SIERRA Low Mach Module: Fuego Theory Manual Version 4.46.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sierra Thermal/Fluid Team

The SIERRA Low Mach Module: Fuego along with the SIERRA Participating Media Radiation Module: Syrinx, henceforth referred to as Fuego and Syrinx, respectively, are the key elements of the ASCI fire environment simulation project. The fire environment simulation project is directed at characterizing both open large-scale pool fires and building enclosure fires. Fuego represents the turbulent, buoyantly-driven incompressible flow, heat transfer, mass transfer, combustion, soot, and absorption coefficient model portion of the simulation software. Syrinx represents the participating-media thermal radiation mechanics. This project is an integral part of the SIERRA multi-mechanics software development project. Fuego depends heavily upon the coremore » architecture developments provided by SIERRA for massively parallel computing, solution adaptivity, and mechanics coupling on unstructured grids.« less

Cooperative high-performance storage in the accelerated strategic computing initiative

NASA Technical Reports Server (NTRS)

Gary, Mark; Howard, Barry; Louis, Steve; Minuzzo, Kim; Seager, Mark

1996-01-01

The use and acceptance of new high-performance, parallel computing platforms will be impeded by the absence of an infrastructure capable of supporting orders-of-magnitude improvement in hierarchical storage and high-speed I/O (Input/Output). The distribution of these high-performance platforms and supporting infrastructures across a wide-area network further compounds this problem. We describe an architectural design and phased implementation plan for a distributed, Cooperative Storage Environment (CSE) to achieve the necessary performance, user transparency, site autonomy, communication, and security features needed to support the Accelerated Strategic Computing Initiative (ASCI). ASCI is a Department of Energy (DOE) program attempting to apply terascale platforms and Problem-Solving Environments (PSEs) toward real-world computational modeling and simulation problems. The ASCI mission must be carried out through a unified, multilaboratory effort, and will require highly secure, efficient access to vast amounts of data. The CSE provides a logically simple, geographically distributed, storage infrastructure of semi-autonomous cooperating sites to meet the strategic ASCI PSE goal of highperformance data storage and access at the user desktop.

The incidence of rugby-related catastrophic injuries (including cardiac events) in South Africa from 2008 to 2011: a cohort study

PubMed Central

Brown, James Craig; Lambert, Mike I; Verhagen, Evert; Readhead, Clint; van Mechelen, Willem; Viljoen, Wayne

2013-01-01

Objectives To establish an accurate and comprehensive injury incidence registry of all rugby union-related catastrophic events in South Africa between 2008 and 2011. An additional aim was to investigate correlates associated with these injuries. Design Prospective. Setting The South African amateur and professional rugby-playing population. Participants An estimated 529 483 Junior and 121 663 Senior rugby union (‘rugby’) players (population at risk). Outcome measures Annual average incidences of rugby-related catastrophic injuries by type (cardiac events, traumatic brain and acute spinal cord injuries (ASCIs)) and outcome (full recoveries—fatalities). Playing level (junior and senior levels), position and event (phase of play) were also assessed. Results The average annual incidence of ASCIs and Traumatic Brain Injuries combined was 2.00 per 100 000 players (95% CI 0.91 to 3.08) from 2008 to 2011. The incidence of ASCIs with permanent outcomes was significantly higher at the Senior level (4.52 per 100 000 players, 95% CI 0.74 to 8.30) than the Junior level (0.24 per 100 000 players, 95% CI 0 to 0.65) during this period. The hooker position was associated with 46% (n=12 of 26) of all permanent ASCI outcomes, the majority of which (83%) occurred during the scrum phase of play. Conclusions The incidence of rugby-related catastrophic injuries in South Africa between 2008 and 2011 is comparable to that of other countries and to most other collision sports. The higher incidence rate of permanent ASCIs at the Senior level could be related to the different law variations or characteristics (eg, less regular training) compared with the Junior level. The hooker and scrum were associated with high proportions of permanent ASCIs. The BokSmart injury prevention programme should focus efforts on these areas (Senior level, hooker and scrum) and use this study as a reference point for the evaluation of the effectiveness of the programme. PMID:23447464

The incidence of rugby-related catastrophic injuries (including cardiac events) in South Africa from 2008 to 2011: a cohort study.

PubMed

Brown, James Craig; Lambert, Mike I; Verhagen, Evert; Readhead, Clint; van Mechelen, Willem; Viljoen, Wayne

2013-01-01

To establish an accurate and comprehensive injury incidence registry of all rugby union-related catastrophic events in South Africa between 2008 and 2011. An additional aim was to investigate correlates associated with these injuries. Prospective. The South African amateur and professional rugby-playing population. An estimated 529 483 Junior and 121 663 Senior rugby union ('rugby') players (population at risk). Annual average incidences of rugby-related catastrophic injuries by type (cardiac events, traumatic brain and acute spinal cord injuries (ASCIs)) and outcome (full recoveries-fatalities). Playing level (junior and senior levels), position and event (phase of play) were also assessed. The average annual incidence of ASCIs and Traumatic Brain Injuries combined was 2.00 per 100 000 players (95% CI 0.91 to 3.08) from 2008 to 2011. The incidence of ASCIs with permanent outcomes was significantly higher at the Senior level (4.52 per 100 000 players, 95% CI 0.74 to 8.30) than the Junior level (0.24 per 100 000 players, 95% CI 0 to 0.65) during this period. The hooker position was associated with 46% (n=12 of 26) of all permanent ASCI outcomes, the majority of which (83%) occurred during the scrum phase of play. The incidence of rugby-related catastrophic injuries in South Africa between 2008 and 2011 is comparable to that of other countries and to most other collision sports. The higher incidence rate of permanent ASCIs at the Senior level could be related to the different law variations or characteristics (eg, less regular training) compared with the Junior level. The hooker and scrum were associated with high proportions of permanent ASCIs. The BokSmart injury prevention programme should focus efforts on these areas (Senior level, hooker and scrum) and use this study as a reference point for the evaluation of the effectiveness of the programme.

Adaptation of the Attitude toward the Subject of Chemistry Inventory (ASCI) into Turkish

ERIC Educational Resources Information Center

Sen, Senol; Yilmaz, Ayhan; Temel, Senar

2016-01-01

Developing an attitude influential in individuals' behaviours and related with academic achievement is a concept whose development science educators consider important. This research aims to adapt the 8-item Attitude toward the Subject of Chemistry Inventory (ASCI)--which was developed by Bauer (2008) and revised by Xu and Lewis (2011)--into…

A Novel Gene, ROA, Is Required for Normal Morphogenesis and Discharge of Ascospores in Gibberella zeae▿†

PubMed Central

Min, Kyunghun; Lee, Jungkwan; Kim, Jin-Cheol; Kim, Sang Gyu; Kim, Young Ho; Vogel, Steven; Trail, Frances; Lee, Yin-Won

2010-01-01

Head blight, caused by Gibberella zeae, is a significant disease among cereal crops, including wheat, barley, and rice, due to contamination of grain with mycotoxins. G. zeae is spread by ascospores forcibly discharged from sexual fruiting bodies forming on crop residues. In this study, we characterized a novel gene, ROA, which is required for normal sexual development. Deletion of ROA (Δroa) resulted in an abnormal size and shape of asci and ascospores but did not affect vegetative growth. The Δroa mutation triggered round ascospores and insufficient cell division after spore delimitation. The asci of the Δroa strain discharged fewer ascospores from the perithecia but achieved a greater dispersal distance than those of the wild-type strain. Turgor pressure within the asci was calculated through the analysis of osmolytes in the epiplasmic fluid. Deletion of the ROA gene appeared to increase turgor pressure in the mutant asci. The higher turgor pressure of the Δroa mutant asci and the mutant spore shape contributed to the longer distance dispersal. When the Δroa mutant was outcrossed with a Δmat1-2 mutant, a strain that contains a green fluorescence protein (GFP) marker in place of the MAT1-2 gene, unusual phenotypic segregation occurred. The ratio of GFP to non-GFP segregation was 1:1; however, all eight spores had the same shape. Taken together, the results of this study suggest that ROA plays multiple roles in maintaining the proper morphology and discharge of ascospores in G. zeae. PMID:20802018

Downregulation of miR-199b promotes the acute spinal cord injury through IKKβ-NF-κB signaling pathway activating microglial cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhou, Heng-Jun; Wang, Li-Qing; Xu, Qing-Sheng

Inflammatory response played an important role in the progression of spinal cord injury (SCI). Several miRNAs were associated with the pathology of SCI. However, the molecular mechanism of miRNA involving in inflammatory response in acute SCI (ASCI) was poorly understood. Sprague-Dawley (SD) rats were divided into 2 groups: control group (n=6) and acute SCI (ASCI) group (n=6). The expression of miR-199b and IκB kinase β-nuclear factor-kappa B (IKKβ-NF-κB) signaling pathway were evaluated by quantitative reverse transcription-PCR (qRT-PCR) in rats with ASCI and in primary microglia activated by lipopolysaccharide (LPS). We found that downregulation of miR-199b and activation of IKKβ/NF-κB weremore » observed in rats after ASCI and in activated microglia. miR-199b negatively regulated IKKβ by targeting its 3′- untranslated regions (UTR) through using luciferase reporter assay. Overexpression of miR-199b reversed the up-regulation of IKKβ, p-p65, tumor necrosis factor-α (TNF-α) and interleukin-1β (IL-1β) in LPS-treated BV2 cells assessed by western blotting analysis. In addition, BMS-345541 reversed the up-regulation effects of miR-199b inhibitor on the expression of TNF-α and IL-1β. In the SCI rats, overexpression of miR-199b attenuated ASCI and decreased the expression of IKKβ-NF-κB signaling pathway and TNF-α and IL-1β. These results indicated that miR-199b attenuated ASCI at least partly through IKKβ-NF-κB signaling pathway and affecting the function of microglia. Our findings suggest that miR-199b may be employed as therapeutic for spinal cord injury. - Highlights: • Downregulation of miR-199b and activation of IKKβ/NF-κB were observed in rat after SCI. • miR-199b negatively regulated IKKβ by targeting its 3′-UTR. • miR-199b overexpression reversed the increasing IKKβ, p-p65, TNF-α and IL-1β in LPS-treated BV2. • BMS-345541 reversed the up-regulation of TNF-α and IL-1β induced by miR-199b inhibitor. • Overexpression of miR-199b attenuated ASCI and decreased the expression of IKKβ-NF-κB in rats.« less

Inhibition on Breast Cancer Induced Bone Pain, Metastasis and Osteolysis in Nude Mice by LOVAZA and DHA Fattty Acids

DTIC Science & Technology

2011-10-01

GCGGTTGTCCC/CATGGTAACAGCATTGCAGGTGC (30 cycles); mouse ASIC3, TGAGAGCCACCAGCTTACCT/ACATGTCCTCAAGGGAGTGG (30 cycles); mouse TRPV1 ...follows: ASIC1a 506bp, ASCI1b 563bp, ASCI3 245pb, TRPV1 FIGURE 8A 8 324bp, and GAPDH 233bp as seen in Figure 8A. Reference: Malin S, et al. (2007

Spinal cord injuries in Australian footballers 1997-2002.

PubMed

Carmody, David J; Taylor, Thomas K F; Parker, David A; Coolican, Myles R J; Cumming, Robert G

2005-06-06

To review acute spinal cord injuries (ASCIs) in all Australian codes of football (rugby union [RU], rugby league [RL], Australian Rules football [ARF] and soccer) for 1997-2002 and to compare data with those of a 1986-1996 survey. Retrospective review of hospital records, and structured interviews with injured players. Patients admitted to any of the six Australian spinal cord injury units with a documented football-related ASCI over the period 1997-2002. Average annual incidence of ASCIs per 100,000 players in the different codes, final Frankel grading of injuries, and wheelchair status. Fifty-two footballers (45 adult men and seven schoolboys) suffered ASCIs between 1997 and 2002. The average annual incidence of ASCIs per 100,000 players was 3.2 for RU, 1.5 for RL, 0.5 for ARF and 0.2 for soccer. While there has been little change in incidence since the 1986-1996 survey, there has been a trend towards less severe injuries in RU and RL, but not in ARF. There have been no scrum injuries in RL since 1996, when the scrum stopped being contested. Seven injuries occurred in RU scrums, six at the moment of engagement of the opposing teams. The incidence of 2-on-1 and "gang" tackles (involving multiple tacklers) in RL is disturbing. Overall, 39% of injured players became permanently wheelchair-dependent. There continues to be good reason to revise the laws of scrum engagement in RU. The laws relating to multiple tacklers in RL should be examined. The insurance cover for injured players is grossly inadequate. The longstanding need for a registry of spinal cord injuries for all football codes regrettably remains unmet.

Application Specific Chemical Information Microprocessor (ASCI mu P)

DTIC Science & Technology

1999-09-30

lithography created channels in polydimethylsiloxane polymer. 1C. Optical micrograph of 100 um line widths using soft lithography Progress has also been made...also collaborated with Dr. Jose Almirall at Florida International University and have accomplished the HPLC method development of explosives detection...analytical materials. We have established the base for LIF electrophoretic chip analysis and similarly for the electrochemcial detection. We have learned the

An Insertional Translocation in Neurospora That Generates Duplications Heterozygous for Mating Type

PubMed Central

Perkins, David D.

1972-01-01

In strain T(I→II)39311 a long interstitial segment is transposed from IL to IIR, where it is inserted in reversed order with respect to the centromere. In crosses of T x T essentially all asci have eight viable, black spores, and all progeny are phenotypically normal. When T(I→II)39311 is crossed by Normal sequence (N), the expected duplication class is viable while the corresponding deficiency is lethal; 44% of the asci have 8 Black (viable) spores and 0 White (inviable) spores, 41% have 4 Black: 4 White, and 10% have 6 Black: 2 White. These are the ascus types expected from normal centromere disjunction without crossing over (8B:0W and 4B:4W equally probable), and with crossing over between centromere and break point (6B:2W). On germination, 8B:0W asci give rise to only parental types—4 T and 4 N; 4B:4W asci usually give four duplication (Dup) progeny; and 6B:2W asci usually give 2 T, 2 N, 2 Dup. Thus one third of all viable, black ascospores contain duplications.—Recessive markers in the donor chromosome which contributes the translocated segment can be mapped by duplication coverage. Ratios of 2 Dominant: 1 Recessive vs. 1 Dominant: 2 Recessive distinguish location in or outside the transposed segment. Eleven loci including mating type have been shown to lie within the segment, and markers at four loci have been transferred into the segment by meiotic recombination. The frequency of marker transfer indicates that the inserted segment usually pairs with its homologue. Ascus types that would result from single exchanges within the insertion are infrequent, as expected if asci containing dicentric bridges usually do not survive.—Duplication ascospores germinate to produce distinctive inhibited colonies. Later these "escape" to grow like wild type, and genes that were initially heterozygous in the duplication segregate when escape occurs. As with duplications from pericentric inversion In(IL→IR)H4250 (Newmeyer and Taylor 1967), the initial inhibition is attributed to mating-type heterozygosity, and escape to a somatic event that makes mating type homoor hemizygous.—Twenty additional duplication-generating Neurospora rearrangements are listed and described briefly in an Appendix. PMID:17248574

Science and Technology Review June 2000

DOE Office of Scientific and Technical Information (OSTI.GOV)

de Pruneda, J.H.

2000-06-01

This issue contains the following articles: (1) ''Accelerating on the ASCI Challenge''. (2) ''New Day Daws in Supercomputing'' When the ASCI White supercomputer comes online this summer, DOE's Stockpile Stewardship Program will make another significant advanced toward helping to ensure the safety, reliability, and performance of the nation's nuclear weapons. (3) ''Uncovering the Secrets of Actinides'' Researchers are obtaining fundamental information about the actinides, a group of elements with a key role in nuclear weapons and fuels. (4) ''A Predictable Structure for Aerogels''. (5) ''Tibet--Where Continents Collide''.

Transreplication and crossing over in Sordaria fimicola.

PubMed

KITANI, Y; OLIVE, L S; EL-ANI, A S

1961-09-08

A study of the segregation of markers closely linked to the gray ascospore color locus in Sordaria fimicola reveals that there is a high incidence of crossing over very near the locus when it transreplicates, which is much more pronounced in 5:3 than in 6:2 asci. Also, a single 7:1 and several aberrant 4:4 asci are described. At a different spore color locus, transreplication yields only 6:2 ratios, while other spore color loci fail to transreplicate altogether

Changes in the Lipid Composition and Fine Structure of Saccharomyces cerevisiae During Ascus Formation

PubMed Central

Illingworth, R. F.; Rose, A. H.; Beckett, A.

1973-01-01

Eighty to ninety percent of vegetative cells of Saccharomyces cerevisiae DCL 740 incubated in KCl-acetate medium form asci, the majority of which are four-spored. Ascospores are visible in asci after about 24 hr, and spore formation is complete after about 48 hr. The dry weight of the cells increases by about 75% during 48 hr of incubation, while the lipid content of the cells increases by a factor of four. The increase in lipid content is attributed mainly to an increased synthesis of sterol esters and triacylglycerols and to a lesser extent of phospholipids. The phospholipid and sterol compositions do not change appreciably, but there is a marked increase in the proportion of unsaturated fatty acid residues in ascan lipids. Uniformly labeled 14C-acetate is incorporated mainly into sterol esters and triacylglycerols and phospholipids. Pulse-labeling by adding acetate-U-14C to sporulating cultures and harvesting after a further 6 hr of incubation reveal two main periods of acetate incorporation, namely between 0 and 18 hr, and between 24 and 30 hr. Electron micrographs of thin sections through developing asci show that the principal changes in fine structure occur between 18 and 24 hr and include the appearance of numerous electron-transparent vesicles which become aligned around the meiotic nucleus, and the laying down of extensive endoplasmic reticulum membranes. Changes in fine structure are discussed in relation to the alterations in lipid content and composition of asci. Images PMID:4569408

Expression of Meiotic Drive Elements Spore Killer-2 and Spore Killer-3 in Asci of Neurospora Tetrasperma

PubMed Central

Raju, N. B.; Perkins, D. D.

1991-01-01

It was shown previously that when a chromosomal Spore killer factor is heterozygous in Neurospora species with eight-spored asci, the four sensitive ascospores in each ascus die and the four survivors are all killers. Sk-2(K) and Sk-3(K) are nonrecombining haplotypes that segregate with the centromere of linkage group III. No killing occurs when either one of these killers is homozygous, but each is sensitive to killing by the other in crosses of Sk-2(K) X Sk-3(K). In the present study, Sk-2(K) and Sk-3(K) were transferred by recurrent backcrosses from the eight-spored species Neurospora crassa into Neurospora tetrasperma, a pseudohomothallic species which normally makes asci with four large spores, each heterokaryotic for mating type and for any other centromere-linked genes that are heterozygous in the cross. The action of Sk-2(K) and Sk-3(K) in N. tetrasperma is that predicted from their behavior in eight-spored species. A sensitive nucleus is protected from killing if it is enclosed in the same ascospore with a killer nucleus. Crosses of Sk-2(K) X Sk-2(S), Sk-3(K) X Sk-3(S), and Sk-2(K) X Sk-3(K) all produce four-spored asci that are wild type in appearance, with the ascospores heterokaryotic and viable. The Eight-spore gene E, which shows variable penetrance, was used to obtain N. tetrasperma asci in which two to eight spores are small and homokaryotic. When killer and sensitive alleles are segregating in the presence of E, only those ascospores that contain a killer allele survive. Half of the small ascospores are killed. In crosses of Sk-2(K) X Sk-3(K) (with E heterozygous), effectively all small ascospores are killed. The ability of N. tetrasperma to carry killer elements in cryptic condition suggests a possible role for Spore killers in the origin of pseudohomothallism, with adoption of the four-spored mode restoring ascospore viability of crosses in which killing would otherwise occur. PMID:1834522

Characterization of Listeria monocytogenes from an ice cream plant by serotyping and pulsed-field gel electrophoresis.

PubMed

Miettinen, M K; Björkroth, K J; Korkeala, H J

1999-02-18

One dominating strain of serotype 1/2b was found when serotyping and pulsed-field gel electrophoresis (PFGE) patterns were used for the characterization of 41 Listeria monocytogenes isolates originating from an ice cream plant. Samples were taken from the production environment, equipment and ice cream during the years 1990-1997. Serotyping divided the isolates into two serovars, 1/2b and 4b. Three rare-cutting enzymes (ApaI, AscI and SmaI) were used in the creation of PFGE patterns. AscI resulted in the best restriction enzyme digestion patterns (REDPs) for visual comparison. Eight different AscI REDPs were obtained, whereas ApaI produced six and SmaI seven banding patterns. When one-band differences are taken into account, 12 different PFGE types were distinguished based on information obtained with all three enzymes. The dominant PFGE type was found to have persisted in the ice cream plant for seven years. Improved and precisely targeted cleaning and disinfection practices combined with structural changes making for easier cleaning of the packaging machine, resulted in eradication of L. monocytogenes from this plant.

IP-Based Video Modem Extender Requirements

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pierson, L G; Boorman, T M; Howe, R E

2003-12-16

Visualization is one of the keys to understanding large complex data sets such as those generated by the large computing resources purchased and developed by the Advanced Simulation and Computing program (aka ASCI). In order to be convenient to researchers, visualization data must be distributed to offices and large complex visualization theaters. Currently, local distribution of the visual data is accomplished by distance limited modems and RGB switches that simply do not scale to hundreds of users across the local, metropolitan, and WAN distances without incurring large costs in fiber plant installation and maintenance. Wide Area application over the DOEmore » Complex is infeasible using these limited distance RGB extenders. On the other hand, Internet Protocols (IP) over Ethernet is a scalable well-proven technology that can distribute large volumes of data over these distances. Visual data has been distributed at lower resolutions over IP in industrial applications. This document describes requirements of the ASCI program in visual signal distribution for the purpose of identifying industrial partners willing to develop products to meet ASCI's needs.« less

Advanced Simulation and Computing: A Summary Report to the Director's Review

DOE Office of Scientific and Technical Information (OSTI.GOV)

McCoy, M G; Peck, T

2003-06-01

It has now been three years since the Advanced Simulation and Computing Program (ASCI), as managed by Defense and Nuclear Technologies (DNT) Directorate, has been reviewed by this Director's Review Committee (DRC). Since that time, there has been considerable progress for all components of the ASCI Program, and these developments will be highlighted in this document and in the presentations planned for June 9 and 10, 2003. There have also been some name changes. Today, the Program is called ''Advanced Simulation and Computing,'' Although it retains the familiar acronym ASCI, the initiative nature of the effort has given way tomore » sustained services as an integral part of the Stockpile Stewardship Program (SSP). All computing efforts at LLNL and the other two Defense Program (DP) laboratories are funded and managed under ASCI. This includes the so-called legacy codes, which remain essential tools in stockpile stewardship. The contract between the Department of Energy (DOE) and the University of California (UC) specifies an independent appraisal of Directorate technical work and programmatic management. Such represents the work of this DNT Review Committee. Beginning this year, the Laboratory is implementing a new review system. This process was negotiated between UC, the National Nuclear Security Administration (NNSA), and the Laboratory Directors. Central to this approach are eight performance objectives that focus on key programmatic and administrative goals. Associated with each of these objectives are a number of performance measures to more clearly characterize the attainment of the objectives. Each performance measure has a lead directorate and one or more contributing directorates. Each measure has an evaluation plan and has identified expected documentation to be included in the ''Assessment File''.« less

Most Uv-Induced Reciprocal Translocations in SORDARIA MACROSPORA Occur in or near Centromere Regions

PubMed Central

Leblon, G.; Zickler, D.; Lebilcot, S.

1986-01-01

In fungi, translocations can be identified and classified by the patterns of ascospore abortion in asci from crosses of rearrangement x normal sequence. Previous studies of UV-induced rearrangements in Sordaria macrospora revealed that a major class (called type III) appeared to be reciprocal translocations that were anomalous in producing an unexpected class of asci with four aborted ascospores in bbbbaaaa linear sequence (b = black; a = abortive). The present study shows that the anomalous type III rearrangements are, in fact, reciprocal translocations having both breakpoints within or adjacent to centromeres and that bbbbaaaa asci result from 3:1 disjunction from the translocation quadrivalent.—Electron microscopic observations of synaptonemal complexes enable centromeres to be visualized. Lengths of synaptonemal complexes lateral elements in translocation quadrivalents accurately reflect chromosome arm lengths, enabling breakpoints to be located reliably in centromere regions. All genetic data are consistent with the behavior expected of translocations with breakpoints at centromeres.—Two-thirds of the UV-induced reciprocal translocations are of this type. Certain centromere regions are involved preferentially. Among 73 type-III translocations, there were but 13 of the 21 possible chromosome combinations and 20 of the 42 possible combinations of chromosome arms. PMID:17246312

Most Uv-Induced Reciprocal Translocations in SORDARIA MACROSPORA Occur in or near Centromere Regions.

PubMed

Leblon, G; Zickler, D; Lebilcot, S

1986-02-01

In fungi, translocations can be identified and classified by the patterns of ascospore abortion in asci from crosses of rearrangement x normal sequence. Previous studies of UV-induced rearrangements in Sordaria macrospora revealed that a major class (called type III) appeared to be reciprocal translocations that were anomalous in producing an unexpected class of asci with four aborted ascospores in bbbbaaaa linear sequence (b = black; a = abortive). The present study shows that the anomalous type III rearrangements are, in fact, reciprocal translocations having both breakpoints within or adjacent to centromeres and that bbbbaaaa asci result from 3:1 disjunction from the translocation quadrivalent.-Electron microscopic observations of synaptonemal complexes enable centromeres to be visualized. Lengths of synaptonemal complexes lateral elements in translocation quadrivalents accurately reflect chromosome arm lengths, enabling breakpoints to be located reliably in centromere regions. All genetic data are consistent with the behavior expected of translocations with breakpoints at centromeres.-Two-thirds of the UV-induced reciprocal translocations are of this type. Certain centromere regions are involved preferentially. Among 73 type-III translocations, there were but 13 of the 21 possible chromosome combinations and 20 of the 42 possible combinations of chromosome arms.

Modeling and Simulation of Explosively Driven Electromechanical Devices

NASA Astrophysics Data System (ADS)

Demmie, Paul N.

2002-07-01

Components that store electrical energy in ferroelectric materials and produce currents when their permittivity is explosively reduced are used in a variety of applications. The modeling and simulation of such devices is a challenging problem since one has to represent the coupled physics of detonation, shock propagation, and electromagnetic field generation. The high fidelity modeling and simulation of complicated electromechanical devices was not feasible prior to having the Accelerated Strategic Computing Initiative (ASCI) computers and the ASCI developed codes at Sandia National Laboratories (SNL). The EMMA computer code is used to model such devices and simulate their operation. In this paper, I discuss the capabilities of the EMMA code for the modeling and simulation of one such electromechanical device, a slim-loop ferroelectric (SFE) firing set.

Attitude to the subject of chemistry in undergraduate nursing students at Fiji National University and Federation University, Australia.

PubMed

Brown, Stephen; Wakeling, Lara; Peck, Blake; Naiker, Mani; Hill, Dolores; Naidu, Keshni

2015-01-01

Attitude to the subject of chemistry was quantified in first-year undergraduate nursing students, at two geographically distinct universities. A purpose-designed diagnostic instrument (ASCI) was given to students at Federation University, Australia (n= 114), and at Fiji National University, Fiji (n=160). Affective and cognitive sub-scales within ASCI showed reasonable internal consistency. Cronbach's alpha for the cognitive sub-scale was 0.786 and 0.630, and 0.787 and 0.788 for affective sub-scale for the Federation University and Fiji National University students, respectively. Mean (SD) score for the cognitive sub-scale was 10.5 (5.6) and 15.2 (4.1) for students at Federation University and Fiji National University, respectively (P<0.001, t-test). Mean (SD) score for the affective sub-scale was 13.1 (5.1) and 20.7 (4.3) for students at Federation University and Fiji National University, respectively (P < 0.001, t-test). An exploratory factor analysis (n=274) confirmed a two-factor solution consistent with affective and cognitive sub-scales, each with good internal consistency. Quantifying attitude to chemistry in undergraduate nursing students using ASCI may have utility in assessing the impact of novel teaching strategies used in the education of nursing students in areas of bioscience and chemistry. However, geographically distinct populations of undergraduate nurses may show very different attitudes to chemistry.

Corridor One:An Integrated Distance Visualization Enuronments for SSI+ASCI Applications

DOE Office of Scientific and Technical Information (OSTI.GOV)

Christopher R. Johnson, Charles D. Hansen

2001-10-29

The goal of Corridor One: An Integrated Distance Visualization Environment for ASCI and SSI Application was to combine the forces of six leading edge laboratories working in the areas of visualization and distributed computing and high performance networking (Argonne National Laboratory, Lawrence Berkeley National Laboratory, Los Alamos National Laboratory, University of Illinois, University of Utah and Princeton University) to develop and deploy the most advanced integrated distance visualization environment for large-scale scientific visualization and demonstrate it on applications relevant to the DOE SSI and ASCI programs. The Corridor One team brought world class expertise in parallel rendering, deep image basedmore » rendering, immersive environment technology, large-format multi-projector wall based displays, volume and surface visualization algorithms, collaboration tools and streaming media technology, network protocols for image transmission, high-performance networking, quality of service technology and distributed computing middleware. Our strategy was to build on the very successful teams that produced the I-WAY, ''Computational Grids'' and CAVE technology and to add these to the teams that have developed the fastest parallel visualizations systems and the most widely used networking infrastructure for multicast and distributed media. Unfortunately, just as we were getting going on the Corridor One project, DOE cut the program after the first year. As such, our final report consists of our progress during year one of the grant.« less

[Measuring the impact of practices of social appropriation of science and technology: a proposal for a set of indicators].

PubMed

Daza-Caicedo, Sandra; Maldonado, Oscar; Arboleda-Castrillón, Tania; Falla, Sigrid; Moreno, Pablo; Tafur-Sequera, Mayali; Papagayo, Diana

2017-01-01

We propose a set of qualitative indicators for monitoring practices of social appropriation of science and technology. The design of this set is based on the Maloka case, but it can be of use to multiple actors involved in the social appropriation of science and technology (referred to by its Spanish acronym, ASCyT). The introduction discusses the concept of ASCyT. The first section provides a review of the literature about measuring activities that link science and society. The second section explains why it is important to develop this type of measurement. The third section lays out the methodology used in designing the indicators. The fourth section explains the set of indicators and the fifth reflects on that process.

2017 Multimodality Appropriate Use Criteria for Noninvasive Cardiac Imaging: Expert Consensus of the Asian Society of Cardiovascular Imaging.

PubMed

Beck, Kyongmin Sarah; Kim, Jeong A; Choe, Yeon Hyeon; Hian, Sim Kui; Hoe, John; Hong, Yoo Jin; Kim, Sung Mok; Kim, Tae Hoon; Kim, Young Jin; Kim, Yun Hyeon; Kuribayashi, Sachio; Lee, Jongmin; Leong, Lilian; Lim, Tae-Hwan; Lu, Bin; Park, Jae Hyung; Sakuma, Hajime; Yang, Dong Hyun; Yaw, Tan Swee; Wan, Yung-Liang; Zhang, Zhaoqi; Zhao, Shihua; Yong, Hwan Seok

2017-01-01

In 2010, the Asian Society of Cardiovascular Imaging (ASCI) provided recommendations for cardiac CT and MRI, and this document reflects an update of the 2010 ASCI appropriate use criteria (AUC). In 2016, the ASCI formed a new working group for revision of AUC for noninvasive cardiac imaging. A major change that we made in this document is the rating of various noninvasive tests (exercise electrocardiogram, echocardiography, positron emission tomography, single-photon emission computed tomography, radionuclide imaging, cardiac magnetic resonance, and cardiac computed tomography/angiography), compared side by side for their applications in various clinical scenarios. Ninety-five clinical scenarios were developed from eight selected pre-existing guidelines and classified into four sections as follows: 1) detection of coronary artery disease, symptomatic or asymptomatic; 2) cardiac evaluation in various clinical scenarios; 3) use of imaging modality according to prior testing; and 4) evaluation of cardiac structure and function. The clinical scenarios were scored by a separate rating committee on a scale of 1-9 to designate appropriate use, uncertain use, or inappropriate use according to a modified Delphi method. Overall, the AUC ratings for CT were higher than those of previous guidelines. These new AUC provide guidance for clinicians choosing among available testing modalities for various cardiac diseases and are also unique, given that most previous AUC for noninvasive imaging include only one imaging technique. As cardiac imaging is multimodal in nature, we believe that these AUC will be more useful for clinical decision making.

Ascus dysgenesis in hybrid crosses of Neurospora and Sordaria (Sordariaceae).

PubMed

Kasbekar, Durgadas P

2017-07-01

When two lineages derived from a common ancestor become reproductively isolated (e.g. Neurospora crassa and N. tetrasperma), genes that have undergone mutation and adaptive evolution in one lineage can potentially become dysfunctional when transferred into the other, since other genes have undergone mutation and evolution in the second lineage, and the derived alleles were never 'tested' together before hybrid formation. Bateson (1909), Dobzhansky (1936), and Muller (1942) recognized that incompatibility between the derived alleles could potentially make the hybrid lethal, sterile, or display some other detriment. Alternatively, the detrimental effects seen in crosses with the hybrids may result from the silencing of ascus-development genes by meiotic silencing by unpaired DNA (MSUD). Aberrant transcripts from genes improperly paired in meiosis are processed into single-stranded MSUD-associated small interfering RNA (masiRNA), which is used to degrade complementary mRNA. Recently, backcrosses of N. crassa / N. tetrasperma hybrid translocation strains with wild-type N. tetrasperma were found to elicit novel ascus dysgenesis phenotypes. One was a transmission ratio distortion that apparently disfavoured the homokaryotic ascospores formed following alternate segregation. Another was the production of heterokaryotic ascospores in eight-spored asci. Lewis (1969) also had reported sighting rare eight-spored asci with heterokaryotic ascospores in interspecific crosses in Sordaria, a related genus. Ordinarily, in both Neurospora and Sordaria, the ascospores are partitioned at the eight-nucleus stage, and ascospores in eight-spored asci are initially uninucleate. Evidently, in hybrid crosses of the family Sordariaceae, ascospore partitioning can be delayed until after one or more mitoses following the postmeiotic mitosis.

2017 Multimodality Appropriate Use Criteria for Noninvasive Cardiac Imaging: Expert Consensus of the Asian Society of Cardiovascular Imaging

PubMed Central

Beck, Kyongmin Sarah; Kim, Jeong A; Choe, Yeon Hyeon; Hian, Sim Kui; Hoe, John; Hong, Yoo Jin; Kim, Sung Mok; Kim, Tae Hoon; Kim, Young Jin; Kim, Yun Hyeon; Kuribayashi, Sachio; Lee, Jongmin; Leong, Lilian; Lim, Tae-Hwan; Lu, Bin; Park, Jae Hyung; Sakuma, Hajime; Yang, Dong Hyun; Yaw, Tan Swee; Wan, Yung-Liang; Zhang, Zhaoqi; Zhao, Shihua

2017-01-01

In 2010, the Asian Society of Cardiovascular Imaging (ASCI) provided recommendations for cardiac CT and MRI, and this document reflects an update of the 2010 ASCI appropriate use criteria (AUC). In 2016, the ASCI formed a new working group for revision of AUC for noninvasive cardiac imaging. A major change that we made in this document is the rating of various noninvasive tests (exercise electrocardiogram, echocardiography, positron emission tomography, single-photon emission computed tomography, radionuclide imaging, cardiac magnetic resonance, and cardiac computed tomography/angiography), compared side by side for their applications in various clinical scenarios. Ninety-five clinical scenarios were developed from eight selected pre-existing guidelines and classified into four sections as follows: 1) detection of coronary artery disease, symptomatic or asymptomatic; 2) cardiac evaluation in various clinical scenarios; 3) use of imaging modality according to prior testing; and 4) evaluation of cardiac structure and function. The clinical scenarios were scored by a separate rating committee on a scale of 1–9 to designate appropriate use, uncertain use, or inappropriate use according to a modified Delphi method. Overall, the AUC ratings for CT were higher than those of previous guidelines. These new AUC provide guidance for clinicians choosing among available testing modalities for various cardiac diseases and are also unique, given that most previous AUC for noninvasive imaging include only one imaging technique. As cardiac imaging is multimodal in nature, we believe that these AUC will be more useful for clinical decision making. PMID:29089819

The ASCI Network for SC 2000: Gigabyte Per Second Networking

DOE Office of Scientific and Technical Information (OSTI.GOV)

PRATT, THOMAS J.; NAEGLE, JOHN H.; MARTINEZ JR., LUIS G.

2001-11-01

This document highlights the Discom's Distance computing and communication team activities at the 2000 Supercomputing conference in Dallas Texas. This conference is sponsored by the IEEE and ACM. Sandia's participation in the conference has now spanned a decade, for the last five years Sandia National Laboratories, Los Alamos National Lab and Lawrence Livermore National Lab have come together at the conference under the DOE's ASCI, Accelerated Strategic Computing Initiatives, Program rubric to demonstrate ASCI's emerging capabilities in computational science and our combined expertise in high performance computer science and communication networking developments within the program. At SC 2000, DISCOM demonstratedmore » an infrastructure. DISCOM2 uses this forum to demonstrate and focus communication and pre-standard implementation of 10 Gigabit Ethernet, the first gigabyte per second data IP network transfer application, and VPN technology that enabled a remote Distributed Resource Management tools demonstration. Additionally a national OC48 POS network was constructed to support applications running between the show floor and home facilities. This network created the opportunity to test PSE's Parallel File Transfer Protocol (PFTP) across a network that had similar speed and distances as the then proposed DISCOM WAN. The SCINET SC2000 showcased wireless networking and the networking team had the opportunity to explore this emerging technology while on the booth. This paper documents those accomplishments, discusses the details of their convention exhibit floor. We also supported the production networking needs of the implementation, and describes how these demonstrations supports DISCOM overall strategies in high performance computing networking.« less

Wickerhamiella van der Walt (1973)

USDA-ARS?s Scientific Manuscript database

This chapter describes the ascomycetous yeast genus Wickerhamiella, which has five described species and has been defined from multigene deoxyribonucleic acid (DNA) sequence analysis. The species reproduce by multilateral budding but do not form hyphae or pseudohyphae. Asci typically form a single a...

Retrieval practice in the form of online homework improved information retention more when spaced 5 days rather than 1 day after class in two physiology courses.

PubMed

Cadaret, Caitlin N; Yates, Dustin T

2018-06-01

Studies have shown that practicing temporally spaced retrieval of previously learned information via formal assessments increases student retention of the information. Our objective was to determine the impact of online homework administered as a first retrieval practice 1 or 5 days after introduction of physiology topics on long-term information retention. Students in two undergraduate courses, Anatomy and Physiology (ASCI 240) and Animal Physiological Systems (ASCI 340), were presented with information on a specific physiological system during each weekly laboratory and then completed an online homework assignment either 1 or 5 days later. Information retention was assessed via an in-class quiz the following week and by a comprehensive final exam at semester's end (4-13 wk later). Performance on homework assignments was generally similar between groups for both courses. Information retention at 1 wk did not differ due to timing of homework in either course. In both courses, however, students who received homework 5 days after class performed better on final exam questions relevant to that week's topic compared with their day 1 counterparts. These findings indicate that the longer period between introducing physiology information in class and assigning the first retrieval practice was more beneficial to long-term information retention than the shorter period, despite seemingly equivalent benefits in the shorter term. Since information is typically forgotten over time, we speculate that the longer interval necessitates greater retrieval effort in much the same way as built-in desirable difficulties, thus allowing for stronger conceptual connections and deeper comprehension.

Multiphysics Application Coupling Toolkit

DOE Office of Scientific and Technical Information (OSTI.GOV)

Campbell, Michael T.

2013-12-02

This particular consortium implementation of the software integration infrastructure will, in large part, refactor portions of the Rocstar multiphysics infrastructure. Development of this infrastructure originated at the University of Illinois DOE ASCI Center for Simulation of Advanced Rockets (CSAR) to support the center's massively parallel multiphysics simulation application, Rocstar, and has continued at IllinoisRocstar, a small company formed near the end of the University-based program. IllinoisRocstar is now licensing these new developments as free, open source, in hopes to help improve their own and others' access to infrastructure which can be readily utilized in developing coupled or composite software systems;more » with particular attention to more rapid production and utilization of multiphysics applications in the HPC environment. There are two major pieces to the consortium implementation, the Application Component Toolkit (ACT), and the Multiphysics Application Coupling Toolkit (MPACT). The current development focus is the ACT, which is (will be) the substrate for MPACT. The ACT itself is built up from the components described in the technical approach. In particular, the ACT has the following major components: 1.The Component Object Manager (COM): The COM package provides encapsulation of user applications, and their data. COM also provides the inter-component function call mechanism. 2.The System Integration Manager (SIM): The SIM package provides constructs and mechanisms for orchestrating composite systems of multiply integrated pieces.« less

Numerical Technology for Large-Scale Computational Electromagnetics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sharpe, R; Champagne, N; White, D

The key bottleneck of implicit computational electromagnetics tools for large complex geometries is the solution of the resulting linear system of equations. The goal of this effort was to research and develop critical numerical technology that alleviates this bottleneck for large-scale computational electromagnetics (CEM). The mathematical operators and numerical formulations used in this arena of CEM yield linear equations that are complex valued, unstructured, and indefinite. Also, simultaneously applying multiple mathematical modeling formulations to different portions of a complex problem (hybrid formulations) results in a mixed structure linear system, further increasing the computational difficulty. Typically, these hybrid linear systems aremore » solved using a direct solution method, which was acceptable for Cray-class machines but does not scale adequately for ASCI-class machines. Additionally, LLNL's previously existing linear solvers were not well suited for the linear systems that are created by hybrid implicit CEM codes. Hence, a new approach was required to make effective use of ASCI-class computing platforms and to enable the next generation design capabilities. Multiple approaches were investigated, including the latest sparse-direct methods developed by our ASCI collaborators. In addition, approaches that combine domain decomposition (or matrix partitioning) with general-purpose iterative methods and special purpose pre-conditioners were investigated. Special-purpose pre-conditioners that take advantage of the structure of the matrix were adapted and developed based on intimate knowledge of the matrix properties. Finally, new operator formulations were developed that radically improve the conditioning of the resulting linear systems thus greatly reducing solution time. The goal was to enable the solution of CEM problems that are 10 to 100 times larger than our previous capability.« less

Modal characterization of the ASCIE segmented optics testbed: New algorithms and experimental results

NASA Technical Reports Server (NTRS)

Carrier, Alain C.; Aubrun, Jean-Noel

1993-01-01

New frequency response measurement procedures, on-line modal tuning techniques, and off-line modal identification algorithms are developed and applied to the modal identification of the Advanced Structures/Controls Integrated Experiment (ASCIE), a generic segmented optics telescope test-bed representative of future complex space structures. The frequency response measurement procedure uses all the actuators simultaneously to excite the structure and all the sensors to measure the structural response so that all the transfer functions are measured simultaneously. Structural responses to sinusoidal excitations are measured and analyzed to calculate spectral responses. The spectral responses in turn are analyzed as the spectral data become available and, which is new, the results are used to maintain high quality measurements. Data acquisition, processing, and checking procedures are fully automated. As the acquisition of the frequency response progresses, an on-line algorithm keeps track of the actuator force distribution that maximizes the structural response to automatically tune to a structural mode when approaching a resonant frequency. This tuning is insensitive to delays, ill-conditioning, and nonproportional damping. Experimental results show that is useful for modal surveys even in high modal density regions. For thorough modeling, a constructive procedure is proposed to identify the dynamics of a complex system from its frequency response with the minimization of a least-squares cost function as a desirable objective. This procedure relies on off-line modal separation algorithms to extract modal information and on least-squares parameter subset optimization to combine the modal results and globally fit the modal parameters to the measured data. The modal separation algorithms resolved modal density of 5 modes/Hz in the ASCIE experiment. They promise to be useful in many challenging applications.

PARAPHYSOIDS, PSEUDOPARAPHYSES, AND APICAL PARAPHYSES,

DTIC Science & Technology

The distinct, vertical, paraphysis-like hyphae developing in the centrum of loculoascomycetes prior to the formation of asci are properly termed...structure is of doubtful usefulness. The downward-growing palisade of hyphae with free tips in the centrum of hypocreaceous fungi should be distinguished as apical paraphyses. (Author)

Spherical harmonic results for the 3D Kobayashi Benchmark suite

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brown, P N; Chang, B; Hanebutte, U R

1999-03-02

Spherical harmonic solutions are presented for the Kobayashi benchmark suite. The results were obtained with Ardra, a scalable, parallel neutron transport code developed at Lawrence Livermore National Laboratory (LLNL). The calculations were performed on the IBM ASCI Blue-Pacific computer at LLNL.

Further evidence that aberrant segregation and crossing over in Sordaria brevicollis may be discrete, though associated, events.

PubMed

Theivendirarajah, K; Whitehouse, H L

1983-01-01

Crosses were made between buff spore colour mutants in Sordaria brevicollis in the presence of flanking markers. Recombinant asci with one or more wild-type spores were isolated and the spores germinated and scored for buff and flanking marker genotype. The buff genotype was determined by back-crossing to each parent and looking for recombinants. It was found that the majority of the recombinant asci had aberrant segregation at one or other mutant site but not both. It was inferred that in the recombinants hybrid DNA rarely extended to both sites. When the aberrant segregation was associated with crossing-over, the crossovers were situated at either end of the gene rather than between the allelic sites where the hybrid DNA was believed to terminate. Thus, some of the crossovers were separated from the site of the aberrant segregation by a site apparently not involved in hybrid DNA and none was in the position predicted by the Meselson-Radding model, that is, where the hybrid DNA terminates.

The Manifestation of Chromosome Rearrangements in Unordered Asci of Neurospora

PubMed Central

Perkins, David D.

1974-01-01

Rapid, effective techniques have been developed for detecting and characterizing chromosome aberrations in Neurospora by visual inspection of ascospores and asci. Rearrangements that are detectable by the presence of deficient, nonblack ascospores in test crosses make up 5 to 10% of survivors after UV doses giving 10-55% survival. Over 135 rearrangements have been diagnosed by classifying unordered asci according to numbers of defective spores. (These include 15 originally identified or analyzed by other workers.) About 100 reciprocal translocations (RT's) have been confirmed and mapped genetically, involving all combinations of the seven chromosomes. Thirty-three other rearrangements generate viable nontandem duplications in meiosis. These consist of insertional translocations (IT's) (15 confirmed), and of rearrangements that involve a chromosome tip (10 translocations and 3 pericentric inversions). No inversion has been found that does not include the centromere. A reciprocal translocation was found within one population in nature. When pairs of RT's that involve the same two chromosome arms were intercrossed, viable duplications were produced if the breakpoints overlapped in such a way that pairing resembled that of insertional translocations (27 combinations).—The rapid analytical technique depends on the following. Deficiency ascospores are usually nonblack (W: "white") and inviable, while nondeficient ascospores, even those that include duplications, are black (B) and viable. Thus RT's typically produce 50% black spores, and IT's 75% black. Asci are shot spontaneously from ripe perithecia, and can be collected in large numbers as groups of eight ascospores representing unordered tetrads, which fall into five classes: 8B:0W; 6B:2W, 4B:4W, 2B:6B, 0B:8W. In isosequential crosses, 90-95% of tetrads are 8:0. When a rearrangement is heterozygous, the frequencies of tetrad classes are diagnostic of the type of rearrangement, and provide information also on the positions of break points. With RT's, 8:0 (alternate centromere segregation) = 0:8 (adjacent-1), 4:4's require interstitial crossing over in a centromere-break point interval, and no 6:2's or 2:6's are expected. With IT's, duplications are viable, 8:0 = 4:4, 6:2's are from interstitial crossing over, 0:8's or 2:6's are rare. Tetrads from RT's that involve a chromosome tip resemble those from IT's, as do tetrads from intercrosses between partially overlapping RT's that involve identical chromosome arms.—Because viable duplications and other aneuploid derivatives regularly occur among the offspring of rearrangements such as insertional translocations, care must be taken in selecting stocks, and original strains should be kept for reference. PMID:4416353

Proceedings from the conference on high speed computing: High speed computing and national security

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hirons, K.P.; Vigil, M.; Carlson, R.

1997-07-01

This meeting covered the following topics: technologies/national needs/policies: past, present and future; information warfare; crisis management/massive data systems; risk assessment/vulnerabilities; Internet law/privacy and rights of society; challenges to effective ASCI programmatic use of 100 TFLOPs systems; and new computing technologies.

Australasian sequestrate fungi 17: the genus Hydnoplicata (Ascomycota, Pezizaceae) resurrected.

Treesearch

James M. Trappe; Andrew W. Claridge

2006-01-01

The genus Hydnoplicata and its type species, H. whitei, were described by Gilkey in 1954. Having discovered that it has amyloid asci and other characters that relate it to the genus Peziza, Trappe later proposed the new combination, Peziza whitei, even though the species is consistently...

Australasian sequestrate fungi 17: The genus Hydnoplicata (Ascomycota, Pezizacae) resurrected

Treesearch

James M. Trappe; Andrew W. Claridge

2006-01-01

The genus Hydnoplicata and its type species, H. whitei, were described by Gilkey in 1954. Having discovered that it has amyloid asci and other characters that relate it to the genus Peziza, Trappe later proposed the new combination, Peziza whiten, even though the species is consistently...

Metschnikowia drakensbergensis sp. nov. and Metschnikowia caudata sp. nov., endemic yeasts associated with Protea flowers in South Africa.

PubMed

de Vega, Clara; Guzmán, Beatriz; Steenhuisen, Sandy-Lynn; Johnson, Steven D; Herrera, Carlos M; Lachance, Marc-André

2014-11-01

In a taxonomic study of yeasts recovered from nectar of flowers and associated insects in South Africa, 11 strains were found to represent two novel species. Morphological and physiological characteristics and sequence analyses of the large-subunit rRNA gene D1/D2 region, as well as the actin, RNA polymerase II and elongation factor 2 genes, showed that the two novel species belonged to the genus Metschnikowia. Metschnikowia drakensbergensis sp. nov. (type strain EBD-CdVSA09-2(T) =CBS 13649(T) =NRRL Y-63721(T); MycoBank no. MB809688; allotype EBD-CdVSA10-2(A) =CBS13650(A) =NRRL Y-63720(A)) was recovered from nectar of Protea roupelliae and the beetle Heterochelus sp. This species belongs to the large-spored Metschnikowia clade and is closely related to Metschnikowia proteae, with which mating reactions and single-spored asci were observed. Metschnikowia caudata sp. nov. (type strain EBD-CdVSA08-1(T) =CBS 13651(T) =NRRL Y-63722(T); MycoBank no. MB809689; allotype EBD-CdVSA57-2(A) =CBS 13729(A) =NRRL Y-63723(A)) was isolated from nectar of Protea dracomontana, P. roupelliae and P. subvestita and a honeybee, and is a sister species to Candida hainanensis and Metschnikowia lopburiensis. Analyses of the four sequences demonstrated the existence of three separate phylotypes. Intraspecies matings led to the production of mature asci of unprecedented morphology, with a long, flexuous tail. A single ascospore was produced in all compatible crosses, regardless of sequence phylotype. The two species appear to be endemic to South Africa. The ecology and habitat specificity of these novel species are discussed in terms of host plant and insect host species. © 2014 IUMS.

Gene Expression of Pneumocystis murina after Treatment with Anidulafungin Results in Strong Signals for Sexual Reproduction, Cell Wall Integrity, and Cell Cycle Arrest, Indicating a Requirement for Ascus Formation for Proliferation.

PubMed

Cushion, Melanie T; Ashbaugh, Alan; Hendrix, Keeley; Linke, Michael J; Tisdale, Nikeya; Sayson, Steven G; Porollo, Aleksey

2018-05-01

The echinocandins are a class of antifungal agents that target β-1,3-d-glucan (BG) biosynthesis. In the ascigerous Pneumocystis species, treatment with these drugs depletes the ascus life cycle stage, which contains BG, but large numbers of forms which do not express BG remain in the infected lungs. In the present study, the gene expression profiles of Pneumocystis murina were compared between infected, untreated mice and mice treated with anidulafungin for 2 weeks to understand the metabolism of the persisting forms. Almost 80 genes were significantly up- or downregulated. Like other fungi exposed to echinocandins, genes associated with sexual replication, cell wall integrity, cell cycle arrest, and stress comprised the strongest upregulated signals in P. murina from the treated mice. The upregulation of the P. murina β-1,3-d-glucan endohydrolase and endo-1,3-glucanase was notable and may explain the disappearance of the existing asci in the lungs of treated mice since both enzymes can degrade BG. The biochemical measurement of BG in the lungs of treated mice and fluorescence microscopy with an anti-BG antibody supported the loss of BG. Downregulated signals included genes involved in cell replication, genome stability, and ribosomal biogenesis and function and the Pneumocystis -specific genes encoding the major surface glycoproteins (Msg). These studies suggest that P. murina attempted to undergo sexual replication in response to a stressed environment and was halted in any type of proliferative cycle, likely due to a lack of BG. Asci appear to be a required part of the life cycle stage of Pneumocystis , and BG may be needed to facilitate progression through the life cycle via sexual replication. Copyright © 2018 Cushion et al.

The Intergradation, Genetic Interchangeability and Interpretation of Gene Conversion Spectrum Types

PubMed Central

Lamb, Bernard C.; Ghikas, Aglaia

1979-01-01

In the Pasadena strains of Ascobolus immersus, the gene conversion propperties of 29 induced (nine UV, nine NG, and 11 ICR-170) and nine spontaneous white-ascospore mutations have been studied. Each mutant was crossed to three types of derived wild-type strains; single mutants often gave very different conversion results in the three types of crosses, with any or all of the following changes in: percentage with post-meiotic segregation among aberrant-ratio asci; percentage with conversion to wild type among aberrant-ratio asci; and in total conversion frequency. — These results are compared with those of Leblon (1972 a, b) from Ascobolus immersus and Yu-Sun, Wickramaratne and Whitehouse (1977) from Sordaria brevicollis. It is shown that conversion spectrum types are not necessarily distinct, but can completely intergrade, on the criteria of both post-meiotic segregation frequency and direction of correction. Genetic differences between strains in the present work resulted in much interchangeability of spectrum types for the same mutation in different crosses; e.g., from type C in one cross to type B/D type in another cross, although the mutation is presumably of the same molecular type (addition or deletion frame shift, or base substitution) in each cross. These changes of conversion properties for a given mutation in different crosses mean that previous interpretations of spectrum types in terms of specific conversion properties for various molecular types of mutation are inapplicable, or inadequate on their own, to explain the present data. Other factors, such as heterozygous cryptic mutations or conversion control genes, are probably involved. Because of asymmetric hybrid DNA formation, correction properties may differ from observed conversion properties. PMID:17248926

Complex Multi-Chamber Airbag Performance Simulation Final Report CRADA No. TSB-961-94

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kay, Gregory; Kithil, Philip

The purpose of this small business CRADA was to evaluate the performance of new airbag concepts which were developed by the Advanced Safety Concepts, Inc. (ASCI). These new airbag concepts, if successful, could have major potential savings to society in terms of fewer injuries, lost time and lives.

Quantifying Attitude to Chemistry in Students at the University of the South Pacific

ERIC Educational Resources Information Center

Brown, S. J.; Sharma, B. N.; Wakeling, L.; Naiker, M.; Chandra, S.; Gopalan, R. D.; Bilimoria, V. B.

2014-01-01

The attitude towards the study of chemistry for new entrant chemistry students from a multi-national, regional, tertiary educational institution in the South Pacific was investigated using a purpose-designed diagnostic instrument. The Attitude toward the Study of Chemistry Inventory (ASCI) was used to quantify attitude in a cohort of first year…

Attitude to the Study of Chemistry and Its Relationship with Achievement in an Introductory Undergraduate Course

ERIC Educational Resources Information Center

Brown, Stephen J.; White, Sue; Sharma, Bibhya; Wakeling, Lara; Naiker, Mani; Chandra, Shaneel; Gopalan, Romila; Bilimoria, Veena

2015-01-01

A positive attitude to a subject may be congruent with higher achievement; however, limited evidence supports this for students in undergraduate chemistry--this may result from difficulties in quantifying attitude. Therefore, in this study, the Attitude to the Study of Chemistry Inventory (ASCI)--a validated instrument to quantify attitude, was…

Using SPEEDES to simulate the blue gene interconnect network

NASA Technical Reports Server (NTRS)

Springer, P.; Upchurch, E.

2003-01-01

JPL and the Center for Advanced Computer Architecture (CACR) is conducting application and simulation analyses of BG/L in order to establish a range of effectiveness for the Blue Gene/L MPP architecture in performing important classes of computations and to determine the design sensitivity of the global interconnect network in support of real world ASCI application execution.

Identification and differentiation of species and strains of Arthrobacter and Microbacterium barkeri isolated from smear cheeses with Amplified Ribosmal DNA Restriction Analysis (ARDRA) and pulsed field gel electrophoresis (PFGE).

PubMed

Hoppe-Seyler, T S; Jaeger, B; Bockelmann, W; Noordman, W H; Geis, A; Heller, K J

2003-09-01

ARDRA (Amplified Ribosomal-DNA Restriction Analysis) was used to differentiate among species and genera of Arthrobacter and Microbacteria. Species-specific restriction patterns of PCR-products were obtained with NciI for Arthrobacter citreus (DSM 20133T), A. sulfureus (DSM 20167T), A. globiformis (DSM 20124T) and A. nicotianae strains (DSM 20123T, MGE 10D, CA13, CA14, isolate 95293, 95294, and 95299), A. rhombi CCUG 38813T, and CCUG 38812, and Microbacterium barkeri strains (DSM 30123T, MGE 10D, CA12 and CA15, isolate 95292, and isolate 95207). All yellow pigmented coryneforme bacteria isolated from the smear of surface ripened cheeses were identified as either A. nicotianae or M. barkeri strains. Using pulsed field gel electrophoresis (PFGE) strain specific restriction pattern for all Arthrobacter species and Microbacteria tested were obtained with restriction enzymes AscI and SpeI.

Purple L1 Milestone Review Panel TotalView Debugger Functionality and Performance for ASC Purple

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wolfe, M

2006-12-12

ASC code teams require a robust software debugging tool to help developers quickly find bugs in their codes and get their codes running. Development debugging commonly runs up to 512 processes. Production jobs run up to full ASC Purple scale, and at times require introspection while running. Developers want a debugger that runs on all their development and production platforms and that works with all compilers and runtimes used with ASC codes. The TotalView Multiprocess Debugger made by Etnus was specified for ASC Purple to address this needed capability. The ASC Purple environment builds on the environment seen by TotalViewmore » on ASCI White. The debugger must now operate with the Power5 CPU, Federation switch, AIX 5.3 operating system including large pages, IBM compilers 7 and 9, POE 4.2 parallel environment, and rs6000 SLURM resource manager. Users require robust, basic debugger functionality with acceptable performance at development debugging scale. A TotalView installation must be provided at the beginning of the early user access period that meets these requirements. A functional enhancement, fast conditional data watchpoints, and a scalability enhancement, capability up to 8192 processes, are to be demonstrated.« less

Diagnosing Changes in Attitude in First-Year College Chemistry Students with a Shortened Version of Bauer's Semantic Differential

ERIC Educational Resources Information Center

Brandriet, Alexandra R.; Xu, Xiaoying; Bretz, Stacey Lowery; Lewis, Jennifer E.

2011-01-01

In this quantitative study, a shortened version of the Attitude toward the Subject of Chemistry Inventory (ASCI) created by Bauer (2008) was used to identify the chemistry attitudes of two populations of general chemistry students at two universities. The ASCIv2 contained just two factors from the original instrument. These factors measured…

Evaluation of the fish passage effectiveness of the Bonneville I prototype surface collector using three-dimensional ultrasonic fish tracking - Final Report

USGS Publications Warehouse

Faber, D.M; Weiland, M.A.; Moursund, R.A.; Carlson, T.J.; Adams, N.; Rondorf, D.

2001-01-01

This report describes tests conducted at Bonneville Dam on the Columbia River in the spring of 2000. The studies used three-dimensional (3D) acoustic telemetry and computational fluid dynamics (CFD) hydraulic modeling techniques to evaluate the response of outmigrating juvenile steelhead (Oncorhynchus mykiss) and yearling chinook (O. tshawytscha) to the Prototype Surface Collector (PSC) installed at Powerhouse I of Bonneville Dam in 1998 to test the concept of using a deep-slot surface bypass collector to divert downstream migrating salmon from turbines. The study was conducted by Pacific Northwest National Laboratory (PNNL), the Waterways Experiment Station of the U.S. Army Corp of Engineers (COE), Asci Corporation, and the U.S. Geological Survey (USGS), and was sponsored by COE’s Portland District. The goal of the study was to observe the three-dimensional behavior of tagged fish (fish bearing ultrasonic micro-transmitters) within 100 meters (m) of the surface flow bypass structure to test hypotheses about the response of migrants to flow stimuli generated by the presence of the surface flow bypass prototype and its operation. Research was done in parallel with radio telemetry studies conducted by USGS and hydroacoustic studies conducted by WES & Asci to evaluate the prototype surface collector.

Analysis, Thematic Maps and Data Mining from Point Cloud to Ontology for Software Development

NASA Astrophysics Data System (ADS)

Nespeca, R.; De Luca, L.

2016-06-01

The primary purpose of the survey for the restoration of Cultural Heritage is the interpretation of the state of building preservation. For this, the advantages of the remote sensing systems that generate dense point cloud (range-based or image-based) are not limited only to the acquired data. The paper shows that it is possible to extrapolate very useful information in diagnostics using spatial annotation, with the use of algorithms already implemented in open-source software. Generally, the drawing of degradation maps is the result of manual work, so dependent on the subjectivity of the operator. This paper describes a method of extraction and visualization of information, obtained by mathematical procedures, quantitative, repeatable and verifiable. The case study is a part of the east facade of the Eglise collégiale Saint-Maurice also called Notre Dame des Grâces, in Caromb, in southern France. The work was conducted on the matrix of information contained in the point cloud asci format. The first result is the extrapolation of new geometric descriptors. First, we create the digital maps with the calculated quantities. Subsequently, we have moved to semi-quantitative analyses that transform new data into useful information. We have written the algorithms for accurate selection, for the segmentation of point cloud, for automatic calculation of the real surface and the volume. Furthermore, we have created the graph of spatial distribution of the descriptors. This work shows that if we work during the data processing we can transform the point cloud into an enriched database: the use, the management and the data mining is easy, fast and effective for everyone involved in the restoration process.

Matrix Metalloproteinases as a Therapeutic Target to Improve Neurologic Recovery After Spinal Cord Injury

DTIC Science & Technology

2015-12-01

aberrant remodeling of the bladder wall, which could contribute to increased weight of this structure and reduced voiding. We next evaluated the...moderate levels of SCI show both neurological and urological recovery. Task 4. Analysis of lesion epicenter and serotonergic fiber tracks caudal to a...SCI in mice. 4a. Perfuse animals with fixative, remove the cords, and stain with Eriochrome cyanine or immunostain for serotonergic fiber tracks

User Metrics in NASA Earth Science Data Systems

NASA Technical Reports Server (NTRS)

Lynnes, Chris

2018-01-01

This presentation the collection and use of user metrics in NASA's Earth Science data systems. A variety of collection methods is discussed, with particular emphasis given to the American Customer Satisfaction Index (ASCI). User sentiment on potential use of cloud computing is presented, with generally positive responses. The presentation also discusses various forms of automatically collected metrics, including an example of the relative usage of different functions within the Giovanni analysis system.

Terascale spectral element algorithms and implementations.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fischer, P. F.; Tufo, H. M.

1999-08-17

We describe the development and implementation of an efficient spectral element code for multimillion gridpoint simulations of incompressible flows in general two- and three-dimensional domains. We review basic and recently developed algorithmic underpinnings that have resulted in good parallel and vector performance on a broad range of architectures, including the terascale computing systems now coming online at the DOE labs. Sustained performance of 219 GFLOPS has been recently achieved on 2048 nodes of the Intel ASCI-Red machine at Sandia.

Architectural requirements for the Red Storm computing system.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Camp, William J.; Tomkins, James Lee

This report is based on the Statement of Work (SOW) describing the various requirements for delivering 3 new supercomputer system to Sandia National Laboratories (Sandia) as part of the Department of Energy's (DOE) Accelerated Strategic Computing Initiative (ASCI) program. This system is named Red Storm and will be a distributed memory, massively parallel processor (MPP) machine built primarily out of commodity parts. The requirements presented here distill extensive architectural and design experience accumulated over a decade and a half of research, development and production operation of similar machines at Sandia. Red Storm will have an unusually high bandwidth, low latencymore » interconnect, specially designed hardware and software reliability features, a light weight kernel compute node operating system and the ability to rapidly switch major sections of the machine between classified and unclassified computing environments. Particular attention has been paid to architectural balance in the design of Red Storm, and it is therefore expected to achieve an atypically high fraction of its peak speed of 41 TeraOPS on real scientific computing applications. In addition, Red Storm is designed to be upgradeable to many times this initial peak capability while still retaining appropriate balance in key design dimensions. Installation of the Red Storm computer system at Sandia's New Mexico site is planned for 2004, and it is expected that the system will be operated for a minimum of five years following installation.« less

Investigation of Surface Phenomena in Shocked Tin in Converging Geometry

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rousculp, Christopher L.; Oro, David Michael; Griego, Jeffrey Randall

2016-04-14

There is a great interest in RMI as source of ejecta from metal shells. Previous experiments have explored wavelength amplitude (kA) variation but they have a small range of drive pressures and are in planer geometry. Simulations, both MD and hydro, have explored RMI in planer geometry. The ejecta source model from RMI is an area of active algorithm and code development in ASCI-IC Lagrangian Applications Project. PHELIX offers precise, reproducible variable driver for Hydro and material physics diagnoses with proton radiography.

Endomyces tetrasperma, sp. n

PubMed Central

Macy, J. M.; Miller, M. W.

1971-01-01

A new fungal species has been described and placed in the genus Endomyces. Endomyces tetrasperma forms a true septate, multinucleate mycelium which breaks up into arthrospores. Ascus formation occurs after isogamous copulation between sexual protuberances which develop at the ends of arthrospores or between two cells, adjacent mycelial cells, or arthrospores. The asci which dehisce at maturity release two to four smooth, ovoid, thick-walled spores, each containing two oil droplets. The proposed life cycle is based on morphological and cytological observations. Images PMID:5541538

Dicer-Like Proteins Regulate Sexual Development via the Biogenesis of Perithecium-Specific MicroRNAs in a Plant Pathogenic Fungus Fusarium graminearum

PubMed Central

Zeng, Wenping; Wang, Jie; Wang, Ying; Lin, Jing; Fu, Yanping; Xie, Jiatao; Jiang, Daohong; Chen, Tao; Liu, Huiquan; Cheng, Jiasen

2018-01-01

Ascospores act as the primary inoculum of Fusarium graminearum, which causes the destructive disease Fusarium head blight (FHB), or scab. MicroRNAs (miRNAs) have been reported in the F. graminearum vegetative stage, and Fgdcl2 is involved in microRNA-like RNA (milRNA) biogenesis but has no major impact on vegetative growth, abiotic stress or pathogenesis. In the present study, we found that ascospore discharge was decreased in the Fgdcl1 deletion mutant, and completely blocked in the double-deletion mutant of Fgdcl1 and Fgdcl2. Besides, more immature asci were observed in the double-deletion mutant. Interestingly, the up-regulated differentially expressed genes (DEGs) common to ΔFgdcl1 and ΔFgdcl1/2 were related to ion transmembrane transporter and membrane components. The combination of small RNA and transcriptome sequencing with bioinformatics analysis predicted 143 novel milRNAs in wild-type perithecia, and 138 of these milRNAs partly or absolutely depended on Fgdcl1, while only 5 novel milRNAs were still obtained in the Fgdcl1 and Fgdcl2 double-deletion mutant. Furthermore, 117 potential target genes were predicted. Overall, Fgdcl1 and Fgdcl2 genes were partly functionally redundant in ascospore discharge and perithecium-specific milRNA generation in F. graminearum, and these perithecium-specific milRNAs play potential roles in sexual development. PMID:29755439

3D Vectorial Time Domain Computational Integrated Photonics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kallman, J S; Bond, T C; Koning, J M

2007-02-16

The design of integrated photonic structures poses considerable challenges. 3D-Time-Domain design tools are fundamental in enabling technologies such as all-optical logic, photonic bandgap sensors, THz imaging, and fast radiation diagnostics. Such technologies are essential to LLNL and WFO sponsors for a broad range of applications: encryption for communications and surveillance sensors (NSA, NAI and IDIV/PAT); high density optical interconnects for high-performance computing (ASCI); high-bandwidth instrumentation for NIF diagnostics; micro-sensor development for weapon miniaturization within the Stockpile Stewardship and DNT programs; and applications within HSO for CBNP detection devices. While there exist a number of photonics simulation tools on the market,more » they primarily model devices of interest to the communications industry. We saw the need to extend our previous software to match the Laboratory's unique emerging needs. These include modeling novel material effects (such as those of radiation induced carrier concentrations on refractive index) and device configurations (RadTracker bulk optics with radiation induced details, Optical Logic edge emitting lasers with lateral optical inputs). In addition we foresaw significant advantages to expanding our own internal simulation codes: parallel supercomputing could be incorporated from the start, and the simulation source code would be accessible for modification and extension. This work addressed Engineering's Simulation Technology Focus Area, specifically photonics. Problems addressed from the Engineering roadmap of the time included modeling the Auston switch (an important THz source/receiver), modeling Vertical Cavity Surface Emitting Lasers (VCSELs, which had been envisioned as part of fast radiation sensors), and multi-scale modeling of optical systems (for a variety of applications). We proposed to develop novel techniques to numerically solve the 3D multi-scale propagation problem for both the microchip laser logic devices as well as devices characterized by electromagnetic (EM) propagation in nonlinear materials with time-varying parameters. The deliverables for this project were extended versions of the laser logic device code Quench2D and the EM propagation code EMsolve with new modules containing the novel solutions incorporated by taking advantage of the existing software interface and structured computational modules. Our approach was multi-faceted since no single methodology can always satisfy the tradeoff between model runtime and accuracy requirements. We divided the problems to be solved into two main categories: those that required Full Wave Methods and those that could be modeled using Approximate Methods. Full Wave techniques are useful in situations where Maxwell's equations are not separable (or the problem is small in space and time), while approximate techniques can treat many of the remaining cases.« less

Pentium Pro inside. 1; A treecode at 430 Gigaflops on ASCI Red

NASA Technical Reports Server (NTRS)

Warren, M. S.; Becker, D. J.; Sterling, T.; Salmon, J. K.; Goda, M. P.

1997-01-01

As an entry for the 1997 Gordon Bell performance prize, we present results from two methods of solving the gravitational N-body problem on the Intel Teraflops system at Sandia National Laboratory (ASCI Red). The first method, an O(N2) algorithm, obtained 635 Gigaflops for a 1 million particle problem on 6800 Pentium Pro processors. The second solution method, a tree-code which scales as O(N log N), sustained 170 Gigaflops over a continuous 9.4 hour period on 4096 processors, integrating the motion of 322 million mutually interacting particles in a cosmology simulation, while saving over 100 Gigabytes of raw data. Additionally, the tree-code sustained 430 Gigaflops on 6800 processors for the first 5 time-steps of that simulation. This tree-code solution is approximately 105 times more efficient than the O(N2) algorithm for this problem. As an entry for the 1997 Gordon Bell price/performance prize, we present two calculations from the disciplines of astrophysics and fluid dynamics. The simulations were performed on two 16 Pentium Pro processor Beowulf-class computers (Loki and Hyglac) constructed entirely from commodity personal computer technology, at a cost of roughly $50k each in September, 1996. The price of an equivalent system in August 1997 is less than $30. At Los Alamos, Loki performed a gravitational tree-code N-body simulation of galaxy formation using 9.75 million particles, which sustained an average of 879 Mflops over a ten day period, and produced roughly 10 Gbytes of raw data.

Scytalidium parasiticum sp. nov., a New Species Parasitizing on Ganoderma boninense Isolated from Oil Palm in Peninsular Malaysia.

PubMed

Goh, Yit Kheng; Goh, Teik Khiang; Marzuki, Nurul Fadhilah; Tung, Hun Jiat; Goh, You Keng; Goh, Kah Joo

2015-06-01

A mycoparasite, Scytalidium parasiticum sp. nov., isolated from the basidiomata of Ganoderma boninense causing basal stem rot of oil palm in Johor, Malaysia, is described and illustrated. It is distinct from other Scytalidium species in having smaller asci and ascospores (teleomorphic stage), longer arthroconidia (anamorphic stage), hyaline to yellowish chlamydospores, and producing a fluorescent pigment. The phylogenetic position of S. parasiticum was determined by sequence analyses of the internal transcribed spacers and the small-subunit ribosomal RNA gene regions. A key to identify Scytalidium species with teleomorphic stage is provided.

Scytalidium parasiticum sp. nov., a New Species Parasitizing on Ganoderma boninense Isolated from Oil Palm in Peninsular Malaysia

PubMed Central

Goh, Teik Khiang; Marzuki, Nurul Fadhilah; Tung, Hun Jiat; Goh, You Keng; Goh, Kah Joo

2015-01-01

A mycoparasite, Scytalidium parasiticum sp. nov., isolated from the basidiomata of Ganoderma boninense causing basal stem rot of oil palm in Johor, Malaysia, is described and illustrated. It is distinct from other Scytalidium species in having smaller asci and ascospores (teleomorphic stage), longer arthroconidia (anamorphic stage), hyaline to yellowish chlamydospores, and producing a fluorescent pigment. The phylogenetic position of S. parasiticum was determined by sequence analyses of the internal transcribed spacers and the small-subunit ribosomal RNA gene regions. A key to identify Scytalidium species with teleomorphic stage is provided. PMID:26190917

Therans-3-enoic acids ofAster alpinus andArctium minus seed oils.

PubMed

Morris, L J; Marshall, M O; Hammond, E W

1968-01-01

Thetrans-3-enoic acids ofAster alpinus (dwarf aster, rock aster) andArctium minus (burdock) seed oils have been isolated and characterized.Arctium seed oil containstrans-3,cis-9,cis-12-octadecatrienoic acid (9.9%), andAster oil containstrans-3-hexadecenoic (7.1%),rans-3-octadecenoic (1.9%),trans-3,cis-9-octadecadienoic (3.0%),a ndtrans-3,cis-9,cis-12-octadecatrienoic (13.7%) acids.Aster oil also has an epoxy acid as a minor constituent (ca. 2.0%), which has been identified ascis-9,10-epoxy-cis-12-octadecenoic acid.

Terascale Visualization: Multi-resolution Aspirin for Big-Data Headaches

NASA Astrophysics Data System (ADS)

Duchaineau, Mark

2001-06-01

Recent experience on the Accelerated Strategic Computing Initiative (ASCI) computers shows that computational physicists are successfully producing a prodigious collection of numbers on several thousand processors. But with this wealth of numbers comes an unprecedented difficulty in processing and moving them to provide useful insight and analysis. In this talk, a few simulations are highlighted where recent advancements in multiple-resolution mathematical representations and algorithms have provided some hope of seeing most of the physics of interest while keeping within the practical limits of the post-simulation storage and interactive data-exploration resources. A whole host of visualization research activities was spawned by the 1999 Gordon Bell Prize-winning computation of a shock-tube experiment showing Richtmyer-Meshkov turbulent instabilities. This includes efforts for the entire data pipeline from running simulation to interactive display: wavelet compression of field data, multi-resolution volume rendering and slice planes, out-of-core extraction and simplification of mixing-interface surfaces, shrink-wrapping to semi-regularize the surfaces, semi-structured surface wavelet compression, and view-dependent display-mesh optimization. More recently on the 12 TeraOps ASCI platform, initial results from a 5120-processor, billion-atom molecular dynamics simulation showed that 30-to-1 reductions in storage size can be achieved with no human-observable errors for the analysis required in simulations of supersonic crack propagation. This made it possible to store the 25 trillion bytes worth of simulation numbers in the available storage, which was under 1 trillion bytes. While multi-resolution methods and related systems are still in their infancy, for the largest-scale simulations there is often no other choice should the science require detailed exploration of the results.

Towards Accurate Application Characterization for Exascale (APEX)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hammond, Simon David

Sandia National Laboratories has been engaged in hardware and software codesign activities for a number of years, indeed, it might be argued that prototyping of clusters as far back as the CPLANT machines and many large capability resources including ASCI Red and RedStorm were examples of codesigned solutions. As the research supporting our codesign activities has moved closer to investigating on-node runtime behavior a nature hunger has grown for detailed analysis of both hardware and algorithm performance from the perspective of low-level operations. The Application Characterization for Exascale (APEX) LDRD was a project concieved of addressing some of these concerns.more » Primarily the research was to intended to focus on generating accurate and reproducible low-level performance metrics using tools that could scale to production-class code bases. Along side this research was an advocacy and analysis role associated with evaluating tools for production use, working with leading industry vendors to develop and refine solutions required by our code teams and to directly engage with production code developers to form a context for the application analysis and a bridge to the research community within Sandia. On each of these accounts significant progress has been made, particularly, as this report will cover, in the low-level analysis of operations for important classes of algorithms. This report summarizes the development of a collection of tools under the APEX research program and leaves to other SAND and L2 milestone reports the description of codesign progress with Sandia’s production users/developers.« less

Generic domain models in software engineering

NASA Technical Reports Server (NTRS)

Maiden, Neil

1992-01-01

This paper outlines three research directions related to domain-specific software development: (1) reuse of generic models for domain-specific software development; (2) empirical evidence to determine these generic models, namely elicitation of mental knowledge schema possessed by expert software developers; and (3) exploitation of generic domain models to assist modelling of specific applications. It focuses on knowledge acquisition for domain-specific software development, with emphasis on tool support for the most important phases of software development.

Absence of Interference in Association with Gene Conversion in SORDARIA FIMICOLA, and Presence of Interference in Association with Ordinary Recombination

PubMed Central

Kitani, Y.

1978-01-01

From the analysis of large samples of gene conversion asci in the g locus of Sordaria fimicola, it was found that neither the conversion event itself nor conversion-associated recombination of flanking markers cause either chiasma or chromatid interference with crossing over in a neighboring interval. The presence of more than one kind of crossover event, one causing interference the other not, is considered. The existence of two kinds of gene loci, one of single-cistron composition and the other of multiple-cistron composition, is discussed in relation to reciprocal recombination within a locus. PMID:17176535

Absence of interference in association with gene conversion in Sordaria fimicola, and presence of interference in association with ordinary recombination.

PubMed

Kitani, Y

1978-07-01

From the analysis of large samples of gene conversion asci in the g locus of Sordaria fimicola, it was found that neither the conversion event itself nor conversion-associated recombination of flanking markers cause either chiasma or chromatid interference with crossing over in a neighboring interval. The presence of more than one kind of crossover event, one causing interference the other not, is considered. The existence of two kinds of gene loci, one of single-cistron composition and the other of multiple-cistron composition, is discussed in relation to reciprocal recombination within a locus.

Handbook for Forecasters in the Mediterranean. Part 2. Regional Forecasting Aids for the Mediterranean Basin.

DTIC Science & Technology

1980-12-01

38 V-i 2 Table V-4. Forecasting rules for stations and anchorages. Sigonella Rules 39-42 Valletta Rules 43-45 Taranto Rules 46-48 Argostolion Rule 49...Lampedusa 16 490 Lecce 16 332 Luga/ Valletta 16 597 Messina 16 420 Pal asci a 16 334 Pantel 1 eri a 16 470 Quargle 60 580 Si gonel I a 16 459 S. Maria Di...8217 Pantelleria Gea S.a Bay 蚦 4 53( 480 Lampedusa *. Cazzo Spadaro52 49.0 " 597 •~ 55• 5 5• ,/ • . Luga/ Valletta . • " El Qued -Guemar 559 580 󈧢 Figure

78 FR 47015 - Software Requirement Specifications for Digital Computer Software Used in Safety Systems of...

Federal Register 2010, 2011, 2012, 2013, 2014

2013-08-02

... NUCLEAR REGULATORY COMMISSION [NRC-2012-0195] Software Requirement Specifications for Digital Computer Software Used in Safety Systems of Nuclear Power Plants AGENCY: Nuclear Regulatory Commission... issuing a revised regulatory guide (RG), revision 1 of RG 1.172, ``Software Requirement Specifications for...

Phylogeny of Penicillium and the segregation of Trichocomaceae into three families

PubMed Central

Houbraken, J.; Samson, R.A.

2011-01-01

Species of Trichocomaceae occur commonly and are important to both industry and medicine. They are associated with food spoilage and mycotoxin production and can occur in the indoor environment, causing health hazards by the formation of β-glucans, mycotoxins and surface proteins. Some species are opportunistic pathogens, while others are exploited in biotechnology for the production of enzymes, antibiotics and other products. Penicillium belongs phylogenetically to Trichocomaceae and more than 250 species are currently accepted in this genus. In this study, we investigated the relationship of Penicillium to other genera of Trichocomaceae and studied in detail the phylogeny of the genus itself. In order to study these relationships, partial RPB1, RPB2 (RNA polymerase II genes), Tsr1 (putative ribosome biogenesis protein) and Cct8 (putative chaperonin complex component TCP-1) gene sequences were obtained. The Trichocomaceae are divided in three separate families: Aspergillaceae, Thermoascaceae and Trichocomaceae. The Aspergillaceae are characterised by the formation flask-shaped or cylindrical phialides, asci produced inside cleistothecia or surrounded by Hülle cells and mainly ascospores with a furrow or slit, while the Trichocomaceae are defined by the formation of lanceolate phialides, asci borne within a tuft or layer of loose hyphae and ascospores lacking a slit. Thermoascus and Paecilomyces, both members of Thermoascaceae, also form ascospores lacking a furrow or slit, but are differentiated from Trichocomaceae by the production of asci from croziers and their thermotolerant or thermophilic nature. Phylogenetic analysis shows that Penicillium is polyphyletic. The genus is re-defined and a monophyletic genus for both anamorphs and teleomorphs is created (Penicillium sensu stricto). The genera Thysanophora, Eupenicillium, Chromocleista, Hemicarpenteles and Torulomyces belong in Penicillium s. str. and new combinations for the species belonging to these genera are proposed. Analysis of Penicillium below genus rank revealed the presence of 25 clades. A new classification system including both anamorph and teleomorph species is proposed and these 25 clades are treated here as sections. An overview of species belonging to each section is presented. Taxonomic novelties: New sections, all in Penicillium: sect. Sclerotiora Houbraken & Samson, sect. Charlesia Houbraken & Samson, sect. Thysanophora Houbraken & Samson,sect. Ochrosalmonea Houbraken & Samson, sect. Cinnamopurpurea Houbraken & Samson, Fracta Houbraken & Samson, sect. Stolkia Houbraken & Samson, sect. Gracilenta Houbraken & Samson, sect. Citrina Houbraken & Samson, sect. Turbata Houbraken & Samson, sect. Paradoxa Houbraken & Samson, sect. Canescentia Houbraken & Samson. New combinations: Penicillium asymmetricum (Subramanian & Sudha) Houbraken & Samson, P. bovifimosum (Tuthill & Frisvad) Houbraken & Samson, P. glaucoalbidum (Desmazières) Houbraken & Samson, P. laeve (K. Ando & Manoch) Houbraken & Samson, P. longisporum (Kendrick) Houbraken & Samson, P. malachiteum (Yaguchi & Udagawa) Houbraken & Samson, P. ovatum (K. Ando & Nawawi) Houbraken & Samson, P. parviverrucosum (K. Ando & Pitt) Houbraken & Samson, P. saturniforme (Wang & Zhuang) Houbraken & Samson, P. taiwanense (Matsushima) Houbraken & Samson. New names: Penicillium coniferophilum Houbraken & Samson, P. hennebertii Houbraken & Samson, P. melanostipe Houbraken & Samson, P. porphyreum Houbraken & Samson. PMID:22308045

75 FR 16817 - Meeting for Software Developers on the Technical Specifications for Common Formats for Patient...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-04-02

... Software Developers on the Technical Specifications for Common Formats for Patient Safety Data Collection... software developers can provide input on these technical specifications for the Common Formats Version 1.1... specifications, which provide direction to software developers that plan to implement the Common Formats...

Working Notes from the 1992 AAAI Workshop on Automating Software Design. Theme: Domain Specific Software Design

NASA Technical Reports Server (NTRS)

Keller, Richard M. (Editor); Barstow, David; Lowry, Michael R.; Tong, Christopher H.

1992-01-01

The goal of this workshop is to identify different architectural approaches to building domain-specific software design systems and to explore issues unique to domain-specific (vs. general-purpose) software design. Some general issues that cut across the particular software design domain include: (1) knowledge representation, acquisition, and maintenance; (2) specialized software design techniques; and (3) user interaction and user interface.

Self-assembling software generator

DOEpatents

Bouchard, Ann M [Albuquerque, NM; Osbourn, Gordon C [Albuquerque, NM

2011-11-25

A technique to generate an executable task includes inspecting a task specification data structure to determine what software entities are to be generated to create the executable task, inspecting the task specification data structure to determine how the software entities will be linked after generating the software entities, inspecting the task specification data structure to determine logic to be executed by the software entities, and generating the software entities to create the executable task.

NASA software specification and evaluation system: Software verification/validation techniques

NASA Technical Reports Server (NTRS)

1977-01-01

NASA software requirement specifications were used in the development of a system for validating and verifying computer programs. The software specification and evaluation system (SSES) provides for the effective and efficient specification, implementation, and testing of computer software programs. The system as implemented will produce structured FORTRAN or ANSI FORTRAN programs, but the principles upon which SSES is designed allow it to be easily adapted to other high order languages.

77 FR 50726 - Software Requirement Specifications for Digital Computer Software and Complex Electronics Used in...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-08-22

... Computer Software and Complex Electronics Used in Safety Systems of Nuclear Power Plants AGENCY: Nuclear...-1209, ``Software Requirement Specifications for Digital Computer Software and Complex Electronics used... Electronics Engineers (ANSI/IEEE) Standard 830-1998, ``IEEE Recommended Practice for Software Requirements...

RT-Syn: A real-time software system generator

NASA Technical Reports Server (NTRS)

Setliff, Dorothy E.

1992-01-01

This paper presents research into providing highly reusable and maintainable components by using automatic software synthesis techniques. This proposal uses domain knowledge combined with automatic software synthesis techniques to engineer large-scale mission-critical real-time software. The hypothesis centers on a software synthesis architecture that specifically incorporates application-specific (in this case real-time) knowledge. This architecture synthesizes complex system software to meet a behavioral specification and external interaction design constraints. Some examples of these external constraints are communication protocols, precisions, timing, and space limitations. The incorporation of application-specific knowledge facilitates the generation of mathematical software metrics which are used to narrow the design space, thereby making software synthesis tractable. Success has the potential to dramatically reduce mission-critical system life-cycle costs not only by reducing development time, but more importantly facilitating maintenance, modifications, and extensions of complex mission-critical software systems, which are currently dominating life cycle costs.

SAGA: A project to automate the management of software production systems

NASA Technical Reports Server (NTRS)

Campbell, Roy H.; Laliberte, D.; Render, H.; Sum, R.; Smith, W.; Terwilliger, R.

1987-01-01

The Software Automation, Generation and Administration (SAGA) project is investigating the design and construction of practical software engineering environments for developing and maintaining aerospace systems and applications software. The research includes the practical organization of the software lifecycle, configuration management, software requirements specifications, executable specifications, design methodologies, programming, verification, validation and testing, version control, maintenance, the reuse of software, software libraries, documentation, and automated management.

76 FR 16785 - Meeting for Software Developers on the Technical Specifications for Common Formats for Patient...

Federal Register 2010, 2011, 2012, 2013, 2014

2011-03-25

... Software Developers on the Technical Specifications for Common Formats for Patient Safety Data Collection... designed as an interactive forum where PSOs and software developers can provide input on these technical... updated event descriptions, forms, and technical specifications for software developers. As an update to...

Speciation in the large-spored Metschnikowia clade and establishment of a new species, Metschnikowia borealis comb. nov.

PubMed

Marinoni, Gaëlle; Lachance, Marc-André

2004-03-01

The reproductive boundaries among species in the large-spored Metschnikowia clade were studied by prototrophic recombinant selection, electrophoretic karyotyping, mitochondrial DNA restriction analysis, and DNA sequence analysis. Inviable ascospores arose from crosses between the two varieties of Metschnikowia continentalis, indicating that they should be recognized as separate species. Prototrophic recombinants were recovered from crosses between auxotrophic mutants of Metschnikowia borealis, M. continentalis, Metschnikowia lochheadii, Metschnikowia sp. UWO(PS)00-154.1, and Candida ipomoeae, showing that some genetic exchange is possible in spite of the sterility of the asci formed in interspecific crosses. Metschnikowia hawaiiensis, although capable of ascus formation when its h(-) mating type is crossed with the h(+) mating type of the other species, did not give rise to recombinants. In the other species, some recombinants acquired the ability to form asci directly from single cells. These often contained the chromosomes of both parents, suggesting formation of allodiploid hybrids. Other recombinants behaved as haploids and were similar to one parent except for having inherited the selectable wild-type allele from the other parent. In most, but not all cases, inheritance of the mitochondrial genome was uniparental and correlated with the inheritance of the nuclear chromosome complement. In some cases, what appeared to be a recombinant mitochondrial genome was observed. Phylogenies derived from the sequences of various DNA regions were not congruent, indicating that hybridization may have taken place in nature as the large-spored species diverged from their common ancestor. Further evidence that C. ipomoeae arose from a natural recombination event was obtained, but a pair of Metschnikowia species that might represent derived forms of the parents could not be identified conclusively. C. ipomoeae and most of its closely related Metschnikowia species contained a group-II intron in the mitochondrial small-subunit ribosomal gene. The intron was absent in M. borealis, M. hawaiiensis, and other species in the genus Metschnikowia.

Power API Prototype

DOE Office of Scientific and Technical Information (OSTI.GOV)

2014-12-04

The software serves two purposes. The first purpose of the software is to prototype the Sandia High Performance Computing Power Application Programming Interface Specification effort. The specification can be found at http://powerapi.sandia.gov . Prototypes of the specification were developed in parallel with the development of the specification. Release of the prototype will be instructive to anyone who intends to implement the specification. More specifically, our vendor collaborators will benefit from the availability of the prototype. The second is in direct support of the PowerInsight power measurement device, which was co-developed with Penguin Computing. The software provides a cluster wide measurementmore » capability enabled by the PowerInsight device. The software can be used by anyone who purchases a PowerInsight device. The software will allow the user to easily collect power and energy information of a node that is instrumented with PowerInsight. The software can also be used as an example prototype implementation of the High Performance Computing Power Application Programming Interface Specification.« less

21 CFR 882.1440 - Neuropsychiatric interpretive electroencephalograph assessment aid.

Code of Federal Regulations, 2014 CFR

2014-04-01

... described in detail in the software requirements specification and software design specification... the device, hardware and software, must be fully characterized and must demonstrate a reasonable assurance of safety and effectiveness. (i) Hardware specifications must be provided. Appropriate...

Drop-out phagemid vector for switching from phage displayed affinity reagents to expression formats.

PubMed

Pershad, Kritika; Sullivan, Mark A; Kay, Brian K

2011-05-15

Affinity reagents that are generated by phage display are typically subcloned into an expression vector for further biochemical characterization. This insert transfer process is time consuming and laborious especially if many inserts are to be subcloned. To simplify the transfer process, we have constructed a "drop-out" phagemid vector that can be rapidly converted to an expression vector by a simple restriction enzyme digestion with MfeI (to "drop-out" the gene III coding sequence), which generates alkaline phosphatase (AP) fusions of the affinity reagents on religation. Subsequently, restriction digestion with AscI drops out the AP coding region and religation generates affinity reagents with a C-terminal six-histidine tag. To validate the usefulness of this vector, four different human single chain Fragments of variable regions (scFv) were tested, three of which show specific binding to three zebrafish (Danio rerio) proteins, namely suppression of tumorigenicity 13, recoverin, and Ppib and the fourth binds to human Lactoferrin protein. For each of the constructs tested, the gene III and AP drop-out efficiency was between 90% and 100%. This vector is especially useful in speeding up the downstream screening of affinity reagents and bypassing the time-consuming subcloning experiments. Copyright © 2011 Elsevier Inc. All rights reserved.

A diversity study of Saccharomycopsis fibuligera in rice wine starter nuruk, reveals the evolutionary process associated with its interspecies hybrid.

PubMed

Farh, Mohamed El-Agamy; Cho, Yunjoo; Lim, Jae Yun; Seo, Jeong-Ah

2017-05-01

The amylolytic yeast Saccharomycopsis fibuligera is the predominant yeast in the starter product, nuruk, which is utilized for rice wine production in South Korea. Latest molecular studies explore a recently developed interspecific hybridization among stains of S. fibuligera with a unique genetic feature. However, the origin of the natural hybridization occurrence is still unclear. Thus, to respectively distinguish parental and hybrid strains, specific primer sets were applied on 141 yeast strains isolated from different nuruk samples fermented in different provinces. Sixty-seven strains were defined accordingly as parental species with genome A while 8 strains were defined as hybrid strains. Unexpectedly, another parental species with genome B could not be found among the strain pools yet. Furthermore, it was observed that hybrid strains are phenotypically different from A genome strains; asci containing tetrad ascospores were observed in A genome strains more frequent than in hybrid strains. Nevertheless, hybrid strains were slightly more thermotolerant than A genome strains. Interestingly, all hybrid strains were located only in Jeju province. Based on these sets of data, we speculated that the unique climate of Jeju province might play an evolutionary role in the interspecific hybridization between A genome strains, as well as the unculturable allopatric B genome strains.

Software requirements specification for the GIS-T/ISTEA pooled fund study phase C linear referencing engine

DOE Office of Scientific and Technical Information (OSTI.GOV)

Amai, W.; Espinoza, J. Jr.; Fletcher, D.R.

1997-06-01

This Software Requirements Specification (SRS) describes the features to be provided by the software for the GIS-T/ISTEA Pooled Fund Study Phase C Linear Referencing Engine project. This document conforms to the recommendations of IEEE Standard 830-1984, IEEE Guide to Software Requirements Specification (Institute of Electrical and Electronics Engineers, Inc., 1984). The software specified in this SRS is a proof-of-concept implementation of the Linear Referencing Engine as described in the GIS-T/ISTEA pooled Fund Study Phase B Summary, specifically Sheet 13 of the Phase B object model. The software allows an operator to convert between two linear referencing methods and a datummore » network.« less

An Interoperability Framework and Capability Profiling for Manufacturing Software

NASA Astrophysics Data System (ADS)

Matsuda, M.; Arai, E.; Nakano, N.; Wakai, H.; Takeda, H.; Takata, M.; Sasaki, H.

ISO/TC184/SC5/WG4 is working on ISO16100: Manufacturing software capability profiling for interoperability. This paper reports on a manufacturing software interoperability framework and a capability profiling methodology which were proposed and developed through this international standardization activity. Within the context of manufacturing application, a manufacturing software unit is considered to be capable of performing a specific set of function defined by a manufacturing software system architecture. A manufacturing software interoperability framework consists of a set of elements and rules for describing the capability of software units to support the requirements of a manufacturing application. The capability profiling methodology makes use of the domain-specific attributes and methods associated with each specific software unit to describe capability profiles in terms of unit name, manufacturing functions, and other needed class properties. In this methodology, manufacturing software requirements are expressed in terns of software unit capability profiles.

Software Requirements Specification for an Ammunition Management System

DTIC Science & Technology

1986-09-01

thesis takes the form of a software requirements specification. Such a specification, according to Pressman [Ref. 7], establishes a complete...defined by Pressman , is depicted in Figure 1.1. 11 Figure 1.1 Generalized Software Life Cycle The common thread which binds the various phases together...application of software engineering principles requires an established methodology. This methodology, according to Pressman [Ref. 8:p. 151 is an

Transforming Aggregate Object-Oriented Formal Specifications to Code

DTIC Science & Technology

1999-03-01

integration issues associated with a formal-based software transformation system, such as the source specification, the problem space architecture , design architecture ... design transforms, and target software transforms. Software is critical in today’s Air Force, yet its specification, design, and development

Bias and design in software specifications

NASA Technical Reports Server (NTRS)

Straub, Pablo A.; Zelkowitz, Marvin V.

1990-01-01

Implementation bias in a specification is an arbitrary constraint in the solution space. Presented here is a model of bias in software specifications. Bias is defined in terms of the specification process and a classification of the attributes of the software product. Our definition of bias provides insight into both the origin and the consequences of bias. It also shows that bias is relative and essentially unavoidable. Finally, we describe current work on defining a measure of bias, formalizing our model, and relating bias to software defects.

NASA software specification and evaluation system design, part 2

NASA Technical Reports Server (NTRS)

1976-01-01

A survey and analysis of the existing methods, tools and techniques employed in the development of software are presented along with recommendations for the construction of reliable software. Functional designs for software specification language, and the data base verifier are presented.

Review of CAI Materials.

ERIC Educational Resources Information Center

McCrary, Ronald G.

A discussion of computer software and courseware for second-language instruction outlines considerations for selecting software of various kinds and presents a list of selected computer programs. Suggestions are made for choosing text-specific software, non-text-specific software intended for language instruction, word processors intended for…

Specifications for Thesaurus Software.

ERIC Educational Resources Information Center

Milstead, Jessica L.

1991-01-01

Presents specifications for software that is designed to support manual development and maintenance of information retrieval thesauri. Evaluation of existing software and design of custom software is discussed, requirements for integration with larger systems and for the user interface are described, and relationships among terms are discussed.…

Status of Simulations for the Cyclotron Laboratory at the Institute for Nuclear Research and Nuclear Energy

NASA Astrophysics Data System (ADS)

Asova, G.; Goutev, N.; Tonev, D.; Artinyan, A.

2018-05-01

The Institute for Nuclear Research and Nuclear Energy is preparing to operate a high-power cyclotron for production of radioisotopes for nuclear medicine, research in radiochemistry, radiobiology, nuclear physics, solid state physics. The cyclotron is a TR24 produced by ASCI, Canada, capable to deliver proton beams in the energy range of 15 to 24 MeV with current as high as 400 µA. Multiple extraction lines can be fed. The primary goal of the project is the production of PET and SPECT isotopes as 18F, 67,68Ga, 99mTc, etc. This contribution reports the status of the project. Design considerations for the cyclotron vault will be discussed for some of the target radioisotopes.

Saturnispora bothae sp. nov., isolated from rotting wood.

PubMed

Morais, Camila G; Lara, Carla A; Borelli, Beatriz M; Cadete, Raquel M; Moreira, Juliana D; Lachance, Marc-André; Rosa, Carlos A

2016-10-01

Two strains representing a novel species of the genus Saturnispora were isolated from rotting wood samples collected in an Atlantic Rainforest site in Brazil. Analyses of the sequences of the D1/D2 domains of the rRNA gene showed that this novel species belongs to a subclade in the Saturnispora clade formed by Saturnispora sanitii, Saturnispora sekii, Saturnispora silvae and Saturnisporasuwanaritii. The novel species differed in D1/D2 sequences by 60 or more nucleotide substitutions from these species. The strains produced asci with one to four hemispherical ascospores. A novel species named Saturnispora bothae sp. nov. is proposed to accommodate these isolates. The type strain is UFMG-CM-Y292T (=CBS 13484T). The MycoBank number is MB 817127.

On the nature of bias and defects in the software specification process

NASA Technical Reports Server (NTRS)

Straub, Pablo A.; Zelkowitz, Marvin V.

1992-01-01

Implementation bias in a specification is an arbitrary constraint in the solution space. This paper describes the problem of bias. Additionally, this paper presents a model of the specification and design processes describing individual subprocesses in terms of precision/detail diagrams and a model of bias in multi-attribute software specifications. While studying how bias is introduced into a specification we realized that software defects and bias are dual problems of a single phenomenon. This was used to explain the large proportion of faults found during the coding phase at the Software Engineering Laboratory at NASA/GSFC.

Flight software requirements and design support system

NASA Technical Reports Server (NTRS)

Riddle, W. E.; Edwards, B.

1980-01-01

The desirability and feasibility of computer-augmented support for the pre-implementation activities occurring during the development of flight control software was investigated. The specific topics to be investigated were the capabilities to be included in a pre-implementation support system for flight control software system development, and the specification of a preliminary design for such a system. Further, the pre-implementation support system was to be characterized and specified under the constraints that it: (1) support both description and assessment of flight control software requirements definitions and design specification; (2) account for known software description and assessment techniques; (3) be compatible with existing and planned NASA flight control software development support system; and (4) does not impose, but may encourage, specific development technologies. An overview of the results is given.

Development and validation of techniques for improving software dependability

NASA Technical Reports Server (NTRS)

Knight, John C.

1992-01-01

A collection of document abstracts are presented on the topic of improving software dependability through NASA grant NAG-1-1123. Specific topics include: modeling of error detection; software inspection; test cases; Magnetic Stereotaxis System safety specifications and fault trees; and injection of synthetic faults into software.

How Well Can Existing Software Support Processes Accomplish Sustainment of a Non-Developmental Item-Based Acquisition Strategy

DTIC Science & Technology

2017-04-06

Research Hypothesis ........................................................................................................... 15 Research Design ...user community and of accommodating advancing software applications by the vendors. Research Design My approach to this project was to conduct... design descriptions , requirements specifications, test documentation, interface requirement specifications, product specifications, and software

Software attribute visualization for high integrity software

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pollock, G.M.

1998-03-01

This report documents a prototype tool developed to investigate the use of visualization and virtual reality technologies for improving software surety confidence. The tool is utilized within the execution phase of the software life cycle. It provides a capability to monitor an executing program against prespecified requirements constraints provided in a program written in the requirements specification language SAGE. The resulting Software Attribute Visual Analysis Tool (SAVAnT) also provides a technique to assess the completeness of a software specification.

Compositional Specification of Software Architecture

NASA Technical Reports Server (NTRS)

Penix, John; Lau, Sonie (Technical Monitor)

1998-01-01

This paper describes our experience using parameterized algebraic specifications to model properties of software architectures. The goal is to model the decomposition of requirements independent of the style used to implement the architecture. We begin by providing an overview of the role of architecture specification in software development. We then describe how architecture specifications are build up from component and connector specifications and give an overview of insights gained from a case study used to validate the method.

Using formal specification in the Guidance and Control Software (GCS) experiment. Formal design and verification technology for life critical systems

NASA Technical Reports Server (NTRS)

Weber, Doug; Jamsek, Damir

1994-01-01

The goal of this task was to investigate how formal methods could be incorporated into a software engineering process for flight-control systems under DO-178B and to demonstrate that process by developing a formal specification for NASA's Guidance and Controls Software (GCS) Experiment. GCS is software to control the descent of a spacecraft onto a planet's surface. The GCS example is simplified from a real example spacecraft, but exhibits the characteristics of realistic spacecraft control software. The formal specification is written in Larch.

A proposed research program in information processing

NASA Technical Reports Server (NTRS)

Schorr, Herbert

1992-01-01

The goal of the Formalized Software Development (FSD) project was to demonstrate improvements productivity of software development and maintenance through the use of a new software lifecycle paradigm. The paradigm calls for the mechanical, but human-guided, derivation of software implementations from formal specifications of the desired software behavior. It relies on altering a system's specification and rederiving its implementation as the standard technology for software maintenance. A system definition for this paradigm is composed of a behavioral specification together with a body of annotations that control the derivation of executable code from the specification. Annotations generally achieve the selection of certain data representations and/or algorithms that are consistent with, but not mandated by, the behavioral specification. In doing this, they may yield systems which exhibit only certain behaviors among multiple alternatives permitted by the behavioral specification. The FSD project proposed to construct a testbed in which to explore the realization of this new paradigm. The testbed was to provide operational support environment for software design, implementation, and maintenance. The testbed was proposed to provide highly automated support for individual programmers ('programming in the small'), but not to address the additional needs of programming teams ('programming in the large'). The testbed proposed to focus on supporting rapid construction and evolution of useful prototypes of software systems, as opposed to focusing on the problems of achieving production quality performance of systems.

What Software to Use in the Teaching of Mathematical Subjects?

ERIC Educational Resources Information Center

Berežný, Štefan

2015-01-01

We can consider two basic views, when using mathematical software in the teaching of mathematical subjects. First: How to learn to use specific software for the specific tasks, e. g., software Statistica for the subjects of Applied statistics, probability and mathematical statistics, or financial mathematics. Second: How to learn to use the…

Delivering Software Process-Specific Project Courses in Tertiary Education Environment: Challenges and Solution

ERIC Educational Resources Information Center

Rong, Guoping; Shao, Dong

2012-01-01

The importance of delivering software process courses to software engineering students has been more and more recognized in China in recent years. However, students usually cannot fully appreciate the value of software process courses by only learning methodology and principle in the classroom. Therefore, a process-specific project course was…

Development of simulation computer complex specification

NASA Technical Reports Server (NTRS)

1973-01-01

The Training Simulation Computer Complex Study was one of three studies contracted in support of preparations for procurement of a shuttle mission simulator for shuttle crew training. The subject study was concerned with definition of the software loads to be imposed on the computer complex to be associated with the shuttle mission simulator and the development of procurement specifications based on the resulting computer requirements. These procurement specifications cover the computer hardware and system software as well as the data conversion equipment required to interface the computer to the simulator hardware. The development of the necessary hardware and software specifications required the execution of a number of related tasks which included, (1) simulation software sizing, (2) computer requirements definition, (3) data conversion equipment requirements definition, (4) system software requirements definition, (5) a simulation management plan, (6) a background survey, and (7) preparation of the specifications.

Reflight certification software design specifications

NASA Technical Reports Server (NTRS)

1984-01-01

The PDSS/IMC Software Design Specification for the Payload Development Support System (PDSS)/Image Motion Compensator (IMC) is contained. The PDSS/IMC is to be used for checkout and verification of the IMC flight hardware and software by NASA/MSFC.

A discussion of higher order software concepts as they apply to functional requirements and specifications. [space shuttles and guidance

NASA Technical Reports Server (NTRS)

Hamilton, M.

1973-01-01

The entry guidance software functional requirements (requirements design phase), its architectural requirements (specifications design phase), and the entry guidance software verified code are discussed. It was found that the proper integration of designs at both the requirements and specifications levels are of high priority consideration.

Preparation guide for class B software specification documents

NASA Technical Reports Server (NTRS)

Tausworthe, R. C.

1979-01-01

General conceptual requirements and specific application rules and procedures are provided for the production of software specification documents in conformance with deep space network software standards and class B standards. Class B documentation is identified as the appropriate level applicable to implementation, sustaining engineering, and operational uses by qualified personnel. Special characteristics of class B documents are defined.

Software requirements: Guidance and control software development specification

NASA Technical Reports Server (NTRS)

Withers, B. Edward; Rich, Don C.; Lowman, Douglas S.; Buckland, R. C.

1990-01-01

The software requirements for an implementation of Guidance and Control Software (GCS) are specified. The purpose of the GCS is to provide guidance and engine control to a planetary landing vehicle during its terminal descent onto a planetary surface and to communicate sensory information about that vehicle and its descent to some receiving device. The specification was developed using the structured analysis for real time system specification methodology by Hatley and Pirbhai and was based on a simulation program used to study the probability of success of the 1976 Viking Lander missions to Mars. Three versions of GCS are being generated for use in software error studies.

Knowledge-based approach for generating target system specifications from a domain model

NASA Technical Reports Server (NTRS)

Gomaa, Hassan; Kerschberg, Larry; Sugumaran, Vijayan

1992-01-01

Several institutions in industry and academia are pursuing research efforts in domain modeling to address unresolved issues in software reuse. To demonstrate the concepts of domain modeling and software reuse, a prototype software engineering environment is being developed at George Mason University to support the creation of domain models and the generation of target system specifications. This prototype environment, which is application domain independent, consists of an integrated set of commercial off-the-shelf software tools and custom-developed software tools. This paper describes the knowledge-based tool that was developed as part of the environment to generate target system specifications from a domain model.

SEPAC flight software detailed design specifications, volume 1

NASA Technical Reports Server (NTRS)

1982-01-01

The detailed design specifications (as built) for the SEPAC Flight Software are defined. The design includes a description of the total software system and of each individual module within the system. The design specifications describe the decomposition of the software system into its major components. The system structure is expressed in the following forms: the control-flow hierarchy of the system, the data-flow structure of the system, the task hierarchy, the memory structure, and the software to hardware configuration mapping. The component design description includes details on the following elements: register conventions, module (subroutines) invocaton, module functions, interrupt servicing, data definitions, and database structure.

Space station: The role of software

NASA Technical Reports Server (NTRS)

Hall, D.

1985-01-01

Software will play a critical role throughout the Space Station Program. This presentation sets the stage and prompts participant interaction at the Software Issues Forum. The presentation is structured into three major topics: (1) an overview of the concept and status of the Space Station Program; (2) several charts designed to lay out the scope and role of software; and (3) information addressing the four specific areas selected for focus at the forum, specifically: software management, the software development environment, languages, and standards. NASA's current thinking is highlighted and some of the relevant critical issues are raised.

Network, system, and status software enhancements for the autonomously managed electrical power system breadboard. Volume 1: Project summary

NASA Technical Reports Server (NTRS)

Mckee, James W.

1990-01-01

This volume (1 of 4) gives a summary of the original AMPS software system configuration, points out some of the problem areas in the original software design that this project is to address, and in the appendix collects all the bimonthly status reports. The purpose of AMPS is to provide a self reliant system to control the generation and distribution of power in the space station. The software in the AMPS breadboard can be divided into three levels: the operating environment software, the protocol software, and the station specific software. This project deals only with the operating environment software and the protocol software. The present station specific software will not change except as necessary to conform to new data formats.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Strohmaier, Erich; Meuer, Hans W.; Dongarra, Jack

20th Edition of TOP500 List of World's Fastest Supercomputers Released MANNHEIM, Germany; KNOXVILLE, Tenn.;&BERKELEY, Calif. In what has become a much-anticipated event in the world of high-performance computing, the 20th edition of the TOP500 list of the world's fastest supercomputers was released today (November 15, 2002). The Earth Simulator supercomputer installed earlier this year at the Earth Simulator Center in Yokohama, Japan, is with its Linpack benchmark performance of 35.86 Tflop/s (trillions of calculations per second) retains the number one position. The No.2 and No.3 positions are held by two new, identical ASCI Q systems at Los Alamos National Laboratorymore » (7.73Tflop/s each). These systems are built by Hewlett-Packard and based on the Alpha Server SC computer system.« less

NASA software specification and evaluation system design, part 1

NASA Technical Reports Server (NTRS)

1976-01-01

The research to develop methods for reducing the effort expended in software and verification is reported. The development of a formal software requirements methodology, a formal specifications language, a programming language, a language preprocessor, and code analysis tools are discussed.

Guidelines for applying the Composite Specification Model (CSM)

NASA Technical Reports Server (NTRS)

Agresti, William

1987-01-01

The Composite Specification Model (CSM) is an approach to representing software requirements. Guidelines are provided for applying CSM and developing each of the three descriptive views of the software: the contextual view, using entities and relationships; the dynamic view, using states and transitions; and the function view, using data flows and processes. Using CSM results in a software specification document, which is outlined.

SSL: A software specification language

NASA Technical Reports Server (NTRS)

Austin, S. L.; Buckles, B. P.; Ryan, J. P.

1976-01-01

SSL (Software Specification Language) is a new formalism for the definition of specifications for software systems. The language provides a linear format for the representation of the information normally displayed in a two-dimensional module inter-dependency diagram. In comparing SSL to FORTRAN or ALGOL, it is found to be largely complementary to the algorithmic (procedural) languages. SSL is capable of representing explicitly module interconnections and global data flow, information which is deeply imbedded in the algorithmic languages. On the other hand, SSL is not designed to depict the control flow within modules. The SSL level of software design explicitly depicts intermodule data flow as a functional specification.

SAGA: A project to automate the management of software production systems

NASA Technical Reports Server (NTRS)

Campbell, Roy H.; Beckman, Carol S.; Benzinger, Leonora; Beshers, George; Hammerslag, David; Kimball, John; Kirslis, Peter A.; Render, Hal; Richards, Paul; Terwilliger, Robert

1985-01-01

The SAGA system is a software environment that is designed to support most of the software development activities that occur in a software lifecycle. The system can be configured to support specific software development applications using given programming languages, tools, and methodologies. Meta-tools are provided to ease configuration. The SAGA system consists of a small number of software components that are adapted by the meta-tools into specific tools for use in the software development application. The modules are design so that the meta-tools can construct an environment which is both integrated and flexible. The SAGA project is documented in several papers which are presented.

48 CFR 227.7202-4 - Contract clause.

Code of Federal Regulations, 2012 CFR

2012-10-01

... Software and Computer Software Documentation 227.7202-4 Contract clause. A specific contract clause governing the Government's rights in commercial computer software or commercial computer software..., release, perform, display, or disclose computer software or computer software documentation shall be...

48 CFR 227.7202-4 - Contract clause.

Code of Federal Regulations, 2011 CFR

2011-10-01

... Software and Computer Software Documentation 227.7202-4 Contract clause. A specific contract clause governing the Government's rights in commercial computer software or commercial computer software..., release, perform, display, or disclose computer software or computer software documentation shall be...

48 CFR 227.7202-4 - Contract clause.

Code of Federal Regulations, 2014 CFR

2014-10-01

... Software and Computer Software Documentation 227.7202-4 Contract clause. A specific contract clause governing the Government's rights in commercial computer software or commercial computer software..., release, perform, display, or disclose computer software or computer software documentation shall be...

48 CFR 227.7202-4 - Contract clause.

Code of Federal Regulations, 2013 CFR

2013-10-01

... Software and Computer Software Documentation 227.7202-4 Contract clause. A specific contract clause governing the Government's rights in commercial computer software or commercial computer software..., release, perform, display, or disclose computer software or computer software documentation shall be...

48 CFR 227.7202-4 - Contract clause.

Code of Federal Regulations, 2010 CFR

2010-10-01

... Software and Computer Software Documentation 227.7202-4 Contract clause. A specific contract clause governing the Government's rights in commercial computer software or commercial computer software..., release, perform, display, or disclose computer software or computer software documentation shall be...

ASCI 2010 appropriateness criteria for cardiac computed tomography: a report of the Asian Society of Cardiovascular Imaging Cardiac Computed Tomography and Cardiac Magnetic Resonance Imaging Guideline Working Group.

PubMed

Tsai, I-Chen; Choi, Byoung Wook; Chan, Carmen; Jinzaki, Masahiro; Kitagawa, Kakuya; Yong, Hwan Seok; Yu, Wei

2010-02-01

In Asia, the healthcare system, populations and patterns of disease differ from Western countries. The current reports on the criteria for cardiac CT scans, provided by Western professional societies, are not appropriate for Asian cultures. The Asian Society of Cardiovascular Imaging, the only society dedicated to cardiovascular imaging in Asia, formed a Working Group and invited 23 Technical Panel members representing a variety of Asian countries to rate the 51 indications for cardiac CT in clinical practice in Asia. The indications were rated as 'appropriate' (7-9), 'uncertain' (4-6), or 'inappropriate' (1-3) on a scale of 1-9. The median score was used for the final result if there was no disagreement. The final ratings for indications were 33 appropriate, 14 uncertain and 4 inappropriate. And 20 of them are highly agreed (19 appropriate and 1 inappropriate). Specifically, the Asian representatives considered cardiac CT as an appropriate modality for Kawasaki disease and congenital heart diseases in follow up and in symptomatic patients. In addition, except for some specified conditions, cardiac CT was considered to be an appropriate modality for one-stop shop ischemic heart disease evaluation due to its general appropriateness in coronary, structure and function evaluation. This report is expected to have a significant impact on the clinical practice, research and reimbursement policy in Asia.

Leaf-inhabiting genera of the Gnomoniaceae, Diaporthales

PubMed Central

Sogonov, M.V.; Castlebury, L.A.; Rossman, A.Y.; Mejía, L.C.; White, J.F.

2008-01-01

The Gnomoniaceae are characterised by ascomata that are generally immersed, solitary, without a stroma, or aggregated with a rudimentary stroma, in herbaceous plant material especially in leaves, twigs or stems, but also in bark or wood. The ascomata are black, soft-textured, thin-walled, and pseudoparenchymatous with one or more central or eccentric necks. The asci usually have a distinct apical ring. The Gnomoniaceae includes species having ascospores that are small, mostly less than 25 μm long, although some are longer, and range in septation from non-septate to one-septate, rarely multi-septate. Molecular studies of the Gnomoniaceae suggest that the traditional classification of genera based on characteristics of the ascomata such as position of the neck and ascospores such as septation have resulted in genera that are not monophyletic. In this paper the concepts of the leaf-inhabiting genera in the Gnomoniaceae are reevaluated using multiple genes, specifically nrLSU, translation elongation factor 1-alpha (tef1-α), and RNA polymerase II second largest subunit (rpb2) for 64 isolates. ITS sequences were generated for 322 isolates. Six genera of leaf-inhabiting Gnomoniaceae are defined based on placement of their type species within the multigene phylogeny. The new monotypic genus Ambarignomonia is established for an unusual species, A. petiolorum. A key to 59 species of leaf-inhabiting Gnomoniaceae is presented and 22 species of Gnomoniaceae are described and illustrated. PMID:19287541

Whole genome sequencing analyses of Listeria monocytogenes that persisted in a milkshake machine for a year and caused illnesses in Washington State.

PubMed

Li, Zhen; Pérez-Osorio, Ailyn; Wang, Yu; Eckmann, Kaye; Glover, William A; Allard, Marc W; Brown, Eric W; Chen, Yi

2017-06-15

In 2015, in addition to a United States multistate outbreak linked to contaminated ice cream, another outbreak linked to ice cream was reported in the Pacific Northwest of the United States. It was a hospital-acquired outbreak linked to milkshakes, made from contaminated ice cream mixes and milkshake maker, served to patients. Here we performed multiple analyses on isolates associated with this outbreak: pulsed-field gel electrophoresis (PFGE), whole genome single nucleotide polymorphism (SNP) analysis, species-specific core genome multilocus sequence typing (cgMLST), lineage-specific cgMLST and whole genome-specific MLST (wgsMLST)/outbreak-specific cgMLST. We also analyzed the prophages and virulence genes. The outbreak isolates belonged to sequence type 1038, clonal complex 101, genetic lineage II. There were no pre-mature stop codons in inlA. Isolates contained Listeria Pathogenicity Island 1 and multiple internalins. PFGE and multiple whole genome sequencing (WGS) analyses all clustered together food, environmental and clinical isolates when compared to outgroup from the same clonal complex, which supported the finding that L. monocytogenes likely persisted in the soft serve ice cream/milkshake maker from November 2014 to November 2015 and caused 3 illnesses, and that the outbreak strain was transmitted between two ice cream production facilities. The whole genome SNP analysis, one of the two species-specific cgMLST, the lineage II-specific cgMLST and the wgsMLST/outbreak-specific cgMLST showed that L. monocytogenes cells persistent in the milkshake maker for a year formed a unique clade inside the outbreak cluster. This clustering was consistent with the cleaning practice after the outbreak was initially recognized in late 2014 and early 2015. Putative prophages were conserved among prophage-containing isolates. The loss of a putative prophage in two isolates resulted in the loss of the AscI restriction site in the prophage, which contributed to their AscI-PFGE banding pattern differences from other isolates. The high resolution of WGS analyses allowed the differentiation of epidemiologically unrelated isolates, as well as the elucidation of the microevolution and persistence of isolates within the scope of one outbreak. We applied a wgsMLST scheme which is essentially the outbreak-specific cgMLST. This scheme can be combined with lineage-specific cgMLST and species-specific cgMLST to maximize the resolution of WGS.

The KASE approach to domain-specific software systems

NASA Technical Reports Server (NTRS)

Bhansali, Sanjay; Nii, H. Penny

1992-01-01

Designing software systems, like all design activities, is a knowledge-intensive task. Several studies have found that the predominant cause of failures among system designers is lack of knowledge: knowledge about the application domain, knowledge about design schemes, knowledge about design processes, etc. The goal of domain-specific software design systems is to explicitly represent knowledge relevant to a class of applications and use it to partially or completely automate various aspects of the designing systems within that domain. The hope is that this would reduce the intellectual burden on the human designers and lead to more efficient software development. In this paper, we present a domain-specific system built on top of KASE, a knowledge-assisted software engineering environment being developed at the Stanford Knowledge Systems Laboratory. We introduce the main ideas underlying the construction of domain specific systems within KASE, illustrate the application of the idea in the synthesis of a system for tracking aircraft from radar signals, and discuss some of the issues in constructing domain-specific systems.

Experience report: Using formal methods for requirements analysis of critical spacecraft software

NASA Technical Reports Server (NTRS)

Lutz, Robyn R.; Ampo, Yoko

1994-01-01

Formal specification and analysis of requirements continues to gain support as a method for producing more reliable software. However, the introduction of formal methods to a large software project is difficult, due in part to the unfamiliarity of the specification languages and the lack of graphics. This paper reports results of an investigation into the effectiveness of formal methods as an aid to the requirements analysis of critical, system-level fault-protection software on a spacecraft currently under development. Our experience indicates that formal specification and analysis can enhance the accuracy of the requirements and add assurance prior to design development in this domain. The work described here is part of a larger, NASA-funded research project whose purpose is to use formal-methods techniques to improve the quality of software in space applications. The demonstration project described here is part of the effort to evaluate experimentally the effectiveness of supplementing traditional engineering approaches to requirements specification with the more rigorous specification and analysis available with formal methods.

Executable Behavioral Modeling of System and Software Architecture Specifications to Inform Resourcing Decisions

DTIC Science & Technology

2016-09-01

BEHAVIORAL MODELING OF SYSTEM- AND SOFTWARE- ARCHITECTURE SPECIFICATIONS TO INFORM RESOURCING DECISIONS by Monica F. Farah-Stapleton...AND SOFTWARE- ARCHITECTURE SPECIFICATIONS TO INFORM RESOURCING DECISIONS 5. FUNDING NUMBERS 6. AUTHOR(S) Monica F. Farah-Stapleton 7. PERFORMING...this thesis are those of the author and do not reflect the official policy or position of the Department of Defense or the U.S. Government. IRB number

2011 Computation Directorate Annual Report

DOE Office of Scientific and Technical Information (OSTI.GOV)

Crawford, D L

2012-04-11

From its founding in 1952 until today, Lawrence Livermore National Laboratory (LLNL) has made significant strategic investments to develop high performance computing (HPC) and its application to national security and basic science. Now, 60 years later, the Computation Directorate and its myriad resources and capabilities have become a key enabler for LLNL programs and an integral part of the effort to support our nation's nuclear deterrent and, more broadly, national security. In addition, the technological innovation HPC makes possible is seen as vital to the nation's economic vitality. LLNL, along with other national laboratories, is working to make supercomputing capabilitiesmore » and expertise available to industry to boost the nation's global competitiveness. LLNL is on the brink of an exciting milestone with the 2012 deployment of Sequoia, the National Nuclear Security Administration's (NNSA's) 20-petaFLOP/s resource that will apply uncertainty quantification to weapons science. Sequoia will bring LLNL's total computing power to more than 23 petaFLOP/s-all brought to bear on basic science and national security needs. The computing systems at LLNL provide game-changing capabilities. Sequoia and other next-generation platforms will enable predictive simulation in the coming decade and leverage industry trends, such as massively parallel and multicore processors, to run petascale applications. Efficient petascale computing necessitates refining accuracy in materials property data, improving models for known physical processes, identifying and then modeling for missing physics, quantifying uncertainty, and enhancing the performance of complex models and algorithms in macroscale simulation codes. Nearly 15 years ago, NNSA's Accelerated Strategic Computing Initiative (ASCI), now called the Advanced Simulation and Computing (ASC) Program, was the critical element needed to shift from test-based confidence to science-based confidence. Specifically, ASCI/ASC accelerated the development of simulation capabilities necessary to ensure confidence in the nuclear stockpile-far exceeding what might have been achieved in the absence of a focused initiative. While stockpile stewardship research pushed LLNL scientists to develop new computer codes, better simulation methods, and improved visualization technologies, this work also stimulated the exploration of HPC applications beyond the standard sponsor base. As LLNL advances to a petascale platform and pursues exascale computing (1,000 times faster than Sequoia), ASC will be paramount to achieving predictive simulation and uncertainty quantification. Predictive simulation and quantifying the uncertainty of numerical predictions where little-to-no data exists demands exascale computing and represents an expanding area of scientific research important not only to nuclear weapons, but to nuclear attribution, nuclear reactor design, and understanding global climate issues, among other fields. Aside from these lofty goals and challenges, computing at LLNL is anything but 'business as usual.' International competition in supercomputing is nothing new, but the HPC community is now operating in an expanded, more aggressive climate of global competitiveness. More countries understand how science and technology research and development are inextricably linked to economic prosperity, and they are aggressively pursuing ways to integrate HPC technologies into their native industrial and consumer products. In the interest of the nation's economic security and the science and technology that underpins it, LLNL is expanding its portfolio and forging new collaborations. We must ensure that HPC remains an asymmetric engine of innovation for the Laboratory and for the U.S. and, in doing so, protect our research and development dynamism and the prosperity it makes possible. One untapped area of opportunity LLNL is pursuing is to help U.S. industry understand how supercomputing can benefit their business. Industrial investment in HPC applications has historically been limited by the prohibitive cost of entry, the inaccessibility of software to run the powerful systems, and the years it takes to grow the expertise to develop codes and run them in an optimal way. LLNL is helping industry better compete in the global market place by providing access to some of the world's most powerful computing systems, the tools to run them, and the experts who are adept at using them. Our scientists are collaborating side by side with industrial partners to develop solutions to some of industry's toughest problems. The goal of the Livermore Valley Open Campus High Performance Computing Innovation Center is to allow American industry the opportunity to harness the power of supercomputing by leveraging the scientific and computational expertise at LLNL in order to gain a competitive advantage in the global economy.« less

Core Community Specifications for Electron Microprobe Operating Systems: Software, Quality Control, and Data Management Issues

NASA Technical Reports Server (NTRS)

Fournelle, John; Carpenter, Paul

2006-01-01

Modem electron microprobe systems have become increasingly sophisticated. These systems utilize either UNIX or PC computer systems for measurement, automation, and data reduction. These systems have undergone major improvements in processing, storage, display, and communications, due to increased capabilities of hardware and software. Instrument specifications are typically utilized at the time of purchase and concentrate on hardware performance. The microanalysis community includes analysts, researchers, software developers, and manufacturers, who could benefit from exchange of ideas and the ultimate development of core community specifications (CCS) for hardware and software components of microprobe instrumentation and operating systems.

Architectural Implementation of NASA Space Telecommunications Radio System Specification

NASA Technical Reports Server (NTRS)

Peters, Kenneth J.; Lux, James P.; Lang, Minh; Duncan, Courtney B.

2012-01-01

This software demonstrates a working implementation of the NASA STRS (Space Telecommunications Radio System) architecture specification. This is a developing specification of software architecture and required interfaces to provide commonality among future NASA and commercial software-defined radios for space, and allow for easier mixing of software and hardware from different vendors. It provides required functions, and supports interaction with STRS-compliant simple test plug-ins ("waveforms"). All of it is programmed in "plain C," except where necessary to interact with C++ plug-ins. It offers a small footprint, suitable for use in JPL radio hardware. Future NASA work is expected to develop into fully capable software-defined radios for use on the space station, other space vehicles, and interplanetary probes.

Model Transformation for a System of Systems Dependability Safety Case

NASA Technical Reports Server (NTRS)

Murphy, Judy; Driskell, Stephen B.

2010-01-01

Software plays an increasingly larger role in all aspects of NASA's science missions. This has been extended to the identification, management and control of faults which affect safety-critical functions and by default, the overall success of the mission. Traditionally, the analysis of fault identification, management and control are hardware based. Due to the increasing complexity of system, there has been a corresponding increase in the complexity in fault management software. The NASA Independent Validation & Verification (IV&V) program is creating processes and procedures to identify, and incorporate safety-critical software requirements along with corresponding software faults so that potential hazards may be mitigated. This Specific to Generic ... A Case for Reuse paper describes the phases of a dependability and safety study which identifies a new, process to create a foundation for reusable assets. These assets support the identification and management of specific software faults and, their transformation from specific to generic software faults. This approach also has applications to other systems outside of the NASA environment. This paper addresses how a mission specific dependability and safety case is being transformed to a generic dependability and safety case which can be reused for any type of space mission with an emphasis on software fault conditions.

Formal specification and verification of Ada software

NASA Technical Reports Server (NTRS)

Hird, Geoffrey R.

1991-01-01

The use of formal methods in software development achieves levels of quality assurance unobtainable by other means. The Larch approach to specification is described, and the specification of avionics software designed to implement the logic of a flight control system is given as an example. Penelope is described which is an Ada-verification environment. The Penelope user inputs mathematical definitions, Larch-style specifications and Ada code and performs machine-assisted proofs that the code obeys its specifications. As an example, the verification of a binary search function is considered. Emphasis is given to techniques assisting the reuse of a verification effort on modified code.

Presenting an evaluation model of the trauma registry software.

PubMed

Asadi, Farkhondeh; Paydar, Somayeh

2018-04-01

Trauma is a major cause of 10% death in the worldwide and is considered as a global concern. This problem has made healthcare policy makers and managers to adopt a basic strategy in this context. Trauma registry has an important and basic role in decreasing the mortality and the disabilities due to injuries resulted from trauma. Today, different software are designed for trauma registry. Evaluation of this software improves management, increases efficiency and effectiveness of these systems. Therefore, the aim of this study is to present an evaluation model for trauma registry software. The present study is an applied research. In this study, general and specific criteria of trauma registry software were identified by reviewing literature including books, articles, scientific documents, valid websites and related software in this domain. According to general and specific criteria and related software, a model for evaluating trauma registry software was proposed. Based on the proposed model, a checklist designed and its validity and reliability evaluated. Mentioned model by using of the Delphi technique presented to 12 experts and specialists. To analyze the results, an agreed coefficient of %75 was determined in order to apply changes. Finally, when the model was approved by the experts and professionals, the final version of the evaluation model for the trauma registry software was presented. For evaluating of criteria of trauma registry software, two groups were presented: 1- General criteria, 2- Specific criteria. General criteria of trauma registry software were classified into four main categories including: 1- usability, 2- security, 3- maintainability, and 4-interoperability. Specific criteria were divided into four main categories including: 1- data submission and entry, 2- reporting, 3- quality control, 4- decision and research support. The presented model in this research has introduced important general and specific criteria of trauma registry software and sub criteria related to each main criteria separately. This model was validated by experts in this field. Therefore, this model can be used as a comprehensive model and a standard evaluation tool for measuring efficiency and effectiveness and performance improvement of trauma registry software. Copyright © 2018 Elsevier B.V. All rights reserved.

Generating Safety-Critical PLC Code From a High-Level Application Software Specification

NASA Technical Reports Server (NTRS)

2008-01-01

The benefits of automatic-application code generation are widely accepted within the software engineering community. These benefits include raised abstraction level of application programming, shorter product development time, lower maintenance costs, and increased code quality and consistency. Surprisingly, code generation concepts have not yet found wide acceptance and use in the field of programmable logic controller (PLC) software development. Software engineers at Kennedy Space Center recognized the need for PLC code generation while developing the new ground checkout and launch processing system, called the Launch Control System (LCS). Engineers developed a process and a prototype software tool that automatically translates a high-level representation or specification of application software into ladder logic that executes on a PLC. All the computer hardware in the LCS is planned to be commercial off the shelf (COTS), including industrial controllers or PLCs that are connected to the sensors and end items out in the field. Most of the software in LCS is also planned to be COTS, with only small adapter software modules that must be developed in order to interface between the various COTS software products. A domain-specific language (DSL) is a programming language designed to perform tasks and to solve problems in a particular domain, such as ground processing of launch vehicles. The LCS engineers created a DSL for developing test sequences of ground checkout and launch operations of future launch vehicle and spacecraft elements, and they are developing a tabular specification format that uses the DSL keywords and functions familiar to the ground and flight system users. The tabular specification format, or tabular spec, allows most ground and flight system users to document how the application software is intended to function and requires little or no software programming knowledge or experience. A small sample from a prototype tabular spec application is shown.

Achieving Better Buying Power for Mobile Open Architecture Software Systems Through Diverse Acquisition Scenarios

DTIC Science & Technology

2016-04-30

software (OSS) and proprietary (CSS) software elements or remote services (Scacchi, 2002, 2010), eventually including recent efforts to support Web ...specific platforms, including those operating on secured Web /mobile devices.  Common Development Technology provides AC development tools and common...transition to OA systems and OSS software elements, specifically for Web and Mobile devices within the realm of C3CB. OA, Open APIs, OSS, and CSS OA

Description of research interests and current work related to automating software design

NASA Technical Reports Server (NTRS)

Kaindl, Hermann

1992-01-01

Enclosed is a list of selected and recent publications. Most of these publications concern applied research in the areas of software engineering and human-computer interaction. It is felt that domain-specific knowledge plays a major role in software development. Additionally, it is believed that improvements in the general software development process (e.g., object-oriented approaches) will have to be combined with the use of large domain-specific knowledge bases.

Intent Specifications: An Approach to Building Human-Centered Specifications

NASA Technical Reports Server (NTRS)

Leveson, Nancy G.

1999-01-01

This paper examines and proposes an approach to writing software specifications, based on research in systems theory, cognitive psychology, and human-machine interaction. The goal is to provide specifications that support human problem solving and the tasks that humans must perform in software development and evolution. A type of specification, called intent specifications, is constructed upon this underlying foundation.

OHD/HL - National Weather Hydrology Laboratory

Science.gov Websites

resources and services. Design and Programming Standards and Guidelines General Programming C C++ FORTRAN Java v 2.0 updated 3/28/2008 Java v 1.9 Korn and Bash Shell Software Design Phase Guidelines OHD Design Specification Template OHD Design Specification Example Software Peer Review Guidelines and Checklists Software

Error Reporting Logic

DTIC Science & Technology

2008-06-01

14] Mark Weiser. Program slicing. Trans. Software Engineering , July 1984. 17 ...entitled “Perpetually Available and Secure In- formation Systems”, the Software Industry Center at CMU and its sponsors, especially the Alfred P. Sloan...ERL In Acme, a software architect can choose to associate a handwritten error message to each specification. If the specification fails, for any

Early Childhood Educational Software: Specific Features and Issues of Localization

ERIC Educational Resources Information Center

Nikolopoulou, Kleopatra

2007-01-01

The computer has now become a recognized tool in the education of young children and when used appropriately can reinforce their learning experiences. This paper reviews specific features (relating to pedagogic design, software content and user-interface design) of early childhood educational software and discusses issues in favor of its…

Onward to Petaflops Computing

NASA Technical Reports Server (NTRS)

Bailey, David H.; Chancellor, Marisa K. (Technical Monitor)

1997-01-01

With programs such as the US High Performance Computing and Communications Program (HPCCP), the attention of scientists and engineers worldwide has been focused on the potential of very high performance scientific computing, namely systems that are hundreds or thousands of times more powerful than those typically available in desktop systems at any given point in time. Extending the frontiers of computing in this manner has resulted in remarkable advances, both in computing technology itself and also in the various scientific and engineering disciplines that utilize these systems. Within the month or two, a sustained rate of 1 Tflop/s (also written 1 teraflops, or 10(exp 12) floating-point operations per second) is likely to be achieved by the 'ASCI Red' system at Sandia National Laboratory in New Mexico. With this objective in sight, it is reasonable to ask what lies ahead for high-end computing.

Test and evaluation procedures for Sandia's Teraflops Operating System (TOS) on Janus.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Barnette, Daniel Wayne

This report describes the test and evaluation methods by which the Teraflops Operating System, or TOS, that resides on Sandia's massively-parallel computer Janus is verified for production release. Also discussed are methods used to build TOS before testing and evaluating, miscellaneous utility scripts, a sample test plan, and a proposed post-test method for quickly examining the large number of test results. The purpose of the report is threefold: (1) to provide a guide to T&E procedures, (2) to aid and guide others who will run T&E procedures on the new ASCI Red Storm machine, and (3) to document some ofmore » the history of evaluation and testing of TOS. This report is not intended to serve as an exhaustive manual for testers to conduct T&E procedures.« less

First record of Talaromyces udagawae in soil related to decomposing human remains in Argentina.

PubMed

Tranchida, María C; Centeno, Néstor D; Stenglein, Sebastián A; Cabello, Marta N

2016-01-01

The morphologic features of Talaromyces udagawae Stolk and Samson are here described and illustrated. This teleomorphic Ascomycota fungus was isolated from soil obtained in Buenos Aires province (Argentina) from beneath a human cadaver in an advanced state of decomposition. After washing and serial dilution of the soil along with moist-chamber techniques for fungal cultivation, T. udagawae formed very restricted colonies of bright yellow color on different growth media with 8-ascospored asci. The ascospores were ellipsoidal and ornamented. The anamorphic state was not observed. Molecular-genetic techniques identified the species. The present record is the first of the species in Argentina, pointing it as a tool to identify soils where cadaver decomposition occurs. Copyright © 2015 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.

The Assignment of Scale to Object-Oriented Software Measures

NASA Technical Reports Server (NTRS)

Neal, Ralph D.; Weistroffer, H. Roland; Coppins, Richard J.

1997-01-01

In order to improve productivity (and quality), measurement of specific aspects of software has become imperative. As object oriented programming languages have become more widely used, metrics designed specifically for object-oriented software are required. Recently a large number of new metrics for object- oriented software has appeared in the literature. Unfortunately, many of these proposed metrics have not been validated to measure what they purport to measure. In this paper fifty (50) of these metrics are analyzed.

48 CFR 227.7205 - Contracts for special works.

Code of Federal Regulations, 2014 CFR

2014-10-01

... Computer Software and Computer Software Documentation 227.7205 Contracts for special works. (a) Use the... a specific need to control the distribution of computer software or computer software documentation..., modification, reproduction, release, performance, display, or disclosure of such software or documentation. Use...

48 CFR 227.7205 - Contracts for special works.

Code of Federal Regulations, 2010 CFR

2010-10-01

... Computer Software and Computer Software Documentation 227.7205 Contracts for special works. (a) Use the... a specific need to control the distribution of computer software or computer software documentation..., modification, reproduction, release, performance, display, or disclosure of such software or documentation. Use...

Development of a software safety process and a case study of its use

NASA Technical Reports Server (NTRS)

Knight, John C.

1993-01-01

The goal of this research is to continue the development of a comprehensive approach to software safety and to evaluate the approach with a case study. The case study is a major part of the project, and it involves the analysis of a specific safety-critical system from the medical equipment domain. The particular application being used was selected because of the availability of a suitable candidate system. We consider the results to be generally applicable and in no way particularly limited by the domain. The research is concentrating on issues raised by the specification and verification phases of the software lifecycle since they are central to our previously-developed rigorous definitions of software safety. The theoretical research is based on our framework of definitions for software safety. In the area of specification, the main topics being investigated are the development of techniques for building system fault trees that correctly incorporate software issues and the development of rigorous techniques for the preparation of software safety specifications. The research results are documented. Another area of theoretical investigation is the development of verification methods tailored to the characteristics of safety requirements. Verification of the correct implementation of the safety specification is central to the goal of establishing safe software. The empirical component of this research is focusing on a case study in order to provide detailed characterizations of the issues as they appear in practice, and to provide a testbed for the evaluation of various existing and new theoretical results, tools, and techniques. The Magnetic Stereotaxis System is summarized.

Specifications and programs for computer software validation

NASA Technical Reports Server (NTRS)

Browne, J. C.; Kleir, R.; Davis, T.; Henneman, M.; Haller, A.; Lasseter, G. L.

1973-01-01

Three software products developed during the study are reported and include: (1) FORTRAN Automatic Code Evaluation System, (2) the Specification Language System, and (3) the Array Index Validation System.

Impact of Requirements Quality on Project Success or Failure

NASA Astrophysics Data System (ADS)

Tamai, Tetsuo; Kamata, Mayumi Itakura

We are interested in the relationship between the quality of the requirements specifications for software projects and the subsequent outcome of the projects. To examine this relationship, we investigated 32 projects started and completed between 2003 and 2005 by the software development division of a large company in Tokyo. The company has collected reliable data on requirements specification quality, as evaluated by software quality assurance teams, and overall project performance data relating to cost and time overruns. The data for requirements specification quality were first converted into a multiple-dimensional space, with each dimension corresponding to an item of the recommended structure for software requirements specifications (SRS) defined in IEEE Std. 830-1998. We applied various statistical analysis methods to the SRS quality data and project outcomes.

Advanced software development workstation project ACCESS user's guide

NASA Technical Reports Server (NTRS)

1990-01-01

ACCESS is a knowledge based software information system designed to assist the user in modifying retrieved software to satisfy user specifications. A user's guide is presented for the knowledge engineer who wishes to create for ACCESS a knowledge base consisting of representations of objects in some software system. This knowledge is accessible to an end user who wishes to use the catalogued software objects to create a new application program or an input stream for an existing system. The application specific portion of an ACCESS knowledge base consists of a taxonomy of object classes, as well as instances of these classes. All objects in the knowledge base are stored in an associative memory. ACCESS provides a standard interface for the end user to browse and modify objects. In addition, the interface can be customized by the addition of application specific data entry forms and by specification of display order for the taxonomy and object attributes. These customization options are described.

Advanced information processing system: Input/output network management software

NASA Technical Reports Server (NTRS)

Nagle, Gail; Alger, Linda; Kemp, Alexander

1988-01-01

The purpose of this document is to provide the software requirements and specifications for the Input/Output Network Management Services for the Advanced Information Processing System. This introduction and overview section is provided to briefly outline the overall architecture and software requirements of the AIPS system before discussing the details of the design requirements and specifications of the AIPS I/O Network Management software. A brief overview of the AIPS architecture followed by a more detailed description of the network architecture.

TMS communications software. Volume 2: Bus interface unit

NASA Technical Reports Server (NTRS)

Gregor, P. J.

1979-01-01

A data bus communication system to support the space shuttle's Trend Monitoring System (TMS) and to provide a basis for evaluation of the bus concept is described. Installation of the system included developing both hardware and software interfaces between the bus and the specific TMS computers and terminals. The software written for the microprocessor-based bus interface units is described. The software implements both the general bus communications protocol and also the specific interface protocols for the TMS computers and terminals.

7 CFR 1753.7 - Plans and specifications (P&S).

Code of Federal Regulations, 2011 CFR

2011-01-01

... specifications prepared by the borrower's engineer. The specifications prepared by the borrower's engineer and... its contractor complies with the insurance and bond requirements. (4) Telecommunications software license provision. If the borrower is required to enter into a software license agreement in order to use...

7 CFR 1753.7 - Plans and specifications (P&S).

Code of Federal Regulations, 2013 CFR

2013-01-01

... specifications prepared by the borrower's engineer. The specifications prepared by the borrower's engineer and... its contractor complies with the insurance and bond requirements. (4) Telecommunications software license provision. If the borrower is required to enter into a software license agreement in order to use...

7 CFR 1753.7 - Plans and specifications (P&S).

Code of Federal Regulations, 2014 CFR

2014-01-01

... specifications prepared by the borrower's engineer. The specifications prepared by the borrower's engineer and... its contractor complies with the insurance and bond requirements. (4) Telecommunications software license provision. If the borrower is required to enter into a software license agreement in order to use...

7 CFR 1753.7 - Plans and specifications (P&S).

Code of Federal Regulations, 2012 CFR

2012-01-01

... specifications prepared by the borrower's engineer. The specifications prepared by the borrower's engineer and... its contractor complies with the insurance and bond requirements. (4) Telecommunications software license provision. If the borrower is required to enter into a software license agreement in order to use...

Heterogeneous Software System Interoperability Through Computer-Aided Resolution of Modeling Differences

DTIC Science & Technology

2002-06-01

techniques for addressing the software component retrieval problem. Steigerwald [Ste91] introduced the use of algebraic specifications for defining the...provided in terms of a specification written using Luqi’s Prototype Specification Description Language (PSDL) [LBY88] augmented with an algebraic

A Study of Visualization for Mathematics Education

NASA Technical Reports Server (NTRS)

Daugherty, Sarah C.

2008-01-01

Graphical representations such as figures, illustrations, and diagrams play a critical role in mathematics and they are equally important in mathematics education. However, graphical representations in mathematics textbooks are static, Le. they are used to illustrate only a specific example or a limited set. of examples. By using computer software to visualize mathematical principles, virtually there is no limit to the number of specific cases and examples that can be demonstrated. However, we have not seen widespread adoption of visualization software in mathematics education. There are currently a number of software packages that provide visualization of mathematics for research and also software packages specifically developed for mathematics education. We conducted a survey of mathematics visualization software packages, summarized their features and user bases, and analyzed their limitations. In this survey, we focused on evaluating the software packages for their use with mathematical subjects adopted by institutions of secondary education in the United States (middle schools and high schools), including algebra, geometry, trigonometry, and calculus. We found that cost, complexity, and lack of flexibility are the major factors that hinder the widespread use of mathematics visualization software in education.

Flight software development for the isothermal dendritic growth experiment

NASA Technical Reports Server (NTRS)

Levinson, Laurie H.; Winsa, Edward A.; Glicksman, Martin E.

1989-01-01

The Isothermal Dendritic Growth Experiment (IDGE) is a microgravity materials science experiment scheduled to fly in the cargo bay of the shuttle on the United States Microgravity Payload (USMP) carrier. The experiment will be operated by real-time control software which will not only monitor and control onboard experiment hardware, but will also communicate, via downlink data and uplink commands, with the Payload Operations Control Center (POCC) at NASA George C. Marshall Space Flight Center (MSFC). The software development approach being used to implement this system began with software functional requirements specification. This was accomplished using the Yourdon/DeMarco methodology as supplemented by the Ward/Mellor real-time extensions. The requirements specification in combination with software prototyping was then used to generate a detailed design consisting of structure charts, module prologues, and Program Design Language (PDL) specifications. This detailed design will next be used to code the software, followed finally by testing against the functional requirements. The result will be a modular real-time control software system with traceability through every phase of the development process.

Flight software development for the isothermal dendritic growth experiment

NASA Technical Reports Server (NTRS)

Levinson, Laurie H.; Winsa, Edward A.; Glicksman, M. E.

1990-01-01

The Isothermal Dendritic Growth Experiment (IDGE) is a microgravity materials science experiment scheduled to fly in the cargo bay of the shuttle on the United States Microgravity Payload (USMP) carrier. The experiment will be operated by real-time control software which will not only monitor and control onboard experiment hardware, but will also communicate, via downlink data and unlink commands, with the Payload Operations Control Center (POCC) at NASA George C. Marshall Space Flight Center (MSFC). The software development approach being used to implement this system began with software functional requirements specification. This was accomplished using the Yourdon/DeMarco methodology as supplemented by the Ward/Mellor real-time extensions. The requirements specification in combination with software prototyping was then used to generate a detailed design consisting of structure charts, module prologues, and Program Design Language (PDL) specifications. This detailed design will next be used to code the software, followed finally by testing against the functional requirements. The result will be a modular real-time control software system with traceability through every phase of the development process.

Enhancing requirements engineering for patient registry software systems with evidence-based components.

PubMed

Lindoerfer, Doris; Mansmann, Ulrich

2017-07-01

Patient registries are instrumental for medical research. Often their structures are complex and their implementations use composite software systems to meet the wide spectrum of challenges. Commercial and open-source systems are available for registry implementation, but many research groups develop their own systems. Methodological approaches in the selection of software as well as the construction of proprietary systems are needed. We propose an evidence-based checklist, summarizing essential items for patient registry software systems (CIPROS), to accelerate the requirements engineering process. Requirements engineering activities for software systems follow traditional software requirements elicitation methods, general software requirements specification (SRS) templates, and standards. We performed a multistep procedure to develop a specific evidence-based CIPROS checklist: (1) A systematic literature review to build a comprehensive collection of technical concepts, (2) a qualitative content analysis to define a catalogue of relevant criteria, and (3) a checklist to construct a minimal appraisal standard. CIPROS is based on 64 publications and covers twelve sections with a total of 72 items. CIPROS also defines software requirements. Comparing CIPROS with traditional software requirements elicitation methods, SRS templates and standards show a broad consensus but differences in issues regarding registry-specific aspects. Using an evidence-based approach to requirements engineering for registry software adds aspects to the traditional methods and accelerates the software engineering process for registry software. The method we used to construct CIPROS serves as a potential template for creating evidence-based checklists in other fields. The CIPROS list supports developers in assessing requirements for existing systems and formulating requirements for their own systems, while strengthening the reporting of patient registry software system descriptions. It may be a first step to create standards for patient registry software system assessments. Copyright © 2017 Elsevier Inc. All rights reserved.

Collected software engineering papers, volume 2

NASA Technical Reports Server (NTRS)

1983-01-01

Topics addressed include: summaries of the software engineering laboratory (SEL) organization, operation, and research activities; results of specific research projects in the areas of resource models and software measures; and strategies for data collection for software engineering research.

Dynamic visualization techniques for high consequence software

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pollock, G.M.

1998-02-01

This report documents a prototype tool developed to investigate the use of visualization and virtual reality technologies for improving software surety confidence. The tool is utilized within the execution phase of the software life cycle. It provides a capability to monitor an executing program against prespecified requirements constraints provided in a program written in the requirements specification language SAGE. The resulting Software Attribute Visual Analysis Tool (SAVAnT) also provides a technique to assess the completeness of a software specification. The prototype tool is described along with the requirements constraint language after a brief literature review is presented. Examples of howmore » the tool can be used are also presented. In conclusion, the most significant advantage of this tool is to provide a first step in evaluating specification completeness, and to provide a more productive method for program comprehension and debugging. The expected payoff is increased software surety confidence, increased program comprehension, and reduced development and debugging time.« less

Investigation of specification measures for the Software Engineering Laboratory (SEL)

NASA Technical Reports Server (NTRS)

1984-01-01

Requirements specification measures are investigated for potential application in the Software Engineering Laboratory. Eighty-seven candidate measures are defined; sixteen are recommended for use. Most measures are derived from a new representation, the Composite Specification Model, which is introduced. The results of extracting the specification measures from the requirements of a real system are described.

OHD/HL - SHEF: code

Science.gov Websites

specification How to install the software How to use the software Download the source code (using .gz). Standard Exchange Format (SHEF) is a documented set of rules for coding of data in a form for both visual and information to describe the data. Current SHEF specification How to install the software How to use the

Towards Archetypes-Based Software Development

NASA Astrophysics Data System (ADS)

Piho, Gunnar; Roost, Mart; Perkins, David; Tepandi, Jaak

We present a framework for the archetypes based engineering of domains, requirements and software (Archetypes-Based Software Development, ABD). An archetype is defined as a primordial object that occurs consistently and universally in business domains and in business software systems. An archetype pattern is a collaboration of archetypes. Archetypes and archetype patterns are used to capture conceptual information into domain specific models that are utilized by ABD. The focus of ABD is on software factories - family-based development artefacts (domain specific languages, patterns, frameworks, tools, micro processes, and others) that can be used to build the family members. We demonstrate the usage of ABD for developing laboratory information management system (LIMS) software for the Clinical and Biomedical Proteomics Group, at the Leeds Institute of Molecular Medicine, University of Leeds.

Java for flight software

NASA Technical Reports Server (NTRS)

Benowitz, E.; Niessner, A.

2003-01-01

This work involves developing representative mission-critical spacecraft software using the Real-Time Specification for Java (RTSJ). This work currently leverages actual flight software used in the design of actual flight software in the NASA's Deep Space 1 (DSI), which flew in 1998.

An overview of very high level software design methods

NASA Technical Reports Server (NTRS)

Asdjodi, Maryam; Hooper, James W.

1988-01-01

Very High Level design methods emphasize automatic transfer of requirements to formal design specifications, and/or may concentrate on automatic transformation of formal design specifications that include some semantic information of the system into machine executable form. Very high level design methods range from general domain independent methods to approaches implementable for specific applications or domains. Applying AI techniques, abstract programming methods, domain heuristics, software engineering tools, library-based programming and other methods different approaches for higher level software design are being developed. Though one finds that a given approach does not always fall exactly in any specific class, this paper provides a classification for very high level design methods including examples for each class. These methods are analyzed and compared based on their basic approaches, strengths and feasibility for future expansion toward automatic development of software systems.

Software Tools for Formal Specification and Verification of Distributed Real-Time Systems.

DTIC Science & Technology

1997-09-30

set of software tools for specification and verification of distributed real time systems using formal methods. The task of this SBIR Phase II effort...to be used by designers of real - time systems for early detection of errors. The mathematical complexity of formal specification and verification has

Model-based software design

NASA Technical Reports Server (NTRS)

Iscoe, Neil; Liu, Zheng-Yang; Feng, Guohui; Yenne, Britt; Vansickle, Larry; Ballantyne, Michael

1992-01-01

Domain-specific knowledge is required to create specifications, generate code, and understand existing systems. Our approach to automating software design is based on instantiating an application domain model with industry-specific knowledge and then using that model to achieve the operational goals of specification elicitation and verification, reverse engineering, and code generation. Although many different specification models can be created from any particular domain model, each specification model is consistent and correct with respect to the domain model.

Beyond formalism

NASA Technical Reports Server (NTRS)

Denning, Peter J.

1991-01-01

The ongoing debate over the role of formalism and formal specifications in software features many speakers with diverse positions. Yet, in the end, they share the conviction that the requirements of a software system can be unambiguously specified, that acceptable software is a product demonstrably meeting the specifications, and that the design process can be carried out with little interaction between designers and users once the specification has been agreed to. This conviction is part of a larger paradigm prevalent in American management thinking, which holds that organizations are systems that can be precisely specified and optimized. This paradigm, which traces historically to the works of Frederick Taylor in the early 1900s, is no longer sufficient for organizations and software systems today. In the domain of software, a new paradigm, called user-centered design, overcomes the limitations of pure formalism. Pioneered in Scandinavia, user-centered design is spreading through Europe and is beginning to make its way into the U.S.

PUS Services Software Building Block Automatic Generation for Space Missions

NASA Astrophysics Data System (ADS)

Candia, S.; Sgaramella, F.; Mele, G.

2008-08-01

The Packet Utilization Standard (PUS) has been specified by the European Committee for Space Standardization (ECSS) and issued as ECSS-E-70-41A to define the application-level interface between Ground Segments and Space Segments. The ECSS-E- 70-41A complements the ECSS-E-50 and the Consultative Committee for Space Data Systems (CCSDS) recommendations for packet telemetry and telecommand. The ECSS-E-70-41A characterizes the identified PUS Services from a functional point of view and the ECSS-E-70-31 standard specifies the rules for their mission-specific tailoring. The current on-board software design for a space mission implies the production of several PUS terminals, each providing a specific tailoring of the PUS services. The associated on-board software building blocks are developed independently, leading to very different design choices and implementations even when the mission tailoring requires very similar services (from the Ground operative perspective). In this scenario, the automatic production of the PUS services building blocks for a mission would be a way to optimize the overall mission economy and improve the robusteness and reliability of the on-board software and of the Ground-Space interactions. This paper presents the Space Software Italia (SSI) activities for the development of an integrated environment to support: the PUS services tailoring activity for a specific mission. the mission-specific PUS services configuration. the generation the UML model of the software building block implementing the mission-specific PUS services and the related source code, support documentation (software requirements, software architecture, test plans/procedures, operational manuals), and the TM/TC database. The paper deals with: (a) the project objectives, (b) the tailoring, configuration, and generation process, (c) the description of the environments supporting the process phases, (d) the characterization of the meta-model used for the generation, (e) the characterization of the reference avionics architecture and of the reference on- board software high-level architecture.

CARDS: A blueprint and environment for domain-specific software reuse

NASA Technical Reports Server (NTRS)

Wallnau, Kurt C.; Solderitsch, Anne Costa; Smotherman, Catherine

1992-01-01

CARDS (Central Archive for Reusable Defense Software) exploits advances in domain analysis and domain modeling to identify, specify, develop, archive, retrieve, understand, and reuse domain-specific software components. An important element of CARDS is to provide visibility into the domain model artifacts produced by, and services provided by, commercial computer-aided software engineering (CASE) technology. The use of commercial CASE technology is important to provide rich, robust support for the varied roles involved in a reuse process. We refer to this kind of use of knowledge representation systems as supporting 'knowledge-based integration.'

Automated Software Development Workstation (ASDW)

NASA Technical Reports Server (NTRS)

Fridge, Ernie

1990-01-01

Software development is a serious bottleneck in the construction of complex automated systems. An increase of the reuse of software designs and components has been viewed as a way to relieve this bottleneck. One approach to achieving software reusability is through the development and use of software parts composition systems. A software parts composition system is a software development environment comprised of a parts description language for modeling parts and their interfaces, a catalog of existing parts, a composition editor that aids a user in the specification of a new application from existing parts, and a code generator that takes a specification and generates an implementation of a new application in a target language. The Automated Software Development Workstation (ASDW) is an expert system shell that provides the capabilities required to develop and manipulate these software parts composition systems. The ASDW is now in Beta testing at the Johnson Space Center. Future work centers on responding to user feedback for capability and usability enhancement, expanding the scope of the software lifecycle that is covered, and in providing solutions to handling very large libraries of reusable components.

Annotated bibliography of Software Engineering Laboratory literature

NASA Technical Reports Server (NTRS)

Morusiewicz, Linda; Valett, Jon D.

1991-01-01

An annotated bibliography of technical papers, documents, and memorandums produced by or related to the Software Engineering Laboratory is given. More than 100 publications are summarized. These publications cover many areas of software engineering and range from research reports to software documentation. All materials have been grouped into eight general subject areas for easy reference: The Software Engineering Laboratory; The Software Engineering Laboratory: Software Development Documents; Software Tools; Software Models; Software Measurement; Technology Evaluations; Ada Technology; and Data Collection. Subject and author indexes further classify these documents by specific topic and individual author.

TOP500 Supercomputers for June 2003

DOE Office of Scientific and Technical Information (OSTI.GOV)

Strohmaier, Erich; Meuer, Hans W.; Dongarra, Jack

2003-06-23

21st Edition of TOP500 List of World's Fastest Supercomputers Released MANNHEIM, Germany; KNOXVILLE, Tenn.;&BERKELEY, Calif. In what has become a much-anticipated event in the world of high-performance computing, the 21st edition of the TOP500 list of the world's fastest supercomputers was released today (June 23, 2003). The Earth Simulator supercomputer built by NEC and installed last year at the Earth Simulator Center in Yokohama, Japan, with its Linpack benchmark performance of 35.86 Tflop/s (teraflops or trillions of calculations per second), retains the number one position. The number 2 position is held by the re-measured ASCI Q system at Los Alamosmore » National Laboratory. With 13.88 Tflop/s, it is the second system ever to exceed the 10 Tflop/smark. ASCIQ was built by Hewlett-Packard and is based on the AlphaServerSC computer system.« less

Freshwater ascomycetes: Alascospora evergladensis, a new genus and species from the Florida Everglades.

PubMed

Raja, Huzefa A; Violi, Helen A; Shearer, Carol A

2010-01-01

Alascospora evergladensis, a freshwater ascomycete collected from submerged dead petioles of Nymphaea odorata during a survey of aquatic fungi along a phosphorus gradient in the Florida Everglades, is described and illustrated as a new genus and species in the Pleosporales (Pleosporomycetidae, Dothideomycetes). The new fungus is unique among genera in the Pleosporales based on a combination of morphological characters that include light brown, translucent, membranous, ostiolate ascomata with dark, amorphous material irregularly deposited on the peridium, especially around the ostiole; globose, fissitunicate, thick-walled asci; septate pseudoparaphyses; and 1-septate ascospores that are hyaline when young, and surrounded by a hyaline gelatinous sheath that is wing-shaped in outline on each side of the ascospore. The sheath is distinctive in that it first expands in water and is translucent, then condenses and darkens around older ascospores, giving them a dark brown, verruculose appearance.

Multi-locus phylogeny of Pleosporales: a taxonomic, ecological and evolutionary re-evaluation

PubMed Central

Zhang, Y.; Schoch, C.L.; Fournier, J.; Crous, P.W.; de Gruyter, J.; Woudenberg, J.H.C.; Hirayama, K.; Tanaka, K.; Pointing, S.B.; Spatafora, J.W.; Hyde, K.D.

2009-01-01

Five loci, nucSSU, nucLSU rDNA, TEF1, RPB1 and RPB2, are used for analysing 129 pleosporalean taxa representing 59 genera and 15 families in the current classification of Pleosporales. The suborder Pleosporineae is emended to include four families, viz. Didymellaceae, Leptosphaeriaceae, Phaeosphaeriaceae and Pleosporaceae. In addition, two new families are introduced, i.e. Amniculicolaceae and Lentitheciaceae. Pleomassariaceae is treated as a synonym of Melanommataceae, and new circumscriptions of Lophiostomataceae s. str., Massarinaceae and Lophiotrema are proposed. Familial positions of Entodesmium and Setomelanomma in Phaeosphaeriaceae, Neophaeosphaeria in Leptosphaeriaceae, Leptosphaerulina, Macroventuria and Platychora in Didymellaceae, Pleomassaria in Melanommataceae and Bimuria, Didymocrea, Karstenula and Paraphaeosphaeria in Montagnulaceae are clarified. Both ecological and morphological characters show varying degrees of phylogenetic significance. Pleosporales is most likely derived from a saprobic ancestor with fissitunicate asci containing conspicuous ocular chambers and apical rings. Nutritional shifts in Pleosporales likely occured from saprotrophic to hemibiotrophic or biotrophic. PMID:20169024

Pichia insulana sp. nov., a novel cactophilic yeast from the Caribbean

PubMed Central

Ganter, Philip F.; Cardinali, Gianluigi; Boundy-Mills, Kyria

2010-01-01

A novel species of ascomycetous yeast, Pichia insulana sp. nov., is described from necrotic tissue of columnar cacti on Caribbean islands. P. insulana is closely related to and phenotypically very similar to Pichia cactophila and Pichia pseudocactophila. There are few distinctions between these taxa besides spore type, host preference and locality. Sporogenous strains of P. insulana that produce asci with four hat-shaped spores have been found only on Curaçao, whereas there was no evidence of sporogenous P. cactophila from that island. In addition, sequences of the D1/D2 fragment of the large-subunit rDNA from 12 Curaçao strains showed consistent differences from the sequences of the type strains of P. cactophila and P. pseudocactophila. The type strain of P. insulana is TSU00-106.5T (=CBS 11169T =UCD-FST 09-160T). PMID:19661524

Case of Contamination by Listeria Monocytogenes in Mozzarella Cheese

PubMed Central

Tolli, Rita; Bossù, Teresa; Rodas, Eda Maria Flores; Di Giamberardino, Fabiola; Di Sirio, Alessandro; Vita, Silvia; De Angelis, Veronica; Bilei, Stefano; Sonnessa, Michele; Gattuso, Antonietta; Lanni, Luigi

2014-01-01

Following a Listeria monocytogenes detection in a mozzarella cheese sampled at a dairy plant in Lazio Region, further investigations have been conducted both by the competent Authority and the food business operatordairy factory (as a part of dairy factory HACCP control). In total, 90 dairy products, 7 brine and 64 environmental samples have been tested. The prevalence of Listeria monocytogenes was 24.4% in mozzarella cheese, and 9.4% in environmental samples, while brines were all negatives. Forty-seven strains of L. monocytogenes have been isolated, all belonging to 4b/4e serotype. In 12 of these, the macrorestriction profile has been determined by means of pulsed field gel electrophoresis. The profiles obtained with AscI enzyme showed a 100% similarity while those obtained with ApaI a 96.78% similarity. These characteristics of the isolated strains jointly with the production process of mozzarella cheese has allowed to hypothesise an environmental contamination. PMID:27800317

LATIS3D: The Goal Standard for Laser-Tissue-Interaction Modeling

NASA Astrophysics Data System (ADS)

London, R. A.; Makarewicz, A. M.; Kim, B. M.; Gentile, N. A.; Yang, T. Y. B.

2000-03-01

The goal of this LDRD project has been to create LATIS3D-the world's premier computer program for laser-tissue interaction modeling. The development was based on recent experience with the 2D LATIS code and the ASCI code, KULL. With LATIS3D, important applications in laser medical therapy were researched including dynamical calculations of tissue emulsification and ablation, photothermal therapy, and photon transport for photodynamic therapy. This project also enhanced LLNL's core competency in laser-matter interactions and high-energy-density physics by pushing simulation codes into new parameter regimes and by attracting external expertise. This will benefit both existing LLNL programs such as ICF and SBSS and emerging programs in medical technology and other laser applications. The purpose of this project was to develop and apply a computer program for laser-tissue interaction modeling to aid in the development of new instruments and procedures in laser medicine.

Ultrastructure of developing ascospores in Sordaria brevicollis.

PubMed

Hackett, C J; Chen, K C

1976-05-01

The ultrastructure of ascospore wall formation in the pyrenomycete Sordaria brevicollis was studied in developing asci at progressive time intervals. From early spore delimitation through final stage of maturation, the wall of the ascospore differentiated into four composite layers, the periascosporium the delineation ascosporium, the subascosproium, and the endoascosproium, While ascospores were at the hyaline stage of development,they possessed only the periascosporium and delineation ascosporium as their wall components. At about 7 to 8 days from the initiation of the cross, the spores developed a yellow color, and this coloration was always associated with the elaboration of the subascorsporium just internal to the ascosporium. Asthe spores continued to progressively darken in color, the subascosporium was seen to increase in complexity, electron density, and thickness. Soon after the formation of the subascosporium, the endoascosporium began to develop de novo and was, therefore, the last wall layer formed as the spore approached maturity.

Meiotic aneuploidy: its origins and induction following chemical treatment in Sordaria brevicollis.

PubMed

Bond, D J; McMillan, L

1979-08-01

A system suitable for the detection of meiotic aneuploidy is described in which various different origins of the aneuploidy can be distinguished. Aneuploid meiotic products are detected as black disomic spores held in asci containing all the products of a single meiosis. Aneuploidy may result from nondisjunction or from a meiosis in which an extra replica of one of the chromosomes has been generated in some other way, e.g., extra replication. By using this system it has been shown that pFPA treatment increase aneuploidy, primarily through an effect on nondisjunction. Preliminary results with trifluralin have indicated that this compound, too, may increase aneuploidy. There is a good possibility that the system can be further developed to permit a more rapid screening using a random plating method; this will allow a more efficient two-part analysis of the effects of compounds under test.

The temporal response of recombination events to gamma radiation of meiotic cells in Sordaria brevicollis.

PubMed

Lewis, L A

1982-01-01

The temporal frequencies of different stages of prophase I were determined cytologically in Sordaria brevicollis (Olive and Fantini) as the basis for ascertaining the degree of synchrony in meiosis in this ascomycete. Croziers, karyogamy-zygotene and pachytene asci were shown to be in significant majorities at three distinct periods of the meiotic cycle. The response of recombination frequency to ionizing radiation was examined for the entire meiotic cycle. Three radiosensitive periods were determined. This response, which correlated temporally with each of the three peaks in ascal frequency, is interpreted as showing that the meiotic cycle of this organism is divided into periods of recombination commitment (radiation reduced frequencies) during the pre-meiotic S phase and recombination consummation (radiation induced frequencies) during zygotene and pachytene. The results are discussed in the context of the time at which recombination is consummated in eukaryotes such as yeast and Drosophila.

48 CFR 27.405-3 - Commercial computer software.

Code of Federal Regulations, 2011 CFR

2011-10-01

... software. 27.405-3 Section 27.405-3 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION... Commercial computer software. (a) When contracting other than from GSA's Multiple Award Schedule contracts for the acquisition of commercial computer software, no specific contract clause prescribed in this...

48 CFR 27.405-3 - Commercial computer software.

Code of Federal Regulations, 2012 CFR

2012-10-01

... software. 27.405-3 Section 27.405-3 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION... Commercial computer software. (a) When contracting other than from GSA's Multiple Award Schedule contracts for the acquisition of commercial computer software, no specific contract clause prescribed in this...

48 CFR 27.405-3 - Commercial computer software.

Code of Federal Regulations, 2014 CFR

2014-10-01

... software. 27.405-3 Section 27.405-3 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION... Commercial computer software. (a) When contracting other than from GSA's Multiple Award Schedule contracts for the acquisition of commercial computer software, no specific contract clause prescribed in this...

48 CFR 27.405-3 - Commercial computer software.

Code of Federal Regulations, 2013 CFR

2013-10-01

... software. 27.405-3 Section 27.405-3 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION... Commercial computer software. (a) When contracting other than from GSA's Multiple Award Schedule contracts for the acquisition of commercial computer software, no specific contract clause prescribed in this...

48 CFR 27.405-3 - Commercial computer software.

Code of Federal Regulations, 2010 CFR

2010-10-01

... software. 27.405-3 Section 27.405-3 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION... Commercial computer software. (a) When contracting other than from GSA's Multiple Award Schedule contracts for the acquisition of commercial computer software, no specific contract clause prescribed in this...

A University Dilemma: The Use of Third Party-Owned Software.

ERIC Educational Resources Information Center

Hersey, Karen

1985-01-01

Reviews specific problems associated with software protection (copyright license, trade secret license), clauses in software license agreements that most frequently cause difficulties, and solutions university administrators and software industry should consider. Topics include confidentiality, restrictive use of modifications, use on single…

An expert system based software sizing tool, phase 2

NASA Technical Reports Server (NTRS)

Friedlander, David

1990-01-01

A software tool was developed for predicting the size of a future computer program at an early stage in its development. The system is intended to enable a user who is not expert in Software Engineering to estimate software size in lines of source code with an accuracy similar to that of an expert, based on the program's functional specifications. The project was planned as a knowledge based system with a field prototype as the goal of Phase 2 and a commercial system planned for Phase 3. The researchers used techniques from Artificial Intelligence and knowledge from human experts and existing software from NASA's COSMIC database. They devised a classification scheme for the software specifications, and a small set of generic software components that represent complexity and apply to large classes of programs. The specifications are converted to generic components by a set of rules and the generic components are input to a nonlinear sizing function which makes the final prediction. The system developed for this project predicted code sizes from the database with a bias factor of 1.06 and a fluctuation factor of 1.77, an accuracy similar to that of human experts but without their significant optimistic bias.

Evaluation of software sensors for on-line estimation of culture conditions in an Escherichia coli cultivation expressing a recombinant protein.

PubMed

Warth, Benedikt; Rajkai, György; Mandenius, Carl-Fredrik

2010-05-03

Software sensors for monitoring and on-line estimation of critical bioprocess variables have mainly been used with standard bioreactor sensors, such as electrodes and gas analyzers, where algorithms in the software model have generated the desired state variables. In this article we propose that other on-line instruments, such as NIR probes and on-line HPLC, should be used to make more reliable and flexible software sensors. Five software sensor architectures were compared and evaluated: (1) biomass concentration from an on-line NIR probe, (2) biomass concentration from titrant addition, (3) specific growth rate from titrant addition, (4) specific growth rate from the NIR probe, and (5) specific substrate uptake rate and by-product rate from on-line HPLC and NIR probe signals. The software sensors were demonstrated on an Escherichia coli cultivation expressing a recombinant protein, green fluorescent protein (GFP), but the results could be extrapolated to other production organisms and product proteins. We conclude that well-maintained on-line instrumentation (hardware sensors) can increase the potential of software sensors. This would also strongly support the intentions with process analytical technology and quality-by-design concepts. 2010 Elsevier B.V. All rights reserved.

Writing testable software requirements

DOE Office of Scientific and Technical Information (OSTI.GOV)

Knirk, D.

1997-11-01

This tutorial identifies common problems in analyzing requirements in the problem and constructing a written specification of what the software is to do. It deals with two main problem areas: identifying and describing problem requirements, and analyzing and describing behavior specifications.

The Effect of Software Features on Software Adoption and Training in the Audit Profession

ERIC Educational Resources Information Center

Kim, Hyo-Jeong

2012-01-01

Although software has been studied with technology adoption and training research, the study of specific software features for professional groups has been limited. To address this gap, I researched the impact of software features of varying complexity on internal audit (IA) professionals. Two studies along with the development of training…

A conceptual model for megaprogramming

NASA Technical Reports Server (NTRS)

Tracz, Will

1990-01-01

Megaprogramming is component-based software engineering and life-cycle management. Magaprogramming and its relationship to other research initiatives (common prototyping system/common prototyping language, domain specific software architectures, and software understanding) are analyzed. The desirable attributes of megaprogramming software components are identified and a software development model and resulting prototype megaprogramming system (library interconnection language extended by annotated Ada) are described.

Comparative Evaluations of Four Specification Methods for Real-Time Systems

DTIC Science & Technology

1989-12-01

December 1989 Comparative Evaluations of Four Specification Methods for Real - Time Systems David P. Wood William G. Wood Specification and Design Methods...Methods for Real - Time Systems Abstract: A number of methods have been proposed in the last decade for the specification of system and software requirements...and software specification for real - time systems . Our process for the identification of methods that meet the above criteria is described in greater

Domain and Specification Models for Software Engineering

NASA Technical Reports Server (NTRS)

Iscoe, Neil; Liu, Zheng-Yang; Feng, Guohui

1992-01-01

This paper discusses our approach to representing application domain knowledge for specific software engineering tasks. Application domain knowledge is embodied in a domain model. Domain models are used to assist in the creation of specification models. Although many different specification models can be created from any particular domain model, each specification model is consistent and correct with respect to the domain model. One aspect of the system-hierarchical organization is described in detail.

Iteration and Prototyping in Creating Technical Specifications.

ERIC Educational Resources Information Center

Flynt, John P.

1994-01-01

Claims that the development process for computer software can be greatly aided by the writers of specifications if they employ basic iteration and prototyping techniques. Asserts that computer software configuration management practices provide ready models for iteration and prototyping. (HB)

Testing Scientific Software: A Systematic Literature Review.

PubMed

Kanewala, Upulee; Bieman, James M

2014-10-01

Scientific software plays an important role in critical decision making, for example making weather predictions based on climate models, and computation of evidence for research publications. Recently, scientists have had to retract publications due to errors caused by software faults. Systematic testing can identify such faults in code. This study aims to identify specific challenges, proposed solutions, and unsolved problems faced when testing scientific software. We conducted a systematic literature survey to identify and analyze relevant literature. We identified 62 studies that provided relevant information about testing scientific software. We found that challenges faced when testing scientific software fall into two main categories: (1) testing challenges that occur due to characteristics of scientific software such as oracle problems and (2) testing challenges that occur due to cultural differences between scientists and the software engineering community such as viewing the code and the model that it implements as inseparable entities. In addition, we identified methods to potentially overcome these challenges and their limitations. Finally we describe unsolved challenges and how software engineering researchers and practitioners can help to overcome them. Scientific software presents special challenges for testing. Specifically, cultural differences between scientist developers and software engineers, along with the characteristics of the scientific software make testing more difficult. Existing techniques such as code clone detection can help to improve the testing process. Software engineers should consider special challenges posed by scientific software such as oracle problems when developing testing techniques.

Computer Software Configuration Item-Specific Flight Software Image Transfer Script Generator

NASA Technical Reports Server (NTRS)

Bolen, Kenny; Greenlaw, Ronald

2010-01-01

A K-shell UNIX script enables the International Space Station (ISS) Flight Control Team (FCT) operators in NASA s Mission Control Center (MCC) in Houston to transfer an entire or partial computer software configuration item (CSCI) from a flight software compact disk (CD) to the onboard Portable Computer System (PCS). The tool is designed to read the content stored on a flight software CD and generate individual CSCI transfer scripts that are capable of transferring the flight software content in a given subdirectory on the CD to the scratch directory on the PCS. The flight control team can then transfer the flight software from the PCS scratch directory to the Electronically Erasable Programmable Read Only Memory (EEPROM) of an ISS Multiplexer/ Demultiplexer (MDM) via the Indirect File Transfer capability. The individual CSCI scripts and the CSCI Specific Flight Software Image Transfer Script Generator (CFITSG), when executed a second time, will remove all components from their original execution. The tool will identify errors in the transfer process and create logs of the transferred software for the purposes of configuration management.

Incorporating a Human-Computer Interaction Course into Software Development Curriculums

ERIC Educational Resources Information Center

Janicki, Thomas N.; Cummings, Jeffrey; Healy, R. Joseph

2015-01-01

Individuals have increasing options on retrieving information related to hardware and software. Specific hardware devices include desktops, tablets and smart devices. Also, the number of software applications has significantly increased the user's capability to access data. Software applications include the traditional web site, smart device…

Seismology software: state of the practice

NASA Astrophysics Data System (ADS)

Smith, W. Spencer; Zeng, Zheng; Carette, Jacques

2018-05-01

We analyzed the state of practice for software development in the seismology domain by comparing 30 software packages on four aspects: product, implementation, design, and process. We found room for improvement in most seismology software packages. The principal areas of concern include a lack of adequate requirements and design specification documents, a lack of test data to assess reliability, a lack of examples to get new users started, and a lack of technological tools to assist with managing the development process. To assist going forward, we provide recommendations for a document-driven development process that includes a problem statement, development plan, requirement specification, verification and validation (V&V) plan, design specification, code, V&V report, and a user manual. We also provide advice on tool use, including issue tracking, version control, code documentation, and testing tools.

Seismology software: state of the practice

NASA Astrophysics Data System (ADS)

Smith, W. Spencer; Zeng, Zheng; Carette, Jacques

2018-02-01

We analyzed the state of practice for software development in the seismology domain by comparing 30 software packages on four aspects: product, implementation, design, and process. We found room for improvement in most seismology software packages. The principal areas of concern include a lack of adequate requirements and design specification documents, a lack of test data to assess reliability, a lack of examples to get new users started, and a lack of technological tools to assist with managing the development process. To assist going forward, we provide recommendations for a document-driven development process that includes a problem statement, development plan, requirement specification, verification and validation (V&V) plan, design specification, code, V&V report, and a user manual. We also provide advice on tool use, including issue tracking, version control, code documentation, and testing tools.

Software reconfigurable processor technologies: the key to long-life infrastructure for future space missions

NASA Technical Reports Server (NTRS)

Srinivasan, J.; Farrington, A.; Gray, A.

2001-01-01

They present an overview of long-life reconfigurable processor technologies and of a specific architecture for implementing a software reconfigurable (software-defined) network processor for space applications.

Diagnostic performance of an automated analysis software for the diagnosis of Alzheimer’s dementia with 18F FDG PET

PubMed Central

Partovi, Sasan; Yuh, Roger; Pirozzi, Sara; Lu, Ziang; Couturier, Spencer; Grosse, Ulrich; Schluchter, Mark D; Nelson, Aaron; Jones, Robert; O’Donnell, James K; Faulhaber, Peter

2017-01-01

The objective of this study was to assess the ability of a quantitative software-aided approach to improve the diagnostic accuracy of 18F FDG PET for Alzheimer’s dementia over visual analysis alone. Twenty normal subjects (M:F-12:8; mean age 80.6 years) and twenty mild AD subjects (M:F-12:8; mean age 70.6 years) with 18F FDG PET scans were obtained from the ADNI database. Three blinded readers interpreted these PET images first using a visual qualitative approach and then using a quantitative software-aided approach. Images were classified on two five-point scales based on normal/abnormal (1-definitely normal; 5-definitely abnormal) and presence of AD (1-definitely not AD; 5-definitely AD). Diagnostic sensitivity, specificity, and accuracy for both approaches were compared based on the aforementioned scales. The sensitivity, specificity, and accuracy for the normal vs. abnormal readings of all readers combined were higher when comparing the software-aided vs. visual approach (sensitivity 0.93 vs. 0.83 P = 0.0466; specificity 0.85 vs. 0.60 P = 0.0005; accuracy 0.89 vs. 0.72 P<0.0001). The specificity and accuracy for absence vs. presence of AD of all readers combined were higher when comparing the software-aided vs. visual approach (specificity 0.90 vs. 0.70 P = 0.0008; accuracy 0.81 vs. 0.72 P = 0.0356). Sensitivities of the software-aided and visual approaches did not differ significantly (0.72 vs. 0.73 P = 0.74). The quantitative software-aided approach appears to improve the performance of 18F FDG PET for the diagnosis of mild AD. It may be helpful for experienced 18F FDG PET readers analyzing challenging cases. PMID:28123864

LogiKit - assisting complex logic specification and implementation for embedded control systems

NASA Astrophysics Data System (ADS)

Diglio, A.; Nicolodi, B.

2002-07-01

LogiKit provides an overall lifecycle solution. LogiKit is a powerful software engineering case toolkit for requirements specification, simulation and documentation. LogiKit also provides an automatic ADA software design, code and unit test generator.

Software engineering with application-specific languages

NASA Technical Reports Server (NTRS)

Campbell, David J.; Barker, Linda; Mitchell, Deborah; Pollack, Robert H.

1993-01-01

Application-Specific Languages (ASL's) are small, special-purpose languages that are targeted to solve a specific class of problems. Using ASL's on software development projects can provide considerable cost savings, reduce risk, and enhance quality and reliability. ASL's provide a platform for reuse within a project or across many projects and enable less-experienced programmers to tap into the expertise of application-area experts. ASL's have been used on several software development projects for the Space Shuttle Program. On these projects, the use of ASL's resulted in considerable cost savings over conventional development techniques. Two of these projects are described.

Formal Verification of Large Software Systems

NASA Technical Reports Server (NTRS)

Yin, Xiang; Knight, John

2010-01-01

We introduce a scalable proof structure to facilitate formal verification of large software systems. In our approach, we mechanically synthesize an abstract specification from the software implementation, match its static operational structure to that of the original specification, and organize the proof as the conjunction of a series of lemmas about the specification structure. By setting up a different lemma for each distinct element and proving each lemma independently, we obtain the important benefit that the proof scales easily for large systems. We present details of the approach and an illustration of its application on a challenge problem from the security domain

Would Consolidation of Army Software Engineering Organizations Help to Control Software Costs for Current and Future Systems

DTIC Science & Technology

2015-04-16

Specific to Work and Organization .................................................................... 32 Summary of Questions Specific to Work and...Limitations include assumptions that the work identified in the software center’s 6 mission and functions manual (10-1; CECOM, 2011) as well as in public...that produced RDECOM. The focus was on the movement of positions based on the position job series, not on the work that was actually being performed

Automating the design of scientific computing software

NASA Technical Reports Server (NTRS)

Kant, Elaine

1992-01-01

SINAPSE is a domain-specific software design system that generates code from specifications of equations and algorithm methods. This paper describes the system's design techniques (planning in a space of knowledge-based refinement and optimization rules), user interaction style (user has option to control decision making), and representation of knowledge (rules and objects). It also summarizes how the system knowledge has evolved over time and suggests some issues in building software design systems to facilitate reuse.

Space shuttle orbiter avionics software: Post review report for the entry FACI (First Article Configuration Inspection). [including orbital flight tests integrated system

NASA Technical Reports Server (NTRS)

Markos, H.

1978-01-01

Status of the computer programs dealing with space shuttle orbiter avionics is reported. Specific topics covered include: delivery status; SSW software; SM software; DL software; GNC software; level 3/4 testing; level 5 testing; performance analysis, SDL readiness for entry first article configuration inspection; and verification assessment.

Project W-211, initial tank retrieval systems, retrieval control system software configuration management plan

DOE Office of Scientific and Technical Information (OSTI.GOV)

RIECK, C.A.

1999-02-23

This Software Configuration Management Plan (SCMP) provides the instructions for change control of the W-211 Project, Retrieval Control System (RCS) software after initial approval/release but prior to the transfer of custody to the waste tank operations contractor. This plan applies to the W-211 system software developed by the project, consisting of the computer human-machine interface (HMI) and programmable logic controller (PLC) software source and executable code, for production use by the waste tank operations contractor. The plan encompasses that portion of the W-211 RCS software represented on project-specific AUTOCAD drawings that are released as part of the C1 definitive designmore » package (these drawings are identified on the drawing list associated with each C-1 package), and the associated software code. Implementation of the plan is required for formal acceptance testing and production release. The software configuration management plan does not apply to reports and data generated by the software except where specifically identified. Control of information produced by the software once it has been transferred for operation is the responsibility of the receiving organization.« less

Institute for scientific computing research;fiscal year 1999 annual report

DOE Office of Scientific and Technical Information (OSTI.GOV)

Keyes, D

2000-03-28

Large-scale scientific computation, and all of the disciplines that support it and help to validate it, have been placed at the focus of Lawrence Livermore National Laboratory by the Accelerated Strategic Computing Initiative (ASCI). The Laboratory operates the computer with the highest peak performance in the world and has undertaken some of the largest and most compute-intensive simulations ever performed. Computers at the architectural extremes, however, are notoriously difficult to use efficiently. Even such successes as the Laboratory's two Bell Prizes awarded in November 1999 only emphasize the need for much better ways of interacting with the results of large-scalemore » simulations. Advances in scientific computing research have, therefore, never been more vital to the core missions of the Laboratory than at present. Computational science is evolving so rapidly along every one of its research fronts that to remain on the leading edge, the Laboratory must engage researchers at many academic centers of excellence. In FY 1999, the Institute for Scientific Computing Research (ISCR) has expanded the Laboratory's bridge to the academic community in the form of collaborative subcontracts, visiting faculty, student internships, a workshop, and a very active seminar series. ISCR research participants are integrated almost seamlessly with the Laboratory's Center for Applied Scientific Computing (CASC), which, in turn, addresses computational challenges arising throughout the Laboratory. Administratively, the ISCR flourishes under the Laboratory's University Relations Program (URP). Together with the other four Institutes of the URP, it must navigate a course that allows the Laboratory to benefit from academic exchanges while preserving national security. Although FY 1999 brought more than its share of challenges to the operation of an academic-like research enterprise within the context of a national security laboratory, the results declare the challenges well met and well worth the continued effort. A change of administration for the ISCR occurred during FY 1999. Acting Director John Fitzgerald retired from LLNL in August after 35 years of service, including the last two at helm of the ISCR. David Keyes, who has been a regular visitor in conjunction with ASCI scalable algorithms research since October 1997, overlapped with John for three months and serves half-time as the new Acting Director.« less

Fostering Multirepresentational Levels of Chemical Concepts: A Framework to Develop Educational Software

ERIC Educational Resources Information Center

Marson, Guilherme A.; Torres, Bayardo B.

2011-01-01

This work presents a convenient framework for developing interactive chemical education software to facilitate the integration of macroscopic, microscopic, and symbolic dimensions of chemical concepts--specifically, via the development of software for gel permeation chromatography. The instructional role of the software was evaluated in a study…

42 CFR 495.360 - Software and ownership rights.

Code of Federal Regulations, 2012 CFR

2012-10-01

... 42 Public Health 5 2012-10-01 2012-10-01 false Software and ownership rights. 495.360 Section 495... PROGRAM Requirements Specific to the Medicaid Program § 495.360 Software and ownership rights. (a) General... that the State or local government will have all ownership rights in software or modifications thereof...

45 CFR 95.617 - Software and ownership rights.

Code of Federal Regulations, 2013 CFR

2013-10-01

... 45 Public Welfare 1 2013-10-01 2013-10-01 false Software and ownership rights. 95.617 Section 95... (FFP) Specific Conditions for Ffp § 95.617 Software and ownership rights. (a) General. The State or... local government will have all ownership rights in software or modifications thereof and associated...

45 CFR 95.617 - Software and ownership rights.

Code of Federal Regulations, 2011 CFR

2011-10-01

... 45 Public Welfare 1 2011-10-01 2011-10-01 false Software and ownership rights. 95.617 Section 95... (FFP) Specific Conditions for Ffp § 95.617 Software and ownership rights. (a) General. The State or... local government will have all ownership rights in software or modifications thereof and associated...

42 CFR 495.360 - Software and ownership rights.

Code of Federal Regulations, 2013 CFR

2013-10-01

... 42 Public Health 5 2013-10-01 2013-10-01 false Software and ownership rights. 495.360 Section 495... PROGRAM Requirements Specific to the Medicaid Program § 495.360 Software and ownership rights. (a) General... that the State or local government will have all ownership rights in software or modifications thereof...

42 CFR 495.360 - Software and ownership rights.

Code of Federal Regulations, 2011 CFR

2011-10-01

... 42 Public Health 5 2011-10-01 2011-10-01 false Software and ownership rights. 495.360 Section 495... PROGRAM Requirements Specific to the Medicaid Program § 495.360 Software and ownership rights. (a) General... that the State or local government will have all ownership rights in software or modifications thereof...

45 CFR 95.617 - Software and ownership rights.

Code of Federal Regulations, 2012 CFR

2012-10-01

... 45 Public Welfare 1 2012-10-01 2012-10-01 false Software and ownership rights. 95.617 Section 95... (FFP) Specific Conditions for Ffp § 95.617 Software and ownership rights. (a) General. The State or... local government will have all ownership rights in software or modifications thereof and associated...

45 CFR 95.617 - Software and ownership rights.

Code of Federal Regulations, 2014 CFR

2014-10-01

... 45 Public Welfare 1 2014-10-01 2014-10-01 false Software and ownership rights. 95.617 Section 95... (FFP) Specific Conditions for Ffp § 95.617 Software and ownership rights. (a) General. The State or... local government will have all ownership rights in software or modifications thereof and associated...

42 CFR 495.360 - Software and ownership rights.

Code of Federal Regulations, 2014 CFR

2014-10-01

... 42 Public Health 5 2014-10-01 2014-10-01 false Software and ownership rights. 495.360 Section 495... PROGRAM Requirements Specific to the Medicaid Program § 495.360 Software and ownership rights. (a) General... that the State or local government will have all ownership rights in software or modifications thereof...

Designing Educational Software for Tomorrow.

ERIC Educational Resources Information Center

Harvey, Wayne

Designed to address the management and use of computer software in education and training, this paper explores both good and poor software design, calling for improvements in the quality of educational software by attending to design considerations that are based on general principles of learning rather than specific educational objectives. This…

From Goal-Oriented Requirements to Event-B Specifications

NASA Technical Reports Server (NTRS)

Aziz, Benjamin; Arenas, Alvaro E.; Bicarregui, Juan; Ponsard, Christophe; Massonet, Philippe

2009-01-01

In goal-oriented requirements engineering methodologies, goals are structured into refinement trees from high-level system-wide goals down to fine-grained requirements assigned to specific software/ hardware/human agents that can realise them. Functional goals assigned to software agents need to be operationalised into specification of services that the agent should provide to realise those requirements. In this paper, we propose an approach for operationalising requirements into specifications expressed in the Event-B formalism. Our approach has the benefit of aiding software designers by bridging the gap between declarative requirements and operational system specifications in a rigorous manner, enabling powerful correctness proofs and allowing further refinements down to the implementation level. Our solution is based on verifying that a consistent Event-B machine exhibits properties corresponding to requirements.

Specification-based software sizing: An empirical investigation of function metrics

NASA Technical Reports Server (NTRS)

Jeffery, Ross; Stathis, John

1993-01-01

For some time the software industry has espoused the need for improved specification-based software size metrics. This paper reports on a study of nineteen recently developed systems in a variety of application domains. The systems were developed by a single software services corporation using a variety of languages. The study investigated several metric characteristics. It shows that: earlier research into inter-item correlation within the overall function count is partially supported; a priori function counts, in themself, do not explain the majority of the effort variation in software development in the organization studied; documentation quality is critical to accurate function identification; and rater error is substantial in manual function counting. The implication of these findings for organizations using function based metrics are explored.

Annotated bibliography of software engineering laboratory literature

NASA Technical Reports Server (NTRS)

Buhler, Melanie; Valett, Jon

1989-01-01

An annotated bibliography is presented of technical papers, documents, and memorandums produced by or related to the Software Engineering Laboratory. The bibliography was updated and reorganized substantially since the original version (SEL-82-006, November 1982). All materials were grouped into eight general subject areas for easy reference: (1) The Software Engineering Laboratory; (2) The Software Engineering Laboratory: Software Development Documents; (3) Software Tools; (4) Software Models; (5) Software Measurement; (6) Technology Evaluations; (7) Ada Technology; and (8) Data Collection. Subject and author indexes further classify these documents by specific topic and individual author.

Software Program: Software Management Guidebook

NASA Technical Reports Server (NTRS)

1996-01-01

The purpose of this NASA Software Management Guidebook is twofold. First, this document defines the core products and activities required of NASA software projects. It defines life-cycle models and activity-related methods but acknowledges that no single life-cycle model is appropriate for all NASA software projects. It also acknowledges that the appropriate method for accomplishing a required activity depends on characteristics of the software project. Second, this guidebook provides specific guidance to software project managers and team leaders in selecting appropriate life cycles and methods to develop a tailored plan for a software engineering project.

Data systems and computer science: Software Engineering Program

NASA Technical Reports Server (NTRS)

Zygielbaum, Arthur I.

1991-01-01

An external review of the Integrated Technology Plan for the Civil Space Program is presented. This review is specifically concerned with the Software Engineering Program. The goals of the Software Engineering Program are as follows: (1) improve NASA's ability to manage development, operation, and maintenance of complex software systems; (2) decrease NASA's cost and risk in engineering complex software systems; and (3) provide technology to assure safety and reliability of software in mission critical applications.

SafetyAnalyst : software tools for safety management of specific highway sites

DOT National Transportation Integrated Search

2010-07-01

SafetyAnalyst provides a set of software tools for use by state and local highway agencies for highway safety management. SafetyAnalyst can be used by highway agencies to improve their programming of site-specific highway safety improvements. SafetyA...

The Role and Quality of Software Safety in the NASA Constellation Program

NASA Technical Reports Server (NTRS)

Layman, Lucas; Basili, Victor R.; Zelkowitz, Marvin V.

2010-01-01

In this study, we examine software safety risk in the early design phase of the NASA Constellation spaceflight program. Obtaining an accurate, program-wide picture of software safety risk is difficult across multiple, independently-developing systems. We leverage one source of safety information, hazard analysis, to provide NASA quality assurance managers with information regarding the ongoing state of software safety across the program. The goal of this research is two-fold: 1) to quantify the relative importance of software with respect to system safety; and 2) to quantify the level of risk presented by software in the hazard analysis. We examined 154 hazard reports created during the preliminary design phase of three major flight hardware systems within the Constellation program. To quantify the importance of software, we collected metrics based on the number of software-related causes and controls of hazardous conditions. To quantify the level of risk presented by software, we created a metric scheme to measure the specificity of these software causes. We found that from 49-70% of hazardous conditions in the three systems could be caused by software or software was involved in the prevention of the hazardous condition. We also found that 12-17% of the 2013 hazard causes involved software, and that 23-29% of all causes had a software control. Furthermore, 10-12% of all controls were software-based. There is potential for inaccuracy in these counts, however, as software causes are not consistently scoped, and the presence of software in a cause or control is not always clear. The application of our software specificity metrics also identified risks in the hazard reporting process. In particular, we found a number of traceability risks in the hazard reports may impede verification of software and system safety.

A formal MIM specification and tools for the common exchange of MIM diagrams: an XML-Based format, an API, and a validation method

PubMed Central

2011-01-01

Background The Molecular Interaction Map (MIM) notation offers a standard set of symbols and rules on their usage for the depiction of cellular signaling network diagrams. Such diagrams are essential for disseminating biological information in a concise manner. A lack of software tools for the notation restricts wider usage of the notation. Development of software is facilitated by a more detailed specification regarding software requirements than has previously existed for the MIM notation. Results A formal implementation of the MIM notation was developed based on a core set of previously defined glyphs. This implementation provides a detailed specification of the properties of the elements of the MIM notation. Building upon this specification, a machine-readable format is provided as a standardized mechanism for the storage and exchange of MIM diagrams. This new format is accompanied by a Java-based application programming interface to help software developers to integrate MIM support into software projects. A validation mechanism is also provided to determine whether MIM datasets are in accordance with syntax rules provided by the new specification. Conclusions The work presented here provides key foundational components to promote software development for the MIM notation. These components will speed up the development of interoperable tools supporting the MIM notation and will aid in the translation of data stored in MIM diagrams to other standardized formats. Several projects utilizing this implementation of the notation are outlined herein. The MIM specification is available as an additional file to this publication. Source code, libraries, documentation, and examples are available at http://discover.nci.nih.gov/mim. PMID:21586134

A formal MIM specification and tools for the common exchange of MIM diagrams: an XML-Based format, an API, and a validation method.

PubMed

Luna, Augustin; Karac, Evrim I; Sunshine, Margot; Chang, Lucas; Nussinov, Ruth; Aladjem, Mirit I; Kohn, Kurt W

2011-05-17

The Molecular Interaction Map (MIM) notation offers a standard set of symbols and rules on their usage for the depiction of cellular signaling network diagrams. Such diagrams are essential for disseminating biological information in a concise manner. A lack of software tools for the notation restricts wider usage of the notation. Development of software is facilitated by a more detailed specification regarding software requirements than has previously existed for the MIM notation. A formal implementation of the MIM notation was developed based on a core set of previously defined glyphs. This implementation provides a detailed specification of the properties of the elements of the MIM notation. Building upon this specification, a machine-readable format is provided as a standardized mechanism for the storage and exchange of MIM diagrams. This new format is accompanied by a Java-based application programming interface to help software developers to integrate MIM support into software projects. A validation mechanism is also provided to determine whether MIM datasets are in accordance with syntax rules provided by the new specification. The work presented here provides key foundational components to promote software development for the MIM notation. These components will speed up the development of interoperable tools supporting the MIM notation and will aid in the translation of data stored in MIM diagrams to other standardized formats. Several projects utilizing this implementation of the notation are outlined herein. The MIM specification is available as an additional file to this publication. Source code, libraries, documentation, and examples are available at http://discover.nci.nih.gov/mim.

Automatic programming for critical applications

NASA Technical Reports Server (NTRS)

Loganantharaj, Raj L.

1988-01-01

The important phases of a software life cycle include verification and maintenance. Usually, the execution performance is an expected requirement in a software development process. Unfortunately, the verification and the maintenance of programs are the time consuming and the frustrating aspects of software engineering. The verification cannot be waived for the programs used for critical applications such as, military, space, and nuclear plants. As a consequence, synthesis of programs from specifications, an alternative way of developing correct programs, is becoming popular. The definition, or what is understood by automatic programming, has been changed with our expectations. At present, the goal of automatic programming is the automation of programming process. Specifically, it means the application of artificial intelligence to software engineering in order to define techniques and create environments that help in the creation of high level programs. The automatic programming process may be divided into two phases: the problem acquisition phase and the program synthesis phase. In the problem acquisition phase, an informal specification of the problem is transformed into an unambiguous specification while in the program synthesis phase such a specification is further transformed into a concrete, executable program.

Annotated bibliography of software engineering laboratory literature

NASA Technical Reports Server (NTRS)

Groves, Paula; Valett, Jon

1990-01-01

An annotated bibliography of technical papers, documents, and memorandums produced by or related to the Software Engineering Laboratory is given. More than 100 publications are summarized. These publications cover many areas of software engineering and range from research reports to software documentation. This document has been updated and reorganized substantially since the original version (SEL-82-006, November 1982). All materials have been grouped into eight general subject areas for easy reference: the Software Engineering Laboratory; the Software Engineering Laboratory-software development documents; software tools; software models; software measurement; technology evaluations; Ada technology; and data collection. Subject and author indexes further classify these documents by specific topic and individual author.

Improving Security in Software Acquisition and Runtime Integration With Data Retention Specifications

DTIC Science & Technology

2016-04-30

Data Retention Specifications Daniel Smullen, Research Assistant, Carnegie Mellon University Travis Breaux, Assistant Professor, Carnegie Mellon... Carnegie Mellon University Travis Breaux, Assistant Professor, Carnegie Mellon University Cybersecurity Figure of Merit CAPT Brian Erickson, USN, SPAWAR...Integration With Data Retention Specifications Daniel Smullen—is a Research Assistant enrolled in the software engineering PhD program at Carnegie Mellon

Methodology for Software Reliability Prediction. Volume 1.

DTIC Science & Technology

1987-11-01

SPACECRAFT 0 MANNED SPACECRAFT B ATCH SYSTEM AIRBORNE AVIONICS 0 UNMANNED EVENT C014TROL a REAL TIME CLOSED 0 UNMANNED SPACECRAFT LOOP OPERATINS SPACECRAFT...software reliability. A Software Reliability Measurement Framework was established which spans the life cycle of a software system and includes the...specification, prediction, estimation, and assessment of software reliability. Data from 59 systems , representing over 5 million lines of code, were

Testing Scientific Software: A Systematic Literature Review

PubMed Central

Kanewala, Upulee; Bieman, James M.

2014-01-01

Context Scientific software plays an important role in critical decision making, for example making weather predictions based on climate models, and computation of evidence for research publications. Recently, scientists have had to retract publications due to errors caused by software faults. Systematic testing can identify such faults in code. Objective This study aims to identify specific challenges, proposed solutions, and unsolved problems faced when testing scientific software. Method We conducted a systematic literature survey to identify and analyze relevant literature. We identified 62 studies that provided relevant information about testing scientific software. Results We found that challenges faced when testing scientific software fall into two main categories: (1) testing challenges that occur due to characteristics of scientific software such as oracle problems and (2) testing challenges that occur due to cultural differences between scientists and the software engineering community such as viewing the code and the model that it implements as inseparable entities. In addition, we identified methods to potentially overcome these challenges and their limitations. Finally we describe unsolved challenges and how software engineering researchers and practitioners can help to overcome them. Conclusions Scientific software presents special challenges for testing. Specifically, cultural differences between scientist developers and software engineers, along with the characteristics of the scientific software make testing more difficult. Existing techniques such as code clone detection can help to improve the testing process. Software engineers should consider special challenges posed by scientific software such as oracle problems when developing testing techniques. PMID:25125798

Atmospheric, Magnetospheric and Plasmas in Space (AMPS) spacelab payload definition study; volume 4: Part 2, Labcraft payload general specification

NASA Technical Reports Server (NTRS)

Keeley, J. T.

1976-01-01

The Labcraft Payload General Specification (LPGS) amplifies those general requirements in the Labcraft Program Specification (LPS) to ensure that all hardware, software, and STS elements will successfully function as an integrated system to accomplish the objectives of the first Labcraft mission. Contract End Item Specifications (CEIS) and Procurement Drawings (PDs) prepared and implemented for all deliverable hardware and software elements are discussed.

How can GPs drive software changes to improve healthcare for Aboriginal and Torres Strait Islanders peoples?

PubMed

Kehoe, Helen

2017-01-01

Changes to the software used in general practice could improve the collection of the Aboriginal and Torres Strait Islander status of all patients, and boost access to healthcare measures specifically for Aboriginal and Torres Strait Islander peoples provided directly or indirectly by general practitioners (GPs). Despite longstanding calls for improvements to general practice software to better support Aboriginal and Torres Strait Islander health, little change has been made. The aim of this article is to promote software improvements by identifying desirable software attributes and encouraging GPs to promote their adoption. Establishing strong links between collecting Aboriginal and Torres Strait Islander status, clinical decision supports, and uptake of GP-mediated health measures specifically for Aboriginal and Torres Strait Islander peoples - and embedding these links in GP software - is a long overdue reform. In the absence of government initiatives in this area, GPs are best placed to advocate for software changes, using the model described here as a starting point for action.

NASA software documentation standard software engineering program

NASA Technical Reports Server (NTRS)

1991-01-01

The NASA Software Documentation Standard (hereinafter referred to as Standard) can be applied to the documentation of all NASA software. This Standard is limited to documentation format and content requirements. It does not mandate specific management, engineering, or assurance standards or techniques. This Standard defines the format and content of documentation for software acquisition, development, and sustaining engineering. Format requirements address where information shall be recorded and content requirements address what information shall be recorded. This Standard provides a framework to allow consistency of documentation across NASA and visibility into the completeness of project documentation. This basic framework consists of four major sections (or volumes). The Management Plan contains all planning and business aspects of a software project, including engineering and assurance planning. The Product Specification contains all technical engineering information, including software requirements and design. The Assurance and Test Procedures contains all technical assurance information, including Test, Quality Assurance (QA), and Verification and Validation (V&V). The Management, Engineering, and Assurance Reports is the library and/or listing of all project reports.

Standardized development of computer software. Part 2: Standards

NASA Technical Reports Server (NTRS)

Tausworthe, R. C.

1978-01-01

This monograph contains standards for software development and engineering. The book sets forth rules for design, specification, coding, testing, documentation, and quality assurance audits of software; it also contains detailed outlines for the documentation to be produced.

Portable Medical Laboratory Applications Software

PubMed Central

Silbert, Jerome A.

1983-01-01

Portability implies that a program can be run on a variety of computers with minimal software revision. The advantages of portability are outlined and design considerations for portable laboratory software are discussed. Specific approaches for achieving this goal are presented.

Finding the Right Educational Software for Your Child.

ERIC Educational Resources Information Center

Moore, Jack

1990-01-01

Ideas are presented for identifying, evaluating, and selecting instructional software for children with special needs. The article notes several library research tools as sources of information and lists specific questions to consider when evaluating software. (JDD)

A Home Computer Primer.

ERIC Educational Resources Information Center

Stone, Antonia

1982-01-01

Provides general information on currently available microcomputers, computer programs (software), hardware requirements, software sources, costs, computer games, and programing. Includes a list of popular microcomputers, providing price category, model, list price, software (cassette, tape, disk), monitor specifications, amount of random access…

[Three-dimensional 3D modeling: First applications in radioanatomy and interventional radiology under CT guidance].

PubMed

Aubry, S; Pousse, A; Sarliève, P; Laborie, L; Delabrousse, E; Kastler, B

2006-11-01

To model vertebrae in 3D to improve radioanatomic knowledge of the spine with the vascular and nerve environment and simulate CT-guided interventions. Vertebra acquisitions were made with multidetector CT. We developed segmentation software and specific viewer software using the Delphi programming environment. This segmentation software makes it possible to model 3D high-resolution segments of vertebrae and their environment from multidetector CT acquisitions. Then the specific viewer software provides multiplanar reconstructions of the CT volume and the possibility to select different 3D objects of interest. This software package improves radiologists' radioanatomic knowledge through a new 3D anatomy presentation. Furthermore, the possibility of inserting virtual 3D objects in the volume can simulate CT-guided intervention. The first volumetric radioanatomic software has been born. Furthermore, it simulates CT-guided intervention and consequently has the potential to facilitate learning interventions using CT guidance.

Development of N-version software samples for an experiment in software fault tolerance

NASA Technical Reports Server (NTRS)

Lauterbach, L.

1987-01-01

The report documents the task planning and software development phases of an effort to obtain twenty versions of code independently designed and developed from a common specification. These versions were created for use in future experiments in software fault tolerance, in continuation of the experimental series underway at the Systems Validation Methods Branch (SVMB) at NASA Langley Research Center. The 20 versions were developed under controlled conditions at four U.S. universities, by 20 teams of two researchers each. The versions process raw data from a modified Redundant Strapped Down Inertial Measurement Unit (RSDIMU). The specifications, and over 200 questions submitted by the developers concerning the specifications, are included as appendices to this report. Design documents, and design and code walkthrough reports for each version, were also obtained in this task for use in future studies.

LogScope

NASA Technical Reports Server (NTRS)

Havelund, Klaus; Smith, Margaret H.; Barringer, Howard; Groce, Alex

2012-01-01

LogScope is a software package for analyzing log files. The intended use is for offline post-processing of such logs, after the execution of the system under test. LogScope can, however, in principle, also be used to monitor systems online during their execution. Logs are checked against requirements formulated as monitors expressed in a rule-based specification language. This language has similarities to a state machine language, but is more expressive, for example, in its handling of data parameters. The specification language is user friendly, simple, and yet expressive enough for many practical scenarios. The LogScope software was initially developed to specifically assist in testing JPL s Mars Science Laboratory (MSL) flight software, but it is very generic in nature and can be applied to any application that produces some form of logging information (which almost any software does).

Would Boys and Girls Benefit from Gender-Specific Educational Software?

ERIC Educational Resources Information Center

Luik, Piret

2011-01-01

Most boys and girls interact differently with educational software and have different preferences for the design of educational software. The question is whether the usage of educational software has the same consequences for both genders. This paper investigates the characteristics of drill-and-practice programmes or drills that are efficient for…

A Reconfigurable Simulation-Based Test System for Automatically Assessing Software Operating Skills

ERIC Educational Resources Information Center

Su, Jun-Ming; Lin, Huan-Yu

2015-01-01

In recent years, software operating skills, the ability in computer literacy to solve problems using specific software, has become much more important. A great deal of research has also proven that students' software operating skills can be efficiently improved by practicing customized virtual and simulated examinations. However, constructing…

49 CFR Appendix C to Part 236 - Safety Assurance Criteria and Processes

Code of Federal Regulations, 2010 CFR

2010-10-01

... system (all its elements including hardware and software) must be designed to assure safe operation with... unsafe errors in the software due to human error in the software specification, design, or coding phases... (hardware or software, or both) are used in combination to ensure safety. If a common mode failure exists...

The Organization of a Computer Software Collection Using an Information Storage and Retrieval Software Package.

ERIC Educational Resources Information Center

Davies, Denise M.

1985-01-01

Discusses design, development, and use of a database to provide organization and access to a computer software collection at the University of Hawaii School of Library Studies. Field specifications, samples of report forms, and a description of the physical organization of the software collection are included. (MBR)

Automated Translation of Safety Critical Application Software Specifications into PLC Ladder Logic

NASA Technical Reports Server (NTRS)

Leucht, Kurt W.; Semmel, Glenn S.

2008-01-01

The numerous benefits of automatic application code generation are widely accepted within the software engineering community. A few of these benefits include raising the abstraction level of application programming, shorter product development time, lower maintenance costs, and increased code quality and consistency. Surprisingly, code generation concepts have not yet found wide acceptance and use in the field of programmable logic controller (PLC) software development. Software engineers at the NASA Kennedy Space Center (KSC) recognized the need for PLC code generation while developing their new ground checkout and launch processing system. They developed a process and a prototype software tool that automatically translates a high-level representation or specification of safety critical application software into ladder logic that executes on a PLC. This process and tool are expected to increase the reliability of the PLC code over that which is written manually, and may even lower life-cycle costs and shorten the development schedule of the new control system at KSC. This paper examines the problem domain and discusses the process and software tool that were prototyped by the KSC software engineers.

Engineering bioinformatics: building reliability, performance and productivity into bioinformatics software.

PubMed

Lawlor, Brendan; Walsh, Paul

2015-01-01

There is a lack of software engineering skills in bioinformatic contexts. We discuss the consequences of this lack, examine existing explanations and remedies to the problem, point out their shortcomings, and propose alternatives. Previous analyses of the problem have tended to treat the use of software in scientific contexts as categorically different from the general application of software engineering in commercial settings. In contrast, we describe bioinformatic software engineering as a specialization of general software engineering, and examine how it should be practiced. Specifically, we highlight the difference between programming and software engineering, list elements of the latter and present the results of a survey of bioinformatic practitioners which quantifies the extent to which those elements are employed in bioinformatics. We propose that the ideal way to bring engineering values into research projects is to bring engineers themselves. We identify the role of Bioinformatic Engineer and describe how such a role would work within bioinformatic research teams. We conclude by recommending an educational emphasis on cross-training software engineers into life sciences, and propose research on Domain Specific Languages to facilitate collaboration between engineers and bioinformaticians.

Engineering bioinformatics: building reliability, performance and productivity into bioinformatics software

PubMed Central

Lawlor, Brendan; Walsh, Paul

2015-01-01

There is a lack of software engineering skills in bioinformatic contexts. We discuss the consequences of this lack, examine existing explanations and remedies to the problem, point out their shortcomings, and propose alternatives. Previous analyses of the problem have tended to treat the use of software in scientific contexts as categorically different from the general application of software engineering in commercial settings. In contrast, we describe bioinformatic software engineering as a specialization of general software engineering, and examine how it should be practiced. Specifically, we highlight the difference between programming and software engineering, list elements of the latter and present the results of a survey of bioinformatic practitioners which quantifies the extent to which those elements are employed in bioinformatics. We propose that the ideal way to bring engineering values into research projects is to bring engineers themselves. We identify the role of Bioinformatic Engineer and describe how such a role would work within bioinformatic research teams. We conclude by recommending an educational emphasis on cross-training software engineers into life sciences, and propose research on Domain Specific Languages to facilitate collaboration between engineers and bioinformaticians. PMID:25996054

Software Requirements Specification for Lunar IceCube

NASA Astrophysics Data System (ADS)

Glaser-Garbrick, Michael R.

Lunar IceCube is a 6U satellite that will orbit the moon to measure water volatiles as a function of position, altitude, and time, and measure in its various phases. Lunar IceCube, is a collaboration between Morehead State University, Vermont Technical University, Busek, and NASA. The Software Requirements Specification will serve as contract between the overall team and the developers of the flight software. It will provide a system's overview of the software that will be developed for Lunar IceCube, in that it will detail all of the interconnects and protocols for each subsystem's that Lunar IceCube will utilize. The flight software will be written in SPARK to the fullest extent, due to SPARK's unique ability to make software free of any errors. The LIC flight software does make use of a general purpose, reusable application framework called CubedOS. This framework imposes some structuring requirements on the architecture and design of the flight software, but it does not impose any high level requirements. It will also detail the tools that we will be using for Lunar IceCube, such as why we will be utilizing VxWorks.

A Matrix Approach to Software Process Definition

NASA Technical Reports Server (NTRS)

Schultz, David; Bachman, Judith; Landis, Linda; Stark, Mike; Godfrey, Sally; Morisio, Maurizio; Powers, Edward I. (Technical Monitor)

2000-01-01

The Software Engineering Laboratory (SEL) is currently engaged in a Methodology and Metrics program for the Information Systems Center (ISC) at Goddard Space Flight Center (GSFC). This paper addresses the Methodology portion of the program. The purpose of the Methodology effort is to assist a software team lead in selecting and tailoring a software development or maintenance process for a specific GSFC project. It is intended that this process will also be compliant with both ISO 9001 and the Software Engineering Institute's Capability Maturity Model (CMM). Under the Methodology program, we have defined four standard ISO-compliant software processes for the ISC, and three tailoring criteria that team leads can use to categorize their projects. The team lead would select a process and appropriate tailoring factors, from which a software process tailored to the specific project could be generated. Our objective in the Methodology program is to present software process information in a structured fashion, to make it easy for a team lead to characterize the type of software engineering to be performed, and to apply tailoring parameters to search for an appropriate software process description. This will enable the team lead to follow a proven, effective software process and also satisfy NASA's requirement for compliance with ISO 9001 and the anticipated requirement for CMM assessment. This work is also intended to support the deployment of sound software processes across the ISC.

Ensemble Eclipse: A Process for Prefab Development Environment for the Ensemble Project

NASA Technical Reports Server (NTRS)

Wallick, Michael N.; Mittman, David S.; Shams, Khawaja, S.; Bachmann, Andrew G.; Ludowise, Melissa

2013-01-01

This software simplifies the process of having to set up an Eclipse IDE programming environment for the members of the cross-NASA center project, Ensemble. It achieves this by assembling all the necessary add-ons and custom tools/preferences. This software is unique in that it allows developers in the Ensemble Project (approximately 20 to 40 at any time) across multiple NASA centers to set up a development environment almost instantly and work on Ensemble software. The software automatically has the source code repositories and other vital information and settings included. The Eclipse IDE is an open-source development framework. The NASA (Ensemble-specific) version of the software includes Ensemble-specific plug-ins as well as settings for the Ensemble project. This software saves developers the time and hassle of setting up a programming environment, making sure that everything is set up in the correct manner for Ensemble development. Existing software (i.e., standard Eclipse) requires an intensive setup process that is both time-consuming and error prone. This software is built once by a single user and tested, allowing other developers to simply download and use the software

End-to-end observatory software modeling using domain specific languages

NASA Astrophysics Data System (ADS)

Filgueira, José M.; Bec, Matthieu; Liu, Ning; Peng, Chien; Soto, José

2014-07-01

The Giant Magellan Telescope (GMT) is a 25-meter extremely large telescope that is being built by an international consortium of universities and research institutions. Its software and control system is being developed using a set of Domain Specific Languages (DSL) that supports a model driven development methodology integrated with an Agile management process. This approach promotes the use of standardized models that capture the component architecture of the system, that facilitate the construction of technical specifications in a uniform way, that facilitate communication between developers and domain experts and that provide a framework to ensure the successful integration of the software subsystems developed by the GMT partner institutions.

Software for aerospace education: A bibliography, 2nd edition

NASA Technical Reports Server (NTRS)

Vogt, Gregory L.; Roth, Susan Kies; Phelps, Malcom V.

1990-01-01

This is the second aerospace education software bibliography to be published by the NASA Educational Technology Branch in Washington, DC. Unlike many software bibliographies, this bibliography does not evaluate and grade software according to its quality and value to the classroom, nor does it make any endorsements or warrant scientific accuracy. Rather, it describes software, its subject, approach, and technical details. This bibliography is intended as a convenience to educators. The specific software included represents replies to more than 300 queries to software producers for aerospace education programs.

1986 Petroleum Software Directory. [800 mini, micro and mainframe computer software packages

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

1985-01-01

Pennwell's 1986 Petroleum Software Directory is a complete listing of software created specifically for the petroleum industry. Details are provided on over 800 mini, micro and mainframe computer software packages from more than 250 different companies. An accountant can locate programs to automate bookkeeping functions in large oil and gas production firms. A pipeline engineer will find programs designed to calculate line flow and wellbore pressure drop.

Consolidated Cab Display (CCD) System, Project Planning Document (PPD),

DTIC Science & Technology

1981-02-01

1980 1981 I 2 3 4 5 6 7 8 9 10 1112 1 2 3 4 5 6 7 8 9 1011112 1 2 31 12. Software Documentation a. Overall Computer Program Description ( OCPD ) b...Approve OCPD c. Computer Program Functional Specifications (CPFS) d. Data Base Table Design Specification (DBTDS) e. Software Interface Control Document...Parts List Master Pattern and Plan View Reproducible Drawings Instruction Book Training Aids/Materials b. Software: OCPD CPFS SI CD PDS DBTDS SDD

Software Design for Real-Time Systems on Parallel Computers: Formal Specifications.

DTIC Science & Technology

1996-04-01

This research investigated the important issues related to the analysis and design of real - time systems targeted to parallel architectures. In...particular, the software specification models for real - time systems on parallel architectures were evaluated. A survey of current formal methods for...uniprocessor real - time systems specifications was conducted to determine their extensibility in specifying real - time systems on parallel architectures. In

SAGA: A project to automate the management of software production systems

NASA Technical Reports Server (NTRS)

Campbell, R. H.; Badger, W.; Beckman, C. S.; Beshers, G.; Hammerslag, D.; Kimball, J.; Kirslis, P. A.; Render, H.; Richards, P.; Terwilliger, R.

1984-01-01

The project to automate the management of software production systems is described. The SAGA system is a software environment that is designed to support most of the software development activities that occur in a software lifecycle. The system can be configured to support specific software development applications using given programming languages, tools, and methodologies. Meta-tools are provided to ease configuration. Several major components of the SAGA system are completed to prototype form. The construction methods are described.

TOPEX Software Document Series. Volume 5; Rev. 1; TOPEX GDR Processing

NASA Technical Reports Server (NTRS)

Lee, Jeffrey; Lockwood, Dennis; Hancock, David W., III

2003-01-01

This document is a compendium of the WFF TOPEX Software Development Team's knowledge regarding Geophysical Data Record (GDR) Processing. It includes many elements of a requirements document, a software specification document, a software design document, and a user's manual. In the more technical sections, this document assumes the reader is familiar with TOPEX and instrument files.

Learning Theories Applied to Teaching Technology: Constructivism versus Behavioral Theory for Instructing Multimedia Software Programs

ERIC Educational Resources Information Center

Reed, Cajah S.

2012-01-01

This study sought to find evidence for a beneficial learning theory to teach computer software programs. Additionally, software was analyzed for each learning theory's applicability to resolve whether certain software requires a specific method of education. The results are meant to give educators more effective teaching tools, so students…

Evaluating Business Intelligence/Business Analytics Software for Use in the Information Systems Curriculum

ERIC Educational Resources Information Center

Davis, Gary Alan; Woratschek, Charles R.

2015-01-01

Business Intelligence (BI) and Business Analytics (BA) Software has been included in many Information Systems (IS) curricula. This study surveyed current and past undergraduate and graduate students to evaluate various BI/BA tools. Specifically, this study compared several software tools from two of the major software providers in the BI/BA field.…

Microcomputer Software for Libraries: A Survey.

ERIC Educational Resources Information Center

Nolan, Jeanne M.

1983-01-01

Reports on findings of research done by Nolan Information Management Services concerning availability of microcomputer software for libraries. Highlights include software categories (specific, generic-database management programs, original); number of programs available in 1982 for 12 applications; projections for 1983; and future software…

Microcomputer Software Packages--Choose with Caution.

ERIC Educational Resources Information Center

Naumer, Janet Noll

1983-01-01

Briefly discusses types of software available for library and media center operations and library instruction, suggests three sources of software reviews, and describes almost 50 specific application programs available for bibliographic management, cataloging, circulation, inventory and purchasing, readability, and teaching library skills in…

Learning from Software Localization.

ERIC Educational Resources Information Center

Guo, She-Sen

2003-01-01

Localization is the process of adapting a product to meet the language, cultural and other requirements of a specific target environment or market. This article describes ways in which software localization impacts upon curriculum, and discusses what students will learn from software localization. (AEF)

Computer-Aided Software Engineering - An approach to real-time software development

NASA Technical Reports Server (NTRS)

Walker, Carrie K.; Turkovich, John J.

1989-01-01

A new software engineering discipline is Computer-Aided Software Engineering (CASE), a technology aimed at automating the software development process. This paper explores the development of CASE technology, particularly in the area of real-time/scientific/engineering software, and a history of CASE is given. The proposed software development environment for the Advanced Launch System (ALS CASE) is described as an example of an advanced software development system for real-time/scientific/engineering (RT/SE) software. The Automated Programming Subsystem of ALS CASE automatically generates executable code and corresponding documentation from a suitably formatted specification of the software requirements. Software requirements are interactively specified in the form of engineering block diagrams. Several demonstrations of the Automated Programming Subsystem are discussed.

Specificity of software cooperating with an optoelectronic sensor in the pulse oximeter system

NASA Astrophysics Data System (ADS)

Cysewska-Sobusiak, Anna; Wiczynski, Grzegorz; Jedwabny, Tomasz

1995-06-01

Specificity of a software package composed of two parts which control an optoelectronic sensor of the computer-aided system made to realize the noninvasive measurements of the arterial blood oxygen saturation as well as some parameters of the peripheral pulse waveform, has been described. Principles of the transmission variant of the one and only noninvasive measurement method, so-called pulse oximetry, has been utilized. The software co-ordinates the suitable cooperation of an IBM PC compatible microcomputer with the sensor and one specialized card. This novel card is a key part of the whole measuring system which some application fields are extended in comparison to pulse oximeters commonly attainable. The user-friendly MS Windows graphical environment which creates the system to be multitask and non-preemptive, has been used to design the specific part of the programming presented here. With this environment, sophisticated tasks of the software package can be performed without excessive complication.

Contribution of Electronic Medical Records to the Management of Rare Diseases.

PubMed

Bremond-Gignac, Dominique; Lewandowski, Elisabeth; Copin, Henri

2015-01-01

Electronic health record systems provide great opportunity to study most diseases. Objective of this study was to determine whether electronic medical records (EMR) in ophthalmology contribute to management of rare eye diseases, isolated or in syndromes. Study was designed to identify and collect patients' data with ophthalmology-specific EMR. Ophthalmology-specific EMR software (Softalmo software Corilus) was used to acquire ophthalmological ocular consultation data from patients with five rare eye diseases. The rare eye diseases and data were selected and collected regarding expertise of eye center. A total of 135,206 outpatient consultations were performed between 2011 and 2014 in our medical center specialized in rare eye diseases. The search software identified 29 congenital aniridia, 6 Axenfeld/Rieger syndrome, 11 BEPS, 3 Nanophthalmos, and 3 Rubinstein-Taybi syndrome. EMR provides advantages for medical care. The use of ophthalmology-specific EMR is reliable and can contribute to a comprehensive ocular visual phenotype useful for clinical research. Routinely EMR acquired with specific software dedicated to ophthalmology provides sufficient detail for rare diseases. These software-collected data appear useful for creating patient cohorts and recording ocular examination, avoiding the time-consuming analysis of paper records and investigation, in a University Hospital linked to a National Reference Rare Center Disease.

Contribution of Electronic Medical Records to the Management of Rare Diseases

PubMed Central

Bremond-Gignac, Dominique; Lewandowski, Elisabeth; Copin, Henri

2015-01-01

Purpose. Electronic health record systems provide great opportunity to study most diseases. Objective of this study was to determine whether electronic medical records (EMR) in ophthalmology contribute to management of rare eye diseases, isolated or in syndromes. Study was designed to identify and collect patients' data with ophthalmology-specific EMR. Methods. Ophthalmology-specific EMR software (Softalmo software Corilus) was used to acquire ophthalmological ocular consultation data from patients with five rare eye diseases. The rare eye diseases and data were selected and collected regarding expertise of eye center. Results. A total of 135,206 outpatient consultations were performed between 2011 and 2014 in our medical center specialized in rare eye diseases. The search software identified 29 congenital aniridia, 6 Axenfeld/Rieger syndrome, 11 BEPS, 3 Nanophthalmos, and 3 Rubinstein-Taybi syndrome. Discussion. EMR provides advantages for medical care. The use of ophthalmology-specific EMR is reliable and can contribute to a comprehensive ocular visual phenotype useful for clinical research. Conclusion. Routinely EMR acquired with specific software dedicated to ophthalmology provides sufficient detail for rare diseases. These software-collected data appear useful for creating patient cohorts and recording ocular examination, avoiding the time-consuming analysis of paper records and investigation, in a University Hospital linked to a National Reference Rare Center Disease. PMID:26539543

A software methodology for compiling quantum programs

NASA Astrophysics Data System (ADS)

Häner, Thomas; Steiger, Damian S.; Svore, Krysta; Troyer, Matthias

2018-04-01

Quantum computers promise to transform our notions of computation by offering a completely new paradigm. To achieve scalable quantum computation, optimizing compilers and a corresponding software design flow will be essential. We present a software architecture for compiling quantum programs from a high-level language program to hardware-specific instructions. We describe the necessary layers of abstraction and their differences and similarities to classical layers of a computer-aided design flow. For each layer of the stack, we discuss the underlying methods for compilation and optimization. Our software methodology facilitates more rapid innovation among quantum algorithm designers, quantum hardware engineers, and experimentalists. It enables scalable compilation of complex quantum algorithms and can be targeted to any specific quantum hardware implementation.

Library-Specific Microcomputer Software.

ERIC Educational Resources Information Center

Levert, Virginia M.

1985-01-01

Discusses number and type of microcomputer software programs useful to libraries and types of hardware on which they run, as identified by Nolan Information Management Services. Highlights include general application programs, applications designed to support library technical processes, producers of library software, and choosing among options.…

MathBrowser: Web-Enabled Mathematical Software with Application to the Chemistry Curriculum, v 1.0

NASA Astrophysics Data System (ADS)

Goldsmith, Jack G.

1997-10-01

MathSoft: Cambridge, MA, 1996; free via ftp from www.mathsoft.com. The movement to provide computer-based applications in chemistry has come to focus on three main areas: software aimed at specific applications (drawing, simulation, data analysis, etc.), multimedia applications designed to assist in the presentation of conceptual information, and packages to be used in conjunction with a particular textbook at a specific point in the chemistry curriculum. The result is a situation where no single software package devoted to problem solving can be used across a large segment of the curriculum. Adoption of World Wide Web (WWW) technology by a manufacturer of mathematical software, however, has produced software that provides an attractive means of providing a problem-solving resource to students in courses from freshman through senior level.

The Knowledge-Based Software Assistant: Beyond CASE

NASA Technical Reports Server (NTRS)

Carozzoni, Joseph A.

1993-01-01

This paper will outline the similarities and differences between two paradigms of software development. Both support the whole software life cycle and provide automation for most of the software development process, but have different approaches. The CASE approach is based on a set of tools linked by a central data repository. This tool-based approach is data driven and views software development as a series of sequential steps, each resulting in a product. The Knowledge-Based Software Assistant (KBSA) approach, a radical departure from existing software development practices, is knowledge driven and centers around a formalized software development process. KBSA views software development as an incremental, iterative, and evolutionary process with development occurring at the specification level.

Generic Kalman Filter Software

NASA Technical Reports Server (NTRS)

Lisano, Michael E., II; Crues, Edwin Z.

2005-01-01

The Generic Kalman Filter (GKF) software provides a standard basis for the development of application-specific Kalman-filter programs. Historically, Kalman filters have been implemented by customized programs that must be written, coded, and debugged anew for each unique application, then tested and tuned with simulated or actual measurement data. Total development times for typical Kalman-filter application programs have ranged from months to weeks. The GKF software can simplify the development process and reduce the development time by eliminating the need to re-create the fundamental implementation of the Kalman filter for each new application. The GKF software is written in the ANSI C programming language. It contains a generic Kalman-filter-development directory that, in turn, contains a code for a generic Kalman filter function; more specifically, it contains a generically designed and generically coded implementation of linear, linearized, and extended Kalman filtering algorithms, including algorithms for state- and covariance-update and -propagation functions. The mathematical theory that underlies the algorithms is well known and has been reported extensively in the open technical literature. Also contained in the directory are a header file that defines generic Kalman-filter data structures and prototype functions and template versions of application-specific subfunction and calling navigation/estimation routine code and headers. Once the user has provided a calling routine and the required application-specific subfunctions, the application-specific Kalman-filter software can be compiled and executed immediately. During execution, the generic Kalman-filter function is called from a higher-level navigation or estimation routine that preprocesses measurement data and post-processes output data. The generic Kalman-filter function uses the aforementioned data structures and five implementation- specific subfunctions, which have been developed by the user on the basis of the aforementioned templates. The GKF software can be used to develop many different types of unfactorized Kalman filters. A developer can choose to implement either a linearized or an extended Kalman filter algorithm, without having to modify the GKF software. Control dynamics can be taken into account or neglected in the filter-dynamics model. Filter programs developed by use of the GKF software can be made to propagate equations of motion for linear or nonlinear dynamical systems that are deterministic or stochastic. In addition, filter programs can be made to operate in user-selectable "covariance analysis" and "propagation-only" modes that are useful in design and development stages.

Software Dependability and Safety Evaluations ESA's Initiative

NASA Astrophysics Data System (ADS)

Hernek, M.

ESA has allocated funds for an initiative to evaluate Dependability and Safety methods of Software. The objectives of this initiative are; · More extensive validation of Safety and Dependability techniques for Software · Provide valuable results to improve the quality of the Software thus promoting the application of Dependability and Safety methods and techniques. ESA space systems are being developed according to defined PA requirement specifications. These requirements may be implemented through various design concepts, e.g. redundancy, diversity etc. varying from project to project. Analysis methods (FMECA. FTA, HA, etc) are frequently used during requirements analysis and design activities to assure the correct implementation of system PA requirements. The criticality level of failures, functions and systems is determined and by doing that the critical sub-systems are identified, on which dependability and safety techniques are to be applied during development. Proper performance of the software development requires the development of a technical specification for the products at the beginning of the life cycle. Such technical specification comprises both functional and non-functional requirements. These non-functional requirements address characteristics of the product such as quality, dependability, safety and maintainability. Software in space systems is more and more used in critical functions. Also the trend towards more frequent use of COTS and reusable components pose new difficulties in terms of assuring reliable and safe systems. Because of this, its dependability and safety must be carefully analysed. ESA identified and documented techniques, methods and procedures to ensure that software dependability and safety requirements are specified and taken into account during the design and development of a software system and to verify/validate that the implemented software systems comply with these requirements [R1].

WFF TOPEX Software Documentation Altimeter Instrument File (AIF) Processing, October 1998. Volume 3

NASA Technical Reports Server (NTRS)

Lee, Jeffrey; Lockwood, Dennis

2003-01-01

This document is a compendium of the WFF TOPEX Software Development Team's knowledge regarding Sensor Data Record (SDR) Processing. It includes many elements of a requirements document, a software specification document, a software design document, and a user's manual. In the more technical sections, this document assumes the reader is familiar with TOPEX and instrument files.

Dose Estimating Application Software Modification: Additional Function of a Size-Specific Effective Dose Calculator and Auto Exposure Control.

PubMed

Kobayashi, Masanao; Asada, Yasuki; Matsubara, Kosuke; Suzuki, Shouichi; Matsunaga, Yuta; Haba, Tomonobu; Kawaguchi, Ai; Daioku, Tomihiko; Toyama, Hiroshi; Kato, Ryoichi

2017-05-01

Adequate dose management during computed tomography is important. In the present study, the dosimetric application software ImPACT was added to a functional calculator of the size-specific dose estimate and was part of the scan settings for the auto exposure control (AEC) technique. This study aimed to assess the practicality and accuracy of the modified ImPACT software for dose estimation. We compared the conversion factors identified by the software with the values reported by the American Association of Physicists in Medicine Task Group 204, and we noted similar results. Moreover, doses were calculated with the AEC technique and a fixed-tube current of 200 mA for the chest-pelvis region. The modified ImPACT software could estimate each organ dose, which was based on the modulated tube current. The ability to perform beneficial modifications indicates the flexibility of the ImPACT software. The ImPACT software can be further modified for estimation of other doses. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

NASA Software Documentation Standard

NASA Technical Reports Server (NTRS)

1991-01-01

The NASA Software Documentation Standard (hereinafter referred to as "Standard") is designed to support the documentation of all software developed for NASA; its goal is to provide a framework and model for recording the essential information needed throughout the development life cycle and maintenance of a software system. The NASA Software Documentation Standard can be applied to the documentation of all NASA software. The Standard is limited to documentation format and content requirements. It does not mandate specific management, engineering, or assurance standards or techniques. This Standard defines the format and content of documentation for software acquisition, development, and sustaining engineering. Format requirements address where information shall be recorded and content requirements address what information shall be recorded. This Standard provides a framework to allow consistency of documentation across NASA and visibility into the completeness of project documentation. The basic framework consists of four major sections (or volumes). The Management Plan contains all planning and business aspects of a software project, including engineering and assurance planning. The Product Specification contains all technical engineering information, including software requirements and design. The Assurance and Test Procedures contains all technical assurance information, including Test, Quality Assurance (QA), and Verification and Validation (V&V). The Management, Engineering, and Assurance Reports is the library and/or listing of all project reports.

Integrating MPI and deduplication engines: a software architecture roadmap.

PubMed

Baksi, Dibyendu

2009-03-01

The objective of this paper is to clarify the major concepts related to architecture and design of patient identity management software systems so that an implementor looking to solve a specific integration problem in the context of a Master Patient Index (MPI) and a deduplication engine can address the relevant issues. The ideas presented are illustrated in the context of a reference use case from Integrating the Health Enterprise Patient Identifier Cross-referencing (IHE PIX) profile. Sound software engineering principles using the latest design paradigm of model driven architecture (MDA) are applied to define different views of the architecture. The main contribution of the paper is a clear software architecture roadmap for implementors of patient identity management systems. Conceptual design in terms of static and dynamic views of the interfaces is provided as an example of platform independent model. This makes the roadmap applicable to any specific solutions of MPI, deduplication library or software platform. Stakeholders in need of integration of MPIs and deduplication engines can evaluate vendor specific solutions and software platform technologies in terms of fundamental concepts and can make informed decisions that preserve investment. This also allows freedom from vendor lock-in and the ability to kick-start integration efforts based on a solid architecture.

Teaching meta-analysis using MetaLight.

PubMed

Thomas, James; Graziosi, Sergio; Higgins, Steve; Coe, Robert; Torgerson, Carole; Newman, Mark

2012-10-18

Meta-analysis is a statistical method for combining the results of primary studies. It is often used in systematic reviews and is increasingly a method and topic that appears in student dissertations. MetaLight is a freely available software application that runs simple meta-analyses and contains specific functionality to facilitate the teaching and learning of meta-analysis. While there are many courses and resources for meta-analysis available and numerous software applications to run meta-analyses, there are few pieces of software which are aimed specifically at helping those teaching and learning meta-analysis. Valuable teaching time can be spent learning the mechanics of a new software application, rather than on the principles and practices of meta-analysis. We discuss ways in which the MetaLight tool can be used to present some of the main issues involved in undertaking and interpreting a meta-analysis. While there are many software tools available for conducting meta-analysis, in the context of a teaching programme such software can require expenditure both in terms of money and in terms of the time it takes to learn how to use it. MetaLight was developed specifically as a tool to facilitate the teaching and learning of meta-analysis and we have presented here some of the ways it might be used in a training situation.

36 CFR 1235.50 - What specifications and standards for transfer apply to electronic records?

Code of Federal Regulations, 2012 CFR

2012-07-01

... electronic records in a format that is independent of specific hardware or software. Except as specified in... a request from NARA to provide the software to decompress the records. (3) Agencies interested in... organization. Acceptable transfer formats include the Geography Markup Language (GML) as defined by the Open...

The Interactive Classroom: An Overview of Smart Notebook Software

ERIC Educational Resources Information Center

Nichols, Bryan E.

2015-01-01

Interactive whiteboards are increasingly used in school classrooms. SMART Boards have been adopted in many schools, including music classes taught by specialists. This article provides specific tips for using the most popular whiteboard application. The main features of the software as well as specific strategies for maximizing their use in the…

Assistive Software for Disabled Learners

ERIC Educational Resources Information Center

Clark, Sharon; Baggaley, Jon

2004-01-01

Previous reports in this series (#32 and 36) have discussed online software features of value to disabled learners in distance education. The current report evaluates four specific assistive software products with useful features for visually and hearing impaired learners: "ATutor", "ACollab", "Natural Voice", and "Just Vanilla". The evaluative…

Application and Implications of Agent Technology for Librarians.

ERIC Educational Resources Information Center

Nardi, Bonnie A.; O'Day, Vicki L.

1998-01-01

Examines intelligent software agents, presents nine design principles aimed specifically at the technology perspective (to personalize task performance and general principles), and discusses what librarians can do that software agents (agents defined as activity-aware software programs) cannot do. Describes an information ecology that integrates…

Framework for Development of Object-Oriented Software

NASA Technical Reports Server (NTRS)

Perez-Poveda, Gus; Ciavarella, Tony; Nieten, Dan

2004-01-01

The Real-Time Control (RTC) Application Framework is a high-level software framework written in C++ that supports the rapid design and implementation of object-oriented application programs. This framework provides built-in functionality that solves common software development problems within distributed client-server, multi-threaded, and embedded programming environments. When using the RTC Framework to develop software for a specific domain, designers and implementers can focus entirely on the details of the domain-specific software rather than on creating custom solutions, utilities, and frameworks for the complexities of the programming environment. The RTC Framework was originally developed as part of a Space Shuttle Launch Processing System (LPS) replacement project called Checkout and Launch Control System (CLCS). As a result of the framework s development, CLCS software development time was reduced by 66 percent. The framework is generic enough for developing applications outside of the launch-processing system domain. Other applicable high-level domains include command and control systems and simulation/ training systems.

Software as a service approach to sensor simulation software deployment

NASA Astrophysics Data System (ADS)

Webster, Steven; Miller, Gordon; Mayott, Gregory

2012-05-01

Traditionally, military simulation has been problem domain specific. Executing an exercise currently requires multiple simulation software providers to specialize, deploy, and configure their respective implementations, integrate the collection of software to achieve a specific system behavior, and then execute for the purpose at hand. This approach leads to rigid system integrations which require simulation expertise for each deployment due to changes in location, hardware, and software. Our alternative is Software as a Service (SaaS) predicated on the virtualization of Night Vision Electronic Sensors (NVESD) sensor simulations as an exemplary case. Management middleware elements layer self provisioning, configuration, and integration services onto the virtualized sensors to present a system of services at run time. Given an Infrastructure as a Service (IaaS) environment, enabled and managed system of simulations yields a durable SaaS delivery without requiring user simulation expertise. Persistent SaaS simulations would provide on demand availability to connected users, decrease integration costs and timelines, and benefit the domain community from immediate deployment of lessons learned.

The embedded software life cycle - An expanded view

NASA Technical Reports Server (NTRS)

Larman, Brian T.; Loesh, Robert E.

1989-01-01

Six common issues that are encountered in the development of software for embedded computer systems are discussed from the perspective of their interrelationships with the development process and/or the system itself. Particular attention is given to concurrent hardware/software development, prototyping, the inaccessibility of the operational system, fault tolerance, the long life cycle, and inheritance. It is noted that the life cycle for embedded software must include elements beyond simply the specification and implementation of the target software.

V&V Within Reuse-Based Software Engineering

NASA Technical Reports Server (NTRS)

Addy, Edward A.

1996-01-01

Verification and Validation (V&V) is used to increase the level of assurance of critical software, particularly that of safety-critical and mission-critical software. V&V is a systems engineering discipline that evaluates the software in a systems context, and is currently applied during the development of a specific application system. In order to bring the effectiveness of V&V to bear within reuse-based software engineering, V&V must be incorporated within the domain engineering process.

Software engineering project management - A state-of-the-art report

NASA Technical Reports Server (NTRS)

Thayer, R. H.; Lehman, J. H.

1977-01-01

The management of software engineering projects in the aerospace industry was investigated. The survey assessed such features as contract type, specification preparation techniques, software documentation required by customers, planning and cost-estimating, quality control, the use of advanced program practices, software tools and test procedures, the education levels of project managers, programmers and analysts, work assignment, automatic software monitoring capabilities, design and coding reviews, production times, success rates, and organizational structure of the projects.

Production of Reliable Flight Crucial Software: Validation Methods Research for Fault Tolerant Avionics and Control Systems Sub-Working Group Meeting

NASA Technical Reports Server (NTRS)

Dunham, J. R. (Editor); Knight, J. C. (Editor)

1982-01-01

The state of the art in the production of crucial software for flight control applications was addressed. The association between reliability metrics and software is considered. Thirteen software development projects are discussed. A short term need for research in the areas of tool development and software fault tolerance was indicated. For the long term, research in format verification or proof methods was recommended. Formal specification and software reliability modeling, were recommended as topics for both short and long term research.

Using PATIMDB to Create Bacterial Transposon Insertion Mutant Libraries

PubMed Central

Urbach, Jonathan M.; Wei, Tao; Liberati, Nicole; Grenfell-Lee, Daniel; Villanueva, Jacinto; Wu, Gang; Ausubel, Frederick M.

2015-01-01

PATIMDB is a software package for facilitating the generation of transposon mutant insertion libraries. The software has two main functions: process tracking and automated sequence analysis. The process tracking function specifically includes recording the status and fates of multiwell plates and samples in various stages of library construction. Automated sequence analysis refers specifically to the pipeline of sequence analysis starting with ABI files from a sequencing facility and ending with insertion location identifications. The protocols in this unit describe installation and use of PATIMDB software. PMID:19343706

Software Configuration Management Guidebook

NASA Technical Reports Server (NTRS)

1995-01-01

The growth in cost and importance of software to NASA has caused NASA to address the improvement of software development across the agency. One of the products of this program is a series of guidebooks that define a NASA concept of the assurance processes which are used in software development. The Software Assurance Guidebook, SMAP-GB-A201, issued in September, 1989, provides an overall picture of the concepts and practices of NASA in software assurance. Lower level guidebooks focus on specific activities that fall within the software assurance discipline, and provide more detailed information for the manager and/or practitioner. This is the Software Configuration Management Guidebook which describes software configuration management in a way that is compatible with practices in industry and at NASA Centers. Software configuration management is a key software development process, and is essential for doing software assurance.

Process Acceptance and Adoption by IT Software Project Practitioners

ERIC Educational Resources Information Center

Guardado, Deana R.

2012-01-01

This study addresses the question of what factors determine acceptance and adoption of processes in the context of Information Technology (IT) software development projects. This specific context was selected because processes required for managing software development projects are less prescriptive than in other, more straightforward, IT…

Microcomputers: Software Evaluation. Evaluation Guides. Guide Number 17.

ERIC Educational Resources Information Center

Gray, Peter J.

This guide discusses three critical steps in selecting microcomputer software and hardware: setting the context, software evaluation, and managing microcomputer use. Specific topics addressed include: (1) conducting an informal task analysis to determine how the potential user's time is spent; (2) identifying tasks amenable to computerization and…

FRAMES-2.0 Software System: Frames 2.0 Pest Integration (F2PEST)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Castleton, Karl J.; Meyer, Philip D.

2009-06-17

The implementation of the FRAMES 2.0 F2PEST module is described, including requirements, design, and specifications of the software. This module integrates the PEST parameter estimation software within the FRAMES 2.0 environmental modeling framework. A test case is presented.

15 CFR Supplement No. 6 to Part 742 - Technical Questionnaire for Encryption Items

Code of Federal Regulations, 2012 CFR

2012-01-01

... software, provide the following information: (1) Description of all the symmetric and asymmetric encryption... third-party hardware or software encryption components (if any). Identify the manufacturers of the hardware or software components, including specific part numbers and version information as needed to...

15 CFR Supplement No. 6 to Part 742 - Technical Questionnaire for Encryption Items

Code of Federal Regulations, 2013 CFR

2013-01-01

... software, provide the following information: (1) Description of all the symmetric and asymmetric encryption... third-party hardware or software encryption components (if any). Identify the manufacturers of the hardware or software components, including specific part numbers and version information as needed to...

15 CFR Supplement No. 6 to Part 742 - Technical Questionnaire for Encryption Items

Code of Federal Regulations, 2014 CFR

2014-01-01

... software, provide the following information: (1) Description of all the symmetric and asymmetric encryption... third-party hardware or software encryption components (if any). Identify the manufacturers of the hardware or software components, including specific part numbers and version information as needed to...

Computer Software for Intelligent Systems.

ERIC Educational Resources Information Center

Lenat, Douglas B.

1984-01-01

Discusses the development and nature of computer software for intelligent systems, indicating that the key to intelligent problem-solving lies in reducing the random search for solutions. Formal reasoning methods, expert systems, and sources of power in problem-solving are among the areas considered. Specific examples of such software are…

Evaluating Math Drill and Practice Programs.

ERIC Educational Resources Information Center

Schnorr, Janice M.; Semmel, Dorothy S.

1986-01-01

General guidelines for a process evaluation of software for a specific subject and grade include: (1) Specify instructional objectives and list desired software program characteristics; (2) Access and review descriptions of programs (information sources for math programs are listed); (3) Preview software; and (4) Compare and make purchase…

Seven Steps to Responsible Software Selection. ERIC Digest.

ERIC Educational Resources Information Center

Komoski, P. Kenneth; Plotnick, Eric

Microcomputers in schools contribute significantly to the learning process, and software selection is taken as seriously as the selection of text books. The seven step process for responsible software selection are: (1) analyzing needs, including the differentiation between needs and objectives; (2) specification of requirements; (3) identifying…

A second generation experiment in fault-tolerant software

NASA Technical Reports Server (NTRS)

Knight, J. C.

1986-01-01

The primary goal was to determine whether the application of fault tolerance to software increases its reliability if the cost of production is the same as for an equivalent nonfault tolerance version derived from the same requirements specification. Software development protocols are discussed. The feasibility of adapting to software design fault tolerance the technique of N-fold Modular Redundancy with majority voting was studied.

Evaluation of the Red Blood Cell Advanced Software Application on the CellaVision DM96.

PubMed

Criel, M; Godefroid, M; Deckers, B; Devos, H; Cauwelier, B; Emmerechts, J

2016-08-01

The CellaVision Advanced Red Blood Cell (RBC) Software Application is a new software for advanced morphological analysis of RBCs on a digital microscopy system. Upon automated precharacterization into 21 categories, the software offers the possibility of reclassification of RBCs by the operator. We aimed to define the optimal cut-off to detect morphological RBC abnormalities and to evaluate the precharacterization performance of this software. Thirty-eight blood samples of healthy donors and sixty-eight samples of hospitalized patients were analyzed. Different methodologies to define a cut-off between negativity and positivity were used. Sensitivity and specificity were calculated according to these different cut-offs using the manual microscopic method as the gold standard. Imprecision was assessed by measuring analytical within-run and between-run variability and by measuring between-observer variability. By optimizing the cut-off between negativity and positivity, sensitivities exceeded 80% for 'critical' RBC categories (target cells, tear drop cells, spherocytes, sickle cells, and parasites), while specificities exceeded 80% for the other RBC morphological categories. Results of within-run, between-run, and between-observer variabilities were all clinically acceptable. The CellaVision Advanced RBC Software Application is an easy-to-use software that helps to detect most RBC morphological abnormalities in a sensitive and specific way without increasing work load, provided the proper cut-offs are chosen. However, evaluation of the images by an experienced observer remains necessary. © 2016 John Wiley & Sons Ltd.

Software Architecture Evaluation in Global Software Development Projects

NASA Astrophysics Data System (ADS)

Salger, Frank

Due to ever increasing system complexity, comprehensive methods for software architecture evaluation become more and more important. This is further stressed in global software development (GSD), where the software architecture acts as a central knowledge and coordination mechanism. However, existing methods for architecture evaluation do not take characteristics of GSD into account. In this paper we discuss what aspects are specific for architecture evaluations in GSD. Our experiences from GSD projects at Capgemini sd&m indicate, that architecture evaluations differ in how rigorously one has to assess modularization, architecturally relevant processes, knowledge transfer and process alignment. From our project experiences, we derive nine good practices, the compliance to which should be checked in architecture evaluations in GSD. As an example, we discuss how far the standard architecture evaluation method used at Capgemini sd&m already considers the GSD-specific good practices, and outline what extensions are necessary to achieve a comprehensive architecture evaluation framework for GSD.

Software Quality Assurance Audits Guidebooks

NASA Technical Reports Server (NTRS)

1990-01-01

The growth in cost and importance of software to NASA has caused NASA to address the improvement of software development across the agency. One of the products of this program is a series of guidebooks that define a NASA concept of the assurance processes that are used in software development. The Software Assurance Guidebook, NASA-GB-A201, issued in September, 1989, provides an overall picture of the NASA concepts and practices in software assurance. Second level guidebooks focus on specific activities that fall within the software assurance discipline, and provide more detailed information for the manager and/or practitioner. This is the second level Software Quality Assurance Audits Guidebook that describes software quality assurance audits in a way that is compatible with practices at NASA Centers.

Luigi Gentile Polese | NREL

Science.gov Websites

software development of next-generation whole-building energy modeling, analysis, and simulation tools technical positions in networking protocol specifications, call control software, and requirements

An Improved Suite of Object Oriented Software Measures

NASA Technical Reports Server (NTRS)

Neal, Ralph D.; Weistroffer, H. Roland; Coppins, Richard J.

1997-01-01

In the pursuit of ever increasing productivity, the need to be able to measure specific aspects of software is generally agreed upon. As object oriented programming languages are becoming more and more widely used, metrics specifically designed for object oriented software are required. In recent years there has been an explosion of new, object oriented software metrics proposed in the literature. Unfortunately, many or most of these proposed metrics have not been validated to measure what they claim to measure. In fact, an analysis of many of these metrics shows that they do not satisfy basic properties of measurement theory, and thus their application has to be suspect. In this paper ten improved metrics are proposed and are validated using measurement theory.

Lessons learned applying CASE methods/tools to Ada software development projects

NASA Technical Reports Server (NTRS)

Blumberg, Maurice H.; Randall, Richard L.

1993-01-01

This paper describes the lessons learned from introducing CASE methods/tools into organizations and applying them to actual Ada software development projects. This paper will be useful to any organization planning to introduce a software engineering environment (SEE) or evolving an existing one. It contains management level lessons learned, as well as lessons learned in using specific SEE tools/methods. The experiences presented are from Alpha Test projects established under the STARS (Software Technology for Adaptable and Reliable Systems) project. They reflect the front end efforts by those projects to understand the tools/methods, initial experiences in their introduction and use, and later experiences in the use of specific tools/methods and the introduction of new ones.

Verrucostoma, a new genus in the bionectriaceae from the Bonin Islands, Japan.

PubMed

Hirooka, Yuuri; Kobayashi, Takao; Ono, Tsuyoshi; Rossman, Amy Y; Chaverri, Priscila

2010-01-01

Verrucostoma freycinetiae gen. et sp. nov. is described and illustrated from specimens on dead leaves of Freycinetia boninensis (Pandanaceae) collected in Hahajima, Bonin (Ogasawara) Islands, Japan. The genus is characterized by pale orange perithecia with protuberances around the perithecial apex, no color change in 3% potassium hydroxide and lactic acid, unitunicate asci, spinulose ascospores and an Acremonium-like anamorph. Morphological characters were compared with other genera in the Bionectriaceae and Nectriaceae (Hypocreales). Verrucostoma is morphologically similar to Bionectria (Bionectriaceae) from which it differs in the formation of conspicuous protuberances around the perithecial apex and the Acremonium-like anamorph. Moreover molecular analyses of Verrucostoma and other members of the Bionectriaceae and Nectriaceae based on alpha-actin, large subunit nuclear ribosomal DNA and RNA polymerase II subunit 1 sequences support the conclusions based on morphological data. Our results confirm that V. freycinetiae is distinct from other genera among the Nectria-like fungi and represents a new genus belonging to the Bionectriaceae.

Evolutionary Dynamics of Spore Killers

PubMed Central

Nauta, M. J.; Hoekstra, R. F.

1993-01-01

Spore killing in ascomycetes is a special form of segregation distortion. When a strain with the Killer genotype is crossed to a Sensitive type, spore killing is expressed by asci with only half the number of ascospores as usual, all surviving ascospores being of the Killer type. Using population genetic modeling, this paper explores conditions for invasion of Spore killers and for polymorphism of Killers, Sensitives and Resistants (which neither kill, nor get killed), as found in natural populations. The models show that a population with only Killers and Sensitives can never be stable. The invasion of Killers and stable polymorphism only occur if Killers have some additional advantage during the process of spore killing. This may be due to the effects of local sib competition or some kind of ``heterozygous'' advantage in the stage of ascospore formation or in the short diploid stage of the life cycle. This form of segregation distortion appears to be essentially different from other, well-investigated forms, and more field data are needed for a better understanding of spore killing. PMID:8293989

Osteomyelitis caused by Neosartorya pseudofischeri.

PubMed Central

Padhye, A A; Godfrey, J H; Chandler, F W; Peterson, S W

1994-01-01

The first case of osteomyelitis caused by Neosartorya pseudofischeri is reported. The patient, a 77-year-old male with a history of silicosis and tuberculosis, on X-ray examination revealed lytic lesions of L2 and L3 vertebrae suspicious for metastatic lesions. Histologic examination of biopsy specimens from vertebral bodies showed short, distorted, extra- and intracellular, hyaline hyphal fragments. The culture from the biopsy tissue produced numerous, evanescent asci containing eight ellipsoidal ascospores with two distinctive equatorial bands ca. 1 micron wide. When examined by a scanning electron microscope, ascospores exhibited a convex surface ornamented with raised flaps of tissue, in shape resembling triangular projections or long ridge lines. The conidial state (anamorph) was identified as Aspergillus thermomutatus on the basis of conidial columns which were smaller and less tightly packed as well as of a lighter shade of green than those observed in Aspergillus fumigatus. On the basis of the morphologic features of the ascospores, the teleomorph was identified as N. pseudofischeri. Images PMID:7852580

Establishing confidence in complex physics codes: Art or science?

DOE Office of Scientific and Technical Information (OSTI.GOV)

Trucano, T.

1997-12-31

The ALEGRA shock wave physics code, currently under development at Sandia National Laboratories and partially supported by the US Advanced Strategic Computing Initiative (ASCI), is generic to a certain class of physics codes: large, multi-application, intended to support a broad user community on the latest generation of massively parallel supercomputer, and in a continual state of formal development. To say that the author has ``confidence`` in the results of ALEGRA is to say something different than that he believes that ALEGRA is ``predictive.`` It is the purpose of this talk to illustrate the distinction between these two concepts. The authormore » elects to perform this task in a somewhat historical manner. He will summarize certain older approaches to code validation. He views these methods as aiming to establish the predictive behavior of the code. These methods are distinguished by their emphasis on local information. He will conclude that these approaches are more art than science.« less

UPEML Version 2. 0: A machine-portable CDC Update emulator

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mehlhorn, T.A.; Young, M.F.

1987-05-01

UPEML is a machine-portable CDC Update emulation program. UPEML is written in ANSI standard Fortran-77 and is relatively simple and compact. It is capable of emulating a significant subset of the standard CDC Update functions, including program library creation and subsequent modification. Machine-portability is an essential attribute of UPEML. UPEML was written primarily to facilitate the use of CDC-based scientific packages on alternate computer systems such as the VAX 11/780 and the IBM 3081. UPEML has also been successfully used on the multiprocessor ELXSI, on CRAYs under both COS and CTSS operating systems, on APOLLO workstations, and on the HP-9000.more » Version 2.0 includes enhanced error checking, full ASCI character support, a program library audit capability, and a partial update option in which only selected or modified decks are written to the compile file. Further enhancements include checks for overlapping corrections, processing of nested calls to common decks, and reads and addfiles from alternate input files.« less

Cloning and expression of two chitin deacetylase genes of Saccharomyces cerevisiae.

PubMed

Mishra, C; Semino, C E; McCreath, K J; de la Vega, H; Jones, B J; Specht, C A; Robbins, P W

1997-03-30

Chitin deacetylase (EC 3.5.1.41), which hydrolyses the N-acetamido groups of N-acetyl-D-glucosamine residues in chitin, has been demonstrated in crude extracts from sporulating Saccharomyces cerevisiae. Two S. cerevisiae open reading frames (ORFs), identified by the Yeast Genome Project, have protein sequence homology to a chitin deacetylase from Mucor rouxii. Northern blot hybridizations show each ORF was transcribed in diploid cells after transfer to sporulation medium and prior to formation of asci. Each ORF was cloned in a vector under transcriptional control of the GAL 1, 10 promoter and introduced back into haploid strains of S. cerevisiae. Chitin deacetylase activity was detected by in vitro assays from vegetative cells grown in galactose. Chemical analysis of these cells also demonstrated the synthesis of chitosam in vivo. Both recombinant chitin deacetylases showed similar qualitative and quantitative activities toward chitooligosaccharides in vitro. A diploid strain deleted to both ORFs, when sporulated, did not show deacetylase activity. The mutant spores were hypersensitive to lytic enzymes (Glusulase or Zymolyase).

Chromosome mechanics of fungi under spaceflight conditions--tetrad analysis of two-factor crosses between spore color mutants of Sordaria macrospora.

PubMed

Hahn, A; Hock, B

1999-01-01

Spore color mutants of the fungus Sordaria macrospora Auersw. were crossed under spaceflight conditions on the space shuttle to MIR mission S/MM 05 (STS-81). The arrangement of spores of different colors in the asci allowed conclusions on the influence of spaceflight conditions on sexual recombination in fungi. Experiments on a 1-g centrifuge in space and in parallel on the ground were used for controls. The samples were analyzed microscopically on their return to earth. Each fruiting body was assessed separately. Statistical analysis of the data showed a significant increase in gene recombination frequencies caused by the heavy ion particle stream in space radiation. The lack of gravity did not influence crossing-over frequencies. Hyphae of the flown samples were assessed for DNA strand breaks. No increase in damage was found compared with the ground samples. It was shown that S. macrospora is able to repair radiation-induced DNA strand breaks within hours.

Genetic Recombination at the Buff Spore Color Locus in SORDARIA BREVICOLLIS. II. Analysis of Flanking Marker Behavior in Crosses between Buff Mutants.

PubMed

Sang, H; Whitehouse, H L

1983-02-01

Aberrant asci containing one or more wild-type spores were selected from crosses between pairs of alleles of the buff locus in the presence of closely linked flanking markers. Data were obtained relating to the site of aberrant segregation and the position of any associated crossover giving recombination of flanking markers. Aberrant segregation at a proximal site within the buff gene may be associated with a crossover proximal to the site of aberrant segregation or, with equal frequency, with a crossover distal to the site of the second mutant present in the cross. Similarly, segregation at a distal site may be associated with a crossover distal to the site or, with lower frequency, with a crossover proximal to the site of the proximal mutant present in the cross. Crossovers between the alleles were rare. This evidence for the relationship between hybrid DNA and crossing over is discussed in terms of current models for the mechanism of recombination.

Isolation of total RNA from yeast cell cultures.

PubMed

Ares, Manuel

2012-10-01

This article describes two procedures for isolating total RNA from yeast cell cultures. The first allows the convenient isolation of total RNA from early log-phase cultures (vegetative cells). RNA isolated in this way is intact and sufficiently pure for use in microarray experiments, primer extension, and RNase protection mapping. With additional treatment to remove contaminating genomic DNA, the preparation is suitable for reverse transcription-polymerase chain reaction (RT-PCR), quantitative PCR (qPCR), cDNA library construction, high-throughput sequencing of RNA, or other manipulations. However, compared to vegetative cells, the isolation of RNA from cells late in meiosis (asci and ascospores) requires additional effort. This is because a tough cell wall composed of heavily cross-linked polysaccharides and proteins is built around the four spores during meiosis and ascospore development. Therefore, an alternative protocol is presented for extracting RNA from cells late in meiosis. This alternative may also be preferable for cells from stationary cultures or from yeast strains and other fungal species isolated from the environment.

Proposing an Evidence-Based Strategy for Software Requirements Engineering.

PubMed

Lindoerfer, Doris; Mansmann, Ulrich

2016-01-01

This paper discusses an evidence-based approach to software requirements engineering. The approach is called evidence-based, since it uses publications on the specific problem as a surrogate for stakeholder interests, to formulate risks and testing experiences. This complements the idea that agile software development models are more relevant, in which requirements and solutions evolve through collaboration between self-organizing cross-functional teams. The strategy is exemplified and applied to the development of a Software Requirements list used to develop software systems for patient registries.

Effects of Using Requirements Catalogs on Effectiveness and Productivity of Requirements Specification in a Software Project Management Course

ERIC Educational Resources Information Center

Fernández-Alemán, José Luis; Carrillo-de-Gea, Juan Manuel; Meca, Joaquín Vidal; Ros, Joaquín Nicolás; Toval, Ambrosio; Idri, Ali

2016-01-01

This paper presents the results of two educational experiments carried out to determine whether the process of specifying requirements (catalog-based reuse as opposed to conventional specification) has an impact on effectiveness and productivity in co-located and distributed software development environments. The participants in the experiments…

Tailoring Software for Multiple Processor Systems

DTIC Science & Technology

1982-10-01

resource management decisions . Despite the lack of programming support, the use of multiple processor systems has grown sub- -stantially. Software has...making resource management decisions . Specifically, program- 1 mers need not allocate specific hardware resources to individual program components...Instead, such allocation decisions are automatically made based on high-level resource directives stated by ap- plication programmers, where each directive

Automatic programming of simulation models

NASA Technical Reports Server (NTRS)

Schroer, Bernard J.; Tseng, Fan T.; Zhang, Shou X.; Dwan, Wen S.

1990-01-01

The concepts of software engineering were used to improve the simulation modeling environment. Emphasis was placed on the application of an element of rapid prototyping, or automatic programming, to assist the modeler define the problem specification. Then, once the problem specification has been defined, an automatic code generator is used to write the simulation code. The following two domains were selected for evaluating the concepts of software engineering for discrete event simulation: manufacturing domain and a spacecraft countdown network sequence. The specific tasks were to: (1) define the software requirements for a graphical user interface to the Automatic Manufacturing Programming System (AMPS) system; (2) develop a graphical user interface for AMPS; and (3) compare the AMPS graphical interface with the AMPS interactive user interface.

Multidisciplinary and Active/Collaborative Approaches in Teaching Requirements Engineering

ERIC Educational Resources Information Center

Rosca, Daniela

2005-01-01

The requirements engineering course is a core component of the curriculum for the Master's in Software Engineering programme, at Monmouth University (MU). It covers the process, methods and tools specific to this area, together with the corresponding software quality issues. The need to produce software engineers with strong teamwork and…

Computer Activities for College Algebra and Precalculus.

ERIC Educational Resources Information Center

White, Jacci Wozniak; Norwich, Vicki Howard

Mathematics software can be a great aid in understanding difficult mathematics concepts at all levels. This paper presents nine exercises on calculus concepts by using different software used in mathematics education. Each exercise includes instruction on how to use software in order to highlight a specific concept in mathematics. This paper also…

A Call for Bioimaging Software Usability

PubMed Central

Carpenter, Anne E.; Kamentsky, Lee; Eliceiri, Kevin W.

2013-01-01

Bioimaging software developed in a research setting often fails to be widely used by the scientific community. We suggest that, to maximize both the public’s and researchers’ investments, usability should be a more highly valued goal. We describe specific characteristics of usability towards which bioimaging software projects should aim. PMID:22743771

Methods and Software for Building Bibliographic Data Bases.

ERIC Educational Resources Information Center

Daehn, Ralph M.

1985-01-01

This in-depth look at database management systems (DBMS) for microcomputers covers data entry, information retrieval, security, DBMS software and design, and downloading of literature search results. The advantages of in-house systems versus online search vendors are discussed, and specifications of three software packages and 14 sources are…

15 CFR Supplement No. 6 to Part 742 - Guidelines for Submitting Review Requests for Encryption Items

Code of Federal Regulations, 2010 CFR

2010-01-01

... brochures or other documentation or specifications related to the technology, commodity or software... commodity or software, provide the following information: (1) Description of all the symmetric and... is provided by third-party hardware or software encryption components (if any). Identify the...

Analysis of Five Instructional Methods for Teaching Sketchpad to Junior High Students

ERIC Educational Resources Information Center

Wright, Geoffrey; Shumway, Steve; Terry, Ronald; Bartholomew, Scott

2012-01-01

This manuscript addresses a problem teachers of computer software applications face today: What is an effective method for teaching new computer software? Technology and engineering teachers, specifically those with communications and other related courses that involve computer software applications, face this problem when teaching computer…

75 FR 10997 - Cuban Assets Control Regulations; Sudanese Sanctions Regulations; Iranian Transactions Regulations

Federal Register 2010, 2011, 2012, 2013, 2014

2010-03-10

... Iranian Transactions Regulations to authorize the exportation of certain services and software incident to... authorize the exportation to persons in Sudan and Iran, respectively, of certain services and software... specific license, or otherwise exempt, the exportation of such services and software from the United States...

42 CFR 495.360 - Software and ownership rights.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 42 Public Health 5 2010-10-01 2010-10-01 false Software and ownership rights. 495.360 Section 495.360 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES... PROGRAM Requirements Specific to the Medicaid Program § 495.360 Software and ownership rights. (a) General...

Supporting Source Code Comprehension during Software Evolution and Maintenance

ERIC Educational Resources Information Center

Alhindawi, Nouh

2013-01-01

This dissertation addresses the problems of program comprehension to support the evolution of large-scale software systems. The research concerns how software engineers locate features and concepts along with categorizing changes within very large bodies of source code along with their versioned histories. More specifically, advanced Information…

An Overview of Software for Conducting Dimensionality Assessment in Multidimensional Models

ERIC Educational Resources Information Center

Svetina, Dubravka; Levy, Roy

2012-01-01

An overview of popular software packages for conducting dimensionality assessment in multidimensional models is presented. Specifically, five popular software packages are described in terms of their capabilities to conduct dimensionality assessment with respect to the nature of analysis (exploratory or confirmatory), types of data (dichotomous,…

Scalability Assessments for the Malicious Activity Simulation Tool (MAST)

DTIC Science & Technology

2012-09-01

the scalability characteristics of MAST. Specifically, we show that an exponential increase in clients using the MAST software does not impact...an exponential increase in clients using the MAST software does not impact network and system resources significantly. Additionally, we...31 1. Hardware .....................................31 2. Software .....................................32 3. Common PC

Initiating Formal Requirements Specifications with Object-Oriented Models

NASA Technical Reports Server (NTRS)

Ampo, Yoko; Lutz, Robyn R.

1994-01-01

This paper reports results of an investigation into the suitability of object-oriented models as an initial step in developing formal specifications. The requirements for two critical system-level software modules were used as target applications. It was found that creating object-oriented diagrams prior to formally specifying the requirements enhanced the accuracy of the initial formal specifications and reduced the effort required to produce them. However, the formal specifications incorporated some information not found in the object-oriented diagrams, such as higher-level strategy or goals of the software.

Automating software design system DESTA

NASA Technical Reports Server (NTRS)

Lovitsky, Vladimir A.; Pearce, Patricia D.

1992-01-01

'DESTA' is the acronym for the Dialogue Evolutionary Synthesizer of Turnkey Algorithms by means of a natural language (Russian or English) functional specification of algorithms or software being developed. DESTA represents the computer-aided and/or automatic artificial intelligence 'forgiving' system which provides users with software tools support for algorithm and/or structured program development. The DESTA system is intended to provide support for the higher levels and earlier stages of engineering design of software in contrast to conventional Computer Aided Design (CAD) systems which provide low level tools for use at a stage when the major planning and structuring decisions have already been taken. DESTA is a knowledge-intensive system. The main features of the knowledge are procedures, functions, modules, operating system commands, batch files, their natural language specifications, and their interlinks. The specific domain for the DESTA system is a high level programming language like Turbo Pascal 6.0. The DESTA system is operational and runs on an IBM PC computer.

Annotated bibliography of Software Engineering Laboratory literature

NASA Technical Reports Server (NTRS)

1985-01-01

An annotated bibliography of technical papers, documents, and memorandums produced by or related to the Software Engineering Laboratory is presented. More than 100 publications are summarized. These publications are summarized. These publications cover many areas of software engineering and range from research reports to software documentation. This document has been updated and reorganized substantially since the original version (SEL-82-006, November 1982). All materials are grouped into five general subject areas for easy reference: (1) the software engineering laboratory; (2) software tools; (3) models and measures; (4) technology evaluations; and (5) data collection. An index further classifies these documents by specific topic.

Performing Verification and Validation in Reuse-Based Software Engineering

NASA Technical Reports Server (NTRS)

Addy, Edward A.

1999-01-01

The implementation of reuse-based software engineering not only introduces new activities to the software development process, such as domain analysis and domain modeling, it also impacts other aspects of software engineering. Other areas of software engineering that are affected include Configuration Management, Testing, Quality Control, and Verification and Validation (V&V). Activities in each of these areas must be adapted to address the entire domain or product line rather than a specific application system. This paper discusses changes and enhancements to the V&V process, in order to adapt V&V to reuse-based software engineering.

Application of NX Siemens PLM software in educational process in preparing students of engineering branch

NASA Astrophysics Data System (ADS)

Sadchikova, G. M.

2017-01-01

This article discusses the results of the introduction of computer-aided design NX by Siemens Plm Software to the classes of a higher education institution. The necessity of application of modern information technologies in teaching students of engineering profile and selection of a software product is substantiated. The author describes stages of the software module study in relation to some specific courses, considers the features of NX software, which require the creation of standard and unified product databases. The article also gives examples of research carried out by the students with the various software modules.

Software for integrated manufacturing systems, part 2

NASA Technical Reports Server (NTRS)

Volz, R. A.; Naylor, A. W.

1987-01-01

Part 1 presented an overview of the unified approach to manufacturing software. The specific characteristics of the approach that allow it to realize the goals of reduced cost, increased reliability and increased flexibility are considered. Why the blending of a components view, distributed languages, generics and formal models is important, why each individual part of this approach is essential, and why each component will typically have each of these parts are examined. An example of a specification for a real material handling system is presented using the approach and compared with the standard interface specification given by the manufacturer. Use of the component in a distributed manufacturing system is then compared with use of the traditional specification with a more traditional approach to designing the system. An overview is also provided of the underlying mechanisms used for implementing distributed manufacturing systems using the unified software/hardware component approach.

Choosing a software design method for real-time Ada applications: JSD process inversion as a means to tailor a design specification to the performance requirements and target machine

NASA Technical Reports Server (NTRS)

Withey, James V.

1986-01-01

The validity of real-time software is determined by its ability to execute on a computer within the time constraints of the physical system it is modeling. In many applications the time constraints are so critical that the details of process scheduling are elevated to the requirements analysis phase of the software development cycle. It is not uncommon to find specifications for a real-time cyclic executive program included to assumed in such requirements. It was found that prelininary designs structured around this implementation abscure the data flow of the real world system that is modeled and that it is consequently difficult and costly to maintain, update and reuse the resulting software. A cyclic executive is a software component that schedules and implicitly synchronizes the real-time software through periodic and repetitive subroutine calls. Therefore a design method is sought that allows the deferral of process scheduling to the later stages of design. The appropriate scheduling paradigm must be chosen given the performance constraints, the largest environment and the software's lifecycle. The concept of process inversion is explored with respect to the cyclic executive.

System and method for deriving a process-based specification

NASA Technical Reports Server (NTRS)

Hinchey, Michael Gerard (Inventor); Rouff, Christopher A. (Inventor); Rash, James Larry (Inventor)

2009-01-01

A system and method for deriving a process-based specification for a system is disclosed. The process-based specification is mathematically inferred from a trace-based specification. The trace-based specification is derived from a non-empty set of traces or natural language scenarios. The process-based specification is mathematically equivalent to the trace-based specification. Code is generated, if applicable, from the process-based specification. A process, or phases of a process, using the features disclosed can be reversed and repeated to allow for an interactive development and modification of legacy systems. The process is applicable to any class of system, including, but not limited to, biological and physical systems, electrical and electro-mechanical systems in addition to software, hardware and hybrid hardware-software systems.

Application of Artificial Intelligence technology to the analysis and synthesis of reliable software systems

NASA Technical Reports Server (NTRS)

Wild, Christian; Eckhardt, Dave

1987-01-01

The development of a methodology for the production of highly reliable software is one of the greatest challenges facing the computer industry. Meeting this challenge will undoubtably involve the integration of many technologies. This paper describes the use of Artificial Intelligence technologies in the automated analysis of the formal algebraic specifications of abstract data types. These technologies include symbolic execution of specifications using techniques of automated deduction and machine learning through the use of examples. On-going research into the role of knowledge representation and problem solving in the process of developing software is also discussed.

Incubator Display Software Cost Reduction Toolset Software Requirements Specification

NASA Technical Reports Server (NTRS)

Moran, Susanne; Jeffords, Ralph

2005-01-01

The Incubator Display Software Requirements Specification was initially developed by Intrinsyx Technologies Corporation (Intrinsyx) under subcontract to Lockheed Martin, Contract Number NAS2-02090, for the National Aeronautics and Space Administration (NASA) Ames Research Center (ARC) Space Station Biological Research Project (SSBRP). The Incubator Display is a User Payload Application (UPA) used to control an Incubator subrack payload for the SSBRP. The Incubator Display functions on-orbit as part of the subrack payload laptop, on the ground as part of the Communication and Data System (CDS) ground control system, and also as part of the crew training environment.

Challenges and Demands on Automated Software Revision

NASA Technical Reports Server (NTRS)

Bonakdarpour, Borzoo; Kulkarni, Sandeep S.

2008-01-01

In the past three decades, automated program verification has undoubtedly been one of the most successful contributions of formal methods to software development. However, when verification of a program against a logical specification discovers bugs in the program, manual manipulation of the program is needed in order to repair it. Thus, in the face of existence of numerous unverified and un- certified legacy software in virtually any organization, tools that enable engineers to automatically verify and subsequently fix existing programs are highly desirable. In addition, since requirements of software systems often evolve during the software life cycle, the issue of incomplete specification has become a customary fact in many design and development teams. Thus, automated techniques that revise existing programs according to new specifications are of great assistance to designers, developers, and maintenance engineers. As a result, incorporating program synthesis techniques where an algorithm generates a program, that is correct-by-construction, seems to be a necessity. The notion of manual program repair described above turns out to be even more complex when programs are integrated with large collections of sensors and actuators in hostile physical environments in the so-called cyber-physical systems. When such systems are safety/mission- critical (e.g., in avionics systems), it is essential that the system reacts to physical events such as faults, delays, signals, attacks, etc, so that the system specification is not violated. In fact, since it is impossible to anticipate all possible such physical events at design time, it is highly desirable to have automated techniques that revise programs with respect to newly identified physical events according to the system specification.

Statistical software applications used in health services research: analysis of published studies in the U.S

PubMed Central

2011-01-01

Background This study aims to identify the statistical software applications most commonly employed for data analysis in health services research (HSR) studies in the U.S. The study also examines the extent to which information describing the specific analytical software utilized is provided in published articles reporting on HSR studies. Methods Data were extracted from a sample of 1,139 articles (including 877 original research articles) published between 2007 and 2009 in three U.S. HSR journals, that were considered to be representative of the field based upon a set of selection criteria. Descriptive analyses were conducted to categorize patterns in statistical software usage in those articles. The data were stratified by calendar year to detect trends in software use over time. Results Only 61.0% of original research articles in prominent U.S. HSR journals identified the particular type of statistical software application used for data analysis. Stata and SAS were overwhelmingly the most commonly used software applications employed (in 46.0% and 42.6% of articles respectively). However, SAS use grew considerably during the study period compared to other applications. Stratification of the data revealed that the type of statistical software used varied considerably by whether authors were from the U.S. or from other countries. Conclusions The findings highlight a need for HSR investigators to identify more consistently the specific analytical software used in their studies. Knowing that information can be important, because different software packages might produce varying results, owing to differences in the software's underlying estimation methods. PMID:21977990

Information Technology and the Human Research Facility

NASA Technical Reports Server (NTRS)

Klee, Margaret

2002-01-01

This slide presentation reviews how information technology supports the Human Research Facility (HRF) and specifically the uses that contractor has for the information. There is information about the contractor, the HRF, some of the experiments that were performed using the HRF on board the Shuttle, overviews of the data architecture, and software both commercial and specially developed software for the specific experiments.

Health care professional workstation: software system construction using DSSA scenario-based engineering process.

PubMed

Hufnagel, S; Harbison, K; Silva, J; Mettala, E

1994-01-01

This paper describes a new method for the evolutionary determination of user requirements and system specifications called scenario-based engineering process (SEP). Health care professional workstations are critical components of large scale health care system architectures. We suggest that domain-specific software architectures (DSSAs) be used to specify standard interfaces and protocols for reusable software components throughout those architectures, including workstations. We encourage the use of engineering principles and abstraction mechanisms. Engineering principles are flexible guidelines, adaptable to particular situations. Abstraction mechanisms are simplifications for management of complexity. We recommend object-oriented design principles, graphical structural specifications, and formal components' behavioral specifications. We give an ambulatory care scenario and associated models to demonstrate SEP. The scenario uses health care terminology and gives patients' and health care providers' system views. Our goal is to have a threefold benefit. (i) Scenario view abstractions provide consistent interdisciplinary communications. (ii) Hierarchical object-oriented structures provide useful abstractions for reuse, understandability, and long term evolution. (iii) SEP and health care DSSA integration into computer aided software engineering (CASE) environments. These environments should support rapid construction and certification of individualized systems, from reuse libraries.

Product Descriptions: Database Software for Science. A MicroSIFT Quarterly Report.

ERIC Educational Resources Information Center

Batey, Anne; And Others

Specific programs and software resources are described in this report on database software for science instruction. Materials are reviewed in the categories of: (1) database management (reviewing AppleWorks, Bank Street School Filer, FileVision, Friendly Filer, MECC DataQuest: The Composer, Scholastic PFS:File, PFS:Report); (2) data files…

Software measurement guidebook

NASA Technical Reports Server (NTRS)

Bassman, Mitchell J.; Mcgarry, Frank; Pajerski, Rose

1994-01-01

This software Measurement Guidebook presents information on the purpose and importance of measurement. It discusses the specific procedures and activities of a measurement program and the roles of the people involved. The guidebook also clarifies the roles that measurement can and must play in the goal of continual, sustained improvement for all software production and maintenance efforts.

An Ontology for Software Engineering Education

ERIC Educational Resources Information Center

Ling, Thong Chee; Jusoh, Yusmadi Yah; Adbullah, Rusli; Alwi, Nor Hayati

2013-01-01

Software agents communicate using ontology. It is important to build an ontology for specific domain such as Software Engineering Education. Building an ontology from scratch is not only hard, but also incur much time and cost. This study aims to propose an ontology through adaptation of the existing ontology which is originally built based on a…

76 FR 36919 - Proof of Concept Demonstration for Electronic Reporting of Clean Water Act Compliance Monitoring...

Federal Register 2010, 2011, 2012, 2013, 2014

2011-06-23

... commercial products or services of any third-party software providers. Proof of Concept Demonstration for..., protocols, and specifications for the Exchange Network's data exchange services, the software provider shall... demonstration will focus the electronic transmission of NPDES DMRs from a third-party commercial software...

TOPEX SDR Processing, October 1998. Volume 4

NASA Technical Reports Server (NTRS)

Lee, Jeffrey E.; Lockwood, Dennis W.

2003-01-01

This document is a compendium of the WFF TOPEX Software Development Team's knowledge regarding Sensor Data Record (SDR) Processing. It includes many elements of a requirements document, a software specification document, a software design document, and a user's manual. In the more technical sections, this document assumes the reader is familiar with TOPEX and instrument files.

Integrated Systems Health Management (ISHM) Toolkit

NASA Technical Reports Server (NTRS)

Venkatesh, Meera; Kapadia, Ravi; Walker, Mark; Wilkins, Kim

2013-01-01

A framework of software components has been implemented to facilitate the development of ISHM systems according to a methodology based on Reliability Centered Maintenance (RCM). This framework is collectively referred to as the Toolkit and was developed using General Atomics' Health MAP (TM) technology. The toolkit is intended to provide assistance to software developers of mission-critical system health monitoring applications in the specification, implementation, configuration, and deployment of such applications. In addition to software tools designed to facilitate these objectives, the toolkit also provides direction to software developers in accordance with an ISHM specification and development methodology. The development tools are based on an RCM approach for the development of ISHM systems. This approach focuses on defining, detecting, and predicting the likelihood of system functional failures and their undesirable consequences.

FermiLib v0.1

DOE Office of Scientific and Technical Information (OSTI.GOV)

MCCLEAN, JARROD; HANER, THOMAS; STEIGER, DAMIAN

FermiLib is an open source software package designed to facilitate the development and testing of algorithms for simulations of fermionic systems on quantum computers. Fermionic simulations represent an important application of early quantum devices with a lot of potential high value targets, such as quantum chemistry for the development of new catalysts. This software strives to provide a link between the required domain expertise in specific fermionic applications and quantum computing to enable more users to directly interface with, and develop for, these applications. It is an extensible Python library designed to interface with the high performance quantum simulator, ProjectQ,more » as well as application specific software such as PSI4 from the domain of quantum chemistry. Such software is key to enabling effective user facilities in quantum computation research.« less

Applications of Formal Methods to Specification and Safety of Avionics Software

NASA Technical Reports Server (NTRS)

Hoover, D. N.; Guaspari, David; Humenn, Polar

1996-01-01

This report treats several topics in applications of formal methods to avionics software development. Most of these topics concern decision tables, an orderly, easy-to-understand format for formally specifying complex choices among alternative courses of action. The topics relating to decision tables include: generalizations fo decision tables that are more concise and support the use of decision tables in a refinement-based formal software development process; a formalism for systems of decision tables with behaviors; an exposition of Parnas tables for users of decision tables; and test coverage criteria and decision tables. We outline features of a revised version of ORA's decision table tool, Tablewise, which will support many of the new ideas described in this report. We also survey formal safety analysis of specifications and software.

Keeping an Eye on the Prize

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hazi, A U

2007-02-06

Setting performance goals is part of the business plan for almost every company. The same is true in the world of supercomputers. Ten years ago, the Department of Energy (DOE) launched the Accelerated Strategic Computing Initiative (ASCI) to help ensure the safety and reliability of the nation's nuclear weapons stockpile without nuclear testing. ASCI, which is now called the Advanced Simulation and Computing (ASC) Program and is managed by DOE's National Nuclear Security Administration (NNSA), set an initial 10-year goal to obtain computers that could process up to 100 trillion floating-point operations per second (teraflops). Many computer experts thought themore » goal was overly ambitious, but the program's results have proved them wrong. Last November, a Livermore-IBM team received the 2005 Gordon Bell Prize for achieving more than 100 teraflops while modeling the pressure-induced solidification of molten metal. The prestigious prize, which is named for a founding father of supercomputing, is awarded each year at the Supercomputing Conference to innovators who advance high-performance computing. Recipients for the 2005 prize included six Livermore scientists--physicists Fred Streitz, James Glosli, and Mehul Patel and computer scientists Bor Chan, Robert Yates, and Bronis de Supinski--as well as IBM researchers James Sexton and John Gunnels. This team produced the first atomic-scale model of metal solidification from the liquid phase with results that were independent of system size. The record-setting calculation used Livermore's domain decomposition molecular-dynamics (ddcMD) code running on BlueGene/L, a supercomputer developed by IBM in partnership with the ASC Program. BlueGene/L reached 280.6 teraflops on the Linpack benchmark, the industry standard used to measure computing speed. As a result, it ranks first on the list of Top500 Supercomputer Sites released in November 2005. To evaluate the performance of nuclear weapons systems, scientists must understand how materials behave under extreme conditions. Because experiments at high pressures and temperatures are often difficult or impossible to conduct, scientists rely on computer models that have been validated with obtainable data. Of particular interest to weapons scientists is the solidification of metals. ''To predict the performance of aging nuclear weapons, we need detailed information on a material's phase transitions'', says Streitz, who leads the Livermore-IBM team. For example, scientists want to know what happens to a metal as it changes from molten liquid to a solid and how that transition affects the material's characteristics, such as its strength.« less

Quantitative Measures for Software Independent Verification and Validation

NASA Technical Reports Server (NTRS)

Lee, Alice

1996-01-01

As software is maintained or reused, it undergoes an evolution which tends to increase the overall complexity of the code. To understand the effects of this, we brought in statistics experts and leading researchers in software complexity, reliability, and their interrelationships. These experts' project has resulted in our ability to statistically correlate specific code complexity attributes, in orthogonal domains, to errors found over time in the HAL/S flight software which flies in the Space Shuttle. Although only a prototype-tools experiment, the result of this research appears to be extendable to all other NASA software, given appropriate data similar to that logged for the Shuttle onboard software. Our research has demonstrated that a more complete domain coverage can be mathematically demonstrated with the approach we have applied, thereby ensuring full insight into the cause-and-effects relationship between the complexity of a software system and the fault density of that system. By applying the operational profile we can characterize the dynamic effects of software path complexity under this same approach We now have the ability to measure specific attributes which have been statistically demonstrated to correlate to increased error probability, and to know which actions to take, for each complexity domain. Shuttle software verifiers can now monitor the changes in the software complexity, assess the added or decreased risk of software faults in modified code, and determine necessary corrections. The reports, tool documentation, user's guides, and new approach that have resulted from this research effort represent advances in the state of the art of software quality and reliability assurance. Details describing how to apply this technique to other NASA code are contained in this document.

An empirical study of software design practices

NASA Technical Reports Server (NTRS)

Card, David N.; Church, Victor E.; Agresti, William W.

1986-01-01

Software engineers have developed a large body of software design theory and folklore, much of which was never validated. The results of an empirical study of software design practices in one specific environment are presented. The practices examined affect module size, module strength, data coupling, descendant span, unreferenced variables, and software reuse. Measures characteristic of these practices were extracted from 887 FORTRAN modules developed for five flight dynamics software projects monitored by the Software Engineering Laboratory (SEL). The relationship of these measures to cost and fault rate was analyzed using a contingency table procedure. The results show that some recommended design practices, despite their intuitive appeal, are ineffective in this environment, whereas others are very effective.

Analyzing Software Requirements Errors in Safety-Critical, Embedded Systems

NASA Technical Reports Server (NTRS)

Lutz, Robyn R.

1993-01-01

This paper analyzes the root causes of safety-related software errors in safety-critical, embedded systems. The results show that software errors identified as potentially hazardous to the system tend to be produced by different error mechanisms than non- safety-related software errors. Safety-related software errors are shown to arise most commonly from (1) discrepancies between the documented requirements specifications and the requirements needed for correct functioning of the system and (2) misunderstandings of the software's interface with the rest of the system. The paper uses these results to identify methods by which requirements errors can be prevented. The goal is to reduce safety-related software errors and to enhance the safety of complex, embedded systems.

Property-Based Software Engineering Measurement

NASA Technical Reports Server (NTRS)

Briand, Lionel; Morasca, Sandro; Basili, Victor R.

1995-01-01

Little theory exists in the field of software system measurement. Concepts such as complexity, coupling, cohesion or even size are very often subject to interpretation and appear to have inconsistent definitions in the literature. As a consequence, there is little guidance provided to the analyst attempting to define proper measures for specific problems. Many controversies in the literature are simply misunderstandings and stem from the fact that some people talk about different measurement concepts under the same label (complexity is the most common case). There is a need to define unambiguously the most important measurement concepts used in the measurement of software products. One way of doing so is to define precisely what mathematical properties characterize these concepts regardless of the specific software artifacts to which these concepts are applied. Such a mathematical framework could generate a consensus in the software engineering community and provide a means for better communication among researchers, better guidelines for analysis, and better evaluation methods for commercial static analyzers for practitioners. In this paper, we propose a mathematical framework which is generic, because it is not specific to any particular software artifact, and rigorous, because it is based on precise mathematical concepts. This framework defines several important measurement concepts (size, length, complexity, cohesion, coupling). It is not intended to be complete or fully objective; other frameworks could have been proposed and different choices could have been made. However, we believe that the formalism and properties we introduce are convenient and intuitive. In addition, we have reviewed the literature on this subject and compared it with our work. This framework contributes constructively to a firmer theoretical ground of software measurement.

Property-Based Software Engineering Measurement

NASA Technical Reports Server (NTRS)

Briand, Lionel C.; Morasca, Sandro; Basili, Victor R.

1997-01-01

Little theory exists in the field of software system measurement. Concepts such as complexity, coupling, cohesion or even size are very often subject to interpretation and appear to have inconsistent definitions in the literature. As a consequence, there is little guidance provided to the analyst attempting to define proper measures for specific problems. Many controversies in the literature are simply misunderstandings and stem from the fact that some people talk about different measurement concepts under the same label (complexity is the most common case). There is a need to define unambiguously the most important measurement concepts used in the measurement of software products. One way of doing so is to define precisely what mathematical properties characterize these concepts, regardless of the specific software artifacts to which these concepts are applied. Such a mathematical framework could generate a consensus in the software engineering community and provide a means for better communication among researchers, better guidelines for analysts, and better evaluation methods for commercial static analyzers for practitioners. In this paper, we propose a mathematical framework which is generic, because it is not specific to any particular software artifact and rigorous, because it is based on precise mathematical concepts. We use this framework to propose definitions of several important measurement concepts (size, length, complexity, cohesion, coupling). It does not intend to be complete or fully objective; other frameworks could have been proposed and different choices could have been made. However, we believe that the formalisms and properties we introduce are convenient and intuitive. This framework contributes constructively to a firmer theoretical ground of software measurement.

Using neural networks in software repositories

NASA Technical Reports Server (NTRS)

Eichmann, David (Editor); Srinivas, Kankanahalli; Boetticher, G.

1992-01-01

The first topic is an exploration of the use of neural network techniques to improve the effectiveness of retrieval in software repositories. The second topic relates to a series of experiments conducted to evaluate the feasibility of using adaptive neural networks as a means of deriving (or more specifically, learning) measures on software. Taken together, these two efforts illuminate a very promising mechanism supporting software infrastructures - one based upon a flexible and responsive technology.

Software Development Life Cycle Security Issues

NASA Astrophysics Data System (ADS)

Kaur, Daljit; Kaur, Parminder

2011-12-01

Security is now-a-days one of the major problems because of many reasons. Security is now-a-days one of the major problems because of many reasons. The main cause is that software can't withstand security attacks because of vulnerabilities in it which are caused by defective specifications design and implementation. We have conducted a survey asking software developers, project managers and other people in software development about their security awareness and implementation in Software Development Life Cycle (SDLC). The survey was open to participation for three weeks and this paper explains the survey results.

ICESat (GLAS) Science Processing Software Document Series. Volume 3; GLAS Science Software Requirements Document; Ver 2.1

NASA Technical Reports Server (NTRS)

Jester, Peggy L.; Lee, Jeffrey; Zukor, Dorothy J. (Technical Monitor)

2001-01-01

This document addresses the software requirements of the Geoscience Laser Altimeter System (GLAS) Standard Data Software (SDS) supporting the GLAS instrument on the EOS ICESat Spacecraft. This Software Requirements Document represents the initial collection of the technical engineering information for the GLAS SDS. This information is detailed within the second of four main volumes of the Standard documentation, the Product Specification volume. This document is a "roll-out" from the governing volume outline containing the Concept and Requirements sections.

Process Based on SysML for New Launchers System and Software Developments

NASA Astrophysics Data System (ADS)

Hiron, Emmanuel; Miramont, Philippe

2010-08-01

The purpose of this paper is to present the Astrium-ST engineering process based on SysML. This process is currently set-up in the frame of common CNES /Astrium-ST R&T studies related to the Ariane 5 electrical system and flight software modelling. The tool used to set up this process is Rhapsody release 7.3 from IBM-Software firm [1]. This process focuses on the system engineering phase dedicated to Software with the objective to generate both System documents (sequential system design and flight control) and Software specifications.

48 CFR 52.250-5 - SAFETY Act-Equitable Adjustment.

Code of Federal Regulations, 2011 CFR

2011-10-01

..., engineering services, software development services, software integration services, threat assessments... security, i.e., it will perform as intended, conforms to the seller's specifications, and is safe for use...

48 CFR 52.250-5 - SAFETY Act-Equitable Adjustment.

Code of Federal Regulations, 2014 CFR

2014-10-01

..., engineering services, software development services, software integration services, threat assessments... security, i.e., it will perform as intended, conforms to the seller's specifications, and is safe for use...

48 CFR 52.250-5 - SAFETY Act-Equitable Adjustment.

Code of Federal Regulations, 2013 CFR

2013-10-01

..., engineering services, software development services, software integration services, threat assessments... security, i.e., it will perform as intended, conforms to the seller's specifications, and is safe for use...

48 CFR 52.250-5 - SAFETY Act-Equitable Adjustment.

Code of Federal Regulations, 2012 CFR

2012-10-01

..., engineering services, software development services, software integration services, threat assessments... security, i.e., it will perform as intended, conforms to the seller's specifications, and is safe for use...

PCOGR: phylogenetic COG ranking as an online tool to judge the specificity of COGs with respect to freely definable groups of organisms.

PubMed

Meereis, Florian; Kaufmann, Michael

2004-10-15

The rapidly increasing number of completely sequenced genomes led to the establishment of the COG-database which, based on sequence homologies, assigns similar proteins from different organisms to clusters of orthologous groups (COGs). There are several bioinformatic studies that made use of this database to determine (hyper)thermophile-specific proteins by searching for COGs containing (almost) exclusively proteins from (hyper)thermophilic genomes. However, public software to perform individually definable group-specific searches is not available. The tool described here exactly fills this gap. The software is accessible at http://www.uni-wh.de/pcogr and is linked to the COG-database. The user can freely define two groups of organisms by selecting for each of the (current) 66 organisms to belong either to groupA, to the reference groupB or to be ignored by the algorithm. Then, for all COGs a specificity index is calculated with respect to the specificity to groupA, i. e. high scoring COGs contain proteins from the most of groupA organisms while proteins from the most organisms assigned to groupB are absent. In addition to ranking all COGs according to the user defined specificity criteria, a graphical visualization shows the distribution of all COGs by displaying their abundance as a function of their specificity indexes. This software allows detecting COGs specific to a predefined group of organisms. All COGs are ranked in the order of their specificity and a graphical visualization allows recognizing (i) the presence and abundance of such COGs and (ii) the phylogenetic relationship between groupA- and groupB-organisms. The software also allows detecting putative protein-protein interactions, novel enzymes involved in only partially known biochemical pathways, and alternate enzymes originated by convergent evolution.

Automated Transfer Vehicle Proximity Flight Safety Overview

NASA Astrophysics Data System (ADS)

Cornier, Dominique; Berthelier, David; Requiston, Helene; Zekri, Eric; Chase, Richard

2005-12-01

The European Automated Transfer Vehicle (ATV) is an unmanned transportation spacecraft designed to contribute to the logistic servicing of the ISS. The ATV will be launched by ARIANE 5 and, after phasing and rendezvous maneuvers, it autonomously docks to the International Space Station (ISS).The ATV control is nominally handled by the Guidance, Navigation and Control (GNC) function using computers, software, sensors and actuators. During rendezvous operations, in order to cover the extreme situations where the GNC function fails to ensure a safe trajectory with respect to the ISS, a segregated Proximity Flight Safety (PFS) function is activated : this function will initiate a collision avoidance maneuver which will place the ATV on a trajectory ensuring safety with respect to the ISS. The PFS function relies on segregated computers, the Monitoring and Safing Units (MSUs) running specific software, on four dedicated thrusters, on dedicated batteries and on specific interfaces with ATV gyrometers.The PFS function being the ultimate protection to ensure ISS safety in case of ATV malfunction, specific rules have been applied to its implementation, in particular for the development of the MSU software, which is critical since any failure of this software may result in catastrophic consequences.This paper provides an overview of the ATV Proximity Flight Safety function. After a short description of the overall ATV avionics architecture and its rationale, the second part of the paper presents more details on the PFS function both in terms of hardware and software implementation. The third part of the paper is dedicated to the MSU software validation method that is specific considering its criticality. The last part of the paper provides information on the different operations related to the use of the PFS function during an ATV flight.

A high order approach to flight software development and testing

NASA Technical Reports Server (NTRS)

Steinbacher, J.

1981-01-01

The use of a software development facility is discussed as a means of producing a reliable and maintainable ECS software system, and as a means of providing efficient use of the ECS hardware test facility. Principles applied to software design are given, including modularity, abstraction, hiding, and uniformity. The general objectives of each phase of the software life cycle are also given, including testing, maintenance, code development, and requirement specifications. Software development facility tools are summarized, and tool deficiencies recognized in the code development and testing phases are considered. Due to limited lab resources, the functional simulation capabilities may be indispensable in the testing phase.

Wildlife software: procedures for publication of computer software

USGS Publications Warehouse

Samuel, M.D.

1990-01-01

Computers and computer software have become an integral part of the practice of wildlife science. Computers now play an important role in teaching, research, and management applications. Because of the specialized nature of wildlife problems, specific computer software is usually required to address a given problem (e.g., home range analysis). This type of software is not usually available from commercial vendors and therefore must be developed by those wildlife professionals with particular skill in computer programming. Current journal publication practices generally prevent a detailed description of computer software associated with new techniques. In addition, peer review of journal articles does not usually include a review of associated computer software. Thus, many wildlife professionals are usually unaware of computer software that would meet their needs or of major improvements in software they commonly use. Indeed most users of wildlife software learn of new programs or important changes only by word of mouth.

A Case Study of Measuring Process Risk for Early Insights into Software Safety

NASA Technical Reports Server (NTRS)

Layman, Lucas; Basili, Victor; Zelkowitz, Marvin V.; Fisher, Karen L.

2011-01-01

In this case study, we examine software safety risk in three flight hardware systems in NASA's Constellation spaceflight program. We applied our Technical and Process Risk Measurement (TPRM) methodology to the Constellation hazard analysis process to quantify the technical and process risks involving software safety in the early design phase of these projects. We analyzed 154 hazard reports and collected metrics to measure the prevalence of software in hazards and the specificity of descriptions of software causes of hazardous conditions. We found that 49-70% of 154 hazardous conditions could be caused by software or software was involved in the prevention of the hazardous condition. We also found that 12-17% of the 2013 hazard causes involved software, and that 23-29% of all causes had a software control. The application of the TPRM methodology identified process risks in the application of the hazard analysis process itself that may lead to software safety risk.

A Novel Method for Mining SaaS Software Tag via Community Detection in Software Services Network

NASA Astrophysics Data System (ADS)

Qin, Li; Li, Bing; Pan, Wei-Feng; Peng, Tao

The number of online software services based on SaaS paradigm is increasing. However, users usually find it hard to get the exact software services they need. At present, tags are widely used to annotate specific software services and also to facilitate the searching of them. Currently these tags are arbitrary and ambiguous since mostly of them are generated manually by service developers. This paper proposes a method for mining tags from the help documents of software services. By extracting terms from the help documents and calculating the similarity between the terms, we construct a software similarity network where nodes represent software services, edges denote the similarity relationship between software services, and the weights of the edges are the similarity degrees. The hierarchical clustering algorithm is used for community detection in this software similarity network. At the final stage, tags are mined for each of the communities and stored as ontology.

Advanced software development workstation project: Engineering scripting language. Graphical editor

NASA Technical Reports Server (NTRS)

1992-01-01

Software development is widely considered to be a bottleneck in the development of complex systems, both in terms of development and in terms of maintenance of deployed systems. Cost of software development and maintenance can also be very high. One approach to reducing costs and relieving this bottleneck is increasing the reuse of software designs and software components. A method for achieving such reuse is a software parts composition system. Such a system consists of a language for modeling software parts and their interfaces, a catalog of existing parts, an editor for combining parts, and a code generator that takes a specification and generates code for that application in the target language. The Advanced Software Development Workstation is intended to be an expert system shell designed to provide the capabilities of a software part composition system.

Software engineering and Ada in design

NASA Technical Reports Server (NTRS)

Oneill, Don

1986-01-01

Modern software engineering promises significant reductions in software costs and improvements in software quality. The Ada language is the focus for these software methodology and tool improvements. The IBM FSD approach, including the software engineering practices that guide the systematic design and development of software products and the management of the software process are examined. The revised Ada design language adaptation is revealed. This four level design methodology is detailed including the purpose of each level, the management strategy that integrates the software design activity with the program milestones, and the technical strategy that maps the Ada constructs to each level of design. A complete description of each design level is provided along with specific design language recording guidelines for each level. Finally, some testimony is offered on education, tools, architecture, and metrics resulting from project use of the four level Ada design language adaptation.

Software assurance standard

NASA Technical Reports Server (NTRS)

1992-01-01

This standard specifies the software assurance program for the provider of software. It also delineates the assurance activities for the provider and the assurance data that are to be furnished by the provider to the acquirer. In any software development effort, the provider is the entity or individual that actually designs, develops, and implements the software product, while the acquirer is the entity or individual who specifies the requirements and accepts the resulting products. This standard specifies at a high level an overall software assurance program for software developed for and by NASA. Assurance includes the disciplines of quality assurance, quality engineering, verification and validation, nonconformance reporting and corrective action, safety assurance, and security assurance. The application of these disciplines during a software development life cycle is called software assurance. Subsequent lower-level standards will specify the specific processes within these disciplines.

Support Vector Machine algorithm for regression and classification

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yu, Chenggang; Zavaljevski, Nela

2001-08-01

The software is an implementation of the Support Vector Machine (SVM) algorithm that was invented and developed by Vladimir Vapnik and his co-workers at AT&T Bell Laboratories. The specific implementation reported here is an Active Set method for solving a quadratic optimization problem that forms the major part of any SVM program. The implementation is tuned to specific constraints generated in the SVM learning. Thus, it is more efficient than general-purpose quadratic optimization programs. A decomposition method has been implemented in the software that enables processing large data sets. The size of the learning data is virtually unlimited by themore » capacity of the computer physical memory. The software is flexible and extensible. Two upper bounds are implemented to regulate the SVM learning for classification, which allow users to adjust the false positive and false negative rates. The software can be used either as a standalone, general-purpose SVM regression or classification program, or be embedded into a larger software system.« less

SCA Waveform Development for Space Telemetry

NASA Technical Reports Server (NTRS)

Mortensen, Dale J.; Kifle, Multi; Hall, C. Steve; Quinn, Todd M.

2004-01-01

The NASA Glenn Research Center is investigating and developing suitable reconfigurable radio architectures for future NASA missions. This effort is examining software-based open-architectures for space based transceivers, as well as common hardware platform architectures. The Joint Tactical Radio System's (JTRS) Software Communications Architecture (SCA) is a candidate for the software approach, but may need modifications or adaptations for use in space. An in-house SCA compliant waveform development focuses on increasing understanding of software defined radio architectures and more specifically the JTRS SCA. Space requirements put a premium on size, mass, and power. This waveform development effort is key to evaluating tradeoffs with the SCA for space applications. Existing NASA telemetry links, as well as Space Exploration Initiative scenarios, are the basis for defining the waveform requirements. Modeling and simulations are being developed to determine signal processing requirements associated with a waveform and a mission-specific computational burden. Implementation of the waveform on a laboratory software defined radio platform is proceeding in an iterative fashion. Parallel top-down and bottom-up design approaches are employed.

Use of Kidspiration[C] Software to Enhance the Reading Comprehension of Story Grammar Components for Elementary-Age Students with Specific Learning Disabilities

ERIC Educational Resources Information Center

Wade, Erin; Boon, Richard T.; Spencer, Vicky G.

2010-01-01

The aim of this research brief was to explore the efficacy of story mapping, with the integration of Kidspiration[C] software, to enhance the reading comprehension skills of story grammar components for elementary-age students. Three students served as the participants, two in third grade and one in fourth, with specific learning disabilities…

Product Definition Data Interface (PDDI) Product Specification

DTIC Science & Technology

1991-07-01

syntax of the language gives a precise specification of the data without interpretation of it. M - Constituent Read Block. CSECT - Control Section, the...to conform to the PDDI Access Software’s internal data representation so that it may be further processed. JCL - Job Control Language - IBM language...software development and life cycle * phases. OUALITY CONTROL - The planned and systematic application of all actions (management/technical) necessary to

Host computer software specifications for a zero-g payload manhandling simulator

NASA Technical Reports Server (NTRS)

Wilson, S. W.

1986-01-01

The HP PASCAL source code was developed for the Mission Planning and Analysis Division (MPAD) of NASA/JSC, and takes the place of detailed flow charts defining the host computer software specifications for MANHANDLE, a digital/graphical simulator that can be used to analyze the dynamics of onorbit (zero-g) payload manhandling operations. Input and output data for representative test cases are contained.

VLSI synthesis of digital application specific neural networks

NASA Technical Reports Server (NTRS)

Beagles, Grant; Winters, Kel

1991-01-01

Neural networks tend to fall into two general categories: (1) software simulations, or (2) custom hardware that must be trained. The scope of this project is the merger of these two classifications into a system whereby a software model of a network is trained to perform a specific task and the results used to synthesize a standard cell realization of the network using automated tools.

Evaluation of management measures of software development. Volume 1: Analysis summary

NASA Technical Reports Server (NTRS)

Page, J.; Card, D.; Mcgarry, F.

1982-01-01

The conceptual model, the data classification scheme, and the analytic procedures are explained. The analytic results are summarized and specific software measures for collection and monitoring are recommended.

Creating Math Videos: Comparing Platforms and Software

ERIC Educational Resources Information Center

Abbasian, Reza O.; Sieben, John T.

2016-01-01

In this paper we present a short tutorial on creating mini-videos using two platforms--PCs and tablets such as iPads--and software packages that work with these devices. Specifically, we describe the step-by-step process of creating and editing videos using a Wacom Intuos pen-tablet plus Camtasia software on a PC platform and using the software…

Designing Online Software for Teaching the Concept of Variable That Facilitates Mental Interaction with the Material: Systemic Approach

ERIC Educational Resources Information Center

Koehler, Natalya A.; Thompson, Ann D.; Correia, Ana-Paula; Hagedorn, Linda Serra

2015-01-01

Our case study is a response to the need for research and reporting on specific strategies employed by software designers to produce effective multimedia instructional solutions. A systemic approach for identifying appropriate software features and conducting a formative evaluation that evaluates both the overall effectiveness of the multimedia…

The Impact of a Simulation and Problem-Based Learning Design Project on Student Learning and Teamwork Skills. CSE Technical Report.

ERIC Educational Resources Information Center

Chung, Gregory K. W. K.

This study examined a civil engineering capstone course that embedded a sophisticated simulation-based task within instruction. Students (n=28) were required to conduct a hazardous waste site investigation using simulation software designed specifically for the course (Interactive Site Investigation Software) (ISIS). The software simulated…

SOA Governance: A Critical SOA Success Factor

DTIC Science & Technology

2010-04-01

Software Perspective Service Consumer Service Providers Interface Optimize tomorrow today. ® Building Blocks...of a SOA Service – Software implemented capability that is well-defined, self contained and does not depend on context or state of other services ... Service Consumer – Service , application or other software component that requires a specific service . – Located through registry – Initiates service

Configuration management and software measurement in the Ground Systems Development Environment (GSDE)

NASA Technical Reports Server (NTRS)

Church, Victor E.; Long, D.; Hartenstein, Ray; Perez-Davila, Alfredo

1992-01-01

A set of functional requirements for software configuration management (CM) and metrics reporting for Space Station Freedom ground systems software are described. This report is one of a series from a study of the interfaces among the Ground Systems Development Environment (GSDE), the development systems for the Space Station Training Facility (SSTF) and the Space Station Control Center (SSCC), and the target systems for SSCC and SSTF. The focus is on the CM of the software following delivery to NASA and on the software metrics that relate to the quality and maintainability of the delivered software. The CM and metrics requirements address specific problems that occur in large-scale software development. Mechanisms to assist in the continuing improvement of mission operations software development are described.

Presenting an Evaluation Model for the Cancer Registry Software.

PubMed

Moghaddasi, Hamid; Asadi, Farkhondeh; Rabiei, Reza; Rahimi, Farough; Shahbodaghi, Reihaneh

2017-12-01

As cancer is increasingly growing, cancer registry is of great importance as the main core of cancer control programs, and many different software has been designed for this purpose. Therefore, establishing a comprehensive evaluation model is essential to evaluate and compare a wide range of such software. In this study, the criteria of the cancer registry software have been determined by studying the documents and two functional software of this field. The evaluation tool was a checklist and in order to validate the model, this checklist was presented to experts in the form of a questionnaire. To analyze the results of validation, an agreed coefficient of %75 was determined in order to apply changes. Finally, when the model was approved, the final version of the evaluation model for the cancer registry software was presented. The evaluation model of this study contains tool and method of evaluation. The evaluation tool is a checklist including the general and specific criteria of the cancer registry software along with their sub-criteria. The evaluation method of this study was chosen as a criteria-based evaluation method based on the findings. The model of this study encompasses various dimensions of cancer registry software and a proper method for evaluating it. The strong point of this evaluation model is the separation between general criteria and the specific ones, while trying to fulfill the comprehensiveness of the criteria. Since this model has been validated, it can be used as a standard to evaluate the cancer registry software.

The new meaning of quality in the information age.

PubMed

Prahalad, C K; Krishnan, M S

1999-01-01

Software applications are now a mission-critical source of competitive advantage for most companies. They are also a source of great risk, as the Y2K bug has made clear. Yet many line managers still haven't confronted software issues--partly because they aren't sure how best to define the quality of the applications in their IT infrastructures. Some companies such as Wal-Mart and the Gap have successfully integrated the software in their networks, but most have accumulated an unwidely number of incompatible applications--all designed to perform the same tasks. The authors provide a framework for measuring the performance of software in a company's IT portfolio. Quality traditionally has been measured according to a product's ability to meet certain specifications; other views of quality have emerged that measure a product's adaptability to customers' needs and a product's ability to encourage innovation. To judge software quality properly, argue the authors, managers must measure applications against all three approaches. Understanding the domain of a software application is an important part of that process. The domain is the body of knowledge about a user's needs and expectations for a product. Software domains change frequently based on how a consumer chooses to use, for example, Microsoft Word or a spreadsheet application. The domain can also be influenced by general changes in technology, such as the development of a new software platform. Thus, applications can't be judged only according to whether they conform to specifications. The authors discuss how to identify domain characteristics and software risks and suggest ways to reduce the variability of software domains.

Investigating the Acquisition of Software Systems that Rely on Open Architecture and Open Source Software

DTIC Science & Technology

2010-03-01

associated with certain software systems [Breaux and Anton 2008]. With this basis to build on, it is now possible to analyze the alignment of...Kazman, R., (2003). Software Architecture in Practice, 2nd Edition, Addison-Wesley Pro- fessional, New York.. Breaux, T.D. and Anton , A.I. (2008... calculus for license rights and obligations in license and context models. Using them, we calculate rights and obligations for specific sys- tems, identify

Knowledge Based Software Assistant Conference Proceedings (4th) Held in Syracuse, New York on 12-14 September 1989

DTIC Science & Technology

1990-05-01

Sanders Associates. Inc. A demonstration of knowledge-based support for the evolut ;cnry development of software system requirements uskig mitV/9 text...Conference Commiffee W Douga W~t Spin-Off Technologies 4 AN OVERVIEW OF RADC’S KNOWLEDGE BASED SOFTWARE ASSISTANT PROGRAM Donald M. Elefante Rome Air...Knowledge-Based Software Assistant is a formally based, computer-mediated paradigm for the specification, development, evolution , and Ir ig term

Craniux: A LabVIEW-Based Modular Software Framework for Brain-Machine Interface Research

DTIC Science & Technology

2011-01-01

open-source BMI software solu- tions are currently available, we feel that the Craniux software package fills a specific need in the realm of BMI...data, such as cortical source imaging using EEG or MEG recordings. It is with these characteristics in mind that we feel the Craniux software package...S. Adee, “Dean Kamen’s ‘luke arm’ prosthesis readies for clinical trials,” IEEE Spectrum, February 2008, http://spectrum .ieee.org/biomedical

Software Measurement Guidebook

NASA Technical Reports Server (NTRS)

1995-01-01

This Software Measurement Guidebook is based on the extensive experience of several organizations that have each developed and applied significant measurement programs over a period of at least 10 years. The lessons derived from those experiences reflect not only successes but also failures. By applying those lessons, an organization can minimize, or at least reduce, the time, effort, and frustration of introducing a software measurement program. The Software Measurement Guidebook is aimed at helping organizations to begin or improve a measurement program. It does not provide guidance for the extensive application of specific measures (such as how to estimate software cost or analyze software complexity) other than by providing examples to clarify points. It does contain advice for establishing and using an effective software measurement program and for understanding some of the key lessons that other organizations have learned. Some of that advice will appear counterintuitive, but it is all based on actual experience. Although all of the information presented in this guidebook is derived from specific experiences of mature measurement programs, the reader must keep in mind that the characteristics of every organization are unique. Some degree of measurement is critical for all software development and maintenance organizations, and most of the key rules captured in this report will be generally applicable. Nevertheless, each organization must strive to understand its own environment so that the measurement program can be tailored to suit its characteristics and needs.

Portable image-manipulation software: what is the extra development cost?

PubMed

Ligier, Y; Ratib, O; Funk, M; Perrier, R; Girard, C; Logean, M

1992-08-01

A hospital-wide picture archiving and communication system (PACS) project is currently under development at the University Hospital of Geneva. The visualization and manipulation of images provided by different imaging modalities constitutes one of the most challenging component of a PACS. It was necessary to provide this visualization software on a number of types of workstations because of the varying requirements imposed by the range of clinical uses it must serve. The user interface must be the same, independent of the underlying workstation. In addition to a standard set of image-manipulation and processing tools, there is a need for more specific clinical tools that can be easily adapted to specific medical requirements. To achieve this goal, it was elected to develop a modular and portable software called OSIRIS. This software is available on two different operating systems (the UNIX standard X-11/OSF-Motif based workstations and the Macintosh family) and can be easily ported to other systems. The extra effort required to design such software in a modular and portable way was worthwhile because it resulted in a platform that can be easily expanded and adapted to a variety of specific clinical applications. Its portability allows users to benefit from the rapidly evolving workstation technology and to adapt the performance to suit their needs.

Flexible Software Architecture for Visualization and Seismic Data Analysis

NASA Astrophysics Data System (ADS)

Petunin, S.; Pavlov, I.; Mogilenskikh, D.; Podzyuban, D.; Arkhipov, A.; Baturuin, N.; Lisin, A.; Smith, A.; Rivers, W.; Harben, P.

2007-12-01

Research in the field of seismology requires software and signal processing utilities for seismogram manipulation and analysis. Seismologists and data analysts often encounter a major problem in the use of any particular software application specific to seismic data analysis: the tuning of commands and windows to the specific waveforms and hot key combinations so as to fit their familiar informational environment. The ability to modify the user's interface independently from the developer requires an adaptive code structure. An adaptive code structure also allows for expansion of software capabilities such as new signal processing modules and implementation of more efficient algorithms. Our approach is to use a flexible "open" architecture for development of geophysical software. This report presents an integrated solution for organizing a logical software architecture based on the Unix version of the Geotool software implemented on the Microsoft NET 2.0 platform. Selection of this platform greatly expands the variety and number of computers that can implement the software, including laptops that can be utilized in field conditions. It also facilitates implementation of communication functions for seismic data requests from remote databases through the Internet. The main principle of the new architecture for Geotool is that scientists should be able to add new routines for digital waveform analysis via software plug-ins that utilize the basic Geotool display for GUI interaction. The use of plug-ins allows the efficient integration of diverse signal-processing software, including software still in preliminary development, into an organized platform without changing the fundamental structure of that platform itself. An analyst's use of Geotool is tracked via a metadata file so that future studies can reconstruct, and alter, the original signal processing operations. The work has been completed in the framework of a joint Russian- American project.

The MINERVA Software Development Process

NASA Technical Reports Server (NTRS)

Narkawicz, Anthony; Munoz, Cesar A.; Dutle, Aaron M.

2017-01-01

This paper presents a software development process for safety-critical software components of cyber-physical systems. The process is called MINERVA, which stands for Mirrored Implementation Numerically Evaluated against Rigorously Verified Algorithms. The process relies on formal methods for rigorously validating code against its requirements. The software development process uses: (1) a formal specification language for describing the algorithms and their functional requirements, (2) an interactive theorem prover for formally verifying the correctness of the algorithms, (3) test cases that stress the code, and (4) numerical evaluation on these test cases of both the algorithm specifications and their implementations in code. The MINERVA process is illustrated in this paper with an application to geo-containment algorithms for unmanned aircraft systems. These algorithms ensure that the position of an aircraft never leaves a predetermined polygon region and provide recovery maneuvers when the region is inadvertently exited.

Using Combined SFTA and SFMECA Techniques for Space Critical Software

NASA Astrophysics Data System (ADS)

Nicodemos, F. G.; Lahoz, C. H. N.; Abdala, M. A. D.; Saotome, O.

2012-01-01

This work addresses the combined Software Fault Tree Analysis (SFTA) and Software Failure Modes, Effects and Criticality Analysis (SFMECA) techniques applied to space critical software of satellite launch vehicles. The combined approach is under research as part of the Verification and Validation (V&V) efforts to increase software dependability and as future application in other projects under development at Instituto de Aeronáutica e Espaço (IAE). The applicability of such approach was conducted on system software specification and applied to a case study based on the Brazilian Satellite Launcher (VLS). The main goal is to identify possible failure causes and obtain compensating provisions that lead to inclusion of new functional and non-functional system software requirements.

PeakWorks

DOE Office of Scientific and Technical Information (OSTI.GOV)

2016-11-30

The PeakWorks software is designed to assist in the quantitative analysis of atom probe tomography (APT) generated mass spectra. Specifically, through an interactive user interface, mass peaks can be identified automatically (defined by a threshold) and/or identified manually. The software then provides a means to assign specific elemental isotopes (including more than one) to each peak. The software also provides a means for the user to choose background subtraction of each peak based on background fitting functions, the choice of which is left to the users discretion. Peak ranging (the mass range over which peaks are integrated) is also automatedmore » allowing the user to chose a quantitative range (e.g. full-widthhalf- maximum). The software then integrates all identified peaks, providing a background-subtracted composition, which also includes the deconvolution of peaks (i.e. those peaks that happen to have overlapping isotopic masses). The software is also able to output a 'range file' that can be used in other software packages, such as within IVAS. A range file lists the peak identities, the mass range of each identified peak, and a color code for the peak. The software is also able to generate 'dummy' peak ranges within an outputted range file that can be used within IVAS to provide a means for background subtracted proximity histogram analysis.« less

Computerized trainings in four groups of struggling readers: Specific effects on word reading and comprehension.

PubMed

Potocki, Anna; Magnan, Annie; Ecalle, Jean

2015-01-01

Four groups of poor readers were identified among a population of students with learning disabilities attending a special class in secondary school: normal readers; specific poor decoders; specific poor comprehenders, and general poor readers (deficits in both decoding and comprehension). These students were then trained with a software program designed to encourage either their word decoding skills or their text comprehension skills. After 5 weeks of training, we observed that the students experiencing word reading deficits and trained with the decoding software improved primarily in the reading fluency task while those exhibiting comprehension deficits and trained with the comprehension software showed improved performance in listening and reading comprehension. But interestingly, the latter software also led to improved performance on the word recognition task. This result suggests that, for these students, training interventions focused at the text level and its comprehension might be more beneficial for reading in general (i.e., for the two components of reading) than word-level decoding trainings. Copyright © 2015 Elsevier Ltd. All rights reserved.

Software development without languages

NASA Technical Reports Server (NTRS)

Osborne, Haywood S.

1988-01-01

Automatic programming generally involves the construction of a formal specification; i.e., one which allows unambiguous interpretation by tools for the subsequent production of the corresponding software. Previous practical efforts in this direction have focused on the serious problems of: (1) designing the optimum specification language; and (2) mapping (translating or compiling) from this specification language to the program itself. The approach proposed bypasses the above problems. It postulates that the specification proper should be an intermediate form, with the sole function of containing information sufficient to facilitate construction of programs and also of matching documentation. Thus, the means of forming the intermediary becomes a human factors task rather than a linguistic one; human users will read documents generated from the specification, rather than the specification itself.

Evaluation of whole genome sequencing and software tools for drug susceptibility testing of Mycobacterium tuberculosis.

PubMed

van Beek, J; Haanperä, M; Smit, P W; Mentula, S; Soini, H

2018-04-11

Culture-based assays are currently the reference standard for drug susceptibility testing for Mycobacterium tuberculosis. They provide good sensitivity and specificity but are time consuming. The objective of this study was to evaluate whether whole genome sequencing (WGS), combined with software tools for data analysis, can replace routine culture-based assays for drug susceptibility testing of M. tuberculosis. M. tuberculosis cultures sent to the Finnish mycobacterial reference laboratory in 2014 (n = 211) were phenotypically tested by Mycobacteria Growth Indicator Tube (MGIT) for first-line drug susceptibilities. WGS was performed for all isolates using the Illumina MiSeq system, and data were analysed using five software tools (PhyResSE, Mykrobe Predictor, TB Profiler, TGS-TB and KvarQ). Diagnostic time and reagent costs were estimated for both methods. The sensitivity of the five software tools to predict any resistance among strains was almost identical, ranging from 74% to 80%, and specificity was more than 95% for all software tools except for TGS-TB. The sensitivity and specificity to predict resistance to individual drugs varied considerably among the software tools. Reagent costs for MGIT and WGS were €26 and €143 per isolate respectively. Turnaround time for MGIT was 19 days (range 10-50 days) for first-line drugs, and turnaround time for WGS was estimated to be 5 days (range 3-7 days). WGS could be used as a prescreening assay for drug susceptibility testing with confirmation of resistant strains by MGIT. The functionality and ease of use of the software tools need to be improved. Copyright © 2018 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

Tools for Embedded Computing Systems Software

NASA Technical Reports Server (NTRS)

1978-01-01

A workshop was held to assess the state of tools for embedded systems software and to determine directions for tool development. A synopsis of the talk and the key figures of each workshop presentation, together with chairmen summaries, are presented. The presentations covered four major areas: (1) tools and the software environment (development and testing); (2) tools and software requirements, design, and specification; (3) tools and language processors; and (4) tools and verification and validation (analysis and testing). The utility and contribution of existing tools and research results for the development and testing of embedded computing systems software are described and assessed.

Programming Language Software For Graphics Applications

NASA Technical Reports Server (NTRS)

Beckman, Brian C.

1993-01-01

New approach reduces repetitive development of features common to different applications. High-level programming language and interactive environment with access to graphical hardware and software created by adding graphical commands and other constructs to standardized, general-purpose programming language, "Scheme". Designed for use in developing other software incorporating interactive computer-graphics capabilities into application programs. Provides alternative to programming entire applications in C or FORTRAN, specifically ameliorating design and implementation of complex control and data structures typifying applications with interactive graphics. Enables experimental programming and rapid development of prototype software, and yields high-level programs serving as executable versions of software-design documentation.

Prevalence, characterization and sources of Listeria monocytogenes in blue crab (Callinectus sapidus) meat and blue crab processing plants.

PubMed

Pagadala, Sivaranjani; Parveen, Salina; Rippen, Thomas; Luchansky, John B; Call, Jeffrey E; Tamplin, Mark L; Porto-Fett, Anna C S

2012-09-01

Seven blue crab processing plants were sampled to determine the prevalence and sources of Listeria spp. and Listeria monocytogenes for two years (2006-2007). A total of 488 raw crabs, 624 cooked crab meat (crab meat) and 624 environmental samples were tested by standard methods. Presumptive Listeria spp. were isolated from 19.5% of raw crabs, 10.8% of crab meat, and 69.5% of environmental samples. L. monocytogenes was isolated from 4.5% of raw crabs, 0.2% of crab meat, and 2.1% of environmental samples. Ninety-seven percent of the isolates were resistant to at least one of the ten antibiotics tested. Eight different serotypes were found among 76 L. monocytogenes isolates tested with the most common being 4b, 1/2b and 1/2a. Automated EcoRI ribotyping differentiated 11 ribotypes among the 106 L. monocytogenes isolates. Based on ribotyping analysis, the distribution of the ribotypes in each processing plant had a unique contamination pattern. A total of 92 ApaI and 88 AscI pulsotypes among the 106 L. monocytogenes isolates were found and distinct pulsotypes were observed in raw crab, crab meat and environmental samples. Ribotypes and serotypes recovered from crab processing plants included subtypes that have been associated with listeriosis cases in other food outbreaks. Our findings suggest that molecular methods may provide critical information about sources of L. monocytogenes in crab processing plants and will augment efforts to improve food safety control strategies such as targeting specific sources of contamination and use of aggressive detergents prior to sanitizing. Copyright © 2012 Elsevier Ltd. All rights reserved.

Formal Methods Specification and Verification Guidebook for Software and Computer Systems. Volume 1; Planning and Technology Insertion

NASA Technical Reports Server (NTRS)

1995-01-01

The Formal Methods Specification and Verification Guidebook for Software and Computer Systems describes a set of techniques called Formal Methods (FM), and outlines their use in the specification and verification of computer systems and software. Development of increasingly complex systems has created a need for improved specification and verification techniques. NASA's Safety and Mission Quality Office has supported the investigation of techniques such as FM, which are now an accepted method for enhancing the quality of aerospace applications. The guidebook provides information for managers and practitioners who are interested in integrating FM into an existing systems development process. Information includes technical and administrative considerations that must be addressed when establishing the use of FM on a specific project. The guidebook is intended to aid decision makers in the successful application of FM to the development of high-quality systems at reasonable cost. This is the first volume of a planned two-volume set. The current volume focuses on administrative and planning considerations for the successful application of FM.

Quality measures and assurance for AI (Artificial Intelligence) software

NASA Technical Reports Server (NTRS)

Rushby, John

1988-01-01

This report is concerned with the application of software quality and evaluation measures to AI software and, more broadly, with the question of quality assurance for AI software. Considered are not only the metrics that attempt to measure some aspect of software quality, but also the methodologies and techniques (such as systematic testing) that attempt to improve some dimension of quality, without necessarily quantifying the extent of the improvement. The report is divided into three parts Part 1 reviews existing software quality measures, i.e., those that have been developed for, and applied to, conventional software. Part 2 considers the characteristics of AI software, the applicability and potential utility of measures and techniques identified in the first part, and reviews those few methods developed specifically for AI software. Part 3 presents an assessment and recommendations for the further exploration of this important area.

ControlShell - A real-time software framework

NASA Technical Reports Server (NTRS)

Schneider, Stanley A.; Ullman, Marc A.; Chen, Vincent W.

1991-01-01

ControlShell is designed to enable modular design and impplementation of real-time software. It is an object-oriented tool-set for real-time software system programming. It provides a series of execution and data interchange mechansims that form a framework for building real-time applications. These mechanisms allow a component-based approach to real-time software generation and mangement. By defining a set of interface specifications for intermodule interaction, ControlShell provides a common platform that is the basis for real-time code development and exchange.

Top Down Implementation Plan for system performance test software

NASA Technical Reports Server (NTRS)

Jacobson, G. N.; Spinak, A.

1982-01-01

The top down implementation plan used for the development of system performance test software during the Mark IV-A era is described. The plan is based upon the identification of the hierarchical relationship of the individual elements of the software design, the development of a sequence of functionally oriented demonstrable steps, the allocation of subroutines to the specific step where they are first required, and objective status reporting. The results are: determination of milestones, improved managerial visibility, better project control, and a successful software development.

Current trends for customized biomedical software tools.

PubMed

Khan, Haseeb Ahmad

2017-01-01

In the past, biomedical scientists were solely dependent on expensive commercial software packages for various applications. However, the advent of user-friendly programming languages and open source platforms has revolutionized the development of simple and efficient customized software tools for solving specific biomedical problems. Many of these tools are designed and developed by biomedical scientists independently or with the support of computer experts and often made freely available for the benefit of scientific community. The current trends for customized biomedical software tools are highlighted in this short review.

Measures and metrics for software development

NASA Technical Reports Server (NTRS)

1984-01-01

The evaluations of and recommendations for the use of software development measures based on the practical and analytical experience of the Software Engineering Laboratory are discussed. The basic concepts of measurement and system of classification for measures are described. The principal classes of measures defined are explicit, analytic, and subjective. Some of the major software measurement schemes appearing in the literature are derived. The applications of specific measures in a production environment are explained. These applications include prediction and planning, review and assessment, and evaluation and selection.

Profile of software engineering within the National Aeronautics and Space Administration (NASA)

NASA Technical Reports Server (NTRS)

Sinclair, Craig C.; Jeletic, Kellyann F.

1994-01-01

This paper presents findings of baselining activities being performed to characterize software practices within the National Aeronautics and Space Administration. It describes how such baseline findings might be used to focus software process improvement activities. Finally, based on the findings to date, it presents specific recommendations in focusing future NASA software process improvement efforts. The findings presented in this paper are based on data gathered and analyzed to date. As such, the quantitative data presented in this paper are preliminary in nature.

An Evaluation of the Availability and Application of Microcomputer Software Programs for Use in Air Force Ground Transportation Squadrons

DTIC Science & Technology

1988-09-01

software programs capable of being used on a microcomputer will be considered for analysis. No software intended for use on a miniframe or mainframe...Dial-A-Log consists of a program written in a computer language called L-10 that is run on a DEC-20 miniframe . The combination of the specific...proliferation of software dealing with microcomputers. Instead, they were geared more towards managing the use of miniframe or mainframe computer

Estimation and enhancement of real-time software reliability through mutation analysis

NASA Technical Reports Server (NTRS)

Geist, Robert; Offutt, A. J.; Harris, Frederick C., Jr.

1992-01-01

A simulation-based technique for obtaining numerical estimates of the reliability of N-version, real-time software is presented. An extended stochastic Petri net is employed to represent the synchronization structure of N versions of the software, where dependencies among versions are modeled through correlated sampling of module execution times. Test results utilizing specifications for NASA's planetary lander control software indicate that mutation-based testing could hold greater potential for enhancing reliability than the desirable but perhaps unachievable goal of independence among N versions.

A software quality model and metrics for risk assessment

NASA Technical Reports Server (NTRS)

Hyatt, L.; Rosenberg, L.

1996-01-01

A software quality model and its associated attributes are defined and used as the model for the basis for a discussion on risk. Specific quality goals and attributes are selected based on their importance to a software development project and their ability to be quantified. Risks that can be determined by the model's metrics are identified. A core set of metrics relating to the software development process and its products is defined. Measurements for each metric and their usability and applicability are discussed.

Rational Design Methodology.

DTIC Science & Technology

1978-09-01

This report describes an effort to specify a software design methodology applicable to the Air Force software environment . Available methodologies...of techniques for proof of correctness, design specification, and performance assessment of static designs. The rational methodology selected is a

Tailoring a software production environment for a large project

NASA Technical Reports Server (NTRS)

Levine, D. R.

1984-01-01

A software production environment was constructed to meet the specific goals of a particular large programming project. These goals, the specific solutions as implemented, and the experiences on a project of over 100,000 lines of source code are discussed. The base development environment for this project was an ordinary PWB Unix (tm) system. Several important aspects of the development process required support not available in the existing tool set.

Claims-Based Authentication for a Web-Based Enterprise

DTIC Science & Technology

2013-07-01

authority must use known and registered (or in specific cases defined ) certificate revocation and currency-checking software . B. Translation of...Machines and services are issued software certificates that contain the public key with the private key generated and remaining in hardware...publicly available) information. A hardware token that contains the certificate is preferred to software -only certificates. For enterprise users

Automatic Requirements Specification Extraction from Natural Language (ARSENAL)

DTIC Science & Technology

2014-10-01

designers, implementers) involved in the design of software systems. However, natural language descriptions can be informal, incomplete, imprecise...communication of technical descriptions between the various stakeholders (e.g., customers, designers, imple- menters) involved in the design of software systems...the accuracy of the natural language processing stage, the degree of automation, and robustness to noise. 1 2 Introduction Software systems operate in

Technical Writing for Software Engineers

DTIC Science & Technology

1991-11-01

3 Analogies: Software Development and Composing 3.1 Art / Science /Design 3.2 General Correspondences Between the Disciplines 3.3 Specific Analogies...domains. The first subsection describes a dialogue common to both fields, one that considers these disciplines as art , science , and design. The second...will find additional similarities between software development and composing in these and other sources. 3.1 Art / Science /Design Ongoing discussions

Acquisition Handbook - Update. Comprehensive Approach to Reusable Defensive Software (CARDS)

DTIC Science & Technology

1994-03-25

designs, and implementation components (source code, test plans, procedures and results, and system/software documentation). This handbook provides a...activities where software components are acquired, evaluated, tested and sometimes modified. In addition to serving as a facility for the acquisition and...systems from such components [1]. Implementation components are at the lowest level and consist of: specifications; detailed designs; code, test

Knowledge-based reusable software synthesis system

NASA Technical Reports Server (NTRS)

Donaldson, Cammie

1989-01-01

The Eli system, a knowledge-based reusable software synthesis system, is being developed for NASA Langley under a Phase 2 SBIR contract. Named after Eli Whitney, the inventor of interchangeable parts, Eli assists engineers of large-scale software systems in reusing components while they are composing their software specifications or designs. Eli will identify reuse potential, search for components, select component variants, and synthesize components into the developer's specifications. The Eli project began as a Phase 1 SBIR to define a reusable software synthesis methodology that integrates reusabilityinto the top-down development process and to develop an approach for an expert system to promote and accomplish reuse. The objectives of the Eli Phase 2 work are to integrate advanced technologies to automate the development of reusable components within the context of large system developments, to integrate with user development methodologies without significant changes in method or learning of special languages, and to make reuse the easiest operation to perform. Eli will try to address a number of reuse problems including developing software with reusable components, managing reusable components, identifying reusable components, and transitioning reuse technology. Eli is both a library facility for classifying, storing, and retrieving reusable components and a design environment that emphasizes, encourages, and supports reuse.

AMPHION: Specification-based programming for scientific subroutine libraries

NASA Technical Reports Server (NTRS)

Lowry, Michael; Philpot, Andrew; Pressburger, Thomas; Underwood, Ian; Waldinger, Richard; Stickel, Mark

1994-01-01

AMPHION is a knowledge-based software engineering (KBSE) system that guides a user in developing a diagram representing a formal problem specification. It then automatically implements a solution to this specification as a program consisting of calls to subroutines from a library. The diagram provides an intuitive domain oriented notation for creating a specification that also facilitates reuse and modification. AMPHION'S architecture is domain independent. AMPHION is specialized to an application domain by developing a declarative domain theory. Creating a domain theory is an iterative process that currently requires the joint expertise of domain experts and experts in automated formal methods for software development.

Automated Transfer Vehicle (ATV) Critical Safety Software Overview

NASA Astrophysics Data System (ADS)

Berthelier, D.

2002-01-01

The European Automated Transfer Vehicle is an unmanned transportation system designed to dock to International Space Station (ISS) and to contribute to the logistic servicing of the ISS. Concisely, ATV control is realized by a nominal flight control function (using computers, softwares, sensors, actuators). In order to cover the extreme situations where this nominal chain can not ensure safe trajectory with respect to ISS, a segregated proximity flight safety function is activated, where unsafe free drift trajectories can be encountered. This function relies notably on a segregated computer, the Monitoring and Safing Unit (MSU) ; in case of major ATV malfunction detection, ATV is then controlled by MSU software. Therefore, this software is critical because a MSU software failure could result in catastrophic consequences. This paper provides an overview both of this software functions and of the software development and validation method which is specific considering its criticality. First part of the paper describes briefly the proximity flight safety chain. Second part deals with the software functions. Indeed, MSU software is in charge of monitoring nominal computers and ATV corridors, using its own navigation algorithms, and, if an abnormal situation is detected, it is in charge of the ATV control during the Collision Avoidance Manoeuvre (CAM) consisting in an attitude controlled braking boost, followed by a Post-CAM manoeuvre : a Sun-pointed ATV attitude control during up to 24 hours on a safe trajectory. Monitoring, navigation and control algorithms principles are presented. Third part of this paper describes the development and validation process : algorithms functional studies , ADA coding and unit validations ; algorithms ADA code integration and validation on a specific non real-time MATLAB/SIMULINK simulator ; global software functional engineering phase, architectural design, unit testing, integration and validation on target computer.

Global Hawk Systems Engineering. Case Study

DTIC Science & Technology

2010-01-01

Management Core System ( TBMCS ) (complex software development) • F-111 Fighter (joint program with significant involvement by the Office of the...Software Requirements Specification TACC Tailored Airworthiness Certification Criteria TBMCS Theater Battle Management Core System TEMP Test and

Object-Oriented Technology-Based Software Library for Operations of Water Reclamation Centers

NASA Astrophysics Data System (ADS)

Otani, Tetsuo; Shimada, Takehiro; Yoshida, Norio; Abe, Wataru

SCADA systems in water reclamation centers have been constructed based on hardware and software that each manufacturer produced according to their design. Even though this approach used to be effective to realize real-time and reliable execution, it is an obstacle to cost reduction about system construction and maintenance. A promising solution to address the problem is to set specifications that can be used commonly. In terms of software, information model approach has been adopted in SCADA systems in other field, such as telecommunications and power systems. An information model is a piece of software specification that describes a physical or logical object to be monitored. In this paper, we propose information models for operations of water reclamation centers, which have not ever existed. In addition, we show the feasibility of the information model in terms of common use and processing performance.

AMBER instrument control software

NASA Astrophysics Data System (ADS)

Le Coarer, Etienne P.; Zins, Gerard; Gluck, Laurence; Duvert, Gilles; Driebe, Thomas; Ohnaka, Keiichi; Heininger, Matthias; Connot, Claus; Behrend, Jan; Dugue, Michel; Clausse, Jean Michel; Millour, Florentin

2004-09-01

AMBER (Astronomical Multiple BEam Recombiner) is a 3 aperture interferometric recombiner operating between 1 and 2.5 um, for the Very Large Telescope Interferometer (VLTI). The control software of the instrument, based on the VLT Common Software, has been written to comply with specific features of the AMBER hardware, such as the Infrared detector read out modes or piezo stage drivers, as well as with the very specific operation modes of an interferomtric instrument. In this respect, the AMBER control software was designed to insure that all operations, from the preparation of the observations to the control/command of the instrument during the observations, would be kept as simple as possible for the users and operators, opening the use of an interferometric instrument to the largest community of astronomers. Peculiar attention was given to internal checks and calibration procedures both to evaluate data quality in real time, and improve the successes of long term UV plane coverage observations.

The Synthetic Biology Open Language (SBOL) provides a community standard for communicating designs in synthetic biology.

PubMed

Galdzicki, Michal; Clancy, Kevin P; Oberortner, Ernst; Pocock, Matthew; Quinn, Jacqueline Y; Rodriguez, Cesar A; Roehner, Nicholas; Wilson, Mandy L; Adam, Laura; Anderson, J Christopher; Bartley, Bryan A; Beal, Jacob; Chandran, Deepak; Chen, Joanna; Densmore, Douglas; Endy, Drew; Grünberg, Raik; Hallinan, Jennifer; Hillson, Nathan J; Johnson, Jeffrey D; Kuchinsky, Allan; Lux, Matthew; Misirli, Goksel; Peccoud, Jean; Plahar, Hector A; Sirin, Evren; Stan, Guy-Bart; Villalobos, Alan; Wipat, Anil; Gennari, John H; Myers, Chris J; Sauro, Herbert M

2014-06-01

The re-use of previously validated designs is critical to the evolution of synthetic biology from a research discipline to an engineering practice. Here we describe the Synthetic Biology Open Language (SBOL), a proposed data standard for exchanging designs within the synthetic biology community. SBOL represents synthetic biology designs in a community-driven, formalized format for exchange between software tools, research groups and commercial service providers. The SBOL Developers Group has implemented SBOL as an XML/RDF serialization and provides software libraries and specification documentation to help developers implement SBOL in their own software. We describe early successes, including a demonstration of the utility of SBOL for information exchange between several different software tools and repositories from both academic and industrial partners. As a community-driven standard, SBOL will be updated as synthetic biology evolves to provide specific capabilities for different aspects of the synthetic biology workflow.

Study of fault tolerant software technology for dynamic systems

NASA Technical Reports Server (NTRS)

Caglayan, A. K.; Zacharias, G. L.

1985-01-01

The major aim of this study is to investigate the feasibility of using systems-based failure detection isolation and compensation (FDIC) techniques in building fault-tolerant software and extending them, whenever possible, to the domain of software fault tolerance. First, it is shown that systems-based FDIC methods can be extended to develop software error detection techniques by using system models for software modules. In particular, it is demonstrated that systems-based FDIC techniques can yield consistency checks that are easier to implement than acceptance tests based on software specifications. Next, it is shown that systems-based failure compensation techniques can be generalized to the domain of software fault tolerance in developing software error recovery procedures. Finally, the feasibility of using fault-tolerant software in flight software is investigated. In particular, possible system and version instabilities, and functional performance degradation that may occur in N-Version programming applications to flight software are illustrated. Finally, a comparative analysis of N-Version and recovery block techniques in the context of generic blocks in flight software is presented.

OAST Space Theme Workshop. Volume 3: Working group summary. 4: Software (E-4). A. Summary. B. Technology needs (form 1). C. Priority assessment (form 2)

NASA Technical Reports Server (NTRS)

1976-01-01

Only a few efforts are currently underway to develop an adequate technology base for the various themes. Particular attention must be given to software commonality and evolutionary capability, to increased system integrity and autonomy; and to improved communications among the program users, the program developers, and the programs themselves. There is a need for quantum improvement in software development methods and increasing the awareness of software by all concerned. Major thrusts identified include: (1) data and systems management; (2) software technology for autonomous systems; (3) technology and methods for improving the software development process; (4) advances related to systems of software elements including their architecture, their attributes as systems, and their interfaces with users and other systems; and (5) applications of software including both the basic algorithms used in a number of applications and the software specific to a particular theme or discipline area. The impact of each theme on software is assessed.

Using Colored Stochastic Petri Net (CS-PN) software for protocol specification, validation, and evaluation

NASA Technical Reports Server (NTRS)

Zenie, Alexandre; Luguern, Jean-Pierre

1987-01-01

The specification, verification, validation, and evaluation, which make up the different steps of the CS-PN software are outlined. The colored stochastic Petri net software is applied to a Wound/Wait protocol decomposable into two principal modules: request or couple (transaction, granule) treatment module and wound treatment module. Each module is specified, verified, validated, and then evaluated separately, to deduce a verification, validation and evaluation of the complete protocol. The colored stochastic Petri nets tool is shown to be a natural extension of the stochastic tool, adapted to distributed systems and protocols, because the color conveniently takes into account the numerous sites, transactions, granules and messages.

NASA PC software evaluation project

NASA Technical Reports Server (NTRS)

Dominick, Wayne D. (Editor); Kuan, Julie C.

1986-01-01

The USL NASA PC software evaluation project is intended to provide a structured framework for facilitating the development of quality NASA PC software products. The project will assist NASA PC development staff to understand the characteristics and functions of NASA PC software products. Based on the results of the project teams' evaluations and recommendations, users can judge the reliability, usability, acceptability, maintainability and customizability of all the PC software products. The objective here is to provide initial, high-level specifications and guidelines for NASA PC software evaluation. The primary tasks to be addressed in this project are as follows: to gain a strong understanding of what software evaluation entails and how to organize a structured software evaluation process; to define a structured methodology for conducting the software evaluation process; to develop a set of PC software evaluation criteria and evaluation rating scales; and to conduct PC software evaluations in accordance with the identified methodology. Communication Packages, Network System Software, Graphics Support Software, Environment Management Software, General Utilities. This report represents one of the 72 attachment reports to the University of Southwestern Louisiana's Final Report on NASA Grant NGT-19-010-900. Accordingly, appropriate care should be taken in using this report out of context of the full Final Report.

Interface Specifications for the A-7E Shared Services Module.

DTIC Science & Technology

1982-09-08

To illustrate the principles, the onboard software for the Navy’s A-7E aircraft will be redesigned and rewritten. The Shared Services module provides...purpose of the Shared Services module is to allow the remainder of the software to remain unchanged when the requirements-based rules for these values and...services change. This report describes the modular structure of the Shared Services module, and contains the abstract interface specifications for all

The CSSIAR v.1.00 Software: A new tool based on SIAR to assess soil redistribution using Compound Specific Stable Isotopes

NASA Astrophysics Data System (ADS)

Sergio, de los Santos-Villalobos; Claudio, Bravo-Linares; dos Anjos Roberto, Meigikos; Renan, Cardoso; Max, Gibbs; Andrew, Swales; Lionel, Mabit; Gerd, Dercon

Soil erosion is one of the biggest challenges for food production around the world. Many techniques have been used to evaluate and mitigate soil degradation. Nowadays isotopic techniques are becoming a powerful tool to assess soil apportionment. One of the innovative techniques used is the Compound Specific Stable Isotopes (CSSI) analysis, which has been used to track down sediments and specify their sources by the isotopic signature of δ13 C in specific fatty acids. The application of this technique on soil apportionment has been recently developed, however there is a lack of user-friendly Software for data processing and interpretation. The aim of this article is to introduce a new open source tool for working with data sets generated by the use of the CSSI technique to assess soil apportionment, called the CSSIARv1.00 Software

Stellar Inertial Navigation Workstation

NASA Technical Reports Server (NTRS)

Johnson, W.; Johnson, B.; Swaminathan, N.

1989-01-01

Software and hardware assembled to support specific engineering activities. Stellar Inertial Navigation Workstation (SINW) is integrated computer workstation providing systems and engineering support functions for Space Shuttle guidance and navigation-system logistics, repair, and procurement activities. Consists of personal-computer hardware, packaged software, and custom software integrated together into user-friendly, menu-driven system. Designed to operate on IBM PC XT. Applied in business and industry to develop similar workstations.

The SoRReL papers: Recent publications of the Software Reuse Repository Lab

NASA Technical Reports Server (NTRS)

Eichmann, David A. (Editor)

1992-01-01

The entire publication is presented of some of the papers recently published by the SoRReL. Some typical titles are as follows: Design of a Lattice-Based Faceted Classification System; A Hybrid Approach to Software Reuse Repository Retrieval; Selecting Reusable Components Using Algebraic Specifications; Neural Network-Based Retrieval from Reuse Repositories; and A Neural Net-Based Approach to Software Metrics.

Cloud Computing

DTIC Science & Technology

2009-11-12

Service (IaaS) Software -as-a- Service ( SaaS ) Cloud Computing Types Platform-as-a- Service (PaaS) Based on Type of Capability Based on access Based...Mellon University Software -as-a- Service ( SaaS ) Application-specific capabilities, e.g., service that provides customer management Allows organizations...as a Service ( SaaS ) Model of software deployment in which a provider licenses an application to customers for use as a service on

Integrating automated structured analysis and design with Ada programming support environments

NASA Technical Reports Server (NTRS)

Hecht, Alan; Simmons, Andy

1986-01-01

Ada Programming Support Environments (APSE) include many powerful tools that address the implementation of Ada code. These tools do not address the entire software development process. Structured analysis is a methodology that addresses the creation of complete and accurate system specifications. Structured design takes a specification and derives a plan to decompose the system subcomponents, and provides heuristics to optimize the software design to minimize errors and maintenance. It can also produce the creation of useable modules. Studies have shown that most software errors result from poor system specifications, and that these errors also become more expensive to fix as the development process continues. Structured analysis and design help to uncover error in the early stages of development. The APSE tools help to insure that the code produced is correct, and aid in finding obscure coding errors. However, they do not have the capability to detect errors in specifications or to detect poor designs. An automated system for structured analysis and design TEAMWORK, which can be integrated with an APSE to support software systems development from specification through implementation is described. These tools completement each other to help developers improve quality and productivity, as well as to reduce development and maintenance costs. Complete system documentation and reusable code also resultss from the use of these tools. Integrating an APSE with automated tools for structured analysis and design provide capabilities and advantages beyond those realized with any of these systems used by themselves.

Intelligent Systems and Advanced User Interfaces for Design, Operation, and Maintenance of Command Management Systems

NASA Technical Reports Server (NTRS)

Mitchell, Christine M.

1998-01-01

Historically Command Management Systems (CMS) have been large, expensive, spacecraft-specific software systems that were costly to build, operate, and maintain. Current and emerging hardware, software, and user interface technologies may offer an opportunity to facilitate the initial formulation and design of a spacecraft-specific CMS as well as a to develop a more generic or a set of core components for CMS systems. Current MOC (mission operations center) hardware and software include Unix workstations, the C/C++ and Java programming languages, and X and Java window interfaces representations. This configuration provides the power and flexibility to support sophisticated systems and intelligent user interfaces that exploit state-of-the-art technologies in human-machine systems engineering, decision making, artificial intelligence, and software engineering. One of the goals of this research is to explore the extent to which technologies developed in the research laboratory can be productively applied in a complex system such as spacecraft command management. Initial examination of some of the issues in CMS design and operation suggests that application of technologies such as intelligent planning, case-based reasoning, design and analysis tools from a human-machine systems engineering point of view (e.g., operator and designer models) and human-computer interaction tools, (e.g., graphics, visualization, and animation), may provide significant savings in the design, operation, and maintenance of a spacecraft-specific CMS as well as continuity for CMS design and development across spacecraft with varying needs. The savings in this case is in software reuse at all stages of the software engineering process.

Advanced Software Development Workstation Project

NASA Technical Reports Server (NTRS)

Lee, Daniel

1989-01-01

The Advanced Software Development Workstation Project, funded by Johnson Space Center, is investigating knowledge-based techniques for software reuse in NASA software development projects. Two prototypes have been demonstrated and a third is now in development. The approach is to build a foundation that provides passive reuse support, add a layer that uses domain-independent programming knowledge, add a layer that supports the acquisition of domain-specific programming knowledge to provide active support, and enhance maintainability and modifiability through an object-oriented approach. The development of new application software would use specification-by-reformulation, based on a cognitive theory of retrieval from very long-term memory in humans, and using an Ada code library and an object base. Current tasks include enhancements to the knowledge representation of Ada packages and abstract data types, extensions to support Ada package instantiation knowledge acquisition, integration with Ada compilers and relational databases, enhancements to the graphical user interface, and demonstration of the system with a NASA contractor-developed trajectory simulation package. Future work will focus on investigating issues involving scale-up and integration.

A Roadmap for Using Agile Development in a Traditional Environment

NASA Technical Reports Server (NTRS)

Streiffert, Barbara; Starbird, Thomas; Grenander, Sven

2006-01-01

One of the newer classes of software engineering techniques is called 'Agile Development'. In Agile Development software engineers take small implementation steps and, in some cases, they program in pairs. In addition, they develop automatic tests prior to implementing their small functional piece. Agile Development focuses on rapid turnaround, incremental planning, customer involvement and continuous integration. Agile Development is not the traditional waterfall method or even a rapid prototyping method (although this methodology is closer to Agile Development). At the Jet Propulsion Laboratory (JPL) a few groups have begun Agile Development software implementations. The difficulty with this approach becomes apparent when Agile Development is used in an organization that has specific criteria and requirements handed down for how software development is to be performed. The work at the JPL is performed for the National Aeronautics and Space Agency (NASA). Both organizations have specific requirements, rules and processes for developing software. This paper will discuss some of the initial uses of the Agile Development methodology, the spread of this method and the current status of the successful incorporation into the current JPL development policies and processes.

A Roadmap for Using Agile Development in a Traditional Environment

NASA Technical Reports Server (NTRS)

Streiffert, Barbara A.; Starbird, Thomas; Grenander, Sven

2006-01-01

One of the newer classes of software engineering techniques is called 'Agile Development'. In Agile Development software engineers take small implementation steps and, in some cases they program in pairs. In addition, they develop automatic tests prior to implementing their small functional piece. Agile Development focuses on rapid turnaround, incremental planning, customer involvement and continuous integration. Agile Development is not the traditional waterfall method or even a rapid prototyping method (although this methodology is closer to Agile Development). At Jet Propulsion Laboratory (JPL) a few groups have begun Agile Development software implementations. The difficulty with this approach becomes apparent when Agile Development is used in an organization that has specific criteria and requirements handed down for how software development is to be performed. The work at the JPL is performed for the National Aeronautics and Space Agency (NASA). Both organizations have specific requirements, rules and procedure for developing software. This paper will discuss the some of the initial uses of the Agile Development methodology, the spread of this method and the current status of the successful incorporation into the current JPL development policies.

Implementation of a software for REmote COMparison of PARticlE and photon treatment plans: ReCompare.

PubMed

Löck, Steffen; Roth, Klaus; Skripcak, Tomas; Worbs, Mario; Helmbrecht, Stephan; Jakobi, Annika; Just, Uwe; Krause, Mechthild; Baumann, Michael; Enghardt, Wolfgang; Lühr, Armin

2015-09-01

To guarantee equal access to optimal radiotherapy, a concept of patient assignment to photon or particle radiotherapy using remote treatment plan exchange and comparison - ReCompare - was proposed. We demonstrate the implementation of this concept and present its clinical applicability. The ReCompare concept was implemented using a client-server based software solution. A clinical workflow for the remote treatment plan exchange and comparison was defined. The steps required by the user and performed by the software for a complete plan transfer were described and an additional module for dose-response modeling was added. The ReCompare software was successfully tested in cooperation with three external partner clinics and worked meeting all required specifications. It was compatible with several standard treatment planning systems, ensured patient data protection, and integrated in the clinical workflow. The ReCompare software can be applied to support non-particle radiotherapy institutions with the patient-specific treatment decision on the optimal irradiation modality by remote treatment plan exchange and comparison. Copyright © 2015. Published by Elsevier GmbH.

Automated Reuse of Scientific Subroutine Libraries through Deductive Synthesis

NASA Technical Reports Server (NTRS)

Lowry, Michael R.; Pressburger, Thomas; VanBaalen, Jeffrey; Roach, Steven

1997-01-01

Systematic software construction offers the potential of elevating software engineering from an art-form to an engineering discipline. The desired result is more predictable software development leading to better quality and more maintainable software. However, the overhead costs associated with the formalisms, mathematics, and methods of systematic software construction have largely precluded their adoption in real-world software development. In fact, many mainstream software development organizations, such as Microsoft, still maintain a predominantly oral culture for software development projects; which is far removed from a formalism-based culture for software development. An exception is the limited domain of safety-critical software, where the high-assuiance inherent in systematic software construction justifies the additional cost. We believe that systematic software construction will only be adopted by mainstream software development organization when the overhead costs have been greatly reduced. Two approaches to cost mitigation are reuse (amortizing costs over many applications) and automation. For the last four years, NASA Ames has funded the Amphion project, whose objective is to automate software reuse through techniques from systematic software construction. In particular, deductive program synthesis (i.e., program extraction from proofs) is used to derive a composition of software components (e.g., subroutines) that correctly implements a specification. The construction of reuse libraries of software components is the standard software engineering solution for improving software development productivity and quality.

Fault Tree Analysis Application for Safety and Reliability

NASA Technical Reports Server (NTRS)

Wallace, Dolores R.

2003-01-01

Many commercial software tools exist for fault tree analysis (FTA), an accepted method for mitigating risk in systems. The method embedded in the tools identifies a root as use in system components, but when software is identified as a root cause, it does not build trees into the software component. No commercial software tools have been built specifically for development and analysis of software fault trees. Research indicates that the methods of FTA could be applied to software, but the method is not practical without automated tool support. With appropriate automated tool support, software fault tree analysis (SFTA) may be a practical technique for identifying the underlying cause of software faults that may lead to critical system failures. We strive to demonstrate that existing commercial tools for FTA can be adapted for use with SFTA, and that applied to a safety-critical system, SFTA can be used to identify serious potential problems long before integrator and system testing.

Computer software.

PubMed

Rosenthal, L E

1986-10-01

Software is the component in a computer system that permits the hardware to perform the various functions that a computer system is capable of doing. The history of software and its development can be traced to the early nineteenth century. All computer systems are designed to utilize the "stored program concept" as first developed by Charles Babbage in the 1850s. The concept was lost until the mid-1940s, when modern computers made their appearance. Today, because of the complex and myriad tasks that a computer system can perform, there has been a differentiation of types of software. There is software designed to perform specific business applications. There is software that controls the overall operation of a computer system. And there is software that is designed to carry out specialized tasks. Regardless of types, software is the most critical component of any computer system. Without it, all one has is a collection of circuits, transistors, and silicone chips.

Information Metacatalog for a Grid

NASA Technical Reports Server (NTRS)

Kolano, Paul

2007-01-01

SWIM is a Software Information Metacatalog that gathers detailed information about the software components and packages installed on a grid resource. Information is currently gathered for Executable and Linking Format (ELF) executables and shared libraries, Java classes, shell scripts, and Perl and Python modules. SWIM is built on top of the POUR framework, which is described in the preceding article. SWIM consists of a set of Perl modules for extracting software information from a system, an XML schema defining the format of data that can be added by users, and a POUR XML configuration file that describes how these elements are used to generate periodic, on-demand, and user-specified information. Periodic software information is derived mainly from the package managers used on each system. SWIM collects information from native package managers in FreeBSD, Solaris, and IRX as well as the RPM, Perl, and Python package managers on multiple platforms. Because not all software is available, or installed in package form, SWIM also crawls the set of relevant paths from the File System Hierarchy Standard that defines the standard file system structure used by all major UNIX distributions. Using these two techniques, the vast majority of software installed on a system can be located. SWIM computes the same information gathered by the periodic routines for specific files on specific hosts, and locates software on a system given only its name and type.

Common characteristics of open source software development and applicability for drug discovery: a systematic review.

PubMed

Ardal, Christine; Alstadsæter, Annette; Røttingen, John-Arne

2011-09-28

Innovation through an open source model has proven to be successful for software development. This success has led many to speculate if open source can be applied to other industries with similar success. We attempt to provide an understanding of open source software development characteristics for researchers, business leaders and government officials who may be interested in utilizing open source innovation in other contexts and with an emphasis on drug discovery. A systematic review was performed by searching relevant, multidisciplinary databases to extract empirical research regarding the common characteristics and barriers of initiating and maintaining an open source software development project. Common characteristics to open source software development pertinent to open source drug discovery were extracted. The characteristics were then grouped into the areas of participant attraction, management of volunteers, control mechanisms, legal framework and physical constraints. Lastly, their applicability to drug discovery was examined. We believe that the open source model is viable for drug discovery, although it is unlikely that it will exactly follow the form used in software development. Hybrids will likely develop that suit the unique characteristics of drug discovery. We suggest potential motivations for organizations to join an open source drug discovery project. We also examine specific differences between software and medicines, specifically how the need for laboratories and physical goods will impact the model as well as the effect of patents.

MISR Data Product Specifications

Atmospheric Science Data Center

2016-11-25

... and usage of metadata. Improvements to MISR algorithmic software occasionally result in changes to file formats. While these changes ...  (DPS).   DPS Revision:   Rev. S Software Version:  5.0.9 Date:  September 20, 2010, updated April ...

The Apple III.

ERIC Educational Resources Information Center

Ditlea, Steve

1982-01-01

Describes and evaluates the features, performance, peripheral devices, available software, and capabilities of the Apple III microcomputer. The computer's operating system, its hardware, and the commercially produced software it accepts are discussed. Specific applications programs for financial planning, accounting, and word processing are…

Software development: A paradigm for the future

NASA Technical Reports Server (NTRS)

Basili, Victor R.

1989-01-01

A new paradigm for software development that treats software development as an experimental activity is presented. It provides built-in mechanisms for learning how to develop software better and reusing previous experience in the forms of knowledge, processes, and products. It uses models and measures to aid in the tasks of characterization, evaluation and motivation. An organization scheme is proposed for separating the project-specific focus from the organization's learning and reuse focuses of software development. The implications of this approach for corporations, research and education are discussed and some research activities currently underway at the University of Maryland that support this approach are presented.

Preparing a scientific manuscript in Linux: Today's possibilities and limitations.

PubMed

Tchantchaleishvili, Vakhtang; Schmitto, Jan D

2011-10-22

Increasing number of scientists are enthusiastic about using free, open source software for their research purposes. Authors' specific goal was to examine whether a Linux-based operating system with open source software packages would allow to prepare a submission-ready scientific manuscript without the need to use the proprietary software. Preparation and editing of scientific manuscripts is possible using Linux and open source software. This letter to the editor describes key steps for preparation of a publication-ready scientific manuscript in a Linux-based operating system, as well as discusses the necessary software components. This manuscript was created using Linux and open source programs for Linux.

Collaborative Software Development in Support of Fast Adaptive AeroSpace Tools (FAAST)

NASA Technical Reports Server (NTRS)

Kleb, William L.; Nielsen, Eric J.; Gnoffo, Peter A.; Park, Michael A.; Wood, William A.

2003-01-01

A collaborative software development approach is described. The software product is an adaptation of proven computational capabilities combined with new capabilities to form the Agency's next generation aerothermodynamic and aerodynamic analysis and design tools. To efficiently produce a cohesive, robust, and extensible software suite, the approach uses agile software development techniques; specifically, project retrospectives, the Scrum status meeting format, and a subset of Extreme Programming's coding practices are employed. Examples are provided which demonstrate the substantial benefits derived from employing these practices. Also included is a discussion of issues encountered when porting legacy Fortran 77 code to Fortran 95 and a Fortran 95 coding standard.

Software development for safety-critical medical applications

NASA Technical Reports Server (NTRS)

Knight, John C.

1992-01-01

There are many computer-based medical applications in which safety and not reliability is the overriding concern. Reduced, altered, or no functionality of such systems is acceptable as long as no harm is done. A precise, formal definition of what software safety means is essential, however, before any attempt can be made to achieve it. Without this definition, it is not possible to determine whether a specific software entity is safe. A set of definitions pertaining to software safety will be presented and a case study involving an experimental medical device will be described. Some new techniques aimed at improving software safety will also be discussed.

Resource utilization during software development

NASA Technical Reports Server (NTRS)

Zelkowitz, Marvin V.

1988-01-01

This paper discusses resource utilization over the life cycle of software development and discusses the role that the current 'waterfall' model plays in the actual software life cycle. Software production in the NASA environment was analyzed to measure these differences. The data from 13 different projects were collected by the Software Engineering Laboratory at NASA Goddard Space Flight Center and analyzed for similarities and differences. The results indicate that the waterfall model is not very realistic in practice, and that as technology introduces further perturbations to this model with concepts like executable specifications, rapid prototyping, and wide-spectrum languages, we need to modify our model of this process.

Orbit targeting specialist function: Level C formulation requirements

NASA Technical Reports Server (NTRS)

Dupont, A.; Mcadoo, S.; Jones, H.; Jones, A. K.; Pearson, D.

1978-01-01

A definition of the level C requirements for onboard maneuver targeting software is provided. Included are revisions of the level C software requirements delineated in JSC IN 78-FM-27, Proximity Operations Software; Level C Requirements, dated May 1978. The software supports the terminal phase midcourse (TPM) maneuver, braking and close-in operations as well as supporting computation of the rendezvous corrective combination maneuver (NCC), and the terminal phase initiation (TPI). Specific formulation is contained here for the orbit targeting specialist function including the processing logic, linkage, and data base definitions for all modules. The crew interface with the software is through the keyboard and the ORBIT-TGT display.

Measurements of the LHCb software stack on the ARM architecture

NASA Astrophysics Data System (ADS)

Vijay Kartik, S.; Couturier, Ben; Clemencic, Marco; Neufeld, Niko

2014-06-01

The ARM architecture is a power-efficient design that is used in most processors in mobile devices all around the world today since they provide reasonable compute performance per watt. The current LHCb software stack is designed (and thus expected) to build and run on machines with the x86/x86_64 architecture. This paper outlines the process of measuring the performance of the LHCb software stack on the ARM architecture - specifically, the ARMv7 architecture on Cortex-A9 processors from NVIDIA and on full-fledged ARM servers with chipsets from Calxeda - and makes comparisons with the performance on x86_64 architectures on the Intel Xeon L5520/X5650 and AMD Opteron 6272. The paper emphasises the aspects of performance per core with respect to the power drawn by the compute nodes for the given performance - this ensures a fair real-world comparison with much more 'powerful' Intel/AMD processors. The comparisons of these real workloads in the context of LHCb are also complemented with the standard synthetic benchmarks HEPSPEC and Coremark. The pitfalls and solutions for the non-trivial task of porting the source code to build for the ARMv7 instruction set are presented. The specific changes in the build process needed for ARM-specific portions of the software stack are described, to serve as pointers for further attempts taken up by other groups in this direction. Cases where architecture-specific tweaks at the assembler lever (both in ROOT and the LHCb software stack) were needed for a successful compile are detailed - these cases are good indicators of where/how the software stack as well as the build system can be made more portable and multi-arch friendly. The experience gained from the tasks described in this paper are intended to i) assist in making an informed choice about ARM-based server solutions as a feasible low-power alternative to the current compute nodes, and ii) revisit the software design and build system for portability and generic improvements.

From Bridges and Rockets, Lessons for Software Systems

NASA Technical Reports Server (NTRS)

Holloway, C. Michael

2004-01-01

Although differences exist between building software systems and building physical structures such as bridges and rockets, enough similarities exist that software engineers can learn lessons from failures in traditional engineering disciplines. This paper draws lessons from two well-known failures the collapse of the Tacoma Narrows Bridge in 1940 and the destruction of the space shuttle Challenger in 1986 and applies these lessons to software system development. The following specific applications are made: (1) the verification and validation of a software system should not be based on a single method, or a single style of methods; (2) the tendency to embrace the latest fad should be overcome; and (3) the introduction of software control into safety-critical systems should be done cautiously.

Technical Support Document for Version 3.6.1 of the COMcheck Software

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bartlett, Rosemarie; Connell, Linda M.; Gowri, Krishnan

2009-09-29

This technical support document (TSD) is designed to explain the technical basis for the COMcheck software as originally developed based on the ANSI/ASHRAE/IES Standard 90.1-1989 (Standard 90.1-1989). Documentation for other national model codes and standards and specific state energy codes supported in COMcheck has been added to this report as appendices. These appendices are intended to provide technical documentation for features specific to the supported codes and for any changes made for state-specific codes that differ from the standard features that support compliance with the national model codes and standards.

Automated benchmark generation based upon a specification language

NASA Technical Reports Server (NTRS)

Rajan, N.; Feteih, S. E.; Saito, J.

1984-01-01

The problem of validating and verifying digital flight control system (DFCS) software is addressed in this paper. A new specification language DIVERS is proposed, and is the keystone of the approach. This language consists of keywords where each keyword represents an element in the block diagram of a DFCS. DIVERS has a dictionary which contains all the keywords a DFCS designer might need. Translator programs convert the system specifications into an executable, high-level language program. The features of translators are discussed and are elucidated by examples. This language is used to describe a typical flight software module.

Specifications for a Federal Information Processing Standard Data Dictionary System

NASA Technical Reports Server (NTRS)

Goldfine, A.

1984-01-01

The development of a software specification that Federal agencies may use in evaluating and selecting data dictionary systems (DDS) is discussed. To supply the flexibility needed by widely different applications and environments in the Federal Government, the Federal Information Processing Standard (FIPS) specifies a core DDS together with an optimal set of modules. The focus and status of the development project are described. Functional specifications for the FIPS DDS are examined for the dictionary, the dictionary schema, and the dictionary processing system. The DDS user interfaces and DDS software interfaces are discussed as well as dictionary administration.

A Probabilistic Software System Attribute Acceptance Paradigm for COTS Software Evaluation

NASA Technical Reports Server (NTRS)

Morris, A. Terry

2005-01-01

Standard software requirement formats are written from top-down perspectives only, that is, from an ideal notion of a client s needs. Despite the exactness of the standard format, software and system errors in designed systems have abounded. Bad and inadequate requirements have resulted in cost overruns, schedule slips and lost profitability. Commercial off-the-shelf (COTS) software components are even more troublesome than designed systems because they are often provided as is and subsequently delivered with unsubstantiated validation of described capabilities. For COTS software, there needs to be a way to express the client s software needs in a consistent and formal manner using software system attributes derived from software quality standards. Additionally, the format needs to be amenable to software evaluation processes that integrate observable evidence garnered from historical data. This paper presents a paradigm that effectively bridges the gap between what a client desires (top-down) and what has been demonstrated (bottom-up) for COTS software evaluation. The paradigm addresses the specification of needs before the software evaluation is performed and can be used to increase the shared understanding between clients and software evaluators about what is required and what is technically possible.

SoftLab: A Soft-Computing Software for Experimental Research with Commercialization Aspects

NASA Technical Reports Server (NTRS)

Akbarzadeh-T, M.-R.; Shaikh, T. S.; Ren, J.; Hubbell, Rob; Kumbla, K. K.; Jamshidi, M

1998-01-01

SoftLab is a software environment for research and development in intelligent modeling/control using soft-computing paradigms such as fuzzy logic, neural networks, genetic algorithms, and genetic programs. SoftLab addresses the inadequacies of the existing soft-computing software by supporting comprehensive multidisciplinary functionalities from management tools to engineering systems. Furthermore, the built-in features help the user process/analyze information more efficiently by a friendly yet powerful interface, and will allow the user to specify user-specific processing modules, hence adding to the standard configuration of the software environment.

Advanced engineering software for in-space assembly and manned planetary spacecraft

NASA Technical Reports Server (NTRS)

Delaquil, Donald; Mah, Robert

1990-01-01

Meeting the objectives of the Lunar/Mars initiative to establish safe and cost-effective extraterrestrial bases requires an integrated software/hardware approach to operational definitions and systems implementation. This paper begins this process by taking a 'software-first' approach to systems design, for implementing specific mission scenarios in the domains of in-space assembly and operations of the manned Mars spacecraft. The technological barriers facing implementation of robust operational systems within these two domains are discussed, and preliminary software requirements and architectures that resolve these barriers are provided.

Software for imaging phase-shift interference microscope

NASA Astrophysics Data System (ADS)

Malinovski, I.; França, R. S.; Couceiro, I. B.

2018-03-01

In recent years absolute interference microscope was created at National Metrology Institute of Brazil (INMETRO). The instrument by principle of operation is imaging phase-shifting interferometer (PSI) equipped with two stabilized lasers of different colour as traceable reference wavelength sources. We report here some progress in development of the software for this instrument. The status of undergoing internal validation and verification of the software is also reported. In contrast with standard PSI method, different methodology of phase evaluation is applied. Therefore, instrument specific procedures for software validation and verification are adapted and discussed.

Property Specification Patterns for intelligence building software

NASA Astrophysics Data System (ADS)

Chun, Seungsu

2018-03-01

In this paper, through the property specification pattern research for Modal MU(μ) logical aspects present a single framework based on the pattern of intelligence building software. In this study, broken down by state property specification pattern classification of Dwyer (S) and action (A) and was subdivided into it again strong (A) and weaknesses (E). Through these means based on a hierarchical pattern classification of the property specification pattern analysis of logical aspects Mu(μ) was applied to the pattern classification of the examples used in the actual model checker. As a result, not only can a more accurate classification than the existing classification systems were easy to create and understand the attributes specified.

Network, system, and status software enhancements for the autonomously managed electrical power system breadboard. Volume 3: Commands specification

NASA Technical Reports Server (NTRS)

Mckee, James W.

1990-01-01

This volume (3 of 4) contains the specification for the command language for the AMPS system. The volume contains a requirements specification for the operating system and commands and a design specification for the operating system and command. The operating system and commands sits on top of the protocol. The commands are an extension of the present set of AMPS commands in that the commands are more compact, allow multiple sub-commands to be bundled into one command, and have provisions for identifying the sender and the intended receiver. The commands make no change to the actual software that implement the commands.

Human isolates of Listeria monocytogenes in Sweden during half a century (1958-2010).

PubMed

Lopez-Valladares, G; Tham, W; Parihar, V Singh; Helmersson, S; Andersson, B; Ivarsson, S; Johansson, C; Ringberg, H; Tjernberg, I; Henriques-Normark, B; Danielsson-Tham, M-L

2014-11-01

Isolates of Listeria monocytogenes (n = 932) isolated in Sweden during 1958-2010 from human patients with invasive listeriosis were characterized by serotyping and pulsed-field gel electrophoresis (PFGE) (AscI). Of the 932 isolates, 183 different PFGE types were identified, of which 83 were each represented by only one isolate. In all, 483 serovar 1/2a isolates were distributed over 114 PFGE types; 90 serovar 1/2b isolates gave 32 PFGE types; 21 serovar 1/2c isolates gave nine PFGE types; three serovar 3b isolates gave one PFGE type; and, 335 serovar 4b isolates gave 31 PFGE types. During the 1980s in Sweden, several serovar 4b cases were associated with the consumption of European raw soft cheese. However, as cheese-production hygiene has improved, the number of 4b cases has decreased. Since 1996, serovar 1/2a has been the dominant L. monocytogenes serovar in human listeriosis in Sweden. Therefore, based on current serovars and PFGE types, an association between human cases of listeriosis and the consumption of vacuum-packed gravad and cold-smoked salmon is suggested.

Symptomatology and morphology of Claviceps cyperi on yellow nut sedge in South Africa.

PubMed

van der Linde, Elna J; Wehner, F C

2007-01-01

Symptoms of ergot on yellow nut sedge, germination of sclerotia of the causal organism, Claviceps cyperi, and morphology of fresh specimens of the pathogen are described for the first time. The initial symptom of infection was a black sooty layer on inflorescences of infected plants due to colonization of the ergot honeydew by Cladosporium cladosporioides. Sclerotia of C. cyperi started to develop in March and April and could be discerned as small protuberances on inflorescences in the place of seed. Mature sclerotia were purplish-black. They generally remained viable for less than a year and germinated without prior cold treatment, although exposure for 21 d to 5 C before incubation significantly increased the germination rate. Under moist conditions at 24 C in the laboratory, germination commenced within 4-8 wk. Stromata took about 12 d to mature. Mature capitula were distinctly lobulate with a perithecium embedded in each lobe and a collar-like appendage around the base. Although dimensions of sclerotia, stipes, capitula, asci and ascospores were larger than in the original description, the general morphology supports treatment of C. cyperi as a distinct species.

Spathaspora boniae sp. nov., a D-xylose-fermenting species in the Candida albicans/Lodderomyces clade.

PubMed

Morais, Camila G; Batista, Thiago M; Kominek, Jacek; Borelli, Beatriz M; Furtado, Carolina; Moreira, Rennan G; Franco, Gloria R; Rosa, Luiz H; Fonseca, César; Hittinger, Chris T; Lachance, Marc-André; Rosa, Carlos A

2017-10-01

Two yeast isolates producing asci-containing elongate ascospores with curved ends typical of the genus Spathaspora were isolated from rotting wood samples collected in an Atlantic rainforest ecosystem in Brazil. Phylogenetic analysis of the LSU rRNA gene D1/D2 domain sequences demonstrated that the strains represent a new species and placed it next to Candida blackwellae, in a clade that also contains Candida albicans and Candida dubliniensis. Other sequences of the ribosomal gene cluster supported same placementin the same clade, and a phylogenomic analysis placed this new species in an early emerging position relative to the larger C. albicans/Lodderomyces clade. One interpretation is that the genus Spathaspora is, in fact, paraphyletic. In conformity with this view, we propose the novel species Spathaspora boniae sp. nov. to accommodate the isolates. The type strain of Spathaspora boniae sp. nov. is UFMG-CM-Y306 T (=CBS 13262 T ). The MycoBank number is MB 821297. A detailed analysis of xylose metabolism was conducted for the new species.

Deterministic alternatives to the full configuration interaction quantum Monte Carlo method for strongly correlated systems

NASA Astrophysics Data System (ADS)

Tubman, Norm; Whaley, Birgitta

The development of exponential scaling methods has seen great progress in tackling larger systems than previously thought possible. One such technique, full configuration interaction quantum Monte Carlo, allows exact diagonalization through stochastically sampling of determinants. The method derives its utility from the information in the matrix elements of the Hamiltonian, together with a stochastic projected wave function, which are used to explore the important parts of Hilbert space. However, a stochastic representation of the wave function is not required to search Hilbert space efficiently and new deterministic approaches have recently been shown to efficiently find the important parts of determinant space. We shall discuss the technique of Adaptive Sampling Configuration Interaction (ASCI) and the related heat-bath Configuration Interaction approach for ground state and excited state simulations. We will present several applications for strongly correlated Hamiltonians. This work was supported through the Scientific Discovery through Advanced Computing (SciDAC) program funded by the U.S. Department of Energy, Office of Science, Advanced Scientific Computing Research and Basic Energy Sciences.

The Generalized Support Software (GSS) Domain Engineering Process: An Object-Oriented Implementation and Reuse Success at Goddard Space Flight Center

NASA Technical Reports Server (NTRS)

Condon, Steven; Hendrick, Robert; Stark, Michael E.; Steger, Warren

1997-01-01

The Flight Dynamics Division (FDD) of NASA's Goddard Space Flight Center (GSFC) recently embarked on a far-reaching revision of its process for developing and maintaining satellite support software. The new process relies on an object-oriented software development method supported by a domain specific library of generalized components. This Generalized Support Software (GSS) Domain Engineering Process is currently in use at the NASA GSFC Software Engineering Laboratory (SEL). The key facets of the GSS process are (1) an architecture for rapid deployment of FDD applications, (2) a reuse asset library for FDD classes, and (3) a paradigm shift from developing software to configuring software for mission support. This paper describes the GSS architecture and process, results of fielding the first applications, lessons learned, and future directions