; Zhao, Yao

    2015-01-01

    Cushing's disease, also known as adrenocorticotropic hormone (ACTH)-secreting pituitary adenomas (PAs) that cause excess cortisol production, accounts for up to 85% of corticotrophin-dependent Cushing's syndrome cases. However, the genetic alterations in this disease are unclear. Here, we performed whole-exome sequencing of DNA derived from 12 ACTH-secreting PAs and matched blood samples, which revealed three types of somatic mutations in a candidate gene, USP8 (encoding ubiquitin-specific protease 8), exclusively in exon 14 in 8 of 12 ACTH-secreting PAs. We further evaluated somatic USP8 mutations in additional 258 PAs by Sanger sequencing. Targeted sequencing further identified a total of 17 types of USP8 variants in 67 of 108 ACTH-secreting PAs (62.04%). However, none of these mutations was detected in other types of PAs (n = 150). These mutations aggregate within the 14-3-3 binding motif of USP8 and disrupt the interaction between USP8 and 14-3-3 protein, resulting in an elevated capacity to protect EGFR from lysosomal degradation. Accordingly, PAs with mutated USP8 display a higher incidence of EGFR expression, elevated EGFR protein abundance and mRNA expression levels of POMC, which encodes the precursor of ACTH. PAs with mutated USP8 are significantly smaller in size and have higher ACTH production than wild-type PAs. In surgically resected primary USP8-mutated tumor cells, USP8 knockdown or blocking EGFR effectively attenuates ACTH secretion. Taken together, somatic gain-of-function USP8 mutations are common and contribute to ACTH overproduction in Cushing's disease. Inhibition of USP8 or EGFR is promising for treating USP8-mutated corticotrophin adenoma. Our study highlights the potentially functional mutated gene in Cushing's disease and provides insights into the therapeutics of this disease. PMID:25675982

  9. Somatic POLE exonuclease domain mutations are early events in sporadic endometrial and colorectal carcinogenesis, determining driver mutational landscape, clonal neoantigen burden and immune response.

    PubMed

    Temko, Daniel; Van Gool, Inge C; Rayner, Emily; Glaire, Mark; Makino, Seiko; Brown, Matthew; Chegwidden, Laura; Palles, Claire; Depreeuw, Jeroen; Beggs, Andrew; Stathopoulou, Chaido; Mason, John; Baker, Ann-Marie; Williams, Marc; Cerundolo, Vincenzo; Rei, Margarida; Taylor, Jenny C; Schuh, Anna; Ahmed, Ahmed; Amant, Frédéric; Lambrechts, Diether; Smit, Vincent Thbm; Bosse, Tjalling; Graham, Trevor A; Church, David N; Tomlinson, Ian

    2018-03-31

    Genomic instability, which is a hallmark of cancer, is generally thought to occur in the middle to late stages of tumourigenesis, following the acquisition of permissive molecular aberrations such as TP53 mutation or whole genome doubling. Tumours with somatic POLE exonuclease domain mutations are notable for their extreme genomic instability (their mutation burden is among the highest in human cancer), distinct mutational signature, lymphocytic infiltrate, and excellent prognosis. To what extent these characteristics are determined by the timing of POLE mutations in oncogenesis is unknown. Here, we have shown that pathogenic POLE mutations are detectable in non-malignant precursors of endometrial and colorectal cancer. Using genome and exome sequencing, we found that multiple driver mutations in POLE-mutant cancers show the characteristic POLE mutational signature, including those in genes conventionally regarded as initiators of tumourigenesis. In POLE-mutant cancers, the proportion of monoclonal predicted neoantigens was similar to that in other cancers, but the absolute number was much greater. We also found that the prominent CD8 + T-cell infiltrate present in POLE-mutant cancers was evident in their precursor lesions. Collectively, these data indicate that somatic POLE mutations are early, quite possibly initiating, events in the endometrial and colorectal cancers in which they occur. The resulting early onset of genomic instability may account for the striking immune response and excellent prognosis of these tumours, as well as their early presentation. © 2018 The Authors. The Journal of Pathology published by John Wiley & Sons Ltd on behalf of Pathological Society of Great Britain and Ireland. © 2018 The Authors. The Journal of Pathology published by John Wiley & Sons Ltd on behalf of Pathological Society of Great Britain and Ireland.

  10. Myeloid neoplasms with germline DDX41 mutation.

    PubMed

    Cheah, Jesse J C; Hahn, Christopher N; Hiwase, Devendra K; Scott, Hamish S; Brown, Anna L

    2017-08-01

    Recently, DDX41 mutations have been identified both as germline and acquired somatic mutations in families with multiple cases of late-onset myelodysplastic syndrome (MDS) and/or acute myeloid leukemia. The majority of germline mutations are frameshift mutations suggesting loss of function with DDX41 acting as a tumor suppressor, and there is a common somatic missense mutation found in a majority of germline mutated tumors. Clinically, DDX41 mutations lead to development of high-risk MDS at an age similar to that observed in sporadic cohorts, presenting a unique challenge to hematologists in recognizing the familial context. Functionally, DDX41 has been shown to contribute to multiple pathways and processes including mRNA splicing, innate immunity and rRNA processing. Mutations in DDX41 result in aberrations to each of these in ways that could potentially impact on tumorigenesis-initiation, maintenance or progression. This review discusses the various molecular, clinical and biological aspects of myeloid malignancy predisposition due to DDX41 mutation and highlights how each of these suggest potential therapeutic opportunities through the use of pathway-specific inhibitors.

  11. Combined hereditary and somatic mutations of replication error repair genes result in rapid onset of ultra-hypermutated cancers.

    PubMed

    Shlien, Adam; Campbell, Brittany B; de Borja, Richard; Alexandrov, Ludmil B; Merico, Daniele; Wedge, David; Van Loo, Peter; Tarpey, Patrick S; Coupland, Paul; Behjati, Sam; Pollett, Aaron; Lipman, Tatiana; Heidari, Abolfazl; Deshmukh, Shriya; Avitzur, Na'ama; Meier, Bettina; Gerstung, Moritz; Hong, Ye; Merino, Diana M; Ramakrishna, Manasa; Remke, Marc; Arnold, Roland; Panigrahi, Gagan B; Thakkar, Neha P; Hodel, Karl P; Henninger, Erin E; Göksenin, A Yasemin; Bakry, Doua; Charames, George S; Druker, Harriet; Lerner-Ellis, Jordan; Mistry, Matthew; Dvir, Rina; Grant, Ronald; Elhasid, Ronit; Farah, Roula; Taylor, Glenn P; Nathan, Paul C; Alexander, Sarah; Ben-Shachar, Shay; Ling, Simon C; Gallinger, Steven; Constantini, Shlomi; Dirks, Peter; Huang, Annie; Scherer, Stephen W; Grundy, Richard G; Durno, Carol; Aronson, Melyssa; Gartner, Anton; Meyn, M Stephen; Taylor, Michael D; Pursell, Zachary F; Pearson, Christopher E; Malkin, David; Futreal, P Andrew; Stratton, Michael R; Bouffet, Eric; Hawkins, Cynthia; Campbell, Peter J; Tabori, Uri

    2015-03-01

    DNA replication-associated mutations are repaired by two components: polymerase proofreading and mismatch repair. The mutation consequences of disruption to both repair components in humans are not well studied. We sequenced cancer genomes from children with inherited biallelic mismatch repair deficiency (bMMRD). High-grade bMMRD brain tumors exhibited massive numbers of substitution mutations (>250/Mb), which was greater than all childhood and most cancers (>7,000 analyzed). All ultra-hypermutated bMMRD cancers acquired early somatic driver mutations in DNA polymerase ɛ or δ. The ensuing mutation signatures and numbers are unique and diagnostic of childhood germ-line bMMRD (P < 10(-13)). Sequential tumor biopsy analysis revealed that bMMRD/polymerase-mutant cancers rapidly amass an excess of simultaneous mutations (∼600 mutations/cell division), reaching but not exceeding ∼20,000 exonic mutations in <6 months. This implies a threshold compatible with cancer-cell survival. We suggest a new mechanism of cancer progression in which mutations develop in a rapid burst after ablation of replication repair.

  12. In situ mutation detection and visualization of intratumor heterogeneity for cancer research and diagnostics

    PubMed Central

    Grundberg, Ida; Kiflemariam, Sara; Mignardi, Marco; Imgenberg-Kreuz, Juliana; Edlund, Karolina; Micke, Patrick; Sundström, Magnus; Sjöblom, Tobias

    2013-01-01

    Current assays for somatic mutation analysis are based on extracts from tissue sections that often contain morphologically heterogeneous neoplastic regions with variable contents of genetically normal stromal and inflammatory cells, obscuring the results of the assays. We have developed an RNA-based in situ mutation assay that targets oncogenic mutations in a multiplex fashion that resolves the heterogeneity of the tissue sample. Activating oncogenic mutations are targets for a new generation of cancer drugs. For anti-EGFR therapy prediction, we demonstrate reliable in situ detection of KRAS mutations in codon 12 and 13 in colon and lung cancers in three different types of routinely processed tissue materials. High-throughput screening of KRAS mutation status was successfully performed on a tissue microarray. Moreover, we show how the patterns of expressed mutated and wild-type alleles can be studied in situ in tumors with complex combinations of mutated EGFR, KRAS and TP53. This in situ method holds great promise as a tool to investigate the role of somatic mutations during tumor progression and for prediction of response to targeted therapy. PMID:24280411

  13. Germline loss-of-function mutations in LZTR1 predispose to an inherited disorder of multiple schwannomas

    PubMed Central

    Piotrowski, Arkadiusz; Xie, Jing; Liu, Ying F; Poplawski, Andrzej B; Gomes, Alicia R; Madanecki, Piotr; Fu, Chuanhua; Crowley, Michael R; Crossman, David K; Armstrong, Linlea; Babovic-Vuksanovic, Dusica; Bergner, Amanda; Blakeley, Jaishri O; Blumenthal, Andrea L; Daniels, Molly S; Feit, Howard; Gardner, Kathy; Hurst, Stephanie; Kobelka, Christine; Lee, Chung; Nagy, Rebecca; Rauen, Katherine A; Slopis, John M; Suwannarat, Pim; Westman, Judith A; Zanko, Andrea; Korf, Bruce R; Messiaen, Ludwine M

    2015-01-01

    Constitutional SMARCB1 mutations at 22q11.23 have been found in ~50% of familial and <10% of sporadic schwannomatosis cases1. We sequenced highly conserved regions along 22q from eight individuals with schwannomatosis whose schwannomas involved somatic loss of one copy of 22q, encompassing SMARCB1 and NF2, with a different somatic mutation of the other NF2 allele in every schwannoma but no mutation of the remaining SMARCB1 allele in blood and tumor samples. LZTR1 germline mutations were identified in seven of the eight cases. LZTR1 sequencing in 12 further cases with the same molecular signature identified 9 additional germline mutations. Loss of heterozygosity with retention of an LZTR1 mutation was present in all 25 schwannomas studied. Mutations segregated with disease in all available affected first-degree relatives, although four asymptomatic parents also carried an LZTR1 mutation. Our findings identify LZTR1 as a gene predisposing to an autosomal dominant inherited disorder of multiple schwannomas in ~80% of 22q-related schwannomatosis cases lacking mutation in SMARCB1. PMID:24362817

  14. Truncation of LEAFY COTYLEDON1 Protein Is Required for Asexual Reproduction in Kalanchoë daigremontiana1[OPEN

    PubMed Central

    Garcês, Helena M.P.; Koenig, Daniel; Townsley, Brad T.; Kim, Minsung; Sinha, Neelima R.

    2014-01-01

    Kalanchoë daigremontiana reproduces asexually by generating numerous plantlets on its leaf margins. The formation of plantlets requires the somatic initiation of organogenic and embryogenic developmental programs in the leaves. However, unlike normal embryogenesis in seeds, leaf somatic embryogenesis bypasses seed dormancy to form viable plantlets. In Arabidopsis (Arabidopsis thaliana), seed dormancy and embryogenesis are initiated by the transcription factor LEAFY COTYLEDON1 (LEC1). The K. daigremontiana ortholog of LEC1 is expressed during leaf somatic embryo development. However, KdLEC1 encodes for a LEC1-type protein that has a unique B domain, with 11 unique amino acids and a premature stop codon. Moreover, the truncated KdLEC1 protein is not functional in Arabidopsis. Here, we show that K. daigremontiana transgenic plants expressing a functional, chimeric KdLEC1 gene under the control of Arabidopsis LEC1 promoter caused several developmental defects to leaf somatic embryos, including seed dormancy characteristics. The dormant plantlets also behaved as typical dormant seeds. Transgenic plantlets accumulated oil bodies and responded to the abscisic acid biosynthesis inhibitor fluridone, which broke somatic-embryo dormancy and promoted their normal development. Our results indicate that having a mutated form of LEC1 gene in K. daigremontiana is essential to bypass dormancy in the leaf embryos and generate viable plantlets, suggesting that the loss of a functional LEC1 promotes viviparous leaf somatic embryos and thus enhances vegetative propagation in K. daigremontiana. Mutations resulting in truncated LEC1 proteins may have been of a selective advantage in creating somatic propagules, because such mutations occurred independently in several Kalanchoë species, which form plantlets constitutively. PMID:24664206

  15. Truncation of LEAFY COTYLEDON1 protein is required for asexual reproduction in Kalanchoë daigremontiana.

    PubMed

    Garcês, Helena M P; Koenig, Daniel; Townsley, Brad T; Kim, Minsung; Sinha, Neelima R

    2014-05-01

    Kalanchoë daigremontiana reproduces asexually by generating numerous plantlets on its leaf margins. The formation of plantlets requires the somatic initiation of organogenic and embryogenic developmental programs in the leaves. However, unlike normal embryogenesis in seeds, leaf somatic embryogenesis bypasses seed dormancy to form viable plantlets. In Arabidopsis (Arabidopsis thaliana), seed dormancy and embryogenesis are initiated by the transcription factor LEAFY COTYLEDON1 (LEC1). The K. daigremontiana ortholog of LEC1 is expressed during leaf somatic embryo development. However, KdLEC1 encodes for a LEC1-type protein that has a unique B domain, with 11 unique amino acids and a premature stop codon. Moreover, the truncated KdLEC1 protein is not functional in Arabidopsis. Here, we show that K. daigremontiana transgenic plants expressing a functional, chimeric KdLEC1 gene under the control of Arabidopsis LEC1 promoter caused several developmental defects to leaf somatic embryos, including seed dormancy characteristics. The dormant plantlets also behaved as typical dormant seeds. Transgenic plantlets accumulated oil bodies and responded to the abscisic acid biosynthesis inhibitor fluridone, which broke somatic-embryo dormancy and promoted their normal development. Our results indicate that having a mutated form of LEC1 gene in K. daigremontiana is essential to bypass dormancy in the leaf embryos and generate viable plantlets, suggesting that the loss of a functional LEC1 promotes viviparous leaf somatic embryos and thus enhances vegetative propagation in K. daigremontiana. Mutations resulting in truncated LEC1 proteins may have been of a selective advantage in creating somatic propagules, because such mutations occurred independently in several Kalanchoë species, which form plantlets constitutively.

  16. Circulating tumor DNA profiling reveals clonal evolution and real-time disease progression in advanced hepatocellular carcinoma.

    PubMed

    Cai, Zhi-Xiong; Chen, Geng; Zeng, Yong-Yi; Dong, Xiu-Qing; Lin, Min-Jie; Huang, Xin-Hui; Zhang, Da; Liu, Xiao-Long; Liu, Jing-Feng

    2017-09-01

    Circulating tumor DNA (ctDNA) provides a potential non-invasive biomarker for cancer diagnosis and prognosis, but whether it could reflect tumor heterogeneity and monitor therapeutic responses in hepatocellular carcinoma (HCC) is unclear. Focusing on 574 cancer genes known to harbor actionable mutations, we identified the mutation repertoire of HCC tissues, and monitored the corresponding ctDNA features in blood samples to evaluate its clinical significance. Analysis of 3 HCC patients' mutation profiles revealed that ctDNA could overcome tumor heterogeneity and provide information of tumor burden and prognosis. Further analysis was conducted on the 4th HCC case with multiple lesion samples and sequential plasma samples. We identified 160 subclonal SNVs in tumor tissues as well as matched peritumor tissues with PBMC as control. 96.9% of this patient's tissue mutations could be also detected in plasma samples. These subclonal SNVs were grouped into 9 clusters according to their trends of cellular prevalence shift in tumor tissues. Two clusters constituted of tumor stem somatic mutations showed circulating levels relating with cancer progression. Analysis of tumor somatic mutations revealed that circulating level of such tumor stem somatic mutations could reflect tumor burden and even predict prognosis earlier than traditional strategies. Furthermore, HCK (p.V174M), identified as a recurrent/metastatic related mutation site, could promote migration and invasion of HCC cells. Taken together, study of mutation profiles in biopsy and plasma samples in HCC patients showed that ctDNA could overcome tumor heterogeneity and real-time track the therapeutic responses in the longitudinal monitoring. © 2017 UICC.

  17. Comparative oncology DNA sequencing of canine T cell lymphoma via human hotspot panel

    PubMed Central

    Beheshti, Afshin; Pilichowska, Monika; Burgess, Kristine; Ricks-Santi, Luisel; McNiel, Elizabeth; London, Cheryl B.; Ravi, Dashnamoorthy; Evens, Andrew M.

    2018-01-01

    T-cell lymphoma (TCL) is an uncommon and aggressive form of human cancer. Lymphoma is the most common hematopoietic tumor in canines (companion animals), with TCL representing approximately 30% of diagnoses. Collectively, the canine is an appealing model for cancer research given the spontaneous occurrence of cancer, intact immune system, and phytogenetic proximity to humans. We sought to establish mutational congruence of the canine with known human TCL mutations in order to identify potential actionable oncogenic pathways. Following pathologic confirmation, DNA was sequenced in 16 canine TCL (cTCL) cases using a custom Human Cancer Hotspot Panel of 68 genes commonly mutated in human TCL. Sequencing identified 4,527,638 total reads with average length of 229 bases containing 346 unique variants and 1,474 total variants; each sample had an average of 92 variants. Among these, there were 258 germline and 32 somatic variants. Among the 32 somatic variants there were 8 missense variants, 1 splice junction variant and the remaining were intron or synonymous variants. A frequency of 4 somatic mutations per sample were noted with >7 mutations detected in MET, KDR, STK11 and BRAF. Expression of these associated proteins were also detected via Western blot analyses. In addition, Sanger sequencing confirmed three variants of high quality (MYC, MET, and TP53 missense mutation). Taken together, the mutational spectrum and protein analyses showed mutations in signaling pathways similar to human TCL and also identified novel mutations that may serve as drug targets as well as potential biomarkers. PMID:29854308

  18. Role of CDKN2C Copy Number in Sporadic Medullary Thyroid Carcinoma.

    PubMed

    Grubbs, Elizabeth G; Williams, Michelle D; Scheet, Paul; Vattathil, Selina; Perrier, Nancy D; Lee, Jeffrey E; Gagel, Robert F; Hai, Tao; Feng, Lei; Cabanillas, Maria E; Cote, Gilbert J

    2016-11-01

    The cyclin-dependent-kinase inhibitors (CDKN)/retinoblastoma (RB1) pathway has been implicated as having a role in medullary thyroid carcinoma (MTC) tumorigenesis. CDKN2C loss has been associated with RET-mediated MTC in humans but with minimal phenotypic correlation provided. The objective of this study was to evaluate the association between tumor RET mutation status, CDKN2C loss, and aggressiveness of MTC in a cohort of patients with sporadic disease. Tumors from patients with sporadic MTC treated at a single institution were evaluated for somatic RET M918T mutation and CDKN2C copy number loss. These variables were compared to patient demographics, pathology detail, clinical course, and disease-specific and overall survival. Sixty-two MTC cases with an initial surgery date ranging from 1983 to 2009 met the inclusion criteria, of whom 36 (58%) were male. The median age at initial surgery was 53 years (range 22-81 years). The median tumor size was 30 mm (range 6-145 mm) with 29 (57%) possessing extrathyroidal extension. Nodal and/or distant metastasis at presentation was found in 47/60 (78%) and 12/61 (20%) patients, respectively. Median follow-up time was 10.5 years (range 1.1-27.8 years) for the censored observations. The presence of CDKN2C loss was associated with worse M stage and overall AJCC stage. Median overall survival of patients with versus without CDKN2C loss was 4.14 [confidence interval (CI) 1.93-NA] versus 18.27 [CI 17.24-NA] years (p < 0.0001). Median overall survival of patients with a combined somatic RET M918T mutation and CDKN2C loss versus no somatic RET M918T mutation and CDKN2C loss versus somatic RET M918T mutation and CDKN2C 2N versus no somatic RET M918T mutation and CDKN2C 2N was 2.38 [CI 1.67-NA] years versus 10.81 [CI 2.46-NA] versus 17.24 [CI 9.82-NA] versus not reached [CI 13.46-NA] years (p < 0.0001). The detection of somatic CDKN2C loss is associated with the presence of distant metastasis at presentation as well decreased overall survival, a relationship enhanced by concomitant RET M918T mutation. Further defining the genes involved in the progression of metastatic MTC will be an important step toward identifying pathways of disease progression and new therapeutic targets.

  19. Discovery of Genomic Breakpoints Affecting Breast Cancer Progression and Prognosis

    DTIC Science & Technology

    2009-10-01

    157 genomic breakpoints in MCF-7 cells that could be confirmed by PCR across breakpoint joins as likely somatic mutations . A total of 79 genes are...SUPPLEMENTARY NOTES 14. ABSTRACT 157 genomic breakpoints could be confirmed as likely somatic mutations . We focused on breakpoints predicted to lead to...enrichment for breakpoints containing genes (50.3% vs 77.4%), and for fusion-containing breakpoints (6.4% vs 16.1%). Also, all chimeric mRNA products are

  20. University of Texas MD Anderson Cancer Center (UT-MDACC): High-Throughput Screening Identifying Driving Mutations in Endometrial Cancer | Office of Cancer Genomics

    Cancer.gov

    Recent advances in next-generation sequencing technology have enabled the unprecedented characterization of a full spectrum of somatic alterations in cancer genomes. Given the large numbers of somatic mutations typically detected by this approach, a key challenge in the downstream analysis is to distinguish “drivers” that functionally contribute to tumorigenesis from “passengers” that occur as the consequence of genomic instability.

  1. ExScalibur: A High-Performance Cloud-Enabled Suite for Whole Exome Germline and Somatic Mutation Identification.

    PubMed

    Bao, Riyue; Hernandez, Kyle; Huang, Lei; Kang, Wenjun; Bartom, Elizabeth; Onel, Kenan; Volchenboum, Samuel; Andrade, Jorge

    2015-01-01

    Whole exome sequencing has facilitated the discovery of causal genetic variants associated with human diseases at deep coverage and low cost. In particular, the detection of somatic mutations from tumor/normal pairs has provided insights into the cancer genome. Although there is an abundance of publicly-available software for the detection of germline and somatic variants, concordance is generally limited among variant callers and alignment algorithms. Successful integration of variants detected by multiple methods requires in-depth knowledge of the software, access to high-performance computing resources, and advanced programming techniques. We present ExScalibur, a set of fully automated, highly scalable and modulated pipelines for whole exome data analysis. The suite integrates multiple alignment and variant calling algorithms for the accurate detection of germline and somatic mutations with close to 99% sensitivity and specificity. ExScalibur implements streamlined execution of analytical modules, real-time monitoring of pipeline progress, robust handling of errors and intuitive documentation that allows for increased reproducibility and sharing of results and workflows. It runs on local computers, high-performance computing clusters and cloud environments. In addition, we provide a data analysis report utility to facilitate visualization of the results that offers interactive exploration of quality control files, read alignment and variant calls, assisting downstream customization of potential disease-causing mutations. ExScalibur is open-source and is also available as a public image on Amazon cloud.

  2. GATA2 mutations in patients with acute myeloid leukemia-paired samples analyses show that the mutation is unstable during disease evolution.

    PubMed

    Hou, Hsin-An; Lin, Yun-Chu; Kuo, Yuan-Yeh; Chou, Wen-Chien; Lin, Chien-Chin; Liu, Chieh-Yu; Chen, Chien-Yuan; Lin, Liang-In; Tseng, Mei-Hsuan; Huang, Chi-Fei; Chiang, Ying-Chieh; Liu, Ming-Chih; Liu, Chia-Wen; Tang, Jih-Luh; Yao, Ming; Huang, Shang-Yi; Ko, Bor-Sheng; Hsu, Szu-Chun; Wu, Shang-Ju; Tsay, Woei; Chen, Yao-Chang; Tien, Hwei-Fang

    2015-02-01

    Recently, mutations of the GATA binding protein 2 (GATA2) gene were identified in acute myeloid leukemia (AML) patients with CEBPA double mutations (CEBPA (double-mut)), but the interaction of this mutation with other genetic alterations and its dynamic changes during disease progression remain to be determined. In this study, 14 different missense GATA2 mutations, which were all clustered in the highly conserved N-terminal zinc finger 1 domain, were identified in 27.4, 6.7, and 1 % of patients with CEBPA (double-mut), CEBPA (single-mut), and CEBPA wild type, respectively. All but one patient with GATA2 mutation had concurrent CEBPA mutation. GATA2 mutations were closely associated with younger age, FAB M1 subtype, intermediate-risk cytogenetics, expression of HLA-DR, CD7, CD15, or CD34 on leukemic cells, and CEBPA mutation, but negatively associated with FAB M4 subtype, favorable-risk cytogenetics, and NPM1 mutation. Patients with GATA2 mutation had significantly better overall survival and relapse-free survival than those without GATA2 mutation. Sequential analysis showed that the original GATA2 mutations might be lost during disease progression in GATA2-mutated patients, while novel GATA2 mutations might be acquired at relapse in GATA2-wild patients. In conclusion, AML patients with GATA2 mutations had distinct clinic-biological features and a favorable prognosis. GATA2 mutations might be lost or acquired at disease progression, implying that it was a second hit in the leukemogenesis of AML, especially those with CEBPA mutation.

  3. Nonoverlapping Clinical and Mutational Patterns in Melanomas from the Female Genital Tract and Atypical Genital Nevi.

    PubMed

    Yélamos, Oriol; Merkel, Emily A; Sholl, Lauren Meldi; Zhang, Bin; Amin, Sapna M; Lee, Christina Y; Guitart, Gerta E; Yang, Jingyi; Wenzel, Alexander T; Bunick, Christopher G; Yazdan, Pedram; Choi, Jaehyuk; Gerami, Pedram

    2016-09-01

    Genital melanomas (GM) are the second most common cancer of the female external genitalia and may be confused with atypical genital nevi (AGN), which exhibit atypical histological features but have benign behavior. In this study, we compared the clinical, histological, and molecular features of 19 GM and 25 AGN. We described chromosomal copy number aberrations and the mutational status of 50 oncogenes and tumor suppressor genes in both groups. Our study showed that a pigmented lesion occurring in mucosal tissue, particularly in postmenopausal women, was more likely to be a melanoma than a nevus. GM had high levels of chromosomal instability, with many copy number aberrations. Furthermore, we found a completely nonoverlapping pattern of oncogenic mutations when comparing GM and AGN. In GM, we report somatic mutations in KIT and TP53. Conversely, AGN had frequent BRAF V600E mutations, which were not seen in any of the GM. Our results show that GM and AGN have distinct clinical and molecular changes and that GM have a different mutational pattern compared with AGN. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  4. Protein Domain-Level Landscape of Cancer-Type-Specific Somatic Mutations

    PubMed Central

    Yang, Fan; Petsalaki, Evangelia; Rolland, Thomas; Hill, David E.; Vidal, Marc; Roth, Frederick P.

    2015-01-01

    Identifying driver mutations and their functional consequences is critical to our understanding of cancer. Towards this goal, and because domains are the functional units of a protein, we explored the protein domain-level landscape of cancer-type-specific somatic mutations. Specifically, we systematically examined tumor genomes from 21 cancer types to identify domains with high mutational density in specific tissues, the positions of mutational hotspots within these domains, and the functional and structural context where possible. While hotspots corresponding to specific gain-of-function mutations are expected for oncoproteins, we found that tumor suppressor proteins also exhibit strong biases toward being mutated in particular domains. Within domains, however, we observed the expected patterns of mutation, with recurrently mutated positions for oncogenes and evenly distributed mutations for tumor suppressors. For example, we identified both known and new endometrial cancer hotspots in the tyrosine kinase domain of the FGFR2 protein, one of which is also a hotspot in breast cancer, and found new two hotspots in the Immunoglobulin I-set domain in colon cancer. Thus, to prioritize cancer mutations for further functional studies aimed at more precise cancer treatments, we have systematically correlated mutations and cancer types at the protein domain level. PMID:25794154

  5. Finding cancer driver mutations in the era of big data research.

    PubMed

    Poulos, Rebecca C; Wong, Jason W H

    2018-04-02

    In the last decade, the costs of genome sequencing have decreased considerably. The commencement of large-scale cancer sequencing projects has enabled cancer genomics to join the big data revolution. One of the challenges still facing cancer genomics research is determining which are the driver mutations in an individual cancer, as these contribute only a small subset of the overall mutation profile of a tumour. Focusing primarily on somatic single nucleotide mutations in this review, we consider both coding and non-coding driver mutations, and discuss how such mutations might be identified from cancer sequencing datasets. We describe some of the tools and database that are available for the annotation of somatic variants and the identification of cancer driver genes. We also address the use of genome-wide variation in mutation load to establish background mutation rates from which to identify driver mutations under positive selection. Finally, we describe the ways in which mutational signatures can act as clues for the identification of cancer drivers, as these mutations may cause, or arise from, certain mutational processes. By defining the molecular changes responsible for driving cancer development, new cancer treatment strategies may be developed or novel preventative measures proposed.

  6. Genotoxicity testing of different types of beverages in the Drosophila wing Somatic Mutation And Recombination Test.

    PubMed

    Graf, U; Moraga, A A; Castro, R; Díaz Carrillo, E

    1994-05-01

    Five wines and one brandy of Spanish origin as well as three herbal teas and ordinary black tea were tested for genotoxicity in the wing Somatic Mutation And Recombination Test (SMART) which makes use of the two recessive wing cell markers multiple wing hairs (mwh) and flare (flr3) on the left arm of chromosome 3 of Drosophila melanogaster. 3-day-old larvae trans-heterozygous for these two markers were fed the beverages at different concentrations and for different feeding periods using Drosophila instant medium. Somatic mutations or mitotic recombinations induced in the cells of the wing imaginal discs give rise to mutant single or twin spots on the wing blade of the emerging adult flies showing either the mwh phenotype or/and the flr phenotype. One of the red wines showed a clear genotoxic activity that was not due to its ethanol content. Two herbal teas (Urtica dioica, Achillea millefolium) and black tea (Camellia sinensis) proved to be weakly genotoxic as well. Furthermore, it was shown that quercetin and rutin, two flavonols present in beverages of plant origin, also exhibited weak genotoxic activity in the somatic cells of Drosophila. These results demonstrate that Drosophila in vivo somatic assays can detect the genotoxicity of complex mixtures such as beverages. In particular, it is possible to administer these test materials in the same form as that in which they are normally consumed.

  7. Deep sequencing reveals double mutations in cis of MPL exon 10 in myeloproliferative neoplasms.

    PubMed

    Pietra, Daniela; Brisci, Angela; Rumi, Elisa; Boggi, Sabrina; Elena, Chiara; Pietrelli, Alessandro; Bordoni, Roberta; Ferrari, Maurizio; Passamonti, Francesco; De Bellis, Gianluca; Cremonesi, Laura; Cazzola, Mario

    2011-04-01

    Somatic mutations of MPL exon 10, mainly involving a W515 substitution, have been described in JAK2 (V617F)-negative patients with essential thrombocythemia and primary myelofibrosis. We used direct sequencing and high-resolution melt analysis to identify mutations of MPL exon 10 in 570 patients with myeloproliferative neoplasms, and allele specific PCR and deep sequencing to further characterize a subset of mutated patients. Somatic mutations were detected in 33 of 221 patients (15%) with JAK2 (V617F)-negative essential thrombocythemia or primary myelofibrosis. Only one patient with essential thrombocythemia carried both JAK2 (V617F) and MPL (W515L). High-resolution melt analysis identified abnormal patterns in all the MPL mutated cases, while direct sequencing did not detect the mutant MPL in one fifth of them. In 3 cases carrying double MPL mutations, deep sequencing analysis showed identical load and location in cis of the paired lesions, indicating their simultaneous occurrence on the same chromosome.

  8. Novel Secondary Somatic Mutations in Ewing's Sarcoma and Desmoplastic Small Round Cell Tumors

    PubMed Central

    Janku, Filip; Ludwig, Joseph A.; Naing, Aung; Benjamin, Robert S.; Brown, Robert E.; Anderson, Pete; Kurzrock, Razelle

    2014-01-01

    Background Ewing's sarcoma (ES) and desmoplastic small round cell tumors (DSRCT) are small round blue cell tumors driven by an N-terminal containing EWS translocation. Very few somatic mutations have been reported in ES, and none have been identified in DSRCT. The aim of this study is to explore potential actionable mutations in ES and DSRCT. Methodology Twenty eight patients with ES or DSRCT had tumor tissue available that could be analyzed by one of the following methods: 1) Next-generation exome sequencing platform; 2) Multiplex PCR/Mass Spectroscopy; 3) Polymerase chain reaction (PCR)-based single- gene mutation screening; 4) Sanger sequencing; 5) Morphoproteomics. Principal Findings Novel somatic mutations were identified in four out of 18 patients with advanced ES and two of 10 patients with advanced DSRCT (six out of 28 (21.4%));KRAS (n = 1), PTPRD (n = 1), GRB10 (n = 2), MET (n = 2) and PIK3CA (n = 1). One patient with both PTPRD and GRB10 mutations and one with a GRB10 mutation achieved a complete remission (CR) on an Insulin like growth factor 1 receptor (IGF1R) inhibitor based treatment. One patient, who achieved a partial remission (PR) with IGF1R inhibitor treatment, but later developed resistance, demonstrated a KRAS mutation in the post-treatment resistant tumor, but not in the pre-treatment tumor suggesting that the RAF/RAS/MEK pathway was activated with progression. Conclusions We have reported several different mutations in advanced ES and DSRCT that have direct implications for molecularly-directed targeted therapy. Our technology agnostic approach provides an initial mutational roadmap used in the path towards individualized combination therapy. PMID:25119929

  9. Low-level APC mutational mosaicism is the underlying cause in a substantial fraction of unexplained colorectal adenomatous polyposis cases.

    PubMed

    Spier, Isabel; Drichel, Dmitriy; Kerick, Martin; Kirfel, Jutta; Horpaopan, Sukanya; Laner, Andreas; Holzapfel, Stefanie; Peters, Sophia; Adam, Ronja; Zhao, Bixiao; Becker, Tim; Lifton, Richard P; Perner, Sven; Hoffmann, Per; Kristiansen, Glen; Timmermann, Bernd; Nöthen, Markus M; Holinski-Feder, Elke; Schweiger, Michal R; Aretz, Stefan

    2016-03-01

    In 30-50% of patients with colorectal adenomatous polyposis, no germline mutation in the known genes APC, causing familial adenomatous polyposis, MUTYH, causing MUTYH-associated polyposis, or POLE or POLD1, causing polymerase-proofreading-associated polyposis can be identified, although a hereditary aetiology is likely. This study aimed to explore the impact of APC mutational mosaicism in unexplained polyposis. To comprehensively screen for somatic low-level APC mosaicism, high-coverage next-generation sequencing of the APC gene was performed using DNA from leucocytes and a total of 53 colorectal tumours from 20 unrelated patients with unexplained sporadic adenomatous polyposis. APC mosaicism was assumed if the same loss-of-function APC mutation was present in ≥ 2 anatomically separated colorectal adenomas/carcinomas per patient. All mutations were validated using diverse methods. In 25% (5/20) of patients, somatic mosaicism of a pathogenic APC mutation was identified as underlying cause of the disease. In 2/5 cases, the mosaic level in leucocyte DNA was slightly below the sensitivity threshold of Sanger sequencing; while in 3/5 cases, the allelic fraction was either very low (0.1-1%) or no mutations were detectable. The majority of mosaic mutations were located outside the somatic mutation cluster region of the gene. The present data indicate a high prevalence of pathogenic mosaic APC mutations below the detection thresholds of routine diagnostics in adenomatous polyposis, even if high-coverage sequencing of leucocyte DNA alone is taken into account. This has important implications for both routine work-up and strategies to identify new causative genes in this patient group. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  10. Ras mutations are rare in solitary cold and toxic thyroid nodules.

    PubMed

    Krohn, K; Reske, A; Ackermann, F; Müller, A; Paschke, R

    2001-08-01

    Activation of ras proto-oncogenes as a result of point mutations is detectable in a significant percentage of most types of tumour. Similar to neoplasms of other organs, mutations of all three ras genes can be found in thyroid tumours. H-, K- and N-ras mutations have been detected in up to 20% of follicular adenomas and adenomatous nodules which were not functionally characterized. This raises the question as to whether ras mutations are specific for hypofunctional nodules and TSH receptor mutations for hyperfunctioning nodules. To investigate ras and TSH receptor mutations with respect to functional differentiation we studied 41 scintigraphically cold nodules and 47 toxic thyroid nodules. To address the likelihood of a somatic mutation we also studied the clonal origin of these tumours. Genomic DNA was extracted from nodular and surrounding tissue. Mutational hot spots in exons 1 and 2 of the H- and K-ras gene were PCR amplified and sequenced using big dye terminator chemistry. Denaturing gradient gel electrophoresis (DGGE) was used to verify sequencing results for the H-ras gene and to analyse the N-ras gene because its greater sensitivity in detecting somatic mutations. Clonality of nodular thyroid tissue was evaluated using X-Chromosome inactivation based on PCR amplification of the human androgen receptor locus. Monoclonal origin was detectable in 14 of 23 informative samples from cold thyroid nodules. In toxic thyroid nodules the frequency of clonal tissue was 20 in 30 informative cases. Only one point mutation could be found in the N-ras gene codon 61 (Gly to Arg) in a cold adenomatous nodule which was monoclonal. In toxic thyroid nodules no ras mutation was detectable. Our study suggests that ras mutations are rare in solitary cold and toxic thyroid nodules and that the frequent monoclonal origin of these tumours implies somatic mutations in genes other than H-, K- and N-ras.

  11. Overlapping SETBP1 gain-of-function mutations in Schinzel-Giedion syndrome and hematologic malignancies

    PubMed Central

    Steehouwer, Marloes; Gilissen, Christian; Graham, Sarah A.; Hoover-Fong, Julie; Telegrafi, Aida B.; Destree, Anne; Smigiel, Robert; Lambie, Lindsday A.; Kayserili, Hülya; Altunoglu, Umut; Lapi, Elisabetta; Uzielli, Maria Luisa; Aracena, Mariana; Nur, Banu G.; Mihci, Ercan; Moreira, Lilia M. A.; Borges Ferreira, Viviane; Horovitz, Dafne D. G.; da Rocha, Katia M.; Jezela-Stanek, Aleksandra; Brooks, Alice S.; Reutter, Heiko; Cohen, Julie S.; Fatemi, Ali; Smitka, Martin; Grebe, Theresa A.; Di Donato, Nataliya; Deshpande, Charu; Vandersteen, Anthony; Marques Lourenço, Charles; Dufke, Andreas; Rossier, Eva; Andre, Gwenaelle; Baumer, Alessandra; Spencer, Careni; McGaughran, Julie; Franke, Lude; Veltman, Joris A.; De Vries, Bert B. A.; Schinzel, Albert; Fisher, Simon E.; Hoischen, Alexander

    2017-01-01

    Schinzel-Giedion syndrome (SGS) is a rare developmental disorder characterized by multiple malformations, severe neurological alterations and increased risk of malignancy. SGS is caused by de novo germline mutations clustering to a 12bp hotspot in exon 4 of SETBP1. Mutations in this hotspot disrupt a degron, a signal for the regulation of protein degradation, and lead to the accumulation of SETBP1 protein. Overlapping SETBP1 hotspot mutations have been observed recurrently as somatic events in leukemia. We collected clinical information of 47 SGS patients (including 26 novel cases) with germline SETBP1 mutations and of four individuals with a milder phenotype caused by de novo germline mutations adjacent to the SETBP1 hotspot. Different mutations within and around the SETBP1 hotspot have varying effects on SETBP1 stability and protein levels in vitro and in in silico modeling. Substitutions in SETBP1 residue I871 result in a weak increase in protein levels and mutations affecting this residue are significantly more frequent in SGS than in leukemia. On the other hand, substitutions in residue D868 lead to the largest increase in protein levels. Individuals with germline mutations affecting D868 have enhanced cell proliferation in vitro and higher incidence of cancer compared to patients with other germline SETBP1 mutations. Our findings substantiate that, despite their overlap, somatic SETBP1 mutations driving malignancy are more disruptive to the degron than germline SETBP1 mutations causing SGS. Additionally, this suggests that the functional threshold for the development of cancer driven by the disruption of the SETBP1 degron is higher than for the alteration in prenatal development in SGS. Drawing on previous studies of somatic SETBP1 mutations in leukemia, our results reveal a genotype-phenotype correlation in germline SETBP1 mutations spanning a molecular, cellular and clinical phenotype. PMID:28346496

  12. Identification of two poorly prognosed ovarian carcinoma subtypes associated with CHEK2 germ-line mutation and non-CHEK2 somatic mutation gene signatures.

    PubMed

    Ow, Ghim Siong; Ivshina, Anna V; Fuentes, Gloria; Kuznetsov, Vladimir A

    2014-01-01

    High-grade serous ovarian cancer (HG-SOC), a major histologic type of epithelial ovarian cancer (EOC), is a poorly-characterized, heterogeneous and lethal disease where somatic mutations of TP53 are common and inherited loss-of-function mutations in BRCA1/2 predispose to cancer in 9.5-13% of EOC patients. However, the overall burden of disease due to either inherited or sporadic mutations is not known. We performed bioinformatics analyses of mutational and clinical data of 334 HG-SOC tumor samples from The Cancer Genome Atlas to identify novel tumor-driving mutations, survival-significant patient subgroups and tumor subtypes potentially driven by either hereditary or sporadic factors. We identified a sub-cluster of high-frequency mutations in 22 patients and 58 genes associated with DNA damage repair, apoptosis and cell cycle. Mutations of CHEK2, observed with the highest intensity, were associated with poor therapy response and overall survival (OS) of these patients (P = 8.00e-05), possibly due to detrimental effect of mutations at the nuclear localization signal. A 21-gene mutational prognostic signature significantly stratifies patients into relatively low or high-risk subgroups with 5-y OS of 37% or 6%, respectively (P = 7.31e-08). Further analysis of these genes and high-risk subgroup revealed 2 distinct classes of tumors characterized by either germline mutations of genes such as CHEK2, RPS6KA2 and MLL4, or somatic mutations of other genes in the signature. Our results could provide improvement in prediction and clinical management of HG-SOC, facilitate our understanding of this complex disease, guide the design of targeted therapeutics and improve screening efforts to identify women at high-risk of hereditary ovarian cancers distinct from those associated with BRCA1/2 mutations.

  13. Identification of two poorly prognosed ovarian carcinoma subtypes associated with CHEK2 germ-line mutation and non-CHEK2 somatic mutation gene signatures

    PubMed Central

    Ow, Ghim Siong; Ivshina, Anna V; Fuentes, Gloria; Kuznetsov, Vladimir A

    2014-01-01

    High-grade serous ovarian cancer (HG-SOC), a major histologic type of epithelial ovarian cancer (EOC), is a poorly-characterized, heterogeneous and lethal disease where somatic mutations of TP53 are common and inherited loss-of-function mutations in BRCA1/2 predispose to cancer in 9.5–13% of EOC patients. However, the overall burden of disease due to either inherited or sporadic mutations is not known.     We performed bioinformatics analyses of mutational and clinical data of 334 HG-SOC tumor samples from The Cancer Genome Atlas to identify novel tumor-driving mutations, survival-significant patient subgroups and tumor subtypes potentially driven by either hereditary or sporadic factors. We identified a sub-cluster of high-frequency mutations in 22 patients and 58 genes associated with DNA damage repair, apoptosis and cell cycle. Mutations of CHEK2, observed with the highest intensity, were associated with poor therapy response and overall survival (OS) of these patients (P = 8.00e-05), possibly due to detrimental effect of mutations at the nuclear localization signal. A 21-gene mutational prognostic signature significantly stratifies patients into relatively low or high-risk subgroups with 5-y OS of 37% or 6%, respectively (P = 7.31e-08). Further analysis of these genes and high-risk subgroup revealed 2 distinct classes of tumors characterized by either germline mutations of genes such as CHEK2, RPS6KA2 and MLL4, or somatic mutations of other genes in the signature. Our results could provide improvement in prediction and clinical management of HG-SOC, facilitate our understanding of this complex disease, guide the design of targeted therapeutics and improve screening efforts to identify women at high-risk of hereditary ovarian cancers distinct from those associated with BRCA1/2 mutations. PMID:24879340

  14. Noonan syndrome-like disorder with loose anagen hair: a second case with neuroblastoma.

    PubMed

    Garavelli, Livia; Cordeddu, Viviana; Errico, Stefania; Bertolini, Patrizia; Street, Maria Elisabeth; Rosato, Simonetta; Pollazzon, Marzia; Wischmeijer, Anita; Ivanovski, Ivan; Daniele, Paola; Bacchini, Ermanno; Lombardi, Alfonsa Anna; Izzi, Giancarlo; Biasucci, Giacomo; Del Rossi, Carmine; Corradi, Domenico; Cazzaniga, Giovanni; Dominici, Carlo; Rossi, Cesare; De Luca, Alessandro; Bernasconi, Sergio; Riccardi, Riccardo; Legius, Eric; Tartaglia, Marco

    2015-08-01

    Noonan-like syndrome with loose anagen hair (NSLH), also known as Mazzanti syndrome, is a RASopathy characterized by craniofacial features resembling Noonan syndrome, cardiac defects, cognitive deficits and behavioral issues, reduced growth generally associated with GH deficit, darkly pigmented skin, and an unique combination of ectodermal anomalies. Virtually all cases of NSLH are caused by an invariant and functionally unique mutation in SHOC2 (c.4A>G, p.Ser2Gly). Here, we report on a child with molecularly confirmed NSLH who developed a neuroblastoma, first suspected at the age 3 months by abdominal ultrasound examination. Based on this finding, scanning of the SHOC2 coding sequence encompassing the c.4A>G change was performed on selected pediatric cohorts of malignancies documented to occur in RASopathies (i.e., neuroblastoma, brain tumors, rhabdomyosarcoma, acute lymphoblastic, and myeloid leukemia), but failed to identify a functionally relevant cancer-associated variant. While these results do not support a major role of somatic SHOC2 mutations in these pediatric cancers, this second instance of neuroblastoma in NSLAH suggests a possible predisposition to this malignancy in subjects heterozygous for the c.4A>G SHOC2 mutation. © 2015 Wiley Periodicals, Inc.

  15. Determining the Origin of Human Germinal Center B Cell-Derived Malignancies.

    PubMed

    Seifert, Marc; Küppers, Ralf

    2017-01-01

    Most human B cell lymphomas originate from germinal center (GC) B cells. This is partly caused by the high proliferative activity of GC B cells and the remodeling processes acting at the immunoglobulin (Ig) loci of these cells, i.e., somatic hypermutation and class-switching. Mistargeting of these processes can cause chromosomal translocations, and the hypermutation machinery may also target non-Ig genes. As somatic hypermutation is exclusively active in GC B cells, the presence of somatic mutations in rearranged IgV genes is a standard criterium for a GC or post-GC B cell origin of lymphomas. Beyond this, ongoing somatic hypermutation during lymphoma clone expansion indicates that the lymphoma has an active GC B cell differentiation program. The proto-oncogene BCL6 is specifically expressed in GC B cells and also acquires somatic mutations as a physiological by-product of the somatic hypermutation process, albeit at a lower level than IgV genes. Thus, detection of BCL6 mutations is a further genetic trait of a GC experience of a B cell lymphoma. Typically, B cell lymphomas retain key features of their specific cells of origin, including a differentiation stage-specific gene expression pattern. This is at least partly due to genetic lesions, which "freeze" the lymphoma cells at the differentiation stage at which the transformation occurred. Therefore, identification of the normal B cell subset with the most similar gene expression pattern to a particular type of B cell lymphoma has been instrumental to deduce the precise cell of origin of lymphomas.We present here protocols to analyze human B cell lymphomas for a potential origin from GC B cells by determining the presence of mutations in rearranged IgV genes and the BCL6 gene, and by comparing the gene expression pattern of lymphoma cells with those of normal B cell subsets by genechip or RNA-sequencing analysis.

  16. A systems approach defining constraints of the genome architecture on lineage selection and evolvability during somatic cancer evolution

    PubMed Central

    Rübben, Albert; Nordhoff, Ole

    2013-01-01

    Summary Most clinically distinguishable malignant tumors are characterized by specific mutations, specific patterns of chromosomal rearrangements and a predominant mechanism of genetic instability but it remains unsolved whether modifications of cancer genomes can be explained solely by mutations and selection through the cancer microenvironment. It has been suggested that internal dynamics of genomic modifications as opposed to the external evolutionary forces have a significant and complex impact on Darwinian species evolution. A similar situation can be expected for somatic cancer evolution as molecular key mechanisms encountered in species evolution also constitute prevalent mutation mechanisms in human cancers. This assumption is developed into a systems approach of carcinogenesis which focuses on possible inner constraints of the genome architecture on lineage selection during somatic cancer evolution. The proposed systems approach can be considered an analogy to the concept of evolvability in species evolution. The principal hypothesis is that permissive or restrictive effects of the genome architecture on lineage selection during somatic cancer evolution exist and have a measurable impact. The systems approach postulates three classes of lineage selection effects of the genome architecture on somatic cancer evolution: i) effects mediated by changes of fitness of cells of cancer lineage, ii) effects mediated by changes of mutation probabilities and iii) effects mediated by changes of gene designation and physical and functional genome redundancy. Physical genome redundancy is the copy number of identical genetic sequences. Functional genome redundancy of a gene or a regulatory element is defined as the number of different genetic elements, regardless of copy number, coding for the same specific biological function within a cancer cell. Complex interactions of the genome architecture on lineage selection may be expected when modifications of the genome architecture have multiple and possibly opposed effects which manifest themselves at disparate times and progression stages. Dissection of putative mechanisms mediating constraints exerted by the genome architecture on somatic cancer evolution may provide an algorithm for understanding and predicting as well as modifying somatic cancer evolution in individual patients. PMID:23336076

  17. Genetic Testing in Pancreatic Ductal Adenocarcinoma: Implications for Prevention and Treatment.

    PubMed

    Peters, Mary Linton B; Tseng, Jennifer F; Miksad, Rebecca A

    2016-07-01

    This article reviews the progress to date and future directions for investigation of germline and somatic genetic testing to inform pancreatic adenocarcinoma (PDAC) treatment, screening, and prevention strategies. We searched PubMed to identify recent articles regarding genetic testing in pancreatic cancer, including both germline and somatic testing, and recent genome-wide association studies. References were specifically hand searched as relevant. Guidelines for testing and screening high-risk individuals were included. We searched clinicaltrials.gov to review the current landscape of active clinical trials. Approximately 10% of PDACs are associated with an identified germline mutation. Although germline mutations may inform treatment options and identify high-risk individuals for screening in other cancers, the data on PDAC are only now emerging. For example, poly adenosine diphosphate ribose polymerase (PARP) inhibitors are under investigation for BRCA-associated PDAC. Somatic mutations have also been identified in PDAC. However, current data are limited regarding treatment for potential PDAC somatic driver mutations. Although erlotinib is used in PDAC, its use is not targeted based on a tumor marker. Many tyrosine kinase inhibitors targeted toward potential driver mutations and critical pathways are in development, including BRAF/MEK, ALK, and CDK4/6. A consensus on screening strategies for individuals at high risk for PDAC is still evolving because of the relatively low prevalence of the disease, the relative invasiveness of endoscopic procedures often used as part of screening, and the lack of a clear survival benefit. Pancreatic cancer has been slower to move toward genomic testing, partially because of a lower prevalence of mutations and partially because of a limited effect of results on treatment choices outside a clinical trial. This is an area of active investigation, and we anticipate that there will be both preventive and therapeutic implications of driver mutations in the coming decade. Copyright © 2016 Elsevier HS Journals, Inc. All rights reserved.

  18. Molecular genetics and clinical features of Birt-Hogg-Dubé syndrome.

    PubMed

    Schmidt, Laura S; Linehan, W Marston

    2015-10-01

    Birt-Hogg-Dubé (BHD) syndrome is an inherited renal cancer syndrome in which affected individuals are at risk of developing benign cutaneous fibrofolliculomas, bilateral pulmonary cysts and spontaneous pneumothoraces, and kidney tumours. Bilateral multifocal renal tumours that develop in BHD syndrome are most frequently hybrid oncocytic tumours and chromophobe renal carcinoma, but can present with other histologies. Germline mutations in the FLCN gene on chromosome 17 are responsible for BHD syndrome--BHD-associated renal tumours display inactivation of the wild-type FLCN allele by somatic mutation or chromosomal loss, confirming that FLCN is a tumour suppressor gene that fits the classic two-hit model. FLCN interacts with two novel proteins, FNIP1 and FNIP2, and with AMPK, a negative regulator of mTOR. Studies with FLCN-deficient cell and animal models support a role for FLCN in modulating the AKT-mTOR pathway. Emerging evidence links FLCN with a number of other molecular pathways and cellular processes important for cell homeostasis that are frequently deregulated in cancer, including regulation of TFE3 and/or TFEB transcriptional activity, amino-acid-dependent mTOR activation through Rag GTPases, TGFβ signalling, PGC1α-driven mitochondrial biogenesis, and autophagy. Currently, surgical intervention is the only therapy available for BHD-associated renal tumours, but improved understanding of the FLCN pathway will hopefully lead to the development of effective forms of targeted systemic therapy for this disease.

  19. Molecular Genetics and Clinical Features of Birt-Hogg-Dubé-Syndrome

    PubMed Central

    Schmidt, Laura S.; Linehan, W. Marston

    2016-01-01

    Birt-Hogg-Dubé (BHD) syndrome is an inherited renal cancer syndrome in which affected individuals are at risk to develop benign, cutaneous fibrofolliculomas, bilateral pulmonary cysts and spontaneous pneumothoraces, and kidney tumors. Bilateral multifocal renal tumors that develop in BHD syndrome are most frequently hybrid oncocytic tumors and chromophobe renal carcinoma, but may present with other histologies. Germline mutations in the FLCN gene on chromosome 17 are responsible for BHD syndrome. BHD-associated renal tumors show inactivation of the wild-type FLCN allele by somatic mutation or chromosomal loss, confirming that FLCN is a tumor suppressor gene that fits the classic two-hit model. FLCN interacts with two novel proteins, FNIP1 and FNIP2, and with AMPK, a negative regulator of mTOR. Studies with FLCN-deficient cell and animal models support a role for FLCN in modulating the AKT-mTOR pathway. Emerging evidence links FLCN with a number of other molecular pathways and cellular processes important for cell homeostasis that are frequently deregulated in cancer, including regulation of TFE3/TFEB transcriptional activity, amino acid-dependent mTOR activation through Rag GTPases, TGF-β signaling, PGC1α-driven mitochondrial biogenesis, and autophagy. Currently, surgical intervention is the only therapy available for BHD-associated renal tumors. Further understanding of the FLCN pathway will hopefully lead to the development of effective forms of therapy for this disease. PMID:26334087

  20. A broad spectrum of genomic changes in latinamerican patients with EXT1/EXT2-CDG

    PubMed Central

    Delgado, M. A.; Martinez-Domenech, G.; Sarrión, P.; Urreizti, R.; Zecchini, L.; Robledo, H. H.; Segura, F.; de Kremer, R. Dodelson; Balcells, S.; Grinberg, D.; Asteggiano, C. G.

    2014-01-01

    Multiple osteochondromatosis (MO), or EXT1/EXT2-CDG, is an autosomal dominant O-linked glycosylation disorder characterized by the formation of multiple cartilage-capped tumors (osteochondromas). In contrast, solitary osteochondroma (SO) is a non-hereditary condition. EXT1 and EXT2, are tumor suppressor genes that encode glycosyltransferases involved in heparan sulfate elongation. We present the clinical and molecular analysis of 33 unrelated Latin American patients (27 MO and 6 SO). Sixty-three percent of all MO cases presented severe phenotype and two malignant transformations to chondrosarcoma (7%). We found the mutant allele in 78% of MO patients. Ten mutations were novel. The disease-causing mutations remained unknown in 22% of the MO patients and in all SO patients. No second mutational hit was detected in the DNA of the secondary chondrosarcoma from a patient who carried a nonsense EXT1 mutation. Neither EXT1 nor EXT2 protein could be detected in this sample. This is the first Latin American research program on EXT1/EXT2-CDG. PMID:25230886

  1. A broad spectrum of genomic changes in latinamerican patients with EXT1/EXT2-CDG.

    PubMed

    Delgado, M A; Martinez-Domenech, G; Sarrión, P; Urreizti, R; Zecchini, L; Robledo, H H; Segura, F; de Kremer, R Dodelson; Balcells, S; Grinberg, D; Asteggiano, C G

    2014-09-18

    Multiple osteochondromatosis (MO), or EXT1/EXT2-CDG, is an autosomal dominant O-linked glycosylation disorder characterized by the formation of multiple cartilage-capped tumors (osteochondromas). In contrast, solitary osteochondroma (SO) is a non-hereditary condition. EXT1 and EXT2, are tumor suppressor genes that encode glycosyltransferases involved in heparan sulfate elongation. We present the clinical and molecular analysis of 33 unrelated Latin American patients (27 MO and 6 SO). Sixty-three percent of all MO cases presented severe phenotype and two malignant transformations to chondrosarcoma (7%). We found the mutant allele in 78% of MO patients. Ten mutations were novel. The disease-causing mutations remained unknown in 22% of the MO patients and in all SO patients. No second mutational hit was detected in the DNA of the secondary chondrosarcoma from a patient who carried a nonsense EXT1 mutation. Neither EXT1 nor EXT2 protein could be detected in this sample. This is the first Latin American research program on EXT1/EXT2-CDG.

  2. Novel mutations in the CDKL5 gene in complex genotypes associated with West syndrome with variable phenotype: First description of somatic mosaic state.

    PubMed

    Jdila, Marwa Ben; Issa, Abir Ben; Khabou, Boudour; Rhouma, Bochra Ben; Kamoun, Fatma; Ammar-Keskes, Leila; Triki, Chahnez; Fakhfakh, Faiza

    2017-10-01

    West syndrome is a rare epileptic encephalopathy of early infancy, characterized by epileptic spasms, hypsarrhythmia, and psychomotor retardation beginning in the first year of life. The present study reports the clinical, molecular and bioinformatic investigation in the three studied West patients. The results revealed a complex genotype with more than one mutation in each patient including the known mutations c.1910C>G (P2, P3); c.2372A>C in P3 and c.2395C>G in P1 and novel variants including c.616G>A, shared by the three patients P1, P2 and P3; c.1403G>C shared by P2 and P3 and c.2288A>G in patient P1. All the mutations were at somatic mosaic state and were de novo in the patients except ones (c.2372A>C). To our knowledge; the somatic mosaic state is described for the first time in patients with West syndrome. Five identified mutations were located in the C-terminal domain of the protein, while the novel mutation (c.616G>A) was in the catalytic domain. Bioinformatic tools predicted that this latter is the most pathogenic substitution affecting 3D protein structure and the secondary mRNA structure. Complex genotype composed of different combinations of mutations in each patient seems to be related to the phenotype variability. Copyright © 2017. Published by Elsevier B.V.

  3. Genomic characterization of biliary tract cancers identifies driver genes and predisposing mutations.

    PubMed

    Wardell, Christopher P; Fujita, Masashi; Yamada, Toru; Simbolo, Michele; Fassan, Matteo; Karlic, Rosa; Polak, Paz; Kim, Jaegil; Hatanaka, Yutaka; Maejima, Kazuhiro; Lawlor, Rita T; Nakanishi, Yoshitsugu; Mitsuhashi, Tomoko; Fujimoto, Akihiro; Furuta, Mayuko; Ruzzenente, Andrea; Conci, Simone; Oosawa, Ayako; Sasaki-Oku, Aya; Nakano, Kaoru; Tanaka, Hiroko; Yamamoto, Yujiro; Michiaki, Kubo; Kawakami, Yoshiiku; Aikata, Hiroshi; Ueno, Masaki; Hayami, Shinya; Gotoh, Kunihito; Ariizumi, Shun-Ichi; Yamamoto, Masakazu; Yamaue, Hiroki; Chayama, Kazuaki; Miyano, Satoru; Getz, Gad; Scarpa, Aldo; Hirano, Satoshi; Nakamura, Toru; Nakagawa, Hidewaki

    2018-05-01

    Biliary tract cancers (BTCs) are clinically and pathologically heterogeneous and respond poorly to treatment. Genomic profiling can offer a clearer understanding of their carcinogenesis, classification and treatment strategy. We performed large-scale genome sequencing analyses on BTCs to investigate their somatic and germline driver events and characterize their genomic landscape. We analyzed 412 BTC samples from Japanese and Italian populations, 107 by whole-exome sequencing (WES), 39 by whole-genome sequencing (WGS), and a further 266 samples by targeted sequencing. The subtypes were 136 intrahepatic cholangiocarcinomas (ICCs), 101 distal cholangiocarcinomas (DCCs), 109 peri-hilar type cholangiocarcinomas (PHCs), and 66 gallbladder or cystic duct cancers (GBCs/CDCs). We identified somatic alterations and searched for driver genes in BTCs, finding pathogenic germline variants of cancer-predisposing genes. We predicted cell-of-origin for BTCs by combining somatic mutation patterns and epigenetic features. We identified 32 significantly and commonly mutated genes including TP53, KRAS, SMAD4, NF1, ARID1A, PBRM1, and ATR, some of which negatively affected patient prognosis. A novel deletion of MUC17 at 7q22.1 affected patient prognosis. Cell-of-origin predictions using WGS and epigenetic features suggest hepatocyte-origin of hepatitis-related ICCs. Deleterious germline mutations of cancer-predisposing genes such as BRCA1, BRCA2, RAD51D, MLH1, or MSH2 were detected in 11% (16/146) of BTC patients. BTCs have distinct genetic features including somatic events and germline predisposition. These findings could be useful to establish treatment and diagnostic strategies for BTCs based on genetic information. We here analyzed genomic features of 412 BTC samples from Japanese and Italian populations. A total of 32 significantly and commonly mutated genes were identified, some of which negatively affected patient prognosis, including a novel deletion of MUC17 at 7q22.1. Cell-of-origin predictions using WGS and epigenetic features suggest hepatocyte-origin of hepatitis-related ICCs. Deleterious germline mutations of cancer-predisposing genes were detected in 11% of patients with BTC. BTCs have distinct genetic features including somatic events and germline predisposition. Copyright © 2018 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.

  4. Analyses of spontaneous pink mutant events in the stamen hairs of Tradescantia clone BNL 4430 cultivated in a nutrient solution circulating growth chamber.

    PubMed

    Ichikawa, S; Wushur, S

    2000-12-20

    In order to obtain more fundamental data on Tradescantia clone BNL 4430, one of the most suitable testers for environmental mutagens, the occurrences of spontaneous somatic pink mutations in the stamen hairs were scored for 52 weeks from 12 December 1998 to 10 December 1999, cultivating the young inflorescence-bearing shoots with roots in a nutrient solution circulating (NSC) growth chamber. The environmental conditions in the chamber were 22.0+/-0.5 degrees C during the 16h day with the light intensity of 7.5klx from white fluorescent tubes, and 20.0+/-0.5 degrees C at night. During the scoring period, 697,443 stamen hairs with an average cell number of 25.36 were observed and 2642 pink mutant events (PMEs) were detected. The overall spontaneous mutation frequency was 1.56+/-0.03 PMEs per 10(4) hair-cell divisions, and the frequency was significantly lower in May, July and August and significantly higher in November and December. By analyzing the sectoring patterns of 1856 PMEs (70.25% of PMEs detected), the most of 172 cases of multiple (two to five) pink sectors observed in the same hairs (scored as 232 PMEs for calculating mutation frequency) were found to be the results of events involving somatic recombinations occurred in single cells or cell lineages, rather than those of two or more independent somatic mutations occurred in different cells. This finding clearly shows the significance of somatic recombinations in producing such multiple sectors (382 sectors in total) which occupied 19.0% of the 2006 pink sectors in total analyzed. Somatic recombinations were considered to be playing a significant role also in producing single PMEs in the stamen hairs.

  5. Whole-exome sequencing identifies recurrent AKT1 mutations in sclerosing hemangioma of lung

    PubMed Central

    Jung, Seung-Hyun; Kim, Min Sung; Lee, Sung-Hak; Park, Hyun-Chun; Choi, Hyun Joo; Maeng, Leeso; Min, Ki Ouk; Kim, Jeana; Park, Tae In; Shin, Ok Ran; Kim, Tae-Jung; Xu, Haidong; Lee, Kyo Young; Kim, Tae-Min; Song, Sang Yong; Lee, Charles; Chung, Yeun-Jun; Lee, Sug Hyung

    2016-01-01

    Pulmonary sclerosing hemangioma (PSH) is a benign tumor with two cell populations (epithelial and stromal cells), for which genomic profiles remain unknown. We conducted exome sequencing of 44 PSHs and identified recurrent somatic mutations of AKT1 (43.2%) and β-catenin (4.5%). We used a second subset of 24 PSHs to confirm the high frequency of AKT1 mutations (overall 31/68, 45.6%; p.E17K, 33.8%) and recurrent β-catenin mutations (overall 3 of 68, 4.4%). Of the PSHs without AKT1 mutations, two exhibited AKT1 copy gain. AKT1 mutations existed in both epithelial and stromal cells. In two separate PSHs from one patient, we observed two different AKT1 mutations, indicating they were not disseminated but independent arising tumors. Because the AKT1 mutations were not found to co-occur with β-catenin mutations (or any other known driver alterations) in any of the PSHs studied, we speculate that this may be the single-most common driver alteration to develop PSHs. Our study revealed genomic differences between PSHs and lung adenocarcinomas, including a high rate of AKT1 mutation in PSHs. These genomic features of PSH identified in the present study provide clues to understanding the biology of PSH and for differential genomic diagnosis of lung tumors. PMID:27601661

  6. Computational approaches to identify functional genetic variants in cancer genomes

    PubMed Central

    Gonzalez-Perez, Abel; Mustonen, Ville; Reva, Boris; Ritchie, Graham R.S.; Creixell, Pau; Karchin, Rachel; Vazquez, Miguel; Fink, J. Lynn; Kassahn, Karin S.; Pearson, John V.; Bader, Gary; Boutros, Paul C.; Muthuswamy, Lakshmi; Ouellette, B.F. Francis; Reimand, Jüri; Linding, Rune; Shibata, Tatsuhiro; Valencia, Alfonso; Butler, Adam; Dronov, Serge; Flicek, Paul; Shannon, Nick B.; Carter, Hannah; Ding, Li; Sander, Chris; Stuart, Josh M.; Stein, Lincoln D.; Lopez-Bigas, Nuria

    2014-01-01

    The International Cancer Genome Consortium (ICGC) aims to catalog genomic abnormalities in tumors from 50 different cancer types. Genome sequencing reveals hundreds to thousands of somatic mutations in each tumor, but only a minority drive tumor progression. We present the result of discussions within the ICGC on how to address the challenge of identifying mutations that contribute to oncogenesis, tumor maintenance or response to therapy, and recommend computational techniques to annotate somatic variants and predict their impact on cancer phenotype. PMID:23900255

  7. CSN1 Somatic Mutations in Penile Squamous Cell Carcinoma.

    PubMed

    Feber, Andrew; Worth, Daniel C; Chakravarthy, Ankur; de Winter, Patricia; Shah, Kunal; Arya, Manit; Saqib, Muhammad; Nigam, Raj; Malone, Peter R; Tan, Wei Shen; Rodney, Simon; Freeman, Alex; Jameson, Charles; Wilson, Gareth A; Powles, Tom; Beck, Stephan; Fenton, Tim; Sharp, Tyson V; Muneer, Asif; Kelly, John D

    2016-08-15

    Other than an association with HPV infection, little is known about the genetic alterations determining the development of penile cancer. Although penile cancer is rare in the developed world, it presents a significant burden in developing countries. Here, we report the findings of whole-exome sequencing (WES) to determine the somatic mutational landscape of penile cancer. WES was performed on penile cancer and matched germline DNA from 27 patients undergoing surgical resection. Targeted resequencing of candidate genes was performed in an independent 70 patient cohort. Mutation data were also integrated with DNA methylation and copy-number information from the same patients. We identified an HPV-associated APOBEC mutation signature and an NpCpG signature in HPV-negative disease. We also identified recurrent mutations in the novel penile cancer tumor suppressor genes CSN1(GPS1) and FAT1 Expression of CSN1 mutants in cells resulted in colocalization with AGO2 in cytoplasmic P-bodies, ultimately leading to the loss of miRNA-mediated gene silencing, which may contribute to disease etiology. Our findings represent the first comprehensive analysis of somatic alterations in penile cancer, highlighting the complex landscape of alterations in this malignancy. Cancer Res; 76(16); 4720-7. ©2016 AACR. ©2016 American Association for Cancer Research.

  8. A comprehensive characterization of rare mitochondrial DNA variants in neuroblastoma

    PubMed Central

    Pignataro, Piero; Lasorsa, Vito Alessandro; Hogarty, Michael D.; Castellano, Aurora; Conte, Massimo; Tonini, Gian Paolo; Iolascon, Achille; Gasparre, Giuseppe; Capasso, Mario

    2016-01-01

    Background Neuroblastoma, a tumor of the developing sympathetic nervous system, is a common childhood neoplasm that is often lethal. Mitochondrial DNA (mtDNA) mutations have been found in most tumors including neuroblastoma. We extracted mtDNA data from a cohort of neuroblastoma samples that had undergone Whole Exome Sequencing (WES) and also used snap-frozen samples in which mtDNA was entirely sequenced by Sanger technology. We next undertook the challenge of determining those mutations that are relevant to, or arisen during tumor development. The bioinformatics pipeline used to extract mitochondrial variants from matched tumor/blood samples was enriched by a set of filters inclusive of heteroplasmic fraction, nucleotide variability, and in silico prediction of pathogenicity. Results Our in silico multistep workflow applied both on WES and Sanger-sequenced neuroblastoma samples, allowed us to identify a limited burden of somatic and germline mitochondrial mutations with a potential pathogenic impact. Conclusions The few singleton germline and somatic mitochondrial mutations emerged, according to our in silico analysis, do not appear to impact on the development of neuroblastoma. Our findings are consistent with the hypothesis that most mitochondrial somatic mutations can be considered as ‘passengers’ and consequently have no discernible effect in this type of cancer. PMID:27351283

  9. Constitutional abnormalities of IDH1 combined with secondary mutations predispose a patient with Maffucci syndrome to acute lymphoblastic leukemia.

    PubMed

    Hirabayashi, Shinsuke; Seki, Masafumi; Hasegawa, Daisuke; Kato, Motohiro; Hyakuna, Nobuyuki; Shuo, Takuya; Kimura, Shunsuke; Yoshida, Kenichi; Kataoka, Keisuke; Fujii, Yoichi; Shiraishi, Yuichi; Chiba, Kenichi; Tanaka, Hiroko; Kiyokawa, Nobutaka; Miyano, Satoru; Ogawa, Seishi; Takita, Junko; Manabe, Atsushi

    2017-12-01

    Maffucci syndrome is a nonhereditary disorder caused by somatic mosaic isocitrate dehydrogenase 1 or 2 (IDH1 or IDH2) mutations and is characterized by multiple enchondromas along with hemangiomas. Malignant transformation of enchondromas to chondrosarcomas and secondary neoplasms, such as brain tumors or acute myeloid leukemia, are serious complications. A 15-year-old female with Maffucci syndrome developed B-cell precursor acute lymphoblastic leukemia (BCP-ALL). A somatic mutation in IDH1 was detected in hemangioma and leukemic cells. KRAS mutation and deletion of IKZF1 were detected in leukemic cells. Patients with Maffucci syndrome may, therefore, be at risk of BCP-ALL associated with secondary genetic events that affect lymphocyte differentiation. © 2017 Wiley Periodicals, Inc.

  10. Targeting mutant fibroblast growth factor receptors in cancer.

    PubMed

    Greulich, Heidi; Pollock, Pamela M

    2011-05-01

    Fibroblast growth factor receptors (FGFRs) play diverse roles in the control of cell proliferation, cell differentiation, angiogenesis and development. Activating the mutations of FGFRs in the germline has long been known to cause a variety of skeletal developmental disorders, but it is only recently that a similar spectrum of somatic FGFR mutations has been associated with human cancers. Many of these somatic mutations are gain-of-function and oncogenic and create dependencies in tumor cell lines harboring such mutations. A combination of knockdown studies and pharmaceutical inhibition in preclinical models has further substantiated genomically altered FGFR as a therapeutic target in cancer, and the oncology community is responding with clinical trials evaluating multikinase inhibitors with anti-FGFR activity and a new generation of specific pan-FGFR inhibitors. Copyright © 2011. Published by Elsevier Ltd.

  11. Recurrent PTPRB and PLCG1 mutations in angiosarcoma.

    PubMed

    Behjati, Sam; Tarpey, Patrick S; Sheldon, Helen; Martincorena, Inigo; Van Loo, Peter; Gundem, Gunes; Wedge, David C; Ramakrishna, Manasa; Cooke, Susanna L; Pillay, Nischalan; Vollan, Hans Kristian M; Papaemmanuil, Elli; Koss, Hans; Bunney, Tom D; Hardy, Claire; Joseph, Olivia R; Martin, Sancha; Mudie, Laura; Butler, Adam; Teague, Jon W; Patil, Meena; Steers, Graham; Cao, Yu; Gumbs, Curtis; Ingram, Davis; Lazar, Alexander J; Little, Latasha; Mahadeshwar, Harshad; Protopopov, Alexei; Al Sannaa, Ghadah A; Seth, Sahil; Song, Xingzhi; Tang, Jiabin; Zhang, Jianhua; Ravi, Vinod; Torres, Keila E; Khatri, Bhavisha; Halai, Dina; Roxanis, Ioannis; Baumhoer, Daniel; Tirabosco, Roberto; Amary, M Fernanda; Boshoff, Chris; McDermott, Ultan; Katan, Matilda; Stratton, Michael R; Futreal, P Andrew; Flanagan, Adrienne M; Harris, Adrian; Campbell, Peter J

    2014-04-01

    Angiosarcoma is an aggressive malignancy that arises spontaneously or secondarily to ionizing radiation or chronic lymphoedema. Previous work has identified aberrant angiogenesis, including occasional somatic mutations in angiogenesis signaling genes, as a key driver of angiosarcoma. Here we employed whole-genome, whole-exome and targeted sequencing to study the somatic changes underpinning primary and secondary angiosarcoma. We identified recurrent mutations in two genes, PTPRB and PLCG1, which are intimately linked to angiogenesis. The endothelial phosphatase PTPRB, a negative regulator of vascular growth factor tyrosine kinases, harbored predominantly truncating mutations in 10 of 39 tumors (26%). PLCG1, a signal transducer of tyrosine kinases, encoded a recurrent, likely activating p.Arg707Gln missense variant in 3 of 34 cases (9%). Overall, 15 of 39 tumors (38%) harbored at least one driver mutation in angiogenesis signaling genes. Our findings inform and reinforce current therapeutic efforts to target angiogenesis signaling in angiosarcoma.

  12. Mutational effects of space flight on Zea mays seeds

    NASA Technical Reports Server (NTRS)

    Mei, M.; Qiu, Y.; He, Y.; Bucker, H.; Yang, C. H.

    1994-01-01

    The growth and development of more than 500 Zea mays seeds flown on Long Duration Exposure Facility (LDEF) were studied. Somatic mutations, including white-yellow stripes on leaves, dwarfing, change of leaf sheath color or seedling color were observed in plants developed from these seeds. When the frequency of white-yellow formation was used as the endpoint and compared with data from ground based studies, the dose to which maize seeds might be exposed during the flight was estimated to be equivalent to 635 cGy of gamma rays. Seeds from one particular holder gave a high mutation frequency and a wide mutation spectrum. White-yellow stripes on leaves were also found in some of the inbred progenies from plants displayed somatic mutation. Electron microscopy studies showed that the damage of chloroplast development in the white-yellow stripe on leaves was similar between seeds flown on LDEF and that irradiated by accelerated heavy ions on ground.

  13. Order Matters: The Order of Somatic Mutations Influences Cancer Evolution.

    PubMed

    Kent, David G; Green, Anthony R

    2017-04-03

    Cancers evolve as a consequence of multiple somatic lesions, with competition between subclones and sequential subclonal evolution. Some driver mutations arise either early or late in the evolution of different individual tumors, suggesting that the final malignant properties of a subclone reflect the sum of mutations acquired rather than the order in which they arose. However, very little is known about the cellular consequences of altering the order in which mutations are acquired. Recent studies of human myeloproliferative neoplasms show that the order in which individual mutations are acquired has a dramatic impact on the cell biological and molecular properties of tumor-initiating cells. Differences in clinical presentation, complications, and response to targeted therapy were all observed and implicate mutation order as an important player in cancer biology. These observations represent the first demonstration that the order of mutation acquisition influences stem and progenitor cell behavior and clonal evolution in any cancer. Thus far, the impact of different mutation orders has only been studied in hematological malignancies, and analogous studies of solid cancers are now required. Copyright © 2017 Cold Spring Harbor Laboratory Press; all rights reserved.

  14. Aldosterone-stimulating somatic gene mutations are common in normal adrenal glands

    PubMed Central

    Nishimoto, Koshiro; Tomlins, Scott A.; Kuick, Rork; Cani, Andi K.; Giordano, Thomas J.; Hovelson, Daniel H.; Liu, Chia-Jen; Sanjanwala, Aalok R.; Edwards, Michael A.; Gomez-Sanchez, Celso E.; Nanba, Kazutaka; Rainey, William E.

    2015-01-01

    Primary aldosteronism (PA) represents the most common cause of secondary hypertension, but little is known regarding its adrenal cellular origins. Recently, aldosterone-producing cell clusters (APCCs) with high expression of aldosterone synthase (CYP11B2) were found in both normal and PA adrenal tissue. PA-causing aldosterone-producing adenomas (APAs) harbor mutations in genes encoding ion channels/pumps that alter intracellular calcium homeostasis and cause renin-independent aldosterone production through increased CYP11B2 expression. Herein, we hypothesized that APCCs have APA-related aldosterone-stimulating somatic gene mutations. APCCs were studied in 42 normal adrenals from kidney donors. To clarify APCC molecular characteristics, we used microarrays to compare the APCC transcriptome with conventional adrenocortical zones [zona glomerulosa (ZG), zona fasciculata, and zona reticularis]. The APCC transcriptome was most similar to ZG but with an enhanced capacity to produce aldosterone. To determine if APCCs harbored APA-related mutations, we performed targeted next generation sequencing of DNA from 23 APCCs and adjacent normal adrenal tissue isolated from both formalin-fixed, paraffin-embedded, and frozen tissues. Known aldosterone driver mutations were identified in 8 of 23 (35%) APCCs, including mutations in calcium channel, voltage-dependent, L-type, α1D-subunit (CACNA1D; 6 of 23 APCCs) and ATPase, Na+/K+ transporting, α1-polypeptide (ATP1A1; 2 of 23 APCCs), which were not observed in the adjacent normal adrenal tissue. Overall, we show three major findings: (i) APCCs are common in normal adrenals, (ii) APCCs harbor somatic mutations known to cause excess aldosterone production, and (iii) the mutation spectrum of aldosterone-driving mutations is different in APCCs from that seen in APA. These results provide molecular support for APCC as a precursor of PA. PMID:26240369

  15. Mosaicism in HIF2A-related polycythemia-paraganglioma syndrome.

    PubMed

    Buffet, Alexandre; Smati, Sarra; Mansuy, Ludovic; Ménara, Mélanie; Lebras, Maëlle; Heymann, Marie-Françoise; Simian, Christophe; Favier, Judith; Murat, Arnaud; Cariou, Bertrand; Gimenez-Roqueplo, Anne-Paule

    2014-02-01

    HIF2A germline mutations were known to cause congenital polycythemia. Recently, HIF2A somatic mutations were found in several patients with polycythemia and paraganglioma, pheochromocytoma, or somatostatinoma, suggesting the occurrence of a de novo postzygotic HIF2A mutation that has not been demonstrated clearly. Patient 1 is a woman suffering from polycythemia diagnosed at the age of 16 years. She was operated on for a pheochromocytoma at 45 years and for two abdominal paragangliomas at 59 years. She was also diagnosed with somatostatinoma. Patient 2 is a young boy who suffered from polycythemia since infancy. He underwent surgery for a nonfunctional adrenal paraganglioma at the age of 9 years. We sequenced by Sanger and next-generation sequencing the HIF2A gene in DNA extracted from tumors, leukocytes, and buccal cells. In patient 1, we identified a somatic HIF2A mutation (c.1586T>C; p.Leu529Pro) in DNA extracted from both paragangliomas. The mutation was detected as a somatic mosaic in DNA extracted from somatostatinoma and was absent from germline DNA. In patient 2, we found an HIF2A heterozygous mutation (c.1625T>C; p.Leu542Pro) in the paraganglioma, but the mutation was also present as a mosaic in leukocyte DNA and in DNA extracted from buccal cells (3.3 and 8.96% of sequencing reads, respectively). Both mutations disrupt the hydroxylation domain of the HIF2α protein. Our study shows that HIF2A-related tumors are caused by postzygotic mutations occurring in early developmental stages. Potential germline mosaicism should be considered during the familial genetic counseling when an individual has been diagnosed with HIF2A-related polycythemia-paraganglioma syndrome.

  16. A somatic-mutational process recurrently duplicates germline susceptibility loci and tissue-specific super-enhancers in breast cancers

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Glodzik, Dominik; Morganella, Sandro; Davies, Helen

    Somatic rearrangements contribute to the mutagenized landscape of cancer genomes. Here, we systematically interrogated rearrangements in 560 breast cancers by using a piecewise constant fitting approach. We identified 33 hotspots of large (>100 kb) tandem duplications, a mutational signature associated with homologous-recombination-repair deficiency. Notably, these tandem-duplication hotspots were enriched in breast cancer germline susceptibility loci (odds ratio (OR) = 4.28) and breast-specific 'super-enhancer' regulatory elements (OR = 3.54). These hotspots may be sites of selective susceptibility to double-strand-break damage due to high transcriptional activity or, through incrementally increasing copy number, may be sites of secondary selective pressure. Furthermore, the transcriptomicmore » consequences ranged from strong individual oncogene effects to weak but quantifiable multigene expression effects. We thus present a somatic-rearrangement mutational process affecting coding sequences and noncoding regulatory elements and contributing a continuum of driver consequences, from modest to strong effects, thereby supporting a polygenic model of cancer development.« less

  17. Noncoding somatic and inherited single-nucleotide variants converge to promote ESR1 expression in breast cancer.

    PubMed

    Bailey, Swneke D; Desai, Kinjal; Kron, Ken J; Mazrooei, Parisa; Sinnott-Armstrong, Nicholas A; Treloar, Aislinn E; Dowar, Mark; Thu, Kelsie L; Cescon, David W; Silvester, Jennifer; Yang, S Y Cindy; Wu, Xue; Pezo, Rossanna C; Haibe-Kains, Benjamin; Mak, Tak W; Bedard, Philippe L; Pugh, Trevor J; Sallari, Richard C; Lupien, Mathieu

    2016-10-01

    Sustained expression of the estrogen receptor-α (ESR1) drives two-thirds of breast cancer and defines the ESR1-positive subtype. ESR1 engages enhancers upon estrogen stimulation to establish an oncogenic expression program. Somatic copy number alterations involving the ESR1 gene occur in approximately 1% of ESR1-positive breast cancers, suggesting that other mechanisms underlie the persistent expression of ESR1. We report significant enrichment of somatic mutations within the set of regulatory elements (SRE) regulating ESR1 in 7% of ESR1-positive breast cancers. These mutations regulate ESR1 expression by modulating transcription factor binding to the DNA. The SRE includes a recurrently mutated enhancer whose activity is also affected by rs9383590, a functional inherited single-nucleotide variant (SNV) that accounts for several breast cancer risk-associated loci. Our work highlights the importance of considering the combinatorial activity of regulatory elements as a single unit to delineate the impact of noncoding genetic alterations on single genes in cancer.

  18. A somatic-mutational process recurrently duplicates germline susceptibility loci and tissue-specific super-enhancers in breast cancers

    DOE PAGES

    Glodzik, Dominik; Morganella, Sandro; Davies, Helen; ...

    2017-01-23

    Somatic rearrangements contribute to the mutagenized landscape of cancer genomes. Here, we systematically interrogated rearrangements in 560 breast cancers by using a piecewise constant fitting approach. We identified 33 hotspots of large (>100 kb) tandem duplications, a mutational signature associated with homologous-recombination-repair deficiency. Notably, these tandem-duplication hotspots were enriched in breast cancer germline susceptibility loci (odds ratio (OR) = 4.28) and breast-specific 'super-enhancer' regulatory elements (OR = 3.54). These hotspots may be sites of selective susceptibility to double-strand-break damage due to high transcriptional activity or, through incrementally increasing copy number, may be sites of secondary selective pressure. Furthermore, the transcriptomicmore » consequences ranged from strong individual oncogene effects to weak but quantifiable multigene expression effects. We thus present a somatic-rearrangement mutational process affecting coding sequences and noncoding regulatory elements and contributing a continuum of driver consequences, from modest to strong effects, thereby supporting a polygenic model of cancer development.« less

  19. Mitochondrial DNA mutations in single human blood cells.

    PubMed

    Yao, Yong-Gang; Kajigaya, Sachiko; Young, Neal S

    2015-09-01

    Determination mitochondrial DNA (mtDNA) sequences from extremely small amounts of DNA extracted from tissue of limited amounts and/or degraded samples is frequently employed in medical, forensic, and anthropologic studies. Polymerase chain reaction (PCR) amplification followed by DNA cloning is a routine method, especially to examine heteroplasmy of mtDNA mutations. In this review, we compare the mtDNA mutation patterns detected by three different sequencing strategies. Cloning and sequencing methods that are based on PCR amplification of DNA extracted from either single cells or pooled cells yield a high frequency of mutations, partly due to the artifacts introduced by PCR and/or the DNA cloning process. Direct sequencing of PCR product which has been amplified from DNA in individual cells is able to detect the low levels of mtDNA mutations present within a cell. We further summarize the findings in our recent studies that utilized this single cell method to assay mtDNA mutation patterns in different human blood cells. Our data show that many somatic mutations observed in the end-stage differentiated cells are found in hematopoietic stem cells (HSCs) and progenitors within the CD34(+) cell compartment. Accumulation of mtDNA variations in the individual CD34+ cells is affected by both aging and family genetic background. Granulocytes harbor higher numbers of mutations compared with the other cells, such as CD34(+) cells and lymphocytes. Serial assessment of mtDNA mutations in a population of single CD34(+) cells obtained from the same donor over time suggests stability of some somatic mutations. CD34(+) cell clones from a donor marked by specific mtDNA somatic mutations can be found in the recipient after transplantation. The significance of these findings is discussed in terms of the lineage tracing of HSCs, aging effect on accumulation of mtDNA mutations and the usage of mtDNA sequence in forensic identification. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. Mechanisms of mutations in myeloproliferative neoplasms.

    PubMed

    Levine, Ross L

    2009-12-01

    In recent years, a series of studies have provided genetic insight into the pathogenesis of myeloproliferative neoplasms (MPNs). It is now known that JAK2V617F mutations are present in 90% of patients with polycythaemia vera (PV), 60% of patients with essential thrombocytosis (ET) and 50% of patients with myelofibrosis (MF). Despite the high prevalence of JAK2V617F mutations in these three myeloid malignancies, several questions remain. For example, how does one mutation contribute to the pathogenesis of three clinically distinct diseases, and how do some patients develop these diseases in the absence of a JAK2V617F mutation? Single nucleotide polymorphisms at various loci and somatic mutations, such as those in MPLW515L/K, TET2 and in exon 12 of JAK2, may also contribute to the pathogenesis of these MPNs. There are likely additional germline and somatic genetic factors important to the MPN phenotype. Additional studies of large MPN and control cohorts with new techniques will help identify these factors.

  1. ExScalibur: A High-Performance Cloud-Enabled Suite for Whole Exome Germline and Somatic Mutation Identification

    PubMed Central

    Huang, Lei; Kang, Wenjun; Bartom, Elizabeth; Onel, Kenan; Volchenboum, Samuel; Andrade, Jorge

    2015-01-01

    Whole exome sequencing has facilitated the discovery of causal genetic variants associated with human diseases at deep coverage and low cost. In particular, the detection of somatic mutations from tumor/normal pairs has provided insights into the cancer genome. Although there is an abundance of publicly-available software for the detection of germline and somatic variants, concordance is generally limited among variant callers and alignment algorithms. Successful integration of variants detected by multiple methods requires in-depth knowledge of the software, access to high-performance computing resources, and advanced programming techniques. We present ExScalibur, a set of fully automated, highly scalable and modulated pipelines for whole exome data analysis. The suite integrates multiple alignment and variant calling algorithms for the accurate detection of germline and somatic mutations with close to 99% sensitivity and specificity. ExScalibur implements streamlined execution of analytical modules, real-time monitoring of pipeline progress, robust handling of errors and intuitive documentation that allows for increased reproducibility and sharing of results and workflows. It runs on local computers, high-performance computing clusters and cloud environments. In addition, we provide a data analysis report utility to facilitate visualization of the results that offers interactive exploration of quality control files, read alignment and variant calls, assisting downstream customization of potential disease-causing mutations. ExScalibur is open-source and is also available as a public image on Amazon cloud. PMID:26271043

  2. Loss-of-function mutations in LEMD3 result in osteopoikilosis, Buschke-Ollendorff syndrome and melorheostosis.

    PubMed

    Hellemans, Jan; Preobrazhenska, Olena; Willaert, Andy; Debeer, Philippe; Verdonk, Peter C M; Costa, Teresa; Janssens, Katrien; Menten, Bjorn; Van Roy, Nadine; Vermeulen, Stefan J T; Savarirayan, Ravi; Van Hul, Wim; Vanhoenacker, Filip; Huylebroeck, Danny; De Paepe, Anne; Naeyaert, Jean-Marie; Vandesompele, Jo; Speleman, Frank; Verschueren, Kristin; Coucke, Paul J; Mortier, Geert R

    2004-11-01

    Osteopoikilosis, Buschke-Ollendorff syndrome (BOS) and melorheostosis are disorders characterized by increased bone density. The occurrence of one or more of these phenotypes in the same individual or family suggests that these entities might be allelic. We collected data from three families in which affected individuals had osteopoikilosis with or without manifestations of BOS or melorheostosis. A genome-wide linkage analysis in these families, followed by the identification of a microdeletion in an unrelated individual with these diseases, allowed us to map the gene that is mutated in osteopoikilosis. All the affected individuals that we investigated were heterozygous with respect to a loss-of-function mutation in LEMD3 (also called MAN1), which encodes an inner nuclear membrane protein. A somatic mutation in the second allele of LEMD3 could not be identified in fibroblasts from affected skin of an individual with BOS and an individual with melorheostosis. XMAN1, the Xenopus laevis ortholog, antagonizes BMP signaling during embryogenesis. In this study, LEMD3 interacted with BMP and activin-TGFbeta receptor-activated Smads and antagonized both signaling pathways in human cells.

  3. Cells Comprising the Prostate Cancer Microenvironment Lack Recurrent Clonal Somatic Genomic Aberrations

    PubMed Central

    Bianchi-Frias, Daniella; Basom, Ryan; Delrow, Jeffrey J; Coleman, Ilsa M; Dakhova, Olga; Qu, Xiaoyu; Fang, Min; Franco, Omar E.; Ericson, Nolan G.; Bielas, Jason H.; Hayward, Simon W.; True, Lawrence; Morrissey, Colm; Brown, Lisha; Bhowmick, Neil A.; Rowley, David; Ittmann, Michael; Nelson, Peter S.

    2017-01-01

    Prostate cancer-associated stroma (CAS) plays an active role in malignant transformation, tumor progression, and metastasis. Molecular analyses of CAS have demonstrated significant changes in gene expression; however, conflicting evidence exists on whether genomic alterations in benign cells comprising the tumor microenvironment (TME) underlie gene expression changes and oncogenic phenotypes. This study evaluates the nuclear and mitochondrial DNA integrity of prostate carcinoma cells, CAS, matched benign epithelium and benign epithelium-associated stroma by whole genome copy number analyses, targeted sequencing of TP53, and fluorescence in situ hybridization. Comparative genomic hybridization (aCGH) of CAS revealed a copy-neutral diploid genome with only rare and small somatic copy number aberrations (SCNAs). In contrast, several expected recurrent SCNAs were evident in the adjacent prostate carcinoma cells, including gains at 3q, 7p, and 8q, and losses at 8p and 10q. No somatic TP53 mutations were observed in CAS. Mitochondrial DNA (mtDNA) extracted from carcinoma cells and stroma identified 23 somatic mtDNA mutations in neoplastic epithelial cells but only one mutation in stroma. Finally, genomic analyses identified no SCNAs, no loss of heterozygosity (LOH) or copy-neutral LOH in cultured cancer-associated fibroblasts (CAFs), which are known to promote prostate cancer progression in vivo. PMID:26753621

  4. Chromosome microduplication in somatic cells decreases the genetic stability of human reprogrammed somatic cells and results in pluripotent stem cells.

    PubMed

    Yu, Yang; Chang, Liang; Zhao, Hongcui; Li, Rong; Fan, Yong; Qiao, Jie

    2015-05-12

    Human pluripotent stem cells, including cloned embryonic and induced pluripotent stem cells, offer a limitless cellular source for regenerative medicine. However, their derivation efficiency is limited, and a large proportion of cells are arrested during reprogramming. In the current study, we explored chromosome microdeletion/duplication in arrested and established reprogrammed cells. Our results show that aneuploidy induced by somatic cell nuclear transfer technology is a key factor in the developmental failure of cloned human embryos and primary colonies from implanted cloned blastocysts and that expression patterns of apoptosis-related genes are dynamically altered. Overall, ~20%-53% of arrested primary colonies in induced plurpotent stem cells displayed aneuploidy, and upregulation of P53 and Bax occurred in all arrested primary colonies. Interestingly, when somatic cells with pre-existing chromosomal mutations were used as donor cells, no cloned blastocysts were obtained, and additional chromosomal mutations were detected in the resulting iPS cells following long-term culture, which was not observed in the two iPS cell lines with normal karyotypes. In conclusion, aneuploidy induced by the reprogramming process restricts the derivation of pluripotent stem cells, and, more importantly, pre-existing chromosomal mutations enhance the risk of genome instability, which limits the clinical utility of these cells.

  5. Proteogenomics connects somatic mutations to signalling in breast cancer.

    PubMed

    Mertins, Philipp; Mani, D R; Ruggles, Kelly V; Gillette, Michael A; Clauser, Karl R; Wang, Pei; Wang, Xianlong; Qiao, Jana W; Cao, Song; Petralia, Francesca; Kawaler, Emily; Mundt, Filip; Krug, Karsten; Tu, Zhidong; Lei, Jonathan T; Gatza, Michael L; Wilkerson, Matthew; Perou, Charles M; Yellapantula, Venkata; Huang, Kuan-lin; Lin, Chenwei; McLellan, Michael D; Yan, Ping; Davies, Sherri R; Townsend, R Reid; Skates, Steven J; Wang, Jing; Zhang, Bing; Kinsinger, Christopher R; Mesri, Mehdi; Rodriguez, Henry; Ding, Li; Paulovich, Amanda G; Fenyö, David; Ellis, Matthew J; Carr, Steven A

    2016-06-02

    Somatic mutations have been extensively characterized in breast cancer, but the effects of these genetic alterations on the proteomic landscape remain poorly understood. Here we describe quantitative mass-spectrometry-based proteomic and phosphoproteomic analyses of 105 genomically annotated breast cancers, of which 77 provided high-quality data. Integrated analyses provided insights into the somatic cancer genome including the consequences of chromosomal loss, such as the 5q deletion characteristic of basal-like breast cancer. Interrogation of the 5q trans-effects against the Library of Integrated Network-based Cellular Signatures, connected loss of CETN3 and SKP1 to elevated expression of epidermal growth factor receptor (EGFR), and SKP1 loss also to increased SRC tyrosine kinase. Global proteomic data confirmed a stromal-enriched group of proteins in addition to basal and luminal clusters, and pathway analysis of the phosphoproteome identified a G-protein-coupled receptor cluster that was not readily identified at the mRNA level. In addition to ERBB2, other amplicon-associated highly phosphorylated kinases were identified, including CDK12, PAK1, PTK2, RIPK2 and TLK2. We demonstrate that proteogenomic analysis of breast cancer elucidates the functional consequences of somatic mutations, narrows candidate nominations for driver genes within large deletions and amplified regions, and identifies therapeutic targets.

  6. Functional Analysis of Somatic Mutations in Lung Cancer

    DTIC Science & Technology

    2015-10-01

    antibody cetuximab [11]. Finally, we have developed novel single cell sequencing approaches to uncover EGFR mutational variants in glioblastoma and their...assessed which mutations are epistatic to EGFR or capable of initiating xenograft tumor formation in vivo. Using eVIP, we identified 69% of mutations...analyzed as impactful whereas 31% appear functionally neutral. A subset of the impactful mutations induce xenograft tumor formation in mice and/or

  7. Cross-talk between AMPK and EGFR dependent Signaling in Non-Small Cell Lung Cancer

    NASA Astrophysics Data System (ADS)

    Praveen, Paurush; Hülsmann, Helen; Sültmann, Holger; Kuner, Ruprecht; Fröhlich, Holger

    2016-06-01

    Lung cancers globally account for 12% of new cancer cases, 85% of these being Non Small Cell Lung Cancer (NSCLC). Therapies like erlotinib target the key player EGFR, which is mutated in about 10% of lung adenocarcinoma. However, drug insensitivity and resistance caused by second mutations in the EGFR or aberrant bypass signaling have evolved as a major challenge in controlling these tumors. Recently, AMPK activation was proposed to sensitize NSCLC cells against erlotinib treatment. However, the underlying mechanism is largely unknown. In this work we aim to unravel the interplay between 20 proteins that were previously associated with EGFR signaling and erlotinib drug sensitivity. The inferred network shows a high level of agreement with protein-protein interactions reported in STRING and HIPPIE databases. It is further experimentally validated with protein measurements. Moreover, predictions derived from our network model fairly agree with somatic mutations and gene expression data from primary lung adenocarcinoma. Altogether our results support the role of AMPK in EGFR signaling and drug sensitivity.

  8. Cross-talk between AMPK and EGFR dependent Signaling in Non-Small Cell Lung Cancer

    PubMed Central

    Praveen, Paurush; Hülsmann, Helen; Sültmann, Holger; Kuner, Ruprecht; Fröhlich, Holger

    2016-01-01

    Lung cancers globally account for 12% of new cancer cases, 85% of these being Non Small Cell Lung Cancer (NSCLC). Therapies like erlotinib target the key player EGFR, which is mutated in about 10% of lung adenocarcinoma. However, drug insensitivity and resistance caused by second mutations in the EGFR or aberrant bypass signaling have evolved as a major challenge in controlling these tumors. Recently, AMPK activation was proposed to sensitize NSCLC cells against erlotinib treatment. However, the underlying mechanism is largely unknown. In this work we aim to unravel the interplay between 20 proteins that were previously associated with EGFR signaling and erlotinib drug sensitivity. The inferred network shows a high level of agreement with protein-protein interactions reported in STRING and HIPPIE databases. It is further experimentally validated with protein measurements. Moreover, predictions derived from our network model fairly agree with somatic mutations and gene expression data from primary lung adenocarcinoma. Altogether our results support the role of AMPK in EGFR signaling and drug sensitivity. PMID:27279498

  9. Cross-talk between AMPK and EGFR dependent Signaling in Non-Small Cell Lung Cancer.

    PubMed

    Praveen, Paurush; Hülsmann, Helen; Sültmann, Holger; Kuner, Ruprecht; Fröhlich, Holger

    2016-06-09

    Lung cancers globally account for 12% of new cancer cases, 85% of these being Non Small Cell Lung Cancer (NSCLC). Therapies like erlotinib target the key player EGFR, which is mutated in about 10% of lung adenocarcinoma. However, drug insensitivity and resistance caused by second mutations in the EGFR or aberrant bypass signaling have evolved as a major challenge in controlling these tumors. Recently, AMPK activation was proposed to sensitize NSCLC cells against erlotinib treatment. However, the underlying mechanism is largely unknown. In this work we aim to unravel the interplay between 20 proteins that were previously associated with EGFR signaling and erlotinib drug sensitivity. The inferred network shows a high level of agreement with protein-protein interactions reported in STRING and HIPPIE databases. It is further experimentally validated with protein measurements. Moreover, predictions derived from our network model fairly agree with somatic mutations and gene expression data from primary lung adenocarcinoma. Altogether our results support the role of AMPK in EGFR signaling and drug sensitivity.

  10. Contributions of intrinsic mutation rate and selfish selection to levels of de novo HRAS mutations in the paternal germline

    PubMed Central

    Giannoulatou, Eleni; McVean, Gilean; Taylor, Indira B.; McGowan, Simon J.; Maher, Geoffrey J.; Iqbal, Zamin; Pfeifer, Susanne P.; Turner, Isaac; Burkitt Wright, Emma M. M.; Shorto, Jennifer; Itani, Aysha; Turner, Karen; Gregory, Lorna; Buck, David; Rajpert-De Meyts, Ewa; Looijenga, Leendert H. J.; Kerr, Bronwyn; Wilkie, Andrew O. M.; Goriely, Anne

    2013-01-01

    The RAS proto-oncogene Harvey rat sarcoma viral oncogene homolog (HRAS) encodes a small GTPase that transduces signals from cell surface receptors to intracellular effectors to control cellular behavior. Although somatic HRAS mutations have been described in many cancers, germline mutations cause Costello syndrome (CS), a congenital disorder associated with predisposition to malignancy. Based on the epidemiology of CS and the occurrence of HRAS mutations in spermatocytic seminoma, we proposed that activating HRAS mutations become enriched in sperm through a process akin to tumorigenesis, termed selfish spermatogonial selection. To test this hypothesis, we quantified the levels, in blood and sperm samples, of HRAS mutations at the p.G12 codon and compared the results to changes at the p.A11 codon, at which activating mutations do not occur. The data strongly support the role of selection in determining HRAS mutation levels in sperm, and hence the occurrence of CS, but we also found differences from the mutation pattern in tumorigenesis. First, the relative prevalence of mutations in sperm correlates weakly with their in vitro activating properties and occurrence in cancers. Second, specific tandem base substitutions (predominantly GC>TT/AA) occur in sperm but not in cancers; genomewide analysis showed that this same mutation is also overrepresented in constitutional pathogenic and polymorphic variants, suggesting a heightened vulnerability to these mutations in the germline. We developed a statistical model to show how both intrinsic mutation rate and selfish selection contribute to the mutational burden borne by the paternal germline. PMID:24259709

  11. Contributions of intrinsic mutation rate and selfish selection to levels of de novo HRAS mutations in the paternal germline.

    PubMed

    Giannoulatou, Eleni; McVean, Gilean; Taylor, Indira B; McGowan, Simon J; Maher, Geoffrey J; Iqbal, Zamin; Pfeifer, Susanne P; Turner, Isaac; Burkitt Wright, Emma M M; Shorto, Jennifer; Itani, Aysha; Turner, Karen; Gregory, Lorna; Buck, David; Rajpert-De Meyts, Ewa; Looijenga, Leendert H J; Kerr, Bronwyn; Wilkie, Andrew O M; Goriely, Anne

    2013-12-10

    The RAS proto-oncogene Harvey rat sarcoma viral oncogene homolog (HRAS) encodes a small GTPase that transduces signals from cell surface receptors to intracellular effectors to control cellular behavior. Although somatic HRAS mutations have been described in many cancers, germline mutations cause Costello syndrome (CS), a congenital disorder associated with predisposition to malignancy. Based on the epidemiology of CS and the occurrence of HRAS mutations in spermatocytic seminoma, we proposed that activating HRAS mutations become enriched in sperm through a process akin to tumorigenesis, termed selfish spermatogonial selection. To test this hypothesis, we quantified the levels, in blood and sperm samples, of HRAS mutations at the p.G12 codon and compared the results to changes at the p.A11 codon, at which activating mutations do not occur. The data strongly support the role of selection in determining HRAS mutation levels in sperm, and hence the occurrence of CS, but we also found differences from the mutation pattern in tumorigenesis. First, the relative prevalence of mutations in sperm correlates weakly with their in vitro activating properties and occurrence in cancers. Second, specific tandem base substitutions (predominantly GC>TT/AA) occur in sperm but not in cancers; genomewide analysis showed that this same mutation is also overrepresented in constitutional pathogenic and polymorphic variants, suggesting a heightened vulnerability to these mutations in the germline. We developed a statistical model to show how both intrinsic mutation rate and selfish selection contribute to the mutational burden borne by the paternal germline.

  12. MAX mutations status in Swedish patients with pheochromocytoma and paraganglioma tumours.

    PubMed

    Crona, Joakim; Maharjan, Rajani; Delgado Verdugo, Alberto; Stålberg, Peter; Granberg, Dan; Hellman, Per; Björklund, Peyman

    2014-03-01

    Pheochromocytoma (PCC) and Paraganglioma are rare tumours originating from neuroendocrine cells. Up to 60% of cases have either germline or somatic mutation in one of eleven described susceptibility loci, SDHA, SDHB, SDHC, SDHD, SDHAF2, VHL, EPAS1, RET, NF1, TMEM127 and MYC associated factor-X (MAX). Recently, germline mutations in MAX were found to confer susceptibility to PCC and paraganglioma (PGL). A subsequent multicentre study found about 1% of PCCs and PGLs to have germline or somatic mutations in MAX. However, there has been no study investigating the frequency of MAX mutations in a Scandinavian cohort. We analysed tumour specimens from 63 patients with PCC and PGL treated at Uppsala University hospital, Sweden, for re-sequencing of MAX using automated Sanger sequencing. Our results show that 0% (0/63) of tumours had mutations in MAX. Allele frequencies of known single nucleotide polymorphisms rs4902359, rs45440292, rs1957948 and rs1957949 corresponded to those available in the Single Nucleotide Polymorphism Database. We conclude that MAX mutations remain unusual events and targeted genetic screening should be considered after more common genetic events have been excluded.

  13. Integrity of immunoglobulin variable regions is supported by GANP during AID-induced somatic hypermutation in germinal center B cells

    PubMed Central

    Eid, Mohammed Mansour Abbas; Shimoda, Mayuko; Singh, Shailendra Kumar; Almofty, Sarah Ameen; Pham, Phuong; Goodman, Myron F.; Maeda, Kazuhiko; Sakaguchi, Nobuo

    2017-01-01

    Abstract Immunoglobulin affinity maturation depends on somatic hypermutation (SHM) in immunoglobulin variable (IgV) regions initiated by activation-induced cytidine deaminase (AID). AID induces transition mutations by C→U deamination on both strands, causing C:G→T:A. Error-prone repairs of U by base excision and mismatch repairs (MMRs) create transversion mutations at C/G and mutations at A/T sites. In Neuberger’s model, it remained to be clarified how transition/transversion repair is regulated. We investigate the role of AID-interacting GANP (germinal center-associated nuclear protein) in the IgV SHM profile. GANP enhances transition mutation of the non-transcribed strand G and reduces mutation at A, restricted to GYW of the AID hotspot motif. It reduces DNA polymerase η hotspot mutations associated with MMRs followed by uracil-DNA glycosylase. Mutation comparison between IgV complementary and framework regions (FWRs) by Bayesian statistical estimation demonstrates that GANP supports the preservation of IgV FWR genomic sequences. GANP works to maintain antibody structure by reducing drastic changes in the IgV FWR in affinity maturation. PMID:28541550

  14. Next generation sequencing as a useful tool in the diagnostics of mosaicism in Alport syndrome.

    PubMed

    Beicht, Sonja; Strobl-Wildemann, Gertrud; Rath, Sabine; Wachter, Oliver; Alberer, Martin; Kaminsky, Elke; Weber, Lutz T; Hinrichsen, Tanja; Klein, Hanns-Georg; Hoefele, Julia

    2013-09-10

    Alport syndrome (ATS) is a progressive hereditary nephropathy characterized by hematuria and/or proteinuria with structural defects of the glomerular basement membrane. It can be associated with extrarenal manifestations (high-tone sensorineural hearing loss and ocular abnormalities). Somatic mutations in COL4A5 (X-linked), COL4A3 and COL4A4 genes (both autosomal recessive and autosomal dominant) cause Alport syndrome. Somatic mosaicism in Alport patients is very rare. The reason for this may be due to the difficulty of detection. We report the case of a boy and his mother who presented with Alport syndrome. Mutational analysis showed the novel hemizygote pathogenic mutation c.2396-1G>A (IVS29-1G>A) at the splice acceptor site of the intron 29 exon 30 boundary of the COL4A5 gene in the boy. The mutation in the mother would not have been detected by Sanger sequencing without the knowledge of the mutational analysis result of her son. Further investigation of the mother using next generation sequencing showed somatic mosaicism and implied potential germ cell mosaicism. The mutation in the mother has most likely occurred during early embryogenesis. Analysis of tissue of different embryonic origin in the mother confirmed mosaicism in both mesoderm and ectoderm. Low grade mosaicism is very difficult to detect by Sanger sequencing. Next generation sequencing is increasingly used in the diagnostics and might improve the detection of mosaicism. In the case of definite clinical symptoms of ATS and missing detection of a mutation by Sanger sequencing, mutational analysis should be performed by next generation sequencing. Copyright © 2013 Elsevier B.V. All rights reserved.

  15. Detection of somatic mutations in the mitochondrial DNA control region D-loop in brain tumors: The first report in Malaysian patients.

    PubMed

    Mohamed Yusoff, Abdul Aziz; Mohd Nasir, Khairol Naaim; Haris, Khalilah; Mohd Khair, Siti Zulaikha Nashwa; Abdul Ghani, Abdul Rahman Izaini; Idris, Zamzuri; Abdullah, Jafri Malin

    2017-11-01

    Although the role of nuclear-encoded gene alterations has been well documented in brain tumor development, the involvement of the mitochondrial genome in brain tumorigenesis has not yet been fully elucidated and remains controversial. The present study aimed to identify mutations in the mitochondrial DNA (mtDNA) control region D-loop in patients with brain tumors in Malaysia. A mutation analysis was performed in which DNA was extracted from paired tumor tissue and blood samples obtained from 49 patients with brain tumors. The D-loop region DNA was amplified using the PCR technique, and genetic data from DNA sequencing analyses were compared with the published revised Cambridge sequence to identify somatic mutations. Among the 49 brain tumor tissue samples evaluated, 25 cases (51%) had somatic mutations of the mtDNA D-loop, with a total of 48 mutations. Novel mutations that had not previously been identified in the D-loop region (176 A-deletion, 476 C>A, 566 C>A and 16405 A-deletion) were also classified. No significant associations between the D-loop mutation status and the clinicopathological parameters were observed. To the best of our knowledge, the current study presents the first evidence of alterations in the mtDNA D-loop regions in the brain tumors of Malaysian patients. These results may provide an overview and data regarding the incidence of mitochondrial genome alterations in Malaysian patients with brain tumors. In addition to nuclear genome aberrations, these specific mitochondrial genome alterations may also be considered as potential cancer biomarkers for the diagnosis and staging of brain cancers.

  16. Association of complementation group and mutation type with clinical outcome in fanconi anemia. European Fanconi Anemia Research Group.

    PubMed

    Faivre, L; Guardiola, P; Lewis, C; Dokal, I; Ebell, W; Zatterale, A; Altay, C; Poole, J; Stones, D; Kwee, M L; van Weel-Sipman, M; Havenga, C; Morgan, N; de Winter, J; Digweed, M; Savoia, A; Pronk, J; de Ravel, T; Jansen, S; Joenje, H; Gluckman, E; Mathew, C G

    2000-12-15

    Fanconi anemia (FA) is a clinically and genetically heterogeneous disorder. Clinical care is complicated by variable age at onset and severity of hematologic symptoms. Recent advances in the molecular biology of FA have allowed us to investigate the relationship between FA genotype and the nature and severity of the clinical phenotype. Two hundred forty-five patients from all 7 known complementation groups (FA-A to FA-G) were studied. Mutations were detected in one of the cloned FANC genes in 169 patients; in the remainder the complementation group was assigned by cell fusion or Western blotting. A range of qualitative and quantitative clinical parameters was compared for each complementation group and for different classes of mutation. Significant phenotypic differences were found. FA-G patients had more severe cytopenia and a higher incidence of leukemia. Somatic abnormalities were less prevalent in FA-C, but more common in the rare groups FA-D, FA-E, and FA-F. In FA-A, patients homozygous for null mutations had an earlier onset of anemia and a higher incidence of leukemia than those with mutations producing an altered protein. In FA-C, there was a later age of onset of aplastic anemia and fewer somatic abnormalities in patients with the 322delG mutation, but there were more somatic abnormalities in patients with IVS4 + 4A --> T. This study indicates that FA patients with mutations in the FANCG gene and patients homozygous for null mutations in FANCA are high-risk groups with a poor hematologic outcome and should be considered as candidates both for frequent monitoring and early therapeutic intervention. (Blood. 2000;96:4064-4070)

  17. Inducing Somatic Pkd1 Mutations in Vivo in a Mouse Model of Autosomal-Dominant Polycystic Kidney Disease

    DTIC Science & Technology

    2016-10-01

    AWARD NUMBER: W81XWH-15-1-0237 TITLE: Inducing Somatic Pkd1 Mutations in Vivo in a Mouse Model of Autosomal-Dominant Polycystic Kidney ... Kidney Disease 5b. GRANT NUMBER W81XWH-15-1-0237 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) Cristina Cebrian-Ligero 5d. PROJECT NUMBER 5e. TASK...Autosomal Dominant Polycystic Kidney Disease (ADPKD) is one of the world’s most common life-threatening genetic diseases. Over 95% of diagnosed cases of

  18. Age-related mutations and chronic myelomonocytic leukemia

    PubMed Central

    Mason, CC; Khorashad, JS; Tantravahi, SK; Kelley, TW; Zabriskie, MS; Yan, D; Pomicter, AD; Reynolds, KR; Eiring, AM; Kronenberg, Z; Sherman, RL; Tyner, JW; Dalley, BK; Dao, K-H; Yandell, M; Druker, BJ; Gotlib, J; O’Hare, T; Deininger, MW

    2016-01-01

    Chronic myelomonocytic leukemia (CMML) is a hematologic malignancy nearly confined to the elderly. Previous studies to determine incidence and prognostic significance of somatic mutations in CMML have relied on candidate gene sequencing, although an unbiased mutational search has not been conducted. As many of the genes commonly mutated in CMML were recently associated with age-related clonal hematopoiesis (ARCH) and aged hematopoiesis is characterized by a myelomonocytic differentiation bias, we hypothesized that CMML and aged hematopoiesis may be closely related. We initially established the somatic mutation landscape of CMML by whole exome sequencing followed by gene-targeted validation. Genes mutated in ⩾ 10% of patients were SRSF2, TET2, ASXL1, RUNX1, SETBP1, KRAS, EZH2, CBL and NRAS, as well as the novel CMML genes FAT4, ARIH1, DNAH2 and CSMD1. Most CMML patients (71%) had mutations in ⩾ 2 ARCH genes and 52% had ⩾ 7 mutations overall. Higher mutation burden was associated with shorter survival. Age-adjusted population incidence and reported ARCH mutation rates are consistent with a model in which clinical CMML ensues when a sufficient number of stochastically acquired age-related mutations has accumulated, suggesting that CMML represents the leukemic conversion of the myelomonocytic-lineage-biased aged hematopoietic system. PMID:26648538

  19. Differences in somatic mutation landscape of hepatocellular carcinoma in Asian American and European American populations

    PubMed Central

    Hu, Qiang; Yan, Li; Liu, Biao; Ambrosone, Christine B.; Wang, Jianmin; Liu, Song

    2016-01-01

    The incidence rate of hepatocellular carcinoma (HCC) is higher in populations of Asian ancestry than European ancestry (EA). We sought to investigate HCC mutational differences between the two populations, which may reflect differences in the prevalence of etiological factors. We compared HCC somatic mutations in patients of self-reported Asian American and EA from The Cancer Genome Atlas (TCGA), and assessed associations of tumor mutations with established HCC risk factors. Although the average mutation burden was similar, TP53 and RB1 were mutated at a much higher frequency in Asian Americans than in EAs (TP53: 43% vs. 21%; RB1: 19% vs. 2%). Three putative oncogenic genes, including TRPM3, SAGE1, and ADAMTS7, were mutated exclusively in Asians. In addition, VEGF binding pathway, a druggable target by tyrosine kinase inhibitors such as sorafenib, was mutated at a higher frequency among Asians (13% vs. 2%); while the negative regulation of IL17 production, involved in inflammation and autoimmunity, was mutated only in EAs (12% vs. 0). Accounting for HCC risk factors had little impact on any of the mutational differences. In conclusion, we demonstrated here mutational differences in important cancer genes and pathways between Asian and European ancestries. These differences may have implications for the prevention and treatment of HCC. PMID:27246981

  20. Differences in somatic mutation landscape of hepatocellular carcinoma in Asian American and European American populations.

    PubMed

    Yao, Song; Johnson, Christopher; Hu, Qiang; Yan, Li; Liu, Biao; Ambrosone, Christine B; Wang, Jianmin; Liu, Song

    2016-06-28

    The incidence rate of hepatocellular carcinoma (HCC) is higher in populations of Asian ancestry than European ancestry (EA). We sought to investigate HCC mutational differences between the two populations, which may reflect differences in the prevalence of etiological factors. We compared HCC somatic mutations in patients of self-reported Asian American and EA from The Cancer Genome Atlas (TCGA), and assessed associations of tumor mutations with established HCC risk factors. Although the average mutation burden was similar, TP53 and RB1 were mutated at a much higher frequency in Asian Americans than in EAs (TP53: 43% vs. 21%; RB1: 19% vs. 2%). Three putative oncogenic genes, including TRPM3, SAGE1, and ADAMTS7, were mutated exclusively in Asians. In addition, VEGF binding pathway, a druggable target by tyrosine kinase inhibitors such as sorafenib, was mutated at a higher frequency among Asians (13% vs. 2%); while the negative regulation of IL17 production, involved in inflammation and autoimmunity, was mutated only in EAs (12% vs. 0). Accounting for HCC risk factors had little impact on any of the mutational differences. In conclusion, we demonstrated here mutational differences in important cancer genes and pathways between Asian and European ancestries. These differences may have implications for the prevention and treatment of HCC.

  1. Distinct Viral and Mutational Spectrum of Endemic Burkitt Lymphoma.

    PubMed

    Abate, Francesco; Ambrosio, Maria Raffaella; Mundo, Lucia; Laginestra, Maria Antonella; Fuligni, Fabio; Rossi, Maura; Zairis, Sakellarios; Gazaneo, Sara; De Falco, Giulia; Lazzi, Stefano; Bellan, Cristiana; Rocca, Bruno Jim; Amato, Teresa; Marasco, Elena; Etebari, Maryam; Ogwang, Martin; Calbi, Valeria; Ndede, Isaac; Patel, Kirtika; Chumba, David; Piccaluga, Pier Paolo; Pileri, Stefano; Leoncini, Lorenzo; Rabadan, Raul

    2015-10-01

    Endemic Burkitt lymphoma (eBL) is primarily found in children in equatorial regions and represents the first historical example of a virus-associated human malignancy. Although Epstein-Barr virus (EBV) infection and MYC translocations are hallmarks of the disease, it is unclear whether other factors may contribute to its development. We performed RNA-Seq on 20 eBL cases from Uganda and showed that the mutational and viral landscape of eBL is more complex than previously reported. First, we found the presence of other herpesviridae family members in 8 cases (40%), in particular human herpesvirus 5 and human herpesvirus 8 and confirmed their presence by immunohistochemistry in the adjacent non-neoplastic tissue. Second, we identified a distinct latency program in EBV involving lytic genes in association with TCF3 activity. Third, by comparing the eBL mutational landscape with published data on sporadic Burkitt lymphoma (sBL), we detected lower frequencies of mutations in MYC, ID3, TCF3 and TP53, and a higher frequency of mutation in ARID1A in eBL samples. Recurrent mutations in two genes not previously associated with eBL were identified in 20% of tumors: RHOA and cyclin F (CCNF). We also observed that polyviral samples showed lower numbers of somatic mutations in common altered genes in comparison to sBL specimens, suggesting dual mechanisms of transformation, mutation versus virus driven in sBL and eBL respectively.

  2. Multiple primary tumors of the upper aerodigestive tract: is there a role for constitutional mutations in the p53 gene?

    PubMed

    Gallo, O; Sardi, I; Pepe, G; Franchi, A; Attanasio, M; Giusti, B; Bocciolini, C; Abbate, R

    1999-07-19

    Head-and-neck cancer (HNC) patients have a high risk of developing second primary tumors of the upper aerodigestive tract, the main cause of death. Although the roles of tobacco and diet in multiple head-and-neck carcinogenesis have been thoroughly investigated, little is known about individual genetic susceptibility factors involved in this process. Genomic instability, reflecting the propensity and the susceptibility of the genome to acquire multiple alterations, could be considered a driving force behind multiple carcinogenesis. Mutation of the p53 tumor-suppressor gene has been proposed to play an important role in this process. Therefore, we evaluated the incidence of inherited p53 germ-line alteration(s) in a population of 24 consecutive HNC patients and their first-degree relatives affected by multiple malignancies as well as the occurrence of p53 somatic acquired mutation(s) in 16 cancers, including first and second primaries from 5 HNCs of the same group. Mutations in exons 4-11 of the p53 gene were investigated using SSCP-PCR analysis and DNA sequencing. Analysis was extended to the peripheral blood and cancer biopsies available from first-degree relatives of cancer-prone families with p53 germ-line mutations. p53 germ-line mutations were identified in the peripheral blood and corresponding cancers of 3 HNC patients who had multiple malignancies. The only missense mutation detected was mapped in exon 6; it is a GTG to GAG substitution with an amino acid change from Val to Glu at codon 197. The remaining 2 p53 germ-line mutations were single-nucleotide substitutions without amino acid change in exon 6 (codon 213, CGA to CGG) and in exon 8 (codon 295, CCT to CCC), respectively. These mutations were found in HNC patients with a family history of cancer. Abnormal expression of wild-type p53 protein in normal and pathological tissues from patients with the same sense single-nucleotide substitutions was detected by immuno-histochemistry.

  3. Somatic Mutation Patterns in Hemizygous Genomic Regions Unveil Purifying Selection during Tumor Evolution

    PubMed Central

    Basu, Swaraj; Larsson, Erik

    2016-01-01

    Identification of cancer driver genes using somatic mutation patterns indicative of positive selection has become a major goal in cancer genomics. However, cancer cells additionally depend on a large number of genes involved in basic cellular processes. While such genes should in theory be subject to strong purifying (negative) selection against damaging somatic mutations, these patterns have been elusive and purifying selection remains inadequately explored in cancer. Here, we hypothesized that purifying selection should be evident in hemizygous genomic regions, where damaging mutations cannot be compensated for by healthy alleles. Using a 7,781-sample pan-cancer dataset, we first confirmed this in POLR2A, an essential gene where hemizygous deletions are known to confer elevated sensitivity to pharmacological suppression. We next used this principle to identify several genes and pathways that show patterns indicative of purifying selection to avoid deleterious mutations. These include the POLR2A interacting protein INTS10 as well as genes involved in mRNA splicing, nonsense-mediated mRNA decay and other RNA processing pathways. Many of these genes belong to large protein complexes, and strong overlaps were observed with recent functional screens for gene essentiality in human cells. Our analysis supports that purifying selection acts to preserve the remaining function of many hemizygously deleted essential genes in tumors, indicating vulnerabilities that might be exploited by future therapeutic strategies. PMID:28027311

  4. Identification of somatic mutations in non-small cell lung carcinomas using whole-exome sequencing

    PubMed Central

    Liu, Pengyuan; Morrison, Carl; Wang, Liang; Xiong, Donghai; Vedell, Peter; Cui, Peng; Hua, Xing; Ding, Feng; Lu, Yan; James, Michael; Ebben, John D.; Xu, Haiming; Adjei, Alex A.; Head, Karen; Andrae, Jaime W.; Tschannen, Michael R.; Jacob, Howard; Pan, Jing; Zhang, Qi; Van den Bergh, Francoise; Xiao, Haijie; Lo, Ken C.; Patel, Jigar; Richmond, Todd; Watt, Mary-Anne; Albert, Thomas; Selzer, Rebecca; Anderson, Marshall; Wang, Jiang; Wang, Yian; Starnes, Sandra; Yang, Ping; You, Ming

    2012-01-01

    Lung cancer is the leading cause of cancer-related death, with non-small cell lung cancer (NSCLC) being the predominant form of the disease. Most lung cancer is caused by the accumulation of genomic alterations due to tobacco exposure. To uncover its mutational landscape, we performed whole-exome sequencing in 31 NSCLCs and their matched normal tissue samples. We identified both common and unique mutation spectra and pathway activation in lung adenocarcinomas and squamous cell carcinomas, two major histologies in NSCLC. In addition to identifying previously known lung cancer genes (TP53, KRAS, EGFR, CDKN2A and RB1), the analysis revealed many genes not previously implicated in this malignancy. Notably, a novel gene CSMD3 was identified as the second most frequently mutated gene (next to TP53) in lung cancer. We further demonstrated that loss of CSMD3 results in increased proliferation of airway epithelial cells. The study provides unprecedented insights into mutational processes, cellular pathways and gene networks associated with lung cancer. Of potential immediate clinical relevance, several highly mutated genes identified in our study are promising druggable targets in cancer therapy including ALK, CTNNA3, DCC, MLL3, PCDHIIX, PIK3C2B, PIK3CG and ROCK2. PMID:22510280

  5. MEN1 mutations and potentially MEN1-targeting miRNAs are responsible for menin deficiency in sporadic and MEN1 syndrome-associated primary hyperparathyroidism.

    PubMed

    Grolmusz, Vince Kornél; Borka, Katalin; Kövesdi, Annamária; Németh, Kinga; Balogh, Katalin; Dékány, Csaba; Kiss, András; Szentpéteri, Anna; Sármán, Beatrix; Somogyi, Anikó; Csajbók, Éva; Valkusz, Zsuzsanna; Tóth, Miklós; Igaz, Péter; Rácz, Károly; Patócs, Attila

    2017-09-01

    Inherited, germline mutations of menin-coding MEN1 gene cause multiple endocrine neoplasia type 1 (MEN1), while somatic MEN1 mutations are the sole main driver mutations in sporadic primary hyperparathyroidism (PHPT), suggesting that menin deficiency has a central role in the pathogenesis of PHPT. MiRNAs are small, noncoding RNAs posttranscriptionally regulating gene expression. Our aim was to investigate both the role of MEN1 mutations and potentially MEN1-targeting miRNAs as the underlying cause of menin deficiency in MEN1-associated and sporadic PHPT tissues. Fifty six PHPT tissues, including 16 MEN1-associated tissues, were evaluated. Diagnosis of MEN1 syndrome was based on identification of germline MEN1 mutations. In silico target prediction was used to identify miRNAs potentially targeting MEN1. Menin expression was determined by immunohistochemistry while expression of miRNAs was analyzed by quantitative real-time PCR. Sporadic PHPT tissues were subjected to somatic MEN1 mutation analysis as well. Lack of nuclear menin was identified in all MEN1-associated and in 28% of sporadic PHPT tissues. Somatic MEN1 mutations were found in 25% of sporadic PHPTs. The sensitivity and specificity of menin immunohistochemistry to detect a MEN1 mutation were 86 and 87%, respectively. Expression levels of hsa-miR-24 and hsa-miR-28 were higher in sporadic compared to MEN1-associated PHPT tissues; however, no difference in miRNA levels occurred between menin-positive and menin-negative PHPT tissues. Menin deficiency is the consequence of a MEN1 mutation in most menin-negative PHPT tissues. Elevated expression of hsa-miR-24 and hsa-miR-28 mark the first epigenetic changes observed between sporadic and MEN1-associated PHPT.

  6. Germline and somatic JAK2 mutations and susceptibility to chronic myeloproliferative neoplasms

    PubMed Central

    2009-01-01

    Myeloproliferative neoplasms (MPNs) are a group of closely related stem-cell-derived clonal proliferative diseases. Most cases are sporadic but first-degree relatives of MPN patients have a five- to seven-fold increased risk for developing an MPN. The tumors of most patients carry a mutation in the Janus kinase 2 gene (JAK2V617F). Recently, three groups have described a strong association of JAK2 germline polymorphisms with MPN in patients positive for JAK2V617F. The somatic mutation occurs primarily on one particular germline JAK2 haplotype, which may account for as much as 50% of the risk to first-degree relatives. This finding provides new directions for unraveling the pathogenesis of MPN. PMID:19490586

  7. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Alexandrov, L. B.

    All cancers originate from a single cell that starts to behave abnormally, to divide uncontrollably, and, eventually, to invade adjacent tissues (1). The aberrant behavior of this single cell is due to somatic mutations—changes in the genomic DNA produced by the activity of different mutational processes (1). These various mutational processes include exposure to exogenous or endogenous mutagens, abnormal DNA editing, the incomplete fidelity of DNA polymerases, and failure of DNA repair mechanisms (2). Early studies that sequenced TP53, the most commonly mutated gene in human cancer, provided evidence that mutational processes leave distinct imprints of somatic mutations on themore » genome of a cancer cell (3). For example, C:G>A:T transversions predominate in smoking-associated lung cancer, whereas C:G>T:A transitions occurring mainly at dipyrimidines and CC:GG>TT:AA double-nucleotide substitutions are common in ultraviolet light–associated skin cancers. Moreover, these patterns of mutations matched the ones induced experimentally by tobacco mutagens and ultraviolet light, respectively, the major, known, exogenous carcinogenic influences in these cancer types, and demonstrated that examining patterns of mutations in cancer genomes can yield information about the mutational processes that cause human cancer (4).« less

  8. Unregulated smooth-muscle myosin in human intestinal neoplasia.

    PubMed

    Alhopuro, Pia; Phichith, Denis; Tuupanen, Sari; Sammalkorpi, Heli; Nybondas, Miranda; Saharinen, Juha; Robinson, James P; Yang, Zhaohui; Chen, Li-Qiong; Orntoft, Torben; Mecklin, Jukka-Pekka; Järvinen, Heikki; Eng, Charis; Moeslein, Gabriela; Shibata, Darryl; Houlston, Richard S; Lucassen, Anneke; Tomlinson, Ian P M; Launonen, Virpi; Ristimäki, Ari; Arango, Diego; Karhu, Auli; Sweeney, H Lee; Aaltonen, Lauri A

    2008-04-08

    A recent study described a recessive ATPase activating germ-line mutation in smooth-muscle myosin (smmhc/myh11) underlying the zebrafish meltdown (mlt) phenotype. The mlt zebrafish develops intestinal abnormalities reminiscent of human Peutz-Jeghers syndrome (PJS) and juvenile polyposis (JP). To examine the role of MYH11 in human intestinal neoplasia, we searched for MYH11 mutations in patients with colorectal cancer (CRC), PJS and JP. We found somatic protein-elongating frameshift mutations in 55% of CRCs displaying microsatellite instability and in the germ-line of one individual with PJS. Additionally, two somatic missense mutations were found in one microsatellite stable CRC. These two missense mutations, R501L and K1044N, and the frameshift mutations were functionally evaluated. All mutations resulted in unregulated molecules displaying constitutive motor activity, similar to the mutant myosin underlying mlt. Thus, MYH11 mutations appear to contribute also to human intestinal neoplasia. Unregulated MYH11 may affect the cellular energy balance or disturb cell lineage decisions in tumor progenitor cells. These data challenge our view on MYH11 as a passive differentiation marker functioning in muscle contraction and add to our understanding of intestinal neoplasia.

  9. Understanding the origins of human cancer

    DOE PAGES

    Alexandrov, L. B.

    2015-12-04

    All cancers originate from a single cell that starts to behave abnormally, to divide uncontrollably, and, eventually, to invade adjacent tissues (1). The aberrant behavior of this single cell is due to somatic mutations—changes in the genomic DNA produced by the activity of different mutational processes (1). These various mutational processes include exposure to exogenous or endogenous mutagens, abnormal DNA editing, the incomplete fidelity of DNA polymerases, and failure of DNA repair mechanisms (2). Early studies that sequenced TP53, the most commonly mutated gene in human cancer, provided evidence that mutational processes leave distinct imprints of somatic mutations on themore » genome of a cancer cell (3). For example, C:G>A:T transversions predominate in smoking-associated lung cancer, whereas C:G>T:A transitions occurring mainly at dipyrimidines and CC:GG>TT:AA double-nucleotide substitutions are common in ultraviolet light–associated skin cancers. Moreover, these patterns of mutations matched the ones induced experimentally by tobacco mutagens and ultraviolet light, respectively, the major, known, exogenous carcinogenic influences in these cancer types, and demonstrated that examining patterns of mutations in cancer genomes can yield information about the mutational processes that cause human cancer (4).« less

  10. Stem cell fusion as an ultimate line of defense against xenobiotics.

    PubMed

    Padron Velazquez, Julio Lazaro

    2006-01-01

    There are several indications that the potential of stem cells to fuse with somatic cells is extremely high and, what's more exciting, in some instances goes as far as reprogramming and/or rescuing altered cells. It remains unclear, however, how frequent this mechanism is and what patho-physiological role it might play in nature. A plausible hypothesis, discussed in this paper, suggests that stem cell niches might provide a safeguard for the intact genome and epigenome. By fusing with somatic de-differentiated cells, stem cells might consent epigenetic reprogramming and/or genetic recovery of genes which otherwise could drive altered cells to malignancy. If the many sophisticated mechanisms of metabolism, cell repair, programmed cell death and tissue regeneration should fail, stem cells might represent a final attempt to recover dedifferentiated cells to avoid inflowing in cancer. In the current reappraisal of the different mechanisms of defense against xenobiotics, even the incidence of cancer itself is considered an evolving mechanism which, through a kind of programmed death of individuals exhibiting defective mutations, favors advancement of the phenotypes which adapt best. Additionally, with regard to the mechanisms of transmitting somatic mutations, based on stem cells' capacity to migrate and to fuse, here it is speculated that stem cells might be capable of carrying acquired somatic mutations from peripheral tissues to the gonads, and transmit that information into the germinal line. If appropriately demonstrated, these mechanisms might delineate a novel therapeutic area to be explored. The use of stem cells to reprogram/recover irreversibly damaged cells or to transmit beneficial mutations might be a valuable therapeutic approach in the future.

  11. Comprehensive molecular profiling of 718 Multiple Myelomas reveals significant differences in mutation frequencies between African and European descent cases

    PubMed Central

    Christofferson, Austin; Aldrich, Jessica; Jewell, Scott; Kittles, Rick A.; Derome, Mary; Craig, David Wesley; Carpten, John D.

    2017-01-01

    Multiple Myeloma (MM) is a plasma cell malignancy with significantly greater incidence and mortality rates among African Americans (AA) compared to Caucasians (CA). The overall goal of this study is to elucidate differences in molecular alterations in MM as a function of self-reported race and genetic ancestry. Our study utilized somatic whole exome, RNA-sequencing, and correlated clinical data from 718 MM patients from the Multiple Myeloma Research Foundation CoMMpass study Interim Analysis 9. Somatic mutational analyses based upon self-reported race corrected for ancestry revealed significant differences in mutation frequency between groups. Of interest, BCL7A, BRWD3, and AUTS2 demonstrate significantly higher mutation frequencies among AA cases. These genes are all involved in translocations in B-cell malignancies. Moreover, we detected a significant difference in mutation frequency of TP53 and IRF4 with frequencies higher among CA cases. Our study provides rationale for interrogating diverse tumor cohorts to best understand tumor genomics across populations. PMID:29166413

  12. Germline MC1R status influences somatic mutation burden in melanoma.

    PubMed

    Robles-Espinoza, Carla Daniela; Roberts, Nicola D; Chen, Shuyang; Leacy, Finbarr P; Alexandrov, Ludmil B; Pornputtapong, Natapol; Halaban, Ruth; Krauthammer, Michael; Cui, Rutao; Timothy Bishop, D; Adams, David J

    2016-07-12

    The major genetic determinants of cutaneous melanoma risk in the general population are disruptive variants (R alleles) in the melanocortin 1 receptor (MC1R) gene. These alleles are also linked to red hair, freckling, and sun sensitivity, all of which are known melanoma phenotypic risk factors. Here we report that in melanomas and for somatic C>T mutations, a signature linked to sun exposure, the expected single-nucleotide variant count associated with the presence of an R allele is estimated to be 42% (95% CI, 15-76%) higher than that among persons without an R allele. This figure is comparable to the expected mutational burden associated with an additional 21 years of age. We also find significant and similar enrichment of non-C>T mutation classes supporting a role for additional mutagenic processes in melanoma development in individuals carrying R alleles.

  13. Noncoding somatic and inherited single-nucleotide variants converge to promote ESR1 expression in breast cancer

    PubMed Central

    Bailey, Swneke D.; Desai, Kinjal; Kron, Ken J.; Mazrooei, Parisa; Sinnott-Armstrong, Nicholas A.; Treloar, Aislinn E.; Dowar, Mark; Thu, Kelsie L.; Cescon, David W.; Silvester, Jennifer; Yang, S. Y. Cindy; Wu, Xue; Pezo, Rossanna C.; Haibe-Kains, Benjamin; Mak, Tak W.; Bedard, Philippe L.; Pugh, Trevor J.; Sallari, Richard C.; Lupien, Mathieu

    2016-01-01

    Sustained expression of the oestrogen receptor alpha (ESR1) drives two-thirds of breast cancer and defines the ESR1-positive subtype. ESR1 engages enhancers upon oestrogen stimulation to establish an oncogenic expression program1. Somatic copy number alterations involving the ESR1 gene occur in approximately 1% of ESR1-positive breast cancers2–5, implying that other mechanisms underlie the persistent expression of ESR1. We report the significant enrichment of somatic mutations within the set of regulatory elements (SRE) regulating ESR1 in 7% of ESR1-positive breast cancers. These mutations regulate ESR1 expression by modulating transcription factor binding to the DNA. The SRE includes a recurrently mutated enhancer whose activity is also affected by a functional inherited single nucleotide variant (SNV) rs9383590 that accounts for several breast cancer risk-loci. Our work highlights the importance of considering the combinatorial activity of regulatory elements as a single unit to delineate the impact of noncoding genetic alterations on single genes in cancer. PMID:27571262

  14. Analysis of the IgV(H) somatic mutations in splenic marginal zone lymphoma defines a group of unmutated cases with frequent 7q deletion and adverse clinical course.

    PubMed

    Algara, Patricia; Mateo, Marisol S; Sanchez-Beato, Margarita; Mollejo, Manuela; Navas, Immaculada C; Romero, Lourdes; Solé, Francesc; Salido, Marta; Florensa, Lourdes; Martínez, Pedro; Campo, Elias; Piris, Miguel A

    2002-02-15

    This study aimed to correlate the frequency of somatic mutations in the IgV(H) gene and the use of specific segments in the V(H) repertoire with the clinical and characteristic features of a series of 35 cases of splenic marginal zone lymphoma (SMZL). The cases were studied by seminested polymerase chain reaction by using primers from the FR1 and J(H) region. The results showed unexpected molecular heterogeneity in this entity, with 49% unmutated cases (less than 2% somatic mutations). The 7q31 deletions and a shorter overall survival were more frequent in this group. Additionally a high percentage (18 of 40 sequences) of SMZL cases showed usage of the V(H)1-2 segment, thereby emphasizing the singularity of this neoplasia, suggesting that this tumor derives from a highly selected B-cell population and encouraging the search for specific antigens that are pathogenically relevant in the genesis or progression of this tumor.

  15. Sepsis Patients with First and Second-Hit Infections Show Different Outcomes Depending on the Causative Organism

    PubMed Central

    Morgan, Matt P.; Szakmany, Tamas; Power, Sarah G.; Olaniyi, Patrick; Hall, Judith E.; Rowan, Kathy; Eberl, Matthias

    2016-01-01

    Objective: With improving rates of initial survival in severe sepsis, second-hit infections that occur following resolution of the primary insult carry an increasing burden of morbidity. However, despite the clinical relevance of these infections, no data are available on differential outcomes in patients with first and second-hit infections depending on the nature of the causative organism. This study aims to explore any differences in these subgroups. Design: In a retrospective, observational cohort study, the United Kingdom Intensive Care National Audit & Research Centre (ICNARC) database was used to explore the outcomes of patient with first-hit infections leading to sepsis, and sepsis patients with second-hit infections grouped according to the Gram status of the causative organism. Setting: General critical care units in England, Wales, and Northern Ireland participating in the ICNARC programme between 1 January, 2007 and 30 June, 2012. Patients: Patient groups analyzed included 2119 patients with and 1319 patients without sepsis who developed an intensive care unit acquired infection in blood. Subgroups included patients with trauma, emergency neurosurgery, elective surgery, and cardiogenic shock. Measurements and main results: Gram-negative organisms were associated with poorer outcomes in first-hit infections. The 90-day mortality of patients who developed a Gram-negative infection was 43.6% following elective surgery and 27.9% following trauma. This compared with a mortality of 25.6 and 20.6%, respectively, in Gram-positive infections. Unexpectedly, an inverse relationship between Gram status and mortality was observed in second-hit infections. Patients with an initial diagnosis of sepsis who developed secondary infections caused by Gram-negative organisms had a 90-day mortality of 40.4%, compared with 43.6% in Gram-positive infections. Conclusions: Our study identifies a fundamental difference in patient outcomes between first-hit and second-hit bacterial infections, which may be due to genetic, microbiological, immunological, and environmental factors. This finding has direct implications for risk stratification and defines future research priorities. PMID:26955367

  16. Sepsis Patients with First and Second-Hit Infections Show Different Outcomes Depending on the Causative Organism.

    PubMed

    Morgan, Matt P; Szakmany, Tamas; Power, Sarah G; Olaniyi, Patrick; Hall, Judith E; Rowan, Kathy; Eberl, Matthias

    2016-01-01

    With improving rates of initial survival in severe sepsis, second-hit infections that occur following resolution of the primary insult carry an increasing burden of morbidity. However, despite the clinical relevance of these infections, no data are available on differential outcomes in patients with first and second-hit infections depending on the nature of the causative organism. This study aims to explore any differences in these subgroups. In a retrospective, observational cohort study, the United Kingdom Intensive Care National Audit & Research Centre (ICNARC) database was used to explore the outcomes of patient with first-hit infections leading to sepsis, and sepsis patients with second-hit infections grouped according to the Gram status of the causative organism. General critical care units in England, Wales, and Northern Ireland participating in the ICNARC programme between 1 January, 2007 and 30 June, 2012. Patient groups analyzed included 2119 patients with and 1319 patients without sepsis who developed an intensive care unit acquired infection in blood. Subgroups included patients with trauma, emergency neurosurgery, elective surgery, and cardiogenic shock. Gram-negative organisms were associated with poorer outcomes in first-hit infections. The 90-day mortality of patients who developed a Gram-negative infection was 43.6% following elective surgery and 27.9% following trauma. This compared with a mortality of 25.6 and 20.6%, respectively, in Gram-positive infections. Unexpectedly, an inverse relationship between Gram status and mortality was observed in second-hit infections. PATIENTS with an initial diagnosis of sepsis who developed secondary infections caused by Gram-negative organisms had a 90-day mortality of 40.4%, compared with 43.6% in Gram-positive infections. Our study identifies a fundamental difference in patient outcomes between first-hit and second-hit bacterial infections, which may be due to genetic, microbiological, immunological, and environmental factors. This finding has direct implications for risk stratification and defines future research priorities.

  17. Mitochondrial DNA sequence variation in human evolution and disease.

    PubMed

    Wallace, D C

    1994-09-13

    Germ-line and somatic mtDNA mutations are hypothesized to act together to shape our history and our health. Germ-line mtDNA mutations, both ancient and recent, have been associated with a variety of degenerative diseases. Mildly to moderately deleterious germ-line mutations, like neutral polymorphisms, have become established in the distant past through genetic drift but now may predispose certain individuals to late-onset degenerative diseases. As an example, a homoplasmic, Caucasian, tRNA(Gln) mutation at nucleotide pair (np) 4336 has been observed in 5% of Alzheimer disease and Parkinson disease patients and may contribute to the multifactorial etiology of these diseases. Moderately to severely deleterious germ-line mutations, on the other hand, appear repeatedly but are eliminated by selection. Hence, all extant mutations of this class are recent and associated with more devastating diseases of young adults and children. Representative of these mutations is a heteroplasmic mutation in MTND6 at np 14459 whose clinical presentations range from adult-onset blindness to pediatric dystonia and basal ganglial degeneration. To the inherited mutations are added somatic mtDNA mutations which accumulate in random arrays within stable tissues. These mutations provide a molecular clock that measures our age and may cause a progressive decline in tissue energy output that could precipitate the onset of degenerative diseases in individuals harboring inherited deleterious mutations.

  18. Global Gene Expression Patterns and Somatic Mutations in Sporadic Intracranial Aneurysms.

    PubMed

    Li, Zhili; Tan, Haibin; Shi, Yi; Huang, Guangfu; Wang, Zhenyu; Liu, Ling; Yin, Cheng; Wang, Qi

    2017-04-01

    High-throughput sequencing technologies can expand our understanding of the pathologic basis of intracranial aneurysms (IAs). Our study was aimed to decipher the gene expression signature and genetic factors associated with IAs. We determined the gene expression levels of 3 cases of IAs by RNA sequencing. Bioinformatics analysis was conducted to identify the differentially expressed genes (DEGs) and uncover their biological function. In addition, whole genome sequencing was performed on an additional 6 cases of IAs to detect the potential somatic alterations in DEGs. Compared with the normal arterial tissue, 1709 genes were differentially expressed in IAs arterial tissue. The most significantly up-regulated gene and down-regulated gene, H19 and HIST1H3J, may be essential for tumorigenesis of IAs. Hub protein of IKBKG in protein-protein interaction network was probably involved in the inflammation process in aneurysms. Another 2 hub proteins, ACTB and MKI67IP, as well as up-regulated genes, might be abnormally activated in aneurysms and involved in the pathogenesis of IAs. Further whole genome sequencing and filtering yielded 4 candidate somatic single nucleotide variants including MUC3B, and BLM may be involved in the pathogenesis of IAs. Even though, our results do not support the hypothesis of somatic mutations occurred in the DEGs. Two-dimensional genomic data from transcriptome and whole genome sequencing indicated that no somatic mutations occurred in DEGs. In addition, 3 DEGs (IKBKG, ACTB, and MKI67IP) and 2 mutant genes (MUC3B and BLM) were essential in IAs. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Mixed adenoneuroendocrine carcinoma of the colon: molecular pathogenesis and treatment.

    PubMed

    Vanacker, Leen; Smeets, Dominiek; Hoorens, Anne; Teugels, Erik; Algaba, Roberto; Dehou, Marie Françoise; De Becker, Ann; Lambrechts, Diether; De Greve, Jacques

    2014-10-01

    We report a case of a mixed adenoneuroendocrine carcinoma developed in a colorectal adenocarcinoma with lymph node and liver metastases exclusively emanating from the neuroendocrine carcinoma component. The patient underwent right hemicolectomy and postoperatively received chemotherapy with cisplatin and etoposide and subsequent high-dose induction chemotherapy, followed by autologous stem cell transplantation. Following this treatment, there was a complete remission. Currently, thirty months after treatment, the patient is in unmaintained complete remission. Comparative exome sequencing of germline DNA and DNA from the two separate malignant components revealed six somatic changes in cancer consensus genes. Both components shared somatic mutations in Adenomatous polyposis coli (APC), Kirsten rat sarcoma viral oncogene homolog (KRAS), B-cell CLL/lymphoma 9 (BCL9) and Forkhead Box P1 (FOXP1) genes. Mutation in SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4 (SMARCA4) was only found in the neuroendocrine carcinoma component. The finding of several identical somatic mutations in both components supports a clonal relationship between the neuroendocrine carcinoma and the adenocarcinoma. We suggest that a mutation in SMARCA4 could be responsible for the transformation of the adenocarcinoma component into the neuroendocrine phenotype. Copyright© 2014 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  20. Cutaneous skeletal hypophosphatemia syndrome (CSHS) is a multilineage somatic mosaic RASopathy.

    PubMed

    Lim, Young H; Ovejero, Diana; Derrick, Kristina M; Collins, Michael T; Choate, Keith A

    2016-08-01

    We recently demonstrated multilineage somatic mosaicism in cutaneous skeletal hypophosphatemia syndrome (CSHS), which features epidermal or melanocytic nevi, elevated fibroblast growth factor (FGF)-23, and hypophosphatemia, finding identical RAS mutations in affected skin and bone. We sought to: (1) provide an updated overview of CSHS; (2) review its pathobiology; (3) present a new patient with CSHS; and (4) discuss treatment modalities. We searched PubMed for "nevus AND rickets," and "nevus AND hypophosphatemia," identifying cases of nevi with hypophosphatemic rickets or elevated serum FGF-23. For our additional patient with CSHS, we performed histopathologic and radiographic surveys of skin and skeletal lesions, respectively. Sequencing was performed for HRAS, KRAS, and NRAS to determine causative mutations. Our new case harbored somatic activating HRAS p.G13 R mutation in affected tissue, consistent with previous findings. Although the mechanism of FGF-23 dysregulation is unknown in CSHS, interaction between FGF and MAPK pathways may provide insight into pathobiology. Anti-FGF-23 antibody KRN-23 may be useful in managing CSHS. Multilineage RAS mutation in CSHS was recently identified; further studies on mechanism are unavailable. Patients with nevi in association with skeletal disease should be evaluated for serum phosphate and FGF-23. Further studies investigating the role of RAS in FGF-23 regulation are needed. Published by Elsevier Inc.

  1. Mice deficient in carbonic anhydrase type 8 exhibit motor dysfunctions and abnormal calcium dynamics in the somatic region of cerebellar granule cells.

    PubMed

    Lamont, Matthew G; Weber, John T

    2015-06-01

    The waddles (wdl) mouse is characterized by a namesake "side-to-side" waddling gait due to a homozygous mutation of the Car8 gene. This mutation results in non-functional copies of the protein carbonic anhydrase type 8. Rota-rod testing was conducted to characterize the wdl mutations' effect on motor output. Results indicated that younger homozygotes outperformed their older cohorts, an effect not seen in previous studies. Heterozygotes, which were thought to be free of motor impairment, displayed motor learning deficiencies when compared with wild type performance. Acute cerebellar slices were then utilized for fluorescent calcium imaging experiments, which revealed significant alterations in cerebellar granule cell somatic calcium signaling when exposed to glutamate. The contribution of GABAergic signaling to these alterations was also verified using bath application of bicuculline. Changes in somatic calcium signals were found to be applicable to an in vivo scenario by comparing group responses to electrical stimulation of afferent mossy fiber projections. Finally, intracellular calcium store function was also found to be altered by the wdl mutation when slices were treated with thapsigargin. These findings, taken together with previous work on the wdl mouse, indicate a widespread disruption in cerebellar circuitry hampering proper neuronal communication. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. Molecular therapy for acute myeloid leukaemia

    PubMed Central

    Coombs, Catherine C.; Tallman, Martin S.; Levine, Ross L.

    2017-01-01

    Acute myeloid leukaemia (AML) is a heterogeneous disease that is, in general, associated with a very poor prognosis. Multiple cytogenetic and molecular abnormalities that characterize different forms of AML have been used to better prognosticate patients and inform treatment decisions. Indeed, risk status in patients with this disease has classically been based on cytogenetic findings; however, additional molecular characteristics have been shown to inform risk assessment, including FLT3, NPM1, KIT, and CEBPA mutation status. Advances in sequencing technology have led to the discovery of novel somatic mutations in tissue samples from patients with AML, providing deeper insight into the mutational landscape of the disease. The majority of patients with AML (>97%) are found to have a clonal somatic abnormality on mutational profiling. Nevertheless, our understanding of the utility of mutation profiling in clinical practice remains incomplete and is continually evolving, and evidence-based approaches to application of these data are needed. In this Review, we discuss the evidence-base for integrating mutational data into treatment decisions for patients with AML, and propose novel therapeutic algorithms in the era of molecular medicine. PMID:26620272

  3. Endometrial cancer and somatic G>T KRAS transversion in patients with constitutional MUTYH biallelic mutations.

    PubMed

    Tricarico, Rossella; Bet, Paola; Ciambotti, Benedetta; Di Gregorio, Carmela; Gatteschi, Beatrice; Gismondi, Viviana; Toschi, Benedetta; Tonelli, Francesco; Varesco, Liliana; Genuardi, Maurizio

    2009-02-18

    MUTYH-associated polyposis (MAP) is an autosomal recessive condition predisposing to colorectal cancer, caused by constitutional biallelic mutations in the base excision repair (BER) gene MUTYH. Colorectal tumours from MAP patients display an excess of somatic G>T mutations in the APC and KRAS genes due to defective BER function. To date, few extracolonic manifestations have been observed in MAP patients, and the clinical spectrum of this condition is not yet fully established. Recently, one patient with a diagnosis of endometrial cancer and biallelic MUTYH mutations has been described. We here report on two additional unrelated MAP patients with biallelic MUTYH germline mutations who developed endometrioid endometrial carcinoma. The endometrial tumours were evaluated for PTEN, PIK3CA, KRAS, BRAF and CTNNB1 mutations. A G>T transversion at codon 12 of the KRAS gene was observed in one tumour. A single 1bp frameshift deletion of PTEN was observed in the same sample. Overall, these findings suggest that endometrial carcinoma is a phenotypic manifestations of MAP and that inefficient repair of oxidative damage can be involved in its pathogenesis.

  4. PPM1D Mosaic Truncating Variants in Ovarian Cancer Cases May Be Treatment-Related Somatic Mutations

    PubMed Central

    Pharoah, Paul D. P.; Song, Honglin; Dicks, Ed; Intermaggio, Maria P.; Harrington, Patricia; Baynes, Caroline; Alsop, Kathryn; Bogdanova, Natalia; Cicek, Mine S.; Cunningham, Julie M.; Fridley, Brooke L.; Gentry-Maharaj, Aleksandra; Hillemanns, Peter; Lele, Shashi; Lester, Jenny; McGuire, Valerie; Moysich, Kirsten B.; Poblete, Samantha; Sieh, Weiva; Sucheston-Campbell, Lara; Widschwendter, Martin; Whittemore, Alice S.; Dörk, Thilo; Menon, Usha; Odunsi, Kunle; Goode, Ellen L.; Karlan, Beth Y.; Bowtell, David D.; Gayther, Simon A.; Ramus, Susan J.

    2016-01-01

    Mosaic truncating mutations in the protein phosphatase, Mg2+/Mn2+-dependent, 1D (PPM1D) gene have recently been reported with a statistically significantly greater frequency in lymphocyte DNA from ovarian cancer case patients compared with unaffected control patients. Using massively parallel sequencing (MPS) we identified truncating PPM1D mutations in 12 of 3236 epithelial ovarian cancer (EOC) case patients (0.37%) but in only one of 3431 unaffected control patients (0.03%) (P = .001). All statistical tests were two-sided. A combination of Sanger sequencing, pyrosequencing, and MPS data suggested that 12 of the 13 mutations were mosaic. All mutations were identified in post-chemotherapy treatment blood samples from case patients (n = 1827) (average 1234 days post-treatment in carriers) rather than from cases collected pretreatment (less than 14 days after diagnosis, n = 1384) (P = .002). These data suggest that PPM1D variants in EOC cases are primarily somatic mosaic mutations caused by treatment and are not associated with germline predisposition to EOC. PMID:26823519

  5. New mutation in the PTEN gene in a Brazilian patient with Cowden's syndrome.

    PubMed

    Lima, Erika U de; Soares, Iberê C; Danilovic, Debora L S; Marui, Suemi

    2012-11-01

    Cowden syndrome is characterized by hamartomatous polyps, trichilemmomas, increased risk of developing neoplasms, and is associated with germline mutations in the PTEN gene. We searched for germline mutations in PTEN in a 49-year-old female patient who presented trichilemmoma with previous history of breast carcinoma, and thyroidectomy for a thyroid nodule. We also searched for somatic mutations in breast and thyroid tumoral tissues. DNA was extracted from peripheral leukocytes, paraffin samples of breast carcinoma, and cytological smears of thyroid nodule fine-needle aspiration biopsy, whose final histopathological diagnosis was adenomatous goiter. PTEN was amplified and sequenced. We identified a novel mutation, due to a T>A inversion at position 159 and A>T inversion at position 160, leading to valine-to-aspartic acid substitution at position 53. The p.Val53Asp was also found in homozygous state in samples obtained from adenocarcinoma breast and thyroid biopsy, denoting loss of heterozygosity. Here, we demonstrated a novel germline mutation in PTEN, as well as somatic loss of the wild-type PTEN allele in breast and thyroid tumors in a patient with Cowden syndrome.

  6. Alpha-latrotoxin induces exocytosis by inhibition of voltage-dependent K+ channels and by stimulation of L-type Ca2+ channels via latrophilin in beta-cells.

    PubMed

    Lajus, Sophie; Vacher, Pierre; Huber, Denise; Dubois, Mathilde; Benassy, Marie-Noëlle; Ushkaryov, Yuri; Lang, Jochen

    2006-03-03

    The spider venom alpha-latrotoxin (alpha-LTX) induces massive exocytosis after binding to surface receptors, and its mechanism is not fully understood. We have investigated its action using toxin-sensitive MIN6 beta-cells, which express endogenously the alpha-LTX receptor latrophilin (LPH), and toxin-insensitive HIT-T15 beta-cells, which lack endogenous LPH. alpha-LTX evoked insulin exocytosis in HIT-T15 cells only upon expression of full-length LPH but not of LPH truncated after the first transmembrane domain (LPH-TD1). In HIT-T15 cells expressing full-length LPH and in native MIN6 cells, alpha-LTX first induced membrane depolarization by inhibition of repolarizing K(+) channels followed by the appearance of Ca(2+) transients. In a second phase, the toxin induced a large inward current and a prominent increase in intracellular calcium ([Ca(2+)](i)) reflecting pore formation. Upon expression of LPH-TD1 in HIT-T15 cells just this second phase was observed. Moreover, the mutated toxin LTX(N4C), which is devoid of pore formation, only evoked oscillations of membrane potential by reversible inhibition of iberiotoxin-sensitive K(+) channels via phospholipase C, activated L-type Ca(2+) channels independently from its effect on membrane potential, and induced an inositol 1,4,5-trisphosphate receptor-dependent release of intracellular calcium in MIN6 cells. The combined effects evoked transient increases in [Ca(2+)](i) in these cells, which were sensitive to inhibitors of phospholipase C, protein kinase C, or L-type Ca(2+) channels. The latter agents also reduced toxin-induced insulin exocytosis. In conclusion, alpha-LTX induces signaling distinct from pore formation via full-length LPH and phospholipase C to regulate physiologically important K(+) and Ca(2+) channels as novel targets of its secretory activity.

  7. Multiplex Droplet Digital PCR Quantification of Recurrent Somatic Mutations in Diffuse Large B-Cell and Follicular Lymphoma.

    PubMed

    Alcaide, Miguel; Yu, Stephen; Bushell, Kevin; Fornika, Daniel; Nielsen, Julie S; Nelson, Brad H; Mann, Koren K; Assouline, Sarit; Johnson, Nathalie A; Morin, Ryan D

    2016-09-01

    A plethora of options to detect mutations in tumor-derived DNA currently exist but each suffers limitations in analytical sensitivity, cost, or scalability. Droplet digital PCR (ddPCR) is an appealing technology for detecting the presence of specific mutations based on a priori knowledge and can be applied to tumor biopsies, including formalin-fixed paraffin embedded (FFPE) tissues. More recently, ddPCR has gained popularity in its utility in quantifying circulating tumor DNA. We have developed a suite of novel ddPCR assays for detecting recurrent mutations that are prevalent in common B-cell non-Hodgkin lymphomas (NHLs), including diffuse large B-cell lymphoma, follicular lymphoma, and lymphoplasmacytic lymphoma. These assays allowed the differentiation and counting of mutant and wild-type molecules using one single hydrolysis probe. We also implemented multiplexing that allowed the simultaneous detection of distinct mutations and an "inverted" ddPCR assay design, based on employing probes matching wild-type alleles, capable of detecting the presence of multiple single nucleotide polymorphisms. The assays successfully detected and quantified somatic mutations commonly affecting enhancer of zeste 2 polycomb repressive complex 2 subunit (EZH2) (Y641) and signal transducer and activator of transcription 6 (STAT6) (D419) hotspots in fresh tumor, FFPE, and liquid biopsies. The "inverted" ddPCR approach effectively reported any single nucleotide variant affecting either of these 2 hotspots as well. Finally, we could effectively multiplex hydrolysis probes targeting 2 additional lymphoma-related hotspots: myeloid differentiation primary response 88 (MYD88; L265P) and cyclin D3 (CCND3; I290R). Our suite of ddPCR assays provides sufficient analytical sensitivity and specificity for either the invasive or noninvasive detection of multiple recurrent somatic mutations in B-cell NHLs. © 2016 American Association for Clinical Chemistry.

  8. First report of bilateral pheochromocytoma in the clinical spectrum of HIF2A-related polycythemia-paraganglioma syndrome.

    PubMed

    Taïeb, David; Yang, Chunzhang; Delenne, Blandine; Zhuang, Zhengping; Barlier, Anne; Sebag, Fréderic; Pacak, Karel

    2013-05-01

    Molecular genetic research has so far resulted in the identification of 10 well-characterized susceptibility genes for hereditary pheochromocytoma (PHEO) or paraganglioma (PGL). Recently, a new syndrome characterized by multiple PGLs and somatostatinomas associated with congenital polycythemia due to somatic mutations in HIF2A has been reported. The aim of the study was to define the genetic defect in a new case of bilateral PHEO and multiple PGLs associated with congenital polycythemia. A female patient presented with neonatal polycythemia (treated by phlebotomies, 1 session approximately every 4 mo), mildly enlarged cerebral ventricles, and bilateral PHEO and multiple PGLs. There was no family history of any neuroendocrine tumor or polycythemia. Surgical removal of the tumors only temporarily normalized plasma erythropoietin (Epo) levels and discontinued phlebotomies. No germline mutations were initially detected in the SDHB, SDHC, SDHD, VHL, and PHD2 genes, known to be associated with polycythemia. The PHEOs presented with a typical noradrenergic biochemical phenotype. A heterozygous missense mutation (c.1589C>T) was identified in exon 12 of HIF2A, resulting in an alanine 530 substitution in the HIF-2α protein with valine (A530V). This somatic mutation was detected in the tissue from 1 PHEO and 1 PGL, with no HIF2A germline mutation found. This mutation led to stabilization of HIF-2α and hence a gain-of-function phenotype, as in previously published studies. This case represents the first association of a somatic HIF2A gain-of-function mutation with PHEO and congenital polycythemia, and it alerts physicians to perform proper genetic screening in patients presenting with multiple norepinephrine-producing PHEOs and polycythemia. This report also extends the previous findings of a new syndrome of only multiple PGLs, somatostatinomas, and polycythemia to multiple PHEOs.

  9. A Somatic HIF2α Mutation-Induced Multiple and Recurrent Pheochromocytoma/Paraganglioma with Polycythemia: Clinical Study with Literature Review.

    PubMed

    Liu, Qiuli; Wang, Yan; Tong, Dali; Liu, Gaolei; Yuan, Wenqiang; Zhang, Jun; Ye, Jin; Zhang, Yao; Yuan, Gang; Feng, Qingxing; Zhang, Dianzheng; Jiang, Jun

    2017-03-01

    A syndrome known as pheochromocytomas (PCC)/paragangliomas (PGL) and polycythemia resulted from gain-of-function mutation of hypoxia-inducible factor 2α (HIF2α) has been reported recently. However, clinical features of this syndrome vary from patient to patient. In our study, we described the clinical features of the patient within 15-year follow-up with a literature review. The patient presented with "red face" since childhood and was diagnosed with polycythemia and pheochromocytoma in 2000, and then, tumor was removed at his age of 27 (year 2000). However, 13 years later (2013), he was diagnosed with multiple paragangliomas. Moreover, 2 years later (2015), another two paragangaliomas were also confirmed. Genetic analysis of hereditary PCC/PGL-related genes was conducted. A somatic heterozygous missense mutation of HIF2α (c.1589C>T) was identified at exon 12, which is responsible for the elevated levels of HIF2α and erythropoietin (EPO) and subsequent development of paragangaliomas. However, this mutation was only found in the tumors from three different areas, not in the blood. So far, 13 cases of PCC/PGL with polycythemia have been reported. Among them, somatic mutations of HIF2α at exon 12 are responsible for 12 cases, and only 1 case was caused by germline mutation of HIF2α at exon 9. The HIF2α mutation-induced polycythemia with PCC/PGL is a rare syndrome with no treatment for cure. Comprehensive therapies for this disease include removal of the tumors and intermittent phlebotomies; administration of medications to control blood pressure and to prevent complications or death resulted from high concentration of red blood cell (RBC). Genetic test is strongly recommended for patients with early onset of polycythemia and multiple/recurrent PCC/PGL.

  10. Somatic hypermutation of the new antigen receptor gene (NAR) in the nurse shark does not generate the repertoire: possible role in antigen-driven reactions in the absence of germinal centers.

    PubMed

    Diaz, M; Greenberg, A S; Flajnik, M F

    1998-11-24

    The new antigen receptor (NAR) gene in the nurse shark diversifies extensively by somatic hypermutation. It is not known, however, whether NAR somatic hypermutation generates the primary repertoire (like in the sheep) or rather is used in antigen-driven immune responses. To address this issue, the sequences of NAR transmembrane (Tm) and secretory (Sec) forms, presumed to represent the primary and secondary repertoires, respectively, were examined from the peripheral blood lymphocytes of three adult nurse sharks. More than 40% of the Sec clones but fewer than 11% of Tm clones contained five mutations or more. Furthermore, more than 75% of the Tm clones had few or no mutations. Mutations in the Sec clones occurred mostly in the complementarity-determining regions (CDR) with a significant bias toward replacement substitutions in CDR1; in Tm clones there was no significant bias toward replacements and only a low level of targeting to the CDRs. Unlike the Tm clones where the replacement mutational pattern was similar to that seen for synonymous changes, Sec replacements displayed a distinct pattern of mutations. The types of mutations in NAR were similar to those found in mouse Ig genes rather than to the unusual pattern reported for shark and Xenopus Ig. Finally, an oligoclonal family of Sec clones revealed a striking trend toward acquisition of glutamic/aspartic acid, suggesting some degree of selection. These data strongly suggest that hypermutation of NAR does not generate the repertoire, but instead is involved in antigen-driven immune responses.

  11. Correlation of somatic mutations and clinical outcome in melanoma patients treated with carboplatin, paclitaxel, and sorafenib

    PubMed Central

    Wilson, Melissa A.; Zhao, Fengmin; Letrero, Richard; D’Andrea, Kurt; Rimm, David L.; Kirkwood, John M.; Kluger, Harriet M.; Lee, Sandra J.; Schuchter, Lynn M.; Flaherty, Keith T.; Nathanson, Katherine L.

    2014-01-01

    Purpose Sorafenib is an inhibitor of VEGFR, PDGFR, and RAF kinases, amongst others. We assessed the association of somatic mutations with clinicopathologic features and clinical outcomes in patients with metastatic melanoma treated on E2603, comparing treatment with carboplatin, paclitaxel +/− sorafenib (CP vs. CPS). Experimental Design Pre-treatment tumor samples from 179 unique individuals enrolled on E2603 were analyzed. Genotyping was performed using a custom iPlex panel interrogating 74 mutations in 13 genes. Statistical analysis was performed using Fisher’s exact test, logistic regression, and Cox’s proportional-hazards models. Progression free survival and overall survival were estimated using Kaplan-Meier methods. Results BRAF and NRAS mutations were found at frequencies consistent with other metastatic melanoma cohorts. BRAF-mutant melanoma was associated with worse performance status, increased number of disease sites, and younger age at diagnosis; NRAS-mutant melanoma was associated with better performance status, fewer sites of disease, and female gender. BRAF and NRAS mutations were not significantly predictive of response or survival when treated with CPS vs. CP. However, patients with NRAS-mutant melanoma trended towards a worse response and PFS on CP than those with BRAF-mutant or WT/WT melanoma, an association that was reversed for this group on the CPS arm. Conclusions This study of somatic mutations in melanoma is the last prospectively collected phase III clinical trial population prior to the era of BRAF targeted therapy. A trend towards improved clinical response in patients with NRAS-mutant melanoma treated with CPS was observed, possibly due to sorafenib’s effect on CRAF. PMID:24714776

  12. Exome and deep sequencing of clinically aggressive neuroblastoma reveal somatic mutations that affect key pathways involved in cancer progression

    PubMed Central

    Lasorsa, Vito Alessandro; Formicola, Daniela; Pignataro, Piero; Cimmino, Flora; Calabrese, Francesco Maria; Mora, Jaume; Esposito, Maria Rosaria; Pantile, Marcella; Zanon, Carlo; De Mariano, Marilena; Longo, Luca; Hogarty, Michael D.; de Torres, Carmen; Tonini, Gian Paolo; Iolascon, Achille; Capasso, Mario

    2016-01-01

    The spectrum of somatic mutation of the most aggressive forms of neuroblastoma is not completely determined. We sought to identify potential cancer drivers in clinically aggressive neuroblastoma. Whole exome sequencing was conducted on 17 germline and tumor DNA samples from high-risk patients with adverse events within 36 months from diagnosis (HR-Event3) to identify somatic mutations and deep targeted sequencing of 134 genes selected from the initial screening in additional 48 germline and tumor pairs (62.5% HR-Event3 and high-risk patients), 17 HR-Event3 tumors and 17 human-derived neuroblastoma cell lines. We revealed 22 significantly mutated genes, many of which implicated in cancer progression. Fifteen genes (68.2%) were highly expressed in neuroblastoma supporting their involvement in the disease. CHD9, a cancer driver gene, was the most significantly altered (4.0% of cases) after ALK. Other genes (PTK2, NAV3, NAV1, FZD1 and ATRX), expressed in neuroblastoma and involved in cell invasion and migration were mutated at frequency ranged from 4% to 2%. Focal adhesion and regulation of actin cytoskeleton pathways, were frequently disrupted (14.1% of cases) thus suggesting potential novel therapeutic strategies to prevent disease progression. Notably BARD1, CHEK2 and AXIN2 were enriched in rare, potentially pathogenic, germline variants. In summary, whole exome and deep targeted sequencing identified novel cancer genes of clinically aggressive neuroblastoma. Our analyses show pathway-level implications of infrequently mutated genes in leading neuroblastoma progression. PMID:27009842

  13. Exome and deep sequencing of clinically aggressive neuroblastoma reveal somatic mutations that affect key pathways involved in cancer progression.

    PubMed

    Lasorsa, Vito Alessandro; Formicola, Daniela; Pignataro, Piero; Cimmino, Flora; Calabrese, Francesco Maria; Mora, Jaume; Esposito, Maria Rosaria; Pantile, Marcella; Zanon, Carlo; De Mariano, Marilena; Longo, Luca; Hogarty, Michael D; de Torres, Carmen; Tonini, Gian Paolo; Iolascon, Achille; Capasso, Mario

    2016-04-19

    The spectrum of somatic mutation of the most aggressive forms of neuroblastoma is not completely determined. We sought to identify potential cancer drivers in clinically aggressive neuroblastoma.Whole exome sequencing was conducted on 17 germline and tumor DNA samples from high-risk patients with adverse events within 36 months from diagnosis (HR-Event3) to identify somatic mutations and deep targeted sequencing of 134 genes selected from the initial screening in additional 48 germline and tumor pairs (62.5% HR-Event3 and high-risk patients), 17 HR-Event3 tumors and 17 human-derived neuroblastoma cell lines.We revealed 22 significantly mutated genes, many of which implicated in cancer progression. Fifteen genes (68.2%) were highly expressed in neuroblastoma supporting their involvement in the disease. CHD9, a cancer driver gene, was the most significantly altered (4.0% of cases) after ALK.Other genes (PTK2, NAV3, NAV1, FZD1 and ATRX), expressed in neuroblastoma and involved in cell invasion and migration were mutated at frequency ranged from 4% to 2%.Focal adhesion and regulation of actin cytoskeleton pathways, were frequently disrupted (14.1% of cases) thus suggesting potential novel therapeutic strategies to prevent disease progression.Notably BARD1, CHEK2 and AXIN2 were enriched in rare, potentially pathogenic, germline variants.In summary, whole exome and deep targeted sequencing identified novel cancer genes of clinically aggressive neuroblastoma. Our analyses show pathway-level implications of infrequently mutated genes in leading neuroblastoma progression.

  14. Impact of experimental design on PET radiomics in predicting somatic mutation status.

    PubMed

    Yip, Stephen S F; Parmar, Chintan; Kim, John; Huynh, Elizabeth; Mak, Raymond H; Aerts, Hugo J W L

    2017-12-01

    PET-based radiomic features have demonstrated great promises in predicting genetic data. However, various experimental parameters can influence the feature extraction pipeline, and hence, Here, we investigated how experimental settings affect the performance of radiomic features in predicting somatic mutation status in non-small cell lung cancer (NSCLC) patients. 348 NSCLC patients with somatic mutation testing and diagnostic PET images were included in our analysis. Radiomic feature extractions were analyzed for varying voxel sizes, filters and bin widths. 66 radiomic features were evaluated. The performance of features in predicting mutations status was assessed using the area under the receiver-operating-characteristic curve (AUC). The influence of experimental parameters on feature predictability was quantified as the relative difference between the minimum and maximum AUC (δ). The large majority of features (n=56, 85%) were significantly predictive for EGFR mutation status (AUC≥0.61). 29 radiomic features significantly predicted EGFR mutations and were robust to experimental settings with δ Overall <5%. The overall influence (δ Overall ) of the voxel size, filter and bin width for all features ranged from 5% to 15%, respectively. For all features, none of the experimental designs was predictive of KRAS+ from KRAS- (AUC≤0.56). The predictability of 29 radiomic features was robust to the choice of experimental settings; however, these settings need to be carefully chosen for all other features. The combined effect of the investigated processing methods could be substantial and must be considered. Optimized settings that will maximize the predictive performance of individual radiomic features should be investigated in the future. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. A Simple Model-Based Approach to Inferring and Visualizing Cancer Mutation Signatures

    PubMed Central

    Shiraishi, Yuichi; Tremmel, Georg; Miyano, Satoru; Stephens, Matthew

    2015-01-01

    Recent advances in sequencing technologies have enabled the production of massive amounts of data on somatic mutations from cancer genomes. These data have led to the detection of characteristic patterns of somatic mutations or “mutation signatures” at an unprecedented resolution, with the potential for new insights into the causes and mechanisms of tumorigenesis. Here we present new methods for modelling, identifying and visualizing such mutation signatures. Our methods greatly simplify mutation signature models compared with existing approaches, reducing the number of parameters by orders of magnitude even while increasing the contextual factors (e.g. the number of flanking bases) that are accounted for. This improves both sensitivity and robustness of inferred signatures. We also provide a new intuitive way to visualize the signatures, analogous to the use of sequence logos to visualize transcription factor binding sites. We illustrate our new method on somatic mutation data from urothelial carcinoma of the upper urinary tract, and a larger dataset from 30 diverse cancer types. The results illustrate several important features of our methods, including the ability of our new visualization tool to clearly highlight the key features of each signature, the improved robustness of signature inferences from small sample sizes, and more detailed inference of signature characteristics such as strand biases and sequence context effects at the base two positions 5′ to the mutated site. The overall framework of our work is based on probabilistic models that are closely connected with “mixed-membership models” which are widely used in population genetic admixture analysis, and in machine learning for document clustering. We argue that recognizing these relationships should help improve understanding of mutation signature extraction problems, and suggests ways to further improve the statistical methods. Our methods are implemented in an R package pmsignature (https://github.com/friend1ws/pmsignature) and a web application available at https://friend1ws.shinyapps.io/pmsignature_shiny/. PMID:26630308

  16. Regulation of AID, the B-cell genome mutator

    PubMed Central

    Keim, Celia; Kazadi, David; Rothschild, Gerson; Basu, Uttiya

    2013-01-01

    The mechanisms by which B cells somatically engineer their genomes to generate the vast diversity of antibodies required to challenge the nearly infinite number of antigens that immune systems encounter are of tremendous clinical and academic interest. The DNA cytidine deaminase activation-induced deaminase (AID) catalyzes two of these mechanisms: class switch recombination (CSR) and somatic hypermutation (SHM). Recent discoveries indicate a significant promiscuous targeting of this B-cell mutator enzyme genome-wide. Here we discuss the various regulatory elements that control AID activity and prevent AID from inducing genomic instability and thereby initiating oncogenesis. PMID:23307864

  17. Somatic clonal evolution: A selection-centric perspective.

    PubMed

    Scott, Jacob; Marusyk, Andriy

    2017-04-01

    It is generally accepted that the initiation and progression of cancers is the result of somatic clonal evolution. Despite many peculiarities, evolution within populations of somatic cells should obey the same Darwinian principles as evolution within natural populations, i.e. variability of heritable phenotypes provides the substrate for context-specific selection forces leading to increased population frequencies of phenotypes, which are better adapted to their environment. Yet, within cancer biology, the more prevalent way to view evolution is as being entirely driven by the accumulation of "driver" mutations. Context-specific selection forces are either ignored, or viewed as constraints from which tumor cells liberate themselves during the course of malignant progression. In this review, we will argue that explicitly focusing on selection forces acting on the populations of neoplastic cells as the driving force of somatic clonal evolution might provide for a more accurate conceptual framework compared to the mutation-centric driver gene paradigm. Whereas little can be done to counteract the "bad luck" of stochastic occurrences of cancer-related mutations, changes in selective pressures and the phenotypic adaptations they induce can, in principle, be exploited to limit the incidence of cancers and to increase the efficiency of existing and future therapies. This article is part of a Special Issue entitled: Evolutionary principles - heterogeneity in cancer?, edited by Dr. Robert A. Gatenby. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Uveal melanoma hepatic metastases mutation spectrum analysis using targeted next-generation sequencing of 400 cancer genes.

    PubMed

    Luscan, A; Just, P A; Briand, A; Burin des Roziers, C; Goussard, P; Nitschké, P; Vidaud, M; Avril, M F; Terris, B; Pasmant, E

    2015-04-01

    Uveal melanoma (UM) is the most common malignant tumour of the eye. Diagnosis often occurs late in the course of disease, and prognosis is generally poor. Recently, recurrent somatic mutations were described, unravelling additional specific altered pathways in UM. Targeted next-generation sequencing (NGS) can now be applied to an accurate and fast identification of somatic mutations in cancer. The aim of the present study was to characterise the mutation pattern of five UM hepatic metastases with well-defined clinical and pathological features. We analysed the UM mutation spectrum using targeted NGS on 409 cancer genes. Four previous reported genes were found to be recurrently mutated. All tumours presented mutually exclusive GNA11 or GNAQ missense mutations. BAP1 loss-of-function mutations were found in three UMs. SF3B1 missense mutations were found in the two UMs with no BAP1 mutations. We then searched for additional mutation targets. We identified the Arg505Cys mutation in the tumour suppressor FBXW7. The same mutation was previously described in different cancer types, and FBXW7 was recently reported to be mutated in UM exomes. Further studies are required to confirm FBXW7 implication in UM tumorigenesis. Elucidating the molecular mechanisms underlying UM tumorigenesis holds the promise for novel and effective targeted UM therapies. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  19. Integrity of immunoglobulin variable regions is supported by GANP during AID-induced somatic hypermutation in germinal center B cells.

    PubMed

    Eid, Mohammed Mansour Abbas; Shimoda, Mayuko; Singh, Shailendra Kumar; Almofty, Sarah Ameen; Pham, Phuong; Goodman, Myron F; Maeda, Kazuhiko; Sakaguchi, Nobuo

    2017-05-01

    Immunoglobulin affinity maturation depends on somatic hypermutation (SHM) in immunoglobulin variable (IgV) regions initiated by activation-induced cytidine deaminase (AID). AID induces transition mutations by C→U deamination on both strands, causing C:G→T:A. Error-prone repairs of U by base excision and mismatch repairs (MMRs) create transversion mutations at C/G and mutations at A/T sites. In Neuberger's model, it remained to be clarified how transition/transversion repair is regulated. We investigate the role of AID-interacting GANP (germinal center-associated nuclear protein) in the IgV SHM profile. GANP enhances transition mutation of the non-transcribed strand G and reduces mutation at A, restricted to GYW of the AID hotspot motif. It reduces DNA polymerase η hotspot mutations associated with MMRs followed by uracil-DNA glycosylase. Mutation comparison between IgV complementary and framework regions (FWRs) by Bayesian statistical estimation demonstrates that GANP supports the preservation of IgV FWR genomic sequences. GANP works to maintain antibody structure by reducing drastic changes in the IgV FWR in affinity maturation. © The Author 2017. Published by Oxford University Press on behalf of The Japanese Society for Immunology.

  20. Rates of loss of heterozygosity and mitotic recombination in NF2 schwannomas, sporadic vestibular schwannomas and schwannomatosis schwannomas.

    PubMed

    Hadfield, K D; Smith, M J; Urquhart, J E; Wallace, A J; Bowers, N L; King, A T; Rutherford, S A; Trump, D; Newman, W G; Evans, D G

    2010-11-25

    Biallelic inactivation of the NF2 gene occurs in the majority of schwannomas. This usually involves a combination of a point mutation or multiexon deletion, in conjunction with either a second point mutation or loss of heterozygosity (LOH). We have performed DNA sequence and dosage analysis of the NF2 gene in a panel of 239 schwannoma tumours: 97 neurofibromatosis type 2 (NF2)-related schwannomas, 104 sporadic vestibular schwannomas (VS) and 38 schwannomatosis-related schwannomas. In total, we identified germline NF2 mutations in 86 out of 97 (89%) NF2 patients and a second mutational event in 77 out of 97 (79%). LOH was by far the most common form of second hit. A combination of microsatellite analysis with either conventional comparative genomic hybridization (CGH) or multiplex ligation-dependent probe amplification (MLPA) identified mitotic recombination (MR) as the cause of LOH in 14 out of 72 (19%) total evaluable tumours. Among sporadic VS, at least one NF2 mutation was identified by sequence analysis or MLPA in 65 out of 98 (66%) tumours. LOH occurred in 54 out of 96 (56%) evaluable tumours, but MR only accounted for 5 out of 77 (6%) tested. LOH was present in 28 out of 34 (82%) schwannomatosis-related schwannomas. In all eight patients who had previously tested positive for a germline SMARCB1 mutation, this involved loss of the whole, or part of the long arm, of chromosome 22. In contrast, 5 out of 22 (23%) tumours from patients with no germline SMARCB1 mutation exhibited MR. High-resolution Affymetrix SNP6 genotyping and copy number (CN) analysis (Affymetrix, Santa Clara, CA, USA) were used to determine the chromosomal breakpoint locations in tumours with MR. A range of unique recombination sites, spanning approximately 11.4 Mb, were identified. This study shows that MR is a mechanism of LOH in NF2 and SMARCB1-negative schwannomatosis-related schwannomas, occurring less frequently in sporadic VS. We found no evidence of MR in SMARCB1-positive schwannomatosis, suggesting that susceptibility to MR varies according to the disease context.

  1. Somatic and Germline TP53 Alterations in Second Malignant Neoplasms from Pediatric Cancer Survivors.

    PubMed

    Sherborne, Amy L; Lavergne, Vincent; Yu, Katharine; Lee, Leah; Davidson, Philip R; Mazor, Tali; Smirnoff, Ivan V; Horvai, Andrew E; Loh, Mignon; DuBois, Steven G; Goldsby, Robert E; Neglia, Joseph P; Hammond, Sue; Robison, Leslie L; Wustrack, Rosanna; Costello, Joseph F; Nakamura, Alice O; Shannon, Kevin M; Bhatia, Smita; Nakamura, Jean L

    2017-04-01

    Purpose: Second malignant neoplasms (SMNs) are severe late complications that occur in pediatric cancer survivors exposed to radiotherapy and other genotoxic treatments. To characterize the mutational landscape of treatment-induced sarcomas and to identify candidate SMN-predisposing variants, we analyzed germline and SMN samples from pediatric cancer survivors. Experimental Design: We performed whole-exome sequencing (WES) and RNA sequencing on radiation-induced sarcomas arising from two pediatric cancer survivors. To assess the frequency of germline TP53 variants in SMNs, Sanger sequencing was performed to analyze germline TP53 in 37 pediatric cancer survivors from the Childhood Cancer Survivor Study (CCSS) without any history of a familial cancer predisposition syndrome but known to have developed SMNs. Results: WES revealed TP53 mutations involving p53's DNA-binding domain in both index cases, one of which was also present in the germline. The germline and somatic TP53- mutant variants were enriched in the transcriptomes for both sarcomas. Analysis of TP53- coding exons in germline specimens from the CCSS survivor cohort identified a G215C variant encoding an R72P amino acid substitution in 6 patients and a synonymous SNP A639G in 4 others, resulting in 10 of 37 evaluable patients (27%) harboring a germline TP53 variant. Conclusions: Currently, germline TP53 is not routinely assessed in patients with pediatric cancer. These data support the concept that identifying germline TP53 variants at the time a primary cancer is diagnosed may identify patients at high risk for SMN development, who could benefit from modified therapeutic strategies and/or intensive posttreatment monitoring. Clin Cancer Res; 23(7); 1852-61. ©2016 AACR . ©2016 American Association for Cancer Research.

  2. Somatic and germline TP53 alterations in second malignant neoplasms from pediatric cancer survivors

    PubMed Central

    Sherborne, Amy L.; Lavergne, Vincent; Yu, Katharine; Lee, Leah; Davidson, Philip R.; Mazor, Tali; Smirnoff, Ivan; Horvai, Andrew; Loh, Mignon; DuBois, Steven G.; Goldsby, Robert E.; Neglia, Joseph; Hammond, Sue; Robison, Leslie L.; Wustrack, Rosanna; Costello, Joseph; Nakamura, Alice O.; Shannon, Kevin; Bhatia, Smita; Nakamura, Jean L.

    2016-01-01

    Purpose Second malignant neoplasms (SMNs) are severe late complications that occur in pediatric cancer survivors exposed to radiotherapy and other genotoxic treatments. To characterize the mutational landscape of treatment-induced sarcomas and to identify candidate SMN-predisposing variants we analyzed germline and SMN samples from pediatric cancer survivors. Experimental Design We performed whole exome sequencing (WES) and RNA sequencing on radiation-induced sarcomas arising from two pediatric cancer survivors. To assess the frequency of germline TP53 variants in SMNs, Sanger sequencing was performed to analyze germline TP53 in thirty-seven pediatric cancer survivors from the Childhood Cancer Survivor Study (CCSS) without history of a familial cancer predisposition syndrome but known to have developed SMNs. Results WES revealed TP53 mutations involving p53’s DNA binding domain in both index cases, one of which was also present in the germline. The germline and somatic TP53 mutant variants were enriched in the transcriptomes for both sarcomas. Analysis of TP53 coding exons in germline specimens from the CCSS survivor cohort identified a G215C variant encoding an R72P amino acid substitution in six patients and a synonymous single nucleotide polymorphism A639G in four others, resulting in ten out of 37 evaluable patients (27%) harboring a germline TP53 variant. Conclusions Currently, germline TP53 is not routinely assessed in pediatric cancer patients. These data support the concept that identifying germline TP53 variants at the time a primary cancer is diagnosed may identify patients at high risk for SMN development, who could benefit from modified therapeutic strategies and/or intensive post-treatment monitoring. PMID:27683180

  3. Clonal evolution in therapy-related neoplasms.

    PubMed

    Fabiani, Emiliano; Falconi, Giulia; Fianchi, Luana; Criscuolo, Marianna; Ottone, Tiziana; Cicconi, Laura; Hohaus, Stefan; Sica, Simona; Postorino, Massimiliano; Neri, Antonino; Lionetti, Marta; Leone, Giuseppe; Lo-Coco, Francesco; Voso, Maria Teresa

    2017-02-14

    Therapy-related myeloid neoplasms (t-MN) may occur as a late effect of cytotoxic therapy for a primary malignancy or autoimmune diseases in susceptible individuals. We studied the development of somatic mutations in t-MN, using a collection of follow-up samples from 14 patients with a primary hematologic malignancy, who developed a secondary leukemia (13 t-MN and 1 t-acute lymphoblastic leukemia), at a median latency of 73 months (range 18-108) from primary cancer diagnosis.Using Sanger and next generation sequencing (NGS) approaches we identified 8 mutations (IDH1 R132H, ASXL1 Y591*, ASXL1 S689*, ASXL1 R693*, SRSF2 P95H, SF3B1 K700E, SETBP1 G870R and TP53 Y220C) in seven of thirteen t-MN patients (54%), whereas the t-ALL patient had a t(4,11) translocation, resulting in the KMT2A/AFF1 fusion gene. These mutations were then tracked backwards in marrow samples preceding secondary leukemia occurrence, using pyrosequencing and a NGS protocol that allows the detection of low variant allele frequencies (≥0.1%).Somatic mutations were detectable in the BM harvested at the primary diagnosis, prior to any cytotoxic treatment in three patients, while they were not detectable and apparently acquired by the t-MN clone in five patients.These data show that clonal evolution in t-MN is heterogeneous, with some somatic mutations preceding cytotoxic treatment and possibly favoring leukemic development.

  4. Integrated Molecular Characterization of Uterine Carcinosarcoma.

    PubMed

    Cherniack, Andrew D; Shen, Hui; Walter, Vonn; Stewart, Chip; Murray, Bradley A; Bowlby, Reanne; Hu, Xin; Ling, Shiyun; Soslow, Robert A; Broaddus, Russell R; Zuna, Rosemary E; Robertson, Gordon; Laird, Peter W; Kucherlapati, Raju; Mills, Gordon B; Weinstein, John N; Zhang, Jiashan; Akbani, Rehan; Levine, Douglas A

    2017-03-13

    We performed genomic, epigenomic, transcriptomic, and proteomic characterizations of uterine carcinosarcomas (UCSs). Cohort samples had extensive copy-number alterations and highly recurrent somatic mutations. Frequent mutations were found in TP53, PTEN, PIK3CA, PPP2R1A, FBXW7, and KRAS, similar to endometrioid and serous uterine carcinomas. Transcriptome sequencing identified a strong epithelial-to-mesenchymal transition (EMT) gene signature in a subset of cases that was attributable to epigenetic alterations at microRNA promoters. The range of EMT scores in UCS was the largest among all tumor types studied via The Cancer Genome Atlas. UCSs shared proteomic features with gynecologic carcinomas and sarcomas with intermediate EMT features. Multiple somatic mutations and copy-number alterations in genes that are therapeutic targets were identified. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. RAS mutations in early age leukaemia modulated by NQO1 rs1800566 (C609T) are associated with second-hand smoking exposures

    PubMed Central

    2014-01-01

    Background Deregulation of the MAPK genes signalling caused by somatic mutations have been implied in leukaemia pathogenesis, including RAS mutation (RASmut) in acute myeloid leukaemia (AML), which has been associated with intra-uterine chemical exposures. A case-case study was conducted in order to explore maternal and child exposures to tobacco smoking associations with early age leukaemia (EAL). Methods Covariables of reference were MLL rearrangements (MLL-r), RASmut and NQO1 rs1800566 (C609T). Samples from 150 acute lymphoblastic leukaemia (ALL) and 85 AML were included. Maternal exposures were assessed using a structured questionnaire with demographic, personal habits and residence history information. Restriction fragment length polymorphism and denaturing high performance liquid chromatography were used to screen FLT3, KRAS, and NRAS mutations; direct sequencing was performed to validate the results. NQO1 polymorphism was detected by real-time allelic discrimination technique. Results Overall, RASmut were detected in 28.7% of EAL cases; BRAFmut was found only in one AML patient. Higher rate of KRASmut was found in ALL (30.3%) compared to AML (20.8%) with MLL-r; RASmut showed an association with second-hand tobacco smoking exposures (OR, 3.06, 95% CI, 1.03-9.07). A considerable increased risk for EAL with the combination of RASmut and NQO1 609CT (OR, 4.24, 95% CI, 1.24-14.50) was observed. Conclusions Our data demonstrated the increased risk association between maternal smoking and EAL with MLL-r. Additionally, suggests that children second-hand tobacco exposures are associated with increased risk of EAL with RASmut modulated by NQO1 rs1800566 (C609T). PMID:24571676

  6. RAS mutations in early age leukaemia modulated by NQO1 rs1800566 (C609T) are associated with second-hand smoking exposures.

    PubMed

    Andrade, Francianne Gomes; Furtado-Silva, Juliana Montibeller; Gonçalves, Bruno Alves de Aguiar; Thuler, Luiz Claudio Santos; Barbosa, Thayana Conceição; Emerenciano, Mariana; Siqueira, André; Pombo-de-Oliveira, Maria S

    2014-02-26

    Deregulation of the MAPK genes signalling caused by somatic mutations have been implied in leukaemia pathogenesis, including RAS mutation (RASmut) in acute myeloid leukaemia (AML), which has been associated with intra-uterine chemical exposures. A case-case study was conducted in order to explore maternal and child exposures to tobacco smoking associations with early age leukaemia (EAL). Covariables of reference were MLL rearrangements (MLL-r), RASmut and NQO1 rs1800566 (C609T). Samples from 150 acute lymphoblastic leukaemia (ALL) and 85 AML were included. Maternal exposures were assessed using a structured questionnaire with demographic, personal habits and residence history information. Restriction fragment length polymorphism and denaturing high performance liquid chromatography were used to screen FLT3, KRAS, and NRAS mutations; direct sequencing was performed to validate the results. NQO1 polymorphism was detected by real-time allelic discrimination technique. Overall, RASmut were detected in 28.7% of EAL cases; BRAFmut was found only in one AML patient. Higher rate of KRASmut was found in ALL (30.3%) compared to AML (20.8%) with MLL-r; RASmut showed an association with second-hand tobacco smoking exposures (OR, 3.06, 95% CI, 1.03-9.07). A considerable increased risk for EAL with the combination of RASmut and NQO1 609CT (OR, 4.24, 95% CI, 1.24-14.50) was observed. Our data demonstrated the increased risk association between maternal smoking and EAL with MLL-r. Additionally, suggests that children second-hand tobacco exposures are associated with increased risk of EAL with RASmut modulated by NQO1 rs1800566 (C609T).

  7. Mutational analysis of FLASH and PTPN13 genes in colorectal carcinomas.

    PubMed

    Jeong, Eun Goo; Lee, Sung Hak; Yoo, Nam Jin; Lee, Sug Hyung

    2008-01-01

    The Fas-Fas ligand system is considered a major pathway for induction of apoptosis in cells and tissues. FLASH was identified as a pro-apoptotic protein that transmits apoptosis signal during Fas-mediated apoptosis. PTPN13 interacts with Fas and functions as both suppressor and inducer of Fas-mediated apoptosis. There are polyadenine tracts in both FLASH (A8 and A9 in exon 8) and PTPN13 (A8 in exon 7) genes that could be frameshift mutation targets in colorectal carcinomas. Because genes encoding proteins in Fas-mediated apoptosis frequently harbor somatic mutations in cancers, we explored the possibility as to whether mutations of FLASH and PTPN13 are a feature of colorectal carcinomas. We analysed human FLASH in exon 8 and PTPN13 in exon 7 for the detection of somatic mutations in 103 colorectal carcinomas by a polymerase chain reaction (PCR)- based single-strand conformation polymorphism (SSCP). We detected two mutations in FLASH gene, but none in PTPN13 gene. However, the two mutations were not frameshift (deletion or insertion) mutations in the polyadenine tracts of FLASH. The two mutations consisted of a deletion mutation (c.3734-3737delAGAA) and a missense mutation (c.3703A>C). These data indicate that frameshift mutation in the polyadenine tracts in both FLASH and PTPN13 genes is rare in colorectal carcinomas. Also, the data suggest that both FLASH and PTPN13 mutations in the polyadenine tracts may not have a crucial role in the pathogenesis of colorectal carcinomas.

  8. Germline mitochondrial DNA mutations aggravate ageing and can impair brain development.

    PubMed

    Ross, Jaime M; Stewart, James B; Hagström, Erik; Brené, Stefan; Mourier, Arnaud; Coppotelli, Giuseppe; Freyer, Christoph; Lagouge, Marie; Hoffer, Barry J; Olson, Lars; Larsson, Nils-Göran

    2013-09-19

    Ageing is due to an accumulation of various types of damage, and mitochondrial dysfunction has long been considered to be important in this process. There is substantial sequence variation in mammalian mitochondrial DNA (mtDNA), and the high mutation rate is counteracted by different mechanisms that decrease maternal transmission of mutated mtDNA. Despite these protective mechanisms, it is becoming increasingly clear that low-level mtDNA heteroplasmy is quite common and often inherited in humans. We designed a series of mouse mutants to investigate the extent to which inherited mtDNA mutations can contribute to ageing. Here we report that maternally transmitted mtDNA mutations can induce mild ageing phenotypes in mice with a wild-type nuclear genome. Furthermore, maternally transmitted mtDNA mutations lead to anticipation of reduced fertility in mice that are heterozygous for the mtDNA mutator allele (PolgA(wt/mut)) and aggravate premature ageing phenotypes in mtDNA mutator mice (PolgA(mut/mut)). Unexpectedly, a combination of maternally transmitted and somatic mtDNA mutations also leads to stochastic brain malformations. Our findings show that a pre-existing mutation load will not only allow somatic mutagenesis to create a critically high total mtDNA mutation load sooner but will also increase clonal expansion of mtDNA mutations to enhance the normally occurring mosaic respiratory chain deficiency in ageing tissues. Our findings suggest that maternally transmitted mtDNA mutations may have a similar role in aggravating aspects of normal human ageing.

  9. The IMD innate immunity pathway of Drosophila influences somatic sex determination via regulation of the Doa locus.

    PubMed

    Zhao, Yunpo; Cocco, Claudia; Domenichini, Severine; Samson, Marie-Laure; Rabinow, Leonard

    2015-11-15

    The IMD pathway induces the innate immune response to infection by gram-negative bacteria. We demonstrate strong female-to-male sex transformations in double mutants of the IMD pathway in combination with Doa alleles. Doa encodes a protein kinase playing a central role in somatic sex determination through its regulation of alternative splicing of dsx transcripts. Transcripts encoding two specific Doa isoforms are reduced in Rel null mutant females, supporting our genetic observations. A role for the IMD pathway in somatic sex determination is further supported by the induction of female-to-male sex transformations by Dredd mutations in sensitized genetic backgrounds. In contrast, mutations in either dorsal or Dif, the two other NF-κB paralogues of Drosophila, display no effects on sex determination, demonstrating the specificity of IMD signaling. Our results reveal a novel role for the innate immune IMD signaling pathway in the regulation of somatic sex determination in addition to its role in response to microbial infection, demonstrating its effects on alternative splicing through induction of a crucial protein kinase. Copyright © 2015 Elsevier Inc. All rights reserved.

  10. Genetics of Primary Intraocular Tumors

    PubMed Central

    Nagarkatti-Gude, Nisha; Wang, Yujuan; Ali, Mohammad Javed; Honavar, Santosh G.; Jager, Martine J.; Chan, Chi-Chao

    2012-01-01

    Primary intraocular neoplasms are tumors that originate within the eye. The most common malignant primary intraocular tumor in adults is uveal melanoma and the second is primary intraocular lymphoma or vitreoretinal (intraocular) lymphoma. The most common malignant intraocular tumor in children is retinoblastoma. Genetics plays a vital role in the diagnosis and detection of ocular tumors. In uveal melanoma, monosomy 3 is the most common genetic alteration and somatic mutations of BAP1, a tumor suppressor gene, have been reported in nearly 50% of primary uveal melanomas. The retinoblastoma gene RB1 is the prototype tumor suppressor gene—mutations in RB1 alleles lead to inactivated RB protein and the development of retinoblastoma. Immunoglobulin heavy chain (IgH) or T-cell receptor (TCR) gene rearrangement is observed in B-cell or T-cell primary vitreoretinal lymphoma, respectively. Other factors related to the genetics of these three common malignancies in the eye are discussed and reviewed. PMID:22834783

  11. Interpretation of mutation induction by accelerated heavy ions in bacteria

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kozubek, S.; Ryznar, L.; Horneck, G.

    In this report, a quantitative interpretation of mutation induction cross sections by heavy charged particles in bacterial cells is presented. The approach is based on the calculation of the fraction of energy deposited by indirect hits in the sensitive structure. In these events the particle does not pass through the sensitive volume, but this region is hit by {delta} rays. Four track structure models, developed by Katz, Chatterjee et al, Kiefer and Straaten and Kudryashov et al., respectively, were used for the calculations. With the latter two models, very good agreement of the calculations with experimental results on mutagenesis inmore » bacteria was obtained. Depending on the linear energy transfer (LET{infinity}) of the particles, two different modes of mutagenic action of heavy ions are distinguished: {open_quotes}{delta}-ray mutagenesis,{close_quotes} which is related to those radiation qualities that preferentially kill the cells in direct hits (LET{infinity} {ge} 100 keV/{mu}m), and {open_quotes}track core mutagenesis,{close_quotes} which arises from direct hits and is observed for lighter ions or ions with high energy (LET{infinity} {le} 100 keV/{mu}m). 37 refs., 6 figs., 1 tab.« less

  12. Identification and characterization of HPV-independent cervical cancers.

    PubMed

    Banister, Carolyn E; Liu, Changlong; Pirisi, Lucia; Creek, Kim E; Buckhaults, Phillip J

    2017-02-21

    Human papillomavirus (HPV) initiates cervical cancer, and continuous expression of HPV oncogenes E6 and E7 is thought to be necessary to maintain malignant growth. Current therapies target proliferating cells, rather than specific pathways, and most experimental therapies specifically target E6/E7. We investigated the presence and expression of HPV in cervical cancer, to correlate HPV oncogene expression with clinical and molecular features of these tumors that may be relevant to new targeted therapies. While virtually all cervical cancers contained HPV DNA, and most expressed E6/E7 (HPV-active), a subset (8%) of HPV DNA-positive cervical cancers did not express HPV transcripts (HPV-inactive). HPV-inactive tumors occurred in older women (median 54 vs. 45 years, p = 0.02) and were associated with poorer survival (median 715 vs 3046 days, p = 0.0003). Gene expression profiles of HPV-active and -inactive tumors were distinct. HPV-active tumors expressed E2F target genes and increased AKT/MTOR signaling. HPV-inactive tumors had increased WNT/β-catenin and Sonic Hedgehog signaling. Substantial genome-wide differences in DNA methylation were observed. HPV-inactive tumors had a global decrease in DNA methylation; however, many promoter-associated CpGs were hypermethylated. Many inflammatory response genes showed promoter methylation and decreased expression. The somatic mutation landscapes were significantly different. HPV-active tumors carried few somatic mutations in driver genes, whereas HPV-inactive tumors were enriched for non-synonymous somatic mutations (p-value < 0.0000001) specifically targeting TP53, ARID, WNT, and PI3K pathways. The Cancer Genome Atlas (TCGA) cervical cancer data were analyzed. Many of the gene expression changes and somatic mutations found in HPV-inactive tumors alter pathways for which targeted therapeutics are available. Treatment strategies focused on WNT, PI3K, or TP53 mutations may be effective against HPV-inactive tumors and could improve survival for these cervical cancer patients.

  13. Recent advances in the study of somatic mosaicism and diseases other than cancer.

    PubMed

    Erickson, Robert P

    2014-06-01

    Somatic mosaicism is well appreciated as a cause of cancer and, possibly, aging. Somatic mosaicism as the cause of other diseases is becoming more appreciated. It is especially important in the causation of deforming diseases (e.g., Proteus syndrome; Sturge-Weber syndrome) which are not inherited because early developmental expression is lethal. It also known to make an important contribution to neurological, dermatological, hematological and other diseases (and probably all diseases but many in which it is harder to detect). There have been exciting recent advances in the detection of somatic mosaicism. In particular, for many diseases of somatic overgrowth in which somatic mosaicism as the sole cause was predicted, the gene somatically mutated has been found. A limited number of pathways seem involved in these disorders, some of which are also implicated in cancer. Copyright © 2014 Elsevier Ltd. All rights reserved.

  14. Emerging importance of ALK in neuroblastoma

    PubMed Central

    Azarova, Anna M.; Gautam, Gargi; George, Rani E.

    2011-01-01

    Since the original descriptions of gain-of function mutations in anaplastic lymphoma kinase (ALK), interest in the role of this receptor tyrosine kinase in neuroblastoma development and as a potential therapeutic target has escalated. As a group, the activating point mutations in full-length ALK, found in approximately 8% of all neuroblastoma tumors, are distributed evenly across different clinical stages. However, the most frequent somatic mutation, F1174L, is associated with amplification of the MYCN oncogene. This combination of features appears to confer a worse prognosis than MYCN amplification alone, suggesting a cooperative effect on neuroblastoma formation by these two proteins. Indeed, F1174L has shown more potent transforming activity in vivo than the second most common activating mutation, R1275Q, and is responsible for innate and acquired resistance to crizotinib, a clinically relevant ALK inhibitor that will soon be commercially available. These advances cast ALK as a bona fide oncoprotein in neuroblastoma and emphasize the need to understand ALK-mediated signaling in this tumor. This review addresses many of the current issues surrounding the role of ALK in normal development and neuroblastoma pathogenesis, and discusses the prospects for clinically effective targeted treatments based on ALK inhibition. PMID:21945349

  15. Somatic mosaicism caused by monoallelic reversion of a mutation in T cells of a patient with ADA-SCID and the effects of enzyme replacement therapy on the revertant phenotype.

    PubMed

    Moncada-Vélez, M; Vélez-Ortega, A; Orrego, J; Santisteban, I; Jagadeesh, J; Olivares, M; Olaya, N; Hershfield, M; Candotti, F; Franco, J

    2011-11-01

    Patients with adenosine deaminase (ADA) deficiency exhibit spontaneous and partial clinical remission associated with somatic reversion of inherited mutations. We report a child with severe combined immunodeficiency (T-B- SCID) due to ADA deficiency diagnosed at the age of 1 month, whose lymphocyte counts including CD4+ and CD8+ T and NK cells began to improve after several months with normalization of ADA activity in Peripheral blood lymphocytes (PBL), as a result of somatic mosaicism caused by monoallelic reversion of the causative mutation in the ADA gene. He was not eligible for haematopoietic stem cell transplantation (HSCT) or gene therapy (GT); therefore he was placed on enzyme replacement therapy (ERT) with bovine PEG-ADA. The follow-up of metabolic and immunologic responses to ERT included gradual improvement in ADA activity in erythrocytes and transient expansion of most lymphocyte subsets, followed by gradual stabilization of CD4+ and CD8+ T (with naïve phenotype) and NK cells, and sustained expansion of TCRγδ+ T cells. This was accompanied by the disappearance of the revertant T cells as shown by DNA sequencing from PBL. Although the patient's clinical condition improved marginally, he later developed a germinal cell tumour and eventually died at the age of 67 months from sepsis. This case adds to our current knowledge of spontaneous reversion of mutations in ADA deficiency and shows that the effects of the ERT may vary among these patients, suggesting that it could depend on the cell and type in which the somatic mosaicism is established upon reversion. © 2011 The Authors. Scandinavian Journal of Immunology © 2011 Blackwell Publishing Ltd.

  16. Somatic mosaicism due to monoallelic reversion of a mutation in T cells of an ADA-SCID patient and the effects of enzyme replacement therapy on the revertant phenotype

    PubMed Central

    Moncada-Vélez, Marcela; Vélez-Ortega, Alejandra C.; Orrego, Julio C.; Santisteban, Inés; Jagadeesh, Jayashree; Olivares, Margarita; Olaya, Natalia; Hershfield, Michael S.; Candotti, Fabio; Franco, Jose L.

    2011-01-01

    Patients with adenosine deaminase (ADA) deficiency exhibit spontaneous and partial clinical remission associated with somatic reversion of inherited mutations. We report a child with severe combined immunodeficiency (T-B-NK- SCID) due to ADA deficiency diagnosed at the age of 1 month, whose lymphocyte counts including CD4+ and CD8+ T and NK cells began to improve after several months with normalization of ADA activity in PBL, as a result of somatic mosaicism due to monoallelic reversion of the causative mutation in the ADA gene. Our patient was not eligible for hematopoietic stem cell transplantation (HSCT) or gene therapy (GT); therefore enzyme replacement therapy (ERT) with bovine PEG-ADA was initiated. The follow up of metabolic and immunologic responses to ERT included gradual improvement in ADA activity in erythrocytes and transient expansion of most lymphocyte subsets, followed by gradual stabilization of CD4+ and CD8+ T (with naïve phenotype) and NK cells, with sustained expansion of TCRγδ+ T cells. This was accompanied by disappearance of the revertant T cells as shown by DNA sequencing from PBL. Although the patient’s clinical condition improved marginally, he later developed a germinal cell tumor and eventually died at the age of 67 months from sepsis. This case adds to our current knowledge of spontaneous reversion of mutations in ADA deficiency and shows that the effects of the ERT may vary among these patients, suggesting that it could depend on the cell and type in which the somatic mosaicism is established upon reversion. PMID:21671975

  17. Global Characterization of Protein-Altering Mutations in Prostate Cancer

    DTIC Science & Technology

    2012-08-01

    observed, and assess prevalence; (3) Perform integrative analyses of somatic mutation with gene expression and copy number change data collected on the...v) completed CGH assays on 200 prostate cancers; (vi) initiated the integrated analyses of gene expression, copy number and mutation in prostate...histories of individual mutations within the progression of the cancer in which it was observed, and to assess the prevalence of candidate cancer genes

  18. Distinct Viral and Mutational Spectrum of Endemic Burkitt Lymphoma

    PubMed Central

    Mundo, Lucia; Laginestra, Maria Antonella; Fuligni, Fabio; Rossi, Maura; Zairis, Sakellarios; Gazaneo, Sara; De Falco, Giulia; Lazzi, Stefano; Bellan, Cristiana; Rocca, Bruno Jim; Amato, Teresa; Marasco, Elena; Etebari, Maryam; Ogwang, Martin; Calbi, Valeria; Ndede, Isaac; Patel, Kirtika; Chumba, David; Piccaluga, Pier Paolo; Pileri, Stefano; Leoncini, Lorenzo; Rabadan, Raul

    2015-01-01

    Endemic Burkitt lymphoma (eBL) is primarily found in children in equatorial regions and represents the first historical example of a virus-associated human malignancy. Although Epstein-Barr virus (EBV) infection and MYC translocations are hallmarks of the disease, it is unclear whether other factors may contribute to its development. We performed RNA-Seq on 20 eBL cases from Uganda and showed that the mutational and viral landscape of eBL is more complex than previously reported. First, we found the presence of other herpesviridae family members in 8 cases (40%), in particular human herpesvirus 5 and human herpesvirus 8 and confirmed their presence by immunohistochemistry in the adjacent non-neoplastic tissue. Second, we identified a distinct latency program in EBV involving lytic genes in association with TCF3 activity. Third, by comparing the eBL mutational landscape with published data on sporadic Burkitt lymphoma (sBL), we detected lower frequencies of mutations in MYC, ID3, TCF3 and TP53, and a higher frequency of mutation in ARID1A in eBL samples. Recurrent mutations in two genes not previously associated with eBL were identified in 20% of tumors: RHOA and cyclin F (CCNF). We also observed that polyviral samples showed lower numbers of somatic mutations in common altered genes in comparison to sBL specimens, suggesting dual mechanisms of transformation, mutation versus virus driven in sBL and eBL respectively. PMID:26468873

  19. Transmissible [corrected] dog cancer genome reveals the origin and history of an ancient cell lineage.

    PubMed

    Murchison, Elizabeth P; Wedge, David C; Alexandrov, Ludmil B; Fu, Beiyuan; Martincorena, Inigo; Ning, Zemin; Tubio, Jose M C; Werner, Emma I; Allen, Jan; De Nardi, Andrigo Barboza; Donelan, Edward M; Marino, Gabriele; Fassati, Ariberto; Campbell, Peter J; Yang, Fengtang; Burt, Austin; Weiss, Robin A; Stratton, Michael R

    2014-01-24

    Canine transmissible venereal tumor (CTVT) is the oldest known somatic cell lineage. It is a transmissible cancer that propagates naturally in dogs. We sequenced the genomes of two CTVT tumors and found that CTVT has acquired 1.9 million somatic substitution mutations and bears evidence of exposure to ultraviolet light. CTVT is remarkably stable and lacks subclonal heterogeneity despite thousands of rearrangements, copy-number changes, and retrotransposon insertions. More than 10,000 genes carry nonsynonymous variants, and 646 genes have been lost. CTVT first arose in a dog with low genomic heterozygosity that may have lived about 11,000 years ago. The cancer spawned by this individual dispersed across continents about 500 years ago. Our results provide a genetic identikit of an ancient dog and demonstrate the robustness of mammalian somatic cells to survive for millennia despite a massive mutation burden.

  20. Mutations in the thyrotropin receptor signal transduction pathway in the hyperfunctioning thyroid nodules from multinodular goiters: a study in the Turkish population.

    PubMed

    Gozu, Hulya; Avsar, Melike; Bircan, Rifat; Sahin, Serap; Deyneli, Oguzhan; Cirakoglu, Beyazit; Akalin, Sema

    2005-10-01

    Many studies have been carried out to determine G(s) alpha and TSHR mutations in autonomously functioning thyroid nodules. Variable prevalences for somatic constitutively activating TSHR mutations in hot nodules have been reported. Moreover, the increased prevalence of toxic multinodular goiters in iodine-deficient regions is well known. In Turkey, a country with high incidence rates of goiter due to iodine deficiency, the frequency of mutations in the thyrotropin receptor signal transduction pathway has not been evaluated up to now. In the present study, a part of the genes of the TSHR, G(s)alpha and the catalytic subunit of the PKA were checked for activating mutations. Thirty-five patients who underwent thyroidectomy for multinodular goiters were examined. Genomic DNAs were extracted from 58 hyperactive nodular specimens and surrounding normal thyroid tissues. Mutation screening was done by single-strand conformational polymorphism (SSCP) analysis. In those cases where a mutation was detected, the localization of the mutation was determined by automatic DNA sequencing. No G(s)alpha or PKA mutations were detected, whereas ten mutations (17%) were identified in the TSHR gene. All mutations were somatic and heterozygotic. In conclusion, the frequency of mutations in the cAMP signal transduction pathway was found to be lower than expected in the Turkish population most likely because of the use of SSCP as a screening method and sequencing only a part of TSHR exon 10.

  1. Frequency of TERT promoter mutations in primary tumors of the liver.

    PubMed

    Quaas, Alexander; Oldopp, Theresa; Tharun, Lars; Klingenfeld, Catina; Krech, Till; Sauter, Guido; Grob, Tobias J

    2014-12-01

    Transcriptional regulation of the TERT gene is a major cause of the cancer-specific increase in telomerase activity. Recently, frequent somatic mutations in the TERT promoter have been described in several tumor entities such as melanoma, glioblastoma, bladder cancer, and hepatocellular carcinoma. By generating a putative consensus binding site for ETS transcription factors within the TERT promoter, these mutations are predicted to increase promoter activity and TERT transcription. In order to improve the understanding of the role of TERT promoter mutation in liver tumorigenesis, the mutational status of the TERT promoter was analyzed in 78 hepatocellular carcinomas, 15 hepatocellular adenomas, and 52 intrahepatic cholangiocarciomas. The promoter region of TERT was screened for the two hotspot mutations using PCR and restriction fragment length analysis, utilizing the introduction of novel restriction sites by the somatic mutations. TERT promoter mutation was found in 37 of 78 hepatocellular carcinomas (47 %) and was restricted to the -124C>T mutation. Frequency of mutations was associated with grade of differentiation ranging from 39 % in well-differentiated tumors to 73 % in high-grade hepatocellular carcinomas. TERT promoter mutations were not found in 15 hepatocellular adenomas and 52 intrahepatic cholangiocarcinomas. These data show that TERT promoter mutation is the most frequent genetic alteration in hepatocellular carcinoma known at this time. The striking predominance of the -124C>T mutation compared with other tumor entities suggest a biological difference of the two hotspot mutations. Analysis of TERT promoter mutation might become a diagnostic tool distinguishing hepatocellular adenoma from well-differentiated hepatocellular carcinoma.

  2. A Novel KCNJ5-insT149 Somatic Mutation Close to, but Outside, the Selectivity Filter Causes Resistant Hypertension by Loss of Selectivity for Potassium

    PubMed Central

    Kuppusamy, Maniselvan; Caroccia, Brasilina; Stindl, Julia; Bandulik, Sascha; Lenzini, Livia; Gioco, Francesca; Fishman, Veniamin; Zanotti, Giuseppe; Gomez-Sanchez, Celso; Bader, Michael; Warth, Richard

    2014-01-01

    Context: Understanding the function of the KCNJ5 potassium channel through characterization of naturally occurring novel mutations is key for dissecting the mechanism(s) of autonomous aldosterone secretion in primary aldosteronism. Objective: We sought for such novel KCNJ5 channel mutations in a large database of patients with aldosterone-producing adenomas (APAs). Methods: We discovered a novel somatic c.446insAAC insertion, resulting in the mutant protein KCNJ5-insT149, in a patient with severe drug-resistant hypertension among 195 consecutive patients with a conclusive diagnosis of APA, 24.6% of whom showed somatic KCNJ5 mutations. By site-directed mutagenesis, we created the mutated cDNA that was transfected, along with KCNJ3 cDNA, in mammalian cells. We also localized CYP11B2 in the excised adrenal gland with immunohistochemistry and immunofluorescence using an antibody specific to human CYP11B2. Whole-cell patch clamp recordings, CYP11B2 mRNA, aldosterone measurement, and molecular modeling were performed to characterize the novel KCNJ5-insT149 mutation. Results: Compared with wild-type and mock-transfected adrenocortical cells, HAC15 cells expressing the mutant KCNJ5 showed increased CYP11B2 expression and aldosterone secretion. Mammalian cells expressing the mutated KCNJ5-insT149 channel exhibited a strong Na+ inward current and, in parallel, a substantial rise in intracellular Ca2+, caused by activation of voltage-gated Ca2+ channels and reduced Ca2+ elimination by Na+/Ca2+ exchangers, as well as an increased production of aldosterone. Conclusions: This novel mutation shows pathological Na+ permeability, membrane depolarization, raised cytosolic Ca2+, and increased aldosterone synthesis. Hence, a novel KCNJ5 channelopathy located after the pore α-helix preceding the selectivity filter causes constitutive secretion of aldosterone with ensuing resistant hypertension in a patient with a small APA. PMID:25057880

  3. Visualization of macrophage recruitment in head and neck carcinoma model using fluorine-19 magnetic resonance imaging.

    PubMed

    Khurana, Aman; Chapelin, Fanny; Xu, Hongyan; Acevedo, Joseph R; Molinolo, Alfred; Nguyen, Quyen; Ahrens, Eric T

    2018-04-01

    To evaluate the role of infiltrating macrophages in murine models of single and double mutation head and neck tumors using a novel fluorine-19 ( 19 F) MRI technology. Tumor cell lines single-hit/SCC4 or double-hit/Cal27, with mutations of TP53 and TP53 & FHIT, respectively, were injected bilaterally into the flanks of (n = 10) female mice. With tumors established, perfluorocarbon nanoemulsion was injected intravenously, which labels in situ predominantly monocytes and macrophages. Longitudinal spin density-weighted 19 F MRI data enabled quantification of the macrophage burden in tumor and surrounding tissue. The average number of 19 F atoms within the tumors was twice as high in the Cal27 group compared with SCC4 (3.9 × 10 19 and 2.0 × 10 19 19 F/tumor, respectively; P = 0.0034) two days after contrast injection, signifying increased tumor-associated macrophages in double-hit tumors. The difference was still significant 10 days after injection. Histology stains correlated with in vivo results, exhibiting numerous perfluorocarbon-labeled macrophages in double-hit tumors and to a lesser extent in single-hit tumors. This study helps to establish 19 F MRI as a method for quantifying immune cells in the tumor microenvironment, allowing distinction between double and single-hit head and neck tumors. This technique would be extremely valuable in the clinic for pretreatment planning, prognostics, and post-treatment surveillance. Magn Reson Med 79:1972-1980, 2018. © 2017 International Society for Magnetic Resonance in Medicine. © 2017 International Society for Magnetic Resonance in Medicine.

  4. Infrequent detectable somatic mutations of the RET and glial cell line-derived neurotrophic factor (GDNF) genes in human pituitary adenomas.

    PubMed

    Yoshimoto, K; Tanaka, C; Moritani, M; Shimizu, E; Yamaoka, T; Yamada, S; Sano, T; Itakura, M

    1999-02-01

    RET is a receptor tyrosine kinase expressed in neuroendocrine cells and tumors. RET is activated by a ligand complex comprising glial cell line-derived neurotrophic factor (GDNF) and GDNF receptor-alpha (GDNFR-alpha). Activating mutations of the RET proto-oncogene were found in multiple endocrine neoplasia (MEN) 2 and in sporadic medullary thyroid carcinoma and pheochromocytoma of neuroendocrine origin. Mutations of the RET proto-oncogene and the glial cell line-derived neurotrophic factor (GDNF) gene were examined in human pituitary tumors. No mutations of the RET proto-oncogene including the cysteine-rich region or codon 768 and 918 in the tyrosine kinase domain were detected in 172 human pituitary adenomas either by polymerase chain reaction (PCR)-single strand conformation polymorphism (SSCP) or by PCR-restriction fragment length polymorphism (RFLP). Further, somatic mutations of the GDNF gene in 33 human pituitary adenomas were not detected by PCR-SSCP. One polymorphism of the GDNF gene at codon 145 of TGC or TGT was observed in a prolactinoma. The RET proto-oncogene message was detected in a normal human pituitary gland or 4 of 4 human pituitary adenomas with reverse transcription (RT)-PCR, and in rodent pituitary tumor cell lines with Western blotting. The expression of GDNF gene was detected in 1 of 4 human somatotroph adenomas, 1 of 2 corticotroph adenomas, and 2 of 6 rodent pituitary tumor cell lines with RT-PCR. Based on these, it is concluded that somatic mutations of the RET proto-oncogene or the GDNF gene do not appear to play a major role in the pituitary tumorigenesis in examined tumors.

  5. Cancer predisposition syndromes: lessons for truly precision medicine.

    PubMed

    Glaire, Mark A; Brown, Matthew; Church, David N; Tomlinson, Ian

    2017-01-01

    Cancer predisposition syndromes are typically uncommon, monogenic, high-penetrance disorders. Despite their rarity, they have proven to be highly clinically relevant in directing cancer prevention strategies. As such, they share notable similarities with an expanding class of low-frequency somatic mutations that are associated with a striking prognostic or predictive effect in the tumours in which they occur. In this review, we highlight these commonalities, with particular reference to mutations in the proofreading domain of replicative DNA polymerases. These molecular phenotypes may occur as either germline or somatic events, and in the latter case, have been shown to confer a favourable prognosis and potential increased benefit from immune checkpoint inhibition. We note that incorporation of these variants into clinical management algorithms will help refine patient management, and that this will be further improved by the inclusion of other germline variants, such as those that determine the likelihood of benefit or toxicity from anti-neoplastic therapy. Finally, we propose that such integrated patient and tumour profiling will be essential if we are to deliver truly precision medicine for cancer patients, but in a similar way to rare germline mutations, we must ensure that we identify and utilize rare somatic mutations with strong predictive and prognostic effects. Copyright © 2016 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2016 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

  6. LDOC1 mRNA is differentially expressed in chronic lymphocytic leukemia and predicts overall survival in untreated patients

    PubMed Central

    Duzkale, Hatice; Schweighofer, Carmen D.; Coombes, Kevin R.; Barron, Lynn L.; Ferrajoli, Alessandra; O'Brien, Susan; Wierda, William G.; Pfeifer, John; Majewski, Tadeusz; Czerniak, Bogdan A.; Jorgensen, Jeffrey L.; Medeiros, L. Jeffrey; Freireich, Emil J; Keating, Michael J.

    2011-01-01

    We previously identified LDOC1 as one of the most significantly differentially expressed genes in untreated chronic lymphocytic leukemia (CLL) patients with respect to the somatic mutation status of the immunoglobulin heavy-chain variable region genes. However, little is known about the normal function of LDOC1, its contribution to the pathophysiology of CLL, or its prognostic significance. In this study, we have investigated LDOC1 mRNA expression in a large cohort of untreated CLL patients, as well as in normal peripheral blood B-cell (NBC) subsets and primary B-cell lymphoma samples. We have confirmed that LDOC1 is dramatically down-regulated in mutated CLL cases compared with unmutated cases, and have identified a new splice variant, LDOC1S. We show that LDOC1 is expressed in NBC subsets (naive > memory), suggesting that it may play a role in normal B-cell development. It is also expressed in primary B-cell lymphoma samples, in which its expression is associated with somatic mutation status. In CLL, we show that high levels of LDOC1 correlate with biomarkers of poor prognosis, including cytogenetic markers, unmutated somatic mutation status, and ZAP70 expression. Finally, we demonstrate that LDOC1 mRNA expression is an excellent predictor of overall survival in untreated CLL patients. PMID:21310924

  7. Cutaneous-Skeletal Hypophosphatemia Syndrome is a Multilineage Somatic Mosaic RASopathy

    PubMed Central

    Lim, Young H.; Ovejero, Diana; Derrick, Kristina M.; Collins, Michael T.; Choate, Keith A.

    2016-01-01

    Background We recently demonstrated multilineage somatic mosaicism in cutaneous-skeletal hypophosphatemia syndrome (CSHS), which features epidermal or melanocytic nevi, elevated fibroblast growth factor-23 (FGF23) and hypophosphatemia, finding identical RAS mutations in affected skin and bone. Objective 1) To provide an updated overview of CSHS; 2) To review its pathobiology; 3) To present a new CSHS patient; and 4) To discuss treatment modalities. Methods We searched PubMed for “nevus AND rickets,” and “nevus AND hypophosphatemia,” identifying cases of nevi with hypophosphatemic rickets or elevated serum FGF23. For our additional CSHS patient, we performed histopathologic and radiographic surveys of skin and skeletal lesions, respectively. Sequencing was performed for HRAS, KRAS, and NRAS to determine causative mutations. Results Our new case harbored somatic activating HRAS p.G13R mutation in affected tissue, consistent with previous findings. While the mechanism of FGF23 dysregulation is unknown in CSHS, interaction between FGF and MAPK pathways may provide insight into pathobiology. Anti-FGF23 antibody KRN23 may be useful in managing CSHS. Limitations Multilineage RAS mutation in CSHS was recently identified; further studies on mechanism are unavailable. Conclusion Patients with nevi in association with skeletal disease should be evaluated for serum phosphate and FGF23. Further studies investigating the role of RAS in FGF23 regulation are needed. PMID:27444071

  8. The Impact of Environmental and Endogenous Damage on Somatic Mutation Load in Human Skin Fibroblasts

    PubMed Central

    Saini, Natalie; Chan, Kin; Grimm, Sara A.; Dai, Shuangshuang; Fargo, David C.; Kaufmann, William K.; Taylor, Jack A.; Lee, Eunjung; Cortes-Ciriano, Isidro; Park, Peter J.; Schurman, Shepherd H.; Malc, Ewa P.; Mieczkowski, Piotr A.

    2016-01-01

    Accumulation of somatic changes, due to environmental and endogenous lesions, in the human genome is associated with aging and cancer. Understanding the impacts of these processes on mutagenesis is fundamental to understanding the etiology, and improving the prognosis and prevention of cancers and other genetic diseases. Previous methods relying on either the generation of induced pluripotent stem cells, or sequencing of single-cell genomes were inherently error-prone and did not allow independent validation of the mutations. In the current study we eliminated these potential sources of error by high coverage genome sequencing of single-cell derived clonal fibroblast lineages, obtained after minimal propagation in culture, prepared from skin biopsies of two healthy adult humans. We report here accurate measurement of genome-wide magnitude and spectra of mutations accrued in skin fibroblasts of healthy adult humans. We found that every cell contains at least one chromosomal rearrangement and 600–13,000 base substitutions. The spectra and correlation of base substitutions with epigenomic features resemble many cancers. Moreover, because biopsies were taken from body parts differing by sun exposure, we can delineate the precise contributions of environmental and endogenous factors to the accrual of genetic changes within the same individual. We show here that UV-induced and endogenous DNA damage can have a comparable impact on the somatic mutation loads in skin fibroblasts. Trial Registration ClinicalTrials.gov NCT01087307 PMID:27788131

  9. ICUS/CCUS/CHIP: basics & beyond.

    PubMed

    Jain, Mili; Tripathi, Anil

    2017-10-01

    Patients presenting with idiopathic cytopenia with non-diagnostic marrow morphology and a normal karyotype pose a diagnostic and therapeutic challenge. Additional diagnostic information from mutation analysis could provide important clinical insights. However, one has to be cautious during such diagnostic interpretations in view of the recent documentation of clonal somatic mutations in healthy elder individuals. Whether to regard clonality synonymous with malignant proliferation or a manifestation of ageing process is to be judged carefully. Areas covered: The review covers defining criteria and diagnostic work up for Idiopathic cytopenia of undetermined significance (ICUS), Clonal cytopenia of undetermined significance (CCUS), Clonal hematopoiesis of indeterminate potential (CHIP). It also presents the results from previous reports on this subject. In addition the evolution and potential impact of these entities is discussed. Expert commentary: Current evidence does not support the use of somatic mutations as presumptive evidence of myelodysplastic syndrome (MDS). Including CCUS under the category of MDS requires further insight on natural disease course. Longitudinal follow up study on ICUS, CCUS, CHIP may eventually identify the pathological significance of the clonal mutations. An absence of mutation however may still be useful as good predictor of not having MDS.

  10. Genome sequencing of mucosal melanomas reveals that they are driven by distinct mechanisms from cutaneous melanoma.

    PubMed

    Furney, Simon J; Turajlic, Samra; Stamp, Gordon; Nohadani, Mahrokh; Carlisle, Anna; Thomas, J Meirion; Hayes, Andrew; Strauss, Dirk; Gore, Martin; van den Oord, Joost; Larkin, James; Marais, Richard

    2013-07-01

    Mucosal melanoma displays distinct clinical and epidemiological features compared to cutaneous melanoma. Here we used whole genome and whole exome sequencing to characterize the somatic alterations and mutation spectra in the genomes of ten mucosal melanomas. We observed somatic mutation rates that are considerably lower than occur in sun-exposed cutaneous melanoma, but comparable to the rates seen in cancers not associated with exposure to known mutagens. In particular, the mutation signatures are not indicative of ultraviolet light- or tobacco smoke-induced DNA damage. Genes previously reported as mutated in other cancers were also mutated in mucosal melanoma. Notably, there were substantially more copy number and structural variations in mucosal melanoma than have been reported in cutaneous melanoma. Thus, mucosal and cutaneous melanomas are distinct diseases with discrete genetic features. Our data suggest that different mechanisms underlie the genesis of these diseases and that structural variations play a more important role in mucosal than in cutaneous melanomagenesis. Copyright © 2013 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

  11. The determination of complete human mitochondrial DNA sequences in single cells: implications for the study of somatic mitochondrial DNA point mutations

    PubMed Central

    Taylor, Robert W.; Taylor, Geoffrey A.; Durham, Steve E.; Turnbull, Douglass M.

    2001-01-01

    Studies of single cells have previously shown intracellular clonal expansion of mitochondrial DNA (mtDNA) mutations to levels that can cause a focal cytochrome c oxidase (COX) defect. Whilst techniques are available to study mtDNA rearrangements at the level of the single cell, recent interest has focused on the possible role of somatic mtDNA point mutations in ageing, neurodegenerative disease and cancer. We have therefore developed a method that permits the reliable determination of the entire mtDNA sequence from single cells without amplifying contaminating, nuclear-embedded pseudogenes. Sequencing and PCR–RFLP analyses of individual COX-negative muscle fibres from a patient with a previously described heteroplasmic COX II (T7587C) mutation indicate that mutant loads as low as 30% can be reliably detected by sequencing. This technique will be particularly useful in identifying the mtDNA mutational spectra in age-related COX-negative cells and will increase our understanding of the pathogenetic mechanisms by which they occur. PMID:11470889

  12. Hotspot mutation panel testing reveals clonal evolution in a study of 265 paired primary and metastatic tumors.

    PubMed

    Goswami, Rashmi S; Patel, Keyur P; Singh, Rajesh R; Meric-Bernstam, Funda; Kopetz, E Scott; Subbiah, Vivek; Alvarez, Ricardo H; Davies, Michael A; Jabbar, Kausar J; Roy-Chowdhuri, Sinchita; Lazar, Alexander J; Medeiros, L Jeffrey; Broaddus, Russell R; Luthra, Rajyalakshmi; Routbort, Mark J

    2015-06-01

    We used a clinical next-generation sequencing (NGS) hotspot mutation panel to investigate clonal evolution in paired primary and metastatic tumors. A total of 265 primary and metastatic tumor pairs were sequenced using a 46-gene cancer mutation panel capable of detecting one or more single-nucleotide variants as well as small insertions/deletions. Mutations were tabulated together with tumor type and percentage, mutational variant frequency, time interval between onset of primary tumor and metastasis, and neoadjuvant therapy status. Of note, 227 of 265 (85.7%) tumor metastasis pairs showed identical mutation calls. Of the tumor pairs with identical mutation calls, 160 (60.4%) possessed defining somatic mutation signatures and 67 (25.3%) did not exhibit any somatic mutations. There were 38 (14.3%) cases that showed at least one novel mutation call between the primary and metastasis. Metastases were almost two times more likely to show novel mutations (n = 20, 7.5%) than primary tumors (n = 12, 4.5%). TP53 was the most common additionally mutated gene in metastatic lesions, followed by PIK3CA and SMAD4. PIK3CA mutations were more often associated with metastasis in colon carcinoma samples. Clinical NGS hotspot panels can be useful in analyzing clonal evolution within tumors as well as in determining subclonal mutations that can expand in future metastases. PIK3CA, SMAD4, and TP53 are most often involved in clonal divergence, providing potential targets that may help guide the clinical management of tumor progression or metastases. ©2015 American Association for Cancer Research.

  13. Mutation of Breast Cancer Cell Genomic DNA by APOBEC3B

    DTIC Science & Technology

    2012-09-01

    down Yes, A3B expression increases the steady-state level of genomic uracil Fig. 2a-2c 2) Can A3B mutate a target gene to escape drug...somatic mutation in human cancer genomes. Nature 446, 153-158 (2007). 10 2 Jones, S. et al. Frequent mutations of chromatin remodeling gene ARID1A in...processes molding the genomes of 21 breast cancers. Cell 149, 979-993 (2012). 9 Stephens, P. J. et al. The landscape of cancer genes and mutational

  14. Genomic profiling of multiple sequentially acquired tumor metastatic sites from an “exceptional responder” lung adenocarcinoma patient reveals extensive genomic heterogeneity and novel somatic variants driving treatment response

    PubMed Central

    Biswas, Romi; Gao, Shaojian; Cultraro, Constance M.; Maity, Tapan K.; Venugopalan, Abhilash; Abdullaev, Zied; Shaytan, Alexey K.; Carter, Corey A.; Thomas, Anish; Rajan, Arun; Song, Young; Pitts, Stephanie; Chen, Kevin; Bass, Sara; Boland, Joseph; Hanada, Ken-Ichi; Chen, Jinqiu; Meltzer, Paul S.; Panchenko, Anna R.; Yang, James C.; Pack, Svetlana; Giaccone, Giuseppe; Schrump, David S.; Khan, Javed; Guha, Udayan

    2016-01-01

    We used next-generation sequencing to identify somatic alterations in multiple metastatic sites from an “exceptional responder” lung adenocarcinoma patient during his 7-yr course of ERBB2-directed therapies. The degree of heterogeneity was unprecedented, with ∼1% similarity between somatic alterations of the lung and lymph nodes. One novel translocation, PLAG1-ACTA2, present in both sites, up-regulated ACTA2 expression. ERBB2, the predominant driver oncogene, was amplified in both sites, more pronounced in the lung, and harbored an L869R mutation in the lymph node. Functional studies showed increased proliferation, migration, metastasis, and resistance to ERBB2-directed therapy because of L869R mutation and increased migration because of ACTA2 overexpression. Within the lung, a nonfunctional CDK12, due to a novel G879V mutation, correlated with down-regulation of DNA damage response genes, causing genomic instability, and sensitivity to chemotherapy. We propose a model whereby a subclone metastasized early from the primary site and evolved independently in lymph nodes. PMID:27900369

  15. Mutations in Mitochondrial DNA From Pancreatic Ductal Adenocarcinomas Associate With Survival Times of Patients and Accumulate as Tumors Progress.

    PubMed

    Hopkins, Julia F; Denroche, Robert E; Aguiar, Jennifer A; Notta, Faiyaz; Connor, Ashton A; Wilson, Julie M; Stein, Lincoln D; Gallinger, Steven; Boutros, Paul C

    2018-05-01

    Somatic mutations have been found in the mitochondria in different types of cancer cells, but it is not clear whether these affect tumorigenesis or tumor progression. We analyzed mitochondrial genomes of 268 early-stage, resected pancreatic ductal adenocarcinoma tissues and paired non-tumor tissues. We defined a mitochondrial somatic mutation (mtSNV) as a position where the difference in heteroplasmy fraction between tumor and normal sample was ≥0.2. Our analysis identified 304 mtSNVs, with at least 1 mtSNV in 61% (164 of 268) of tumor samples. The noncoding control region had the greatest proportion of mtSNVs (60 of 304 mutations); this region contains sites that regulate mitochondrial DNA transcription and replication. Frequently mutated genes included ND5, RNR2, and CO1, plus 29 mutations in transfer RNA genes. mtSNVs in 2 separate mitochondrial genes (ND4 and ND6) were associated with shorter overall survival time. This association appeared to depend on the level of mtSNV heteroplasmy. Non-random co-occurrence between mtSNVs and mutations in nuclear genes indicates interactions between nuclear and mitochondrial DNA. In an analysis of primary tumors and metastases from 6 patients, we found tumors to accumulate mitochondrial mutational mutations as they progress. Copyright © 2018 AGA Institute. Published by Elsevier Inc. All rights reserved.

  16. Mutational and structural analysis of diffuse large B-cell lymphoma using whole genome sequencing | Office of Cancer Genomics

    Cancer.gov

    Abstract: Diffuse large B-cell lymphoma (DLBCL) is a genetically heterogeneous cancer comprising at least two molecular subtypes that differ in gene expression and distribution of mutations. Recently, application of genome/exome sequencing and RNA-seq to DLBCL has revealed numerous genes that are recurrent targets of somatic point mutation in this disease.

  17. PPM1D Mosaic Truncating Variants in Ovarian Cancer Cases May Be Treatment-Related Somatic Mutations.

    PubMed

    Pharoah, Paul D P; Song, Honglin; Dicks, Ed; Intermaggio, Maria P; Harrington, Patricia; Baynes, Caroline; Alsop, Kathryn; Bogdanova, Natalia; Cicek, Mine S; Cunningham, Julie M; Fridley, Brooke L; Gentry-Maharaj, Aleksandra; Hillemanns, Peter; Lele, Shashi; Lester, Jenny; McGuire, Valerie; Moysich, Kirsten B; Poblete, Samantha; Sieh, Weiva; Sucheston-Campbell, Lara; Widschwendter, Martin; Whittemore, Alice S; Dörk, Thilo; Menon, Usha; Odunsi, Kunle; Goode, Ellen L; Karlan, Beth Y; Bowtell, David D; Gayther, Simon A; Ramus, Susan J

    2016-03-01

    Mosaic truncating mutations in the protein phosphatase, Mg(2+)/Mn(2+)-dependent, 1D (PPM1D) gene have recently been reported with a statistically significantly greater frequency in lymphocyte DNA from ovarian cancer case patients compared with unaffected control patients. Using massively parallel sequencing (MPS) we identified truncating PPM1D mutations in 12 of 3236 epithelial ovarian cancer (EOC) case patients (0.37%) but in only one of 3431 unaffected control patients (0.03%) (P = .001). All statistical tests were two-sided. A combination of Sanger sequencing, pyrosequencing, and MPS data suggested that 12 of the 13 mutations were mosaic. All mutations were identified in post-chemotherapy treatment blood samples from case patients (n = 1827) (average 1234 days post-treatment in carriers) rather than from cases collected pretreatment (less than 14 days after diagnosis, n = 1384) (P = .002). These data suggest that PPM1D variants in EOC cases are primarily somatic mosaic mutations caused by treatment and are not associated with germline predisposition to EOC. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  18. Somatic HRPT2 Mutation (Arg234X) of Parathyroid Carcinoma Associated with Slipped Capital Femoral Epiphysis: A First Case Report.

    PubMed

    Niramitmahapanya, Sathit; Deerochanawong, Chaicharn; Sarinnapakorn, Veerasak; Sunthornthepvarakul, Thongkum; Pingsuthiwong, Sarinee; Athipan, Pornake; Sangsuda, Yuthana

    2016-02-01

    A 14-year-old boy was admitted to the orthopedic clinic of Rajavithi Hospital complaining of pain in the left hip. A year earlier, pain had developed in his left joint and had gradually increased in intensity in both hips. A month before he was referred, radiographs obtained at another hospital showed bilateral slipped capital femoral epiphysis (SCFE). The patient's biochemical laboratory data showed hypercalcemia, hypophosphatemia, and a high level of intact parathyroid hormone (iPTH) compatible with primary hyperparathyroidism. HRPT2 gene analysis found heterozygosity for c. 700 C > T mutation (Arg234X) of HRPT2 gene at exon 7. This is the first report in the literature about somatic mutation of the HRPT2 gene of parathyroid carcinoma associated with slipped capital femoral epiphysis.

  19. Prevalence and clinical significance of mediator complex subunit 12 mutations in 362 Han Chinese samples with uterine leiomyoma.

    PubMed

    Wu, Juan; Zou, Yang; Luo, Yong; Guo, Jiu-Bai; Liu, Fa-Ying; Zhou, Jiang-Yan; Zhang, Zi-Yu; Wan, Lei; Huang, Ou-Ping

    2017-07-01

    Uterine leiomyomas (ULs) are the most common gynecological benign tumors originating from the myometrium. Prevalent mutations in the mediator complex subunit 12 (MED12) gene have been identified in ULs, and functional evidence has revealed that these mutations may promote the development of ULs. However, whether MED12 mutations are associated with certain clinical characteristics in ULs remains largely unknown. In the present study, the potential mutations of MED12 and its paralogous gene, mediator complex subunit 12-like (MED12L), were screened in 362 UL tumors from Han Chinese patients. A total of 158 out of 362 UL tumors (43.6%) were identified as harboring MED12 somatic mutations, and the majority of these mutations were restricted to the 44th residue. MED12 mutations were also observed in 2 out of 145 (1.4%) adjacent control myometrium. Furthermore, the mutation spectrum of MED12 in the concurrent leiomyomas was noticeably different. Correlation analysis of MED12 mutations with the available clinical features indicated that patients with mutated MED12 tended to have smaller cervical diameters. By contrast, no MED12L mutation was identified in the present samples. In summary, the present study demonstrated the presence of prevalent MED12 somatic mutations in UL samples, and the MED12 mutation was associated with smaller cervical diameters. The low mutation frequency of MED12 in adjacent control myometrium indicated that MED12 mutation may be an early event in the pathogenesis of ULs. Furthermore, MED12 mutation status in concurrent tumors from multiple leiomyomas supported several prior observations that the majority of these tumors arose independently.

  20. Sleeping Beauty transposon system for genetic etiological research and gene therapy of cancers.

    PubMed

    Hou, Xiaomei; Du, Yan; Deng, Yang; Wu, Jianfeng; Cao, Guangwen

    2015-01-01

    Carcinogenesis is etiologically associated with somatic mutations of critical genes. Recently, a number of somatic mutations and key molecules have been found to be involved in functional networks affecting cancer progression. Suitable animal models are required to validate cancer-promoting or -inhibiting capacities of these mutants and molecules. Sleeping Beauty transposon system consists of a transposon that carries gene(s) of interest and a transposase that recognizes, excises, and reinserts genes in given location of the genome. It can create both gain-of-function and loss-of-function mutations, thus being frequently chosen to investigate the etiological mechanisms and gene therapy for cancers in animal models. In this review, we summarized current advances of Sleeping Beauty transposon system in revealing molecular mechanism of cancers and improving gene therapy. Understanding molecular mechanisms by which driver mutations contribute to carcinogenesis and metastasis may pave the way for the development of innovative prophylactic and therapeutic strategies against malignant diseases.

  1. Personalized genomic analyses for cancer mutation discovery and interpretation

    PubMed Central

    Jones, Siân; Anagnostou, Valsamo; Lytle, Karli; Parpart-Li, Sonya; Nesselbush, Monica; Riley, David R.; Shukla, Manish; Chesnick, Bryan; Kadan, Maura; Papp, Eniko; Galens, Kevin G.; Murphy, Derek; Zhang, Theresa; Kann, Lisa; Sausen, Mark; Angiuoli, Samuel V.; Diaz, Luis A.; Velculescu, Victor E.

    2015-01-01

    Massively parallel sequencing approaches are beginning to be used clinically to characterize individual patient tumors and to select therapies based on the identified mutations. A major question in these analyses is the extent to which these methods identify clinically actionable alterations and whether the examination of the tumor tissue alone is sufficient or whether matched normal DNA should also be analyzed to accurately identify tumor-specific (somatic) alterations. To address these issues, we comprehensively evaluated 815 tumor-normal paired samples from patients of 15 tumor types. We identified genomic alterations using next-generation sequencing of whole exomes or 111 targeted genes that were validated with sensitivities >95% and >99%, respectively, and specificities >99.99%. These analyses revealed an average of 140 and 4.3 somatic mutations per exome and targeted analysis, respectively. More than 75% of cases had somatic alterations in genes associated with known therapies or current clinical trials. Analyses of matched normal DNA identified germline alterations in cancer-predisposing genes in 3% of patients with apparently sporadic cancers. In contrast, a tumor-only sequencing approach could not definitively identify germline changes in cancer-predisposing genes and led to additional false-positive findings comprising 31% and 65% of alterations identified in targeted and exome analyses, respectively, including in potentially actionable genes. These data suggest that matched tumor-normal sequencing analyses are essential for precise identification and interpretation of somatic and germline alterations and have important implications for the diagnostic and therapeutic management of cancer patients. PMID:25877891

  2. A Two-Hit Model of Autism: Adolescence as the Second Hit

    PubMed Central

    Picci, Giorgia; Scherf, K. Suzanne

    2015-01-01

    Adolescence brings dramatic changes in behavior and neural organization. Unfortunately, for some 30% of individuals with autism, there is marked decline in adaptive functioning during adolescence. We propose a two-hit model of autism. First, early perturbations in neural development function as a “first hit” that sets up a neural system that is “built to fail” in the face of a second hit. Second, the confluence of pubertal hormones, neural reorganization, and increasing social demands during adolescence provides the “second hit” that interferes with the ability to transition into adult social roles and levels of adaptive functioning. In support of this model, we review evidence about adolescent-specific neural and behavioral development in autism. We conclude with predictions and recommendations for empirical investigation about several domains in which developmental trajectories for individuals with autism may be uniquely deterred in adolescence. PMID:26609500

  3. Late-Onset Cryopyrin-Associated Periodic Syndromes Caused by Somatic NLRP3 Mosaicism-UK Single Center Experience.

    PubMed

    Rowczenio, Dorota M; Gomes, Sónia Melo; Aróstegui, Juan I; Mensa-Vilaro, Anna; Omoyinmi, Ebun; Trojer, Hadija; Baginska, Anna; Baroja-Mazo, Alberto; Pelegrin, Pablo; Savic, Sinisa; Lane, Thirusha; Williams, Rene; Brogan, Paul; Lachmann, Helen J; Hawkins, Philip N

    2017-01-01

    Cryopyrin-associated periodic syndrome (CAPS) is caused by gain-of-function NLRP3 mutations. Recently, somatic NLRP3 mosaicism has been reported in some CAPS patients who were previously classified as "mutation-negative." We describe here the clinical and laboratory findings in eight British adult patients who presented with symptoms typical of CAPS other than an onset in mid-late adulthood. All patients underwent comprehensive clinical and laboratory investigations, including analysis of the NLRP3 gene using Sanger and amplicon-based deep sequencing (ADS) along with measurements of extracellular apoptosis-associated speck-like protein with CARD domain (ASC) aggregates. The clinical phenotype in all subjects was consistent with mid-spectrum CAPS, except a median age at disease onset of 50 years. Sanger sequencing of NLRP3 was non-diagnostic but ADS detected a somatic NLRP3 mutation in each case. In one patient, DNA isolated from blood demonstrated an increase in the mutant allele from 5 to 45% over 12 years. ASC aggregates in patients' serum measured during active disease were significantly higher than healthy controls. This series represents 8% of CAPS patients diagnosed in a single center, suggesting that acquired NLRP3 mutations may not be an uncommon cause of the syndrome and should be sought in all patients with late-onset symptoms otherwise compatible with CAPS. Steadily worsening CAPS symptoms in one patient were associated with clonal expansion of the mutant allele predominantly affecting myeloid cells. Two patients developed AA amyloidosis, which previously has only been reported in CAPS in association with life-long germline NLRP3 mutations.

  4. Somatic KRAS mutation in an infant with linear nevus sebaceous syndrome associated with lymphatic malformations: A case report and literature review.

    PubMed

    Lihua, Jiang; Feng, Gao; Shanshan, Mao; Jialu, Xu; Kewen, Jiang

    2017-11-01

    Linear nevus sebaceous syndrome (LNSS) is a rare neurocutaneous syndrome, characterized by nevus sebaceous,central nervous system (CNS), ocular and skeletal abnormalities. The present study describes KRAS somatic mosaic mutation in a case of LNSS with lymphatic malformations (LMs). A 4-month-old female with a clinical diagnosis of LNSS presented with infantile spasms, mental retardation, skull dysplasia, ocular abnormalities, congenital atrial septal defect, and LMs. Cervical ultrasonography revealed a 4.6 × 4.6 × 2.2cm no echo packet with clear boundary in the subcutaneous tissues of the right neck. The neck MRI indicated a cyst in the subcutaneous tissues of the right neck. Whole-exome sequencing revealed a low-level heterozygous mutation of the KRAS gene (c.35C > T; p.G12D, 19%) in the skin lesion sample. This mutation was not present in the blood samples of the patient and her parents. The patient received sclerotherapy with paicibanil (OK-432) injection for the cyst. Following 1 year of treatment, the patient exhibited fewer seizures. The mental and motor development was significantly improved. The patient can currently walk with assistance and speak simple words. LNSS is a rare, congenital neurocutaneous syndrome consisting of a spectrum of abnormalities involving the skin, central nervous system, eyes, LMs and other systems. LNSS can be caused by postzygotic somatic mutation in the RAS family of genes. Multidisciplinary evaluation and treatment is needed. Copyright © 2017 The Authors. Published by Wolters Kluwer Health, Inc. All rights reserved.

  5. Somatic gain-of-function mutations in PIK3CA in patients with macrodactyly

    PubMed Central

    Rios, Jonathan J.; Paria, Nandina; Burns, Dennis K.; Israel, Bonnie A.; Cornelia, Reuel; Wise, Carol A.; Ezaki, Marybeth

    2013-01-01

    Macrodactyly is a discrete congenital anomaly consisting of enlargement of all tissues localized to the terminal portions of a limb, typically within a ‘nerve territory’. The classic terminology for this condition is ‘lipofibromatous hamartoma of nerve’ or Type I macrodactyly. The peripheral nerve, itself, is enlarged both in circumference and in length. It is not related to neurofibromatosis (NF1), nor is it associated with vascular malformations, such as in the recently reported CLOVES syndrome. The specific nerve pathophysiology in this form of macrodactyly has not been well described and a genetic etiology for this specific form of enlargement is unknown. To identify the genetic cause of macrodactyly, we used whole-exome sequencing to identify somatic mutations present in the affected nerve of a single patient. We confirmed a novel mutation in PIK3CA (R115P) present in the patient's affected nerve tissue but not in blood DNA. Sequencing PIK3CA exons identified gain-of-function mutations (E542K, H1047L or H1047R) in the affected tissue of five additional unrelated patients; mutations were absent in blood DNA available from three patients. Immunocytochemistry confirmed AKT activation in cultured cells from the nerve of a macrodactyly patient. Additionally, we found that the most abnormal structure within the involved nerve in a macrodactylous digit is the perineurium, with additional secondary effects on the axon number and size. Thus, isolated congenital macrodactyly is caused by somatic activation of the PI3K/AKT cell-signaling pathway and is genetically and biochemically related to other overgrowth syndromes. PMID:23100325

  6. Somatic gain-of-function mutations in PIK3CA in patients with macrodactyly.

    PubMed

    Rios, Jonathan J; Paria, Nandina; Burns, Dennis K; Israel, Bonnie A; Cornelia, Reuel; Wise, Carol A; Ezaki, Marybeth

    2013-02-01

    Macrodactyly is a discrete congenital anomaly consisting of enlargement of all tissues localized to the terminal portions of a limb, typically within a 'nerve territory'. The classic terminology for this condition is 'lipofibromatous hamartoma of nerve' or Type I macrodactyly. The peripheral nerve, itself, is enlarged both in circumference and in length. It is not related to neurofibromatosis (NF1), nor is it associated with vascular malformations, such as in the recently reported CLOVES syndrome. The specific nerve pathophysiology in this form of macrodactyly has not been well described and a genetic etiology for this specific form of enlargement is unknown. To identify the genetic cause of macrodactyly, we used whole-exome sequencing to identify somatic mutations present in the affected nerve of a single patient. We confirmed a novel mutation in PIK3CA (R115P) present in the patient's affected nerve tissue but not in blood DNA. Sequencing PIK3CA exons identified gain-of-function mutations (E542K, H1047L or H1047R) in the affected tissue of five additional unrelated patients; mutations were absent in blood DNA available from three patients. Immunocytochemistry confirmed AKT activation in cultured cells from the nerve of a macrodactyly patient. Additionally, we found that the most abnormal structure within the involved nerve in a macrodactylous digit is the perineurium, with additional secondary effects on the axon number and size. Thus, isolated congenital macrodactyly is caused by somatic activation of the PI3K/AKT cell-signaling pathway and is genetically and biochemically related to other overgrowth syndromes.

  7. A systematic profile of clinical inhibitors responsive to EGFR somatic amino acid mutations in lung cancer: implication for the molecular mechanism of drug resistance and sensitivity.

    PubMed

    Ai, Xinghao; Sun, Yingjia; Wang, Haidong; Lu, Shun

    2014-07-01

    Human epidermal growth factor receptor (EGFR) has become a well-established target for the treatment of patients with non-small cell lung cancer (NSCLC). However, a large number of somatic mutations in such protein have been observed to cause drug resistance or sensitivity during pathological progression, limiting the application of reversible EGFR tyrosine kinase inhibitor therapy in NSCLC. In the current work, we describe an integration of in silico analysis and in vitro assay to profile six representative EGFR inhibitors against a panel of 71 observed somatic mutations in EGFR tyrosine kinase domain. In the procedure, the changes in interaction free energy of inhibitors with EGFR upon various mutations were calculated one by one using a rigorous computational scheme, which was preoptimized based on a set of structure-solved, affinity-known samples to improve its performance in characterizing the EGFR-inhibitor system. This method was later demonstrated to be effective in inferring drug response to the classical L858R and G719S mutations that confer constitutive activation for the EGFR kinase. It is found that the Staurosporine, a natural product isolated from the bacterium Streptomyces staurosporeus, exhibits selective inhibitory activity on the T790M and T790M/L858R mutants. This finding was subsequently solidified by in vitro kinase assay experiment; the inhibitory IC50 values of Staurosporine against wild-type, T790M and T790M/L858R mutant EGFR were measured to be 937, 12 and 3 nM, respectively.

  8. Evaluation of pre-analytical conditions and comparison of the performance of several digital PCR assays for the detection of major EGFR mutations in circulating DNA from non-small cell lung cancers: the CIRCAN_0 study

    PubMed Central

    Garcia, Jessica; Dusserre, Eric; Cheynet, Valérie; Bringuier, Pierre Paul; Brengle-Pesce, Karen; Wozny, Anne-Sophie; Rodriguez-Lafrasse, Claire; Freyer, Gilles; Brevet, Marie; Payen, Léa; Couraud, Sébastien

    2017-01-01

    Non invasive somatic detection assays are suitable for repetitive tumor characterization or for detecting the appearance of somatic resistance during lung cancer. Molecular diagnosis based on circulating free DNA (cfDNA) offers the opportunity to track the genomic evolution of the tumor, and was chosen to assess the molecular profile of several EGFR alterations, including deletions in exon 19 (delEX19), the L858R substitution on exon 21 and the EGFR resistance mutation T790M on exon 20. Our study aimed at determining optimal pre-analytical conditions and EGFR mutation detection assays for analyzing cfDNA using the picoliter-droplet digital polymerase chain reaction (ddPCR) assay. Within the framework of the CIRCAN project set-up at the Lyon University Hospital, plasma samples were collected to establish a pre-analytical and analytical workflow of cfDNA analysis. We evaluated all of the steps from blood sampling to mutation detection output, including shipping conditions (4H versus 24H in EDTA tubes), the reproducibility of cfDNA extraction, the specificity/sensitivity of ddPCR (using external controls), and the comparison of different PCR assays for the detection of the three most important EGFR hotspots, which highlighted the increased sensitivity of our in-house primers/probes. Hence, we have described a new protocol facilitating the molecular detection of somatic mutations in cancer patients from liquid biopsies, improving their diagnosis and introducing a less traumatic monitoring system during tumor progression. PMID:29152135

  9. Exome sequencing identifies recurrent somatic RAC1 mutations in melanoma

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Krauthammer, Michael; Kong, Yong; Ha, Byung Hak

    We characterized the mutational landscape of melanoma, the form of skin cancer with the highest mortality rate, by sequencing the exomes of 147 melanomas. Sun-exposed melanomas had markedly more ultraviolet (UV)-like C>T somatic mutations compared to sun-shielded acral, mucosal and uveal melanomas. Among the newly identified cancer genes was PPP6C, encoding a serine/threonine phosphatase, which harbored mutations that clustered in the active site in 12% of sun-exposed melanomas, exclusively in tumors with mutations in BRAF or NRAS. Notably, we identified a recurrent UV-signature, an activating mutation in RAC1 in 9.2% of sun-exposed melanomas. This activating mutation, the third most frequentmore » in our cohort of sun-exposed melanoma after those of BRAF and NRAS, changes Pro29 to serine (RAC1{sup P29S}) in the highly conserved switch I domain. Crystal structures, and biochemical and functional studies of RAC1{sup P29S} showed that the alteration releases the conformational restraint conferred by the conserved proline, causes an increased binding of the protein to downstream effectors, and promotes melanocyte proliferation and migration. These findings raise the possibility that pharmacological inhibition of downstream effectors of RAC1 signaling could be of therapeutic benefit.« less

  10. Somatic mutations in benign breast disease tissue and risk of subsequent invasive breast cancer.

    PubMed

    Rohan, Thomas E; Miller, Christopher A; Li, Tiandao; Wang, Yihong; Loudig, Olivier; Ginsberg, Mindy; Glass, Andrew; Mardis, Elaine

    2018-06-06

    Insights into the molecular pathogenesis of breast cancer might come from molecular analysis of tissue from early stages of the disease. We conducted a case-control study nested in a cohort of women who had biopsy-confirmed benign breast disease (BBD) diagnosed between 1971 and 2006 at Kaiser Permanente Northwest and who were followed to mid-2015 to ascertain subsequent invasive breast cancer (IBC); cases (n = 218) were women with BBD who developed subsequent IBC and controls, individually matched (1:1) to cases, were women with BBD who did not develop IBC in the same follow-up interval as that for the corresponding case. Targeted sequence capture and sequencing were performed for 83 genes of importance in breast cancer. There were no significant case-control differences in mutation burden overall, for non-silent mutations, for individual genes, or with respect either to the nature of the gene mutations or to mutational enrichment at the pathway level. For seven subjects with DNA from the BBD and ipsilateral IBC, virtually no mutations were shared. This study, the first to use a targeted multi-gene sequencing approach on early breast cancer precursor lesions to investigate the genomic basis of the disease, showed that somatic mutations detected in BBD tissue were not associated with breast cancer risk.

  11. TSH Receptor Signaling Abrogation by a Novel Small Molecule

    PubMed Central

    Latif, Rauf; Realubit, Ronald B.; Karan, Charles; Mezei, Mihaly; Davies, Terry F.

    2016-01-01

    Pathological activation of the thyroid-stimulating hormone receptor (TSHR) is caused by thyroid-stimulating antibodies in patients with Graves’ disease (GD) or by somatic and rare genomic mutations that enhance constitutive activation of the receptor influencing both G protein and non-G protein signaling. Potential selective small molecule antagonists represent novel therapeutic compounds for abrogation of such abnormal TSHR signaling. In this study, we describe the identification and in vitro characterization of a novel small molecule antagonist by high-throughput screening (HTS). The identification of the TSHR antagonist was performed using a transcription-based TSH-inhibition bioassay. TSHR-expressing CHO cells, which also expressed a luciferase-tagged CRE response element, were optimized using bovine TSH as the activator, in a 384 well plate format, which had a Z score of 0.3–0.6. Using this HTS assay, we screened a diverse library of ~80,000 compounds at a final concentration of 16.7 μM. The selection criteria for a positive hit were based on a mean signal threshold of ≥50% inhibition of control TSH stimulation. The screening resulted in 450 positive hits giving a hit ratio of 0.56%. A secondary confirmation screen against TSH and forskolin – a post receptor activator of adenylyl cyclase – confirmed one TSHR-specific candidate antagonist molecule (named VA-K-14). This lead molecule had an IC50 of 12.3 μM and a unique chemical structure. A parallel analysis for cell viability indicated that the lead inhibitor was non-cytotoxic at its effective concentrations. In silico docking studies performed using a TSHR transmembrane model showed the hydrophobic contact locations and the possible mode of inhibition of TSHR signaling. Furthermore, this molecule was capable of inhibiting TSHR stimulation by GD patient sera and monoclonal-stimulating TSHR antibodies. In conclusion, we report the identification of a novel small molecule TSHR inhibitor, which has the potential to be developed as a therapeutic antagonist for abrogation of TSHR signaling by TSHR autoantibodies in GD. PMID:27729899

  12. Drug Resistance Missense Mutations in Cancer Are Subject to Evolutionary Constraints

    PubMed Central

    Friedman, Ran

    2013-01-01

    Several tumour types are sensitive to deactivation of just one or very few genes that are constantly active in the cancer cells, a phenomenon that is termed ‘oncogene addiction’. Drugs that target the products of those oncogenes can yield a temporary relief, and even complete remission. Unfortunately, many patients receiving oncogene-targeted therapies relapse on treatment. This often happens due to somatic mutations in the oncogene (‘resistance mutations’). ‘Compound mutations’, which in the context of cancer drug resistance are defined as two or more mutations of the drug target in the same clone may lead to enhanced resistance against the most selective inhibitors. Here, it is shown that the vast majority of the resistance mutations occurring in cancer patients treated with tyrosin kinase inhibitors aimed at three different proteins follow an evolutionary pathway. Using bioinformatic analysis tools, it is found that the drug-resistance mutations in the tyrosine kinase domains of Abl1, ALK and exons 20 and 21 of EGFR favour transformations to residues that can be identified in similar positions in evolutionary related proteins. The results demonstrate that evolutionary pressure shapes the mutational landscape in the case of drug-resistance somatic mutations. The constraints on the mutational landscape suggest that it may be possible to counter single drug-resistance point mutations. The observation of relatively many resistance mutations in Abl1, but not in the other genes, is explained by the fact that mutations in Abl1 tend to be biochemically conservative, whereas mutations in EGFR and ALK tend to be radical. Analysis of Abl1 compound mutations suggests that such mutations are more prevalent than hitherto reported and may be more difficult to counter. This supports the notion that such mutations may provide an escape route for targeted cancer drug resistance. PMID:24376513

  13. Mutational landscape of EGFR-, MYC-, and Kras-driven genetically engineered mouse models of lung adenocarcinoma

    PubMed Central

    McFadden, David G.; Politi, Katerina; Bhutkar, Arjun; Chen, Frances K.; Song, Xiaoling; Pirun, Mono; Santiago, Philip M.; Kim-Kiselak, Caroline; Platt, James T.; Lee, Emily; Hodges, Emily; Rosebrock, Adam P.; Bronson, Roderick T.; Socci, Nicholas D.; Hannon, Gregory J.; Jacks, Tyler; Varmus, Harold

    2016-01-01

    Genetically engineered mouse models (GEMMs) of cancer are increasingly being used to assess putative driver mutations identified by large-scale sequencing of human cancer genomes. To accurately interpret experiments that introduce additional mutations, an understanding of the somatic genetic profile and evolution of GEMM tumors is necessary. Here, we performed whole-exome sequencing of tumors from three GEMMs of lung adenocarcinoma driven by mutant epidermal growth factor receptor (EGFR), mutant Kirsten rat sarcoma viral oncogene homolog (Kras), or overexpression of MYC proto-oncogene. Tumors from EGFR- and Kras-driven models exhibited, respectively, 0.02 and 0.07 nonsynonymous mutations per megabase, a dramatically lower average mutational frequency than observed in human lung adenocarcinomas. Tumors from models driven by strong cancer drivers (mutant EGFR and Kras) harbored few mutations in known cancer genes, whereas tumors driven by MYC, a weaker initiating oncogene in the murine lung, acquired recurrent clonal oncogenic Kras mutations. In addition, although EGFR- and Kras-driven models both exhibited recurrent whole-chromosome DNA copy number alterations, the specific chromosomes altered by gain or loss were different in each model. These data demonstrate that GEMM tumors exhibit relatively simple somatic genotypes compared with human cancers of a similar type, making these autochthonous model systems useful for additive engineering approaches to assess the potential of novel mutations on tumorigenesis, cancer progression, and drug sensitivity. PMID:27702896

  14. Mutational landscape of EGFR-, MYC-, and Kras-driven genetically engineered mouse models of lung adenocarcinoma.

    PubMed

    McFadden, David G; Politi, Katerina; Bhutkar, Arjun; Chen, Frances K; Song, Xiaoling; Pirun, Mono; Santiago, Philip M; Kim-Kiselak, Caroline; Platt, James T; Lee, Emily; Hodges, Emily; Rosebrock, Adam P; Bronson, Roderick T; Socci, Nicholas D; Hannon, Gregory J; Jacks, Tyler; Varmus, Harold

    2016-10-18

    Genetically engineered mouse models (GEMMs) of cancer are increasingly being used to assess putative driver mutations identified by large-scale sequencing of human cancer genomes. To accurately interpret experiments that introduce additional mutations, an understanding of the somatic genetic profile and evolution of GEMM tumors is necessary. Here, we performed whole-exome sequencing of tumors from three GEMMs of lung adenocarcinoma driven by mutant epidermal growth factor receptor (EGFR), mutant Kirsten rat sarcoma viral oncogene homolog (Kras), or overexpression of MYC proto-oncogene. Tumors from EGFR- and Kras-driven models exhibited, respectively, 0.02 and 0.07 nonsynonymous mutations per megabase, a dramatically lower average mutational frequency than observed in human lung adenocarcinomas. Tumors from models driven by strong cancer drivers (mutant EGFR and Kras) harbored few mutations in known cancer genes, whereas tumors driven by MYC, a weaker initiating oncogene in the murine lung, acquired recurrent clonal oncogenic Kras mutations. In addition, although EGFR- and Kras-driven models both exhibited recurrent whole-chromosome DNA copy number alterations, the specific chromosomes altered by gain or loss were different in each model. These data demonstrate that GEMM tumors exhibit relatively simple somatic genotypes compared with human cancers of a similar type, making these autochthonous model systems useful for additive engineering approaches to assess the potential of novel mutations on tumorigenesis, cancer progression, and drug sensitivity.

  15. Somatic diversification in the heavy chain variable region genes expressed by human autoantibodies bearing a lupus-associated nephritogenic anti-DNA idiotype

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Demaison, C.; Chastagner, P.; Theze, J.

    1994-01-18

    Monoclonal anti-DNA antibodies bearing a lupus nephritis-associated idiotype were derived from five patients with systemic lupus erythematosus (SLE). Genes encoding their heavy (H)-chain variable (V[sub H]) regions were cloned and sequenced. When compared with their closest V[sub h] germ-line gene relatives, these sequences exhibit a number of silent (S) and replacement (R) substitutions. The ratios of R/S mutations were much higher in the complementarity-determining regions (CDRs) of the antibodies than in the framework regions. Molecular amplification of genomic V[sub H] genes and Southern hybridization with somatic CDR2-specific oligonucleotide probes showed that the configuration of the V[sub H] genes corresponding tomore » V[sub H] sequences in the nephritogenic antibodies is not present in the patient's own germ-line DNA, implying that the B-cell clones underwent somatic mutation in vivo. These findings, together with the characteristics of the diversity and junctional gene elements utilized to form the antibody, indicate that these autoantibodies have been driven through somatic selection processes reminiscent of those that govern antibody responses triggered by exogenous stimuli.« less

  16. Germline mutations of KIT in gastrointestinal stromal tumor (GIST) and mastocytosis.

    PubMed

    Ke, Hengning; Kazi, Julhash U; Zhao, Hui; Sun, Jianmin

    2016-01-01

    Somatic mutations of KIT are frequently found in mastocytosis and gastrointestinal stromal tumor (GIST), while germline mutations of KIT are rare, and only found in few cases of familial GIST and mastocytosis. Although ligand-independent activation is the common feature of KIT mutations, the phenotypes mediated by various germline KIT mutations are different. Germline KIT mutations affect different tissues such as interstitial cells of Cajal (ICC), mast cells or melanocytes, and thereby lead to GIST, mastocytosis, or abnormal pigmentation. In this review, we summarize germline KIT mutations in familial mastocytosis and GIST and discuss the possible cellular context dependent transforming activity of KIT mutations.

  17. Novel KRAS Gene Mutations in Sporadic Colorectal Cancer

    PubMed Central

    Naser, Walid M.; Shawarby, Mohamed A.; Al-Tamimi, Dalal M.; Seth, Arun; Al-Quorain, Abdulaziz; Nemer, Areej M. Al; Albagha, Omar M. E.

    2014-01-01

    Introduction In this article, we report 7 novel KRAS gene mutations discovered while retrospectively studying the prevalence and pattern of KRAS mutations in cancerous tissue obtained from 56 Saudi sporadic colorectal cancer patients from the Eastern Province. Methods Genomic DNA was extracted from formalin-fixed, paraffin-embedded cancerous and noncancerous colorectal tissues. Successful and specific PCR products were then bi-directionally sequenced to detect exon 4 mutations while Mutector II Detection Kits were used for identifying mutations in codons 12, 13 and 61. The functional impact of the novel mutations was assessed using bioinformatics tools and molecular modeling. Results KRAS gene mutations were detected in the cancer tissue of 24 cases (42.85%). Of these, 11 had exon 4 mutations (19.64%). They harbored 8 different mutations all of which except two altered the KRAS protein amino acid sequence and all except one were novel as revealed by COSMIC database. The detected novel mutations were found to be somatic. One mutation is predicted to be benign. The remaining mutations are predicted to cause substantial changes in the protein structure. Of these, the Q150X nonsense mutation is the second truncating mutation to be reported in colorectal cancer in the literature. Conclusions Our discovery of novel exon 4 KRAS mutations that are, so far, unique to Saudi colorectal cancer patients may be attributed to environmental factors and/or racial/ethnic variations due to genetic differences. Alternatively, it may be related to paucity of clinical studies on mutations other than those in codons 12, 13, 61 and 146. Further KRAS testing on a large number of patients of various ethnicities, particularly beyond the most common hotspot alleles in exons 2 and 3 is needed to assess the prevalence and explore the exact prognostic and predictive significance of the discovered novel mutations as well as their possible role in colorectal carcinogenesis. PMID:25412182

  18. Mutation Pattern of Paired Immunoglobulin Heavy and Light Variable Domains in Chronic Lymphocytic Leukemia B Cells

    PubMed Central

    Ghiotto, Fabio; Marcatili, Paolo; Tenca, Claudya; Calevo, Maria Grazia; Yan, Xiao-Jie; Albesiano, Emilia; Bagnara, Davide; Colombo, Monica; Cutrona, Giovanna; Chu, Charles C; Morabito, Fortunato; Bruno, Silvia; Ferrarini, Manlio; Tramontano, Anna; Fais, Franco; Chiorazzi, Nicholas

    2011-01-01

    B-cell chronic lymphocytic leukemia (CLL) patients display leukemic clones bearing either germline or somatically mutated immunoglobulin heavy variable (IGHV ) genes. Most information on CLL immunoglobulins (Igs), such as the definition of stereotyped B-cell receptors (BCRs), was derived from germline unmutated Igs. In particular, detailed studies on the distribution and nature of mutations in paired heavy- and light-chain domains of CLL clones bearing mutated Igs are lacking. To address the somatic hyper-mutation dynamics of CLL Igs, we analyzed the mutation pattern of paired IGHV–diversity-joining (IGHV-D-J ) and immunoglobulin kappa/lambda variable-joining (IGK/LV-J ) rearrangements of 193 leukemic clones that displayed ≥2% mutations in at least one of the two immunoglobulin variable (IGV ) genes (IGHV and/or IGK/LV ). The relationship between the mutation frequency in IGHV and IGK/LV complementarity determining regions (CDRs) and framework regions (FRs) was evaluated by correlation analysis. Replacement (R) mutation frequency within IGK/LV chain CDRs correlated significantly with mutation frequency of paired IGHV CDRs in λ but not κ isotype CLL clones. CDRs of IGKV-J rearrangements displayed a lower percentage of R mutations than IGHVs. The frequency/pattern of mutations in kappa CLL Igs differed also from that in κ-expressing normal B cells described in the literature. Instead, the mutation frequency within the FRs of IGHV and either IGKV or IGLV was correlated. Notably, the amount of diversity introduced by replaced amino acids was comparable between IGHVs and IGKVs. The data indicate a different mutation pattern between κ and λ isotype CLL clones and suggest an antigenic selection that, in κ samples, operates against CDR variation. PMID:21785810

  19. Genome Sequencing and Analysis of the Tasmanian Devil and Its Transmissible Cancer

    PubMed Central

    Murchison, Elizabeth P.; Schulz-Trieglaff, Ole B.; Ning, Zemin; Alexandrov, Ludmil B.; Bauer, Markus J.; Fu, Beiyuan; Hims, Matthew; Ding, Zhihao; Ivakhno, Sergii; Stewart, Caitlin; Ng, Bee Ling; Wong, Wendy; Aken, Bronwen; White, Simon; Alsop, Amber; Becq, Jennifer; Bignell, Graham R.; Cheetham, R. Keira; Cheng, William; Connor, Thomas R.; Cox, Anthony J.; Feng, Zhi-Ping; Gu, Yong; Grocock, Russell J.; Harris, Simon R.; Khrebtukova, Irina; Kingsbury, Zoya; Kowarsky, Mark; Kreiss, Alexandre; Luo, Shujun; Marshall, John; McBride, David J.; Murray, Lisa; Pearse, Anne-Maree; Raine, Keiran; Rasolonjatovo, Isabelle; Shaw, Richard; Tedder, Philip; Tregidgo, Carolyn; Vilella, Albert J.; Wedge, David C.; Woods, Gregory M.; Gormley, Niall; Humphray, Sean; Schroth, Gary; Smith, Geoffrey; Hall, Kevin; Searle, Stephen M.J.; Carter, Nigel P.; Papenfuss, Anthony T.; Futreal, P. Andrew; Campbell, Peter J.; Yang, Fengtang; Bentley, David R.; Evers, Dirk J.; Stratton, Michael R.

    2012-01-01

    Summary The Tasmanian devil (Sarcophilus harrisii), the largest marsupial carnivore, is endangered due to a transmissible facial cancer spread by direct transfer of living cancer cells through biting. Here we describe the sequencing, assembly, and annotation of the Tasmanian devil genome and whole-genome sequences for two geographically distant subclones of the cancer. Genomic analysis suggests that the cancer first arose from a female Tasmanian devil and that the clone has subsequently genetically diverged during its spread across Tasmania. The devil cancer genome contains more than 17,000 somatic base substitution mutations and bears the imprint of a distinct mutational process. Genotyping of somatic mutations in 104 geographically and temporally distributed Tasmanian devil tumors reveals the pattern of evolution and spread of this parasitic clonal lineage, with evidence of a selective sweep in one geographical area and persistence of parallel lineages in other populations. PaperClip PMID:22341448

  20. Conserved nonsense-prone CpG sites in apoptosis-regulatory genes: conditional stop signs on the road to cell death.

    PubMed

    Zhao, Yongzhong; Epstein, Richard J

    2013-01-01

    Methylation-prone CpG dinucleotides are strongly conserved in the germline, yet are also predisposed to somatic mutation. Here we quantify the relationship between germline codon mutability and somatic carcinogenesis by comparing usage of the nonsense-prone CGA (→TGA) codons in gene groups that differ in apoptotic function; to this end, suppressor genes were subclassified as either apoptotic (gatekeepers) or repair (caretakers). Mutations affecting CGA codons in sporadic tumors proved to be highly asymmetric. Moreover, nonsense mutations were 3-fold more likely to affect gatekeepers than caretakers. In addition, intragenic CGA clustering nonrandomly affected functionally critical regions of gatekeepers. We conclude that human gatekeeper suppressor genes are enriched for nonsense-prone codons, and submit that this germline vulnerability to tumors could reflect in utero selection for a methylation-dependent capability to short-circuit environmental insults that otherwise trigger apoptosis and fetal loss.

  1. SHP-2 acts via ROCK to regulate the cardiac actin cytoskeleton

    PubMed Central

    Langdon, Yvette; Tandon, Panna; Paden, Erika; Duddy, Jennifer; Taylor, Joan M.; Conlon, Frank L.

    2012-01-01

    Noonan syndrome is one of the most common causes of human congenital heart disease and is frequently associated with missense mutations in the protein phosphatase SHP-2. Interestingly, patients with acute myelogenous leukemia (AML), acute lymphoblastic leukemia (ALL), juvenile myelomonocytic leukemia (JMML) and LEOPARD syndrome frequently carry a second, somatically introduced subset of missense mutations in SHP-2. To determine the cellular and molecular mechanisms by which SHP-2 regulates heart development and, thus, understand how Noonan-associated mutations affect cardiogenesis, we introduced SHP-2 encoding the most prevalent Noonan syndrome and JMML mutations into Xenopus embryos. Resulting embryos show a direct relationship between a Noonan SHP-2 mutation and its ability to cause cardiac defects in Xenopus; embryos expressing Noonan SHP-2 mutations exhibit morphologically abnormal hearts, whereas those expressing an SHP-2 JMML-associated mutation do not. Our studies indicate that the cardiac defects associated with the introduction of the Noonan-associated SHP-2 mutations are coupled with a delay or arrest of the cardiac cell cycle in M-phase and a failure of cardiomyocyte progenitors to incorporate into the developing heart. We show that these defects are a result of an underlying malformation in the formation and polarity of cardiac actin fibers and F-actin deposition. We show that these defects can be rescued in culture and in embryos through the inhibition of the Rho-associated, coiled-coil-containing protein kinase 1 (ROCK), thus demonstrating a direct relationship between SHP-2N308D and ROCK activation in the developing heart. PMID:22278918

  2. SHP-2 acts via ROCK to regulate the cardiac actin cytoskeleton.

    PubMed

    Langdon, Yvette; Tandon, Panna; Paden, Erika; Duddy, Jennifer; Taylor, Joan M; Conlon, Frank L

    2012-03-01

    Noonan syndrome is one of the most common causes of human congenital heart disease and is frequently associated with missense mutations in the protein phosphatase SHP-2. Interestingly, patients with acute myelogenous leukemia (AML), acute lymphoblastic leukemia (ALL), juvenile myelomonocytic leukemia (JMML) and LEOPARD syndrome frequently carry a second, somatically introduced subset of missense mutations in SHP-2. To determine the cellular and molecular mechanisms by which SHP-2 regulates heart development and, thus, understand how Noonan-associated mutations affect cardiogenesis, we introduced SHP-2 encoding the most prevalent Noonan syndrome and JMML mutations into Xenopus embryos. Resulting embryos show a direct relationship between a Noonan SHP-2 mutation and its ability to cause cardiac defects in Xenopus; embryos expressing Noonan SHP-2 mutations exhibit morphologically abnormal hearts, whereas those expressing an SHP-2 JMML-associated mutation do not. Our studies indicate that the cardiac defects associated with the introduction of the Noonan-associated SHP-2 mutations are coupled with a delay or arrest of the cardiac cell cycle in M-phase and a failure of cardiomyocyte progenitors to incorporate into the developing heart. We show that these defects are a result of an underlying malformation in the formation and polarity of cardiac actin fibers and F-actin deposition. We show that these defects can be rescued in culture and in embryos through the inhibition of the Rho-associated, coiled-coil-containing protein kinase 1 (ROCK), thus demonstrating a direct relationship between SHP-2(N308D) and ROCK activation in the developing heart.

  3. Whole Exome Sequencing Identifies de Novo Mutations in GATA6 Associated with Congenital Diaphragmatic Hernia

    PubMed Central

    Yu, Lan; Bennett, James T.; Wynn, Julia; Carvill, Gemma L.; Cheung, Yee Him; Shen, Yufeng; Mychaliska, George B.; Azarow, Kenneth S.; Crombleholme, Timothy M.; Chung, Dai H.; Potoka, Douglas; Warner, Brad W.; Bucher, Brian; Lim, Foong-Yen; Pietsch, John; Stolar, Charles; Aspelund, Gudrun; Arkovitz, Marc S.; Mefford, Heather; Chung, Wendy K.

    2014-01-01

    Background Congenital diaphragmatic hernia (CDH) is a common birth defect affecting 1 in 3,000 births. It is characterized by herniation of abdominal viscera through an incompletely formed diaphragm. Although chromosomal anomalies and mutations in several genes have been implicated, the cause for most patients is unknown. Methods We used whole exome sequencing in two families with CDH and congenital heart disease, and identified mutations in GATA6 in both. Results In the first family, we identified a de novo missense mutation (c.1366C>T, p.R456C) in a sporadic CDH patient with tetralogy of Fallot. In the second, a nonsense mutation (c.712G>T, p.G238*) was identified in two siblings with CDH and a large ventricular septal defect. The G238* mutation was inherited from their mother, who was clinically affected with congenital absence of the pericardium, patent ductus arteriosus, and intestinal malrotation. Deep sequencing of blood and saliva derived DNA from the mother suggested somatic mosaicism as an explanation for her milder phenotype, with only approximately 15% mutant alleles. To determine the frequency of GATA6 mutations in CDH, we sequenced the gene in 378 patients with CDH. We identified one additional de novo mutation (c.1071delG, p.V358Cfs34*). Conclusions Mutations in GATA6 have been previously associated with pancreatic agenesis and congenital heart disease. We conclude that, in addition to the heart and the pancreas, GATA6 is involved in development of two additional organs, the diaphragm and the pericardium. In addition we have shown that de novo mutations can contribute to the development of CDH, a common birth defect. PMID:24385578

  4. Frequent somatic TERT promoter mutations and CTNNB1 mutations in hepatocellular carcinoma.

    PubMed

    Lee, Seung Eun; Chang, Seong-Hwan; Kim, Wook Youn; Lim, So Dug; Kim, Wan Seop; Hwang, Tea Sook; Han, Hye Seung

    2016-10-25

    Genetic alterations of TERT and CTNNB1 have been documented in hepatocellular carcinoma. TERT promoter mutations are the earliest genetic events in the multistep process of hepatocarcinogenesis related to cirrhosis. However, analyses of TERT promoter and CTNNB1 mutations in hepatocellular carcinoma tumor samples have not been performed in the Korean population, where hepatitis B virus-related hepatocellular carcinoma is prevalent. In order to identify the role of TERT promoter and CTNNB1 mutations in the hepatocarcinogenesis and pathogenesis of recurrent hepatocellular carcinoma, we performed the sequence analyses in 140 hepatocellular nodules (including 107 hepatocellular carcinomas), and 8 pairs of matched primary and relapsed hepatocellular carcinomas. TERT promoter and CTNNB1 mutations were only observed in hepatocellular carcinomas but not in precursor lesions. Of 109 patients with hepatocellular carcinoma, 41 (39.0%) and 15 (14.6%) harbored TERT and CTNNB1 mutations, respectively. TERT promotermutations were significantly more frequent in hepatocellular carcinomas related to hepatitis C virus infection (5/6; 83.3%) compared to tumors of other etiologies (P = 0.001). In two cases, discordance in TERT promoter mutation status was observed between the primary and the corresponding recurrent hepatocellular carcinoma. The two patients with discordant cases had early relapses. In conclusion, we identified TERT promoter and CTNNB1 mutations as the most frequent somatic genetic alterations observed in hepatocellular carcinoma, indicating its pivotal role in hepatocarcinogenesis. Furthermore, we suggest the possibility of intratumoral genetic heterogeneity of TERT promoter mutations in hepatocellular carcinoma as indicated by the discordance in TERT promoter mutations between primary and corresponding recurrent hepatocellular carcinoma.

  5. Merkel Cell Polyomavirus Exhibits Dominant Control of the Tumor Genome and Transcriptome in Virus-Associated Merkel Cell Carcinoma.

    PubMed

    Starrett, Gabriel J; Marcelus, Christina; Cantalupo, Paul G; Katz, Joshua P; Cheng, Jingwei; Akagi, Keiko; Thakuria, Manisha; Rabinowits, Guilherme; Wang, Linda C; Symer, David E; Pipas, James M; Harris, Reuben S; DeCaprio, James A

    2017-01-03

    Merkel cell polyomavirus is the primary etiological agent of the aggressive skin cancer Merkel cell carcinoma (MCC). Recent studies have revealed that UV radiation is the primary mechanism for somatic mutagenesis in nonviral forms of MCC. Here, we analyze the whole transcriptomes and genomes of primary MCC tumors. Our study reveals that virus-associated tumors have minimally altered genomes compared to non-virus-associated tumors, which are dominated by UV-mediated mutations. Although virus-associated tumors contain relatively small mutation burdens, they exhibit a distinct mutation signature with observable transcriptionally biased kataegic events. In addition, viral integration sites overlap focal genome amplifications in virus-associated tumors, suggesting a potential mechanism for these events. Collectively, our studies indicate that Merkel cell polyomavirus is capable of hijacking cellular processes and driving tumorigenesis to the same severity as tens of thousands of somatic genome alterations. A variety of mutagenic processes that shape the evolution of tumors are critical determinants of disease outcome. Here, we sequenced the entire genome of virus-positive and virus-negative primary Merkel cell carcinomas (MCCs), revealing distinct mutation spectra and corresponding expression profiles. Our studies highlight the strong effect that Merkel cell polyomavirus has on the divergent development of viral MCC compared to the somatic alterations that typically drive nonviral tumorigenesis. A more comprehensive understanding of the distinct mutagenic processes operative in viral and nonviral MCCs has implications for the effective treatment of these tumors. Copyright © 2017 Starrett et al.

  6. Novel recurrently mutated genes and a prognostic mutation signature in colorectal cancer.

    PubMed

    Yu, Jun; Wu, William K K; Li, Xiangchun; He, Jun; Li, Xiao-Xing; Ng, Simon S M; Yu, Chang; Gao, Zhibo; Yang, Jie; Li, Miao; Wang, Qiaoxiu; Liang, Qiaoyi; Pan, Yi; Tong, Joanna H; To, Ka F; Wong, Nathalie; Zhang, Ning; Chen, Jie; Lu, Youyong; Lai, Paul B S; Chan, Francis K L; Li, Yingrui; Kung, Hsiang-Fu; Yang, Huanming; Wang, Jun; Sung, Joseph J Y

    2015-04-01

    Characterisation of colorectal cancer (CRC) genomes by next-generation sequencing has led to the discovery of novel recurrently mutated genes. Nevertheless, genomic data has not yet been used for CRC prognostication. To identify recurrent somatic mutations with prognostic significance in patients with CRC. Exome sequencing was performed to identify somatic mutations in tumour tissues of 22 patients with CRC, followed by validation of 187 recurrent and pathway-related genes using targeted capture sequencing in additional 160 cases. Seven significantly mutated genes, including four reported (APC, TP53, KRAS and SMAD4) and three novel recurrently mutated genes (CDH10, FAT4 and DOCK2), exhibited high mutation prevalence (6-14% for novel cancer genes) and higher-than-expected number of non-silent mutations in our CRC cohort. For prognostication, a five-gene-signature (CDH10, COL6A3, SMAD4, TMEM132D, VCAN) was devised, in which mutation(s) in one or more of these genes was significantly associated with better overall survival independent of tumor-node-metastasis (TNM) staging. The median survival time was 80.4 months in the mutant group versus 42.4 months in the wild type group (p=0.0051). The prognostic significance of this signature was successfully verified using the data set from the Cancer Genome Atlas study. The application of next-generation sequencing has led to the identification of three novel significantly mutated genes in CRC and a mutation signature that predicts survival outcomes for stratifying patients with CRC independent of TNM staging. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  7. Creation of Mice Bearing a Partial Duplication of HPRT Gene Marked with a GFP Gene and Detection of Revertant Cells In Situ as GFP-Positive Somatic Cells.

    PubMed

    Noda, Asao; Suemori, Hirofumi; Hirai, Yuko; Hamasaki, Kanya; Kodama, Yoshiaki; Mitani, Hiroshi; Landes, Reid D; Nakamura, Nori

    2015-01-01

    It is becoming clear that apparently normal somatic cells accumulate mutations. Such accumulations or propagations of mutant cells are thought to be related to certain diseases such as cancer. To better understand the nature of somatic mutations, we developed a mouse model that enables in vivo detection of rare genetically altered cells via GFP positive cells. The mouse model carries a partial duplication of 3' portion of X-chromosomal HPRT gene and a GFP gene at the end of the last exon. In addition, although HPRT gene expression was thought ubiquitous, the expression level was found insufficient in vivo to make the revertant cells detectable by GFP positivity. To overcome the problem, we replaced the natural HPRT-gene promoter with a CAG promoter. In such animals, termed HPRT-dup-GFP mouse, losing one duplicated segment by crossover between the two sister chromatids or within a single molecule of DNA reactivates gene function, producing hybrid HPRT-GFP proteins which, in turn, cause the revertant cells to be detected as GFP-positive cells in various tissues. Frequencies of green mutant cells were measured using fixed and frozen sections (liver and pancreas), fixed whole mount (small intestine), or by means of flow cytometry (unfixed splenocytes). The results showed that the frequencies varied extensively among individuals as well as among tissues. X-ray exposure (3 Gy) increased the frequency moderately (~2 times) in the liver and small intestine. Further, in two animals out of 278 examined, some solid tissues showed too many GFP-positive cells to score (termed extreme jackpot mutation). Present results illustrated a complex nature of somatic mutations occurring in vivo. While the HPRT-dup-GFP mouse may have a potential for detecting tissue-specific environmental mutagens, large inter-individual variations of mutant cell frequency cause the results unstable and hence have to be reduced. This future challenge will likely involve lowering the background mutation frequency, thus reducing inter-individual variation.

  8. Optimizing the molecular diagnosis of CDKL5 gene-related epileptic encephalopathy in boys.

    PubMed

    Mei, Davide; Darra, Francesca; Barba, Carmen; Marini, Carla; Fontana, Elena; Chiti, Laura; Parrini, Elena; Dalla Bernardina, Bernardo; Guerrini, Renzo

    2014-11-01

    Mutations involving the cyclin-dependent kinase-like 5 (CDKL5) gene cause an early onset epileptic encephalopathy (EE) with severe neurologic impairment and a skewed 12:1 female-to-male ratio. To date, 18 mutations have been described in boys. We analyzed our cohort of boys with early onset EE to assess the diagnostic yield of our molecular approach. We studied 74 boys who presented early onset severe seizures, including infantile spasms and developmental delay, in the setting of EE, using Sanger sequencing, next-generation sequencing (NGS) and multiplex ligation-dependent probe amplification (MLPA). We identified alterations involving CDKL5 in four boys (5.4%) using NGS in one and MLPA in three. Three of four mutations were indicative of somatic mosaicism. CDKL5 gene mutations accounted for 5.4% of boys with early onset EE. Somatic mosaic mutations might be even more represented than germline mutations, probably because their less deleterious effect enhances viability of the male embryo. The molecular approach used for CDKL5 screening remarkably influences the diagnostic yield in boys. Diagnosis is optimized by Sanger sequencing combined with array-based methods or MLPA; alternatively, NGS targeted resequencing designed to also detect copy number alterations, may be performed. Wiley Periodicals, Inc. © 2014 International League Against Epilepsy.

  9. Clinical implications of somatic mutations in aplastic anemia and myelodysplastic syndrome in genomic age.

    PubMed

    Maciejewski, Jaroslaw P; Balasubramanian, Suresh K

    2017-12-08

    Recent technological advances in genomics have led to the discovery of new somatic mutations and have brought deeper insights into clonal diversity. This discovery has changed not only the understanding of disease mechanisms but also the diagnostics and clinical management of bone marrow failure. The clinical applications of genomics include enhancement of current prognostic schemas, prediction of sensitivity or refractoriness to treatments, and conceptualization and selective application of targeted therapies. However, beyond these traditional clinical aspects, complex hierarchical clonal architecture has been uncovered and linked to the current concepts of leukemogenesis and stem cell biology. Detection of clonal mutations, otherwise typical of myelodysplastic syndrome, in the course of aplastic anemia (AA) and paroxysmal nocturnal hemoglobinuria has led to new pathogenic concepts in these conditions and created a new link between AA and its clonal complications, such as post-AA and paroxysmal nocturnal hemoglobinuria. Distinctions among founder vs subclonal mutations, types of clonal evolution (linear or branching), and biological features of individual mutations (sweeping, persistent, or vanishing) will allow for better predictions of the biologic impact they impart in individual cases. As clonal markers, mutations can be used for monitoring clonal dynamics of the stem cell compartment during physiologic aging, disease processes, and leukemic evolution. © 2016 by The American Society of Hematology. All rights reserved.

  10. Molecular characteristics of endometrial cancer coexisting with peritoneal malignant mesothelioma in Li-Fraumeni-like syndrome.

    PubMed

    Chao, Angel; Lai, Chyong-Huey; Lee, Yun-Shien; Ueng, Shir-Hwa; Lin, Chiao-Yun; Wang, Tzu-Hao

    2015-01-15

    Endometrial cancer that occurs concurrently with peritoneal malignant mesothelioma (PMM) is difficult to diagnose preoperatively. A postmenopausal woman had endometrial cancer extending to the cervix, vagina and pelvic lymph nodes, and PMM in bilateral ovaries, cul-de-sac, and multiple peritoneal sites. Adjuvant therapies included chemotherapy and radiotherapy. Targeted, massively parallel DNA sequencing and molecular inversion probe microarray analysis revealed a germline TP53 mutation compatible with Li-Fraumeni-like syndrome, somatic mutations of PIK3CA in the endometrial cancer, and a somatic mutation of GNA11 and JAK3 in the PMM. Large-scale genomic amplifications and some deletions were found in the endometrial cancer. The patient has been stable for 24 months after therapy. One of her four children was also found to carry the germline TP53 mutation. Molecular characterization of the coexistent tumors not only helps us make the definite diagnosis, but also provides information to select targeted therapies if needed in the future. Identification of germline TP53 mutation further urged us to monitor future development of malignancies in this patient and encourage cancer screening in her family.

  11. Lynch syndrome and Lynch syndrome mimics: The growing complex landscape of hereditary colon cancer

    PubMed Central

    Carethers, John M; Stoffel, Elena M

    2015-01-01

    Hereditary non-polyposis colorectal cancer (HNPCC) was previously synonymous with Lynch syndrome; however, identification of the role of germline mutations in the DNA mismatch repair (MMR) genes has made it possible to differentiate Lynch syndrome from other conditions associated with familial colorectal cancer (CRC). Broadly, HNPCC may be dichotomized into conditions that demonstrate defective DNA MMR and microsatellite instability (MSI) vs those conditions that demonstrate intact DNA MMR. Conditions characterized by MMR deficient CRCs include Lynch syndrome (germline MMR mutation), Lynch-like syndrome (biallelic somatic MMR mutations), constitutional MMR deficiency syndrome (biallelic germline MMR mutations), and sporadic MSI CRC (somatic biallelic methylation of MLH1). HNPCC conditions with intact DNA MMR associated with familial CRC include polymerase proofreading associated polyposis and familial colorectal cancer type X. Although next generation sequencing technologies have elucidated the genetic cause for some HNPCC conditions, others remain genetically undefined. Differentiating between Lynch syndrome and the other HNPCC disorders has profound implications for cancer risk assessment and surveillance of affected patients and their at-risk relatives. Clinical suspicion coupled with molecular tumor analysis and testing for germline mutations can help differentiate the clinical mimicry within HNPCC and facilitate diagnosis and management. PMID:26309352

  12. Lynch syndrome and Lynch syndrome mimics: The growing complex landscape of hereditary colon cancer.

    PubMed

    Carethers, John M; Stoffel, Elena M

    2015-08-21

    Hereditary non-polyposis colorectal cancer (HNPCC) was previously synonymous with Lynch syndrome; however, identification of the role of germline mutations in the DNA mismatch repair (MMR) genes has made it possible to differentiate Lynch syndrome from other conditions associated with familial colorectal cancer (CRC). Broadly, HNPCC may be dichotomized into conditions that demonstrate defective DNA MMR and microsatellite instability (MSI) vs those conditions that demonstrate intact DNA MMR. Conditions characterized by MMR deficient CRCs include Lynch syndrome (germline MMR mutation), Lynch-like syndrome (biallelic somatic MMR mutations), constitutional MMR deficiency syndrome (biallelic germline MMR mutations), and sporadic MSI CRC (somatic biallelic methylation of MLH1). HNPCC conditions with intact DNA MMR associated with familial CRC include polymerase proofreading associated polyposis and familial colorectal cancer type X. Although next generation sequencing technologies have elucidated the genetic cause for some HNPCC conditions, others remain genetically undefined. Differentiating between Lynch syndrome and the other HNPCC disorders has profound implications for cancer risk assessment and surveillance of affected patients and their at-risk relatives. Clinical suspicion coupled with molecular tumor analysis and testing for germline mutations can help differentiate the clinical mimicry within HNPCC and facilitate diagnosis and management.

  13. A human systemic lupus erythematosus-related anti-cardiolipin/single-stranded DNA autoantibody is encoded by a somatically mutated variant of the developmentally restricted 51P1 V[sub H] gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Van Es, J.H.; Aanstoot, H.; Gmelig-Meyling, F.H.J.

    1992-09-15

    The authors report the Ig H and L chain V region sequences from the cDNAs encoding a monoclonal human IgG anti-cardiolipin/ssDNA autoantibody (R149) derived from a patient with active SLE. Comparison with the germ-line V-gene repertoire of this patient revealed that R149 likely arose as a consequence of an Ag-driven selection process. The Ag-binding portions of the V regions were characterized by a high number of arginine residues, a property that has been associated with anti-dsDNA autoantibodies from lupus-prone mice and patients with SLE. The V[sub H] gene encoding autoantibody R149 was a somatically mutated variant of the 51P1 genemore » segment, which is frequently associated with the restricted fetal B cell repertoire, malignant CD5 B cells, and natural antibodies. These data suggest that in SLE patients a common antigenic stimulus may evoke anti-DNA and anti-cardiolipin autoantibodies and provide further evidence that a small set of developmentally restricted V[sub H] genes can give rise to disease-associated autoantibodies through Ag-selected somatic mutations. 42 refs., 5 figs.« less

  14. Generation of biallelic knock-out sheep via gene-editing and somatic cell nuclear transfer

    PubMed Central

    Li, Honghui; Wang, Gui; Hao, Zhiqiang; Zhang, Guozhong; Qing, Yubo; Liu, Shuanghui; Qing, Lili; Pan, Weirong; Chen, Lei; Liu, Guichun; Zhao, Ruoping; Jia, Baoyu; Zeng, Luyao; Guo, Jianxiong; Zhao, Lixiao; Zhao, Heng; Lv, Chaoxiang; Xu, Kaixiang; Cheng, Wenmin; Li, Hushan; Zhao, Hong-Ye; Wang, Wen; Wei, Hong-Jiang

    2016-01-01

    Transgenic sheep can be used to achieve genetic improvements in breeds and as an important large-animal model for biomedical research. In this study, we generated a TALEN plasmid specific for ovine MSTN and transfected it into fetal fibroblast cells of STH sheep. MSTN biallelic-KO somatic cells were selected as nuclear donor cells for SCNT. In total, cloned embryos were transferred into 37 recipient gilts, 28 (75.7%) becoming pregnant and 15 delivering, resulting in 23 lambs, 12 of which were alive. Mutations in the lambs were verified via sequencing and T7EI assay, and the gene mutation site was consistent with that in the donor cells. Off-target analysis was performed, and no off-target mutations were detected. MSTN KO affected the mRNA expression of MSTN relative genes. The growth curve for the resulting sheep suggested that MSTN KO caused a remarkable increase in body weight compared with those of wild-type sheep. Histological analyses revealed that MSTN KO resulted in muscle fiber hypertrophy. These findings demonstrate the successful generation of MSTN biallelic-KO STH sheep via gene editing in somatic cells using TALEN technology and SCNT. These MSTN mutant sheep developed and grew normally, and exhibited increased body weight and muscle growth. PMID:27654750

  15. MUFFINN: cancer gene discovery via network analysis of somatic mutation data.

    PubMed

    Cho, Ara; Shim, Jung Eun; Kim, Eiru; Supek, Fran; Lehner, Ben; Lee, Insuk

    2016-06-23

    A major challenge for distinguishing cancer-causing driver mutations from inconsequential passenger mutations is the long-tail of infrequently mutated genes in cancer genomes. Here, we present and evaluate a method for prioritizing cancer genes accounting not only for mutations in individual genes but also in their neighbors in functional networks, MUFFINN (MUtations For Functional Impact on Network Neighbors). This pathway-centric method shows high sensitivity compared with gene-centric analyses of mutation data. Notably, only a marginal decrease in performance is observed when using 10 % of TCGA patient samples, suggesting the method may potentiate cancer genome projects with small patient populations.

  16. The developmental basis for germline mosaicism in mouse and Drosophila melanogaster.

    PubMed

    Drost, J B; Lee, W R

    1998-01-01

    Data involving germline mosaics in Drosophila melanogaster and mouse are reconciled with developmental observations. Mutations that become fixed in the early embryo before separation of soma from the germline may, by the sampling process of development, continue as part of germline and/or differentiate into any somatic tissue. The cuticle of adult D. melanogaster, because of segmental development, can be used to estimate the proportion of mutant nuclei in the early embryo, but most somatic tissues and the germlines of both species continue from samples too small to be representative of the early embryo. Because of the small sample of cells/nuclei that remain in the germline after separation of soma in both species, mosaic germlines have percentages of mutant cells that vary widely, with a mean of 50% and an unusual platykurtic, flat-topped distribution. While the sampling process leads to similar statistical results for both species, their patterns of development are very different. In D. melanogaster the first differentiation is the separation of soma from germline with the germline continuing from a sample of only two to four nuclei, whereas the adult cuticle is a representative sample of cleavage nuclei. The presence of mosaicism in D. melanogaster germline is independent of mosaicism in the eye, head, and thorax. This independence was used to determine that mutations can occur at any of the early embryonic cell divisions and still average 50% mutant germ cells when the germline is mosaic; however, the later the mutation occurs, the higher the proportion of completely nonmutant germlines. In contrast to D. melanogaster, the first differentiation in the mouse does not separate soma from germline but produces the inner cell mass that is representative of the cleavage nuclei. Following formation of the primitive streak, the primordial germ cells develop at the base of the allantois and among a clonally related sample of cells, providing the same statistical distribution in the mouse germlines as in D. melanogaster. The proportion of mutations that are fixed during early embryonic development is greatly underestimated. For example, a DNA lesion in a postmeiotic gamete that becomes fixed as a dominant mutation during early embryonic development of the F1 may produce an individual completely mutant in the germ line and relevant somatic tissue or, alternatively, the F1 germline may be completely mutant but with no relevant somatic tissues for detecting the mutation until the F2. In both cases the mutation would be classified as complete in the F1 and F2, respectively, and not recognized as embryonic in origin. Because germ cells differentiate later in mammalian development, there are more opportunities for correlation between germline and soma in the mammal than Drosophila. However, because the germ cells and any somatic tissue, like blood, are derived from small samples, there may be many individuals that test negative in blood but have germlines that are either mosaic or entirely mutant.

  17. Somatic NLRP3 mosaicism in Muckle-Wells syndrome. A genetic mechanism shared by different phenotypes of cryopyrin-associated periodic syndromes.

    PubMed

    Nakagawa, Kenji; Gonzalez-Roca, Eva; Souto, Alejandro; Kawai, Toshinao; Umebayashi, Hiroaki; Campistol, Josep María; Cañellas, Jeronima; Takei, Syuji; Kobayashi, Norimoto; Callejas-Rubio, Jose Luis; Ortego-Centeno, Norberto; Ruiz-Ortiz, Estíbaliz; Rius, Fina; Anton, Jordi; Iglesias, Estibaliz; Jimenez-Treviño, Santiago; Vargas, Carmen; Fernandez-Martin, Julian; Calvo, Inmaculada; Hernández-Rodríguez, José; Mendez, María; Dordal, María Teresa; Basagaña, Maria; Bujan, Segundo; Yashiro, Masato; Kubota, Tetsuo; Koike, Ryuji; Akuta, Naoko; Shimoyama, Kumiko; Iwata, Naomi; Saito, Megumu K; Ohara, Osamu; Kambe, Naotomo; Yasumi, Takahiro; Izawa, Kazushi; Kawai, Tomoki; Heike, Toshio; Yagüe, Jordi; Nishikomori, Ryuta; Aróstegui, Juan I

    2015-03-01

    : Familial cold autoinflammatory syndrome, Muckle-Wells syndrome (MWS), and chronic, infantile, neurological, cutaneous and articular (CINCA) syndrome are dominantly inherited autoinflammatory diseases associated to gain-of-function NLRP3 mutations and included in the cryopyrin-associated periodic syndromes (CAPS). A variable degree of somatic NLRP3 mosaicism has been detected in ≈35% of patients with CINCA. However, no data are currently available regarding the relevance of this mechanism in other CAPS phenotypes. To evaluate somatic NLRP3 mosaicism as the disease-causing mechanism in patients with clinical CAPS phenotypes other than CINCA and NLRP3 mutation-negative. NLRP3 analyses were performed by Sanger sequencing and by massively parallel sequencing. Apoptosis-associated Speck-like protein containing a CARD (ASC)-dependent nuclear factor kappa-light chain-enhancer of activated B cells (NF-κB) activation and transfection-induced THP-1 cell death assays determined the functional consequences of the detected variants. A variable degree (5.5-34.9%) of somatic NLRP3 mosaicism was detected in 12.5% of enrolled patients, all of them with a MWS phenotype. Six different missense variants, three novel (p.D303A, p.K355T and p.L411F), were identified. Bioinformatics and functional analyses confirmed that they were disease-causing, gain-of-function NLRP3 mutations. All patients treated with anti-interleukin1 drugs showed long-lasting positive responses. We herein show somatic NLRP3 mosaicism underlying MWS, probably representing a shared genetic mechanism in CAPS not restricted to CINCA syndrome. The data here described allowed definitive diagnoses of these patients, which had serious implications for gaining access to anti-interleukin 1 treatments under legal indication and for genetic counselling. The detection of somatic mosaicism is difficult when using conventional methods. Potential candidates should benefit from the use of modern genetic tools. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  18. Late-Onset Cryopyrin-Associated Periodic Syndromes Caused by Somatic NLRP3 Mosaicism—UK Single Center Experience

    PubMed Central

    Rowczenio, Dorota M.; Gomes, Sónia Melo; Aróstegui, Juan I.; Mensa-Vilaro, Anna; Omoyinmi, Ebun; Trojer, Hadija; Baginska, Anna; Baroja-Mazo, Alberto; Pelegrin, Pablo; Savic, Sinisa; Lane, Thirusha; Williams, Rene; Brogan, Paul; Lachmann, Helen J.; Hawkins, Philip N.

    2017-01-01

    Cryopyrin-associated periodic syndrome (CAPS) is caused by gain-of-function NLRP3 mutations. Recently, somatic NLRP3 mosaicism has been reported in some CAPS patients who were previously classified as “mutation-negative.” We describe here the clinical and laboratory findings in eight British adult patients who presented with symptoms typical of CAPS other than an onset in mid-late adulthood. All patients underwent comprehensive clinical and laboratory investigations, including analysis of the NLRP3 gene using Sanger and amplicon-based deep sequencing (ADS) along with measurements of extracellular apoptosis-associated speck-like protein with CARD domain (ASC) aggregates. The clinical phenotype in all subjects was consistent with mid-spectrum CAPS, except a median age at disease onset of 50 years. Sanger sequencing of NLRP3 was non-diagnostic but ADS detected a somatic NLRP3 mutation in each case. In one patient, DNA isolated from blood demonstrated an increase in the mutant allele from 5 to 45% over 12 years. ASC aggregates in patients’ serum measured during active disease were significantly higher than healthy controls. This series represents 8% of CAPS patients diagnosed in a single center, suggesting that acquired NLRP3 mutations may not be an uncommon cause of the syndrome and should be sought in all patients with late-onset symptoms otherwise compatible with CAPS. Steadily worsening CAPS symptoms in one patient were associated with clonal expansion of the mutant allele predominantly affecting myeloid cells. Two patients developed AA amyloidosis, which previously has only been reported in CAPS in association with life-long germline NLRP3 mutations. PMID:29163488

  19. Diphtheria toxin resistance in human lymphocytes and lymphoblasts in the in vivo somatic cell mutation test

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tomkins, D.J.; Wei, L.; Laurie, K.E.

    1985-01-01

    It has been shown that circulating peripheral blood lymphocytes can be used for the enumeration of 6-thioguanine-resistant cells that presumably arise by mutation in vivo. This somatic cell mutation test has been studied in lymphocytes from human populations exposed to known mutagens and/or carcinogens. The sensitivity of the test could be further enhanced by including other gene markers, since there is evidence for locus-specific differences in response to mutagens. Resistance to diphtheria toxin (Dip/sup r/) seemed like a potential marker to incorporate into the test because the mutation acts codominantly, can readily be selected in human diploid fibroblasts and Chinesemore » hamster cells with no evidence for cell density or cross-feeding effects, and can be assayed for in nondividing cells by measuring protein synthesis inhibition. Blood samples were collected from seven individuals, and fresh, cryopreserved, or Epstein-Barr virus (EBV)-transformed lymphocytes were tested for continued DNA synthesis (TH-thymidine, autoradiography) or protein synthesis (TVS-methionine, scintillation counting). Both fresh and cryopreserved lymphocytes, stimulated to divide with phytohemagglutinin (PHA), continued to synthesize DNA in the presence of high doses of diphtheria toxin (DT). Similarly, both dividing (PHA-stimulated) and nondividing fresh lymphocytes carried on significant levels of protein synthesis even 68 hr after exposure to 100 flocculating units (LF)/ml DT. The results suggest that human T and B lymphocytes may not be as sensitive to DT protein synthesis inhibition as human fibroblast and Chinese hamster cells. For this reason, Dip/sup r/ may not be a suitable marker for the somatic cell mutation test.« less

  20. IMPACT: a whole-exome sequencing analysis pipeline for integrating molecular profiles with actionable therapeutics in clinical samples

    PubMed Central

    Hintzsche, Jennifer; Kim, Jihye; Yadav, Vinod; Amato, Carol; Robinson, Steven E; Seelenfreund, Eric; Shellman, Yiqun; Wisell, Joshua; Applegate, Allison; McCarter, Martin; Box, Neil; Tentler, John; De, Subhajyoti

    2016-01-01

    Objective Currently, there is a disconnect between finding a patient’s relevant molecular profile and predicting actionable therapeutics. Here we develop and implement the Integrating Molecular Profiles with Actionable Therapeutics (IMPACT) analysis pipeline, linking variants detected from whole-exome sequencing (WES) to actionable therapeutics. Methods and materials The IMPACT pipeline contains 4 analytical modules: detecting somatic variants, calling copy number alterations, predicting drugs against deleterious variants, and analyzing tumor heterogeneity. We tested the IMPACT pipeline on whole-exome sequencing data in The Cancer Genome Atlas (TCGA) lung adenocarcinoma samples with known EGFR mutations. We also used IMPACT to analyze melanoma patient tumor samples before treatment, after BRAF-inhibitor treatment, and after BRAF- and MEK-inhibitor treatment. Results IMPACT Food and Drug Administration (FDA) correctly identified known EGFR mutations in the TCGA lung adenocarcinoma samples. IMPACT linked these EGFR mutations to the appropriate FDA-approved EGFR inhibitors. For the melanoma patient samples, we identified NRAS p.Q61K as an acquired resistance mutation to BRAF-inhibitor treatment. We also identified CDKN2A deletion as a novel acquired resistance mutation to BRAFi/MEKi inhibition. The IMPACT analysis pipeline predicts these somatic variants to actionable therapeutics. We observed the clonal dynamic in the tumor samples after various treatments. We showed that IMPACT not only helped in successful prioritization of clinically relevant variants but also linked these variations to possible targeted therapies. Conclusion IMPACT provides a new bioinformatics strategy to delineate candidate somatic variants and actionable therapies. This approach can be applied to other patient tumor samples to discover effective drug targets for personalized medicine. IMPACT is publicly available at http://tanlab.ucdenver.edu/IMPACT. PMID:27026619

  1. A case study of an integrative genomic and experimental therapeutic approach for rare tumors: identification of vulnerabilities in a pediatric poorly differentiated carcinoma.

    PubMed

    Dela Cruz, Filemon S; Diolaiti, Daniel; Turk, Andrew T; Rainey, Allison R; Ambesi-Impiombato, Alberto; Andrews, Stuart J; Mansukhani, Mahesh M; Nagy, Peter L; Alvarez, Mariano J; Califano, Andrea; Forouhar, Farhad; Modzelewski, Beata; Mitchell, Chelsey M; Yamashiro, Darrell J; Marks, Lianna J; Glade Bender, Julia L; Kung, Andrew L

    2016-10-31

    Precision medicine approaches are ideally suited for rare tumors where comprehensive characterization may have diagnostic, prognostic, and therapeutic value. We describe the clinical case and molecular characterization of an adolescent with metastatic poorly differentiated carcinoma (PDC). Given the rarity and poor prognosis associated with PDC in children, we utilized genomic analysis and preclinical models to validate oncogenic drivers and identify molecular vulnerabilities. We utilized whole exome sequencing (WES) and transcriptome analysis to identify germline and somatic alterations in the patient's tumor. In silico and in vitro studies were used to determine the functional consequences of genomic alterations. Primary tumor was used to generate a patient-derived xenograft (PDX) model, which was used for in vivo assessment of predicted therapeutic options. WES revealed a novel germline frameshift variant (p.E1554fs) in APC, establishing a diagnosis of Gardner syndrome, along with a somatic nonsense (p.R790*) APC mutation in the tumor. Somatic mutations in TP53, MAX, BRAF, ROS1, and RPTOR were also identified and transcriptome and immunohistochemical analyses suggested hyperactivation of the Wnt/ß-catenin and AKT/mTOR pathways. In silico and biochemical assays demonstrated that the MAX p.R60Q and BRAF p.K483E mutations were activating mutations, whereas the ROS1 and RPTOR mutations were of lower utility for therapeutic targeting. Utilizing a patient-specific PDX model, we demonstrated in vivo activity of mTOR inhibition with temsirolimus and partial response to inhibition of MEK. This clinical case illustrates the depth of investigation necessary to fully characterize the functional significance of the breadth of alterations identified through genomic analysis.

  2. FOXL2 impairment in human disease.

    PubMed

    Verdin, Hannah; De Baere, Elfride

    2012-01-01

    FOXL2 encodes a forkhead transcription factor that plays important roles in the ovary during development and in post-natal, adult life. Here, we focus on the clinical consequences of FOXL2 impairment in human disease. In line with other forkhead transcription factors, its constitutional genetic defects and a somatic mutation lead to developmental disease and cancer, respectively. More than 100 unique constitutional mutations and regulatory defects have been found in blepharophimosis syndrome (BPES), a complex eyelid malformation associated (type I) or not (type II) with premature ovarian failure (POF). In agreement with the BPES phenotype, FOXL2 is expressed in the developing eyelids and in fetal and adult ovaries. Two knock-out mice and at least one natural animal model, the Polled Intersex Syndrome goat, are known. They recapitulate the BPES phenotype and have provided many insights into the ovarian pathology. Only a few constitutional mutations have been described in nonsyndromic POF. Moreover, a recurrent somatic mutation p.C134W was found to be specific for adult ovarian granulo-sa cell tumors. Functional studies investigating the consequences of FOXL2 mutations or regulatory defects have shed light on the molecular pathogenesis of the aforementioned conditions, and contributed considerably to genotype-phenotype correlations. Recently, a conditional knock-out of Foxl2 in the mouse induced somatic transdifferentiation of ovary into testis in adult mice, suggesting that Foxl2 has an anti-testis function in the adult ovary. This changed our view on the ovary and testis as terminally differentiated organs in adult mammals. Finally, this might have potential implications for the understanding and treatment of frequent conditions such as POF and polycystic ovary syndrome. Copyright © 2012 S. Karger AG, Basel.

  3. Monitoring exposure to atomic bomb radiation by somatic mutation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Akiyama, Mitoshi; Kyoizumi, Seishi; Kusunoki, Yoichiro

    Atomic bomb survivors are a population suitable for studying the relationship between somatic mutation and cancer risk because their exposure doses are relatively well known and their dose responses in terms of cancer risk have also been thoroughly studied. An analysis has been made of erythrocyte glycophorin A (GPA) gene mutations in 1,226 atomic bomb survivors in Hiroshima and Nagasaki. The GPA mutation frequency (Mf) increased slightly but significantly with age at the time of measurement and with the number of cigarettes smoked. After adjustment for the effect of smoking, the Mf was significantly higher in males than in femalesmore » and higher in Hiroshima than in Nagasaki. All of these characteristics of the background GPA Mf were in accord with those of solid tumor incidence obtained from an earlier epidemiological study of A-bomb survivors. Analysis of the dose effect on Mf revealed the doubling dose to be about 1.20 Sv and the minimum dose for detection of a significant increase to be about 0.24 Sv. No significant dose effect for difference in sex, city, or age at the time of bombing was observed. Interestingly, the doubling dose for the GPA Mf approximated that for solid cancer incidence (1.59 Sv). And the minimum dose for detection was not inconsistent with the data for solid cancer incidence. The dose effect was significantly higher in those diagnosed with cancer before or after measurement than in those without a history of cancer. These findings are consistent with the hypothesis that somatic mutations are the main cause of excess cancer risk from radiation exposure. 27 refs., 2 figs.« less

  4. Somatic mosaicism in Fanconi anemia: Evidence of genotypic reversion in lymphohematopoietic stem cells

    PubMed Central

    Gregory, John J.; Wagner, John E.; Verlander, Peter C.; Levran, Orna; Batish, Sat Dev; Eide, Cindy R.; Steffenhagen, Amy; Hirsch, Betsy; Auerbach, Arleen D.

    2001-01-01

    Somatic mosaicism has been observed previously in the lymphocyte population of patients with Fanconi anemia (FA). To identify the cellular origin of the genotypic reversion, we examined each lymphohematopoietic and stromal cell lineage in an FA patient with a 2815–2816ins19 mutation in FANCA and known lymphocyte somatic mosaicism. DNA extracted from individually plucked peripheral blood T cell colonies and marrow colony-forming unit granulocyte–macrophage and burst-forming unit erythroid cells revealed absence of the maternal FANCA exon 29 mutation in 74.0%, 80.3%, and 86.2% of colonies, respectively. These data, together with the absence of the FANCA exon 29 mutation in Epstein–Barr virus-transformed B cells and its presence in fibroblasts, indicate that genotypic reversion, most likely because of back mutation, originated in a lymphohematopoietic stem cell and not solely in a lymphocyte population. Contrary to a predicted increase in marrow cellularity resulting from reversion in a hematopoietic stem cell, pancytopenia was progressive. Additional evaluations revealed a partial deletion of 11q in 3 of 20 bone marrow metaphase cells. By using interphase fluorescence in situ hybridization with an MLL gene probe mapped to band 11q23 to identify colony-forming unit granulocyte–macrophage and burst-forming unit erythroid cells with the 11q deletion, the abnormal clone was exclusive to colonies with the FANCA exon 29 mutation. Thus, we demonstrate the spontaneous genotypic reversion in a lymphohematopoietic stem cell. The subsequent development of a clonal cytogenetic abnormality in nonrevertant cells suggests that ex vivo correction of hematopoietic stem cells by gene transfer may not be sufficient for providing life-long stable hematopoiesis in patients with FA. PMID:11226273

  5. IMPACT: a whole-exome sequencing analysis pipeline for integrating molecular profiles with actionable therapeutics in clinical samples.

    PubMed

    Hintzsche, Jennifer; Kim, Jihye; Yadav, Vinod; Amato, Carol; Robinson, Steven E; Seelenfreund, Eric; Shellman, Yiqun; Wisell, Joshua; Applegate, Allison; McCarter, Martin; Box, Neil; Tentler, John; De, Subhajyoti; Robinson, William A; Tan, Aik Choon

    2016-07-01

    Currently, there is a disconnect between finding a patient's relevant molecular profile and predicting actionable therapeutics. Here we develop and implement the Integrating Molecular Profiles with Actionable Therapeutics (IMPACT) analysis pipeline, linking variants detected from whole-exome sequencing (WES) to actionable therapeutics. The IMPACT pipeline contains 4 analytical modules: detecting somatic variants, calling copy number alterations, predicting drugs against deleterious variants, and analyzing tumor heterogeneity. We tested the IMPACT pipeline on whole-exome sequencing data in The Cancer Genome Atlas (TCGA) lung adenocarcinoma samples with known EGFR mutations. We also used IMPACT to analyze melanoma patient tumor samples before treatment, after BRAF-inhibitor treatment, and after BRAF- and MEK-inhibitor treatment. IMPACT Food and Drug Administration (FDA) correctly identified known EGFR mutations in the TCGA lung adenocarcinoma samples. IMPACT linked these EGFR mutations to the appropriate FDA-approved EGFR inhibitors. For the melanoma patient samples, we identified NRAS p.Q61K as an acquired resistance mutation to BRAF-inhibitor treatment. We also identified CDKN2A deletion as a novel acquired resistance mutation to BRAFi/MEKi inhibition. The IMPACT analysis pipeline predicts these somatic variants to actionable therapeutics. We observed the clonal dynamic in the tumor samples after various treatments. We showed that IMPACT not only helped in successful prioritization of clinically relevant variants but also linked these variations to possible targeted therapies. IMPACT provides a new bioinformatics strategy to delineate candidate somatic variants and actionable therapies. This approach can be applied to other patient tumor samples to discover effective drug targets for personalized medicine.IMPACT is publicly available at http://tanlab.ucdenver.edu/IMPACT. © The Author 2016. Published by Oxford University Press on behalf of the American Medical Informatics Association. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  6. Oncogenic PIK3CA mutations occur in epidermal nevi and seborrheic keratoses with a characteristic mutation pattern

    PubMed Central

    Hafner, Christian; López-Knowles, Elena; Luis, Nuno M.; Toll, Agustí; Baselga, Eulàlia; Fernández-Casado, Alex; Hernández, Silvia; Ribé, Adriana; Mentzel, Thomas; Stoehr, Robert; Hofstaedter, Ferdinand; Landthaler, Michael; Vogt, Thomas; Pujol, Ramòn M.; Hartmann, Arndt; Real, Francisco X.

    2007-01-01

    Activating mutations of the p110 α subunit of PI3K (PIK3CA) oncogene have been identified in a broad spectrum of malignant tumors. However, their role in benign or preneoplastic conditions is unknown. Activating FGF receptor 3 (FGFR3) mutations are common in benign skin lesions, either as embryonic mutations in epidermal nevi (EN) or as somatic mutations in seborrheic keratoses (SK). FGFR3 mutations are also common in low-grade malignant bladder tumors, where they often occur in association with PIK3CA mutations. Therefore, we examined exons 9 and 20 of PIK3CA and FGFR3 hotspot mutations in EN (n = 33) and SK (n = 62), two proliferative skin lesions lacking malignant potential. Nine of 33 (27%) EN harbored PIK3CA mutations; all cases showed the E545G substitution, which is uncommon in cancers. In EN, R248C was the only FGFR3 mutation identified. By contrast, 10 of 62 (16%) SK revealed the typical cancer-associated PIK3CA mutations E542K, E545K, and H1047R. The same lesions displayed a wide range of FGFR3 mutations. Corresponding unaffected tissue was available for four EN and two mutant SK: all control samples displayed a WT sequence, confirming the somatic nature of the mutations found in lesional tissue. Forty of 95 (42%) lesions showed at least one mutation in either gene. PIK3CA and FGFR3 mutations displayed an independent distribution; 5/95 lesions harbored mutations in both genes. Our findings suggest that, in addition to their role in cancer, oncogenic PIK3CA mutations contribute to the pathogenesis of skin tumors lacking malignant potential. The remarkable genotype–phenotype correlation as observed in this study points to a distinct etiopathogenesis of the mutations in keratinocytes occuring either during fetal development or in adult life. PMID:17673550

  7. Pms2 and uracil-DNA glycosylases act jointly in the mismatch repair pathway to generate Ig gene mutations at A-T base pairs.

    PubMed

    Girelli Zubani, Giulia; Zivojnovic, Marija; De Smet, Annie; Albagli-Curiel, Olivier; Huetz, François; Weill, Jean-Claude; Reynaud, Claude-Agnès; Storck, Sébastien

    2017-04-03

    During somatic hypermutation (SHM) of immunoglobulin genes, uracils introduced by activation-induced cytidine deaminase are processed by uracil-DNA glycosylase (UNG) and mismatch repair (MMR) pathways to generate mutations at G-C and A-T base pairs, respectively. Paradoxically, the MMR-nicking complex Pms2/Mlh1 is apparently dispensable for A-T mutagenesis. Thus, how detection of U:G mismatches is translated into the single-strand nick required for error-prone synthesis is an open question. One model proposed that UNG could cooperate with MMR by excising a second uracil in the vicinity of the U:G mismatch, but it failed to explain the low impact of UNG inactivation on A-T mutagenesis. In this study, we show that uracils generated in the G1 phase in B cells can generate equal proportions of A-T and G-C mutations, which suggests that UNG and MMR can operate within the same time frame during SHM. Furthermore, we show that Ung -/- Pms2 -/- mice display a 50% reduction in mutations at A-T base pairs and that most remaining mutations at A-T bases depend on two additional uracil glycosylases, thymine-DNA glycosylase and SMUG1. These results demonstrate that Pms2/Mlh1 and multiple uracil glycosylases act jointly, each one with a distinct strand bias, to enlarge the immunoglobulin gene mutation spectrum from G-C to A-T bases. © 2017 Girelli Zubani et al.

  8. Pms2 and uracil-DNA glycosylases act jointly in the mismatch repair pathway to generate Ig gene mutations at A-T base pairs

    PubMed Central

    De Smet, Annie; Albagli-Curiel, Olivier; Huetz, François; Weill, Jean-Claude

    2017-01-01

    During somatic hypermutation (SHM) of immunoglobulin genes, uracils introduced by activation-induced cytidine deaminase are processed by uracil-DNA glycosylase (UNG) and mismatch repair (MMR) pathways to generate mutations at G-C and A-T base pairs, respectively. Paradoxically, the MMR-nicking complex Pms2/Mlh1 is apparently dispensable for A-T mutagenesis. Thus, how detection of U:G mismatches is translated into the single-strand nick required for error-prone synthesis is an open question. One model proposed that UNG could cooperate with MMR by excising a second uracil in the vicinity of the U:G mismatch, but it failed to explain the low impact of UNG inactivation on A-T mutagenesis. In this study, we show that uracils generated in the G1 phase in B cells can generate equal proportions of A-T and G-C mutations, which suggests that UNG and MMR can operate within the same time frame during SHM. Furthermore, we show that Ung−/−Pms2−/− mice display a 50% reduction in mutations at A-T base pairs and that most remaining mutations at A-T bases depend on two additional uracil glycosylases, thymine-DNA glycosylase and SMUG1. These results demonstrate that Pms2/Mlh1 and multiple uracil glycosylases act jointly, each one with a distinct strand bias, to enlarge the immunoglobulin gene mutation spectrum from G-C to A-T bases. PMID:28283534

  9. Autosomal dominant polycystic kidney disease caused by somatic and germline mosaicism.

    PubMed

    Tan, A Y; Blumenfeld, J; Michaeel, A; Donahue, S; Bobb, W; Parker, T; Levine, D; Rennert, H

    2015-04-01

    Autosomal dominant polycystic kidney disease (ADPKD) is a heterogeneous genetic disorder caused by loss of function mutations of PKD1 or PKD2 genes. Although PKD1 is highly polymorphic and the new mutation rate is relatively high, the role of mosaicism is incompletely defined. Herein, we describe the molecular analysis of ADPKD in a 19-year-old female proband and her father. The proband had a PKD1 truncation mutation c.10745dupC (p.Val3584ArgfsX43), which was absent in paternal peripheral blood lymphocytes (PBL). However, very low quantities of this mutation were detected in the father's sperm DNA, but not in DNA from his buccal cells or urine sediment. Next generation sequencing (NGS) analysis determined the level of this mutation in the father's PBL, buccal cells and sperm to be ∼3%, 4.5% and 10%, respectively, consistent with somatic and germline mosaicism. The PKD1 mutation in ∼10% of her father's sperm indicates that it probably occurred early in embryogenesis. In ADPKD cases where a de novo mutation is suspected because of negative PKD gene testing of PBL, additional evaluation with more sensitive methods (e.g. NGS) of the proband PBL and paternal sperm can enhance detection of mosaicism and facilitate genetic counseling. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  10. Mutation drivers of immunological responses to cancer

    PubMed Central

    Porta-Pardo, Eduard; Godzik, Adam

    2016-01-01

    In cancer immunology, somatic missense mutations have been mostly studied regarding their role in the generation of neoantigens. However, growing evidence suggests that mutations in certain genes, such as CASP8 or TP53, influence the immune response against a tumor by other mechanisms. Identifying these genes and mechanisms is important because, just as the identification of cancer driver genes led to the development of personalized cancer therapies, a comprehensive catalog of such cancer immunity drivers will aid in the development of therapies aimed at restoring antitumor immunity. Here we present an algorithm, domainXplorer, that can be used to identify potential cancer immunity drivers. To demonstrate its potential, we used it to analyze a dataset of 5,164 tumor samples from TCGA and to identify protein domains whose mutation status correlates with the presence of immune cells in cancer tissue (immune infiltrate). We identified 122 such protein regions including several that belong to proteins with known roles in immune response, such as C2, CD163L1, or FCγR2A. In several cases we show that mutations within the same protein can be associated with more or less immune cell infiltration, depending on the specific domain mutated. These results expand the catalog of potential cancer immunity drivers and highlight the importance of taking into account the structural context of somatic mutations when analyzing their potential association with immune phenotypes. PMID:27401919

  11. Development of a novel class of B-RafV600E-selective inhibitors through virtual screening and hierarchical hit optimization

    PubMed Central

    Kong, Xiangqian; Qin, Jie; Li, Zeng; Vultur, Adina; Tong, Linjiang; Feng, Enguang; Rajan, Geena; Liu, Shien; Lu, Junyan; Liang, Zhongjie; Zheng, Mingyue; Zhu, Weiliang; Jiang, Hualiang; Herlyn, Meenhard; Liu, Hong; Marmorstein, Ronen; Luo, Cheng

    2012-01-01

    Oncogenic mutations in critical nodes of cellular signaling pathways have been associated with tumorigenesis and progression. The B-Raf protein kinase, a key hub in the canonical MAPK signaling cascade, is mutated in a broad range of human cancers and especially in malignant melanoma. The most prevalent B-RafV600E mutant exhibits elevated kinase activity and results in constitutive activation of the MAPK pathway, thus making it a promising drug target for cancer therapy. Herein, we described the development of novel B-RafV600E selective inhibitors via multi-step virtual screening and hierarchical hit optimization. Nine hit compounds with low micromolar IC50 values were identified as B-RafV600E inhibitors through virtual screening. Subsequent scaffold-based analogue searching and medicinal chemistry efforts significantly improved both the inhibitor potency and oncogene selectivity. In particular, compounds 22f and 22q possess nanomolar IC50 values with selectivity for B-RafV600E in vitro and exclusive cytotoxicity against B-RafV600E harboring cancer cells. PMID:22875039

  12. Development of a novel class of B-Raf(V600E)-selective inhibitors through virtual screening and hierarchical hit optimization.

    PubMed

    Kong, Xiangqian; Qin, Jie; Li, Zeng; Vultur, Adina; Tong, Linjiang; Feng, Enguang; Rajan, Geena; Liu, Shien; Lu, Junyan; Liang, Zhongjie; Zheng, Mingyue; Zhu, Weiliang; Jiang, Hualiang; Herlyn, Meenhard; Liu, Hong; Marmorstein, Ronen; Luo, Cheng

    2012-09-28

    Oncogenic mutations in critical nodes of cellular signaling pathways have been associated with tumorigenesis and progression. The B-Raf protein kinase, a key hub in the canonical MAPK signaling cascade, is mutated in a broad range of human cancers and especially in malignant melanoma. The most prevalent B-Raf(V600E) mutant exhibits elevated kinase activity and results in constitutive activation of the MAPK pathway, thus making it a promising drug target for cancer therapy. Herein, we describe the development of novel B-Raf(V600E) selective inhibitors via multi-step virtual screening and hierarchical hit optimization. Nine hit compounds with low micromolar IC(50) values were identified as B-Raf(V600E) inhibitors through virtual screening. Subsequent scaffold-based analogue searching and medicinal chemistry efforts significantly improved both the inhibitor potency and oncogene selectivity. In particular, compounds 22f and 22q possess nanomolar IC(50) values with selectivity for B-Raf(V600E)in vitro and exclusive cytotoxicity against B-Raf(V600E) harboring cancer cells.

  13. Further yearly analyses of spontaneous pink mutant events in the stamen hairs of tradescantia clone BNL 4430 cultivated in the NSC growth chamber.

    PubMed

    Ichikawa, S; Wushur, S

    2001-06-01

    In order to confirm the results obtained in the previous 1-year-term (December 12, 1998, through December 10, 1999) scorings and analyses of spontaneous pink mutant events (PMEs) in the stamen hairs of Tradescantia clone BNL 4430 cultivated in a nutrient solution circulating (NSC) growth chamber, similar scorings and analyses were continued for another 52-week period from December 11, 1999, through December 8, 2000. The environmental conditions were not changed, except for a minor modification in the method of supplying the nutrient solution used. During the scoring period, 732,128 stamen hairs with an average cell number of 24.90 cells were observed, and 2,368 PMEs were detected. The overall spontaneous somatic mutation frequency was 1.35 +/- 0.03 PMEs per 10(4) hair-cell divisions, which was significantly lower than the value of 1.56 +/- 0.03 determined in the previous 52-week period, and the frequencies were lower during April through September than in other months, the period showing lower frequencies lasting 1-month longer than in the previous year. The present results reconfirmed the occurrence of a clear seasonal variation in the spontaneous mutation frequency in the NSC growth chamber, and the lower overall frequency, probably related to the minor modification in supplying the nutrient solution, is helpful for conducting mutagenicity tests at low levels, offering a lower background level. The analyses of the sectoring patterns of all these PMEs showed that the most of the 203 cases of multiple (two to five) pink sectors observed in the same stamen hairs (scored as 253 PMEs for calculating mutation frequency) were the results of events involving somatic recombinations occurred in single cells or cell lineages, rather than those of two or more independent somatic mutations occurred in different cells, agreeing with our previous study, and the significance of somatic recombinations in causing single PMEs was also reconfirmed.

  14. Analysis of IgV gene mutations in B cell chronic lymphocytic leukaemia according to antigen-driven selection identifies subgroups with different prognosis and usage of the canonical somatic hypermutation machinery.

    PubMed

    Degan, Massimo; Bomben, Riccardo; Bo, Michele Dal; Zucchetto, Antonella; Nanni, Paola; Rupolo, Maurizio; Steffan, Agostino; Attadia, Vincenza; Ballerini, Pier Ferruccio; Damiani, Daniela; Pucillo, Carlo; Poeta, Giovanni Del; Colombatti, Alfonso; Gattei, Valter

    2004-07-01

    Cases of B-cell chronic lymphocytic leukaemia (B-CLL) with mutated (M) IgV(H) genes have a better prognosis than unmutated (UM) cases. We analysed the IgV(H) mutational status of B-CLL according to the features of a canonical somatic hypermutation (SHM) process, correlating this data with survival. In a series of 141 B-CLLs, 124 cases were examined for IgV(H) gene per cent mutations and skewing of replacement/silent mutations in the framework/complementarity-determining regions as evidence of antigen-driven selection; this identified three B-CLL subsets: significantly mutated (sM), with evidence of antigen-driven selection, not significantly mutated (nsM) and UM, without such evidence and IgV(H) gene per cent mutations above or below the 2% cut-off. sM B-CLL patients had longer survival within the good prognosis subgroup that had more than 2% mutations of IgV(H) genes. sM, nsM and UM B-CLL were also characterized for the biased usage of IgV(H) families, intraclonal IgV(H) gene diversification, preference of mutations to target-specific nucleotides or hotspots, and for the expression of enzymes involved in SHM (translesion DNA polymerase zeta and eta and activation-induced cytidine deaminase). These findings indicate the activation of a canonical SHM process in nsM and sM B-CLLs and underscore the role of the antigen in defining the specific clinical and biological features of B-CLL.

  15. Somatic mosaicism in a case of apparently sporadic Creutzfeldt-Jakob disease carrying a de novo D178N mutation in the PRNP gene.

    PubMed

    Alzualde, A; Moreno, F; Martínez-Lage, P; Ferrer, I; Gorostidi, A; Otaegui, D; Blázquez, L; Atares, B; Cardoso, S; Martínez de Pancorbo, M; Juste, R; Rodríguez-Martínez, A B; Indakoetxea, B; López de Munain, A

    2010-10-05

    Transmissible spongiform encephalopathies (TSEs) are a group of rare fatal neurodegenerative disorders. Creutzfeldt-Jakob disease (CJD) represents the most common form of TSE and can be classified into sporadic, genetic, iatrogenic and variant forms. Genetic cases are related to prion protein gene mutations but they only account for 10-20% of cases. Here we report an apparently sporadic CJD case with negative family history carrying a mutation at codon 178 of prion protein gene. This mutation is a de novo mutation as the parents of the case do not show it. Furthermore the presence of three different alleles (wild type 129M-178D and 129V-178D and mutated 129V-178N), confirmed by different methods, indicates that this de novo mutation is a post-zygotic mutation that produces somatic mosaicism. The proportion of mutated cells in peripheral blood cells and in brain tissue was similar and was estimated at approximately 97%, suggesting that the mutation occurred at an early stage of embryogenesis. Neuropathological examination disclosed spongiform change mainly involving the caudate and putamen, and the cerebral cortex, together with proteinase K-resistant PrP globular deposits in the cerebrum and cerebellum. PrP typing was characterized by a lower band of 21 kDa. This is the first case of mosaicism described in prion diseases and illustrates a potential etiology for apparently sporadic neurodegenerative diseases. In light of this case, genetic counseling for inherited and sporadic forms of transmissible encephalopathies should take into account this possibility for genetic screening procedures.

  16. Genomic analysis of the origins and evolution of multicentric diffuse lower-grade gliomas.

    PubMed

    Hayes, Josie; Yu, Yao; Jalbert, Llewellyn E; Mazor, Tali; Jones, Lindsey E; Wood, Matthew D; Walsh, Kyle M; Bengtsson, Henrik; Hong, Chibo; Oberndorfer, Stefan; Roetzer, Thomas; Smirnov, Ivan V; Clarke, Jennifer L; Aghi, Manish K; Chang, Susan M; Nelson, Sarah J; Woehrer, Adelheid; Phillips, Joanna J; Solomon, David A; Costello, Joseph F

    2018-04-09

    Rare multicentric lower-grade gliomas (LGGs) represent a unique opportunity to study the heterogeneity among distinct tumor foci in a single patient and to infer their origins and parallel patterns of evolution. In this study, we integrate clinical features, histology, and immunohistochemistry for 4 patients with multicentric LGG, arising both synchronously and metachronously. For 3 patients we analyze the phylogeny of the lesions using exome sequencing, including one case with a total of 8 samples from the 2 lesions. One patient was diagnosed with multicentric isocitrate dehydrogenase 1 (IDH1) mutated diffuse astrocytomas harboring distinct IDH1 mutations, R132H and R132C; the latter mutation has been associated with Li-Fraumeni syndrome, which was subsequently confirmed in the patient's germline DNA and shown in additional cases with The Cancer Genome Atlas data. In another patient, phylogenetic analysis of synchronously arising grade II and grade III diffuse astrocytomas demonstrated a single shared mutation, IDH1 R132H, and revealed convergent evolution via non-overlapping mutations in ATRX and TP53. In 2 cases, there was divergent evolution of IDH1-mutated and 1p/19q-codeleted oligodendroglioma and IDH1-mutated and 1p/19q-intact diffuse astrocytoma, occurring synchronously in one case and metachronously in a second. Each tumor in multicentric LGG cases may arise independently or may diverge very early in their development, presenting as genetically and histologically distinct tumors. Comprehensive sampling of these lesions can therefore significantly alter diagnosis and management. Additionally, somatic IDH1 R132C mutation in either multicentric or solitary LGG identifies unsuspected germline TP53 mutation, validating the limited number of published cases.

  17. The Gene of the Ubiquitin-Specific Protease 8 Is Frequently Mutated in Adenomas Causing Cushing's Disease.

    PubMed

    Perez-Rivas, Luis G; Theodoropoulou, Marily; Ferraù, Francesco; Nusser, Clara; Kawaguchi, Kohei; Stratakis, Constantine A; Faucz, Fabio Rueda; Wildemberg, Luiz E; Assié, Guillaume; Beschorner, Rudi; Dimopoulou, Christina; Buchfelder, Michael; Popovic, Vera; Berr, Christina M; Tóth, Miklós; Ardisasmita, Arif Ibrahim; Honegger, Jürgen; Bertherat, Jerôme; Gadelha, Monica R; Beuschlein, Felix; Stalla, Günter; Komada, Masayuki; Korbonits, Márta; Reincke, Martin

    2015-07-01

    We have recently reported somatic mutations in the ubiquitin-specific protease USP8 gene in a small series of adenomas of patients with Cushing's disease. To determine the prevalence of USP8 mutations and the genotype-phenotype correlation in a large series of patients diagnosed with Cushing's disease. We performed a retrospective, multicentric, genetic analysis of 134 functioning and 11 silent corticotroph adenomas using Sanger sequencing. Biochemical and clinical features were collected and examined within the context of the mutational status of USP8, and new mutations were characterized by functional studies. A total of 145 patients who underwent surgery for an ACTH-producing pituitary adenoma. Mutational status of USP8. Biochemical and clinical features included sex, age at diagnosis, tumor size, preoperative and postoperative hormonal levels, and comorbidities. We found somatic mutations in USP8 in 48 (36%) pituitary adenomas from patients with Cushing's disease but in none of 11 silent corticotropinomas. The prevalence was higher in adults than in pediatric cases (41 vs 17%) and in females than in males (43 vs 17%). Adults having USP8-mutated adenomas were diagnosed at an earlier age than those with wild-type lesions (36 vs 44 y). Mutations were primarily found in adenomas of 10 ± 7 mm and were inversely associated with the development of postoperative adrenal insufficiency. All the mutations affected the residues Ser718 or Pro720, including five new identified alterations. Mutations reduced the interaction between USP8 and 14-3-3 and enhanced USP8 activity. USP8 mutants diminished epidermal growth factor receptor ubiquitination and induced Pomc promoter activity in immortalized AtT-20 corticotropinoma cells. USP8 is frequently mutated in adenomas causing Cushing's disease, especially in those from female adult patients diagnosed at a younger age.

  18. A novel splicing site IRP1 somatic mutation in a patient with pheochromocytoma and JAK2V617F positive polycythemia vera: a case report.

    PubMed

    Pang, Ying; Gupta, Garima; Yang, Chunzhang; Wang, Herui; Huynh, Thanh-Truc; Abdullaev, Ziedulla; Pack, Svetlana D; Percy, Melanie J; Lappin, Terence R J; Zhuang, Zhengping; Pacak, Karel

    2018-03-13

    The role of the hypoxia signaling pathway in the pathogenesis of pheochromocytoma/paraganglioma (PPGL)-polycythemia syndrome has been elucidated. Novel somatic mutations in hypoxia-inducible factor type 2A (HIF2A) and germline mutations in prolyl hydroxylase type 1 and type 2 (PHD1 and PHD2) have been identified to cause upregulation of the hypoxia signaling pathway and its target genes including erythropoietin (EPO) and its receptor (EPOR). However, in a minority of patients presenting with this syndrome, the genetics and molecular pathogenesis remain unexplained. The aim of the present study was to uncover novel genetic causes of PPGL-polycythemia syndrome. A female presented with a history of JAK2 V617F positive PV, diagnosed in 2007, and right adrenal pheochromocytoma diagnosed and resected in 2011. Her polycythemia symptoms and hematocrit levels continued to worsen from 2007 to 2011, with an increased frequency of phlebotomies. Postoperatively, until early 2013, her hematocrit levels remained normalized. Following this, the hematocrit levels ranged between 46.4 and 48.9% [35-45%]. Tumor tissue from the patient was further tested for mutations in genes related to upregulation of the hypoxia signaling pathway including iron regulatory protein 1 (IRP1), which is a known regulator of HIF-2α mRNA translation. Functional studies were performed to investigate the consequences of these mutations, especially their effect on the HIF signaling pathway and EPO. Indel mutations (c.267-1_267delGGinsTA) were discovered at the exon 3 splicing site of IRP1. Minigene construct and splicing site analysis showed that the mutation led to a new splicing site and a frameshift mutation of IRP1, which caused a truncated protein. Fluorescence in situ hybridization analysis demonstrated heterozygous IRP1 deletions in tumor cells. Immunohistochemistry results confirmed the truncated IRP1 and overexpressed HIF-2α, EPO and EPOR in tumor cells. This is the first report which provides direct molecular genetic evidence of association between a somatic IRP1 loss-of-function mutation and PHEO and secondary polycythemia. In patients diagnosed with PHEO/PGL and polycythemia with negative genetic testing for mutations in HIF2A, PHD1/2, and VHL, IRP1 should be considered as a candidate gene.

  19. Somatic activating mutations in MAP2K1 cause melorheostosis.

    PubMed

    Kang, Heeseog; Jha, Smita; Deng, Zuoming; Fratzl-Zelman, Nadja; Cabral, Wayne A; Ivovic, Aleksandra; Meylan, Françoise; Hanson, Eric P; Lange, Eileen; Katz, James; Roschger, Paul; Klaushofer, Klaus; Cowen, Edward W; Siegel, Richard M; Marini, Joan C; Bhattacharyya, Timothy

    2018-04-11

    Melorheostosis is a sporadic disease of uncertain etiology characterized by asymmetric bone overgrowth and functional impairment. Using whole exome sequencing, we identify somatic mosaic MAP2K1 mutations in affected, but not unaffected, bone of eight unrelated patients with melorheostosis. The activating mutations (Q56P, K57E and K57N) cluster tightly in the MEK1 negative regulatory domain. Affected bone displays a mosaic pattern of increased p-ERK1/2 in osteoblast immunohistochemistry. Osteoblasts cultured from affected bone comprise two populations with distinct p-ERK1/2 levels by flow cytometry, enhanced ERK1/2 activation, and increased cell proliferation. However, these MAP2K1 mutations inhibit BMP2-mediated osteoblast mineralization and differentiation in vitro, underlying the markedly increased osteoid detected in affected bone histology. Mosaicism is also detected in the skin overlying bone lesions in four of five patients tested. Our data show that the MAP2K1 oncogene is important in human bone formation and implicate MEK1 inhibition as a potential treatment avenue for melorheostosis.

  20. Relevance of the immunoglobulin VH somatic mutation status in patients with chronic lymphocytic leukemia treated with fludarabine, cyclophosphamide, and rituximab (FCR) or related chemoimmunotherapy regimens.

    PubMed

    Lin, Katherine I; Tam, Constantine S; Keating, Michael J; Wierda, William G; O'Brien, Susan; Lerner, Susan; Coombes, Kevin R; Schlette, Ellen; Ferrajoli, Alessandra; Barron, Lynn L; Kipps, Thomas J; Rassenti, Laura; Faderl, Stefan; Kantarjian, Hagop; Abruzzo, Lynne V

    2009-04-02

    Although immunoglobulin V(H) mutation status (IgV(H) MS) is prognostic in patients with chronic lymphocytic leukemia (CLL) who are treated with alkylating agents or single-agent fludarabine, its significance in the era of chemoimmunotherapy is not known. We determined the IgV(H) somatic mutation status (MS) in 177 patients enrolled in a phase 2 study of fludarabine, cyclophosphamide, and rituximab (FCR) and in 127 patients treated with subsequent chemoimmunotherapy protocols. IgV(H) MS did not impact significantly on the complete remission (CR) rate of patients receiving FCR or related regimens. However, CR duration was significantly shorter in patients with CLL that used unmutated IgV(H) than those whose CLL used mutated IgV(H) (TTP 47% vs 82% at 6 years, P < .001). In a multivariate model considering all baseline characteristics, IgV(H) MS emerged as the only determinant of remission duration (hazard ratio 3.8, P < .001). Our results suggest that postremission interventions should be targeted toward patients with unmutated IgV(H) status.

  1. Scalable Open Science Approach for Mutation Calling of Tumor Exomes Using Multiple Genomic Pipelines.

    PubMed

    Ellrott, Kyle; Bailey, Matthew H; Saksena, Gordon; Covington, Kyle R; Kandoth, Cyriac; Stewart, Chip; Hess, Julian; Ma, Singer; Chiotti, Kami E; McLellan, Michael; Sofia, Heidi J; Hutter, Carolyn; Getz, Gad; Wheeler, David; Ding, Li

    2018-03-28

    The Cancer Genome Atlas (TCGA) cancer genomics dataset includes over 10,000 tumor-normal exome pairs across 33 different cancer types, in total >400 TB of raw data files requiring analysis. Here we describe the Multi-Center Mutation Calling in Multiple Cancers project, our effort to generate a comprehensive encyclopedia of somatic mutation calls for the TCGA data to enable robust cross-tumor-type analyses. Our approach accounts for variance and batch effects introduced by the rapid advancement of DNA extraction, hybridization-capture, sequencing, and analysis methods over time. We present best practices for applying an ensemble of seven mutation-calling algorithms with scoring and artifact filtering. The dataset created by this analysis includes 3.5 million somatic variants and forms the basis for PanCan Atlas papers. The results have been made available to the research community along with the methods used to generate them. This project is the result of collaboration from a number of institutes and demonstrates how team science drives extremely large genomics projects. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

  2. Expression of inflammation-related genes in aldosterone-producing adenomas with KCNJ5 mutation.

    PubMed

    Murakami, Masanori; Yoshimoto, Takanobu; Nakano, Yujiro; Tsuchiya, Kyoichiro; Minami, Isao; Bouchi, Ryotaro; Fujii, Yasuhisa; Nakabayashi, Kazuhiko; Hashimoto, Koshi; Hata, Ken-Ichiro; Kihara, Kazunori; Ogawa, Yoshihiro

    2016-08-05

    The adrenocortical cells have been shown to produce various inflammatory cytokines such as TNFα and IL-6, which could modulate steroidogenesis. However, the role of inflammatory cytokines in aldosterone-producing adenomas (APAs) is not fully understood. In the present study, we examined the relationships between mRNA expression levels of the inflammation-related genes and somatic mutations in APA tissues. We evaluated mRNA expression levels of TNFA, IL6, and NFKB1 in APA tissues obtained from 44 Japanese APA patients. We revealed that mRNA expression patterns of the inflammation-related genes depended on a KCNJ5 somatic mutation. In addition, we showed that mRNA expression levels of the inflammation-related genes correlated with those of the steroidogenic enzyme CYP11B1 in the patients with APAs. The present study documented for the first time the expression of inflammation-related genes in APAs and the correlation of their expression levels with the KCNJ5 mutation status and mRNA expression levels of steroidogenic enzymes, indicating the pathophysiological relevance of inflammation-related genes in APAs. Copyright © 2016 Elsevier Inc. All rights reserved.

  3. Recurrent SOX9 deletion campomelic dysplasia due to somatic mosaicism in the father.

    PubMed

    Smyk, M; Obersztyn, E; Nowakowska, B; Bocian, E; Cheung, S W; Mazurczak, T; Stankiewicz, P

    2007-04-15

    Haploinsufficiency of SOX9, a master gene in chondrogenesis and testis development, leads to the semi-lethal skeletal malformation syndrome campomelic dysplasia (CD), with or without XY sex reversal. We report on two children with CD and a phenotypically normal father, a carrier of a somatic mosaic SOX9 deletion. This is the first report of a mosaic deletion of SOX9; few familial CD cases with germline and somatic mutation mosaicism have been described. Our findings confirm the utility of aCGH and indicate that for a more accurate estimate of the recurrence risk for a completely penetrant autosomal dominant disorder, parental somatic mosaicism should be considered in healthy parents. Copyright 2007 Wiley-Liss, Inc.

  4. Report of a patient with a constitutional missense mutation in SMARCB1, Coffin-Siris phenotype, and schwannomatosis.

    PubMed

    Gossai, Nathan; Biegel, Jaclyn A; Messiaen, Ludwine; Berry, Susan A; Moertel, Christopher L

    2015-12-01

    We report a patient with a constitutional missense mutation in SMARCB1, Coffin-Siris Syndrome (CSS), and schwannomatosis. CSS is a rare congenital syndrome with characteristic clinical findings. This thirty-three-year-old man was diagnosed early in life with the constellation of moderate intellectual disability, hypotonia, mild microcephaly, coarse facies, wide mouth with full lips, hypoplasia of the digits, and general hirsutism. At age 26, he was found to have schwannomatosis after presenting with acute spinal cord compression. Blood and tissue analysis of multiple subsequent schwannoma resections revealed a germline missense mutation of SMARCB1, acquired loss of 22q including SMARCB1 and NF2 and mutation of the remaining NF2 wild-type allele-thus completing the four-hit, three-event mechanism associated with schwannomatosis. Variations in five genes have been associated with the Coffin-Siris phenotype: ARID1A, ARID1B, SMARCA4, SMARCB1, and SMARCE1. Of these genes, SMARCB1 has a well-established association with schwannomatosis and malignancy. This is the first report of a patient with a constitutional missense mutation of SMARCB1 resulting in CSS and subsequent development of schwannomatosis. This finding demonstrates that a SMARCB1 mutation may be the initial "hit" (constitutional) for a genetic disorder with subsequent risk of developing schwannomas and other malignancies, and raises the possibility that other patients with switch/sucrose non-fermenting (SWI/SNF) mutations may be at increased risk for tumors. © 2015 Wiley Periodicals, Inc.

  5. A novel molecular diagnostics platform for somatic and germline precision oncology.

    PubMed

    Cabanillas, Rubén; Diñeiro, Marta; Castillo, David; Pruneda, Patricia C; Penas, Cristina; Cifuentes, Guadalupe A; de Vicente, Álvaro; Durán, Noelia S; Álvarez, Rebeca; Ordóñez, Gonzalo R; Cadiñanos, Juan

    2017-07-01

    Next-generation sequencing (NGS) opens new options in clinical oncology, from therapy selection to genetic counseling. However, realization of this potential not only requires succeeding in the bioinformatics and interpretation of the results, but also in their integration into the clinical practice. We have developed a novel NGS diagnostic platform aimed at detecting (1) somatic genomic alterations associated with the response to approved targeted cancer therapies and (2) germline mutations predisposing to hereditary malignancies. Next-generation sequencing libraries enriched in the exons of 215 cancer genes (97 for therapy selection and 148 for predisposition, with 30 informative for both applications), as well as selected introns from 17 genes involved in drug-related rearrangements, were prepared from 39 tumors (paraffin-embedded tissues/cytologies), 36 germline samples (blood) and 10 cell lines using hybrid capture. Analysis of NGS results was performed with specifically developed bioinformatics pipelines. The platform detects single-nucleotide variants (SNVs) and insertions/deletions (indels) with sensitivity and specificity >99.5% (allelic frequency ≥0.1), as well as copy-number variants (CNVs) and rearrangements. Somatic testing identified tailored approved targeted drugs in 35/39 tumors (89.74%), showing a diagnostic yield comparable to that of leading commercial platforms. A somatic EGFR p.E746_S752delinsA mutation in a mediastinal metastasis from a breast cancer prompted its anatomopathologic reassessment, its definite reclassification as a lung cancer and its treatment with gefitinib (partial response sustained for 15 months). Testing of 36 germline samples identified two pathogenic mutations (in CDKN2A and BRCA2 ). We propose a strategy for interpretation and reporting of results adaptable to the aim of the request, the availability of tumor and/or normal samples and the scope of the informed consent. With an adequate methodology, it is possible to translate to the clinical practice the latest advances in precision oncology, integrating under the same platform the identification of somatic and germline genomic alterations.

  6. Germline PTPN11 and somatic PIK3CA variant in a boy with megalencephaly-capillary malformation syndrome (MCAP) - pure coincidence?

    PubMed Central

    Döcker, Dennis; Schubach, Max; Menzel, Moritz; Spaich, Christiane; Gabriel, Heinz-Dieter; Zenker, Martin; Bartholdi, Deborah; Biskup, Saskia

    2015-01-01

    Megalencephaly-capillary malformation (MCAP) syndrome is an overgrowth syndrome that is diagnosed by clinical criteria. Recently, somatic and germline variants in genes that are involved in the PI3K-AKT pathway (AKT3, PIK3R2 and PIK3CA) have been described to be associated with MCAP and/or other related megalencephaly syndromes. We performed trio-exome sequencing in a 6-year-old boy and his healthy parents. Clinical features were macrocephaly, cutis marmorata, angiomata, asymmetric overgrowth, developmental delay, discrete midline facial nevus flammeus, toe syndactyly and postaxial polydactyly—thus, clearly an MCAP phenotype. Exome sequencing revealed a pathogenic de novo germline variant in the PTPN11 gene (c.1529A>G; p.(Gln510Arg)), which has so far been associated with Noonan, as well as LEOPARD syndrome. Whole-exome sequencing (>100 × coverage) did not reveal any alteration in the known megalencephaly genes. However, ultra-deep sequencing results from saliva (>1000 × coverage) revealed a 22% mosaic variant in PIK3CA (c.2740G>A; p.(Gly914Arg)). To our knowledge, this report is the first description of a PTPN11 germline variant in an MCAP patient. Data from experimental studies show a complex interaction of SHP2 (gene product of PTPN11) and the PI3K-AKT pathway. We hypothesize that certain PTPN11 germline variants might drive toward additional second-hit alterations. PMID:24939587

  7. Germline PTPN11 and somatic PIK3CA variant in a boy with megalencephaly-capillary malformation syndrome (MCAP)--pure coincidence?

    PubMed

    Döcker, Dennis; Schubach, Max; Menzel, Moritz; Spaich, Christiane; Gabriel, Heinz-Dieter; Zenker, Martin; Bartholdi, Deborah; Biskup, Saskia

    2015-03-01

    Megalencephaly-capillary malformation (MCAP) syndrome is an overgrowth syndrome that is diagnosed by clinical criteria. Recently, somatic and germline variants in genes that are involved in the PI3K-AKT pathway (AKT3, PIK3R2 and PIK3CA) have been described to be associated with MCAP and/or other related megalencephaly syndromes. We performed trio-exome sequencing in a 6-year-old boy and his healthy parents. Clinical features were macrocephaly, cutis marmorata, angiomata, asymmetric overgrowth, developmental delay, discrete midline facial nevus flammeus, toe syndactyly and postaxial polydactyly--thus, clearly an MCAP phenotype. Exome sequencing revealed a pathogenic de novo germline variant in the PTPN11 gene (c.1529A>G; p.(Gln510Arg)), which has so far been associated with Noonan, as well as LEOPARD syndrome. Whole-exome sequencing (>100 × coverage) did not reveal any alteration in the known megalencephaly genes. However, ultra-deep sequencing results from saliva (>1000 × coverage) revealed a 22% mosaic variant in PIK3CA (c.2740G>A; p.(Gly914Arg)). To our knowledge, this report is the first description of a PTPN11 germline variant in an MCAP patient. Data from experimental studies show a complex interaction of SHP2 (gene product of PTPN11) and the PI3K-AKT pathway. We hypothesize that certain PTPN11 germline variants might drive toward additional second-hit alterations.

  8. Donation, Not Disease! A Multiple-Hit Hypothesis on Development of Post-Donation Kidney Disease.

    PubMed

    Cheng, Xingxing S; Glassock, Richard J; Lentine, Krista L; Chertow, Glenn M; Tan, Jane C

    2017-01-01

    The risks following living kidney donation has been the subject of rigorous investigation in the past several decades. How to utilize the burgeoning new knowledge base to better the risk assessment, education, and health maintenance of donors is unclear. We review the physiologic and epidemiologic evidences on the post-donation state and submit a multiple-hit hypothesis to reconcile the finite elevation in risk of kidney disease after donation with the benign course of most kidney donors. The risk of end-stage kidney disease is higher in kidney donors compared to similarly healthy non-kidney donors. Nonetheless, post-donation kidney disease is uncommon and arises mostly in the setting of other "hits"-either a "first hit" present at birth or a "second hit" acquired later in life. The transplant community's focus should be directed toward (1) personalized risk assessment to inform consent before donation and (2) preventing and treating development of "second hits" following kidney donation.

  9. Sequencing Structural Variants in Cancer for Precision Therapeutics.

    PubMed

    Macintyre, Geoff; Ylstra, Bauke; Brenton, James D

    2016-09-01

    The identification of mutations that guide therapy selection for patients with cancer is now routine in many clinical centres. The majority of assays used for solid tumour profiling use DNA sequencing to interrogate somatic point mutations because they are relatively easy to identify and interpret. Many cancers, however, including high-grade serous ovarian, oesophageal, and small-cell lung cancer, are driven by somatic structural variants that are not measured by these assays. Therefore, there is currently an unmet need for clinical assays that can cheaply and rapidly profile structural variants in solid tumours. In this review we survey the landscape of 'actionable' structural variants in cancer and identify promising detection strategies based on massively-parallel sequencing. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. Specific Intensity for Peaking: Is Race Pace the Best Option?

    PubMed Central

    Munoz, Iker; Seiler, Stephen; Alcocer, Alberto; Carr, Natasha; Esteve-Lanao, Jonathan

    2015-01-01

    Background: The peaking period for endurance competition is characterized for a relative increase of the intensity of training, after a longer period of training relatively dominated by lower intensity and higher volume Objectives: The present study was designed to compare physiological and 10 km performance effects of high intensity training (HIT) versus race pace interval training (RP) during peaking for competition in well-trained runners. Patients and Methods: 13 athletes took part in the study, they were divided into two groups: HIT and RP. HIT performed short intervals at ~105% of the maximal aerobic velocity (MAV), while RP trained longer intervals at a speed of ~90% of the MAV (a speed approximating 10 km race pace). After 12 weeks of baseline training, the athletes trained for 6 weeks under one of the two peaking regimes. Subjects performed 10 km prior to and after the intervention period. The total load of training was matched between groups during the treatment phase. Subjects completed a graded treadmill running test until volitional exhaustion prior to each 10 km race. MAV was determined as the minimal velocity eliciting maximal oxygen consumption (VO2max). Results: Both groups significantly improved their 10 km time (35 minutes 29 seconds ± 1 minutes 41 seconds vs 34 minutes 53 seconds ± 1 minutes 55 seconds, P < 0.01 for HIT; 35 minutes 27 seconds ± 1 minutes 40 seconds vs 34 minutes 53 seconds ± 1 minutes 18 seconds P < 0.01 for RP). VO2max increased after HIT (69 ± 3.6 vs 71.5 ± 4.2 ml.Kg-1.min-1, P < 0.05); while it didn’t for RP (68.4 ± 6 vs 69.8 ± 3 ml.Kg-1.min-1, p>0.05). In contrast, running economy decreased significantly after HIT (210 ± 6 ml.Kg-1.km-1 vs 218 ± 9, P < 0.05). Conclusions: A 6 week period of training at either 105% of MAV or 90% of MAV yielded similar performance gains in a 10km race performed at ~90% MAV. Therefore, the physiological impact of HIT training seems to be positive for VO2max but negative for running economy. PMID:26448854

  11. Parental mosaicism is a pitfall in preimplantation genetic diagnosis of dominant disorders.

    PubMed

    Steffann, Julie; Michot, Caroline; Borghese, Roxana; Baptista-Fernandes, Marcia; Monnot, Sophie; Bonnefont, Jean-Paul; Munnich, Arnold

    2014-05-01

    PCR amplification on single cells is prone to allele drop-out (PCR failure of one allele), a cause of misdiagnosis in preimplantation genetic diagnosis (PGD). Owing to this error risk, PGD usually relies on both direct and indirect genetic analyses. When the affected partner is the sporadic case of a dominant disorder, building haplotypes require spermatozoon or polar body testing prior to PGD, but these procedures are cost and time-consuming. A couple requested PGD because the male partner suffered from a dominant Cowden syndrome (CS). He was a sporadic case, but the couple had a first unaffected child and the non-mutated paternal haplotype was tentatively deduced. The couple had a second spontaneous pregnancy and the fetus was found to carry the at-risk haplotype but not the PTEN mutation. The mutation was present in blood from the affected father, but at low level, confirming the somatic mosaicism. Ignoring the possibility of mosaicism in the CS patient would have potentially led to selection of affected embryos. This observation emphasizes the risk of PGD in families at risk to transmit autosomal-dominant disorder when the affected partner is a sporadic case.

  12. Comparison of EGFR signaling pathway somatic DNA mutations derived from peripheral blood and corresponding tumor tissue of patients with advanced non-small-cell lung cancer using liquidchip technology.

    PubMed

    Zhang, Hui; Liu, Deruo; Li, Shanqing; Zheng, Yongqing; Yang, Xinjie; Li, Xi; Zhang, Quan; Qin, Na; Lu, Jialin; Ren-Heidenreich, Lifen; Yang, Huiyi; Wu, Yuhua; Zhang, Xinyong; Nong, Jingying; Sun, Yifen; Zhang, Shucai

    2013-11-01

    Somatic DNA mutations affecting the epidermal growth factor receptor (EGFR) signaling pathway are known to predict responsiveness to EGFR-tyrosine kinase inhibitor drugs in patients with advanced non-small-cell lung cancers. We evaluated a sensitive liquidchip platform for detecting EGFR, KRAS (alias Ki-ras), proto-oncogene B-Raf, and phosphatidylinositol 3-kinase CA mutations in plasma samples, which were highly correlated with matched tumor tissues from 86 patients with advanced non-small-cell lung cancers. Either EGFR exon 19 or 21 mutations were detected in 36 patients: 23 of whom had identical mutations in both their blood and tissue samples; whereas mutations in the remaining 13 were found only in their tumor samples. These EGFR mutations occurred at a significantly higher frequency in females, never-smokers, and in patients with adenocarcinomas (P ≤ 0.001). The EGFR exon 20 T790M mutation was detected in only one of the paired samples [100% (95% CI, 96% to 100%) agreement]. For KRAS, proto-oncogene B-Raf, and phosphatidylinositol 3-kinase CA mutations, the overall agreements were 97% (95% CI, 90% to 99%), 98% (95% CI, 92% to 99%), and 97% (95% CI, 90% to 99%), respectively, and these were not associated with age, sex, smoking history, or histopathologic type. In conclusion, mutations detected in plasma correlated strongly with mutation profiles in each respective tumor sample, suggesting that this liquidchip platform may offer a rapid and noninvasive method for predicting tumor responsiveness to EGFR-tyrosine kinase inhibitor drugs in patients with advanced non-small-cell lung cancers. Copyright © 2013 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  13. CREBBP mutations in relapsed acute lymphoblastic leukaemia

    PubMed Central

    Mullighan, Charles G.; Zhang, Jinghui; Kasper, Lawryn H.; Lerach, Stephanie; Payne-Turner, Debbie; Phillips, Letha A.; Heatley, Sue L.; Holmfeldt, Linda; Collins-Underwood, J. Racquel; Ma, Jing; Buetow, Kenneth H.; Pui, Ching-Hon; Baker, Sharyn D.; Brindle, Paul K.; Downing, James R.

    2010-01-01

    Relapsed acute lymphoblastic leukaemia (ALL) is a leading cause of death due to disease in young people, but the biologic determinants of treatment failure remain poorly understood. Recent genome-wide profiling of structural DNA alterations in ALL have identified multiple submicroscopic somatic mutations targeting key cellular pathways1,2, and have demonstrated substantial evolution in genetic alterations from diagnosis to relapse3. However, detailed analysis of sequence mutations in ALL has not been performed. To identify novel mutations in relapsed ALL, we resequenced 300 genes in matched diagnosis and relapse samples from 23 patients with ALL. This identified 52 somatic non-synonymous mutations in 32 genes, many of which were novel, including the transcriptional coactivators CREBBP and NCOR1, the transcription factors ERG, SPI1, TCF4 and TCF7L2, components of the Ras signalling pathway, histone genes, genes involved in histone modification (CREBBP and CTCF), and genes previously shown to be targets of recurring DNA copy number alteration in ALL. Analysis of an extended cohort of 71 diagnosis-relapse cases and 270 acute leukaemia cases that did not relapse found that 18.3% of relapse cases had sequence or deletion mutations of CREBBP, which encodes the transcriptional coactivator and histone acetyltransferase (HAT) CREB-binding protein (CBP)4. The mutations were either present at diagnosis or acquired at relapse, and resulted in truncated alleles or deleterious substitutions in conserved residues of the HAT domain. Functionally, the mutations impaired histone acetylation and transcriptional regulation of CREBBP targets, including glucocorticoid responsive genes. Several mutations acquired at relapse were detected in subclones at diagnosis, suggesting that the mutations may confer resistance to therapy. These results extend the landscape of genetic alterations in leukaemia, and identify mutations targeting transcriptional and epigenetic regulation as a mechanism of resistance in ALL. PMID:21390130

  14. Immunohistochemical loss of 5-hydroxymethylcytosine expression in acute myeloid leukaemia: relationship to somatic gene mutations affecting epigenetic pathways.

    PubMed

    Magotra, Minoti; Sakhdari, Ali; Lee, Paul J; Tomaszewicz, Keith; Dresser, Karen; Hutchinson, Lloyd M; Woda, Bruce A; Chen, Benjamin J

    2016-12-01

    Genes affecting epigenetic pathways are frequently mutated in myeloid malignancies, including acute myeloid leukaemia (AML). The genes encoding TET2, IDH1 and IDH2 are among the most commonly mutated genes, and cause defective conversion of 5-methylcytosine into 5-hydroxymethylcytosine (5hmC), impairing demethylation of DNA, and presumably serving as driver mutations in leukaemogenesis. The aim of this study was to correlate 5hmC immunohistochemical loss with the mutation status of genes involved in epigenetic pathways in AML. Immunohistochemical staining with an anti-5hmC antibody was performed on 41 decalcified, formalin-fixed paraffin-embedded (FFPE) bone marrow biopsies from patients with AML. Archived DNA was subjected to next-generation sequencing for analysis of a panel of genes, including TET2, IDH1, IDH2, WT1 and DNMT3A. TET2, IDH1, IDH2, WT1 and DNMT3A mutations were found in 46% (19/41) of the cases. Ten of 15 cases (67%) with TET2, IDH1, IDH2 or WT1 mutations showed deficient 5hmC staining, whereas nine of 26 cases (35%) without a mutation in these genes showed loss of 5hmC. It is of note that all four cases with TET2 mutations showed deficient 5hmC staining. Overall, somatic mutations in TET2, IDH1, IDH2, WT1 and DNMT3A were common in our cohort of AML cases. Immunohistochemical staining for 5hmC was lost in the majority of cases harbouring mutations in these genes, reflecting the proposed relationship between dysfunctional epigenetic pathways and leukaemogenesis. © 2016 John Wiley & Sons Ltd.

  15. Mutational Signature Mark Cancer’s Smoking Gun

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Alexandrov, Ludmil

    A broad computational study of cancer genome sequences by Los Alamos National Laboratory with the UK’s Wellcome Trust Sanger Institute and other collaborators identifies telltale mutational signatures associated with smoking tobacco. The research demonstrates, for the first time, that smoking increases cancer risk by causing somatic mutations in tissues directly and indirectly exposed to tobacco smoke. The international study was published in the November 4 issue of Science. The analysis shows that tobacco smoking causes mutations leading to cancer by multiple distinct mechanisms, including by damaging DNA in organs and by speeding up a mutational cellular clock.

  16. Mutational Signature Mark Cancer’s Smoking Gun

    ScienceCinema

    Alexandrov, Ludmil

    2018-06-13

    A broad computational study of cancer genome sequences by Los Alamos National Laboratory with the UK’s Wellcome Trust Sanger Institute and other collaborators identifies telltale mutational signatures associated with smoking tobacco. The research demonstrates, for the first time, that smoking increases cancer risk by causing somatic mutations in tissues directly and indirectly exposed to tobacco smoke. The international study was published in the November 4 issue of Science. The analysis shows that tobacco smoking causes mutations leading to cancer by multiple distinct mechanisms, including by damaging DNA in organs and by speeding up a mutational cellular clock.

  17. Monoallelic mutation analysis (MAMA) for identifying germline mutations.

    PubMed

    Papadopoulos, N; Leach, F S; Kinzler, K W; Vogelstein, B

    1995-09-01

    Dissection of germline mutations in a sensitive and specific manner presents a continuing challenge. In dominantly inherited diseases, mutations occur in only one allele and are often masked by the normal allele. Here we report the development of a sensitive and specific diagnostic strategy based on somatic cell hybridization termed MAMA (monoallelic mutation analysis). We have demonstrated the utility of this strategy in two different hereditary colorectal cancer syndromes, one caused by a defective tumour suppressor gene on chromosome 5 (familial adenomatous polyposis, FAP) and the other caused by a defective mismatch repair gene on chromosome 2 (hereditary non-polyposis colorectal cancer, HNPCC).

  18. Novel recurrently mutated genes in African American colon cancers.

    PubMed

    Guda, Kishore; Veigl, Martina L; Varadan, Vinay; Nosrati, Arman; Ravi, Lakshmeswari; Lutterbaugh, James; Beard, Lydia; Willson, James K V; Sedwick, W David; Wang, Zhenghe John; Molyneaux, Neil; Miron, Alexander; Adams, Mark D; Elston, Robert C; Markowitz, Sanford D; Willis, Joseph E

    2015-01-27

    We used whole-exome and targeted sequencing to characterize somatic mutations in 103 colorectal cancers (CRC) from African Americans, identifying 20 new genes as significantly mutated in CRC. Resequencing 129 Caucasian derived CRCs confirmed a 15-gene set as a preferential target for mutations in African American CRCs. Two predominant genes, ephrin type A receptor 6 (EPHA6) and folliculin (FLCN), with mutations exclusive to African American CRCs, are by genetic and biological criteria highly likely African American CRC driver genes. These previously unsuspected differences in the mutational landscapes of CRCs arising among individuals of different ethnicities have potential to impact on broader disparities in cancer behaviors.

  19. Macrolides Blunt Aldosterone Biosynthesis: A Proof-of-Concept Study in KCNJ5 Mutated Adenoma Cells Ex Vivo.

    PubMed

    Caroccia, Brasilina; Prisco, Selene; Seccia, Teresa Maria; Piazza, Maria; Maiolino, Giuseppe; Rossi, Gian Paolo

    2017-12-01

    Aldosterone-producing adenoma (APA), a major subtype of primary hyperaldosteronism, the main curable cause of human endocrine hypertension, involves somatic mutations in the potassium channel Kir3.4 ( KCNJ5 ) in 30% to 70% of cases, typically the more florid phenotypes. Because KCNJ5 mutated channels were reported to be specifically sensitive to inhibition by macrolide antibiotics, which concentration dependently blunts aldosterone production in HAC15 transfected with the G151R and L168R mutated channel, we herein tested the effect of clarithromycin on aldosterone synthesis and secretion in a pure population of aldosterone-secreting cells obtained by immunoseparation (CD56 + cells) from APA tissues with/without the 2 most common KCNJ5 mutations. From a large cohort of patients with an unambiguous APA diagnosis, we recruited those who were wild type (n=3) or had G151R (n=2) and L168R (n=2) mutations. We found that clarithromycin concentration dependently lowered CYP11B2 gene expression (by 60%) and aldosterone secretion (by 70%; P <0.001 for both) in CD56 + cells isolated ex vivo from KCNJ5 mutated APAs, although it was ineffective in CD56 + cells from wild-type APAs. By proving the principle that the oversecretion of aldosterone can be specifically blunted in APA cells ex vivo with G151R and L168R mutations, these results provide compelling evidence of the possibility of specifically correcting aldosterone excess in patients with APA carrying the 2 most common KCNJ5 somatic mutations. © 2017 American Heart Association, Inc.

  20. Biological characterization of adult MYC-translocation-positive mature B-cell lymphomas other than molecular Burkitt lymphoma.

    PubMed

    Aukema, Sietse M; Kreuz, Markus; Kohler, Christian W; Rosolowski, Maciej; Hasenclever, Dirk; Hummel, Michael; Küppers, Ralf; Lenze, Dido; Ott, German; Pott, Christiane; Richter, Julia; Rosenwald, Andreas; Szczepanowski, Monika; Schwaenen, Carsten; Stein, Harald; Trautmann, Heiko; Wessendorf, Swen; Trümper, Lorenz; Loeffler, Markus; Spang, Rainer; Kluin, Philip M; Klapper, Wolfram; Siebert, Reiner

    2014-04-01

    Chromosomal translocations affecting the MYC oncogene are the biological hallmark of Burkitt lymphomas but also occur in a subset of other mature B-cell lymphomas. If accompanied by a chromosomal break targeting the BCL2 and/or BCL6 oncogene these MYC translocation-positive (MYC(+)) lymphomas are called double-hit lymphomas, otherwise the term single-hit lymphomas is applied. In order to characterize the biological features of these MYC(+) lymphomas other than Burkitt lymphoma we explored, after exclusion of molecular Burkitt lymphoma as defined by gene expression profiling, the molecular, pathological and clinical aspects of 80 MYC-translocation-positive lymphomas (31 single-hit, 46 double-hit and 3 MYC(+)-lymphomas with unknown BCL6 status). Comparison of single-hit and double-hit lymphomas revealed no difference in MYC partner (IG/non-IG), genomic complexity, MYC expression or gene expression profile. Double-hit lymphomas more frequently showed a germinal center B-cell-like gene expression profile and had higher IGH and MYC mutation frequencies. Gene expression profiling revealed 130 differentially expressed genes between BCL6(+)/MYC(+) and BCL2(+)/MYC(+) double-hit lymphomas. BCL2(+)/MYC(+) double-hit lymphomas more frequently showed a germinal center B-like gene expression profile. Analysis of all lymphomas according to MYC partner (IG/non-IG) revealed no substantial differences. In this series of lymphomas, in which immunochemotherapy was administered in only a minority of cases, single-hit and double-hit lymphomas had a similar poor outcome in contrast to the outcome of molecular Burkitt lymphoma and lymphomas without the MYC break. Our data suggest that, after excluding molecular Burkitt lymphoma and pediatric cases, MYC(+) lymphomas are biologically quite homogeneous with single-hit and double-hit lymphomas as well as IG-MYC and non-IG-MYC(+) lymphomas sharing various molecular characteristics.

Top