Degrees of separation as a statistical tool for evaluating candidate genes.

PubMed

Nelson, Ronald M; Pettersson, Mats E

2014-12-01

Selection of candidate genes is an important step in the exploration of complex genetic architecture. The number of gene networks available is increasing and these can provide information to help with candidate gene selection. It is currently common to use the degree of connectedness in gene networks as validation in Genome Wide Association (GWA) and Quantitative Trait Locus (QTL) mapping studies. However, it can cause misleading results if not validated properly. Here we present a method and tool for validating the gene pairs from GWA studies given the context of the network they co-occur in. It ensures that proposed interactions and gene associations are not statistical artefacts inherent to the specific gene network architecture. The CandidateBacon package provides an easy and efficient method to calculate the average degree of separation (DoS) between pairs of genes to currently available gene networks. We show how these empirical estimates of average connectedness are used to validate candidate gene pairs. Validation of interacting genes by comparing their connectedness with the average connectedness in the gene network will provide support for said interactions by utilising the growing amount of gene network information available. Copyright © 2014 Elsevier Ltd. All rights reserved.

Genome-wide prediction and analysis of human tissue-selective genes using microarray expression data

PubMed Central

2013-01-01

Background Understanding how genes are expressed specifically in particular tissues is a fundamental question in developmental biology. Many tissue-specific genes are involved in the pathogenesis of complex human diseases. However, experimental identification of tissue-specific genes is time consuming and difficult. The accurate predictions of tissue-specific gene targets could provide useful information for biomarker development and drug target identification. Results In this study, we have developed a machine learning approach for predicting the human tissue-specific genes using microarray expression data. The lists of known tissue-specific genes for different tissues were collected from UniProt database, and the expression data retrieved from the previously compiled dataset according to the lists were used for input vector encoding. Random Forests (RFs) and Support Vector Machines (SVMs) were used to construct accurate classifiers. The RF classifiers were found to outperform SVM models for tissue-specific gene prediction. The results suggest that the candidate genes for brain or liver specific expression can provide valuable information for further experimental studies. Our approach was also applied for identifying tissue-selective gene targets for different types of tissues. Conclusions A machine learning approach has been developed for accurately identifying the candidate genes for tissue specific/selective expression. The approach provides an efficient way to select some interesting genes for developing new biomedical markers and improve our knowledge of tissue-specific expression. PMID:23369200

Genome-Wide Specific Selection in Three Domestic Sheep Breeds.

PubMed

Wang, Huihua; Zhang, Li; Cao, Jiaxve; Wu, Mingming; Ma, Xiaomeng; Liu, Zhen; Liu, Ruizao; Zhao, Fuping; Wei, Caihong; Du, Lixin

2015-01-01

Commercial sheep raised for mutton grow faster than traditional Chinese sheep breeds. Here, we aimed to evaluate genetic selection among three different types of sheep breed: two well-known commercial mutton breeds and one indigenous Chinese breed. We first combined locus-specific branch lengths and di statistical methods to detect candidate regions targeted by selection in the three different populations. The results showed that the genetic distances reached at least medium divergence for each pairwise combination. We found these two methods were highly correlated, and identified many growth-related candidate genes undergoing artificial selection. For production traits, APOBR and FTO are associated with body mass index. For meat traits, ALDOA, STK32B and FAM190A are related to marbling. For reproduction traits, CCNB2 and SLC8A3 affect oocyte development. We also found two well-known genes, GHR (which affects meat production and quality) and EDAR (associated with hair thickness) were associated with German mutton merino sheep. Furthermore, four genes (POL, RPL7, MSL1 and SHISA9) were associated with pre-weaning gain in our previous genome-wide association study. Our results indicated that combine locus-specific branch lengths and di statistical approaches can reduce the searching ranges for specific selection. And we got many credible candidate genes which not only confirm the results of previous reports, but also provide a suite of novel candidate genes in defined breeds to guide hybridization breeding.

Candidate genes for idiopathic epilepsy in four dog breeds.

PubMed

Ekenstedt, Kari J; Patterson, Edward E; Minor, Katie M; Mickelson, James R

2011-04-25

Idiopathic epilepsy (IE) is a naturally occurring and significant seizure disorder affecting all dog breeds. Because dog breeds are genetically isolated populations, it is possible that IE is attributable to common founders and is genetically homogenous within breeds. In humans, a number of mutations, the majority of which are genes encoding ion channels, neurotransmitters, or their regulatory subunits, have been discovered to cause rare, specific types of IE. It was hypothesized that there are simple genetic bases for IE in some purebred dog breeds, specifically in Vizslas, English Springer Spaniels (ESS), Greater Swiss Mountain Dogs (GSMD), and Beagles, and that the gene(s) responsible may, in some cases, be the same as those already discovered in humans. Candidate genes known to be involved in human epilepsy, along with selected additional genes in the same gene families that are involved in murine epilepsy or are expressed in neural tissue, were examined in populations of affected and unaffected dogs. Microsatellite markers in close proximity to each candidate gene were genotyped and subjected to two-point linkage in Vizslas, and association analysis in ESS, GSMD and Beagles. Most of these candidate genes were not significantly associated with IE in these four dog breeds, while a few genes remained inconclusive. Other genes not included in this study may still be causing monogenic IE in these breeds or, like many cases of human IE, the disease in dogs may be likewise polygenic.

Integrative Approach to Pain Genetics Identifies Pain Sensitivity Loci across Diseases

PubMed Central

Ruau, David; Dudley, Joel T.; Chen, Rong; Phillips, Nicholas G.; Swan, Gary E.; Lazzeroni, Laura C.; Clark, J. David

2012-01-01

Identifying human genes relevant for the processing of pain requires difficult-to-conduct and expensive large-scale clinical trials. Here, we examine a novel integrative paradigm for data-driven discovery of pain gene candidates, taking advantage of the vast amount of existing disease-related clinical literature and gene expression microarray data stored in large international repositories. First, thousands of diseases were ranked according to a disease-specific pain index (DSPI), derived from Medical Subject Heading (MESH) annotations in MEDLINE. Second, gene expression profiles of 121 of these human diseases were obtained from public sources. Third, genes with expression variation significantly correlated with DSPI across diseases were selected as candidate pain genes. Finally, selected candidate pain genes were genotyped in an independent human cohort and prospectively evaluated for significant association between variants and measures of pain sensitivity. The strongest signal was with rs4512126 (5q32, ABLIM3, P = 1.3×10−10) for the sensitivity to cold pressor pain in males, but not in females. Significant associations were also observed with rs12548828, rs7826700 and rs1075791 on 8q22.2 within NCALD (P = 1.7×10−4, 1.8×10−4, and 2.2×10−4 respectively). Our results demonstrate the utility of a novel paradigm that integrates publicly available disease-specific gene expression data with clinical data curated from MEDLINE to facilitate the discovery of pain-relevant genes. This data-derived list of pain gene candidates enables additional focused and efficient biological studies validating additional candidates. PMID:22685391

A new gene in A. rubens: A sea star Ig kappa gene.

PubMed

Vincent, Nadine; Osteras, Magne; Otten, Patricia; Leclerc, Michel

2014-12-01

The sea star Asterias rubens reacts specifically to the antigen:HRP (horse-radish peroxydase) and produces an antibody anti-HRP. We previously identified a candidate Ig kappa gene corresponding to this manuscript. We show now the gene referred to as: "sea star Ig kappa gene in its specificity".

Comparative molecular analyses of select pH- and osmoregulatory genes in three freshwater crayfish Cherax quadricarinatus, C. destructor and C. cainii

PubMed Central

Pavasovic, Ana; Dammannagoda, Lalith K.; Mather, Peter B.; Prentis, Peter J.

2017-01-01

Systemic acid-base balance and osmotic/ionic regulation in decapod crustaceans are in part maintained by a set of transport-related enzymes such as carbonic anhydrase (CA), Na+/K+-ATPase (NKA), H+-ATPase (HAT), Na+/K+/2Cl− cotransporter (NKCC), Na+/Cl−/HCO\\documentclass[12pt]{minimal} \\usepackage{amsmath} \\usepackage{wasysym} \\usepackage{amsfonts} \\usepackage{amssymb} \\usepackage{amsbsy} \\usepackage{upgreek} \\usepackage{mathrsfs} \\setlength{\\oddsidemargin}{-69pt} \\begin{document} }{}${}_{3}^{-}$\\end{document}3− cotransporter (NBC), Na+/H+ exchanger (NHE), Arginine kinase (AK), Sarcoplasmic Ca+2-ATPase (SERCA) and Calreticulin (CRT). We carried out a comparative molecular analysis of these genes in three commercially important yet eco-physiologically distinct freshwater crayfish, Cherax quadricarinatus, C. destructor and C. cainii, with the aim to identify mutations in these genes and determine if observed patterns of mutations were consistent with the action of natural selection. We also conducted a tissue-specific expression analysis of these genes across seven different organs, including gills, hepatopancreas, heart, kidney, liver, nerve and testes using NGS transcriptome data. The molecular analysis of the candidate genes revealed a high level of sequence conservation across the three Cherax sp. Hyphy analysis revealed that all candidate genes showed patterns of molecular variation consistent with neutral evolution. The tissue-specific expression analysis showed that 46% of candidate genes were expressed in all tissue types examined, while approximately 10% of candidate genes were only expressed in a single tissue type. The largest number of genes was observed in nerve (84%) and gills (78%) and the lowest in testes (66%). The tissue-specific expression analysis also revealed that most of the master genes regulating pH and osmoregulation (CA, NKA, HAT, NKCC, NBC, NHE) were expressed in all tissue types indicating an important physiological role for these genes outside of osmoregulation in other tissue types. The high level of sequence conservation observed in the candidate genes may be explained by the important role of these genes as well as potentially having a number of other basic physiological functions in different tissue types. PMID:28852583

Convergence of GWA and candidate gene studies for alcoholism

PubMed Central

Olfson, Emily; Bierut, Laura Jean

2012-01-01

Background Genome-wide association (GWA) studies have led to a paradigm shift in how researchers study the genetics underlying disease. Many GWA studies are now publicly available and can be used to examine whether or not previously proposed candidate genes are supported by GWA data. This approach is particularly important for the field of alcoholism because the contribution of many candidate genes remains controversial. Methods Using the Human Genome Epidemiology (HuGE) Navigator, we selected candidate genes for alcoholism that have been frequently examined in scientific articles in the past decade. Specific candidate loci as well as all the reported SNPs in candidate genes were examined in the Study of Alcohol Addiction: Genetics and Addiction (SAGE), a GWA study comparing alcohol dependent and non-dependent subjects. Results Several commonly reported candidate loci, including rs1800497 in DRD2, rs698 in ADH1C, rs1799971 in OPRM1 and rs4680 in COMT, are not replicated in SAGE (p> .05). Among candidate loci available for analysis, only rs279858 in GABRA2 (p=0.0052, OR=1.16) demonstrated a modest association. Examination of all SNPs reported in SAGE in over 50 candidate genes revealed no SNPs with large frequency differences between cases and controls and the lowest p value of any SNP was .0006. Discussion We provide evidence that several extensively studied candidate loci do not have a strong contribution to risk of developing alcohol dependence in European and African Ancestry populations. Due to lack of coverage, we were unable to rule out the contribution of other variants and these genes and particular loci warrant further investigation. Our analysis demonstrates that publicly available GWA results can be used to better understand which if any of previously proposed candidate genes contribute to disease. Furthermore, we illustrate how examining the convergence of candidate gene and GWA studies can help elucidate the genetic architecture of alcoholism and more generally complex diseases. PMID:22978509

Disease gene prioritization by integrating tissue-specific molecular networks using a robust multi-network model.

PubMed

Ni, Jingchao; Koyuturk, Mehmet; Tong, Hanghang; Haines, Jonathan; Xu, Rong; Zhang, Xiang

2016-11-10

Accurately prioritizing candidate disease genes is an important and challenging problem. Various network-based methods have been developed to predict potential disease genes by utilizing the disease similarity network and molecular networks such as protein interaction or gene co-expression networks. Although successful, a common limitation of the existing methods is that they assume all diseases share the same molecular network and a single generic molecular network is used to predict candidate genes for all diseases. However, different diseases tend to manifest in different tissues, and the molecular networks in different tissues are usually different. An ideal method should be able to incorporate tissue-specific molecular networks for different diseases. In this paper, we develop a robust and flexible method to integrate tissue-specific molecular networks for disease gene prioritization. Our method allows each disease to have its own tissue-specific network(s). We formulate the problem of candidate gene prioritization as an optimization problem based on network propagation. When there are multiple tissue-specific networks available for a disease, our method can automatically infer the relative importance of each tissue-specific network. Thus it is robust to the noisy and incomplete network data. To solve the optimization problem, we develop fast algorithms which have linear time complexities in the number of nodes in the molecular networks. We also provide rigorous theoretical foundations for our algorithms in terms of their optimality and convergence properties. Extensive experimental results show that our method can significantly improve the accuracy of candidate gene prioritization compared with the state-of-the-art methods. In our experiments, we compare our methods with 7 popular network-based disease gene prioritization algorithms on diseases from Online Mendelian Inheritance in Man (OMIM) database. The experimental results demonstrate that our methods recover true associations more accurately than other methods in terms of AUC values, and the performance differences are significant (with paired t-test p-values less than 0.05). This validates the importance to integrate tissue-specific molecular networks for studying disease gene prioritization and show the superiority of our network models and ranking algorithms toward this purpose. The source code and datasets are available at http://nijingchao.github.io/CRstar/ .

The Arabidopsis translatome cell-specific mRNA atlas: Mining suberin and cutin lipid monomer biosynthesis genes as an example for data application.

PubMed

Mustroph, Angelika; Bailey-Serres, Julia

2010-03-01

Plants consist of distinct cell types distinguished by position, morphological features and metabolic activities. We recently developed a method to extract cell-type specific mRNA populations by immunopurification of ribosome-associated mRNAs. Microarray profiles of 21 cell-specific mRNA populations from seedling roots and shoots comprise the Arabidopsis Translatome dataset. This gene expression atlas provides a new tool for the study of cell-specific processes. Here we provide an example of how genes involved in a pathway limited to one or few cell-types can be further characterized and new candidate genes can be predicted. Cells of the root endodermis produce suberin as an inner barrier between the cortex and stele, whereas the shoot epidermal cells form cutin as a barrier to the external environment. Both polymers consist of fatty acid derivates, and share biosynthetic origins. We use the Arabidopsis Translatome dataset to demonstrate the significant cell-specific expression patterns of genes involved in those biosynthetic processes and suggest new candidate genes in the biosynthesis of suberin and cutin.

Classification of Genes and Putative Biomarker Identification Using Distribution Metrics on Expression Profiles

PubMed Central

Huang, Hung-Chung; Jupiter, Daniel; VanBuren, Vincent

2010-01-01

Background Identification of genes with switch-like properties will facilitate discovery of regulatory mechanisms that underlie these properties, and will provide knowledge for the appropriate application of Boolean networks in gene regulatory models. As switch-like behavior is likely associated with tissue-specific expression, these gene products are expected to be plausible candidates as tissue-specific biomarkers. Methodology/Principal Findings In a systematic classification of genes and search for biomarkers, gene expression profiles (GEPs) of more than 16,000 genes from 2,145 mouse array samples were analyzed. Four distribution metrics (mean, standard deviation, kurtosis and skewness) were used to classify GEPs into four categories: predominantly-off, predominantly-on, graded (rheostatic), and switch-like genes. The arrays under study were also grouped and examined by tissue type. For example, arrays were categorized as ‘brain group’ and ‘non-brain group’; the Kolmogorov-Smirnov distance and Pearson correlation coefficient were then used to compare GEPs between brain and non-brain for each gene. We were thus able to identify tissue-specific biomarker candidate genes. Conclusions/Significance The methodology employed here may be used to facilitate disease-specific biomarker discovery. PMID:20140228

Outlier Analysis Defines Zinc Finger Gene Family DNA Methylation in Tumors and Saliva of Head and Neck Cancer Patients.

PubMed

Gaykalova, Daria A; Vatapalli, Rajita; Wei, Yingying; Tsai, Hua-Ling; Wang, Hao; Zhang, Chi; Hennessey, Patrick T; Guo, Theresa; Tan, Marietta; Li, Ryan; Ahn, Julie; Khan, Zubair; Westra, William H; Bishop, Justin A; Zaboli, David; Koch, Wayne M; Khan, Tanbir; Ochs, Michael F; Califano, Joseph A

2015-01-01

Head and Neck Squamous Cell Carcinoma (HNSCC) is the fifth most common cancer, annually affecting over half a million people worldwide. Presently, there are no accepted biomarkers for clinical detection and surveillance of HNSCC. In this work, a comprehensive genome-wide analysis of epigenetic alterations in primary HNSCC tumors was employed in conjunction with cancer-specific outlier statistics to define novel biomarker genes which are differentially methylated in HNSCC. The 37 identified biomarker candidates were top-scoring outlier genes with prominent differential methylation in tumors, but with no signal in normal tissues. These putative candidates were validated in independent HNSCC cohorts from our institution and TCGA (The Cancer Genome Atlas). Using the top candidates, ZNF14, ZNF160, and ZNF420, an assay was developed for detection of HNSCC cancer in primary tissue and saliva samples with 100% specificity when compared to normal control samples. Given the high detection specificity, the analysis of ZNF DNA methylation in combination with other DNA methylation biomarkers may be useful in the clinical setting for HNSCC detection and surveillance, particularly in high-risk patients. Several additional candidates identified through this work can be further investigated toward future development of a multi-gene panel of biomarkers for the surveillance and detection of HNSCC.

A Stratified Transcriptomics Analysis of Polygenic Fat and Lean Mouse Adipose Tissues Identifies Novel Candidate Obesity Genes

PubMed Central

Morton, Nicholas M.; Nelson, Yvonne B.; Michailidou, Zoi; Di Rollo, Emma M.; Ramage, Lynne; Hadoke, Patrick W. F.; Seckl, Jonathan R.; Bunger, Lutz; Horvat, Simon; Kenyon, Christopher J.; Dunbar, Donald R.

2011-01-01

Background Obesity and metabolic syndrome results from a complex interaction between genetic and environmental factors. In addition to brain-regulated processes, recent genome wide association studies have indicated that genes highly expressed in adipose tissue affect the distribution and function of fat and thus contribute to obesity. Using a stratified transcriptome gene enrichment approach we attempted to identify adipose tissue-specific obesity genes in the unique polygenic Fat (F) mouse strain generated by selective breeding over 60 generations for divergent adiposity from a comparator Lean (L) strain. Results To enrich for adipose tissue obesity genes a ‘snap-shot’ pooled-sample transcriptome comparison of key fat depots and non adipose tissues (muscle, liver, kidney) was performed. Known obesity quantitative trait loci (QTL) information for the model allowed us to further filter genes for increased likelihood of being causal or secondary for obesity. This successfully identified several genes previously linked to obesity (C1qr1, and Np3r) as positional QTL candidate genes elevated specifically in F line adipose tissue. A number of novel obesity candidate genes were also identified (Thbs1, Ppp1r3d, Tmepai, Trp53inp2, Ttc7b, Tuba1a, Fgf13, Fmr) that have inferred roles in fat cell function. Quantitative microarray analysis was then applied to the most phenotypically divergent adipose depot after exaggerating F and L strain differences with chronic high fat feeding which revealed a distinct gene expression profile of line, fat depot and diet-responsive inflammatory, angiogenic and metabolic pathways. Selected candidate genes Npr3 and Thbs1, as well as Gys2, a non-QTL gene that otherwise passed our enrichment criteria were characterised, revealing novel functional effects consistent with a contribution to obesity. Conclusions A focussed candidate gene enrichment strategy in the unique F and L model has identified novel adipose tissue-enriched genes contributing to obesity. PMID:21915269

A stratified transcriptomics analysis of polygenic fat and lean mouse adipose tissues identifies novel candidate obesity genes.

PubMed

Morton, Nicholas M; Nelson, Yvonne B; Michailidou, Zoi; Di Rollo, Emma M; Ramage, Lynne; Hadoke, Patrick W F; Seckl, Jonathan R; Bunger, Lutz; Horvat, Simon; Kenyon, Christopher J; Dunbar, Donald R

2011-01-01

Obesity and metabolic syndrome results from a complex interaction between genetic and environmental factors. In addition to brain-regulated processes, recent genome wide association studies have indicated that genes highly expressed in adipose tissue affect the distribution and function of fat and thus contribute to obesity. Using a stratified transcriptome gene enrichment approach we attempted to identify adipose tissue-specific obesity genes in the unique polygenic Fat (F) mouse strain generated by selective breeding over 60 generations for divergent adiposity from a comparator Lean (L) strain. To enrich for adipose tissue obesity genes a 'snap-shot' pooled-sample transcriptome comparison of key fat depots and non adipose tissues (muscle, liver, kidney) was performed. Known obesity quantitative trait loci (QTL) information for the model allowed us to further filter genes for increased likelihood of being causal or secondary for obesity. This successfully identified several genes previously linked to obesity (C1qr1, and Np3r) as positional QTL candidate genes elevated specifically in F line adipose tissue. A number of novel obesity candidate genes were also identified (Thbs1, Ppp1r3d, Tmepai, Trp53inp2, Ttc7b, Tuba1a, Fgf13, Fmr) that have inferred roles in fat cell function. Quantitative microarray analysis was then applied to the most phenotypically divergent adipose depot after exaggerating F and L strain differences with chronic high fat feeding which revealed a distinct gene expression profile of line, fat depot and diet-responsive inflammatory, angiogenic and metabolic pathways. Selected candidate genes Npr3 and Thbs1, as well as Gys2, a non-QTL gene that otherwise passed our enrichment criteria were characterised, revealing novel functional effects consistent with a contribution to obesity. A focussed candidate gene enrichment strategy in the unique F and L model has identified novel adipose tissue-enriched genes contributing to obesity.

[Stability analysis of reference gene based on real-time PCR in Artemisia annua under cadmium treatment].

PubMed

Zhou, Liang-Yun; Mo, Ge; Wang, Sheng; Tang, Jin-Fu; Yue, Hong; Huang, Lu-Qi; Shao, Ai-Juan; Guo, Lan-Ping

2014-03-01

In this study, Actin, 18S rRNA, PAL, GAPDH and CPR of Artemisia annua were selected as candidate reference genes, and their gene-specific primers for real-time PCR were designed, then geNorm, NormFinder, BestKeeper, Delta CT and RefFinder were used to evaluate their expression stability in the leaves of A. annua under treatment of different concentrations of Cd, with the purpose of finding a reliable reference gene to ensure the reliability of gene-expression analysis. The results showed that there were some significant differences among the candidate reference genes under different treatments and the order of expression stability of candidate reference gene was Actin > 18S rRNA > PAL > GAPDH > CPR. These results suggested that Actin, 18S rRNA and PAL could be used as ideal reference genes of gene expression analysis in A. annua and multiple internal control genes were adopted for results calibration. In addition, differences in expression stability of candidate reference genes in the leaves of A. annua under the same concentrations of Cd were observed, which suggested that the screening of candidate reference genes was needed even under the same treatment. To our best knowledge, this study for the first time provided the ideal reference genes under Cd treatment in the leaves of A. annua and offered reference for the gene expression analysis of A. annua under other conditions.

Single nucleotide polymorphisms in specific candidate genes are associated with phenotypic differences in days open for first lactation in Holstein cows

USDA-ARS?s Scientific Manuscript database

Previously, a candidate gene approach identified 51 single nucleotide polymorphisms (SNP) associated with genetic merit for reproductive traits and 26 associated with genetic merit for production in dairy bulls. We evaluated association of the 77 SNPs with days open (DO) for first lactation in a pop...

LOD score exclusion analyses for candidate genes using random population samples.

PubMed

Deng, H W; Li, J; Recker, R R

2001-05-01

While extensive analyses have been conducted to test for, no formal analyses have been conducted to test against, the importance of candidate genes with random population samples. We develop a LOD score approach for exclusion analyses of candidate genes with random population samples. Under this approach, specific genetic effects and inheritance models at candidate genes can be analysed and if a LOD score is < or = - 2.0, the locus can be excluded from having an effect larger than that specified. Computer simulations show that, with sample sizes often employed in association studies, this approach has high power to exclude a gene from having moderate genetic effects. In contrast to regular association analyses, population admixture will not affect the robustness of our analyses; in fact, it renders our analyses more conservative and thus any significant exclusion result is robust. Our exclusion analysis complements association analysis for candidate genes in random population samples and is parallel to the exclusion mapping analyses that may be conducted in linkage analyses with pedigrees or relative pairs. The usefulness of the approach is demonstrated by an application to test the importance of vitamin D receptor and estrogen receptor genes underlying the differential risk to osteoporotic fractures.

Non-coding cancer driver candidates identified with a sample- and position-specific model of the somatic mutation rate

PubMed Central

Juul, Malene; Bertl, Johanna; Guo, Qianyun; Nielsen, Morten Muhlig; Świtnicki, Michał; Hornshøj, Henrik; Madsen, Tobias; Hobolth, Asger; Pedersen, Jakob Skou

2017-01-01

Non-coding mutations may drive cancer development. Statistical detection of non-coding driver regions is challenged by a varying mutation rate and uncertainty of functional impact. Here, we develop a statistically founded non-coding driver-detection method, ncdDetect, which includes sample-specific mutational signatures, long-range mutation rate variation, and position-specific impact measures. Using ncdDetect, we screened non-coding regulatory regions of protein-coding genes across a pan-cancer set of whole-genomes (n = 505), which top-ranked known drivers and identified new candidates. For individual candidates, presence of non-coding mutations associates with altered expression or decreased patient survival across an independent pan-cancer sample set (n = 5454). This includes an antigen-presenting gene (CD1A), where 5’UTR mutations correlate significantly with decreased survival in melanoma. Additionally, mutations in a base-excision-repair gene (SMUG1) correlate with a C-to-T mutational-signature. Overall, we find that a rich model of mutational heterogeneity facilitates non-coding driver identification and integrative analysis points to candidates of potential clinical relevance. DOI: http://dx.doi.org/10.7554/eLife.21778.001 PMID:28362259

Photoreceptor dysplasia (pd) in miniature schnauzer dogs: evaluation of candidate genes by molecular genetic analysis.

PubMed

Zhang, Q; Baldwin, V J; Acland, G M; Parshall, C J; Haskel, J; Aguirre, G D; Ray, K

1999-01-01

Photoreceptor dysplasia (pd) is one of a group of at least six distinct autosomal and one X-linked retinal disorders identified in dogs which are collectively known as progressive retinal atrophy (PRA). It is an early onset retinal disease identified in miniature schnauzer dogs, and pedigree analysis and breeding studies have established autosomal recessive inheritance of the disease. Using a gene-based approach, a number of retina-expressed genes, including some members of the phototransduction pathway, have been causally implicated in retinal diseases of humans and other animals. Here we examined seven such potential candidate genes (opsin, RDS/peripherin, ROM1, rod cGMP-gated cation channel alpha-subunit, and three subunits of transducin) for their causal association with the pd locus by testing segregation of intragenic markers with the disease locus, or, in the absence of informative polymorphisms, sequencing of the coding regions of the genes. Based on these results, we have conclusively excluded four photoreceptor-specific genes as candidates for pd by linkage analysis. For three other photoreceptor-specific genes, we did not find any mutation in the coding sequences of the genes and have excluded them provisionally. Formal exclusion would require investigation of the levels of expression of the candidate genes in pd-affected dogs relative to age-matched controls. At present we are building suitable informative pedigrees for the disease locus with a sufficient number of meiosis to be useful for genomewide screening. This should identify markers linked to the disease locus and eventually permit progress toward the identification of the photoreceptor dysplasia gene and the disease-causing mutation.

Phenoscape: Identifying Candidate Genes for Evolutionary Phenotypes

PubMed Central

Edmunds, Richard C.; Su, Baofeng; Balhoff, James P.; Eames, B. Frank; Dahdul, Wasila M.; Lapp, Hilmar; Lundberg, John G.; Vision, Todd J.; Dunham, Rex A.; Mabee, Paula M.; Westerfield, Monte

2016-01-01

Phenotypes resulting from mutations in genetic model organisms can help reveal candidate genes for evolutionarily important phenotypic changes in related taxa. Although testing candidate gene hypotheses experimentally in nonmodel organisms is typically difficult, ontology-driven information systems can help generate testable hypotheses about developmental processes in experimentally tractable organisms. Here, we tested candidate gene hypotheses suggested by expert use of the Phenoscape Knowledgebase, specifically looking for genes that are candidates responsible for evolutionarily interesting phenotypes in the ostariophysan fishes that bear resemblance to mutant phenotypes in zebrafish. For this, we searched ZFIN for genetic perturbations that result in either loss of basihyal element or loss of scales phenotypes, because these are the ancestral phenotypes observed in catfishes (Siluriformes). We tested the identified candidate genes by examining their endogenous expression patterns in the channel catfish, Ictalurus punctatus. The experimental results were consistent with the hypotheses that these features evolved through disruption in developmental pathways at, or upstream of, brpf1 and eda/edar for the ancestral losses of basihyal element and scales, respectively. These results demonstrate that ontological annotations of the phenotypic effects of genetic alterations in model organisms, when aggregated within a knowledgebase, can be used effectively to generate testable, and useful, hypotheses about evolutionary changes in morphology. PMID:26500251

Islander: A database of precisely mapped genomic islands in tRNA and tmRNA genes

DOE PAGES

Hudson, Corey M.; Lau, Britney Y.; Williams, Kelly P.

2014-11-05

Genomic islands are mobile DNAs that are major agents of bacterial and archaeal evolution. Integration into prokaryotic chromosomes usually occurs site-specifically at tRNA or tmRNA gene (together, tDNA) targets, catalyzed by tyrosine integrases. This splits the target gene, yet sequences within the island restore the disrupted gene; the regenerated target and its displaced fragment precisely mark the endpoints of the island. We applied this principle to search for islands in genomic DNA sequences. Our algorithm identifies tDNAs, finds fragments of those tDNAs in the same replicon and removes unlikely candidate islands through a series of filters. A search for islandsmore » in 2168 whole prokaryotic genomes produced 3919 candidates. The website Islander (recently moved to http://bioinformatics.sandia.gov/islander/) presents these precisely mapped candidate islands, the gene content and the island sequence. The algorithm further insists that each island encode an integrase, and attachment site sequence identity is carefully noted; therefore, the database also serves in the study of integrase site-specificity and its evolution.« less

Convergence of genome-wide association and candidate gene studies for alcoholism.

PubMed

Olfson, Emily; Bierut, Laura Jean

2012-12-01

Genome-wide association (GWA) studies have led to a paradigm shift in how researchers study the genetics underlying disease. Many GWA studies are now publicly available and can be used to examine whether or not previously proposed candidate genes are supported by GWA data. This approach is particularly important for the field of alcoholism because the contribution of many candidate genes remains controversial. Using the Human Genome Epidemiology (HuGE) Navigator, we selected candidate genes for alcoholism that have been frequently examined in scientific articles in the past decade. Specific candidate loci as well as all the reported single nucleotide polymorphisms (SNPs) in candidate genes were examined in the Study of Addiction: Genetics and Environment (SAGE), a GWA study comparing alcohol-dependent and nondependent subjects. Several commonly reported candidate loci, including rs1800497 in DRD2, rs698 in ADH1C, rs1799971 in OPRM1, and rs4680 in COMT, are not replicated in SAGE (p > 0.05). Among candidate loci available for analysis, only rs279858 in GABRA2 (p = 0.0052, OR = 1.16) demonstrated a modest association. Examination of all SNPs reported in SAGE in over 50 candidate genes revealed no SNPs with large frequency differences between cases and controls, and the lowest p-value of any SNP was 0.0006. We provide evidence that several extensively studied candidate loci do not have a strong contribution to risk of developing alcohol dependence in European and African ancestry populations. Owing to the lack of coverage, we were unable to rule out the contribution of other variants, and these genes and particular loci warrant further investigation. Our analysis demonstrates that publicly available GWA results can be used to better understand which if any of previously proposed candidate genes contribute to disease. Furthermore, we illustrate how examining the convergence of candidate gene and GWA studies can help elucidate the genetic architecture of alcoholism and more generally complex diseases. Copyright © 2012 by the Research Society on Alcoholism.

Inheritance of partial resistance against Colletotrichum lindemuthianum in Phaseolus vulgaris and co-localization of quantitative trait loci with genes involved in specific resistance.

PubMed

Geffroy, V; Sévignac, M; De Oliveira, J C; Fouilloux, G; Skroch, P; Thoquet, P; Gepts, P; Langin, T; Dron, M

2000-03-01

Anthracnose, one of the most important diseases of common bean (Phaseolus vulgaris), is caused by the fungus Colletotrichum lindemuthianum. A "candidate gene" approach was used to map anthracnose resistance quantitative trait loci (QTL). Candidate genes included genes for both pathogen recognition (resistance genes and resistance gene analogs [RGAs]) and general plant defense (defense response genes). Two strains of C. lindemuthianum, identified in a world collection of 177 strains, displayed a reproducible and differential aggressiveness toward BAT93 and JaloEEP558, two parental lines of P. vulgaris representing the two major gene pools of this crop. A reliable test was developed to score partial resistance in aerial organs of the plant (stem, leaf, petiole) under controlled growth chamber conditions. BAT93 was more resistant than JaloEEP558 regardless of the organ or strain tested. With a recombinant inbred line (RIL) population derived from a cross between these two parental lines, 10 QTL were located on a genetic map harboring 143 markers, including known defense response genes, anthracnose-specific resistance genes, and RGAs. Eight of the QTL displayed isolate specificity. Two were co-localized with known defense genes (phenylalanine ammonia-lyase and hydroxyproline-rich glycoprotein) and three with anthracnose-specific resistance genes and/or RGAs. Interestingly, two QTL, with different allelic contribution, mapped on linkage group B4 in a 5.0 cM interval containing Andean and Mesoamerican specific resistance genes against C. lindemuthianum and 11 polymorphic fragments revealed with a RGA probe. The possible relationship between genes underlying specific and partial resistance is discussed.

The Terpene Synthase Gene Family of Carrot (Daucus carota L.): Identification of QTLs and Candidate Genes Associated with Terpenoid Volatile Compounds

PubMed Central

Keilwagen, Jens; Lehnert, Heike; Berner, Thomas; Budahn, Holger; Nothnagel, Thomas; Ulrich, Detlef; Dunemann, Frank

2017-01-01

Terpenes are an important group of secondary metabolites in carrots influencing taste and flavor, and some of them might also play a role as bioactive substances with an impact on human physiology and health. Understanding the genetic and molecular basis of terpene synthases (TPS) involved in the biosynthesis of volatile terpenoids will provide insights for improving breeding strategies aimed at quality traits and for developing specific carrot chemotypes possibly useful for pharmaceutical applications. Hence, a combination of terpene metabolite profiling, genotyping-by-sequencing (GBS), and genome-wide association study (GWAS) was used in this work to get insights into the genetic control of terpene biosynthesis in carrots and to identify several TPS candidate genes that might be involved in the production of specific monoterpenes. In a panel of 85 carrot cultivars and accessions, metabolite profiling was used to identify 31 terpenoid volatile organic compounds (VOCs) in carrot leaves and roots, and a GBS approach was used to provide dense genome-wide marker coverage (>168,000 SNPs). Based on this data, a total of 30 quantitative trait loci (QTLs) was identified for 15 terpenoid volatiles. Most QTLs were detected for the monoterpene compounds ocimene, sabinene, β-pinene, borneol and bornyl acetate. We identified four genomic regions on three different carrot chromosomes by GWAS which are both associated with high significance (LOD ≥ 5.91) to distinct monoterpenes and to TPS candidate genes, which have been identified by homology-based gene prediction utilizing RNA-seq data. In total, 65 TPS candidate gene models in carrot were identified and assigned to known plant TPS subfamilies with the exception of TPS-d and TPS-h. TPS-b was identified as largest subfamily with 32 TPS candidate genes. PMID:29170675

Candidate innate immune system gene expression in the ecological model Daphnia

PubMed Central

Decaestecker, Ellen; Labbé, Pierrick; Ellegaard, Kirsten; Allen, Judith E.; Little, Tom J.

2011-01-01

The last ten years have witnessed increasing interest in host–pathogen interactions involving invertebrate hosts. The invertebrate innate immune system is now relatively well characterised, but in a limited range of genetic model organisms and under a limited number of conditions. Immune systems have been little studied under real-world scenarios of environmental variation and parasitism. Thus, we have investigated expression of candidate innate immune system genes in the water flea Daphnia, a model organism for ecological genetics, and whose capacity for clonal reproduction facilitates an exceptionally rigorous control of exposure dose or the study of responses at many time points. A unique characteristic of the particular Daphnia clones and pathogen strain combinations used presently is that they have been shown to be involved in specific host–pathogen coevolutionary interactions in the wild. We choose five genes, which are strong candidates to be involved in Daphnia–pathogen interactions, given that they have been shown to code for immune effectors in related organisms. Differential expression of these genes was quantified by qRT-PCR following exposure to the bacterial pathogen Pasteuria ramosa. Constitutive expression levels differed between host genotypes, and some genes appeared to show correlated expression. However, none of the genes appeared to show a major modification of expression level in response to Pasteuria exposure. By applying knowledge from related genetic model organisms (e.g. Drosophila) to models for the study of evolutionary ecology and coevolution (i.e. Daphnia), the candidate gene approach is temptingly efficient. However, our results show that detection of only weak patterns is likely if one chooses target genes for study based on previously identified genome sequences by comparison to homologues from other related organisms. Future work on the Daphnia–Pasteuria system will need to balance a candidate gene approach with more comprehensive approaches to de novo identify immune system genes specific to the Daphnia–Pasteuria interaction. PMID:21550363

Candidate innate immune system gene expression in the ecological model Daphnia.

PubMed

Decaestecker, Ellen; Labbé, Pierrick; Ellegaard, Kirsten; Allen, Judith E; Little, Tom J

2011-10-01

The last ten years have witnessed increasing interest in host-pathogen interactions involving invertebrate hosts. The invertebrate innate immune system is now relatively well characterised, but in a limited range of genetic model organisms and under a limited number of conditions. Immune systems have been little studied under real-world scenarios of environmental variation and parasitism. Thus, we have investigated expression of candidate innate immune system genes in the water flea Daphnia, a model organism for ecological genetics, and whose capacity for clonal reproduction facilitates an exceptionally rigorous control of exposure dose or the study of responses at many time points. A unique characteristic of the particular Daphnia clones and pathogen strain combinations used presently is that they have been shown to be involved in specific host-pathogen coevolutionary interactions in the wild. We choose five genes, which are strong candidates to be involved in Daphnia-pathogen interactions, given that they have been shown to code for immune effectors in related organisms. Differential expression of these genes was quantified by qRT-PCR following exposure to the bacterial pathogen Pasteuria ramosa. Constitutive expression levels differed between host genotypes, and some genes appeared to show correlated expression. However, none of the genes appeared to show a major modification of expression level in response to Pasteuria exposure. By applying knowledge from related genetic model organisms (e.g. Drosophila) to models for the study of evolutionary ecology and coevolution (i.e. Daphnia), the candidate gene approach is temptingly efficient. However, our results show that detection of only weak patterns is likely if one chooses target genes for study based on previously identified genome sequences by comparison to homologues from other related organisms. Future work on the Daphnia-Pasteuria system will need to balance a candidate gene approach with more comprehensive approaches to de novo identify immune system genes specific to the Daphnia-Pasteuria interaction. Copyright © 2011 Elsevier Ltd. All rights reserved.

The cld mutation: narrowing the critical chromosomal region and selecting candidate genes.

PubMed

Péterfy, Miklós; Mao, Hui Z; Doolittle, Mark H

2006-10-01

Combined lipase deficiency (cld) is a recessive, lethal mutation specific to the tw73 haplotype on mouse Chromosome 17. While the cld mutation results in lipase proteins that are inactive, aggregated, and retained in the endoplasmic reticulum (ER), it maps separately from the lipase structural genes. We have narrowed the gene critical region by about 50% using the tw18 haplotype for deletion mapping and a recombinant chromosome used originally to map cld with respect to the phenotypic marker tf. The region now extends from 22 to 25.6 Mbp on the wild-type chromosome, currently containing 149 genes and 50 expressed sequence tags (ESTs). To identify the affected gene, we have selected candidates based on their known role in associated biological processes, cellular components, and molecular functions that best fit with the predicted function of the cld gene. A secondary approach was based on differences in mRNA levels between mutant (cld/cld) and unaffected (+/cld) cells. Using both approaches, we have identified seven functional candidates with an ER localization and/or an involvement in protein maturation and folding that could explain the lipase deficiency, and six expression candidates that exhibit large differences in mRNA levels between mutant and unaffected cells. Significantly, two genes were found to be candidates with regard to both function and expression, thus emerging as the strongest candidates for cld. We discuss the implications of our mapping results and our selection of candidates with respect to other genes, deletions, and mutations occurring in the cld critical region.

Dissecting the organ specificity of insecticide resistance candidate genes in Anopheles gambiae: known and novel candidate genes.

PubMed

Ingham, Victoria A; Jones, Christopher M; Pignatelli, Patricia; Balabanidou, Vasileia; Vontas, John; Wagstaff, Simon C; Moore, Jonathan D; Ranson, Hilary

2014-11-25

The elevated expression of enzymes with insecticide metabolism activity can lead to high levels of insecticide resistance in the malaria vector, Anopheles gambiae. In this study, adult female mosquitoes from an insecticide susceptible and resistant strain were dissected into four different body parts. RNA from each of these samples was used in microarray analysis to determine the enrichment patterns of the key detoxification gene families within the mosquito and to identify additional candidate insecticide resistance genes that may have been overlooked in previous experiments on whole organisms. A general enrichment in the transcription of genes from the four major detoxification gene families (carboxylesterases, glutathione transferases, UDP glucornyltransferases and cytochrome P450s) was observed in the midgut and malpighian tubules. Yet the subset of P450 genes that have previously been implicated in insecticide resistance in An gambiae, show a surprisingly varied profile of tissue enrichment, confirmed by qPCR and, for three candidates, by immunostaining. A stringent selection process was used to define a list of 105 genes that are significantly (p ≤0.001) over expressed in body parts from the resistant versus susceptible strain. Over half of these, including all the cytochrome P450s on this list, were identified in previous whole organism comparisons between the strains, but several new candidates were detected, notably from comparisons of the transcriptomes from dissected abdomen integuments. The use of RNA extracted from the whole organism to identify candidate insecticide resistance genes has a risk of missing candidates if key genes responsible for the phenotype have restricted expression within the body and/or are over expression only in certain tissues. However, as transcription of genes implicated in metabolic resistance to insecticides is not enriched in any one single organ, comparison of the transcriptome of individual dissected body parts cannot be recommended as a preferred means to identify new candidate insecticide resistant genes. Instead the rich data set on in vivo sites of transcription should be consulted when designing follow up qPCR validation steps, or for screening known candidates in field populations.

Genes contributing to the development of alcoholism: an overview.

PubMed

Edenberg, Howard J

2012-01-01

Genetic factors (i.e., variations in specific genes) account for a substantial portion of the risk for alcoholism. However, identifying those genes and the specific variations involved is challenging. Researchers have used both case-control and family studies to identify genes related to alcoholism risk. In addition, different strategies such as candidate gene analyses and genome-wide association studies have been used. The strongest effects have been found for specific variants of genes that encode two enzymes involved in alcohol metabolism-alcohol dehydrogenase and aldehyde dehydrogenase. Accumulating evidence indicates that variations in numerous other genes have smaller but measurable effects.

Computational exploration of cis-regulatory modules in rhythmic expression data using the "Exploration of Distinctive CREs and CRMs" (EDCC) and "CRM Network Generator" (CNG) programs.

PubMed

Bekiaris, Pavlos Stephanos; Tekath, Tobias; Staiger, Dorothee; Danisman, Selahattin

2018-01-01

Understanding the effect of cis-regulatory elements (CRE) and clusters of CREs, which are called cis-regulatory modules (CRM), in eukaryotic gene expression is a challenge of computational biology. We developed two programs that allow simple, fast and reliable analysis of candidate CREs and CRMs that may affect specific gene expression and that determine positional features between individual CREs within a CRM. The first program, "Exploration of Distinctive CREs and CRMs" (EDCC), correlates candidate CREs and CRMs with specific gene expression patterns. For pairs of CREs, EDCC also determines positional preferences of the single CREs in relation to each other and to the transcriptional start site. The second program, "CRM Network Generator" (CNG), prioritizes these positional preferences using a neural network and thus allows unbiased rating of the positional preferences that were determined by EDCC. We tested these programs with data from a microarray study of circadian gene expression in Arabidopsis thaliana. Analyzing more than 1.5 million pairwise CRE combinations, we found 22 candidate combinations, of which several contained known clock promoter elements together with elements that had not been identified as relevant to circadian gene expression before. CNG analysis further identified positional preferences of these CRE pairs, hinting at positional information that may be relevant for circadian gene expression. Future wet lab experiments will have to determine which of these combinations confer daytime specific circadian gene expression.

Computational exploration of cis-regulatory modules in rhythmic expression data using the “Exploration of Distinctive CREs and CRMs” (EDCC) and “CRM Network Generator” (CNG) programs

PubMed Central

Staiger, Dorothee

2018-01-01

Understanding the effect of cis-regulatory elements (CRE) and clusters of CREs, which are called cis-regulatory modules (CRM), in eukaryotic gene expression is a challenge of computational biology. We developed two programs that allow simple, fast and reliable analysis of candidate CREs and CRMs that may affect specific gene expression and that determine positional features between individual CREs within a CRM. The first program, “Exploration of Distinctive CREs and CRMs” (EDCC), correlates candidate CREs and CRMs with specific gene expression patterns. For pairs of CREs, EDCC also determines positional preferences of the single CREs in relation to each other and to the transcriptional start site. The second program, “CRM Network Generator” (CNG), prioritizes these positional preferences using a neural network and thus allows unbiased rating of the positional preferences that were determined by EDCC. We tested these programs with data from a microarray study of circadian gene expression in Arabidopsis thaliana. Analyzing more than 1.5 million pairwise CRE combinations, we found 22 candidate combinations, of which several contained known clock promoter elements together with elements that had not been identified as relevant to circadian gene expression before. CNG analysis further identified positional preferences of these CRE pairs, hinting at positional information that may be relevant for circadian gene expression. Future wet lab experiments will have to determine which of these combinations confer daytime specific circadian gene expression. PMID:29298348

Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children.

PubMed

Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A

2015-10-01

The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.

Schizophrenia, vitamin D, and brain development.

PubMed

Mackay-Sim, Alan; Féron, François; Eyles, Darryl; Burne, Thomas; McGrath, John

2004-01-01

Schizophrenia research is invigorated at present by the recent discovery of several plausible candidate susceptibility genes identified from genetic linkage and gene expression studies of brains from persons with schizophrenia. It is a current challenge to reconcile this gathering evidence for specific candidate susceptibility genes with the "neurodevelopmental hypothesis," which posits that schizophrenia arises from gene-environment interactions that disrupt brain development. We make the case here that schizophrenia may result not from numerous genes of small effect, but a few genes of transcriptional regulation acting during brain development. In particular we propose that low vitamin D during brain development interacts with susceptibility genes to alter the trajectory of brain development, probably by epigenetic regulation that alters gene expression throughout adult life. Vitamin D is an attractive "environmental" candidate because it appears to explain several key epidemiological features of schizophrenia. Vitamin D is an attractive "genetic" candidate because its nuclear hormone receptor regulates gene expression and nervous system development. The polygenic quality of schizophrenia, with linkage to many genes of small effect, maybe brought together via this "vitamin D hypothesis." We also discuss the possibility of a broader set of environmental and genetic factors interacting via the nuclear hormone receptors to affect the development of the brain leading to schizophrenia.

Multi-Dimensional Prioritization of Dental Caries Candidate Genes and Its Enriched Dense Network Modules

PubMed Central

Wang, Quan; Jia, Peilin; Cuenco, Karen T.; Feingold, Eleanor; Marazita, Mary L.; Wang, Lily; Zhao, Zhongming

2013-01-01

A number of genetic studies have suggested numerous susceptibility genes for dental caries over the past decade with few definite conclusions. The rapid accumulation of relevant information, along with the complex architecture of the disease, provides a challenging but also unique opportunity to review and integrate the heterogeneous data for follow-up validation and exploration. In this study, we collected and curated candidate genes from four major categories: association studies, linkage scans, gene expression analyses, and literature mining. Candidate genes were prioritized according to the magnitude of evidence related to dental caries. We then searched for dense modules enriched with the prioritized candidate genes through their protein-protein interactions (PPIs). We identified 23 modules comprising of 53 genes. Functional analyses of these 53 genes revealed three major clusters: cytokine network relevant genes, matrix metalloproteinases (MMPs) family, and transforming growth factor-beta (TGF-β) family, all of which have been previously implicated to play important roles in tooth development and carious lesions. Through our extensive data collection and an integrative application of gene prioritization and PPI network analyses, we built a dental caries-specific sub-network for the first time. Our study provided insights into the molecular mechanisms underlying dental caries. The framework we proposed in this work can be applied to other complex diseases. PMID:24146904

In Silico Gene Prioritization by Integrating Multiple Data Sources

PubMed Central

Zhou, Yingyao; Shields, Robert; Chanda, Sumit K.; Elston, Robert C.; Li, Jing

2011-01-01

Identifying disease genes is crucial to the understanding of disease pathogenesis, and to the improvement of disease diagnosis and treatment. In recent years, many researchers have proposed approaches to prioritize candidate genes by considering the relationship of candidate genes and existing known disease genes, reflected in other data sources. In this paper, we propose an expandable framework for gene prioritization that can integrate multiple heterogeneous data sources by taking advantage of a unified graphic representation. Gene-gene relationships and gene-disease relationships are then defined based on the overall topology of each network using a diffusion kernel measure. These relationship measures are in turn normalized to derive an overall measure across all networks, which is utilized to rank all candidate genes. Based on the informativeness of available data sources with respect to each specific disease, we also propose an adaptive threshold score to select a small subset of candidate genes for further validation studies. We performed large scale cross-validation analysis on 110 disease families using three data sources. Results have shown that our approach consistently outperforms other two state of the art programs. A case study using Parkinson disease (PD) has identified four candidate genes (UBB, SEPT5, GPR37 and TH) that ranked higher than our adaptive threshold, all of which are involved in the PD pathway. In particular, a very recent study has observed a deletion of TH in a patient with PD, which supports the importance of the TH gene in PD pathogenesis. A web tool has been implemented to assist scientists in their genetic studies. PMID:21731658

Comparative Transcriptional Profiling of the Axolotl Limb Identifies a Tripartite Regeneration-Specific Gene Program

PubMed Central

Knapp, Dunja; Schulz, Herbert; Rascon, Cynthia Alexander; Volkmer, Michael; Scholz, Juliane; Nacu, Eugen; Le, Mu; Novozhilov, Sergey; Tazaki, Akira; Protze, Stephanie; Jacob, Tina; Hubner, Norbert; Habermann, Bianca; Tanaka, Elly M.

2013-01-01

Understanding how the limb blastema is established after the initial wound healing response is an important aspect of regeneration research. Here we performed parallel expression profile time courses of healing lateral wounds versus amputated limbs in axolotl. This comparison between wound healing and regeneration allowed us to identify amputation-specific genes. By clustering the expression profiles of these samples, we could detect three distinguishable phases of gene expression – early wound healing followed by a transition-phase leading to establishment of the limb development program, which correspond to the three phases of limb regeneration that had been defined by morphological criteria. By focusing on the transition-phase, we identified 93 strictly amputation-associated genes many of which are implicated in oxidative-stress response, chromatin modification, epithelial development or limb development. We further classified the genes based on whether they were or were not significantly expressed in the developing limb bud. The specific localization of 53 selected candidates within the blastema was investigated by in situ hybridization. In summary, we identified a set of genes that are expressed specifically during regeneration and are therefore, likely candidates for the regulation of blastema formation. PMID:23658691

A role for genetic susceptibility in sporadic focal segmental glomerulosclerosis

PubMed Central

Yu, Haiyang; Artomov, Mykyta; Brähler, Sebastian; Stander, M. Christine; Shamsan, Ghaidan; Sampson, Matthew G.; White, J. Michael; Kretzler, Matthias; Jain, Sanjay; Winkler, Cheryl A.; Mitra, Robi D.; Daly, Mark J.; Shaw, Andrey S.

2016-01-01

Focal segmental glomerulosclerosis (FSGS) is a syndrome that involves kidney podocyte dysfunction and causes chronic kidney disease. Multiple factors including chemical toxicity, inflammation, and infection underlie FSGS; however, highly penetrant disease genes have been identified in a small fraction of patients with a family history of FSGS. Variants of apolipoprotein L1 (APOL1) have been linked to FSGS in African Americans with HIV or hypertension, supporting the proposal that genetic factors enhance FSGS susceptibility. Here, we used sequencing to investigate whether genetics plays a role in the majority of FSGS cases that are identified as primary or sporadic FSGS and have no known cause. Given the limited number of biopsy-proven cases with ethnically matched controls, we devised an analytic strategy to identify and rank potential candidate genes and used an animal model for validation. Nine candidate FSGS susceptibility genes were identified in our patient cohort, and three were validated using a high-throughput mouse method that we developed. Specifically, we introduced a podocyte-specific, doxycycline-inducible transactivator into a murine embryonic stem cell line with an FSGS-susceptible genetic background that allows shRNA-mediated targeting of candidate genes in the adult kidney. Our analysis supports a broader role for genetic susceptibility of both sporadic and familial cases of FSGS and provides a tool to rapidly evaluate candidate FSGS-associated genes. PMID:26901816

Cross-Species Transcriptome Profiling Identifies New Alveolar Epithelial Type I Cell–Specific Genes

PubMed Central

Sunohara, Mitsuhiro; Pouldar, Tiffany M.; Wang, Hongjun; Liu, Yixin; Rieger, Megan E.; Tran, Evelyn; Flodby, Per; Siegmund, Kimberly D.; Crandall, Edward D.; Laird-Offringa, Ite A.

2017-01-01

Diseases involving the distal lung alveolar epithelium include chronic obstructive pulmonary disease, idiopathic pulmonary fibrosis, and lung adenocarcinoma. Accurate labeling of specific cell types is critical for determining the contribution of each to the pathogenesis of these diseases. The distal lung alveolar epithelium is composed of two cell types, alveolar epithelial type 1 (AT1) and type 2 (AT2) cells. Although cell type–specific markers, most prominently surfactant protein C, have allowed detailed lineage tracing studies of AT2 cell differentiation and the cells’ roles in disease, studies of AT1 cells have been hampered by a lack of genes with expression unique to AT1 cells. In this study, we performed genome-wide expression profiling of multiple rat organs together with purified rat AT2, AT1, and in vitro differentiated AT1-like cells, resulting in the identification of 54 candidate AT1 cell markers. Cross-referencing with genes up-regulated in human in vitro differentiated AT1-like cells narrowed the potential list to 18 candidate genes. Testing the top four candidate genes at RNA and protein levels revealed GRAM domain 2 (GRAMD2), a protein of unknown function, as highly specific to AT1 cells. RNA sequencing (RNAseq) confirmed that GRAMD2 is transcriptionally silent in human AT2 cells. Immunofluorescence verified that GRAMD2 expression is restricted to the plasma membrane of AT1 cells and is not expressed in bronchial epithelial cells, whereas reverse transcription–polymerase chain reaction confirmed that it is not expressed in endothelial cells. Using GRAMD2 as a new AT1 cell–specific gene will enhance AT1 cell isolation, the investigation of alveolar epithelial cell differentiation potential, and the contribution of AT1 cells to distal lung diseases. PMID:27749084

A Controlled Pharmacogenetic Trial of Sibutramine on Weight Loss and Body Composition in Obese or Overweight Adults

PubMed Central

Grudell, April B.M.; Sweetser, Seth; Camilleri, Michael; Eckert, Deborah J.; Vazquez-Roque, Maria I.; Carlson, Paula J.; Burton, Duane D.; Braddock, Autumn E.; Clark, Matthew M.; Graszer, Karen M.; Kalsy, Sarah A.; Zinsmeister, Alan R.

2008-01-01

Background/ Aim Weight loss in response to sibutramine is highly variable. We assessed the association of specific markers of polymorphisms of candidate a2A adrenoreceptor, 5-HT transporter and GNβ3 genes and weight loss with sibutramine. Methods We conducted a randomized, double-blind, pharmacogenetic study of behavioral therapy and sibutramine (10 or 15 mg daily) or placebo for 12 weeks in 181 overweight or obese participants. We measured body weight, BMI, body composition, gastric emptying and genetic variation (α2A C1291G, 5-HTTLPR, and GNβ3 C825T genotypes). ANCOVA was used to assess treatment effects on, and associations of the specific markers of candidate genes with weight loss and body composition. Results Sibutramine, 10 and 15 mg, caused significant weight loss (p = 0.009); there was a statistically significant gene by dose interaction for GNβ3 genotype. For each candidate gene, significant treatment effects at 12 weeks were observed (p<0.017) for all specific genotype variants (delta weight loss in the 2 sibutramine doses versus placebo): α2A CC genotype ( Δ ~5kg), GNβ3 TC/TT genotype (Δ ~6kg), and 5-HTTLPR LS/SS (Δ ~4.5kg). Gene pairs resulted in significantly greater sibutramine treatment effects on weight (both p<0.002): in participants with 5-HTTLPR LS/SS with GNβ3 TC/TT, Δ ~6kg and those with a2A CC with GNβ3 TC/TT, Δ ~8kg; however, effects were not synergistic. Treatment with sibutramine also resulted in significantly greater reduction of body fat for specific α2A CC and GNβ3 TC/TT genotype variants individually (both p<0.02). Conclusions Selection of patients with obesity based on candidate genes may enhance response to multidimensional sibutramine and behavioral therapy. PMID:18725220

Candidate genes have sex-specific effects on timing of spring migration and moult speed in a long-distance migratory bird.

PubMed

Bazzi, Gaia; Podofillini, Stefano; Gatti, Emanuele; Gianfranceschi, Luca; Cecere, Jacopo G; Spina, Fernando; Saino, Nicola; Rubolini, Diego

2017-10-01

The timing of major life-history events, such as migration and moult, is set by endogenous circadian and circannual clocks, that have been well characterized at the molecular level. Conversely, the genetic sources of variation in phenology and in other behavioral traits have been sparsely addressed. It has been proposed that inter-individual variability in the timing of seasonal events may arise from allelic polymorphism at phenological candidate genes involved in the signaling cascade of the endogenous clocks. In this study of a long-distance migratory passerine bird, the willow warbler Phylloscopus trochilus , we investigated whether allelic variation at 5 polymorphic loci of 4 candidate genes ( Adcyap1 , Clock , Creb1 , and Npas2 ), predicted 2 major components of the annual schedule, namely timing of spring migration across the central Mediterranean sea and moult speed, the latter gauged from ptilochronological analyses of tail feathers moulted in the African winter quarters. We identified a novel Clock gene locus ( Clock region 3) showing polyQ polymorphism, which was however not significantly associated with any phenotypic trait. Npas2 allele size predicted male (but not female) spring migration date, with males bearing longer alleles migrating significantly earlier than those bearing shorter alleles. Creb1 allele size significantly predicted male (but not female) moult speed, longer alleles being associated with faster moult. All other genotype-phenotype associations were statistically non-significant. These findings provide new evidence for a role of candidate genes in modulating the phenology of different circannual activities in long-distance migratory birds, and for the occurrence of sex-specific candidate gene effects.

Integrating microarray analysis and the soybean genome to understand the soybeans iron deficiency response

PubMed Central

2009-01-01

Background Soybeans grown in the upper Midwestern United States often suffer from iron deficiency chlorosis, which results in yield loss at the end of the season. To better understand the effect of iron availability on soybean yield, we identified genes in two near isogenic lines with changes in expression patterns when plants were grown in iron sufficient and iron deficient conditions. Results Transcriptional profiles of soybean (Glycine max, L. Merr) near isogenic lines Clark (PI548553, iron efficient) and IsoClark (PI547430, iron inefficient) grown under Fe-sufficient and Fe-limited conditions were analyzed and compared using the Affymetrix® GeneChip® Soybean Genome Array. There were 835 candidate genes in the Clark (PI548553) genotype and 200 candidate genes in the IsoClark (PI547430) genotype putatively involved in soybean's iron stress response. Of these candidate genes, fifty-eight genes in the Clark genotype were identified with a genetic location within known iron efficiency QTL and 21 in the IsoClark genotype. The arrays also identified 170 single feature polymorphisms (SFPs) specific to either Clark or IsoClark. A sliding window analysis of the microarray data and the 7X genome assembly coupled with an iterative model of the data showed the candidate genes are clustered in the genome. An analysis of 5' untranslated regions in the promoter of candidate genes identified 11 conserved motifs in 248 differentially expressed genes, all from the Clark genotype, representing 129 clusters identified earlier, confirming the cluster analysis results. Conclusion These analyses have identified the first genes with expression patterns that are affected by iron stress and are located within QTL specific to iron deficiency stress. The genetic location and promoter motif analysis results support the hypothesis that the differentially expressed genes are co-regulated. The combined results of all analyses lead us to postulate iron inefficiency in soybean is a result of a mutation in a transcription factor(s), which controls the expression of genes required in inducing an iron stress response. PMID:19678937

Antioxidant Defense Enzyme Genes and Asthma Susceptibility: Gender-Specific Effects and Heterogeneity in Gene-Gene Interactions between Pathogenetic Variants of the Disease

PubMed Central

Polonikov, Alexey V.; Ivanov, Vladimir P.; Bogomazov, Alexey D.; Freidin, Maxim B.; Illig, Thomas; Solodilova, Maria A.

2014-01-01

Oxidative stress resulting from an increased amount of reactive oxygen species and an imbalance between oxidants and antioxidants plays an important role in the pathogenesis of asthma. The present study tested the hypothesis that genetic susceptibility to allergic and nonallergic variants of asthma is determined by complex interactions between genes encoding antioxidant defense enzymes (ADE). We carried out a comprehensive analysis of the associations between adult asthma and 46 single nucleotide polymorphisms of 34 ADE genes and 12 other candidate genes of asthma in Russian population using set association analysis and multifactor dimensionality reduction approaches. We found for the first time epistatic interactions between ADE genes underlying asthma susceptibility and the genetic heterogeneity between allergic and nonallergic variants of the disease. We identified GSR (glutathione reductase) and PON2 (paraoxonase 2) as novel candidate genes for asthma susceptibility. We observed gender-specific effects of ADE genes on the risk of asthma. The results of the study demonstrate complexity and diversity of interactions between genes involved in oxidative stress underlying susceptibility to allergic and nonallergic asthma. PMID:24895604

Molecular evolution of candidate male reproductive genes in the brown algal model Ectocarpus.

PubMed

Lipinska, Agnieszka P; Van Damme, Els J M; De Clerck, Olivier

2016-01-05

Evolutionary studies of genes that mediate recognition between sperm and egg contribute to our understanding of reproductive isolation and speciation. Surface receptors involved in fertilization are targets of sexual selection, reinforcement, and other evolutionary forces including positive selection. This observation was made across different lineages of the eukaryotic tree from land plants to mammals, and is particularly evident in free-spawning animals. Here we use the brown algal model species Ectocarpus (Phaeophyceae) to investigate the evolution of candidate gamete recognition proteins in a distant major phylogenetic group of eukaryotes. Male gamete specific genes were identified by comparing transcriptome data covering different stages of the Ectocarpus life cycle and screened for characteristics expected from gamete recognition receptors. Selected genes were sequenced in a representative number of strains from distant geographical locations and varying stages of reproductive isolation, to search for signatures of adaptive evolution. One of the genes (Esi0130_0068) showed evidence of selective pressure. Interestingly, that gene displayed domain similarities to the receptor for egg jelly (REJ) protein involved in sperm-egg recognition in sea urchins. We have identified a male gamete specific gene with similarity to known gamete recognition receptors and signatures of adaptation. Altogether, this gene could contribute to gamete interaction during reproduction as well as reproductive isolation in Ectocarpus and is therefore a good candidate for further functional evaluation.

Breast Tumors with Elevated Expression of 1q Candidate Genes Confer Poor Clinical Outcome and Sensitivity to Ras/PI3K Inhibition

PubMed Central

Viveka Thangaraj, Soundara; Periasamy, Jayaprakash; Bhaskar Rao, Divya; Barnabas, Georgina D.; Raghavan, Swetha; Ganesan, Kumaresan

2013-01-01

Genomic aberrations are common in cancers and the long arm of chromosome 1 is known for its frequent amplifications in breast cancer. However, the key candidate genes of 1q, and their contribution in breast cancer pathogenesis remain unexplored. We have analyzed the gene expression profiles of 1635 breast tumor samples using meta-analysis based approach and identified clinically significant candidates from chromosome 1q. Seven candidate genes including exonuclease 1 (EXO1) are consistently over expressed in breast tumors, specifically in high grade and aggressive breast tumors with poor clinical outcome. We derived a EXO1 co-expression module from the mRNA profiles of breast tumors which comprises 1q candidate genes and their co-expressed genes. By integrative functional genomics investigation, we identified the involvement of EGFR, RAS, PI3K / AKT, MYC, E2F signaling in the regulation of these selected 1q genes in breast tumors and breast cancer cell lines. Expression of EXO1 module was found as indicative of elevated cell proliferation, genomic instability, activated RAS/AKT/MYC/E2F1 signaling pathways and loss of p53 activity in breast tumors. mRNA–drug connectivity analysis indicates inhibition of RAS/PI3K as a possible targeted therapeutic approach for the patients with activated EXO1 module in breast tumors. Thus, we identified seven 1q candidate genes strongly associated with the poor survival of breast cancer patients and identified the possibility of targeting them with EGFR/RAS/PI3K inhibitors. PMID:24147022

Identification of cancer genes that are independent of dominant proliferation and lineage programs

PubMed Central

Selfors, Laura M.; Stover, Daniel G.; Harris, Isaac S.; Brugge, Joan S.; Coloff, Jonathan L.

2017-01-01

Large, multidimensional cancer datasets provide a resource that can be mined to identify candidate therapeutic targets for specific subgroups of tumors. Here, we analyzed human breast cancer data to identify transcriptional programs associated with tumors bearing specific genetic driver alterations. Using an unbiased approach, we identified thousands of genes whose expression was enriched in tumors with specific genetic alterations. However, expression of the vast majority of these genes was not enriched if associations were analyzed within individual breast tumor molecular subtypes, across multiple tumor types, or after gene expression was normalized to account for differences in proliferation or tumor lineage. Together with linear modeling results, these findings suggest that most transcriptional programs associated with specific genetic alterations in oncogenes and tumor suppressors are highly context-dependent and are predominantly linked to differences in proliferation programs between distinct breast cancer subtypes. We demonstrate that such proliferation-dependent gene expression dominates tumor transcriptional programs relative to matched normal tissues. However, we also identified a relatively small group of cancer-associated genes that are both proliferation- and lineage-independent. A subset of these genes are attractive candidate targets for combination therapy because they are essential in breast cancer cell lines, druggable, enriched in stem-like breast cancer cells, and resistant to chemotherapy-induced down-regulation. PMID:29229826

Gene expression atlas of pigeonpea and its application to gain insights into genes associated with pollen fertility implicated in seed formation

PubMed Central

Pazhamala, Lekha T.; Purohit, Shilp; Saxena, Rachit K.; Garg, Vanika; Krishnamurthy, L.; Verdier, Jerome

2017-01-01

Abstract Pigeonpea (Cajanus cajan) is an important grain legume of the semi-arid tropics, mainly used for its protein rich seeds. To link the genome sequence information with agronomic traits resulting from specific developmental processes, a Cajanus cajan gene expression atlas (CcGEA) was developed using the Asha genotype. Thirty tissues/organs representing developmental stages from germination to senescence were used to generate 590.84 million paired-end RNA-Seq data. The CcGEA revealed a compendium of 28 793 genes with differential, specific, spatio-temporal and constitutive expression during various stages of development in different tissues. As an example to demonstrate the application of the CcGEA, a network of 28 flower-related genes analysed for cis-regulatory elements and splicing variants has been identified. In addition, expression analysis of these candidate genes in male sterile and male fertile genotypes suggested their critical role in normal pollen development leading to seed formation. Gene network analysis also identified two regulatory genes, a pollen-specific SF3 and a sucrose–proton symporter, that could have implications for improvement of agronomic traits such as seed production and yield. In conclusion, the CcGEA provides a valuable resource for pigeonpea to identify candidate genes involved in specific developmental processes and to understand the well-orchestrated growth and developmental process in this resilient crop. PMID:28338822

Differences in candidate gene association between European ancestry and African American asthmatic children.

PubMed

Baye, Tesfaye M; Butsch Kovacic, Melinda; Biagini Myers, Jocelyn M; Martin, Lisa J; Lindsey, Mark; Patterson, Tia L; He, Hua; Ericksen, Mark B; Gupta, Jayanta; Tsoras, Anna M; Lindsley, Andrew; Rothenberg, Marc E; Wills-Karp, Marsha; Eissa, N Tony; Borish, Larry; Khurana Hershey, Gurjit K

2011-02-28

Candidate gene case-control studies have identified several single nucleotide polymorphisms (SNPs) that are associated with asthma susceptibility. Most of these studies have been restricted to evaluations of specific SNPs within a single gene and within populations from European ancestry. Recently, there is increasing interest in understanding racial differences in genetic risk associated with childhood asthma. Our aim was to compare association patterns of asthma candidate genes between children of European and African ancestry. Using a custom-designed Illumina SNP array, we genotyped 1,485 children within the Greater Cincinnati Pediatric Clinic Repository and Cincinnati Genomic Control Cohort for 259 SNPs in 28 genes and evaluated their associations with asthma. We identified 14 SNPs located in 6 genes that were significantly associated (p-values <0.05) with childhood asthma in African Americans. Among Caucasians, 13 SNPs in 5 genes were associated with childhood asthma. Two SNPs in IL4 were associated with asthma in both races (p-values <0.05). Gene-gene interaction studies identified race specific sets of genes that best discriminate between asthmatic children and non-allergic controls. We identified IL4 as having a role in asthma susceptibility in both African American and Caucasian children. However, while IL4 SNPs were associated with asthma in asthmatic children with European and African ancestry, the relative contributions of the most replicated asthma-associated SNPs varied by ancestry. These data provides valuable insights into the pathways that may predispose to asthma in individuals with European vs. African ancestry.

Identification of Candidate Genes Responsible for Stem Pith Production Using Expression Analysis in Solid-Stemmed Wheat.

PubMed

Oiestad, A J; Martin, J M; Cook, J; Varella, A C; Giroux, M J

2017-07-01

The wheat stem sawfly (WSS) is an economically important pest of wheat in the Northern Great Plains. The primary means of WSS control is resistance associated with the single quantitative trait locus (QTL) , which controls most stem solidness variation. The goal of this study was to identify stem solidness candidate genes via RNA-seq. This study made use of 28 single nucleotide polymorphism (SNP) makers derived from expressed sequence tags (ESTs) linked to contained within a 5.13 cM region. Allele specific expression of EST markers was examined in stem tissue for solid and hollow-stemmed pairs of two spring wheat near isogenic lines (NILs) differing for the QTL. Of the 28 ESTs, 13 were located within annotated genes and 10 had detectable stem expression. Annotated genes corresponding to four of the ESTs were differentially expressed between solid and hollow-stemmed NILs and represent possible stem solidness gene candidates. Further examination of the 5.13 cM region containing the 28 EST markers identified 260 annotated genes. Twenty of the 260 linked genes were up-regulated in hollow NIL stems, while only seven genes were up-regulated in solid NIL stems. An -methyltransferase within the region of interest was identified as a candidate based on differential expression between solid and hollow-stemmed NILs and putative function. Further study of these candidate genes may lead to the identification of the gene(s) controlling stem solidness and an increased ability to select for wheat stem solidness and manage WSS. Copyright © 2017 Crop Science Society of America.

Adaptation to climate through flowering phenology: a case study in Medicago truncatula.

PubMed

Burgarella, Concetta; Chantret, Nathalie; Gay, Laurène; Prosperi, Jean-Marie; Bonhomme, Maxime; Tiffin, Peter; Young, Nevin D; Ronfort, Joelle

2016-07-01

Local climatic conditions likely constitute an important selective pressure on genes underlying important fitness-related traits such as flowering time, and in many species, flowering phenology and climatic gradients strongly covary. To test whether climate shapes the genetic variation on flowering time genes and to identify candidate flowering genes involved in the adaptation to environmental heterogeneity, we used a large Medicago truncatula core collection to examine the association between nucleotide polymorphisms at 224 candidate genes and both climate variables and flowering phenotypes. Unlike genome-wide studies, candidate gene approaches are expected to enrich for the number of meaningful trait associations because they specifically target genes that are known to affect the trait of interest. We found that flowering time mediates adaptation to climatic conditions mainly by variation at genes located upstream in the flowering pathways, close to the environmental stimuli. Variables related to the annual precipitation regime reflected selective constraints on flowering time genes better than the other variables tested (temperature, altitude, latitude or longitude). By comparing phenotype and climate associations, we identified 12 flowering genes as the most promising candidates responsible for phenological adaptation to climate. Four of these genes were located in the known flowering time QTL region on chromosome 7. However, climate and flowering associations also highlighted largely distinct gene sets, suggesting different genetic architectures for adaptation to climate and flowering onset. © 2016 John Wiley & Sons Ltd.

Revealing Alzheimer's disease genes spectrum in the whole-genome by machine learning.

PubMed

Huang, Xiaoyan; Liu, Hankui; Li, Xinming; Guan, Liping; Li, Jiankang; Tellier, Laurent Christian Asker M; Yang, Huanming; Wang, Jian; Zhang, Jianguo

2018-01-10

Alzheimer's disease (AD) is an important, progressive neurodegenerative disease, with a complex genetic architecture. A key goal of biomedical research is to seek out disease risk genes, and to elucidate the function of these risk genes in the development of disease. For this purpose, expanding the AD-associated gene set is necessary. In past research, the prediction methods for AD related genes has been limited in their exploration of the target genome regions. We here present a genome-wide method for AD candidate genes predictions. We present a machine learning approach (SVM), based upon integrating gene expression data with human brain-specific gene network data, to discover the full spectrum of AD genes across the whole genome. We classified AD candidate genes with an accuracy and the area under the receiver operating characteristic (ROC) curve of 84.56% and 94%. Our approach provides a supplement for the spectrum of AD-associated genes extracted from more than 20,000 genes in a genome wide scale. In this study, we have elucidated the whole-genome spectrum of AD, using a machine learning approach. Through this method, we expect for the candidate gene catalogue to provide a more comprehensive annotation of AD for researchers.

Antennal transcriptome analysis of the piercing moth Oraesia emarginata (Lepidoptera: Noctuidae)

PubMed Central

Feng, Bo; Guo, Qianshuang; Zheng, Kaidi; Qin, Yuanxia; Du, Yongjun

2017-01-01

The piercing fruit moth Oraesia emarginata is an economically significant pest; however, our understanding of its olfactory mechanisms in infestation is limited. The present study conducted antennal transcriptome analysis of olfactory genes using real-time quantitative reverse transcription PCR analysis (RT-qPCR). We identified a total of 104 candidate chemosensory genes from several gene families, including 35 olfactory receptors (ORs), 41 odorant-binding proteins, 20 chemosensory proteins, 6 ionotropic receptors, and 2 sensory neuron membrane proteins. Seven candidate pheromone receptors (PRs) and 3 candidate pheromone-binding proteins (PBPs) for sex pheromone recognition were found. OemaOR29 and OemaPBP1 had the highest fragments per kb per million fragments (FPKM) values in all ORs and OBPs, respectively. Eighteen olfactory genes were upregulated in females, including 5 candidate PRs, and 20 olfactory genes were upregulated in males, including 2 candidate PRs (OemaOR29 and 4) and 2 PBPs (OemaPBP1 and 3). These genes may have roles in mediating sex-specific behaviors. Most candidate olfactory genes of sex pheromone recognition (except OemaOR29 and OemaPBP3) in O. emarginata were not clustered with those of studied noctuid species (type I pheromone). In addition, OemaOR29 was belonged to cluster PRIII, which comprise proteins that recognize type II pheromones instead of type I pheromones. The structure and function of olfactory genes that encode sex pheromones in O. emarginata might thus differ from those of other studied noctuids. The findings of the present study may help explain the molecular mechanism underlying olfaction and the evolution of olfactory genes encoding sex pheromones in O. emarginata. PMID:28614384

Bioinformatics-Based Identification of Candidate Genes from QTLs Associated with Cell Wall Traits in Populus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ranjan, Priya; Yin, Tongming; Zhang, Xinye

2009-11-01

Quantitative trait locus (QTL) studies are an integral part of plant research and are used to characterize the genetic basis of phenotypic variation observed in structured populations and inform marker-assisted breeding efforts. These QTL intervals can span large physical regions on a chromosome comprising hundreds of genes, thereby hampering candidate gene identification. Genome history, evolution, and expression evidence can be used to narrow the genes in the interval to a smaller list that is manageable for detailed downstream functional genomics characterization. Our primary motivation for the present study was to address the need for a research methodology that identifies candidatemore » genes within a broad QTL interval. Here we present a bioinformatics-based approach for subdividing candidate genes within QTL intervals into alternate groups of high probability candidates. Application of this approach in the context of studying cell wall traits, specifically lignin content and S/G ratios of stem and root in Populus plants, resulted in manageable sets of genes of both known and putative cell wall biosynthetic function. These results provide a roadmap for future experimental work leading to identification of new genes controlling cell wall recalcitrance and, ultimately, in the utility of plant biomass as an energy feedstock.« less

Digital transcriptome analysis of putative sex-determination genes in papaya (Carica papaya).

PubMed

Urasaki, Naoya; Tarora, Kazuhiko; Shudo, Ayano; Ueno, Hiroki; Tamaki, Moritoshi; Miyagi, Norimichi; Adaniya, Shinichi; Matsumura, Hideo

2012-01-01

Papaya (Carica papaya) is a trioecious plant species that has male, female and hermaphrodite flowers on different plants. The primitive sex chromosomes genetically determine the sex of the papaya. Although draft sequences of the papaya genome are already available, the genes for sex determination have not been identified, likely due to the complicated structure of its sex-chromosome sequences. To identify the candidate genes for sex determination, we conducted a transcriptome analysis of flower samples from male, female and hermaphrodite plants using high-throughput SuperSAGE for digital gene expression analysis. Among the short sequence tags obtained from the transcripts, 312 unique tags were specifically mapped to the primitive sex chromosome (X or Y(h)) sequences. An annotation analysis revealed that retroelements are the most abundant sequences observed in the genes corresponding to these tags. The majority of tags on the sex chromosomes were located on the X chromosome, and only 30 tags were commonly mapped to both the X and Y(h) chromosome, implying a loss of many genes on the Y(h) chromosome. Nevertheless, candidate Y(h) chromosome-specific female determination genes, including a MADS-box gene, were identified. Information on these sex chromosome-specific expressed genes will help elucidating sex determination in the papaya.

Digital Transcriptome Analysis of Putative Sex-Determination Genes in Papaya (Carica papaya)

PubMed Central

Urasaki, Naoya; Tarora, Kazuhiko; Shudo, Ayano; Ueno, Hiroki; Tamaki, Moritoshi; Miyagi, Norimichi; Adaniya, Shinichi; Matsumura, Hideo

2012-01-01

Papaya (Carica papaya) is a trioecious plant species that has male, female and hermaphrodite flowers on different plants. The primitive sex chromosomes genetically determine the sex of the papaya. Although draft sequences of the papaya genome are already available, the genes for sex determination have not been identified, likely due to the complicated structure of its sex-chromosome sequences. To identify the candidate genes for sex determination, we conducted a transcriptome analysis of flower samples from male, female and hermaphrodite plants using high-throughput SuperSAGE for digital gene expression analysis. Among the short sequence tags obtained from the transcripts, 312 unique tags were specifically mapped to the primitive sex chromosome (X or Yh) sequences. An annotation analysis revealed that retroelements are the most abundant sequences observed in the genes corresponding to these tags. The majority of tags on the sex chromosomes were located on the X chromosome, and only 30 tags were commonly mapped to both the X and Yh chromosome, implying a loss of many genes on the Yh chromosome. Nevertheless, candidate Yh chromosome-specific female determination genes, including a MADS-box gene, were identified. Information on these sex chromosome-specific expressed genes will help elucidating sex determination in the papaya. PMID:22815863

Exploring Valid Reference Genes for Quantitative Real-time PCR Analysis in Plutella xylostella (Lepidoptera: Plutellidae)

PubMed Central

Fu, Wei; Xie, Wen; Zhang, Zhuo; Wang, Shaoli; Wu, Qingjun; Liu, Yong; Zhou, Xiaomao; Zhou, Xuguo; Zhang, Youjun

2013-01-01

Abstract: Quantitative real-time PCR (qRT-PCR), a primary tool in gene expression analysis, requires an appropriate normalization strategy to control for variation among samples. The best option is to compare the mRNA level of a target gene with that of reference gene(s) whose expression level is stable across various experimental conditions. In this study, expression profiles of eight candidate reference genes from the diamondback moth, Plutella xylostella, were evaluated under diverse experimental conditions. RefFinder, a web-based analysis tool, integrates four major computational programs including geNorm, Normfinder, BestKeeper, and the comparative ΔCt method to comprehensively rank the tested candidate genes. Elongation factor 1 (EF1) was the most suited reference gene for the biotic factors (development stage, tissue, and strain). In contrast, although appropriate reference gene(s) do exist for several abiotic factors (temperature, photoperiod, insecticide, and mechanical injury), we were not able to identify a single universal reference gene. Nevertheless, a suite of candidate reference genes were specifically recommended for selected experimental conditions. Our finding is the first step toward establishing a standardized qRT-PCR analysis of this agriculturally important insect pest. PMID:23983612

Integrated analysis of gene expression and methylation profiles of 48 candidate genes in breast cancer patients.

PubMed

Li, Zibo; Heng, Jianfu; Yan, Jinhua; Guo, Xinwu; Tang, Lili; Chen, Ming; Peng, Limin; Wu, Yepeng; Wang, Shouman; Xiao, Zhi; Deng, Zhongping; Dai, Lizhong; Wang, Jun

2016-11-01

Gene-specific methylation and expression have shown biological and clinical importance for breast cancer diagnosis and prognosis. Integrated analysis of gene methylation and gene expression may identify genes associated with biology mechanism and clinical outcome of breast cancer and aid in clinical management. Using high-throughput microfluidic quantitative PCR, we analyzed the expression profiles of 48 candidate genes in 96 Chinese breast cancer patients and investigated their correlation with gene methylation and associations with breast cancer clinical parameters. Breast cancer-specific gene expression alternation was found in 25 genes with significant expression difference between paired tumor and normal tissues. A total of 9 genes (CCND2, EGFR, GSTP1, PGR, PTGS2, RECK, SOX17, TNFRSF10D, and WIF1) showed significant negative correlation between methylation and gene expression, which were validated in the TCGA database. Total 23 genes (ACADL, APC, BRCA2, CADM1, CAV1, CCND2, CST6, EGFR, ESR2, GSTP1, ICAM5, NPY, PGR, PTGS2, RECK, RUNX3, SFRP1, SOX17, SYK, TGFBR2, TNFRSF10D, WIF1, and WRN) annotated with potential TFBSs in the promoter regions showed negative correlation between methylation and expression. In logistics regression analysis, 31 of the 48 genes showed improved performance in disease prediction with combination of methylation and expression coefficient. Our results demonstrated the complex correlation and the possible regulatory mechanisms between DNA methylation and gene expression. Integration analysis of methylation and expression of candidate genes could improve performance in breast cancer prediction. These findings would contribute to molecular characterization and identification of biomarkers for potential clinical applications.

A specific endogenous reference for genetically modified common bean (Phaseolus vulgaris L.) DNA quantification by real-time PCR targeting lectin gene.

PubMed

Venturelli, Gustavo L; Brod, Fábio C A; Rossi, Gabriela B; Zimmermann, Naíra F; Oliveira, Jaison P; Faria, Josias C; Arisi, Ana C M

2014-11-01

The Embrapa 5.1 genetically modified (GM) common bean was approved for commercialization in Brazil. Methods for the quantification of this new genetically modified organism (GMO) are necessary. The development of a suitable endogenous reference is essential for GMO quantification by real-time PCR. Based on this, a new taxon-specific endogenous reference quantification assay was developed for Phaseolus vulgaris L. Three genes encoding common bean proteins (phaseolin, arcelin, and lectin) were selected as candidates for endogenous reference. Primers targeting these candidate genes were designed and the detection was evaluated using the SYBR Green chemistry. The assay targeting lectin gene showed higher specificity than the remaining assays, and a hydrolysis probe was then designed. This assay showed high specificity for 50 common bean samples from two gene pools, Andean and Mesoamerican. For GM common bean varieties, the results were similar to those obtained for non-GM isogenic varieties with PCR efficiency values ranging from 92 to 101 %. Moreover, this assay presented a limit of detection of ten haploid genome copies. The primers and probe developed in this work are suitable to detect and quantify either GM or non-GM common bean.

Identification of mediator complex 26 (Crsp7) gametologs on platypus X1 and Y5 sex chromosomes: a candidate testis-determining gene in monotremes?

PubMed

Tsend-Ayush, Enkhjargal; Kortschak, R Daniel; Bernard, Pascal; Lim, Shu Ly; Ryan, Janelle; Rosenkranz, Ruben; Borodina, Tatiana; Dohm, Juliane C; Himmelbauer, Heinz; Harley, Vincent R; Grützner, Frank

2012-01-01

The basal lineage of monotremes features an extraordinarily complex sex chromosome system which has provided novel insights into the evolution of mammalian sex chromosomes. Recently, sequence information from autosomes, X chromosomes, and XY-shared pseudoautosomal regions has become available. However, no gene has so far been described on any of the Y chromosome-specific regions. We analyzed sequences derived from Y-specific BAC clones to identify genes with potentially male-specific function. Here, we report the identification and characterization of the mediator complex protein gametologs on platypus Y5 (Crspy). We also identified the X-chromosomal copy which unexpectedly maps to X1 (Crspx). Sequence comparison shows extensive divergence between the X and Y copy, but we found no significant positive selection on either gametolog. Expression analysis shows widespread expression of Crspx. Crspy is expressed exclusively in males with particularly strong expression in testis and kidney. Reporter gene assays to investigate whether Crspx/y can act on the recently discovered mouse Sox9 testis-specific enhancer element did reveal a modest effect together with mouse Sox9 + Sf1, but showed overall no significant upregulation of the reporter gene. This is the first report of a differentiated functional male-specific gene on platypus Y chromosomes, providing new insights into sex chromosome evolution and a candidate gene for male-specific function in monotremes.

Inheritance-mode specific pathogenicity prioritization (ISPP) for human protein coding genes.

PubMed

Hsu, Jacob Shujui; Kwan, Johnny S H; Pan, Zhicheng; Garcia-Barcelo, Maria-Mercè; Sham, Pak Chung; Li, Miaoxin

2016-10-15

Exome sequencing studies have facilitated the detection of causal genetic variants in yet-unsolved Mendelian diseases. However, the identification of disease causal genes among a list of candidates in an exome sequencing study is still not fully settled, and it is often difficult to prioritize candidate genes for follow-up studies. The inheritance mode provides crucial information for understanding Mendelian diseases, but none of the existing gene prioritization tools fully utilize this information. We examined the characteristics of Mendelian disease genes under different inheritance modes. The results suggest that Mendelian disease genes with autosomal dominant (AD) inheritance mode are more haploinsufficiency and de novo mutation sensitive, whereas those autosomal recessive (AR) genes have significantly more non-synonymous variants and regulatory transcript isoforms. In addition, the X-linked (XL) Mendelian disease genes have fewer non-synonymous and synonymous variants. As a result, we derived a new scoring system for prioritizing candidate genes for Mendelian diseases according to the inheritance mode. Our scoring system assigned to each annotated protein-coding gene (N = 18 859) three pathogenic scores according to the inheritance mode (AD, AR and XL). This inheritance mode-specific framework achieved higher accuracy (area under curve  = 0.84) in XL mode. The inheritance-mode specific pathogenicity prioritization (ISPP) outperformed other well-known methods including Haploinsufficiency, Recessive, Network centrality, Genic Intolerance, Gene Damage Index and Gene Constraint scores. This systematic study suggests that genes manifesting disease inheritance modes tend to have unique characteristics. ISPP is included in KGGSeq v1.0 (http://grass.cgs.hku.hk/limx/kggseq/), and source code is available from (https://github.com/jacobhsu35/ISPP.git). mxli@hku.hkSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Common genetic variants related to genomic integrity and risk of papillary thyroid cancer

PubMed Central

Neta, Gila; Brenner, Alina V.; Sturgis, Erich M.; Pfeiffer, Ruth M.; Hutchinson, Amy A.; Aschebrook-Kilfoy, Briseis; Yeager, Meredith; Xu, Li; Wheeler, William; Abend, Michael; Ron, Elaine; Tucker, Margaret A.; Chanock, Stephen J.; Sigurdson, Alice J.

2011-01-01

DNA damage is an important mechanism in carcinogenesis, so genes related to maintaining genomic integrity may influence papillary thyroid cancer (PTC) risk. Candidate gene studies targeting some of these genes have identified only a few polymorphisms associated with risk of PTC. Here, we expanded the scope of previous candidate studies by increasing the number and coverage of genes related to maintenance of genomic integrity. We evaluated 5077 tag single-nucleotide polymorphisms (SNPs) from 340 candidate gene regions hypothesized to be involved in DNA repair, epigenetics, tumor suppression, apoptosis, telomere function and cell cycle control and signaling pathways in a case–control study of 344 PTC cases and 452 matched controls. We estimated odds ratios for associations of single SNPs with PTC risk and combined P values for SNPs in the same gene region or pathway to obtain gene region-specific or pathway-specific P values using adaptive rank-truncated product methods. Nine SNPs had P values <0.0005, three of which were in HDAC4 and were inversely related to PTC risk. After multiple comparisons adjustment, no SNPs remained associated with PTC risk. Seven gene regions were associated with PTC risk at P < 0.01, including HUS1, ALKBH3, HDAC4, BAK1, FAF1_CDKN2C, DACT3 and FZD6. Our results suggest a possible role of genes involved in maintenance of genomic integrity in relation to risk of PTC. PMID:21642358

Functional dissection of drought-responsive gene expression patterns in Cynodon dactylon L.

PubMed

Kim, Changsoo; Lemke, Cornelia; Paterson, Andrew H

2009-05-01

Water deficit is one of the main abiotic factors that affect plant productivity in subtropical regions. To identify genes induced during the water stress response in Bermudagrass (Cynodon dactylon), cDNA macroarrays were used. The macroarray analysis identified 189 drought-responsive candidate genes from C. dactylon, of which 120 were up-regulated and 69 were down-regulated. The candidate genes were classified into seven groups by cluster analysis of expression levels across two intensities and three durations of imposed stress. Annotation using BLASTX suggested that up-regulated genes may be involved in proline biosynthesis, signal transduction pathways, protein repair systems, and removal of toxins, while down-regulated genes were mostly related to basic plant metabolism such as photosynthesis and glycolysis. The functional classification of gene ontology (GO) was consistent with the BLASTX results, also suggesting some crosstalk between abiotic and biotic stress. Comparative analysis of cis-regulatory elements from the candidate genes implicated specific elements in drought response in Bermudagrass. Although only a subset of genes was studied, Bermudagrass shared many drought-responsive genes and cis-regulatory elements with other botanical models, supporting a strategy of cross-taxon application of drought-responsive genes, regulatory cues, and physiological-genetic information.

Finding gene regulatory network candidates using the gene expression knowledge base.

PubMed

Venkatesan, Aravind; Tripathi, Sushil; Sanz de Galdeano, Alejandro; Blondé, Ward; Lægreid, Astrid; Mironov, Vladimir; Kuiper, Martin

2014-12-10

Network-based approaches for the analysis of large-scale genomics data have become well established. Biological networks provide a knowledge scaffold against which the patterns and dynamics of 'omics' data can be interpreted. The background information required for the construction of such networks is often dispersed across a multitude of knowledge bases in a variety of formats. The seamless integration of this information is one of the main challenges in bioinformatics. The Semantic Web offers powerful technologies for the assembly of integrated knowledge bases that are computationally comprehensible, thereby providing a potentially powerful resource for constructing biological networks and network-based analysis. We have developed the Gene eXpression Knowledge Base (GeXKB), a semantic web technology based resource that contains integrated knowledge about gene expression regulation. To affirm the utility of GeXKB we demonstrate how this resource can be exploited for the identification of candidate regulatory network proteins. We present four use cases that were designed from a biological perspective in order to find candidate members relevant for the gastrin hormone signaling network model. We show how a combination of specific query definitions and additional selection criteria derived from gene expression data and prior knowledge concerning candidate proteins can be used to retrieve a set of proteins that constitute valid candidates for regulatory network extensions. Semantic web technologies provide the means for processing and integrating various heterogeneous information sources. The GeXKB offers biologists such an integrated knowledge resource, allowing them to address complex biological questions pertaining to gene expression. This work illustrates how GeXKB can be used in combination with gene expression results and literature information to identify new potential candidates that may be considered for extending a gene regulatory network.

Artificial selection on brain-expressed genes during the domestication of dog.

PubMed

Li, Yan; Vonholdt, Bridgett M; Reynolds, Andy; Boyko, Adam R; Wayne, Robert K; Wu, Dong-Dong; Zhang, Ya-Ping

2013-08-01

Domesticated dogs have many unique behaviors not found in gray wolves that have augmented their interaction and communication with humans. The genetic basis of such unique behaviors in dogs remains poorly understood. We found that genes within regions highly differentiated between outbred Chinese native dogs (CNs) and wolves show high bias for expression localized to brain tissues, particularly the prefrontal cortex, a specific region responsible for complex cognitive behaviors. In contrast, candidate genes showing high population differentiation between CNs and German Shepherd dogs (GSs) did not demonstrate significant expression bias. These observations indicate that these candidate genes highly expressed in the brain have rapidly evolved. This rapid evolution was probably driven by artificial selection during the primary transition from wolves to ancient dogs and was consistent with the evolution of dog-specific characteristics, such as behavior transformation, for thousands of years.

Identification of candidate genes in Populus cell wall biosynthesis using text-mining, co-expression network and comparative genomics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yang, Xiaohan; Ye, Chuyu; Bisaria, Anjali

2011-01-01

Populus is an important bioenergy crop for bioethanol production. A greater understanding of cell wall biosynthesis processes is critical in reducing biomass recalcitrance, a major hindrance in efficient generation of ethanol from lignocellulosic biomass. Here, we report the identification of candidate cell wall biosynthesis genes through the development and application of a novel bioinformatics pipeline. As a first step, via text-mining of PubMed publications, we obtained 121 Arabidopsis genes that had the experimental evidences supporting their involvement in cell wall biosynthesis or remodeling. The 121 genes were then used as bait genes to query an Arabidopsis co-expression database and additionalmore » genes were identified as neighbors of the bait genes in the network, increasing the number of genes to 548. The 548 Arabidopsis genes were then used to re-query the Arabidopsis co-expression database and re-construct a network that captured additional network neighbors, expanding to a total of 694 genes. The 694 Arabidopsis genes were computationally divided into 22 clusters. Queries of the Populus genome using the Arabidopsis genes revealed 817 Populus orthologs. Functional analysis of gene ontology and tissue-specific gene expression indicated that these Arabidopsis and Populus genes are high likelihood candidates for functional genomics in relation to cell wall biosynthesis.« less

Identification and Comparison of Candidate Olfactory Genes in the Olfactory and Non-Olfactory Organs of Elm Pest Ambrostoma quadriimpressum (Coleoptera: Chrysomelidae) Based on Transcriptome Analysis.

PubMed

Wang, Yinliang; Chen, Qi; Zhao, Hanbo; Ren, Bingzhong

2016-01-01

The leaf beetle Ambrostoma quadriimpressum (Coleoptera: Chrysomelidae) is a predominant forest pest that causes substantial damage to the lumber industry and city management. However, no effective and environmentally friendly chemical method has been discovered to control this pest. Until recently, the molecular basis of the olfactory system in A. quadriimpressum was completely unknown. In this study, antennae and leg transcriptomes were analyzed and compared using deep sequencing data to identify the olfactory genes in A. quadriimpressum. Moreover, the expression profiles of both male and female candidate olfactory genes were analyzed and validated by bioinformatics, motif analysis, homology analysis, semi-quantitative RT-PCR and RT-qPCR experiments in antennal and non-olfactory organs to explore the candidate olfactory genes that might play key roles in the life cycle of A. quadriimpressum. As a result, approximately 102.9 million and 97.3 million clean reads were obtained from the libraries created from the antennas and legs, respectively. Annotation led to 34344 Unigenes, which were matched to known proteins. Annotation data revealed that the number of genes in antenna with binding functions and receptor activity was greater than that of legs. Furthermore, many pathway genes were differentially expressed in the two organs. Sixteen candidate odorant binding proteins (OBPs), 10 chemosensory proteins (CSPs), 34 odorant receptors (ORs), 20 inotropic receptors [1] and 2 sensory neuron membrane proteins (SNMPs) and their isoforms were identified. Additionally, 15 OBPs, 9 CSPs, 18 ORs, 6 IRs and 2 SNMPs were predicted to be complete ORFs. Using RT-PCR, RT-qPCR and homology analysis, AquaOBP1/2/4/7/C1/C6, AquaCSP3/9, AquaOR8/9/10/14/15/18/20/26/29/33, AquaIR8a/13/25a showed olfactory-specific expression, indicating that these genes might play a key role in olfaction-related behaviors in A. quadriimpressum such as foraging and seeking. AquaOBP4/C5, AquaOBP4/C5, AquaCSP7/9/10, AquaOR17/24/32 and AquaIR4 were highly expressed in the antenna of males, suggesting that these genes were related to sex-specific behaviors, and expression trends that were male specific were observed for most candidate olfactory genes, which supported the existence of a female-produced sex pheromone in A. quadriimpressum. All of these results could provide valuable information and guidance for future functional studies on these genes and provide better molecular knowledge regarding the olfactory system in A. quadriimpressum.

Combining mouse mammary gland gene expression and comparative mapping for the identification of candidate genes for QTL of milk production traits in cattle

PubMed Central

Ron, Micha; Israeli, Galit; Seroussi, Eyal; Weller, Joel I; Gregg, Jeffrey P; Shani, Moshe; Medrano, Juan F

2007-01-01

Background Many studies have found segregating quantitative trait loci (QTL) for milk production traits in different dairy cattle populations. However, even for relatively large effects with a saturated marker map the confidence interval for QTL location by linkage analysis spans tens of map units, or hundreds of genes. Combining mapping and arraying has been suggested as an approach to identify candidate genes. Thus, gene expression analysis in the mammary gland of genes positioned in the confidence interval of the QTL can bridge the gap between fine mapping and quantitative trait nucleotide (QTN) determination. Results We hybridized Affymetrix microarray (MG-U74v2), containing 12,488 murine probes, with RNA derived from mammary gland of virgin, pregnant, lactating and involuting C57BL/6J mice in a total of nine biological replicates. We combined microarray data from two additional studies that used the same design in mice with a total of 75 biological replicates. The same filtering and normalization was applied to each microarray data using GeneSpring software. Analysis of variance identified 249 differentially expressed probe sets common to the three experiments along the four developmental stages of puberty, pregnancy, lactation and involution. 212 genes were assigned to their bovine map positions through comparative mapping, and thus form a list of candidate genes for previously identified QTLs for milk production traits. A total of 82 of the genes showed mammary gland-specific expression with at least 3-fold expression over the median representing all tissues tested in GeneAtlas. Conclusion This work presents a web tool for candidate genes for QTL (cgQTL) that allows navigation between the map of bovine milk production QTL, potential candidate genes and their level of expression in mammary gland arrays and in GeneAtlas. Three out of four confirmed genes that affect QTL in livestock (ABCG2, DGAT1, GDF8, IGF2) were over expressed in the target organ. Thus, cgQTL can be used to determine priority of candidate genes for QTN analysis based on differential expression in the target organ. PMID:17584498

Gene expression atlas of pigeonpea and its application to gain insights into genes associated with pollen fertility implicated in seed formation.

PubMed

Pazhamala, Lekha T; Purohit, Shilp; Saxena, Rachit K; Garg, Vanika; Krishnamurthy, L; Verdier, Jerome; Varshney, Rajeev K

2017-04-01

Pigeonpea (Cajanus cajan) is an important grain legume of the semi-arid tropics, mainly used for its protein rich seeds. To link the genome sequence information with agronomic traits resulting from specific developmental processes, a Cajanus cajan gene expression atlas (CcGEA) was developed using the Asha genotype. Thirty tissues/organs representing developmental stages from germination to senescence were used to generate 590.84 million paired-end RNA-Seq data. The CcGEA revealed a compendium of 28 793 genes with differential, specific, spatio-temporal and constitutive expression during various stages of development in different tissues. As an example to demonstrate the application of the CcGEA, a network of 28 flower-related genes analysed for cis-regulatory elements and splicing variants has been identified. In addition, expression analysis of these candidate genes in male sterile and male fertile genotypes suggested their critical role in normal pollen development leading to seed formation. Gene network analysis also identified two regulatory genes, a pollen-specific SF3 and a sucrose-proton symporter, that could have implications for improvement of agronomic traits such as seed production and yield. In conclusion, the CcGEA provides a valuable resource for pigeonpea to identify candidate genes involved in specific developmental processes and to understand the well-orchestrated growth and developmental process in this resilient crop. © The Author 2017. Published by Oxford University Press on behalf of the Society for Experimental Biology.

Association of candidate gene polymorphisms with clinical subtypes of preterm birth in a Latin American population

PubMed Central

Gimenez, Lucas G.; Momany, Allison M.; Poletta, Fernando A.; Krupitzki, Hugo B.; Gili, Juan A.; Busch, Tamara D.; Saleme, Cesar; Cosentino, Viviana R.; Pawluk, Mariela S.; Campaña, Hebe; Gadow, Enrique C.; Murray, Jeffrey C.; Lopez-Camelo, Jorge S.

2017-01-01

Background Preterm birth (PTB) is the leading cause of neonatal mortality and morbidity. PTB is often classified according to clinical presentation: Idiopathic (PTB-I), preterm premature rupture of membranes (PTB-PPROM), and medically induced (PTB-M). The aim of this study was to evaluate the associations between specific candidate genes and clinical subtypes of PTB. Methods 24 SNPs were genotyped in 18 candidate genes in 709 infant triads. Of them, 243 were PTB-I, 256 PTB-PPROM, and 210 PTB-M. These data were analyzed with a Family-Based Association. Results PTB was nominally associated with rs2272365 in PON1, rs883319 in KCNN3, rs4458044 in CRHR1, and rs610277 in F3. Regarding clinical subtypes analysis, 3 SNPs were associated with PTB-I (rs2272365 in PON1, rs10178458 in COL4A3, and rs4458044 in CRHR1), rs610277 in F3 was associated with PTB-PPROM, and rs883319 in KCNN3 and rs610277 in F3 were associated with PTB-M. Conclusions Our study identified polymorphisms potentially associated with specific clinical subtypes of PTB in this Latin American population. These results could suggest a specific role of such genes in the mechanisms involved in each clinical subtype. Further studies are required to confirm our results and to determine the role of these genes in the pathophysiology of clinical subtypes. PMID:28426651

Association of candidate gene polymorphisms with clinical subtypes of preterm birth in a Latin American population.

PubMed

Gimenez, Lucas G; Momany, Allison M; Poletta, Fernando A; Krupitzki, Hugo B; Gili, Juan A; Busch, Tamara D; Saleme, Cesar; Cosentino, Viviana R; Pawluk, Mariela S; Campaña, Hebe; Gadow, Enrique C; Murray, Jeffrey C; Lopez-Camelo, Jorge S

2017-09-01

BackgroundPreterm birth (PTB) is the leading cause of neonatal mortality and morbidity. PTB is often classified according to clinical presentation as follows: idiopathic (PTB-I), preterm premature rupture of membranes (PTB-PPROM), and medically induced (PTB-M). The aim of this study was to evaluate the associations between specific candidate genes and clinical subtypes of PTB.MethodsTwenty-four single-nucleotide polymorphisms (SNPs) were genotyped in 18 candidate genes in 709 infant triads. Of them, 243 were PTB-I, 256 were PTB-PPROM, and 210 were PTB-M. These data were analyzed with a Family-Based Association.ResultsPTB was nominally associated with rs2272365 in PON1, rs883319 in KCNN3, rs4458044 in CRHR1, and rs610277 in F3. Regarding clinical subtypes analysis, three SNPs were associated with PTB-I (rs2272365 in PON1, rs10178458 in COL4A3, and rs4458044 in CRHR1), rs610277 in F3 was associated with PTB-PPROM, and rs883319 in KCNN3 and rs610277 in F3 were associated with PTB-M.ConclusionOur study identified polymorphisms potentially associated with specific clinical subtypes of PTB in this Latin American population. These results could suggest a specific role of such genes in the mechanisms involved in each clinical subtype. Further studies are required to confirm our results and to determine the role of these genes in the pathophysiology of clinical subtypes.

Cancerouspdomains: comprehensive analysis of cancer type-specific recurrent somatic mutations in proteins and domains.

PubMed

Hashemi, Seirana; Nowzari Dalini, Abbas; Jalali, Adrin; Banaei-Moghaddam, Ali Mohammad; Razaghi-Moghadam, Zahra

2017-08-16

Discriminating driver mutations from the ones that play no role in cancer is a severe bottleneck in elucidating molecular mechanisms underlying cancer development. Since protein domains are representatives of functional regions within proteins, mutations on them may disturb the protein functionality. Therefore, studying mutations at domain level may point researchers to more accurate assessment of the functional impact of the mutations. This article presents a comprehensive study to map mutations from 29 cancer types to both sequence- and structure-based domains. Statistical analysis was performed to identify candidate domains in which mutations occur with high statistical significance. For each cancer type, the corresponding type-specific domains were distinguished among all candidate domains. Subsequently, cancer type-specific domains facilitated the identification of specific proteins for each cancer type. Besides, performing interactome analysis on specific proteins of each cancer type showed high levels of interconnectivity among them, which implies their functional relationship. To evaluate the role of mitochondrial genes, stem cell-specific genes and DNA repair genes in cancer development, their mutation frequency was determined via further analysis. This study has provided researchers with a publicly available data repository for studying both CATH and Pfam domain regions on protein-coding genes. Moreover, the associations between different groups of genes/domains and various cancer types have been clarified. The work is available at http://www.cancerouspdomains.ir .

Identifying Candidate Reprogramming Genes in Mouse Induced Pluripotent Stem Cells.

PubMed

Gao, Fang; Li, Jingyu; Zhang, Heng; Yang, Xu; An, Tiezhu

2017-08-01

Factor-based induced reprogramming approaches have tremendous potential for human regenerative medicine, but the efficiencies of these approaches are still low. In this study, we analyzed the global transcriptional profiles of mouse induced pluripotent stem cells (miPSCs) and mouse embryonic stem cells (mESCs) from seven different labs and present here the first successful clustering according to cell type, not by lab of origin. We identified 2131 different expression genes (DEs) as candidate pluripotency-associated genes by comparing mESCs/miPSCs with somatic cells and 720 DEs between miPSCs and mESCs. Interestingly, there was a significant overlap between the two DE sets. Therefore, we defined the overlap DEs as "consensus DEs" including 313 miPSC-specific genes expressed at a higher level in miPSCs versus mESCs and 184 mESC-specific genes in total and reasoned that these may contribute to the differences in pluripotency between mESCs and miPSCs. A classification of "consensus DEs" according to their different expression levels between somatic cells and mESCs/miPSCs shows that 86% of the miPSC-specific genes are more highly expressed in somatic cells, while 73% of mESC-specific genes are highly expressed in mESCs/miPSCs, indicating that the miPSCs have not efficiently silenced the expression pattern of the somatic cells from which they are derived and failed to completely induce the genes with high expression levels in mESCs. We further revealed a strong correlation between oocyte-enriched factors and insufficiently induced mESC-specific genes and identified 11 hub genes via network analysis. In light of these findings, we postulated that these key hub genes might not only drive somatic cell nuclear transfer (SCNT) reprogramming but also augment the efficiency and quality of miPSC reprogramming.

Neuroprotective therapies in glaucoma: II. Genetic nanotechnology tools.

PubMed

Nafissi, Nafiseh; Foldvari, Marianna

2015-01-01

Neurotrophic factor genome engineering could have many potential applications not only in the deeper understanding of neurodegenerative disorders but also in improved therapeutics. The fields of nanomedicine, regenerative medicine, and gene/cell-based therapy have been revolutionized by the development of safer and efficient non-viral technologies for gene delivery and genome editing with modern techniques for insertion of the neurotrophic factors into clinically relevant cells for a more sustained pharmaceutical effect. It has been suggested that the long-term expression of neurotrophic factors is the ultimate approach to prevent and/or treat neurodegenerative disorders such as glaucoma in patients who do not respond to available treatments or are at the progressive stage of the disease. Recent preclinical research suggests that novel neuroprotective gene and cell therapeutics could be promising approaches for both non-invasive neuroprotection and regenerative functions in the eye. Several progenitor and retinal cell types have been investigated as potential candidates for glaucoma neurotrophin therapy either as targets for gene therapy, options for cell replacement therapy, or as vehicles for gene delivery. Therefore, in parallel with deeper understanding of the specific protective effects of different neurotrophic factors and the potential therapeutic cell candidates for glaucoma neuroprotection, the development of non-invasive and highly specific gene delivery methods with safe and effective technologies to modify cell candidates for life-long neuroprotection in the eye is essential before investing in this field.

Network-Based Identification and Prioritization of Key Regulators of Coronary Artery Disease Loci

PubMed Central

Zhao, Yuqi; Chen, Jing; Freudenberg, Johannes M.; Meng, Qingying; Rajpal, Deepak K.; Yang, Xia

2017-01-01

Objective Recent genome-wide association studies of coronary artery disease (CAD) have revealed 58 genome-wide significant and 148 suggestive genetic loci. However, the molecular mechanisms through which they contribute to CAD and the clinical implications of these findings remain largely unknown. We aim to retrieve gene subnetworks of the 206 CAD loci and identify and prioritize candidate regulators to better understand the biological mechanisms underlying the genetic associations. Approach and Results We devised a new integrative genomics approach that incorporated (1) candidate genes from the top CAD loci, (2) the complete genetic association results from the 1000 genomes-based CAD genome-wide association studies from the Coronary Artery Disease Genome Wide Replication and Meta-Analysis Plus the Coronary Artery Disease consortium, (3) tissue-specific gene regulatory networks that depict the potential relationship and interactions between genes, and (4) tissue-specific gene expression patterns between CAD patients and controls. The networks and top-ranked regulators according to these data-driven criteria were further queried against literature, experimental evidence, and drug information to evaluate their disease relevance and potential as drug targets. Our analysis uncovered several potential novel regulators of CAD such as LUM and STAT3, which possess properties suitable as drug targets. We also revealed molecular relations and potential mechanisms through which the top CAD loci operate. Furthermore, we found that multiple CAD-relevant biological processes such as extracellular matrix, inflammatory and immune pathways, complement and coagulation cascades, and lipid metabolism interact in the CAD networks. Conclusions Our data-driven integrative genomics framework unraveled tissue-specific relations among the candidate genes of the CAD genome-wide association studies loci and prioritized novel network regulatory genes orchestrating biological processes relevant to CAD. PMID:26966275

Genome sequence comparison reveals a candidate gene involved in male-hermaphrodite differentiation in papaya (Carica papaya) trees.

PubMed

Ueno, Hiroki; Urasaki, Naoya; Natsume, Satoshi; Yoshida, Kentaro; Tarora, Kazuhiko; Shudo, Ayano; Terauchi, Ryohei; Matsumura, Hideo

2015-04-01

The sex type of papaya (Carica papaya) is determined by the pair of sex chromosomes (XX, female; XY, male; and XY(h), hermaphrodite), in which there is a non-recombining genomic region in the Y and Y(h) chromosomes. This region is presumed to be involved in determination of males and hermaphrodites; it is designated as the male-specific region in the Y chromosome (MSY) and the hermaphrodite-specific region in the Y(h) chromosome (HSY). Here, we identified the genes determining male and hermaphrodite sex types by comparing MSY and HSY genomic sequences. In the MSY and HSY genomic regions, we identified 14,528 nucleotide substitutions and 965 short indels with a large gap and two highly diverged regions. In the predicted genes expressed in flower buds, we found no nucleotide differences leading to amino acid changes between the MSY and HSY. However, we found an HSY-specific transposon insertion in a gene (SVP like) showing a similarity to the Short Vegetative Phase (SVP) gene. Study of SVP-like transcripts revealed that the MSY allele encoded an intact protein, while the HSY allele encoded a truncated protein. Our findings demonstrated that the SVP-like gene is a candidate gene for male-hermaphrodite determination in papaya.

A genomic scan for selection reveals candidates for genes involved in the evolution of cultivated sunflower (Helianthus annuus).

PubMed

Chapman, Mark A; Pashley, Catherine H; Wenzler, Jessica; Hvala, John; Tang, Shunxue; Knapp, Steven J; Burke, John M

2008-11-01

Genomic scans for selection are a useful tool for identifying genes underlying phenotypic transitions. In this article, we describe the results of a genome scan designed to identify candidates for genes targeted by selection during the evolution of cultivated sunflower. This work involved screening 492 loci derived from ESTs on a large panel of wild, primitive (i.e., landrace), and improved sunflower (Helianthus annuus) lines. This sampling strategy allowed us to identify candidates for selectively important genes and investigate the likely timing of selection. Thirty-six genes showed evidence of selection during either domestication or improvement based on multiple criteria, and a sequence-based test of selection on a subset of these loci confirmed this result. In view of what is known about the structure of linkage disequilibrium across the sunflower genome, these genes are themselves likely to have been targeted by selection, rather than being merely linked to the actual targets. While the selection candidates showed a broad range of putative functions, they were enriched for genes involved in amino acid synthesis and protein catabolism. Given that a similar pattern has been detected in maize (Zea mays), this finding suggests that selection on amino acid composition may be a general feature of the evolution of crop plants. In terms of genomic locations, the selection candidates were significantly clustered near quantitative trait loci (QTL) that contribute to phenotypic differences between wild and cultivated sunflower, and specific instances of QTL colocalization provide some clues as to the roles that these genes may have played during sunflower evolution.

Genome-Wide Identification of Differentially Expressed Genes Associated with the High Yielding of Oleoresin in Secondary Xylem of Masson Pine (Pinus massoniana Lamb) by Transcriptomic Analysis

PubMed Central

Liu, Qinghua; Zhou, Zhichun; Wei, Yongcheng; Shen, Danyu; Feng, Zhongping; Hong, Shanping

2015-01-01

Masson pine is an important timber and resource for oleoresin in South China. Increasing yield of oleoresin in stems can raise economic benefits and enhance the resistance to bark beetles. However, the genetic mechanisms for regulating the yield of oleoresin were still unknown. Here, high-throughput sequencing technology was used to investigate the transcriptome and compare the gene expression profiles of high and low oleoresin-yielding genotypes. A total of 40,690,540 reads were obtained and assembled into 137,499 transcripts from the secondary xylem tissues. We identified 84,842 candidate unigenes based on sequence annotation using various databases and 96 unigenes were candidates for terpenoid backbone biosynthesis in pine. By comparing the expression profiles of high and low oleoresin-yielding genotypes, 649 differentially expressed genes (DEGs) were identified. GO enrichment analysis of DEGs revealed that multiple pathways were related to high yield of oleoresin. Nine candidate genes were validated by QPCR analysis. Among them, the candidate genes encoding geranylgeranyl diphosphate synthase (GGPS) and (-)-alpha/beta-pinene synthase were up-regulated in the high oleoresin-yielding genotype, while tricyclene synthase revealed lower expression level, which was in good agreement with the GC/MS result. In addition, DEG encoding ABC transporters, pathogenesis-related proteins (PR5 and PR9), phosphomethylpyrimidine synthase, non-specific lipid-transfer protein-like protein and ethylene responsive transcription factors (ERFs) were also confirmed to be critical for the biosynthesis of oleoresin. The next-generation sequencing strategy used in this study has proven to be a powerful means for analyzing transcriptome variation related to the yield of oleoresin in masson pine. The candidate genes encoding GGPS, (-)-alpha/beta-pinene, tricyclene synthase, ABC transporters, non-specific lipid-transfer protein-like protein, phosphomethylpyrimidine synthase, ERFs and pathogen responses may play important roles in regulating the yield of oleoresin. These DEGs are worthy of special attention in future studies. PMID:26167875

Genome-wide transcriptome study in wheat identified candidate genes related to processing quality, majority of them showing interaction (quality x development) and having temporal and spatial distributions.

PubMed

Singh, Anuradha; Mantri, Shrikant; Sharma, Monica; Chaudhury, Ashok; Tuli, Rakesh; Roy, Joy

2014-01-16

The cultivated bread wheat (Triticum aestivum L.) possesses unique flour quality, which can be processed into many end-use food products such as bread, pasta, chapatti (unleavened flat bread), biscuit, etc. The present wheat varieties require improvement in processing quality to meet the increasing demand of better quality food products. However, processing quality is very complex and controlled by many genes, which have not been completely explored. To identify the candidate genes whose expressions changed due to variation in processing quality and interaction (quality x development), genome-wide transcriptome studies were performed in two sets of diverse Indian wheat varieties differing for chapatti quality. It is also important to understand the temporal and spatial distributions of their expressions for designing tissue and growth specific functional genomics experiments. Gene-specific two-way ANOVA analysis of expression of about 55 K transcripts in two diverse sets of Indian wheat varieties for chapatti quality at three seed developmental stages identified 236 differentially expressed probe sets (10-fold). Out of 236, 110 probe sets were identified for chapatti quality. Many processing quality related key genes such as glutenin and gliadins, puroindolines, grain softness protein, alpha and beta amylases, proteases, were identified, and many other candidate genes related to cellular and molecular functions were also identified. The ANOVA analysis revealed that the expression of 56 of 110 probe sets was involved in interaction (quality x development). Majority of the probe sets showed differential expression at early stage of seed development i.e. temporal expression. Meta-analysis revealed that the majority of the genes expressed in one or a few growth stages indicating spatial distribution of their expressions. The differential expressions of a few candidate genes such as pre-alpha/beta-gliadin and gamma gliadin were validated by RT-PCR. Therefore, this study identified several quality related key genes including many other genes, their interactions (quality x development) and temporal and spatial distributions. The candidate genes identified for processing quality and information on temporal and spatial distributions of their expressions would be useful for designing wheat improvement programs for processing quality either by changing their expression or development of single nucleotide polymorphisms (SNPs) markers.

Genome-wide transcriptome study in wheat identified candidate genes related to processing quality, majority of them showing interaction (quality x development) and having temporal and spatial distributions

PubMed Central

2014-01-01

Background The cultivated bread wheat (Triticum aestivum L.) possesses unique flour quality, which can be processed into many end-use food products such as bread, pasta, chapatti (unleavened flat bread), biscuit, etc. The present wheat varieties require improvement in processing quality to meet the increasing demand of better quality food products. However, processing quality is very complex and controlled by many genes, which have not been completely explored. To identify the candidate genes whose expressions changed due to variation in processing quality and interaction (quality x development), genome-wide transcriptome studies were performed in two sets of diverse Indian wheat varieties differing for chapatti quality. It is also important to understand the temporal and spatial distributions of their expressions for designing tissue and growth specific functional genomics experiments. Results Gene-specific two-way ANOVA analysis of expression of about 55 K transcripts in two diverse sets of Indian wheat varieties for chapatti quality at three seed developmental stages identified 236 differentially expressed probe sets (10-fold). Out of 236, 110 probe sets were identified for chapatti quality. Many processing quality related key genes such as glutenin and gliadins, puroindolines, grain softness protein, alpha and beta amylases, proteases, were identified, and many other candidate genes related to cellular and molecular functions were also identified. The ANOVA analysis revealed that the expression of 56 of 110 probe sets was involved in interaction (quality x development). Majority of the probe sets showed differential expression at early stage of seed development i.e. temporal expression. Meta-analysis revealed that the majority of the genes expressed in one or a few growth stages indicating spatial distribution of their expressions. The differential expressions of a few candidate genes such as pre-alpha/beta-gliadin and gamma gliadin were validated by RT-PCR. Therefore, this study identified several quality related key genes including many other genes, their interactions (quality x development) and temporal and spatial distributions. Conclusions The candidate genes identified for processing quality and information on temporal and spatial distributions of their expressions would be useful for designing wheat improvement programs for processing quality either by changing their expression or development of single nucleotide polymorphisms (SNPs) markers. PMID:24433256

Identification of rhizome-specific genes by genome-wide differential expression analysis in Oryza longistaminata.

PubMed

Hu, Fengyi; Wang, Di; Zhao, Xiuqin; Zhang, Ting; Sun, Haixi; Zhu, Linghua; Zhang, Fan; Li, Lijuan; Li, Qiong; Tao, Dayun; Fu, Binying; Li, Zhikang

2011-01-24

Rhizomatousness is a key component of perenniality of many grasses that contribute to competitiveness and invasiveness of many noxious grass weeds, but can potentially be used to develop perennial cereal crops for sustainable farmers in hilly areas of tropical Asia. Oryza longistaminata, a perennial wild rice with strong rhizomes, has been used as the model species for genetic and molecular dissection of rhizome development and in breeding efforts to transfer rhizome-related traits into annual rice species. In this study, an effort was taken to get insights into the genes and molecular mechanisms underlying the rhizomatous trait in O. longistaminata by comparative analysis of the genome-wide tissue-specific gene expression patterns of five different tissues of O. longistaminata using the Affymetrix GeneChip Rice Genome Array. A total of 2,566 tissue-specific genes were identified in five different tissues of O. longistaminata, including 58 and 61 unique genes that were specifically expressed in the rhizome tips (RT) and internodes (RI), respectively. In addition, 162 genes were up-regulated and 261 genes were down-regulated in RT compared to the shoot tips. Six distinct cis-regulatory elements (CGACG, GCCGCC, GAGAC, AACGG, CATGCA, and TAAAG) were found to be significantly more abundant in the promoter regions of genes differentially expressed in RT than in the promoter regions of genes uniformly expressed in all other tissues. Many of the RT and/or RI specifically or differentially expressed genes were located in the QTL regions associated with rhizome expression, rhizome abundance and rhizome growth-related traits in O. longistaminata and thus are good candidate genes for these QTLs. The initiation and development of the rhizomatous trait in O. longistaminata are controlled by very complex gene networks involving several plant hormones and regulatory genes, different members of gene families showing tissue specificity and their regulated pathways. Auxin/IAA appears to act as a negative regulator in rhizome development, while GA acts as the activator in rhizome development. Co-localization of the genes specifically expressed in rhizome tips and rhizome internodes with the QTLs for rhizome traits identified a large set of candidate genes for rhizome initiation and development in rice for further confirmation.

Identification of novel candidate drivers connecting different dysfunctional levels for lung adenocarcinoma using protein-protein interactions and a shortest path approach

NASA Astrophysics Data System (ADS)

Chen, Lei; Huang, Tao; Zhang, Yu-Hang; Jiang, Yang; Zheng, Mingyue; Cai, Yu-Dong

2016-07-01

Tumors are formed by the abnormal proliferation of somatic cells with disordered growth regulation under the influence of tumorigenic factors. Recently, the theory of “cancer drivers” connects tumor initiation with several specific mutations in the so-called cancer driver genes. According to the differentiation of four basic levels between tumor and adjacent normal tissues, the cancer drivers can be divided into the following: (1) Methylation level, (2) microRNA level, (3) mutation level, and (4) mRNA level. In this study, a computational method is proposed to identify novel lung adenocarcinoma drivers based on dysfunctional genes on the methylation, microRNA, mutation and mRNA levels. First, a large network was constructed using protein-protein interactions. Next, we searched all of the shortest paths connecting dysfunctional genes on different levels and extracted new candidate genes lying on these paths. Finally, the obtained candidate genes were filtered by a permutation test and an additional strict selection procedure involving a betweenness ratio and an interaction score. Several candidate genes remained, which are deemed to be related to two different levels of cancer. The analyses confirmed our assertions that some have the potential to contribute to the tumorigenesis process on multiple levels.

Mining biological databases for candidate disease genes

NASA Astrophysics Data System (ADS)

Braun, Terry A.; Scheetz, Todd; Webster, Gregg L.; Casavant, Thomas L.

2001-07-01

The publicly-funded effort to sequence the complete nucleotide sequence of the human genome, the Human Genome Project (HGP), has currently produced more than 93% of the 3 billion nucleotides of the human genome into a preliminary `draft' format. In addition, several valuable sources of information have been developed as direct and indirect results of the HGP. These include the sequencing of model organisms (rat, mouse, fly, and others), gene discovery projects (ESTs and full-length), and new technologies such as expression analysis and resources (micro-arrays or gene chips). These resources are invaluable for the researchers identifying the functional genes of the genome that transcribe and translate into the transcriptome and proteome, both of which potentially contain orders of magnitude more complexity than the genome itself. Preliminary analyses of this data identified approximately 30,000 - 40,000 human `genes.' However, the bulk of the effort still remains -- to identify the functional and structural elements contained within the transcriptome and proteome, and to associate function in the transcriptome and proteome to genes. A fortuitous consequence of the HGP is the existence of hundreds of databases containing biological information that may contain relevant data pertaining to the identification of disease-causing genes. The task of mining these databases for information on candidate genes is a commercial application of enormous potential. We are developing a system to acquire and mine data from specific databases to aid our efforts to identify disease genes. A high speed cluster of Linux of workstations is used to analyze sequence and perform distributed sequence alignments as part of our data mining and processing. This system has been used to mine GeneMap99 sequences within specific genomic intervals to identify potential candidate disease genes associated with Bardet-Biedle Syndrome (BBS).

Identification of Differentially Expressed Genes in Blood Cells of Narcolepsy Patients

PubMed Central

Tanaka, Susumu; Honda, Yutaka; Honda, Makoto

2007-01-01

Study Objective: A close association between the human leukocyte antigen (HLA)-DRB1*1501/DQB1*0602 and abnormalities in some inflammatory cytokines have been demonstrated in narcolepsy. Specific alterations in the immune system have been suggested to occur in this disorder. We attempted to identify alterations in gene expression underlying the abnormalities in the blood cells of narcoleptic patients. Designs: Total RNA from 12 narcolepsy-cataplexy patients and from 12 age- and sex-matched healthy controls were pooled. The pooled samples were initially screened for candidate genes for narcolepsy by differential display analysis using annealing control primers (ACP). The second screening of the samples was carried out by semiquantitative PCR using gene-specific primers. Finally, the expression levels of the candidate genes were further confirmed by quantitative real-time PCR using a new set of samples (20 narcolepsy-cataplexy patients and 20 healthy controls). Results: The second screening revealed differential expression of 4 candidate genes. Among them, MX2 was confirmed as a significantly down-regulated gene in the white blood cells of narcoleptic patients by quantitative real-time PCR. Conclusion: We found the MX2 gene to be significantly less expressed in comparison with normal subjects in the white blood cells of narcoleptic patients. This gene is relevant to the immune system. Although differential display analysis using ACP technology has a limitation in that it does not help in determining the functional mechanism underlying sleep/wakefulness dysregulation, it is useful for identifying novel genetic factors related to narcolepsy, such as HLA molecules. Further studies are required to explore the functional relationship between the MX2 gene and narcolepsy pathophysiology. Citation: Tanaka S; Honda Y; Honda M. Identification of differentially expressed genes in blood cells of narcolepsy patients. SLEEP 2007;30(8):974-979. PMID:17702266

Leveraging lung tissue transcriptome to uncover candidate causal genes in COPD genetic associations.

PubMed

Lamontagne, Maxime; Bérubé, Jean-Christophe; Obeidat, Ma'en; Cho, Michael H; Hobbs, Brian D; Sakornsakolpat, Phuwanat; de Jong, Kim; Boezen, H Marike; Nickle, David; Hao, Ke; Timens, Wim; van den Berge, Maarten; Joubert, Philippe; Laviolette, Michel; Sin, Don D; Paré, Peter D; Bossé, Yohan

2018-05-15

Causal genes of chronic obstructive pulmonary disease (COPD) remain elusive. The current study aims at integrating genome-wide association studies (GWAS) and lung expression quantitative trait loci (eQTL) data to map COPD candidate causal genes and gain biological insights into the recently discovered COPD susceptibility loci. Two complementary genomic datasets on COPD were studied. First, the lung eQTL dataset which included whole-genome gene expression and genotyping data from 1038 individuals. Second, the largest COPD GWAS to date from the International COPD Genetics Consortium (ICGC) with 13 710 cases and 38 062 controls. Methods that integrated GWAS with eQTL signals including transcriptome-wide association study (TWAS), colocalization and Mendelian randomization-based (SMR) approaches were used to map causality genes, i.e. genes with the strongest evidence of being the functional effector at specific loci. These methods were applied at the genome-wide level and at COPD risk loci derived from the GWAS literature. Replication was performed using lung data from GTEx. We collated 129 non-overlapping risk loci for COPD from the GWAS literature. At the genome-wide scale, 12 new COPD candidate genes/loci were revealed and six replicated in GTEx including CAMK2A, DMPK, MYO15A, TNFRSF10A, BTN3A2 and TRBV30. In addition, we mapped candidate causal genes for 60 out of the 129 GWAS-nominated loci and 23 of them were replicated in GTEx. Mapping candidate causal genes in lung tissue represents an important contribution to the genetics of COPD, enriches our biological interpretation of GWAS findings, and brings us closer to clinical translation of genetic associations.

Genetics of human neural tube defects

PubMed Central

Greene, Nicholas D.E.; Stanier, Philip; Copp, Andrew J.

2009-01-01

Neural tube defects (NTDs) are common, severe congenital malformations whose causation involves multiple genes and environmental factors. Although more than 200 genes are known to cause NTDs in mice, there has been rather limited progress in delineating the molecular basis underlying most human NTDs. Numerous genetic studies have been carried out to investigate candidate genes in cohorts of patients, with particular reference to those that participate in folate one-carbon metabolism. Although the homocysteine remethylation gene MTHFR has emerged as a risk factor in some human populations, few other consistent findings have resulted from this approach. Similarly, attention focused on the human homologues of mouse NTD genes has contributed only limited positive findings to date, although an emerging association between genes of the non-canonical Wnt (planar cell polarity) pathway and NTDs provides candidates for future studies. Priorities for the next phase of this research include: (i) larger studies that are sufficiently powered to detect significant associations with relatively minor risk factors; (ii) analysis of multiple candidate genes in groups of well-genotyped individuals to detect possible gene–gene interactions; (iii) use of high throughput genomic technology to evaluate the role of copy number variants and to detect ‘private’ and regulatory mutations, neither of which have been studied to date; (iv) detailed analysis of patient samples stratified by phenotype to enable, for example, hypothesis-driven testing of candidates genes in groups of NTDs with specific defects of folate metabolism, or in groups of fetuses with well-defined phenotypes such as craniorachischisis. PMID:19808787

Genetic analysis of the calcineurin pathway identifies members of the EGR gene family, specifically EGR3, as potential susceptibility candidates in schizophrenia

PubMed Central

Yamada, Kazuo; Gerber, David J.; Iwayama, Yoshimi; Ohnishi, Tetsuo; Ohba, Hisako; Toyota, Tomoko; Aruga, Jun; Minabe, Yoshio; Tonegawa, Susumu; Yoshikawa, Takeo

2007-01-01

The calcineurin cascade is central to neuronal signal transduction, and genes in this network are intriguing candidate schizophrenia susceptibility genes. To replicate and extend our previously reported association between the PPP3CC gene, encoding the calcineurin catalytic γ-subunit, and schizophrenia, we examined 84 SNPs from 14 calcineurin-related candidate genes for genetic association by using 124 Japanese schizophrenic pedigrees. Four of these genes (PPP3CC, EGR2, EGR3, and EGR4) showed nominally significant association with schizophrenia. In a postmortem brain study, EGR1, EGR2, and EGR3 transcripts were shown to be down-regulated in the prefrontal cortex of schizophrenic, but not bipolar, patients. These findings raise a potentially important role for EGR genes in schizophrenia pathogenesis. Because EGR3 is an attractive candidate gene based on its chromosomal location close to PPP3CC within 8p21.3 and its functional link to dopamine, glutamate, and neuregulin signaling, we extended our analysis by resequencing the entire EGR3 genomic interval and detected 15 SNPs. One of these, IVS1 + 607A→G SNP, displayed the strongest evidence for disease association, which was confirmed in 1,140 independent case-control samples. An in vitro promoter assay detected a possible expression-regulatory effect of this SNP. These findings support the previous genetic association of altered calcineurin signaling with schizophrenia pathogenesis and identify EGR3 as a compelling susceptibility gene. PMID:17360599

Systematic identification and validation of candidate genes for detection of circulating tumor cells in peripheral blood specimens of colorectal cancer patients.

PubMed

Findeisen, Peter; Röckel, Matthias; Nees, Matthias; Röder, Christian; Kienle, Peter; Von Knebel Doeberitz, Magnus; Kalthoff, Holger; Neumaier, Michael

2008-11-01

The presence of tumor cells in peripheral blood is being regarded increasingly as a clinically relevant prognostic factor for colorectal cancer patients. Current molecular methods are very sensitive but due to low specificity their diagnostic value is limited. This study was undertaken in order to systematically identify and validate new colorectal cancer (CRC) marker genes for improved detection of minimal residual disease in peripheral blood mononuclear cells of colorectal cancer patients. Marker genes with upregulated gene expression in colorectal cancer tissue and cell lines were identified using microarray experiments and publicly available gene expression data. A systematic iterative approach was used to reduce a set of 346 candidate genes, reportedly associated with CRC to a selection of candidate genes that were then further validated by relative quantitative real-time RT-PCR. Analytical sensitivity of RT-PCR assays was determined by spiking experiments with CRC cells. Diagnostic sensitivity as well as specificity was tested on a control group consisting of 18 CRC patients compared to 12 individuals without malignant disease. From a total of 346-screened genes only serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 5 (SERPINB5) showed significantly elevated transcript levels in peripheral venous blood specimens of tumor patients when compared to the nonmalignant control group. These results were confirmed by analysis of an enlarged collective consisting of 63 CRC patients and 36 control individuals without malignant disease. In conclusion SERPINB5 seems to be a promising marker for detection of circulating tumor cells in peripheral blood of colorectal cancer patients.

Transcriptome profiling of the whitefly Bemisia tabaci reveals stage-specific gene expression signatures for thiamethoxam resistance

PubMed Central

Yang, N; Xie, W; Jones, CM; Bass, C; Jiao, X; Yang, X; Liu, B; Li, R; Zhang, Y

2013-01-01

Bemisia tabaci has developed high levels of resistance to many insecticides including the neonicotinoids and there is strong evidence that for some compounds resistance is stage-specific. To investigate the molecular basis of B. tabaci resistance to the neonicotinoid thiamethoxam we used a custom whitefly microarray to compare gene expression in the egg, nymph and adult stages of a thiamethoxam-resistant strain (TH-R) with a susceptible strain (TH-S). Gene ontology and bioinformatic analyses revealed that in all life stages many of the differentially expressed transcripts encoded enzymes involved in metabolic processes and/or metabolism of xenobiotics. Several of these are candidate resistance genes and include the cytochrome P450 CYP6CM1, which has been shown to confer resistance to several neonicotinoids previously, a P450 belonging to the Cytochrome P450s 4 family and a glutathione S-transferase (GST) belonging to the sigma class. Finally several ATP-binding cassette transporters of the ABCG subfamily were highly over-expressed in the adult stage of the TH-R strain and may play a role in resistance by active efflux. Here, we evaluated both common and stage-specific gene expression signatures and identified several candidate resistance genes that may underlie B. tabaci resistance to thiamethoxam. PMID:23889345

A polymorphic region in the human transcription factor AP-2beta gene is associated with specific personality traits.

PubMed

Damberg, M; Garpenstrand, H; Alfredsson, J; Ekblom, J; Forslund, K; Rylander, G; Oreland, L

2000-03-01

Transcription factor AP-2beta is implicated in playing an important role during embryonic development of different parts of the brain, eg, midbrain, hindbrain, spinal cord, dorsal and cranial root ganglia.1,2 The gene encoding AP-2beta contains a polymorphic region which includes a tetranucleotide repeat of [CAAA] four or five times, located in intron 2 between nucleotides 12593 and 12612.3 Since the midbrain contains structures important for variables such as mood and personality, we have investigated if the AP-2beta genotype is associated with personality traits estimated by the Karolinska Scales of Personality (KSP). Identification of transcription factor genes as candidate genes in psychiatric disorders is a novel approach to further elucidate the genetic factors that, together with environmental factors, are involved in the expression of specific psychiatric phenotypes. The AP-2beta genotype and KSP scores were determined for 137 Caucasian volunteers (73 females and 64 males). The personality traits muscular tension, guilt, somatic anxiety, psychastenia and indirect aggression were significantly associated with the specific AP-2beta genotype, albeit with significant difference between genders. Based on this result the human AP-2beta gene seems to be an important candidate gene for personality disorders. Moreover, the present results suggest that the structure of the intron 2 region of the AP-2beta gene is one factor that contributes to development of the constitutional component of specific personality traits.

Human retina-specific amine oxidase (RAO): cDNA cloning, tissue expression, and chromosomal mapping

DOE Office of Scientific and Technical Information (OSTI.GOV)

Imamura, Yutaka; Kubota, Ryo; Wang, Yimin

In search of candidate genes for hereditary retinal disease, we have employed a subtractive and differential cDNA cloning strategy and isolated a novel retina-specific cDNA. Nucleotide sequence analysis revealed an open reading frame of 2187 bp, which encodes a 729-amino-acid protein with a calculated molecular mass of 80,644 Da. The putative protein contained a conserved domain of copper amine oxidase, which is found in various species from bacteria to mammals. It showed the highest homology to bovine serum amine oxidase, which is believed to control the level of serum biogenic amines. Northern blot analysis of human adult and fetal tissuesmore » revealed that the protein is expressed abundantly and specifically in retina as a 2.7-kb transcript. Thus, we considered this protein a human retina-specific amine oxidase (RAO). The RAO gene (AOC2) was mapped by fluorescence in situ hybridization to human chromosome 17q21. We propose that AOC2 may be a candidate gene for hereditary ocular diseases. 38 refs., 4 figs.« less

Identification and Analyses of AUX-IAA target genes controlling multiple pathways in developing fiber cells of Gossypium hirsutum L

PubMed Central

Nigam, Deepti; Sawant, Samir V

2013-01-01

Technological development led to an increased interest in systems biological approaches in plants to characterize developmental mechanism and candidate genes relevant to specific tissue or cell morphology. AUX-IAA proteins are important plant-specific putative transcription factors. There are several reports on physiological response of this family in Arabidopsis but in cotton fiber the transcriptional network through which AUX-IAA regulated its target genes is still unknown. in-silico modelling of cotton fiber development specific gene expression data (108 microarrays and 22,737 genes) using Algorithm for the Reconstruction of Accurate Cellular Networks (ARACNe) reveals 3690 putative AUX-IAA target genes of which 139 genes were known to be AUX-IAA co-regulated within Arabidopsis. Further AUX-IAA targeted gene regulatory network (GRN) had substantial impact on the transcriptional dynamics of cotton fiber, as showed by, altered TF networks, and Gene Ontology (GO) biological processes and metabolic pathway associated with its target genes. Analysis of the AUX-IAA-correlated gene network reveals multiple functions for AUX-IAA target genes such as unidimensional cell growth, cellular nitrogen compound metabolic process, nucleosome organization, DNA-protein complex and process related to cell wall. These candidate networks/pathways have a variety of profound impacts on such cellular functions as stress response, cell proliferation, and cell differentiation. While these functions are fairly broad, their underlying TF networks may provide a global view of AUX-IAA regulated gene expression and a GRN that guides future studies in understanding role of AUX-IAA box protein and its targets regulating fiber development. PMID:24497725

Analysis of shared homozygosity regions in Saudi siblings with attention deficit hyperactivity disorder

PubMed Central

Al Yemni, Eman A.A.; Alnaemi, Faten M.; Abebe, Dejene; Al-Abdulaziz, Basma S.; Al Mubarak, Bashayer R.; Ghaziuddin, Mohammad; Al Tassan, Nada A.

2017-01-01

Aim Genetic and clinical complexities are common features of most psychiatric illnesses that pose a major obstacle in risk-gene identification. Attention deficit hyperactivity disorder (ADHD) is the most prevalent child-onset psychiatric illness, with high heritability. Over the past decade, numerous genetic studies utilizing various approaches, such as genome-wide association, candidate-gene association, and linkage analysis, have identified a multitude of candidate loci/genes. However, such studies have yielded diverse findings that are rarely reproduced, indicating that other genetic determinants have not been discovered yet. In this study, we carried out sib-pair analysis on seven multiplex families with ADHD from Saudi Arabia. We aimed to identify the candidate chromosomal regions and genes linked to the disease. Patients and methods A total of 41 individuals from multiplex families were analyzed for shared regions of homozygosity. Genes within these regions were prioritized according to their potential relevance to ADHD. Results We identified multiple genomic regions spanning different chromosomes to be shared among affected members of each family; these included chromosomes 3, 5, 6, 7, 8, 9, 10, 13, 17, and 18. We also found specific regions on chromosomes 8 and 17 to be shared between affected individuals from more than one family. Among the genes present in the regions reported here were involved in neurotransmission (GRM3, SIGMAR1, CHAT, and SLC18A3) and members of the HLA gene family (HLA-A, HLA-DPA1, and MICC). Conclusion The candidate regions identified in this study highlight the genetic diversity of ADHD. Upon further investigation, these loci may reveal candidate genes that enclose variants associated with ADHD. Although most ADHD studies were conducted in other populations, our study provides insight from an understudied, ethnically interesting population. PMID:28452824

Analysis of shared homozygosity regions in Saudi siblings with attention deficit hyperactivity disorder.

PubMed

Shinwari, Jameela M A; Al Yemni, Eman A A; Alnaemi, Faten M; Abebe, Dejene; Al-Abdulaziz, Basma S; Al Mubarak, Bashayer R; Ghaziuddin, Mohammad; Al Tassan, Nada A

2017-08-01

Genetic and clinical complexities are common features of most psychiatric illnesses that pose a major obstacle in risk-gene identification. Attention deficit hyperactivity disorder (ADHD) is the most prevalent child-onset psychiatric illness, with high heritability. Over the past decade, numerous genetic studies utilizing various approaches, such as genome-wide association, candidate-gene association, and linkage analysis, have identified a multitude of candidate loci/genes. However, such studies have yielded diverse findings that are rarely reproduced, indicating that other genetic determinants have not been discovered yet. In this study, we carried out sib-pair analysis on seven multiplex families with ADHD from Saudi Arabia. We aimed to identify the candidate chromosomal regions and genes linked to the disease. A total of 41 individuals from multiplex families were analyzed for shared regions of homozygosity. Genes within these regions were prioritized according to their potential relevance to ADHD. We identified multiple genomic regions spanning different chromosomes to be shared among affected members of each family; these included chromosomes 3, 5, 6, 7, 8, 9, 10, 13, 17, and 18. We also found specific regions on chromosomes 8 and 17 to be shared between affected individuals from more than one family. Among the genes present in the regions reported here were involved in neurotransmission (GRM3, SIGMAR1, CHAT, and SLC18A3) and members of the HLA gene family (HLA-A, HLA-DPA1, and MICC). The candidate regions identified in this study highlight the genetic diversity of ADHD. Upon further investigation, these loci may reveal candidate genes that enclose variants associated with ADHD. Although most ADHD studies were conducted in other populations, our study provides insight from an understudied, ethnically interesting population.

Genomic approaches for the elucidation of genes and gene networks underlying cardiovascular traits.

PubMed

Adriaens, M E; Bezzina, C R

2018-06-22

Genome-wide association studies have shed light on the association between natural genetic variation and cardiovascular traits. However, linking a cardiovascular trait associated locus to a candidate gene or set of candidate genes for prioritization for follow-up mechanistic studies is all but straightforward. Genomic technologies based on next-generation sequencing technology nowadays offer multiple opportunities to dissect gene regulatory networks underlying genetic cardiovascular trait associations, thereby aiding in the identification of candidate genes at unprecedented scale. RNA sequencing in particular becomes a powerful tool when combined with genotyping to identify loci that modulate transcript abundance, known as expression quantitative trait loci (eQTL), or loci modulating transcript splicing known as splicing quantitative trait loci (sQTL). Additionally, the allele-specific resolution of RNA-sequencing technology enables estimation of allelic imbalance, a state where the two alleles of a gene are expressed at a ratio differing from the expected 1:1 ratio. When multiple high-throughput approaches are combined with deep phenotyping in a single study, a comprehensive elucidation of the relationship between genotype and phenotype comes into view, an approach known as systems genetics. In this review, we cover key applications of systems genetics in the broad cardiovascular field.

Diversifying selection in the wheat stem rust fungus acts predominantly on pathogen-associated gene families and reveals candidate effectors

PubMed Central

Sperschneider, Jana; Ying, Hua; Dodds, Peter N.; Gardiner, Donald M.; Upadhyaya, Narayana M.; Singh, Karam B.; Manners, John M.; Taylor, Jennifer M.

2014-01-01

Plant pathogens cause severe losses to crop plants and threaten global food production. One striking example is the wheat stem rust fungus, Puccinia graminis f. sp. tritici, which can rapidly evolve new virulent pathotypes in response to resistant host lines. Like several other filamentous fungal and oomycete plant pathogens, its genome features expanded gene families that have been implicated in host-pathogen interactions, possibly encoding effector proteins that interact directly with target host defense proteins. Previous efforts to understand virulence largely relied on the prediction of secreted, small and cysteine-rich proteins as candidate effectors and thus delivered an overwhelming number of candidates. Here, we implement an alternative analysis strategy that uses the signal of adaptive evolution as a line of evidence for effector function, combined with comparative information and expression data. We demonstrate that in planta up-regulated genes that are rapidly evolving are found almost exclusively in pathogen-associated gene families, affirming the impact of host-pathogen co-evolution on genome structure and the adaptive diversification of specialized gene families. In particular, we predict 42 effector candidates that are conserved only across pathogens, induced during infection and rapidly evolving. One of our top candidates has recently been shown to induce genotype-specific hypersensitive cell death in wheat. This shows that comparative genomics incorporating the evolutionary signal of adaptation is powerful for predicting effector candidates for laboratory verification. Our system can be applied to a wide range of pathogens and will give insight into host-pathogen dynamics, ultimately leading to progress in strategies for disease control. PMID:25225496

Detecting novel genes with sparse arrays

PubMed Central

Haiminen, Niina; Smit, Bart; Rautio, Jari; Vitikainen, Marika; Wiebe, Marilyn; Martinez, Diego; Chee, Christine; Kunkel, Joe; Sanchez, Charles; Nelson, Mary Anne; Pakula, Tiina; Saloheimo, Markku; Penttilä, Merja; Kivioja, Teemu

2014-01-01

Species-specific genes play an important role in defining the phenotype of an organism. However, current gene prediction methods can only efficiently find genes that share features such as sequence similarity or general sequence characteristics with previously known genes. Novel sequencing methods and tiling arrays can be used to find genes without prior information and they have demonstrated that novel genes can still be found from extensively studied model organisms. Unfortunately, these methods are expensive and thus are not easily applicable, e.g., to finding genes that are expressed only in very specific conditions. We demonstrate a method for finding novel genes with sparse arrays, applying it on the 33.9 Mb genome of the filamentous fungus Trichoderma reesei. Our computational method does not require normalisations between arrays and it takes into account the multiple-testing problem typical for analysis of microarray data. In contrast to tiling arrays, that use overlapping probes, only one 25mer microarray oligonucleotide probe was used for every 100 b. Thus, only relatively little space on a microarray slide was required to cover the intergenic regions of a genome. The analysis was done as a by-product of a conventional microarray experiment with no additional costs. We found at least 23 good candidates for novel transcripts that could code for proteins and all of which were expressed at high levels. Candidate genes were found to neighbour ire1 and cre1 and many other regulatory genes. Our simple, low-cost method can easily be applied to finding novel species-specific genes without prior knowledge of their sequence properties. PMID:20691772

Identifying candidate genes for Type 2 Diabetes Mellitus and obesity through gene expression profiling in multiple tissues or cells.

PubMed

Chen, Junhui; Meng, Yuhuan; Zhou, Jinghui; Zhuo, Min; Ling, Fei; Zhang, Yu; Du, Hongli; Wang, Xiaoning

2013-01-01

Type 2 Diabetes Mellitus (T2DM) and obesity have become increasingly prevalent in recent years. Recent studies have focused on identifying causal variations or candidate genes for obesity and T2DM via analysis of expression quantitative trait loci (eQTL) within a single tissue. T2DM and obesity are affected by comprehensive sets of genes in multiple tissues. In the current study, gene expression levels in multiple human tissues from GEO datasets were analyzed, and 21 candidate genes displaying high percentages of differential expression were filtered out. Specifically, DENND1B, LYN, MRPL30, POC1B, PRKCB, RP4-655J12.3, HIBADH, and TMBIM4 were identified from the T2DM-control study, and BCAT1, BMP2K, CSRNP2, MYNN, NCKAP5L, SAP30BP, SLC35B4, SP1, BAP1, GRB14, HSP90AB1, ITGA5, and TOMM5 were identified from the obesity-control study. The majority of these genes are known to be involved in T2DM and obesity. Therefore, analysis of gene expression in various tissues using GEO datasets may be an effective and feasible method to determine novel or causal genes associated with T2DM and obesity.

Single-Cell RNA-Seq of Mouse Dopaminergic Neurons Informs Candidate Gene Selection for Sporadic Parkinson Disease.

PubMed

Hook, Paul W; McClymont, Sarah A; Cannon, Gabrielle H; Law, William D; Morton, A Jennifer; Goff, Loyal A; McCallion, Andrew S

2018-03-01

Genetic variation modulating risk of sporadic Parkinson disease (PD) has been primarily explored through genome-wide association studies (GWASs). However, like many other common genetic diseases, the impacted genes remain largely unknown. Here, we used single-cell RNA-seq to characterize dopaminergic (DA) neuron populations in the mouse brain at embryonic and early postnatal time points. These data facilitated unbiased identification of DA neuron subpopulations through their unique transcriptional profiles, including a postnatal neuroblast population and substantia nigra (SN) DA neurons. We use these population-specific data to develop a scoring system to prioritize candidate genes in all 49 GWAS intervals implicated in PD risk, including genes with known PD associations and many with extensive supporting literature. As proof of principle, we confirm that the nigrostriatal pathway is compromised in Cplx1-null mice. Ultimately, this systematic approach establishes biologically pertinent candidates and testable hypotheses for sporadic PD, informing a new era of PD genetic research. Copyright © 2018 American Society of Human Genetics. All rights reserved.

Characterization of the OmyY1 region on the rainbow trout Y chromosome

USGS Publications Warehouse

Phillips, Ruth B.; DeKoning, Jenefer J.; Brunelli, Joseph P.; Faber-Hammond, Joshua J.; Hansen, John D.; Christensen, Kris A.; Renn, Suzy C.P.; Thorgaard, Gary H.

2013-01-01

We characterized the male-specific region on the Y chromosome of rainbow trout, which contains both sdY (the sex-determining gene) and the male-specific genetic marker, OmyY1. Several clones containing the OmyY1 marker were screened from a BAC library from a YY clonal line and found to be part of an 800 kb BAC contig. Using fluorescence in situ hybridization (FISH), these clones were localized to the end of the short arm of the Y chromosome in rainbow trout, with an additional signal on the end of the X chromosome in many cells. We sequenced a minimum tiling path of these clones using Illumina and 454 pyrosequencing. The region is rich in transposons and rDNA, but also appears to contain several single-copy protein-coding genes. Most of these genes are also found on the X chromosome; and in several cases sex-specific SNPs in these genes were identified between the male (YY) and female (XX) homozygous clonal lines. Additional genes were identified by hybridization of the BACs to the cGRASP salmonid 4x44K oligo microarray. By BLASTn evaluations using hypothetical transcripts of OmyY1-linked candidate genes as query against several EST databases, we conclude at least 12 of these candidate genes are likely functional, and expressed.

Genome-Wide Identification and Expression Analyses of Aquaporin Gene Family during Development and Abiotic Stress in Banana

PubMed Central

Hu, Wei; Hou, Xiaowan; Huang, Chao; Yan, Yan; Tie, Weiwei; Ding, Zehong; Wei, Yunxie; Liu, Juhua; Miao, Hongxia; Lu, Zhiwei; Li, Meiying; Xu, Biyu; Jin, Zhiqiang

2015-01-01

Aquaporins (AQPs) function to selectively control the flow of water and other small molecules through biological membranes, playing crucial roles in various biological processes. However, little information is available on the AQP gene family in bananas. In this study, we identified 47 banana AQP genes based on the banana genome sequence. Evolutionary analysis of AQPs from banana, Arabidopsis, poplar, and rice indicated that banana AQPs (MaAQPs) were clustered into four subfamilies. Conserved motif analysis showed that all banana AQPs contained the typical AQP-like or major intrinsic protein (MIP) domain. Gene structure analysis suggested the majority of MaAQPs had two to four introns with a highly specific number and length for each subfamily. Expression analysis of MaAQP genes during fruit development and postharvest ripening showed that some MaAQP genes exhibited high expression levels during these stages, indicating the involvement of MaAQP genes in banana fruit development and ripening. Additionally, some MaAQP genes showed strong induction after stress treatment and therefore, may represent potential candidates for improving banana resistance to abiotic stress. Taken together, this study identified some excellent tissue-specific, fruit development- and ripening-dependent, and abiotic stress-responsive candidate MaAQP genes, which could lay a solid foundation for genetic improvement of banana cultivars. PMID:26307965

Genetic control of functional traits related to photosynthesis and water use efficiency in Pinus pinaster Ait. drought response: integration of genome annotation, allele association and QTL detection for candidate gene identification.

PubMed

de Miguel, Marina; Cabezas, José-Antonio; de María, Nuria; Sánchez-Gómez, David; Guevara, María-Ángeles; Vélez, María-Dolores; Sáez-Laguna, Enrique; Díaz, Luis-Manuel; Mancha, Jose-Antonio; Barbero, María-Carmen; Collada, Carmen; Díaz-Sala, Carmen; Aranda, Ismael; Cervera, María-Teresa

2014-06-12

Understanding molecular mechanisms that control photosynthesis and water use efficiency in response to drought is crucial for plant species from dry areas. This study aimed to identify QTL for these traits in a Mediterranean conifer and tested their stability under drought. High density linkage maps for Pinus pinaster were used in the detection of QTL for photosynthesis and water use efficiency at three water irrigation regimes. A total of 28 significant and 27 suggestive QTL were found. QTL detected for photochemical traits accounted for the higher percentage of phenotypic variance. Functional annotation of genes within the QTL suggested 58 candidate genes for the analyzed traits. Allele association analysis in selected candidate genes showed three SNPs located in a MYB transcription factor that were significantly associated with efficiency of energy capture by open PSII reaction centers and specific leaf area. The integration of QTL mapping of functional traits, genome annotation and allele association yielded several candidate genes involved with molecular control of photosynthesis and water use efficiency in response to drought in a conifer species. The results obtained highlight the importance of maintaining the integrity of the photochemical machinery in P. pinaster drought response.

Integrated microarray and ChIP analysis identifies multiple Foxa2 dependent target genes in the notochord.

PubMed

Tamplin, Owen J; Cox, Brian J; Rossant, Janet

2011-12-15

The node and notochord are key tissues required for patterning of the vertebrate body plan. Understanding the gene regulatory network that drives their formation and function is therefore important. Foxa2 is a key transcription factor at the top of this genetic hierarchy and finding its targets will help us to better understand node and notochord development. We performed an extensive microarray-based gene expression screen using sorted embryonic notochord cells to identify early notochord-enriched genes. We validated their specificity to the node and notochord by whole mount in situ hybridization. This provides the largest available resource of notochord-expressed genes, and therefore candidate Foxa2 target genes in the notochord. Using existing Foxa2 ChIP-seq data from adult liver, we were able to identify a set of genes expressed in the notochord that had associated regions of Foxa2-bound chromatin. Given that Foxa2 is a pioneer transcription factor, we reasoned that these sites might represent notochord-specific enhancers. Candidate Foxa2-bound regions were tested for notochord specific enhancer function in a zebrafish reporter assay and 7 novel notochord enhancers were identified. Importantly, sequence conservation or predictive models could not have readily identified these regions. Mutation of putative Foxa2 binding elements in two of these novel enhancers abrogated reporter expression and confirmed their Foxa2 dependence. The combination of highly specific gene expression profiling and genome-wide ChIP analysis is a powerful means of understanding developmental pathways, even for small cell populations such as the notochord. Copyright © 2011 Elsevier Inc. All rights reserved.

Transcriptome and proteome data reveal candidate genes for pollinator attraction in sexually deceptive orchids.

PubMed

Sedeek, Khalid E M; Qi, Weihong; Schauer, Monica A; Gupta, Alok K; Poveda, Lucy; Xu, Shuqing; Liu, Zhong-Jian; Grossniklaus, Ueli; Schiestl, Florian P; Schlüter, Philipp M

2013-01-01

Sexually deceptive orchids of the genus Ophrys mimic the mating signals of their pollinator females to attract males as pollinators. This mode of pollination is highly specific and leads to strong reproductive isolation between species. This study aims to identify candidate genes responsible for pollinator attraction and reproductive isolation between three closely related species, O. exaltata, O. sphegodes and O. garganica. Floral traits such as odour, colour and morphology are necessary for successful pollinator attraction. In particular, different odour hydrocarbon profiles have been linked to differences in specific pollinator attraction among these species. Therefore, the identification of genes involved in these traits is important for understanding the molecular basis of pollinator attraction by sexually deceptive orchids. We have created floral reference transcriptomes and proteomes for these three Ophrys species using a combination of next-generation sequencing (454 and Solexa), Sanger sequencing, and shotgun proteomics (tandem mass spectrometry). In total, 121 917 unique transcripts and 3531 proteins were identified. This represents the first orchid proteome and transcriptome from the orchid subfamily Orchidoideae. Proteome data revealed proteins corresponding to 2644 transcripts and 887 proteins not observed in the transcriptome. Candidate genes for hydrocarbon and anthocyanin biosynthesis were represented by 156 and 61 unique transcripts in 20 and 7 genes classes, respectively. Moreover, transcription factors putatively involved in the regulation of flower odour, colour and morphology were annotated, including Myb, MADS and TCP factors. Our comprehensive data set generated by combining transcriptome and proteome technologies allowed identification of candidate genes for pollinator attraction and reproductive isolation among sexually deceptive orchids. This includes genes for hydrocarbon and anthocyanin biosynthesis and regulation, and the development of floral morphology. These data will serve as an invaluable resource for research in orchid floral biology, enabling studies into the molecular mechanisms of pollinator attraction and speciation.

Transcriptome and Proteome Data Reveal Candidate Genes for Pollinator Attraction in Sexually Deceptive Orchids

PubMed Central

Sedeek, Khalid E. M.; Qi, Weihong; Schauer, Monica A.; Gupta, Alok K.; Poveda, Lucy; Xu, Shuqing; Liu, Zhong-Jian; Grossniklaus, Ueli; Schiestl, Florian P.; Schlüter, Philipp M.

2013-01-01

Background Sexually deceptive orchids of the genus Ophrys mimic the mating signals of their pollinator females to attract males as pollinators. This mode of pollination is highly specific and leads to strong reproductive isolation between species. This study aims to identify candidate genes responsible for pollinator attraction and reproductive isolation between three closely related species, O. exaltata, O. sphegodes and O. garganica. Floral traits such as odour, colour and morphology are necessary for successful pollinator attraction. In particular, different odour hydrocarbon profiles have been linked to differences in specific pollinator attraction among these species. Therefore, the identification of genes involved in these traits is important for understanding the molecular basis of pollinator attraction by sexually deceptive orchids. Results We have created floral reference transcriptomes and proteomes for these three Ophrys species using a combination of next-generation sequencing (454 and Solexa), Sanger sequencing, and shotgun proteomics (tandem mass spectrometry). In total, 121 917 unique transcripts and 3531 proteins were identified. This represents the first orchid proteome and transcriptome from the orchid subfamily Orchidoideae. Proteome data revealed proteins corresponding to 2644 transcripts and 887 proteins not observed in the transcriptome. Candidate genes for hydrocarbon and anthocyanin biosynthesis were represented by 156 and 61 unique transcripts in 20 and 7 genes classes, respectively. Moreover, transcription factors putatively involved in the regulation of flower odour, colour and morphology were annotated, including Myb, MADS and TCP factors. Conclusion Our comprehensive data set generated by combining transcriptome and proteome technologies allowed identification of candidate genes for pollinator attraction and reproductive isolation among sexually deceptive orchids. This includes genes for hydrocarbon and anthocyanin biosynthesis and regulation, and the development of floral morphology. These data will serve as an invaluable resource for research in orchid floral biology, enabling studies into the molecular mechanisms of pollinator attraction and speciation. PMID:23734209

Longevity candidate genes and their association with personality traits in the elderly

PubMed Central

Luciano, Michelle; Lopez, Lorna M.; de Moor, Marleen H.M.; Harris, Sarah E.; Davies, Gail; Nutile, Teresa; Krueger, Robert F.; Esko, Tõnu; Schlessinger, David; Toshiko, Tanaka; Derringer, Jaime L.; Realo, Anu; Hansell, Narelle K.; Pergadia, Michele L.; Pesonen, Anu-Katriina; Sanna, Serena; Terracciano, Antonio; Madden, Pamela A.F.; Penninx, Brenda; Spinhoven, Philip; Hartman, Catherine; Oostra, Ben A.; Janssens, A. Cecile J.W.; Eriksson, Johan G; Starr, John M.; Cannas, Alessandra; Ferrucci, Luigi; Metspalu, Andres; Wright, Margeret J.; Heath, Andrew C.; van Duijn, Cornelia M.; Bierut, Laura J.; Raikkonen, Katri; Martin, Nicholas G.; Ciullo, Marina; Rujescu, Dan; Boomsma, Dorret I.; Deary, Ian J.

2013-01-01

Human longevity and personality traits are both heritable and are consistently linked at the phenotypic level. We test the hypothesis that candidate genes influencing longevity in lower organisms are associated with variance in the five major dimensions of human personality (measured by the NEO-FFI and IPIP inventories) plus related mood states of anxiety and depression. Seventy single nucleotide polymorphisms (SNPs) in six brain expressed, longevity candidate genes (AFG3L2, FRAP1, MAT1A, MAT2A, SYNJ1 and SYNJ2) were typed in over one thousand 70-year old participants from the Lothian Birth Cohort of 1936 (LBC1936). No SNPs were associated with the personality and psychological distress traits at a Bonferroni corrected level of significance (p < 0.0002), but there was an over-representation of nominally significant (p < 0.05) SNPs in the synaptojanin-2 (SYNJ2) gene associated with agreeableness and symptoms of depression. Eight SNPs which showed nominally significant association across personality measurement instruments were tested in an extremely large replication sample of 17 106 participants. SNP rs350292, in SYNJ2, was significant: the minor allele was associated with an average decrease in NEO agreeableness scale scores of 0.25 points, and 0.67 points in the restricted analysis of elderly cohorts (most aged > 60 years). Because we selected a specific set of longevity genes based on functional genomics findings, further research on other longevity gene candidates is warranted to discover whether they are relevant candidates for personality and psychological distress traits. PMID:22213687

Selection of reference genes for RT-qPCR analysis in tumor tissues from male hepatocellular carcinoma patients with hepatitis B infection and cirrhosis.

PubMed

Liu, Shuang; Zhu, Pengfei; Zhang, Ling; Ding, Shanlong; Zheng, Sujun; Wang, Yang; Lu, Fengmin

2013-01-01

Reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR) has been widely used to quantify relative gene expression because of the high specificity, sensitivity and accuracy of this technique. However, its reliability is strongly depends on the expression stability of reference gene used for data normalization. Therefore, identification of reliable and condition specific reference genes is critical for the success of RT-qPCR. Hepatitis B virus (HBV) infection, male gender and the presence of cirrhosis are widely recognized as the leading independent risk factors for the development of hepatocellular carcinoma (HCC). This study aimed to select reliable reference gene for RT-qPCR analysis in HCC patients with all of those risk factors. Six candidate reference genes were analyzed in 33 paired tumor and non-tumor tissues from untreated HCC patients. The genes expression stabilities were assessed by geNorm and NormFinder. C-terminal binding protein 1(CTBP1) was the most stable gene among the 6 candidate genes evaluated by both geNorm and NormFinder. The expression stability values were 0.08 for CTBP1 and UBC, 0.09 for HPRT1, 0.12 for HMBS, 0.14 for GAPDH and 0.18 for 18S with geNorm analysis. The stability values suggested by NormFinder software were CTBP1: 0.044, UBC: 0.063, HMBS: 0.072, HPRT1: 0.072, GAPDH: 0.098 and 18S rRNA: 0.161. This is the first systematic analysis which suggested CTBP1 as the highest expression-stable gene in human male HBV infection related-HCC with cirrhosis. We recommend CTBP1 as the best candidate reference gene when RT-qPCR was used to determine gene(s) expression in HCC. This may facilitate the relevant HBV related HCC studies in the future.

Linkage study of nonsyndromic cleft lip with or without cleft palate using candidate genes and mapped polymorphic markers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stein, J.D.; Nelson, L.D.; Conner, B.J.

1994-09-01

Nonsyndromic cleft lip with or without cleft palate (CL(P)) involves fusion or growth failure of facial primordia during development. Complex segregation analysis of clefting populations suggest that an autosomal dominant gene may play a role in this common craniofacial disorder. We have ascertained 16 multigenerational families with CL(P) and tested linkage to 29 candidate genes and 139 mapped short tandem repeat markers. The candidate genes were selected based on their expression in craniofacial development or were identified through murine models. These include: TGF{alpha}, TGF{beta}1, TGF{beta}2, TGF{beta}3, EGF, EGFR, GRAS, cMyc, FGFR, Jun, JunB, PDFG{alpha}, PDGF{beta}, IGF2R, GCR Hox7, Hox8, Hox2B,more » twirler, 5 collagen and 3 extracellular matrix genes. Linkage was tested assuming an autosomal dominant model with sex-specific decreased penetrance. Linkage to all of the candidate loci was excluded in 11 families. RARA was tested and was not informative. However, haplotype analysis of markers flanking RARA on 17q allowed exclusion of this candidate locus. We have previously excluded linkage to 61 STR markers in 11 families. Seventy-eight mapped short tandem repeat markers have recently been tested in 16 families and 30 have been excluded. The remaining are being analyzed and an exclusion map is being developed based on the entire study results.« less

Molecular insight into the association between cartilage regeneration and ear wound healing in genetic mouse models: targeting new genes in regeneration.

PubMed

Rai, Muhammad Farooq; Schmidt, Eric J; McAlinden, Audrey; Cheverud, James M; Sandell, Linda J

2013-11-06

Tissue regeneration is a complex trait with few genetic models available. Mouse strains LG/J and MRL are exceptional healers. Using recombinant inbred strains from a large (LG/J, healer) and small (SM/J, nonhealer) intercross, we have previously shown a positive genetic correlation between ear wound healing, knee cartilage regeneration, and protection from osteoarthritis. We hypothesize that a common set of genes operates in tissue healing and articular cartilage regeneration. Taking advantage of archived histological sections from recombinant inbred strains, we analyzed expression of candidate genes through branched-chain DNA technology directly from tissue lysates. We determined broad-sense heritability of candidates, Pearson correlation of candidates with healing phenotypes, and Ward minimum variance cluster analysis for strains. A bioinformatic assessment of allelic polymorphisms within and near candidate genes was also performed. The expression of several candidates was significantly heritable among strains. Although several genes correlated with both ear wound healing and cartilage healing at a marginal level, the expression of four genes representing DNA repair (Xrcc2, Pcna) and Wnt signaling (Axin2, Wnt16) pathways was significantly positively correlated with both phenotypes. Cluster analysis accurately classified healers and nonhealers for seven out of eight strains based on gene expression. Specific sequence differences between LG/J and SM/J were identified as potential causal polymorphisms. Our study suggests a common genetic basis between tissue healing and osteoarthritis susceptibility. Mapping genetic variations causing differences in diverse healing responses in multiple tissues may reveal generic healing processes in pursuit of new therapeutic targets designed to induce or enhance regeneration and, potentially, protection from osteoarthritis.

RNA-Seq analysis and annotation of a draft blueberry genome assembly identifies candidate genes involved in fruit ripening, biosynthesis of bioactive compounds, and stage-specific alternative splicing.

PubMed

Gupta, Vikas; Estrada, April D; Blakley, Ivory; Reid, Rob; Patel, Ketan; Meyer, Mason D; Andersen, Stig Uggerhøj; Brown, Allan F; Lila, Mary Ann; Loraine, Ann E

2015-01-01

Blueberries are a rich source of antioxidants and other beneficial compounds that can protect against disease. Identifying genes involved in synthesis of bioactive compounds could enable the breeding of berry varieties with enhanced health benefits. Toward this end, we annotated a previously sequenced draft blueberry genome assembly using RNA-Seq data from five stages of berry fruit development and ripening. Genome-guided assembly of RNA-Seq read alignments combined with output from ab initio gene finders produced around 60,000 gene models, of which more than half were similar to proteins from other species, typically the grape Vitis vinifera. Comparison of gene models to the PlantCyc database of metabolic pathway enzymes identified candidate genes involved in synthesis of bioactive compounds, including bixin, an apocarotenoid with potential disease-fighting properties, and defense-related cyanogenic glycosides, which are toxic. Cyanogenic glycoside (CG) biosynthetic enzymes were highly expressed in green fruit, and a candidate CG detoxification enzyme was up-regulated during fruit ripening. Candidate genes for ethylene, anthocyanin, and 400 other biosynthetic pathways were also identified. Homology-based annotation using Blast2GO and InterPro assigned Gene Ontology terms to around 15,000 genes. RNA-Seq expression profiling showed that blueberry growth, maturation, and ripening involve dynamic gene expression changes, including coordinated up- and down-regulation of metabolic pathway enzymes and transcriptional regulators. Analysis of RNA-seq alignments identified developmentally regulated alternative splicing, promoter use, and 3' end formation. We report genome sequence, gene models, functional annotations, and RNA-Seq expression data that provide an important new resource enabling high throughput studies in blueberry.

Identification of rhizome-specific genes by genome-wide differential expression Analysis in Oryza longistaminata

PubMed Central

2011-01-01

Background Rhizomatousness is a key component of perenniality of many grasses that contribute to competitiveness and invasiveness of many noxious grass weeds, but can potentially be used to develop perennial cereal crops for sustainable farmers in hilly areas of tropical Asia. Oryza longistaminata, a perennial wild rice with strong rhizomes, has been used as the model species for genetic and molecular dissection of rhizome development and in breeding efforts to transfer rhizome-related traits into annual rice species. In this study, an effort was taken to get insights into the genes and molecular mechanisms underlying the rhizomatous trait in O. longistaminata by comparative analysis of the genome-wide tissue-specific gene expression patterns of five different tissues of O. longistaminata using the Affymetrix GeneChip Rice Genome Array. Results A total of 2,566 tissue-specific genes were identified in five different tissues of O. longistaminata, including 58 and 61 unique genes that were specifically expressed in the rhizome tips (RT) and internodes (RI), respectively. In addition, 162 genes were up-regulated and 261 genes were down-regulated in RT compared to the shoot tips. Six distinct cis-regulatory elements (CGACG, GCCGCC, GAGAC, AACGG, CATGCA, and TAAAG) were found to be significantly more abundant in the promoter regions of genes differentially expressed in RT than in the promoter regions of genes uniformly expressed in all other tissues. Many of the RT and/or RI specifically or differentially expressed genes were located in the QTL regions associated with rhizome expression, rhizome abundance and rhizome growth-related traits in O. longistaminata and thus are good candidate genes for these QTLs. Conclusion The initiation and development of the rhizomatous trait in O. longistaminata are controlled by very complex gene networks involving several plant hormones and regulatory genes, different members of gene families showing tissue specificity and their regulated pathways. Auxin/IAA appears to act as a negative regulator in rhizome development, while GA acts as the activator in rhizome development. Co-localization of the genes specifically expressed in rhizome tips and rhizome internodes with the QTLs for rhizome traits identified a large set of candidate genes for rhizome initiation and development in rice for further confirmation. PMID:21261937

Targeted Deletion and Lipidomic Analysis Identify Epithelial Cell COX-2 as a Major Driver of Chemically-induced Skin Cancer

PubMed Central

Jiao, Jing; Ishikawa, Tomo-o; Dumlao, Darren S.; Norris, Paul C.; Magyar, Clara E.; Mikulec, Carol; Catapang, Art; Dennis, Edward A.; Fischer, Susan M.; Herschman, Harvey R.

2014-01-01

Pharmacologic and global gene deletion studies demonstrate that cyclooxygenase-2 (PTGS2/COX2) plays a critical role in DMBA/TPA-induced skin tumor induction. While many cell types in the tumor microenvironment express COX-2, the cell types in which COX-2 expression is required for tumor promotion are not clearly established. Here, cell-type specific Cox-2 gene deletion reveals a vital role for skin epithelial cell COX-2 expression in DMBA/TPA tumor induction. In contrast, myeloid Cox-2 gene deletion has no effect on DMBA/TPA tumorigenesis. The infrequent, small tumors that develop on mice with an epithelial cell-specific Cox-2 gene deletion have decreased proliferation and increased cell differentiation properties. Blood vessel density is reduced in tumors with an epithelial cell-specific Cox-2 gene deletion, compared to littermate control tumors, suggesting a reciprocal relationship in tumor progression between COX-2 expressing tumor epithelial cells and microenvironment endothelial cells. Lipidomics analysis of skin and tumors from DMBA/TPA-treated mice suggests that the prostaglandins PGE2 and PGF2α are likely candidates for the epithelial cell COX-2-dependent eicosanoids that mediate tumor progression. This study both illustrates the value of cell-type specific gene deletions in understanding the cellular roles of signal-generating pathways in complex microenvironments and emphasizes the benefit of a systems-based lipidomic analysis approach to identify candidate lipid mediators of biological responses. PMID:25063587

Candidate genes for obesity-susceptibility show enriched association within a large genome-wide association study for BMI.

PubMed

Vimaleswaran, Karani S; Tachmazidou, Ioanna; Zhao, Jing Hua; Hirschhorn, Joel N; Dudbridge, Frank; Loos, Ruth J F

2012-10-15

Before the advent of genome-wide association studies (GWASs), hundreds of candidate genes for obesity-susceptibility had been identified through a variety of approaches. We examined whether those obesity candidate genes are enriched for associations with body mass index (BMI) compared with non-candidate genes by using data from a large-scale GWAS. A thorough literature search identified 547 candidate genes for obesity-susceptibility based on evidence from animal studies, Mendelian syndromes, linkage studies, genetic association studies and expression studies. Genomic regions were defined to include the genes ±10 kb of flanking sequence around candidate and non-candidate genes. We used summary statistics publicly available from the discovery stage of the genome-wide meta-analysis for BMI performed by the genetic investigation of anthropometric traits consortium in 123 564 individuals. Hypergeometric, rank tail-strength and gene-set enrichment analysis tests were used to test for the enrichment of association in candidate compared with non-candidate genes. The hypergeometric test of enrichment was not significant at the 5% P-value quantile (P = 0.35), but was nominally significant at the 25% quantile (P = 0.015). The rank tail-strength and gene-set enrichment tests were nominally significant for the full set of genes and borderline significant for the subset without SNPs at P < 10(-7). Taken together, the observed evidence for enrichment suggests that the candidate gene approach retains some value. However, the degree of enrichment is small despite the extensive number of candidate genes and the large sample size. Studies that focus on candidate genes have only slightly increased chances of detecting associations, and are likely to miss many true effects in non-candidate genes, at least for obesity-related traits.

Commentary: Fundamental problems with candidate gene-by-environment interaction studies - reflections on Moore and Thoemmes (2016).

PubMed

Border, Richard; Keller, Matthew C

2017-03-01

Moore and Thoemmes elaborate on one particular source of difficulty in the study of candidate gene-by-environment interactions (cG × E): how different biologically plausible configurations of gene-environment covariation can bias estimates of cG × E when not explicitly modeled. However, even if cG × E investigators were able to account for the sources of bias Moore and Thoemmes elaborate, it is unlikely that conventional approaches would yield reliable results. Published cG × E findings to date have generally employed inadequate analytic procedures, have relied on samples orders of magnitude too small to detect plausible effects, and have relied on a particular candidate gene approach that has been unfruitful and largely jettisoned in mainstream genetic analyses of complex traits. Analytic procedures for the study of gene-environment interplay must evolve to meet the challenges that the genetic architecture of complex traits presents, and investigators must collaborate on grander scales if we hope to begin to understand how specific genes and environments combine to affect behavior. © 2017 Association for Child and Adolescent Mental Health.

Quantitative Trait Loci for BMD in an SM/J by NZB/BlNJ Intercross Population and Identification of Trps1 as a Probable Candidate Gene

PubMed Central

Ishimori, Naoki; Stylianou, Ioannis M; Korstanje, Ron; Marion, Michael A; Li, Renhua; Donahue, Leah Rae; Rosen, Clifford J; Beamer, Wesley G; Paigen, Beverly; Churchill, Gary A

2008-01-01

Identification of genes that regulate BMD will enhance our understanding of osteoporosis and could provide novel molecular targets for treatment or prevention. We generated a mouse intercross population and carried out a quantitative trait locus (QTL) analysis of 143 female and 124 male F2 progeny from progenitor strains SM/J and NZB/BlNJ using whole body and vertebral areal BMD (aBMD) as measured by DXA. We found that both whole body and vertebral aBMD was affected by two loci on chromosome 9: one with a significant epistatic interaction on distal chromosome 8 and the other with a sex-specific effect. Two additional significant QTLs were identified on chromosome 12, and several suggestive ones were identified on chromosomes 5, 8, 15, and 19. The chromosome 9, 12, and 15 loci have been previously identified in other crosses. SNP-based haplotype analysis of the progenitor strains identified blocks within the QTL region that distinguish the low allele strains from the high allele strains, significantly narrowing the QTL region and reducing the possible candidate genes to 98 for chromosome 9, 31 for chromosome 12, and only 2 for chromosome 15. Trps1 is the most probable candidate gene for the chromosome 15 QTL. The sex-specific effects may help to elucidate the BMD differences between males and females. This study shows the power of statistical modeling to resolve linked QTLs and the use of haplotype analysis in narrowing the list of candidates. PMID:18442308

Revealing the Strong Functional Association of adipor2 and cdh13 with adipoq: A Gene Network Study.

PubMed

Bag, Susmita; Anbarasu, Anand

2015-04-01

In the present study, we have analyzed functional gene interactions of adiponectin gene (adipoq). The key role of adipoq is in regulating energy homeostasis and it functions as a novel signaling molecule for adipose tissue. Modules of highly inter-connected genes in disease-specific adipoq network are derived by integrating gene function and protein interaction data. Among twenty genes in adipoq web, adipoq is effectively conjoined with two genes: Adiponectin receptor 2 (adipor2) and cadherin 13 (cdh13). The functional analysis is done via ontological briefing and candidate disease identification. We observed that the highly efficient-interlinked genes connected with adipoq are adipor2 and cdh13. Interestingly, the ontological aspect of adipor2 and cdh13 in the adipoq network reveal the fact that adipoq and adipor2 are involved mostly in glucose and lipid metabolic processes. The gene cdh13 indulge in cell adhesion process with adipoq and adipor2. Our computational gene web analysis also predicts potential candidate disease recognition, thus indicating the involvement of adipoq, adipor2, and cdh13 with not only with obesity but also with breast cancer, leukemia, renal cancer, lung cancer, and cervical cancer. The current study provides researchers a comprehensible layout of adipoq network, its functional strategies and candidate disease approach associated with adipoq network.

Identification and fine mapping of a stay-green gene (Brnye1) in pakchoi (Brassica campestris L. ssp. chinensis).

PubMed

Wang, Nan; Liu, Zhiyong; Zhang, Yun; Li, Chengyu; Feng, Hui

2018-03-01

Using bulked segregant analysis combined with next-generation sequencing, we delimited the Brnye1 gene responsible for the stay-green trait of nye in pakchoi. Sequence analysis identified Bra019346 as the candidate gene. "Stay-green" refers to a plant trait whereby leaves remain green during senescence. This trait is useful in the cultivation of pakchoi (Brassica campestris L. ssp. chinensis), which is marketed as a green leaf product. This study aimed to identify the gene responsible for the stay-green trait in pakchoi. We identified a stay-green mutant in pakchoi, which we termed "nye". Genetic analysis revealed that the stay-green trait is controlled by a single recessive gene, Brnye1. Using the BSA-seq method, a 3.0-Mb candidate region was mapped on chromosome A03, which helped us localize Brnye1 to an 81.01-kb interval between SSR markers SSRWN27 and SSRWN30 via linkage analysis in an F 2 population. We identified 12 genes in this region, 11 of which were annotated based on the Brassica rapa annotation database, and one was a functionally unknown gene. An orthologous gene of the Arabidopsis gene AtNYE1, Bra019346, was identified as the potential candidate for Brnye1. Sequence analysis revealed a 40-bp insertion in the second exon of Bra019346 in nye, which generated the TAA stop codon. A candidate gene-specific Indel marker in 1561 F 2 individuals showed perfect cosegregation with Brnye1 in the nye mutant. These results provide a foundation for uncovering the molecular mechanism of the stay-green trait in pakchoi.

Fine mapping of RYMV3: a new resistance gene to Rice yellow mottle virus from Oryza glaberrima.

PubMed

Pidon, Hélène; Ghesquière, Alain; Chéron, Sophie; Issaka, Souley; Hébrard, Eugénie; Sabot, François; Kolade, Olufisayo; Silué, Drissa; Albar, Laurence

2017-04-01

A new resistance gene against Rice yellow mottle virus was identified and mapped in a 15-kb interval. The best candidate is a CC-NBS-LRR gene. Rice yellow mottle virus (RYMV) disease is a serious constraint to the cultivation of rice in Africa and selection for resistance is considered to be the most effective management strategy. The aim of this study was to characterize the resistance of Tog5307, a highly resistant accession belonging to the African cultivated rice species (Oryza glaberrima), that has none of the previously identified resistance genes to RYMV. The specificity of Tog5307 resistance was analyzed using 18 RYMV isolates. While three of them were able to infect Tog5307 very rapidly, resistance against the others was effective despite infection events attributed to resistance-breakdown or incomplete penetrance of the resistance. Segregation of resistance in an interspecific backcross population derived from a cross between Tog5307 and the susceptible Oryza sativa variety IR64 showed that resistance is dominant and is controlled by a single gene, named RYMV3. RYMV3 was mapped in an approximately 15-kb interval in which two candidate genes, coding for a putative transmembrane protein and a CC-NBS-LRR domain-containing protein, were annotated. Sequencing revealed non-synonymous polymorphisms between Tog5307 and the O. glaberrima susceptible accession CG14 in both candidate genes. An additional resistant O. glaberrima accession, Tog5672, was found to have the Tog5307 genotype for the CC-NBS-LRR gene but not for the putative transmembrane protein gene. Analysis of the cosegregation of Tog5672 resistance with the RYMV3 locus suggests that RYMV3 is also involved in Tog5672 resistance, thereby supporting the CC-NBS-LRR gene as the best candidate for RYMV3.

Candidate Luminal B Breast Cancer Genes Identified by Genome, Gene Expression and DNA Methylation Profiling

PubMed Central

Addou-Klouche, Lynda; Finetti, Pascal; Saade, Marie-Rose; Manai, Marwa; Carbuccia, Nadine; Bekhouche, Ismahane; Letessier, Anne; Charafe-Jauffret, Emmanuelle; Jacquemier, Jocelyne; Spicuglia, Salvatore; de The, Hugues; Viens, Patrice; Bertucci, François; Birnbaum, Daniel; Chaffanet, Max

2014-01-01

Breast cancers (BCs) of the luminal B subtype are estrogen receptor-positive (ER+), highly proliferative, resistant to standard therapies and have a poor prognosis. To better understand this subtype we compared DNA copy number aberrations (CNAs), DNA promoter methylation, gene expression profiles, and somatic mutations in nine selected genes, in 32 luminal B tumors with those observed in 156 BCs of the other molecular subtypes. Frequent CNAs included 8p11-p12 and 11q13.1-q13.2 amplifications, 7q11.22-q34, 8q21.12-q24.23, 12p12.3-p13.1, 12q13.11-q24.11, 14q21.1-q23.1, 17q11.1-q25.1, 20q11.23-q13.33 gains and 6q14.1-q24.2, 9p21.3-p24,3, 9q21.2, 18p11.31-p11.32 losses. A total of 237 and 101 luminal B-specific candidate oncogenes and tumor suppressor genes (TSGs) presented a deregulated expression in relation with their CNAs, including 11 genes previously reported associated with endocrine resistance. Interestingly, 88% of the potential TSGs are located within chromosome arm 6q, and seven candidate oncogenes are potential therapeutic targets. A total of 100 candidate oncogenes were validated in a public series of 5,765 BCs and the overexpression of 67 of these was associated with poor survival in luminal tumors. Twenty-four genes presented a deregulated expression in relation with a high DNA methylation level. FOXO3, PIK3CA and TP53 were the most frequent mutated genes among the nine tested. In a meta-analysis of next-generation sequencing data in 875 BCs, KCNB2 mutations were associated with luminal B cases while candidate TSGs MDN1 (6q15) and UTRN (6q24), were mutated in this subtype. In conclusion, we have reported luminal B candidate genes that may play a role in the development and/or hormone resistance of this aggressive subtype. PMID:24416132

Fast Evolution and Lineage-Specific Gene Family Expansions of Aphid Salivary Effectors Driven by Interactions with Host-Plants.

PubMed

Boulain, Hélène; Legeai, Fabrice; Guy, Endrick; Morlière, Stéphanie; Douglas, Nadine E; Oh, Jonghee; Murugan, Marimuthu; Smith, Michael; Jaquiéry, Julie; Peccoud, Jean; White, Frank F; Carolan, James C; Simon, Jean-Christophe; Sugio, Akiko

2018-05-18

Effector proteins play crucial roles in plant-parasite interactions by suppressing plant defenses and hijacking plant physiological responses to facilitate parasite invasion and propagation. Although effector proteins have been characterized in many microbial plant pathogens, their nature and role in adaptation to host plants are largely unknown in insect herbivores. Aphids rely on salivary effector proteins injected into the host plants to promote phloem sap uptake. Therefore, gaining insight into the repertoire and evolution of aphid effectors is key to unveiling the mechanisms responsible for aphid virulence and host plant specialization. With this aim in mind, we assembled catalogues of putative effectors in the legume specialist aphid, Acyrthosiphon pisum, using transcriptomics and proteomics approaches. We identified 3603 candidate effector genes predicted to be expressed in A. pisum salivary glands (SGs), and 740 of which displayed up-regulated expression in SGs in comparison to the alimentary tract. A search for orthologs in 17 arthropod genomes revealed that SG-up-regulated effector candidates of A. pisum are enriched in aphid-specific genes and tend to evolve faster compared to the whole gene set. We also found that a large fraction of proteins detected in the A. pisum saliva belonged to three gene families, of which certain members show evidence consistent with positive selection. Overall, this comprehensive analysis suggests that the large repertoire of effector candidates in A. pisum constitutes a source of novelties promoting plant adaptation to legumes.

Selection of reference genes for RT-qPCR analysis in a predatory biological control agent, Coleomegilla maculata (Coleoptera: Coccinellidae).

PubMed

Yang, Chunxiao; Pan, Huipeng; Noland, Jeffrey Edward; Zhang, Deyong; Zhang, Zhanhong; Liu, Yong; Zhou, Xuguo

2015-12-10

Reverse transcriptase-quantitative polymerase chain reaction (RT-qPCR) is a reliable technique for quantifying gene expression across various biological processes, of which requires a set of suited reference genes to normalize the expression data. Coleomegilla maculata (Coleoptera: Coccinellidae), is one of the most extensively used biological control agents in the field to manage arthropod pest species. In this study, expression profiles of 16 housekeeping genes selected from C. maculata were cloned and investigated. The performance of these candidates as endogenous controls under specific experimental conditions was evaluated by dedicated algorithms, including geNorm, Normfinder, BestKeeper, and ΔCt method. In addition, RefFinder, a comprehensive platform integrating all the above-mentioned algorithms, ranked the overall stability of these candidate genes. As a result, various sets of suitable reference genes were recommended specifically for experiments involving different tissues, developmental stages, sex, and C. maculate larvae treated with dietary double stranded RNA. This study represents the critical first step to establish a standardized RT-qPCR protocol for the functional genomics research in a ladybeetle C. maculate. Furthermore, it lays the foundation for conducting ecological risk assessment of RNAi-based gene silencing biotechnologies on non-target organisms; in this case, a key predatory biological control agent.

Direct and long-term detection of gene doping in conventional blood samples.

PubMed

Beiter, T; Zimmermann, M; Fragasso, A; Hudemann, J; Niess, A M; Bitzer, M; Lauer, U M; Simon, P

2011-03-01

The misuse of somatic gene therapy for the purpose of enhancing athletic performance is perceived as a coming threat to the world of sports and categorized as 'gene doping'. This article describes a direct detection approach for gene doping that gives a clear yes-or-no answer based on the presence or absence of transgenic DNA in peripheral blood samples. By exploiting a priming strategy to specifically amplify intronless DNA sequences, we developed PCR protocols allowing the detection of very small amounts of transgenic DNA in genomic DNA samples to screen for six prime candidate genes. Our detection strategy was verified in a mouse model, giving positive signals from minute amounts (20 μl) of blood samples for up to 56 days following intramuscular adeno-associated virus-mediated gene transfer, one of the most likely candidate vector systems to be misused for gene doping. To make our detection strategy amenable for routine testing, we implemented a robust sample preparation and processing protocol that allows cost-efficient analysis of small human blood volumes (200 μl) with high specificity and reproducibility. The practicability and reliability of our detection strategy was validated by a screening approach including 327 blood samples taken from professional and recreational athletes under field conditions.

Changing the Game: Using Integrative Genomics to Probe Virulence Mechanisms of the Stem Rust Pathogen Puccinia graminis f. sp. tritici.

PubMed

Figueroa, Melania; Upadhyaya, Narayana M; Sperschneider, Jana; Park, Robert F; Szabo, Les J; Steffenson, Brian; Ellis, Jeff G; Dodds, Peter N

2016-01-01

The recent resurgence of wheat stem rust caused by new virulent races of Puccinia graminis f. sp. tritici (Pgt) poses a threat to food security. These concerns have catalyzed an extensive global effort toward controlling this disease. Substantial research and breeding programs target the identification and introduction of new stem rust resistance (Sr) genes in cultivars for genetic protection against the disease. Such resistance genes typically encode immune receptor proteins that recognize specific components of the pathogen, known as avirulence (Avr) proteins. A significant drawback to deploying cultivars with single Sr genes is that they are often overcome by evolution of the pathogen to escape recognition through alterations in Avr genes. Thus, a key element in achieving durable rust control is the deployment of multiple effective Sr genes in combination, either through conventional breeding or transgenic approaches, to minimize the risk of resistance breakdown. In this situation, evolution of pathogen virulence would require changes in multiple Avr genes in order to bypass recognition. However, choosing the optimal Sr gene combinations to deploy is a challenge that requires detailed knowledge of the pathogen Avr genes with which they interact and the virulence phenotypes of Pgt existing in nature. Identifying specific Avr genes from Pgt will provide screening tools to enhance pathogen virulence monitoring, assess heterozygosity and propensity for mutation in pathogen populations, and confirm individual Sr gene functions in crop varieties carrying multiple effective resistance genes. Toward this goal, much progress has been made in assembling a high quality reference genome sequence for Pgt, as well as a Pan-genome encompassing variation between multiple field isolates with diverse virulence spectra. In turn this has allowed prediction of Pgt effector gene candidates based on known features of Avr genes in other plant pathogens, including the related flax rust fungus. Upregulation of gene expression in haustoria and evidence for diversifying selection are two useful parameters to identify candidate Avr genes. Recently, we have also applied machine learning approaches to agnostically predict candidate effectors. Here, we review progress in stem rust pathogenomics and approaches currently underway to identify Avr genes recognized by wheat Sr genes.

Acquisition and evolution of plant pathogenesis-associated gene clusters and candidate determinants of tissue-specificity in xanthomonas.

PubMed

Lu, Hong; Patil, Prabhu; Van Sluys, Marie-Anne; White, Frank F; Ryan, Robert P; Dow, J Maxwell; Rabinowicz, Pablo; Salzberg, Steven L; Leach, Jan E; Sonti, Ramesh; Brendel, Volker; Bogdanove, Adam J

2008-01-01

Xanthomonas is a large genus of plant-associated and plant-pathogenic bacteria. Collectively, members cause diseases on over 392 plant species. Individually, they exhibit marked host- and tissue-specificity. The determinants of this specificity are unknown. To assess potential contributions to host- and tissue-specificity, pathogenesis-associated gene clusters were compared across genomes of eight Xanthomonas strains representing vascular or non-vascular pathogens of rice, brassicas, pepper and tomato, and citrus. The gum cluster for extracellular polysaccharide is conserved except for gumN and sequences downstream. The xcs and xps clusters for type II secretion are conserved, except in the rice pathogens, in which xcs is missing. In the otherwise conserved hrp cluster, sequences flanking the core genes for type III secretion vary with respect to insertion sequence element and putative effector gene content. Variation at the rpf (regulation of pathogenicity factors) cluster is more pronounced, though genes with established functional relevance are conserved. A cluster for synthesis of lipopolysaccharide varies highly, suggesting multiple horizontal gene transfers and reassortments, but this variation does not correlate with host- or tissue-specificity. Phylogenetic trees based on amino acid alignments of gum, xps, xcs, hrp, and rpf cluster products generally reflect strain phylogeny. However, amino acid residues at four positions correlate with tissue specificity, revealing hpaA and xpsD as candidate determinants. Examination of genome sequences of xanthomonads Xylella fastidiosa and Stenotrophomonas maltophilia revealed that the hrp, gum, and xcs clusters are recent acquisitions in the Xanthomonas lineage. Our results provide insight into the ancestral Xanthomonas genome and indicate that differentiation with respect to host- and tissue-specificity involved not major modifications or wholesale exchange of clusters, but subtle changes in a small number of genes or in non-coding sequences, and/or differences outside the clusters, potentially among regulatory targets or secretory substrates.

Candidate genes for alcohol dependence: A genetic association study from India.

PubMed

Malhotra, Savita; Basu, Debasish; Khullar, Madhu; Ghosh, Abhishek; Chugh, Neera

2016-11-01

Search for candidate genes for alcohol dependence (AD) has been inconsistent and inconclusive. Moreover, most of the research has been confined to a few specific ethnic groups. Hence, the aim of our study was to explore specific candidate genes for AD in north Indian male population. In this clinic-based genetic association study, 210 males with AD and 200 controls matched for age, gender and ethnicity were recruited from the clinic and the general population, respectively. Cases were diagnosed with Semi-structured Assessment for Genetics of Alcoholism-II (SSAGA-II). Single-nucleotide polymorphism genotyping was done by real-time quantitative-polymerase chain reaction (PCR) using Taq Man assay (ABI 7500) fast real-time PCR system. Both at the genotypic level and at allelic frequency, Met158 variant of catechol-O-methyl transferase (COMT) showed significant increase in cases as compared to controls. The frequency of heterozygous genotype (A/G) of gamma-aminobutyric acid receptor A1 (GABRA1) was significantly lower in cases as compared to controls. Likewise, for GABRA2, the frequency of homozygous recessive genotype (G/G) was significantly higher in the control group. With respect to the 5-hydroxytryptamine (5HT) transporter long promoter region (5HTTLPR), cholinergic receptor muscarinic (CHRM2) and alcohol dehydrogenase 1B (ADH1B) genes, there was no significant difference between the cases and the controls. Aldehyde dehydrogenase (ALDH2) gene was found to be monomorphic in our study population. Our study findings showed COMT polymorphism conferring risk and GABRA polymorphism as a protective genotype for Indian male with AD. Genes for alcohol metabolism, serotonin transporter and cholinergic receptor gene polymorphism were perhaps not contributory to AD for Indian population.

"Contrasting patterns of selection at Pinus pinaster Ait. Drought stress candidate genes as revealed by genetic differentiation analyses".

PubMed

Eveno, Emmanuelle; Collada, Carmen; Guevara, M Angeles; Léger, Valérie; Soto, Alvaro; Díaz, Luis; Léger, Patrick; González-Martínez, Santiago C; Cervera, M Teresa; Plomion, Christophe; Garnier-Géré, Pauline H

2008-02-01

The importance of natural selection for shaping adaptive trait differentiation among natural populations of allogamous tree species has long been recognized. Determining the molecular basis of local adaptation remains largely unresolved, and the respective roles of selection and demography in shaping population structure are actively debated. Using a multilocus scan that aims to detect outliers from simulated neutral expectations, we analyzed patterns of nucleotide diversity and genetic differentiation at 11 polymorphic candidate genes for drought stress tolerance in phenotypically contrasted Pinus pinaster Ait. populations across its geographical range. We compared 3 coalescent-based methods: 2 frequentist-like, including 1 approach specifically developed for biallelic single nucleotide polymorphisms (SNPs) here and 1 Bayesian. Five genes showed outlier patterns that were robust across methods at the haplotype level for 2 of them. Two genes presented higher F(ST) values than expected (PR-AGP4 and erd3), suggesting that they could have been affected by the action of diversifying selection among populations. In contrast, 3 genes presented lower F(ST) values than expected (dhn-1, dhn2, and lp3-1), which could represent signatures of homogenizing selection among populations. A smaller proportion of outliers were detected at the SNP level suggesting the potential functional significance of particular combinations of sites in drought-response candidate genes. The Bayesian method appeared robust to low sample sizes, flexible to assumptions regarding migration rates, and powerful for detecting selection at the haplotype level, but the frequentist-like method adapted to SNPs was more efficient for the identification of outlier SNPs showing low differentiation. Population-specific effects estimated in the Bayesian method also revealed populations with lower immigration rates, which could have led to favorable situations for local adaptation. Outlier patterns are discussed in relation to the different genes' putative involvement in drought tolerance responses, from published results in transcriptomics and association mapping in P. pinaster and other related species. These genes clearly constitute relevant candidates for future association studies in P. pinaster.

Cancer in silico drug discovery: a systems biology tool for identifying candidate drugs to target specific molecular tumor subtypes.

PubMed

San Lucas, F Anthony; Fowler, Jerry; Chang, Kyle; Kopetz, Scott; Vilar, Eduardo; Scheet, Paul

2014-12-01

Large-scale cancer datasets such as The Cancer Genome Atlas (TCGA) allow researchers to profile tumors based on a wide range of clinical and molecular characteristics. Subsequently, TCGA-derived gene expression profiles can be analyzed with the Connectivity Map (CMap) to find candidate drugs to target tumors with specific clinical phenotypes or molecular characteristics. This represents a powerful computational approach for candidate drug identification, but due to the complexity of TCGA and technology differences between CMap and TCGA experiments, such analyses are challenging to conduct and reproduce. We present Cancer in silico Drug Discovery (CiDD; scheet.org/software), a computational drug discovery platform that addresses these challenges. CiDD integrates data from TCGA, CMap, and Cancer Cell Line Encyclopedia (CCLE) to perform computational drug discovery experiments, generating hypotheses for the following three general problems: (i) determining whether specific clinical phenotypes or molecular characteristics are associated with unique gene expression signatures; (ii) finding candidate drugs to repress these expression signatures; and (iii) identifying cell lines that resemble the tumors being studied for subsequent in vitro experiments. The primary input to CiDD is a clinical or molecular characteristic. The output is a biologically annotated list of candidate drugs and a list of cell lines for in vitro experimentation. We applied CiDD to identify candidate drugs to treat colorectal cancers harboring mutations in BRAF. CiDD identified EGFR and proteasome inhibitors, while proposing five cell lines for in vitro testing. CiDD facilitates phenotype-driven, systematic drug discovery based on clinical and molecular data from TCGA. ©2014 American Association for Cancer Research.

Annotating novel genes by integrating synthetic lethals and genomic information

PubMed Central

Schöner, Daniel; Kalisch, Markus; Leisner, Christian; Meier, Lukas; Sohrmann, Marc; Faty, Mahamadou; Barral, Yves; Peter, Matthias; Gruissem, Wilhelm; Bühlmann, Peter

2008-01-01

Background Large scale screening for synthetic lethality serves as a common tool in yeast genetics to systematically search for genes that play a role in specific biological processes. Often the amounts of data resulting from a single large scale screen far exceed the capacities of experimental characterization of every identified target. Thus, there is need for computational tools that select promising candidate genes in order to reduce the number of follow-up experiments to a manageable size. Results We analyze synthetic lethality data for arp1 and jnm1, two spindle migration genes, in order to identify novel members in this process. To this end, we use an unsupervised statistical method that integrates additional information from biological data sources, such as gene expression, phenotypic profiling, RNA degradation and sequence similarity. Different from existing methods that require large amounts of synthetic lethal data, our method merely relies on synthetic lethality information from two single screens. Using a Multivariate Gaussian Mixture Model, we determine the best subset of features that assign the target genes to two groups. The approach identifies a small group of genes as candidates involved in spindle migration. Experimental testing confirms the majority of our candidates and we present she1 (YBL031W) as a novel gene involved in spindle migration. We applied the statistical methodology also to TOR2 signaling as another example. Conclusion We demonstrate the general use of Multivariate Gaussian Mixture Modeling for selecting candidate genes for experimental characterization from synthetic lethality data sets. For the given example, integration of different data sources contributes to the identification of genetic interaction partners of arp1 and jnm1 that play a role in the same biological process. PMID:18194531

New animal models reveal that coenzyme Q2 (Coq2) and placenta-specific 8 (Plac8) are candidate genes for the onset of type 2 diabetes associated with obesity in rats.

PubMed

Sasaki, Daiki; Kotoh, Jun; Watadani, Risa; Matsumoto, Kozo

2015-12-01

Obesity is a major risk factor for the onset of type 2 diabetes; however, little is known about the gene(s) involved. Therefore, we developed new animal models of obesity to search for diabetogenic genes associated with obesity. We generated double congenic rat strains with a hyperglycaemic quantitative trait locus (QTL) derived from the Otsuka Long-Evans Tokushima Fatty rat and a fa/fa (Lepr-/-) locus derived from the Zucker Fatty rat; phenotypic analysis for plasma glucose and insulin levels and RNA and protein levels were determined using reverse transcription quantitative PCR and Western blotting analyses, respectively. The double congenic strain F344-fa-nidd2 (Lepr-/- and Nidd2/of) exhibited significantly higher glucose levels and significantly lower hypoglycaemic response to insulin than the obese control strain F344-fa (Lepr-/-). These phenotypes were clearly observed in the obese strains but not in the lean strains. These results indicate that the Nidd2/of locus harbours a diabetogenic gene associated with obesity. We measured the expression of 60 genes in the Nidd2/of QTL region between the strains and found that the mRNA expression levels of five genes were significantly different between the strains under the condition of obesity. However, three of the five genes were differentially expressed in both obese and lean rats, indicating that these genes are not specific for the condition of obesity. Conversely, the other two genes, coenzyme Q2 (Coq2) and placenta-specific 8 (Plac8), were differentially expressed only in the obese rats, suggesting that these two genes are candidates for the onset of type 2 diabetes associated with obesity in rats.

Functional profiles of orphan membrane transporters in the life cycle of the malaria parasite

PubMed Central

Kenthirapalan, Sanketha; Waters, Andrew P.; Matuschewski, Kai; Kooij, Taco W. A.

2016-01-01

Assigning function to orphan membrane transport proteins and prioritizing candidates for detailed biochemical characterization remain fundamental challenges and are particularly important for medically relevant pathogens, such as malaria parasites. Here we present a comprehensive genetic analysis of 35 orphan transport proteins of Plasmodium berghei during its life cycle in mice and Anopheles mosquitoes. Six genes, including four candidate aminophospholipid transporters, are refractory to gene deletion, indicative of essential functions. We generate and phenotypically characterize 29 mutant strains with deletions of individual transporter genes. Whereas seven genes appear to be dispensable under the experimental conditions tested, deletion of any of the 22 other genes leads to specific defects in life cycle progression in vivo and/or host transition. Our study provides growing support for a potential link between heavy metal homeostasis and host switching and reveals potential targets for rational design of new intervention strategies against malaria. PMID:26796412

Genetic influences on insight problem solving: the role of catechol-O-methyltransferase (COMT) gene polymorphisms

PubMed Central

Jiang, Weili; Shang, Siyuan; Su, Yanjie

2015-01-01

People may experience an “aha” moment, when suddenly realizing a solution of a puzzling problem. This experience is called insight problem solving. Several findings suggest that catecholamine-related genes may contribute to insight problem solving, among which the catechol-O-methyltransferase (COMT) gene is the most promising candidate. The current study examined 753 healthy individuals to determine the associations between 7 candidate single nucleotide polymorphisms on the COMT gene and insight problem-solving performance, while considering gender differences. The results showed that individuals carrying A allele of rs4680 or T allele of rs4633 scored significantly higher on insight problem-solving tasks, and the COMT gene rs5993883 combined with gender interacted with correct solutions of insight problems, specifically showing that this gene only influenced insight problem-solving performance in males. This study presents the first investigation of the genetic impact on insight problem solving and provides evidence that highlights the role that the COMT gene plays in insight problem solving. PMID:26528222

Genetic influences on insight problem solving: the role of catechol-O-methyltransferase (COMT) gene polymorphisms.

PubMed

Jiang, Weili; Shang, Siyuan; Su, Yanjie

2015-01-01

People may experience an "aha" moment, when suddenly realizing a solution of a puzzling problem. This experience is called insight problem solving. Several findings suggest that catecholamine-related genes may contribute to insight problem solving, among which the catechol-O-methyltransferase (COMT) gene is the most promising candidate. The current study examined 753 healthy individuals to determine the associations between 7 candidate single nucleotide polymorphisms on the COMT gene and insight problem-solving performance, while considering gender differences. The results showed that individuals carrying A allele of rs4680 or T allele of rs4633 scored significantly higher on insight problem-solving tasks, and the COMT gene rs5993883 combined with gender interacted with correct solutions of insight problems, specifically showing that this gene only influenced insight problem-solving performance in males. This study presents the first investigation of the genetic impact on insight problem solving and provides evidence that highlights the role that the COMT gene plays in insight problem solving.

Using Single-nucleotide Polymorphisms and Genetic Mapping to find Candidate Genes that Influence Varroa-Specific Hygiene

USDA-ARS?s Scientific Manuscript database

Varroa-sensitive hygienic (VSH) behavior is one of two behaviors identified that are most important for controlling the growth of Varroa mite populations in bee hives. A study was conducted to map quantitative trait loci (QTL) that influence VSH so that resistance genes could be identified. Crosses ...

snoSeeker: an advanced computational package for screening of guide and orphan snoRNA genes in the human genome.

PubMed

Yang, Jian-Hua; Zhang, Xiao-Chen; Huang, Zhan-Peng; Zhou, Hui; Huang, Mian-Bo; Zhang, Shu; Chen, Yue-Qin; Qu, Liang-Hu

2006-01-01

Small nucleolar RNAs (snoRNAs) represent an abundant group of non-coding RNAs in eukaryotes. They can be divided into guide and orphan snoRNAs according to the presence or absence of antisense sequence to rRNAs or snRNAs. Current snoRNA-searching programs, which are essentially based on sequence complementarity to rRNAs or snRNAs, exist only for the screening of guide snoRNAs. In this study, we have developed an advanced computational package, snoSeeker, which includes CDseeker and ACAseeker programs, for the highly efficient and specific screening of both guide and orphan snoRNA genes in mammalian genomes. By using these programs, we have systematically scanned four human-mammal whole-genome alignment (WGA) sequences and identified 54 novel candidates including 26 orphan candidates as well as 266 known snoRNA genes. Eighteen novel snoRNAs were further experimentally confirmed with four snoRNAs exhibiting a tissue-specific or restricted expression pattern. The results of this study provide the most comprehensive listing of two families of snoRNA genes in the human genome till date.

Reveal genes functionally associated with ACADS by a network study.

PubMed

Chen, Yulong; Su, Zhiguang

2015-09-15

Establishing a systematic network is aimed at finding essential human gene-gene/gene-disease pathway by means of network inter-connecting patterns and functional annotation analysis. In the present study, we have analyzed functional gene interactions of short-chain acyl-coenzyme A dehydrogenase gene (ACADS). ACADS plays a vital role in free fatty acid β-oxidation and regulates energy homeostasis. Modules of highly inter-connected genes in disease-specific ACADS network are derived by integrating gene function and protein interaction data. Among the 8 genes in ACADS web retrieved from both STRING and GeneMANIA, ACADS is effectively conjoined with 4 genes including HAHDA, HADHB, ECHS1 and ACAT1. The functional analysis is done via ontological briefing and candidate disease identification. We observed that the highly efficient-interlinked genes connected with ACADS are HAHDA, HADHB, ECHS1 and ACAT1. Interestingly, the ontological aspect of genes in the ACADS network reveals that ACADS, HAHDA and HADHB play equally vital roles in fatty acid metabolism. The gene ACAT1 together with ACADS indulges in ketone metabolism. Our computational gene web analysis also predicts potential candidate disease recognition, thus indicating the involvement of ACADS, HAHDA, HADHB, ECHS1 and ACAT1 not only with lipid metabolism but also with infant death syndrome, skeletal myopathy, acute hepatic encephalopathy, Reye-like syndrome, episodic ketosis, and metabolic acidosis. The current study presents a comprehensible layout of ACADS network, its functional strategies and candidate disease approach associated with ACADS network. Copyright © 2015 Elsevier B.V. All rights reserved.

A literature search tool for intelligent extraction of disease-associated genes.

PubMed

Jung, Jae-Yoon; DeLuca, Todd F; Nelson, Tristan H; Wall, Dennis P

2014-01-01

To extract disorder-associated genes from the scientific literature in PubMed with greater sensitivity for literature-based support than existing methods. We developed a PubMed query to retrieve disorder-related, original research articles. Then we applied a rule-based text-mining algorithm with keyword matching to extract target disorders, genes with significant results, and the type of study described by the article. We compared our resulting candidate disorder genes and supporting references with existing databases. We demonstrated that our candidate gene set covers nearly all genes in manually curated databases, and that the references supporting the disorder-gene link are more extensive and accurate than other general purpose gene-to-disorder association databases. We implemented a novel publication search tool to find target articles, specifically focused on links between disorders and genotypes. Through comparison against gold-standard manually updated gene-disorder databases and comparison with automated databases of similar functionality we show that our tool can search through the entirety of PubMed to extract the main gene findings for human diseases rapidly and accurately.

Population Structure and Domestication Revealed by High-Depth Resequencing of Korean Cultivated and Wild Soybean Genomes†

PubMed Central

Chung, Won-Hyong; Jeong, Namhee; Kim, Jiwoong; Lee, Woo Kyu; Lee, Yun-Gyeong; Lee, Sang-Heon; Yoon, Woongchang; Kim, Jin-Hyun; Choi, Ik-Young; Choi, Hong-Kyu; Moon, Jung-Kyung; Kim, Namshin; Jeong, Soon-Chun

2014-01-01

Despite the importance of soybean as a major crop, genome-wide variation and evolution of cultivated soybeans are largely unknown. Here, we catalogued genome variation in an annual soybean population by high-depth resequencing of 10 cultivated and 6 wild accessions and obtained 3.87 million high-quality single-nucleotide polymorphisms (SNPs) after excluding the sites with missing data in any accession. Nuclear genome phylogeny supported a single origin for the cultivated soybeans. We identified 10-fold longer linkage disequilibrium (LD) in the wild soybean relative to wild maize and rice. Despite the small population size, the long LD and large SNP data allowed us to identify 206 candidate domestication regions with significantly lower diversity in the cultivated, but not in the wild, soybeans. Some of the genes in these candidate regions were associated with soybean homologues of canonical domestication genes. However, several examples, which are likely specific to soybean or eudicot crop plants, were also observed. Consequently, the variation data identified in this study should be valuable for breeding and for identifying agronomically important genes in soybeans. However, the long LD of wild soybeans may hinder pinpointing causal gene(s) in the candidate regions. PMID:24271940

Effects of DGAT1 gene on meat and carcass fatness quality in Chinese commercial cattle.

PubMed

Yuan, Zhengrong; Li, Junya; Li, Jiao; Gao, Xue; Gao, Huijiang; Xu, Shangzhong

2013-02-01

This study was designed to investigate the candidate single nucleotide polymorphisms (SNPs) in the exon's region of bovine diacylglycerol O-acyltransferase (DGAT1) gene using bioinformatics and experimental methods. A total of 17 SNPs were screened from public data resources and DNA sequencing. Three SNPs (c.572A>G, c.1241C>T and c.1416T>G) of these candidate SNPs were genotyped by created restriction site-polymerase chain reaction (CRS-PCR) methods. The gene-specific SNP markers and their effects on meat and carcass fatness quality traits were evaluated in Chinese commercial cattle. The c.572A>G and c.1416T>G significantly effected on backfat thickness, longissimus muscle area, marbling score, fat color and Warner-Bratzler shear force. No significant association was detected between the c.1241C>T and measured traits. Results from this study suggested that the SNP markers may be effective for the marker-assisted selection of meat and carcass fatness quality traits, and added new evidence that DGAT1 gene is an important candidate gene for the improvement of meat and carcass fatness quality in beef cattle industry.

A simple PCR-based marker to determine sex in aspen.

PubMed

Pakull, B; Kersten, B; Lüneburg, J; Fladung, M

2015-01-01

The genus Populus features a genetically controlled sex determination system, located on chromosome 19. However, different Populus species vary in the position of the sex-linked region on the respective chromosome and the apparent heterogametic sex, and the precise mechanism of sex determination in Populus is still unknown. Using next generation sequencing of pooled samples of male and female aspens, we identified the aspen homologue of the P. trichocarpa gene Potri.019G047300 ('TOZ19') to be male-specific. While in P. tremuloides, the complete gene is missing in the genome of female plants, a short fragment of the 3'-part of the gene is still present in P. tremula females. The male-specific presence and transcription of TOZ19 was further verified using PCR in various different aspen individuals and RT-PCR expression analysis. TOZ19 is potentially involved in early steps of flower development, and represents an interesting candidate gene for involvement in sex determination in aspen. Regardless of its role as candidate gene, TOZ19 represents an ideal marker for determination of the sex of non-flowering aspen individuals or seedlings. © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands.

Positive selection on human gamete-recognition genes

PubMed Central

Stover, Daryn A.; Guerra, Vanessa; Mozaffari, Sahar V.; Ober, Carole; Mugal, Carina F.; Kaj, Ingemar

2018-01-01

Coevolution of genes that encode interacting proteins expressed on the surfaces of sperm and eggs can lead to variation in reproductive compatibility between mates and reproductive isolation between members of different species. Previous studies in mice and other mammals have focused in particular on evidence for positive or diversifying selection that shapes the evolution of genes that encode sperm-binding proteins expressed in the egg coat or zona pellucida (ZP). By fitting phylogenetic models of codon evolution to data from the 1000 Genomes Project, we identified candidate sites evolving under diversifying selection in the human genes ZP3 and ZP2. We also identified one candidate site under positive selection in C4BPA, which encodes a repetitive protein similar to the mouse protein ZP3R that is expressed in the sperm head and binds to the ZP at fertilization. Results from several additional analyses that applied population genetic models to the same data were consistent with the hypothesis of selection on those candidate sites leading to coevolution of sperm- and egg-expressed genes. By contrast, we found no candidate sites under selection in a fourth gene (ZP1) that encodes an egg coat structural protein not directly involved in sperm binding. Finally, we found that two of the candidate sites (in C4BPA and ZP2) were correlated with variation in family size and birth rate among Hutterite couples, and those two candidate sites were also in linkage disequilibrium in the same Hutterite study population. All of these lines of evidence are consistent with predictions from a previously proposed hypothesis of balancing selection on epistatic interactions between C4BPA and ZP3 at fertilization that lead to the evolution of co-adapted allele pairs. Such patterns also suggest specific molecular traits that may be associated with both natural reproductive variation and clinical infertility. PMID:29340252

Evolution and cell-type specificity of human-specific genes preferentially expressed in progenitors of fetal neocortex.

PubMed

Florio, Marta; Heide, Michael; Pinson, Anneline; Brandl, Holger; Albert, Mareike; Winkler, Sylke; Wimberger, Pauline; Huttner, Wieland B; Hiller, Michael

2018-03-21

Understanding the molecular basis that underlies the expansion of the neocortex during primate, and notably human, evolution requires the identification of genes that are particularly active in the neural stem and progenitor cells of the developing neocortex. Here, we have used existing transcriptome datasets to carry out a comprehensive screen for protein-coding genes preferentially expressed in progenitors of fetal human neocortex. We show that 15 human-specific genes exhibit such expression, and many of them evolved distinct neural progenitor cell-type expression profiles and levels compared to their ancestral paralogs. Functional studies on one such gene, NOTCH2NL , demonstrate its ability to promote basal progenitor proliferation in mice. An additional 35 human genes with progenitor-enriched expression are shown to have orthologs only in primates. Our study provides a resource of genes that are promising candidates to exert specific, and novel, roles in neocortical development during primate, and notably human, evolution. © 2018, Florio et al.

Evolution and cell-type specificity of human-specific genes preferentially expressed in progenitors of fetal neocortex

PubMed Central

Pinson, Anneline; Brandl, Holger; Albert, Mareike; Winkler, Sylke; Wimberger, Pauline

2018-01-01

Understanding the molecular basis that underlies the expansion of the neocortex during primate, and notably human, evolution requires the identification of genes that are particularly active in the neural stem and progenitor cells of the developing neocortex. Here, we have used existing transcriptome datasets to carry out a comprehensive screen for protein-coding genes preferentially expressed in progenitors of fetal human neocortex. We show that 15 human-specific genes exhibit such expression, and many of them evolved distinct neural progenitor cell-type expression profiles and levels compared to their ancestral paralogs. Functional studies on one such gene, NOTCH2NL, demonstrate its ability to promote basal progenitor proliferation in mice. An additional 35 human genes with progenitor-enriched expression are shown to have orthologs only in primates. Our study provides a resource of genes that are promising candidates to exert specific, and novel, roles in neocortical development during primate, and notably human, evolution. PMID:29561261

Genomic and Coexpression Analyses Predict Multiple Genes Involved in Triterpene Saponin Biosynthesis in Medicago truncatula[C][W

PubMed Central

Naoumkina, Marina A.; Modolo, Luzia V.; Huhman, David V.; Urbanczyk-Wochniak, Ewa; Tang, Yuhong; Sumner, Lloyd W.; Dixon, Richard A.

2010-01-01

Saponins, an important group of bioactive plant natural products, are glycosides of triterpenoid or steroidal aglycones (sapogenins). Saponins possess many biological activities, including conferring potential health benefits for humans. However, most of the steps specific for the biosynthesis of triterpene saponins remain uncharacterized at the molecular level. Here, we use comprehensive gene expression clustering analysis to identify candidate genes involved in the elaboration, hydroxylation, and glycosylation of the triterpene skeleton in the model legume Medicago truncatula. Four candidate uridine diphosphate glycosyltransferases were expressed in Escherichia coli, one of which (UGT73F3) showed specificity for multiple sapogenins and was confirmed to glucosylate hederagenin at the C28 position. Genetic loss-of-function studies in M. truncatula confirmed the in vivo function of UGT73F3 in saponin biosynthesis. This report provides a basis for future studies to define genetically the roles of multiple cytochromes P450 and glycosyltransferases in triterpene saponin biosynthesis in Medicago. PMID:20348429

Case-Control Study of Candidate Gene Methylation and Adenomatous Polyp Formation

PubMed Central

M, Alexander; JB, Burch; SE, Steck; C-F, Chen; TG, Hurley; P, Cavicchia; N, Shivappa; J, Guess; H, Zhang; SD, Youngstedt; KE, Creek; S, Lloyd; K, Jones; JR, Hébert

2016-01-01

Purpose Colorectal cancer (CRC) is one of the most common and preventable forms of cancer, but remains the second leading cause of cancer-related death. Colorectal adenomas are precursor lesions that develop in 70–90% of CRC cases. Identification of peripheral biomarkers for adenomas would help to enhance screening efforts. This exploratory study examined the methylation status of 20 candidate markers in peripheral blood leukocytes and their association with adenoma formation. Methods Patients recruited from a local endoscopy clinic provided informed consent, and completed an interview to ascertain demographic, lifestyle, and adenoma risk factors. Cases were individuals with a histopathologically confirmed adenoma, and controls included patients with a normal colonoscopy, or those with histopathological findings not requiring heightened surveillance (normal biopsy, hyperplastic polyp). Methylation-specific polymerase chain reaction was used to characterize candidate gene promoter methylation. Odds ratios and 95% confidence intervals (OR, 95% CI) were calculated using unconditional multivariable logistic regression to test the hypothesis that candidate gene methylation differed between cases and controls, after adjustment for confounders. Results Complete data were available for 107 participants; 36% had adenomas (men: 40%, women: 31%). Hypomethylation of the MINT1 locus (OR: 5.3, 95% CI: 1.0–28.2), and the PER1 (OR: 2.9, 95% CI: 1.1–7.7) and PER3 (OR: 11.6, 95% CI: 1.6–78.5) clock gene promoters was more common among adenoma cases. While specificity was moderate to high for the three markers (71–97%), sensitivity was relatively low (18–45%). Conclusion Follow-up of these epigenetic markers is suggested to further evaluate their utility for adenoma screening or surveillance. PMID:27771773

Utilizing Gene Tree Variation to Identify Candidate Effector Genes in Zymoseptoria tritici

PubMed Central

McDonald, Megan C.; McGinness, Lachlan; Hane, James K.; Williams, Angela H.; Milgate, Andrew; Solomon, Peter S.

2016-01-01

Zymoseptoria tritici is a host-specific, necrotrophic pathogen of wheat. Infection by Z. tritici is characterized by its extended latent period, which typically lasts 2 wks, and is followed by extensive host cell death, and rapid proliferation of fungal biomass. This work characterizes the level of genomic variation in 13 isolates, for which we have measured virulence on 11 wheat cultivars with differential resistance genes. Between the reference isolate, IPO323, and the 13 Australian isolates we identified over 800,000 single nucleotide polymorphisms, of which ∼10% had an effect on the coding regions of the genome. Furthermore, we identified over 1700 probable presence/absence polymorphisms in genes across the Australian isolates using de novo assembly. Finally, we developed a gene tree sorting method that quickly identifies groups of isolates within a single gene alignment whose sequence haplotypes correspond with virulence scores on a single wheat cultivar. Using this method, we have identified < 100 candidate effector genes whose gene sequence correlates with virulence toward a wheat cultivar carrying a major resistance gene. PMID:26837952

Targeted deletion and lipidomic analysis identify epithelial cell COX-2 as a major driver of chemically induced skin cancer.

PubMed

Jiao, Jing; Ishikawa, Tomo-O; Dumlao, Darren S; Norris, Paul C; Magyar, Clara E; Mikulec, Carol; Catapang, Art; Dennis, Edward A; Fischer, Susan M; Herschman, Harvey R

2014-11-01

Pharmacologic and global gene deletion studies demonstrate that cyclooxygenase-2 (PTGS2/COX-2) plays a critical role in DMBA/TPA-induced skin tumor induction. Although many cell types in the tumor microenvironment express COX-2, the cell types in which COX-2 expression is required for tumor promotion are not clearly established. Here, cell type-specific Cox-2 gene deletion reveals a vital role for skin epithelial cell COX-2 expression in DMBA/TPA tumor induction. In contrast, myeloid Cox-2 gene deletion has no effect on DMBA/TPA tumorigenesis. The infrequent, small tumors that develop on mice with an epithelial cell-specific Cox-2 gene deletion have decreased proliferation and increased cell differentiation properties. Blood vessel density is reduced in tumors with an epithelial cell-specific Cox-2 gene deletion, compared with littermate control tumors, suggesting a reciprocal relationship in tumor progression between COX-2-expressing tumor epithelial cells and microenvironment endothelial cells. Lipidomics analysis of skin and tumors from DMBA/TPA-treated mice suggests that the prostaglandins PGE2 and PGF2α are likely candidates for the epithelial cell COX-2-dependent eicosanoids that mediate tumor progression. This study both illustrates the value of cell type-specific gene deletions in understanding the cellular roles of signal-generating pathways in complex microenvironments and emphasizes the benefit of a systems-based lipidomic analysis approach to identify candidate lipid mediators of biologic responses. Cox-2 gene deletion demonstrates that intrinsic COX-2 expression in initiated keratinocytes is a principal driver of skin carcinogenesis; lipidomic analysis identifies likely prostanoid effectors. ©2014 American Association for Cancer Research.

Cellular dissection of psoriasis for transcriptome analyses and the post-GWAS era

PubMed Central

2014-01-01

Background Genome-scale studies of psoriasis have been used to identify genes of potential relevance to disease mechanisms. For many identified genes, however, the cell type mediating disease activity is uncertain, which has limited our ability to design gene functional studies based on genomic findings. Methods We identified differentially expressed genes (DEGs) with altered expression in psoriasis lesions (n = 216 patients), as well as candidate genes near susceptibility loci from psoriasis GWAS studies. These gene sets were characterized based upon their expression across 10 cell types present in psoriasis lesions. Susceptibility-associated variation at intergenic (non-coding) loci was evaluated to identify sites of allele-specific transcription factor binding. Results Half of DEGs showed highest expression in skin cells, although the dominant cell type differed between psoriasis-increased DEGs (keratinocytes, 35%) and psoriasis-decreased DEGs (fibroblasts, 33%). In contrast, psoriasis GWAS candidates tended to have highest expression in immune cells (71%), with a significant fraction showing maximal expression in neutrophils (24%, P < 0.001). By identifying candidate cell types for genes near susceptibility loci, we could identify and prioritize SNPs at which susceptibility variants are predicted to influence transcription factor binding. This led to the identification of potentially causal (non-coding) SNPs for which susceptibility variants influence binding of AP-1, NF-κB, IRF1, STAT3 and STAT4. Conclusions These findings underscore the role of innate immunity in psoriasis and highlight neutrophils as a cell type linked with pathogenetic mechanisms. Assignment of candidate cell types to genes emerging from GWAS studies provides a first step towards functional analysis, and we have proposed an approach for generating hypotheses to explain GWAS hits at intergenic loci. PMID:24885462

Identification and validation of single nucleotide polymorphisms in growth- and maturation-related candidate genes in sole (Solea solea L.).

PubMed

Diopere, Eveline; Hellemans, Bart; Volckaert, Filip A M; Maes, Gregory E

2013-03-01

Genomic methodologies applied in evolutionary and fisheries research have been of great benefit to understand the marine ecosystem and the management of natural resources. Although single nucleotide polymorphisms (SNPs) are attractive for the study of local adaptation, spatial stock management and traceability, and investigating the effects of fisheries-induced selection, they have rarely been exploited in non-model organisms. This is partly due to difficulties in finding and validating SNPs in species with limited or no genomic resources. Complementary to random genome-scan approaches, a targeted candidate gene approach has the potential to unveil pre-selected functional diversity and provides more in depth information on the action of selection at specific genes. For example genes can be under selective pressure due to climate change and sustained periods of heavy fishing pressure. In this study, we applied a candidate gene approach in sole (Solea solea L.), an important member of the demersal ecosystem. As consumption flatfish it is heavy exploited and has experienced associated life-history changes over the last 60years. To discover novel genetic polymorphisms in or around genes linked to important life history traits in sole, we screened a total of 76 candidate genes related to growth and maturation using a targeted resequencing approach. We identified in total 86 putative SNPs in 22 genes and validated 29 SNPs using a multiplex single-base extension genotyping assay. We found 22 informative SNPs, of which two represent non-synonymous mutations, potentially of functional relevance. These novel markers should be rapidly and broadly applicable in analyses of natural sole populations, as a measure of the evolutionary signature of overfishing and for initiatives on marker assisted selection. Copyright © 2012 Elsevier B.V. All rights reserved.

A hierarchical two-phase framework for selecting genes in cancer datasets with a neuro-fuzzy system.

PubMed

Lim, Jongwoo; Wang, Bohyun; Lim, Joon S

2016-04-29

Finding the minimum number of appropriate biomarkers for specific targets such as a lung cancer has been a challenging issue in bioinformatics. We propose a hierarchical two-phase framework for selecting appropriate biomarkers that extracts candidate biomarkers from the cancer microarray datasets and then selects the minimum number of appropriate biomarkers from the extracted candidate biomarkers datasets with a specific neuro-fuzzy algorithm, which is called a neural network with weighted fuzzy membership function (NEWFM). In this context, as the first phase, the proposed framework is to extract candidate biomarkers by using a Bhattacharyya distance method that measures the similarity of two discrete probability distributions. Finally, the proposed framework is able to reduce the cost of finding biomarkers by not receiving medical supplements and improve the accuracy of the biomarkers in specific cancer target datasets.

Identifying Stable Reference Genes for qRT-PCR Normalisation in Gene Expression Studies of Narrow-Leafed Lupin (Lupinus angustifolius L.).

PubMed

Taylor, Candy M; Jost, Ricarda; Erskine, William; Nelson, Matthew N

2016-01-01

Quantitative Reverse Transcription PCR (qRT-PCR) is currently one of the most popular, high-throughput and sensitive technologies available for quantifying gene expression. Its accurate application depends heavily upon normalisation of gene-of-interest data with reference genes that are uniformly expressed under experimental conditions. The aim of this study was to provide the first validation of reference genes for Lupinus angustifolius (narrow-leafed lupin, a significant grain legume crop) using a selection of seven genes previously trialed as reference genes for the model legume, Medicago truncatula. In a preliminary evaluation, the seven candidate reference genes were assessed on the basis of primer specificity for their respective targeted region, PCR amplification efficiency, and ability to discriminate between cDNA and gDNA. Following this assessment, expression of the three most promising candidates [Ubiquitin C (UBC), Helicase (HEL), and Polypyrimidine tract-binding protein (PTB)] was evaluated using the NormFinder and RefFinder statistical algorithms in two narrow-leafed lupin lines, both with and without vernalisation treatment, and across seven organ types (cotyledons, stem, leaves, shoot apical meristem, flowers, pods and roots) encompassing three developmental stages. UBC was consistently identified as the most stable candidate and has sufficiently uniform expression that it may be used as a sole reference gene under the experimental conditions tested here. However, as organ type and developmental stage were associated with greater variability in relative expression, it is recommended using UBC and HEL as a pair to achieve optimal normalisation. These results highlight the importance of rigorously assessing candidate reference genes for each species across a diverse range of organs and developmental stages. With emerging technologies, such as RNAseq, and the completion of valuable transcriptome data sets, it is possible that other potentially more suitable reference genes will be identified for this species in future.

Identifying Stable Reference Genes for qRT-PCR Normalisation in Gene Expression Studies of Narrow-Leafed Lupin (Lupinus angustifolius L.)

PubMed Central

Erskine, William; Nelson, Matthew N.

2016-01-01

Quantitative Reverse Transcription PCR (qRT-PCR) is currently one of the most popular, high-throughput and sensitive technologies available for quantifying gene expression. Its accurate application depends heavily upon normalisation of gene-of-interest data with reference genes that are uniformly expressed under experimental conditions. The aim of this study was to provide the first validation of reference genes for Lupinus angustifolius (narrow-leafed lupin, a significant grain legume crop) using a selection of seven genes previously trialed as reference genes for the model legume, Medicago truncatula. In a preliminary evaluation, the seven candidate reference genes were assessed on the basis of primer specificity for their respective targeted region, PCR amplification efficiency, and ability to discriminate between cDNA and gDNA. Following this assessment, expression of the three most promising candidates [Ubiquitin C (UBC), Helicase (HEL), and Polypyrimidine tract-binding protein (PTB)] was evaluated using the NormFinder and RefFinder statistical algorithms in two narrow-leafed lupin lines, both with and without vernalisation treatment, and across seven organ types (cotyledons, stem, leaves, shoot apical meristem, flowers, pods and roots) encompassing three developmental stages. UBC was consistently identified as the most stable candidate and has sufficiently uniform expression that it may be used as a sole reference gene under the experimental conditions tested here. However, as organ type and developmental stage were associated with greater variability in relative expression, it is recommended using UBC and HEL as a pair to achieve optimal normalisation. These results highlight the importance of rigorously assessing candidate reference genes for each species across a diverse range of organs and developmental stages. With emerging technologies, such as RNAseq, and the completion of valuable transcriptome data sets, it is possible that other potentially more suitable reference genes will be identified for this species in future. PMID:26872362

Generation of transgenic mouse model using PTTG as an oncogene.

PubMed

Kakar, Sham S; Kakar, Cohin

2015-01-01

The close physiological similarity between the mouse and human has provided tools to understanding the biological function of particular genes in vivo by introduction or deletion of a gene of interest. Using a mouse as a model has provided a wealth of resources, knowledge, and technology, helping scientists to understand the biological functions, translocation, trafficking, and interaction of a candidate gene with other intracellular molecules, transcriptional regulation, posttranslational modification, and discovery of novel signaling pathways for a particular gene. Most importantly, the generation of the mouse model for a specific human disease has provided a powerful tool to understand the etiology of a disease and discovery of novel therapeutics. This chapter describes in detail the step-by-step generation of the transgenic mouse model, which can be helpful in guiding new investigators in developing successful models. For practical purposes, we will describe the generation of a mouse model using pituitary tumor transforming gene (PTTG) as the candidate gene of interest.

A Drosophila model for toxicogenomics: Genetic variation in susceptibility to heavy metal exposure

PubMed Central

Luoma, Sarah E.; St. Armour, Genevieve E.; Thakkar, Esha

2017-01-01

The genetic factors that give rise to variation in susceptibility to environmental toxins remain largely unexplored. Studies on genetic variation in susceptibility to environmental toxins are challenging in human populations, due to the variety of clinical symptoms and difficulty in determining which symptoms causally result from toxic exposure; uncontrolled environments, often with exposure to multiple toxicants; and difficulty in relating phenotypic effect size to toxic dose, especially when symptoms become manifest with a substantial time lag. Drosophila melanogaster is a powerful model that enables genome-wide studies for the identification of allelic variants that contribute to variation in susceptibility to environmental toxins, since the genetic background, environmental rearing conditions and toxic exposure can be precisely controlled. Here, we used extreme QTL mapping in an outbred population derived from the D. melanogaster Genetic Reference Panel to identify alleles associated with resistance to lead and/or cadmium, two ubiquitous environmental toxins that present serious health risks. We identified single nucleotide polymorphisms (SNPs) associated with variation in resistance to both heavy metals as well as SNPs associated with resistance specific to each of them. The effects of these SNPs were largely sex-specific. We applied mutational and RNAi analyses to 33 candidate genes and functionally validated 28 of them. We constructed networks of candidate genes as blueprints for orthologous networks of human genes. The latter not only provided functional contexts for known human targets of heavy metal toxicity, but also implicated novel candidate susceptibility genes. These studies validate Drosophila as a translational toxicogenomics gene discovery system. PMID:28732062

Genome-wide identification of lineage-specific genes in Arabidopsis, Oryza and Populus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yang, Xiaohan; Jawdy, Sara; Tschaplinski, Timothy J

2009-01-01

Protein sequences were compared among Arabidopsis, Oryza and Populus to identify differential gene (DG) sets that are in one but not the other two genomes. The DG sets were screened against a plant transcript database, the NR protein database and six newly-sequenced genomes (Carica, Glycine, Medicago, Sorghum, Vitis and Zea) to identify a set of species-specific genes (SS). Gene expression, protein motif and intron number were examined. 192, 641 and 109 SS genes were identified in Arabidopsis, Oryza and Populus, respectively. Some SS genes were preferentially expressed in flowers, roots, xylem and cambium or up-regulated by stress. Six conserved motifsmore » in Arabidopsis and Oryza SS proteins were found in other distant lineages. The SS gene sets were enriched with intronless genes. The results reflect functional and/or anatomical differences between monocots and eudicots or between herbaceous and woody plants. The Populus-specific genes are candidates for carbon sequestration and biofuel research.« less

Cancer diagnosis marker extraction for soft tissue sarcomas based on gene expression profiling data by using projective adaptive resonance theory (PART) filtering method

PubMed Central

Takahashi, Hiro; Nemoto, Takeshi; Yoshida, Teruhiko; Honda, Hiroyuki; Hasegawa, Tadashi

2006-01-01

Background Recent advances in genome technologies have provided an excellent opportunity to determine the complete biological characteristics of neoplastic tissues, resulting in improved diagnosis and selection of treatment. To accomplish this objective, it is important to establish a sophisticated algorithm that can deal with large quantities of data such as gene expression profiles obtained by DNA microarray analysis. Results Previously, we developed the projective adaptive resonance theory (PART) filtering method as a gene filtering method. This is one of the clustering methods that can select specific genes for each subtype. In this study, we applied the PART filtering method to analyze microarray data that were obtained from soft tissue sarcoma (STS) patients for the extraction of subtype-specific genes. The performance of the filtering method was evaluated by comparison with other widely used methods, such as signal-to-noise, significance analysis of microarrays, and nearest shrunken centroids. In addition, various combinations of filtering and modeling methods were used to extract essential subtype-specific genes. The combination of the PART filtering method and boosting – the PART-BFCS method – showed the highest accuracy. Seven genes among the 15 genes that are frequently selected by this method – MIF, CYFIP2, HSPCB, TIMP3, LDHA, ABR, and RGS3 – are known prognostic marker genes for other tumors. These genes are candidate marker genes for the diagnosis of STS. Correlation analysis was performed to extract marker genes that were not selected by PART-BFCS. Sixteen genes among those extracted are also known prognostic marker genes for other tumors, and they could be candidate marker genes for the diagnosis of STS. Conclusion The procedure that consisted of two steps, such as the PART-BFCS and the correlation analysis, was proposed. The results suggest that novel diagnostic and therapeutic targets for STS can be extracted by a procedure that includes the PART filtering method. PMID:16948864

The large-scale investigation of gene expression in Leymus chinensis stigmas provides a valuable resource for understanding the mechanisms of poaceae self-incompatibility.

PubMed

Zhou, Qingyuan; Jia, Junting; Huang, Xing; Yan, Xueqing; Cheng, Liqin; Chen, Shuangyan; Li, Xiaoxia; Peng, Xianjun; Liu, Gongshe

2014-05-26

Many Poaceae species show a gametophytic self-incompatibility (GSI) system, which is controlled by at least two independent and multiallelic loci, S and Z. Until currently, the gene products for S and Z were unknown. Grass SI plant stigmas discriminate between pollen grains that land on its surface and support compatible pollen tube growth and penetration into the stigma, whereas recognizing incompatible pollen and thus inhibiting pollination behaviors. Leymus chinensis (Trin.) Tzvel. (sheepgrass) is a Poaceae SI species. A comprehensive analysis of sheepgrass stigma transcriptome may provide valuable information for understanding the mechanism of pollen-stigma interactions and grass SI. The transcript abundance profiles of mature stigmas, mature ovaries and leaves were examined using high-throughput next generation sequencing technology. A comparative transcriptomic analysis of these tissues identified 1,025 specifically or preferentially expressed genes in sheepgrass stigmas. These genes contained a significant proportion of genes predicted to function in cell-cell communication and signal transduction. We identified 111 putative transcription factors (TFs) genes and the most abundant groups were MYB, C2H2, C3H, FAR1, MADS. Comparative analysis of the sheepgrass, rice and Arabidopsis stigma-specific or preferential datasets showed broad similarities and some differences in the proportion of genes in the Gene Ontology (GO) functional categories. Potential SI candidate genes identified in other grasses were also detected in the sheepgrass stigma-specific or preferential dataset. Quantitative real-time PCR experiments validated the expression pattern of stigma preferential genes including homologous grass SI candidate genes. This study represents the first large-scale investigation of gene expression in the stigmas of an SI grass species. We uncovered many notable genes that are potentially involved in pollen-stigma interactions and SI mechanisms, including genes encoding receptor-like protein kinases (RLK), CBL (calcineurin B-like proteins) interacting protein kinases, calcium-dependent protein kinase, expansins, pectinesterase, peroxidases and various transcription factors. The availability of a pool of stigma-specific or preferential genes for L. chinensis offers an opportunity to elucidate the mechanisms of SI in Poaceae.

MMTV insertional mutagenesis identifies genes, gene families and pathways involved in mammary cancer.

PubMed

Theodorou, Vassiliki; Kimm, Melanie A; Boer, Mandy; Wessels, Lodewyk; Theelen, Wendy; Jonkers, Jos; Hilkens, John

2007-06-01

We performed a high-throughput retroviral insertional mutagenesis screen in mouse mammary tumor virus (MMTV)-induced mammary tumors and identified 33 common insertion sites, of which 17 genes were previously not known to be associated with mammary cancer and 13 had not previously been linked to cancer in general. Although members of the Wnt and fibroblast growth factors (Fgf) families were frequently tagged, our exhaustive screening for MMTV insertion sites uncovered a new repertoire of candidate breast cancer oncogenes. We validated one of these genes, Rspo3, as an oncogene by overexpression in a p53-deficient mammary epithelial cell line. The human orthologs of the candidate oncogenes were frequently deregulated in human breast cancers and associated with several tumor parameters. Computational analysis of all MMTV-tagged genes uncovered specific gene families not previously associated with cancer and showed a significant overrepresentation of protein domains and signaling pathways mainly associated with development and growth factor signaling. Comparison of all tagged genes in MMTV and Moloney murine leukemia virus-induced malignancies showed that both viruses target mostly different genes that act predominantly in distinct pathways.

Assays for the Identification and Prioritization of Drug Candidates for Spinal Muscular Atrophy

PubMed Central

Cherry, Jonathan J.; Kobayashi, Dione T.; Lynes, Maureen M.; Naryshkin, Nikolai N.; Tiziano, Francesco Danilo; Zaworski, Phillip G.; Rubin, Lee L.

2014-01-01

Abstract Spinal muscular atrophy (SMA) is an autosomal recessive genetic disorder resulting in degeneration of α-motor neurons of the anterior horn and proximal muscle weakness. It is the leading cause of genetic mortality in children younger than 2 years. It affects ∼1 in 11,000 live births. In 95% of cases, SMA is caused by homozygous deletion of the SMN1 gene. In addition, all patients possess at least one copy of an almost identical gene called SMN2. A single point mutation in exon 7 of the SMN2 gene results in the production of low levels of full-length survival of motor neuron (SMN) protein at amounts insufficient to compensate for the loss of the SMN1 gene. Although no drug treatments are available for SMA, a number of drug discovery and development programs are ongoing, with several currently in clinical trials. This review describes the assays used to identify candidate drugs for SMA that modulate SMN2 gene expression by various means. Specifically, it discusses the use of high-throughput screening to identify candidate molecules from primary screens, as well as the technical aspects of a number of widely used secondary assays to assess SMN messenger ribonucleic acid (mRNA) and protein expression, localization, and function. Finally, it describes the process of iterative drug optimization utilized during preclinical SMA drug development to identify clinical candidates for testing in human clinical trials. PMID:25147906

Survival dimensionality reduction (SDR): development and clinical application of an innovative approach to detect epistasis in presence of right-censored data.

PubMed

Beretta, Lorenzo; Santaniello, Alessandro; van Riel, Piet L C M; Coenen, Marieke J H; Scorza, Raffaella

2010-08-06

Epistasis is recognized as a fundamental part of the genetic architecture of individuals. Several computational approaches have been developed to model gene-gene interactions in case-control studies, however, none of them is suitable for time-dependent analysis. Herein we introduce the Survival Dimensionality Reduction (SDR) algorithm, a non-parametric method specifically designed to detect epistasis in lifetime datasets. The algorithm requires neither specification about the underlying survival distribution nor about the underlying interaction model and proved satisfactorily powerful to detect a set of causative genes in synthetic epistatic lifetime datasets with a limited number of samples and high degree of right-censorship (up to 70%). The SDR method was then applied to a series of 386 Dutch patients with active rheumatoid arthritis that were treated with anti-TNF biological agents. Among a set of 39 candidate genes, none of which showed a detectable marginal effect on anti-TNF responses, the SDR algorithm did find that the rs1801274 SNP in the Fc gamma RIIa gene and the rs10954213 SNP in the IRF5 gene non-linearly interact to predict clinical remission after anti-TNF biologicals. Simulation studies and application in a real-world setting support the capability of the SDR algorithm to model epistatic interactions in candidate-genes studies in presence of right-censored data. http://sourceforge.net/projects/sdrproject/.

A global view of the nonprotein-coding transcriptome in Plasmodium falciparum

PubMed Central

Raabe, Carsten A.; Sanchez, Cecilia P.; Randau, Gerrit; Robeck, Thomas; Skryabin, Boris V.; Chinni, Suresh V.; Kube, Michael; Reinhardt, Richard; Ng, Guey Hooi; Manickam, Ravichandran; Kuryshev, Vladimir Y.; Lanzer, Michael; Brosius, Juergen; Tang, Thean Hock; Rozhdestvensky, Timofey S.

2010-01-01

Nonprotein-coding RNAs (npcRNAs) represent an important class of regulatory molecules that act in many cellular pathways. Here, we describe the experimental identification and validation of the small npcRNA transcriptome of the human malaria parasite Plasmodium falciparum. We identified 630 novel npcRNA candidates. Based on sequence and structural motifs, 43 of them belong to the C/D and H/ACA-box subclasses of small nucleolar RNAs (snoRNAs) and small Cajal body-specific RNAs (scaRNAs). We further observed the exonization of a functional H/ACA snoRNA gene, which might contribute to the regulation of ribosomal protein L7a gene expression. Some of the small npcRNA candidates are from telomeric and subtelomeric repetitive regions, suggesting their potential involvement in maintaining telomeric integrity and subtelomeric gene silencing. We also detected 328 cis-encoded antisense npcRNAs (asRNAs) complementary to P. falciparum protein-coding genes of a wide range of biochemical pathways, including determinants of virulence and pathology. All cis-encoded asRNA genes tested exhibit lifecycle-specific expression profiles. For all but one of the respective sense–antisense pairs, we deduced concordant patterns of expression. Our findings have important implications for a better understanding of gene regulatory mechanisms in P. falciparum, revealing an extended and sophisticated npcRNA network that may control the expression of housekeeping genes and virulence factors. PMID:19864253

A global view of the nonprotein-coding transcriptome in Plasmodium falciparum.

PubMed

Raabe, Carsten A; Sanchez, Cecilia P; Randau, Gerrit; Robeck, Thomas; Skryabin, Boris V; Chinni, Suresh V; Kube, Michael; Reinhardt, Richard; Ng, Guey Hooi; Manickam, Ravichandran; Kuryshev, Vladimir Y; Lanzer, Michael; Brosius, Juergen; Tang, Thean Hock; Rozhdestvensky, Timofey S

2010-01-01

Nonprotein-coding RNAs (npcRNAs) represent an important class of regulatory molecules that act in many cellular pathways. Here, we describe the experimental identification and validation of the small npcRNA transcriptome of the human malaria parasite Plasmodium falciparum. We identified 630 novel npcRNA candidates. Based on sequence and structural motifs, 43 of them belong to the C/D and H/ACA-box subclasses of small nucleolar RNAs (snoRNAs) and small Cajal body-specific RNAs (scaRNAs). We further observed the exonization of a functional H/ACA snoRNA gene, which might contribute to the regulation of ribosomal protein L7a gene expression. Some of the small npcRNA candidates are from telomeric and subtelomeric repetitive regions, suggesting their potential involvement in maintaining telomeric integrity and subtelomeric gene silencing. We also detected 328 cis-encoded antisense npcRNAs (asRNAs) complementary to P. falciparum protein-coding genes of a wide range of biochemical pathways, including determinants of virulence and pathology. All cis-encoded asRNA genes tested exhibit lifecycle-specific expression profiles. For all but one of the respective sense-antisense pairs, we deduced concordant patterns of expression. Our findings have important implications for a better understanding of gene regulatory mechanisms in P. falciparum, revealing an extended and sophisticated npcRNA network that may control the expression of housekeeping genes and virulence factors.

Agave tequilana MADS genes show novel expression patterns in meristems, developing bulbils and floral organs.

PubMed

Delgado Sandoval, Silvia del Carmen; Abraham Juárez, María Jazmín; Simpson, June

2012-03-01

Agave tequilana is a monocarpic perennial species that flowers after 5-8 years of vegetative growth signaling the end of the plant's life cycle. When fertilization is unsuccessful, vegetative bulbils are induced on the umbels of the inflorescence near the bracteoles from newly formed meristems. Although the regulation of inflorescence and flower development has been described in detail for monocarpic annuals and polycarpic species, little is known at the molecular level for these processes in monocarpic perennials, and few studies have been carried out on bulbils. Histological samples revealed the early induction of umbel meristems soon after the initiation of the vegetative to inflorescence transition in A. tequilana. To identify candidate genes involved in the regulation of floral induction, a search for MADS-box transcription factor ESTs was conducted using an A. tequilana transcriptome database. Seven different MIKC MADS genes classified into 6 different types were identified based on previously characterized A. thaliana and O. sativa MADS genes and sequences from non-grass monocotyledons. Quantitative real-time PCR analysis of the seven candidate MADS genes in vegetative, inflorescence, bulbil and floral tissues uncovered novel patterns of expression for some of the genes in comparison with orthologous genes characterized in other species. In situ hybridization studies using two different genes showed expression in specific tissues of vegetative meristems and floral buds. Distinct MADS gene regulatory patterns in A. tequilana may be related to the specific reproductive strategies employed by this species.

Quantitative trait loci affecting the 3D skull shape and size in mouse and prioritization of candidate genes in-silico

PubMed Central

Maga, A. Murat; Navarro, Nicolas; Cunningham, Michael L.; Cox, Timothy C.

2015-01-01

We describe the first application of high-resolution 3D micro-computed tomography, together with 3D landmarks and geometric morphometrics, to map QTL responsible for variation in skull shape and size using a backcross between C57BL/6J and A/J inbred strains. Using 433 animals, 53 3D landmarks, and 882 SNPs from autosomes, we identified seven QTL responsible for the skull size (SCS.qtl) and 30 QTL responsible for the skull shape (SSH.qtl). Size, sex, and direction-of-cross were all significant factors and included in the analysis as covariates. All autosomes harbored at least one SSH.qtl, sometimes up to three. Effect sizes of SSH.qtl appeared to be small, rarely exceeding 1% of the overall shape variation. However, they account for significant amount of variation in some specific directions of the shape space. Many QTL have stronger effect on the neurocranium than expected from a random vector that will parcellate uniformly across the four cranial regions. On the contrary, most of QTL have an effect on the palate weaker than expected. Combined interval length of 30 SSH.qtl was about 315 MB and contained 2476 known protein coding genes. We used a bioinformatics approach to filter these candidate genes and identified 16 high-priority candidates that are likely to play a role in the craniofacial development and disorders. Thus, coupling the QTL mapping approach in model organisms with candidate gene enrichment approaches appears to be a feasible way to identify high-priority candidates genes related to the structure or tissue of interest. PMID:25859222

Selection of a DNA barcode for Nectriaceae from fungal whole-genomes.

PubMed

Zeng, Zhaoqing; Zhao, Peng; Luo, Jing; Zhuang, Wenying; Yu, Zhihe

2012-01-01

A DNA barcode is a short segment of sequence that is able to distinguish species. A barcode must ideally contain enough variation to distinguish every individual species and be easily obtained. Fungi of Nectriaceae are economically important and show high species diversity. To establish a standard DNA barcode for this group of fungi, the genomes of Neurospora crassa and 30 other filamentous fungi were compared. The expect value was treated as a criterion to recognize homologous sequences. Four candidate markers, Hsp90, AAC, CDC48, and EF3, were tested for their feasibility as barcodes in the identification of 34 well-established species belonging to 13 genera of Nectriaceae. Two hundred and fifteen sequences were analyzed. Intra- and inter-specific variations and the success rate of PCR amplification and sequencing were considered as important criteria for estimation of the candidate markers. Ultimately, the partial EF3 gene met the requirements for a good DNA barcode: No overlap was found between the intra- and inter-specific pairwise distances. The smallest inter-specific distance of EF3 gene was 3.19%, while the largest intra-specific distance was 1.79%. In addition, there was a high success rate in PCR and sequencing for this gene (96.3%). CDC48 showed sufficiently high sequence variation among species, but the PCR and sequencing success rate was 84% using a single pair of primers. Although the Hsp90 and AAC genes had higher PCR and sequencing success rates (96.3% and 97.5%, respectively), overlapping occurred between the intra- and inter-specific variations, which could lead to misidentification. Therefore, we propose the EF3 gene as a possible DNA barcode for the nectriaceous fungi.

An Efficient Approach for the Development of Locus Specific Primers in Bread Wheat (Triticum aestivum L.) and Its Application to Re-Sequencing of Genes Involved in Frost Tolerance

PubMed Central

Babben, Steve; Perovic, Dragan; Koch, Michael; Ordon, Frank

2015-01-01

Recent declines in costs accelerated sequencing of many species with large genomes, including hexaploid wheat (Triticum aestivum L.). Although the draft sequence of bread wheat is known, it is still one of the major challenges to developlocus specific primers suitable to be used in marker assisted selection procedures, due to the high homology of the three genomes. In this study we describe an efficient approach for the development of locus specific primers comprising four steps, i.e. (i) identification of genomic and coding sequences (CDS) of candidate genes, (ii) intron- and exon-structure reconstruction, (iii) identification of wheat A, B and D sub-genome sequences and primer development based on sequence differences between the three sub-genomes, and (iv); testing of primers for functionality, correct size and localisation. This approach was applied to single, low and high copy genes involved in frost tolerance in wheat. In summary for 27 of these genes for which sequences were derived from Triticum aestivum, Triticum monococcum and Hordeum vulgare, a set of 119 primer pairs was developed and after testing on Nulli-tetrasomic (NT) lines, a set of 65 primer pairs (54.6%), corresponding to 19 candidate genes, turned out to be specific. Out of these a set of 35 fragments was selected for validation via Sanger's amplicon re-sequencing. All fragments, with the exception of one, could be assigned to the original reference sequence. The approach presented here showed a much higher specificity in primer development in comparison to techniques used so far in bread wheat and can be applied to other polyploid species with a known draft sequence. PMID:26565976

Gene Duplication and Gene Expression Changes Play a Role in the Evolution of Candidate Pollen Feeding Genes in Heliconius Butterflies

PubMed Central

Smith, Gilbert; Macias-Muñoz, Aide; Briscoe, Adriana D.

2016-01-01

Heliconius possess a unique ability among butterflies to feed on pollen. Pollen feeding significantly extends their lifespan, and is thought to have been important to the diversification of the genus. We used RNA sequencing to examine feeding-related gene expression in the mouthparts of four species of Heliconius and one nonpollen feeding species, Eueides isabella. We hypothesized that genes involved in morphology and protein metabolism might be upregulated in Heliconius because they have longer proboscides than Eueides, and because pollen contains more protein than nectar. Using de novo transcriptome assemblies, we tested these hypotheses by comparing gene expression in mouthparts against antennae and legs. We first looked for genes upregulated in mouthparts across all five species and discovered several hundred genes, many of which had functional annotations involving metabolism of proteins (cocoonase), lipids, and carbohydrates. We then looked specifically within Heliconius where we found eleven common upregulated genes with roles in morphology (CPR cuticle proteins), behavior (takeout-like), and metabolism (luciferase-like). Closer examination of these candidates revealed that cocoonase underwent several duplications along the lineage leading to heliconiine butterflies, including two Heliconius-specific duplications. Luciferase-like genes also underwent duplication within lepidopterans, and upregulation in Heliconius mouthparts. Reverse-transcription PCR confirmed that three cocoonases, a peptidase, and one luciferase-like gene are expressed in the proboscis with little to no expression in labial palps and salivary glands. Our results suggest pollen feeding, like other dietary specializations, was likely facilitated by adaptive expansions of preexisting genes—and that the butterfly proboscis is involved in digestive enzyme production. PMID:27553646

Integrating genetic and toxicogenomic information for determining underlying susceptibility to developmental disorders.

PubMed

Robinson, Joshua F; Port, Jesse A; Yu, Xiaozhong; Faustman, Elaine M

2010-10-01

To understand the complex etiology of developmental disorders, an understanding of both genetic and environmental risk factors is needed. Human and rodent genetic studies have identified a multitude of gene candidates for specific developmental disorders such as neural tube defects (NTDs). With the emergence of toxicogenomic-based assessments, scientists now also have the ability to compare and understand the expression of thousands of genes simultaneously across strain, time, and exposure in developmental models. Using a systems-based approach in which we are able to evaluate information from various parts and levels of the developing organism, we propose a framework for integrating genetic information with toxicogenomic-based studies to better understand gene-environmental interactions critical for developmental disorders. This approach has allowed us to characterize candidate genes in the context of variables critical for determining susceptibility such as strain, time, and exposure. Using a combination of toxicogenomic studies and complementary bioinformatic tools, we characterize NTD candidate genes during normal development by function (gene ontology), linked phenotype (disease outcome), location, and expression (temporally and strain-dependent). In addition, we show how environmental exposures (cadmium, methylmercury) can influence expression of these genes in a strain-dependent manner. Using NTDs as an example of developmental disorder, we show how simple integration of genetic information from previous studies into the standard microarray design can enhance analysis of gene-environment interactions to better define environmental exposure-disease pathways in sensitive and resistant mouse strains. © Wiley-Liss, Inc.

Genetic mechanisms involved in the evolution of the cephalopod camera eye revealed by transcriptomic and developmental studies

PubMed Central

2011-01-01

Background Coleoid cephalopods (squids and octopuses) have evolved a camera eye, the structure of which is very similar to that found in vertebrates and which is considered a classic example of convergent evolution. Other molluscs, however, possess mirror, pin-hole, or compound eyes, all of which differ from the camera eye in the degree of complexity of the eye structures and neurons participating in the visual circuit. Therefore, genes expressed in the cephalopod eye after divergence from the common molluscan ancestor could be involved in eye evolution through association with the acquisition of new structural components. To clarify the genetic mechanisms that contributed to the evolution of the cephalopod camera eye, we applied comprehensive transcriptomic analysis and conducted developmental validation of candidate genes involved in coleoid cephalopod eye evolution. Results We compared gene expression in the eyes of 6 molluscan (3 cephalopod and 3 non-cephalopod) species and selected 5,707 genes as cephalopod camera eye-specific candidate genes on the basis of homology searches against 3 molluscan species without camera eyes. First, we confirmed the expression of these 5,707 genes in the cephalopod camera eye formation processes by developmental array analysis. Second, using molecular evolutionary (dN/dS) analysis to detect positive selection in the cephalopod lineage, we identified 156 of these genes in which functions appeared to have changed after the divergence of cephalopods from the molluscan ancestor and which contributed to structural and functional diversification. Third, we selected 1,571 genes, expressed in the camera eyes of both cephalopods and vertebrates, which could have independently acquired a function related to eye development at the expression level. Finally, as experimental validation, we identified three functionally novel cephalopod camera eye genes related to optic lobe formation in cephalopods by in situ hybridization analysis of embryonic pygmy squid. Conclusion We identified 156 genes positively selected in the cephalopod lineage and 1,571 genes commonly found in the cephalopod and vertebrate camera eyes from the analysis of cephalopod camera eye specificity at the expression level. Experimental validation showed that the cephalopod camera eye-specific candidate genes include those expressed in the outer part of the optic lobes, which unique to coleoid cephalopods. The results of this study suggest that changes in gene expression and in the primary structure of proteins (through positive selection) from those in the common molluscan ancestor could have contributed, at least in part, to cephalopod camera eye acquisition. PMID:21702923

Identification of Putative Transmembrane Proteins Involved in Salinity Tolerance in Chenopodium quinoa by Integrating Physiological Data, RNAseq, and SNP Analyses

PubMed Central

Schmöckel, Sandra M.; Lightfoot, Damien J.; Razali, Rozaimi; Tester, Mark; Jarvis, David E.

2017-01-01

Chenopodium quinoa (quinoa) is an emerging crop that produces nutritious grains with the potential to contribute to global food security. Quinoa can also grow on marginal lands, such as soils affected by high salinity. To identify candidate salt tolerance genes in the recently sequenced quinoa genome, we used a multifaceted approach integrating RNAseq analyses with comparative genomics and topology prediction. We identified 219 candidate genes by selecting those that were differentially expressed in response to salinity, were specific to or overrepresented in quinoa relative to other Amaranthaceae species, and had more than one predicted transmembrane domain. To determine whether these genes might underlie variation in salinity tolerance in quinoa and its close relatives, we compared the response to salinity stress in a panel of 21 Chenopodium accessions (14 C. quinoa, 5 C. berlandieri, and 2 C. hircinum). We found large variation in salinity tolerance, with one C. hircinum displaying the highest salinity tolerance. Using genome re-sequencing data from these accessions, we investigated single nucleotide polymorphisms and copy number variation (CNV) in the 219 candidate genes in accessions of contrasting salinity tolerance, and identified 15 genes that could contribute to the differences in salinity tolerance of these Chenopodium accessions. PMID:28680429

Association Study of 60 Candidate Genes with Antipsychotic-induced Weight Gain in Schizophrenia Patients.

PubMed

Ryu, S; Huh, I-S; Cho, E-Y; Cho, Y; Park, T; Yoon, S C; Joo, Y H; Hong, K S

2016-03-01

This study aimed to investigate the association of multiple candidate genes with weight gain and appetite change during antipsychotic treatment. A total of 233 single nucleotide polymorphisms (SNPs) within 60 candidate genes were genotyped. BMI changes for up to 8 weeks in 84 schizophrenia patients receiving antipsychotic medication were analyzed using a linear mixed model. In addition, we assessed appetite change during antipsychotic treatment in a different group of 46 schizophrenia patients using the Drug-Related Eating Behavior Questionnaire. No SNP showed a statistically significant association with BMI or appetite change after correction for multiple testing. We observed trends of association (P<0.05) between 19 SNPs of 11 genes and weight gain, and between 7 SNPs of 5 genes and appetite change. In particular, rs696217 in GHRL showed suggestive evidence of association with not only weight gain (P=0.001) but also appetite change (P=0.042). Patients carrying the GG genotype of rs696217 exhibited higher increase in both BMI and appetite compared to patients carrying the GT/TT genotype. Our findings suggested the involvement of a GHRL polymorphism in weight gain, which was specifically mediated by appetite change, during antipsychotic treatment in schizophrenia patients. © Georg Thieme Verlag KG Stuttgart · New York.

A Drosophila mutant of LETM1, a candidate gene for seizures in Wolf-Hirschhorn syndrome.

PubMed

McQuibban, Angus G; Joza, Nicholas; Megighian, Aram; Scorzeto, Michele; Zanini, Damiano; Reipert, Siegfried; Richter, Constance; Schweyen, Rudolf J; Nowikovsky, Karin

2010-03-15

Human Wolf-Hirschhorn syndrome (WHS) is a multigenic disorder resulting from a hemizygous deletion on chromosome 4. LETM1 is the best candidate gene for seizures, the strongest haploinsufficiency phenotype of WHS patients. Here, we identify the Drosophila gene CG4589 as the ortholog of LETM1 and name the gene DmLETM1. Using RNA interference approaches in both Drosophila melanogaster cultured cells and the adult fly, we have assayed the effects of down-regulating the LETM1 gene on mitochondrial function. We also show that DmLETM1 complements growth and mitochondrial K(+)/H(+) exchange (KHE) activity in yeast deficient for LETM1. Genetic studies allowing the conditional inactivation of LETM1 function in specific tissues demonstrate that the depletion of DmLETM1 results in roughening of the adult eye, mitochondrial swelling and developmental lethality in third-instar larvae, possibly the result of deregulated mitophagy. Neuronal specific down-regulation of DmLETM1 results in impairment of locomotor behavior in the fly and reduced synaptic neurotransmitter release. Taken together our results demonstrate the function of DmLETM1 as a mitochondrial osmoregulator through its KHE activity and uncover a pathophysiological WHS phenotype in the model organism D. melanogaster.

Differences in Brain Transcriptomes of Closely Related Baikal Coregonid Species

PubMed Central

Bychenko, Oksana S.; Sukhanova, Lyubov V.; Azhikina, Tatyana L.; Skvortsov, Timofey A.; Belomestnykh, Tuyana V.; Sverdlov, Eugene D.

2014-01-01

The aim of this work was to get deeper insight into genetic factors involved in the adaptive divergence of closely related species, specifically two representatives of Baikal coregonids—Baikal whitefish (Coregonus baicalensis Dybowski) and Baikal omul (Coregonus migratorius Georgi)—that diverged from a common ancestor as recently as 10–20 thousand years ago. Using the Serial Analysis of Gene Expression method, we obtained libraries of short representative cDNA sequences (tags) from the brains of Baikal whitefish and omul. A comparative analysis of the libraries revealed quantitative differences among ~4% tags of the fishes under study. Based on the similarity of these tags with cDNA of known organisms, we identified candidate genes taking part in adaptive divergence. The most important candidate genes related to the adaptation of Baikal whitefish and Baikal omul, identified in this work, belong to the genes of cell metabolism, nervous and immune systems, protein synthesis, and regulatory genes as well as to DTSsa4 Tc1-like transposons which are widespread among fishes. PMID:24719892

Loss of RNA expression and allele-specific expression associated with congenital heart disease

PubMed Central

McKean, David M.; Homsy, Jason; Wakimoto, Hiroko; Patel, Neil; Gorham, Joshua; DePalma, Steven R.; Ware, James S.; Zaidi, Samir; Ma, Wenji; Patel, Nihir; Lifton, Richard P.; Chung, Wendy K.; Kim, Richard; Shen, Yufeng; Brueckner, Martina; Goldmuntz, Elizabeth; Sharp, Andrew J.; Seidman, Christine E.; Gelb, Bruce D.; Seidman, J. G.

2016-01-01

Congenital heart disease (CHD), a prevalent birth defect occurring in 1% of newborns, likely results from aberrant expression of cardiac developmental genes. Mutations in a variety of cardiac transcription factors, developmental signalling molecules and molecules that modify chromatin cause at least 20% of disease, but most CHD remains unexplained. We employ RNAseq analyses to assess allele-specific expression (ASE) and biallelic loss-of-expression (LOE) in 172 tissue samples from 144 surgically repaired CHD subjects. Here we show that only 5% of known imprinted genes with paternal allele silencing are monoallelic versus 56% with paternal allele expression—this cardiac-specific phenomenon seems unrelated to CHD. Further, compared with control subjects, CHD subjects have a significant burden of both LOE genes and ASE events associated with altered gene expression. These studies identify FGFBP2, LBH, RBFOX2, SGSM1 and ZBTB16 as candidate CHD genes because of significantly altered transcriptional expression. PMID:27670201

High-Density Association Study of 383 Candidate Genes for Volumetric BMD at the Femoral Neck and Lumbar Spine Among Older Men

PubMed Central

Yerges, Laura M.; Klei, Lambertus; Cauley, Jane A.; Roeder, Kathryn; Kammerer, Candace M.; Moffett, Susan P.; Ensrud, Kristine E.; Nestlerode, Cara S.; Marshall, Lynn M.; Hoffman, Andrew R.; Lewis, Cora; Lang, Thomas F.; Barrett-Connor, Elizabeth; Ferrell, Robert E.; Orwoll, Eric S.

2009-01-01

Genetics is a well-established but poorly understood determinant of BMD. Whereas some genetic variants may influence BMD throughout the body, others may be skeletal site specific. We initially screened for associations between 4608 tagging and potentially functional single nucleotide polymorphisms (SNPs) in 383 candidate genes and femoral neck and lumbar spine volumetric BMD (vBMD) measured from QCT scans among 862 community-dwelling white men ≥65 yr of age in the Osteoporotic Fractures in Men Study (MrOS). The most promising SNP associations (p < 0.01) were validated by genotyping an additional 1156 white men from MrOS. This analysis identified 8 SNPs in 6 genes (APC, DMP1, FGFR2, FLT1, HOXA, and PTN) that were associated with femoral neck vBMD and 13 SNPs in 7 genes (APC, BMPR1B, FOXC2, HOXA, IGFBP2, NFATC1, and SOST) that were associated with lumbar spine vBMD in both genotyping samples (p < 0.05). Although most associations were specific to one skeletal site, SNPs in the APC and HOXA gene regions were associated with both femoral neck and lumbar spine BMD. This analysis identifies several novel and robust genetic associations for volumetric BMD, and these findings in combination with other data suggest the presence of genetic loci for volumetric BMD that are at least to some extent skeletal-site specific. PMID:19453261

Identification and Characterization of a Novel Galactofuranose-Specific β-D-Galactofuranosidase from Streptomyces Species

PubMed Central

Matsunaga, Emiko; Higuchi, Yujiro; Mori, Kazuki; Yairo, Nao; Oka, Takuji; Shinozuka, Saki; Tashiro, Kosuke; Izumi, Minoru; Kuhara, Satoru; Takegawa, Kaoru

2015-01-01

β-D-galactofuranose (Galf) is a component of polysaccharides and glycoconjugates and its transferase has been well analyzed. However, no β-D-galactofuranosidase (Galf-ase) gene has been identified in any organism. To search for a Galf-ase gene we screened soil samples and discovered a strain, identified as a Streptomyces species by the 16S ribosomal RNA gene analysis, that exhibits Galf-ase activity for 4-nitrophenyl β-D-galactofuranoside (pNP-β-D-Galf) in culture supernatants. By draft genome sequencing of the strain, named JHA19, we found four candidate genes encoding Galf-ases. Using recombinant proteins expressed in Escherichia coli, we found that three out of four candidates displayed the activity of not only Galf-ase but also α-L-arabinofuranosidase (Araf-ase), whereas the other one showed only the Galf-ase activity. This novel Galf-specific hydrolase is encoded by ORF1110 and has an optimum pH of 5.5 and a Km of 4.4 mM for the substrate pNP-β-D-Galf. In addition, this enzyme was able to release galactose residue from galactomannan prepared from the filamentous fungus Aspergillus fumigatus, suggesting that natural polysaccharides could be also substrates. By the BLAST search using the amino acid sequence of ORF1110 Galf-ase, we found that there are homolog genes in both prokaryotes and eukaryotes, indicating that Galf-specific Galf-ases widely exist in microorganisms. PMID:26340350

Transcriptome dynamics of a susceptible wheat upon Fusarium head blight reveals that molecular responses to Fusarium graminearum infection fit over the grain development processes.

PubMed

Chetouhi, Cherif; Bonhomme, Ludovic; Lasserre-Zuber, Pauline; Cambon, Florence; Pelletier, Sandra; Renou, Jean-Pierre; Langin, Thierry

2016-03-01

In many plant/pathogen interactions, host susceptibility factors are key determinants of disease development promoting pathogen growth and spreading in plant tissues. In the Fusarium head blight (FHB) disease, the molecular basis of wheat susceptibility is still poorly understood while it could provide new insights into the understanding of the wheat/Fusarium graminearum (Fg) interaction and guide future breeding programs to produce cultivars with sustainable resistance. To identify the wheat grain candidate genes, a genome-wide gene expression profiling was performed in the French susceptible wheat cultivar, Recital. Gene-specific two-way ANOVA of about 40 K transcripts at five grain developmental stages identified 1309 differentially expressed genes. Out of these, 536 were impacted by the Fg effect alone. Most of these Fg-responsive genes belonged to biological and molecular functions related to biotic and abiotic stresses indicating the activation of common stress pathways during susceptibility response of wheat grain to FHB. This analysis revealed also 773 other genes displaying either specific Fg-responsive profiles along with grain development stages or synergistic adjustments with the grain development effect. These genes were involved in various molecular pathways including primary metabolism, cell death, and gene expression reprogramming. An increasingly complex host response was revealed, as was the impact of both Fg infection and grain ontogeny on the transcription of wheat genes. This analysis provides a wealth of candidate genes and pathways involved in susceptibility responses to FHB and depicts new clues to the understanding of the susceptibility determinism in plant/pathogen interactions.

Computational Analysis of Candidate Disease Genes and Variants for Salt-Sensitive Hypertension in Indigenous Southern Africans

PubMed Central

Tiffin, Nicki; Meintjes, Ayton; Ramesar, Rajkumar; Bajic, Vladimir B.; Rayner, Brian

2010-01-01

Multiple factors underlie susceptibility to essential hypertension, including a significant genetic and ethnic component, and environmental effects. Blood pressure response of hypertensive individuals to salt is heterogeneous, but salt sensitivity appears more prevalent in people of indigenous African origin. The underlying genetics of salt-sensitive hypertension, however, are poorly understood. In this study, computational methods including text- and data-mining have been used to select and prioritize candidate aetiological genes for salt-sensitive hypertension. Additionally, we have compared allele frequencies and copy number variation for single nucleotide polymorphisms in candidate genes between indigenous Southern African and Caucasian populations, with the aim of identifying candidate genes with significant variability between the population groups: identifying genetic variability between population groups can exploit ethnic differences in disease prevalence to aid with prioritisation of good candidate genes. Our top-ranking candidate genes include parathyroid hormone precursor (PTH) and type-1angiotensin II receptor (AGTR1). We propose that the candidate genes identified in this study warrant further investigation as potential aetiological genes for salt-sensitive hypertension. PMID:20886000

Comparative Transcriptomics in East African Cichlids Reveals Sex- and Species-Specific Expression and New Candidates for Sex Differentiation in Fishes

PubMed Central

Böhne, Astrid; Sengstag, Thierry; Salzburger, Walter

2014-01-01

Males and females of the same species differ largely in gene expression, which accounts for most of the morphological and physiological differences and sex-specific phenotypes. Here, we analyzed sex-specific gene expression in the brain and the gonads of cichlid fishes from Lake Tanganyika belonging to four different lineages, so-called tribes (Eretmodini, Ectodini, Haplochromini, and Lamprologini), using the outgroup Nile tilapia (Oreochromis niloticus) as reference. The comparison between male and female brains revealed few differences between the sexes, consistent in all investigated species. The gonads, on the other hand, showed a large fraction of differentially expressed transcripts with the majority of them showing the same direction of expression in all four species. All here-studied cichlids, especially the three investigated mouth-breeding species, showed a trend toward more male- than female-biased transcripts. Transcripts, which were female-biased in expression in all four species, were overrepresented on linkage group (LG)1 in the reference genome and common male-biased transcripts showed accumulation on LG23, the presumable sex chromosomes of the Nile tilapia. Sex-specific transcripts contained candidate genes for sex determination and differentiation in fishes, especially members of the transforming growth factor-β-superfamily and the Wnt-pathway and also prominent members of the sox-, dm-domain-, and high mobility group-box families. We further confirmed our previous finding on species/lineage-specific gene expression shifts in the sex steroid pathway, including synthesizing enzymes as the aromatase cyp19a1 and estrogen and androgen receptors. PMID:25364805

An Integrated Genomic Approach for Rapid Delineation of Candidate Genes Regulating Agro-Morphological Traits in Chickpea

PubMed Central

Saxena, Maneesha S.; Bajaj, Deepak; Das, Shouvik; Kujur, Alice; Kumar, Vinod; Singh, Mohar; Bansal, Kailash C.; Tyagi, Akhilesh K.; Parida, Swarup K.

2014-01-01

The identification and fine mapping of robust quantitative trait loci (QTLs)/genes governing important agro-morphological traits in chickpea still lacks systematic efforts at a genome-wide scale involving wild Cicer accessions. In this context, an 834 simple sequence repeat and single-nucleotide polymorphism marker-based high-density genetic linkage map between cultivated and wild parental accessions (Cicer arietinum desi cv. ICC 4958 and Cicer reticulatum wild cv. ICC 17160) was constructed. This inter-specific genetic map comprising eight linkage groups spanned a map length of 949.4 cM with an average inter-marker distance of 1.14 cM. Eleven novel major genomic regions harbouring 15 robust QTLs (15.6–39.8% R2 at 4.2–15.7 logarithm of odds) associated with four agro-morphological traits (100-seed weight, pod and branch number/plant and plant hairiness) were identified and mapped on chickpea chromosomes. Most of these QTLs showed positive additive gene effects with effective allelic contribution from ICC 4958, particularly for increasing seed weight (SW) and pod and branch number. One robust SW-influencing major QTL region (qSW4.2) has been narrowed down by combining QTL mapping with high-resolution QTL region-specific association analysis, differential expression profiling and gene haplotype-based association/LD mapping. This enabled to delineate a strong SW-regulating ABI3VP1 transcription factor (TF) gene at trait-specific QTL interval and consequently identified favourable natural allelic variants and superior high seed weight-specific haplotypes in the upstream regulatory region of this gene showing increased transcript expression during seed development. The genes (TFs) harbouring diverse trait-regulating QTLs, once validated and fine-mapped by our developed rapid integrated genomic approach and through gene/QTL map-based cloning, can be utilized as potential candidates for marker-assisted genetic enhancement of chickpea. PMID:25335477

Mammalian X homolog acts as sex chromosome in lacertid lizards

PubMed Central

Rovatsos, M; Vukić, J; Kratochvíl, L

2016-01-01

Among amniotes, squamate reptiles are especially variable in their mechanisms of sex determination; however, based largely on cytogenetic data, some lineages possess highly evolutionary stable sex chromosomes. The still very limited knowledge of the genetic content of squamate sex chromosomes precludes a reliable reconstruction of the evolutionary history of sex determination in this group and consequently in all amniotes. Female heterogamety with a degenerated W chromosome typifies the lizards of the family Lacertidae, the widely distributed Old World clade including several hundreds of species. From the liver transcriptome of the lacertid Takydromus sexlineatus female, we selected candidates for Z-specific genes as the loci lacking single-nucleotide polymorphisms. We validated the candidate genes through the comparison of the copy numbers in the female and male genomes of T. sexlineatus and another lacertid species, Lacerta agilis, by quantitative PCR that also proved to be a reliable technique for the molecular sexing of the studied species. We suggest that this novel approach is effective for the detection of Z-specific and X-specific genes in lineages with degenerated W, respectively Y chromosomes. The analyzed gene content of the Z chromosome revealed that lacertid sex chromosomes are not homologous with those of other reptiles including birds, but instead the genes have orthologs in the X-conserved region shared by viviparous mammals. It is possible that this part of the vertebrate genome was independently co-opted for the function of sex chromosomes in viviparous mammals and lacertids because of its content of genes involved in gonad differentiation. PMID:26980341

Characterization of Heterobasidion occidentale transcriptomes reveals candidate genes and DNA polymorphisms for virulence variations.

PubMed

Liu, Jun-Jun; Shamoun, Simon Francis; Leal, Isabel; Kowbel, Robert; Sumampong, Grace; Zamany, Arezoo

2018-05-01

Characterization of genes involved in differentiation of pathogen species and isolates with variations of virulence traits provides valuable information to control tree diseases for meeting the challenges of sustainable forest health and phytosanitary trade issues. Lack of genetic knowledge and genomic resources hinders novel gene discovery, molecular mechanism studies and development of diagnostic tools in the management of forest pathogens. Here, we report on transcriptome profiling of Heterobasidion occidentale isolates with contrasting virulence levels. Comparative transcriptomic analysis identified orthologous groups exclusive to H. occidentale and its isolates, revealing biological processes involved in the differentiation of isolates. Further bioinformatics analyses identified an H. occidentale secretome, CYPome and other candidate effectors, from which genes with species- and isolate-specific expression were characterized. A large proportion of differentially expressed genes were revealed to have putative activities as cell wall modification enzymes and transcription factors, suggesting their potential roles in virulence and fungal pathogenesis. Next, large numbers of simple sequence repeats (SSRs) and single nucleotide polymorphisms (SNPs) were detected, including more than 14 000 interisolate non-synonymous SNPs. These polymorphic loci and species/isolate-specific genes may contribute to virulence variations and provide ideal DNA markers for development of diagnostic tools and investigation of genetic diversity. © 2018 The Authors. Microbial Biotechnology published by John Wiley & Sons Ltd and Society for Applied Microbiology.

Lung cancer signature biomarkers: tissue specific semantic similarity based clustering of digital differential display (DDD) data.

PubMed

Srivastava, Mousami; Khurana, Pankaj; Sugadev, Ragumani

2012-11-02

The tissue-specific Unigene Sets derived from more than one million expressed sequence tags (ESTs) in the NCBI, GenBank database offers a platform for identifying significantly and differentially expressed tissue-specific genes by in-silico methods. Digital differential display (DDD) rapidly creates transcription profiles based on EST comparisons and numerically calculates, as a fraction of the pool of ESTs, the relative sequence abundance of known and novel genes. However, the process of identifying the most likely tissue for a specific disease in which to search for candidate genes from the pool of differentially expressed genes remains difficult. Therefore, we have used 'Gene Ontology semantic similarity score' to measure the GO similarity between gene products of lung tissue-specific candidate genes from control (normal) and disease (cancer) sets. This semantic similarity score matrix based on hierarchical clustering represents in the form of a dendrogram. The dendrogram cluster stability was assessed by multiple bootstrapping. Multiple bootstrapping also computes a p-value for each cluster and corrects the bias of the bootstrap probability. Subsequent hierarchical clustering by the multiple bootstrapping method (α = 0.95) identified seven clusters. The comparative, as well as subtractive, approach revealed a set of 38 biomarkers comprising four distinct lung cancer signature biomarker clusters (panel 1-4). Further gene enrichment analysis of the four panels revealed that each panel represents a set of lung cancer linked metastasis diagnostic biomarkers (panel 1), chemotherapy/drug resistance biomarkers (panel 2), hypoxia regulated biomarkers (panel 3) and lung extra cellular matrix biomarkers (panel 4). Expression analysis reveals that hypoxia induced lung cancer related biomarkers (panel 3), HIF and its modulating proteins (TGM2, CSNK1A1, CTNNA1, NAMPT/Visfatin, TNFRSF1A, ETS1, SRC-1, FN1, APLP2, DMBT1/SAG, AIB1 and AZIN1) are significantly down regulated. All down regulated genes in this panel were highly up regulated in most other types of cancers. These panels of proteins may represent signature biomarkers for lung cancer and will aid in lung cancer diagnosis and disease monitoring as well as in the prediction of responses to therapeutics.

Identification of genetic aberrations on chromosome 22 outside the NF2 locus in schwannomatosis and neurofibromatosis type 2.

PubMed

Buckley, Patrick G; Mantripragada, Kiran K; Díaz de Ståhl, Teresita; Piotrowski, Arkadiusz; Hansson, Caisa M; Kiss, Hajnalka; Vetrie, David; Ernberg, Ingemar T; Nordenskjöld, Magnus; Bolund, Lars; Sainio, Markku; Rouleau, Guy A; Niimura, Michihito; Wallace, Andrew J; Evans, D Gareth R; Grigelionis, Gintautas; Menzel, Uwe; Dumanski, Jan P

2005-12-01

Schwannomatosis is characterized by multiple peripheral and cranial nerve schwannomas that occur in the absence of bilateral 8th cranial nerve schwannomas. The latter is the main diagnostic criterion of neurofibromatosis type 2 (NF2), which is a related but distinct disorder. The genetic factors underlying the differences between schwannomatosis and NF2 are poorly understood, although available evidence implicates chromosome 22 as the primary location of the gene(s) of interest. To investigate this, we comprehensively profiled the DNA copy number in samples from sporadic and familial schwannomatosis, NF2, and a large cohort of normal controls. Using a tiling-path chromosome 22 genomic array, we identified two candidate regions of copy number variation, which were further characterized by a PCR-based array with higher resolution. The latter approach allows the detection of minute alterations in total genomic DNA, with as little as 1.5 kb per measurement point of nonredundant sequence on the array. In DNA derived from peripheral blood from a schwannomatosis patient and a sporadic schwannoma sample, we detected rearrangements of the immunoglobulin lambda (IGL) locus, which is unlikely to be due to a B-cell specific somatic recombination of IGL. Analysis of normal controls indicated that these IGL rearrangements were restricted to schwannomatosis/schwannoma samples. In the second candidate region spanning GSTT1 and CABIN1 genes, we observed a frequent copy number polymorphism at the GSTT1 locus. We further describe missense mutations in the CABIN1 gene that are specific to samples from schwannomatosis and NF2 and make this gene a plausible candidate for contributing to the pathogenesis of these disorders. Copyright 2005 Wiley-Liss, Inc.

Identification of Causal Genes, Networks, and Transcriptional Regulators of REM Sleep and Wake

PubMed Central

Millstein, Joshua; Winrow, Christopher J.; Kasarskis, Andrew; Owens, Joseph R.; Zhou, Lili; Summa, Keith C.; Fitzpatrick, Karrie; Zhang, Bin; Vitaterna, Martha H.; Schadt, Eric E.; Renger, John J.; Turek, Fred W.

2011-01-01

Study Objective: Sleep-wake traits are well-known to be under substantial genetic control, but the specific genes and gene networks underlying primary sleep-wake traits have largely eluded identification using conventional approaches, especially in mammals. Thus, the aim of this study was to use systems genetics and statistical approaches to uncover the genetic networks underlying 2 primary sleep traits in the mouse: 24-h duration of REM sleep and wake. Design: Genome-wide RNA expression data from 3 tissues (anterior cortex, hypothalamus, thalamus/midbrain) were used in conjunction with high-density genotyping to identify candidate causal genes and networks mediating the effects of 2 QTL regulating the 24-h duration of REM sleep and one regulating the 24-h duration of wake. Setting: Basic sleep research laboratory. Patients or Participants: Male [C57BL/6J × (BALB/cByJ × C57BL/6J*) F1] N2 mice (n = 283). Interventions: None. Measurements and Results: The genetic variation of a mouse N2 mapping cross was leveraged against sleep-state phenotypic variation as well as quantitative gene expression measurement in key brain regions using integrative genomics approaches to uncover multiple causal sleep-state regulatory genes, including several surprising novel candidates, which interact as components of networks that modulate REM sleep and wake. In particular, it was discovered that a core network module, consisting of 20 genes, involved in the regulation of REM sleep duration is conserved across the cortex, hypothalamus, and thalamus. A novel application of a formal causal inference test was also used to identify those genes directly regulating sleep via control of expression. Conclusion: Systems genetics approaches reveal novel candidate genes, complex networks and specific transcriptional regulators of REM sleep and wake duration in mammals. Citation: Millstein J; Winrow CJ; Kasarskis A; Owens JR; Zhou L; Summa KC; Fitzpatrick K; Zhang B; Vitaterna MH; Schadt EE; Renger JJ; Turek FW. Identification of causal genes, networks, and transcriptional regulators of REM sleep and wake. SLEEP 2011;34(11):1469-1477. PMID:22043117

Gene expression profile and immunological evaluation of unique hypothetical unknown proteins of Mycobacterium leprae by using quantitative real-time PCR.

PubMed

Kim, Hee Jin; Prithiviraj, Kalyani; Groathouse, Nathan; Brennan, Patrick J; Spencer, John S

2013-02-01

The cell-mediated immunity (CMI)-based in vitro gamma interferon release assay (IGRA) of Mycobacterium leprae-specific antigens has potential as a promising diagnostic means to detect those individuals in the early stages of M. leprae infection. Diagnosis of leprosy is a major obstacle toward ultimate disease control and has been compromised in the past by the lack of specific markers. Comparative bioinformatic analysis among mycobacterial genomes identified potential M. leprae-specific proteins called "hypothetical unknowns." Due to massive gene decay and the prevalence of pseudogenes, it is unclear whether any of these proteins are expressed or are immunologically relevant. In this study, we performed cDNA-based quantitative real-time PCR to investigate the expression status of 131 putative open reading frames (ORFs) encoding hypothetical unknowns. Twenty-six of the M. leprae-specific antigen candidates showed significant levels of gene expression compared to that of ESAT-6 (ML0049), which is an important T cell antigen of low abundance in M. leprae. Fifteen of 26 selected antigen candidates were expressed and purified in Escherichia coli. The seroreactivity to these proteins of pooled sera from lepromatous leprosy patients and cavitary tuberculosis patients revealed that 9 of 15 recombinant hypothetical unknowns elicited M. leprae-specific immune responses. These nine proteins may be good diagnostic reagents to improve both the sensitivity and specificity of detection of individuals with asymptomatic leprosy.

Gene Expression Profile and Immunological Evaluation of Unique Hypothetical Unknown Proteins of Mycobacterium leprae by Using Quantitative Real-Time PCR

PubMed Central

Prithiviraj, Kalyani; Groathouse, Nathan; Brennan, Patrick J.; Spencer, John S.

2013-01-01

The cell-mediated immunity (CMI)-based in vitro gamma interferon release assay (IGRA) of Mycobacterium leprae-specific antigens has potential as a promising diagnostic means to detect those individuals in the early stages of M. leprae infection. Diagnosis of leprosy is a major obstacle toward ultimate disease control and has been compromised in the past by the lack of specific markers. Comparative bioinformatic analysis among mycobacterial genomes identified potential M. leprae-specific proteins called “hypothetical unknowns.” Due to massive gene decay and the prevalence of pseudogenes, it is unclear whether any of these proteins are expressed or are immunologically relevant. In this study, we performed cDNA-based quantitative real-time PCR to investigate the expression status of 131 putative open reading frames (ORFs) encoding hypothetical unknowns. Twenty-six of the M. leprae-specific antigen candidates showed significant levels of gene expression compared to that of ESAT-6 (ML0049), which is an important T cell antigen of low abundance in M. leprae. Fifteen of 26 selected antigen candidates were expressed and purified in Escherichia coli. The seroreactivity to these proteins of pooled sera from lepromatous leprosy patients and cavitary tuberculosis patients revealed that 9 of 15 recombinant hypothetical unknowns elicited M. leprae-specific immune responses. These nine proteins may be good diagnostic reagents to improve both the sensitivity and specificity of detection of individuals with asymptomatic leprosy. PMID:23239802

Immunogenetics of pemphigus: an update.

PubMed

Tron, François; Gilbert, Danièle; Joly, Pascal; Mouquet, Hugo; Drouot, Laurent; Ayed, Mourad Ben; Sellami, Myriam; Masmoudi, Hatem; Makni, Sondès

2006-11-01

Pemphigus are rare but informative models of organ-specific autoimmune diseases, resulting from the interplay of environmental, genetic and stochastic factors. There are many arguments to consider that pemphigus have a genetic basis involving, as many other autoimmune diseases, several different genes with additive or synergistic effects. So far, the unique strategy used to identify the contributive loci has been direct analysis of candidate genes through conventional case-control association studies. The major histocompatibility complex in particular the class II locus was demonstrated to be associated with pemphigus with a high rate of replicability. The progresses in the understanding of pemphigus physiopathology and the development of new molecular tools offer new perspectives to unveiled the genetic basis of this group of autoimmune blistering diseases, as shown by recent studies of candidate genes expressed at different levels of the autoimmune process.

Identification of a strawberry flavor gene candidate using an integrated genetic-genomic-analytical chemistry approach.

PubMed

Chambers, Alan H; Pillet, Jeremy; Plotto, Anne; Bai, Jinhe; Whitaker, Vance M; Folta, Kevin M

2014-04-17

There is interest in improving the flavor of commercial strawberry (Fragaria × ananassa) varieties. Fruit flavor is shaped by combinations of sugars, acids and volatile compounds. Many efforts seek to use genomics-based strategies to identify genes controlling flavor, and then designing durable molecular markers to follow these genes in breeding populations. In this report, fruit from two cultivars, varying for presence-absence of volatile compounds, along with segregating progeny, were analyzed using GC/MS and RNAseq. Expression data were bulked in silico according to presence/absence of a given volatile compound, in this case γ-decalactone, a compound conferring a peach flavor note to fruits. Computationally sorting reads in segregating progeny based on γ-decalactone presence eliminated transcripts not directly relevant to the volatile, revealing transcripts possibly imparting quantitative contributions. One candidate encodes an omega-6 fatty acid desaturase, an enzyme known to participate in lactone production in fungi, noted here as FaFAD1. This candidate was induced by ripening, was detected in certain harvests, and correlated with γ-decalactone presence. The FaFAD1 gene is present in every genotype where γ-decalactone has been detected, and it was invariably missing in non-producers. A functional, PCR-based molecular marker was developed that cosegregates with the phenotype in F1 and BC1 populations, as well as in many other cultivars and wild Fragaria accessions. Genetic, genomic and analytical chemistry techniques were combined to identify FaFAD1, a gene likely controlling a key flavor volatile in strawberry. The same data may now be re-sorted based on presence/absence of any other volatile to identify other flavor-affecting candidates, leading to rapid generation of gene-specific markers.

Identification of a strawberry flavor gene candidate using an integrated genetic-genomic-analytical chemistry approach

PubMed Central

2014-01-01

Background There is interest in improving the flavor of commercial strawberry (Fragaria × ananassa) varieties. Fruit flavor is shaped by combinations of sugars, acids and volatile compounds. Many efforts seek to use genomics-based strategies to identify genes controlling flavor, and then designing durable molecular markers to follow these genes in breeding populations. In this report, fruit from two cultivars, varying for presence-absence of volatile compounds, along with segregating progeny, were analyzed using GC/MS and RNAseq. Expression data were bulked in silico according to presence/absence of a given volatile compound, in this case γ-decalactone, a compound conferring a peach flavor note to fruits. Results Computationally sorting reads in segregating progeny based on γ-decalactone presence eliminated transcripts not directly relevant to the volatile, revealing transcripts possibly imparting quantitative contributions. One candidate encodes an omega-6 fatty acid desaturase, an enzyme known to participate in lactone production in fungi, noted here as FaFAD1. This candidate was induced by ripening, was detected in certain harvests, and correlated with γ-decalactone presence. The FaFAD1 gene is present in every genotype where γ-decalactone has been detected, and it was invariably missing in non-producers. A functional, PCR-based molecular marker was developed that cosegregates with the phenotype in F1 and BC1 populations, as well as in many other cultivars and wild Fragaria accessions. Conclusions Genetic, genomic and analytical chemistry techniques were combined to identify FaFAD1, a gene likely controlling a key flavor volatile in strawberry. The same data may now be re-sorted based on presence/absence of any other volatile to identify other flavor-affecting candidates, leading to rapid generation of gene-specific markers. PMID:24742080

Identification of candidate genes affecting Δ9-tetrahydrocannabinol biosynthesis in Cannabis sativa

PubMed Central

Marks, M. David; Tian, Li; Wenger, Jonathan P.; Omburo, Stephanie N.; Soto-Fuentes, Wilfredo; He, Ji; Gang, David R.; Weiblen, George D.; Dixon, Richard A.

2009-01-01

RNA isolated from the glands of a Δ9-tetrahydrocannabinolic acid (THCA)-producing strain of Cannabis sativa was used to generate a cDNA library containing over 100 000 expressed sequence tags (ESTs). Sequencing of over 2000 clones from the library resulted in the identification of over 1000 unigenes. Candidate genes for almost every step in the biochemical pathways leading from primary metabolites to THCA were identified. Quantitative PCR analysis suggested that many of the pathway genes are preferentially expressed in the glands. Hexanoyl-CoA, one of the metabolites required for THCA synthesis, could be made via either de novo fatty acids synthesis or via the breakdown of existing lipids. qPCR analysis supported the de novo pathway. Many of the ESTs encode transcription factors and two putative MYB genes were identified that were preferentially expressed in glands. Given the similarity of the Cannabis MYB genes to those in other species with known functions, these Cannabis MYBs may play roles in regulating gland development and THCA synthesis. Three candidates for the polyketide synthase (PKS) gene responsible for the first committed step in the pathway to THCA were characterized in more detail. One of these was identical to a previously reported chalcone synthase (CHS) and was found to have CHS activity. All three could use malonyl-CoA and hexanoyl-CoA as substrates, including the CHS, but reaction conditions were not identified that allowed for the production of olivetolic acid (the proposed product of the PKS activity needed for THCA synthesis). One of the PKS candidates was highly and specifically expressed in glands (relative to whole leaves) and, on the basis of these expression data, it is proposed to be the most likely PKS responsible for olivetolic acid synthesis in Cannabis glands. PMID:19581347

Direct interplay between two candidate genes in FSHD muscular dystrophy

PubMed Central

Ferri, Giulia; Huichalaf, Claudia H.; Caccia, Roberta; Gabellini, Davide

2015-01-01

Facioscapulohumeral muscular dystrophy (FSHD) is one of the most common neuromuscular disorders. The major form of the disease (FSHD1) is linked to decrease in copy number of a 3.3-kb tandem repeated macrosatellite (D4Z4), located on chromosome 4q35. D4Z4 deletion alters chromatin structure of the locus leading to aberrant expression of nearby 4q35 genes. Given the high variability in disease onset and progression, multiple factors could contribute to the pathogenesis of FSHD. Among the FSHD candidate genes are double homeobox 4 (DUX4), encoded by the most telomeric D4Z4 unit, and FSHD region gene 1 (FRG1). DUX4 is a sequence-specific transcription factor. Here, we located putative DUX4 binding sites in the human FRG1 genomic area and we show specific DUX4 association to these regions. We found also that ectopically expressed DUX4 up-regulates the endogenous human FRG1 gene in healthy muscle cells, while DUX4 knockdown leads to a decrease in FRG1 expression in FSHD muscle cells. Moreover, DUX4 binds directly and specifically to its binding site located in the human FRG1 gene and transactivates constructs containing FRG1 genomic regions. Intriguingly, the mouse Frg1 genomic area lacks DUX4 binding sites and DUX4 is unable to activate the endogenous mouse Frg1 gene providing a possible explanation for the lack of muscle phenotype in DUX4 transgenic mice. Altogether, our results demonstrate that FRG1 is a direct DUX4 transcriptional target uncovering a novel regulatory circuit contributing to FSHD. PMID:25326393

Gsg1, Trnp1, and Tmem215 Mark Subpopulations of Bipolar Interneurons in the Mouse Retina

PubMed Central

Park, Ko Uoon; Randazzo, Grace; Jones, Kenneth L.; Brzezinski, Joseph A.

2017-01-01

Purpose How retinal bipolar cell interneurons are specified and assigned to specialized subtypes is only partially understood. In part, this is due to a lack of early pan- and subtype-specific bipolar cell markers. To discover these factors, we identified genes that were upregulated in Blimp1 (Prdm1) mutant retinas, which exhibit precocious bipolar cell development. Methods Postnatal day (P)2 retinas from Blimp1 conditional knock-out (CKO) mice and controls were processed for RNA sequencing. Genes that increased at least 45% and were statistically different between conditions were considered candidate bipolar-specific factors. Candidates were further evaluated by RT-PCR, in situ hybridization, and immunohistochemistry. Knock-in Tmem215-LacZ mice were used to better trace retinal expression. Results A comparison between Blimp1 CKO and control RNA-seq datasets revealed approximately 40 significantly upregulated genes. We characterized the expression of three genes that have no known function in the retina, Gsg1 (germ cell associated gene), Trnp1 (TMF-regulated nuclear protein), and Tmem215 (a predicted transmembrane protein). Germ cell associated gene appeared restricted to a small subset of cone bipolars while Trnp1 was seen in all ON type bipolar cells. Using Tmem215-LacZ heterozygous knock-in mice, we observed that β-galactosidase expression started early in bipolar cell development. In adults, Tmem215 was expressed by a subset of ON and OFF cone bipolar cells. Conclusions We have identified Gsg1, Tmem215, and Trnp1 as novel bipolar subtype-specific genes. The spatial and temporal pattern of their expression is consistent with a role in controlling bipolar subtype fate choice, differentiation, or physiology. PMID:28199486

Isolation and characterization of multiple F-box genes linked to the S9- and S10-RNase in apple (Malus × domestica Borkh.).

PubMed

Okada, Kazuma; Moriya, Shigeki; Haji, Takashi; Abe, Kazuyuki

2013-06-01

Using 11 consensus primer pairs designed from S-linked F-box genes of apple and Japanese pear, 10 new F-box genes (MdFBX21 to 30) were isolated from the apple cultivar 'Spartan' (S(9)S(10)). MdFBX21 to 23 and MdFBX24 to 30 were completely linked to the S(9) -RNase and S(10-)RNase, respectively, and showed pollen-specific expression and S-haplotype-specific polymorphisms. Therefore, these 10 F-box genes are good candidates for the pollen determinant of self-incompatibility in apple. Phylogenetic analysis and comparison of deduced amino acid sequences of MdFBX21 to 30 with those of 25 S-linked F-box genes previously isolated from apple showed that a deduced amino acid identity of greater than 88.0 % can be used as the tentative criterion to classify F-box genes into one type. Using this criterion, 31 of 35 F-box genes of apple were classified into 11 types (SFBB1-11). All types included F-box genes derived from S(3-) and S(9-)haplotypes, and seven types included F-box genes derived from S(3-), S(9-), and S(10-)haplotypes. Moreover, comparison of nucleotide sequences of S-RNases and multiple F-box genes among S(3-), S(9-), and S(10-)haplotypes suggested that F-box genes within each type showed high nucleotide identity regardless of the identity of the S-RNase. The large number of F-box genes as candidates for the pollen determinant and the high degree of conservation within each type are consistent with the collaborative non-self-recognition model reported for Petunia. These findings support that the collaborative non-self-recognition system also exists in apple.

Gene Duplication and Gene Expression Changes Play a Role in the Evolution of Candidate Pollen Feeding Genes in Heliconius Butterflies.

PubMed

Smith, Gilbert; Macias-Muñoz, Aide; Briscoe, Adriana D

2016-09-02

Heliconius possess a unique ability among butterflies to feed on pollen. Pollen feeding significantly extends their lifespan, and is thought to have been important to the diversification of the genus. We used RNA sequencing to examine feeding-related gene expression in the mouthparts of four species of Heliconius and one nonpollen feeding species, Eueides isabella We hypothesized that genes involved in morphology and protein metabolism might be upregulated in Heliconius because they have longer proboscides than Eueides, and because pollen contains more protein than nectar. Using de novo transcriptome assemblies, we tested these hypotheses by comparing gene expression in mouthparts against antennae and legs. We first looked for genes upregulated in mouthparts across all five species and discovered several hundred genes, many of which had functional annotations involving metabolism of proteins (cocoonase), lipids, and carbohydrates. We then looked specifically within Heliconius where we found eleven common upregulated genes with roles in morphology (CPR cuticle proteins), behavior (takeout-like), and metabolism (luciferase-like). Closer examination of these candidates revealed that cocoonase underwent several duplications along the lineage leading to heliconiine butterflies, including two Heliconius-specific duplications. Luciferase-like genes also underwent duplication within lepidopterans, and upregulation in Heliconius mouthparts. Reverse-transcription PCR confirmed that three cocoonases, a peptidase, and one luciferase-like gene are expressed in the proboscis with little to no expression in labial palps and salivary glands. Our results suggest pollen feeding, like other dietary specializations, was likely facilitated by adaptive expansions of preexisting genes-and that the butterfly proboscis is involved in digestive enzyme production. © The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Chemical modification of chitosan for efficient gene therapy.

PubMed

Jiang, Hu-Lin; Cui, Peng-Fei; Xie, Rong-Lin; Cho, Chong-Su

2014-01-01

Gene therapy involves the introduction of foreign genetic material into cells in order to exert a therapeutic effect. Successful gene therapy relies on effective vector system. Viral vectors are highly efficient in transfecting cells, but the undesirable complications limit their therapeutic applications. As a natural biopolymer, chitosan has been considered to be a good gene carrier candidate due to its ideal character which combines biocompatibility, low toxicity with high cationic density together. However, the low cell specificity and low transfection efficiency of chitosan as a gene carrier need to be overcome before undertaking clinical trials. This chapter is principally on those endeavors such as chemical modifications using cell-specific ligands and stimuli-response groups as well as penetrating modifications that have been done to increase the performances of chitosan in gene therapy. © 2014 Elsevier Inc. All rights reserved.

Genome-wide significant localization for working and spatial memory: Identifying genes for psychosis using models of cognition.

PubMed

Knowles, Emma E M; Carless, Melanie A; de Almeida, Marcio A A; Curran, Joanne E; McKay, D Reese; Sprooten, Emma; Dyer, Thomas D; Göring, Harald H; Olvera, Rene; Fox, Peter; Almasy, Laura; Duggirala, Ravi; Kent, Jack W; Blangero, John; Glahn, David C

2014-01-01

It is well established that risk for developing psychosis is largely mediated by the influence of genes, but identifying precisely which genes underlie that risk has been problematic. Focusing on endophenotypes, rather than illness risk, is one solution to this problem. Impaired cognition is a well-established endophenotype of psychosis. Here we aimed to characterize the genetic architecture of cognition using phenotypically detailed models as opposed to relying on general IQ or individual neuropsychological measures. In so doing we hoped to identify genes that mediate cognitive ability, which might also contribute to psychosis risk. Hierarchical factor models of genetically clustered cognitive traits were subjected to linkage analysis followed by QTL region-specific association analyses in a sample of 1,269 Mexican American individuals from extended pedigrees. We identified four genome wide significant QTLs, two for working and two for spatial memory, and a number of plausible and interesting candidate genes. The creation of detailed models of cognition seemingly enhanced the power to detect genetic effects on cognition and provided a number of possible candidate genes for psychosis. © 2013 Wiley Periodicals, Inc.

Updates on the COPD gene list

PubMed Central

Bossé, Yohan

2012-01-01

A genetic contribution to develop chronic obstructive pulmonary disease (COPD) is well established. However, the specific genes responsible for enhanced risk or host differences in susceptibility to smoke exposure remain poorly understood. The goal of this review is to provide a comprehensive literature overview on the genetics of COPD, highlight the most promising findings during the last few years, and ultimately provide an updated COPD gene list. Candidate gene studies on COPD and related phenotypes indexed in PubMed before January 5, 2012 are tabulated. An exhaustive list of publications for any given gene was looked for. This well-documented COPD candidate-gene list is expected to serve many purposes for future replication studies and meta-analyses as well as for reanalyzing collected genomic data in the field. In addition, this review summarizes recent genetic loci identified by genome-wide association studies on COPD, lung function, and related complications. Assembling resources, integrative genomic approaches, and large sample sizes of well-phenotyped subjects is part of the path forward to elucidate the genetic basis of this debilitating disease. PMID:23055711

Comprehensive analysis of alternative splicing and functionality in neuronal differentiation of P19 cells.

PubMed

Suzuki, Hitoshi; Osaki, Ken; Sano, Kaori; Alam, A H M Khurshid; Nakamura, Yuichiro; Ishigaki, Yasuhito; Kawahara, Kozo; Tsukahara, Toshifumi

2011-02-18

Alternative splicing, which produces multiple mRNAs from a single gene, occurs in most human genes and contributes to protein diversity. Many alternative isoforms are expressed in a spatio-temporal manner, and function in diverse processes, including in the neural system. The purpose of the present study was to comprehensively investigate neural-splicing using P19 cells. GeneChip Exon Array analysis was performed using total RNAs purified from cells during neuronal cell differentiation. To efficiently and readily extract the alternative exon candidates, 9 filtering conditions were prepared, yielding 262 candidate exons (236 genes). Semiquantitative RT-PCR results in 30 randomly selected candidates suggested that 87% of the candidates were differentially alternatively spliced in neuronal cells compared to undifferentiated cells. Gene ontology and pathway analyses suggested that many of the candidate genes were associated with neural events. Together with 66 genes whose functions in neural cells or organs were reported previously, 47 candidate genes were found to be linked to 189 events in the gene-level profile of neural differentiation. By text-mining for the alternative isoform, distinct functions of the isoforms of 9 candidate genes indicated by the result of Exon Array were confirmed. Alternative exons were successfully extracted. Results from the informatics analyses suggested that neural events were primarily governed by genes whose expression was increased and whose transcripts were differentially alternatively spliced in the neuronal cells. In addition to known functions in neural cells or organs, the uninvestigated alternative splicing events of 11 genes among 47 candidate genes suggested that cell cycle events are also potentially important. These genes may help researchers to differentiate the roles of alternative splicing in cell differentiation and cell proliferation.

Sex-Specific Associations between Particulate Matter Exposure and Gene Expression in Independent Discovery and Validation Cohorts of Middle-Aged Men and Women.

PubMed

Vrijens, Karen; Winckelmans, Ellen; Tsamou, Maria; Baeyens, Willy; De Boever, Patrick; Jennen, Danyel; de Kok, Theo M; Den Hond, Elly; Lefebvre, Wouter; Plusquin, Michelle; Reynders, Hans; Schoeters, Greet; Van Larebeke, Nicolas; Vanpoucke, Charlotte; Kleinjans, Jos; Nawrot, Tim S

2017-04-01

Particulate matter (PM) exposure leads to premature death, mainly due to respiratory and cardiovascular diseases. Identification of transcriptomic biomarkers of air pollution exposure and effect in a healthy adult population. Microarray analyses were performed in 98 healthy volunteers (48 men, 50 women). The expression of eight sex-specific candidate biomarker genes (significantly associated with PM 10 in the discovery cohort and with a reported link to air pollution-related disease) was measured with qPCR in an independent validation cohort (75 men, 94 women). Pathway analysis was performed using Gene Set Enrichment Analysis. Average daily PM 2.5 and PM 10 exposures over 2-years were estimated for each participant's residential address using spatiotemporal interpolation in combination with a dispersion model. Average long-term PM 10 was 25.9 (± 5.4) and 23.7 (± 2.3) μg/m 3 in the discovery and validation cohorts, respectively. In discovery analysis, associations between PM 10 and the expression of individual genes differed by sex. In the validation cohort, long-term PM 10 was associated with the expression of DNAJB5 and EAPP in men and ARHGAP4 ( p = 0.053) in women. AKAP6 and LIMK1 were significantly associated with PM 10 in women, although associations differed in direction between the discovery and validation cohorts. Expression of the eight candidate genes in the discovery cohort differentiated between validation cohort participants with high versus low PM 10 exposure (area under the receiver operating curve = 0.92; 95% CI: 0.85, 1.00; p = 0.0002 in men, 0.86; 95% CI: 0.76, 0.96; p = 0.004 in women). Expression of the sex-specific candidate genes identified in the discovery population predicted PM 10 exposure in an independent cohort of adults from the same area. Confirmation in other populations may further support this as a new approach for exposure assessment, and may contribute to the discovery of molecular mechanisms for PM-induced health effects.

Survival dimensionality reduction (SDR): development and clinical application of an innovative approach to detect epistasis in presence of right-censored data

PubMed Central

2010-01-01

Background Epistasis is recognized as a fundamental part of the genetic architecture of individuals. Several computational approaches have been developed to model gene-gene interactions in case-control studies, however, none of them is suitable for time-dependent analysis. Herein we introduce the Survival Dimensionality Reduction (SDR) algorithm, a non-parametric method specifically designed to detect epistasis in lifetime datasets. Results The algorithm requires neither specification about the underlying survival distribution nor about the underlying interaction model and proved satisfactorily powerful to detect a set of causative genes in synthetic epistatic lifetime datasets with a limited number of samples and high degree of right-censorship (up to 70%). The SDR method was then applied to a series of 386 Dutch patients with active rheumatoid arthritis that were treated with anti-TNF biological agents. Among a set of 39 candidate genes, none of which showed a detectable marginal effect on anti-TNF responses, the SDR algorithm did find that the rs1801274 SNP in the FcγRIIa gene and the rs10954213 SNP in the IRF5 gene non-linearly interact to predict clinical remission after anti-TNF biologicals. Conclusions Simulation studies and application in a real-world setting support the capability of the SDR algorithm to model epistatic interactions in candidate-genes studies in presence of right-censored data. Availability: http://sourceforge.net/projects/sdrproject/ PMID:20691091

Strong motion deficits in dyslexia associated with DCDC2 gene alteration.

PubMed

Cicchini, Guido Marco; Marino, Cecilia; Mascheretti, Sara; Perani, Daniela; Morrone, Maria Concetta

2015-05-27

Dyslexia is a specific impairment in reading that affects 1 in 10 people. Previous studies have failed to isolate a single cause of the disorder, but several candidate genes have been reported. We measured motion perception in two groups of dyslexics, with and without a deletion within the DCDC2 gene, a risk gene for dyslexia. We found impairment for motion particularly strong at high spatial frequencies in the population carrying the deletion. The data suggest that deficits in motion processing occur in a specific genotype, rather than the entire dyslexia population, contributing to the large variability in impairment of motion thresholds in dyslexia reported in the literature. Copyright © 2015 the authors 0270-6474/15/358059-06$15.00/0.

RNA interference of tubulin genes has lethal effects in Mythimna separate.

PubMed

Wang, Jin-da; Wang, Ya-Ru; Wang, Yong-Zhi; Wang, Wei-Zhong; Wang, Rong; Gao, San-Ji

2018-05-23

RNAi (RNA interference) is a technology for silencing expression of target genes via sequence-specific double-stranded RNA (dsRNA). Recently, dietary introduction of bacterially expressed dsRNA has shown great potential in the field of pest management. Identification of potential candidate genes for RNAi is the first step in this application. The oriental armyworm, Mythimna separata Walker (Lepidoptera: Noctuidae) is a polyphagous, migratory pest, and outbreaks have led to severe crop damage in China. In the present study, two tubulin genes were chosen as target genes because of their crucial role in insect development. Both Msα-tubulin and Msβ-tubulin genes are expressed across all life stages and are highly expressed in the head and epidermis. Feeding of bacterially expressed dsRNA of Msα-tubulin and Msβ-tubulin to third-instar larvae knocked down target mRNAs. A lethal phenotype was observed with knockdown of Msα-tubulin and Msβ-tubulin concurrent with reduction in body weight. Bacterially expressed dsRNA can be used to control M. separata, and tubulin genes could be effective candidate genes for an RNAi-based control strategy of this pest. Copyright © 2017. Published by Elsevier B.V.

mRNA expression pattern of selected candidate genes differs in bovine oviductal epithelial cells in vitro compared with the in vivo state and during cell culture passages.

PubMed

Danesh Mesgaran, Sadjad; Sharbati, Jutta; Einspanier, Ralf; Gabler, Christoph

2016-08-15

The mammalian oviduct provides the optimal environment for gamete maturation including sperm capacitation, fertilization, and development of the early embryo. Various cell culture models for primary bovine oviductal epithelial cells (BOEC) were established to reveal such physiological events. The aim of this study was to evaluate 17 candidate mRNA expression patterns in oviductal epithelial cells (1) in transition from in vivo cells to in vitro cells; (2) during three consecutive cell culture passages; (3) affected by the impact of LOW or HIGH glucose content media; and (4) influenced by different phases of the estrous cycle in vivo and in vitro. In addition, the release of a metabolite and proteins from BOEC at two distinct cell culture passage numbers was estimated to monitor the functionality. BOEC from 8 animals were isolated and cultured for three consecutive passages. Total RNA was extracted from in vivo and in vitro samples and subjected to reverse transcription quantitative polymerase chain reaction to reveal mRNA expression of selected candidate genes. The release of prostaglandin E2 (PGE2), oviduct-specific glycoprotein 1 (OVGP1) and interleukin 8 (IL8) by BOEC was measured by EIA or ELISA after 24 h. Almost all candidate genes (prostaglandin synthases, enzymes of cellular metabolism and mucins) mRNA expression pattern differed compared in vivo with in vitro state. In addition, transcription of most candidate genes was influenced by the number of cell culture passages. Different glucose medium content did not affect mRNA expression of most candidate genes. The phase of the estrous cycle altered some candidate mRNA expression in BOEC in vitro at later passages. The release of PGE2 and OVGP1 between passages did not differ. However, BOEC in passage 3 released significantly higher amount of IL8 compared with cells in passage 0. This study supports the hypothesis that candidate mRNA expression in BOEC was influenced by transition from the in vivo situation to the new in vitro environment and during consecutive passages. The consequence of cell culture passaging on BOEC ability to release bioactive compounds should be considered.

Evaluation and Validation of Housekeeping Genes as Reference for Gene Expression Studies in Pigeonpea (Cajanus cajan) Under Drought Stress Conditions

PubMed Central

Sinha, Pallavi; Singh, Vikas K.; Suryanarayana, V.; Krishnamurthy, L.; Saxena, Rachit K.; Varshney, Rajeev K.

2015-01-01

Gene expression analysis using quantitative real-time PCR (qRT-PCR) is a very sensitive technique and its sensitivity depends on the stable performance of reference gene(s) used in the study. A number of housekeeping genes have been used in various expression studies in many crops however, their expression were found to be inconsistent under different stress conditions. As a result, species specific housekeeping genes have been recommended for different expression studies in several crop species. However, such specific housekeeping genes have not been reported in the case of pigeonpea (Cajanus cajan) despite the fact that genome sequence has become available for the crop. To identify the stable housekeeping genes in pigeonpea for expression analysis under drought stress conditions, the relative expression variations of 10 commonly used housekeeping genes (EF1α, UBQ10, GAPDH, 18SrRNA, 25SrRNA, TUB6, ACT1, IF4α, UBC and HSP90) were studied on root, stem and leaves tissues of Asha (ICPL 87119). Three statistical algorithms geNorm, NormFinder and BestKeeper were used to define the stability of candidate genes. geNorm analysis identified IF4α and TUB6 as the most stable housekeeping genes however, NormFinder analysis determined IF4α and HSP90 as the most stable housekeeping genes under drought stress conditions. Subsequently validation of the identified candidate genes was undertaken in qRT-PCR based gene expression analysis of uspA gene which plays an important role for drought stress conditions in pigeonpea. The relative quantification of the uspA gene varied according to the internal controls (stable and least stable genes), thus highlighting the importance of the choice of as well as validation of internal controls in such experiments. The identified stable and validated housekeeping genes will facilitate gene expression studies in pigeonpea especially under drought stress conditions. PMID:25849964

Evaluation and validation of housekeeping genes as reference for gene expression studies in pigeonpea (Cajanus cajan) under drought stress conditions.

PubMed

Sinha, Pallavi; Singh, Vikas K; Suryanarayana, V; Krishnamurthy, L; Saxena, Rachit K; Varshney, Rajeev K

2015-01-01

Gene expression analysis using quantitative real-time PCR (qRT-PCR) is a very sensitive technique and its sensitivity depends on the stable performance of reference gene(s) used in the study. A number of housekeeping genes have been used in various expression studies in many crops however, their expression were found to be inconsistent under different stress conditions. As a result, species specific housekeeping genes have been recommended for different expression studies in several crop species. However, such specific housekeeping genes have not been reported in the case of pigeonpea (Cajanus cajan) despite the fact that genome sequence has become available for the crop. To identify the stable housekeeping genes in pigeonpea for expression analysis under drought stress conditions, the relative expression variations of 10 commonly used housekeeping genes (EF1α, UBQ10, GAPDH, 18SrRNA, 25SrRNA, TUB6, ACT1, IF4α, UBC and HSP90) were studied on root, stem and leaves tissues of Asha (ICPL 87119). Three statistical algorithms geNorm, NormFinder and BestKeeper were used to define the stability of candidate genes. geNorm analysis identified IF4α and TUB6 as the most stable housekeeping genes however, NormFinder analysis determined IF4α and HSP90 as the most stable housekeeping genes under drought stress conditions. Subsequently validation of the identified candidate genes was undertaken in qRT-PCR based gene expression analysis of uspA gene which plays an important role for drought stress conditions in pigeonpea. The relative quantification of the uspA gene varied according to the internal controls (stable and least stable genes), thus highlighting the importance of the choice of as well as validation of internal controls in such experiments. The identified stable and validated housekeeping genes will facilitate gene expression studies in pigeonpea especially under drought stress conditions.

Biodiversity of mannose-specific adhesion in Lactobacillus plantarum revisited: strain-specific domain composition of the mannose-adhesin.

PubMed

Gross, G; Snel, J; Boekhorst, J; Smits, M A; Kleerebezem, M

2010-03-01

Recently, we have identified the mannose-specific adhesin encoding gene (msa) of Lactobacillus plantarum. In the current study, structure and function of this potentially probiotic effector gene were further investigated, exploring genetic diversity of msa in L. plantarum in relation to mannose adhesion capacity. The results demonstrate that there is considerable variation in quantitative in vitro mannose adhesion capacity, which is paralleled by msa gene sequence variation. The msa genes of different L. plantarum strains encode proteins with variable domain composition. Construction of L. plantarum 299v mutant strains revealed that the msa gene product is the key-protein for mannose adhesion, also in a strain with high mannose adhering capacity. However, no straightforward correlation between adhesion capacity and domain composition of Msa in L. plantarum could be identified. Nevertheless, differences in Msa sequences in combination with variable genetic background of specific bacterial strains appears to determine mannose adhesion capacity and potentially affects probiotic properties. These findings exemplify the strain-specificity of probiotic characteristics and illustrate the need for careful and molecular selection of new candidate probiotics.

Integrated multi-cohort transcriptional meta-analysis of neurodegenerative diseases.

PubMed

Li, Matthew D; Burns, Terry C; Morgan, Alexander A; Khatri, Purvesh

2014-09-04

Neurodegenerative diseases share common pathologic features including neuroinflammation, mitochondrial dysfunction and protein aggregation, suggesting common underlying mechanisms of neurodegeneration. We undertook a meta-analysis of public gene expression data for neurodegenerative diseases to identify a common transcriptional signature of neurodegeneration. Using 1,270 post-mortem central nervous system tissue samples from 13 patient cohorts covering four neurodegenerative diseases, we identified 243 differentially expressed genes, which were similarly dysregulated in 15 additional patient cohorts of 205 samples including seven neurodegenerative diseases. This gene signature correlated with histologic disease severity. Metallothioneins featured prominently among differentially expressed genes, and functional pathway analysis identified specific convergent themes of dysregulation. MetaCore network analyses revealed various novel candidate hub genes (e.g. STAU2). Genes associated with M1-polarized macrophages and reactive astrocytes were strongly enriched in the meta-analysis data. Evaluation of genes enriched in neurons revealed 70 down-regulated genes, over half not previously associated with neurodegeneration. Comparison with aging brain data (3 patient cohorts, 221 samples) revealed 53 of these to be unique to neurodegenerative disease, many of which are strong candidates to be important in neuropathogenesis (e.g. NDN, NAP1L2). ENCODE ChIP-seq analysis predicted common upstream transcriptional regulators not associated with normal aging (REST, RBBP5, SIN3A, SP2, YY1, ZNF143, IKZF1). Finally, we removed genes common to neurodegeneration from disease-specific gene signatures, revealing uniquely robust immune response and JAK-STAT signaling in amyotrophic lateral sclerosis. Our results implicate pervasive bioenergetic deficits, M1-type microglial activation and gliosis as unifying themes of neurodegeneration, and identify numerous novel genes associated with neurodegenerative processes.

Deploying QTL-seq for rapid delineation of a potential candidate gene underlying major trait-associated QTL in chickpea

PubMed Central

Das, Shouvik; Upadhyaya, Hari D.; Bajaj, Deepak; Kujur, Alice; Badoni, Saurabh; Laxmi; Kumar, Vinod; Tripathi, Shailesh; Gowda, C. L. Laxmipathi; Sharma, Shivali; Singh, Sube; Tyagi, Akhilesh K.; Parida, Swarup K.

2015-01-01

A rapid high-resolution genome-wide strategy for molecular mapping of major QTL(s)/gene(s) regulating important agronomic traits is vital for in-depth dissection of complex quantitative traits and genetic enhancement in chickpea. The present study for the first time employed a NGS-based whole-genome QTL-seq strategy to identify one major genomic region harbouring a robust 100-seed weight QTL using an intra-specific 221 chickpea mapping population (desi cv. ICC 7184 × desi cv. ICC 15061). The QTL-seq-derived major SW QTL (CaqSW1.1) was further validated by single-nucleotide polymorphism (SNP) and simple sequence repeat (SSR) marker-based traditional QTL mapping (47.6% R2 at higher LOD >19). This reflects the reliability and efficacy of QTL-seq as a strategy for rapid genome-wide scanning and fine mapping of major trait regulatory QTLs in chickpea. The use of QTL-seq and classical QTL mapping in combination narrowed down the 1.37 Mb (comprising 177 genes) major SW QTL (CaqSW1.1) region into a 35 kb genomic interval on desi chickpea chromosome 1 containing six genes. One coding SNP (G/A)-carrying constitutive photomorphogenic9 (COP9) signalosome complex subunit 8 (CSN8) gene of these exhibited seed-specific expression, including pronounced differential up-/down-regulation in low and high seed weight mapping parents and homozygous individuals during seed development. The coding SNP mined in this potential seed weight-governing candidate CSN8 gene was found to be present exclusively in all cultivated species/genotypes, but not in any wild species/genotypes of primary, secondary and tertiary gene pools. This indicates the effect of strong artificial and/or natural selection pressure on target SW locus during chickpea domestication. The proposed QTL-seq-driven integrated genome-wide strategy has potential to delineate major candidate gene(s) harbouring a robust trait regulatory QTL rapidly with optimal use of resources. This will further assist us to extrapolate the molecular mechanism underlying complex quantitative traits at a genome-wide scale leading to fast-paced marker-assisted genetic improvement in diverse crop plants, including chickpea. PMID:25922536

Dehydration induced transcriptomic responses in two Tibetan hulless barley (Hordeum vulgare var. nudum) accessions distinguished by drought tolerance.

PubMed

Liang, Junjun; Chen, Xin; Deng, Guangbing; Pan, Zhifen; Zhang, Haili; Li, Qiao; Yang, Kaijun; Long, Hai; Yu, Maoqun

2017-10-11

The harsh environment on the Qinghai-Tibetan Plateau gives Tibetan hulless barley (Hordeum vulgare var. nudum) great ability to resist adversities such as drought, salinity, and low temperature, and makes it a good subject for the analysis of drought tolerance mechanism. To elucidate the specific gene networks and pathways that contribute to its drought tolerance, and for identifying new candidate genes for breeding purposes, we performed a transcriptomic analysis using two accessions of Tibetan hulless barley, namely Z772 (drought-tolerant) and Z013 (drought-sensitive). There were more up-regulated genes of Z772 than Z013 under both mild (5439-VS-2604) and severe (7203-VS-3359) dehydration treatments. Under mild dehydration stress, the pathways exclusively enriched in drought-tolerance genotype Z772 included Protein processing in endoplasmic reticulum, tricarboxylic acid (TCA) cycle, Wax biosynthesis, and Spliceosome. Under severe dehydration stress, the pathways that were mainly enriched in Z772 included Carbon fixation in photosynthetic organisms, Pyruvate metabolism, Porphyrin and chlorophyll metabolism. The main differentially expressed genes (DEGs) in response to dehydration stress and genes whose expression was different between tolerant and sensitive genotypes were presented in this study, respectively. The candidate genes for drought tolerance were selected based on their expression patterns. The RNA-Seq data obtained in this study provided an initial overview on global gene expression patterns and networks that related to dehydration shock in Tibetan hulless barley. Furthermore, these data provided pathways and a targeted set of candidate genes that might be essential for deep analyzing the molecular mechanisms of plant tolerance to drought stress.

Scanning the genome for gene single nucleotide polymorphisms involved in adaptive population differentiation in white spruce

PubMed Central

Namroud, Marie-Claire; Beaulieu, Jean; Juge, Nicolas; Laroche, Jérôme; Bousquet, Jean

2008-01-01

Conifers are characterized by a large genome size and a rapid decay of linkage disequilibrium, most often within gene limits. Genome scans based on noncoding markers are less likely to detect molecular adaptation linked to genes in these species. In this study, we assessed the effectiveness of a genome-wide single nucleotide polymorphism (SNP) scan focused on expressed genes in detecting local adaptation in a conifer species. Samples were collected from six natural populations of white spruce (Picea glauca) moderately differentiated for several quantitative characters. A total of 534 SNPs representing 345 expressed genes were analysed. Genes potentially under natural selection were identified by estimating the differentiation in SNP frequencies among populations (FST) and identifying outliers, and by estimating local differentiation using a Bayesian approach. Both average expected heterozygosity and population differentiation estimates (HE = 0.270 and FST = 0.006) were comparable to those obtained with other genetic markers. Of all genes, 5.5% were identified as outliers with FST at the 95% confidence level, while 14% were identified as candidates for local adaptation with the Bayesian method. There was some overlap between the two gene sets. More than half of the candidate genes for local adaptation were specific to the warmest population, about 20% to the most arid population, and 15% to the coldest and most humid higher altitude population. These adaptive trends were consistent with the genes’ putative functions and the divergence in quantitative traits noted among the populations. The results suggest that an approach separating the locus and population effects is useful to identify genes potentially under selection. These candidates are worth exploring in more details at the physiological and ecological levels. PMID:18662225

A comprehensive approach to identify reliable reference gene candidates to investigate the link between alcoholism and endocrinology in Sprague-Dawley rats.

PubMed

Taki, Faten A; Abdel-Rahman, Abdel A; Zhang, Baohong

2014-01-01

Gender and hormonal differences are often correlated with alcohol dependence and related complications like addiction and breast cancer. Estrogen (E2) is an important sex hormone because it serves as a key protein involved in organism level signaling pathways. Alcoholism has been reported to affect estrogen receptor signaling; however, identifying the players involved in such multi-faceted syndrome is complex and requires an interdisciplinary approach. In many situations, preliminary investigations included a straight forward, yet informative biotechniques such as gene expression analyses using quantitative real time PCR (qRT-PCR). The validity of qRT-PCR-based conclusions is affected by the choice of reliable internal controls. With this in mind, we compiled a list of 15 commonly used housekeeping genes (HKGs) as potential reference gene candidates in rat biological models. A comprehensive comparison among 5 statistical approaches (geNorm, dCt method, NormFinder, BestKeeper, and RefFinder) was performed to identify the minimal number as well the most stable reference genes required for reliable normalization in experimental rat groups that comprised sham operated (SO), ovariectomized rats in the absence (OVX) or presence of E2 (OVXE2). These rat groups were subdivided into subgroups that received alcohol in liquid diet or isocalroic control liquid diet for 12 weeks. Our results showed that U87, 5S rRNA, GAPDH, and U5a were the most reliable gene candidates for reference genes in heart and brain tissue. However, different gene stability ranking was specific for each tissue input combination. The present preliminary findings highlight the variability in reference gene rankings across different experimental conditions and analytic methods and constitute a fundamental step for gene expression assays.

Genome Comparison of Human and Non-Human Malaria Parasites Reveals Species Subset-Specific Genes Potentially Linked to Human Disease

PubMed Central

Frech, Christian; Chen, Nansheng

2011-01-01

Genes underlying important phenotypic differences between Plasmodium species, the causative agents of malaria, are frequently found in only a subset of species and cluster at dynamically evolving subtelomeric regions of chromosomes. We hypothesized that chromosome-internal regions of Plasmodium genomes harbour additional species subset-specific genes that underlie differences in human pathogenicity, human-to-human transmissibility, and human virulence. We combined sequence similarity searches with synteny block analyses to identify species subset-specific genes in chromosome-internal regions of six published Plasmodium genomes, including Plasmodium falciparum, Plasmodium vivax, Plasmodium knowlesi, Plasmodium yoelii, Plasmodium berghei, and Plasmodium chabaudi. To improve comparative analysis, we first revised incorrectly annotated gene models using homology-based gene finders and examined putative subset-specific genes within syntenic contexts. Confirmed subset-specific genes were then analyzed for their role in biological pathways and examined for molecular functions using publicly available databases. We identified 16 genes that are well conserved in the three primate parasites but not found in rodent parasites, including three key enzymes of the thiamine (vitamin B1) biosynthesis pathway. Thirteen genes were found to be present in both human parasites but absent in the monkey parasite P. knowlesi, including genes specifically upregulated in sporozoites or gametocytes that could be linked to parasite transmission success between humans. Furthermore, we propose 15 chromosome-internal P. falciparum-specific genes as new candidate genes underlying increased human virulence and detected a currently uncharacterized cluster of P. vivax-specific genes on chromosome 6 likely involved in erythrocyte invasion. In conclusion, Plasmodium species harbour many chromosome-internal differences in the form of protein-coding genes, some of which are potentially linked to human disease and thus promising leads for future laboratory research. PMID:22215999

Allele specific expression analysis identifies regulatory variation associated with stress-related genes in the Mexican highland maize landrace Palomero Toluqueño

PubMed Central

González-Segovia, Eric; Ross-Ibarra, Jeffrey; Simpson, June K.

2017-01-01

Background Gene regulatory variation has been proposed to play an important role in the adaptation of plants to environmental stress. In the central highlands of Mexico, farmer selection has generated a unique group of maize landraces adapted to the challenges of the highland niche. In this study, gene expression in Mexican highland maize and a reference maize breeding line were compared to identify evidence of regulatory variation in stress-related genes. It was hypothesised that local adaptation in Mexican highland maize would be associated with a transcriptional signature observable even under benign conditions. Methods Allele specific expression analysis was performed using the seedling-leaf transcriptome of an F1 individual generated from the cross between the highland adapted Mexican landrace Palomero Toluqueño and the reference line B73, grown under benign conditions. Results were compared with a published dataset describing the transcriptional response of B73 seedlings to cold, heat, salt and UV treatments. Results A total of 2,386 genes were identified to show allele specific expression. Of these, 277 showed an expression difference between Palomero Toluqueño and B73 alleles under benign conditions that anticipated the response of B73 cold, heat, salt and/or UV treatments, and, as such, were considered to display a prior stress response. Prior stress response candidates included genes associated with plant hormone signaling and a number of transcription factors. Construction of a gene co-expression network revealed further signaling and stress-related genes to be among the potential targets of the transcription factors candidates. Discussion Prior activation of responses may represent the best strategy when stresses are severe but predictable. Expression differences observed here between Palomero Toluqueño and B73 alleles indicate the presence of cis-acting regulatory variation linked to stress-related genes in Palomero Toluqueño. Considered alongside gene annotation and population data, allele specific expression analysis of plants grown under benign conditions provides an attractive strategy to identify functional variation potentially linked to local adaptation. PMID:28852597

Genome-wide Discovery of Circular RNAs in the Leaf and Seedling Tissues of Arabidopsis Thaliana

PubMed Central

Dou, Yongchao; Li, Shengjun; Yang, Weilong; Liu, Kan; Du, Qian; Ren, Guodong; Yu, Bin; Zhang, Chi

2017-01-01

Background: Recently, identification and functional studies of circular RNAs, a type of non-coding RNAs arising from a ligation of 3’ and 5’ ends of a linear RNA molecule, were conducted in mammalian cells with the development of RNA-seq technology. Method: Since compared with animals, studies on circular RNAs in plants are less thorough, a genome-wide identification of circular RNA candidates in Arabidopsis was conducted with our own developed bioinformatics tool to several existing RNA-seq datasets specifically for non-coding RNAs. Results: A total of 164 circular RNA candidates were identified from RNA-seq data, and 4 circular RNA transcripts, including both exonic and intronic circular RNAs, were experimentally validated. Interestingly, our results show that circular RNA transcripts are enriched in the photosynthesis system for the leaf tissue and correlated to the higher expression levels of their parent genes. Sixteen out of all 40 genes that have circular RNA candidates are related to the photosynthesis system, and out of the total 146 exonic circular RNA candidates, 63 are found in chloroplast. PMID:29081691

Gene Expression by Mouse Inner Ear Hair Cells during Development

PubMed Central

Scheffer, Déborah I.; Shen, Jun

2015-01-01

Hair cells of the inner ear are essential for hearing and balance. As a consequence, pathogenic variants in genes specifically expressed in hair cells often cause hereditary deafness. Hair cells are few in number and not easily isolated from the adjacent supporting cells, so the biochemistry and molecular biology of hair cells can be difficult to study. To study gene expression in hair cells, we developed a protocol for hair cell isolation by FACS. With nearly pure hair cells and surrounding cells, from cochlea and utricle and from E16 to P7, we performed a comprehensive cell type-specific RNA-Seq study of gene expression during mouse inner ear development. Expression profiling revealed new hair cell genes with distinct expression patterns: some are specific for vestibular hair cells, others for cochlear hair cells, and some are expressed just before or after maturation of mechanosensitivity. We found that many of the known hereditary deafness genes are much more highly expressed in hair cells than surrounding cells, suggesting that genes preferentially expressed in hair cells are good candidates for unknown deafness genes. PMID:25904789

Candidate genes and molecular markers associated with heat tolerance in colonial Bentgrass.

PubMed

Jespersen, David; Belanger, Faith C; Huang, Bingru

2017-01-01

Elevated temperature is a major abiotic stress limiting the growth of cool-season grasses during the summer months. The objectives of this study were to determine the genetic variation in the expression patterns of selected genes involved in several major metabolic pathways regulating heat tolerance for two genotypes contrasting in heat tolerance to confirm their status as potential candidate genes, and to identify PCR-based markers associated with candidate genes related to heat tolerance in a colonial (Agrostis capillaris L.) x creeping bentgrass (Agrostis stolonifera L.) hybrid backcross population. Plants were subjected to heat stress in controlled-environmental growth chambers for phenotypic evaluation and determination of genetic variation in candidate gene expression. Molecular markers were developed for genes involved in protein degradation (cysteine protease), antioxidant defense (catalase and glutathione-S-transferase), energy metabolism (glyceraldehyde-3-phosphate dehydrogenase), cell expansion (expansin), and stress protection (heat shock proteins HSP26, HSP70, and HSP101). Kruskal-Wallis analysis, a commonly used non-parametric test used to compare population individuals with or without the gene marker, found the physiological traits of chlorophyll content, electrolyte leakage, normalized difference vegetative index, and turf quality were associated with all candidate gene markers with the exception of HSP101. Differential gene expression was frequently found for the tested candidate genes. The development of candidate gene markers for important heat tolerance genes may allow for the development of new cultivars with increased abiotic stress tolerance using marker-assisted selection.

Candidate genes and molecular markers associated with heat tolerance in colonial Bentgrass

PubMed Central

Jespersen, David; Belanger, Faith C.; Huang, Bingru

2017-01-01

Elevated temperature is a major abiotic stress limiting the growth of cool-season grasses during the summer months. The objectives of this study were to determine the genetic variation in the expression patterns of selected genes involved in several major metabolic pathways regulating heat tolerance for two genotypes contrasting in heat tolerance to confirm their status as potential candidate genes, and to identify PCR-based markers associated with candidate genes related to heat tolerance in a colonial (Agrostis capillaris L.) x creeping bentgrass (Agrostis stolonifera L.) hybrid backcross population. Plants were subjected to heat stress in controlled-environmental growth chambers for phenotypic evaluation and determination of genetic variation in candidate gene expression. Molecular markers were developed for genes involved in protein degradation (cysteine protease), antioxidant defense (catalase and glutathione-S-transferase), energy metabolism (glyceraldehyde-3-phosphate dehydrogenase), cell expansion (expansin), and stress protection (heat shock proteins HSP26, HSP70, and HSP101). Kruskal-Wallis analysis, a commonly used non-parametric test used to compare population individuals with or without the gene marker, found the physiological traits of chlorophyll content, electrolyte leakage, normalized difference vegetative index, and turf quality were associated with all candidate gene markers with the exception of HSP101. Differential gene expression was frequently found for the tested candidate genes. The development of candidate gene markers for important heat tolerance genes may allow for the development of new cultivars with increased abiotic stress tolerance using marker-assisted selection. PMID:28187136

Defining the proximal border of the Huntington disease candidate region by multipoint recombination analyses

DOE Office of Scientific and Technical Information (OSTI.GOV)

Skraastad, M.I.; De Rooij, K.E.; De Koning Gans, P.A.M.

1993-06-01

The candidate region for the Huntington disease (HD) gene has been narrowed down to a 2.2-Mb region between D4S10 and D4S98 on the short arm of chromosome 4. To map the HD gene within this candidate region 65 Dutch HD families were studied. In total 338 informative meioses were analyzed and 11 multiple informative crossovers were detected. Assuming a minimum number of recombinations and no double recombinations, the multiple informative crossovers are consistent with one specific genetic order for 12 loci: D4S10-(D4S81,D4S126)-D4S125-(D4S127,D4S95)-D4S43-(D4S115, D4S96, D4S111, D4S90, D4S141).This is in agreement with the known data derived from similar and other methods. Themore » loci between brackets could not be mapped relative to each other. In the family material, two informative three-point marker recombination events were detected in the proximal HD candidate region, which are also informative for HD. Both recombination events map the HD gene distal to D4S81 and most likely distal to D4S125, narrowing down the HD candidate region to a 1.7-Mb region between D4S125 and D4S98. 39 refs., 3 figs., 2 tabs.« less

Genome-wide association study identified genetic variations and candidate genes for plant architecture component traits in Chinese upland cotton.

PubMed

Su, Junji; Li, Libei; Zhang, Chi; Wang, Caixiang; Gu, Lijiao; Wang, Hantao; Wei, Hengling; Liu, Qibao; Huang, Long; Yu, Shuxun

2018-06-01

Thirty significant associations between 22 SNPs and five plant architecture component traits in Chinese upland cotton were identified via GWAS. Four peak SNP loci located on chromosome D03 were simultaneously associated with more plant architecture component traits. A candidate gene, Gh_D03G0922, might be responsible for plant height in upland cotton. A compact plant architecture is increasingly required for mechanized harvesting processes in China. Therefore, cotton plant architecture is an important trait, and its components, such as plant height, fruit branch length and fruit branch angle, affect the suitability of a cultivar for mechanized harvesting. To determine the genetic basis of cotton plant architecture, a genome-wide association study (GWAS) was performed using a panel composed of 355 accessions and 93,250 single nucleotide polymorphisms (SNPs) identified using the specific-locus amplified fragment sequencing method. Thirty significant associations between 22 SNPs and five plant architecture component traits were identified via GWAS. Most importantly, four peak SNP loci located on chromosome D03 were simultaneously associated with more plant architecture component traits, and these SNPs were harbored in one linkage disequilibrium block. Furthermore, 21 candidate genes for plant architecture were predicted in a 0.95-Mb region including the four peak SNPs. One of these genes (Gh_D03G0922) was near the significant SNP D03_31584163 (8.40 kb), and its Arabidopsis homologs contain MADS-box domains that might be involved in plant growth and development. qRT-PCR showed that the expression of Gh_D03G0922 was upregulated in the apical buds and young leaves of the short and compact cotton varieties, and virus-induced gene silencing (VIGS) proved that the silenced plants exhibited increased PH. These results indicate that Gh_D03G0922 is likely the candidate gene for PH in cotton. The genetic variations and candidate genes identified in this study lay a foundation for cultivating moderately short and compact varieties in future Chinese cotton-breeding programs.

Proposal for a new therapy for drug-resistant malaria using Plasmodium synthetic lethality inference.

PubMed

Lee, Sang Joon; Seo, Eunseok; Cho, Yonghyun

2013-12-01

Many antimalarial drugs kill malaria parasites, but antimalarial drug resistance (ADR) and toxicity to normal cells limit their usefulness. To solve this problem, we suggest a new therapy for drug-resistant malaria. The approach consists of data integration and inference through homology analysis of yeast-human-Plasmodium. If one gene of a Plasmodium synthetic lethal (SL) gene pair has a mutation that causes ADR, a drug targeting the other gene of the SL pair might be used as an effective treatment for drug-resistant strains of malaria. A simple computational tool to analyze the inferred SL genes of Plasmodium species (malaria parasites Plasmodium falciparum and Plasmodium vivax for human malarial therapy, and rodent parasite Plasmodium berghei for in vivo studies of human malarias) was established to identify SL genes that can be used as drug targets. Information on SL gene pairs with ADR genes and their first neighbors was inferred from yeast SL genes to search for pertinent antimalarial drug targets. We not only suggest drug target gene candidates for further experimental validation, but also provide information on new usage for already-described drugs. The proposed specific antimalarial drug candidates can be inferred by searching drugs that cause a fitness defect in yeast SL genes.

Optimization of HIV-1 Envelope DNA Vaccine Candidates within Three Different Animal Models, Guinea Pigs, Rabbits and Cynomolgus Macaques.

PubMed

Borggren, Marie; Vinner, Lasse; Andresen, Betina Skovgaard; Grevstad, Berit; Repits, Johanna; Melchers, Mark; Elvang, Tara Laura; Sanders, Rogier W; Martinon, Frédéric; Dereuddre-Bosquet, Nathalie; Bowles, Emma Joanne; Stewart-Jones, Guillaume; Biswas, Priscilla; Scarlatti, Gabriella; Jansson, Marianne; Heyndrickx, Leo; Grand, Roger Le; Fomsgaard, Anders

2013-07-19

HIV-1 DNA vaccines have many advantageous features. Evaluation of HIV-1 vaccine candidates often starts in small animal models before macaque and human trials. Here, we selected and optimized DNA vaccine candidates through systematic testing in rabbits for the induction of broadly neutralizing antibodies (bNAb). We compared three different animal models: guinea pigs, rabbits and cynomolgus macaques. Envelope genes from the prototype isolate HIV-1 Bx08 and two elite neutralizers were included. Codon-optimized genes, encoded secreted gp140 or membrane bound gp150, were modified for expression of stabilized soluble trimer gene products, and delivered individually or mixed. Specific IgG after repeated i.d. inoculations with electroporation confirmed in vivo expression and immunogenicity. Evaluations of rabbits and guinea pigs displayed similar results. The superior DNA construct in rabbits was a trivalent mix of non-modified codon-optimized gp140 envelope genes. Despite NAb responses with some potency and breadth in guinea pigs and rabbits, the DNA vaccinated macaques displayed less bNAb activity. It was concluded that a trivalent mix of non-modified gp140 genes from rationally selected clinical isolates was, in this study, the best option to induce high and broad NAb in the rabbit model, but this optimization does not directly translate into similar responses in cynomolgus macaques.

Optimization of HIV-1 Envelope DNA Vaccine Candidates within Three Different Animal Models, Guinea Pigs, Rabbits and Cynomolgus Macaques

PubMed Central

Borggren, Marie; Vinner, Lasse; Andresen, Betina Skovgaard; Grevstad, Berit; Repits, Johanna; Melchers, Mark; Elvang, Tara Laura; Sanders, Rogier W; Martinon, Frédéric; Dereuddre-Bosquet, Nathalie; Bowles, Emma Joanne; Stewart-Jones, Guillaume; Biswas, Priscilla; Scarlatti, Gabriella; Jansson, Marianne; Heyndrickx, Leo; Le Grand, Roger; Fomsgaard, Anders

2013-01-01

HIV-1 DNA vaccines have many advantageous features. Evaluation of HIV-1 vaccine candidates often starts in small animal models before macaque and human trials. Here, we selected and optimized DNA vaccine candidates through systematic testing in rabbits for the induction of broadly neutralizing antibodies (bNAb). We compared three different animal models: guinea pigs, rabbits and cynomolgus macaques. Envelope genes from the prototype isolate HIV-1 Bx08 and two elite neutralizers were included. Codon-optimized genes, encoded secreted gp140 or membrane bound gp150, were modified for expression of stabilized soluble trimer gene products, and delivered individually or mixed. Specific IgG after repeated i.d. inoculations with electroporation confirmed in vivo expression and immunogenicity. Evaluations of rabbits and guinea pigs displayed similar results. The superior DNA construct in rabbits was a trivalent mix of non-modified codon-optimized gp140 envelope genes. Despite NAb responses with some potency and breadth in guinea pigs and rabbits, the DNA vaccinated macaques displayed less bNAb activity. It was concluded that a trivalent mix of non-modified gp140 genes from rationally selected clinical isolates was, in this study, the best option to induce high and broad NAb in the rabbit model, but this optimization does not directly translate into similar responses in cynomolgus macaques. PMID:26344115

Analysis of the QTL for sleep homeostasis in mice: Homer1a is a likely candidate.

PubMed

Mackiewicz, M; Paigen, B; Naidoo, N; Pack, A I

2008-03-14

Electroencephalographic oscillations in the frequency range of 0.5-4 Hz, characteristic of slow-wave sleep (SWS), are often referred to as the delta oscillation or delta power. Delta power reflects sleep intensity and correlates with the homeostatic response to sleep loss. A published survey of inbred strains of mice demonstrated that the time course of accumulation of delta power varied among inbred strains, and the segregation of the rebound of delta power in BxD recombinant inbred strains identified a genomic region on chromosome 13 referred to as the delta power in SWS (or Dps1). The quantitative trait locus (QTL) contains genes that modify the accumulation of delta power after sleep deprivation. Here, we narrow the QTL using interval-specific haplotype analysis and present a comprehensive annotation of the remaining genes in the Dps1 region with sequence comparisons to identify polymorphisms within the coding and regulatory regions. We established the expression pattern of selected genes located in the Dps1 interval in sleep and wakefulness in B6 and D2 parental strains. Taken together, these steps reduced the number of potential candidate genes that may underlie the accumulation of delta power after sleep deprivation and explain the Dps1 QTL. The strongest candidate gene is Homer1a, which is supported by expression differences between sleep and wakefulness and the SNP polymorphism in the upstream regulatory regions.

Many human accelerated regions are developmental enhancers

PubMed Central

Capra, John A.; Erwin, Genevieve D.; McKinsey, Gabriel; Rubenstein, John L. R.; Pollard, Katherine S.

2013-01-01

The genetic changes underlying the dramatic differences in form and function between humans and other primates are largely unknown, although it is clear that gene regulatory changes play an important role. To identify regulatory sequences with potentially human-specific functions, we and others used comparative genomics to find non-coding regions conserved across mammals that have acquired many sequence changes in humans since divergence from chimpanzees. These regions are good candidates for performing human-specific regulatory functions. Here, we analysed the DNA sequence, evolutionary history, histone modifications, chromatin state and transcription factor (TF) binding sites of a combined set of 2649 non-coding human accelerated regions (ncHARs) and predicted that at least 30% of them function as developmental enhancers. We prioritized the predicted ncHAR enhancers using analysis of TF binding site gain and loss, along with the functional annotations and expression patterns of nearby genes. We then tested both the human and chimpanzee sequence for 29 ncHARs in transgenic mice, and found 24 novel developmental enhancers active in both species, 17 of which had very consistent patterns of activity in specific embryonic tissues. Of these ncHAR enhancers, five drove expression patterns suggestive of different activity for the human and chimpanzee sequence at embryonic day 11.5. The changes to human non-coding DNA in these ncHAR enhancers may modify the complex patterns of gene expression necessary for proper development in a human-specific manner and are thus promising candidates for understanding the genetic basis of human-specific biology. PMID:24218637

Racial Differences in DNA-Methylation of CpG Sites Within Preterm-Promoting Genes and Gene Variants.

PubMed

Salihu, H M; Das, R; Morton, L; Huang, H; Paothong, A; Wilson, R E; Aliyu, M H; Salemi, J L; Marty, P J

2016-08-01

Objective To evaluate the role DNA methylation may play in genes associated with preterm birth for higher rates of preterm births in African-American women. Methods Fetal cord blood samples from births collected at delivery and maternal demographic and medical information were used in a cross-sectional study to examine fetal DNA methylation of genes implicated in preterm birth among black and non-black infants. Allele-specific DNA methylation analysis was performed using a methylation bead array. Targeted maximum likelihood estimation was applied to examine the relationship between race and fetal DNA methylation of candidate preterm birth genes. Receiver-operating characteristic analyses were then conducted to validate the CpG site methylation marker within the two racial groups. Bootstrapping, a method of validation and replication, was employed. Results 42 CpG sites were screened within 20 candidate gene variants reported consistently in the literature as being associated with preterm birth. Of these, three CpG sites on TNFAIP8 and PON1 genes (corresponding to: cg23917399; cg07086380; and cg07404485, respectively) were significantly differentially methylated between black and non-black individuals. The three CpG sites showed lower methylation status among infants of black women. Bootstrapping validated and replicated results. Conclusion for Practice Our study identified significant differences in levels of methylation on specific genes between black and non-black individuals. Understanding the genetic/epigenetic mechanisms that lead to preterm birth may lead to enhanced prevention strategies to reduce morbidity and mortality by eventually providing a means to identify individuals with a genetic predisposition to preterm labor.

A small number of candidate gene SNPs reveal continental ancestry in African Americans

PubMed Central

KODAMAN, NURI; ALDRICH, MELINDA C.; SMITH, JEFFREY R.; SIGNORELLO, LISA B.; BRADLEY, KEVIN; BREYER, JOAN; COHEN, SARAH S.; LONG, JIRONG; CAI, QIUYIN; GILES, JUSTIN; BUSH, WILLIAM S.; BLOT, WILLIAM J.; MATTHEWS, CHARLES E.; WILLIAMS, SCOTT M.

2013-01-01

SUMMARY Using genetic data from an obesity candidate gene study of self-reported African Americans and European Americans, we investigated the number of Ancestry Informative Markers (AIMs) and candidate gene SNPs necessary to infer continental ancestry. Proportions of African and European ancestry were assessed with STRUCTURE (K=2), using 276 AIMs. These reference values were compared to estimates derived using 120, 60, 30, and 15 SNP subsets randomly chosen from the 276 AIMs and from 1144 SNPs in 44 candidate genes. All subsets generated estimates of ancestry consistent with the reference estimates, with mean correlations greater than 0.99 for all subsets of AIMs, and mean correlations of 0.99±0.003; 0.98± 0.01; 0.93±0.03; and 0.81± 0.11 for subsets of 120, 60, 30, and 15 candidate gene SNPs, respectively. Among African Americans, the median absolute difference from reference African ancestry values ranged from 0.01 to 0.03 for the four AIMs subsets and from 0.03 to 0.09 for the four candidate gene SNP subsets. Furthermore, YRI/CEU Fst values provided a metric to predict the performance of candidate gene SNPs. Our results demonstrate that a small number of SNPs randomly selected from candidate genes can be used to estimate admixture proportions in African Americans reliably. PMID:23278390

Genome-wide association study discovered candidate genes of Verticillium wilt resistance in upland cotton (Gossypium hirsutum L.).

PubMed

Li, Tinggang; Ma, Xuefeng; Li, Nanyang; Zhou, Lei; Liu, Zheng; Han, Huanyong; Gui, Yuejing; Bao, Yuming; Chen, Jieyin; Dai, Xiaofeng

2017-12-01

Verticillium wilt (VW), caused by infection by Verticillium dahliae, is considered one of the most yield-limiting diseases in cotton. To examine the genetic architecture of cotton VW resistance, we performed a genome-wide association study (GWAS) using a panel of 299 accessions and 85 630 single nucleotide polymorphisms (SNPs) detected using the specific-locus amplified fragment sequencing (SLAF-seq) approach. Trait-SNP association analysis detected a total of 17 significant SNPs at P < 1.17 × 10 -5 (P = 1/85 630, -log 10 P = 4.93); the peaks of SNPs associated with VW resistance on A10 were continuous and common in three environments (RDIG2015, RDIF2015 and RDIF2016). Haplotype block structure analysis predicted 22 candidate genes for VW resistance based on A10_99672586 with a minimum P-value (-log 10 P = 6.21). One of these genes (CG02) was near the significant SNP A10_99672586 (0.26 Mb), located in a 372-kb haplotype block, and its Arabidopsis AT3G25510 homologues contain TIR-NBS-LRR domains that may be involved in disease resistance response. Real-time quantitative PCR and virus-induced gene silencing (VIGS) analysis showed that CG02 was specific to up-regulation in the resistant (R) genotype Zhongzhimian2 (ZZM2) and that silenced plants were more susceptible to V. dahliae. These results indicate that CG02 is likely the candidate gene for resistance against V. dahliae in cotton. The identified locus or gene may serve as a promising target for genetic engineering and selection for improving resistance to VW in cotton. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Systems genetics: a paradigm to improve discovery of candidate genes and mechanisms underlying complex traits.

PubMed

Feltus, F Alex

2014-06-01

Understanding the control of any trait optimally requires the detection of causal genes, gene interaction, and mechanism of action to discover and model the biochemical pathways underlying the expressed phenotype. Functional genomics techniques, including RNA expression profiling via microarray and high-throughput DNA sequencing, allow for the precise genome localization of biological information. Powerful genetic approaches, including quantitative trait locus (QTL) and genome-wide association study mapping, link phenotype with genome positions, yet genetics is less precise in localizing the relevant mechanistic information encoded in DNA. The coupling of salient functional genomic signals with genetically mapped positions is an appealing approach to discover meaningful gene-phenotype relationships. Techniques used to define this genetic-genomic convergence comprise the field of systems genetics. This short review will address an application of systems genetics where RNA profiles are associated with genetically mapped genome positions of individual genes (eQTL mapping) or as gene sets (co-expression network modules). Both approaches can be applied for knowledge independent selection of candidate genes (and possible control mechanisms) underlying complex traits where multiple, likely unlinked, genomic regions might control specific complex traits. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Identification and Evolutionary Analysis of Potential Candidate Genes in a Human Eating Disorder.

PubMed

Sabbagh, Ubadah; Mullegama, Saman; Wyckoff, Gerald J

2016-01-01

The purpose of this study was to find genes linked with eating disorders and associated with both metabolic and neural systems. Our operating hypothesis was that there are genetic factors underlying some eating disorders resting in both those pathways. Specifically, we are interested in disorders that may rest in both sleep and metabolic function, generally called Night Eating Syndrome (NES). A meta-analysis of the Gene Expression Omnibus targeting the mammalian nervous system, sleep, and obesity studies was performed, yielding numerous genes of interest. Through a text-based analysis of the results, a number of potential candidate genes were identified. VGF, in particular, appeared to be relevant both to obesity and, broadly, to brain or neural development. VGF is a highly connected protein that interacts with numerous targets via proteolytically digested peptides. We examined VGF from an evolutionary perspective to determine whether other available evidence supported a role for the gene in human disease. We conclude that some of the already identified variants in VGF from human polymorphism studies may contribute to eating disorders and obesity. Our data suggest that there is enough evidence to warrant eGWAS and GWAS analysis of these genes in NES patients in a case-control study.

Genetic Mapping of Fixed Phenotypes: Disease Frequency as a Breed Characteristic

PubMed Central

Jones, Paul; Martin, Alan; Ostrander, Elaine A.; Lark, Karl G.

2009-01-01

Traits that have been stringently selected to conform to specific criteria in a closed population are phenotypic stereotypes. In dogs, Canis familiaris, such stereotypes have been produced by breeding for conformation, performance (behaviors), etc. We measured phenotypes on a representative sample to establish breed stereotypes. DNA samples from 147 dog breeds were used to characterize single nucleotide polymorphism allele frequencies for association mapping of breed stereotypes. We identified significant size loci (quantitative trait loci [QTLs]), implicating candidate genes appropriate to regulation of size (e.g., IGF1, IGF2BP2 SMAD2, etc.). Analysis of other morphological stereotypes, also under extreme selection, identified many additional significant loci. Behavioral loci for herding, pointing, and boldness implicated candidate genes appropriate to behavior (e.g., MC2R, DRD1, and PCDH9). Significant loci for longevity, a breed characteristic inversely correlated with breed size, were identified. The power of this approach to identify loci regulating the incidence of specific polygenic diseases is demonstrated by the association of a specific IGF1 haplotype with hip dysplasia, patella luxation, and pacreatitis. PMID:19321632

Genetic mapping of fixed phenotypes: disease frequency as a breed characteristic.

PubMed

Chase, Kevin; Jones, Paul; Martin, Alan; Ostrander, Elaine A; Lark, Karl G

2009-01-01

Traits that have been stringently selected to conform to specific criteria in a closed population are phenotypic stereotypes. In dogs, Canis familiaris, such stereotypes have been produced by breeding for conformation, performance (behaviors), etc. We measured phenotypes on a representative sample to establish breed stereotypes. DNA samples from 147 dog breeds were used to characterize single nucleotide polymorphism allele frequencies for association mapping of breed stereotypes. We identified significant size loci (quantitative trait loci [QTLs]), implicating candidate genes appropriate to regulation of size (e.g., IGF1, IGF2BP2 SMAD2, etc.). Analysis of other morphological stereotypes, also under extreme selection, identified many additional significant loci. Behavioral loci for herding, pointing, and boldness implicated candidate genes appropriate to behavior (e.g., MC2R, DRD1, and PCDH9). Significant loci for longevity, a breed characteristic inversely correlated with breed size, were identified. The power of this approach to identify loci regulating the incidence of specific polygenic diseases is demonstrated by the association of a specific IGF1 haplotype with hip dysplasia, patella luxation, and pancreatitis.

Isolation and identification of new pollen-specific SFB genes in Japanese apricot (Prunus mume).

PubMed

Wang, P P; Gao, Z H; Ni, Z J; Zhuang, W B; Zhang, Z

2013-09-03

SFB, a candidate gene for the pollen S gene, has been identified in several species of Prunus (Rosaceae). We isolated 5 new SFB alleles from 6 Japanese apricot (Prunus mume) lines using a specific Prunus SFB primer pair (SFB-C1F and Pm-Vb), which was designed from conserved regions of Prunus SFB. The nucleotide sequences of these SFB genes were submitted to the GenBank database. The 5 new SFB alleles share typical structural features with SFB alleles from other Prunus species and were found to be polymorphic, with 67.08 to 96.91% amino acid identity. These new SFB alleles were specifically expressed in the pollen. We conclude that the PmSFB alleles that we identified are the pollen S determinants of Japanese apricot; they have potential as a tool for studies of the mechanisms of pollen self-incompatibility.

Genetic approaches to understanding post-traumatic stress disorder

PubMed Central

Almli, Lynn M.; Fani, Negar; Smith, Alicia K.; Ressler, Kerry J.

2015-01-01

Post-traumatic stress disorder (PTSD) is increasingly recognized as both a disorder of enormous mental health and societal burden, but also as an anxiety disorder that may be particularly understandable from a scientific perspective. Specifically, PTSD can be conceptualized as a disorder of fear and stress dysregulation, and the neural circuitry underlying these pathways in both animals and humans are becoming increasingly well understood. Furthermore, PTSD is the only disorder in psychiatry in which the initiating factor, the trauma exposure, can be identified. Thus, the pathophysiology of the fear and stress response underlying PTSD can be examined and potentially interrupted. Twin studies have shown that the development of PTSD following a trauma is heritable, and that genetic risk factors may account for up to 30–40% of this heritability. A current goal is to understand the gene pathways that are associated with PTSD, and how those genes act on the fear/stress circuitry to mediate risk vs. resilience for PTSD. This review will examine gene pathways that have recently been analysed, primarily through candidate gene studies (including neuroimaging studies of candidate genes), in addition to genome-wide associations and the epigenetic regulation of PTSD. Future and on-going studies are utilizing larger and collaborative cohorts to identify novel gene candidates through genome-wide association and other powerful genomic approaches. Identification of PTSD biological pathways strengthens the hope of progress in the mechanistic understanding of a model psychiatric disorder and allows for the development of targeted treatments and interventions. PMID:24103155

Confluence of genes, environment, development, and behavior in a post Genome-Wide Association Study world.

PubMed

Vrieze, Scott I; Iacono, William G; McGue, Matt

2012-11-01

This article serves to outline a research paradigm to investigate main effects and interactions of genes, environment, and development on behavior and psychiatric illness. We provide a historical context for candidate gene studies and genome-wide association studies, including benefits, limitations, and expected payoffs. Using substance use and abuse as our driving example, we then turn to the importance of etiological psychological theory in guiding genetic, environmental, and developmental research, as well as the utility of refined phenotypic measures, such as endophenotypes, in the pursuit of etiological understanding and focused tests of genetic and environmental associations. Phenotypic measurement has received considerable attention in the history of psychology and is informed by psychometrics, whereas the environment remains relatively poorly measured and is often confounded with genetic effects (i.e., gene-environment correlation). Genetically informed designs, which are no longer limited to twin and adoption studies thanks to ever-cheaper genotyping, are required to understand environmental influences. Finally, we outline the vast amount of individual difference in structural genomic variation, most of which remains to be leveraged in genetic association tests. Although the genetic data can be massive and burdensome (tens of millions of variants per person), we argue that improved understanding of genomic structure and function will provide investigators with new tools to test specific a priori hypotheses derived from etiological psychological theory, much like current candidate gene research but with less confusion and more payoff than candidate gene research has to date.

In Vitro Evaluation of Glycoengineered RSV-F in the Human Artificial Lymph Node Reactor.

PubMed

Radke, Lars; Sandig, Grit; Lubitz, Annika; Schließer, Ulrike; von Horsten, Hans Henning; Blanchard, Veronique; Keil, Karolin; Sandig, Volker; Giese, Christoph; Hummel, Michael; Hinderlich, Stephan; Frohme, Marcus

2017-08-15

Subunit vaccines often require adjuvants to elicit sustained immune activity. Here, a method is described to evaluate the efficacy of single vaccine candidates in the preclinical stage based on cytokine and gene expression analysis. As a model, the recombinant human respiratory syncytial virus (RSV) fusion protein (RSV-F) was produced in CHO cells. For comparison, wild-type and glycoengineered, afucosylated RSV-F were established. Both glycoprotein vaccines were tested in a commercial Human Artificial Lymph Node in vitro model (HuALN ® ). The analysis of six key cytokines in cell culture supernatants showed well-balanced immune responses for the afucosylated RSV-F, while immune response of wild-type RSV-F was more Th1 accentuated. In particular, stronger and specific secretion of interleukin-4 after each round of re-stimulation underlined higher potency and efficacy of the afucosylated vaccine candidate. Comprehensive gene expression analysis by nCounter gene expression assay confirmed the stronger onset of the immunologic reaction in stimulation experiments with the afucosylated vaccine in comparison to wild-type RSV-F and particularly revealed prominent activation of Th17 related genes, innate immunity, and comprehensive activation of humoral immunity. We, therefore, show that our method is suited to distinguish the potency of two vaccine candidates with minor structural differences.

Selection signatures in four lignin genes from switchgrass populations divergently selected for in vitro dry matter digestibility

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, Shiyu; Kaeppler, Shawn M.; Vogel, Kenneth P.

Switchgrass is undergoing development as a dedicated cellulosic bioenergy crop. Fermentation of lignocellulosic biomass to ethanol in a bioenergy system or to volatile fatty acids in a livestock production system is strongly and negatively influenced by lignification of cell walls. This study detects specific loci that exhibit selection signatures across switchgrass breeding populations that differ in in vitro dry matter digestibility (IVDMD), ethanol yield, and lignin concentration. Allele frequency changes in candidate genes were used to detect loci under selection. Out of the 183 polymorphisms identified in the four candidate genes, twenty-five loci in the intron regions and four locimore » in coding regions were found to display a selection signature. All loci in the coding regions are synonymous substitutions. Selection in both directions were observed on polymorphisms that appeared to be under selection. Genetic diversity and linkage disequilibrium within the candidate genes were low. The recurrent divergent selection caused excessive moderate allele frequencies in the cycle 3 reduced lignin population as compared to the base population. As a result, this study provides valuable insight on genetic changes occurring in short-term selection in the polyploid populations, and discovered potential markers for breeding switchgrass with improved biomass quality.« less

Selection signatures in four lignin genes from switchgrass populations divergently selected for in vitro dry matter digestibility

DOE PAGES

Chen, Shiyu; Kaeppler, Shawn M.; Vogel, Kenneth P.; ...

2016-11-28

Switchgrass is undergoing development as a dedicated cellulosic bioenergy crop. Fermentation of lignocellulosic biomass to ethanol in a bioenergy system or to volatile fatty acids in a livestock production system is strongly and negatively influenced by lignification of cell walls. This study detects specific loci that exhibit selection signatures across switchgrass breeding populations that differ in in vitro dry matter digestibility (IVDMD), ethanol yield, and lignin concentration. Allele frequency changes in candidate genes were used to detect loci under selection. Out of the 183 polymorphisms identified in the four candidate genes, twenty-five loci in the intron regions and four locimore » in coding regions were found to display a selection signature. All loci in the coding regions are synonymous substitutions. Selection in both directions were observed on polymorphisms that appeared to be under selection. Genetic diversity and linkage disequilibrium within the candidate genes were low. The recurrent divergent selection caused excessive moderate allele frequencies in the cycle 3 reduced lignin population as compared to the base population. As a result, this study provides valuable insight on genetic changes occurring in short-term selection in the polyploid populations, and discovered potential markers for breeding switchgrass with improved biomass quality.« less

Using Zebrafish to Test the Genetic Basis of Human Craniofacial Diseases.

PubMed

Machado, R Grecco; Eames, B Frank

2017-10-01

Genome-wide association studies (GWASs) opened an innovative and productive avenue to investigate the molecular basis of human craniofacial disease. However, GWASs identify candidate genes only; they do not prove that any particular one is the functional villain underlying disease or just an unlucky genomic bystander. Genetic manipulation of animal models is the best approach to reveal which genetic loci identified from human GWASs are functionally related to specific diseases. The purpose of this review is to discuss the potential of zebrafish to resolve which candidate genetic loci are mechanistic drivers of craniofacial diseases. Many anatomic, embryonic, and genetic features of craniofacial development are conserved among zebrafish and mammals, making zebrafish a good model of craniofacial diseases. Also, the ability to manipulate gene function in zebrafish was greatly expanded over the past 20 y, enabling systems such as Gateway Tol2 and CRISPR-Cas9 to test gain- and loss-of-function alleles identified from human GWASs in coding and noncoding regions of DNA. With the optimization of genetic editing methods, large numbers of candidate genes can be efficiently interrogated. Finding the functional villains that underlie diseases will permit new treatments and prevention strategies and will increase understanding of how gene pathways operate during normal development.

Comprehensive Identification of Meningococcal Genes and Small Noncoding RNAs Required for Host Cell Colonization

PubMed Central

Capel, Elena; Zomer, Aldert L.; Nussbaumer, Thomas; Bole, Christine; Izac, Brigitte; Frapy, Eric; Meyer, Julie; Bouzinba-Ségard, Haniaa; Bille, Emmanuelle; Jamet, Anne; Cavau, Anne; Letourneur, Franck; Bourdoulous, Sandrine; Rattei, Thomas; Coureuil, Mathieu

2016-01-01

ABSTRACT Neisseria meningitidis is a leading cause of bacterial meningitis and septicemia, affecting infants and adults worldwide. N. meningitidis is also a common inhabitant of the human nasopharynx and, as such, is highly adapted to its niche. During bacteremia, N. meningitidis gains access to the blood compartment, where it adheres to endothelial cells of blood vessels and causes dramatic vascular damage. Colonization of the nasopharyngeal niche and communication with the different human cell types is a major issue of the N. meningitidis life cycle that is poorly understood. Here, highly saturated random transposon insertion libraries of N. meningitidis were engineered, and the fitness of mutations during routine growth and that of colonization of endothelial and epithelial cells in a flow device were assessed in a transposon insertion site sequencing (Tn-seq) analysis. This allowed the identification of genes essential for bacterial growth and genes specifically required for host cell colonization. In addition, after having identified the small noncoding RNAs (sRNAs) located in intergenic regions, the phenotypes associated with mutations in those sRNAs were defined. A total of 383 genes and 8 intergenic regions containing sRNA candidates were identified to be essential for growth, while 288 genes and 33 intergenic regions containing sRNA candidates were found to be specifically required for host cell colonization. PMID:27486197

Search for sarcoidosis candidate genes by integration of data from genomic, transcriptomic and proteomic studies.

PubMed

Maver, Ales; Medica, Igor; Peterlin, Borut

2009-12-01

The search for gene candidates in multifactorial diseases such as sarcoidosis can be based on the integration of linkage association data, gene expression data, and protein profile data from genomic, transcriptomic and proteomic studies, respectively. In this study we performed a literature-based search for studies reporting such data, followed by integration of collected information. Different databases were examined--Medline, HugGE Navigator, ArrayExpress and Gene Expression Omnibus (GEO). Candidate genes were defined as genes which were reported in at least 2 different types of omics studies. Genes previously investigated in sarcoidosis were excluded from further analyses. We identified 177 genes associated with sarcoidosis as potential new candidate genes. Subsequently, 9 gene candidates identified to overlap in 2 different types of studies (genomic, transcriptomic and/or proteomic) were consistently reported in at least 3 studies: SERPINB1, FABP4, S100A8, HBEGF, IL7R, LRIG1, PTPN23, DPM2 and NUP214. These genes are involved in regulation of immune response, cellular proliferation, apoptosis, inhibition of protease activity, lipid metabolism. Exact biological functions of HBEGF, LRIG1, PTPN23, DPM2 and NUP214 remain to be completely elucidated. We propose 9 candidate genes: SERPINB1, FABP4, S100A8, HBEGF, IL7R, LRIG1, PTPN23, DPM2 and NUP214, as genes with high potential for association with sarcoidosis.

Improved Innate and Adaptive Immunostimulation by Genetically Modified HIV-1 Protein Expressing NYVAC Vectors

PubMed Central

Quakkelaar, Esther D.; Redeker, Anke; Haddad, Elias K.; Harari, Alexandre; McCaughey, Stella Mayo; Duhen, Thomas; Filali-Mouhim, Abdelali; Goulet, Jean-Philippe; Loof, Nikki M.; Ossendorp, Ferry; Perdiguero, Beatriz; Heinen, Paul; Gomez, Carmen E.; Kibler, Karen V.; Koelle, David M.; Sékaly, Rafick P.; Sallusto, Federica; Lanzavecchia, Antonio; Pantaleo, Giuseppe; Esteban, Mariano; Tartaglia, Jim; Jacobs, Bertram L.; Melief, Cornelis J. M.

2011-01-01

Attenuated poxviruses are safe and capable of expressing foreign antigens. Poxviruses are applied in veterinary vaccination and explored as candidate vaccines for humans. However, poxviruses express multiple genes encoding proteins that interfere with components of the innate and adaptive immune response. This manuscript describes two strategies aimed to improve the immunogenicity of the highly attenuated, host-range restricted poxvirus NYVAC: deletion of the viral gene encoding type-I interferon-binding protein and development of attenuated replication-competent NYVAC. We evaluated these newly generated NYVAC mutants, encoding HIV-1 env, gag, pol and nef, for their ability to stimulate HIV-specific CD8 T-cell responses in vitro from blood mononuclear cells of HIV-infected subjects. The new vectors were evaluated and compared to the parental NYVAC vector in dendritic cells (DCs), RNA expression arrays, HIV gag expression and cross-presentation assays in vitro. Deletion of type-I interferon-binding protein enhanced expression of interferon and interferon-induced genes in DCs, and increased maturation of infected DCs. Restoration of replication competence induced activation of pathways involving antigen processing and presentation. Also, replication-competent NYVAC showed increased Gag expression in infected cells, permitting enhanced cross-presentation to HIV-specific CD8 T cells and proliferation of HIV-specific memory CD8 T-cells in vitro. The recombinant NYVAC combining both modifications induced interferon-induced genes and genes involved in antigen processing and presentation, as well as increased Gag expression. This combined replication-competent NYVAC is a promising candidate for the next generation of HIV vaccines. PMID:21347234

Genomic Diversity of Burkholderia pseudomallei Clinical Isolates: Subtractive Hybridization Reveals a Burkholderia mallei-Specific Propage in B. pseudomallei 1026b

DTIC Science & Technology

2004-06-01

identification of several new virulence gene candidates. In particular, K96243 harbors multiple genomic islands with relatively low GC contents, suggesting...coli, Streptococcus pyogenes, Staphylococcus aureus, S. enterica, and Xylella fastidiosa (11, 16, 17). The genomic sequencing results for multiple... virulence genes by subtractive hybridization: identifica- tion of capsular polysaccharide of Burkholderia pseudomallei as a major virulence determinant

DNA methylation profiles distinguish different subtypes of gastroenteropancreatic neuroendocrine tumors.

PubMed

How-Kit, Alexandre; Dejeux, Emelyne; Dousset, Bertrand; Renault, Victor; Baudry, Marion; Terris, Benoit; Tost, Jörg

2015-01-01

Most studies have considered gastroenteropancreatic neuroendocrine tumors (GEP-NETs) as a homogenous group of samples or distinguish only gastrointestinal from pancreatic endocrine tumors. This article investigates if DNA methylation patterns could distinguish subtypes of GEP-NETs. The DNA methylation level of 807 cancer-related genes was investigated in insulinomas, gastrinomas, non-functioning pancreatic endocrine tumors and small intestine endocrine tumors. DNA methylation patterns were found to be tumor type specific for each of the pancreatic tumor subtypes and identified two distinct methylation-based groups in small intestine endocrine tumors. Differences of DNA methylation levels were validated by pyrosequencing for 20 candidate genes and correlated with differences at the transcriptional level for four candidate genes. The heterogeneity of DNA methylation patterns in the different subtypes of gastroenteropancreatic neuroendocrine tumors suggests different underlying pathways and, therefore, these tumors should be considered as distinct entities in molecular and clinical studies.

Systematic screening of isogenic cancer cells identifies DUSP6 as context-specific synthetic lethal target in melanoma

PubMed Central

Wittig-Blaich, Stephanie; Wittig, Rainer; Schmidt, Steffen; Lyer, Stefan; Bewerunge-Hudler, Melanie; Gronert-Sum, Sabine; Strobel-Freidekind, Olga; Müller, Carolin; List, Markus; Jaskot, Aleksandra; Christiansen, Helle; Hafner, Mathias; Schadendorf, Dirk; Block, Ines; Mollenhauer, Jan

2017-01-01

Next-generation sequencing has dramatically increased genome-wide profiling options and conceptually initiates the possibility for personalized cancer therapy. State-of-the-art sequencing studies yield large candidate gene sets comprising dozens or hundreds of mutated genes. However, few technologies are available for the systematic downstream evaluation of these results to identify novel starting points of future cancer therapies. We improved and extended a site-specific recombination-based system for systematic analysis of the individual functions of a large number of candidate genes. This was facilitated by a novel system for the construction of isogenic constitutive and inducible gain- and loss-of-function cell lines. Additionally, we demonstrate the construction of isogenic cell lines with combinations of the traits for advanced functional in vitro analyses. In a proof-of-concept experiment, a library of 108 isogenic melanoma cell lines was constructed and 8 genes were identified that significantly reduced viability in a discovery screen and in an independent validation screen. Here, we demonstrate the broad applicability of this recombination-based method and we proved its potential to identify new drug targets via the identification of the tumor suppressor DUSP6 as potential synthetic lethal target in melanoma cell lines with BRAF V600E mutations and high DUSP6 expression. PMID:28423600

Sequencing of a QTL-rich region of the Theobroma cacao genome using pooled BACs and the identification of trait specific candidate genes

USDA-ARS?s Scientific Manuscript database

Background: BAC-based physical maps provide for sequencing across an entire genome or selected sub-genome regions of biological interest. Using the minimum tiling path as a guide, it is possible to select specific BAC clones from prioritized genome sections such as a genetically defined QTL interv...

Transcriptional signature associated with early rheumatoid arthritis and healthy individuals at high risk to develop the disease

PubMed Central

Macías-Segura, N.; Bastian, Y.; Santiago-Algarra, D.; Castillo-Ortiz, J. D.; Alemán-Navarro, A. L.; Jaime-Sánchez, E.; Gomez-Moreno, M.; Saucedo-Toral, C. A.; Lara-Ramírez, Edgar E.; Zapata-Zuñiga, M.; Enciso-Moreno, L.; González-Amaro, R.; Ramos-Remus, C.; Enciso-Moreno, J. A.

2018-01-01

Background Little is known regarding the mechanisms underlying the loss of tolerance in the early and preclinical stages of autoimmune diseases. The aim of this work was to identify the transcriptional profile and signaling pathways associated to non-treated early rheumatoid arthritis (RA) and subjects at high risk. Several biomarker candidates for early RA are proposed. Methods Whole blood total RNA was obtained from non-treated early RA patients with <1 year of evolution as well as from healthy first-degree relatives of patients with RA (FDR) classified as ACCP+ and ACCP- according to their antibodies serum levels against cyclic citrullinated peptides. Complementary RNA (cRNA) was synthetized and hybridized to high-density microarrays. Data was analyzed in Genespring Software and functional categories were assigned to a specific transcriptome identified in subjects with RA and FDR ACCP positive. Specific signaling pathways for genes associated to RA were identified. Gene expression was evaluated by qPCR. Receiver operating characteristic (ROC) analysis was used to evaluate these genes as biomarkers. Results A characteristic transcriptome of 551 induced genes and 4,402 repressed genes were identified in early RA patients. Bioinformatics analysis of the data identified a specific transcriptome in RA patients. Moreover, some overlapped transcriptional profiles between patients with RA and ACCP+ were identified, suggesting an up-regulated distinctive transcriptome from the preclinical stages up to progression to an early RA state. A total of 203 pathways have up-regulated genes that are shared between RA and ACCP+. Some of these genes show potential to be used as progression biomarkers for early RA with area under the curve of ROC > 0.92. These genes come from several functional categories associated to inflammation, Wnt signaling and type I interferon pathways. Conclusion The presence of a specific transcriptome in whole blood of RA patients suggests the activation of a specific inflammatory transcriptional signature in early RA development. The set of overexpressed genes in early RA patients that are shared with ACCP+ subjects but not with ACCP- subjects, can represent a transcriptional signature involved with the transition of a preclinical to a clinical RA stage. Some of these particular up-regulated and down-regulated genes are related to inflammatory processes and could be considered as biomarker candidates for disease progression in subjects at risk to develop RA. PMID:29584756

Mapping QTLs for water-use efficiency reveals the potential candidate genes involved in regulating the trait in apple under drought stress.

PubMed

Wang, Haibo; Zhao, Shuang; Mao, Ke; Dong, Qinglong; Liang, Bowen; Li, Chao; Wei, Zhiwei; Li, Mingjun; Ma, Fengwang

2018-06-26

Improvement of water-use efficiency (WUE) can effectively reduce production losses caused by drought stress. A better understanding of the genetic determination of WUE in crops under drought stress has great potential value for developing cultivars adapted to arid regions. To identify the genetic loci associated with WUE and reveal genes responsible for the trait in apple, we aim to map the quantitative trait loci (QTLs) for carbon isotope composition, the proxy for WUE, applying two contrasting irrigating regimes over the two-year experiment and search for the candidate genes encompassed in the mapped QTLs. We constructed a high-density genetic linkage map with 10,172 markers of apple, using single nucleotide polymorphism (SNP) markers obtained through restriction site-associated DNA sequencing (RADseq) and a final segregating population of 350 seedlings from the cross of Honeycrisp and Qinguan. In total, 33 QTLs were identified for carbon isotope composition in apple under both well-watered and drought-stressed conditions. Three QTLs were stable over 2 years under drought stress on linkage groups LG8, LG15 and LG16, as validated by Kompetitive Allele-Specific PCR (KASP) assays. In those validated QTLs, 258 genes were screened according to their Gene Ontology functional annotations. Among them, 28 genes were identified, which exhibited significant responses to drought stress in 'Honeycrisp' and/or 'Qinguan'. These genes are involved in signaling, photosynthesis, response to stresses, carbohydrate metabolism, protein metabolism and modification, hormone metabolism and transport, transport, respiration, transcriptional regulation, and development regulation. They, especially those for photoprotection and relevant signal transduction, are potential candidate genes connected with WUE regulation in drought-stressed apple. We detected three stable QTLs for carbon isotope composition in apple under drought stress over 2 years, and validated them by KASP assay. Twenty-eight candidate genes encompassed in these QTLs were identified. These stable genetic loci and series of genes provided here serve as a foundation for further studies on marker-assisted selection of high WUE and regulatory mechanism of WUE in apple exposed to drought conditions, respectively.

Identifying the candidate genes involved in the calyx abscission process of 'Kuerlexiangli' (Pyrus sinkiangensis Yu) by digital transcript abundance measurements.

PubMed

Qi, Xiaoxiao; Wu, Jun; Wang, Lifen; Li, Leiting; Cao, Yufen; Tian, Luming; Dong, Xingguang; Zhang, Shaoling

2013-10-23

'Kuerlexiangli' (Pyrus sinkiangensis Yu), a native pear of Xinjiang, China, is an important agricultural fruit and primary export to the international market. However, fruit with persistent calyxes affect fruit shape and quality. Although several studies have looked into the physiological aspects of the calyx abscission process, the underlying molecular mechanisms remain unknown. In order to better understand the molecular basis of the process of calyx abscission, materials at three critical stages of regulation, with 6000 × Flusilazole plus 300 × PBO treatment (calyx abscising treatment) and 50 mg.L-1GA3 treatment (calyx persisting treatment), were collected and cDNA fragments were sequenced using digital transcript abundance measurements to identify candidate genes. Digital transcript abundance measurements was performed using high-throughput Illumina GAII sequencing on seven samples that were collected at three important stages of the calyx abscission process with chemical agent treatments promoting calyx abscission and persistence. Altogether more than 251,123,845 high quality reads were obtained with approximately 8.0 M raw data for each library. The values of 69.85%-71.90% of clean data in the digital transcript abundance measurements could be mapped to the pear genome database. There were 12,054 differentially expressed genes having Gene Ontology (GO) terms and associating with 251 Kyoto Encyclopedia of Genes and Genomes (KEGG) defined pathways. The differentially expressed genes correlated with calyx abscission were mainly involved in photosynthesis, plant hormone signal transduction, cell wall modification, transcriptional regulation, and carbohydrate metabolism. Furthermore, candidate calyx abscission-specific genes, e.g. Inflorescence deficient in abscission gene, were identified. Quantitative real-time PCR was used to confirm the digital transcript abundance measurements results. We identified candidate genes that showed highly dynamic changes in expression during the calyx abscission process. These genes are potential targets for future functional characterization and should be valuable for exploration of the mechanisms of calyx abscission, and eventually for developing methods based on small molecule application to induce calyx abscission in fruit production.

Sex-Specific Associations between Particulate Matter Exposure and Gene Expression in Independent Discovery and Validation Cohorts of Middle-Aged Men and Women

PubMed Central

Vrijens, Karen; Winckelmans, Ellen; Tsamou, Maria; Baeyens, Willy; De Boever, Patrick; Jennen, Danyel; de Kok, Theo M.; Den Hond, Elly; Lefebvre, Wouter; Plusquin, Michelle; Reynders, Hans; Schoeters, Greet; Van Larebeke, Nicolas; Vanpoucke, Charlotte; Kleinjans, Jos; Nawrot, Tim S.

2016-01-01

Background: Particulate matter (PM) exposure leads to premature death, mainly due to respiratory and cardiovascular diseases. Objectives: Identification of transcriptomic biomarkers of air pollution exposure and effect in a healthy adult population. Methods: Microarray analyses were performed in 98 healthy volunteers (48 men, 50 women). The expression of eight sex-specific candidate biomarker genes (significantly associated with PM10 in the discovery cohort and with a reported link to air pollution-related disease) was measured with qPCR in an independent validation cohort (75 men, 94 women). Pathway analysis was performed using Gene Set Enrichment Analysis. Average daily PM2.5 and PM10 exposures over 2-years were estimated for each participant’s residential address using spatiotemporal interpolation in combination with a dispersion model. Results: Average long-term PM10 was 25.9 (± 5.4) and 23.7 (± 2.3) μg/m3 in the discovery and validation cohorts, respectively. In discovery analysis, associations between PM10 and the expression of individual genes differed by sex. In the validation cohort, long-term PM10 was associated with the expression of DNAJB5 and EAPP in men and ARHGAP4 (p = 0.053) in women. AKAP6 and LIMK1 were significantly associated with PM10 in women, although associations differed in direction between the discovery and validation cohorts. Expression of the eight candidate genes in the discovery cohort differentiated between validation cohort participants with high versus low PM10 exposure (area under the receiver operating curve = 0.92; 95% CI: 0.85, 1.00; p = 0.0002 in men, 0.86; 95% CI: 0.76, 0.96; p = 0.004 in women). Conclusions: Expression of the sex-specific candidate genes identified in the discovery population predicted PM10 exposure in an independent cohort of adults from the same area. Confirmation in other populations may further support this as a new approach for exposure assessment, and may contribute to the discovery of molecular mechanisms for PM-induced health effects. Citation: Vrijens K, Winckelmans E, Tsamou M, Baeyens W, De Boever P, Jennen D, de Kok TM, Den Hond E, Lefebvre W, Plusquin M, Reynders H, Schoeters G, Van Larebeke N, Vanpoucke C, Kleinjans J, Nawrot TS. 2017. Sex-specific associations between particulate matter exposure and gene expression in independent discovery and validation cohorts of middle-aged men and women. Environ Health Perspect 125:660–669; http://dx.doi.org/10.1289/EHP370 PMID:27740511

Selection and Validation of Appropriate Reference Genes for qRT-PCR Analysis in Isatis indigotica Fort.

PubMed Central

Li, Tao; Wang, Jing; Lu, Miao; Zhang, Tianyi; Qu, Xinyun; Wang, Zhezhi

2017-01-01

Due to its sensitivity and specificity, real-time quantitative PCR (qRT-PCR) is a popular technique for investigating gene expression levels in plants. Based on the Minimum Information for Publication of Real-Time Quantitative PCR Experiments (MIQE) guidelines, it is necessary to select and validate putative appropriate reference genes for qRT-PCR normalization. In the current study, three algorithms, geNorm, NormFinder, and BestKeeper, were applied to assess the expression stability of 10 candidate reference genes across five different tissues and three different abiotic stresses in Isatis indigotica Fort. Additionally, the IiYUC6 gene associated with IAA biosynthesis was applied to validate the candidate reference genes. The analysis results of the geNorm, NormFinder, and BestKeeper algorithms indicated certain differences for the different sample sets and different experiment conditions. Considering all of the algorithms, PP2A-4 and TUB4 were recommended as the most stable reference genes for total and different tissue samples, respectively. Moreover, RPL15 and PP2A-4 were considered to be the most suitable reference genes for abiotic stress treatments. The obtained experimental results might contribute to improved accuracy and credibility for the expression levels of target genes by qRT-PCR normalization in I. indigotica. PMID:28702046

SZGR 2.0: a one-stop shop of schizophrenia candidate genes

PubMed Central

Jia, Peilin; Han, Guangchun; Zhao, Junfei; Lu, Pinyi; Zhao, Zhongming

2017-01-01

SZGR 2.0 is a comprehensive resource of candidate variants and genes for schizophrenia, covering genetic, epigenetic, transcriptomic, translational and many other types of evidence. By systematic review and curation of multiple lines of evidence, we included almost all variants and genes that have ever been reported to be associated with schizophrenia. In particular, we collected ∼4200 common variants reported in genome-wide association studies, ∼1000 de novo mutations discovered by large-scale sequencing of family samples, 215 genes spanning rare and replication copy number variations, 99 genes overlapping with linkage regions, 240 differentially expressed genes, 4651 differentially methylated genes and 49 genes as antipsychotic drug targets. To facilitate interpretation, we included various functional annotation data, especially brain eQTL, methylation QTL, brain expression featured in deep categorization of brain areas and developmental stages and brain-specific promoter and enhancer annotations. Furthermore, we conducted cross-study, cross-data type and integrative analyses of the multidimensional data deposited in SZGR 2.0, and made the data and results available through a user-friendly interface. In summary, SZGR 2.0 provides a one-stop shop of schizophrenia variants and genes and their function and regulation, providing an important resource in the schizophrenia and other mental disease community. SZGR 2.0 is available at https://bioinfo.uth.edu/SZGR/. PMID:27733502

Constitutional downregulation of SEMA5A expression in autism.

PubMed

Melin, M; Carlsson, B; Anckarsater, H; Rastam, M; Betancur, C; Isaksson, A; Gillberg, C; Dahl, N

2006-01-01

There is strong evidence for the importance of genetic factors in idiopathic autism. The results from independent twin and family studies suggest that the disorder is caused by the action of several genes, possibly acting epistatically. We have used cDNA microarray technology for the identification of constitutional changes in the gene expression profile associated with idiopathic autism. Samples were obtained and analyzed from 6 affected subjects belonging to multiplex autism families and from 6 healthy controls. We assessed the expression levels for approximately 7,700 genes by cDNA microarrays using mRNA derived from Epstein-Barr virus-transformed B lymphocytes. The microarray data were analyzed in order to identify up- or downregulation of specific genes. A common pattern with nine downregulated genes was identified among samples derived from individuals with autism when compared to controls. Four of these nine genes encode proteins involved in biological processes associated with brain function or the immune system, and are consequently considered as candidates for genes associated with autism. Quantitative real-time PCR confirms the downregulation of the gene encoding SEMA5A, a protein involved in axonal guidance. Epstein-Barr virus should be considered as a possible source for altered expression, but our consistent results make us suggest SEMA5A as a candidate gene in the etiology of idiopathic autism.

Constitutional downregulation of SEMA5A expression in autism

PubMed Central

Melin, Malin; Carlsson, Birgit; Anckarsäter, Henrik; Rastam, Maria; Betancur, Catalina; Isaksson, Anders; Gillberg, Christopher; Dahl, Niklas

2006-01-01

There is strong evidence for the importance of genetic factors in idiopathic autism. The results from independent twin and family studies suggest that the disorder is caused by the action of several genes, possibly acting epistatically. We have used cDNA microarray technology for the identification of constitutional changes in the gene expression profile associated with idiopathic autism. Samples were obtained and analyzed from six affected subjects belonging to multiplex autism families and from six healthy controls. We assessed the expression levels for approximately 7,700 genes by cDNA microarrays using mRNA derived from Epstein Barr virus (EBV)-transformed B-lymphocytes. The microarray data was analyzed in order to identify up- or down-regulation of specific genes. A common pattern with nine down-regulated genes was identified among samples derived from individuals with autism when compared to controls. Four of these nine genes encode proteins involved in biological processes associated with brain function or the immune system, and are consequently considered as candidates for genes associated with autism. Quantitative realtime PCR confirms the down-regulation of the gene encoding SEMA5A, a protein involved in axonal guidance. EBV should be considered as a possible source for altered expression but our consistent results make us suggest SEMA5A a candidate gene in the etiology of idiopathic autism. PMID:17028446

Identification of immunohistochemical markers for distinguishing lung adenocarcinoma from squamous cell carcinoma

PubMed Central

Zhan, Cheng; Yan, Li; Wang, Lin; Sun, Yang; Wang, Xingxing; Lin, Zongwu; Zhang, Yongxing; Wang, Qun

2015-01-01

Background Immunohistochemical staining has been widely used in distinguishing lung adenocarcinoma (LUAD) from lung squamous cell carcinoma (LUSC), which is of vital importance for the diagnosis and treatment of lung cancer. Due to the lack of a comprehensive analysis of different lung cancer subtypes, there may still be undiscovered markers with higher diagnostic accuracy. Methods Herein first, we systematically analyzed high-throughput data obtained from The Cancer Genome Atlas (TCGA) database. Combining differently expressed gene screening and receiver operating characteristic (ROC) curve analysis, we attempted to identify the genes which might be suitable as immunohistochemical markers in distinguishing LUAD from LUSC. Then we detected the expression of six of these genes (MLPH, TMC5, SFTA3, DSG3, DSC3 and CALML3) in lung cancer sections using immunohistochemical staining. Results A number of genes were identified as candidate immunohistochemical markers with high sensitivity and specificity in distinguishing LUAD from LUSC. Then the staining results confirmed the potentials of the six genes (MLPH, TMC5, SFTA3, DSG3, DSC3 and CALML3) in distinguishing LUAD from LUSC, and their sensitivity and specificity were not less than many commonly used markers. Conclusions The results revealed that the six genes (MLPH, TMC5, SFTA3, DSG3, DSC3 and CALML3) might be suitable markers in distinguishing LUAD from LUSC, and also validated the feasibility of our methods for identification of candidate markers from high-throughput data. PMID:26380766

Identification of gene-specific polymorphisms and association with capsaicin pathway metabolites in Capsicum annuum L. collections.

PubMed

Reddy, Umesh K; Almeida, Aldo; Abburi, Venkata L; Alaparthi, Suresh Babu; Unselt, Desiree; Hankins, Gerald; Park, Minkyu; Choi, Doil; Nimmakayala, Padma

2014-01-01

Pepper (Capsicum annuum L.) is an economically important crop with added nutritional value. Production of capsaicin is an important quantitative trait with high environmental variance, so the development of markers regulating capsaicinoid accumulation is important for pepper breeding programs. In this study, we performed association mapping at the gene level to identify single nucleotide polymorphisms (SNPs) associated with capsaicin pathway metabolites in a diverse Capsicum annuum collection during two seasons. The genes Pun1, CCR, KAS and HCT were sequenced and matched with the whole-genome sequence draft of pepper to identify SNP locations and for further characterization. The identified SNPs for each gene underwent candidate gene association mapping. Association mapping results revealed Pun1 as a key regulator of major metabolites in the capsaicin pathway mainly affecting capsaicinoids and precursors for acyl moieties of capsaicinoids. Six different SNPs in the promoter sequence of Pun1 were found associated with capsaicin in plants from both seasons. Our results support that CCR is an important control point for the flux of p-coumaric acid to specific biosynthesis pathways. KAS was found to regulate the major precursors for acyl moieties of capsaicinoids and may play a key role in capsaicinoid production. Candidate gene association mapping of Pun1 suggested that the accumulation of capsaicinoids depends on the expression of Pun1, as revealed by the most important associated SNPs found in the promoter region of Pun1.

Identification of Gene-Specific Polymorphisms and Association with Capsaicin Pathway Metabolites in Capsicum annuum L. Collections

PubMed Central

Abburi, Venkata L.; Alaparthi, Suresh Babu; Unselt, Desiree; Hankins, Gerald; Park, Minkyu; Choi, Doil

2014-01-01

Pepper (Capsicum annuum L.) is an economically important crop with added nutritional value. Production of capsaicin is an important quantitative trait with high environmental variance, so the development of markers regulating capsaicinoid accumulation is important for pepper breeding programs. In this study, we performed association mapping at the gene level to identify single nucleotide polymorphisms (SNPs) associated with capsaicin pathway metabolites in a diverse Capsicum annuum collection during two seasons. The genes Pun1, CCR, KAS and HCT were sequenced and matched with the whole-genome sequence draft of pepper to identify SNP locations and for further characterization. The identified SNPs for each gene underwent candidate gene association mapping. Association mapping results revealed Pun1 as a key regulator of major metabolites in the capsaicin pathway mainly affecting capsaicinoids and precursors for acyl moieties of capsaicinoids. Six different SNPs in the promoter sequence of Pun1 were found associated with capsaicin in plants from both seasons. Our results support that CCR is an important control point for the flux of p-coumaric acid to specific biosynthesis pathways. KAS was found to regulate the major precursors for acyl moieties of capsaicinoids and may play a key role in capsaicinoid production. Candidate gene association mapping of Pun1 suggested that the accumulation of capsaicinoids depends on the expression of Pun1, as revealed by the most important associated SNPs found in the promoter region of Pun1. PMID:24475113

Association of candidate genes with drought tolerance traits in diverse perennial ryegrass accessions

Treesearch

Xiaoqing Yu; Guihua Bai; Shuwei Liu; Na Luo; Ying Wang; Douglas S. Richmond; Paula M. Pijut; Scott A. Jackson; Jianming Yu; Yiwei Jiang

2013-01-01

Drought is a major environmental stress limiting growth of perennial grasses in temperate regions. Plant drought tolerance is a complex trait that is controlled by multiple genes. Candidate gene association mapping provides a powerful tool for dissection of complex traits. Candidate gene association mapping of drought tolerance traits was conducted in 192 diverse...

Genetics of alcoholism.

PubMed

Edenberg, Howard J; Foroud, Tatiana

2014-01-01

Multiple lines of evidence strongly indicate that genetic factors contribute to the risk for alcohol use disorders (AUD). There is substantial heterogeneity in AUD, which complicates studies seeking to identify specific genetic factors. To identify these genetic effects, several different alcohol-related phenotypes have been analyzed, including diagnosis and quantitative measures related to AUDs. Study designs have used candidate gene analyses, genetic linkage studies, genomewide association studies (GWAS), and analyses of rare variants. Two genes that encode enzymes of alcohol metabolism have the strongest effect on AUD: aldehyde dehydrogenase 2 and alcohol dehydrogenase 1B each has strongly protective variants that reduce risk, with odds ratios approximately 0.2-0.4. A number of other genes important in AUD have been identified and replicated, including GABRA2 and alcohol dehydrogenases 1B and 4. GWAS have identified additional candidates. Rare variants are likely also to play a role; studies of these are just beginning. A multifaceted approach to gene identification, targeting both rare and common variations and assembling much larger datasets for meta-analyses, is critical for identifying the key genes and pathways important in AUD. © 2014 Elsevier B.V. All rights reserved.

Allele Mining in Barley Genetic Resources Reveals Genes of Race-Non-Specific Powdery Mildew Resistance

PubMed Central

Spies, Annika; Korzun, Viktor; Bayles, Rosemary; Rajaraman, Jeyaraman; Himmelbach, Axel; Hedley, Pete E.; Schweizer, Patrick

2012-01-01

Race-non-specific, or quantitative, pathogen resistance is of high importance to plant breeders due to its expected durability. However, it is usually controlled by multiple quantitative trait loci (QTL) and therefore difficult to handle in practice. Knowing the genes that underlie race-non-specific resistance (NR) would allow its exploitation in a more targeted manner. Here, we performed an association-genetic study in a customized worldwide collection of spring barley accessions for candidate genes of race-NR to the powdery mildew fungus Blumeria graminis f. sp. hordei (Bgh) and combined data with results from QTL mapping as well as functional-genomics approaches. This led to the identification of 11 associated genes with converging evidence for an important role in race-NR in the presence of the Mlo gene for basal susceptibility. Outstanding in this respect was the gene encoding the transcription factor WRKY2. The results suggest that unlocking plant genetic resources and integrating functional-genomic with genetic approaches can accelerate the discovery of genes underlying race-NR in barley and other crop plants. PMID:22629270

Comparative genomics and prediction of conditionally dispensable sequences in legume-infecting Fusarium oxysporum formae speciales facilitates identification of candidate effectors.

PubMed

Williams, Angela H; Sharma, Mamta; Thatcher, Louise F; Azam, Sarwar; Hane, James K; Sperschneider, Jana; Kidd, Brendan N; Anderson, Jonathan P; Ghosh, Raju; Garg, Gagan; Lichtenzveig, Judith; Kistler, H Corby; Shea, Terrance; Young, Sarah; Buck, Sally-Anne G; Kamphuis, Lars G; Saxena, Rachit; Pande, Suresh; Ma, Li-Jun; Varshney, Rajeev K; Singh, Karam B

2016-03-05

Soil-borne fungi of the Fusarium oxysporum species complex cause devastating wilt disease on many crops including legumes that supply human dietary protein needs across many parts of the globe. We present and compare draft genome assemblies for three legume-infecting formae speciales (ff. spp.): F. oxysporum f. sp. ciceris (Foc-38-1) and f. sp. pisi (Fop-37622), significant pathogens of chickpea and pea respectively, the world's second and third most important grain legumes, and lastly f. sp. medicaginis (Fom-5190a) for which we developed a model legume pathosystem utilising Medicago truncatula. Focusing on the identification of pathogenicity gene content, we leveraged the reference genomes of Fusarium pathogens F. oxysporum f. sp. lycopersici (tomato-infecting) and F. solani (pea-infecting) and their well-characterised core and dispensable chromosomes to predict genomic organisation in the newly sequenced legume-infecting isolates. Dispensable chromosomes are not essential for growth and in Fusarium species are known to be enriched in host-specificity and pathogenicity-associated genes. Comparative genomics of the publicly available Fusarium species revealed differential patterns of sequence conservation across F. oxysporum formae speciales, with legume-pathogenic formae speciales not exhibiting greater sequence conservation between them relative to non-legume-infecting formae speciales, possibly indicating the lack of a common ancestral source for legume pathogenicity. Combining predicted dispensable gene content with in planta expression in the model legume-infecting isolate, we identified small conserved regions and candidate effectors, four of which shared greatest similarity to proteins from another legume-infecting ff. spp. We demonstrate that distinction of core and potential dispensable genomic regions of novel F. oxysporum genomes is an effective tool to facilitate effector discovery and the identification of gene content possibly linked to host specificity. While the legume-infecting isolates didn't share large genomic regions of pathogenicity-related content, smaller regions and candidate effector proteins were highly conserved, suggesting that they may play specific roles in inducing disease on legume hosts.

Integration of genome-wide association studies with biological knowledge identifies six novel genes related to kidney function.

PubMed

Chasman, Daniel I; Fuchsberger, Christian; Pattaro, Cristian; Teumer, Alexander; Böger, Carsten A; Endlich, Karlhans; Olden, Matthias; Chen, Ming-Huei; Tin, Adrienne; Taliun, Daniel; Li, Man; Gao, Xiaoyi; Gorski, Mathias; Yang, Qiong; Hundertmark, Claudia; Foster, Meredith C; O'Seaghdha, Conall M; Glazer, Nicole; Isaacs, Aaron; Liu, Ching-Ti; Smith, Albert V; O'Connell, Jeffrey R; Struchalin, Maksim; Tanaka, Toshiko; Li, Guo; Johnson, Andrew D; Gierman, Hinco J; Feitosa, Mary F; Hwang, Shih-Jen; Atkinson, Elizabeth J; Lohman, Kurt; Cornelis, Marilyn C; Johansson, Asa; Tönjes, Anke; Dehghan, Abbas; Lambert, Jean-Charles; Holliday, Elizabeth G; Sorice, Rossella; Kutalik, Zoltan; Lehtimäki, Terho; Esko, Tõnu; Deshmukh, Harshal; Ulivi, Sheila; Chu, Audrey Y; Murgia, Federico; Trompet, Stella; Imboden, Medea; Coassin, Stefan; Pistis, Giorgio; Harris, Tamara B; Launer, Lenore J; Aspelund, Thor; Eiriksdottir, Gudny; Mitchell, Braxton D; Boerwinkle, Eric; Schmidt, Helena; Cavalieri, Margherita; Rao, Madhumathi; Hu, Frank; Demirkan, Ayse; Oostra, Ben A; de Andrade, Mariza; Turner, Stephen T; Ding, Jingzhong; Andrews, Jeanette S; Freedman, Barry I; Giulianini, Franco; Koenig, Wolfgang; Illig, Thomas; Meisinger, Christa; Gieger, Christian; Zgaga, Lina; Zemunik, Tatijana; Boban, Mladen; Minelli, Cosetta; Wheeler, Heather E; Igl, Wilmar; Zaboli, Ghazal; Wild, Sarah H; Wright, Alan F; Campbell, Harry; Ellinghaus, David; Nöthlings, Ute; Jacobs, Gunnar; Biffar, Reiner; Ernst, Florian; Homuth, Georg; Kroemer, Heyo K; Nauck, Matthias; Stracke, Sylvia; Völker, Uwe; Völzke, Henry; Kovacs, Peter; Stumvoll, Michael; Mägi, Reedik; Hofman, Albert; Uitterlinden, Andre G; Rivadeneira, Fernando; Aulchenko, Yurii S; Polasek, Ozren; Hastie, Nick; Vitart, Veronique; Helmer, Catherine; Wang, Jie Jin; Stengel, Bénédicte; Ruggiero, Daniela; Bergmann, Sven; Kähönen, Mika; Viikari, Jorma; Nikopensius, Tiit; Province, Michael; Ketkar, Shamika; Colhoun, Helen; Doney, Alex; Robino, Antonietta; Krämer, Bernhard K; Portas, Laura; Ford, Ian; Buckley, Brendan M; Adam, Martin; Thun, Gian-Andri; Paulweber, Bernhard; Haun, Margot; Sala, Cinzia; Mitchell, Paul; Ciullo, Marina; Kim, Stuart K; Vollenweider, Peter; Raitakari, Olli; Metspalu, Andres; Palmer, Colin; Gasparini, Paolo; Pirastu, Mario; Jukema, J Wouter; Probst-Hensch, Nicole M; Kronenberg, Florian; Toniolo, Daniela; Gudnason, Vilmundur; Shuldiner, Alan R; Coresh, Josef; Schmidt, Reinhold; Ferrucci, Luigi; Siscovick, David S; van Duijn, Cornelia M; Borecki, Ingrid B; Kardia, Sharon L R; Liu, Yongmei; Curhan, Gary C; Rudan, Igor; Gyllensten, Ulf; Wilson, James F; Franke, Andre; Pramstaller, Peter P; Rettig, Rainer; Prokopenko, Inga; Witteman, Jacqueline; Hayward, Caroline; Ridker, Paul M; Parsa, Afshin; Bochud, Murielle; Heid, Iris M; Kao, W H Linda; Fox, Caroline S; Köttgen, Anna

2012-12-15

In conducting genome-wide association studies (GWAS), analytical approaches leveraging biological information may further understanding of the pathophysiology of clinical traits. To discover novel associations with estimated glomerular filtration rate (eGFR), a measure of kidney function, we developed a strategy for integrating prior biological knowledge into the existing GWAS data for eGFR from the CKDGen Consortium. Our strategy focuses on single nucleotide polymorphism (SNPs) in genes that are connected by functional evidence, determined by literature mining and gene ontology (GO) hierarchies, to genes near previously validated eGFR associations. It then requires association thresholds consistent with multiple testing, and finally evaluates novel candidates by independent replication. Among the samples of European ancestry, we identified a genome-wide significant SNP in FBXL20 (P = 5.6 × 10(-9)) in meta-analysis of all available data, and additional SNPs at the INHBC, LRP2, PLEKHA1, SLC3A2 and SLC7A6 genes meeting multiple-testing corrected significance for replication and overall P-values of 4.5 × 10(-4)-2.2 × 10(-7). Neither the novel PLEKHA1 nor FBXL20 associations, both further supported by association with eGFR among African Americans and with transcript abundance, would have been implicated by eGFR candidate gene approaches. LRP2, encoding the megalin receptor, was identified through connection with the previously known eGFR gene DAB2 and extends understanding of the megalin system in kidney function. These findings highlight integration of existing genome-wide association data with independent biological knowledge to uncover novel candidate eGFR associations, including candidates lacking known connections to kidney-specific pathways. The strategy may also be applicable to other clinical phenotypes, although more testing will be needed to assess its potential for discovery in general.

Integration of genome-wide association studies with biological knowledge identifies six novel genes related to kidney function

PubMed Central

Chasman, Daniel I.; Fuchsberger, Christian; Pattaro, Cristian; Teumer, Alexander; Böger, Carsten A.; Endlich, Karlhans; Olden, Matthias; Chen, Ming-Huei; Tin, Adrienne; Taliun, Daniel; Li, Man; Gao, Xiaoyi; Gorski, Mathias; Yang, Qiong; Hundertmark, Claudia; Foster, Meredith C.; O'Seaghdha, Conall M.; Glazer, Nicole; Isaacs, Aaron; Liu, Ching-Ti; Smith, Albert V.; O'Connell, Jeffrey R.; Struchalin, Maksim; Tanaka, Toshiko; Li, Guo; Johnson, Andrew D.; Gierman, Hinco J.; Feitosa, Mary F.; Hwang, Shih-Jen; Atkinson, Elizabeth J.; Lohman, Kurt; Cornelis, Marilyn C.; Johansson, Åsa; Tönjes, Anke; Dehghan, Abbas; Lambert, Jean-Charles; Holliday, Elizabeth G.; Sorice, Rossella; Kutalik, Zoltan; Lehtimäki, Terho; Esko, Tõnu; Deshmukh, Harshal; Ulivi, Sheila; Chu, Audrey Y.; Murgia, Federico; Trompet, Stella; Imboden, Medea; Coassin, Stefan; Pistis, Giorgio; Harris, Tamara B.; Launer, Lenore J.; Aspelund, Thor; Eiriksdottir, Gudny; Mitchell, Braxton D.; Boerwinkle, Eric; Schmidt, Helena; Cavalieri, Margherita; Rao, Madhumathi; Hu, Frank; Demirkan, Ayse; Oostra, Ben A.; de Andrade, Mariza; Turner, Stephen T.; Ding, Jingzhong; Andrews, Jeanette S.; Freedman, Barry I.; Giulianini, Franco; Koenig, Wolfgang; Illig, Thomas; Meisinger, Christa; Gieger, Christian; Zgaga, Lina; Zemunik, Tatijana; Boban, Mladen; Minelli, Cosetta; Wheeler, Heather E.; Igl, Wilmar; Zaboli, Ghazal; Wild, Sarah H.; Wright, Alan F.; Campbell, Harry; Ellinghaus, David; Nöthlings, Ute; Jacobs, Gunnar; Biffar, Reiner; Ernst, Florian; Homuth, Georg; Kroemer, Heyo K.; Nauck, Matthias; Stracke, Sylvia; Völker, Uwe; Völzke, Henry; Kovacs, Peter; Stumvoll, Michael; Mägi, Reedik; Hofman, Albert; Uitterlinden, Andre G.; Rivadeneira, Fernando; Aulchenko, Yurii S.; Polasek, Ozren; Hastie, Nick; Vitart, Veronique; Helmer, Catherine; Wang, Jie Jin; Stengel, Bénédicte; Ruggiero, Daniela; Bergmann, Sven; Kähönen, Mika; Viikari, Jorma; Nikopensius, Tiit; Province, Michael; Ketkar, Shamika; Colhoun, Helen; Doney, Alex; Robino, Antonietta; Krämer, Bernhard K.; Portas, Laura; Ford, Ian; Buckley, Brendan M.; Adam, Martin; Thun, Gian-Andri; Paulweber, Bernhard; Haun, Margot; Sala, Cinzia; Mitchell, Paul; Ciullo, Marina; Kim, Stuart K.; Vollenweider, Peter; Raitakari, Olli; Metspalu, Andres; Palmer, Colin; Gasparini, Paolo; Pirastu, Mario; Jukema, J. Wouter; Probst-Hensch, Nicole M.; Kronenberg, Florian; Toniolo, Daniela; Gudnason, Vilmundur; Shuldiner, Alan R.; Coresh, Josef; Schmidt, Reinhold; Ferrucci, Luigi; Siscovick, David S.; van Duijn, Cornelia M.; Borecki, Ingrid B.; Kardia, Sharon L.R.; Liu, Yongmei; Curhan, Gary C.; Rudan, Igor; Gyllensten, Ulf; Wilson, James F.; Franke, Andre; Pramstaller, Peter P.; Rettig, Rainer; Prokopenko, Inga; Witteman, Jacqueline; Hayward, Caroline; Ridker, Paul M; Parsa, Afshin; Bochud, Murielle; Heid, Iris M.; Kao, W.H. Linda; Fox, Caroline S.; Köttgen, Anna

2012-01-01

In conducting genome-wide association studies (GWAS), analytical approaches leveraging biological information may further understanding of the pathophysiology of clinical traits. To discover novel associations with estimated glomerular filtration rate (eGFR), a measure of kidney function, we developed a strategy for integrating prior biological knowledge into the existing GWAS data for eGFR from the CKDGen Consortium. Our strategy focuses on single nucleotide polymorphism (SNPs) in genes that are connected by functional evidence, determined by literature mining and gene ontology (GO) hierarchies, to genes near previously validated eGFR associations. It then requires association thresholds consistent with multiple testing, and finally evaluates novel candidates by independent replication. Among the samples of European ancestry, we identified a genome-wide significant SNP in FBXL20 (P = 5.6 × 10−9) in meta-analysis of all available data, and additional SNPs at the INHBC, LRP2, PLEKHA1, SLC3A2 and SLC7A6 genes meeting multiple-testing corrected significance for replication and overall P-values of 4.5 × 10−4–2.2 × 10−7. Neither the novel PLEKHA1 nor FBXL20 associations, both further supported by association with eGFR among African Americans and with transcript abundance, would have been implicated by eGFR candidate gene approaches. LRP2, encoding the megalin receptor, was identified through connection with the previously known eGFR gene DAB2 and extends understanding of the megalin system in kidney function. These findings highlight integration of existing genome-wide association data with independent biological knowledge to uncover novel candidate eGFR associations, including candidates lacking known connections to kidney-specific pathways. The strategy may also be applicable to other clinical phenotypes, although more testing will be needed to assess its potential for discovery in general. PMID:22962313

Gene expression factor analysis to differentiate pathways linked to fibromyalgia, chronic fatigue syndrome, and depression in a diverse patient sample

PubMed Central

Iacob, Eli; Light, Alan R.; Donaldson, Gary W.; Okifuji, Akiko; Hughen, Ronald W.; White, Andrea T.; Light, Kathleen C.

2015-01-01

Objective To determine if independent candidate genes can be grouped into meaningful biological factors and if these factors are associated with the diagnosis of chronic fatigue syndrome (CFS) and fibromyalgia (FMS) while controlling for co-morbid depression, sex, and age. Methods We included leukocyte mRNA gene expression from a total of 261 individuals including healthy controls (n=61), patients with FMS only (n=15), CFS only (n=33), co-morbid CFS and FMS (n=79), and medication-resistant (n=42) or medication-responsive (n=31) depression. We used Exploratory Factor Analysis (EFA) on 34 candidate genes to determine factor scores and regression analysis to examine if these factors were associated with specific diagnoses. Results EFA resulted in four independent factors with minimal overlap of genes between factors explaining 51% of the variance. We labeled these factors by function as: 1) Purinergic and cellular modulators; 2) Neuronal growth and immune function; 3) Nociception and stress mediators; 4) Energy and mitochondrial function. Regression analysis predicting these biological factors using FMS, CFS, depression severity, age, and sex revealed that greater expression in Factors 1 and 3 was positively associated with CFS and negatively associated with depression severity (QIDS score), but not associated with FMS. Conclusion Expression of candidate genes can be grouped into meaningful clusters, and CFS and depression are associated with the same 2 clusters but in opposite directions when controlling for co-morbid FMS. Given high co-morbid disease and interrelationships between biomarkers, EFA may help determine patient subgroups in this population based on gene expression. PMID:26097208

Sensitive and specific detection of early gastric cancer with DNA methylation analysis of gastric washes.

PubMed

Watanabe, Yoshiyuki; Kim, Hyun Soo; Castoro, Ryan J; Chung, Woonbok; Estecio, Marcos R H; Kondo, Kimie; Guo, Yi; Ahmed, Saira S; Toyota, Minoru; Itoh, Fumio; Suk, Ki Tae; Cho, Mee-Yon; Shen, Lanlan; Jelinek, Jaroslav; Issa, Jean-Pierre J

2009-06-01

Aberrant DNA methylation is an early and frequent process in gastric carcinogenesis and could be useful for detection of gastric neoplasia. We hypothesized that methylation analysis of DNA recovered from gastric washes could be used to detect gastric cancer. We studied 51 candidate genes in 7 gastric cancer cell lines and 24 samples (training set) and identified 6 for further studies. We examined the methylation status of these genes in a test set consisting of 131 gastric neoplasias at various stages. Finally, we validated the 6 candidate genes in a different population of 40 primary gastric cancer samples and 113 nonneoplastic gastric mucosa samples. Six genes (MINT25, RORA, GDNF, ADAM23, PRDM5, MLF1) showed frequent differential methylation between gastric cancer and normal mucosa in the training, test, and validation sets. GDNF and MINT25 were most sensitive molecular markers of early stage gastric cancer, whereas PRDM5 and MLF1 were markers of a field defect. There was a close correlation (r = 0.5-0.9, P = .03-.001) between methylation levels in tumor biopsy and gastric washes. MINT25 methylation had the best sensitivity (90%), specificity (96%), and area under the receiver operating characteristic curve (0.961) in terms of tumor detection in gastric washes. These findings suggest MINT25 is a sensitive and specific marker for screening in gastric cancer. Additionally, we have developed a new method for gastric cancer detection by DNA methylation in gastric washes.

Genetics of Obsessive-Compulsive Disorder and Related Disorders

PubMed Central

Browne, Heidi A.; Gair, Shannon L.; Scharf, Jeremiah M.; Grice, Dorothy E.

2014-01-01

Synopsis Twin and family studies support a significant genetic contribution to obsessive-compulsive disorder (OCD) and related disorders such as chronic tic disorders, trichotillomania, skin picking disorder, body dysmorphic disorder, and hoarding disorder. Recently, population-based studies and novel laboratory-based methods have confirmed substantial heritability in OCD. Genome-wide association studies and candidate gene association studies have provided information on specific genes that may be involved in the pathobiology of OCD and also of related disorders, particularly chronic tic disorders, though these genes each contribute only a small portion of the total genetic risk and a substantial portion of the specific genetic risk profile in OCD is still unknown. Nevertheless, there are some examples of genes for which perturbations produce OCD-like phenotypes in animal model systems, allowing a laboratory platform for investigating the pathobiology of --- and new treatments for --- OCD and related disorders. Future work promises to continue to clarify the specific genes involved in risk for OCD as well as their interaction with environmental variables. PMID:25150565

Identification of candidate genes for drought tolerance in coffee by high-throughput sequencing in the shoot apex of different Coffea arabica cultivars.

PubMed

Mofatto, Luciana Souto; Carneiro, Fernanda de Araújo; Vieira, Natalia Gomes; Duarte, Karoline Estefani; Vidal, Ramon Oliveira; Alekcevetch, Jean Carlos; Cotta, Michelle Guitton; Verdeil, Jean-Luc; Lapeyre-Montes, Fabienne; Lartaud, Marc; Leroy, Thierry; De Bellis, Fabien; Pot, David; Rodrigues, Gustavo Costa; Carazzolle, Marcelo Falsarella; Pereira, Gonçalo Amarante Guimarães; Andrade, Alan Carvalho; Marraccini, Pierre

2016-04-19

Drought is a widespread limiting factor in coffee plants. It affects plant development, fruit production, bean development and consequently beverage quality. Genetic diversity for drought tolerance exists within the coffee genus. However, the molecular mechanisms underlying the adaptation of coffee plants to drought are largely unknown. In this study, we compared the molecular responses to drought in two commercial cultivars (IAPAR59, drought-tolerant and Rubi, drought-susceptible) of Coffea arabica grown in the field under control (irrigation) and drought conditions using the pyrosequencing of RNA extracted from shoot apices and analysing the expression of 38 candidate genes. Pyrosequencing from shoot apices generated a total of 34.7 Mbp and 535,544 reads enabling the identification of 43,087 clusters (41,512 contigs and 1,575 singletons). These data included 17,719 clusters (16,238 contigs and 1,575 singletons) exclusively from 454 sequencing reads, along with 25,368 hybrid clusters assembled with 454 sequences. The comparison of DNA libraries identified new candidate genes (n = 20) presenting differential expression between IAPAR59 and Rubi and/or drought conditions. Their expression was monitored in plagiotropic buds, together with those of other (n = 18) candidates genes. Under drought conditions, up-regulated expression was observed in IAPAR59 but not in Rubi for CaSTK1 (protein kinase), CaSAMT1 (SAM-dependent methyltransferase), CaSLP1 (plant development) and CaMAS1 (ABA biosynthesis). Interestingly, the expression of lipid-transfer protein (nsLTP) genes was also highly up-regulated under drought conditions in IAPAR59. This may have been related to the thicker cuticle observed on the abaxial leaf surface in IAPAR59 compared to Rubi. The full transcriptome assembly of C. arabica, followed by functional annotation, enabled us to identify differentially expressed genes related to drought conditions. Using these data, candidate genes were selected and their differential expression profiles were confirmed by qPCR experiments in plagiotropic buds of IAPAR59 and Rubi under drought conditions. As regards the genes up-regulated under drought conditions, specifically in the drought-tolerant IAPAR59, several corresponded to orphan genes but also to genes coding proteins involved in signal transduction pathways, as well as ABA and lipid metabolism, for example. The identification of these genes should help advance our understanding of the genetic determinism of drought tolerance in coffee.

Gene expression profile during testicular development in patients with SRY-negative 46,XX testicular disorder of sex development.

PubMed

Mizuno, Kentaro; Kojima, Yoshiyuki; Kamisawa, Hideyuki; Moritoki, Yoshinobu; Nishio, Hidenori; Kohri, Kenjiro; Hayashi, Yutaro

2013-12-01

To elucidate alternative pathways in testicular development, we attempted to clarify the genetic characteristics of SRY-negative XX testes. We previously reported 5 cases of SRY-negative 46,XX testicular disorders of sex development and demonstrated that coordinated expression of genes such as SOX9, SOX3, and DAX1 was associated with testicular development. We performed a case-control study between the aforementioned boy with 46,XX testicular disorders of sex development and an age-matched patient with hydrocele testis (46,XY). During their consecutive surgeries, testicular biopsy specimens were obtained. Genes with differential expression compared with XY testis were identified using polymerase chain reaction (PCR)-based subtractive hybridization and sequencing. For validation of differential gene expression, real-time RT-PCR was performed using gene-specific primers. The distribution of candidate proteins in the testicular tissue was clarified by immunohistochemistry in human and rodent specimens. Moreover, in vitro inhibitory assays were performed. We identified 13 upregulated and 7 downregulated genes in XX testis. Among the candidate genes, we focused on ROCK1 (Rho-associated, coiled-coil protein kinase 1) in the upregulated gene group, because high expression in XX testis was validated by real-time RT-PCR. ROCK1 protein was detected in germ cells, Leydig cells, and Sertoli cells by immunohistochemistry. Moreover, the addition of specific ROCK1 inhibitor to Sertoli cells decreased SOX9 gene expression. On the basis of in vitro inhibitory assay, it is suggested that ROCK1 phosphorylates and activates SOX9 in Sertoli cells. Testes formation might be initiated by an alternative signaling pathway attributed to ROCK1, not SRY, activation in XX testes. Copyright © 2013 Elsevier Inc. All rights reserved.

Selection of reliable reference genes for RT-qPCR studies in Octopus vulgaris paralarvae during development and immune-stimulation.

PubMed

García-Fernández, P; Castellanos-Martínez, S; Iglesias, J; Otero, J J; Gestal, C

2016-07-01

The common octopus, Octopus vulgaris is a new candidate species for aquaculture. However, rearing of octopus paralarvae is hampered by high mortality and poor growth rates that impede its entire culture. The study of genes involved in the octopus development and immune response capability could help to understand the key of paralarvae survival and thus, to complete the octopus life cycle. Quantitative real-time PCR (RT-qPCR) is the most frequently tool used to quantify the gene expression because of specificity and sensitivity. However, reliability of RT-qPCR requires the selection of appropriate normalization genes whose expression must be stable across the different experimental conditions of the study. Hence, the aim of the present work is to evaluate the stability of six candidate genes: β-actin (ACT), elongation factor 1-α (EF), ubiquitin (UBI), β-tubulin (TUB), glyceraldehyde 3-phosphate dehydrogenase (GADPH) and ribosomal RNA 18 (18S) in order to select the best reference gene. The stability of gene expression was analyzed using geNorm, NormFinder and Bestkeeper, in octopus paralarvae of seven developmental stages (embryo, paralarvae of 0, 10, 15, 20, 30 and 34days) and paralarvae of 20days after challenge with Vibrio lentus and Vibrio splendidus. The results were validated by measuring the expression of PGRP, a stimuli-specific gene. Our results showed UBI, EF and 18S as the most suitable reference genes during development of octopus paralarvae, and UBI, ACT and 18S for bacterial infection. These results provide a basis for further studies exploring molecular mechanism of their development and innate immune defense. Copyright © 2016 Elsevier Inc. All rights reserved.

Evidence for somatic gene conversion and deletion in bipolar disorder, Crohn's disease, coronary artery disease, hypertension, rheumatoid arthritis, type-1 diabetes, and type-2 diabetes

PubMed Central

2011-01-01

Background During gene conversion, genetic information is transferred unidirectionally between highly homologous but non-allelic regions of DNA. While germ-line gene conversion has been implicated in the pathogenesis of some diseases, somatic gene conversion has remained technically difficult to investigate on a large scale. Methods A novel analysis technique is proposed for detecting the signature of somatic gene conversion from SNP microarray data. The Wellcome Trust Case Control Consortium has gathered SNP microarray data for two control populations and cohorts for bipolar disorder (BD), cardiovascular disease (CAD), Crohn's disease (CD), hypertension (HT), rheumatoid arthritis (RA), type-1 diabetes (T1D) and type-2 diabetes (T2D). Using the new analysis technique, the seven disease cohorts are analyzed to identify cohort-specific SNPs at which conversion is predicted. The quality of the predictions is assessed by identifying known disease associations for genes in the homologous duplicons, and comparing the frequency of such associations with background rates. Results Of 28 disease/locus pairs meeting stringent conditions, 22 show various degrees of disease association, compared with only 8 of 70 in a mock study designed to measure the background association rate (P < 10-9). Additional candidate genes are identified using less stringent filtering conditions. In some cases, somatic deletions appear likely. RA has a distinctive pattern of events relative to other diseases. Similarities in patterns are apparent between BD and HT. Conclusions The associations derived represent the first evidence that somatic gene conversion could be a significant causative factor in each of the seven diseases. The specific genes provide potential insights about disease mechanisms, and are strong candidates for further study. Please see Commentary: http://www.biomedcentral.com/1741-7015/9/13/abstract. PMID:21291537

Evidence for somatic gene conversion and deletion in bipolar disorder, Crohn's disease, coronary artery disease, hypertension, rheumatoid arthritis, type-1 diabetes, and type-2 diabetes.

PubMed

Ross, Kenneth Andrew

2011-02-03

During gene conversion, genetic information is transferred unidirectionally between highly homologous but non-allelic regions of DNA. While germ-line gene conversion has been implicated in the pathogenesis of some diseases, somatic gene conversion has remained technically difficult to investigate on a large scale. A novel analysis technique is proposed for detecting the signature of somatic gene conversion from SNP microarray data. The Wellcome Trust Case Control Consortium has gathered SNP microarray data for two control populations and cohorts for bipolar disorder (BD), cardiovascular disease (CAD), Crohn's disease (CD), hypertension (HT), rheumatoid arthritis (RA), type-1 diabetes (T1D) and type-2 diabetes (T2D). Using the new analysis technique, the seven disease cohorts are analyzed to identify cohort-specific SNPs at which conversion is predicted. The quality of the predictions is assessed by identifying known disease associations for genes in the homologous duplicons, and comparing the frequency of such associations with background rates. Of 28 disease/locus pairs meeting stringent conditions, 22 show various degrees of disease association, compared with only 8 of 70 in a mock study designed to measure the background association rate (P < 10-9). Additional candidate genes are identified using less stringent filtering conditions. In some cases, somatic deletions appear likely. RA has a distinctive pattern of events relative to other diseases. Similarities in patterns are apparent between BD and HT. The associations derived represent the first evidence that somatic gene conversion could be a significant causative factor in each of the seven diseases. The specific genes provide potential insights about disease mechanisms, and are strong candidates for further study.

The genome of Theobroma cacao.

PubMed

Argout, Xavier; Salse, Jerome; Aury, Jean-Marc; Guiltinan, Mark J; Droc, Gaetan; Gouzy, Jerome; Allegre, Mathilde; Chaparro, Cristian; Legavre, Thierry; Maximova, Siela N; Abrouk, Michael; Murat, Florent; Fouet, Olivier; Poulain, Julie; Ruiz, Manuel; Roguet, Yolande; Rodier-Goud, Maguy; Barbosa-Neto, Jose Fernandes; Sabot, Francois; Kudrna, Dave; Ammiraju, Jetty Siva S; Schuster, Stephan C; Carlson, John E; Sallet, Erika; Schiex, Thomas; Dievart, Anne; Kramer, Melissa; Gelley, Laura; Shi, Zi; Bérard, Aurélie; Viot, Christopher; Boccara, Michel; Risterucci, Ange Marie; Guignon, Valentin; Sabau, Xavier; Axtell, Michael J; Ma, Zhaorong; Zhang, Yufan; Brown, Spencer; Bourge, Mickael; Golser, Wolfgang; Song, Xiang; Clement, Didier; Rivallan, Ronan; Tahi, Mathias; Akaza, Joseph Moroh; Pitollat, Bertrand; Gramacho, Karina; D'Hont, Angélique; Brunel, Dominique; Infante, Diogenes; Kebe, Ismael; Costet, Pierre; Wing, Rod; McCombie, W Richard; Guiderdoni, Emmanuel; Quetier, Francis; Panaud, Olivier; Wincker, Patrick; Bocs, Stephanie; Lanaud, Claire

2011-02-01

We sequenced and assembled the draft genome of Theobroma cacao, an economically important tropical-fruit tree crop that is the source of chocolate. This assembly corresponds to 76% of the estimated genome size and contains almost all previously described genes, with 82% of these genes anchored on the 10 T. cacao chromosomes. Analysis of this sequence information highlighted specific expansion of some gene families during evolution, for example, flavonoid-related genes. It also provides a major source of candidate genes for T. cacao improvement. Based on the inferred paleohistory of the T. cacao genome, we propose an evolutionary scenario whereby the ten T. cacao chromosomes were shaped from an ancestor through eleven chromosome fusions.

Nuclease-mediated double-strand break (DSB) enhancement of small fragment homologous recombination (SFHR) gene modification in human-induced pluripotent stem cells (hiPSCs).

PubMed

Sargent, R Geoffrey; Suzuki, Shingo; Gruenert, Dieter C

2014-01-01

Recent developments in methods to specifically modify genomic DNA using sequence-specific endonucleases and donor DNA have opened the door to a new therapeutic paradigm for cell and gene therapy of inherited diseases. Sequence-specific endonucleases, in particular transcription activator-like (TAL) effector nucleases (TALENs), have been coupled with polynucleotide small/short DNA fragments (SDFs) to correct the most common mutation in the cystic fibrosis (CF) transmembrane conductance regulator (CFTR) gene, a 3-base-pair deletion at codon 508 (delF508), in induced pluripotent stem (iPS) cells. The studies presented here describe the generation of candidate TALENs and their co-transfection with wild-type (wt) CFTR-SDFs into CF-iPS cells homozygous for the delF508 mutation. Using an allele-specific PCR (AS-PCR)-based cyclic enrichment protocol, clonal populations of corrected CF-iPS cells were isolated and expanded.

Expression stability and selection of optimal reference genes for gene expression normalization in early life stage rainbow trout exposed to cadmium and copper.

PubMed

Shekh, Kamran; Tang, Song; Niyogi, Som; Hecker, Markus

2017-09-01

Gene expression analysis represents a powerful approach to characterize the specific mechanisms by which contaminants interact with organisms. One of the key considerations when conducting gene expression analyses using quantitative real-time reverse transcription-polymerase chain reaction (qPCR) is the selection of appropriate reference genes, which is often overlooked. Specifically, to reach meaningful conclusions when using relative quantification approaches, expression levels of reference genes must be highly stable and cannot vary as a function of experimental conditions. However, to date, information on the stability of commonly used reference genes across developmental stages, tissues and after exposure to contaminants such as metals is lacking for many vertebrate species including teleost fish. Therefore, in this study, we assessed the stability of expression of 8 reference gene candidates in the gills and skin of three different early life-stages of rainbow trout after acute exposure (24h) to two metals, cadmium (Cd) and copper (Cu) using qPCR. Candidate housekeeping genes were: beta actin (b-actin), DNA directed RNA polymerase II subunit I (DRP2), elongation factor-1 alpha (EF1a), glyceraldehyde 3-phosphate dehydrogenase (GAPDH), glucose-6-phosphate dehydrogenase (G6PD), hypoxanthine phosphoribosyltransferase (HPRT), ribosomal protein L8 (RPL8), and 18S ribosomal RNA (18S). Four algorithms, geNorm, NormFinder, BestKeeper, and the comparative ΔCt method were employed to systematically evaluate the expression stability of these candidate genes under control and exposed conditions as well as across three different life-stages. Finally, stability of genes was ranked by taking geometric means of the ranks established by the different methods. Stability of reference genes was ranked in the following order (from lower to higher stability): HPRT

Microarray analysis identifies candidate genes for key roles in coral development

PubMed Central

Grasso, Lauretta C; Maindonald, John; Rudd, Stephen; Hayward, David C; Saint, Robert; Miller, David J; Ball, Eldon E

2008-01-01

Background Anthozoan cnidarians are amongst the simplest animals at the tissue level of organization, but are surprisingly complex and vertebrate-like in terms of gene repertoire. As major components of tropical reef ecosystems, the stony corals are anthozoans of particular ecological significance. To better understand the molecular bases of both cnidarian development in general and coral-specific processes such as skeletogenesis and symbiont acquisition, microarray analysis was carried out through the period of early development – when skeletogenesis is initiated, and symbionts are first acquired. Results Of 5081 unique peptide coding genes, 1084 were differentially expressed (P ≤ 0.05) in comparisons between four different stages of coral development, spanning key developmental transitions. Genes of likely relevance to the processes of settlement, metamorphosis, calcification and interaction with symbionts were characterised further and their spatial expression patterns investigated using whole-mount in situ hybridization. Conclusion This study is the first large-scale investigation of developmental gene expression for any cnidarian, and has provided candidate genes for key roles in many aspects of coral biology, including calcification, metamorphosis and symbiont uptake. One surprising finding is that some of these genes have clear counterparts in higher animals but are not present in the closely-related sea anemone Nematostella. Secondly, coral-specific processes (i.e. traits which distinguish corals from their close relatives) may be analogous to similar processes in distantly related organisms. This first large-scale application of microarray analysis demonstrates the potential of this approach for investigating many aspects of coral biology, including the effects of stress and disease. PMID:19014561

Transcriptional Profiling of Ectoderm Specification to Keratinocyte Fate in Human Embryonic Stem Cells

PubMed Central

Tadeu, Ana Mafalda Baptista; Lin, Samantha; Hou, Lin; Chung, Lisa; Zhong, Mei; Zhao, Hongyu; Horsley, Valerie

2015-01-01

In recent years, several studies have shed light into the processes that regulate epidermal specification and homeostasis. We previously showed that a broad-spectrum γ–secretase inhibitor DAPT promoted early keratinocyte specification in human embryonic stem cells triggered to undergo ectoderm specification. Here, we show that DAPT accelerates human embryonic stem cell differentiation and induces expression of the ectoderm protein AP2. Furthermore, we utilize RNA sequencing to identify several candidate regulators of ectoderm specification including those involved in epithelial and epidermal development in human embryonic stem cells. Genes associated with transcriptional regulation and growth factor activity are significantly enriched upon DAPT treatment during specification of human embryonic stem cells to the ectoderm lineage. The human ectoderm cell signature identified in this study contains several genes expressed in ectodermal and epithelial tissues. Importantly, these genes are also associated with skin disorders and ectodermal defects, providing a platform for understanding the biology of human epidermal keratinocyte development under diseased and homeostatic conditions. PMID:25849374

Sex-dependent genetic effects on immune responses to a parasitic nematode.

PubMed

Hayes, Kelly S; Hager, Reinmar; Grencis, Richard K

2014-03-14

Many disease aetiologies have sex specific effects, which have important implications for disease management. It is now becoming increasingly evident that such effects are the result of the differential expression of autosomal genes rather than sex-specific genes. Such sex-specific variation in the response to Trichuris muris, a murine parasitic nematode infection and model for the human parasitic nematode T. trichiura, has been well documented, however, the underlying genetic causes of these differences have been largely neglected. We used the BXD mouse set of recombinant inbred strains to identify sex-specific loci that contribute to immune phenotypes in T. muris infection. Response phenotypes to T. muris infection were found to be highly variable between different lines of BXD mice. A significant QTL on chromosome 5 (TM5) associated with IFN-γ production was found in male mice but not in female mice. This QTL was in the same location as a suggestive QTL for TNF-α and IL-6 production in male mice suggesting a common control of these pro-inflammatory cytokines. A second QTL was identified on chromosome 4 (TM4) affecting worm burden in both male and female cohorts. We have identified several genes as potential candidates for modifying responses to T. muris infection. We have used the largest mammalian genetic model system, the BXD mouse population, to identify candidate genes with sex-specific effects in immune responses to T. muris infection. Some of these genes may be differentially expressed in male and female mice leading to the difference in immune response between the sexes reported in previous studies. Our study further highlights the importance of considering sex as an important factor in investigations of immune response at the genome-wide level, in particular the bias that can be introduced when generalizing results obtained from only one sex or a mixed sex population. Rather, analyses of interaction effects between sex and genotype should be part of future studies.

Identification of prostate cancer modifier pathways using parental strain expression mapping

PubMed Central

Xu, Qing; Majumder, Pradip K.; Ross, Kenneth; Shim, Yeonju; Golub, Todd R.; Loda, Massimo; Sellers, William R.

2007-01-01

Inherited genetic risk factors play an important role in cancer. However, other than the Mendelian fashion cancer susceptibility genes found in familial cancer syndromes, little is known about risk modifiers that control individual susceptibility. Here we developed a strategy, parental strain expression mapping, that utilizes the homogeneity of inbred mice and genome-wide mRNA expression analyses to directly identify candidate germ-line modifier genes and pathways underlying phenotypic differences among murine strains exposed to transgenic activation of AKT1. We identified multiple candidate modifier pathways and, specifically, the glycolysis pathway as a candidate negative modulator of AKT1-induced proliferation. In keeping with the findings in the murine models, in multiple human prostate expression data set, we found that enrichment of glycolysis pathways in normal tissues was associated with decreased rates of cancer recurrence after prostatectomy. Together, these data suggest that parental strain expression mapping can directly identify germ-line modifier pathways of relevance to human disease. PMID:17978178

Population structure and its effect on haplotype diversity and linkage disequilibrium surrounding the xa5 locus of rice (Oryza sativa L.).

PubMed Central

Garris, Amanda J; McCouch, Susan R; Kresovich, Stephen

2003-01-01

To assess the usefulness of linkage disequilibrium mapping in an autogamous, domesticated species, we have characterized linkage disequilibrium in the candidate region for xa5, a recessive gene conferring race-specific resistance to bacterial blight in rice. This trait and locus have good mapping information, a tractable phenotype, and available sequence data, but no cloned gene. We sampled 13 short segments from the 70-kb candidate region in 114 accessions of Oryza sativa. Five additional segments were sequenced from the adjacent 45-kb region in resistant accessions to estimate the distance at which linkage disequilibrium decays. The data show significant linkage disequilibrium between sites 100 kb apart. The presence of the xa5 resistant reaction in two ecotypes and in accessions with different haplotypes in the candidate region may indicate multiple origins or genetic heterogeneity for resistance. In addition, genetic differentiation between ecotypes emphasizes the need for controlling for population structure in the design of linkage disequilibrium studies in rice. PMID:14573486

Immunogenetic mechanisms leading to thyroid autoimmunity: recent advances in identifying susceptibility genes and regions.

PubMed

Brand, Oliver J; Gough, Stephen C L

2011-12-01

The autoimmune thyroid diseases (AITD) include Graves' disease (GD) and Hashimoto's thyroiditis (HT), which are characterised by a breakdown in immune tolerance to thyroid antigens. Unravelling the genetic architecture of AITD is vital to better understanding of AITD pathogenesis, required to advance therapeutic options in both disease management and prevention. The early whole-genome linkage and candidate gene association studies provided the first evidence that the HLA region and CTLA-4 represented AITD risk loci. Recent improvements in; high throughput genotyping technologies, collection of larger disease cohorts and cataloguing of genome-scale variation have facilitated genome-wide association studies and more thorough screening of candidate gene regions. This has allowed identification of many novel AITD risk genes and more detailed association mapping. The growing number of confirmed AITD susceptibility loci, implicates a number of putative disease mechanisms most of which are tightly linked with aspects of immune system function. The unprecedented advances in genetic study will allow future studies to identify further novel disease risk genes and to identify aetiological variants within specific gene regions, which will undoubtedly lead to a better understanding of AITD patho-physiology.

Immunogenetic Mechanisms Leading to Thyroid Autoimmunity: Recent Advances in Identifying Susceptibility Genes and Regions

PubMed Central

Brand, Oliver J; Gough, Stephen C.L

2011-01-01

The autoimmune thyroid diseases (AITD) include Graves’ disease (GD) and Hashimoto’s thyroiditis (HT), which are characterised by a breakdown in immune tolerance to thyroid antigens. Unravelling the genetic architecture of AITD is vital to better understanding of AITD pathogenesis, required to advance therapeutic options in both disease management and prevention. The early whole-genome linkage and candidate gene association studies provided the first evidence that the HLA region and CTLA-4 represented AITD risk loci. Recent improvements in; high throughput genotyping technologies, collection of larger disease cohorts and cataloguing of genome-scale variation have facilitated genome-wide association studies and more thorough screening of candidate gene regions. This has allowed identification of many novel AITD risk genes and more detailed association mapping. The growing number of confirmed AITD susceptibility loci, implicates a number of putative disease mechanisms most of which are tightly linked with aspects of immune system function. The unprecedented advances in genetic study will allow future studies to identify further novel disease risk genes and to identify aetiological variants within specific gene regions, which will undoubtedly lead to a better understanding of AITD patho-physiology. PMID:22654554

Sequence analysis of the Ras-MAPK pathway genes SOS1, EGFR & GRB2 in silver foxes (Vulpes vulpes): candidate genes for hereditary hyperplastic gingivitis.

PubMed

Clark, Jo-Anna B J; Tully, Sara J; Dawn Marshall, H

2014-12-01

Hereditary hyperplastic gingivitis (HHG) is an autosomal recessive disease that presents with progressive gingival proliferation in farmed silver foxes. Hereditary gingival fibromatosis (HGF) is an analogous condition in humans that is genetically heterogeneous with several known autosomal dominant loci. For one locus the causative mutation is in the Son of sevenless homologue 1 (SOS1) gene. For the remaining loci, the molecular mechanisms are unknown but Ras pathway involvement is suspected. Here we compare sequences for the SOS1 gene, and two adjacent genes in the Ras pathway, growth receptor bound protein 2 (GRB2) and epidermal growth factor receptor (EGFR), between HHG-affected and unaffected foxes. We conclude that the known HGF causative mutation does not cause HHG in foxes, nor do the coding regions or intron-exon boundaries of these three genes contain any candidate mutations for fox gum disease. Patterns of molecular evolution among foxes and other mammals reflect high conservation and strong functional constraints for SOS1 and GRB2 but reveal a lineage-specific pattern of variability in EGFR consistent with mutational rate differences, relaxed functional constraints, and possibly positive selection.

Transcriptome profiling during a natural host-parasite interaction.

PubMed

McTaggart, Seanna J; Cézard, Timothée; Garbutt, Jennie S; Wilson, Phil J; Little, Tom J

2015-08-28

Infection outcome in some coevolving host-pathogens is characterised by host-pathogen genetic interactions, where particular host genotypes are susceptible only to a subset of pathogen genotypes. To identify candidate genes responsible for the infection status of the host, we exposed a Daphnia magna host genotype to two bacterial strains of Pasteuria ramosa, one of which results in infection, while the other does not. At three time points (four, eight and 12 h) post pathogen exposure, we sequenced the complete transcriptome of the hosts using RNA-Seq (Illumina). We observed a rapid and transient response to pathogen treatment. Specifically, at the four-hour time point, eight genes were differentially expressed. At the eight-hour time point, a single gene was differentially expressed in the resistant combination only, and no genes were differentially expressed at the 12-h time point. We found that pathogen-associated transcriptional activity is greatest soon after exposure. Genome-wide resistant combinations were more likely to show upregulation of genes, while susceptible combinations were more likely to be downregulated, relative to controls. Our results also provide several novel candidate genes that may play a pivotal role in determining infection outcomes.

Partial genome assembly for a candidate division OP11 single cell from an anoxic spring (Zodletone Spring, Oklahoma).

PubMed

Youssef, Noha H; Blainey, Paul C; Quake, Stephen R; Elshahed, Mostafa S

2011-11-01

Members of candidate division OP11 are widely distributed in terrestrial and marine ecosystems, yet little information regarding their metabolic capabilities and ecological role within such habitats is currently available. Here, we report on the microfluidic isolation, multiple-displacement-amplification, pyrosequencing, and genomic analysis of a single cell (ZG1) belonging to candidate division OP11. Genome analysis of the ∼270-kb partial genome assembly obtained showed that it had no particular similarity to a specific phylum. Four hundred twenty-three open reading frames were identified, 46% of which had no function prediction. In-depth analysis revealed a heterotrophic lifestyle, with genes encoding endoglucanase, amylopullulanase, and laccase enzymes, suggesting a capacity for utilization of cellulose, starch, and, potentially, lignin, respectively. Genes encoding several glycolysis enzymes as well as formate utilization were identified, but no evidence for an electron transport chain was found. The presence of genes encoding various components of lipopolysaccharide biosynthesis indicates a Gram-negative bacterial cell wall. The partial genome also provides evidence for antibiotic resistance (β-lactamase, aminoglycoside phosphotransferase), as well as antibiotic production (bacteriocin) and extracellular bactericidal peptidases. Multiple mechanisms for stress response were identified, as were elements of type I and type IV secretion systems. Finally, housekeeping genes identified within the partial genome were used to demonstrate the OP11 affiliation of multiple hitherto unclassified genomic fragments from multiple database-deposited metagenomic data sets. These results provide the first glimpse into the lifestyle of a member of a ubiquitous, yet poorly understood bacterial candidate division.

Discovery of cancer common and specific driver gene sets

PubMed Central

2017-01-01

Abstract Cancer is known as a disease mainly caused by gene alterations. Discovery of mutated driver pathways or gene sets is becoming an important step to understand molecular mechanisms of carcinogenesis. However, systematically investigating commonalities and specificities of driver gene sets among multiple cancer types is still a great challenge, but this investigation will undoubtedly benefit deciphering cancers and will be helpful for personalized therapy and precision medicine in cancer treatment. In this study, we propose two optimization models to de novo discover common driver gene sets among multiple cancer types (ComMDP) and specific driver gene sets of one certain or multiple cancer types to other cancers (SpeMDP), respectively. We first apply ComMDP and SpeMDP to simulated data to validate their efficiency. Then, we further apply these methods to 12 cancer types from The Cancer Genome Atlas (TCGA) and obtain several biologically meaningful driver pathways. As examples, we construct a common cancer pathway model for BRCA and OV, infer a complex driver pathway model for BRCA carcinogenesis based on common driver gene sets of BRCA with eight cancer types, and investigate specific driver pathways of the liquid cancer lymphoblastic acute myeloid leukemia (LAML) versus other solid cancer types. In these processes more candidate cancer genes are also found. PMID:28168295

Analysis of eye lens-specific genes in congenital hereditary cataracts and microphthalmia of the miniature schnauzer dog.

PubMed

Zhang, R L; Samuelson, D A; Zhang, Z G; Reddy, V N; Shastry, B S

1991-08-01

The congenital hereditary cataracts and microphthalmia in the miniature schnauzer dog are inherited by an autosomal recessive mode. To understand the genetic basis of these diseases, the authors purified and analyzed leukocyte deoxyribonucleic acid (DNA) from affected and normal animals using a candidate gene approach. Because the genes that encode the lens-specific proteins, specifically, alpha, beta, and gamma crystallins and the membrane protein (MP26), are known to maintain the structure and function of the lens, the authors used complimentary DNA (cDNA) fragments that corresponded to the above genes to search for the mutations at their loci in the affected animals. They found no evidence of the gene deletion and rearrangement in any of the five loci. In addition, the hybridizable sequences of the dog DNA to the specific probes for the human chromosome 4 and 18 loci, which are reported to be involved in the abnormality of the human eye, seem to be unaffected. These data support the notion that the hereditary cataracts and microphthalmia in the dog may be associated with genes other than those reported for several animal systems.

Meta-review of protein network regulating obesity between validated obesity candidate genes in the white adipose tissue of high-fat diet-induced obese C57BL/6J mice.

PubMed

Kim, Eunjung; Kim, Eun Jung; Seo, Seung-Won; Hur, Cheol-Goo; McGregor, Robin A; Choi, Myung-Sook

2014-01-01

Worldwide obesity and related comorbidities are increasing, but identifying new therapeutic targets remains a challenge. A plethora of microarray studies in diet-induced obesity models has provided large datasets of obesity associated genes. In this review, we describe an approach to examine the underlying molecular network regulating obesity, and we discuss interactions between obesity candidate genes. We conducted network analysis on functional protein-protein interactions associated with 25 obesity candidate genes identified in a literature-driven approach based on published microarray studies of diet-induced obesity. The obesity candidate genes were closely associated with lipid metabolism and inflammation. Peroxisome proliferator activated receptor gamma (Pparg) appeared to be a core obesity gene, and obesity candidate genes were highly interconnected, suggesting a coordinately regulated molecular network in adipose tissue. In conclusion, the current network analysis approach may help elucidate the underlying molecular network regulating obesity and identify anti-obesity targets for therapeutic intervention.

Whole exome sequencing identifies novel candidate genes that modify chronic obstructive pulmonary disease susceptibility.

PubMed

Bruse, Shannon; Moreau, Michael; Bromberg, Yana; Jang, Jun-Ho; Wang, Nan; Ha, Hongseok; Picchi, Maria; Lin, Yong; Langley, Raymond J; Qualls, Clifford; Klensney-Tait, Julia; Zabner, Joseph; Leng, Shuguang; Mao, Jenny; Belinsky, Steven A; Xing, Jinchuan; Nyunoya, Toru

2016-01-07

Chronic obstructive pulmonary disease (COPD) is characterized by an irreversible airflow limitation in response to inhalation of noxious stimuli, such as cigarette smoke. However, only 15-20 % smokers manifest COPD, suggesting a role for genetic predisposition. Although genome-wide association studies have identified common genetic variants that are associated with susceptibility to COPD, effect sizes of the identified variants are modest, as is the total heritability accounted for by these variants. In this study, an extreme phenotype exome sequencing study was combined with in vitro modeling to identify COPD candidate genes. We performed whole exome sequencing of 62 highly susceptible smokers and 30 exceptionally resistant smokers to identify rare variants that may contribute to disease risk or resistance to COPD. This was a cross-sectional case-control study without therapeutic intervention or longitudinal follow-up information. We identified candidate genes based on rare variant analyses and evaluated exonic variants to pinpoint individual genes whose function was computationally established to be significantly different between susceptible and resistant smokers. Top scoring candidate genes from these analyses were further filtered by requiring that each gene be expressed in human bronchial epithelial cells (HBECs). A total of 81 candidate genes were thus selected for in vitro functional testing in cigarette smoke extract (CSE)-exposed HBECs. Using small interfering RNA (siRNA)-mediated gene silencing experiments, we showed that silencing of several candidate genes augmented CSE-induced cytotoxicity in vitro. Our integrative analysis through both genetic and functional approaches identified two candidate genes (TACC2 and MYO1E) that augment cigarette smoke (CS)-induced cytotoxicity and, potentially, COPD susceptibility.

Determining ACTB, ATP5B and RPL32 as optimal reference genes for quantitative RT-PCR studies of cryopreserved stallion semen.

PubMed

Pérez-Rico, A; Crespo, F; Sanmartín, M L; De Santiago, A; Vega-Pla, J L

2014-10-01

Equine germplasm bank management involves not only the conservation and use of semen doses, in addition it can also be a resource to study stallion semen quality and after thawing semen properties for reproductive purposes. A possible criterion to measure quality may be based on differential gene expression of loci involved during spermatogenesis and sperm quality maturation. The rapid degradation of sperm after thawing affects the integrity and availability of RNA. In this study we have analyzed genes expressed in equine cryopreserved sperm, which provided an adequate amplification, specificity, and stability to be used as future reference genes in expression studies. Live spermatozoa were selected from cryopreserved semen straws derived from 20 stallions, through a discontinuous concentration gradient. RNA purification followed a combination of the organic and column extraction methods together with a deoxyribonuclease treatment. The selective amplification of nine candidate genes was undertaken using reverse transcription and real-time polymerase chain reaction (qPCR) carried out in a one-step mode (qRT-PCR). Specificities were tested by melting curves, agarose gel electrophoresis and sequencing. In addition, gene stabilities were also calculated. Results indicated that five out of the nine candidate genes amplified properly (β-Actin, ATP synthase subunit beta, Protamine 1, L32 ribosomal protein and Ubiquitin B), of which β-Actin and the L32 Ribosomal protein showed the highest stability thus being the most suitable to be considered as reference genes for equine cryopreserved sperm studies, followed by the ATP synthase subunit beta and Ubiquitin B. Copyright © 2014 Elsevier B.V. All rights reserved.

NeuroRDF: semantic integration of highly curated data to prioritize biomarker candidates in Alzheimer's disease.

PubMed

Iyappan, Anandhi; Kawalia, Shweta Bagewadi; Raschka, Tamara; Hofmann-Apitius, Martin; Senger, Philipp

2016-07-08

Neurodegenerative diseases are incurable and debilitating indications with huge social and economic impact, where much is still to be learnt about the underlying molecular events. Mechanistic disease models could offer a knowledge framework to help decipher the complex interactions that occur at molecular and cellular levels. This motivates the need for the development of an approach integrating highly curated and heterogeneous data into a disease model of different regulatory data layers. Although several disease models exist, they often do not consider the quality of underlying data. Moreover, even with the current advancements in semantic web technology, we still do not have cure for complex diseases like Alzheimer's disease. One of the key reasons accountable for this could be the increasing gap between generated data and the derived knowledge. In this paper, we describe an approach, called as NeuroRDF, to develop an integrative framework for modeling curated knowledge in the area of complex neurodegenerative diseases. The core of this strategy lies in the usage of well curated and context specific data for integration into one single semantic web-based framework, RDF. This increases the probability of the derived knowledge to be novel and reliable in a specific disease context. This infrastructure integrates highly curated data from databases (Bind, IntAct, etc.), literature (PubMed), and gene expression resources (such as GEO and ArrayExpress). We illustrate the effectiveness of our approach by asking real-world biomedical questions that link these resources to prioritize the plausible biomarker candidates. Among the 13 prioritized candidate genes, we identified MIF to be a potential emerging candidate due to its role as a pro-inflammatory cytokine. We additionally report on the effort and challenges faced during generation of such an indication-specific knowledge base comprising of curated and quality-controlled data. Although many alternative approaches have been proposed and practiced for modeling diseases, the semantic web technology is a flexible and well established solution for harmonized aggregation. The benefit of this work, to use high quality and context specific data, becomes apparent in speculating previously unattended biomarker candidates around a well-known mechanism, further leveraged for experimental investigations.

Differentially-Expressed Pseudogenes in HIV-1 Infection.

PubMed

Gupta, Aditi; Brown, C Titus; Zheng, Yong-Hui; Adami, Christoph

2015-09-29

Not all pseudogenes are transcriptionally silent as previously thought. Pseudogene transcripts, although not translated, contribute to the non-coding RNA pool of the cell that regulates the expression of other genes. Pseudogene transcripts can also directly compete with the parent gene transcripts for mRNA stability and other cell factors, modulating their expression levels. Tissue-specific and cancer-specific differential expression of these "functional" pseudogenes has been reported. To ascertain potential pseudogene:gene interactions in HIV-1 infection, we analyzed transcriptomes from infected and uninfected T-cells and found that 21 pseudogenes are differentially expressed in HIV-1 infection. This is interesting because parent genes of one-third of these differentially-expressed pseudogenes are implicated in HIV-1 life cycle, and parent genes of half of these pseudogenes are involved in different viral infections. Our bioinformatics analysis identifies candidate pseudogene:gene interactions that may be of significance in HIV-1 infection. Experimental validation of these interactions would establish that retroviruses exploit this newly-discovered layer of host gene expression regulation for their own benefit.

Identification and Expression Profiles of Sex Pheromone Biosynthesis and Transport Related Genes in Spodoptera litura

PubMed Central

Zhang, Ya-Nan; Zhu, Xiu-Yun; Fang, Li-Ping; He, Peng; Wang, Zhi-Qiang; Chen, Geng; Sun, Liang; Ye, Zhan-Feng; Deng, Dao-Gui; Li, Jin-Bu

2015-01-01

Although the general pathway of sex pheromone synthesis in moth species has been established, the molecular mechanisms remain poorly understood. The common cutworm Spodoptera litura is an important agricultural pest worldwide and causes huge economic losses annually. The female sex pheromone of S. litura comprises Z9,E11-14:OAc, Z9,E12-14:OAc, Z9-14:OAc, and E11-14:OAc. By sequencing and analyzing the transcriptomic data of the sex pheromone glands, we identified 94 candidate genes related to pheromone biosynthesis (55 genes) or chemoreception (39 genes). Gene expression patterns and phylogenetic analysis revealed that two desaturase genes (SlitDes5 and SlitDes11) and one fatty acyl reductase gene (SlitFAR3) showed pheromone gland (PG) biased or specific expression, and clustered with genes known to be involved in pheromone synthesis in other moth species. Furthermore, 4 chemoreception related genes (SlitOBP6, SlitOBP11, SlitCSP3, and SlitCSP14) also showed higher expression in the PG, and could be additional candidate genes involved in sex pheromone transport. This study provides the first solid background information that should facilitate further elucidation of sex pheromone biosynthesis and transport, and indicates potential targets to disrupt sexual communication in S. litura for a novel pest management strategy. PMID:26445454

Digital gene expression analysis of the zebra finch genome

PubMed Central

2010-01-01

Background In order to understand patterns of adaptation and molecular evolution it is important to quantify both variation in gene expression and nucleotide sequence divergence. Gene expression profiling in non-model organisms has recently been facilitated by the advent of massively parallel sequencing technology. Here we investigate tissue specific gene expression patterns in the zebra finch (Taeniopygia guttata) with special emphasis on the genes of the major histocompatibility complex (MHC). Results Almost 2 million 454-sequencing reads from cDNA of six different tissues were assembled and analysed. A total of 11,793 zebra finch transcripts were represented in this EST data, indicating a transcriptome coverage of about 65%. There was a positive correlation between the tissue specificity of gene expression and non-synonymous to synonymous nucleotide substitution ratio of genes, suggesting that genes with a specialised function are evolving at a higher rate (or with less constraint) than genes with a more general function. In line with this, there was also a negative correlation between overall expression levels and expression specificity of contigs. We found evidence for expression of 10 different genes related to the MHC. MHC genes showed relatively tissue specific expression levels and were in general primarily expressed in spleen. Several MHC genes, including MHC class I also showed expression in brain. Furthermore, for all genes with highest levels of expression in spleen there was an overrepresentation of several gene ontology terms related to immune function. Conclusions Our study highlights the usefulness of next-generation sequence data for quantifying gene expression in the genome as a whole as well as in specific candidate genes. Overall, the data show predicted patterns of gene expression profiles and molecular evolution in the zebra finch genome. Expression of MHC genes in particular, corresponds well with expression patterns in other vertebrates. PMID:20359325

RNA-Seq identification of candidate defense genes targeted by endophytic Bacillus cereus-mediated induced systemic resistance against Meloidogyne incognita in tomato.

PubMed

Hu, Haijing; Wang, Cong; Li, Xia; Tang, Yunyun; Wang, Yufang; Chen, Shuanglin; Yan, Shuzhen

2018-05-08

The endophytic bacteria Bacillus cereus BCM2 has shown great potential as a defense against the parasitic nematode Meloidogyne incognita. Here, we studied the endophytic bacteria-mediated plant defense against M. incognita and searched for defense-related candidate genes using RNA-Seq. The induced systemic resistance of BCM2 against M. incognita was tested using the split-root method. Pre-inoculated BCM2 on the inducer side was associated with a dramatic reduction in galls and egg masses at the responder side, but inoculated BCM2 alone did not produce the same effect. In order to investigate which plant defense-related genes are specifically activated by BCM2, four RNA samples from tomato roots were sequenced, and four high quality total clean bases were obtained, ranging from 6.64 to 6.75 Gb, with an average of 21558 total genes. The 34 candidate defense-related genes were identified by pair-wise comparison among libraries, representing the targets for BCM2 priming resistance against M. incognita. Functional characterization revealed that the plant-pathogen interaction pathway (ID: ko04626) was significantly enriched for BCM2-mediated M. incognita resistance. This study demonstrates that B. cereus BCM2 maintains a harmonious host-microbe relationship with tomato, but appeared to prime the plant, resulting in more vigorous defense response toward the infection nematode. This article is protected by copyright. All rights reserved.

Genes encoding cuticular proteins are components of the Nimrod gene cluster in Drosophila.

PubMed

Cinege, Gyöngyi; Zsámboki, János; Vidal-Quadras, Maite; Uv, Anne; Csordás, Gábor; Honti, Viktor; Gábor, Erika; Hegedűs, Zoltán; Varga, Gergely I B; Kovács, Attila L; Juhász, Gábor; Williams, Michael J; Andó, István; Kurucz, Éva

2017-08-01

The Nimrod gene cluster, located on the second chromosome of Drosophila melanogaster, is the largest synthenic unit of the Drosophila genome. Nimrod genes show blood cell specific expression and code for phagocytosis receptors that play a major role in fruit fly innate immune functions. We previously identified three homologous genes (vajk-1, vajk-2 and vajk-3) located within the Nimrod cluster, which are unrelated to the Nimrod genes, but are homologous to a fourth gene (vajk-4) located outside the cluster. Here we show that, unlike the Nimrod candidates, the Vajk proteins are expressed in cuticular structures of the late embryo and the late pupa, indicating that they contribute to cuticular barrier functions. Copyright © 2017 Elsevier Ltd. All rights reserved.

Cross-talk of the biotrophic pathogen Claviceps purpurea and its host Secale cereale.

PubMed

Oeser, Birgitt; Kind, Sabine; Schurack, Selma; Schmutzer, Thomas; Tudzynski, Paul; Hinsch, Janine

2017-04-04

The economically important Ergot fungus Claviceps purpurea is an interesting biotrophic model system because of its strict organ specificity (grass ovaries) and the lack of any detectable plant defense reactions. Though several virulence factors were identified, the exact infection mechanisms are unknown, e.g. how the fungus masks its attack and if the host detects the infection at all. We present a first dual transcriptome analysis using an RNA-Seq approach. We studied both, fungal and plant gene expression in young ovaries infected by the wild-type and two virulence-attenuated mutants. We can show that the plant recognizes the fungus, since defense related genes are upregulated, especially several phytohormone genes. We present a survey of in planta expressed fungal genes, among them several confirmed virulence genes. Interestingly, the set of most highly expressed genes includes a high proportion of genes encoding putative effectors, small secreted proteins which might be involved in masking the fungal attack or interfering with host defense reactions. As known from several other phytopathogens, the C. purpurea genome contains more than 400 of such genes, many of them clustered and probably highly redundant. Since the lack of effective defense reactions in spite of recognition of the fungus could very well be achieved by effectors, we started a functional analysis of some of the most highly expressed candidates. However, the redundancy of the system made the identification of a drastic effect of a single gene most unlikely. We can show that at least one candidate accumulates in the plant apoplast. Deletion of some candidates led to a reduced virulence of C. purpurea on rye, indicating a role of the respective proteins during the infection process. We show for the first time that- despite the absence of effective plant defense reactions- the biotrophic pathogen C. purpurea is detected by its host. This points to a role of effectors in modulation of the effective plant response. Indeed, several putative effector genes are among the highest expressed genes in planta.

Role of skeletal muscle in ear development.

PubMed

Rot, Irena; Baguma-Nibasheka, Mark; Costain, Willard J; Hong, Paul; Tafra, Robert; Mardesic-Brakus, Snjezana; Mrduljas-Djujic, Natasa; Saraga-Babic, Mirna; Kablar, Boris

2017-10-01

The current paper is a continuation of our work described in Rot and Kablar, 2010. Here, we show lists of 10 up- and 87 down-regulated genes obtained by a cDNA microarray analysis that compared developing Myf5-/-:Myod-/- (and Mrf4-/-) petrous part of the temporal bone, containing middle and inner ear, to the control, at embryonic day 18.5. Myf5-/-:Myod-/- fetuses entirely lack skeletal myoblasts and muscles. They are unable to move their head, which interferes with the perception of angular acceleration. Previously, we showed that the inner ear areas most affected in Myf5-/-:Myod-/- fetuses were the vestibular cristae ampullaris, sensitive to angular acceleration. Our finding that the type I hair cells were absent in the mutants' cristae was further used here to identify a profile of genes specific to the lacking cell type. Microarrays followed by a detailed consultation of web-accessible mouse databases allowed us to identify 6 candidate genes with a possible role in the development of the inner ear sensory organs: Actc1, Pgam2, Ldb3, Eno3, Hspb7 and Smpx. Additionally, we searched for human homologues of the candidate genes since a number of syndromes in humans have associated inner ear abnormalities. Mutations in one of our candidate genes, Smpx, have been reported as the cause of X-linked deafness in humans. Our current study suggests an epigenetic role that mechanical, and potentially other, stimuli originating from muscle, play in organogenesis, and offers an approach to finding novel genes responsible for altered inner ear phenotypes.

Methylation analysis of plasma cell-free DNA for breast cancer early detection using bisulfite next-generation sequencing.

PubMed

Li, Zibo; Guo, Xinwu; Tang, Lili; Peng, Limin; Chen, Ming; Luo, Xipeng; Wang, Shouman; Xiao, Zhi; Deng, Zhongping; Dai, Lizhong; Xia, Kun; Wang, Jun

2016-10-01

Circulating cell-free DNA (cfDNA) has been considered as a potential biomarker for non-invasive cancer detection. To evaluate the methylation levels of six candidate genes (EGFR, GREM1, PDGFRB, PPM1E, SOX17, and WRN) in plasma cfDNA as biomarkers for breast cancer early detection, quantitative analysis of the promoter methylation of these genes from 86 breast cancer patients and 67 healthy controls was performed by using microfluidic-PCR-based target enrichment and next-generation bisulfite sequencing technology. The predictive performance of different logistic models based on methylation status of candidate genes was investigated by means of the area under the ROC curve (AUC) and odds ratio (OR) analysis. Results revealed that EGFR, PPM1E, and 8 gene-specific CpG sites showed significantly hypermethylation in cancer patients' plasma and significantly associated with breast cancer (OR ranging from 2.51 to 9.88). The AUC values for these biomarkers were ranging from 0.66 to 0.75. Combinations of multiple hypermethylated genes or CpG sites substantially improved the predictive performance for breast cancer detection. Our study demonstrated the feasibility of quantitative measurement of candidate gene methylation in cfDNA by using microfluidic-PCR-based target enrichment and bisulfite next-generation sequencing, which is worthy of further validation and potentially benefits a broad range of applications in clinical oncology practice. Quantitative analysis of methylation pattern of plasma cfDNA by next-generation sequencing might be a valuable non-invasive tool for early detection of breast cancer.

Evaluating Reported Candidate Gene Associations with Polycystic Ovary Syndrome

PubMed Central

Pau, Cindy; Saxena, Richa; Welt, Corrine Kolka

2013-01-01

Objective To replicate variants in candidate genes associated with PCOS in a population of European PCOS and control subjects. Design Case-control association analysis and meta-analysis. Setting Major academic hospital Patients Women of European ancestry with PCOS (n=525) and controls (n=472), aged 18 to 45 years. Intervention Variants previously associated with PCOS in candidate gene studies were genotyped (n=39). Metabolic, reproductive and anthropomorphic parameters were examined as a function of the candidate variants. All genetic association analyses were adjusted for age, BMI and ancestry and were reported after correction for multiple testing. Main Outcome Measure Association of candidate gene variants with PCOS. Results Three variants, rs3797179 (SRD5A1), rs12473543 (POMC), and rs1501299 (ADIPOQ), were nominally associated with PCOS. However, they did not remain significant after correction for multiple testing and none of the variants replicated in a sufficiently powered meta-analysis. Variants in the FBN3 gene (rs17202517 and rs73503752) were associated with smaller waist circumferences and variant rs727428 in the SHBG gene was associated with lower SHBG levels. Conclusion Previously identified variants in candidate genes do not appear to be associated with PCOS risk. PMID:23375202

One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes.

PubMed

Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Iriny, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N; Houbraken, J; Lombard, L; Quaedvlieg, W; Binder, M; Vaas, L A I; Vu, D; Yurkov, A; Begerow, D; Roehl, O; Guerreiro, M; Fonseca, A; Samerpitak, K; van Diepeningen, A D; Dolatabadi, S; Moreno, L F; Casaregola, S; Mallet, S; Jacques, N; Roscini, L; Egidi, E; Bizet, C; Garcia-Hermoso, D; Martín, M P; Deng, S; Groenewald, J Z; Boekhout, T; de Beer, Z W; Barnes, I; Duong, T A; Wingfield, M J; de Hoog, G S; Crous, P W; Lewis, C T; Hambleton, S; Moussa, T A A; Al-Zahrani, H S; Almaghrabi, O A; Louis-Seize, G; Assabgui, R; McCormick, W; Omer, G; Dukik, K; Cardinali, G; Eberhardt, U; de Vries, M; Robert, V

2015-12-01

The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers were tested across > 1 500 species (1 931 strains or specimens) and the outcomes of almost twenty thousand (19 577) polymerase chain reactions were evaluated. We tested several well-known primer pairs that amplify: i) sections of the nuclear ribosomal RNA gene large subunit (D1-D2 domains of 26/28S); ii) the complete internal transcribed spacer region (ITS1/2); iii) partial β -tubulin II (TUB2); iv) γ-actin (ACT); v) translation elongation factor 1-α (TEF1α); and vi) the second largest subunit of RNA-polymerase II (partial RPB2, section 5-6). Their PCR efficiencies were compared with novel candidate primers corresponding to: i) the fungal-specific translation elongation factor 3 (TEF3); ii) a small ribosomal protein necessary for t-RNA docking; iii) the 60S L10 (L1) RP; iv) DNA topoisomerase I (TOPI); v) phosphoglycerate kinase (PGK); vi) hypothetical protein LNS2; and vii) alternative sections of TEF1α. Results showed that several gene sections are accessible to universal primers (or primers universal for phyla) yielding a single PCR-product. Barcode gap and multi-dimensional scaling analyses revealed that some of the tested candidate markers have universal properties providing adequate infra- and inter-specific variation that make them attractive barcodes for species identification. Among these gene sections, a novel high fidelity primer pair for TEF1α, already widely used as a phylogenetic marker in mycology, has potential as a supplementary DNA barcode with superior resolution to ITS. Both TOPI and PGK show promise for the Ascomycota, while TOPI and LNS2 are attractive for the Pucciniomycotina, for which universal primers for ribosomal subunits often fail.

Reranking candidate gene models with cross-species comparison for improved gene prediction

PubMed Central

Liu, Qian; Crammer, Koby; Pereira, Fernando CN; Roos, David S

2008-01-01

Background Most gene finders score candidate gene models with state-based methods, typically HMMs, by combining local properties (coding potential, splice donor and acceptor patterns, etc). Competing models with similar state-based scores may be distinguishable with additional information. In particular, functional and comparative genomics datasets may help to select among competing models of comparable probability by exploiting features likely to be associated with the correct gene models, such as conserved exon/intron structure or protein sequence features. Results We have investigated the utility of a simple post-processing step for selecting among a set of alternative gene models, using global scoring rules to rerank competing models for more accurate prediction. For each gene locus, we first generate the K best candidate gene models using the gene finder Evigan, and then rerank these models using comparisons with putative orthologous genes from closely-related species. Candidate gene models with lower scores in the original gene finder may be selected if they exhibit strong similarity to probable orthologs in coding sequence, splice site location, or signal peptide occurrence. Experiments on Drosophila melanogaster demonstrate that reranking based on cross-species comparison outperforms the best gene models identified by Evigan alone, and also outperforms the comparative gene finders GeneWise and Augustus+. Conclusion Reranking gene models with cross-species comparison improves gene prediction accuracy. This straightforward method can be readily adapted to incorporate additional lines of evidence, as it requires only a ranked source of candidate gene models. PMID:18854050

Comparative Genomics and Immunoinformatics Approach for the Identification of Vaccine Candidates for Enterohemorrhagic Escherichia coli O157:H7

PubMed Central

García-Angulo, Víctor A.; Kalita, Anjana; Kalita, Mridul; Lozano, Luis

2014-01-01

Enterohemorrhagic Escherichia coli (EHEC) O157:H7 strains are major human food-borne pathogens, responsible for bloody diarrhea and hemolytic-uremic syndrome worldwide. Thus far, there is no vaccine for humans against EHEC infections. In this study, a comparative genomics analysis was performed to identify EHEC-specific antigens useful as potential vaccines. The genes present in both EHEC EDL933 and Sakai strains but absent in nonpathogenic E. coli K-12 and HS strains were subjected to an in silico analysis to identify secreted or surface-expressed proteins. We obtained a total of 65 gene-encoding protein candidates, which were subjected to immunoinformatics analysis. Our criteria of selection aided in categorizing the candidates as high, medium, and low priority. Three members of each group were randomly selected and cloned into pVAX-1. Candidates were pooled accordingly to their priority group and tested for immunogenicity against EHEC O157:H7 using a murine model of gastrointestinal infection. The high-priority (HP) pool, containing genes encoding a Lom-like protein (pVAX-31), a putative pilin subunit (pVAX-12), and a fragment of the type III secretion structural protein EscC (pVAX-56.2), was able to induce the production of EHEC IgG and sIgA in sera and feces. HP candidate-immunized mice displayed elevated levels of Th2 cytokines and diminished cecum colonization after wild-type challenge. Individually tested HP vaccine candidates showed that pVAX-12 and pVAX-56.2 significantly induced Th2 cytokines and production of fecal EHEC sIgA, with pVAX-56.2 reducing EHEC cecum colonization. We describe here a bioinformatics approach able to identify novel vaccine candidates potentially useful for preventing EHEC O157:H7 infections. PMID:24595137

Identification of candidate genes in osteoporosis by integrated microarray analysis.

PubMed

Li, J J; Wang, B Q; Fei, Q; Yang, Y; Li, D

2016-12-01

In order to screen the altered gene expression profile in peripheral blood mononuclear cells of patients with osteoporosis, we performed an integrated analysis of the online microarray studies of osteoporosis. We searched the Gene Expression Omnibus (GEO) database for microarray studies of peripheral blood mononuclear cells in patients with osteoporosis. Subsequently, we integrated gene expression data sets from multiple microarray studies to obtain differentially expressed genes (DEGs) between patients with osteoporosis and normal controls. Gene function analysis was performed to uncover the functions of identified DEGs. A total of three microarray studies were selected for integrated analysis. In all, 1125 genes were found to be significantly differentially expressed between osteoporosis patients and normal controls, with 373 upregulated and 752 downregulated genes. Positive regulation of the cellular amino metabolic process (gene ontology (GO): 0033240, false discovery rate (FDR) = 1.00E + 00) was significantly enriched under the GO category for biological processes, while for molecular functions, flavin adenine dinucleotide binding (GO: 0050660, FDR = 3.66E-01) and androgen receptor binding (GO: 0050681, FDR = 6.35E-01) were significantly enriched. DEGs were enriched in many osteoporosis-related signalling pathways, including those of mitogen-activated protein kinase (MAPK) and calcium. Protein-protein interaction (PPI) network analysis showed that the significant hub proteins contained ubiquitin specific peptidase 9, X-linked (Degree = 99), ubiquitin specific peptidase 19 (Degree = 57) and ubiquitin conjugating enzyme E2 B (Degree = 57). Analysis of gene function of identified differentially expressed genes may expand our understanding of fundamental mechanisms leading to osteoporosis. Moreover, significantly enriched pathways, such as MAPK and calcium, may involve in osteoporosis through osteoblastic differentiation and bone formation.Cite this article: J. J. Li, B. Q. Wang, Q. Fei, Y. Yang, D. Li. Identification of candidate genes in osteoporosis by integrated microarray analysis. Bone Joint Res 2016;5:594-601. DOI: 10.1302/2046-3758.512.BJR-2016-0073.R1. © 2016 Fei et al.

Genetic basis of HDL variation in 129/SvImJ and C57BL/6J mice: importance of testing candidate genes in targeted mutant mice.

PubMed

Su, Zhiguang; Wang, Xiaosong; Tsaih, Shirng-Wern; Zhang, Aihong; Cox, Allison; Sheehan, Susan; Paigen, Beverly

2009-01-01

To evaluate the effect of genetic background on high-density lipoprotein cholesterol (HDL) levels in Soat1(-/-) mice, we backcrossed sterol O-acyltransferase 1 (Soat1)(-/-) mice, originally reported to have elevated HDL levels, to C57BL/6 mice and constructed a congenic strain with only a small region (3.3Mb) of 129 alleles, specifically excluding the nearby apolipoprotein A-II (Apoa2) gene from 129. HDL levels in these Soat1(-/-) mice were no different from C57BL/6, indicating that the passenger gene Apoa2 caused the previously reported elevation of HDL in these Soat1(-/-) mice. Because many knockouts are made in strain 129 and then subsequently backcrossed into C57BL/6, it is important to identify quantitative trait loci (QTL) that differ between 129 and C57BL/6 so that one can guard against effects ascribed to a knockout but really caused by a passenger gene from 129. To provide such data, we generated 528 F(2) progeny from an intercross of 129S1/SvImJ and C57BL/6 and measured HDL concentrations in F(2) animals first fed chow and then atherogenic diet. A genome wide scan using 508 single-nucleotide polymorphisms (SNPs) identified 19 QTL, 2 of which were male specific and 2 were female specific. Using comparative genomics and haplotype analysis, we narrowed QTL on chromosomes 3, 5, 8, 17, and 18 to 0.5, 6.3, 2.6, 1.1, and 0.6 Mb, respectively. These data will serve as a reference for any effort to test the impact of candidate genes on HDL using a knockout strategy.

Candidate gene prioritization by network analysis of differential expression using machine learning approaches

PubMed Central

2010-01-01

Background Discovering novel disease genes is still challenging for diseases for which no prior knowledge - such as known disease genes or disease-related pathways - is available. Performing genetic studies frequently results in large lists of candidate genes of which only few can be followed up for further investigation. We have recently developed a computational method for constitutional genetic disorders that identifies the most promising candidate genes by replacing prior knowledge by experimental data of differential gene expression between affected and healthy individuals. To improve the performance of our prioritization strategy, we have extended our previous work by applying different machine learning approaches that identify promising candidate genes by determining whether a gene is surrounded by highly differentially expressed genes in a functional association or protein-protein interaction network. Results We have proposed three strategies scoring disease candidate genes relying on network-based machine learning approaches, such as kernel ridge regression, heat kernel, and Arnoldi kernel approximation. For comparison purposes, a local measure based on the expression of the direct neighbors is also computed. We have benchmarked these strategies on 40 publicly available knockout experiments in mice, and performance was assessed against results obtained using a standard procedure in genetics that ranks candidate genes based solely on their differential expression levels (Simple Expression Ranking). Our results showed that our four strategies could outperform this standard procedure and that the best results were obtained using the Heat Kernel Diffusion Ranking leading to an average ranking position of 8 out of 100 genes, an AUC value of 92.3% and an error reduction of 52.8% relative to the standard procedure approach which ranked the knockout gene on average at position 17 with an AUC value of 83.7%. Conclusion In this study we could identify promising candidate genes using network based machine learning approaches even if no knowledge is available about the disease or phenotype. PMID:20840752

A candidate gene for autoimmune myasthenia gravis

PubMed Central

Landouré, Guida; Knight, Melanie A.; Stanescu, Horia; Taye, Addis A.; Shi, Yijun; Diallo, Oumarou; Johnson, Janel O.; Hernandez, Dena; Traynor, Bryan J.; Biesecker, Leslie G.; Elkahloun, Abdel; Rinaldi, Carlo; Vincent, Angela; Willcox, Nick; Kleta, Robert; Fischbeck, Kenneth H.

2012-01-01

Objective: We sought to identify a causative mutation in a previously reported kindred with parental consanguinity and 5 of 10 siblings with adult-onset autoimmune myasthenia gravis. Methods: We performed genome-wide homozygosity mapping, and sequenced all known genes in the one region of extended homozygosity. Quantitative and allele-specific reverse transcriptase PCR (RT-PCR) were performed on a candidate gene to determine the RNA expression level in affected siblings and controls and the relative abundance of the wild-type and mutant alleles in a heterozygote. Results: A region of shared homozygosity at chromosome 13q13.3–13q14.11 was found in 4 affected siblings and 1 unaffected sibling. A homozygous single nucleotide variant was found in the 3′-untranslated region of the ecto-NADH oxidase 1 gene (ENOX1). No other variants likely to be pathogenic were found in genes in this region or elsewhere. The ENOX1 sequence variant was not found in 764 controls. Quantitative RT-PCR showed that expression of ENOX1 decreased to about 20% of normal levels in lymphoblastoid cells from individuals homozygous for the variant and to about 50% in 2 unaffected heterozygotes. Allele-specific RT-PCR showed a 55%–60% reduction in the level of the variant transcript in heterozygous cells due to reduced mRNA stability. Conclusion: These results indicate that this sequence variant in ENOX1 may contribute to the familial autoimmune myasthenia in these patients. PMID:22744667

Rare copy number variants in patients with congenital conotruncal heart defects.

PubMed

Xie, Hongbo M; Werner, Petra; Stambolian, Dwight; Bailey-Wilson, Joan E; Hakonarson, Hakon; White, Peter S; Taylor, Deanne M; Goldmuntz, Elizabeth

2017-03-01

Previous studies using different cardiac phenotypes, technologies and designs suggest a burden of large, rare or de novo copy number variants (CNVs) in subjects with congenital heart defects. We sought to identify disease-related CNVs, candidate genes, and functional pathways in a large number of cases with conotruncal and related defects that carried no known genetic syndrome. Cases and control samples were divided into two cohorts and genotyped to assess each subject's CNV content. Analyses were performed to ascertain differences in overall CNV prevalence and to identify enrichment of specific genes and functional pathways in conotruncal cases relative to healthy controls. Only findings present in both cohorts are presented. From 973 total conotruncal cases, a burden of rare CNVs was detected in both cohorts. Candidate genes from rare CNVs found in both cohorts were identified based on their association with cardiac development or disease, and/or their reported disruption in published studies. Functional and pathway analyses revealed significant enrichment of terms involved in either heart or early embryonic development. Our study tested one of the largest cohorts specifically with cardiac conotruncal and related defects. These results confirm and extend previous findings that CNVs contribute to disease risk for congenital heart defects in general and conotruncal defects in particular. As disease heterogeneity renders identification of single recurrent genes or loci difficult, functional pathway and gene regulation network analyses appear to be more informative. Birth Defects Research 109:271-295, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Gene Therapy for Neuropathic Pain through siRNA-IRF5 Gene Delivery with Homing Peptides to Microglia.

PubMed

Terashima, Tomoya; Ogawa, Nobuhiro; Nakae, Yuki; Sato, Toshiyuki; Katagi, Miwako; Okano, Junko; Maegawa, Hiroshi; Kojima, Hideto

2018-06-01

Astrocyte- and microglia-targeting peptides were identified and isolated using phage display technology. A series of procedures, including three cycles of both in vivo and in vitro biopanning, was performed separately in astrocytes and in M1 or M2 microglia, yielding 50-58 phage plaques in each cell type. Analyses of the sequences of this collection identified one candidate homing peptide targeting astrocytes (AS1[C-LNSSQPS-C]) and two candidate homing peptides targeting microglia (MG1[C-HHSSSAR-C] and MG2[C-NTGSPYE-C]). To determine peptide specificity for the target cell in vitro, each peptide was synthesized and introduced into the primary cultures of astrocytes or microglia. Those peptides could bind to the target cells and be selectively taken up by the corresponding cell, namely, astrocytes, M1 microglia, or M2 microglia. To confirm cell-specific gene delivery to M1 microglia, the complexes between peptide MG1 and siRNA-interferon regulatory factor 5 were prepared and intrathecally injected into a mouse model of neuropathic pain. The complexes successfully suppressed hyperalgesia with high efficiency in this neuropathic pain model. Here, we describe a novel gene therapy for the treatment neuropathic pain, which has a high potential to be of clinical relevance. This strategy will ensure the targeted delivery of therapeutic genes while minimizing side effects to non-target tissues or cells. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

Multi-breed and multi-trait co-association analysis of meat tenderness and other meat quality traits in three French beef cattle breeds.

PubMed

Ramayo-Caldas, Yuliaxis; Renand, Gilles; Ballester, Maria; Saintilan, Romain; Rocha, Dominique

2016-04-23

Studies to identify markers associated with beef tenderness have focused on Warner-Bratzler shear force (WBSF) but the interplay between the genes associated with WBSF has not been explored. We used the association weight matrix (AWM), a systems biology approach, to identify a set of interacting genes that are co-associated with tenderness and other meat quality traits, and shared across the Charolaise, Limousine and Blonde d'Aquitaine beef cattle breeds. Genome-wide association studies were performed using ~500K single nucleotide polymorphisms (SNPs) and 17 phenotypes measured on more than 1000 animals for each breed. First, this multi-trait approach was applied separately for each breed across 17 phenotypes and second, between- and across-breed comparisons at the AWM and functional levels were performed. Genetic heterogeneity was observed, and most of the variants that were associated with WBSF segregated within rather than across breeds. We identified 206 common candidate genes associated with WBSF across the three breeds. SNPs in these common genes explained between 28 and 30 % of the phenotypic variance for WBSF. A reduced number of common SNPs mapping to the 206 common genes were identified, suggesting that different mutations may target the same genes in a breed-specific manner. Therefore, it is likely that, depending on allele frequencies and linkage disequilibrium patterns, a SNP that is identified for one breed may not be informative for another unrelated breed. Well-known candidate genes affecting beef tenderness were identified. In addition, some of the 206 common genes are located within previously reported quantitative trait loci for WBSF in several cattle breeds. Moreover, the multi-breed co-association analysis detected new candidate genes, regulators and metabolic pathways that are likely involved in the determination of meat tenderness and other meat quality traits in beef cattle. Our results suggest that systems biology approaches that explore associations of correlated traits increase statistical power to identify candidate genes beyond the one-dimensional approach. Further studies on the 206 common genes, their pathways, regulators and interactions will expand our knowledge on the molecular basis of meat tenderness and could lead to the discovery of functional mutations useful for genomic selection in a multi-breed beef cattle context.

Construction of a high-density genetic map by specific locus amplified fragment sequencing (SLAF-seq) and its application to Quantitative Trait Loci (QTL) analysis for boll weight in upland cotton (Gossypium hirsutum.).

PubMed

Zhang, Zhen; Shang, Haihong; Shi, Yuzhen; Huang, Long; Li, Junwen; Ge, Qun; Gong, Juwu; Liu, Aiying; Chen, Tingting; Wang, Dan; Wang, Yanling; Palanga, Koffi Kibalou; Muhammad, Jamshed; Li, Weijie; Lu, Quanwei; Deng, Xiaoying; Tan, Yunna; Song, Weiwu; Cai, Juan; Li, Pengtao; Rashid, Harun or; Gong, Wankui; Yuan, Youlu

2016-04-11

Upland Cotton (Gossypium hirsutum) is one of the most important worldwide crops it provides natural high-quality fiber for the industrial production and everyday use. Next-generation sequencing is a powerful method to identify single nucleotide polymorphism markers on a large scale for the construction of a high-density genetic map for quantitative trait loci mapping. In this research, a recombinant inbred lines population developed from two upland cotton cultivars 0-153 and sGK9708 was used to construct a high-density genetic map through the specific locus amplified fragment sequencing method. The high-density genetic map harbored 5521 single nucleotide polymorphism markers which covered a total distance of 3259.37 cM with an average marker interval of 0.78 cM without gaps larger than 10 cM. In total 18 quantitative trait loci of boll weight were identified as stable quantitative trait loci and were detected in at least three out of 11 environments and explained 4.15-16.70 % of the observed phenotypic variation. In total, 344 candidate genes were identified within the confidence intervals of these stable quantitative trait loci based on the cotton genome sequence. These genes were categorized based on their function through gene ontology analysis, Kyoto Encyclopedia of Genes and Genomes analysis and eukaryotic orthologous groups analysis. This research reported the first high-density genetic map for Upland Cotton (Gossypium hirsutum) with a recombinant inbred line population using single nucleotide polymorphism markers developed by specific locus amplified fragment sequencing. We also identified quantitative trait loci of boll weight across 11 environments and identified candidate genes within the quantitative trait loci confidence intervals. The results of this research would provide useful information for the next-step work including fine mapping, gene functional analysis, pyramiding breeding of functional genes as well as marker-assisted selection.

‘Obesity’ is healthy for cetaceans? Evidence from pervasive positive selection in genes related to triacylglycerol metabolism

PubMed Central

Wang, Zhengfei; Chen, Zhuo; Xu, Shixia; Ren, Wenhua; Zhou, Kaiya; Yang, Guang

2015-01-01

Cetaceans are a group of secondarily adapted marine mammals with an enigmatic history of transition from terrestrial to fully aquatic habitat and subsequent adaptive radiation in waters around the world. Numerous physiological and morphological cetacean characteristics have been acquired in response to this drastic habitat transition; for example, the thickened blubber is one of the most striking changes that increases their buoyancy, supports locomotion, and provides thermal insulation. However, the genetic basis underlying the blubber thickening in cetaceans remains poorly explored. Here, 88 candidate genes associated with triacylglycerol metabolism were investigated in representative cetaceans and other mammals to test whether the thickened blubber matched adaptive evolution of triacylglycerol metabolism-related genes. Positive selection was detected in 41 of the 88 candidate genes, and functional characterization of these genes indicated that these are involved mainly in triacylglycerol synthesis and lipolysis processes. In addition, some essential regulatory genes underwent significant positive selection in cetacean-specific lineages, whereas no selection signal was detected in the counterpart terrestrial mammals. The extensive occurrence of positive selection in triacylglycerol metabolism-related genes is suggestive of their essential role in secondary adaptation to an aquatic life, and further implying that ‘obesity’ might be an indicator of good health for cetaceans. PMID:26381091

'Obesity' is healthy for cetaceans? Evidence from pervasive positive selection in genes related to triacylglycerol metabolism.

PubMed

Wang, Zhengfei; Chen, Zhuo; Xu, Shixia; Ren, Wenhua; Zhou, Kaiya; Yang, Guang

2015-09-18

Cetaceans are a group of secondarily adapted marine mammals with an enigmatic history of transition from terrestrial to fully aquatic habitat and subsequent adaptive radiation in waters around the world. Numerous physiological and morphological cetacean characteristics have been acquired in response to this drastic habitat transition; for example, the thickened blubber is one of the most striking changes that increases their buoyancy, supports locomotion, and provides thermal insulation. However, the genetic basis underlying the blubber thickening in cetaceans remains poorly explored. Here, 88 candidate genes associated with triacylglycerol metabolism were investigated in representative cetaceans and other mammals to test whether the thickened blubber matched adaptive evolution of triacylglycerol metabolism-related genes. Positive selection was detected in 41 of the 88 candidate genes, and functional characterization of these genes indicated that these are involved mainly in triacylglycerol synthesis and lipolysis processes. In addition, some essential regulatory genes underwent significant positive selection in cetacean-specific lineages, whereas no selection signal was detected in the counterpart terrestrial mammals. The extensive occurrence of positive selection in triacylglycerol metabolism-related genes is suggestive of their essential role in secondary adaptation to an aquatic life, and further implying that 'obesity' might be an indicator of good health for cetaceans.

Loci and candidate genes conferring resistance to soybean cyst nematode HG type 2.5.7.

PubMed

Zhao, Xue; Teng, Weili; Li, Yinghui; Liu, Dongyuan; Cao, Guanglu; Li, Dongmei; Qiu, Lijuan; Zheng, Hongkun; Han, Yingpeng; Li, Wenbin

2017-06-14

Soybean (Glycine max L. Merr.) cyst nematode (SCN, Heterodera glycines I,) is a major pest of soybean worldwide. The most effective strategy to control this pest involves the use of resistant cultivars. The aim of the present study was to investigate the genome-wide genetic architecture of resistance to SCN HG Type 2.5.7 (race 1) in landrace and elite cultivated soybeans. A total of 200 diverse soybean accessions were screened for resistance to SCN HG Type 2.5.7 and genotyped through sequencing using the Specific Locus Amplified Fragment Sequencing (SLAF-seq) approach with a 6.14-fold average sequencing depth. A total of 33,194 SNPs were identified with minor allele frequencies (MAF) over 4%, covering 97% of all the genotypes. Genome-wide association mapping (GWAS) revealed thirteen SNPs associated with resistance to SCN HG Type 2.5.7. These SNPs were distributed on five chromosomes (Chr), including Chr7, 8, 14, 15 and 18. Four SNPs were novel resistance loci and nine SNPs were located near known QTL. A total of 30 genes were identified as candidate genes underlying SCN resistance. A total of sixteen novel soybean accessions were identified with significant resistance to HG Type 2.5.7. The beneficial alleles and candidate genes identified by GWAS might be valuable for improving marker-assisted breeding efficiency and exploring the molecular mechanisms underlying SCN resistance.

Bisphenol A-Associated Alterations in the Expression and Epigenetic Regulation of Genes Encoding Xenobiotic Metabolizing Enzymes in Human Fetal Liver

PubMed Central

Nahar, Muna S.; Kim, Jung H.; Sartor, Maureen A.; Dolinoy, Dana C.

2014-01-01

Alterations in xenobiotic metabolizing enzyme (XME) expression across the life course, along with genetic, nutritional, and environmental regulation, can influence how organisms respond to toxic insults. In this study, we investigated the hypothesis that in utero exposure to the endocrine active compound, bisphenol A (BPA), influences expression and epigenetic regulation of phase I and II XME genes during development. Using healthy 1st to 2nd trimester human fetal liver specimens quantified for internal BPA levels, we examined XME gene expression using PCR Array (n =8) and RNA-sequencing (n =12) platforms. Of the greater than 160 XME genes assayed, 2 phase I and 12 phase II genes exhibited significantly reduced expression with higher BPA levels, including isoforms from the carboxylesterase, catechol O-methyltransferase, glutathione S-transferase, sulfotransferase, and UDP-glucuronosyltransferase families. When the promoters of these candidate genes were evaluated in silico, putative binding sites for the E-twenty-six (ETS) and activator protein1 (AP1) related transcription factor families were identified and unique to 97% of all candidate transcripts. Interestingly, many ETS binding sites contain cytosine-guanine dinucleotides (CpGs) within their consensus sequences. Thus, quantitative analysis of CpG methylation of three candidate genes was conducted across n =50 samples. Higher BPA levels were associated with increased site-specific methylation at COMT (P <0.005) and increased average methylation at SULT2A1 (P <0.020) promoters. While toxicological studies have traditionally focused on high-dose effects and hormonal receptor mediated regulation, our findings suggest the importance of low-dose effects and nonclassical mechanisms of endocrine disruption during development. PMID:24214726

Genetic Predictors of Susceptibility to Cutaneous Fungal Infections: a pilot Genome Wide Association Study to Refine a Candidate Gene Search

PubMed Central

Abdel-Rahman, Susan M.; Preuett, Barry L.

2012-01-01

Background Trichophyton tonsurans is the foremost fungal pathogen of minority children in the U.S. Despite overwhelming infection rates, it does not appear that this fungus infects children in a non-specific manner. Objective This study was designed to identify genes that may predispose or protect a child from T. tonsurans infection. Methods Children participating in an earlier longitudinal study wherein infection rates could be reliably determined were eligible for inclusion. DNA from a subset (n=40) of these children at the population extremes underwent whole genome genotyping (WGG). Allele frequencies between cases and controls were examined and significant SNPs were used to develop a candidate gene list for which the remainder of the cohort (n=115) were genotyped. Cumulative infection rate was examined by genotype and the ability of selected genotypes to predict the likelihood of infection explored by multivariable analysis. Results 23 genes with a putative mechanistic role in cutaneous infection were selected for evaluation. Of these, 21 demonstrated significant differences in infection rate between genotypes. A risk index assigned to genotypes in the 21 genes accounted for over 60% of the variability observed in infection rate (adjusted r2=0.665, p<0.001). Among these, 8 appeared to account for the majority of variability that was observed (r2=0.603, p<0.001). These included genes involved in: leukocyte activation and migration, extracellular matrix integrity and remodeling, epidermal maintenance and wound repair, and cutaneous permeability. Conclusions Applying WGG to individuals at the extremes of phenotype can help to guide the selection of candidate genes in populations of small cohorts where disease etiology is likely polygenic in nature. PMID:22704677

Computational discovery of pathway-level genetic vulnerabilities in non-small-cell lung cancer | Office of Cancer Genomics

Cancer.gov

Novel approaches are needed for discovery of targeted therapies for non-small-cell lung cancer (NSCLC) that are specific to certain patients. Whole genome RNAi screening of lung cancer cell lines provides an ideal source for determining candidate drug targets. Unsupervised learning algorithms uncovered patterns of differential vulnerability across lung cancer cell lines to loss of functionally related genes. Such genetic vulnerabilities represent candidate targets for therapy and are found to be involved in splicing, translation and protein folding.

Topological analysis of metabolic networks integrating co-segregating transcriptomes and metabolomes in type 2 diabetic rat congenic series.

PubMed

Dumas, Marc-Emmanuel; Domange, Céline; Calderari, Sophie; Martínez, Andrea Rodríguez; Ayala, Rafael; Wilder, Steven P; Suárez-Zamorano, Nicolas; Collins, Stephan C; Wallis, Robert H; Gu, Quan; Wang, Yulan; Hue, Christophe; Otto, Georg W; Argoud, Karène; Navratil, Vincent; Mitchell, Steve C; Lindon, John C; Holmes, Elaine; Cazier, Jean-Baptiste; Nicholson, Jeremy K; Gauguier, Dominique

2016-09-30

The genetic regulation of metabolic phenotypes (i.e., metabotypes) in type 2 diabetes mellitus occurs through complex organ-specific cellular mechanisms and networks contributing to impaired insulin secretion and insulin resistance. Genome-wide gene expression profiling systems can dissect the genetic contributions to metabolome and transcriptome regulations. The integrative analysis of multiple gene expression traits and metabolic phenotypes (i.e., metabotypes) together with their underlying genetic regulation remains a challenge. Here, we introduce a systems genetics approach based on the topological analysis of a combined molecular network made of genes and metabolites identified through expression and metabotype quantitative trait locus mapping (i.e., eQTL and mQTL) to prioritise biological characterisation of candidate genes and traits. We used systematic metabotyping by 1 H NMR spectroscopy and genome-wide gene expression in white adipose tissue to map molecular phenotypes to genomic blocks associated with obesity and insulin secretion in a series of rat congenic strains derived from spontaneously diabetic Goto-Kakizaki (GK) and normoglycemic Brown-Norway (BN) rats. We implemented a network biology strategy approach to visualize the shortest paths between metabolites and genes significantly associated with each genomic block. Despite strong genomic similarities (95-99 %) among congenics, each strain exhibited specific patterns of gene expression and metabotypes, reflecting the metabolic consequences of series of linked genetic polymorphisms in the congenic intervals. We subsequently used the congenic panel to map quantitative trait loci underlying specific mQTLs and genome-wide eQTLs. Variation in key metabolites like glucose, succinate, lactate, or 3-hydroxybutyrate and second messenger precursors like inositol was associated with several independent genomic intervals, indicating functional redundancy in these regions. To navigate through the complexity of these association networks we mapped candidate genes and metabolites onto metabolic pathways and implemented a shortest path strategy to highlight potential mechanistic links between metabolites and transcripts at colocalized mQTLs and eQTLs. Minimizing the shortest path length drove prioritization of biological validations by gene silencing. These results underline the importance of network-based integration of multilevel systems genetics datasets to improve understanding of the genetic architecture of metabotype and transcriptomic regulation and to characterize novel functional roles for genes determining tissue-specific metabolism.

Identification of a duplication within the GDF9 gene and novel candidate genes for primary ovarian insufficiency (POI) by a customized high-resolution array comparative genomic hybridization platform.

PubMed

Norling, A; Hirschberg, A L; Rodriguez-Wallberg, K A; Iwarsson, E; Wedell, A; Barbaro, M

2014-08-01

Can high-resolution array comparative genomic hybridization (CGH) analysis of DNA samples from women with primary ovarian insufficiency (POI) improve the diagnosis of the condition and identify novel candidate genes for POI? A mutation affecting the regulatory region of growth differentiation factor 9 (GDF9) was identified for the first time together with several novel candidate genes for POI. Most patients with POI do not receive a molecular diagnosis despite a significant genetic component in the pathogenesis. We performed a case-control study. Twenty-six patients were analyzed by array CGH for identification of copy number variants. Novel changes were investigated in 95 controls and in a separate population of 28 additional patients with POI. The experimental procedures were performed during a 1-year period. DNA samples from 26 patients with POI were analyzed by a customized 1M array-CGH platform with whole genome coverage and probe enrichment targeting 78 genes in sex development. By PCR amplification and sequencing, the breakpoint of an identified partial GDF9 gene duplication was characterized. A multiplex ligation-dependent probe amplification (MLPA) probe set for specific identification of deletions/duplications affecting GDF9 was developed. An MLPA probe set for the identification of additional cases or controls carrying novel candidate regions identified by array-CGH was developed. Sequencing of three candidate genes was performed. Eleven unique copy number changes were identified in a total of 11 patients, including a tandem duplication of 475 bp, containing part of the GDF9 gene promoter region. The duplicated region contains three NOBOX-binding elements and an E-box, important for GDF9 gene regulation. This aberration is likely causative of POI. Fifty-four patients were investigated for copy number changes within GDF9, but no additional cases were found. Ten aberrations constituting novel candidate regions were detected, including a second DNAH6 deletion in a patient with POI. Other identified candidate genes were TSPYL6, SMARCC1, CSPG5 and ZFR2. This is a descriptive study and no functional experiments were performed. The study illustrates the importance of analyzing small copy number changes in addition to sequence alterations in the genetic investigation of patients with POI. Also, promoter regions should be included in the investigation. The study was supported by grants from the Swedish Research council (project no 12198 to A.W. and project no 20324 to A.L.H.), Stockholm County Council (E.I., A.W. and K.R.W.), Foundation Frimurare Barnhuset (A.N., A.W. and M.B.), Karolinska Institutet (A.N., A.L.H., E.I., A.W. and M.B.), Novo Nordic Foundation (A.W.) and Svenska Läkaresällskapet (M.B.). The funding sources had no involvement in the design or analysis of the study. The authors have no competing interests to declare. Not applicable. © The Author 2014. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology.

Prediction of Human Disease Genes by Human-Mouse Conserved Coexpression Analysis

PubMed Central

Grassi, Elena; Damasco, Christian; Silengo, Lorenzo; Oti, Martin; Provero, Paolo; Di Cunto, Ferdinando

2008-01-01

Background Even in the post-genomic era, the identification of candidate genes within loci associated with human genetic diseases is a very demanding task, because the critical region may typically contain hundreds of positional candidates. Since genes implicated in similar phenotypes tend to share very similar expression profiles, high throughput gene expression data may represent a very important resource to identify the best candidates for sequencing. However, so far, gene coexpression has not been used very successfully to prioritize positional candidates. Methodology/Principal Findings We show that it is possible to reliably identify disease-relevant relationships among genes from massive microarray datasets by concentrating only on genes sharing similar expression profiles in both human and mouse. Moreover, we show systematically that the integration of human-mouse conserved coexpression with a phenotype similarity map allows the efficient identification of disease genes in large genomic regions. Finally, using this approach on 850 OMIM loci characterized by an unknown molecular basis, we propose high-probability candidates for 81 genetic diseases. Conclusion Our results demonstrate that conserved coexpression, even at the human-mouse phylogenetic distance, represents a very strong criterion to predict disease-relevant relationships among human genes. PMID:18369433

Targeted and Untargeted Approaches Unravel Novel Candidate Genes and Diagnostic SNPs for Quantitative Resistance of the Potato (Solanum tuberosum L.) to Phytophthora infestans Causing the Late Blight Disease.

PubMed

Mosquera, Teresa; Alvarez, Maria Fernanda; Jiménez-Gómez, José M; Muktar, Meki Shehabu; Paulo, Maria João; Steinemann, Sebastian; Li, Jinquan; Draffehn, Astrid; Hofmann, Andrea; Lübeck, Jens; Strahwald, Josef; Tacke, Eckhard; Hofferbert, Hans-Reinhardt; Walkemeier, Birgit; Gebhardt, Christiane

2016-01-01

The oomycete Phytophthora infestans causes late blight of potato, which can completely destroy the crop. Therefore, for the past 160 years, late blight has been the most important potato disease worldwide. The identification of cultivars with high and durable field resistance to P. infestans is an objective of most potato breeding programs. This type of resistance is polygenic and therefore quantitative. Its evaluation requires multi-year and location trials. Furthermore, quantitative resistance to late blight correlates with late plant maturity, a negative agricultural trait. Knowledge of the molecular genetic basis of quantitative resistance to late blight not compromised by late maturity is very limited. It is however essential for developing diagnostic DNA markers that facilitate the efficient combination of superior resistance alleles in improved cultivars. We used association genetics in a population of 184 tetraploid potato cultivars in order to identify single nucleotide polymorphisms (SNPs) that are associated with maturity corrected resistance (MCR) to late blight. The population was genotyped for almost 9000 SNPs from three different sources. The first source was candidate genes specifically selected for their function in the jasmonate pathway. The second source was novel candidate genes selected based on comparative transcript profiling (RNA-Seq) of groups of genotypes with contrasting levels of quantitative resistance to P. infestans. The third source was the first generation 8.3k SolCAP SNP genotyping array available in potato for genome wide association studies (GWAS). Twenty seven SNPs from all three sources showed robust association with MCR. Some of those were located in genes that are strong candidates for directly controlling quantitative resistance, based on functional annotation. Most important were: a lipoxygenase (jasmonate pathway), a 3-hydroxy-3-methylglutaryl coenzyme A reductase (mevalonate pathway), a P450 protein (terpene biosynthesis), a transcription factor and a homolog of a major gene for resistance to P. infestans from the wild potato species Solanum venturii. The candidate gene approach and GWAS complemented each other as they identified different genes. The results of this study provide new insight in the molecular genetic basis of quantitative resistance in potato and a toolbox of diagnostic SNP markers for breeding applications.

Targeted and Untargeted Approaches Unravel Novel Candidate Genes and Diagnostic SNPs for Quantitative Resistance of the Potato (Solanum tuberosum L.) to Phytophthora infestans Causing the Late Blight Disease

PubMed Central

Jiménez-Gómez, José M.; Muktar, Meki Shehabu; Paulo, Maria João; Steinemann, Sebastian; Li, Jinquan; Draffehn, Astrid; Hofmann, Andrea; Lübeck, Jens; Strahwald, Josef; Tacke, Eckhard; Hofferbert, Hans-Reinhardt; Walkemeier, Birgit; Gebhardt, Christiane

2016-01-01

The oomycete Phytophthora infestans causes late blight of potato, which can completely destroy the crop. Therefore, for the past 160 years, late blight has been the most important potato disease worldwide. The identification of cultivars with high and durable field resistance to P. infestans is an objective of most potato breeding programs. This type of resistance is polygenic and therefore quantitative. Its evaluation requires multi-year and location trials. Furthermore, quantitative resistance to late blight correlates with late plant maturity, a negative agricultural trait. Knowledge of the molecular genetic basis of quantitative resistance to late blight not compromised by late maturity is very limited. It is however essential for developing diagnostic DNA markers that facilitate the efficient combination of superior resistance alleles in improved cultivars. We used association genetics in a population of 184 tetraploid potato cultivars in order to identify single nucleotide polymorphisms (SNPs) that are associated with maturity corrected resistance (MCR) to late blight. The population was genotyped for almost 9000 SNPs from three different sources. The first source was candidate genes specifically selected for their function in the jasmonate pathway. The second source was novel candidate genes selected based on comparative transcript profiling (RNA-Seq) of groups of genotypes with contrasting levels of quantitative resistance to P. infestans. The third source was the first generation 8.3k SolCAP SNP genotyping array available in potato for genome wide association studies (GWAS). Twenty seven SNPs from all three sources showed robust association with MCR. Some of those were located in genes that are strong candidates for directly controlling quantitative resistance, based on functional annotation. Most important were: a lipoxygenase (jasmonate pathway), a 3-hydroxy-3-methylglutaryl coenzyme A reductase (mevalonate pathway), a P450 protein (terpene biosynthesis), a transcription factor and a homolog of a major gene for resistance to P. infestans from the wild potato species Solanum venturii. The candidate gene approach and GWAS complemented each other as they identified different genes. The results of this study provide new insight in the molecular genetic basis of quantitative resistance in potato and a toolbox of diagnostic SNP markers for breeding applications. PMID:27281327

Downregulation of the expression of mitochondrial electron transport complex genes in autism brains.

PubMed

Anitha, Ayyappan; Nakamura, Kazuhiko; Thanseem, Ismail; Matsuzaki, Hideo; Miyachi, Taishi; Tsujii, Masatsugu; Iwata, Yasuhide; Suzuki, Katsuaki; Sugiyama, Toshiro; Mori, Norio

2013-05-01

Mitochondrial dysfunction (MtD) and abnormal brain bioenergetics have been implicated in autism, suggesting possible candidate genes in the electron transport chain (ETC). We compared the expression of 84 ETC genes in the post-mortem brains of autism patients and controls. Brain tissues from the anterior cingulate gyrus, motor cortex, and thalamus of autism patients (n = 8) and controls (n = 10) were obtained from Autism Tissue Program, USA. Quantitative real-time PCR arrays were used to quantify gene expression. We observed reduced expression of several ETC genes in autism brains compared to controls. Eleven genes of Complex I, five genes each of Complex III and Complex IV, and seven genes of Complex V showed brain region-specific reduced expression in autism. ATP5A1 (Complex V), ATP5G3 (Complex V) and NDUFA5 (Complex I) showed consistently reduced expression in all the brain regions of autism patients. Upon silencing ATP5A1, the expression of mitogen-activated protein kinase 13 (MAPK13), a p38 MAPK responsive to stress stimuli, was upregulated in HEK 293 cells. This could have been induced by oxidative stress due to impaired ATP synthesis. We report new candidate genes involved in abnormal brain bioenergetics in autism, supporting the hypothesis that mitochondria, critical for neurodevelopment, may play a role in autism. © 2012 The Authors; Brain Pathology © 2012 International Society of Neuropathology.

SZGR 2.0: a one-stop shop of schizophrenia candidate genes.

PubMed

Jia, Peilin; Han, Guangchun; Zhao, Junfei; Lu, Pinyi; Zhao, Zhongming

2017-01-04

SZGR 2.0 is a comprehensive resource of candidate variants and genes for schizophrenia, covering genetic, epigenetic, transcriptomic, translational and many other types of evidence. By systematic review and curation of multiple lines of evidence, we included almost all variants and genes that have ever been reported to be associated with schizophrenia. In particular, we collected ∼4200 common variants reported in genome-wide association studies, ∼1000 de novo mutations discovered by large-scale sequencing of family samples, 215 genes spanning rare and replication copy number variations, 99 genes overlapping with linkage regions, 240 differentially expressed genes, 4651 differentially methylated genes and 49 genes as antipsychotic drug targets. To facilitate interpretation, we included various functional annotation data, especially brain eQTL, methylation QTL, brain expression featured in deep categorization of brain areas and developmental stages and brain-specific promoter and enhancer annotations. Furthermore, we conducted cross-study, cross-data type and integrative analyses of the multidimensional data deposited in SZGR 2.0, and made the data and results available through a user-friendly interface. In summary, SZGR 2.0 provides a one-stop shop of schizophrenia variants and genes and their function and regulation, providing an important resource in the schizophrenia and other mental disease community. SZGR 2.0 is available at https://bioinfo.uth.edu/SZGR/. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Transcriptome-Wide Identification of Reference Genes for Expression Analysis of Soybean Responses to Drought Stress along the Day.

PubMed

Marcolino-Gomes, Juliana; Rodrigues, Fabiana Aparecida; Fuganti-Pagliarini, Renata; Nakayama, Thiago Jonas; Ribeiro Reis, Rafaela; Bouças Farias, Jose Renato; Harmon, Frank G; Correa Molinari, Hugo Bruno; Correa Molinari, Mayla Daiane; Nepomuceno, Alexandre

2015-01-01

The soybean transcriptome displays strong variation along the day in optimal growth conditions and also in response to adverse circumstances, like drought stress. However, no study conducted to date has presented suitable reference genes, with stable expression along the day, for relative gene expression quantification in combined studies on drought stress and diurnal oscillations. Recently, water deficit responses have been associated with circadian clock oscillations at the transcription level, revealing the existence of hitherto unknown processes and increasing the demand for studies on plant responses to drought stress and its oscillation during the day. We performed data mining from a transcriptome-wide background using microarrays and RNA-seq databases to select an unpublished set of candidate reference genes, specifically chosen for the normalization of gene expression in studies on soybean under both drought stress and diurnal oscillations. Experimental validation and stability analysis in soybean plants submitted to drought stress and sampled during a 24 h timecourse showed that four of these newer reference genes (FYVE, NUDIX, Golgin-84 and CYST) indeed exhibited greater expression stability than the conventionally used housekeeping genes (ELF1-β and β-actin) under these conditions. We also demonstrated the effect of using reference candidate genes with different stability values to normalize the relative expression data from a drought-inducible soybean gene (DREB5) evaluated in different periods of the day.

Identifying metabolic enzymes with multiple types of association evidence

PubMed Central

Kharchenko, Peter; Chen, Lifeng; Freund, Yoav; Vitkup, Dennis; Church, George M

2006-01-01

Background Existing large-scale metabolic models of sequenced organisms commonly include enzymatic functions which can not be attributed to any gene in that organism. Existing computational strategies for identifying such missing genes rely primarily on sequence homology to known enzyme-encoding genes. Results We present a novel method for identifying genes encoding for a specific metabolic function based on a local structure of metabolic network and multiple types of functional association evidence, including clustering of genes on the chromosome, similarity of phylogenetic profiles, gene expression, protein fusion events and others. Using E. coli and S. cerevisiae metabolic networks, we illustrate predictive ability of each individual type of association evidence and show that significantly better predictions can be obtained based on the combination of all data. In this way our method is able to predict 60% of enzyme-encoding genes of E. coli metabolism within the top 10 (out of 3551) candidates for their enzymatic function, and as a top candidate within 43% of the cases. Conclusion We illustrate that a combination of genome context and other functional association evidence is effective in predicting genes encoding metabolic enzymes. Our approach does not rely on direct sequence homology to known enzyme-encoding genes, and can be used in conjunction with traditional homology-based metabolic reconstruction methods. The method can also be used to target orphan metabolic activities. PMID:16571130

Genomic Diversity of Burkholderia pseudomallei Clinical Isolates: Subtractive Hybridization Reveals a Burkholderia mallei-Specific Prophage in B. pseudomallei 1026b

DTIC Science & Technology

2004-06-01

identification of several new virulence gene candidates. In particular, K96243 harbors multiple genomic islands with relatively low GC contents...differences were observed. Prophage-encoded virulence factors in other bacterial species have been described (5), and it was of interest to see if gene ... Xylella fastidiosa (11, 16, 17). The genomic sequencing results for multiple strains of Streptococcus and Xylella suggest that different disease

Genome-wide patterns of genetic distances reveal candidate Loci contributing to human population-specific traits.

PubMed

de Magalhães, João Pedro; Matsuda, Alex

2012-03-01

Modern humans originated in Africa before migrating across the world with founder effects and adaptations to new environments contributing to their present phenotypic diversity. Determining the genetic basis of differences between populations may provide clues about our evolutionary history and may have clinical implications. Herein, we develop a method to detect genes and biological processes in which populations most differ by calculating the genetic distance between modern populations and a hypothetical ancestral population. We apply our method to large-scale single nucleotide polymorphism (SNP) data from human populations of African, European and Asian origin. As expected, ancestral alleles were more conserved in the African populations and we found evidence of high divergence in genes previously suggested as targets of selection related to skin pigmentation, immune response, senses and dietary adaptations. Our genome-wide scan also reveals novel candidates for contributing to population-specific traits. These include genes related to neuronal development and behavior that may have been influenced by cultural processes. Moreover, in the African populations, we found a high divergence in genes related to UV protection and to the male reproductive system. Taken together, these results confirm and expand previous findings, providing new clues about the evolution and genetics of human phenotypic diversity. © 2011 The Authors Annals of Human Genetics © 2011 Blackwell Publishing Ltd/University College London.

The Role of Genetics in IBS

PubMed Central

Saito, Yuri A.

2011-01-01

IBS is a common disorder that has been shown to aggregate in families, to affect multiple generations, but not in a manner consistent with a major Mendelian effect. Relatives of an individual with IBS are two to three times as likely to have IBS, with both genders being affected. The estimated genetic liability ranges between 1–20%, with heritability estimates ranging between 0–57%. Although the role of childhood events such as nasogastric tube placement, poor nutrition, abuse, and other stressors have been clearly associated with IBS, these factors have not been studied in families and are unlikely to completely explain the clustering of bowel dysfunction observed in family studies. Furthermore, the familial clustering of IBS does not appear to be explained by psychological traits, based on family studies as well as candidate gene studies of functional variants associated with other psychiatric disorders. To date, over a hundred genetic variants in over 60 genes from various pathways have been studied in a number of candidate gene studies with several positive associations reported. These findings suggest that there may be distinct, as well as shared, molecular underpinnings for IBS and its subtypes. Much new and confirmatory work remains to be performed to elucidate the role of specific genetic variants in IBS development, as well as the specific ways the genes and environment interact to result in IBS susceptibility. PMID:21333900

Maternal Germline-Specific Genes in the Asian Malaria Mosquito Anopheles stephensi: Characterization and Application for Disease Control

PubMed Central

Biedler, James K.; Qi, Yumin; Pledger, David; Macias, Vanessa M.; James, Anthony A.; Tu, Zhijian

2014-01-01

Anopheles stephensi is a principal vector of urban malaria on the Indian subcontinent and an emerging model for molecular and genetic studies of mosquito biology. To enhance our understanding of female mosquito reproduction, and to develop new tools for basic research and for genetic strategies to control mosquito-borne infectious diseases, we identified 79 genes that displayed previtellogenic germline-specific expression based on RNA-Seq data generated from 11 life stage–specific and sex-specific samples. Analysis of this gene set provided insights into the biology and evolution of female reproduction. Promoters from two of these candidates, vitellogenin receptor and nanos, were used in independent transgenic cassettes for the expression of artificial microRNAs against suspected mosquito maternal-effect genes, discontinuous actin hexagon and myd88. We show these promoters have early germline-specific expression and demonstrate 73% and 42% knockdown of myd88 and discontinuous actin hexagon mRNA in ovaries 48 hr after blood meal, respectively. Additionally, we demonstrate maternal-specific delivery of mRNA and protein to progeny embryos. We discuss the application of this system of maternal delivery of mRNA/miRNA/protein in research on mosquito reproduction and embryonic development, and for the development of a gene drive system based on maternal-effect dominant embryonic arrest. PMID:25480960

Identification of an expressed gene in Dipylidium caninum.

PubMed

Miranda, Rodrigo R C; Costa-Júnior, Livio M; Campos, Artur K; Santos, Hudson A; Rabelo, Elida M L

2004-10-01

Recombinant DNA studies have been focused on developing vaccines to different cestodes. But few studies involving Dipylidium caninum molecular biology and genes have been done. Only partial sequences of mitochondrial DNA and ribosomal RNA gene are available in databases. Any molecular work with this parasite, including epidemiology, study of drug-resistant strains, and vaccine development, is hampered by the lack of knowledge of its genome. Thus, the knowledge of specific genes of different developmental stages of D. caninum is crucial to locate potential targets to be used as candidates to develop a vaccine and/or new drugs against this parasite. Here we report, for the first time, the sequencing of a fragment of a D. caninum expressed gene.

Identifying gene networks underlying the neurobiology of ethanol and alcoholism.

PubMed

Wolen, Aaron R; Miles, Michael F

2012-01-01

For complex disorders such as alcoholism, identifying the genes linked to these diseases and their specific roles is difficult. Traditional genetic approaches, such as genetic association studies (including genome-wide association studies) and analyses of quantitative trait loci (QTLs) in both humans and laboratory animals already have helped identify some candidate genes. However, because of technical obstacles, such as the small impact of any individual gene, these approaches only have limited effectiveness in identifying specific genes that contribute to complex diseases. The emerging field of systems biology, which allows for analyses of entire gene networks, may help researchers better elucidate the genetic basis of alcoholism, both in humans and in animal models. Such networks can be identified using approaches such as high-throughput molecular profiling (e.g., through microarray-based gene expression analyses) or strategies referred to as genetical genomics, such as the mapping of expression QTLs (eQTLs). Characterization of gene networks can shed light on the biological pathways underlying complex traits and provide the functional context for identifying those genes that contribute to disease development.

Expression patterns of ethylene biosynthesis genes from bananas during fruit ripening and in relationship with finger drop

PubMed Central

Hubert, Olivier; Mbéguié-A-Mbéguié, Didier

2012-01-01

Background and aims Banana finger drop is defined as dislodgement of individual fruits from the hand at the pedicel rupture area. For some banana varieties, this is a major feature of the ripening process, in addition to ethylene production and sugar metabolism. The few studies devoted to assessing the physiological and molecular basis of this process revealed (i) the similarity between this process and softening, (ii) the early onset of related molecular events, between the first and fourth day after ripening induction, and (iii) the putative involvement of ethylene as a regulatory factor. This study was conducted with the aim of identifying, through a candidate gene approach, a quality-related marker that could be used as a tool in breeding programmes. Here we examined the relationship between ripening ethylene biosynthesis (EB) and finger drop in order to gain further insight into the upstream regulatory steps of the banana finger drop process and to identify putative related candidate genes. Methods Postharvest ripening of green banana fruit was induced by acetylene treatment and fruit taken at 1–4 days after ripening induction, and total RNA extracted from the median area [control zone (CZ)] and the pedicel rupture area [drop zone (DZ)] of peel tissue. Then the expression patterns of EB genes (MaACO1, MaACO2, MaACS1, MaACS2, MaACS3 and MaACS4) were comparatively examined in CZ and DZ via real-time quantitative polymerase chain reaction. Principal results Differential expression of EB gene was observed in CZ and DZ during the postharvest period examined in this study. MaACO1, MaACS2 and MaACS1 were more highly induced in DZ than in the control, while a slight induction of the MaACS4 gene was observed. No marked differences between the two zones were observed for the MaACO2 gene. Conclusions The finger drop process enhanced EB gene expression including developmental- and ripening-induced genes (MaACO1), specific ripening-induced genes (MaACS1) and wound-induced genes (MaACS2). Thus, this process might be associated with a specific ethylene production in DZ of the pedicel area and the result of crosstalk between developmental, ripening and wound regulatory pathways. MaACO1, MaACS1, MaACS2, and to a lesser extent MaACS4 genes, which are more highly induced in DZ than in CZ, could be considered as putative candidates of the finger drop process. PMID:23267429

Identification of Inherited Retinal Disease-Associated Genetic Variants in 11 Candidate Genes.

PubMed

Astuti, Galuh D N; van den Born, L Ingeborgh; Khan, M Imran; Hamel, Christian P; Bocquet, Béatrice; Manes, Gaël; Quinodoz, Mathieu; Ali, Manir; Toomes, Carmel; McKibbin, Martin; El-Asrag, Mohammed E; Haer-Wigman, Lonneke; Inglehearn, Chris F; Black, Graeme C M; Hoyng, Carel B; Cremers, Frans P M; Roosing, Susanne

2018-01-10

Inherited retinal diseases (IRDs) display an enormous genetic heterogeneity. Whole exome sequencing (WES) recently identified genes that were mutated in a small proportion of IRD cases. Consequently, finding a second case or family carrying pathogenic variants in the same candidate gene often is challenging. In this study, we searched for novel candidate IRD gene-associated variants in isolated IRD families, assessed their causality, and searched for novel genotype-phenotype correlations. Whole exome sequencing was performed in 11 probands affected with IRDs. Homozygosity mapping data was available for five cases. Variants with minor allele frequencies ≤ 0.5% in public databases were selected as candidate disease-causing variants. These variants were ranked based on their: (a) presence in a gene that was previously implicated in IRD; (b) minor allele frequency in the Exome Aggregation Consortium database (ExAC); (c) in silico pathogenicity assessment using the combined annotation dependent depletion (CADD) score; and (d) interaction of the corresponding protein with known IRD-associated proteins. Twelve unique variants were found in 11 different genes in 11 IRD probands. Novel autosomal recessive and dominant inheritance patterns were found for variants in Small Nuclear Ribonucleoprotein U5 Subunit 200 ( SNRNP200 ) and Zinc Finger Protein 513 ( ZNF513 ), respectively. Using our pathogenicity assessment, a variant in DEAH-Box Helicase 32 ( DHX32 ) was the top ranked novel candidate gene to be associated with IRDs, followed by eight medium and lower ranked candidate genes. The identification of candidate disease-associated sequence variants in 11 single families underscores the notion that the previously identified IRD-associated genes collectively carry > 90% of the defects implicated in IRDs. To identify multiple patients or families with variants in the same gene and thereby provide extra proof for pathogenicity, worldwide data sharing is needed.

Identification of parental line specific effects of MLF2 on resistance to coccidiosis in chickens

PubMed Central

2011-01-01

Background MLF2 was the candidate gene associated with coccidiosis resistance in chickens. Although single marker analysis supported the association between MLF2 and coccidiosis resistance, causative mutation relevant to coccidiosis was not identified yet. Thus, this study suggested segregation analysis of MLF2 haplotype and the association test of the other candidate genes using improved data transformation. Results A haplotype probably originated from one parental line was found out of 4 major haplotypes of MLF2. Frequency of this haplotype was 0.2 in parental chickens and its offspring in 12 families. Allele substitution effect of the MLF2 haplotype originated from a specific line was associated with increased body weight and fecal egg count explaining coccidiosis resistance. Nevertheless Box-Cox transformation was able to improve normality; association test did not produce obvious different results compared with analysis with log transformed phenotype. Conclusion Allele substitution effect analysis and classification of MLF2 haplotype identified the segregation of haplotype associated with coccidiosis resistance. The haplotype originated from a specific parental line was associated with improving disease resistance. Estimating effect of MLF2 haplotype on coccidiosis resistance will provide useful information for selecting animals or lines for future study. PMID:21645301

Hybridization-based antibody cDNA recovery for the production of recombinant antibodies identified by repertoire sequencing.

PubMed

Valdés-Alemán, Javier; Téllez-Sosa, Juan; Ovilla-Muñoz, Marbella; Godoy-Lozano, Elizabeth; Velázquez-Ramírez, Daniel; Valdovinos-Torres, Humberto; Gómez-Barreto, Rosa E; Martinez-Barnetche, Jesús

2014-01-01

High-throughput sequencing of the antibody repertoire is enabling a thorough analysis of B cell diversity and clonal selection, which may improve the novel antibody discovery process. Theoretically, an adequate bioinformatic analysis could allow identification of candidate antigen-specific antibodies, requiring their recombinant production for experimental validation of their specificity. Gene synthesis is commonly used for the generation of recombinant antibodies identified in silico. Novel strategies that bypass gene synthesis could offer more accessible antibody identification and validation alternatives. We developed a hybridization-based recovery strategy that targets the complementarity-determining region 3 (CDRH3) for the enrichment of cDNA of candidate antigen-specific antibody sequences. Ten clonal groups of interest were identified through bioinformatic analysis of the heavy chain antibody repertoire of mice immunized with hen egg white lysozyme (HEL). cDNA from eight of the targeted clonal groups was recovered efficiently, leading to the generation of recombinant antibodies. One representative heavy chain sequence from each clonal group recovered was paired with previously reported anti-HEL light chains to generate full antibodies, later tested for HEL-binding capacity. The recovery process proposed represents a simple and scalable molecular strategy that could enhance antibody identification and specificity assessment, enabling a more cost-efficient generation of recombinant antibodies.

Comparative transcriptome analysis of stylar canal cells identifies novel candidate genes implicated in the self-incompatibility response of Citrus clementina

PubMed Central

2012-01-01

Background Reproductive biology in citrus is still poorly understood. Although in recent years several efforts have been made to study pollen-pistil interaction and self-incompatibility, little information is available about the molecular mechanisms regulating these processes. Here we report the identification of candidate genes involved in pollen-pistil interaction and self-incompatibility in clementine (Citrus clementina Hort. ex Tan.). These genes have been identified comparing the transcriptomes of laser-microdissected stylar canal cells (SCC) isolated from two genotypes differing for self-incompatibility response ('Comune', a self-incompatible cultivar and 'Monreal', a self- compatible mutation of 'Comune'). Results The transcriptome profiling of SCC indicated that the differential regulation of few specific, mostly uncharacterized transcripts is associated with the breakdown of self-incompatibility in 'Monreal'. Among them, a novel F-box gene showed a drastic up-regulation both in laser microdissected stylar canal cells and in self-pollinated whole styles with stigmas of 'Comune' in concomitance with the arrest of pollen tube growth. Moreover, we identify a non-characterized gene family as closely associated to the self-incompatibility genetic program activated in 'Comune'. Three different aspartic-acid rich (Asp-rich) protein genes, located in tandem in the clementine genome, were over-represented in the transcriptome of 'Comune'. These genes are tightly linked to a DELLA gene, previously found to be up-regulated in the self-incompatible genotype during pollen-pistil interaction. Conclusion The highly specific transcriptome survey of the stylar canal cells identified novel genes which have not been previously associated with self-pollen rejection in citrus and in other plant species. Bioinformatic and transcriptional analyses suggested that the mutation leading to self-compatibility in 'Monreal' affected the expression of non-homologous genes located in a restricted genome region. Also, we hypothesize that the Asp-rich protein genes may act as Ca2+ "entrapping" proteins, potentially regulating Ca2+ homeostasis during self-pollen recognition. PMID:22333138

Novel microcephalic primordial dwarfism disorder associated with variants in the centrosomal protein ninein.

PubMed

Dauber, Andrew; Lafranchi, Stephen H; Maliga, Zoltan; Lui, Julian C; Moon, Jennifer E; McDeed, Cailin; Henke, Katrin; Zonana, Jonathan; Kingman, Garrett A; Pers, Tune H; Baron, Jeffrey; Rosenfeld, Ron G; Hirschhorn, Joel N; Harris, Matthew P; Hwa, Vivian

2012-11-01

Microcephalic primordial dwarfism (MPD) is a rare, severe form of human growth failure in which growth restriction is evident in utero and continues into postnatal life. Single causative gene defects have been identified in a number of patients with MPD, and all involve genes fundamental to cellular processes including centrosome functions. The objective of the study was to find the genetic etiology of a novel presentation of MPD. The design of the study was whole-exome sequencing performed on two affected sisters in a single family. Molecular and functional studies of a candidate gene were performed using patient-derived primary fibroblasts and a zebrafish morpholino oligonucleotides knockdown model. Two sisters presented with a novel subtype of MPD, including severe intellectual disabilities. NIN, encoding Ninein, a centrosomal protein critically involved in asymmetric cell division, was identified as a candidate gene, and functional impacts in fibroblasts and zebrafish were studied. From 34,606 genomic variants, two very rare missense variants in NIN were identified. Both probands were compound heterozygotes. In the zebrafish, ninein knockdown led to specific and novel defects in the specification and morphogenesis of the anterior neuroectoderm, resulting in a deformity of the developing cranium with a small, squared skull highly reminiscent of the human phenotype. We identified a novel clinical subtype of MPD in two sisters who have rare variants in NIN. We show, for the first time, that reduction of ninein function in the developing zebrafish leads to specific deficiencies of brain and skull development, offering a developmental basis for the myriad phenotypes in our patients.

Sensitive and Specific Detection of Early Gastric Cancer Using DNA Methylation Analysis of Gastric Washes

PubMed Central

Watanabe, Yoshiyuki; Kim, Hyun Soo; Castoro, Ryan J.; Chung, Woonbok; Estecio, Marcos R. H.; Kondo, Kimie; Guo, Yi; Ahmed, Saira S.; Toyota, Minoru; Itoh, Fumio; Suk, Ki Tae; Cho, Mee-Yon; Shen, Lanlan; Jelinek, Jaroslav; Issa, Jean-Pierre J.

2009-01-01

Background & Aims Aberrant DNA methylation is an early and frequent process in gastric carcinogenesis and could be useful for detection of gastric neoplasia. We hypothesized that methylation analysis of DNA recovered from gastric washes could be used to detect gastric cancer. Methods We studied 51 candidate genes in 7 gastric cancer cell lines and 24 samples (training set) and identified 6 for further studies. We examined the methylation status of these genes in a test set consisting of 131 gastric neoplasias at various stages. Finally, we validated the 6 candidate genes in a different population of 40 primary gastric cancer samples and 113 non-neoplastic gastric mucosa samples. Results 6 genes (MINT25, RORA, GDNF, ADAM23, PRDM5, MLF1) showed frequent differential methylation between gastric cancer and normal mucosa in the training, test and validation sets. GDNF and MINT25 were most sensitive molecular markers of early stage gastric cancer while PRDM5 and MLF1 were markers of a field defect. There was a close correlation (r=0.5 to 0.9, p=0.03 to 0.001) between methylation levels in tumor biopsy and gastric washes. MINT25 methylation had the best sensitivity (90%), specificity (96%), and area under the ROC curve (0.961) in terms of tumor detection in gastric washes. Conclusions These findings suggest MINT25 is a sensitive and specific marker for screening in gastric cancer. Additionally we have developed a new methodology for gastric cancer detection by DNA methylation in gastric washes. PMID:19375421

Association and linkage studies of candidate genes involved in GABAergic neurotransmission in lithium-responsive bipolar disorder.

PubMed Central

Duffy, A; Turecki, G; Grof, P; Cavazzoni, P; Grof, E; Joober, R; Ahrens, B; Berghöfer, A; Müller-Oerlinghausen, B; Dvoráková, M; Libigerová, E; Vojtĕchovský, M; Zvolský, P; Nilsson, A; Licht, R W; Rasmussen, N A; Schou, M; Vestergaard, P; Holzinger, A; Schumann, C; Thau, K; Robertson, C; Rouleau, G A; Alda, M

2000-01-01

OBJECTIVE: To test for genetic linkage and association with GABAergic candidate genes in lithium-responsive bipolar disorder. DESIGN: Polymorphisms located in genes that code for GABRA3, GABRA5 and GABRB3 subunits of the GABAA receptor were investigated using association and linkage strategies. PARTICIPANTS: A total of 138 patients with bipolar 1 disorder with a clear response to lithium prophylaxis, selected from specialized lithium clinics in Canada and Europe that are part of the International Group for the Study of Lithium-Treated Patients, and 108 psychiatrically healthy controls. Families of 24 probands were suitable for linkage analysis. OUTCOME MEASURES: The association between the candidate genes and patients with bipolar disorder versus that of controls and genetic linkage within families. RESULTS: There was no significant association or linkage found between lithium-responsive bipolar disorder and the GABAergic candidate genes investigated. CONCLUSIONS: This study does not support a major role for the GABAergic candidate genes tested in lithium-responsive bipolar disorder. PMID:11022400

A roadmap for the genetic analysis of renal aging

PubMed Central

Noordmans, Gerda A; Hillebrands, Jan-Luuk; van Goor, Harry; Korstanje, Ron

2015-01-01

Several studies show evidence for the genetic basis of renal disease, which renders some individuals more prone than others to accelerated renal aging. Studying the genetics of renal aging can help us to identify genes involved in this process and to unravel the underlying pathways. First, this opinion article will give an overview of the phenotypes that can be observed in age-related kidney disease. Accurate phenotyping is essential in performing genetic analysis. For kidney aging, this could include both functional and structural changes. Subsequently, this article reviews the studies that report on candidate genes associated with renal aging in humans and mice. Several loci or candidate genes have been found associated with kidney disease, but identification of the specific genetic variants involved has proven to be difficult. CUBN, UMOD, and SHROOM3 were identified by human GWAS as being associated with albuminuria, kidney function, and chronic kidney disease (CKD). These are promising examples of genes that could be involved in renal aging, and were further mechanistically evaluated in animal models. Eventually, we will provide approaches for performing genetic analysis. We should leverage the power of mouse models, as testing in humans is limited. Mouse and other animal models can be used to explain the underlying biological mechanisms of genes and loci identified by human GWAS. Furthermore, mouse models can be used to identify genetic variants associated with age-associated histological changes, of which Far2, Wisp2, and Esrrg are examples. A new outbred mouse population with high genetic diversity will facilitate the identification of genes associated with renal aging by enabling high-resolution genetic mapping while also allowing the control of environmental factors, and by enabling access to renal tissues at specific time points for histology, proteomics, and gene expression. PMID:26219736

Transcriptional changes induced by candidate malaria vaccines and correlation with protection against malaria in a human challenge model

PubMed Central

Dunachie, Susanna; Berthoud, Tamara; Hill, Adrian V.S.; Fletcher, Helen A.

2015-01-01

Introduction The complexity of immunity to malaria is well known, and clear correlates of protection against malaria have not been established. A better understanding of immune markers induced by candidate malaria vaccines would greatly enhance vaccine development, immunogenicity monitoring and estimation of vaccine efficacy in the field. We have previously reported complete or partial efficacy against experimental sporozoite challenge by several vaccine regimens in healthy malaria-naïve subjects in Oxford. These include a prime-boost regimen with RTS,S/AS02A and modified vaccinia virus Ankara (MVA) expressing the CSP antigen, and a DNA-prime, MVA-boost regimen expressing the ME TRAP antigens. Using samples from these trials we performed transcriptional profiling, allowing a global assessment of responses to vaccination. Methods We used Human RefSeq8 Bead Chips from Illumina to examine gene expression using PBMC (peripheral blood mononuclear cells) from 16 human volunteers. To focus on antigen-specific changes, comparisons were made between PBMC stimulated with CSP or TRAP peptide pools and unstimulated PBMC post vaccination. We then correlated gene expression with protection against malaria in a human Plasmodium falciparum malaria challenge model. Results Differentially expressed genes induced by both vaccine regimens were predominantly in the IFN-γ pathway. Gene set enrichment analysis revealed antigen-specific effects on genes associated with IFN induction and proteasome modules after vaccination. Genes associated with IFN induction and antigen presentation modules were positively enriched in subjects with complete protection from malaria challenge, while genes associated with haemopoietic stem cells, regulatory monocytes and the myeloid lineage modules were negatively enriched in protected subjects. Conclusions These results represent novel insights into the immune repertoires involved in malaria vaccination. PMID:26256523

The Wright stuff: reimagining path analysis reveals novel components of the sex determination hierarchy in Drosophila melanogaster.

PubMed

Fear, Justin M; Arbeitman, Michelle N; Salomon, Matthew P; Dalton, Justin E; Tower, John; Nuzhdin, Sergey V; McIntyre, Lauren M

2015-09-04

The Drosophila sex determination hierarchy is a classic example of a transcriptional regulatory hierarchy, with sex-specific isoforms regulating morphology and behavior. We use a structural equation modeling approach, leveraging natural genetic variation from two studies on Drosophila female head tissues--DSPR collection (596 F1-hybrids from crosses between DSPR sub-populations) and CEGS population (75 F1-hybrids from crosses between DGRP/Winters lines to a reference strain w1118)--to expand understanding of the sex hierarchy gene regulatory network (GRN). This approach is completely generalizable to any natural population, including humans. We expanded the sex hierarchy GRN adding novel links among genes, including a link from fruitless (fru) to Sex-lethal (Sxl) identified in both populations. This link is further supported by the presence of fru binding sites in the Sxl locus. 754 candidate genes were added to the pathway, including the splicing factors male-specific lethal 2 and Rm62 as downstream targets of Sxl which are well-supported links in males. Independent studies of doublesex and transformer mutants support many additions, including evidence for a link between the sex hierarchy and metabolism, via Insulin-like receptor. The genes added in the CEGS population were enriched for genes with sex-biased splicing and components of the spliceosome. A common goal of molecular biologists is to expand understanding about regulatory interactions among genes. Using natural alleles we can not only identify novel relationships, but using supervised approaches can order genes into a regulatory hierarchy. Combining these results with independent large effect mutation studies, allows clear candidates for detailed molecular follow-up to emerge.

Transcriptional changes induced by candidate malaria vaccines and correlation with protection against malaria in a human challenge model.

PubMed

Dunachie, Susanna; Berthoud, Tamara; Hill, Adrian V S; Fletcher, Helen A

2015-09-29

The complexity of immunity to malaria is well known, and clear correlates of protection against malaria have not been established. A better understanding of immune markers induced by candidate malaria vaccines would greatly enhance vaccine development, immunogenicity monitoring and estimation of vaccine efficacy in the field. We have previously reported complete or partial efficacy against experimental sporozoite challenge by several vaccine regimens in healthy malaria-naïve subjects in Oxford. These include a prime-boost regimen with RTS,S/AS02A and modified vaccinia virus Ankara (MVA) expressing the CSP antigen, and a DNA-prime, MVA-boost regimen expressing the ME TRAP antigens. Using samples from these trials we performed transcriptional profiling, allowing a global assessment of responses to vaccination. We used Human RefSeq8 Bead Chips from Illumina to examine gene expression using PBMC (peripheral blood mononuclear cells) from 16 human volunteers. To focus on antigen-specific changes, comparisons were made between PBMC stimulated with CSP or TRAP peptide pools and unstimulated PBMC post vaccination. We then correlated gene expression with protection against malaria in a human Plasmodium falciparum malaria challenge model. Differentially expressed genes induced by both vaccine regimens were predominantly in the IFN-γ pathway. Gene set enrichment analysis revealed antigen-specific effects on genes associated with IFN induction and proteasome modules after vaccination. Genes associated with IFN induction and antigen presentation modules were positively enriched in subjects with complete protection from malaria challenge, while genes associated with haemopoietic stem cells, regulatory monocytes and the myeloid lineage modules were negatively enriched in protected subjects. These results represent novel insights into the immune repertoires involved in malaria vaccination. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

Immuno-Navigator, a batch-corrected coexpression database, reveals cell type-specific gene networks in the immune system

PubMed Central

Vandenbon, Alexis; Dinh, Viet H.; Mikami, Norihisa; Kitagawa, Yohko; Teraguchi, Shunsuke; Ohkura, Naganari; Sakaguchi, Shimon

2016-01-01

High-throughput gene expression data are one of the primary resources for exploring complex intracellular dynamics in modern biology. The integration of large amounts of public data may allow us to examine general dynamical relationships between regulators and target genes. However, obstacles for such analyses are study-specific biases or batch effects in the original data. Here we present Immuno-Navigator, a batch-corrected gene expression and coexpression database for 24 cell types of the mouse immune system. We systematically removed batch effects from the underlying gene expression data and showed that this removal considerably improved the consistency between inferred correlations and prior knowledge. The data revealed widespread cell type-specific correlation of expression. Integrated analysis tools allow users to use this correlation of expression for the generation of hypotheses about biological networks and candidate regulators in specific cell types. We show several applications of Immuno-Navigator as examples. In one application we successfully predicted known regulators of importance in naturally occurring Treg cells from their expression correlation with a set of Treg-specific genes. For one high-scoring gene, integrin β8 (Itgb8), we confirmed an association between Itgb8 expression in forkhead box P3 (Foxp3)-positive T cells and Treg-specific epigenetic remodeling. Our results also suggest that the regulation of Treg-specific genes within Treg cells is relatively independent of Foxp3 expression, supporting recent results pointing to a Foxp3-independent component in the development of Treg cells. PMID:27078110

Transcriptomic analysis of the mussel Elliptio complanata identifies candidate stress-response genes and an abundance of novel or noncoding transcripts

USGS Publications Warehouse

Cornman, Robert S.; Robertson, Laura S.; Galbraith, Heather S.; Blakeslee, Carrie J.

2014-01-01

Mussels are useful indicator species of environmental stress and degradation, and the global decline in freshwater mussel diversity and abundance is of conservation concern. Elliptio complanata is a common freshwater mussel of eastern North America that can serve both as an indicator and as an experimental model for understanding mussel physiology and genetics. To support genetic components of these research goals, we assembled transcriptome contigs from Illumina paired-end reads. Despite efforts to collapse similar contigs, the final assembly was in excess of 136,000 contigs with an N50 of 982 bp. Even so, comparisons to the CEGMA database of conserved eukaryotic genes indicated that ∼20% of genes remain unrepresented. However, numerous candidate stress-response genes were present, and we identified lineage-specific patterns of diversification among molluscs for cytochrome P450 detoxification genes and two saccharide-modifying enzymes: 1,3 beta-galactosyltransferase and fucosyltransferase. Less than a quarter of contigs had protein-level similarity based on modest BLAST and Hmmer3 statistical thresholds. These results add comparative genomic resources for molluscs and suggest a wealth of novel proteins and noncoding transcripts.

Lack of specific alleles for the bovine chemokine (C-X-C) receptor type 4 (CXCR4) gene in West African cattle questions its role as a candidate for trypanotolerance.

PubMed

Álvarez, Isabel; Pérez-Pardal, Lucía; Traoré, Amadou; Fernández, Iván; Goyache, Félix

2016-08-01

A panel of 81 Asian, African and European cattle (Bos taurus and B. indicus) was analysed for the whole sequence of the CXCR4 gene (3844bp), a strong candidate for cattle trypanotolerance. Thirty-one polymorphic sites identified gave 31 different haplotypes. Neutrality tests rejected the hypothesis of either positive or purifying selection. Bayesian phylogenetic tree showed differentiation of haplotypes into two clades gathering genetic variability predating domestication. Related with clades definition, linkage disequilibrium analyses suggested the existence of one only linkage block on the CXCR4 gene. Two tag SNPs identified on exon 2 captured 50% of variability. Whatever the analysis carried out, no clear separation between cattle groups was identified. Most haplotypes identified in West African taurine cattle were also found in European cattle and in Asian and West African zebu. West African taurine samples did not carry unique variants on the CXCR4 gene sequence. The current analysis failed in identifying a causal mutation on the CXCR4 gene underlying a previously reported QTL for cattle trypanotolerance on BTA2. Copyright © 2016 Elsevier B.V. All rights reserved.

Scanning of selection signature provides a glimpse into important economic traits in goats (Capra hircus).

PubMed

Guan, Dailu; Luo, Nanjian; Tan, Xiaoshan; Zhao, Zhongquan; Huang, Yongfu; Na, Risu; Zhang, Jiahua; Zhao, Yongju

2016-10-31

Goats (Capra hircus) are one of the oldest livestock domesticated species, and have been used for their milk, meat, hair and skins over much of the world. Detection of selection footprints in genomic regions can provide potential insights for understanding the genetic mechanism of specific phenotypic traits and better guide in animal breeding. The study presented here has generated 192.747G raw data and identified more than 5.03 million single-nucleotide polymorphisms (SNPs) and 334,151 Indels (insertions and deletions). In addition, we identified 155 and 294 candidate regions harboring 86 and 97 genes based on allele frequency differences in Dazu black goats (DBG) and Inner Mongolia cashmere goats (IMCG), respectively. Populations differentiation reflected by Fst values detected 368 putative selective sweep regions including 164 genes. The top 1% regions of both low heterozygosity and high genetic differentiation contained 239 (135 genes) and 176 (106 genes) candidate regions in DBG and IMCG, respectively. These genes were related to reproductive and productive traits, such as "neurohypophyseal hormone activity" and "adipocytokine signaling pathway". These findings may be conducive to molecular breeding and the long-term preservation of the valuable genetic resources for this species.

Defining a new candidate gene for amelogenesis imperfecta: from molecular genetics to biochemistry.

PubMed

Urzúa, Blanca; Ortega-Pinto, Ana; Morales-Bozo, Irene; Rojas-Alcayaga, Gonzalo; Cifuentes, Víctor

2011-02-01

Amelogenesis imperfecta is a group of genetic conditions that affect the structure and clinical appearance of tooth enamel. The types (hypoplastic, hypocalcified, and hypomature) are correlated with defects in different stages of the process of enamel synthesis. Autosomal dominant, recessive, and X-linked types have been previously described. These disorders are considered clinically and genetically heterogeneous in etiology, involving a variety of genes, such as AMELX, ENAM, DLX3, FAM83H, MMP-20, KLK4, and WDR72. The mutations identified within these causal genes explain less than half of all cases of amelogenesis imperfecta. Most of the candidate and causal genes currently identified encode proteins involved in enamel synthesis. We think it is necessary to refocus the search for candidate genes using biochemical processes. This review provides theoretical evidence that the human SLC4A4 gene (sodium bicarbonate cotransporter) may be a new candidate gene.

A public platform for the verification of the phenotypic effect of candidate genes for resistance to aflatoxin accumulation and Aspergillus flavus infection in maize.

PubMed

Warburton, Marilyn L; Williams, William Paul; Hawkins, Leigh; Bridges, Susan; Gresham, Cathy; Harper, Jonathan; Ozkan, Seval; Mylroie, J Erik; Shan, Xueyan

2011-07-01

A public candidate gene testing pipeline for resistance to aflatoxin accumulation or Aspergillus flavus infection in maize is presented here. The pipeline consists of steps for identifying, testing, and verifying the association of selected maize gene sequences with resistance under field conditions. Resources include a database of genetic and protein sequences associated with the reduction in aflatoxin contamination from previous studies; eight diverse inbred maize lines for polymorphism identification within any maize gene sequence; four Quantitative Trait Loci (QTL) mapping populations and one association mapping panel, all phenotyped for aflatoxin accumulation resistance and associated phenotypes; and capacity for Insertion/Deletion (InDel) and SNP genotyping in the population(s) for mapping. To date, ten genes have been identified as possible candidate genes and put through the candidate gene testing pipeline, and results are presented here to demonstrate the utility of the pipeline.

Refined mapping of autoimmune disease associated genetic variants with gene expression suggests an important role for non-coding RNAs.

PubMed

Ricaño-Ponce, Isis; Zhernakova, Daria V; Deelen, Patrick; Luo, Oscar; Li, Xingwang; Isaacs, Aaron; Karjalainen, Juha; Di Tommaso, Jennifer; Borek, Zuzanna Agnieszka; Zorro, Maria M; Gutierrez-Achury, Javier; Uitterlinden, Andre G; Hofman, Albert; van Meurs, Joyce; Netea, Mihai G; Jonkers, Iris H; Withoff, Sebo; van Duijn, Cornelia M; Li, Yang; Ruan, Yijun; Franke, Lude; Wijmenga, Cisca; Kumar, Vinod

2016-04-01

Genome-wide association and fine-mapping studies in 14 autoimmune diseases (AID) have implicated more than 250 loci in one or more of these diseases. As more than 90% of AID-associated SNPs are intergenic or intronic, pinpointing the causal genes is challenging. We performed a systematic analysis to link 460 SNPs that are associated with 14 AID to causal genes using transcriptomic data from 629 blood samples. We were able to link 71 (39%) of the AID-SNPs to two or more nearby genes, providing evidence that for part of the AID loci multiple causal genes exist. While 54 of the AID loci are shared by one or more AID, 17% of them do not share candidate causal genes. In addition to finding novel genes such as ULK3, we also implicate novel disease mechanisms and pathways like autophagy in celiac disease pathogenesis. Furthermore, 42 of the AID SNPs specifically affected the expression of 53 non-coding RNA genes. To further understand how the non-coding genome contributes to AID, the SNPs were linked to functional regulatory elements, which suggest a model where AID genes are regulated by network of chromatin looping/non-coding RNAs interactions. The looping model also explains how a causal candidate gene is not necessarily the gene closest to the AID SNP, which was the case in nearly 50% of cases. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

Further evidence of the limited role of candidate genes in relation to infant-mother attachment outcomes.

PubMed

Leerkes, Esther M; Gedaly, Lindsey R; Zhou, Nan; Calkins, Susan; Henrich, Vincent C; Smolen, Andrew

2017-02-01

In this paper, we examine the associations between specific candidate genes (DRD2, DRD4, COMT, biallelic and tri-allelic 5HTTLPR, and OXTR) and infant attachment outcomes as main effects and in conjunction with maternal sensitivity. The sample included 200 infants (97 European American, 94 African-American, and 9 biracial) and their mothers. Maternal sensitivity and overtly negative maternal behavior were observed when infants were 6 months and 1 year old in distress-eliciting contexts, attachment was assessed via the Strange Situation at age 1, and DNA samples were collected when children were 2 years old. Consistent with recent research in large samples, there was little evidence that these genes are associated with attachment security, disorganization, or distress as main effects (in additive, dominant, and homozygous models) or in conjunction with maternal sensitivity or overtly negative behavior (primarily dominance models). Furthermore, there was little evidence that associations vary as a function of race.

Further Evidence of the Limited Role of Candidate Genes in Relation to Infant-Mother Attachment Outcomes

PubMed Central

Leerkes, Esther M.; Gedaly, Lindsey R.; Zhou, Nan; Calkins, Susan; Henrich, Vincent C.; Smolen, Andrew

2017-01-01

In this paper, we examine the associations between specific candidate genes (DRD2, DRD4, COMT, biallelic and tri-allelic 5HTTLPR, and OXTR) and infant attachment outcomes as main effects and in conjunction with maternal sensitivity. The sample included 200 infants (97 European American, 94 African American, and 9 bi-racial) and their mothers. Maternal sensitivity and overtly negative maternal behavior were observed when infants were 6 months and 1 year old in distress-eliciting contexts, attachment was assessed via the Strange Situation at age 1, and DNA samples were collected when children were 2 years old. Consistent with recent research in large samples (Luijk et al., 2011; Roisman et al., 2013), there was little evidence that these genes are associated with attachment security, disorganization, or distress as main effects (in additive, dominant, and homozygous models) or in conjunction with maternal sensitivity or overtly negative behavior (primarily dominance models). Furthermore, there was little evidence that associations vary as a function of race. PMID:27852134

ENU Mutagenesis in Mice Identifies Candidate Genes For Hypogonadism

PubMed Central

Weiss, Jeffrey; Hurley, Lisa A.; Harris, Rebecca M.; Finlayson, Courtney; Tong, Minghan; Fisher, Lisa A.; Moran, Jennifer L.; Beier, David R.; Mason, Christopher; Jameson, J. Larry

2012-01-01

Genome-wide mutagenesis was performed in mice to identify candidate genes for male infertility, for which the predominant causes remain idiopathic. Mice were mutagenized using N-ethyl-N-nitrosourea (ENU), bred, and screened for phenotypes associated with the male urogenital system. Fifteen heritable lines were isolated and chromosomal loci were assigned using low density genome-wide SNP arrays. Ten of the fifteen lines were pursued further using higher resolution SNP analysis to narrow the candidate gene regions. Exon sequencing of candidate genes identified mutations in mice with cystic kidneys (Bicc1), cryptorchidism (Rxfp2), restricted germ cell deficiency (Plk4), and severe germ cell deficiency (Prdm9). In two other lines with severe hypogonadism candidate sequencing failed to identify mutations, suggesting defects in genes with previously undocumented roles in gonadal function. These genomic intervals were sequenced in their entirety and a candidate mutation was identified in SnrpE in one of the two lines. The line harboring the SnrpE variant retains substantial spermatogenesis despite small testis size, an unusual phenotype. In addition to the reproductive defects, heritable phenotypes were observed in mice with ataxia (Myo5a), tremors (Pmp22), growth retardation (unknown gene), and hydrocephalus (unknown gene). These results demonstrate that the ENU screen is an effective tool for identifying potential causes of male infertility. PMID:22258617

Epigenetic inactivation of VGF associated with Urothelial Cell Carcinoma and its potential as a non-invasive biomarker using urine.

PubMed

Hayashi, Masamichi; Bernert, Heike; Kagohara, Luciane Tsukamoto; Maldonado, Leonel; Brait, Mariana; Schoenberg, Mark; Bivalacqua, Trinity; Netto, George J; Koch, Wayne; Sidransky, David; Hoque, Mohammad O

2014-05-30

To identify new epigenetic markers and further characterize Urothelial Cell Carcinoma (UCC), we tested the promoter methylation (PM) status of 19 genes previously identified as cancer specific methylated genes in other solid tumors. We used bisulfite sequencing, methylation specific PCR and quantitative methylation specific PCR (QMSP) to test the PM status of 19 genes in urothelial cancer cell lines. Among the 19 genes tested, VGF was found to be completely methylated in several UCC cell lines. VGF QMSP analysis showed that methylation values of almost all the primary 19 UCC tissues were higher than the paired normal tissues (P=0.009). In another cohort, 12/35 (34.3%) of low grade UCC cases displayed VGF methylation. As a biomarker for non-invasive detection of UCC, VGF showed a significantly higher frequency of methylation in urine from UCC cases (8/20) compared to controls (1/20) (P=0.020). After treatment of cell lines with 5-Aza-2'-deoxycytidine, VGF was robustly re-expressed. Forced expression of VGF in bladder cancer cell lines inhibited cell growth. Selection of candidates from genome-wide screening approach in other solid tumors successfully identified UCC specific methylated genes.

From genomes to vaccines: Leishmania as a model.

PubMed Central

Almeida, Renata; Norrish, Alan; Levick, Mark; Vetrie, David; Freeman, Tom; Vilo, Jaak; Ivens, Alasdair; Lange, Uta; Stober, Carmel; McCann, Sharon; Blackwell, Jenefer M

2002-01-01

The 35 Mb genome of Leishmania should be sequenced by late 2002. It contains approximately 8500 genes that will probably translate into more than 10 000 proteins. In the laboratory we have been piloting strategies to try to harness the power of the genome-proteome for rapid screening of new vaccine candidate. To this end, microarray analysis of 1094 unique genes identified using an EST analysis of 2091 cDNA clones from spliced leader libraries prepared from different developmental stages of Leishmania has been employed. The plan was to identify amastigote-expressed genes that could be used in high-throughput DNA-vaccine screens to identify potential new vaccine candidates. Despite the lack of transcriptional regulation that polycistronic transcription in Leishmania dictates, the data provide evidence for a high level of post-transcriptional regulation of RNA abundance during the developmental cycle of promastigotes in culture and in lesion-derived amastigotes of Leishmania major. This has provided 147 candidates from the 1094 unique genes that are specifically upregulated in amastigotes and are being used in vaccine studies. Using DNA vaccination, it was demonstrated that pooling strategies can work to identify protective vaccines, but it was found that some potentially protective antigens are masked by other disease-exacerbatory antigens in the pool. A total of 100 new vaccine candidates are currently being tested separately and in pools to extend this analysis, and to facilitate retrospective bioinformatic analysis to develop predictive algorithms for sequences that constitute potentially protective antigens. We are also working with other members of the Leishmania Genome Network to determine whether RNA expression determined by microarray analyses parallels expression at the protein level. We believe we are making good progress in developing strategies that will allow rapid translation of the sequence of Leishmania into potential interventions for disease control in humans. PMID:11839176

The Naïve Murine Cornea as a Model System to Identify Novel Endogenous Regulators of Lymphangiogenesis: TRAIL and rtPA.

PubMed

Regenfuß, Birgit; Dreisow, Marie-Luise; Hos, Deniz; Masli, Sharmila; Bock, Felix; Cursiefen, Claus

2015-06-01

In the murine cornea, which is an established model for analyzing pathologic lymphatic vessel growth, phenotypic heterogeneity of the endogenous lymphatic vessels in the limbus of the cornea was previously described. In this study, the cornea of BALB/c, C57BL/6, and FVB mice with different limbal lymphangiogenic phenotypes was analyzed to identify novel candidates potentially influencing lymphatic vessel growth. Pathway specific expression analysis of the cornea was performed to identify novel candidate genes. Corneal protein expression of the respective candidates was analyzed by fluorescent immunohistochemistry. The effect of the candidates on proliferation of human dermal lymphatic endothelial cells (HDLECs) was analyzed by BrdU proliferation ELISA. Thirteen genes were differentially regulated in corneas of mouse strains with more endogenous limbal lymphatic vessels (high-lymphangiogenic) (C57BL/6) compared to mouse strains with less endogenous limbal lymphatic vessels (low-lymphangiogenic) (BALB/c, FVB). Two candidates, Tumor necrosis factor (ligand) superfamily member 10 (Tnfsf10/Trail) and Plasminogen activator, tissue (Plat/tPA) were expressed in the cornea of BALB/c and C57BL/6 mice on the protein level. In vitro, Trail and recombinant tPA inhibited the proliferation of human dermal lymphatic endothelial cells. Molecular analysis of the naive cornea in mouse strains with different limbal lymphatic phenotypes is a valuable model to identify novel endogenous regulators of lymphangiogenesis.

Localization of a new autosomal dominant retinitis pigmentosa gene on chromosome 17p screeningof candidate genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Greenberg, J.; Goliath, R.; Shugart, Y.Y.

1994-09-01

A new gene locus for autosomal dominant retinitis pigmentosa (ADRP) on 17p has been identified in a large South African (SA) family consisting of 28 living affected individuals in 4 successive generations. This is the first ADRP gene to be reported from SA. The human recoverin (RCVN) gene, which codes for a retinal-specific protein important in recovery to the dark state after visual excitation, has been mapped to 17p13.1 and was considered as a prime candidate gene for the disorder in this family. Mutation screening (using 8 different electrophoretic conditions to resolve heteroduplexes and SSCPs) did not produce any evidencemore » of RCVN being involved in the pathogenesis of ADRP in this SA family. In addition, a mobility shift detected within exon 1 of the RCVN gene did not track with the ADRP phenotype. RP patients from 77 SA families and 30 normal individuals are being examined to establish the frequency of this polymorphism in the SA population. Highly polymorphic markers from 17p13 are now being sought in order to establish the minimum region containing this novel ADRP-SA gene. Two additional recently described retinal-expressed cDNAs, guanylyl cyclase and pigment epithelium-derived factor, which map to 17p13.1, will be tested for tight linkage to ADRP-SA.« less

An integrative “omics” approach identifies new candidate genes to impact aroma volatiles in peach fruit

PubMed Central

2013-01-01

Background Ever since the recent completion of the peach genome, the focus of genetic research in this area has turned to the identification of genes related to important traits, such as fruit aroma volatiles. Of the over 100 volatile compounds described in peach, lactones most likely have the strongest effect on fruit aroma, while esters, terpenoids, and aldehydes have minor, yet significant effects. The identification of key genes underlying the production of aroma compounds is of interest for any fruit-quality improvement strategy. Results Volatile (52 compounds) and gene expression (4348 genes) levels were profiled in peach fruit from a maturity time-course series belonging to two peach genotypes that showed considerable differences in maturation characteristics and postharvest ripening. This data set was analyzed by complementary correlation-based approaches to discover the genes related to the main aroma-contributing compounds: lactones, esters, and phenolic volatiles, among others. As a case study, one of the candidate genes was cloned and expressed in yeast to show specificity as an ω-6 Oleate desaturase, which may be involved in the production of a precursor of lactones/esters. Conclusions Our approach revealed a set of genes (an alcohol acyl transferase, fatty acid desaturases, transcription factors, protein kinases, cytochromes, etc.) that are highly associated with peach fruit volatiles, and which could prove useful in breeding or for biotechnological purposes. PMID:23701715

Gene Targeting in Rabbits: Single-Step Generation of Knock-out Rabbits by Microinjection of CRISPR/Cas9 Plasmids.

PubMed

Kawano, Yoshihiro; Honda, Arata

2017-01-01

The development of genome editing technology has allowed gene disruptions to be achieved in various animal species and has been beneficial to many mammals. Gene disruption using pluripotent stem cells is difficult to achieve in rabbits, but thanks to advances in genome editing technology, a number of gene disruptions have been conducted. This paper describes a simple and easy method for carrying out gene disruptions in rabbits using CRISPR/Cas9 in which the gene to be disrupted is marked, the presence or absence of off-target candidates is checked, and a plasmid allowing simultaneous expression of Cas9 and sgRNA is constructed. Next, the cleaving activity of candidate sequences is investigated, and assessments are carried out to determine whether the target sequences can be cut. Female rabbits subjected to superovulation treatment are mated with male rabbits and fertilized eggs are collected, and then pronuclear injection of plasmid DNA is performed. The next day, the two-cell stage embryos are transplanted into pseudopregnant rabbits, and offspring are born within approximately 29-30 days. The genomic DNA of the offspring is then examined to check what types of genetic modifications have occurred. With the advent of CRISPR/Cas9, the accessibility of gene disruptions in rabbits has improved remarkably. This paper summarizes specifically how to carry out gene disruptions in rabbits.

Expression of the Bs2 pepper gene confers resistance to bacterial spot disease in tomato

PubMed Central

Tai, Thomas H.; Dahlbeck, Douglas; Clark, Eszter T.; Gajiwala, Paresh; Pasion, Romela; Whalen, Maureen C.; Stall, Robert E.; Staskawicz, Brian J.

1999-01-01

The Bs2 resistance gene of pepper specifically recognizes and confers resistance to strains of Xanthomonas campestris pv. vesicatoria that contain the corresponding bacterial avirulence gene, avrBs2. The involvement of avrBs2 in pathogen fitness and its prevalence in many X. campestris pathovars suggests that the Bs2 gene may be durable in the field and provide resistance when introduced into other plant species. Employing a positional cloning strategy, the Bs2 locus was isolated and the gene was identified by coexpression with avrBs2 in an Agrobacterium-mediated transient assay. A single candidate gene, predicted to encode motifs characteristic of the nucleotide binding site–leucine-rich repeat class of resistance genes, was identified. This gene specifically controlled the hypersensitive response when transiently expressed in susceptible pepper and tomato lines and in a nonhost species, Nicotiana benthamiana, and was designated as Bs2. Functional expression of Bs2 in stable transgenic tomatoes supports its use as a source of resistance in other Solanaceous plant species. PMID:10570214

Expression of the Bs2 pepper gene confers resistance to bacterial spot disease in tomato.

PubMed

Tai, T H; Dahlbeck, D; Clark, E T; Gajiwala, P; Pasion, R; Whalen, M C; Stall, R E; Staskawicz, B J

1999-11-23

The Bs2 resistance gene of pepper specifically recognizes and confers resistance to strains of Xanthomonas campestris pv. vesicatoria that contain the corresponding bacterial avirulence gene, avrBs2. The involvement of avrBs2 in pathogen fitness and its prevalence in many X. campestris pathovars suggests that the Bs2 gene may be durable in the field and provide resistance when introduced into other plant species. Employing a positional cloning strategy, the Bs2 locus was isolated and the gene was identified by coexpression with avrBs2 in an Agrobacterium-mediated transient assay. A single candidate gene, predicted to encode motifs characteristic of the nucleotide binding site-leucine-rich repeat class of resistance genes, was identified. This gene specifically controlled the hypersensitive response when transiently expressed in susceptible pepper and tomato lines and in a nonhost species, Nicotiana benthamiana, and was designated as Bs2. Functional expression of Bs2 in stable transgenic tomatoes supports its use as a source of resistance in other Solanaceous plant species.

A taxonomic framework for cable bacteria and proposal of the candidate genera Electrothrix and Electronema.

PubMed

Trojan, Daniela; Schreiber, Lars; Bjerg, Jesper T; Bøggild, Andreas; Yang, Tingting; Kjeldsen, Kasper U; Schramm, Andreas

2016-07-01

Cable bacteria are long, multicellular filaments that can conduct electric currents over centimeter-scale distances. All cable bacteria identified to date belong to the deltaproteobacterial family Desulfobulbaceae and have not been isolated in pure culture yet. Their taxonomic delineation and exact phylogeny is uncertain, as most studies so far have reported only short partial 16S rRNA sequences or have relied on identification by a combination of filament morphology and 16S rRNA-targeted fluorescence in situ hybridization with a Desulfobulbaceae-specific probe. In this study, nearly full-length 16S rRNA gene sequences of 16 individual cable bacteria filaments from freshwater, salt marsh, and marine sites of four geographic locations are presented. These sequences formed a distinct, monophyletic sister clade to the genus Desulfobulbus and could be divided into six coherent, species-level clusters, arranged as two genus-level groups. The same grouping was retrieved by phylogenetic analysis of full or partial dsrAB genes encoding the dissimilatory sulfite reductase. Based on these results, it is proposed to accommodate cable bacteria within two novel candidate genera: the mostly marine "Candidatus Electrothrix", with four candidate species, and the mostly freshwater "Candidatus Electronema", with two candidate species. This taxonomic framework can be used to assign environmental sequences confidently to the cable bacteria clade, even without morphological information. Database searches revealed 185 16S rRNA gene sequences that affiliated within the clade formed by the proposed cable bacteria genera, of which 120 sequences could be assigned to one of the six candidate species, while the remaining 65 sequences indicated the existence of up to five additional species. Copyright © 2016 The Author(s). Published by Elsevier GmbH.. All rights reserved.

Sexual dimorphic floral development in dioecious plants revealed by transcriptome, phytohormone, and DNA methylation analysis in Populus tomentosa.

PubMed

Song, Yuepeng; Ma, Kaifeng; Ci, Dong; Chen, Qingqing; Tian, Jiaxing; Zhang, Deqiang

2013-12-01

Dioecious plants have evolved sex-specific floral development mechanisms. However, the precise gene expression patterns in dioecious plant flower development remain unclear. Here, we used andromonoecious poplar, an exceptional model system, to eliminate the confounding effects of genetic background of dioecious plants. Comparative transcriptome and physiological analysis allowed us to characterize sex-specific development of female and male flowers. Transcriptome analysis identified genes significantly differentially expressed between the sexes, including genes related to floral development, phytohormone synthesis and metabolism, and DNA methylation. Correlation analysis revealed a significant correlation between phytohormone signaling and gene expression, identifying specific phytohormone-responsive genes and their cis-regulatory elements. Two genes related to DNA methylation, METHYLTRANSFERASE1 (MET1) and DECREASED DNA METHYLATION 1 (DDM1), which are located in the sex determination region of Chromosome XIX, have differential expression between female and male flowers. A time-course analysis revealed that MET1 and DDM1 expression may produce different DNA methylation levels in female and male flowers. Understanding the interactions of phytohormone signaling, DNA methylation and target gene expression should lead to a better understanding of sexual differences in floral development. Thus, this study identifies a set of candidate genes for further studies of poplar sexual dimorphism and relates sex-specific floral development to physiological and epigenetic changes.

Shared heritability of attention-deficit/hyperactivity disorder and autism spectrum disorder.

PubMed

Rommelse, Nanda N J; Franke, Barbara; Geurts, Hilde M; Hartman, Catharina A; Buitelaar, Jan K

2010-03-01

Attention-deficit/hyperactivity disorder (ADHD) and autism spectrum disorder (ASD) are both highly heritable neurodevelopmental disorders. Evidence indicates both disorders co-occur with a high frequency, in 20-50% of children with ADHD meeting criteria for ASD and in 30-80% of ASD children meeting criteria for ADHD. This review will provide an overview on all available studies [family based, twin, candidate gene, linkage, and genome wide association (GWA) studies] shedding light on the role of shared genetic underpinnings of ADHD and ASD. It is concluded that family and twin studies do provide support for the hypothesis that ADHD and ASD originate from partly similar familial/genetic factors. Only a few candidate gene studies, linkage studies and GWA studies have specifically addressed this co-occurrence, pinpointing to some promising pleiotropic genes, loci and single nucleotide polymorphisms (SNPs), but the research field is in urgent need for better designed and powered studies to tackle this complex issue. We propose that future studies examining shared familial etiological factors for ADHD and ASD use a family-based design in which the same phenotypic (ADHD and ASD), candidate endophenotypic, and environmental measurements are obtained from all family members. Multivariate multi-level models are probably best suited for the statistical analysis.

The genetic basis of panic and phobic anxiety disorders.

PubMed

Smoller, Jordan W; Gardner-Schuster, Erica; Covino, Jennifer

2008-05-15

Panic disorder and phobic anxiety disorders are common disorders that are often chronic and disabling. Genetic epidemiologic studies have documented that these disorders are familial and moderately heritable. Linkage studies have implicated several chromosomal regions that may harbor susceptibility genes; however, candidate gene association studies have not established a role for any specific loci to date. Increasing evidence from family and genetic studies suggests that genes underlying these disorders overlap and transcend diagnostic boundaries. Heritable forms of anxious temperament, anxiety-related personality traits and neuroimaging assays of fear circuitry may represent intermediate phenotypes that predispose to panic and phobic disorders. The identification of specific susceptibility variants will likely require much larger sample sizes and the integration of insights from genetic analyses of animal models and intermediate phenotypes. Copyright 2008 Wiley-Liss, Inc.

Comparative Analysis of Fruit Metabolites and Pungency Candidate Genes Expression between Bhut Jolokia and Other Capsicum Species.

PubMed

M, Sarpras; Gaur, Rashmi; Sharma, Vineet; Chhapekar, Sushil Satish; Das, Jharna; Kumar, Ajay; Yadava, Satish Kumar; Nitin, Mukesh; Brahma, Vijaya; Abraham, Suresh K; Ramchiary, Nirala

2016-01-01

Bhut jolokia, commonly known as Ghost chili, a native Capsicum species found in North East India was recorded as the naturally occurring hottest chili in the world by the Guinness Book of World Records in 2006. Although few studies have reported variation in pungency content of this particular species, no study till date has reported detailed expression analysis of candidate genes involved in capsaicinoids (pungency) biosynthesis pathway and other fruit metabolites. Therefore, the present study was designed to evaluate the diversity of fruit morphology, fruiting habit, capsaicinoids and other metabolite contents in 136 different genotypes mainly collected from North East India. Significant intra and inter-specific variations for fruit morphological traits, fruiting habits and 65 fruit metabolites were observed in the collected Capsicum germplasm belonging to three Capsicum species i.e., Capsicum chinense (Bhut jolokia, 63 accessions), C. frutescens (17 accessions) and C. annuum (56 accessions). The pungency level, measured in Scoville Heat Unit (SHU) and antioxidant activity measured by 2, 2-diphenyl-1-picrylhydrazyl (DPPH) free radical scavenging assay showed maximum levels in C. chinense accessions followed by C. frutescens accessions, while C. annuum accessions showed the lowest value for both the traits. The number of different fruit metabolites detected did not vary significantly among the different species but the metabolite such as benzoic acid hydroxyl esters identified in large percentage in majority of C. annuum genotypes was totally absent in the C. chinense genotypes and sparingly present in few genotypes of C. frutescens. Significant correlations were observed between fruit metabolites capsaicin, dihydrocapsaicin, hexadecanoic acid, cyclopentane, α-tocopherol and antioxidant activity. Furthermore, comparative expression analysis (through qRT-PCR) of candidate genes involved in capsaicinoid biosynthesis pathway revealed many fold higher expression of majority of the genes in C. chinense compared to C. frutescens and C. annuum suggesting that the possible reason for extremely high pungency might be due to the higher level of candidate gene(s) expression although nucleotide variation in pungency related genes may also be involved in imparting variations in level of pungency.

Comparative Analysis of Fruit Metabolites and Pungency Candidate Genes Expression between Bhut Jolokia and Other Capsicum Species

PubMed Central

M, Sarpras; Gaur, Rashmi; Sharma, Vineet; Chhapekar, Sushil Satish; Das, Jharna; Kumar, Ajay; Yadava, Satish Kumar; Nitin, Mukesh; Brahma, Vijaya; Abraham, Suresh K.; Ramchiary, Nirala

2016-01-01

Bhut jolokia, commonly known as Ghost chili, a native Capsicum species found in North East India was recorded as the naturally occurring hottest chili in the world by the Guinness Book of World Records in 2006. Although few studies have reported variation in pungency content of this particular species, no study till date has reported detailed expression analysis of candidate genes involved in capsaicinoids (pungency) biosynthesis pathway and other fruit metabolites. Therefore, the present study was designed to evaluate the diversity of fruit morphology, fruiting habit, capsaicinoids and other metabolite contents in 136 different genotypes mainly collected from North East India. Significant intra and inter-specific variations for fruit morphological traits, fruiting habits and 65 fruit metabolites were observed in the collected Capsicum germplasm belonging to three Capsicum species i.e., Capsicum chinense (Bhut jolokia, 63 accessions), C. frutescens (17 accessions) and C. annuum (56 accessions). The pungency level, measured in Scoville Heat Unit (SHU) and antioxidant activity measured by 2, 2-diphenyl-1-picrylhydrazyl (DPPH) free radical scavenging assay showed maximum levels in C. chinense accessions followed by C. frutescens accessions, while C. annuum accessions showed the lowest value for both the traits. The number of different fruit metabolites detected did not vary significantly among the different species but the metabolite such as benzoic acid hydroxyl esters identified in large percentage in majority of C. annuum genotypes was totally absent in the C. chinense genotypes and sparingly present in few genotypes of C. frutescens. Significant correlations were observed between fruit metabolites capsaicin, dihydrocapsaicin, hexadecanoic acid, cyclopentane, α-tocopherol and antioxidant activity. Furthermore, comparative expression analysis (through qRT-PCR) of candidate genes involved in capsaicinoid biosynthesis pathway revealed many fold higher expression of majority of the genes in C. chinense compared to C. frutescens and C. annuum suggesting that the possible reason for extremely high pungency might be due to the higher level of candidate gene(s) expression although nucleotide variation in pungency related genes may also be involved in imparting variations in level of pungency. PMID:27936081

Gene expression differences between Noccaea caerulescens ecotypes help to identify candidate genes for metal phytoremediation.

PubMed

Halimaa, Pauliina; Lin, Ya-Fen; Ahonen, Viivi H; Blande, Daniel; Clemens, Stephan; Gyenesei, Attila; Häikiö, Elina; Kärenlampi, Sirpa O; Laiho, Asta; Aarts, Mark G M; Pursiheimo, Juha-Pekka; Schat, Henk; Schmidt, Holger; Tuomainen, Marjo H; Tervahauta, Arja I

2014-03-18

Populations of Noccaea caerulescens show tremendous differences in their capacity to hyperaccumulate and hypertolerate metals. To explore the differences that could contribute to these traits, we undertook SOLiD high-throughput sequencing of the root transcriptomes of three phenotypically well-characterized N. caerulescens accessions, i.e., Ganges, La Calamine, and Monte Prinzera. Genes with possible contribution to zinc, cadmium, and nickel hyperaccumulation and hypertolerance were predicted. The most significant differences between the accessions were related to metal ion (di-, trivalent inorganic cation) transmembrane transporter activity, iron and calcium ion binding, (inorganic) anion transmembrane transporter activity, and antioxidant activity. Analysis of correlation between the expression profile of each gene and the metal-related characteristics of the accessions disclosed both previously characterized (HMA4, HMA3) and new candidate genes (e.g., for nickel IRT1, ZIP10, and PDF2.3) as possible contributors to the hyperaccumulation/tolerance phenotype. A number of unknown Noccaea-specific transcripts also showed correlation with Zn(2+), Cd(2+), or Ni(2+) hyperaccumulation/tolerance. This study shows that N. caerulescens populations have evolved great diversity in the expression of metal-related genes, facilitating adaptation to various metalliferous soils. The information will be helpful in the development of improved plants for metal phytoremediation.

Brain Transcriptional Profiles of Male Alternative Reproductive Tactics and Females in Bluegill Sunfish

PubMed Central

Partridge, Charlyn G.; MacManes, Matthew D.; Knapp, Rosemary; Neff, Bryan D.

2016-01-01

Bluegill sunfish (Lepomis macrochirus) are one of the classic systems for studying male alternative reproductive tactics (ARTs) in teleost fishes. In this species, there are two distinct life histories: parental and cuckolder, encompassing three reproductive tactics, parental, satellite, and sneaker. The parental life history is fixed, whereas individuals who enter the cuckolder life history transition from sneaker to satellite tactic as they grow. For this study, we used RNAseq to characterize the brain transcriptome of the three male tactics and females during spawning to identify gene ontology (GO) categories and potential candidate genes associated with each tactic. We found that sneaker males had higher levels of gene expression differentiation compared to the other two male tactics. Sneaker males also had higher expression in ionotropic glutamate receptor genes, specifically AMPA receptors, compared to other males, which may be important for increased spatial working memory while attempting to cuckold parental males at their nests. Larger differences in gene expression also occurred among male tactics than between males and females. We found significant expression differences in several candidate genes that were previously identified in other species with ARTs and suggest a previously undescribed role for cAMP-responsive element modulator (crem) in influencing parental male behaviors during spawning. PMID:27907106

Brain Transcriptional Profiles of Male Alternative Reproductive Tactics and Females in Bluegill Sunfish.

PubMed

Partridge, Charlyn G; MacManes, Matthew D; Knapp, Rosemary; Neff, Bryan D

2016-01-01

Bluegill sunfish (Lepomis macrochirus) are one of the classic systems for studying male alternative reproductive tactics (ARTs) in teleost fishes. In this species, there are two distinct life histories: parental and cuckolder, encompassing three reproductive tactics, parental, satellite, and sneaker. The parental life history is fixed, whereas individuals who enter the cuckolder life history transition from sneaker to satellite tactic as they grow. For this study, we used RNAseq to characterize the brain transcriptome of the three male tactics and females during spawning to identify gene ontology (GO) categories and potential candidate genes associated with each tactic. We found that sneaker males had higher levels of gene expression differentiation compared to the other two male tactics. Sneaker males also had higher expression in ionotropic glutamate receptor genes, specifically AMPA receptors, compared to other males, which may be important for increased spatial working memory while attempting to cuckold parental males at their nests. Larger differences in gene expression also occurred among male tactics than between males and females. We found significant expression differences in several candidate genes that were previously identified in other species with ARTs and suggest a previously undescribed role for cAMP-responsive element modulator (crem) in influencing parental male behaviors during spawning.

Pediatric Glioblastoma Therapies Based on Patient-Derived Stem Cell Resources

DTIC Science & Technology

2013-10-01

stem cell lines have been successfully isolated from adults, in this proposal we aim to isolate and characterize GSC populations from pediatric patients. In the past two years we have successfully derived and cultured eight patient-derived pediatric glioma stem cell lines. In the past year we have continued molecular and phenotypic characterization of these lines. This characterization included analysis of gene expression and patient-specific gene mutations, and also proof-of-concept shRNA screens. In addition we have begun to identify candidate

Kinase domain-targeted isolation of defense-related receptor-like kinases (RLK/Pelle) in Platanus×acerifolia: phylogenetic and structural analysis.

PubMed

Pilotti, Massimo; Brunetti, Angela; Uva, Paolo; Lumia, Valentina; Tizzani, Lorenza; Gervasi, Fabio; Iacono, Michele; Pindo, Massimo

2014-12-08

Plant receptor-like kinase (RLK/Pelle) family regulates growth and developmental processes and interaction with pathogens and symbionts.Platanaceae is one of the earliest branches of Eudicots temporally located before the split which gave rise to Rosids and Asterids. Thus investigations into the RLK family in Platanus can provide information on the evolution of this gene family in the land plants.Moreover RLKs are good candidates for finding genes that are able to confer resistance to Platanus pathogens. Degenerate oligonucleotide primers targeting the kinase domain of stress-related RLKs were used to isolate for the first time 111 RLK gene fragments in Platanus×acerifolia. Sequences were classified as candidates of the following subfamilies: CrRLK1L, LRR XII, WAK-like, and LRR X-BRI1 group. All the structural features typical of the RLK kinase domain were identified, including the non-RD motif which marks potential pathogen recognition receptors (PRRs). The LRR XII candidates, whose counterpart in Arabidopsis and rice comprises non-RD PRRs, were mostly non-RD kinases, suggesting a group of PRRs. Region-specific signatures of a relaxed purifying selection in the LRR XII candidates were also found, which is novel for plant RLK kinase domain and further supports the role of LRR XII candidates as PRRs. As we obtained CrRLK1L candidates using primers designed on Pto of tomato, we analysed the phylogenetic relationship between CrRLK1L and Pto-like of plant species. We thus classified all non-solanaceous Pto-like genes as CrRLK1L and highlighted for the first time the close phylogenetic vicinity between CrRLK1L and Pto group. The origins of Pto from CrRLK1L is proposed as an evolutionary mechanism. The signatures of relaxed purifying selection highlight that a group of RLKs might have been involved in the expression of phenotypic plasticity and is thus a good candidate for investigations into pathogen resistance.Search of Pto-like genes in Platanus highlighted the close relationship between CrRLK1L and Pto group. It will be exciting to verify if sensu strictu Pto are present in taxonomic groups other than Solanaceae, in order to further clarify the evolutionary link with CrRLK1L.We obtained a first valuable resource useful for an in-depth study on stress perception systems.

Extra Large G-Protein Interactome Reveals Multiple Stress Response Function and Partner-Dependent XLG Subcellular Localization

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liang, Ying; Gao, Yajun; Jones, Alan M.

The three-member family of Arabidopsis extra-large G proteins (XLG1-3) defines the prototype of an atypical Ga subunit in the heterotrimeric G protein complex. Some recent evidence indicate that XLG subunits operate along with its Gbg dimer in root morphology, stress responsiveness, and cytokinin induced development, however downstream targets of activated XLG proteins in the stress pathways are rarely known. In order to assemble a set of candidate XLG-targeted proteins, a yeast two-hybrid complementation-based screen was performed using XLG protein baits to query interactions between XLG and partner protein found in glucose-treated seedlings, roots, and Arabidopsis cells in culture. Seventy twomore » interactors were identified and >60% of a test set displayed in vivo interaction with XLG proteins. Gene co-expression analysis shows that >70% of the interactors are positively correlated with the corresponding XLG partners. Gene Ontology enrichment for all the candidates indicates stress responses and posits a molecular mechanism involving a specific set of transcription factor partners to XLG. Genes encoding two of these transcription factors, SZF1 and 2, require XLG proteins for full NaCl-induced expression. Furthermore, the subcellular localization of the XLG proteins in the nucleus, endosome, and plasma membrane is dependent on the specific interacting partner.« less

Extra Large G-Protein Interactome Reveals Multiple Stress Response Function and Partner-Dependent XLG Subcellular Localization

DOE PAGES

Liang, Ying; Gao, Yajun; Jones, Alan M.

2017-06-13

The three-member family of Arabidopsis extra-large G proteins (XLG1-3) defines the prototype of an atypical Ga subunit in the heterotrimeric G protein complex. Some recent evidence indicate that XLG subunits operate along with its Gbg dimer in root morphology, stress responsiveness, and cytokinin induced development, however downstream targets of activated XLG proteins in the stress pathways are rarely known. In order to assemble a set of candidate XLG-targeted proteins, a yeast two-hybrid complementation-based screen was performed using XLG protein baits to query interactions between XLG and partner protein found in glucose-treated seedlings, roots, and Arabidopsis cells in culture. Seventy twomore » interactors were identified and >60% of a test set displayed in vivo interaction with XLG proteins. Gene co-expression analysis shows that >70% of the interactors are positively correlated with the corresponding XLG partners. Gene Ontology enrichment for all the candidates indicates stress responses and posits a molecular mechanism involving a specific set of transcription factor partners to XLG. Genes encoding two of these transcription factors, SZF1 and 2, require XLG proteins for full NaCl-induced expression. Furthermore, the subcellular localization of the XLG proteins in the nucleus, endosome, and plasma membrane is dependent on the specific interacting partner.« less

[Construction and expression analysis of the zebrafish heart-specific transgenetic vector based on Tol2 transposable element].

PubMed

Chen, Tingfang; Luo, Na; Xie, Huaping; Wu, Xiushan; Deng, Yun

2010-02-01

In an effort to generate a desired expression construct for making heart-specific expression transgenic zebrafish, a Tol2 plasmid, which can drive EGFP reporter gene specifically expressed in the heart, was modified using subcloning technology. An IRES fragment bearing multiple cloning site (MCS) was amplified directly from pIRES2-EGFP plasmid and was inserted between the CMLC2 promoter and EGFP fragment of the pDestTol2CG vector. This recombinant expression plasmid pTol2-CMLC2-IRES-EGFP can drive any interested gene specifically expressed in the zebrafish heart along with EGFP reporter gene. To test the effectiveness of this new expression plasmid, we constructed pTol2-CMLC2-RED-IRES-EGFP plasmid by inserting another reporter gene DsRed-Monome into MCS downstream of the CMLC2 promoter and injected this transgenic recombinant plasmid into one-cell stage embryos of zebrafish. Under fluorescence microscope, both the red fluorescence and the green fluorescence produced by pTol2-CMLC2-RED-IRES-EGFP were detected specifically in the heart tissue in the same expression pattern. This novel expression construct pTol2-CMLC2-IRES-EGFP will become an important tool for our research on identifying heart development candidate genes' function using zebrafish as a model.

Identification of candidate chemosensory genes in the antennal transcriptome of Tenebrio molitor (Coleoptera: Tenebrionidae).

PubMed

Liu, Su; Rao, Xiang-Jun; Li, Mao-Ye; Feng, Ming-Feng; He, Meng-Zhu; Li, Shi-Guang

2015-03-01

We present the first antennal transcriptome sequencing information for the yellow mealworm beetle, Tenebrio molitor (Coleoptera: Tenebrionidae). Analysis of the transcriptome dataset obtained 52,216,616 clean reads, from which 35,363 unigenes were assembled. Of these, 18,820 unigenes showed significant similarity (E-value <10(-5)) to known proteins in the NCBI non-redundant protein database. Gene ontology (GO) and Cluster of Orthologous Groups (COG) analyses were used for functional classification of these unigenes. We identified 19 putative odorant-binding protein (OBP) genes, 12 chemosensory protein (CSP) genes, 20 olfactory receptor (OR) genes, 6 ionotropic receptor (IR) genes and 2 sensory neuron membrane protein (SNMP) genes. BLASTX best hit results indicated that these chemosensory genes were most identical to their respective orthologs from Tribolium castaneum. Phylogenetic analyses also revealed that the T. molitor OBPs and CSPs are closely related to those of T. castaneum. Real-time quantitative PCR assays showed that eight TmolOBP genes were antennae-specific. Of these, TmolOBP5, TmolOBP7 and TmolOBP16 were found to be predominantly expressed in male antennae, while TmolOBP17 was expressed mainly in the legs of males. Several other genes were identified that were neither tissue-specific nor sex-specific. These results establish a firm foundation for future studies of the chemosensory genes in T. molitor. Copyright © 2015 Elsevier Inc. All rights reserved.

A study of alternative splicing in the pig

PubMed Central

2010-01-01

Background Since at least half of the genes in mammalian genomes are subjected to alternative splicing, alternative pre-mRNA splicing plays an important contribution to the complexity of the mammalian proteome. Expressed sequence tags (ESTs) provide evidence of a great number of possible alternative isoforms. With the EST resource for the domestic pig now containing more than one million porcine ESTs, it is possible to identify alternative splice forms of the individual transcripts in this species from the EST data with some confidence. Results The pig EST data generated by the Sino-Danish Pig Genome project has been assembled with publicly available ESTs and made available in the PigEST database. Using the Distiller package 2,515 EST clusters with candidate alternative isoforms were identified in the EST data with high confidence. In agreement with general observations in human and mouse, we find putative splice variants in about 30% of the contigs with more than 50 ESTs. Based on the criteria that a minimum of two EST sequences confirmed each splice event, a list of 100 genes with the most distinct tissue-specific alternative splice events was generated from the list of candidates. To confirm the tissue specificity of the splice events, 10 genes with functional annotation were randomly selected from which 16 individual splice events were chosen for experimental verification by quantitative PCR (qPCR). Six genes were shown to have tissue specific alternatively spliced transcripts with expression patterns matching those of the EST data. The remaining four genes had tissue-restricted expression of alternative spliced transcripts. Five out of the 16 splice events that were experimentally verified were found to be putative pig specific. Conclusions In accordance with human and rodent studies we estimate that approximately 30% of the porcine genes undergo alternative splicing. We found a good correlation between EST predicted tissue-specificity and experimentally validated splice events in different porcine tissue. This study indicates that a cluster size of around 50 ESTs is optimal for in silico detection of alternative splicing. Although based on a limited number of splice events, the study supports the notion that alternative splicing could have an important impact on species differentiation since 31% of the splice events studied appears to be species specific. PMID:20444244

The abundance of cis-acting loci leading to differential allele expression in F1 mice and their relationship to loci harboring genes affecting complex traits.

PubMed

Yeo, Seungeun; Hodgkinson, Colin A; Zhou, Zhifeng; Jung, Jeesun; Leung, Ming; Yuan, Qiaoping; Goldman, David

2016-08-11

Genome-wide surveys have detected cis-acting quantitative trait loci altering levels of RNA transcripts (RNA-eQTLs) by associating SNV alleles to transcript levels. However, the sensitivity and specificity of detection of cis- expression quantitative trait loci (eQTLs) by genetic approaches, reliant as it is on measurements of transcript levels in recombinant inbred strains or offspring from arranged crosses, is unknown, as is their relationship to QTL's for complex phenotypes. We used transcriptome-wide differential allele expression (DAE) to detect cis-eQTLs in forebrain and kidney from reciprocal crosses between three mouse inbred strains, 129S1/SvlmJ, DBA/2J, and CAST/EiJ and C57BL/6 J. Two of these crosses were previously characterized for cis-eQTLs and QTLs for various complex phenotypes by genetic analysis of recombinant inbred (RI) strains. 5.4 %, 1.9 % and 1.5 % of genes assayed in forebrain of B6/129SF1, B6/DBAF1, and B6/CASTF1 mice, respectively, showed differential allelic expression, indicative of cis-acting alleles at these genes. Moreover, the majority of DAE QTLs were observed to be tissue-specific with only a small fraction showing cis-effects in both tissues. Comparing DAE QTLs in F1 mice to cis-eQTLs previously mapped in RI strains we observed that many of the cis-eQTLs were not confirmed by DAE. Additionally several novel DAE-QTLs not identified as cis-eQTLs were identified suggesting that there are differences in sensitivity and specificity for QTL detection between the two methodologies. Strain specific DAE QTLs in B6/DBAF1 mice were located in excess at candidate genes for alcohol use disorders, seizures, and angiogenesis previously implicated by genetic linkage in C57BL/6J × DBA/2JF2 mice or BXD RI strains. Via a survey for differential allele expression in F1 mice, a substantial proportion of genes were found to have alleles altering expression in cis-acting fashion. Comparing forebrain and kidney, many or most of these alleles were tissue-specific in action. The identification of strain specific DAE QTLs, can assist in assessment of candidate genes located within the large intervals associated with trait QTLs.

A Near-Complete Haplotype-Phased Genome of the Dikaryotic Wheat Stripe Rust Fungus Puccinia striiformis f. sp. tritici Reveals High Interhaplotype Diversity

PubMed Central

Sperschneider, Jana; Garnica, Diana P.; Miller, Marisa E.; Taylor, Jennifer M.; Dodds, Peter N.; Park, Robert F.

2018-01-01

ABSTRACT A long-standing biological question is how evolution has shaped the genomic architecture of dikaryotic fungi. To answer this, high-quality genomic resources that enable haplotype comparisons are essential. Short-read genome assemblies for dikaryotic fungi are highly fragmented and lack haplotype-specific information due to the high heterozygosity and repeat content of these genomes. Here, we present a diploid-aware assembly of the wheat stripe rust fungus Puccinia striiformis f. sp. tritici based on long reads using the FALCON-Unzip assembler. Transcriptome sequencing data sets were used to infer high-quality gene models and identify virulence genes involved in plant infection referred to as effectors. This represents the most complete Puccinia striiformis f. sp. tritici genome assembly to date (83 Mb, 156 contigs, N50 of 1.5 Mb) and provides phased haplotype information for over 92% of the genome. Comparisons of the phase blocks revealed high interhaplotype diversity of over 6%. More than 25% of all genes lack a clear allelic counterpart. When we investigated genome features that potentially promote the rapid evolution of virulence, we found that candidate effector genes are spatially associated with conserved genes commonly found in basidiomycetes. Yet, candidate effectors that lack an allelic counterpart are more distant from conserved genes than allelic candidate effectors and are less likely to be evolutionarily conserved within the P. striiformis species complex and Pucciniales. In summary, this haplotype-phased assembly enabled us to discover novel genome features of a dikaryotic plant-pathogenic fungus previously hidden in collapsed and fragmented genome assemblies. PMID:29463659

Mapping and characterization of the amplicon near APOA2 in 1q23 in human sarcomas by FISH and array CGH.

PubMed

Kresse, Stine H; Berner, Jeanne-Marie; Meza-Zepeda, Leonardo A; Gregory, Simon G; Kuo, Wen-Lin; Gray, Joe W; Forus, Anne; Myklebost, Ola

2005-11-07

Amplification of the q21-q23 region on chromosome 1 is frequently found in sarcomas and a variety of other solid tumours. Previous analyses of sarcomas have indicated the presence of at least two separate amplicons within this region, one located in 1q21 and one located near the apolipoprotein A-II (APOA2) gene in 1q23. In this study we have mapped and characterized the amplicon in 1q23 in more detail. We have used fluorescence in situ hybridisation (FISH) and microarray-based comparative genomic hybridisation (array CGH) to map and define the borders of the amplicon in 10 sarcomas. A subregion of approximately 800 kb was identified as the core of the amplicon. The amplification patterns of nine possible candidate target genes located to this subregion were determined by Southern blot analysis. The genes activating transcription factor 6 (ATF6) and dual specificity phosphatase 12 (DUSP12) showed the highest level of amplification, and they were also shown to be over-expressed by quantitative real-time reverse transcription PCR (RT-PCR). In general, the level of expression reflected the level of amplification in the different tumours. DUSP12 was expressed significantly higher than ATF6 in a subset of the tumours. In addition, two genes known to be transcriptionally activated by ATF6, glucose-regulated protein 78 kDa and -94 kDa (GRP78 and GRP94), were shown to be over-expressed in the tumours that showed over-expression of ATF6. ATF6 and DUSP12 seem to be the most likely candidate target genes for the 1q23 amplification in sarcomas. Both genes have possible roles in promoting cell growth, which makes them interesting candidate targets.

Alkane hydroxylase genes in psychrophile genomes and the potential for cold active catalysis.

PubMed

Bowman, Jeff S; Deming, Jody W

2014-12-16

Psychrophiles are presumed to play a large role in the catabolism of alkanes and other components of crude oil in natural low temperature environments. In this study we analyzed the functional diversity of genes for alkane hydroxylases, the enzymes responsible for converting alkanes to more labile alcohols, as found in the genomes of nineteen psychrophiles for which alkane degradation has not been reported. To identify possible mechanisms of low temperature optimization we compared putative alkane hydroxylases from these psychrophiles with homologues from nineteen taxonomically related mesophilic strains. Seven of the analyzed psychrophile genomes contained a total of 27 candidate alkane hydroxylase genes, only two of which are currently annotated as alkane hydroxylase. These candidates were mostly related to the AlkB and cytochrome p450 alkane hydroxylases, but several homologues of the LadA and AlmA enzymes, significant for their ability to degrade long-chain alkanes, were also detected. These putative alkane hydroxylases showed significant differences in primary structure from their mesophile homologues, with preferences for specific amino acids and increased flexibility on loops, bends, and α-helices. A focused analysis on psychrophile genomes led to discovery of numerous candidate alkane hydroxylase genes not currently annotated as alkane hydroxylase. Gene products show signs of optimization to low temperature, including regions of increased flexibility and amino acid preferences typical of psychrophilic proteins. These findings are consistent with observations of microbial degradation of crude oil in cold environments and identify proteins that can be targeted in rate studies and in the design of molecular tools for low temperature bioremediation.

A computational approach to candidate gene prioritization for X-linked mental retardation using annotation-based binary filtering and motif-based linear discriminatory analysis

PubMed Central

2011-01-01

Background Several computational candidate gene selection and prioritization methods have recently been developed. These in silico selection and prioritization techniques are usually based on two central approaches - the examination of similarities to known disease genes and/or the evaluation of functional annotation of genes. Each of these approaches has its own caveats. Here we employ a previously described method of candidate gene prioritization based mainly on gene annotation, in accompaniment with a technique based on the evaluation of pertinent sequence motifs or signatures, in an attempt to refine the gene prioritization approach. We apply this approach to X-linked mental retardation (XLMR), a group of heterogeneous disorders for which some of the underlying genetics is known. Results The gene annotation-based binary filtering method yielded a ranked list of putative XLMR candidate genes with good plausibility of being associated with the development of mental retardation. In parallel, a motif finding approach based on linear discriminatory analysis (LDA) was employed to identify short sequence patterns that may discriminate XLMR from non-XLMR genes. High rates (>80%) of correct classification was achieved, suggesting that the identification of these motifs effectively captures genomic signals associated with XLMR vs. non-XLMR genes. The computational tools developed for the motif-based LDA is integrated into the freely available genomic analysis portal Galaxy (http://main.g2.bx.psu.edu/). Nine genes (APLN, ZC4H2, MAGED4, MAGED4B, RAP2C, FAM156A, FAM156B, TBL1X, and UXT) were highlighted as highly-ranked XLMR methods. Conclusions The combination of gene annotation information and sequence motif-orientated computational candidate gene prediction methods highlight an added benefit in generating a list of plausible candidate genes, as has been demonstrated for XLMR. Reviewers: This article was reviewed by Dr Barbara Bardoni (nominated by Prof Juergen Brosius); Prof Neil Smalheiser and Dr Dustin Holloway (nominated by Prof Charles DeLisi). PMID:21668950

The construction of an EST database for Bombyx mori and its application

PubMed Central

Mita, Kazuei; Morimyo, Mitsuoki; Okano, Kazuhiro; Koike, Yoshiko; Nohata, Junko; Kawasaki, Hideki; Kadono-Okuda, Keiko; Yamamoto, Kimiko; Suzuki, Masataka G.; Shimada, Toru; Goldsmith, Marian R.; Maeda, Susumu

2003-01-01

To build a foundation for the complete genome analysis of Bombyx mori, we have constructed an EST database. Because gene expression patterns deeply depend on tissues as well as developmental stages, we analyzed many cDNA libraries prepared from various tissues and different developmental stages to cover the entire set of Bombyx genes. So far, the Bombyx EST database contains 35,000 ESTs from 36 cDNA libraries, which are grouped into ≈11,000 nonredundant ESTs with the average length of 1.25 kb. The comparison with FlyBase suggests that the present EST database, SilkBase, covers >55% of all genes of Bombyx. The fraction of library-specific ESTs in each cDNA library indicates that we have not yet reached saturation, showing the validity of our strategy for constructing an EST database to cover all genes. To tackle the coming saturation problem, we have checked two methods, subtraction and normalization, to increase coverage and decrease the number of housekeeping genes, resulting in a 5–11% increase of library-specific ESTs. The identification of a number of genes and comprehensive cloning of gene families have already emerged from the SilkBase search. Direct links of SilkBase with FlyBase and WormBase provide ready identification of candidate Lepidoptera-specific genes. PMID:14614147

Composite selection signals can localize the trait specific genomic regions in multi-breed populations of cattle and sheep

PubMed Central

2014-01-01

Background Discerning the traits evolving under neutral conditions from those traits evolving rapidly because of various selection pressures is a great challenge. We propose a new method, composite selection signals (CSS), which unifies the multiple pieces of selection evidence from the rank distribution of its diverse constituent tests. The extreme CSS scores capture highly differentiated loci and underlying common variants hauling excess haplotype homozygosity in the samples of a target population. Results The data on high-density genotypes were analyzed for evidence of an association with either polledness or double muscling in various cohorts of cattle and sheep. In cattle, extreme CSS scores were found in the candidate regions on autosome BTA-1 and BTA-2, flanking the POLL locus and MSTN gene, for polledness and double muscling, respectively. In sheep, the regions with extreme scores were localized on autosome OAR-2 harbouring the MSTN gene for double muscling and on OAR-10 harbouring the RXFP2 gene for polledness. In comparison to the constituent tests, there was a partial agreement between the signals at the four candidate loci; however, they consistently identified additional genomic regions harbouring no known genes. Persuasively, our list of all the additional significant CSS regions contains genes that have been successfully implicated to secondary phenotypic diversity among several subpopulations in our data. For example, the method identified a strong selection signature for stature in cattle capturing selective sweeps harbouring UQCC-GDF5 and PLAG1-CHCHD7 gene regions on BTA-13 and BTA-14, respectively. Both gene pairs have been previously associated with height in humans, while PLAG1-CHCHD7 has also been reported for stature in cattle. In the additional analysis, CSS identified significant regions harbouring multiple genes for various traits under selection in European cattle including polledness, adaptation, metabolism, growth rate, stature, immunity, reproduction traits and some other candidate genes for dairy and beef production. Conclusions CSS successfully localized the candidate regions in validation datasets as well as identified previously known and novel regions for various traits experiencing selection pressure. Together, the results demonstrate the utility of CSS by its improved power, reduced false positives and high-resolution of selection signals as compared to individual constituent tests. PMID:24636660

Next-generation DNA sequencing identifies novel gene variants and pathways involved in specific language impairment.

PubMed

Chen, Xiaowei Sylvia; Reader, Rose H; Hoischen, Alexander; Veltman, Joris A; Simpson, Nuala H; Francks, Clyde; Newbury, Dianne F; Fisher, Simon E

2017-04-25

A significant proportion of children have unexplained problems acquiring proficient linguistic skills despite adequate intelligence and opportunity. Developmental language disorders are highly heritable with substantial societal impact. Molecular studies have begun to identify candidate loci, but much of the underlying genetic architecture remains undetermined. We performed whole-exome sequencing of 43 unrelated probands affected by severe specific language impairment, followed by independent validations with Sanger sequencing, and analyses of segregation patterns in parents and siblings, to shed new light on aetiology. By first focusing on a pre-defined set of known candidates from the literature, we identified potentially pathogenic variants in genes already implicated in diverse language-related syndromes, including ERC1, GRIN2A, and SRPX2. Complementary analyses suggested novel putative candidates carrying validated variants which were predicted to have functional effects, such as OXR1, SCN9A and KMT2D. We also searched for potential "multiple-hit" cases; one proband carried a rare AUTS2 variant in combination with a rare inherited haplotype affecting STARD9, while another carried a novel nonsynonymous variant in SEMA6D together with a rare stop-gain in SYNPR. On broadening scope to all rare and novel variants throughout the exomes, we identified biological themes that were enriched for such variants, including microtubule transport and cytoskeletal regulation.

Next-generation DNA sequencing identifies novel gene variants and pathways involved in specific language impairment

PubMed Central

Chen, Xiaowei Sylvia; Reader, Rose H.; Hoischen, Alexander; Veltman, Joris A.; Simpson, Nuala H.; Francks, Clyde; Newbury, Dianne F.; Fisher, Simon E.

2017-01-01

A significant proportion of children have unexplained problems acquiring proficient linguistic skills despite adequate intelligence and opportunity. Developmental language disorders are highly heritable with substantial societal impact. Molecular studies have begun to identify candidate loci, but much of the underlying genetic architecture remains undetermined. We performed whole-exome sequencing of 43 unrelated probands affected by severe specific language impairment, followed by independent validations with Sanger sequencing, and analyses of segregation patterns in parents and siblings, to shed new light on aetiology. By first focusing on a pre-defined set of known candidates from the literature, we identified potentially pathogenic variants in genes already implicated in diverse language-related syndromes, including ERC1, GRIN2A, and SRPX2. Complementary analyses suggested novel putative candidates carrying validated variants which were predicted to have functional effects, such as OXR1, SCN9A and KMT2D. We also searched for potential “multiple-hit” cases; one proband carried a rare AUTS2 variant in combination with a rare inherited haplotype affecting STARD9, while another carried a novel nonsynonymous variant in SEMA6D together with a rare stop-gain in SYNPR. On broadening scope to all rare and novel variants throughout the exomes, we identified biological themes that were enriched for such variants, including microtubule transport and cytoskeletal regulation. PMID:28440294

The CanOE strategy: integrating genomic and metabolic contexts across multiple prokaryote genomes to find candidate genes for orphan enzymes.

PubMed

Smith, Adam Alexander Thil; Belda, Eugeni; Viari, Alain; Medigue, Claudine; Vallenet, David

2012-05-01

Of all biochemically characterized metabolic reactions formalized by the IUBMB, over one out of four have yet to be associated with a nucleic or protein sequence, i.e. are sequence-orphan enzymatic activities. Few bioinformatics annotation tools are able to propose candidate genes for such activities by exploiting context-dependent rather than sequence-dependent data, and none are readily accessible and propose result integration across multiple genomes. Here, we present CanOE (Candidate genes for Orphan Enzymes), a four-step bioinformatics strategy that proposes ranked candidate genes for sequence-orphan enzymatic activities (or orphan enzymes for short). The first step locates "genomic metabolons", i.e. groups of co-localized genes coding proteins catalyzing reactions linked by shared metabolites, in one genome at a time. These metabolons can be particularly helpful for aiding bioanalysts to visualize relevant metabolic data. In the second step, they are used to generate candidate associations between un-annotated genes and gene-less reactions. The third step integrates these gene-reaction associations over several genomes using gene families, and summarizes the strength of family-reaction associations by several scores. In the final step, these scores are used to rank members of gene families which are proposed for metabolic reactions. These associations are of particular interest when the metabolic reaction is a sequence-orphan enzymatic activity. Our strategy found over 60,000 genomic metabolons in more than 1,000 prokaryote organisms from the MicroScope platform, generating candidate genes for many metabolic reactions, of which more than 70 distinct orphan reactions. A computational validation of the approach is discussed. Finally, we present a case study on the anaerobic allantoin degradation pathway in Escherichia coli K-12.

Transcriptome analysis of Brassica napus pod using RNA-Seq and identification of lipid-related candidate genes.

PubMed

Xu, Hai-Ming; Kong, Xiang-Dong; Chen, Fei; Huang, Ji-Xiang; Lou, Xiang-Yang; Zhao, Jian-Yi

2015-10-24

Brassica napus is an important oilseed crop. Dissection of the genetic architecture underlying oil-related biological processes will greatly facilitates the genetic improvement of rapeseed. The differential gene expression during pod development offers a snapshot on the genes responsible for oil accumulation in. To identify candidate genes in the linkage peaks reported previously, we used RNA sequencing (RNA-Seq) technology to analyze the pod transcriptomes of German cultivar Sollux and Chinese inbred line Gaoyou. The RNA samples were collected for RNA-Seq at 5-7, 15-17 and 25-27 days after flowering (DAF). Bioinformatics analysis was performed to investigate differentially expressed genes (DEGs). Gene annotation analysis was integrated with QTL mapping and Brassica napus pod transcriptome profiling to detect potential candidate genes in oilseed. Four hundred sixty five and two thousand, one hundred fourteen candidate DEGs were identified, respectively, between two varieties at the same stages and across different periods of each variety. Then, 33 DEGs between Sollux and Gaoyou were identified as the candidate genes affecting seed oil content by combining those DEGs with the quantitative trait locus (QTL) mapping results, of which, one was found to be homologous to Arabidopsis thaliana lipid-related genes. Intervarietal DEGs of lipid pathways in QTL regions represent important candidate genes for oil-related traits. Integrated analysis of transcriptome profiling, QTL mapping and comparative genomics with other relative species leads to efficient identification of most plausible functional genes underlying oil-content related characters, offering valuable resources for bettering breeding program of Brassica napus. This study provided a comprehensive overview on the pod transcriptomes of two varieties with different oil-contents at the three developmental stages.

Prediction of gene-phenotype associations in humans, mice, and plants using phenologs.

PubMed

Woods, John O; Singh-Blom, Ulf Martin; Laurent, Jon M; McGary, Kriston L; Marcotte, Edward M

2013-06-21

Phenotypes and diseases may be related to seemingly dissimilar phenotypes in other species by means of the orthology of underlying genes. Such "orthologous phenotypes," or "phenologs," are examples of deep homology, and may be used to predict additional candidate disease genes. In this work, we develop an unsupervised algorithm for ranking phenolog-based candidate disease genes through the integration of predictions from the k nearest neighbor phenologs, comparing classifiers and weighting functions by cross-validation. We also improve upon the original method by extending the theory to paralogous phenotypes. Our algorithm makes use of additional phenotype data--from chicken, zebrafish, and E. coli, as well as new datasets for C. elegans--establishing that several types of annotations may be treated as phenotypes. We demonstrate the use of our algorithm to predict novel candidate genes for human atrial fibrillation (such as HRH2, ATP4A, ATP4B, and HOPX) and epilepsy (e.g., PAX6 and NKX2-1). We suggest gene candidates for pharmacologically-induced seizures in mouse, solely based on orthologous phenotypes from E. coli. We also explore the prediction of plant gene-phenotype associations, as for the Arabidopsis response to vernalization phenotype. We are able to rank gene predictions for a significant portion of the diseases in the Online Mendelian Inheritance in Man database. Additionally, our method suggests candidate genes for mammalian seizures based only on bacterial phenotypes and gene orthology. We demonstrate that phenotype information may come from diverse sources, including drug sensitivities, gene ontology biological processes, and in situ hybridization annotations. Finally, we offer testable candidates for a variety of human diseases, plant traits, and other classes of phenotypes across a wide array of species.

Endeavour update: a web resource for gene prioritization in multiple species

PubMed Central

Tranchevent, Léon-Charles; Barriot, Roland; Yu, Shi; Van Vooren, Steven; Van Loo, Peter; Coessens, Bert; De Moor, Bart; Aerts, Stein; Moreau, Yves

2008-01-01

Endeavour (http://www.esat.kuleuven.be/endeavourweb; this web site is free and open to all users and there is no login requirement) is a web resource for the prioritization of candidate genes. Using a training set of genes known to be involved in a biological process of interest, our approach consists of (i) inferring several models (based on various genomic data sources), (ii) applying each model to the candidate genes to rank those candidates against the profile of the known genes and (iii) merging the several rankings into a global ranking of the candidate genes. In the present article, we describe the latest developments of Endeavour. First, we provide a web-based user interface, besides our Java client, to make Endeavour more universally accessible. Second, we support multiple species: in addition to Homo sapiens, we now provide gene prioritization for three major model organisms: Mus musculus, Rattus norvegicus and Caenorhabditis elegans. Third, Endeavour makes use of additional data sources and is now including numerous databases: ontologies and annotations, protein–protein interactions, cis-regulatory information, gene expression data sets, sequence information and text-mining data. We tested the novel version of Endeavour on 32 recent disease gene associations from the literature. Additionally, we describe a number of recent independent studies that made use of Endeavour to prioritize candidate genes for obesity and Type II diabetes, cleft lip and cleft palate, and pulmonary fibrosis. PMID:18508807

Differential Network Analysis Reveals Evolutionary Complexity in Secondary Metabolism of Rauvolfia serpentina over Catharanthus roseus

PubMed Central

Pathania, Shivalika; Bagler, Ganesh; Ahuja, Paramvir S.

2016-01-01

Comparative co-expression analysis of multiple species using high-throughput data is an integrative approach to determine the uniformity as well as diversification in biological processes. Rauvolfia serpentina and Catharanthus roseus, both members of Apocyanacae family, are reported to have remedial properties against multiple diseases. Despite of sharing upstream of terpenoid indole alkaloid pathway, there is significant diversity in tissue-specific synthesis and accumulation of specialized metabolites in these plants. This led us to implement comparative co-expression network analysis to investigate the modules and genes responsible for differential tissue-specific expression as well as species-specific synthesis of metabolites. Toward these goals differential network analysis was implemented to identify candidate genes responsible for diversification of metabolites profile. Three genes were identified with significant difference in connectivity leading to differential regulatory behavior between these plants. These genes may be responsible for diversification of secondary metabolism, and thereby for species-specific metabolite synthesis. The network robustness of R. serpentina, determined based on topological properties, was also complemented by comparison of gene-metabolite networks of both plants, and may have evolved to have complex metabolic mechanisms as compared to C. roseus under the influence of various stimuli. This study reveals evolution of complexity in secondary metabolism of R. serpentina, and key genes that contribute toward diversification of specific metabolites. PMID:27588023

Differential Network Analysis Reveals Evolutionary Complexity in Secondary Metabolism of Rauvolfia serpentina over Catharanthus roseus.

PubMed

Pathania, Shivalika; Bagler, Ganesh; Ahuja, Paramvir S

2016-01-01

Comparative co-expression analysis of multiple species using high-throughput data is an integrative approach to determine the uniformity as well as diversification in biological processes. Rauvolfia serpentina and Catharanthus roseus, both members of Apocyanacae family, are reported to have remedial properties against multiple diseases. Despite of sharing upstream of terpenoid indole alkaloid pathway, there is significant diversity in tissue-specific synthesis and accumulation of specialized metabolites in these plants. This led us to implement comparative co-expression network analysis to investigate the modules and genes responsible for differential tissue-specific expression as well as species-specific synthesis of metabolites. Toward these goals differential network analysis was implemented to identify candidate genes responsible for diversification of metabolites profile. Three genes were identified with significant difference in connectivity leading to differential regulatory behavior between these plants. These genes may be responsible for diversification of secondary metabolism, and thereby for species-specific metabolite synthesis. The network robustness of R. serpentina, determined based on topological properties, was also complemented by comparison of gene-metabolite networks of both plants, and may have evolved to have complex metabolic mechanisms as compared to C. roseus under the influence of various stimuli. This study reveals evolution of complexity in secondary metabolism of R. serpentina, and key genes that contribute toward diversification of specific metabolites.

Functional genomics identifies specific vulnerabilities in PTEN-deficient breast cancer.

PubMed

Tang, Yew Chung; Ho, Szu-Chi; Tan, Elisabeth; Ng, Alvin Wei Tian; McPherson, John R; Goh, Germaine Yen Lin; Teh, Bin Tean; Bard, Frederic; Rozen, Steven G

2018-03-22

Phosphatase and tensin homolog (PTEN) is one of the most frequently inactivated tumor suppressors in breast cancer. While PTEN itself is not considered a druggable target, PTEN synthetic-sick or synthetic-lethal (PTEN-SSL) genes are potential drug targets in PTEN-deficient breast cancers. Therefore, with the aim of identifying potential targets for precision breast cancer therapy, we sought to discover PTEN-SSL genes present in a broad spectrum of breast cancers. To discover broad-spectrum PTEN-SSL genes in breast cancer, we used a multi-step approach that started with (1) a genome-wide short interfering RNA (siRNA) screen of ~ 21,000 genes in a pair of isogenic human mammary epithelial cell lines, followed by (2) a short hairpin RNA (shRNA) screen of ~ 1200 genes focused on hits from the first screen in a panel of 11 breast cancer cell lines; we then determined reproducibility of hits by (3) identification of overlaps between our results and reanalyzed data from 3 independent gene-essentiality screens, and finally, for selected candidate PTEN-SSL genes we (4) confirmed PTEN-SSL activity using either drug sensitivity experiments in a panel of 19 cell lines or mutual exclusivity analysis of publicly available pan-cancer somatic mutation data. The screens (steps 1 and 2) and the reproducibility analysis (step 3) identified six candidate broad-spectrum PTEN-SSL genes (PIK3CB, ADAMTS20, AP1M2, HMMR, STK11, and NUAK1). PIK3CB was previously identified as PTEN-SSL, while the other five genes represent novel PTEN-SSL candidates. Confirmation studies (step 4) provided additional evidence that NUAK1 and STK11 have PTEN-SSL patterns of activity. Consistent with PTEN-SSL status, inhibition of the NUAK1 protein kinase by the small molecule drug HTH-01-015 selectively impaired viability in multiple PTEN-deficient breast cancer cell lines, while mutations affecting STK11 and PTEN were largely mutually exclusive across large pan-cancer data sets. Six genes showed PTEN-SSL patterns of activity in a large proportion of PTEN-deficient breast cancer cell lines and are potential specific vulnerabilities in PTEN-deficient breast cancer. Furthermore, the NUAK1 PTEN-SSL vulnerability identified by RNA interference techniques can be recapitulated and exploited using the small molecule kinase inhibitor HTH-01-015. Thus, NUAK1 inhibition may be an effective strategy for precision treatment of PTEN-deficient breast tumors.

Identification of downy mildew resistance gene candidates by positional cloning in maize (Zea mays subsp. mays; Poaceae)1

PubMed Central

Kim, Jae Yoon; Moon, Jun-Cheol; Kim, Hyo Chul; Shin, Seungho; Song, Kitae; Kim, Kyung-Hee; Lee, Byung-Moo

2017-01-01

Premise of the study: Positional cloning in combination with phenotyping is a general approach to identify disease-resistance gene candidates in plants; however, it requires several time-consuming steps including population or fine mapping. Therefore, in the present study, we suggest a new combined strategy to improve the identification of disease-resistance gene candidates. Methods and Results: Downy mildew (DM)–resistant maize was selected from five cultivars using a spreader row technique. Positional cloning and bioinformatics tools were used to identify the DM-resistance quantitative trait locus marker (bnlg1702) and 47 protein-coding gene annotations. Eventually, five DM-resistance gene candidates, including bZIP34, Bak1, and Ppr, were identified by quantitative reverse-transcription PCR (RT-PCR) without fine mapping of the bnlg1702 locus. Conclusions: The combined protocol with the spreader row technique, quantitative trait locus positional cloning, and quantitative RT-PCR was effective for identifying DM-resistance candidate genes. This cloning approach may be applied to other whole-genome-sequenced crops or resistance to other diseases. PMID:28224059

De novo Transcriptome Assembly of Floral Buds of Pineapple and Identification of Differentially Expressed Genes in Response to Ethephon Induction

PubMed Central

Liu, Chuan-He; Fan, Chao

2016-01-01

A remarkable characteristic of pineapple is its ability to undergo floral induction in response to external ethylene stimulation. However, little information is available regarding the molecular mechanism underlying this process. In this study, the differentially expressed genes (DEGs) in plants exposed to 1.80 mL·L−1 (T1) or 2.40 mL·L−1 ethephon (T2) compared with Ct plants (control, cleaning water) were identified using RNA-seq and gene expression profiling. Illumina sequencing generated 65,825,224 high-quality reads that were assembled into 129,594 unigenes with an average sequence length of 1173 bp. Of these unigenes, 24,775 were assigned to specific KEGG pathways, of which metabolic pathways and biosynthesis of secondary metabolites were the most highly represented. Gene Ontology (GO) analysis of the annotated unigenes revealed that the majority were involved in metabolic and cellular processes, cell and cell part, catalytic activity and binding. Gene expression profiling analysis revealed 3788, 3062, and 758 DEGs in the comparisons of T1 with Ct, T2 with Ct, and T2 with T1, respectively. GO analysis indicated that these DEGs were predominantly annotated to metabolic and cellular processes, cell and cell part, catalytic activity, and binding. KEGG pathway analysis revealed the enrichment of several important pathways among the DEGs, including metabolic pathways, biosynthesis of secondary metabolites and plant hormone signal transduction. Thirteen DEGs were identified as candidate genes associated with the process of floral induction by ethephon, including three ERF-like genes, one ETR-like gene, one LTI-like gene, one FT-like gene, one VRN1-like gene, three FRI-like genes, one AP1-like gene, one CAL-like gene, and one AG-like gene. qPCR analysis indicated that the changes in the expression of these 13 candidate genes were consistent with the alterations in the corresponding RPKM values, confirming the accuracy and credibility of the RNA-seq and gene expression profiling results. Ethephon-mediated induction likely mimics the process of vernalization in the floral transition in pineapple by increasing LTI, FT, and VRN1 expression and promoting the up-regulation of floral meristem identity genes involved in flower development. The candidate genes screened can be used in investigations of the molecular mechanisms of the flowering pathway and of various other biological mechanisms in pineapple. PMID:26955375

Integrative strategies to identify candidate genes in rodent models of human alcoholism.

PubMed

Treadwell, Julie A

2006-01-01

The search for genes underlying alcohol-related behaviours in rodent models of human alcoholism has been ongoing for many years with only limited success. Recently, new strategies that integrate several of the traditional approaches have provided new insights into the molecular mechanisms underlying ethanol's actions in the brain. We have used alcohol-preferring C57BL/6J (B6) and alcohol-avoiding DBA/2J (D2) genetic strains of mice in an integrative strategy combining high-throughput gene expression screening, genetic segregation analysis, and mapping to previously published quantitative trait loci to uncover candidate genes for the ethanol-preference phenotype. In our study, 2 genes, retinaldehyde binding protein 1 (Rlbp1) and syntaxin 12 (Stx12), were found to be strong candidates for ethanol preference. Such experimental approaches have the power and the potential to greatly speed up the laborious process of identifying candidate genes for the animal models of human alcoholism.

Genetic susceptibility to Grave's disease.

PubMed

Li, Hong; Chen, Qiuying

2013-06-01

The variety of clinical presentations of eye changes in patients with Graves' disease (GD) suggests that complex interactions between genetic, environmental, endogenous and local factors influence the severity of Graves' ophthalmopathy (GO). It is thought that the development of GO might be influenced by genetic factors and environmental factors, such as cigarette smoking. At present, however, the role of genetic factors in the development of GO is not known. On the basis of studies with candidate genes and other genetic approaches, several susceptibility loci in GO have been proposed, including immunological genes, human leukocyte antigen (HLA), cytotoxic T-lymphocyte antigen-4 (CTLA-4), regulatory T-cell genes and thyroid-specific genes. This review gives a brief overview of the current range of major susceptibility genes found for GD.

Mapping genes to human chromosome 19

DOE Office of Scientific and Technical Information (OSTI.GOV)

Connolly, Sarah

1996-05-01

For this project, 22 Expressed Sequence Tags (ESTs) were fine mapped to regions of human chromosome 19. An EST is a short DNA sequence that occurs once in the genome and corresponds to a single expressed gene. {sup 32}P-radiolabeled probes were made by polymerase chain reaction for each EST and hybridized to filters containing a chromosome 19-specific cosmid library. The location of the ESTs on the chromosome was determined by the location of the ordered cosmid to which the EST hybridized. Of the 22 ESTs that were sublocalized, 6 correspond to known genes, and 16 correspond to anonymous genes. Thesemore » localized ESTs may serve as potential candidates for disease genes, as well as markers for future physical mapping.« less

Differential co-expression analysis reveals a novel prognostic gene module in ovarian cancer.

PubMed

Gov, Esra; Arga, Kazim Yalcin

2017-07-10

Ovarian cancer is one of the most significant disease among gynecological disorders that women suffered from over the centuries. However, disease-specific and effective biomarkers were still not available, since studies have focused on individual genes associated with ovarian cancer, ignoring the interactions and associations among the gene products. Here, ovarian cancer differential co-expression networks were reconstructed via meta-analysis of gene expression data and co-expressed gene modules were identified in epithelial cells from ovarian tumor and healthy ovarian surface epithelial samples to propose ovarian cancer associated genes and their interactions. We propose a novel, highly interconnected, differentially co-expressed, and co-regulated gene module in ovarian cancer consisting of 84 prognostic genes. Furthermore, the specificity of the module to ovarian cancer was shown through analyses of datasets in nine other cancers. These observations underscore the importance of transcriptome based systems biomarkers research in deciphering the elusive pathophysiology of ovarian cancer, and here, we present reciprocal interplay between candidate ovarian cancer genes and their transcriptional regulatory dynamics. The corresponding gene module might provide new insights on ovarian cancer prognosis and treatment strategies that continue to place a significant burden on global health.

Tumour angiogenesis is reduced in the Tc1 mouse model of Down's syndrome.

PubMed

Reynolds, Louise E; Watson, Alan R; Baker, Marianne; Jones, Tania A; D'Amico, Gabriela; Robinson, Stephen D; Joffre, Carine; Garrido-Urbani, Sarah; Rodriguez-Manzaneque, Juan Carlos; Martino-Echarri, Estefanía; Aurrand-Lions, Michel; Sheer, Denise; Dagna-Bricarelli, Franca; Nizetic, Dean; McCabe, Christopher J; Turnell, Andrew S; Kermorgant, Stephanie; Imhof, Beat A; Adams, Ralf; Fisher, Elizabeth M C; Tybulewicz, Victor L J; Hart, Ian R; Hodivala-Dilke, Kairbaan M

2010-06-10

Down's syndrome (DS) is a genetic disorder caused by full or partial trisomy of human chromosome 21 and presents with many clinical phenotypes including a reduced incidence of solid tumours. Recent work with the Ts65Dn model of DS, which has orthologues of about 50% of the genes on chromosome 21 (Hsa21), has indicated that three copies of the ETS2 (ref. 3) or DS candidate region 1 (DSCR1) genes (a previously known suppressor of angiogenesis) is sufficient to inhibit tumour growth. Here we use the Tc1 transchromosomic mouse model of DS to dissect the contribution of extra copies of genes on Hsa21 to tumour angiogenesis. This mouse expresses roughly 81% of Hsa21 genes but not the human DSCR1 region. We transplanted B16F0 and Lewis lung carcinoma tumour cells into Tc1 mice and showed that growth of these tumours was substantially reduced compared with wild-type littermate controls. Furthermore, tumour angiogenesis was significantly repressed in Tc1 mice. In particular, in vitro and in vivo angiogenic responses to vascular endothelial growth factor (VEGF) were inhibited. Examination of the genes on the segment of Hsa21 in Tc1 mice identified putative anti-angiogenic genes (ADAMTS1and ERG) and novel endothelial cell-specific genes, never previously shown to be involved in angiogenesis (JAM-B and PTTG1IP), that, when overexpressed, are responsible for inhibiting angiogenic responses to VEGF. Three copies of these genes within the stromal compartment reduced tumour angiogenesis, explaining the reduced tumour growth in DS. Furthermore, we expect that, in addition to the candidate genes that we show to be involved in the repression of angiogenesis, the Tc1 mouse model of DS will permit the identification of other endothelium-specific anti-angiogenic targets relevant to a broad spectrum of cancer patients.

Use of homologous and heterologous gene expression profiling tools to characterize transcription dynamics during apple fruit maturation and ripening.

PubMed

Costa, Fabrizio; Alba, Rob; Schouten, Henk; Soglio, Valeria; Gianfranceschi, Luca; Serra, Sara; Musacchi, Stefano; Sansavini, Silviero; Costa, Guglielmo; Fei, Zhangjun; Giovannoni, James

2010-10-25

Fruit development, maturation and ripening consists of a complex series of biochemical and physiological changes that in climacteric fruits, including apple and tomato, are coordinated by the gaseous hormone ethylene. These changes lead to final fruit quality and understanding of the functional machinery underlying these processes is of both biological and practical importance. To date many reports have been made on the analysis of gene expression in apple. In this study we focused our investigation on the role of ethylene during apple maturation, specifically comparing transcriptomics of normal ripening with changes resulting from application of the hormone receptor competitor 1-methylcyclopropene. To gain insight into the molecular process regulating ripening in apple, and to compare to tomato (model species for ripening studies), we utilized both homologous and heterologous (tomato) microarray to profile transcriptome dynamics of genes involved in fruit development and ripening, emphasizing those which are ethylene regulated.The use of both types of microarrays facilitated transcriptome comparison between apple and tomato (for the later using data previously published and available at the TED: tomato expression database) and highlighted genes conserved during ripening of both species, which in turn represent a foundation for further comparative genomic studies. The cross-species analysis had the secondary aim of examining the efficiency of heterologous (specifically tomato) microarray hybridization for candidate gene identification as related to the ripening process. The resulting transcriptomics data revealed coordinated gene expression during fruit ripening of a subset of ripening-related and ethylene responsive genes, further facilitating the analysis of ethylene response during fruit maturation and ripening. Our combined strategy based on microarray hybridization enabled transcriptome characterization during normal climacteric apple ripening, as well as definition of ethylene-dependent transcriptome changes. Comparison with tomato fruit maturation and ethylene responsive transcriptome activity facilitated identification of putative conserved orthologous ripening-related genes, which serve as an initial set of candidates for assessing conservation of gene activity across genomes of fruit bearing plant species.

Differentially-Expressed Pseudogenes in HIV-1 Infection

PubMed Central

Gupta, Aditi; Brown, C. Titus; Zheng, Yong-Hui; Adami, Christoph

2015-01-01

Not all pseudogenes are transcriptionally silent as previously thought. Pseudogene transcripts, although not translated, contribute to the non-coding RNA pool of the cell that regulates the expression of other genes. Pseudogene transcripts can also directly compete with the parent gene transcripts for mRNA stability and other cell factors, modulating their expression levels. Tissue-specific and cancer-specific differential expression of these “functional” pseudogenes has been reported. To ascertain potential pseudogene:gene interactions in HIV-1 infection, we analyzed transcriptomes from infected and uninfected T-cells and found that 21 pseudogenes are differentially expressed in HIV-1 infection. This is interesting because parent genes of one-third of these differentially-expressed pseudogenes are implicated in HIV-1 life cycle, and parent genes of half of these pseudogenes are involved in different viral infections. Our bioinformatics analysis identifies candidate pseudogene:gene interactions that may be of significance in HIV-1 infection. Experimental validation of these interactions would establish that retroviruses exploit this newly-discovered layer of host gene expression regulation for their own benefit. PMID:26426037

Large-scale identification of wheat genes resistant to cereal cyst nematode Heterodera avenae using comparative transcriptomic analysis.

PubMed

Kong, Ling-An; Wu, Du-Qing; Huang, Wen-Kun; Peng, Huan; Wang, Gao-Feng; Cui, Jiang-Kuan; Liu, Shi-Ming; Li, Zhi-Gang; Yang, Jun; Peng, De-Liang

2015-10-16

Cereal cyst nematode Heterodera avenae, an important soil-borne pathogen in wheat, causes numerous annual yield losses worldwide, and use of resistant cultivars is the best strategy for control. However, target genes are not readily available for breeding resistant cultivars. Therefore, comparative transcriptomic analyses were performed to identify more applicable resistance genes for cultivar breeding. The developing nematodes within roots were stained with acid fuchsin solution. Transcriptome assemblies and redundancy filteration were obtained by Trinity, TGI Clustering Tool and BLASTN, respectively. Gene Ontology annotation was yielded by Blast2GO program, and metabolic pathways of transcripts were analyzed by Path_finder. The ROS levels were determined by luminol-chemiluminescence assay. The transcriptional gene expression profiles were obtained by quantitative RT-PCR. The RNA-sequencing was performed using an incompatible wheat cultivar VP1620 and a compatible control cultivar WEN19 infected with H. avenae at 24 h, 3 d and 8 d. Infection assays showed that VP1620 failed to block penetration of H. avenae but disturbed the transition of developmental stages, leading to a significant reduction in cyst formation. Two types of expression profiles were established to predict candidate resistance genes after developing a novel strategy to generate clean RNA-seq data by removing the transcripts of H. avenae within the raw data before assembly. Using the uncoordinated expression profiles with transcript abundance as a standard, 424 candidate resistance genes were identified, including 302 overlapping genes and 122 VP1620-specific genes. Genes with similar expression patterns were further classified according to the scales of changed transcript abundances, and 182 genes were rescued as supplementary candidate resistance genes. Functional characterizations revealed that diverse defense-related pathways were responsible for wheat resistance against H. avenae. Moreover, phospholipase was involved in many defense-related pathways and localized in the connection position. Furthermore, strong bursts of reactive oxygen species (ROS) within VP1620 roots infected with H. avenae were induced at 24 h and 3 d, and eight ROS-producing genes were significantly upregulated, including three class III peroxidase and five lipoxygenase genes. Large-scale identification of wheat resistance genes were processed by comparative transcriptomic analysis. Functional characterization showed that phospholipases associated with ROS production played vital roles in early defense responses to H. avenae via involvement in diverse defense-related pathways as a hub switch. This study is the first to investigate the early defense responses of wheat against H. avenae, not only provides applicable candidate resistance genes for breeding novel wheat cultivars, but also enables a better understanding of the defense mechanisms of wheat against H. avenae.

Global Microarray Analysis of Carbohydrate Use in Alkaliphilic Hemicellulolytic Bacterium Bacillus sp. N16-5

PubMed Central

Song, Yajian; Xue, Yanfen; Ma, Yanhe

2013-01-01

The alkaliphilic hemicellulolytic bacterium Bacillus sp. N16-5 has a broad substrate spectrum and exhibits the capacity to utilize complex carbohydrates such as galactomannan, xylan, and pectin. In the monosaccharide mixture, sequential utilization by Bacillus sp. N16-5 was observed. Glucose appeared to be its preferential monosaccharide, followed by fructose, mannose, arabinose, xylose, and galactose. Global transcription profiles of the strain were determined separately for growth on six monosaccharides (glucose, fructose, mannose, galactose, arabinose, and xylose) and four polysaccharides (galactomannan, xylan, pectin, and sodium carboxymethylcellulose) using one-color microarrays. Numerous genes potentially related to polysaccharide degradation, sugar transport, and monosaccharide metabolism were found to respond to a specific substrate. Putative gene clusters for different carbohydrates were identified according to transcriptional patterns and genome annotation. Identification and analysis of these gene clusters contributed to pathway reconstruction for carbohydrate utilization in Bacillus sp. N16-5. Several genes encoding putative sugar transporters were highly expressed during growth on specific sugars, suggesting their functional roles. Two phosphoenolpyruvate-dependent phosphotransferase systems were identified as candidate transporters for mannose and fructose, and a major facilitator superfamily transporter was identified as a candidate transporter for arabinose and xylose. Five carbohydrate uptake transporter 1 family ATP-binding cassette transporters were predicted to participate in the uptake of hemicellulose and pectin degradation products. Collectively, microarray data improved the pathway reconstruction involved in carbohydrate utilization of Bacillus sp. N16-5 and revealed that the organism precisely regulates gene transcription in response to fluctuations in energy resources. PMID:23326578

Sensitivity to House Dust Mites Allergens with Atopic Asthma and Its Relationship with CD14 C(-159T) Polymorphism in Patients of West Bengal, India.

PubMed

Ghosh, Amlan; Dutta, Shampa; Podder, Sanjoy; Mondal, Priti; Laha, Arghya; Saha, Nimai Chandra; Moitra, Saibal; Saha, Goutam Kumar

2018-01-10

India is the home to around 15-20 million asthmatics, and asthma prevalence is increasing in Indian metropolitan area, including Kolkata, West Bengal. Complex interactions of genetic and environmental factors are involved in asthma. Genome-wide search for susceptible loci regulating IgE response (atopy) have identified a candidate gene CD14 which is most important in the context of allergic responses of respiratory system. This study was aimed to investigate the role of house dust and house dust mites in development of bronchial asthma and to explore the possible association of candidate gene CD14 with disease manifestation among Kolkata patient population. Skin-prick test was done among 950 asthmatic patients against 8 aeroallergens, including house dust and house dust mites and total serum IgE and allergen-specific IgE were measured. Polymerase chain reaction-restriction fragment length polymorphism was done in patients and nonasthmatic control (n = 255 in each) to characterize a functional polymorphism, C(-159)T, of CD14, a positional candidate gene for allergy. We identified house dust as the most common aeroallergen sensitizer among atopic patients in Kolkata followed by Dermatophagoides pteronyssinus and Dermatophagoides farinae Hughes (Acari: Pyroglyphidae) mites. Patient's sera contain significantly higher IgE level than that of control. Allergen-specific IgE antibody test revealed that 76.36% patients had specific IgE antibody against D. pteronyssinus mite. There was a significant difference in the distribution of alleles and genotypes for CD14 polymorphism with an increase in disease severity. So, in Kolkata, house dust mite is a common aeroallergen and D. pteronyssinus is predominant among mites. The present study revealed that bronchial asthma has a genetic background. © The Author(s) 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

[Screening efficient siRNAs in vitro as the candidate genes for chicken anti-avian influenza virus H5N1 breeding].

PubMed

Zhang, P; Wang, J G; Wan, J G; Liu, W Q

2010-01-01

The frequent disease outbreaks caused by avian influenza virus not only affect the poultry industry but also pose a threat to human safety. To address the problem, RNA interference (RNAi) has recently been widely used as a potential antiviral approach. Transgenesis in combination with RNAi to specifically inhibit avian enza virus gene expression has been proposed to make chickens resistant to the infection. For the transgenic breeding, screening in vitro efficient siRNAs as the candidate genes is one of the most important tasks. Here, we combined an online search tool and a series of bioinformatics programs with a set of rules for designing siRNAs targeted towards different mRNA regions of H5N1 avian influenza virus. Five rational siRNAs were chosen by this method, five U6 promoter-driven shRNA expression plasmids containing the siRNA genes were constructed and used for producing stably transfected MDCK cells. The data obtained by virus titration, IFA, PI-stained flow cytometry, real-time quantitative RT-PCR, and DAS-ELISA analyses showed that all five stably transfected cell lines we re resistant to virusreplication when exposed to 100 CCID50 of avian influenza virus H5N1. Finally, most effective plasmids (pSi-604i and pSi-1597i) as the candidates for making the transgenic chickens were chosen. These findings provide baseline information on use of RNAi technique for breeding transgenic chickens resistant to avian influenza virus.

A role for neurotransmission and neurodevelopment in attention-deficit/hyperactivity disorder

PubMed Central

2009-01-01

Attention-deficit/hyperactivity disorder (ADHD) has a moderate to high genetic component, probably due to many genes with small effects. Several susceptibility genes have been suggested on the basis of hypotheses that catecholaminergic pathways in the brain are responsible for ADHD. However, many negative association findings have been reported, indicating a limited success for investigations using this approach. The results from genome-wide association studies have suggested that genes related to general brain functions rather than specific aspects of the disorder may contribute to its development. Plausible biological hypotheses linked to neurotransmission and neurodevelopment in general and common to different psychiatric conditions need to be considered when defining candidate genes for ADHD association studies. PMID:19930624

Candidate Genes for Inherited Autism Susceptibility in the Lebanese Population.

PubMed

Kourtian, Silva; Soueid, Jihane; Makhoul, Nadine J; Guisso, Dikran Richard; Chahrour, Maria; Boustany, Rose-Mary N

2017-03-30

Autism spectrum disorder (ASD) is characterized by ritualistic-repetitive behaviors and impaired verbal/non-verbal communication. Many ASD susceptibility genes implicated in neuronal pathways/brain development have been identified. The Lebanese population is ideal for uncovering recessive genes because of shared ancestry and a high rate of consanguineous marriages. Aims here are to analyze for published ASD genes and uncover novel inherited ASD susceptibility genes specific to the Lebanese. We recruited 36 ASD families (ASD: 37, unaffected parents: 36, unaffected siblings: 33) and 100 unaffected Lebanese controls. Cytogenetics 2.7 M Microarrays/CytoScan™ HD arrays allowed mapping of homozygous regions of the genome. The CNTNAP2 gene was screened by Sanger sequencing. Homozygosity mapping uncovered DPP4, TRHR, and MLF1 as novel candidate susceptibility genes for ASD in the Lebanese. Sequencing of hot spot exons in CNTNAP2 led to discovery of a 5 bp insertion in 23/37 ASD patients. This mutation was present in unaffected family members and unaffected Lebanese controls. Although a slight increase in number was observed in ASD patients and family members compared to controls, there were no significant differences in allele frequencies between affecteds and controls (C/TTCTG: γ 2 value = 0.014; p = 0.904). The CNTNAP2 polymorphism identified in this population, hence, is not linked to the ASD phenotype.

Candidate Genes for Inherited Autism Susceptibility in the Lebanese Population

PubMed Central

Kourtian, Silva; Soueid, Jihane; Makhoul, Nadine J.; Guisso, Dikran Richard; Chahrour, Maria; Boustany, Rose-Mary N.

2017-01-01

Autism spectrum disorder (ASD) is characterized by ritualistic-repetitive behaviors and impaired verbal/non-verbal communication. Many ASD susceptibility genes implicated in neuronal pathways/brain development have been identified. The Lebanese population is ideal for uncovering recessive genes because of shared ancestry and a high rate of consanguineous marriages. Aims here are to analyze for published ASD genes and uncover novel inherited ASD susceptibility genes specific to the Lebanese. We recruited 36 ASD families (ASD: 37, unaffected parents: 36, unaffected siblings: 33) and 100 unaffected Lebanese controls. Cytogenetics 2.7 M Microarrays/CytoScan™ HD arrays allowed mapping of homozygous regions of the genome. The CNTNAP2 gene was screened by Sanger sequencing. Homozygosity mapping uncovered DPP4, TRHR, and MLF1 as novel candidate susceptibility genes for ASD in the Lebanese. Sequencing of hot spot exons in CNTNAP2 led to discovery of a 5 bp insertion in 23/37 ASD patients. This mutation was present in unaffected family members and unaffected Lebanese controls. Although a slight increase in number was observed in ASD patients and family members compared to controls, there were no significant differences in allele frequencies between affecteds and controls (C/TTCTG: γ2 value = 0.014; p = 0.904). The CNTNAP2 polymorphism identified in this population, hence, is not linked to the ASD phenotype. PMID:28358038

Tissue-Specific Transcriptomic Profiling of Sorghum propinquum using a Rice Genome Array

PubMed Central

Zhang, Ting; Zhao, Xiuqin; Huang, Liyu; Liu, Xiaoyue; Zong, Ying; Zhu, Linghua; Yang, Daichang; Fu, Binying

2013-01-01

Sorghum (Sorghum bicolor) is one of the world's most important cereal crops. S. propinquum is a perennial wild relative of S. bicolor with well-developed rhizomes. Functional genomics analysis of S. propinquum, especially with respect to molecular mechanisms related to rhizome growth and development, can contribute to the development of more sustainable grain, forage, and bioenergy cropping systems. In this study, we used a whole rice genome oligonucleotide microarray to obtain tissue-specific gene expression profiles of S. propinquum with special emphasis on rhizome development. A total of 548 tissue-enriched genes were detected, including 31 and 114 unique genes that were expressed predominantly in the rhizome tips (RT) and internodes (RI), respectively. Further GO analysis indicated that the functions of these tissue-enriched genes corresponded to their characteristic biological processes. A few distinct cis-elements, including ABA-responsive RY repeat CATGCA, sugar-repressive TTATCC, and GA-responsive TAACAA, were found to be prevalent in RT-enriched genes, implying an important role in rhizome growth and development. Comprehensive comparative analysis of these rhizome-enriched genes and rhizome-specific genes previously identified in Oryza longistaminata and S. propinquum indicated that phytohormones, including ABA, GA, and SA, are key regulators of gene expression during rhizome development. Co-localization of rhizome-enriched genes with rhizome-related QTLs in rice and sorghum generated functional candidates for future cloning of genes associated with rhizome growth and development. PMID:23536906

Structural and Functional Analysis of the GRAS Gene Family in Grapevine Indicates a Role of GRAS Proteins in the Control of Development and Stress Responses

PubMed Central

Grimplet, Jérôme; Agudelo-Romero, Patricia; Teixeira, Rita T.; Martinez-Zapater, Jose M.; Fortes, Ana M.

2016-01-01

GRAS transcription factors are involved in many processes of plant growth and development (e.g., axillary shoot meristem formation, root radial patterning, nodule morphogenesis, arbuscular development) as well as in plant disease resistance and abiotic stress responses. However, little information is available concerning this gene family in grapevine (Vitis vinifera L.), an economically important woody crop. We performed a model curation of GRAS genes identified in the latest genome annotation leading to the identification of 52 genes. Gene models were improved and three new genes were identified that could be grapevine- or woody-plant specific. Phylogenetic analysis showed that GRAS genes could be classified into 13 groups that mapped on the 19 V. vinifera chromosomes. Five new subfamilies, previously not characterized in other species, were identified. Multiple sequence alignment showed typical GRAS domain in the proteins and new motifs were also described. As observed in other species, both segmental and tandem duplications contributed significantly to the expansion and evolution of the GRAS gene family in grapevine. Expression patterns across a variety of tissues and upon abiotic and biotic conditions revealed possible divergent functions of GRAS genes in grapevine development and stress responses. By comparing the information available for tomato and grapevine GRAS genes, we identified candidate genes that might constitute conserved transcriptional regulators of both climacteric and non-climacteric fruit ripening. Altogether this study provides valuable information and robust candidate genes for future functional analysis aiming at improving the quality of fleshy fruits. PMID:27065316

"Bad genes" & criminal responsibility.

PubMed

González-Tapia, María Isabel; Obsuth, Ingrid

2015-01-01

The genetics of the accused is trying to break into the courts. To date several candidate genes have been put forward and their links to antisocial behavior have been examined and documented with some consistency. In this paper, we focus on the so called "warrior gene", or the low-activity allele of the MAOA gene, which has been most consistently related to human behavior and specifically to violence and antisocial behavior. In preparing this paper we had two objectives. First, to summarize and analyze the current scientific evidence, in order to gain an in depth understanding of the state of the issue and determine whether a dominant line of generally accepted scientific knowledge in this field can be asserted. Second, to derive conclusions and put forward recommendations related to the use of genetic information, specifically the presence of the low-activity genotype of the MAOA gene, in modulation of criminal responsibility in European and US courts. Copyright © 2015 Elsevier Ltd. All rights reserved.

Walking the interactome for candidate prioritization in exome sequencing studies of Mendelian diseases

DOE PAGES

Smedley, Damian; Kohler, Sebastian; Czeschik, Johanna Christina; ...

2014-07-30

Here, whole-exome sequencing (WES) has opened up previously unheard of possibilities for identifying novel disease genes in Mendelian disorders, only about half of which have been elucidated to date. However, interpretation of WES data remains challenging. As a result, we analyze protein–protein association (PPA) networks to identify candidate genes in the vicinity of genes previously implicated in a disease. The analysis, using a random-walk with restart (RWR) method, is adapted to the setting of WES by developing a composite variant-gene relevance score based on the rarity, location and predicted pathogenicity of variants and the RWR evaluation of genes harboring themore » variants. Benchmarking using known disease variants from 88 disease-gene families reveals that the correct gene is ranked among the top 10 candidates in ≥50% of cases, a figure which we confirmed using a prospective study of disease genes identified in 2012 and PPA data produced before that date. In conclusion, we implement our method in a freely available Web server, ExomeWalker, that displays a ranked list of candidates together with information on PPAs, frequency and predicted pathogenicity of the variants to allow quick and effective searches for candidates that are likely to reward closer investigation.« less

Integration of QTL and bioinformatic tools to identify candidate genes for triglycerides in mice[S

PubMed Central

Leduc, Magalie S.; Hageman, Rachael S.; Verdugo, Ricardo A.; Tsaih, Shirng-Wern; Walsh, Kenneth; Churchill, Gary A.; Paigen, Beverly

2011-01-01

To identify genetic loci influencing lipid levels, we performed quantitative trait loci (QTL) analysis between inbred mouse strains MRL/MpJ and SM/J, measuring triglyceride levels at 8 weeks of age in F2 mice fed a chow diet. We identified one significant QTL on chromosome (Chr) 15 and three suggestive QTL on Chrs 2, 7, and 17. We also carried out microarray analysis on the livers of parental strains of 282 F2 mice and used these data to find cis-regulated expression QTL. We then narrowed the list of candidate genes under significant QTL using a “toolbox” of bioinformatic resources, including haplotype analysis; parental strain comparison for gene expression differences and nonsynonymous coding single nucleotide polymorphisms (SNP); cis-regulated eQTL in livers of F2 mice; correlation between gene expression and phenotype; and conditioning of expression on the phenotype. We suggest Slc25a7 as a candidate gene for the Chr 7 QTL and, based on expression differences, five genes (Polr3 h, Cyp2d22, Cyp2d26, Tspo, and Ttll12) as candidate genes for Chr 15 QTL. This study shows how bioinformatics can be used effectively to reduce candidate gene lists for QTL related to complex traits. PMID:21622629

Walking the interactome for candidate prioritization in exome sequencing studies of Mendelian diseases

DOE Office of Scientific and Technical Information (OSTI.GOV)

Smedley, Damian; Kohler, Sebastian; Czeschik, Johanna Christina

Here, whole-exome sequencing (WES) has opened up previously unheard of possibilities for identifying novel disease genes in Mendelian disorders, only about half of which have been elucidated to date. However, interpretation of WES data remains challenging. As a result, we analyze protein–protein association (PPA) networks to identify candidate genes in the vicinity of genes previously implicated in a disease. The analysis, using a random-walk with restart (RWR) method, is adapted to the setting of WES by developing a composite variant-gene relevance score based on the rarity, location and predicted pathogenicity of variants and the RWR evaluation of genes harboring themore » variants. Benchmarking using known disease variants from 88 disease-gene families reveals that the correct gene is ranked among the top 10 candidates in ≥50% of cases, a figure which we confirmed using a prospective study of disease genes identified in 2012 and PPA data produced before that date. In conclusion, we implement our method in a freely available Web server, ExomeWalker, that displays a ranked list of candidates together with information on PPAs, frequency and predicted pathogenicity of the variants to allow quick and effective searches for candidates that are likely to reward closer investigation.« less

Dengue serotype-specific immune response in Aedes aegypti and Aedes albopictus.

PubMed

Smartt, Chelsea T; Shin, Dongyoung; Alto, Barry W

2017-12-01

Dengue viruses (DENV) are considered one of the most important emerging pathogens and dengue disease is a global health threat. The geographic expansion of dengue viruses has led to co-circulation of all four dengue serotypes making it imperative that new DENV control strategies be devised. Here we characterize dengue serotype-specific innate immune responses in Aedes aegypti and Aedes albopictus using DENV from Puerto Rico (PR). Ae. aegypti and Ae. albopictus were infected with dengue serotype 1 and 2 isolated from Puerto Rico. DENV infected mosquito samples were collected and temporal change in expression of selected innate immune response pathway genes analyzed by quantitative real time PCR. The Toll pathway is involved in anti-dengue response in Ae. aegypti, and Ae. albopictus. Infections with PR DENV- 1 elicited a stronger response from genes of the Toll immune pathway than PR DENV-2 in Ae. aegypti but in infected Ae. albopictus expression of Toll pathway genes tended to be similar between the serotypes. Two genes (a ribosomal S5 protein gene and a nimrod-like gene) from Ae. albopictus were expressed in response to DENV. These studies revealed a role for antiviral genes in DENV serotype-specific interactions with DENV vectors, demonstrated that infections with DENV-2 can modulate the Toll immune response pathway in Ae. aegypti and elucidated candidate molecules that might be used to interfere with serotype specific vector-virus interactions.

A Strong Immune Response in Young Adult Honeybees Masks Their Increased Susceptibility to Infection Compared to Older Bees

PubMed Central

Bull, James C.; Ryabov, Eugene V.; Prince, Gill; Mead, Andrew; Zhang, Cunjin; Baxter, Laura A.; Pell, Judith K.; Osborne, Juliet L.; Chandler, Dave

2012-01-01

Honeybees, Apis mellifera, show age-related division of labor in which young adults perform maintenance (“housekeeping”) tasks inside the colony before switching to outside foraging at approximately 23 days old. Disease resistance is an important feature of honeybee biology, but little is known about the interaction of pathogens and age-related division of labor. We tested a hypothesis that older forager bees and younger “house” bees differ in susceptibility to infection. We coupled an infection bioassay with a functional analysis of gene expression in individual bees using a whole genome microarray. Forager bees treated with the entomopathogenic fungus Metarhizium anisopliae s.l. survived for significantly longer than house bees. This was concomitant with substantial differences in gene expression including genes associated with immune function. In house bees, infection was associated with differential expression of 35 candidate immune genes contrasted with differential expression of only two candidate immune genes in forager bees. For control bees (i.e. not treated with M. anisopliae) the development from the house to the forager stage was associated with differential expression of 49 candidate immune genes, including up-regulation of the antimicrobial peptide gene abaecin, plus major components of the Toll pathway, serine proteases, and serpins. We infer that reduced pathogen susceptibility in forager bees was associated with age-related activation of specific immune system pathways. Our findings contrast with the view that the immunocompetence in social insects declines with the onset of foraging as a result of a trade-off in the allocation of resources for foraging. The up-regulation of immune-related genes in young adult bees in response to M. anisopliae infection was an indicator of disease susceptibility; this also challenges previous research in social insects, in which an elevated immune status has been used as a marker of increased disease resistance and fitness without considering the effects of age-related development. PMID:23300441

Prioritization of candidate disease genes by topological similarity between disease and protein diffusion profiles.

PubMed

Zhu, Jie; Qin, Yufang; Liu, Taigang; Wang, Jun; Zheng, Xiaoqi

2013-01-01

Identification of gene-phenotype relationships is a fundamental challenge in human health clinic. Based on the observation that genes causing the same or similar phenotypes tend to correlate with each other in the protein-protein interaction network, a lot of network-based approaches were proposed based on different underlying models. A recent comparative study showed that diffusion-based methods achieve the state-of-the-art predictive performance. In this paper, a new diffusion-based method was proposed to prioritize candidate disease genes. Diffusion profile of a disease was defined as the stationary distribution of candidate genes given a random walk with restart where similarities between phenotypes are incorporated. Then, candidate disease genes are prioritized by comparing their diffusion profiles with that of the disease. Finally, the effectiveness of our method was demonstrated through the leave-one-out cross-validation against control genes from artificial linkage intervals and randomly chosen genes. Comparative study showed that our method achieves improved performance compared to some classical diffusion-based methods. To further illustrate our method, we used our algorithm to predict new causing genes of 16 multifactorial diseases including Prostate cancer and Alzheimer's disease, and the top predictions were in good consistent with literature reports. Our study indicates that integration of multiple information sources, especially the phenotype similarity profile data, and introduction of global similarity measure between disease and gene diffusion profiles are helpful for prioritizing candidate disease genes. Programs and data are available upon request.

Massive expression of germ cell-specific genes is a hallmark of cancer and a potential target for novel treatment development.

PubMed

Bruggeman, Jan Willem; Koster, Jan; Lodder, Paul; Repping, Sjoerd; Hamer, Geert

2018-06-15

Cancer cells have been found to frequently express genes that are normally restricted to the testis, often referred to as cancer/testis (CT) antigens or genes. Because germ cell-specific antigens are not recognized as "self" by the innate immune system, CT-genes have previously been suggested as ideal candidate targets for cancer therapy. The use of CT-genes in cancer therapy has thus far been unsuccessful, most likely because their identification has relied on gene expression in whole testis, including the testicular somatic cells, precluding the detection of true germ cell-specific genes. By comparing the transcriptomes of micro-dissected germ cell subtypes, representing the main developmental stages of human spermatogenesis, with the publicly accessible transcriptomes of 2617 samples from 49 different healthy somatic tissues and 9232 samples from 33 tumor types, we here discover hundreds of true germ cell-specific cancer expressed genes. Strikingly, we found these germ cell cancer genes (GC-genes) to be widely expressed in all analyzed tumors. Many GC-genes appeared to be involved in processes that are likely to actively promote tumor viability, proliferation and metastasis. Targeting these true GC-genes thus has the potential to inhibit tumor growth with infertility being the only possible side effect. Moreover, we identified a subset of GC-genes that are not expressed in spermatogonial stem cells. Targeting of this GC-gene subset is predicted to only lead to temporary infertility, as untargeted spermatogonial stem cells can recover spermatogenesis after treatment. Our GC-gene dataset enables improved understanding of tumor biology and provides multiple novel targets for cancer treatment.

Roles of the plasticity regions of Helicobacter pylori in gastroduodenal pathogenesis.

PubMed

Yamaoka, Yoshio

2008-05-01

Putative virulence genes of Helicobacter pylori are generally classified into three categories: strain-specific genes, phase-variable genes and genes with variable structures/genotypes. Among these, there has recently been considerable interest in strain-specific genes found outside of the cag pathogenicity island, especially genes in the plasticity regions. Nearly half of the strain-specific genes of H. pylori are located in the plasticity regions in strains 26695 and J99. Strain HPAG1, however, seems to lack a typical plasticity region; instead it has 43 HPAG1-specific genes which are either undetectable or incompletely represented in the genomes of strains 26695 and J99. Recent studies showed that certain genes or combination of genes in this region may play important roles in the pathogenesis of H. pylori-associated gastroduodenal diseases. Most previous studies have focused on the plasticity region in strain J99 (jhp0914-jhp0961) and the jhp0947 gene and the duodenal ulcer promoting (dupA) gene are good candidate markers for gastroduodenal diseases although there are some paradoxical findings. The jhp0947 gene is reported to be associated with an increased risk of both duodenal ulcers and gastric cancers, whereas the dupA gene, which encompasses jhp0917 and jhp0918, is reported to be associated with an increased risk of duodenal ulcers and protection against gastric cancers. In addition, recent studies showed that approximately 10-30 % of clinical isolates possess a 16.3 kb type IV secretion apparatus (tfs3) in the plasticity region. Studies on the plasticity region have only just begun, and further investigation is necessary to elucidate the roles of genes in this region in gastroduodenal pathogenesis.

Roles of the plasticity regions of Helicobacter pylori in gastroduodenal pathogenesis

PubMed Central

Yamaoka, Yoshio

2010-01-01

Putative virulence genes of Helicobacter pylori are generally classified into three categories: strain-specific genes, phase-variable genes and genes with variable structures/genotypes. Among these, there has recently been considerable interest in strain-specific genes found outside of the cag pathogenicity island, especially genes in the plasticity regions. Nearly half of the strain-specific genes of H. pylori are located in the plasticity regions in strains 26695 and J99. Strain HPAG1, however, seems to lack a typical plasticity region; instead it has 43 HPAG1-specific genes which are either undetectable or incompletely represented in the genomes of strains 26695 and J99. Recent studies showed that certain genes or combination of genes in this region may play important roles in the pathogenesis of H. pylori-associated gastroduodenal diseases. Most previous studies have focused on the plasticity region in strain J99 (jhp0914–jhp0961) and the jhp0947 gene and the duodenal ulcer promoting (dupA) gene are good candidate markers for gastroduodenal diseases although there are some paradoxical findings. The jhp0947 gene is reported to be associated with an increased risk of both duodenal ulcers and gastric cancers, whereas the dupA gene, which encompasses jhp0917 and jhp0918, is reported to be associated with an increased risk of duodenal ulcers and protection against gastric cancers. In addition, recent studies showed that approximately 10–30% of clinical isolates possess a 16.3 kb type IV secretion apparatus (tfs3) in the plasticity region. Studies on the plasticity region have only just begun, and further investigation is necessary to elucidate the roles of genes in this region in gastroduodenal pathogenesis. PMID:18436586

The Genetic Basis for Variation in Sensitivity to Lead Toxicity in Drosophila melanogaster.

PubMed

Zhou, Shanshan; Morozova, Tatiana V; Hussain, Yasmeen N; Luoma, Sarah E; McCoy, Lenovia; Yamamoto, Akihiko; Mackay, Trudy F C; Anholt, Robert R H

2016-07-01

Lead toxicity presents a worldwide health problem, especially due to its adverse effects on cognitive development in children. However, identifying genes that give rise to individual variation in susceptibility to lead toxicity is challenging in human populations. Our goal was to use Drosophila melanogaster to identify evolutionarily conserved candidate genes associated with individual variation in susceptibility to lead exposure. To identify candidate genes associated with variation in susceptibility to lead toxicity, we measured effects of lead exposure on development time, viability and adult activity in the Drosophila melanogaster Genetic Reference Panel (DGRP) and performed genome-wide association analyses to identify candidate genes. We used mutants to assess functional causality of candidate genes and constructed a genetic network associated with variation in sensitivity to lead exposure, on which we could superimpose human orthologs. We found substantial heritabilities for all three traits and identified candidate genes associated with variation in susceptibility to lead exposure for each phenotype. The genetic architectures that determine variation in sensitivity to lead exposure are highly polygenic. Gene ontology and network analyses showed enrichment of genes associated with early development and function of the nervous system. Drosophila melanogaster presents an advantageous model to study the genetic underpinnings of variation in susceptibility to lead toxicity. Evolutionary conservation of cellular pathways that respond to toxic exposure allows predictions regarding orthologous genes and pathways across phyla. Thus, studies in the D. melanogaster model system can identify candidate susceptibility genes to guide subsequent studies in human populations. Zhou S, Morozova TV, Hussain YN, Luoma SE, McCoy L, Yamamoto A, Mackay TF, Anholt RR. 2016. The genetic basis for variation in sensitivity to lead toxicity in Drosophila melanogaster. Environ Health Perspect 124:1062-1070; http://dx.doi.org/10.1289/ehp.1510513.

Replication of type 2 diabetes candidate genes variations in three geographically unrelated Indian population groups.

PubMed

Ali, Shafat; Chopra, Rupali; Manvati, Siddharth; Singh, Yoginder Pal; Kaul, Nabodita; Behura, Anita; Mahajan, Ankit; Sehajpal, Prabodh; Gupta, Subash; Dhar, Manoj K; Chainy, Gagan B N; Bhanwer, Amarjit S; Sharma, Swarkar; Bamezai, Rameshwar N K

2013-01-01

Type 2 diabetes (T2D) is a syndrome of multiple metabolic disorders and is genetically heterogeneous. India comprises one of the largest global populations with highest number of reported type 2 diabetes cases. However, limited information about T2D associated loci is available for Indian populations. It is, therefore, pertinent to evaluate the previously associated candidates as well as identify novel genetic variations in Indian populations to understand the extent of genetic heterogeneity. We chose to do a cost effective high-throughput mass-array genotyping and studied the candidate gene variations associated with T2D in literature. In this case-control candidate genes association study, 91 SNPs from 55 candidate genes have been analyzed in three geographically independent population groups from India. We report the genetic variants in five candidate genes: TCF7L2, HHEX, ENPP1, IDE and FTO, are significantly associated (after Bonferroni correction, p<5.5E-04) with T2D susceptibility in combined population. Interestingly, SNP rs7903146 of the TCF7L2 gene passed the genome wide significance threshold (combined P value = 2.05E-08) in the studied populations. We also observed the association of rs7903146 with blood glucose (fasting and postprandial) levels, supporting the role of TCF7L2 gene in blood glucose homeostasis. Further, we noted that the moderate risk provided by the independently associated loci in combined population with Odds Ratio (OR)<1.38 increased to OR = 2.44, (95%CI = 1.67-3.59) when the risk providing genotypes of TCF7L2, HHEX, ENPP1 and FTO genes were combined, suggesting the importance of gene-gene interactions evaluation in complex disorders like T2D.

Replication of Type 2 Diabetes Candidate Genes Variations in Three Geographically Unrelated Indian Population Groups

PubMed Central

Ali, Shafat; Chopra, Rupali; Manvati, Siddharth; Mahajan, Ankit; Sehajpal, Prabodh; Gupta, Subash; Dhar, Manoj K.; Chainy, Gagan B. N.; Bhanwer, Amarjit S.; Sharma, Swarkar; Bamezai, Rameshwar N. K.

2013-01-01

Type 2 diabetes (T2D) is a syndrome of multiple metabolic disorders and is genetically heterogeneous. India comprises one of the largest global populations with highest number of reported type 2 diabetes cases. However, limited information about T2D associated loci is available for Indian populations. It is, therefore, pertinent to evaluate the previously associated candidates as well as identify novel genetic variations in Indian populations to understand the extent of genetic heterogeneity. We chose to do a cost effective high-throughput mass-array genotyping and studied the candidate gene variations associated with T2D in literature. In this case-control candidate genes association study, 91 SNPs from 55 candidate genes have been analyzed in three geographically independent population groups from India. We report the genetic variants in five candidate genes: TCF7L2, HHEX, ENPP1, IDE and FTO, are significantly associated (after Bonferroni correction, p<5.5E−04) with T2D susceptibility in combined population. Interestingly, SNP rs7903146 of the TCF7L2 gene passed the genome wide significance threshold (combined P value = 2.05E−08) in the studied populations. We also observed the association of rs7903146 with blood glucose (fasting and postprandial) levels, supporting the role of TCF7L2 gene in blood glucose homeostasis. Further, we noted that the moderate risk provided by the independently associated loci in combined population with Odds Ratio (OR)<1.38 increased to OR = 2.44, (95%CI = 1.67–3.59) when the risk providing genotypes of TCF7L2, HHEX, ENPP1 and FTO genes were combined, suggesting the importance of gene-gene interactions evaluation in complex disorders like T2D. PMID:23527042

Intraflagellar transport 88 (IFT88) is crucial for craniofacial development in mice and is a candidate gene for human cleft lip and palate.

PubMed

Tian, Hua; Feng, Jifan; Li, Jingyuan; Ho, Thach-Vu; Yuan, Yuan; Liu, Yang; Brindopke, Frederick; Figueiredo, Jane C; Magee, William; Sanchez-Lara, Pedro A; Chai, Yang

2017-03-01

Ciliopathies are pleiotropic human diseases resulting from defects of the primary cilium, and these patients often have cleft lip and palate. IFT88 is required for the assembly and function of the primary cilia, which mediate the activity of key developmental signaling pathways. Through whole exome sequencing of a family of three affected siblings with isolated cleft lip and palate, we discovered that they share a novel missense mutation in IFT88 (c.915G > C, p.E305D), suggesting this gene should be considered a candidate for isolated orofacial clefting. In order to evaluate the function of IFT88 in regulating craniofacial development, we generated Wnt1-Cre;Ift88fl/fl mice to eliminate Ift88 specifically in cranial neural crest (CNC) cells. Wnt1-Cre;Ift88fl/flpups died at birth due to severe craniofacial defects including bilateral cleft lip and palate and tongue agenesis, following the loss of the primary cilia in the CNC-derived palatal mesenchyme. Loss of Ift88 also resulted in a decrease in neural crest cell proliferation during early stages of palatogenesis as well as a downregulation of the Shh signaling pathway in the palatal mesenchyme. Importantly, Osr2KI-Cre;Ift88fl/flmice, in which Ift88 is lost specifically in the palatal mesenchyme, exhibit isolated cleft palate. Taken together, our results demonstrate that IFT88 has a highly conserved function within the primary cilia of the CNC-derived mesenchyme in the lip and palate region in mice and is a strong candidate as an orofacial clefting gene in humans. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Deletion of the Vaccinia Virus Gene A46R, Encoding for an Inhibitor of TLR Signalling, Is an Effective Approach to Enhance the Immunogenicity in Mice of the HIV/AIDS Vaccine Candidate NYVAC-C

PubMed Central

Perdiguero, Beatriz; Gómez, Carmen Elena; Di Pilato, Mauro; Sorzano, Carlos Oscar S.; Delaloye, Julie; Roger, Thierry; Calandra, Thierry; Pantaleo, Giuseppe; Esteban, Mariano

2013-01-01

Viruses have developed strategies to counteract signalling through Toll-like receptors (TLRs) that are involved in the detection of viruses and induction of proinflammatory cytokines and IFNs. Vaccinia virus (VACV) encodes A46 protein which disrupts TLR signalling by interfering with TLR: adaptor interactions. Since the innate immune response to viruses is critical to induce protective immunity, we studied whether deletion of A46R gene in a NYVAC vector expressing HIV-1 Env, Gag, Pol and Nef antigens (NYVAC-C) improves immune responses against HIV-1 antigens. This question was examined in human macrophages and in mice infected with a single A46R deletion mutant of the vaccine candidate NYVAC-C (NYVAC-C-ΔA46R). The viral gene A46R is not required for virus replication in primary chicken embryo fibroblast (CEF) cells and its deletion in NYVAC-C markedly increases TNF, IL-6 and IL-8 secretion by human macrophages. Analysis of the immune responses elicited in BALB/c mice after DNA prime/NYVAC boost immunization shows that deletion of A46R improves the magnitude of the HIV-1-specific CD4 and CD8 T cell immune responses during adaptive and memory phases, maintains the functional profile observed with the parental NYVAC-C and enhances anti-gp120 humoral response during the memory phase. These findings establish the immunological role of VACV A46R on innate immune responses of macrophages in vitro and antigen-specific T and B cell immune responses in vivo and suggest that deletion of viral inhibitors of TLR signalling is a useful approach for the improvement of poxvirus-based vaccine candidates. PMID:24069354

Novel Microcephalic Primordial Dwarfism Disorder Associated with Variants in the Centrosomal Protein Ninein

PubMed Central

LaFranchi, Stephen H.; Maliga, Zoltan; Lui, Julian C.; Moon, Jennifer E.; McDeed, Cailin; Henke, Katrin; Zonana, Jonathan; Kingman, Garrett A.; Pers, Tune H.; Baron, Jeffrey; Rosenfeld, Ron G.; Hirschhorn, Joel N.; Harris, Matthew P.; Hwa, Vivian

2012-01-01

Context: Microcephalic primordial dwarfism (MPD) is a rare, severe form of human growth failure in which growth restriction is evident in utero and continues into postnatal life. Single causative gene defects have been identified in a number of patients with MPD, and all involve genes fundamental to cellular processes including centrosome functions. Objective: The objective of the study was to find the genetic etiology of a novel presentation of MPD. Design: The design of the study was whole-exome sequencing performed on two affected sisters in a single family. Molecular and functional studies of a candidate gene were performed using patient-derived primary fibroblasts and a zebrafish morpholino oligonucleotides knockdown model. Patients: Two sisters presented with a novel subtype of MPD, including severe intellectual disabilities. Main Outcome Measures: NIN, encoding Ninein, a centrosomal protein critically involved in asymmetric cell division, was identified as a candidate gene, and functional impacts in fibroblasts and zebrafish were studied. Results: From 34,606 genomic variants, two very rare missense variants in NIN were identified. Both probands were compound heterozygotes. In the zebrafish, ninein knockdown led to specific and novel defects in the specification and morphogenesis of the anterior neuroectoderm, resulting in a deformity of the developing cranium with a small, squared skull highly reminiscent of the human phenotype. Conclusion: We identified a novel clinical subtype of MPD in two sisters who have rare variants in NIN. We show, for the first time, that reduction of ninein function in the developing zebrafish leads to specific deficiencies of brain and skull development, offering a developmental basis for the myriad phenotypes in our patients. PMID:22933543

A Single Transcriptome of a Green Toad (Bufo viridis) Yields Candidate Genes for Sex Determination and -Differentiation and Non-Anonymous Population Genetic Markers

PubMed Central

Gerchen, Jörn F.; Reichert, Samuel J.; Röhr, Johannes T.; Dieterich, Christoph; Kloas, Werner

2016-01-01

Large genome size, including immense repetitive and non-coding fractions, still present challenges for capacity, bioinformatics and thus affordability of whole genome sequencing in most amphibians. Here, we test the performance of a single transcriptome to understand whether it can provide a cost-efficient resource for species with large unknown genomes. Using RNA from six different tissues from a single Palearctic green toad (Bufo viridis) specimen and Hiseq2000, we obtained 22,5 Mio reads and publish >100,000 unigene sequences. To evaluate efficacy and quality, we first use this data to identify green toad specific candidate genes, known from other vertebrates for their role in sex determination and differentiation. Of a list of 37 genes, the transcriptome yielded 32 (87%), many of which providing the first such data for this non-model anuran species. However, for many of these genes, only fragments could be retrieved. In order to allow also applications to population genetics, we further used the transcriptome for the targeted development of 21 non-anonymous microsatellites and tested them in genetic families and backcrosses. Eleven markers were specifically developed to be located on the B. viridis sex chromosomes; for eight markers we can indeed demonstrate sex-specific transmission in genetic families. Depending on phylogenetic distance, several markers, which are sex-linked in green toads, show high cross-amplification success across the anuran phylogeny, involving nine systematic anuran families. Our data support the view that single transcriptome sequencing (based on multiple tissues) provides a reliable genomic resource and cost-efficient method for non-model amphibian species with large genome size and, despite limitations, should be considered as long as genome sequencing remains unaffordable for most species. PMID:27232626

Individual genetic variations related to satiety and appetite control increase risk of obesity in preschool-age children in the STRONG kids program.

PubMed

Wang, Yingying; Wang, Anthony; Donovan, Sharon M; Teran-Garcia, Margarita

2013-01-01

The burden of the childhood obesity epidemic is well recognized; nevertheless, the genetic markers and gene-environment interactions associated with the development of common obesity are still unknown. In this study, candidate genes associated to satiety and appetite control pathways with obesity-related traits were tested in Caucasian preschoolers from the STRONG Kids project. Eight genetic variants in genes related to obesity (BDNF, LEPR, FTO, PCSK1, POMC, TUB, LEP, and MC4R) were genotyped in 128 children from the STRONG Kids project (mean age 39.7 months). Data were analyzed for individual associations and to test for genetic predisposition scores (GPSs) with body mass index (BMI) and anthropometric traits (Z-scores, e.g. height-for-age Z-score, HAZ). Covariates included age, sex, and breastfeeding (BF) duration. Obesity and overweight prevalence was 6.3 and 19.5%, respectively, according to age- and sex-specific BMI percentiles. Individual genetic associations of MC4R and LEPR markers with HAZ were strengthened when BF duration was included as a covariate. Our GPSs show that, as the number of risk alleles increased, the risk of higher BMI and HAZ also increased. Overall, the GPSs assembled were able to explain 2-3% of the variability in BMI and HAZ phenotypes. Genetic associations with common obesity-related phenotypes were found in the STRONG Kids project. GPSs assembled for specific candidate genes were associated with BMI and HAZ phenotypes. © 2013 S. Karger AG, Basel.

Genetic basis of interindividual susceptibility to cancer cachexia: selection of potential candidate gene polymorphisms for association studies.

PubMed

Johns, N; Tan, B H; MacMillan, M; Solheim, T S; Ross, J A; Baracos, V E; Damaraju, S; Fearon, K C H

2014-12-01

Cancer cachexia is a complex and multifactorial disease. Evolving definitions highlight the fact that a diverse range of biological processes contribute to cancer cachexia. Part of the variation in who will and who will not develop cancer cachexia may be genetically determined. As new definitions, classifications and biological targets continue to evolve, there is a need for reappraisal of the literature for future candidate association studies. This review summarizes genes identified or implicated as well as putative candidate genes contributing to cachexia, identified through diverse technology platforms and model systems to further guide association studies. A systematic search covering 1986-2012 was performed for potential candidate genes / genetic polymorphisms relating to cancer cachexia. All candidate genes were reviewed for functional polymorphisms or clinically significant polymorphisms associated with cachexia using the OMIM and GeneRIF databases. Pathway analysis software was used to reveal possible network associations between genes. Functionality of SNPs/genes was explored based on published literature, algorithms for detecting putative deleterious SNPs and interrogating the database for expression of quantitative trait loci (eQTLs). A total of 154 genes associated with cancer cachexia were identified and explored for functional polymorphisms. Of these 154 genes, 119 had a combined total of 281 polymorphisms with functional and/or clinical significance in terms of cachexia associated with them. Of these, 80 polymorphisms (in 51 genes) were replicated in more than one study with 24 polymorphisms found to influence two or more hallmarks of cachexia (i.e., inflammation, loss of fat mass and/or lean mass and reduced survival). Selection of candidate genes and polymorphisms is a key element of multigene study design. The present study provides a contemporary basis to select genes and/or polymorphisms for further association studies in cancer cachexia, and to develop their potential as susceptibility biomarkers of cachexia.

A fruit quality gene map of Prunus

PubMed Central

2009-01-01

Background Prunus fruit development, growth, ripening, and senescence includes major biochemical and sensory changes in texture, color, and flavor. The genetic dissection of these complex processes has important applications in crop improvement, to facilitate maximizing and maintaining stone fruit quality from production and processing through to marketing and consumption. Here we present an integrated fruit quality gene map of Prunus containing 133 genes putatively involved in the determination of fruit texture, pigmentation, flavor, and chilling injury resistance. Results A genetic linkage map of 211 markers was constructed for an intraspecific peach (Prunus persica) progeny population, Pop-DG, derived from a canning peach cultivar 'Dr. Davis' and a fresh market cultivar 'Georgia Belle'. The Pop-DG map covered 818 cM of the peach genome and included three morphological markers, 11 ripening candidate genes, 13 cold-responsive genes, 21 novel EST-SSRs from the ChillPeach database, 58 previously reported SSRs, 40 RAFs, 23 SRAPs, 14 IMAs, and 28 accessory markers from candidate gene amplification. The Pop-DG map was co-linear with the Prunus reference T × E map, with 39 SSR markers in common to align the maps. A further 158 markers were bin-mapped to the reference map: 59 ripening candidate genes, 50 cold-responsive genes, and 50 novel EST-SSRs from ChillPeach, with deduced locations in Pop-DG via comparative mapping. Several candidate genes and EST-SSRs co-located with previously reported major trait loci and quantitative trait loci for chilling injury symptoms in Pop-DG. Conclusion The candidate gene approach combined with bin-mapping and availability of a community-recognized reference genetic map provides an efficient means of locating genes of interest in a target genome. We highlight the co-localization of fruit quality candidate genes with previously reported fruit quality QTLs. The fruit quality gene map developed here is a valuable tool for dissecting the genetic architecture of fruit quality traits in Prunus crops. PMID:19995417

Candidate Gene Identification of Feed Efficiency and Coat Color Traits in a C57BL/6J × Kunming F2 Mice Population Using Genome-Wide Association Study.

PubMed

Miao, Yuanxin; Soudy, Fathia; Xu, Zhong; Liao, Mingxing; Zhao, Shuhong; Li, Xinyun

2017-01-01

Feed efficiency (FE) is a very important trait in livestock industry. Identification of the candidate genes could be of benefit for the improvement of FE trait. Mouse is used as the model for many studies in mammals. In this study, the candidate genes related to FE and coat color were identified using C57BL/6J (C57) × Kunming (KM) F2 mouse population. GWAS results showed that 61 and 2 SNPs were genome-wise suggestive significantly associated with feed conversion ratio (FCR) and feed intake (FI) traits, respectively. Moreover, the Erbin, Msrb2, Ptf1a, and Fgf10 were considered as the candidate genes of FE. The Lpl was considered as the candidate gene of FI. Further, the coat color trait was studied. KM mice are white and C57 ones are black. The GWAS results showed that the most significant SNP was located at chromosome 7, and the closely linked gene was Tyr. Therefore, our study offered useful target genes related to FE in mice; these genes may play similar roles in FE of livestock. Also, we identified the major gene of coat color in mice, which would be useful for better understanding of natural mutation of the coat color in mice.

Gene expression underlying enhanced, steroid-dependent auditory sensitivity of hair cell epithelium in a vocal fish.

PubMed

Fergus, Daniel J; Feng, Ni Y; Bass, Andrew H

2015-10-14

Successful animal communication depends on a receiver's ability to detect a sender's signal. Exemplars of adaptive sender-receiver coupling include acoustic communication, often important in the context of seasonal reproduction. During the reproductive summer season, both male and female midshipman fish (Porichthys notatus) exhibit similar increases in the steroid-dependent frequency sensitivity of the saccule, the main auditory division of the inner ear. This form of auditory plasticity enhances detection of the higher frequency components of the multi-harmonic, long-duration advertisement calls produced repetitively by males during summer nights of peak vocal and spawning activity. The molecular basis of this seasonal auditory plasticity has not been fully resolved. Here, we utilize an unbiased transcriptomic RNA sequencing approach to identify differentially expressed transcripts within the saccule's hair cell epithelium of reproductive summer and non-reproductive winter fish. We assembled 74,027 unique transcripts from our saccular epithelial sequence reads. Of these, 6.4 % and 3.0 % were upregulated in the reproductive and non-reproductive saccular epithelium, respectively. Gene ontology (GO) term enrichment analyses of the differentially expressed transcripts showed that the reproductive saccular epithelium was transcriptionally, translationally, and metabolically more active than the non-reproductive epithelium. Furthermore, the expression of a specific suite of candidate genes, including ion channels and components of steroid-signaling pathways, was upregulated in the reproductive compared to the non-reproductive saccular epithelium. We found reported auditory functions for 14 candidate genes upregulated in the reproductive midshipman saccular epithelium, 8 of which are enriched in mouse hair cells, validating their hair cell-specific functions across vertebrates. We identified a suite of differentially expressed genes belonging to neurotransmission and steroid-signaling pathways, consistent with previous work showing the importance of these characters in regulating hair cell auditory sensitivity in midshipman fish and, more broadly, vertebrates. The results were also consistent with auditory hair cells being generally more physiologically active when animals are in a reproductive state, a time of enhanced sensory-motor coupling between the auditory periphery and the upper harmonics of vocalizations. Together with several new candidate genes, our results identify discrete patterns of gene expression linked to frequency- and steroid-dependent plasticity of hair cell auditory sensitivity.

Microarray Data Analysis of Space Grown Arabidopsis Leaves for Genes Important in Vascular Patterning

NASA Technical Reports Server (NTRS)

Weitzeal, A. J.; Wyatt, S. E.; Parsons-Wingerter, P.

2016-01-01

Venation patterning in leaves is a major determinant of photosynthesis efficiency because of its dependency on vascular transport of photoassimilates, water, and minerals. Arabidopsis thaliana grown in microgravity show delayed growth and leaf maturation. Gene expression data from the roots, hypocotyl, and leaves of A. thaliana grown during spaceflight vs. ground control analyzed by Affymetrix microarray are available through NASAs GeneLab (GLDS-7). We analyzed the data for differential expression of genes in leaves resulting from the effects of spaceflight on vascular patterning. Two genes were found by preliminary analysis to be upregulated during spaceflight that may be related to vascular formation. The genes are responsible for coding an ARGOS like protein (potentially affecting cell elongation in the leaves), and an F-boxkelch-repeat protein (possibly contributing to protoxylem specification). Further analysis that will focus on raw data quality assessment and a moderated t-test may further confirm upregulation of the two genes and/or identify other gene candidates. Plants defective in these genes will then be assessed for phenotype by the mapping and quantification of leaf vascular patterning by NASAs VESsel GENeration (VESGEN) software to model specific vascular differences of plants grown in spaceflight.

Microarray Data Analysis of Space Grown Arabidopsis Leaves for Genes Important in Vascular Patterning

NASA Technical Reports Server (NTRS)

Weitzeal, A. J.; Wyatt, S. E.; Parsons-Wingerter, P.

2016-01-01

Venation patterning in leaves is a major determinant of photosynthesis efficiency because of its dependency on vascular transport of photoassimilates, water, and minerals. Arabidopsis thaliana grown in microgravity show delayed growth and leaf maturation. Gene expression data from the roots, hypocotyl, and leaves of A. thaliana grown during spaceflight vs. ground control analyzed by Affymetrix microarray are available through NASA's GeneLab (GLDS-7). We analyzed the data for differential expression of genes in leaves resulting from the effects of spaceflight on vascular patterning. Two genes were found by preliminary analysis to be upregulated during spaceflight that may be related to vascular formation. The genes are responsible for coding an ARGOS like protein (potentially affecting cell elongation in the leaves), and an F-box/kelch-repeat protein (possibly contributing to protoxylem specification). Further analysis that will focus on raw data quality assessment and a moderated t-test may further confirm upregulation of the two genes and/or identify other gene candidates. Plants defective in these genes will then be assessed for phenotype by the mapping and quantification of leaf vascular patterning by NASA's VESsel GENeration (VESGEN) software to model specific vascular differences of plants grown in spaceflight.

Genome-Wide Identification, Characterization and Expression Analysis of the Solute Carrier 6 Gene Family in Silkworm (Bombyx mori)

PubMed Central

Tang, Xin; Liu, Huawei; Chen, Quanmei; Wang, Xin; Xiong, Ying; Zhao, Ping

2016-01-01

The solute carrier 6 (SLC6) gene family, initially known as the neurotransmitter transporters, plays vital roles in the regulation of neurotransmitter signaling, nutrient absorption and motor behavior. In this study, a total of 16 candidate genes were identified as SLC6 family gene homologs in the silkworm (Bombyx mori) genome. Spatio-temporal expression patterns of silkworm SLC6 gene transcripts indicated that these genes were highly and specifically expressed in midgut, brain and gonads; moreover, these genes were expressed primarily at the feeding stage or adult stage. Levels of expression for most midgut-specific and midgut-enriched gene transcripts were down-regulated after starvation but up-regulated after re-feeding. In addition, we observed that expression levels of these genes except for BmSLC6-15 and BmGT1 were markedly up-regulated by a juvenile hormone analog. Moreover, brain-enriched genes showed differential expression patterns during wandering and mating processes, suggesting that these genes may be involved in modulating wandering and mating behaviors. Our results improve our understanding of the expression patterns and potential physiological functions of the SLC6 gene family, and provide valuable information for the comprehensive functional analysis of the SLC6 gene family. PMID:27706106

Genome-Wide Identification, Characterization and Expression Analysis of the Solute Carrier 6 Gene Family in Silkworm (Bombyx mori).

PubMed

Tang, Xin; Liu, Huawei; Chen, Quanmei; Wang, Xin; Xiong, Ying; Zhao, Ping

2016-10-03

The solute carrier 6 (SLC6) gene family, initially known as the neurotransmitter transporters, plays vital roles in the regulation of neurotransmitter signaling, nutrient absorption and motor behavior. In this study, a total of 16 candidate genes were identified as SLC6 family gene homologs in the silkworm (Bombyx mori) genome. Spatio-temporal expression patterns of silkworm SLC6 gene transcripts indicated that these genes were highly and specifically expressed in midgut, brain and gonads; moreover, these genes were expressed primarily at the feeding stage or adult stage. Levels of expression for most midgut-specific and midgut-enriched gene transcripts were down-regulated after starvation but up-regulated after re-feeding. In addition, we observed that expression levels of these genes except for BmSLC6-15 and BmGT1 were markedly up-regulated by a juvenile hormone analog. Moreover, brain-enriched genes showed differential expression patterns during wandering and mating processes, suggesting that these genes may be involved in modulating wandering and mating behaviors. Our results improve our understanding of the expression patterns and potential physiological functions of the SLC6 gene family, and provide valuable information for the comprehensive functional analysis of the SLC6 gene family.

A gene regulatory network model for floral transition of the shoot apex in maize and its dynamic modeling.

PubMed

Dong, Zhanshan; Danilevskaya, Olga; Abadie, Tabare; Messina, Carlos; Coles, Nathan; Cooper, Mark

2012-01-01

The transition from the vegetative to reproductive development is a critical event in the plant life cycle. The accurate prediction of flowering time in elite germplasm is important for decisions in maize breeding programs and best agronomic practices. The understanding of the genetic control of flowering time in maize has significantly advanced in the past decade. Through comparative genomics, mutant analysis, genetic analysis and QTL cloning, and transgenic approaches, more than 30 flowering time candidate genes in maize have been revealed and the relationships among these genes have been partially uncovered. Based on the knowledge of the flowering time candidate genes, a conceptual gene regulatory network model for the genetic control of flowering time in maize is proposed. To demonstrate the potential of the proposed gene regulatory network model, a first attempt was made to develop a dynamic gene network model to predict flowering time of maize genotypes varying for specific genes. The dynamic gene network model is composed of four genes and was built on the basis of gene expression dynamics of the two late flowering id1 and dlf1 mutants, the early flowering landrace Gaspe Flint and the temperate inbred B73. The model was evaluated against the phenotypic data of the id1 dlf1 double mutant and the ZMM4 overexpressed transgenic lines. The model provides a working example that leverages knowledge from model organisms for the utilization of maize genomic information to predict a whole plant trait phenotype, flowering time, of maize genotypes.

Defining the role of the MADS-box gene, Zea agamous like1, in maize domestication

USDA-ARS?s Scientific Manuscript database

Genomic scans for genes that show the signature of past selection have been widely applied to a number of species and have identified a large number of selection candidate genes. In cultivated maize (Zea mays ssp. mays) selection scans have identified several hundred candidate domestication genes...

Genetic and Proteomic Interrogation of Lower Confidence Candidate Genes Reveals Signaling Networks in beta-Catenin-Active Cancers | Office of Cancer Genomics

Cancer.gov

Genome-scale expression studies and comprehensive loss-of-function genetic screens have focused almost exclusively on the highest confidence candidate genes. Here, we describe a strategy for characterizing the lower confidence candidates identified by such approaches.

A candidate gene study in low HDL-cholesterol families provides evidence for the involvement of the APOA2 gene and the APOA1C3A4 gene cluster.

PubMed

Lilja, Heidi E; Soro, Aino; Ylitalo, Kati; Nuotio, Ilpo; Viikari, Jorma S A; Salomaa, Veikko; Vartiainen, Erkki; Taskinen, Marja-Riitta; Peltonen, Leena; Pajukanta, Päivi

2002-09-01

In patients with premature coronary heart disease, the most common lipoprotein abnormality is high-density lipoprotein (HDL) deficiency. To assess the genetic background of the low HDL-cholesterol trait, we performed a candidate gene study in 25 families with low HDL, collected from the genetically isolated population of Finland. We studied 21 genes encoding essential proteins involved in the HDL metabolism by genotyping intragenic and flanking markers for these genes. We found suggestive evidence for linkage in two candidate regions: Marker D1S2844, in the apolipoprotein A-II (APOA2) region, yielded a LOD score of 2.14 and marker D11S939 flanking the apolipoprotein A-I/C-III/A-IV gene cluster (APOA1C3A4) produced a LOD score of 1.69. Interestingly, we identified potential shared haplotypes in these two regions in a subset of low HDL families. These families also contributed to the obtained positive LOD scores, whereas the rest of the families produced negative LOD scores. None of the remaining candidate regions provided any evidence for linkage. Since only a limited number of loci were tested in this candidate gene study, these LOD scores suggest significant involvement of the APOA2 gene and the APOA1C3A4 gene cluster, or loci in their immediate vicinity, in the pathogenesis of low HDL.

Selection of housekeeping genes as internal controls for quantitative RT-PCR analysis of the veined rapa whelk (Rapana venosa).

PubMed

Song, Hao; Dang, Xin; He, Yuan-Qiu; Zhang, Tao; Wang, Hai-Yan

2017-01-01

The veined rapa whelk Rapana venosa is an important commercial shellfish in China and quantitative real-time PCR (qRT-PCR) has become the standard method to study gene expression in R. venosa . For accurate and reliable gene expression results, qRT-PCR assays require housekeeping genes as internal controls, which display highly uniform expression in different tissues or stages of development. However, to date no studies have validated housekeeping genes in R. venosa for use as internal controls for qRT-PCR. In this study, we selected the following 13 candidate genes for suitability as internal controls: elongation factor-1 α ( EF-1α ), α -actin ( ACT ), cytochrome c oxidase subunit 1 ( COX1 ), nicotinamide adenine dinucleotide dehydrogenase (ubiquinone) 1 α subcomplex subunit 7 ( NDUFA7 ), 60S ribosomal protein L5 ( RL5 ), 60S ribosomal protein L28 ( RL28 ), glyceraldehyde 3-phosphate dehydrogenase ( GAPDH ), β -tubulin ( TUBB ), 40S ribosomal protein S25 ( RS25 ), 40S ribosomal protein S8 ( RS8 ), ubiquitin-conjugating enzyme E2 ( UBE2 ), histone H3 ( HH3 ), and peptidyl-prolyl cis-trans isomerase A ( PPIA ). We measured the expression levels of these 13 candidate internal controls in eight different tissues and twelve larvae developmental stages by qRT-PCR. Further analysis of the expression stability of the tested genes was performed using GeNorm and RefFinder algorithms. Of the 13 candidate genes tested, we found that EF-1α was the most stable internal control gene in almost all adult tissue samples investigated with RL5 and RL28 as secondary choices. For the normalization of a single specific tissue, we suggested that EF-1α and NDUFA7 are the best combination in gonad, as well as COX1 and RL28 for intestine, EF-1α and RL5 for kidney, EF-1α and COX1 for gill, EF-1α and RL28 for Leiblein and mantle, EF-1α , RL5 , and NDUFA7 for liver , GAPDH , PPIA , and RL28 for hemocyte. From a developmental perspective, we found that RL28 was the most stable gene in all developmental stages measured, and COX1 and RL5 were appropriate secondary choices. For the specific developmental stage, we recommended the following combination for normalization, PPIA , RS25 , and RL28 for stage 1, RL5 and RL28 for stage 2 and 5, RL28 and NDUFA7 for stage 3, and PPIA and TUBB for stage 4. Our results are instrumental for the selection of appropriately validated housekeeping genes for use as internal controls for gene expression studies in adult tissues or larval development of R. venosa in the future.

Genomic and metabolic characterisation of alkaloid biosynthesis by asexual Epichloë fungal endophytes of tall fescue pasture grasses.

PubMed

Ekanayake, Piyumi N; Kaur, Jatinder; Tian, Pei; Rochfort, Simone J; Guthridge, Kathryn M; Sawbridge, Timothy I; Spangenberg, German C; Forster, John W

2017-06-01

Symbiotic associations between tall fescue grasses and asexual Epichloë fungal endophytes exhibit biosynthesis of alkaloid compounds causing both beneficial and detrimental effects. Candidate novel endophytes with favourable chemotypic profiles have been identified in germplasm collections by screening for genetic diversity, followed by metabolite profile analysis in endogenous genetic backgrounds. A subset of candidates was subjected to genome survey sequencing to detect the presence or absence and structural status of known genes for biosynthesis of the major alkaloid classes. The capacity to produce specific metabolites was directly predictable from metabolic data. In addition, study of duplicated gene structure in heteroploid genomic constitutions provided further evidence for the origin of such endophytes. Selected strains were inoculated into meristem-derived callus cultures from specific tall fescue genotypes to perform isogenic comparisons of alkaloid profile in different host backgrounds, revealing evidence for host-specific quantitative control of metabolite production, consistent with previous studies. Certain strains were capable of both inoculation and formation of longer-term associations with a nonhost species, perennial ryegrass (Lolium perenne L.). Discovery and primary characterisation of novel endophytes by DNA analysis, followed by confirmatory metabolic studies, offers improvements of speed and efficiency and hence accelerated deployment in pasture grass improvement programs.

A common variant in DRD3 receptor is associated with autism spectrum disorder.

PubMed

de Krom, Mariken; Staal, Wouter G; Ophoff, Roel A; Hendriks, Judith; Buitelaar, Jan; Franke, Barbara; de Jonge, Maretha V; Bolton, Patrick; Collier, David; Curran, Sarah; van Engeland, Herman; van Ree, Jan M

2009-04-01

The presence of specific and common genetic etiologies for autism spectrum disorders (ASD) and attention-deficit/hyperactivity disorder (ADHD) was investigated for 132 candidate genes in a two-stage design-association study. 1,536 single nucleotide polymorphisms (SNPs) covering these candidate genes were tested in ASD (n = 144) and ADHD (n = 110) patients and control subjects (n = 404) from The Netherlands. A second stage was performed with those SNPs from Stage I reaching a significance threshold for association of p < .01 in an independent sample of ASD patients (n = 128) and controls (n = 124) from the United Kingdom and a Dutch ADHD (n = 150) and control (n = 149) sample. No shared association was found between ASD and ADHD. However, in the first and second ASD samples and in a joint statistical analysis, a significant association between SNP rs167771 located in the DRD3 gene was found (joint analysis uncorrected: p = 3.11 x 10(-6); corrected for multiple testing and potential stratification: p = .00162). The DRD3 gene is related to stereotyped behavior, liability to side effects of antipsychotic medication, and movement disorders and may therefore have important clinical implications for ASD.

Elderly male smokers with right lung tumors are viable candidates for KRAS mutation screening.

PubMed

Yang, Yang; Shi, Chun; Sun, Hui; Yin, Wei; Zhou, Xiao; Zhang, Lei; Jiang, Gening

2016-01-07

Genetic aberrations in tumor driver genes provide specific molecular targets for therapeutic intervention, which can greatly improve therapeutic outcomes. Here, we analyzed the mutational frequency of EGFR and KRAS gene, as well as EML4-ALK rearrangement, and summarized the clinicopathological characters of Chinese lung cancer patients. We detected the mutation spectrum of 1033 primary lung cancer patients. The analyzed clinicopathological parameters included gender, age at diagnosis, smoking status, pathological TNM stage, tumor morphology and location, visceral pleural invasion, and histological type. A total of 618 patients had mutations in EGFR or KRAS gene as well as rearrangement of EML4-ALK. Exon 19 deletions and L858R in the EGFR gene were the most frequent mutations. Left-side lung cancer was more common in female patients carrying the KRAS mutation. Rearrangement of EML4-ALK was more common in non-tobacco-using male patients, who also exhibited a higher likelihood of visceral pleura invasion. Elderly females who never smoked and possessed 1-20 mm stage I adenocarcinomas in the right side exhibited a higher frequency of EGFR mutations. Elderly male smokers with right lung tumors were viable candidates for KRAS mutation screening.

Poultry Allele-Specific Expression (ASE) of CD4+ T Cells in Response to Marek’s Disease Virus Infection

USDA-ARS?s Scientific Manuscript database

Marek’s disease (MD) is a T cell lymphoma disease of poultry induced by Marek’s disease virus (MDV), a highly oncogenic alphaherpesvirus. To identify high-confidence candidate genes of MD genetic resistance, transcriptomic data in CD4+ T cells were obtained from MDV infected and non-infected groups ...

Development of RNAi method for screening candidate genes to control emerald ash borer, Agrilus planipennis

USDA-ARS?s Scientific Manuscript database

Emerald ash borer (EAB), a serious invasive forest pest in the United States, has killed millions of North American ash trees and spread to 29 states since it was first detected in 2002 in southern Michigan. Development of a new control method that specifically targets the pest but has no adverse i...

Pharmacogenetics: Implications of Race and Ethnicity on Defining Genetic Profiles for Personalized Medicine

PubMed Central

Ortega, Victor E.; Meyers, Deborah A.

2014-01-01

Pharmacogenetics is being used to develop personalized therapies specific to individuals from different ethnic or racial groups. Pharmacogenetic studies to date have been primarily performed in trial cohorts consisting of non-Hispanic whites of European descent. A “bottleneck” or collapse of genetic diversity associated with the first human colonization of Europe during the Upper Paleolithic period, followed by the recent mixing of African, European, and Native American ancestries has resulted in different ethnic groups with varying degrees of genetic diversity. Differences in genetic ancestry may introduce genetic variation which has the potential to alter the therapeutic efficacy of commonly used asthma therapies, for example β2-adrenergic receptor agonists (beta agonists). Pharmacogenetic studies of admixed ethnic groups have been limited to small candidate gene association studies of which the best example is the gene coding for the receptor target of beta agonist therapy, ADRB2. Large consortium-based sequencing studies are using next-generation whole-genome sequencing to provide a diverse genome map of different admixed populations which can be used for future pharmacogenetic studies. These studies will include candidate gene studies, genome-wide association studies, and whole-genome admixture-based approaches which account for ancestral genetic structure, complex haplotypes, gene-gene interactions, and rare variants to detect and replicate novel pharmacogenetic loci. PMID:24369795

Evolutionary Analysis and Expression Profiling of Zebra Finch Immune Genes

PubMed Central

Ekblom, Robert; French, Lisa; Slate, Jon; Burke, Terry

2010-01-01

Genes of the immune system are generally considered to evolve rapidly due to host–parasite coevolution. They are therefore of great interest in evolutionary biology and molecular ecology. In this study, we manually annotated 144 avian immune genes from the zebra finch (Taeniopygia guttata) genome and conducted evolutionary analyses of these by comparing them with their orthologs in the chicken (Gallus gallus). Genes classified as immune receptors showed elevated dN/dS ratios compared with other classes of immune genes. Immune genes in general also appear to be evolving more rapidly than other genes, as inferred from a higher dN/dS ratio compared with the rest of the genome. Furthermore, ten genes (of 27) for which sequence data were available from at least three bird species showed evidence of positive selection acting on specific codons. From transcriptome data of eight different tissues, we found evidence for expression of 106 of the studied immune genes, with primary expression of most of these in bursa, blood, and spleen. These immune-related genes showed a more tissue-specific expression pattern than other genes in the zebra finch genome. Several of the avian immune genes investigated here provide strong candidates for in-depth studies of molecular adaptation in birds. PMID:20884724

Interleukin-27 is a novel candidate diagnostic biomarker for bacterial infection in critically ill children.

PubMed

Wong, Hector R; Cvijanovich, Natalie Z; Hall, Mark; Allen, Geoffrey L; Thomas, Neal J; Freishtat, Robert J; Anas, Nick; Meyer, Keith; Checchia, Paul A; Lin, Richard; Bigham, Michael T; Sen, Anita; Nowak, Jeffrey; Quasney, Michael; Henricksen, Jared W; Chopra, Arun; Banschbach, Sharon; Beckman, Eileen; Harmon, Kelli; Lahni, Patrick; Shanley, Thomas P

2012-10-29

Differentiating between sterile inflammation and bacterial infection in critically ill patients with fever and other signs of the systemic inflammatory response syndrome (SIRS) remains a clinical challenge. The objective of our study was to mine an existing genome-wide expression database for the discovery of candidate diagnostic biomarkers to predict the presence of bacterial infection in critically ill children. Genome-wide expression data were compared between patients with SIRS having negative bacterial cultures (n = 21) and patients with sepsis having positive bacterial cultures (n = 60). Differentially expressed genes were subjected to a leave-one-out cross-validation (LOOCV) procedure to predict SIRS or sepsis classes. Serum concentrations of interleukin-27 (IL-27) and procalcitonin (PCT) were compared between 101 patients with SIRS and 130 patients with sepsis. All data represent the first 24 hours of meeting criteria for either SIRS or sepsis. Two hundred twenty one gene probes were differentially regulated between patients with SIRS and patients with sepsis. The LOOCV procedure correctly predicted 86% of the SIRS and sepsis classes, and Epstein-Barr virus-induced gene 3 (EBI3) had the highest predictive strength. Computer-assisted image analyses of gene-expression mosaics were able to predict infection with a specificity of 90% and a positive predictive value of 94%. Because EBI3 is a subunit of the heterodimeric cytokine, IL-27, we tested the ability of serum IL-27 protein concentrations to predict infection. At a cut-point value of ≥5 ng/ml, serum IL-27 protein concentrations predicted infection with a specificity and a positive predictive value of >90%, and the overall performance of IL-27 was generally better than that of PCT. A decision tree combining IL-27 and PCT improved overall predictive capacity compared with that of either biomarker alone. Genome-wide expression analysis has provided the foundation for the identification of IL-27 as a novel candidate diagnostic biomarker for predicting bacterial infection in critically ill children. Additional studies will be required to test further the diagnostic performance of IL-27. The microarray data reported in this article have been deposited in the Gene Expression Omnibus under accession number GSE4607.

Identification of genes from the Treacher Collins candidate region

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dixon, M.; Dixon, J.; Edwards, S.

Treacher Collins syndrome (TCOF1) is an autosomal dominant disorder of craniofacial development. The TCOF1 locus has previously been mapped to chromosome 5q32-33. The candidate gene region has been defined as being between two flanking markers, ribosomal protein S14 (RPS14) and Annexin 6 (ANX6), by analyzing recombination events in affected individuals. It is estimated that the distance between these flanking markers is 500 kb by three separate analysis methods: (1) radiation hybrid mapping; (2) genetic linkage; and (3) YAC contig analysis. A cosmid contig which spans the candidate gene region for TCOF1 has been constructed by screening the Los Alamos Nationalmore » Laboratory flow-sorted chromosome 5 cosmid library. Cosmids were obtained by using a combination of probes generated from YAC end clones, Alu-PCR fragments from YACs, and asymmetric PCR fragments from both T7 and T3 cosmid ends. Exon amplifications, the selection of genomic coding sequences based upon the presence of functional splice acceptor and donor sites, was used to identify potential exon sequences. Sequences found to be conserved between species were then used to screen cDNA libraries in order to identify candidate genes. To date, four different cDNAs have been isolated from this region and are being analyzed as potential candidate genes for TCOF1. These include the genes encoding plasma glutathione peroxidase (GPX3), heparin sulfate sulfotransferase (HSST), a gene with homology to the ETS family of proteins and one which shows no homology to any known genes. Work is also in progress to identify and characterize additional cDNAs from the candidate gene region.« less

Mapping a candidate gene (MdMYB10) for red flesh and foliage colour in apple

PubMed Central

Chagné, David; Carlisle, Charmaine M; Blond, Céline; Volz, Richard K; Whitworth, Claire J; Oraguzie, Nnadozie C; Crowhurst, Ross N; Allan, Andrew C; Espley, Richard V; Hellens, Roger P; Gardiner, Susan E

2007-01-01

Background Integrating plant genomics and classical breeding is a challenge for both plant breeders and molecular biologists. Marker-assisted selection (MAS) is a tool that can be used to accelerate the development of novel apple varieties such as cultivars that have fruit with anthocyanin through to the core. In addition, determining the inheritance of novel alleles, such as the one responsible for red flesh, adds to our understanding of allelic variation. Our goal was to map candidate anthocyanin biosynthetic and regulatory genes in a population segregating for the red flesh phenotypes. Results We have identified the Rni locus, a major genetic determinant of the red foliage and red colour in the core of apple fruit. In a population segregating for the red flesh and foliage phenotype we have determined the inheritance of the Rni locus and DNA polymorphisms of candidate anthocyanin biosynthetic and regulatory genes. Simple Sequence Repeats (SSRs) and Single Nucleotide Polymorphisms (SNPs) in the candidate genes were also located on an apple genetic map. We have shown that the MdMYB10 gene co-segregates with the Rni locus and is on Linkage Group (LG) 09 of the apple genome. Conclusion We have performed candidate gene mapping in a fruit tree crop and have provided genetic evidence that red colouration in the fruit core as well as red foliage are both controlled by a single locus named Rni. We have shown that the transcription factor MdMYB10 may be the gene underlying Rni as there were no recombinants between the marker for this gene and the red phenotype in a population of 516 individuals. Associating markers derived from candidate genes with a desirable phenotypic trait has demonstrated the application of genomic tools in a breeding programme of a horticultural crop species. PMID:17608951

Epigenetic inactivation of VGF associated with Urothelial Cell Carcinoma and its potential as a non-invasive biomarker using urine

PubMed Central

Kagohara, Luciane Tsukamoto; Maldonado, Leonel; Brait, Mariana; Schoenberg, Mark; Bivalacqua, Trinity; Netto, George J; Koch, Wayne; Sidransky, David; Hoque, Mohammad O.

2014-01-01

Background: To identify new epigenetic markers and further characterize Urothelial Cell Carcinoma (UCC), we tested the promoter methylation (PM) status of 19 genes previously identified as cancer specific methylated genes in other solid tumors. Methods: We used bisulfite sequencing, methylation specific PCR and quantitative methylation specific PCR (QMSP) to test the PM status of 19 genes in urothelial cancer cell lines. Results: Among the 19 genes tested, VGF was found to be completely methylated in several UCC cell lines. VGF QMSP analysis showed that methylation values of almost all the primary 19 UCC tissues were higher than the paired normal tissues (P=0.009). In another cohort, 12/35 (34.3%) of low grade UCC cases displayed VGF methylation. As a biomarker for non-invasive detection of UCC, VGF showed a significantly higher frequency of methylation in urine from UCC cases (8/20) compared to controls (1/20) (P=0.020). After treatment of cell lines with 5-Aza-2'-deoxycytidine, VGF was robustly re-expressed. Forced expression of VGF in bladder cancer cell lines inhibited cell growth. Conclusion: Selection of candidates from genome-wide screening approach in other solid tumors successfully identified UCC specific methylated genes. PMID:24830820

EBF factors drive expression of multiple classes of target genes governing neuronal development.

PubMed

Green, Yangsook S; Vetter, Monica L

2011-04-30

Early B cell factor (EBF) family members are transcription factors known to have important roles in several aspects of vertebrate neurogenesis, including commitment, migration and differentiation. Knowledge of how EBF family members contribute to neurogenesis is limited by a lack of detailed understanding of genes that are transcriptionally regulated by these factors. We performed a microarray screen in Xenopus animal caps to search for targets of EBF transcriptional activity, and identified candidate targets with multiple roles, including transcription factors of several classes. We determined that, among the most upregulated candidate genes with expected neuronal functions, most require EBF activity for some or all of their expression, and most have overlapping expression with ebf genes. We also found that the candidate target genes that had the most strongly overlapping expression patterns with ebf genes were predicted to be direct transcriptional targets of EBF transcriptional activity. The identification of candidate targets that are transcription factor genes, including nscl-1, emx1 and aml1, improves our understanding of how EBF proteins participate in the hierarchy of transcription control during neuronal development, and suggests novel mechanisms by which EBF activity promotes migration and differentiation. Other candidate targets, including pcdh8 and kcnk5, expand our knowledge of the types of terminal differentiated neuronal functions that EBF proteins regulate.

Development of New Candidate Gene and EST-Based Molecular Markers for Gossypium Species

PubMed Central

Buyyarapu, Ramesh; Kantety, Ramesh V.; Yu, John Z.; Saha, Sukumar; Sharma, Govind C.

2011-01-01

New source of molecular markers accelerate the efforts in improving cotton fiber traits and aid in developing high-density integrated genetic maps. We developed new markers based on candidate genes and G. arboreum EST sequences that were used for polymorphism detection followed by genetic and physical mapping. Nineteen gene-based markers were surveyed for polymorphism detection in 26 Gossypium species. Cluster analysis generated a phylogenetic tree with four major sub-clusters for 23 species while three species branched out individually. CAP method enhanced the rate of polymorphism of candidate gene-based markers between G. hirsutum and G. barbadense. Two hundred A-genome based SSR markers were designed after datamining of G. arboreum EST sequences (Mississippi Gossypium arboreum   EST-SSR: MGAES). Over 70% of MGAES markers successfully produced amplicons while 65 of them demonstrated polymorphism between the parents of G. hirsutum and G. barbadense RIL population and formed 14 linkage groups. Chromosomal localization of both candidate gene-based and MGAES markers was assisted by euploid and hypoaneuploid CS-B analysis. Gene-based and MGAES markers were highly informative as they were designed from candidate genes and fiber transcriptome with a potential to be integrated into the existing cotton genetic and physical maps. PMID:22315588

A substitution involving the NLGN4 gene associated with autistic behavior in the Greek population.

PubMed

Pampanos, Andreas; Volaki, Konstantina; Kanavakis, Emmanuel; Papandreou, Ourania; Youroukos, Sotiris; Thomaidis, Loretta; Karkelis, Savvas; Tzetis, Maria; Kitsiou-Tzeli, Sophia

2009-10-01

Autism is a neurodevelopmental disorder characterized by clinical, etiologic, and genetic heterogeneity. During the last decade, predisposing genes and genetic loci were under investigation. Recently, mutations in two X-linked neuroligin genes, neuroligin 3 (NLGN3) and neuroligin 4 (NLGN4), have been implicated in the pathogenesis of autism. In our ongoing survey, we screened 169 patients with autism for mutations linked with autism. In the preliminary study of specific exons of NLGN3 and NLGN4 genes, we identified the p.K378R substitution (c.1597 A > G) in exon 5 of the NLGN4 gene in a patient who was found to have mild autism and normal IQ at 3 years of age. The same mutation has previously been found in a patient with autism. It is important that, for the first time, a specific mutation in neuroligins is confirmed in a molecular screen in another homogeneous ethnic population. This finding further contributes to consideration of neuroligins as probable candidate genes for future molecular genetic studies, suggesting that a defect of synaptogenesis may predispose to autism.

Identification of candidate transmission-blocking antigen genes in Theileria annulata and related vector-borne apicomplexan parasites.

PubMed

Lempereur, Laetitia; Larcombe, Stephen D; Durrani, Zeeshan; Karagenc, Tulin; Bilgic, Huseyin Bilgin; Bakirci, Serkan; Hacilarlioglu, Selin; Kinnaird, Jane; Thompson, Joanne; Weir, William; Shiels, Brian

2017-06-05

Vector-borne apicomplexan parasites are a major cause of mortality and morbidity to humans and livestock globally. The most important disease syndromes caused by these parasites are malaria, babesiosis and theileriosis. Strategies for control often target parasite stages in the mammalian host that cause disease, but this can result in reservoir infections that promote pathogen transmission and generate economic loss. Optimal control strategies should protect against clinical disease, block transmission and be applicable across related genera of parasites. We have used bioinformatics and transcriptomics to screen for transmission-blocking candidate antigens in the tick-borne apicomplexan parasite, Theileria annulata. A number of candidate antigen genes were identified which encoded amino acid domains that are conserved across vector-borne Apicomplexa (Babesia, Plasmodium and Theileria), including the Pfs48/45 6-cys domain and a novel cysteine-rich domain. Expression profiling confirmed that selected candidate genes are expressed by life cycle stages within infected ticks. Additionally, putative B cell epitopes were identified in the T. annulata gene sequences encoding the 6-cys and cysteine rich domains, in a gene encoding a putative papain-family cysteine peptidase, with similarity to the Plasmodium SERA family, and the gene encoding the T. annulata major merozoite/piroplasm surface antigen, Tams1. Candidate genes were identified that encode proteins with similarity to known transmission blocking candidates in related parasites, while one is a novel candidate conserved across vector-borne apicomplexans and has a potential role in the sexual phase of the life cycle. The results indicate that a 'One Health' approach could be utilised to develop a transmission-blocking strategy effective against vector-borne apicomplexan parasites of animals and humans.

Sleeping Beauty transposon mutagenesis identifies genes that cooperate with mutant Smad4 in gastric cancer development

PubMed Central

Takeda, Haruna; Rust, Alistair G.; Ward, Jerrold M.; Yew, Christopher Chin Kuan; Jenkins, Nancy A.; Copeland, Neal G.

2016-01-01

Mutations in SMAD4 predispose to the development of gastrointestinal cancer, which is the third leading cause of cancer-related deaths. To identify genes driving gastric cancer (GC) development, we performed a Sleeping Beauty (SB) transposon mutagenesis screen in the stomach of Smad4+/− mutant mice. This screen identified 59 candidate GC trunk drivers and a much larger number of candidate GC progression genes. Strikingly, 22 SB-identified trunk drivers are known or candidate cancer genes, whereas four SB-identified trunk drivers, including PTEN, SMAD4, RNF43, and NF1, are known human GC trunk drivers. Similar to human GC, pathway analyses identified WNT, TGF-β, and PI3K-PTEN signaling, ubiquitin-mediated proteolysis, adherens junctions, and RNA degradation in addition to genes involved in chromatin modification and organization as highly deregulated pathways in GC. Comparative oncogenomic filtering of the complete list of SB-identified genes showed that they are highly enriched for genes mutated in human GC and identified many candidate human GC genes. Finally, by comparing our complete list of SB-identified genes against the list of mutated genes identified in five large-scale human GC sequencing studies, we identified LDL receptor-related protein 1B (LRP1B) as a previously unidentified human candidate GC tumor suppressor gene. In LRP1B, 129 mutations were found in 462 human GC samples sequenced, and LRP1B is one of the top 10 most deleted genes identified in a panel of 3,312 human cancers. SB mutagenesis has, thus, helped to catalog the cooperative molecular mechanisms driving SMAD4-induced GC growth and discover genes with potential clinical importance in human GC. PMID:27006499

Sleeping Beauty transposon mutagenesis identifies genes that cooperate with mutant Smad4 in gastric cancer development.

PubMed

Takeda, Haruna; Rust, Alistair G; Ward, Jerrold M; Yew, Christopher Chin Kuan; Jenkins, Nancy A; Copeland, Neal G

2016-04-05

Mutations in SMAD4 predispose to the development of gastrointestinal cancer, which is the third leading cause of cancer-related deaths. To identify genes driving gastric cancer (GC) development, we performed a Sleeping Beauty (SB) transposon mutagenesis screen in the stomach of Smad4(+/-) mutant mice. This screen identified 59 candidate GC trunk drivers and a much larger number of candidate GC progression genes. Strikingly, 22 SB-identified trunk drivers are known or candidate cancer genes, whereas four SB-identified trunk drivers, including PTEN, SMAD4, RNF43, and NF1, are known human GC trunk drivers. Similar to human GC, pathway analyses identified WNT, TGF-β, and PI3K-PTEN signaling, ubiquitin-mediated proteolysis, adherens junctions, and RNA degradation in addition to genes involved in chromatin modification and organization as highly deregulated pathways in GC. Comparative oncogenomic filtering of the complete list of SB-identified genes showed that they are highly enriched for genes mutated in human GC and identified many candidate human GC genes. Finally, by comparing our complete list of SB-identified genes against the list of mutated genes identified in five large-scale human GC sequencing studies, we identified LDL receptor-related protein 1B (LRP1B) as a previously unidentified human candidate GC tumor suppressor gene. In LRP1B, 129 mutations were found in 462 human GC samples sequenced, and LRP1B is one of the top 10 most deleted genes identified in a panel of 3,312 human cancers. SB mutagenesis has, thus, helped to catalog the cooperative molecular mechanisms driving SMAD4-induced GC growth and discover genes with potential clinical importance in human GC.

confFuse: High-Confidence Fusion Gene Detection across Tumor Entities.

PubMed

Huang, Zhiqin; Jones, David T W; Wu, Yonghe; Lichter, Peter; Zapatka, Marc

2017-01-01

Background: Fusion genes play an important role in the tumorigenesis of many cancers. Next-generation sequencing (NGS) technologies have been successfully applied in fusion gene detection for the last several years, and a number of NGS-based tools have been developed for identifying fusion genes during this period. Most fusion gene detection tools based on RNA-seq data report a large number of candidates (mostly false positives), making it hard to prioritize candidates for experimental validation and further analysis. Selection of reliable fusion genes for downstream analysis becomes very important in cancer research. We therefore developed confFuse, a scoring algorithm to reliably select high-confidence fusion genes which are likely to be biologically relevant. Results: confFuse takes multiple parameters into account in order to assign each fusion candidate a confidence score, of which score ≥8 indicates high-confidence fusion gene predictions. These parameters were manually curated based on our experience and on certain structural motifs of fusion genes. Compared with alternative tools, based on 96 published RNA-seq samples from different tumor entities, our method can significantly reduce the number of fusion candidates (301 high-confidence from 8,083 total predicted fusion genes) and keep high detection accuracy (recovery rate 85.7%). Validation of 18 novel, high-confidence fusions detected in three breast tumor samples resulted in a 100% validation rate. Conclusions: confFuse is a novel downstream filtering method that allows selection of highly reliable fusion gene candidates for further downstream analysis and experimental validations. confFuse is available at https://github.com/Zhiqin-HUANG/confFuse.

Comparative analysis of protein interactome networks prioritizes candidate genes with cancer signatures.

PubMed

Li, Yongsheng; Sahni, Nidhi; Yi, Song

2016-11-29

Comprehensive understanding of human cancer mechanisms requires the identification of a thorough list of cancer-associated genes, which could serve as biomarkers for diagnoses and therapies in various types of cancer. Although substantial progress has been made in functional studies to uncover genes involved in cancer, these efforts are often time-consuming and costly. Therefore, it remains challenging to comprehensively identify cancer candidate genes. Network-based methods have accelerated this process through the analysis of complex molecular interactions in the cell. However, the extent to which various interactome networks can contribute to prediction of candidate genes responsible for cancer is still enigmatic. In this study, we evaluated different human protein-protein interactome networks and compared their application to cancer gene prioritization. Our results indicate that network analyses can increase the power to identify novel cancer genes. In particular, such predictive power can be enhanced with the use of unbiased systematic protein interaction maps for cancer gene prioritization. Functional analysis reveals that the top ranked genes from network predictions co-occur often with cancer-related terms in literature, and further, these candidate genes are indeed frequently mutated across cancers. Finally, our study suggests that integrating interactome networks with other omics datasets could provide novel insights into cancer-associated genes and underlying molecular mechanisms.

Characterization of candidate genes in inflammatory bowel disease–associated risk loci

PubMed Central

Peloquin, Joanna M.; Sartor, R. Balfour; Newberry, Rodney D.; McGovern, Dermot P.; Yajnik, Vijay; Lira, Sergio A.

2016-01-01

GWAS have linked SNPs to risk of inflammatory bowel disease (IBD), but a systematic characterization of disease-associated genes has been lacking. Prior studies utilized microarrays that did not capture many genes encoded within risk loci or defined expression quantitative trait loci (eQTLs) using peripheral blood, which is not the target tissue in IBD. To address these gaps, we sought to characterize the expression of IBD-associated risk genes in disease-relevant tissues and in the setting of active IBD. Terminal ileal (TI) and colonic mucosal tissues were obtained from patients with Crohn’s disease or ulcerative colitis and from healthy controls. We developed a NanoString code set to profile 678 genes within IBD risk loci. A subset of patients and controls were genotyped for IBD-associated risk SNPs. Analyses included differential expression and variance analysis, weighted gene coexpression network analysis, and eQTL analysis. We identified 116 genes that discriminate between healthy TI and colon samples and uncovered patterns in variance of gene expression that highlight heterogeneity of disease. We identified 107 coexpressed gene pairs for which transcriptional regulation is either conserved or reversed in an inflammation-independent or -dependent manner. We demonstrate that on average approximately 60% of disease-associated genes are differentially expressed in inflamed tissue. Last, we identified eQTLs with either genotype-only effects on expression or an interaction effect between genotype and inflammation. Our data reinforce tissue specificity of expression in disease-associated candidate genes, highlight genes and gene pairs that are regulated in disease-relevant tissue and inflammation, and provide a foundation to advance the understanding of IBD pathogenesis. PMID:27668286

Putative pathway of sex pheromone biosynthesis and degradation by expression patterns of genes identified from female pheromone gland and adult antenna of Sesamia inferens (Walker).

PubMed

Zhang, Ya-Nan; Xia, Yi-Han; Zhu, Jia-Yao; Li, Sheng-Yun; Dong, Shuang-Lin

2014-05-01

The general pathway of biosynthesis and degradation for Type-I sex pheromones in moths is well established, but some genes involved in this pathway remain to be characterized. The purple stem borer, Sesamia inferens, employs a pheromone blend containing components with three different terminal functional groups (Z11-16:OAc, Z11-16:OH, and Z11-16:Ald) of Type-I sex pheromones. Thus, it provides a good model to study the diversity of genes involved in pheromone biosynthesis and degradation pathways. By analyzing previously obtained transcriptomic data of the sex pheromone glands and antennae, we identified 73 novel genes that are possibly related to pheromone biosynthesis (46 genes) or degradation (27 genes). Gene expression patterns and phylogenetic analysis revealed that one desaturase (SinfDes4), one fatty acid reductase (SinfFAR2), and one fatty acid xtransport protein (SinfFATP1) genes were predominantly expressed in pheromone glands, and clustered with genes involved in pheromone synthesis in other moth species. Ten genes including five carboxylesterases (SinfCXE10, 13, 14, 18, and 20), three aldehyde oxidases (SinfAOX1, 2 and 3), and two alcohol dehydrogenases (SinfAD1 and 3) were expressed specifically or predominantly in antennae, and could be candidate genes involved in pheromone degradation. SinfAD1 and 3 are the first reported alcohol dehydrogenase genes with antennae-biased expression. Based on these results we propose a pathway involving these potential enzyme-encoding gene candidates in sex pheromone biosynthesis and degradation in S. inferens. This study provides robust background information for further elucidation of the genetic basis of sex pheromone biosynthesis and degradation, and ultimately provides potential targets to disrupt sexual communication in S. inferens for control purposes.

The promoter of a plant defensin gene directs specific expression in nematode-induced syncytia in Arabidopsis roots.

PubMed

Siddique, Shahid; Wieczorek, Krzysztof; Szakasits, Dagmar; Kreil, David P; Bohlmann, Holger

2011-10-01

The beet cyst nematode Heterodera schachtii induces a feeding site, called syncytium, in roots of host plants. In Arabidopsis, one of the genes whose expression is strongly induced in these structures is Pdf2.1 which codes for an antimicrobial plant defensin. Arabidopsis has 13 plant defensin genes. Besides Pdf2.1, the Pdf2.2 and Pdf2.3 genes were strongly expressed in syncytia and therefore the expression of all three Pdf genes was studied in detail. The promoter of the Pdf2.1 gene turned out to be an interesting candidate to drive a syncytium-specific expression of foreign genes as RT-PCR showed that apart from the feeding site it was only expressed in siliques (seeds). The Pdf2.2 and Pdf2.3 genes were in addition expressed in seedlings, roots, leaves, stems, and flowers. These results were supported by the analysis of promoter::GUS lines. After infection with H. schachtii all GUS lines showed a strong staining in syncytia at 5 and 15 dpi. This expression pattern was confirmed by in situ RT-PCR. Copyright © 2011 Elsevier Masson SAS. All rights reserved.

Gene amplification of the transcription factor DP1 and CTNND1 in human lung cancer.

PubMed

Castillo, Sandra D; Angulo, Barbara; Suarez-Gauthier, Ana; Melchor, Lorenzo; Medina, Pedro P; Sanchez-Verde, Lydia; Torres-Lanzas, Juan; Pita, Guillermo; Benitez, Javier; Sanchez-Cespedes, Montse

2010-09-01

The search for novel oncogenes is important because they could be the target of future specific anticancer therapies. In the present paper we report the identification of novel amplified genes in lung cancer by means of global gene expression analysis. To screen for amplicons, we aligned the gene expression data according to the position of transcripts in the human genome and searched for clusters of over-expressed genes. We found several clusters with gene over-expression, suggesting an underlying genomic amplification. FISH and microarray analysis for DNA copy number in two clusters, at chromosomes 11q12 and 13q34, confirmed the presence of amplifications spanning about 0.4 and 1 Mb for 11q12 and 13q34, respectively. Amplification at these regions each occurred at a frequency of 3%. Moreover, quantitative RT-PCR of each individual transcript within the amplicons allowed us to verify the increased in gene expression of several genes. The p120ctn and DP1 proteins, encoded by two candidate oncogenes, CTNND1 and TFDP1, at 11q12 and 13q amplicons, respectively, showed very strong immunostaining in lung tumours with gene amplification. We then focused on the 13q34 amplicon and in the TFDP1 candidate oncogene. To further determine the oncogenic properties of DP1, we searched for lung cancer cell lines carrying TFDP1 amplification. Depletion of TFDP1 expression by small interference RNA in a lung cancer cell line (HCC33) with TFDP1 amplification and protein over-expression reduced cell viability by 50%. In conclusion, we report the identification of two novel amplicons, at 13q34 and 11q12, each occurring at a frequency of 3% of non-small cell lung cancers. TFDP1, which encodes the E2F-associated transcription factor DP1 is a candidate oncogene at 13q34. The data discussed in this publication have been deposited in NCBIs Gene Expression Omnibus (GEO; http://www.ncbi.nlm.nih.gov/geo/) and are accessible through GEO Series Accession No. GSE21168.

Mice, humans and haplotypes--the hunt for disease genes in SLE.

PubMed

Rigby, R J; Fernando, M M A; Vyse, T J

2006-09-01

Defining the polymorphisms that contribute to the development of complex genetic disease traits is a challenging, although increasingly tractable problem. Historically, the technical difficulties in conducting association studies across the entire human genome are such that murine models have been used to generate candidate genes for analysis in human complex diseases, such as SLE. In this article we discuss the advantages and disadvantages of this approach and specifically address some assumptions made in the transition from studying one species to another, using lupus as an example. These issues include differences in genetic structure and genetic organisation which are a reflection on the population history. Clearly there are major differences in the histories of the human population and inbred laboratory strains of mice. Both human and murine genomes do exhibit structure at the genetic level. That is to say, they comprise haplotypes which are genomic regions that carry runs of polymorphisms that are not independently inherited. Haplotypes therefore reduce the number of combinations of the polymorphisms in the DNA in that region and facilitate the identification of disease susceptibility genes in both mice and humans. There are now novel means of generating candidate genes in SLE using mutagenesis (with ENU) in mice and identifying mice that generate antinuclear autoimmunity. In addition, murine models still provide a valuable means of exploring the functional consequences of genetic variation. However, advances in technology are such that human geneticists can now screen large fractions of the human genome for disease associations using microchip technologies that provide information on upwards of 100,000 different polymorphisms. These approaches are aimed at identifying haplotypes that carry disease susceptibility mutations and rely less on the generation of candidate genes.

Grouping and characterization of putative glycosyltransferase genes from Panax ginseng Meyer.

PubMed

Khorolragchaa, Altanzul; Kim, Yu-Jin; Rahimi, Shadi; Sukweenadhi, Johan; Jang, Moon-Gi; Yang, Deok-Chun

2014-02-15

Glycosyltransferases are members of the multigene family of plants that can transfer single or multiple activated sugars to a range of plant molecules, resulting in the glycosylation of plant compounds. Although the activities of many glycosyltransferases and their products have been recognized for a long time, only in recent years were some glycosyltransferase genes identified and few have been functionally characterized in detail. Korean ginseng (Panax ginseng Meyer), belonging to Araliaceae, has been well known as a popular mysterious medicinal herb in East Asia for over 2,000 years. A total of 704 glycosyltransferase unique sequences have been found from a ginseng expressed sequence tag (EST) library, and these sequences encode enzymes responsible for the secondary metabolite biosynthesis. Finally, twelve UDP glycosyltransferases (UGTs) were selected as the candidates most likely to be involved in triterpenoid synthesis. In this study, we classified the candidate P. ginseng UGTs (PgUGTs) into proper families and groups, which resulted in eight UGT families and six UGT groups. We also investigated those gene candidates encoding for glycosyltransferases by analysis of gene expression in methyl jasmonate (MeJA)-treated ginseng adventitious roots and different tissues from four-year-old ginseng using quantitative reverse transcriptase-polymerase chain reaction (RT-PCR). For organ-specific expression, most of PgUGT transcription levels were higher in leaves and roots compared with flower buds and stems. The transcription of PgUGTs in adventitious roots treated with MeJA increased as compared with the control. PgUGT1 and PgUGT2, which belong to the UGT71 family genes expressed in MeJA-treated adventitious roots, were especially sensitive, showing 33.32 and 38.88-fold expression increases upon 24h post-treatments, respectively. © 2013 Elsevier B.V. All rights reserved.

A locus on mouse Ch10 influences susceptibility to limbic seizure severity: fine mapping and in silico candidate gene analysis

PubMed Central

Winawer, Melodie R.; Klassen, Tara L.; Teed, Sarah; Shipman, Marissa; Leung, Emily H.; Palmer, Abraham A.

2014-01-01

Identification of genes contributing to mouse seizure susceptibility can reveal novel genes or pathways that provide insight into human epilepsy. Using mouse chromosome substitution strains and interval-specific congenic strains (ISCS), we previously identified an interval conferring pilocarpine-induced limbic seizure susceptibility on distal mouse Chromosome 10 (Ch10). We narrowed the region by generating subcongenics with smaller A/J Ch10 segments on a C57BL/6J (B6) background and tested them with pilocarpine. We also tested pilocarpine susceptible congenics for 6Hz ECT, another model of limbic seizure susceptibility, to determine whether the susceptibility locus might have a broad effect on neuronal hyperexcitability across more than one mode of limbic seizure induction. ISCS Line 1, which contained the distal 2.7 Mb segment from A/J (starting at rs29382217), was more susceptible to both pilocarpine and ECT. Line 2, which was a subcongenic of Line1 (starting at rs13480828), was not susceptible; thus defining a 1.0 Mb critical region that was unique to Line1. Bioinformatic approaches identified 52 human orthologues within the unique Line 1 susceptibility region, the majority syntenic to human Ch12. Applying an epilepsy network analysis of known and suspected excitability genes and examination of interstrain genomic and brain expression differences revealed novel candidates within the region. These include Stat2, which plays a role in hippocampal GABA receptor expression after status epilepticus, and novel candidates Pan2, Cdk2, Gls2, and Cs, which are involved in neural cell differentiation, cellular remodeling, and embryonic development. Our strategy may facilitate discovery of novel human epilepsy genes. PMID:24373497

A genomewide DNA microsatellite association study of Japanese patients with autoimmune hepatitis type 1.

PubMed

Yokosawa, Shuichi; Yoshizawa, Kaname; Ota, Masao; Katsuyama, Yoshihiko; Kawa, Shigeyuki; Ichijo, Tetsuya; Umemura, Takeji; Tanaka, Eiji; Kiyosawa, Kendo

2007-02-01

Genetic predisposition to type 1 autoimmune hepatitis (AIH) is linked mainly to HLA class II genes. We previously searched the whole HLA region for AIH susceptibility genes using microsatellite markers and found only HLA-DR/DQ to be a candidate region for this suspected multifactorial disease. As such, the aim of this study was to broaden our search and screen the whole genome for additional genes that might contribute to type 1 AIH susceptibility. Eighty-one patients with type 1 AIH (15 men, 66 women, average age 55.9) and 80 healthy sex- and age-matched Japanese controls were enrolled in this study. We performed a case-control association study using 400 polymorphic microsatellite markers with an average spacing of 10.8 cM distributed throughout the whole genome. Two markers, one on chromosome 11 (D11S902, Pc = 0.013) and one on chromosome 18 (D18S464, Pc = 0.008), were revealed to have statistically significant associations with AIH. An additional 7 markers (D2S367, D6S309, D9S273, D11S1320, D16S423, D17S938, and D18S68) were also found to be candidate susceptibility regions. In addition, our results showed there were 17 regions that may contain genes of resistance to AIH. No specific markers were detected in HLA-DR4-negative patients, and no differences were seen in the clinical courses of patients (severe versus mild to moderate). This first genomewide scan of Japanese AIH patients revealed at least 26 candidate AIH susceptibility or resistance regions other than HLA class II loci. These results also suggested that the products of several genes interact to determine heritable susceptibility to AIH.

Survey of candidate genes for maize resistance to infection by Aspergillus flavus and/or aflatoxin contamination

Treesearch

Leigh Hawkins; Marilyn Warburton; Juliet Tang; John Tomashek; Dafne Alves Oliveira; Oluwaseun Ogunola; J. Smith; W. Williams

2018-01-01

Many projects have identified candidate genes for resistance to aflatoxin accumulation or Aspergillus flavus infection and growth in maize using genetic mapping, genomics, transcriptomics and/or proteomics studies. However, only a small percentage of these candidates have been validated in field conditions, and their relative contribution to...

Meta-QTL analysis of seed iron and zinc concentration and content in common bean (Phaseolus vulgaris L.).

PubMed

Izquierdo, Paulo; Astudillo, Carolina; Blair, Matthew W; Iqbal, Asif M; Raatz, Bodo; Cichy, Karen A

2018-05-11

Twelve meta-QTL for seed Fe and Zn concentration and/or content were identified from 87 QTL originating from seven population grown in sixteen field trials. These meta-QTL include 2 specific to iron, 2 specific to zinc and 8 that co-localize for iron and zinc concentrations and/or content. Common bean (Phaseolus vulgaris L.) is the most important legume for human consumption worldwide and it is an important source of microelements, especially iron and zinc. Bean biofortification breeding programs develop new varieties with high levels of Fe and Zn targeted for countries with human micronutrient deficiencies. Biofortification efforts thus far have relied on phenotypic selection of raw seed mineral concentrations in advanced generations. While numerous quantitative trait loci (QTL) studies have been conducted to identify genomic regions associated with increased Fe and Zn concentration in seeds, these results have yet to be employed for marker-assisted breeding. The objective of this study was to conduct a meta-analysis from seven QTL studies in Andean and Middle American intra- and inter-gene pool populations to identify the regions in the genome that control the Fe and Zn levels in seeds. Two meta-QTL specific to Fe and two meta-QTL specific to Zn were identified. Additionally, eight Meta QTL that co-localized for Fe and Zn concentration and/or content were identified across seven chromosomes. The Fe and Zn shared meta-QTL could be useful candidates for marker-assisted breeding to simultaneously increase seed Fe and Zn. The physical positions for 12 individual meta-QTL were identified and within five of the meta-QTL, candidate genes were identified from six gene families that have been associated with transport of iron and zinc in plants.

Control of Metastatic Progression by microRNA Regulatory Networks

PubMed Central

Pencheva, Nora; Tavazoie, Sohail F.

2015-01-01

Aberrant microRNA (miRNA) expression is a defining feature of human malignancy. Specific miRNAs have been identified as promoters or suppressors of metastatic progression. These miRNAs control metastasis through divergent or convergent regulation of metastatic gene pathways. Some miRNA regulatory networks govern cell-autonomous cancer phenotypes, while others modulate the cell-extrinsic composition of the metastatic microenvironment. The use of small RNAs as probes into the molecular and cellular underpinnings of metastasis holds promise for the identification of candidate genes for potential therapeutic intervention. PMID:23728460

Genome-Wide Association Study of Piglet Uniformity and Farrowing Interval

PubMed Central

Wang, Yuan; Ding, Xiangdong; Tan, Zhen; Ning, Chao; Xing, Kai; Yang, Ting; Pan, Yongjie; Sun, Dongxiao; Wang, Chuduan

2017-01-01

Piglet uniformity (PU) and farrowing interval (FI) are important reproductive traits related to production and economic profits in the pig industry. However, the genetic architecture of the longitudinal trends of reproductive traits still remains elusive. Herein, we performed a genome-wide association study (GWAS) to detect potential genetic variation and candidate genes underlying the phenotypic records at different parities for PU and FI in a population of 884 Large White pigs. In total, 12 significant SNPs were detected on SSC1, 3, 4, 9, and 14, which collectively explained 1–1.79% of the phenotypic variance for PU from parity 1 to 4, and 2.58–4.11% for FI at different stages. Of these, seven SNPs were located within 16 QTL regions related to swine reproductive traits. One QTL region was associated with birth body weight (related to PU) and contained the peak SNP MARC0040730, and another was associated with plasma FSH concentration (related to FI) and contained the SNP MARC0031325. Finally, some positional candidate genes for PU and FI were identified because of their roles in prenatal skeletal muscle development, fetal energy substrate, pre-implantation, and the expression of mammary gland epithelium. Identification of novel variants and candidate genes will greatly advance our understanding of the genetic mechanisms of PU and FI, and suggest a specific opportunity for improving marker assisted selection or genomic selection in pigs. PMID:29234349

Genetic basis of HDL variation in 129/SvImJ and C57BL/6J mice: importance of testing candidate genes in targeted mutant mice*s⃞

PubMed Central

Su, Zhiguang; Wang, Xiaosong; Tsaih, Shirng-Wern; Zhang, Aihong; Cox, Allison; Sheehan, Susan; Paigen, Beverly

2009-01-01

To evaluate the effect of genetic background on high-density lipoprotein cholesterol (HDL) levels in Soat1−/− mice, we backcrossed sterol O-acyltransferase 1 (Soat1)−/− mice, originally reported to have elevated HDL levels, to C57BL/6 mice and constructed a congenic strain with only a small region (3.3Mb) of 129 alleles, specifically excluding the nearby apolipoprotein A-II (Apoa2) gene from 129. HDL levels in these Soat1−/− mice were no different from C57BL/6, indicating that the passenger gene Apoa2 caused the previously reported elevation of HDL in these Soat1−/− mice. Because many knockouts are made in strain 129 and then subsequently backcrossed into C57BL/6, it is important to identify quantitative trait loci (QTL) that differ between 129 and C57BL/6 so that one can guard against effects ascribed to a knockout but really caused by a passenger gene from 129. To provide such data, we generated 528 F2 progeny from an intercross of 129S1/SvImJ and C57BL/6 and measured HDL concentrations in F2 animals first fed chow and then atherogenic diet. A genome wide scan using 508 single-nucleotide polymorphisms (SNPs) identified 19 QTL, 2 of which were male specific and 2 were female specific. Using comparative genomics and haplotype analysis, we narrowed QTL on chromosomes 3, 5, 8, 17, and 18 to 0.5, 6.3, 2.6, 1.1, and 0.6 Mb, respectively. These data will serve as a reference for any effort to test the impact of candidate genes on HDL using a knockout strategy. PMID:18772481

A comparative analysis of genetic diversity of candidate genes associated with type 2 diabetes in worldwide populations.

PubMed

Gong, Xian; Zhang, Chao; Yiliyasi·Aisa, Yiliyasi·Aisa; Shi, Ying; Yang, Xue-wei; NuersimanguliAosiman, NuersimanguliAosiman; Guan, Ya-qun; Xu, Shu-hua

2016-06-20

Over the last decade, a larger number of type 2 diabetes mellitus (T2DM) susceptible candidate genes have been reported by numerous genome-wide association studies (GWAS). Understanding the genetic diversity of these candidate genes among worldwide populations not only facilitates to elucidating the genetic mechanism of T2DM, but also provides guidance to further studies of pathogenesis of T2DM in any certain population. In this study, we identified 170 genes or genomic regions associated with T2DM by searching the GWAS databases and related literatures. We next analyzed the genetic diversity of these genes (or genomic regions) among present-day human populations by curetting the 1000 Genomes Projects phase1 dataset covering 14 worldwide populations. We further compared the characteristics of T2DM genes in different populations. No significant differences of genetic diversity were observed among the 14 worldwide populations between the T2DM candidate genes and the non-T2DM genes in terms of overall pattern. However, we observed some genes, such as IL20RA, RNMTL1-NXN, NOTCH2, ADRA2A-BTBD7P2, TBC1D4, RBM38-HMGB1P1, UBE2E2, and PPARD, show considerable differentiation between populations. In particular, IL20RA (FST=0.1521) displays the greatest population difference which is mainly contributed by that between Africans and non-Africans. Moreover, we revealed genetic differences between East Asians and Europeans on some candidate genes such as DGKB-AGMO (FST=0.173) and JAZF1 (FST=0.182). Our results indicate that some T2DM susceptible candidate genes harbor highly-differentiated variants between populations. These analyses, despite preliminary, should advance our understanding of the population difference of susceptibility to T2DM and provide insightful reference that future studies can relay on.

Identification of Immunity Related Genes to Study the Physalis peruviana – Fusarium oxysporum Pathosystem

PubMed Central

Enciso-Rodríguez, Felix E.; González, Carolina; Rodríguez, Edwin A.; López, Camilo E.; Landsman, David; Barrero, Luz Stella; Mariño-Ramírez, Leonardo

2013-01-01

The Cape gooseberry ( Physalis peruviana L) is an Andean exotic fruit with high nutritional value and appealing medicinal properties. However, its cultivation faces important phytosanitary problems mainly due to pathogens like Fusarium oxysporum, Cercosporaphysalidis and Alternaria spp. Here we used the Cape gooseberry foliar transcriptome to search for proteins that encode conserved domains related to plant immunity including: NBS (Nucleotide Binding Site), CC (Coiled-Coil), TIR (Toll/Interleukin-1 Receptor). We identified 74 immunity related gene candidates in P . peruviana which have the typical resistance gene (R-gene) architecture, 17 Receptor like kinase (RLKs) candidates related to PAMP-Triggered Immunity (PTI), eight (TIR-NBS-LRR, or TNL) and nine (CC–NBS-LRR, or CNL) candidates related to Effector-Triggered Immunity (ETI) genes among others. These candidate genes were categorized by molecular function (98%), biological process (85%) and cellular component (79%) using gene ontology. Some of the most interesting predicted roles were those associated with binding and transferase activity. We designed 94 primers pairs from the 74 immunity-related genes (IRGs) to amplify the corresponding genomic regions on six genotypes that included resistant and susceptible materials. From these, we selected 17 single band amplicons and sequenced them in 14 F. oxysporum resistant and susceptible genotypes. Sequence polymorphisms were analyzed through preliminary candidate gene association, which allowed the detection of one SNP at the PpIRG-63 marker revealing a nonsynonymous mutation in the predicted LRR domain suggesting functional roles for resistance. PMID:23844210

Identification of immunity related genes to study the Physalis peruviana--Fusarium oxysporum pathosystem.

PubMed

Enciso-Rodríguez, Felix E; González, Carolina; Rodríguez, Edwin A; López, Camilo E; Landsman, David; Barrero, Luz Stella; Mariño-Ramírez, Leonardo

2013-01-01

The Cape gooseberry (Physalisperuviana L) is an Andean exotic fruit with high nutritional value and appealing medicinal properties. However, its cultivation faces important phytosanitary problems mainly due to pathogens like Fusarium oxysporum, Cercosporaphysalidis and Alternaria spp. Here we used the Cape gooseberry foliar transcriptome to search for proteins that encode conserved domains related to plant immunity including: NBS (Nucleotide Binding Site), CC (Coiled-Coil), TIR (Toll/Interleukin-1 Receptor). We identified 74 immunity related gene candidates in P. peruviana which have the typical resistance gene (R-gene) architecture, 17 Receptor like kinase (RLKs) candidates related to PAMP-Triggered Immunity (PTI), eight (TIR-NBS-LRR, or TNL) and nine (CC-NBS-LRR, or CNL) candidates related to Effector-Triggered Immunity (ETI) genes among others. These candidate genes were categorized by molecular function (98%), biological process (85%) and cellular component (79%) using gene ontology. Some of the most interesting predicted roles were those associated with binding and transferase activity. We designed 94 primers pairs from the 74 immunity-related genes (IRGs) to amplify the corresponding genomic regions on six genotypes that included resistant and susceptible materials. From these, we selected 17 single band amplicons and sequenced them in 14 F. oxysporum resistant and susceptible genotypes. Sequence polymorphisms were analyzed through preliminary candidate gene association, which allowed the detection of one SNP at the PpIRG-63 marker revealing a nonsynonymous mutation in the predicted LRR domain suggesting functional roles for resistance.

Akirins in sea lice: first steps towards a deeper understanding.

PubMed

Carpio, Yamila; García, Claudia; Pons, Tirso; Haussmann, Denise; Rodríguez-Ramos, Tania; Basabe, Liliana; Acosta, Jannel; Estrada, Mario Pablo

2013-10-01

Sea lice (Copepoda, Caligidae) are the most widely distributed marine pathogens in the salmon industry. Vaccination could be an environmentally friendly alternative for sea lice control; however, research on the development of such vaccines is still at an early stage of development. Recent results have suggested that subolesin/akirin/my32 are good candidate antigens for the control of arthropod infestations, including sea lice, but background knowledge about these genes in crustaceans is limited. Herein, we characterize the my32 gene/protein from two important sea lice species, Caligus rogercresseyi and Lepeophtheirus salmonis, based on cDNA sequence isolation, phylogenetic relationships, three dimensional structure prediction and expression analysis. The results show that these genes/proteins have the main characteristics of akirins from invertebrates. In addition, immunization with purified recombinant my32 from L. salmonis elicited a specific antibody response in mice and fish. These results provide an improvement to our current knowledge about my32 proteins and their potential use as vaccine candidates against sea lice in fish. Copyright © 2013 Elsevier Inc. All rights reserved.

Two Novel Determinants of Etoposide Resistance in Small Cell Lung Cancer

PubMed Central

Lawson, Malcolm H; Cummings, Natalie M; Rassl, Doris M; Russell, Roslin; Brenton, James D; Rintoul, Robert C; Murphy, Gillian

2011-01-01

Patient survival in small cell lung cancer (SCLC) is limited by acquired chemoresistance. Here we report the use of a biologically relevant model to identify novel candidate genes mediating in vivo acquired resistance to etoposide. Candidate genes derived from a cDNA microarray analysis were cloned and transiently overexpressed to evaluate their potential functional roles. We identified two promising genes in the DNA repair enzyme DNA Polymerase β and in the neuroendocrine transcription factor NKX2.2. Specific inhibition of DNA Polymerase β reduced the numbers of cells surviving treatment with etoposide and increased the amount of DNA damage in cells. Conversely, stable overexpression of NKX2.2 increased cell survival in response to etoposide in SCLC cell lines. Consistent with these findings, we found that an absence of nuclear staining for NKX2.2 in SCLC primary tumors was an independent predictor of improved outcomes in chemotherapy-treated patients. Taken together, our findings justify future prospective studies to confirm the roles of these molecules in mediating chemotherapy resistance in SCLC. PMID:21642373

The Identification of Two Arabinosyltransferases from Tomato Reveals Functional Equivalency of Xyloglucan Side Chain Substituents1[W][OPEN

PubMed Central

Schultink, Alex; Cheng, Kun; Park, Yong Bum; Cosgrove, Daniel J.; Pauly, Markus

2013-01-01

Xyloglucan (XyG) is the dominant hemicellulose present in the primary cell walls of dicotyledonous plants. Unlike Arabidopsis (Arabidopsis thaliana) XyG, which contains galactosyl and fucosyl substituents, tomato (Solanum lycopersicum) XyG contains arabinofuranosyl residues. To investigate the biological function of these differing substituents, we used a functional complementation approach. Candidate glycosyltransferases were identified from tomato by using comparative genomics with known XyG galactosyltransferase genes from Arabidopsis. These candidate genes were expressed in an Arabidopsis mutant lacking XyG galactosylation, and two of them resulted in the production of arabinosylated XyG, a structure not previously found in this plant species. These genes may therefore encode XyG arabinofuranosyltransferases. Moreover, the addition of arabinofuranosyl residues to the XyG of this Arabidopsis mutant rescued a growth and cell wall biomechanics phenotype, demonstrating that the function of XyG in plant growth, development, and mechanics has considerable flexibility in terms of the specific residues in the side chains. These experiments also highlight the potential of reengineering the sugar substituents on plant wall polysaccharides without compromising growth or viability. PMID:23893172

Next-generation sequencing for identification of candidate genes for Fusarium wilt and sterility mosaic disease in pigeonpea (Cajanus cajan).

PubMed

Singh, Vikas K; Khan, Aamir W; Saxena, Rachit K; Kumar, Vinay; Kale, Sandip M; Sinha, Pallavi; Chitikineni, Annapurna; Pazhamala, Lekha T; Garg, Vanika; Sharma, Mamta; Sameer Kumar, Chanda Venkata; Parupalli, Swathi; Vechalapu, Suryanarayana; Patil, Suyash; Muniswamy, Sonnappa; Ghanta, Anuradha; Yamini, Kalinati Narasimhan; Dharmaraj, Pallavi Subbanna; Varshney, Rajeev K

2016-05-01

To map resistance genes for Fusarium wilt (FW) and sterility mosaic disease (SMD) in pigeonpea, sequencing-based bulked segregant analysis (Seq-BSA) was used. Resistant (R) and susceptible (S) bulks from the extreme recombinant inbred lines of ICPL 20096 × ICPL 332 were sequenced. Subsequently, SNP index was calculated between R- and S-bulks with the help of draft genome sequence and reference-guided assembly of ICPL 20096 (resistant parent). Seq-BSA has provided seven candidate SNPs for FW and SMD resistance in pigeonpea. In parallel, four additional genotypes were re-sequenced and their combined analysis with R- and S-bulks has provided a total of 8362 nonsynonymous (ns) SNPs. Of 8362 nsSNPs, 60 were found within the 2-Mb flanking regions of seven candidate SNPs identified through Seq-BSA. Haplotype analysis narrowed down to eight nsSNPs in seven genes. These eight nsSNPs were further validated by re-sequencing 11 genotypes that are resistant and susceptible to FW and SMD. This analysis revealed association of four candidate nsSNPs in four genes with FW resistance and four candidate nsSNPs in three genes with SMD resistance. Further, In silico protein analysis and expression profiling identified two most promising candidate genes namely C.cajan_01839 for SMD resistance and C.cajan_03203 for FW resistance. Identified candidate genomic regions/SNPs will be useful for genomics-assisted breeding in pigeonpea. © 2015 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

A Novel Strategy for Selection and Validation of Reference Genes in Dynamic Multidimensional Experimental Design in Yeast

PubMed Central

Cankorur-Cetinkaya, Ayca; Dereli, Elif; Eraslan, Serpil; Karabekmez, Erkan; Dikicioglu, Duygu; Kirdar, Betul

2012-01-01

Background Understanding the dynamic mechanism behind the transcriptional organization of genes in response to varying environmental conditions requires time-dependent data. The dynamic transcriptional response obtained by real-time RT-qPCR experiments could only be correctly interpreted if suitable reference genes are used in the analysis. The lack of available studies on the identification of candidate reference genes in dynamic gene expression studies necessitates the identification and the verification of a suitable gene set for the analysis of transient gene expression response. Principal Findings In this study, a candidate reference gene set for RT-qPCR analysis of dynamic transcriptional changes in Saccharomyces cerevisiae was determined using 31 different publicly available time series transcriptome datasets. Ten of the twelve candidates (TPI1, FBA1, CCW12, CDC19, ADH1, PGK1, GCN4, PDC1, RPS26A and ARF1) we identified were not previously reported as potential reference genes. Our method also identified the commonly used reference genes ACT1 and TDH3. The most stable reference genes from this pool were determined as TPI1, FBA1, CDC19 and ACT1 in response to a perturbation in the amount of available glucose and as FBA1, TDH3, CCW12 and ACT1 in response to a perturbation in the amount of available ammonium. The use of these newly proposed gene sets outperformed the use of common reference genes in the determination of dynamic transcriptional response of the target genes, HAP4 and MEP2, in response to relaxation from glucose and ammonium limitations, respectively. Conclusions A candidate reference gene set to be used in dynamic real-time RT-qPCR expression profiling in yeast was proposed for the first time in the present study. Suitable pools of stable reference genes to be used under different experimental conditions could be selected from this candidate set in order to successfully determine the expression profiles for the genes of interest. PMID:22675547

Discovery of genomic intervals that underlie nematode responses to benzimidazoles.

PubMed

Zamanian, Mostafa; Cook, Daniel E; Zdraljevic, Stefan; Brady, Shannon C; Lee, Daehan; Lee, Junho; Andersen, Erik C

2018-03-01

Parasitic nematodes impose a debilitating health and economic burden across much of the world. Nematode resistance to anthelmintic drugs threatens parasite control efforts in both human and veterinary medicine. Despite this threat, the genetic landscape of potential resistance mechanisms to these critical drugs remains largely unexplored. Here, we exploit natural variation in the model nematodes Caenorhabditis elegans and Caenorhabditis briggsae to discover quantitative trait loci (QTL) that control sensitivity to benzimidazoles widely used in human and animal medicine. High-throughput phenotyping of albendazole, fenbendazole, mebendazole, and thiabendazole responses in panels of recombinant lines led to the discovery of over 15 QTL in C. elegans and four QTL in C. briggsae associated with divergent responses to these anthelmintics. Many of these QTL are conserved across benzimidazole derivatives, but others show drug and dose specificity. We used near-isogenic lines to recapitulate and narrow the C. elegans albendazole QTL of largest effect and identified candidate variants correlated with the resistance phenotype. These QTL do not overlap with known benzimidazole target resistance genes from parasitic nematodes and present specific new leads for the discovery of novel mechanisms of nematode benzimidazole resistance. Analyses of orthologous genes reveal conservation of candidate benzimidazole resistance genes in medically important parasitic nematodes. These data provide a basis for extending these approaches to other anthelmintic drug classes and a pathway towards validating new markers for anthelmintic resistance that can be deployed to improve parasite disease control.