Oligo/Polynucleotide-Based Gene Modification: Strategies and Therapeutic Potential

PubMed Central

Sargent, R. Geoffrey; Kim, Soya

2011-01-01

Oligonucleotide- and polynucleotide-based gene modification strategies were developed as an alternative to transgene-based and classical gene targeting-based gene therapy approaches for treatment of genetic disorders. Unlike the transgene-based strategies, oligo/polynucleotide gene targeting approaches maintain gene integrity and the relationship between the protein coding and gene-specific regulatory sequences. Oligo/polynucleotide-based gene modification also has several advantages over classical vector-based homologous recombination approaches. These include essentially complete homology to the target sequence and the potential to rapidly engineer patient-specific oligo/polynucleotide gene modification reagents. Several oligo/polynucleotide-based approaches have been shown to successfully mediate sequence-specific modification of genomic DNA in mammalian cells. The strategies involve the use of polynucleotide small DNA fragments, triplex-forming oligonucleotides, and single-stranded oligodeoxynucleotides to mediate homologous exchange. The primary focus of this review will be on the mechanistic aspects of the small fragment homologous replacement, triplex-forming oligonucleotide-mediated, and single-stranded oligodeoxynucleotide-mediated gene modification strategies as it relates to their therapeutic potential. PMID:21417933

Cloning, sequencing and characterization of lipase genes from a polyhydroxyalkanoate- (PHA-) synthesizing Pseudomonas resinovorans

USDA-ARS?s Scientific Manuscript database

Lipase (lip) and lipase-specific foldase (lif) genes of a biodegradable polyhydroxyalkanoate- (PHA-) synthesizing Pseudomonas resinovorans NRRL B-2649 were cloned using primers based on consensus sequences, followed by PCR-based genome walking. Sequence analyses showed a putative Lip gene-product (...

Adenovirus EIIA early promoter: transcriptional control elements and induction by the viral pre-early EIA gene, which appears to be sequence independent.

PubMed Central

Murthy, S C; Bhat, G P; Thimmappaya, B

1985-01-01

A molecular dissection of the adenovirus EIIA early (E) promoter was undertaken to study the sequence elements required for transcription and to examine the nucleotide sequences, if any, specific for its trans-activation by the viral pre-early EIA gene product. A chimeric gene in which the EIIA-E promoter region fused to the coding sequences of the bacterial chloramphenicol acetyltransferase (CAT) gene was used in transient assays to identify the transcriptional control regions. Deletion mapping studies revealed that the upstream DNA sequences up to -86 were sufficient for the optimal basal level transcription in HeLa cells and also for the EIA-induced transcription. A series of linker-scanning (LS) mutants were constructed to precisely identify the nucleotide sequences that control transcription. Analysis of these LS mutants allowed us to identify two regions of the promoter that are critical for the EIIA-E transcription. These regions are located between -29 and -21 (region I) and between -82 and -66 (region II). Mutations in region I affected initiation and appeared functionally similar to the "TATA" sequence of the commonly studied promoters. To examine whether or not the EIIA-E promoter contained DNA sequences specific for the trans-activation by the EIA, the LS mutants were analyzed in a cotransfection assay containing a plasmid carrying the EIA gene. CAT activity of all of the LS mutants was induced by the EIA gene in this assay, suggesting that the induction of transcription of the EIIA-E promoter by the EIA gene is not sequence-specific. Images PMID:3857577

Development of sequence-specific antimicrobials based on programmable CRISPR-Cas nucleases

PubMed Central

Bikard, David; Euler, Chad; Jiang, Wenyan; Nussenzweig, Philip M.; Goldberg, Gregory W.; Duportet, Xavier; Fischetti, Vincent A.; Marraffini, Luciano A.

2014-01-01

Antibiotics target conserved bacterial cellular pathways or growth functions and therefore cannot selectively kill specific members of a complex microbial population. Here, we develop programmable, sequence-specific antimicrobials using the RNA-guided nuclease Cas91, 2 delivered by a bacteriophage. We show that Cas9 re-programmed to target virulence genes kills virulent, but not avirulent, Staphylococcus aureus. Re-programming the nuclease to target antibiotic resistance genes destroys staphylococcal plasmids that harbor antibiotic resistance genes3, 4 and immunizes avirulent staphylococci to prevent the spread of plasmid-borne resistance genes. We also demonstrate the approach in vivo, showing its efficacy against S. aureus in a mouse skin colonization model. This new technology creates opportunities to manipulate complex bacterial populations in a sequence-specific manner. PMID:25282355

A regulatory sequence from the retinoid X receptor γ gene directs expression to horizontal cells and photoreceptors in the embryonic chicken retina.

PubMed

Blixt, Maria K E; Hallböök, Finn

2016-01-01

Combining techniques of episomal vector gene-specific Cre expression and genomic integration using the piggyBac transposon system enables studies of gene expression-specific cell lineage tracing in the chicken retina. In this work, we aimed to target the retinal horizontal cell progenitors. A 208 bp gene regulatory sequence from the chicken retinoid X receptor γ gene (RXRγ208) was used to drive Cre expression. RXRγ is expressed in progenitors and photoreceptors during development. The vector was combined with a piggyBac "donor" vector containing a floxed STOP sequence followed by enhanced green fluorescent protein (EGFP), as well as a piggyBac helper vector for efficient integration into the host cell genome. The vectors were introduced into the embryonic chicken retina with in ovo electroporation. Tissue electroporation targets specific developmental time points and in specific structures. Cells that drove Cre expression from the regulatory RXRγ208 sequence excised the floxed STOP-sequence and expressed GFP. The approach generated a stable lineage with robust expression of GFP in retinal cells that have activated transcription from the RXRγ208 sequence. Furthermore, GFP was expressed in cells that express horizontal or photoreceptor markers when electroporation was performed between developmental stages 22 and 28. Electroporation of a stage 12 optic cup gave multiple cell types in accordance with RXRγ gene expression in the early retina. In this study, we describe an easy, cost-effective, and time-efficient method for testing regulatory sequences in general. More specifically, our results open up the possibility for further studies of the RXRγ-gene regulatory network governing the formation of photoreceptor and horizontal cells. In addition, the method presents approaches to target the expression of effector genes, such as regulators of cell fate or cell cycle progression, to these cells and their progenitor.

[Development of specific and degenerated primers to CesA genes encoding flax (Linum usitatissimum L.) cellulose synthase].

PubMed

Grushetskaia, Z E; Lemesh, V A; Khotyleva, L V

2010-01-01

Cellulose synthase catalytic subunit genes, CesA, have been discovered in several higher plant species, and it has been shown that the CesA gene family has multiple members. HVR2 fragment of these genes determine the class specificity of the CESA protein and its participation in the primary or secondary cell wall synthesis. The aim of this study was development of specific and degenerated primers to flax CesA gene fragments leading to obtaining the class specific HVR2 region of the gene. Two pairs of specific primers to the certain fragments of CesA-1 and CesA-6 genes and one pair of degenerated primers to HVR2 region of all flax CesA genes were developed basing on comparison of six CesA EST sequences of flax and full cDNA sequences of Arabidopsis, poplar, maize and cotton plants, obtained from GenBank. After amplification of flax cDNA, the bands of expected size were detected (201 and 300 b.p. for the CesA-1 and CesA-6, and 600 b.p. for the HVR2 region of CesA respectively). The developed markers can be used for cloning and sequencing of flax CesA genes, identifying their number in flax genome, tissue and stage specificity.

Complete cDNA sequence and amino acid analysis of a bovine ribonuclease K6 gene.

PubMed

Pietrowski, D; Förster, M

2000-01-01

The complete cDNA sequence of a ribonuclease k6 gene of Bos Taurus has been determined. It codes for a protein with 154 amino acids and contains the invariant cysteine, histidine and lysine residues as well as the characteristic motifs specific to ribonuclease active sites. The deduced protein sequence is 27 residues longer than other known ribonucleases k6 and shows amino acids exchanges which could reflect a strain specificity or polymorphism within the bovine genome. Based on sequence similarity we have termed the identified gene bovine ribonuclease k6 b (brk6b).

Enrichment of individual KIR2DL4 sequences from genomic DNA using long-template PCR and allele-specific hybridization to magnetic bead-bound oligonucleotide probes.

PubMed

Roberts, C H; Turino, C; Madrigal, J A; Marsh, S G E

2007-06-01

DNA enrichment by allele-specific hybridization (DEASH) was used as a means to isolate individual alleles of the killer cell immunoglobulin-like receptor (KIR2DL4) gene from heterozygous genomic DNA. Using long-template polymerase chain reaction (LT-PCR), the complete KIR2DL4 gene was amplified from a cell line that had previously been characterized for its KIR gene content by PCR using sequence-specific primers (PCR-SSP). The whole gene amplicons were sequenced and we identified two heterozygous positions in accordance with the predictions of the PCR-SSP. The amplicons were then hybridized to allele-specific, biotinylated oligonucleotide probes and through binding to streptavidin-coated beads, the targeted alleles were enriched. A second PCR amplified only the exonic regions of the enriched allele, and these were then sequenced in full. We show DEASH to be capable of enriching single alleles from a heterozygous PCR product, and through sequencing the enriched DNA, we are able to produce complete coding sequences of the KIR2DL4 alleles in accordance with the typing predicted by PCR-SSP.

HuMiChip: Development of a Functional Gene Array for the Study of Human Microbiomes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tu, Q.; Deng, Ye; Lin, Lu

Microbiomes play very important roles in terms of nutrition, health and disease by interacting with their hosts. Based on sequence data currently available in public domains, we have developed a functional gene array to monitor both organismal and functional gene profiles of normal microbiota in human and mouse hosts, and such an array is called human and mouse microbiota array, HMM-Chip. First, seed sequences were identified from KEGG databases, and used to construct a seed database (seedDB) containing 136 gene families in 19 metabolic pathways closely related to human and mouse microbiomes. Second, a mother database (motherDB) was constructed withmore » 81 genomes of bacterial strains with 54 from gut and 27 from oral environments, and 16 metagenomes, and used for selection of genes and probe design. Gene prediction was performed by Glimmer3 for bacterial genomes, and by the Metagene program for metagenomes. In total, 228,240 and 801,599 genes were identified for bacterial genomes and metagenomes, respectively. Then the motherDB was searched against the seedDB using the HMMer program, and gene sequences in the motherDB that were highly homologous with seed sequences in the seedDB were used for probe design by the CommOligo software. Different degrees of specific probes, including gene-specific, inclusive and exclusive group-specific probes were selected. All candidate probes were checked against the motherDB and NCBI databases for specificity. Finally, 7,763 probes covering 91.2percent (12,601 out of 13,814) HMMer confirmed sequences from 75 bacterial genomes and 16 metagenomes were selected. This developed HMM-Chip is able to detect the diversity and abundance of functional genes, the gene expression of microbial communities, and potentially, the interactions of microorganisms and their hosts.« less

Identification, characterization and expression analysis of lineage-specific genes within sweet orange (Citrus sinensis).

PubMed

Xu, Yuantao; Wu, Guizhi; Hao, Baohai; Chen, Lingling; Deng, Xiuxin; Xu, Qiang

2015-11-23

With the availability of rapidly increasing number of genome and transcriptome sequences, lineage-specific genes (LSGs) can be identified and characterized. Like other conserved functional genes, LSGs play important roles in biological evolution and functions. Two set of citrus LSGs, 296 citrus-specific genes (CSGs) and 1039 orphan genes specific to sweet orange, were identified by comparative analysis between the sweet orange genome sequences and 41 genomes and 273 transcriptomes. With the two sets of genes, gene structure and gene expression pattern were investigated. On average, both the CSGs and orphan genes have fewer exons, shorter gene length and higher GC content when compared with those evolutionarily conserved genes (ECs). Expression profiling indicated that most of the LSGs expressed in various tissues of sweet orange and some of them exhibited distinct temporal and spatial expression patterns. Particularly, the orphan genes were preferentially expressed in callus, which is an important pluripotent tissue of citrus. Besides, part of the CSGs and orphan genes expressed responsive to abiotic stress, indicating their potential functions during interaction with environment. This study identified and characterized two sets of LSGs in citrus, dissected their sequence features and expression patterns, and provided valuable clues for future functional analysis of the LSGs in sweet orange.

Selection of a DNA barcode for Nectriaceae from fungal whole-genomes.

PubMed

Zeng, Zhaoqing; Zhao, Peng; Luo, Jing; Zhuang, Wenying; Yu, Zhihe

2012-01-01

A DNA barcode is a short segment of sequence that is able to distinguish species. A barcode must ideally contain enough variation to distinguish every individual species and be easily obtained. Fungi of Nectriaceae are economically important and show high species diversity. To establish a standard DNA barcode for this group of fungi, the genomes of Neurospora crassa and 30 other filamentous fungi were compared. The expect value was treated as a criterion to recognize homologous sequences. Four candidate markers, Hsp90, AAC, CDC48, and EF3, were tested for their feasibility as barcodes in the identification of 34 well-established species belonging to 13 genera of Nectriaceae. Two hundred and fifteen sequences were analyzed. Intra- and inter-specific variations and the success rate of PCR amplification and sequencing were considered as important criteria for estimation of the candidate markers. Ultimately, the partial EF3 gene met the requirements for a good DNA barcode: No overlap was found between the intra- and inter-specific pairwise distances. The smallest inter-specific distance of EF3 gene was 3.19%, while the largest intra-specific distance was 1.79%. In addition, there was a high success rate in PCR and sequencing for this gene (96.3%). CDC48 showed sufficiently high sequence variation among species, but the PCR and sequencing success rate was 84% using a single pair of primers. Although the Hsp90 and AAC genes had higher PCR and sequencing success rates (96.3% and 97.5%, respectively), overlapping occurred between the intra- and inter-specific variations, which could lead to misidentification. Therefore, we propose the EF3 gene as a possible DNA barcode for the nectriaceous fungi.

Exome sequencing and arrayCGH detection of gene sequence and copy number variation between ILS and ISS mouse strains.

PubMed

Dumas, Laura; Dickens, C Michael; Anderson, Nathan; Davis, Jonathan; Bennett, Beth; Radcliffe, Richard A; Sikela, James M

2014-06-01

It has been well documented that genetic factors can influence predisposition to develop alcoholism. While the underlying genomic changes may be of several types, two of the most common and disease associated are copy number variations (CNVs) and sequence alterations of protein coding regions. The goal of this study was to identify CNVs and single-nucleotide polymorphisms that occur in gene coding regions that may play a role in influencing the risk of an individual developing alcoholism. Toward this end, two mouse strains were used that have been selectively bred based on their differential sensitivity to alcohol: the Inbred long sleep (ILS) and Inbred short sleep (ISS) mouse strains. Differences in initial response to alcohol have been linked to risk for alcoholism, and the ILS/ISS strains are used to investigate the genetics of initial sensitivity to alcohol. Array comparative genomic hybridization (arrayCGH) and exome sequencing were conducted to identify CNVs and gene coding sequence differences, respectively, between ILS and ISS mice. Mouse arrayCGH was performed using catalog Agilent 1 × 244 k mouse arrays. Subsequently, exome sequencing was carried out using an Illumina HiSeq 2000 instrument. ArrayCGH detected 74 CNVs that were strain-specific (38 ILS/36 ISS), including several ISS-specific deletions that contained genes implicated in brain function and neurotransmitter release. Among several interesting coding variations detected by exome sequencing was the gain of a premature stop codon in the alpha-amylase 2B (AMY2B) gene specifically in the ILS strain. In total, exome sequencing detected 2,597 and 1,768 strain-specific exonic gene variants in the ILS and ISS mice, respectively. This study represents the most comprehensive and detailed genomic comparison of ILS and ISS mouse strains to date. The two complementary genome-wide approaches identified strain-specific CNVs and gene coding sequence variations that should provide strong candidates to contribute to the alcohol-related phenotypic differences associated with these strains.

Quantitative statistical analysis of cis-regulatory sequences in ABA/VP1- and CBF/DREB1-regulated genes of Arabidopsis.

PubMed

Suzuki, Masaharu; Ketterling, Matthew G; McCarty, Donald R

2005-09-01

We have developed a simple quantitative computational approach for objective analysis of cis-regulatory sequences in promoters of coregulated genes. The program, designated MotifFinder, identifies oligo sequences that are overrepresented in promoters of coregulated genes. We used this approach to analyze promoter sequences of Viviparous1 (VP1)/abscisic acid (ABA)-regulated genes and cold-regulated genes, respectively, of Arabidopsis (Arabidopsis thaliana). We detected significantly enriched sequences in up-regulated genes but not in down-regulated genes. This result suggests that gene activation but not repression is mediated by specific and common sequence elements in promoters. The enriched motifs include several known cis-regulatory sequences as well as previously unidentified motifs. With respect to known cis-elements, we dissected the flanking nucleotides of the core sequences of Sph element, ABA response elements (ABREs), and the C repeat/dehydration-responsive element. This analysis identified the motif variants that may correlate with qualitative and quantitative differences in gene expression. While both VP1 and cold responses are mediated in part by ABA signaling via ABREs, these responses correlate with unique ABRE variants distinguished by nucleotides flanking the ACGT core. ABRE and Sph motifs are tightly associated uniquely in the coregulated set of genes showing a strict dependence on VP1 and ABA signaling. Finally, analysis of distribution of the enriched sequences revealed a striking concentration of enriched motifs in a proximal 200-base region of VP1/ABA and cold-regulated promoters. Overall, each class of coregulated genes possesses a discrete set of the enriched motifs with unique distributions in their promoters that may account for the specificity of gene regulation.

Definition of Cis-Acting Elements Regulating Expression of the Drosophila Melanogaster Ninae Opsin Gene by Oligonucleotide-Directed Mutagenesis

PubMed Central

Mismer, D.; Rubin, G. M.

1989-01-01

We have analyzed the cis-acting regulatory sequences of the Rh1 (ninaE) gene in Drosophila melanogaster by P-element-mediated germline transformation of indicator genes transcribed from mutant ninaE promoter sequences. We have previously shown that a 200-bp region extending from -120 to +67 relative to the transcription start site is sufficient to obtain eye-specific expression from the ninaE promoter. In the present study, 22 different 4-13-bp sequences in the -120/+67 promoter region were altered by oligonucleotide-directed mutagenesis. Several of these sequences were found to be required for proper promoter function; two of these are conserved in the promoter of the homologous gene isolated from the related species Drosophila virilis. Alteration of a conserved 9-bp sequence results in aberrant, low level expression in the body. Alteration of a separate 11-bp sequence, found in the promoter regions of several photoreceptor-specific genes of Drosophila, results in an approximately 15-fold reduction in promoter efficiency but without apparent alteration of tissue-specificity. A protein factor capable of interacting with this 11-bp sequence has been detected by DNaseI footprinting in embryonic nuclear extracts. Finally, we have further characterized two separable enhancer sequences previously shown to be required for normal levels of expression from this promoter. PMID:2521839

Occurrence of diverse alkane hydroxylase alkB genes in indigenous oil-degrading bacteria of Baltic Sea surface water.

PubMed

Viggor, Signe; Jõesaar, Merike; Vedler, Eve; Kiiker, Riinu; Pärnpuu, Liis; Heinaru, Ain

2015-12-30

Formation of specific oil degrading bacterial communities in diesel fuel, crude oil, heptane and hexadecane supplemented microcosms of the Baltic Sea surface water samples was revealed. The 475 sequences from constructed alkane hydroxylase alkB gene clone libraries were grouped into 30 OPFs. The two largest groups were most similar to Pedobacter sp. (245 from 475) and Limnobacter sp. (112 from 475) alkB gene sequences. From 56 alkane-degrading bacterial strains 41 belonged to the Pseudomonas spp. and 8 to the Rhodococcus spp. having redundant alkB genes. Together 68 alkB gene sequences were identified. These genes grouped into 20 OPFs, half of them being specific only to the isolated strains. Altogether 543 diverse alkB genes were characterized in the brackish Baltic Sea water; some of them representing novel lineages having very low sequence identities with corresponding genes of the reference strains. Copyright © 2015 Elsevier Ltd. All rights reserved.

Ubiquitous and gene-specific regulatory 5' sequences in a sea urchin histone DNA clone coding for histone protein variants.

PubMed Central

Busslinger, M; Portmann, R; Irminger, J C; Birnstiel, M L

1980-01-01

The DNA sequences of the entire structural H4, H3, H2A and H2B genes and of their 5' flanking regions have been determined in the histone DNA clone h19 of the sea urchin Psammechinus miliaris. In clone h19 the polarity of transcription and the relative arrangement of the histone genes is identical to that in clone h22 of the same species. The histone proteins encoded by h19 DNA differ in their primary structure from those encoded by clone h22 and have been compared to histone protein sequences of other sea urchin species as well as other eukaryotes. A comparative analysis of the 5' flanking DNA sequences of the structural histone genes in both clones revealed four ubiquitous sequence motifs; a pentameric element GATCC, followed at short distance by the Hogness box GTATAAATAG, a conserved sequence PyCATTCPu, in or near which the 5' ends of the mRNAs map in h22 DNA and lastly a sequence A, containing the initiation codon. These sequences are also found, sometimes in modified version, in front of other eukaryotic genes transcribed by polymerase II. When prelude sequences of isocoding histone genes in clone h19 and h22 are compared areas of homology are seen to extend beyond the ubiquitous sequence motifs towards the divergent AT-rich spacer and terminate between approximately 140 and 240 nucleotides away from the structural gene. These prelude regions contain quite large conservative sequence blocks which are specific for each type of histone genes. Images PMID:7443547

Properties of a U1 RNA enhancer-like sequence.

PubMed Central

Ciliberto, G; Palla, F; Tebb, G; Mattaj, I W; Philipson, L

1987-01-01

The properties of a X.laevis U1B snRNA gene enhancer have been studied by microinjection in Xenopus oocytes. The enhancer-like sequence, defined as a short DNA stretch that is able to activate transcription in an orientation independent manner, is interchangeable between different U snRNA genes. The enhancer sequence alone does not, however, efficiently activate transcription from an SV40 pol II promoter but regains its activity when combined with the U-gene specific proximal sequence element. DNase I protection experiments show that the X.laevis U1B enhancer can interact specifically with a nuclear factor present in mammalian cells. Images PMID:3031597

IDP-ASE: haplotyping and quantifying allele-specific expression at the gene and gene isoform level by hybrid sequencing

PubMed Central

Deonovic, Benjamin; Wang, Yunhao; Weirather, Jason; Wang, Xiu-Jie; Au, Kin Fai

2017-01-01

Abstract Allele-specific expression (ASE) is a fundamental problem in studying gene regulation and diploid transcriptome profiles, with two key challenges: (i) haplotyping and (ii) estimation of ASE at the gene isoform level. Existing ASE analysis methods are limited by a dependence on haplotyping from laborious experiments or extra genome/family trio data. In addition, there is a lack of methods for gene isoform level ASE analysis. We developed a tool, IDP-ASE, for full ASE analysis. By innovative integration of Third Generation Sequencing (TGS) long reads with Second Generation Sequencing (SGS) short reads, the accuracy of haplotyping and ASE quantification at the gene and gene isoform level was greatly improved as demonstrated by the gold standard data GM12878 data and semi-simulation data. In addition to methodology development, applications of IDP-ASE to human embryonic stem cells and breast cancer cells indicate that the imbalance of ASE and non-uniformity of gene isoform ASE is widespread, including tumorigenesis relevant genes and pluripotency markers. These results show that gene isoform expression and allele-specific expression cooperate to provide high diversity and complexity of gene regulation and expression, highlighting the importance of studying ASE at the gene isoform level. Our study provides a robust bioinformatics solution to understand ASE using RNA sequencing data only. PMID:27899656

Bivalve-specific gene expansion in the pearl oyster genome: implications of adaptation to a sessile lifestyle.

PubMed

Takeuchi, Takeshi; Koyanagi, Ryo; Gyoja, Fuki; Kanda, Miyuki; Hisata, Kanako; Fujie, Manabu; Goto, Hiroki; Yamasaki, Shinichi; Nagai, Kiyohito; Morino, Yoshiaki; Miyamoto, Hiroshi; Endo, Kazuyoshi; Endo, Hirotoshi; Nagasawa, Hiromichi; Kinoshita, Shigeharu; Asakawa, Shuichi; Watabe, Shugo; Satoh, Noriyuki; Kawashima, Takeshi

2016-01-01

Bivalve molluscs have flourished in marine environments, and many species constitute important aquatic resources. Recently, whole genome sequences from two bivalves, the pearl oyster, Pinctada fucata, and the Pacific oyster, Crassostrea gigas, have been decoded, making it possible to compare genomic sequences among molluscs, and to explore general and lineage-specific genetic features and trends in bivalves. In order to improve the quality of sequence data for these purposes, we have updated the entire P. fucata genome assembly. We present a new genome assembly of the pearl oyster, Pinctada fucata (version 2.0). To update the assembly, we conducted additional sequencing, obtaining accumulated sequence data amounting to 193× the P. fucata genome. Sequence redundancy in contigs that was caused by heterozygosity was removed in silico, which significantly improved subsequent scaffolding. Gene model version 2.0 was generated with the aid of manual gene annotations supplied by the P. fucata research community. Comparison of mollusc and other bilaterian genomes shows that gene arrangements of Hox, ParaHox, and Wnt clusters in the P. fucata genome are similar to those of other molluscs. Like the Pacific oyster, P. fucata possesses many genes involved in environmental responses and in immune defense. Phylogenetic analyses of heat shock protein70 and C1q domain-containing protein families indicate that extensive expansion of genes occurred independently in each lineage. Several gene duplication events prior to the split between the pearl oyster and the Pacific oyster are also evident. In addition, a number of tandem duplications of genes that encode shell matrix proteins are also well characterized in the P. fucata genome. Both the Pinctada and Crassostrea lineages have expanded specific gene families in a lineage-specific manner. Frequent duplication of genes responsible for shell formation in the P. fucata genome explains the diversity of mollusc shell structures. These duplications reveal dynamic genome evolution to forge the complex physiology that enables bivalves to employ a sessile lifestyle in the intertidal zone.

Use of tuf Sequences for Genus-Specific PCR Detection and Phylogenetic Analysis of 28 Streptococcal Species

PubMed Central

Picard, François J.; Ke, Danbing; Boudreau, Dominique K.; Boissinot, Maurice; Huletsky, Ann; Richard, Dave; Ouellette, Marc; Roy, Paul H.; Bergeron, Michel G.

2004-01-01

A 761-bp portion of the tuf gene (encoding the elongation factor Tu) from 28 clinically relevant streptococcal species was obtained by sequencing amplicons generated using broad-range PCR primers. These tuf sequences were used to select Streptococcus-specific PCR primers and to perform phylogenetic analysis. The specificity of the PCR assay was verified using 102 different bacterial species, including the 28 streptococcal species. Genomic DNA purified from all streptococcal species was efficiently detected, whereas there was no amplification with DNA from 72 of the 74 nonstreptococcal bacterial species tested. There was cross-amplification with DNAs from Enterococcus durans and Lactococcus lactis. However, the 15 to 31% nucleotide sequence divergence in the 761-bp tuf portion of these two species compared to any streptococcal tuf sequence provides ample sequence divergence to allow the development of internal probes specific to streptococci. The Streptococcus-specific assay was highly sensitive for all 28 streptococcal species tested (i.e., detection limit of 1 to 10 genome copies per PCR). The tuf sequence data was also used to perform extensive phylogenetic analysis, which was generally in agreement with phylogeny determined on the basis of 16S rRNA gene data. However, the tuf gene provided a better discrimination at the streptococcal species level that should be particularly useful for the identification of very closely related species. In conclusion, tuf appears more suitable than the 16S ribosomal RNA gene for the development of diagnostic assays for the detection and identification of streptococcal species because of its higher level of species-specific genetic divergence. PMID:15297518

De novo Transcriptome Assembly of Common Wild Rice (Oryza rufipogon Griff.) and Discovery of Drought-Response Genes in Root Tissue Based on Transcriptomic Data.

PubMed

Tian, Xin-Jie; Long, Yan; Wang, Jiao; Zhang, Jing-Wen; Wang, Yan-Yan; Li, Wei-Min; Peng, Yu-Fa; Yuan, Qian-Hua; Pei, Xin-Wu

2015-01-01

The perennial O. rufipogon (common wild rice), which is considered to be the ancestor of Asian cultivated rice species, contains many useful genetic resources, including drought resistance genes. However, few studies have identified the drought resistance and tissue-specific genes in common wild rice. In this study, transcriptome sequencing libraries were constructed, including drought-treated roots (DR) and control leaves (CL) and roots (CR). Using Illumina sequencing technology, we generated 16.75 million bases of high-quality sequence data for common wild rice and conducted de novo assembly and annotation of genes without prior genome information. These reads were assembled into 119,332 unigenes with an average length of 715 bp. A total of 88,813 distinct sequences (74.42% of unigenes) significantly matched known genes in the NCBI NT database. Differentially expressed gene (DEG) analysis showed that 3617 genes were up-regulated and 4171 genes were down-regulated in the CR library compared with the CL library. Among the DEGs, 535 genes were expressed in roots but not in shoots. A similar comparison between the DR and CR libraries showed that 1393 genes were up-regulated and 315 genes were down-regulated in the DR library compared with the CR library. Finally, 37 genes that were specifically expressed in roots were screened after comparing the DEGs identified in the above-described analyses. This study provides a transcriptome sequence resource for common wild rice plants and establishes a digital gene expression profile of wild rice plants under drought conditions using the assembled transcriptome data as a reference. Several tissue-specific and drought-stress-related candidate genes were identified, representing a fully characterized transcriptome and providing a valuable resource for genetic and genomic studies in plants.

Assessment of clinical analytical sensitivity and specificity of next-generation sequencing for detection of simple and complex mutations.

PubMed

Chin, Ephrem L H; da Silva, Cristina; Hegde, Madhuri

2013-02-19

Detecting mutations in disease genes by full gene sequence analysis is common in clinical diagnostic laboratories. Sanger dideoxy terminator sequencing allows for rapid development and implementation of sequencing assays in the clinical laboratory, but it has limited throughput, and due to cost constraints, only allows analysis of one or at most a few genes in a patient. Next-generation sequencing (NGS), on the other hand, has evolved rapidly, although to date it has mainly been used for large-scale genome sequencing projects and is beginning to be used in the clinical diagnostic testing. One advantage of NGS is that many genes can be analyzed easily at the same time, allowing for mutation detection when there are many possible causative genes for a specific phenotype. In addition, regions of a gene typically not tested for mutations, like deep intronic and promoter mutations, can also be detected. Here we use 20 previously characterized Sanger-sequenced positive controls in disease-causing genes to demonstrate the utility of NGS in a clinical setting using standard PCR based amplification to assess the analytical sensitivity and specificity of the technology for detecting all previously characterized changes (mutations and benign SNPs). The positive controls chosen for validation range from simple substitution mutations to complex deletion and insertion mutations occurring in autosomal dominant and recessive disorders. The NGS data was 100% concordant with the Sanger sequencing data identifying all 119 previously identified changes in the 20 samples. We have demonstrated that NGS technology is ready to be deployed in clinical laboratories. However, NGS and associated technologies are evolving, and clinical laboratories will need to invest significantly in staff and infrastructure to build the necessary foundation for success.

Identification of upstream and intragenic regulatory elements that confer cell-type-restricted and differentiation-specific expression on the muscle creatine kinase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sternberg, E.A.; Spizz, G.; Perry, W.M.

1988-07-01

Terminal differentiation of skeletal myobalsts is accompanied by induction of a series of tissue-specific gene products, which includes the muscle isoenzymte of creatine kinase (MCK). To begin to define the sequences and signals involved in MCK regulation in developing muscle cells, the mouse MCK gene has been isolated. Sequence analysis of 4,147 bases of DNA surrounding the transcription initiation site revealed several interesting structural features, some of which are common to other muscle-specific genes and to cellular and viral enhancers.

Long-range comparison of human and mouse Sprr loci to identify conserved noncoding sequences involved in coordinate regulation

PubMed Central

Martin, Natalia; Patel, Satyakam; Segre, Julia A.

2004-01-01

Mammalian epidermis provides a permeability barrier between an organism and its environment. Under homeostatic conditions, epidermal cells produce structural proteins, which are cross-linked in an orderly fashion to form a cornified envelope (CE). However, under genetic or environmental stress, specific genes are induced to rapidly build a temporary barrier. Small proline-rich (SPRR) proteins are the primary constituents of the CE. Under stress the entire family of 14 Sprr genes is upregulated. The Sprr genes are clustered within the larger epidermal differentiation complex on mouse chromosome 3, human chromosome 1q21. The clustering of the Sprr genes and their upregulation under stress suggest that these genes may be coordinately regulated. To identify enhancer elements that regulate this stress response activation of the Sprr locus, we utilized bioinformatic tools and classical biochemical dissection. Long-range comparative sequence analysis identified conserved noncoding sequences (CNSs). Clusters of epidermal-specific DNaseI-hypersensitive sites (HSs) mapped to specific CNSs. Increased prevalence of these HSs in barrier-deficient epidermis provides in vivo evidence of the regulation of the Sprr locus by these conserved sequences. Individual components of these HSs were cloned, and one was shown to have strong enhancer activity specific to conditions when the Sprr genes are coordinately upregulated. PMID:15574822

Parallel gene analysis with allele-specific padlock probes and tag microarrays

PubMed Central

Banér, Johan; Isaksson, Anders; Waldenström, Erik; Jarvius, Jonas; Landegren, Ulf; Nilsson, Mats

2003-01-01

Parallel, highly specific analysis methods are required to take advantage of the extensive information about DNA sequence variation and of expressed sequences. We present a scalable laboratory technique suitable to analyze numerous target sequences in multiplexed assays. Sets of padlock probes were applied to analyze single nucleotide variation directly in total genomic DNA or cDNA for parallel genotyping or gene expression analysis. All reacted probes were then co-amplified and identified by hybridization to a standard tag oligonucleotide array. The technique was illustrated by analyzing normal and pathogenic variation within the Wilson disease-related ATP7B gene, both at the level of DNA and RNA, using allele-specific padlock probes. PMID:12930977

ETS target genes: Identification of Egr1 as a target by RNA differential display and whole genome PCR techniques

PubMed Central

Robinson, Lois; Panayiotakis, Alexandra; Papas, Takis S.; Kola, Ismail; Seth, Arun

1997-01-01

ETS transcription factors play important roles in hematopoiesis, angiogenesis, and organogenesis during murine development. The ETS genes also have a role in neoplasia, for example in Ewing’s sarcomas and retrovirally induced cancers. The ETS genes encode transcription factors that bind to specific DNA sequences and activate transcription of various cellular and viral genes. To isolate novel ETS target genes, we used two approaches. In the first approach, we isolated genes by the RNA differential display technique. Previously, we have shown that the overexpression of ETS1 and ETS2 genes effects transformation of NIH 3T3 cells and specific transformants produce high levels of the ETS proteins. To isolate ETS1 and ETS2 responsive genes in these transformed cells, we prepared RNA from ETS1, ETS2 transformants, and normal NIH 3T3 cell lines and converted it into cDNA. This cDNA was amplified by PCR and displayed on sequencing gels. The differentially displayed bands were subcloned into plasmid vectors. By Northern blot analysis, several clones showed differential patterns of mRNA expression in the NIH 3T3-, ETS1-, and ETS2-expressing cell lines. Sixteen clones were analyzed by DNA sequence analysis, and 13 of them appeared to be unique because their DNA sequences did not match with any of the known genes present in the gene bank. Three known genes were found to be identical to the CArG box binding factor, phospholipase A2-activating protein, and early growth response 1 (Egr1) genes. In the second approach, to isolate ETS target promoters directly, we performed ETS1 binding with MboI-cleaved genomic DNA in the presence of a specific mAb followed by whole genome PCR. The immune complex-bound ETS binding sites containing DNA fragments were amplified and subcloned into pBluescript and subjected to DNA sequence and computer analysis. We found that, of a large number of clones isolated, 43 represented unique sequences not previously identified. Three clones turned out to contain regulatory sequences derived from human serglycin, preproapolipoprotein C II, and Egr1 genes. The ETS binding sites derived from these three regulatory sequences showed specific binding with recombinant ETS proteins. Of interest, Egr1 was identified by both of these techniques, suggesting strongly that it is indeed an ETS target gene. PMID:9207063

Acquisition and evolution of plant pathogenesis-associated gene clusters and candidate determinants of tissue-specificity in xanthomonas.

PubMed

Lu, Hong; Patil, Prabhu; Van Sluys, Marie-Anne; White, Frank F; Ryan, Robert P; Dow, J Maxwell; Rabinowicz, Pablo; Salzberg, Steven L; Leach, Jan E; Sonti, Ramesh; Brendel, Volker; Bogdanove, Adam J

2008-01-01

Xanthomonas is a large genus of plant-associated and plant-pathogenic bacteria. Collectively, members cause diseases on over 392 plant species. Individually, they exhibit marked host- and tissue-specificity. The determinants of this specificity are unknown. To assess potential contributions to host- and tissue-specificity, pathogenesis-associated gene clusters were compared across genomes of eight Xanthomonas strains representing vascular or non-vascular pathogens of rice, brassicas, pepper and tomato, and citrus. The gum cluster for extracellular polysaccharide is conserved except for gumN and sequences downstream. The xcs and xps clusters for type II secretion are conserved, except in the rice pathogens, in which xcs is missing. In the otherwise conserved hrp cluster, sequences flanking the core genes for type III secretion vary with respect to insertion sequence element and putative effector gene content. Variation at the rpf (regulation of pathogenicity factors) cluster is more pronounced, though genes with established functional relevance are conserved. A cluster for synthesis of lipopolysaccharide varies highly, suggesting multiple horizontal gene transfers and reassortments, but this variation does not correlate with host- or tissue-specificity. Phylogenetic trees based on amino acid alignments of gum, xps, xcs, hrp, and rpf cluster products generally reflect strain phylogeny. However, amino acid residues at four positions correlate with tissue specificity, revealing hpaA and xpsD as candidate determinants. Examination of genome sequences of xanthomonads Xylella fastidiosa and Stenotrophomonas maltophilia revealed that the hrp, gum, and xcs clusters are recent acquisitions in the Xanthomonas lineage. Our results provide insight into the ancestral Xanthomonas genome and indicate that differentiation with respect to host- and tissue-specificity involved not major modifications or wholesale exchange of clusters, but subtle changes in a small number of genes or in non-coding sequences, and/or differences outside the clusters, potentially among regulatory targets or secretory substrates.

Flanking sequence determination and event-specific detection of genetically modified wheat B73-6-1.

PubMed

Xu, Junyi; Cao, Jijuan; Cao, Dongmei; Zhao, Tongtong; Huang, Xin; Zhang, Piqiao; Luan, Fengxia

2013-05-01

In order to establish a specific identification method for genetically modified (GM) wheat, exogenous insert DNA and flanking sequence between exogenous fragment and recombinant chromosome of GM wheat B73-6-1 were successfully acquired by means of conventional polymerase chain reaction (PCR) and thermal asymmetric interlaced (TAIL)-PCR strategies. Newly acquired exogenous fragment covered the full-length sequence of transformed genes such as transformed plasmid and corresponding functional genes including marker uidA, herbicide-resistant bar, ubiquitin promoter, and high-molecular-weight gluten subunit. The flanking sequence between insert DNA revealed high similarity with Triticum turgidum A gene (GenBank: AY494981.1). A specific PCR detection method for GM wheat B73-6-1 was established on the basis of primers designed according to the flanking sequence. This specific PCR method was validated by GM wheat, GM corn, GM soybean, GM rice, and non-GM wheat. The specifically amplified target band was observed only in GM wheat B73-6-1. This method is of high specificity, high reproducibility, rapid identification, and excellent accuracy for the identification of GM wheat B73-6-1.

Construction and Evaluation of Normalized cDNA Libraries Enriched with Full-Length Sequences for Rapid Discovery of New Genes from Sisal (Agave sisalana Perr.) Different Developmental Stages

PubMed Central

Zhou, Wen-Zhao; Zhang, Yan-Mei; Lu, Jun-Ying; Li, Jun-Feng

2012-01-01

To provide a resource of sisal-specific expressed sequence data and facilitate this powerful approach in new gene research, the preparation of normalized cDNA libraries enriched with full-length sequences is necessary. Four libraries were produced with RNA pooled from Agave sisalana multiple tissues to increase efficiency of normalization and maximize the number of independent genes by SMART™ method and the duplex-specific nuclease (DSN). This procedure kept the proportion of full-length cDNAs in the subtracted/normalized libraries and dramatically enhanced the discovery of new genes. Sequencing of 3875 cDNA clones of libraries revealed 3320 unigenes with an average insert length about 1.2 kb, indicating that the non-redundancy of libraries was about 85.7%. These unigene functions were predicted by comparing their sequences to functional domain databases and extensively annotated with Gene Ontology (GO) terms. Comparative analysis of sisal unigenes and other plant genomes revealed that four putative MADS-box genes and knotted-like homeobox (knox) gene were obtained from a total of 1162 full-length transcripts. Furthermore, real-time PCR showed that the characteristics of their transcripts mainly depended on the tight expression regulation of a number of genes during the leaf and flower development. Analysis of individual library sequence data indicated that the pooled-tissue approach was highly effective in discovering new genes and preparing libraries for efficient deep sequencing. PMID:23202944

Isolation and characterization of a water stress-specific genomic gene, pwsi 18, from rice.

PubMed

Joshee, N; Kisaka, H; Kitagawa, Y

1998-01-01

One of the water stress-specific cDNA clones of rice characterised previously, wsi18, was selected for further study. The wsi18 gene can be induced by water stress conditions such as mannitol, NaCl, and dryness, but not by ABA, cold, or heat. A genomic clone for wsi18, pwsi18, contained about 1.7 kbp of the 5' upstream sequence, two introns, and the full coding sequence. The 5'-upstream sequence of pwsi18 contained putative cis-acting elements, namely an ABA-responsive element (ABRE), three G-boxes, three E-boxes, a MEF-2 sequence, four direct and two inverted repeats, and four sequences similar to DRE, which is involved in the dehydration response of Arabidopsis genes. The gusA reporter gene under the control of the pwsi18 promoter showed transient expression in response to water stress. Deletion of the downstream DRE-like sequence between the distal G-boxes-2 and -3 resulted in rather low GUS expression.

In silico comparison of genomic regions containing genes coding for enzymes and transcription factors for the phenylpropanoid pathway in Phaseolus vulgaris L. and Glycine max L. Merr

PubMed Central

Reinprecht, Yarmilla; Yadegari, Zeinab; Perry, Gregory E.; Siddiqua, Mahbuba; Wright, Lori C.; McClean, Phillip E.; Pauls, K. Peter

2013-01-01

Legumes contain a variety of phytochemicals derived from the phenylpropanoid pathway that have important effects on human health as well as seed coat color, plant disease resistance and nodulation. However, the information about the genes involved in this important pathway is fragmentary in common bean (Phaseolus vulgaris L.). The objectives of this research were to isolate genes that function in and control the phenylpropanoid pathway in common bean, determine their genomic locations in silico in common bean and soybean, and analyze sequences of the 4CL gene family in two common bean genotypes. Sequences of phenylpropanoid pathway genes available for common bean or other plant species were aligned, and the conserved regions were used to design sequence-specific primers. The PCR products were cloned and sequenced and the gene sequences along with common bean gene-based (g) markers were BLASTed against the Glycine max v.1.0 genome and the P. vulgaris v.1.0 (Andean) early release genome. In addition, gene sequences were BLASTed against the OAC Rex (Mesoamerican) genome sequence assembly. In total, fragments of 46 structural and regulatory phenylpropanoid pathway genes were characterized in this way and placed in silico on common bean and soybean sequence maps. The maps contain over 250 common bean g and SSR (simple sequence repeat) markers and identify the positions of more than 60 additional phenylpropanoid pathway gene sequences, plus the putative locations of seed coat color genes. The majority of cloned phenylpropanoid pathway gene sequences were mapped to one location in the common bean genome but had two positions in soybean. The comparison of the genomic maps confirmed previous studies, which show that common bean and soybean share genomic regions, including those containing phenylpropanoid pathway gene sequences, with conserved synteny. Indels identified in the comparison of Andean and Mesoamerican common bean 4CL gene sequences might be used to develop inter-pool phenylpropanoid pathway gene-based markers. We anticipate that the information obtained by this study will simplify and accelerate selections of common bean with specific phenylpropanoid pathway alleles to increase the contents of beneficial phenylpropanoids in common bean and other legumes. PMID:24046770

The Unique hmuY Gene Sequence as a Specific Marker of Porphyromonas gingivalis

PubMed Central

Mackiewicz, Paweł; Radwan-Oczko, Małgorzata; Kantorowicz, Małgorzata; Chomyszyn-Gajewska, Maria; Frąszczak, Magdalena; Bielecki, Marcin; Olczak, Mariusz; Olczak, Teresa

2013-01-01

Porphyromonas gingivalis, a major etiological agent of chronic periodontitis, acquires heme from host hemoproteins using the HmuY hemophore. The aim of this study was to develop a specific P. gingivalis marker based on a hmuY gene sequence. Subgingival samples were collected from 66 patients with chronic periodontitis and 40 healthy subjects and the entire hmuY gene was analyzed in positive samples. Phylogenetic analyses demonstrated that both the amino acid sequence of the HmuY protein and the nucleotide sequence of the hmuY gene are unique among P. gingivalis strains/isolates and show low identity to sequences found in other species (below 50 and 56%, respectively). In agreement with these findings, a set of hmuY gene-based primers and standard/real-time PCR with SYBR Green chemistry allowed us to specifically detect P. gingivalis in patients with chronic periodontitis (77.3%) and healthy subjects (20%), the latter possessing lower number of P. gingivalis cells and total bacterial cells. Isolates from healthy subjects possess the hmuY gene-based nucleotide sequence pattern occurring in W83/W50/A7436 (n = 4), 381/ATCC 33277 (n = 3) or TDC60 (n = 1) strains, whereas those from patients typically have TDC60 (n = 21), W83/W50/A7436 (n = 17) and 381/ATCC 33277 (n = 13) strains. We observed a significant correlation between periodontal index of risk of infectiousness (PIRI) and the presence/absence of P. gingivalis (regardless of the hmuY gene-based sequence pattern of the isolate identified [r = 0.43; P = 0.0002] and considering particular isolate pattern [r = 0.38; P = 0.0012]). In conclusion, we demonstrated that the hmuY gene sequence or its fragments may be used as one of the molecular markers of P. gingivalis. PMID:23844074

Transcriptional insulation of the human keratin 18 gene in transgenic mice.

PubMed Central

Neznanov, N; Thorey, I S; Ceceña, G; Oshima, R G

1993-01-01

Expression of the 10-kb human keratin 18 (K18) gene in transgenic mice results in efficient and appropriate tissue-specific expression in a variety of internal epithelial organs, including liver, lung, intestine, kidney, and the ependymal epithelium of brain, but not in spleen, heart, or skeletal muscle. Expression at the RNA level is directly proportional to the number of integrated K18 transgenes. These results indicate that the K18 gene is able to insulate itself both from the commonly observed cis-acting effects of the sites of integration and from the potential complications of duplicated copies of the gene arranged in head-to-tail fashion. To begin to identify the K18 gene sequences responsible for this property of transcriptional insulation, additional transgenic mouse lines containing deletions of either the 5' or 3' distal end of the K18 gene have been characterized. Deletion of 1.5 kb of the distal 5' flanking sequence has no effect upon either the tissue specificity or the copy number-dependent behavior of the transgene. In contrast, deletion of the 3.5-kb 3' flanking sequence of the gene results in the loss of the copy number-dependent behavior of the gene in liver and intestine. However, expression in kidney, lung, and brain remains efficient and copy number dependent in these transgenic mice. Furthermore, herpes simplex virus thymidine kinase gene expression is copy number dependent in transgenic mice when the gene is located between the distal 5'- and 3'-flanking sequences of the K18 gene. Each adult transgenic male expressed the thymidine kinase gene in testes and brain and proportionally to the number of integrated transgenes. We conclude that the characteristic of copy number-dependent expression of the K18 gene is tissue specific because the sequence requirements for transcriptional insulation in adult liver and intestine are different from those for lung and kidney. In addition, the behavior of the transgenic thymidine kinase gene in testes and brain suggests that the property of transcriptional insulation of the K18 gene may be conferred by the distal flanking sequences of the K18 gene and, additionally, may function for other genes. Images PMID:7681143

Bioinformatics analysis and detection of gelatinase encoded gene in Lysinibacillussphaericus

NASA Astrophysics Data System (ADS)

Repin, Rul Aisyah Mat; Mutalib, Sahilah Abdul; Shahimi, Safiyyah; Khalid, Rozida Mohd.; Ayob, Mohd. Khan; Bakar, Mohd. Faizal Abu; Isa, Mohd Noor Mat

2016-11-01

In this study, we performed bioinformatics analysis toward genome sequence of Lysinibacillussphaericus (L. sphaericus) to determine gene encoded for gelatinase. L. sphaericus was isolated from soil and gelatinase species-specific bacterium to porcine and bovine gelatin. This bacterium offers the possibility of enzymes production which is specific to both species of meat, respectively. The main focus of this research is to identify the gelatinase encoded gene within the bacteria of L. Sphaericus using bioinformatics analysis of partially sequence genome. From the research study, three candidate gene were identified which was, gelatinase candidate gene 1 (P1), NODE_71_length_93919_cov_158.931839_21 which containing 1563 base pair (bp) in size with 520 amino acids sequence; Secondly, gelatinase candidate gene 2 (P2), NODE_23_length_52851_cov_190.061386_17 which containing 1776 bp in size with 591 amino acids sequence; and Thirdly, gelatinase candidate gene 3 (P3), NODE_106_length_32943_cov_169.147919_8 containing 1701 bp in size with 566 amino acids sequence. Three pairs of oligonucleotide primers were designed and namely as, F1, R1, F2, R2, F3 and R3 were targeted short sequences of cDNA by PCR. The amplicons were reliably results in 1563 bp in size for candidate gene P1 and 1701 bp in size for candidate gene P3. Therefore, the results of bioinformatics analysis of L. Sphaericus resulting in gene encoded gelatinase were identified.

Employment of Near Full-Length Ribosome Gene TA-Cloning and Primer-Blast to Detect Multiple Species in a Natural Complex Microbial Community Using Species-Specific Primers Designed with Their Genome Sequences.

PubMed

Zhang, Huimin; He, Hongkui; Yu, Xiujuan; Xu, Zhaohui; Zhang, Zhizhou

2016-11-01

It remains an unsolved problem to quantify a natural microbial community by rapidly and conveniently measuring multiple species with functional significance. Most widely used high throughput next-generation sequencing methods can only generate information mainly for genus-level taxonomic identification and quantification, and detection of multiple species in a complex microbial community is still heavily dependent on approaches based on near full-length ribosome RNA gene or genome sequence information. In this study, we used near full-length rRNA gene library sequencing plus Primer-Blast to design species-specific primers based on whole microbial genome sequences. The primers were intended to be specific at the species level within relevant microbial communities, i.e., a defined genomics background. The primers were tested with samples collected from the Daqu (also called fermentation starters) and pit mud of a traditional Chinese liquor production plant. Sixteen pairs of primers were found to be suitable for identification of individual species. Among them, seven pairs were chosen to measure the abundance of microbial species through quantitative PCR. The combination of near full-length ribosome RNA gene library sequencing and Primer-Blast may represent a broadly useful protocol to quantify multiple species in complex microbial population samples with species-specific primers.

A Comprehensive Analysis of Transcript-Supported De Novo Genes in Saccharomyces sensu stricto Yeasts

PubMed Central

Lu, Tzu-Chiao; Leu, Jun-Yi; Lin, Wen-Chang

2017-01-01

Abstract Novel genes arising from random DNA sequences (de novo genes) have been suggested to be widespread in the genomes of different organisms. However, our knowledge about the origin and evolution of de novo genes is still limited. To systematically understand the general features of de novo genes, we established a robust pipeline to analyze >20,000 transcript-supported coding sequences (CDSs) from the budding yeast Saccharomyces cerevisiae. Our analysis pipeline combined phylogeny, synteny, and sequence alignment information to identify possible orthologs across 20 Saccharomycetaceae yeasts and discovered 4,340 S. cerevisiae-specific de novo genes and 8,871 S. sensu stricto-specific de novo genes. We further combine information on CDS positions and transcript structures to show that >65% of de novo genes arose from transcript isoforms of ancient genes, especially in the upstream and internal regions of ancient genes. Fourteen identified de novo genes with high transcript levels were chosen to verify their protein expressions. Ten of them, including eight transcript isoform-associated CDSs, showed translation signals and five proteins exhibited specific cytosolic localizations. Our results suggest that de novo genes frequently arise in the S. sensu stricto complex and have the potential to be quickly integrated into ancient cellular network. PMID:28981695

The histidine permease gene (HIP1) of Saccharomyces cerevisiae.

PubMed

Tanaka, J; Fink, G R

1985-01-01

The histidine-specific permease gene (HIP1) of Saccharomyces cerevisiae has been mapped, cloned, and sequenced. The HIP1 gene maps to the right arm of chromosome VII, approx. 11 cM distal to the ADE3 gene. The gene was isolated as an 8.6-kb BamHI-Sau3A fragment by complementation of the histidine-specific permease deficiency in recipient yeast cells. We sequenced a 2.4-kb subfragment of this BamHI-Sau3A fragment containing the HIP1 gene and identified a 1596-bp open reading frame (ORF). We confirmed the assignment of the 1596-bp ORF as the HIP1 coding sequence by sequencing a hip1 nonsense mutation. Analysis of the amino acid (aa) sequence of the HIP1 gene reveals several hydrophobic stretches, but shows no obvious N-terminal signal peptide. We have constructed a deletion of the HIP1 gene in vitro and replaced the wild-type copy of the gene with this deletion. The hip1 deletion mutant can grow when it is supplemented with 30 mM histidine, 50 times the amount required for the growth of HIP1 cells. Revertants of this deletion mutant able to grow on a normal level of histidine arise by mutation in unlinked genes. Both these observations suggest that there are additional, low-affinity pathways for histidine uptake.

Characterization of genetic elements required for site-specific integration of Lactobacillus delbrueckii subsp. bulgaricus bacteriophage mv4 and construction of an integration-proficient vector for Lactobacillus plantarum.

PubMed Central

Dupont, L; Boizet-Bonhoure, B; Coddeville, M; Auvray, F; Ritzenthaler, P

1995-01-01

Temperate phage mv4 integrates its DNA into the chromosome of Lactobacillus delbrueckii subsp. bulgaricus strains via site-specific recombination. Nucleotide sequencing of a 2.2-kb attP-containing phage fragment revealed the presence of four open reading frames. The larger open reading frame, close to the attP site, encoded a 427-amino-acid polypeptide with similarity in its C-terminal domain to site-specific recombinases of the integrase family. Comparison of the sequences of attP, bacterial attachment site attB, and host-phage junctions attL and attR identified a 17-bp common core sequence, where strand exchange occurs during recombination. Analysis of the attB sequence indicated that the core region overlaps the 3' end of a tRNA(Ser) gene. Phage mv4 DNA integration into the tRNA(Ser) gene preserved an intact tRNA(Ser) gene at the attL site. An integration vector based on the mv4 attP site and int gene was constructed. This vector transforms a heterologous host, L. plantarum, through site-specific integration into the tRNA(Ser) gene of the genome and will be useful for development of an efficient integration system for a number of additional bacterial species in which an identical tRNA gene is present. PMID:7836291

Sequence comparison of prefrontal cortical brain transcriptome from a tame and an aggressive silver fox (Vulpes vulpes).

PubMed

Kukekova, Anna V; Johnson, Jennifer L; Teiling, Clotilde; Li, Lewyn; Oskina, Irina N; Kharlamova, Anastasiya V; Gulevich, Rimma G; Padte, Ravee; Dubreuil, Michael M; Vladimirova, Anastasiya V; Shepeleva, Darya V; Shikhevich, Svetlana G; Sun, Qi; Ponnala, Lalit; Temnykh, Svetlana V; Trut, Lyudmila N; Acland, Gregory M

2011-10-03

Two strains of the silver fox (Vulpes vulpes), with markedly different behavioral phenotypes, have been developed by long-term selection for behavior. Foxes from the tame strain exhibit friendly behavior towards humans, paralleling the sociability of canine puppies, whereas foxes from the aggressive strain are defensive and exhibit aggression to humans. To understand the genetic differences underlying these behavioral phenotypes fox-specific genomic resources are needed. cDNA from mRNA from pre-frontal cortex of a tame and an aggressive fox was sequenced using the Roche 454 FLX Titanium platform (> 2.5 million reads & 0.9 Gbase of tame fox sequence; >3.3 million reads & 1.2 Gbase of aggressive fox sequence). Over 80% of the fox reads were assembled into contigs. Mapping fox reads against the fox transcriptome assembly and the dog genome identified over 30,000 high confidence fox-specific SNPs. Fox transcripts for approximately 14,000 genes were identified using SwissProt and the dog RefSeq databases. An at least 2-fold expression difference between the two samples (p < 0.05) was observed for 335 genes, fewer than 3% of the total number of genes identified in the fox transcriptome. Transcriptome sequencing significantly expanded genomic resources available for the fox, a species without a sequenced genome. In a very cost efficient manner this yielded a large number of fox-specific SNP markers for genetic studies and provided significant insights into the gene expression profile of the fox pre-frontal cortex; expression differences between the two fox samples; and a catalogue of potentially important gene-specific sequence variants. This result demonstrates the utility of this approach for developing genomic resources in species with limited genomic information.

Sequence comparison of prefrontal cortical brain transcriptome from a tame and an aggressive silver fox (Vulpes vulpes)

PubMed Central

2011-01-01

Background Two strains of the silver fox (Vulpes vulpes), with markedly different behavioral phenotypes, have been developed by long-term selection for behavior. Foxes from the tame strain exhibit friendly behavior towards humans, paralleling the sociability of canine puppies, whereas foxes from the aggressive strain are defensive and exhibit aggression to humans. To understand the genetic differences underlying these behavioral phenotypes fox-specific genomic resources are needed. Results cDNA from mRNA from pre-frontal cortex of a tame and an aggressive fox was sequenced using the Roche 454 FLX Titanium platform (> 2.5 million reads & 0.9 Gbase of tame fox sequence; >3.3 million reads & 1.2 Gbase of aggressive fox sequence). Over 80% of the fox reads were assembled into contigs. Mapping fox reads against the fox transcriptome assembly and the dog genome identified over 30,000 high confidence fox-specific SNPs. Fox transcripts for approximately 14,000 genes were identified using SwissProt and the dog RefSeq databases. An at least 2-fold expression difference between the two samples (p < 0.05) was observed for 335 genes, fewer than 3% of the total number of genes identified in the fox transcriptome. Conclusions Transcriptome sequencing significantly expanded genomic resources available for the fox, a species without a sequenced genome. In a very cost efficient manner this yielded a large number of fox-specific SNP markers for genetic studies and provided significant insights into the gene expression profile of the fox pre-frontal cortex; expression differences between the two fox samples; and a catalogue of potentially important gene-specific sequence variants. This result demonstrates the utility of this approach for developing genomic resources in species with limited genomic information. PMID:21967120

Wheat-specific gene, ribosomal protein l21, used as the endogenous reference gene for qualitative and real-time quantitative polymerase chain reaction detection of transgenes.

PubMed

Liu, Yi-Ke; Li, He-Ping; Huang, Tao; Cheng, Wei; Gao, Chun-Sheng; Zuo, Dong-Yun; Zhao, Zheng-Xi; Liao, Yu-Cai

2014-10-29

Wheat-specific ribosomal protein L21 (RPL21) is an endogenous reference gene suitable for genetically modified (GM) wheat identification. This taxon-specific RPL21 sequence displayed high homogeneity in different wheat varieties. Southern blots revealed 1 or 3 copies, and sequence analyses showed one amplicon in common wheat. Combined analyses with sequences from common wheat (AABBDD) and three diploid ancestral species, Triticum urartu (AA), Aegilops speltoides (BB), and Aegilops tauschii (DD), demonstrated the presence of this amplicon in the AA genome. Using conventional qualitative polymerase chain reaction (PCR), the limit of detection was 2 copies of wheat haploid genome per reaction. In the quantitative real-time PCR assay, limits of detection and quantification were about 2 and 8 haploid genome copies, respectively, the latter of which is 2.5-4-fold lower than other reported wheat endogenous reference genes. Construct-specific PCR assays were developed using RPL21 as an endogenous reference gene, and as little as 0.5% of GM wheat contents containing Arabidopsis NPR1 were properly quantified.

[Comparison of the sensibility and specificity between single-stranded conformation polymorphism and denaturing high-performance liquid chromatography in screening hMSH2 and hMLH1 gene mutations in hereditary non-polyposis colorectal cancer].

PubMed

Wei, Guang-hui; Zhao, Bo; Wang, Zhen-jun

2008-09-01

To compare the sensibility and specificity between single-stranded conformation polymorphism (SSCP) and denaturing high-performance liquid chromatography (DHPLC) in screening hMSH2 and hMLH1 gene mutations for the diagnosis of hereditary non-polyposis colorectal cancer (HNPCC). Seven Chinese HNPCC kindreds were collected. PCR-SSCP and DHPLC were used to screen the coding regions of hMSH2 and hMLH1 genes and the abnormal profiles were sequenced by a 377 DNA sequencer. Seven gene sequence variations of hMSH2 or hMLH1 were found. Among them, 4 variations were not found by SSCP, but by DHPLC. The sensibility of SSCP and DHPLC were 51.6% and 100% respectively, and the specificity were 66.6% and 93.3% respectively. DHPLC has better sensibility and specificity in screening hMSH2 and hMLH1 gene mutation as compared to SSCP. DHPLC is an ideal method in the diagnosis of HNPCC.

Progress of targeted genome modification approaches in higher plants.

PubMed

Cardi, Teodoro; Neal Stewart, C

2016-07-01

Transgene integration in plants is based on illegitimate recombination between non-homologous sequences. The low control of integration site and number of (trans/cis)gene copies might have negative consequences on the expression of transferred genes and their insertion within endogenous coding sequences. The first experiments conducted to use precise homologous recombination for gene integration commenced soon after the first demonstration that transgenic plants could be produced. Modern transgene targeting categories used in plant biology are: (a) homologous recombination-dependent gene targeting; (b) recombinase-mediated site-specific gene integration; (c) oligonucleotide-directed mutagenesis; (d) nuclease-mediated site-specific genome modifications. New tools enable precise gene replacement or stacking with exogenous sequences and targeted mutagenesis of endogeneous sequences. The possibility to engineer chimeric designer nucleases, which are able to target virtually any genomic site, and use them for inducing double-strand breaks in host DNA create new opportunities for both applied plant breeding and functional genomics. CRISPR is the most recent technology available for precise genome editing. Its rapid adoption in biological research is based on its inherent simplicity and efficacy. Its utilization, however, depends on available sequence information, especially for genome-wide analysis. We will review the approaches used for genome modification, specifically those for affecting gene integration and modification in higher plants. For each approach, the advantages and limitations will be noted. We also will speculate on how their actual commercial development and implementation in plant breeding will be affected by governmental regulations.

Gene finding in metatranscriptomic sequences.

PubMed

Ismail, Wazim Mohammed; Ye, Yuzhen; Tang, Haixu

2014-01-01

Metatranscriptomic sequencing is a highly sensitive bioassay of functional activity in a microbial community, providing complementary information to the metagenomic sequencing of the community. The acquisition of the metatranscriptomic sequences will enable us to refine the annotations of the metagenomes, and to study the gene activities and their regulation in complex microbial communities and their dynamics. In this paper, we present TransGeneScan, a software tool for finding genes in assembled transcripts from metatranscriptomic sequences. By incorporating several features of metatranscriptomic sequencing, including strand-specificity, short intergenic regions, and putative antisense transcripts into a Hidden Markov Model, TranGeneScan can predict a sense transcript containing one or multiple genes (in an operon) or an antisense transcript. We tested TransGeneScan on a mock metatranscriptomic data set containing three known bacterial genomes. The results showed that TranGeneScan performs better than metagenomic gene finders (MetaGeneMark and FragGeneScan) on predicting protein coding genes in assembled transcripts, and achieves comparable or even higher accuracy than gene finders for microbial genomes (Glimmer and GeneMark). These results imply, with the assistance of metatranscriptomic sequencing, we can obtain a broad and precise picture about the genes (and their functions) in a microbial community. TransGeneScan is available as open-source software on SourceForge at https://sourceforge.net/projects/transgenescan/.

Comparative Analysis of the Genomes of Two Field Isolates of the Rice Blast Fungus Magnaporthe oryzae

PubMed Central

Li, Zhigang; Hu, Songnian; Yao, Nan; Dean, Ralph A.; Zhao, Wensheng; Shen, Mi; Zhang, Haiwang; Li, Chao; Liu, Liyuan; Cao, Lei; Xu, Xiaowen; Xing, Yunfei; Hsiang, Tom; Zhang, Ziding; Xu, Jin-Rong; Peng, You-Liang

2012-01-01

Rice blast caused by Magnaporthe oryzae is one of the most destructive diseases of rice worldwide. The fungal pathogen is notorious for its ability to overcome host resistance. To better understand its genetic variation in nature, we sequenced the genomes of two field isolates, Y34 and P131. In comparison with the previously sequenced laboratory strain 70-15, both field isolates had a similar genome size but slightly more genes. Sequences from the field isolates were used to improve genome assembly and gene prediction of 70-15. Although the overall genome structure is similar, a number of gene families that are likely involved in plant-fungal interactions are expanded in the field isolates. Genome-wide analysis on asynonymous to synonymous nucleotide substitution rates revealed that many infection-related genes underwent diversifying selection. The field isolates also have hundreds of isolate-specific genes and a number of isolate-specific gene duplication events. Functional characterization of randomly selected isolate-specific genes revealed that they play diverse roles, some of which affect virulence. Furthermore, each genome contains thousands of loci of transposon-like elements, but less than 30% of them are conserved among different isolates, suggesting active transposition events in M. oryzae. A total of approximately 200 genes were disrupted in these three strains by transposable elements. Interestingly, transposon-like elements tend to be associated with isolate-specific or duplicated sequences. Overall, our results indicate that gain or loss of unique genes, DNA duplication, gene family expansion, and frequent translocation of transposon-like elements are important factors in genome variation of the rice blast fungus. PMID:22876203

Species specific identification of spore-producing microbes using the gene sequence of small acid-soluble spore coat proteins for amplification based diagnostics

DOEpatents

McKinney, Nancy

2002-01-01

PCR (polymerase chain reaction) primers for the detection of certain Bacillus species, such as Bacillus anthracis. The primers specifically amplify only DNA found in the target species and can distinguish closely related species. Species-specific PCR primers for Bacillus anthracis, Bacillus globigii and Clostridium perfringens are disclosed. The primers are directed to unique sequences within sasp (small acid soluble protein) genes.

Strain-Level Diversity of Secondary Metabolism in Streptomyces albus

PubMed Central

Seipke, Ryan F.

2015-01-01

Streptomyces spp. are robust producers of medicinally-, industrially- and agriculturally-important small molecules. Increased resistance to antibacterial agents and the lack of new antibiotics in the pipeline have led to a renaissance in natural product discovery. This endeavor has benefited from inexpensive high quality DNA sequencing technology, which has generated more than 140 genome sequences for taxonomic type strains and environmental Streptomyces spp. isolates. Many of the sequenced streptomycetes belong to the same species. For instance, Streptomyces albus has been isolated from diverse environmental niches and seven strains have been sequenced, consequently this species has been sequenced more than any other streptomycete, allowing valuable analyses of strain-level diversity in secondary metabolism. Bioinformatics analyses identified a total of 48 unique biosynthetic gene clusters harboured by Streptomyces albus strains. Eighteen of these gene clusters specify the core secondary metabolome of the species. Fourteen of the gene clusters are contained by one or more strain and are considered auxiliary, while 16 of the gene clusters encode the production of putative strain-specific secondary metabolites. Analysis of Streptomyces albus strains suggests that each strain of a Streptomyces species likely harbours at least one strain-specific biosynthetic gene cluster. Importantly, this implies that deep sequencing of a species will not exhaust gene cluster diversity and will continue to yield novelty. PMID:25635820

Detecting novel genes with sparse arrays

PubMed Central

Haiminen, Niina; Smit, Bart; Rautio, Jari; Vitikainen, Marika; Wiebe, Marilyn; Martinez, Diego; Chee, Christine; Kunkel, Joe; Sanchez, Charles; Nelson, Mary Anne; Pakula, Tiina; Saloheimo, Markku; Penttilä, Merja; Kivioja, Teemu

2014-01-01

Species-specific genes play an important role in defining the phenotype of an organism. However, current gene prediction methods can only efficiently find genes that share features such as sequence similarity or general sequence characteristics with previously known genes. Novel sequencing methods and tiling arrays can be used to find genes without prior information and they have demonstrated that novel genes can still be found from extensively studied model organisms. Unfortunately, these methods are expensive and thus are not easily applicable, e.g., to finding genes that are expressed only in very specific conditions. We demonstrate a method for finding novel genes with sparse arrays, applying it on the 33.9 Mb genome of the filamentous fungus Trichoderma reesei. Our computational method does not require normalisations between arrays and it takes into account the multiple-testing problem typical for analysis of microarray data. In contrast to tiling arrays, that use overlapping probes, only one 25mer microarray oligonucleotide probe was used for every 100 b. Thus, only relatively little space on a microarray slide was required to cover the intergenic regions of a genome. The analysis was done as a by-product of a conventional microarray experiment with no additional costs. We found at least 23 good candidates for novel transcripts that could code for proteins and all of which were expressed at high levels. Candidate genes were found to neighbour ire1 and cre1 and many other regulatory genes. Our simple, low-cost method can easily be applied to finding novel species-specific genes without prior knowledge of their sequence properties. PMID:20691772

The "grep" command but not FusionMap, FusionFinder or ChimeraScan captures the CIC-DUX4 fusion gene from whole transcriptome sequencing data on a small round cell tumor with t(4;19)(q35;q13).

PubMed

Panagopoulos, Ioannis; Gorunova, Ludmila; Bjerkehagen, Bodil; Heim, Sverre

2014-01-01

Whole transcriptome sequencing was used to study a small round cell tumor in which a t(4;19)(q35;q13) was part of the complex karyotype but where the initial reverse transcriptase PCR (RT-PCR) examination did not detect a CIC-DUX4 fusion transcript previously described as the crucial gene-level outcome of this specific translocation. The RNA sequencing data were analysed using the FusionMap, FusionFinder, and ChimeraScan programs which are specifically designed to identify fusion genes. FusionMap, FusionFinder, and ChimeraScan identified 1017, 102, and 101 fusion transcripts, respectively, but CIC-DUX4 was not among them. Since the RNA sequencing data are in the fastq text-based format, we searched the files using the "grep" command-line utility. The "grep" command searches the text for specific expressions and displays, by default, the lines where matches occur. The "specific expression" was a sequence of 20 nucleotides from the coding part of the last exon 20 of CIC (Reference Sequence: NM_015125.3) chosen since all the so far reported CIC breakpoints have occurred here. Fifteen chimeric CIC-DUX4 cDNA sequences were captured and the fusion between the CIC and DUX4 genes was mapped precisely. New primer combinations were constructed based on these findings and were used together with a polymerase suitable for amplification of GC-rich DNA templates to amplify CIC-DUX4 cDNA fragments which had the same fusion point found with "grep". In conclusion, FusionMap, FusionFinder, and ChimeraScan generated a plethora of fusion transcripts but did not detect the biologically important CIC-DUX4 chimeric transcript; they are generally useful but evidently suffer from imperfect both sensitivity and specificity. The "grep" command is an excellent tool to capture chimeric transcripts from RNA sequencing data when the pathological and/or cytogenetic information strongly indicates the presence of a specific fusion gene.

High-Resolution Whole-Genome Sequencing Reveals That Specific Chromatin Domains from Most Human Chromosomes Associate with Nucleoli

PubMed Central

van Koningsbruggen, Silvana; Gierliński, Marek; Schofield, Pietá; Martin, David; Barton, Geoffey J.; Ariyurek, Yavuz; den Dunnen, Johan T.

2010-01-01

The nuclear space is mostly occupied by chromosome territories and nuclear bodies. Although this organization of chromosomes affects gene function, relatively little is known about the role of nuclear bodies in the organization of chromosomal regions. The nucleolus is the best-studied subnuclear structure and forms around the rRNA repeat gene clusters on the acrocentric chromosomes. In addition to rDNA, other chromatin sequences also surround the nucleolar surface and may even loop into the nucleolus. These additional nucleolar-associated domains (NADs) have not been well characterized. We present here a whole-genome, high-resolution analysis of chromatin endogenously associated with nucleoli. We have used a combination of three complementary approaches, namely fluorescence comparative genome hybridization, high-throughput deep DNA sequencing and photoactivation combined with time-lapse fluorescence microscopy. The data show that specific sequences from most human chromosomes, in addition to the rDNA repeat units, associate with nucleoli in a reproducible and heritable manner. NADs have in common a high density of AT-rich sequence elements, low gene density and a statistically significant enrichment in transcriptionally repressed genes. Unexpectedly, both the direct DNA sequencing and fluorescence photoactivation data show that certain chromatin loci can specifically associate with either the nucleolus, or the nuclear envelope. PMID:20826608

High-resolution whole-genome sequencing reveals that specific chromatin domains from most human chromosomes associate with nucleoli.

PubMed

van Koningsbruggen, Silvana; Gierlinski, Marek; Schofield, Pietá; Martin, David; Barton, Geoffey J; Ariyurek, Yavuz; den Dunnen, Johan T; Lamond, Angus I

2010-11-01

The nuclear space is mostly occupied by chromosome territories and nuclear bodies. Although this organization of chromosomes affects gene function, relatively little is known about the role of nuclear bodies in the organization of chromosomal regions. The nucleolus is the best-studied subnuclear structure and forms around the rRNA repeat gene clusters on the acrocentric chromosomes. In addition to rDNA, other chromatin sequences also surround the nucleolar surface and may even loop into the nucleolus. These additional nucleolar-associated domains (NADs) have not been well characterized. We present here a whole-genome, high-resolution analysis of chromatin endogenously associated with nucleoli. We have used a combination of three complementary approaches, namely fluorescence comparative genome hybridization, high-throughput deep DNA sequencing and photoactivation combined with time-lapse fluorescence microscopy. The data show that specific sequences from most human chromosomes, in addition to the rDNA repeat units, associate with nucleoli in a reproducible and heritable manner. NADs have in common a high density of AT-rich sequence elements, low gene density and a statistically significant enrichment in transcriptionally repressed genes. Unexpectedly, both the direct DNA sequencing and fluorescence photoactivation data show that certain chromatin loci can specifically associate with either the nucleolus, or the nuclear envelope.

MicroRNAs Form Triplexes with Double Stranded DNA at Sequence-Specific Binding Sites; a Eukaryotic Mechanism via which microRNAs Could Directly Alter Gene Expression

PubMed Central

Grace, Christy R.; Ferreira, Antonio M.; Waddell, M. Brett; Ridout, Granger; Naeve, Deanna; Leuze, Michael; LoCascio, Philip F.; Panetta, John C.; Wilkinson, Mark R.; Pui, Ching-Hon; Naeve, Clayton W.; Uberbacher, Edward C.; Bonten, Erik J.; Evans, William E.

2016-01-01

MicroRNAs are important regulators of gene expression, acting primarily by binding to sequence-specific locations on already transcribed messenger RNAs (mRNA) and typically down-regulating their stability or translation. Recent studies indicate that microRNAs may also play a role in up-regulating mRNA transcription levels, although a definitive mechanism has not been established. Double-helical DNA is capable of forming triple-helical structures through Hoogsteen and reverse Hoogsteen interactions in the major groove of the duplex, and we show physical evidence (i.e., NMR, FRET, SPR) that purine or pyrimidine-rich microRNAs of appropriate length and sequence form triple-helical structures with purine-rich sequences of duplex DNA, and identify microRNA sequences that favor triplex formation. We developed an algorithm (Trident) to search genome-wide for potential triplex-forming sites and show that several mammalian and non-mammalian genomes are enriched for strong microRNA triplex binding sites. We show that those genes containing sequences favoring microRNA triplex formation are markedly enriched (3.3 fold, p<2.2 × 10−16) for genes whose expression is positively correlated with expression of microRNAs targeting triplex binding sequences. This work has thus revealed a new mechanism by which microRNAs could interact with gene promoter regions to modify gene transcription. PMID:26844769

Development of PCR primers specific for the amplification and direct sequencing of gyrB genes from microbacteria, order Actinomycetales.

PubMed

Richert, Kathrin; Brambilla, Evelyne; Stackebrandt, Erko

2005-01-01

PCR primer sets were developed for the specific amplification and sequence analyses encoding the gyrase subunit B (gyrB) of members of the family Microbacteriaceae, class Actinobacteria. The family contains species highly related by 16S rRNA gene sequence analyses. In order to test if the gene sequence analysis of gyrB is appropriate to discriminate between closely related species, we evaluate the 16S rRNA gene phylogeny of its members. As the published universal primer set for gyrB failed to amplify the responding gene of the majority of the 80 type strains of the family, three new primer sets were identified that generated fragments with a composite sequence length of about 900 nt. However, the amplification of all three fragments was successful only in 25% of the 80 type strains. In this study, the substitution frequencies in genes encoding gyrase and 16S rDNA were compared for 10 strains of nine genera. The frequency of gyrB nucleotide substitution is significantly higher than that of the 16S rDNA, and no linear correlation exists between the similarities of both molecules among members of the Microbacteriaceae. The phylogenetic analyses using the gyrB sequences provide higher resolution than using 16S rDNA sequences and seem able to discriminate between closely related species.

Genome analysis and identification of gelatinase encoded gene in Enterobacter aerogenes

NASA Astrophysics Data System (ADS)

Shahimi, Safiyyah; Mutalib, Sahilah Abdul; Khalid, Rozida Abdul; Repin, Rul Aisyah Mat; Lamri, Mohd Fadly; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat

2016-11-01

In this study, bioinformatic analysis towards genome sequence of E. aerogenes was done to determine gene encoded for gelatinase. Enterobacter aerogenes was isolated from hot spring water and gelatinase species-specific bacterium to porcine and fish gelatin. This bacterium offers the possibility of enzymes production which is specific to both species gelatine, respectively. Enterobacter aerogenes was partially genome sequenced resulting in 5.0 mega basepair (Mbp) total size of sequence. From pre-process pipeline, 87.6 Mbp of total reads, 68.8 Mbp of total high quality reads and 78.58 percent of high quality percentage was determined. Genome assembly produced 120 contigs with 67.5% of contigs over 1 kilo base pair (kbp), 124856 bp of N50 contig length and 55.17 % of GC base content percentage. About 4705 protein gene was identified from protein prediction analysis. Two candidate genes selected have highest similarity identity percentage against gelatinase enzyme available in Swiss-Prot and NCBI online database. They were NODE_9_length_26866_cov_148.013245_12 containing 1029 base pair (bp) sequence with 342 amino acid sequence and NODE_24_length_155103_cov_177.082458_62 which containing 717 bp sequence with 238 amino acid sequence, respectively. Thus, two paired of primers (forward and reverse) were designed, based on the open reading frame (ORF) of selected genes. Genome analysis of E. aerogenes resulting genes encoded gelatinase were identified.

An active role for endogenous beta-1,3-glucanase genes in transgene-mediated co-suppression in tobacco.

PubMed

Sanders, Matthew; Maddelein, Wendy; Depicker, Anna; Van Montagu, Marc; Cornelissen, Marc; Jacobs, John

2002-11-01

Post-transcriptional gene silencing (PTGS) is characterized by the accumulation of short interfering RNAs that are proposed to mediate sequence-specific degradation of cognate and secondary target mRNAs. In plants, it is unclear to what extent endogenous genes contribute to this process. Here, we address the role of the endogenous target genes in transgene-mediated PTGS of beta-1,3-glucanases in tobacco. We found that mRNA sequences of the endogenous glucanase glb gene with varying degrees of homology to the Nicotiana plumbaginifolia gn1 transgene are targeted by the silencing machinery, although less efficiently than corresponding transgene regions. Importantly, we show that endogene-specific nucleotides in the glb sequence provide specificity to the silencing process. Consistent with this finding, small sense and antisense 21- to 23-nucleotide RNAs homologous to the endogenous glb gene were detected. Combined, these data demonstrate that a co-suppressed endogenous glucan ase gene is involved in signal amplification and selection of homologous targets, and show that endogenous genes can actively participate in PTGS in plants. The findings are introduced as a further sophistication of the post-transciptional silencing model.

Prospecting Metagenomic Enzyme Subfamily Genes for DNA Family Shuffling by a Novel PCR-based Approach*

PubMed Central

Wang, Qiuyan; Wu, Huili; Wang, Anming; Du, Pengfei; Pei, Xiaolin; Li, Haifeng; Yin, Xiaopu; Huang, Lifeng; Xiong, Xiaolong

2010-01-01

DNA family shuffling is a powerful method for enzyme engineering, which utilizes recombination of naturally occurring functional diversity to accelerate laboratory-directed evolution. However, the use of this technique has been hindered by the scarcity of family genes with the required level of sequence identity in the genome database. We describe here a strategy for collecting metagenomic homologous genes for DNA shuffling from environmental samples by truncated metagenomic gene-specific PCR (TMGS-PCR). Using identified metagenomic gene-specific primers, twenty-three 921-bp truncated lipase gene fragments, which shared 64–99% identity with each other and formed a distinct subfamily of lipases, were retrieved from 60 metagenomic samples. These lipase genes were shuffled, and selected active clones were characterized. The chimeric clones show extensive functional and genetic diversity, as demonstrated by functional characterization and sequence analysis. Our results indicate that homologous sequences of genes captured by TMGS-PCR can be used as suitable genetic material for DNA family shuffling with broad applications in enzyme engineering. PMID:20962349

Chromosomal location and gene paucity of the male specific region on papaya Y chromosome.

PubMed

Yu, Qingyi; Hou, Shaobin; Hobza, Roman; Feltus, F Alex; Wang, Xiue; Jin, Weiwei; Skelton, Rachel L; Blas, Andrea; Lemke, Cornelia; Saw, Jimmy H; Moore, Paul H; Alam, Maqsudul; Jiang, Jiming; Paterson, Andrew H; Vyskot, Boris; Ming, Ray

2007-08-01

Sex chromosomes in flowering plants evolved recently and many of them remain homomorphic, including those in papaya. We investigated the chromosomal location of papaya's small male specific region of the hermaphrodite Y (Yh) chromosome (MSY) and its genomic features. We conducted chromosome fluorescence in situ hybridization mapping of Yh-specific bacterial artificial chromosomes (BACs) and placed the MSY near the centromere of the papaya Y chromosome. Then we sequenced five MSY BACs to examine the genomic features of this specialized region, which resulted in the largest collection of contiguous genomic DNA sequences of a Y chromosome in flowering plants. Extreme gene paucity was observed in the papaya MSY with no functional gene identified in 715 kb MSY sequences. A high density of retroelements and local sequence duplications were detected in the MSY that is suppressed for recombination. Location of the papaya MSY near the centromere might have provided recombination suppression and fostered paucity of genes in the male specific region of the Y chromosome. Our findings provide critical information for deciphering the sex chromosomes in papaya and reference information for comparative studies of other sex chromosomes in animals and plants.

Surface Diversity in Mycoplasma agalactiae Is Driven by Site-Specific DNA Inversions within the vpma Multigene Locus

PubMed Central

Glew, Michelle D.; Marenda, Marc; Rosengarten, Renate; Citti, Christine

2002-01-01

The ruminant pathogen Mycoplasma agalactiae possesses a family of abundantly expressed variable surface lipoproteins called Vpmas. Phenotypic switches between Vpma members have previously been correlated with DNA rearrangements within a locus of vpma genes and are proposed to play an important role in disease pathogenesis. In this study, six vpma genes were characterized in the M. agalactiae type strain PG2. All vpma genes clustered within an 8-kb region and shared highly conserved 5′ untranslated regions, lipoprotein signal sequences, and short N-terminal sequences. Analyses of the vpma loci from consecutive clonal isolates showed that vpma DNA rearrangements were site specific and that cleavage and strand exchange occurred within a minimal region of 21 bp located within the 5′ untranslated region of all vpma genes. This process controlled expression of vpma genes by effectively linking the open reading frame (ORF) of a silent gene to a unique active promoter sequence within the locus. An ORF (xer1) immediately adjacent to one end of the vpma locus did not undergo rearrangement and had significant homology to a distinct subset of genes belonging to the λ integrase family of site-specific xer recombinases. It is proposed that xer1 codes for a site-specific recombinase that is not involved in chromosome dimer resolution but rather is responsible for the observed vpma-specific recombination in M. agalactiae. PMID:12374833

Influence of sequence mismatches on the specificity of recombinase polymerase amplification technology.

PubMed

Daher, Rana K; Stewart, Gale; Boissinot, Maurice; Boudreau, Dominique K; Bergeron, Michel G

2015-04-01

Recombinase polymerase amplification (RPA) technology relies on three major proteins, recombinase proteins, single-strand binding proteins, and polymerases, to specifically amplify nucleic acid sequences in an isothermal format. The performance of RPA with respect to sequence mismatches of closely-related non-target molecules is not well documented and the influence of the number and distribution of mismatches in DNA sequences on RPA amplification reaction is not well understood. We investigated the specificity of RPA by testing closely-related species bearing naturally occurring mismatches for the tuf gene sequence of Pseudomonas aeruginosa and/or Mycobacterium tuberculosis and for the cfb gene sequence of Streptococcus agalactiae. In addition, the impact of the number and distribution of mismatches on RPA efficiency was assessed by synthetically generating 14 types of mismatched forward primers for detecting five bacterial species of high diagnostic relevance such as Clostridium difficile, Staphylococcus aureus, S. agalactiae, P. aeruginosa, and M. tuberculosis as well as Bacillus atropheus subsp. globigii for which we use the spores as internal control in diagnostic assays. A total of 87 mismatched primers were tested in this study. We observed that target specific RPA primers with mismatches (n > 1) at their 3'extrimity hampered RPA reaction. In addition, 3 mismatches covering both extremities and the center of the primer sequence negatively affected RPA yield. We demonstrated that the specificity of RPA was multifactorial. Therefore its application in clinical settings must be selected and validated a priori. We recommend that the selection of a target gene must consider the presence of closely-related non-target genes. It is advisable to choose target regions with a high number of mismatches (≥36%, relative to the size of amplicon) with respect to closely-related species and the best case scenario would be by choosing a unique target gene. Copyright © 2014 Elsevier Ltd. All rights reserved.

Selective DNA demethylation by fusion of TDG with a sequence-specific DNA-binding domain

PubMed Central

Gregory, David J.; Mikhaylova, Lyudmila; Fedulov, Alexey V.

2012-01-01

Our ability to selectively manipulate gene expression by epigenetic means is limited, as there is no approach for targeted reactivation of epigenetically silenced genes, in contrast to what is available for selective gene silencing. We aimed to develop a tool for selective transcriptional activation by DNA demethylation. Here we present evidence that direct targeting of thymine-DNA-glycosylase (TDG) to specific sequences in the DNA can result in local DNA demethylation at potential regulatory sequences and lead to enhanced gene induction. When TDG was fused to a well-characterized DNA-binding domain [the Rel-homology domain (RHD) of NFκB], we observed decreased DNA methylation and increased transcriptional response to unrelated stimulus of inducible nitric oxide synthase (NOS2). The effect was not seen for control genes lacking either RHD-binding sites or high levels of methylation, nor in control mock-transduced cells. Specific reactivation of epigenetically silenced genes may thus be achievable by this approach, which provides a broadly useful strategy to further our exploration of biological mechanisms and to improve control over the epigenome. PMID:22419066

SGP-1: Prediction and Validation of Homologous Genes Based on Sequence Alignments

PubMed Central

Wiehe, Thomas; Gebauer-Jung, Steffi; Mitchell-Olds, Thomas; Guigó, Roderic

2001-01-01

Conventional methods of gene prediction rely on the recognition of DNA-sequence signals, the coding potential or the comparison of a genomic sequence with a cDNA, EST, or protein database. Reasons for limited accuracy in many circumstances are species-specific training and the incompleteness of reference databases. Lately, comparative genome analysis has attracted increasing attention. Several analysis tools that are based on human/mouse comparisons are already available. Here, we present a program for the prediction of protein-coding genes, termed SGP-1 (Syntenic Gene Prediction), which is based on the similarity of homologous genomic sequences. In contrast to most existing tools, the accuracy of SGP-1 depends little on species-specific properties such as codon usage or the nucleotide distribution. SGP-1 may therefore be applied to nonstandard model organisms in vertebrates as well as in plants, without the need for extensive parameter training. In addition to predicting genes in large-scale genomic sequences, the program may be useful to validate gene structure annotations from databases. To this end, SGP-1 output also contains comparisons between predicted and annotated gene structures in HTML format. The program can be accessed via a Web server at http://soft.ice.mpg.de/sgp-1. The source code, written in ANSI C, is available on request from the authors. PMID:11544202

Cell type-specific termination of transcription by transposable element sequences.

PubMed

Conley, Andrew B; Jordan, I King

2012-09-30

Transposable elements (TEs) encode sequences necessary for their own transposition, including signals required for the termination of transcription. TE sequences within the introns of human genes show an antisense orientation bias, which has been proposed to reflect selection against TE sequences in the sense orientation owing to their ability to terminate the transcription of host gene transcripts. While there is evidence in support of this model for some elements, the extent to which TE sequences actually terminate transcription of human gene across the genome remains an open question. Using high-throughput sequencing data, we have characterized over 9,000 distinct TE-derived sequences that provide transcription termination sites for 5,747 human genes across eight different cell types. Rarefaction curve analysis suggests that there may be twice as many TE-derived termination sites (TE-TTS) genome-wide among all human cell types. The local chromatin environment for these TE-TTS is similar to that seen for 3' UTR canonical TTS and distinct from the chromatin environment of other intragenic TE sequences. However, those TE-TTS located within the introns of human genes were found to be far more cell type-specific than the canonical TTS. TE-TTS were much more likely to be found in the sense orientation than other intragenic TE sequences of the same TE family and TE-TTS in the sense orientation terminate transcription more efficiently than those found in the antisense orientation. Alu sequences were found to provide a large number of relatively weak TTS, whereas LTR elements provided a smaller number of much stronger TTS. TE sequences provide numerous termination sites to human genes, and TE-derived TTS are particularly cell type-specific. Thus, TE sequences provide a powerful mechanism for the diversification of transcriptional profiles between cell types and among evolutionary lineages, since most TE-TTS are evolutionarily young. The extent of transcription termination by TEs seen here, along with the preference for sense-oriented TE insertions to provide TTS, is consistent with the observed antisense orientation bias of human TEs.

Identification of mediator complex 26 (Crsp7) gametologs on platypus X1 and Y5 sex chromosomes: a candidate testis-determining gene in monotremes?

PubMed

Tsend-Ayush, Enkhjargal; Kortschak, R Daniel; Bernard, Pascal; Lim, Shu Ly; Ryan, Janelle; Rosenkranz, Ruben; Borodina, Tatiana; Dohm, Juliane C; Himmelbauer, Heinz; Harley, Vincent R; Grützner, Frank

2012-01-01

The basal lineage of monotremes features an extraordinarily complex sex chromosome system which has provided novel insights into the evolution of mammalian sex chromosomes. Recently, sequence information from autosomes, X chromosomes, and XY-shared pseudoautosomal regions has become available. However, no gene has so far been described on any of the Y chromosome-specific regions. We analyzed sequences derived from Y-specific BAC clones to identify genes with potentially male-specific function. Here, we report the identification and characterization of the mediator complex protein gametologs on platypus Y5 (Crspy). We also identified the X-chromosomal copy which unexpectedly maps to X1 (Crspx). Sequence comparison shows extensive divergence between the X and Y copy, but we found no significant positive selection on either gametolog. Expression analysis shows widespread expression of Crspx. Crspy is expressed exclusively in males with particularly strong expression in testis and kidney. Reporter gene assays to investigate whether Crspx/y can act on the recently discovered mouse Sox9 testis-specific enhancer element did reveal a modest effect together with mouse Sox9 + Sf1, but showed overall no significant upregulation of the reporter gene. This is the first report of a differentiated functional male-specific gene on platypus Y chromosomes, providing new insights into sex chromosome evolution and a candidate gene for male-specific function in monotremes.

Characteristics of the Lotus japonicus gene repertoire deduced from large-scale expressed sequence tag (EST) analysis.

PubMed

Asamizu, Erika; Nakamura, Yasukazu; Sato, Shusei; Tabata, Satoshi

2004-02-01

To perform a comprehensive analysis of genes expressed in a model legume, Lotus japonicus, a total of 74472 3'-end expressed sequence tags (EST) were generated from cDNA libraries produced from six different organs. Clustering of sequences was performed with an identity criterion of 95% for 50 bases, and a total of 20457 non-redundant sequences, 8503 contigs and 11954 singletons were generated. EST sequence coverage was analyzed by using the annotated L. japonicus genomic sequence and 1093 of the 1889 predicted protein-encoding genes (57.9%) were hit by the EST sequence(s). Gene content was compared to several plant species. Among the 8503 contigs, 471 were identified as sequences conserved only in leguminous species and these included several disease resistance-related genes. This suggested that in legumes, these genes may have evolved specifically to resist pathogen attack. The rate of gene sequence divergence was assessed by comparing similarity level and functional category based on the Gene Ontology (GO) annotation of Arabidopsis genes. This revealed that genes encoding ribosomal proteins, as well as those related to translation, photosynthesis, and cellular structure were more abundantly represented in the highly conserved class, and that genes encoding transcription factors and receptor protein kinases were abundantly represented in the less conserved class. To make the sequence information and the cDNA clones available to the research community, a Web database with useful services was created at http://www.kazusa.or.jp/en/plant/lotus/EST/.

Computational sequence analysis of predicted long dsRNA transcriptomes of major crops reveals sequence complementarity with human genes.

PubMed

Jensen, Peter D; Zhang, Yuanji; Wiggins, B Elizabeth; Petrick, Jay S; Zhu, Jin; Kerstetter, Randall A; Heck, Gregory R; Ivashuta, Sergey I

2013-01-01

Long double-stranded RNAs (long dsRNAs) are precursors for the effector molecules of sequence-specific RNA-based gene silencing in eukaryotes. Plant cells can contain numerous endogenous long dsRNAs. This study demonstrates that such endogenous long dsRNAs in plants have sequence complementarity to human genes. Many of these complementary long dsRNAs have perfect sequence complementarity of at least 21 nucleotides to human genes; enough complementarity to potentially trigger gene silencing in targeted human cells if delivered in functional form. However, the number and diversity of long dsRNA molecules in plant tissue from crops such as lettuce, tomato, corn, soy and rice with complementarity to human genes that have a long history of safe consumption supports a conclusion that long dsRNAs do not present a significant dietary risk.

Properties of Cells Carrying the Herpes Simplex Virus Type 2 Thymidine Kinase Gene: Mechanisms of Reversion to a Thymidine Kinase-Negative Phenotype

PubMed Central

Bastow, K. F.; Darby, G.; Wildy, P.; Minson, A. C.

1980-01-01

We have isolated cells with a thymidine kinase-negative (tk−) phenotype from cells which carry the herpes simplex virus type 2 tk gene by selection in 5-bromodeoxyuridine or 9-(2-hydroxyethoxymethyl)guanine. Both selection routines generated revertants with a frequency of 10−3 to 10−4, and resistance to either compound conferred simultaneous resistance to the other. tk− revertants fell into three classes: (i) cells that arose by deletion of all virus sequences, (ii) cells that had lost the virus tk gene but retained a nonselected virus-specific function and arose by deletion of part of the virus-specific sequence, and (iii) cells that retained the potential to express all of the virus-specific functions of the parental cells and retained all of the virus-specific DNA sequences. Images PMID:16789205

Tissue- and Time-Specific Expression of Otherwise Identical tRNA Genes

PubMed Central

Adir, Idan; Dahan, Orna; Broday, Limor; Pilpel, Yitzhak; Rechavi, Oded

2016-01-01

Codon usage bias affects protein translation because tRNAs that recognize synonymous codons differ in their abundance. Although the current dogma states that tRNA expression is exclusively regulated by intrinsic control elements (A- and B-box sequences), we revealed, using a reporter that monitors the levels of individual tRNA genes in Caenorhabditis elegans, that eight tryptophan tRNA genes, 100% identical in sequence, are expressed in different tissues and change their expression dynamically. Furthermore, the expression levels of the sup-7 tRNA gene at day 6 were found to predict the animal’s lifespan. We discovered that the expression of tRNAs that reside within introns of protein-coding genes is affected by the host gene’s promoter. Pairing between specific Pol II genes and the tRNAs that are contained in their introns is most likely adaptive, since a genome-wide analysis revealed that the presence of specific intronic tRNAs within specific orthologous genes is conserved across Caenorhabditis species. PMID:27560950

Leveraging long sequencing reads to investigate R-gene clustering and variation in sugar beet

USDA-ARS?s Scientific Manuscript database

Host-pathogen interactions are of prime importance to modern agriculture. Plants utilize various types of resistance genes to mitigate pathogen damage. Identification of the specific gene responsible for a specific resistance can be difficult due to duplication and clustering within R-gene families....

Flanking sequence determination and specific PCR identification of transgenic wheat B102-1-2.

PubMed

Cao, Jijuan; Xu, Junyi; Zhao, Tongtong; Cao, Dongmei; Huang, Xin; Zhang, Piqiao; Luan, Fengxia

2014-01-01

The exogenous fragment sequence and flanking sequence between the exogenous fragment and recombinant chromosome of transgenic wheat B102-1-2 were successfully acquired using genome walking technology. The newly acquired exogenous fragment encoded the full-length sequence of transformed genes with transformed plasmid and corresponding functional genes including ubi, vector pBANF-bar, vector pUbiGUSPlus, vector HSP, reporter vector pUbiGUSPlus, promoter ubiquitin, and coli DH1. A specific polymerase chain reaction (PCR) identification method for transgenic wheat B102-1-2 was established on the basis of designed primers according to flanking sequence. This established specific PCR strategy was validated by using transgenic wheat, transgenic corn, transgenic soybean, transgenic rice, and non-transgenic wheat. A specifically amplified target band was observed only in transgenic wheat B102-1-2. Therefore, this method is characterized by high specificity, high reproducibility, rapid identification, and excellent accuracy for the identification of transgenic wheat B102-1-2.

Gene discovery in Eimeria tenella by immunoscreening cDNA expression libraries of sporozoites and schizonts with chicken intestinal antibodies.

PubMed

Réfega, Susana; Girard-Misguich, Fabienne; Bourdieu, Christiane; Péry, Pierre; Labbé, Marie

2003-04-02

Specific antibodies were produced ex vivo from intestinal culture of Eimeria tenella infected chickens. The specificity of these intestinal antibodies was tested against different parasite stages. These antibodies were used to immunoscreen first generation schizont and sporozoite cDNA libraries permitting the identification of new E. tenella antigens. We obtained a total of 119 cDNA clones which were subjected to sequence analysis. The sequences coding for the proteins inducing local immune responses were compared with nucleotide or protein databases and with expressed sequence tags (ESTs) databases. We identified new Eimeria genes coding for heat shock proteins, a ribosomal protein, a pyruvate kinase and a pyridoxine kinase. Specific features of other sequences are discussed.

Pervasive sequence patents cover the entire human genome.

PubMed

Rosenfeld, Jeffrey A; Mason, Christopher E

2013-01-01

The scope and eligibility of patents for genetic sequences have been debated for decades, but a critical case regarding gene patents (Association of Molecular Pathologists v. Myriad Genetics) is now reaching the US Supreme Court. Recent court rulings have supported the assertion that such patents can provide intellectual property rights on sequences as small as 15 nucleotides (15mers), but an analysis of all current US patent claims and the human genome presented here shows that 15mer sequences from all human genes match at least one other gene. The average gene matches 364 other genes as 15mers; the breast-cancer-associated gene BRCA1 has 15mers matching at least 689 other genes. Longer sequences (1,000 bp) still showed extensive cross-gene matches. Furthermore, 15mer-length claims from bovine and other animal patents could also claim as much as 84% of the genes in the human genome. In addition, when we expanded our analysis to full-length patent claims on DNA from all US patents to date, we found that 41% of the genes in the human genome have been claimed. Thus, current patents for both short and long nucleotide sequences are extraordinarily non-specific and create an uncertain, problematic liability for genomic medicine, especially in regard to targeted re-sequencing and other sequence diagnostic assays.

Looking into flowering time in almond (Prunus dulcis (Mill) D. A. Webb): the candidate gene approach.

PubMed

Silva, C; Garcia-Mas, J; Sánchez, A M; Arús, P; Oliveira, M M

2005-03-01

Blooming time is one of the most important agronomic traits in almond. Biochemical and molecular events underlying flowering regulation must be understood before methods to stimulate late flowering can be developed. Attempts to elucidate the genetic control of this process have led to the identification of a major gene (Lb) and quantitative trait loci (QTLs) linked to observed phenotypic differences, but although this gene and these QTLs have been placed on the Prunus reference genetic map, their sequences and specific functions remain unknown. The aim of our investigation was to associate these loci with known genes using a candidate gene approach. Two almond cDNAs and eight Prunus expressed sequence tags were selected as candidate genes (CGs) since their sequences were highly identical to those of flowering regulatory genes characterized in other species. The CGs were amplified from both parental lines of the mapping population using specific primers. Sequence comparison revealed DNA polymorphisms between the parental lines, mainly of the single nucleotide type. Polymorphisms were used to develop co-dominant cleaved amplified polymorphic sequence markers or length polymorphisms based on insertion/deletion events for mapping the candidate genes on the Prunus reference map. Ten candidate genes were assigned to six linkage groups in the Prunus genome. The positions of two of these were compatible with the regions where two QTLs for blooming time were detected. One additional candidate was localized close to the position of the Evergrowing gene, which determines a non-deciduous behaviour in peach.

The genome sequence of taurine cattle: a window to ruminant biology and evolution.

PubMed

Elsik, Christine G; Tellam, Ross L; Worley, Kim C; Gibbs, Richard A; Muzny, Donna M; Weinstock, George M; Adelson, David L; Eichler, Evan E; Elnitski, Laura; Guigó, Roderic; Hamernik, Debora L; Kappes, Steve M; Lewin, Harris A; Lynn, David J; Nicholas, Frank W; Reymond, Alexandre; Rijnkels, Monique; Skow, Loren C; Zdobnov, Evgeny M; Schook, Lawrence; Womack, James; Alioto, Tyler; Antonarakis, Stylianos E; Astashyn, Alex; Chapple, Charles E; Chen, Hsiu-Chuan; Chrast, Jacqueline; Câmara, Francisco; Ermolaeva, Olga; Henrichsen, Charlotte N; Hlavina, Wratko; Kapustin, Yuri; Kiryutin, Boris; Kitts, Paul; Kokocinski, Felix; Landrum, Melissa; Maglott, Donna; Pruitt, Kim; Sapojnikov, Victor; Searle, Stephen M; Solovyev, Victor; Souvorov, Alexandre; Ucla, Catherine; Wyss, Carine; Anzola, Juan M; Gerlach, Daniel; Elhaik, Eran; Graur, Dan; Reese, Justin T; Edgar, Robert C; McEwan, John C; Payne, Gemma M; Raison, Joy M; Junier, Thomas; Kriventseva, Evgenia V; Eyras, Eduardo; Plass, Mireya; Donthu, Ravikiran; Larkin, Denis M; Reecy, James; Yang, Mary Q; Chen, Lin; Cheng, Ze; Chitko-McKown, Carol G; Liu, George E; Matukumalli, Lakshmi K; Song, Jiuzhou; Zhu, Bin; Bradley, Daniel G; Brinkman, Fiona S L; Lau, Lilian P L; Whiteside, Matthew D; Walker, Angela; Wheeler, Thomas T; Casey, Theresa; German, J Bruce; Lemay, Danielle G; Maqbool, Nauman J; Molenaar, Adrian J; Seo, Seongwon; Stothard, Paul; Baldwin, Cynthia L; Baxter, Rebecca; Brinkmeyer-Langford, Candice L; Brown, Wendy C; Childers, Christopher P; Connelley, Timothy; Ellis, Shirley A; Fritz, Krista; Glass, Elizabeth J; Herzig, Carolyn T A; Iivanainen, Antti; Lahmers, Kevin K; Bennett, Anna K; Dickens, C Michael; Gilbert, James G R; Hagen, Darren E; Salih, Hanni; Aerts, Jan; Caetano, Alexandre R; Dalrymple, Brian; Garcia, Jose Fernando; Gill, Clare A; Hiendleder, Stefan G; Memili, Erdogan; Spurlock, Diane; Williams, John L; Alexander, Lee; Brownstein, Michael J; Guan, Leluo; Holt, Robert A; Jones, Steven J M; Marra, Marco A; Moore, Richard; Moore, Stephen S; Roberts, Andy; Taniguchi, Masaaki; Waterman, Richard C; Chacko, Joseph; Chandrabose, Mimi M; Cree, Andy; Dao, Marvin Diep; Dinh, Huyen H; Gabisi, Ramatu Ayiesha; Hines, Sandra; Hume, Jennifer; Jhangiani, Shalini N; Joshi, Vandita; Kovar, Christie L; Lewis, Lora R; Liu, Yih-Shin; Lopez, John; Morgan, Margaret B; Nguyen, Ngoc Bich; Okwuonu, Geoffrey O; Ruiz, San Juana; Santibanez, Jireh; Wright, Rita A; Buhay, Christian; Ding, Yan; Dugan-Rocha, Shannon; Herdandez, Judith; Holder, Michael; Sabo, Aniko; Egan, Amy; Goodell, Jason; Wilczek-Boney, Katarzyna; Fowler, Gerald R; Hitchens, Matthew Edward; Lozado, Ryan J; Moen, Charles; Steffen, David; Warren, James T; Zhang, Jingkun; Chiu, Readman; Schein, Jacqueline E; Durbin, K James; Havlak, Paul; Jiang, Huaiyang; Liu, Yue; Qin, Xiang; Ren, Yanru; Shen, Yufeng; Song, Henry; Bell, Stephanie Nicole; Davis, Clay; Johnson, Angela Jolivet; Lee, Sandra; Nazareth, Lynne V; Patel, Bella Mayurkumar; Pu, Ling-Ling; Vattathil, Selina; Williams, Rex Lee; Curry, Stacey; Hamilton, Cerissa; Sodergren, Erica; Wheeler, David A; Barris, Wes; Bennett, Gary L; Eggen, André; Green, Ronnie D; Harhay, Gregory P; Hobbs, Matthew; Jann, Oliver; Keele, John W; Kent, Matthew P; Lien, Sigbjørn; McKay, Stephanie D; McWilliam, Sean; Ratnakumar, Abhirami; Schnabel, Robert D; Smith, Timothy; Snelling, Warren M; Sonstegard, Tad S; Stone, Roger T; Sugimoto, Yoshikazu; Takasuga, Akiko; Taylor, Jeremy F; Van Tassell, Curtis P; Macneil, Michael D; Abatepaulo, Antonio R R; Abbey, Colette A; Ahola, Virpi; Almeida, Iassudara G; Amadio, Ariel F; Anatriello, Elen; Bahadue, Suria M; Biase, Fernando H; Boldt, Clayton R; Carroll, Jeffery A; Carvalho, Wanessa A; Cervelatti, Eliane P; Chacko, Elsa; Chapin, Jennifer E; Cheng, Ye; Choi, Jungwoo; Colley, Adam J; de Campos, Tatiana A; De Donato, Marcos; Santos, Isabel K F de Miranda; de Oliveira, Carlo J F; Deobald, Heather; Devinoy, Eve; Donohue, Kaitlin E; Dovc, Peter; Eberlein, Annett; Fitzsimmons, Carolyn J; Franzin, Alessandra M; Garcia, Gustavo R; Genini, Sem; Gladney, Cody J; Grant, Jason R; Greaser, Marion L; Green, Jonathan A; Hadsell, Darryl L; Hakimov, Hatam A; Halgren, Rob; Harrow, Jennifer L; Hart, Elizabeth A; Hastings, Nicola; Hernandez, Marta; Hu, Zhi-Liang; Ingham, Aaron; Iso-Touru, Terhi; Jamis, Catherine; Jensen, Kirsty; Kapetis, Dimos; Kerr, Tovah; Khalil, Sari S; Khatib, Hasan; Kolbehdari, Davood; Kumar, Charu G; Kumar, Dinesh; Leach, Richard; Lee, Justin C-M; Li, Changxi; Logan, Krystin M; Malinverni, Roberto; Marques, Elisa; Martin, William F; Martins, Natalia F; Maruyama, Sandra R; Mazza, Raffaele; McLean, Kim L; Medrano, Juan F; Moreno, Barbara T; Moré, Daniela D; Muntean, Carl T; Nandakumar, Hari P; Nogueira, Marcelo F G; Olsaker, Ingrid; Pant, Sameer D; Panzitta, Francesca; Pastor, Rosemeire C P; Poli, Mario A; Poslusny, Nathan; Rachagani, Satyanarayana; Ranganathan, Shoba; Razpet, Andrej; Riggs, Penny K; Rincon, Gonzalo; Rodriguez-Osorio, Nelida; Rodriguez-Zas, Sandra L; Romero, Natasha E; Rosenwald, Anne; Sando, Lillian; Schmutz, Sheila M; Shen, Libing; Sherman, Laura; Southey, Bruce R; Lutzow, Ylva Strandberg; Sweedler, Jonathan V; Tammen, Imke; Telugu, Bhanu Prakash V L; Urbanski, Jennifer M; Utsunomiya, Yuri T; Verschoor, Chris P; Waardenberg, Ashley J; Wang, Zhiquan; Ward, Robert; Weikard, Rosemarie; Welsh, Thomas H; White, Stephen N; Wilming, Laurens G; Wunderlich, Kris R; Yang, Jianqi; Zhao, Feng-Qi

2009-04-24

To understand the biology and evolution of ruminants, the cattle genome was sequenced to about sevenfold coverage. The cattle genome contains a minimum of 22,000 genes, with a core set of 14,345 orthologs shared among seven mammalian species of which 1217 are absent or undetected in noneutherian (marsupial or monotreme) genomes. Cattle-specific evolutionary breakpoint regions in chromosomes have a higher density of segmental duplications, enrichment of repetitive elements, and species-specific variations in genes associated with lactation and immune responsiveness. Genes involved in metabolism are generally highly conserved, although five metabolic genes are deleted or extensively diverged from their human orthologs. The cattle genome sequence thus provides a resource for understanding mammalian evolution and accelerating livestock genetic improvement for milk and meat production.

Mining biological databases for candidate disease genes

NASA Astrophysics Data System (ADS)

Braun, Terry A.; Scheetz, Todd; Webster, Gregg L.; Casavant, Thomas L.

2001-07-01

The publicly-funded effort to sequence the complete nucleotide sequence of the human genome, the Human Genome Project (HGP), has currently produced more than 93% of the 3 billion nucleotides of the human genome into a preliminary `draft' format. In addition, several valuable sources of information have been developed as direct and indirect results of the HGP. These include the sequencing of model organisms (rat, mouse, fly, and others), gene discovery projects (ESTs and full-length), and new technologies such as expression analysis and resources (micro-arrays or gene chips). These resources are invaluable for the researchers identifying the functional genes of the genome that transcribe and translate into the transcriptome and proteome, both of which potentially contain orders of magnitude more complexity than the genome itself. Preliminary analyses of this data identified approximately 30,000 - 40,000 human `genes.' However, the bulk of the effort still remains -- to identify the functional and structural elements contained within the transcriptome and proteome, and to associate function in the transcriptome and proteome to genes. A fortuitous consequence of the HGP is the existence of hundreds of databases containing biological information that may contain relevant data pertaining to the identification of disease-causing genes. The task of mining these databases for information on candidate genes is a commercial application of enormous potential. We are developing a system to acquire and mine data from specific databases to aid our efforts to identify disease genes. A high speed cluster of Linux of workstations is used to analyze sequence and perform distributed sequence alignments as part of our data mining and processing. This system has been used to mine GeneMap99 sequences within specific genomic intervals to identify potential candidate disease genes associated with Bardet-Biedle Syndrome (BBS).

Novel Mutations in pncA Gene of Pyrazinamide Resistant Clinical Isolates of Mycobacterium tuberculosis.

PubMed

Kahbazi, Manijeh; Sarmadian, Hossein; Ahmadi, Azam; Didgar, Farshideh; Sadrnia, Maryam; Poolad, Toktam; Arjomandzadegan, Mohammad

2018-04-16

In clinical isolates of Mycobacterium tuberculosis (MTB), resistance to pyrazinamide occurs by mutations in any positions of the pncA gene (NC_000962.3) especially in nucleotides 359 and 374. In this study we examined the pncA gene sequence in clinical isolates of MTB. Genomic DNA of 33 clinical isolates of MTB was extracted by the Chelex100 method. The polymerase chain reactions (PCR) were performed using specific primers for amplification of 744 bp amplicon comprising the coding sequences (CDS) of the pncA gene. PCR products were sequenced by an automated sequencing Bioscience system. Additionally, semi Nested-allele specific (sNASP) and polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) methods were carried out for verification of probable mutations in nucleotides 359 and 374. Sequencing results showed that from 33 MTB clinical isolates, nine pyrazinamide-resistant isolates have mutations. Furthermore, no mutation was detected in 24 susceptible strains in the entire 561 bp of the pncA gene. Moreover, new mutations of G→A at position 3 of the pncA gene were identified in some of the resistant isolates. Results showed that the sNASP method could detect mutations in nucleotide 359 and 374 of the pncA gene, but the PCR-RFLP method by the SacII enzyme could not detect these mutations. In conclusion, the identification of new mutations in the pncA gene confirmed the probable occurrence of mutations in any nucleotides of the pncA gene sequence in resistant isolates of MTB.

Whole exome sequencing is an efficient, sensitive and specific method for determining the genetic cause of short-rib thoracic dystrophies.

PubMed

McInerney-Leo, A M; Harris, J E; Leo, P J; Marshall, M S; Gardiner, B; Kinning, E; Leong, H Y; McKenzie, F; Ong, W P; Vodopiutz, J; Wicking, C; Brown, M A; Zankl, A; Duncan, E L

2015-12-01

Short-rib thoracic dystrophies (SRTDs) are congenital disorders due to defects in primary cilium function. SRTDs are recessively inherited with mutations identified in 14 genes to date (comprising 398 exons). Conventional mutation detection (usually by iterative Sanger sequencing) is inefficient and expensive, and often not undertaken. Whole exome massive parallel sequencing has been used to identify new genes for SRTD (WDR34, WDR60 and IFT172); however, the clinical utility of whole exome sequencing (WES) has not been established. WES was performed in 11 individuals with SRTDs. Compound heterozygous or homozygous mutations were identified in six confirmed SRTD genes in 10 individuals (IFT172, DYNC2H1, TTC21B, WDR60, WDR34 and NEK1), giving overall sensitivity of 90.9%. WES data from 993 unaffected individuals sequenced using similar technology showed two individuals with rare (minor allele frequency <0.005) compound heterozygous variants of unknown significance in SRTD genes (specificity >99%). Costs for consumables, laboratory processing and bioinformatic analysis were

Rapid bursts of androgen-binding protein (Abp) gene duplication occurred independently in diverse mammals

PubMed Central

2008-01-01

Background The draft mouse (Mus musculus) genome sequence revealed an unexpected proliferation of gene duplicates encoding a family of secretoglobin proteins including the androgen-binding protein (ABP) α, β and γ subunits. Further investigation of 14 α-like (Abpa) and 13 β- or γ-like (Abpbg) undisrupted gene sequences revealed a rich diversity of developmental stage-, sex- and tissue-specific expression. Despite these studies, our understanding of the evolution of this gene family remains incomplete. Questions arise from imperfections in the initial mouse genome assembly and a dearth of information about the gene family structure in other rodents and mammals. Results Here, we interrogate the latest 'finished' mouse (Mus musculus) genome sequence assembly to show that the Abp gene repertoire is, in fact, twice as large as reported previously, with 30 Abpa and 34 Abpbg genes and pseudogenes. All of these have arisen since the last common ancestor with rat (Rattus norvegicus). We then demonstrate, by sequencing homologs from species within the Mus genus, that this burst of gene duplication occurred very recently, within the past seven million years. Finally, we survey Abp orthologs in genomes from across the mammalian clade and show that bursts of Abp gene duplications are not specific to the murid rodents; they also occurred recently in the lagomorph (rabbit, Oryctolagus cuniculus) and ruminant (cattle, Bos taurus) lineages, although not in other mammalian taxa. Conclusion We conclude that Abp genes have undergone repeated bursts of gene duplication and adaptive sequence diversification driven by these genes' participation in chemosensation and/or sexual identification. PMID:18269759

Rapid bursts of androgen-binding protein (Abp) gene duplication occurred independently in diverse mammals.

PubMed

Laukaitis, Christina M; Heger, Andreas; Blakley, Tyler D; Munclinger, Pavel; Ponting, Chris P; Karn, Robert C

2008-02-12

The draft mouse (Mus musculus) genome sequence revealed an unexpected proliferation of gene duplicates encoding a family of secretoglobin proteins including the androgen-binding protein (ABP) alpha, beta and gamma subunits. Further investigation of 14 alpha-like (Abpa) and 13 beta- or gamma-like (Abpbg) undisrupted gene sequences revealed a rich diversity of developmental stage-, sex- and tissue-specific expression. Despite these studies, our understanding of the evolution of this gene family remains incomplete. Questions arise from imperfections in the initial mouse genome assembly and a dearth of information about the gene family structure in other rodents and mammals. Here, we interrogate the latest 'finished' mouse (Mus musculus) genome sequence assembly to show that the Abp gene repertoire is, in fact, twice as large as reported previously, with 30 Abpa and 34 Abpbg genes and pseudogenes. All of these have arisen since the last common ancestor with rat (Rattus norvegicus). We then demonstrate, by sequencing homologs from species within the Mus genus, that this burst of gene duplication occurred very recently, within the past seven million years. Finally, we survey Abp orthologs in genomes from across the mammalian clade and show that bursts of Abp gene duplications are not specific to the murid rodents; they also occurred recently in the lagomorph (rabbit, Oryctolagus cuniculus) and ruminant (cattle, Bos taurus) lineages, although not in other mammalian taxa. We conclude that Abp genes have undergone repeated bursts of gene duplication and adaptive sequence diversification driven by these genes' participation in chemosensation and/or sexual identification.

Development of unidentified dna-specific hif 1α gene of lizard (hemidactylus platyurus) which plays a role in tissue regeneration process

NASA Astrophysics Data System (ADS)

Novianti, T.; Sadikin, M.; Widia, S.; Juniantito, V.; Arida, E. A.

2018-03-01

Development of unidentified specific gene is essential to analyze the availability these genes in biological process. Identification unidentified specific DNA of HIF 1α genes is important to analyze their contribution in tissue regeneration process in lizard tail (Hemidactylus platyurus). Bioinformatics and PCR techniques are relatively an easier method to identify an unidentified gene. The most widely used method is BLAST (Basic Local Alignment Sequence Tools) method for alignment the sequences from the other organism. BLAST technique is online software from website https://blast.ncbi.nlm.nih.gov/Blast.cgi that capable to generate the similar sequences from closest kinship to distant kindship. Gecko japonicus is a species that it has closest kinship with H. platyurus. Comparing HIF 1 α gene sequence of G. japonicus with the other species used multiple alignment methods from Mega7 software. Conserved base areas were identified using Clustal IX method. Primary DNA of HIF 1 α gene was design by Primer3 software. HIF 1α gene of lizard (H. platyurus) was successfully amplified using a real-time PCR machine by primary DNA that we had designed from Gecko japonicus. Identification unidentified gene of HIF 1a lizard has been done successfully with multiple alignment method. The study was conducted by analyzing during the growth of tail on day 1, 3, 5, 7, 10, 13 and 17 of lizard tail after autotomy. Process amplification of HIF 1α gene was described by CT value in real time PCR machine. HIF 1α expression of gene is quantified by Livak formula. Chi-square statistic test is 0.000 which means that there is a different expression of HIF 1 α gene in every growth day treatment.

Genome-wide identification of lineage-specific genes in Arabidopsis, Oryza and Populus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yang, Xiaohan; Jawdy, Sara; Tschaplinski, Timothy J

2009-01-01

Protein sequences were compared among Arabidopsis, Oryza and Populus to identify differential gene (DG) sets that are in one but not the other two genomes. The DG sets were screened against a plant transcript database, the NR protein database and six newly-sequenced genomes (Carica, Glycine, Medicago, Sorghum, Vitis and Zea) to identify a set of species-specific genes (SS). Gene expression, protein motif and intron number were examined. 192, 641 and 109 SS genes were identified in Arabidopsis, Oryza and Populus, respectively. Some SS genes were preferentially expressed in flowers, roots, xylem and cambium or up-regulated by stress. Six conserved motifsmore » in Arabidopsis and Oryza SS proteins were found in other distant lineages. The SS gene sets were enriched with intronless genes. The results reflect functional and/or anatomical differences between monocots and eudicots or between herbaceous and woody plants. The Populus-specific genes are candidates for carbon sequestration and biofuel research.« less

Identification and characterization of cell-specific enhancer elements for the mouse ETF/Tead2 gene.

PubMed

Tanoue, Y; Yasunami, M; Suzuki, K; Ohkubo, H

2001-12-21

We have identified and characterized by transient transfection assays the cell-specific 117-bp enhancer sequence in the first intron of the mouse ETF (Embryonic TEA domain-containing factor)/Tead2 gene required for transcriptional activation in ETF/Tead2 gene-expressing cells, such as P19 cells. The 117-bp enhancer contains one GC-rich sequence (5'-GGGGCGGGG-3'), termed the GC box, and two tandemly repeated GA-rich sequences (5'-GGGGGAGGGG-3'), termed the proximal and distal GA elements. Further analyses, including transfection studies and electrophoretic mobility shift assays using a series of deletion and mutation constructs, indicated that Sp1, a putative activator, may be required to predominate over its competition with another unknown putative repressor, termed the GA element-binding factor, for binding to both the GC box, which overlapped with the proximal GA element, and the distal GA element in the 117-bp sequence in order to achieve a full enhancer activity. We also discuss a possible mechanism underlying the cell-specific enhancer activity of the 117-bp sequence.

Gene structure of CYP3A4, an adult-specific form of cytochrome P450 in human livers, and its transcriptional control.

PubMed

Hashimoto, H; Toide, K; Kitamura, R; Fujita, M; Tagawa, S; Itoh, S; Kamataki, T

1993-12-01

CYP3 A4 is the adult-specific form of cytochrome P450 in human livers [Komori, M., Nishio, K., Kitada, M., Shiramatsu, K., Muroya, K., Soma, M., Nagashima, K. & Kamataki, T. (1990) Biochemistry 29, 4430-4433]. The sequences of three genomic clones for CYP3A4 were analyzed for all exons, exon-intron junctions and the 5'-flanking region from the major transcription site to nucleotide position -1105, and compared with those of the CYP3A7 gene, a fetal-specific form of cytochrome P450 in humans. The results showed that the identity of 5'-flanking sequences between CYP3A4 and CYP3A7 genes was 91%, and that each 5'-flanking region had characteristic sequences termed as NFSE (P450NF-specific element) and HFLaSE (P450HFLa specific element), respectively. A basic transcription element (BTE) also lay in the 5'-flanking region of the CYP3A4 gene as seen in many CYP genes [Yanagida, A., Sogawa, K., Yasumoto, K. & Fujii-Kuriyama, Y. (1990) Mol. Cell. Biol. 10, 1470-1475]. The BTE binding factor (BTEB) was present in both adult and fetal human livers. To examine the transcriptional activity of the CYP3A4 gene, DNA fragments in the 5'-flanking region of the gene were inserted in front of the simian virus 40 promoter and the chloramphenicol acetyltransferase structural gene, and the constructs were transfected in HepG2 cells. The analysis of the chloramphenicol acetyltransferase activity indicated that (a) specific element(s) which could bind with a factor(s) in livers was present in the 5'-flanking region of the CYP3A4 gene to show the transcriptional activity.

Evolution of the alternative AQP2 gene: Acquisition of a novel protein-coding sequence in dolphins.

PubMed

Kishida, Takushi; Suzuki, Miwa; Takayama, Asuka

2018-01-01

Taxon-specific de novo protein-coding sequences are thought to be important for taxon-specific environmental adaptation. A recent study revealed that bottlenose dolphins acquired a novel isoform of aquaporin 2 generated by alternative splicing (alternative AQP2), which helps dolphins to live in hyperosmotic seawater. The AQP2 gene consists of four exons, but the alternative AQP2 gene lacks the fourth exon and instead has a longer third exon that includes the original third exon and a part of the original third intron. Here, we show that the latter half of the third exon of the alternative AQP2 arose from a non-protein-coding sequence. Intact ORF of this de novo sequence is shared not by all cetaceans, but only by delphinoids. However, this sequence is conservative in all modern cetaceans, implying that this de novo sequence potentially plays important roles for marine adaptation in cetaceans. Copyright © 2017 Elsevier Inc. All rights reserved.

Versatile Gene-Specific Sequence Tags for Arabidopsis Functional Genomics: Transcript Profiling and Reverse Genetics Applications

PubMed Central

Hilson, Pierre; Allemeersch, Joke; Altmann, Thomas; Aubourg, Sébastien; Avon, Alexandra; Beynon, Jim; Bhalerao, Rishikesh P.; Bitton, Frédérique; Caboche, Michel; Cannoot, Bernard; Chardakov, Vasil; Cognet-Holliger, Cécile; Colot, Vincent; Crowe, Mark; Darimont, Caroline; Durinck, Steffen; Eickhoff, Holger; de Longevialle, Andéol Falcon; Farmer, Edward E.; Grant, Murray; Kuiper, Martin T.R.; Lehrach, Hans; Léon, Céline; Leyva, Antonio; Lundeberg, Joakim; Lurin, Claire; Moreau, Yves; Nietfeld, Wilfried; Paz-Ares, Javier; Reymond, Philippe; Rouzé, Pierre; Sandberg, Goran; Segura, Maria Dolores; Serizet, Carine; Tabrett, Alexandra; Taconnat, Ludivine; Thareau, Vincent; Van Hummelen, Paul; Vercruysse, Steven; Vuylsteke, Marnik; Weingartner, Magdalena; Weisbeek, Peter J.; Wirta, Valtteri; Wittink, Floyd R.A.; Zabeau, Marc; Small, Ian

2004-01-01

Microarray transcript profiling and RNA interference are two new technologies crucial for large-scale gene function studies in multicellular eukaryotes. Both rely on sequence-specific hybridization between complementary nucleic acid strands, inciting us to create a collection of gene-specific sequence tags (GSTs) representing at least 21,500 Arabidopsis genes and which are compatible with both approaches. The GSTs were carefully selected to ensure that each of them shared no significant similarity with any other region in the Arabidopsis genome. They were synthesized by PCR amplification from genomic DNA. Spotted microarrays fabricated from the GSTs show good dynamic range, specificity, and sensitivity in transcript profiling experiments. The GSTs have also been transferred to bacterial plasmid vectors via recombinational cloning protocols. These cloned GSTs constitute the ideal starting point for a variety of functional approaches, including reverse genetics. We have subcloned GSTs on a large scale into vectors designed for gene silencing in plant cells. We show that in planta expression of GST hairpin RNA results in the expected phenotypes in silenced Arabidopsis lines. These versatile GST resources provide novel and powerful tools for functional genomics. PMID:15489341

Regularized rare variant enrichment analysis for case-control exome sequencing data.

PubMed

Larson, Nicholas B; Schaid, Daniel J

2014-02-01

Rare variants have recently garnered an immense amount of attention in genetic association analysis. However, unlike methods traditionally used for single marker analysis in GWAS, rare variant analysis often requires some method of aggregation, since single marker approaches are poorly powered for typical sequencing study sample sizes. Advancements in sequencing technologies have rendered next-generation sequencing platforms a realistic alternative to traditional genotyping arrays. Exome sequencing in particular not only provides base-level resolution of genetic coding regions, but also a natural paradigm for aggregation via genes and exons. Here, we propose the use of penalized regression in combination with variant aggregation measures to identify rare variant enrichment in exome sequencing data. In contrast to marginal gene-level testing, we simultaneously evaluate the effects of rare variants in multiple genes, focusing on gene-based least absolute shrinkage and selection operator (LASSO) and exon-based sparse group LASSO models. By using gene membership as a grouping variable, the sparse group LASSO can be used as a gene-centric analysis of rare variants while also providing a penalized approach toward identifying specific regions of interest. We apply extensive simulations to evaluate the performance of these approaches with respect to specificity and sensitivity, comparing these results to multiple competing marginal testing methods. Finally, we discuss our findings and outline future research. © 2013 WILEY PERIODICALS, INC.

FlyPrimerBank: An Online Database for Drosophila melanogaster Gene Expression Analysis and Knockdown Evaluation of RNAi Reagents

PubMed Central

Hu, Yanhui; Sopko, Richelle; Foos, Marianna; Kelley, Colleen; Flockhart, Ian; Ammeux, Noemie; Wang, Xiaowei; Perkins, Lizabeth; Perrimon, Norbert; Mohr, Stephanie E.

2013-01-01

The evaluation of specific endogenous transcript levels is important for understanding transcriptional regulation. More specifically, it is useful for independent confirmation of results obtained by the use of microarray analysis or RNA-seq and for evaluating RNA interference (RNAi)-mediated gene knockdown. Designing specific and effective primers for high-quality, moderate-throughput evaluation of transcript levels, i.e., quantitative, real-time PCR (qPCR), is nontrivial. To meet community needs, predefined qPCR primer pairs for mammalian genes have been designed and sequences made available, e.g., via PrimerBank. In this work, we adapted and refined the algorithms used for the mammalian PrimerBank to design 45,417 primer pairs for 13,860 Drosophila melanogaster genes, with three or more primer pairs per gene. We experimentally validated primer pairs for ~300 randomly selected genes expressed in early Drosophila embryos, using SYBR Green-based qPCR and sequence analysis of products derived from conventional PCR. All relevant information, including primer sequences, isoform specificity, spatial transcript targeting, and any available validation results and/or user feedback, is available from an online database (www.flyrnai.org/flyprimerbank). At FlyPrimerBank, researchers can retrieve primer information for fly genes either one gene at a time or in batch mode. Importantly, we included the overlap of each predicted amplified sequence with RNAi reagents from several public resources, making it possible for researchers to choose primers suitable for knockdown evaluation of RNAi reagents (i.e., to avoid amplification of the RNAi reagent itself). We demonstrate the utility of this resource for validation of RNAi reagents in vivo. PMID:23893746

Comparative Genomics of Completely Sequenced Lactobacillus helveticus Genomes Provides Insights into Strain-Specific Genes and Resolves Metagenomics Data Down to the Strain Level.

PubMed

Schmid, Michael; Muri, Jonathan; Melidis, Damianos; Varadarajan, Adithi R; Somerville, Vincent; Wicki, Adrian; Moser, Aline; Bourqui, Marc; Wenzel, Claudia; Eugster-Meier, Elisabeth; Frey, Juerg E; Irmler, Stefan; Ahrens, Christian H

2018-01-01

Although complete genome sequences hold particular value for an accurate description of core genomes, the identification of strain-specific genes, and as the optimal basis for functional genomics studies, they are still largely underrepresented in public repositories. Based on an assessment of the genome assembly complexity for all lactobacilli, we used Pacific Biosciences' long read technology to sequence and de novo assemble the genomes of three Lactobacillus helveticus starter strains, raising the number of completely sequenced strains to 12. The first comparative genomics study for L. helveticus -to our knowledge-identified a core genome of 988 genes and sets of unique, strain-specific genes ranging from about 30 to more than 200 genes. Importantly, the comparison of MiSeq- and PacBio-based assemblies uncovered that not only accessory but also core genes can be missed in incomplete genome assemblies based on short reads. Analysis of the three genomes revealed that a large number of pseudogenes were enriched for functional Gene Ontology categories such as amino acid transmembrane transport and carbohydrate metabolism, which is in line with a reductive genome evolution in the rich natural habitat of L. helveticus . Notably, the functional Clusters of Orthologous Groups of proteins categories "cell wall/membrane biogenesis" and "defense mechanisms" were found to be enriched among the strain-specific genes. A genome mining effort uncovered examples where an experimentally observed phenotype could be linked to the underlying genotype, such as for cell envelope proteinase PrtH3 of strain FAM8627. Another possible link identified for peptidoglycan hydrolases will require further experiments. Of note, strain FAM22155 did not harbor a CRISPR/Cas system; its loss was also observed in other L. helveticus strains and lactobacillus species, thus questioning the value of the CRISPR/Cas system for diagnostic purposes. Importantly, the complete genome sequences proved to be very useful for the analysis of natural whey starter cultures with metagenomics, as a larger percentage of the sequenced reads of these complex mixtures could be unambiguously assigned down to the strain level.

Comparative Genomics of Completely Sequenced Lactobacillus helveticus Genomes Provides Insights into Strain-Specific Genes and Resolves Metagenomics Data Down to the Strain Level

PubMed Central

Schmid, Michael; Muri, Jonathan; Melidis, Damianos; Varadarajan, Adithi R.; Somerville, Vincent; Wicki, Adrian; Moser, Aline; Bourqui, Marc; Wenzel, Claudia; Eugster-Meier, Elisabeth; Frey, Juerg E.; Irmler, Stefan; Ahrens, Christian H.

2018-01-01

Although complete genome sequences hold particular value for an accurate description of core genomes, the identification of strain-specific genes, and as the optimal basis for functional genomics studies, they are still largely underrepresented in public repositories. Based on an assessment of the genome assembly complexity for all lactobacilli, we used Pacific Biosciences' long read technology to sequence and de novo assemble the genomes of three Lactobacillus helveticus starter strains, raising the number of completely sequenced strains to 12. The first comparative genomics study for L. helveticus—to our knowledge—identified a core genome of 988 genes and sets of unique, strain-specific genes ranging from about 30 to more than 200 genes. Importantly, the comparison of MiSeq- and PacBio-based assemblies uncovered that not only accessory but also core genes can be missed in incomplete genome assemblies based on short reads. Analysis of the three genomes revealed that a large number of pseudogenes were enriched for functional Gene Ontology categories such as amino acid transmembrane transport and carbohydrate metabolism, which is in line with a reductive genome evolution in the rich natural habitat of L. helveticus. Notably, the functional Clusters of Orthologous Groups of proteins categories “cell wall/membrane biogenesis” and “defense mechanisms” were found to be enriched among the strain-specific genes. A genome mining effort uncovered examples where an experimentally observed phenotype could be linked to the underlying genotype, such as for cell envelope proteinase PrtH3 of strain FAM8627. Another possible link identified for peptidoglycan hydrolases will require further experiments. Of note, strain FAM22155 did not harbor a CRISPR/Cas system; its loss was also observed in other L. helveticus strains and lactobacillus species, thus questioning the value of the CRISPR/Cas system for diagnostic purposes. Importantly, the complete genome sequences proved to be very useful for the analysis of natural whey starter cultures with metagenomics, as a larger percentage of the sequenced reads of these complex mixtures could be unambiguously assigned down to the strain level. PMID:29441050

Co-regulation of the atrial natriuretic factor and cardiac myosin light chain-2 genes during alpha-adrenergic stimulation of neonatal rat ventricular cells. Identification of cis sequences within an embryonic and a constitutive contractile protein gene which mediate inducible expression.

PubMed

Knowlton, K U; Baracchini, E; Ross, R S; Harris, A N; Henderson, S A; Evans, S M; Glembotski, C C; Chien, K R

1991-04-25

To study the mechanisms which mediate the transcriptional activation of cardiac genes during alpha adrenergic stimulation, the present study examined the regulated expression of three cardiac genes, a ventricular embryonic gene (atrial natriuretic factor, ANF), a constitutively expressed contractile protein gene (cardiac MLC-2), and a cardiac sodium channel gene. alpha 1-Adrenergic stimulation activates the expression and release of ANF from neonatal ventricular cells. As assessed by RNase protection analyses, treatment with alpha-adrenergic agonists increases the steady-state levels of ANF mRNA by greater than 15-fold. However, a rat cardiac sodium channel gene mRNA is not induced, indicating that alpha-adrenergic stimulation does not lead to an increase in the expression of all cardiac genes. Studies employing a series of rat ANF luciferase and rat MLC-2 luciferase fusion genes identify 315- and 92-base pair cis regulatory sequences within an embryonic gene (ANF) and a constitutively expressed contractile protein gene (MLC-2), respectively, which mediate alpha-adrenergic-inducible gene expression. Transfection of various ANF luciferase reporters into neonatal rat ventricular cells demonstrated that upstream sequences which mediate tissue-specific expression (-3003 to -638) can be segregated from those responsible for inducibility. The lack of inducibility of a cardiac Na+ channel gene, and the segregation of ANF gene sequences which mediate cardiac specific from those which mediate inducible expression, provides further insight into the relationship between muscle-specific and inducible expression during cardiac myocyte hypertrophy. Based on these results, a testable model is proposed for the induction of embryonic cardiac genes and constitutively expressed contractile protein genes and the noninducibility of a subset of cardiac genes during alpha-adrenergic stimulation of neonatal rat ventricular cells.

Promoter mapping of the mouse Tcp-10bt gene in transgenic mice identifies essential male germ cell regulatory sequences.

PubMed

Ewulonu, U K; Snyder, L; Silver, L M; Schimenti, J C

1996-03-01

Transgenic mice were generated to localize essential promoter elements in the mouse testis-expressed Tcp-10 genes. These genes are expressed exclusively in male germ cells, and exhibit a diffuse range of transcriptional start sites, possibly due to the absence of a TATA box. A series of transgene constructs containing different amounts of 5' flanking DNA revealed that all sequences necessary for appropriate temporal and tissue-specific transcription of Tcp-10 reside between positions -1 to -973. All transgenic animals containing these sequences expressed a chimeric transgene at high levels, in a pattern that paralleled the endogenous genes. These experiments further defined a 227 bp fragment from -746 to -973 that was absolutely essential for expression. In a gel-shift assay, this 227-bp fragment bound nuclear protein from testis, but not other tissues, to yield two retarded bands. Sequence analysis of this fragment revealed a half-site for the AP-2 transcription factor recognition sequence. Gel shift assays using native or mutant oligonucleotides demonstrated that the putative AP-2 recognition sequence was essential for generating the retarded bands. Since the binding activity is testis-specific, but AP-2 expression is not exclusive to male germ cells, it is possible that transcription of Tcp-10 requires interaction between AP-2 and a germ cell-specific transcription factor.

Identification of Alternative Splicing and Fusion Transcripts in Non-Small Cell Lung Cancer by RNA Sequencing.

PubMed

Hong, Yoonki; Kim, Woo Jin; Bang, Chi Young; Lee, Jae Cheol; Oh, Yeon-Mok

2016-04-01

Lung cancer is the most common cause of cancer related death. Alterations in gene sequence, structure, and expression have an important role in the pathogenesis of lung cancer. Fusion genes and alternative splicing of cancer-related genes have the potential to be oncogenic. In the current study, we performed RNA-sequencing (RNA-seq) to investigate potential fusion genes and alternative splicing in non-small cell lung cancer. RNA was isolated from lung tissues obtained from 86 subjects with lung cancer. The RNA samples from lung cancer and normal tissues were processed with RNA-seq using the HiSeq 2000 system. Fusion genes were evaluated using Defuse and ChimeraScan. Candidate fusion transcripts were validated by Sanger sequencing. Alternative splicing was analyzed using multivariate analysis of transcript sequencing and validated using quantitative real time polymerase chain reaction. RNA-seq data identified oncogenic fusion genes EML4-ALK and SLC34A2-ROS1 in three of 86 normal-cancer paired samples. Nine distinct fusion transcripts were selected using DeFuse and ChimeraScan; of which, four fusion transcripts were validated by Sanger sequencing. In 33 squamous cell carcinoma, 29 tumor specific skipped exon events and six mutually exclusive exon events were identified. ITGB4 and PYCR1 were top genes that showed significant tumor specific splice variants. In conclusion, RNA-seq data identified novel potential fusion transcripts and splice variants. Further evaluation of their functional significance in the pathogenesis of lung cancer is required.

Cloning and sequence analysis of the invertase gene INV 1 from the yeast Pichia anomala.

PubMed

Pérez, J A; Rodríguez, J; Rodríguez, L; Ruiz, T

1996-02-01

A genomic library from the yeast Pichia anomala has been constructed and employed to clone the gene encoding the sucrose-hydrolysing enzyme invertase by complementation of a sucrose non-fermenting mutant of Saccharomyces cerevisiae. The cloned gene, INV1, was sequenced and found to encode a polypeptide of 550 amino acids which contained a 22 amino-acid signal sequence and ten potential glycosylation sites. The amino-acid sequence shows significant identity with other yeast invertases and also with Kluyveromyces marxianus inulinase, a yeast beta-fructofuranosidase which has a different substrate specificity. The nucleotide sequences of the 5' and 3' non-coding regions were found to contain several consensus motifs probably involved in the initiation and termination of gene transcription.

Characterization of the two intra-individual sequence variants in the 18S rRNA gene in the plant parasitic nematode, Rotylenchulus reniformis.

PubMed

Nyaku, Seloame T; Sripathi, Venkateswara R; Kantety, Ramesh V; Gu, Yong Q; Lawrence, Kathy; Sharma, Govind C

2013-01-01

The 18S rRNA gene is fundamental to cellular and organismal protein synthesis and because of its stable persistence through generations it is also used in phylogenetic analysis among taxa. Sequence variation in this gene within a single species is rare, but it has been observed in few metazoan organisms. More frequently it has mostly been reported in the non-transcribed spacer region. Here, we have identified two sequence variants within the near full coding region of 18S rRNA gene from a single reniform nematode (RN) Rotylenchulus reniformis labeled as reniform nematode variant 1 (RN_VAR1) and variant 2 (RN_VAR2). All sequences from three of the four isolates had both RN variants in their sequences; however, isolate 13B had only RN variant 2 sequence. Specific variable base sites (96 or 5.5%) were found within the 18S rRNA gene that can clearly distinguish the two 18S rDNA variants of RN, in 11 (25.0%) and 33 (75.0%) of the 44 RN clones, for RN_VAR1 and RN_VAR2, respectively. Neighbor-joining trees show that the RN_VAR1 is very similar to the previously existing R. reniformis sequence in GenBank, while the RN_VAR2 sequence is more divergent. This is the first report of the identification of two major variants of the 18S rRNA gene in the same single RN, and documents the specific base variation between the two variants, and hypothesizes on simultaneous co-existence of these two variants for this gene.

Characterization of the Two Intra-Individual Sequence Variants in the 18S rRNA Gene in the Plant Parasitic Nematode, Rotylenchulus reniformis

PubMed Central

Nyaku, Seloame T.; Sripathi, Venkateswara R.; Kantety, Ramesh V.; Gu, Yong Q.; Lawrence, Kathy; Sharma, Govind C.

2013-01-01

The 18S rRNA gene is fundamental to cellular and organismal protein synthesis and because of its stable persistence through generations it is also used in phylogenetic analysis among taxa. Sequence variation in this gene within a single species is rare, but it has been observed in few metazoan organisms. More frequently it has mostly been reported in the non-transcribed spacer region. Here, we have identified two sequence variants within the near full coding region of 18S rRNA gene from a single reniform nematode (RN) Rotylenchulus reniformis labeled as reniform nematode variant 1 (RN_VAR1) and variant 2 (RN_VAR2). All sequences from three of the four isolates had both RN variants in their sequences; however, isolate 13B had only RN variant 2 sequence. Specific variable base sites (96 or 5.5%) were found within the 18S rRNA gene that can clearly distinguish the two 18S rDNA variants of RN, in 11 (25.0%) and 33 (75.0%) of the 44 RN clones, for RN_VAR1 and RN_VAR2, respectively. Neighbor-joining trees show that the RN_VAR1 is very similar to the previously existing R. reniformis sequence in GenBank, while the RN_VAR2 sequence is more divergent. This is the first report of the identification of two major variants of the 18S rRNA gene in the same single RN, and documents the specific base variation between the two variants, and hypothesizes on simultaneous co-existence of these two variants for this gene. PMID:23593343

MicroRNAs form triplexes with double stranded DNA at sequence-specific binding sites; a eukaryotic mechanism via which microRNAs could directly alter gene expression

DOE PAGES

Paugh, Steven W.; Coss, David R.; Bao, Ju; ...

2016-02-04

MicroRNAs are important regulators of gene expression, acting primarily by binding to sequence-specific locations on already transcribed messenger RNAs (mRNA). Recent studies indicate that microRNAs may also play a role in up-regulating mRNA transcription levels, although a definitive mechanism has not been established. Double-helical DNA is capable of forming triple-helical structures through Hoogsteen and reverse Hoogsteen interactions in the major groove of the duplex, and we show physical evidence that microRNAs form triple-helical structures with duplex DNA, and identify microRNA sequences that favor triplex formation. We developed an algorithm (Trident) to search genome-wide for potential triplex-forming sites and show thatmore » several mammalian and non-mammalian genomes are enriched for strong microRNA triplex binding sites. We show that those genes containing sequences favoring microRNA triplex formation are markedly enriched (3.3 fold, p<2.2 x 10 -16) for genes whose expression is positively correlated with expression of microRNAs targeting triplex binding sequences. As a result, this work has thus revealed a new mechanism by which microRNAs can interact with gene promoter regions to modify gene transcription.« less

MicroRNAs form triplexes with double stranded DNA at sequence-specific binding sites; a eukaryotic mechanism via which microRNAs could directly alter gene expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Paugh, Steven W.; Coss, David R.; Bao, Ju

MicroRNAs are important regulators of gene expression, acting primarily by binding to sequence-specific locations on already transcribed messenger RNAs (mRNA). Recent studies indicate that microRNAs may also play a role in up-regulating mRNA transcription levels, although a definitive mechanism has not been established. Double-helical DNA is capable of forming triple-helical structures through Hoogsteen and reverse Hoogsteen interactions in the major groove of the duplex, and we show physical evidence that microRNAs form triple-helical structures with duplex DNA, and identify microRNA sequences that favor triplex formation. We developed an algorithm (Trident) to search genome-wide for potential triplex-forming sites and show thatmore » several mammalian and non-mammalian genomes are enriched for strong microRNA triplex binding sites. We show that those genes containing sequences favoring microRNA triplex formation are markedly enriched (3.3 fold, p<2.2 x 10 -16) for genes whose expression is positively correlated with expression of microRNAs targeting triplex binding sequences. As a result, this work has thus revealed a new mechanism by which microRNAs can interact with gene promoter regions to modify gene transcription.« less

Targeted isolation, sequence assembly and characterization of two white spruce (Picea glauca) BAC clones for terpenoid synthase and cytochrome P450 genes involved in conifer defence reveal insights into a conifer genome

PubMed Central

2009-01-01

Background Conifers are a large group of gymnosperm trees which are separated from the angiosperms by more than 300 million years of independent evolution. Conifer genomes are extremely large and contain considerable amounts of repetitive DNA. Currently, conifer sequence resources exist predominantly as expressed sequence tags (ESTs) and full-length (FL)cDNAs. There is no genome sequence available for a conifer or any other gymnosperm. Conifer defence-related genes often group into large families with closely related members. The goals of this study are to assess the feasibility of targeted isolation and sequence assembly of conifer BAC clones containing specific genes from two large gene families, and to characterize large segments of genomic DNA sequence for the first time from a conifer. Results We used a PCR-based approach to identify BAC clones for two target genes, a terpene synthase (3-carene synthase; 3CAR) and a cytochrome P450 (CYP720B4) from a non-arrayed genomic BAC library of white spruce (Picea glauca). Shotgun genomic fragments isolated from the BAC clones were sequenced to a depth of 15.6- and 16.0-fold coverage, respectively. Assembly and manual curation yielded sequence scaffolds of 172 kbp (3CAR) and 94 kbp (CYP720B4) long. Inspection of the genomic sequences revealed the intron-exon structures, the putative promoter regions and putative cis-regulatory elements of these genes. Sequences related to transposable elements (TEs), high complexity repeats and simple repeats were prevalent and comprised approximately 40% of the sequenced genomic DNA. An in silico simulation of the effect of sequencing depth on the quality of the sequence assembly provides direction for future efforts of conifer genome sequencing. Conclusion We report the first targeted cloning, sequencing, assembly, and annotation of large segments of genomic DNA from a conifer. We demonstrate that genomic BAC clones for individual members of multi-member gene families can be isolated in a gene-specific fashion. The results of the present work provide important new information about the structure and content of conifer genomic DNA that will guide future efforts to sequence and assemble conifer genomes. PMID:19656416

Targeted isolation, sequence assembly and characterization of two white spruce (Picea glauca) BAC clones for terpenoid synthase and cytochrome P450 genes involved in conifer defence reveal insights into a conifer genome.

PubMed

Hamberger, Björn; Hall, Dawn; Yuen, Mack; Oddy, Claire; Hamberger, Britta; Keeling, Christopher I; Ritland, Carol; Ritland, Kermit; Bohlmann, Jörg

2009-08-06

Conifers are a large group of gymnosperm trees which are separated from the angiosperms by more than 300 million years of independent evolution. Conifer genomes are extremely large and contain considerable amounts of repetitive DNA. Currently, conifer sequence resources exist predominantly as expressed sequence tags (ESTs) and full-length (FL)cDNAs. There is no genome sequence available for a conifer or any other gymnosperm. Conifer defence-related genes often group into large families with closely related members. The goals of this study are to assess the feasibility of targeted isolation and sequence assembly of conifer BAC clones containing specific genes from two large gene families, and to characterize large segments of genomic DNA sequence for the first time from a conifer. We used a PCR-based approach to identify BAC clones for two target genes, a terpene synthase (3-carene synthase; 3CAR) and a cytochrome P450 (CYP720B4) from a non-arrayed genomic BAC library of white spruce (Picea glauca). Shotgun genomic fragments isolated from the BAC clones were sequenced to a depth of 15.6- and 16.0-fold coverage, respectively. Assembly and manual curation yielded sequence scaffolds of 172 kbp (3CAR) and 94 kbp (CYP720B4) long. Inspection of the genomic sequences revealed the intron-exon structures, the putative promoter regions and putative cis-regulatory elements of these genes. Sequences related to transposable elements (TEs), high complexity repeats and simple repeats were prevalent and comprised approximately 40% of the sequenced genomic DNA. An in silico simulation of the effect of sequencing depth on the quality of the sequence assembly provides direction for future efforts of conifer genome sequencing. We report the first targeted cloning, sequencing, assembly, and annotation of large segments of genomic DNA from a conifer. We demonstrate that genomic BAC clones for individual members of multi-member gene families can be isolated in a gene-specific fashion. The results of the present work provide important new information about the structure and content of conifer genomic DNA that will guide future efforts to sequence and assemble conifer genomes.

Discrimination of germline V genes at different sequencing lengths and mutational burdens: A new tool for identifying and evaluating the reliability of V gene assignment.

PubMed

Zhang, Bochao; Meng, Wenzhao; Prak, Eline T Luning; Hershberg, Uri

2015-12-01

Immune repertoires are collections of lymphocytes that express diverse antigen receptor gene rearrangements consisting of Variable (V), (Diversity (D) in the case of heavy chains) and Joining (J) gene segments. Clonally related cells typically share the same germline gene segments and have highly similar junctional sequences within their third complementarity determining regions. Identifying clonal relatedness of sequences is a key step in the analysis of immune repertoires. The V gene is the most important for clone identification because it has the longest sequence and the greatest number of sequence variants. However, accurate identification of a clone's germline V gene source is challenging because there is a high degree of similarity between different germline V genes. This difficulty is compounded in antibodies, which can undergo somatic hypermutation. Furthermore, high-throughput sequencing experiments often generate partial sequences and have significant error rates. To address these issues, we describe a novel method to estimate which germline V genes (or alleles) cannot be discriminated under different conditions (read lengths, sequencing errors or somatic hypermutation frequencies). Starting with any set of germline V genes, this method measures their similarity using different sequencing lengths and calculates their likelihood of unambiguous assignment under different levels of mutation. Hence, one can identify, under different experimental and biological conditions, the germline V genes (or alleles) that cannot be uniquely identified and bundle them together into groups of specific V genes with highly similar sequences. Copyright © 2015 Elsevier B.V. All rights reserved.

Improving RNA-Seq expression estimation by modeling isoform- and exon-specific read sequencing rate.

PubMed

Liu, Xuejun; Shi, Xinxin; Chen, Chunlin; Zhang, Li

2015-10-16

The high-throughput sequencing technology, RNA-Seq, has been widely used to quantify gene and isoform expression in the study of transcriptome in recent years. Accurate expression measurement from the millions or billions of short generated reads is obstructed by difficulties. One is ambiguous mapping of reads to reference transcriptome caused by alternative splicing. This increases the uncertainty in estimating isoform expression. The other is non-uniformity of read distribution along the reference transcriptome due to positional, sequencing, mappability and other undiscovered sources of biases. This violates the uniform assumption of read distribution for many expression calculation approaches, such as the direct RPKM calculation and Poisson-based models. Many methods have been proposed to address these difficulties. Some approaches employ latent variable models to discover the underlying pattern of read sequencing. However, most of these methods make bias correction based on surrounding sequence contents and share the bias models by all genes. They therefore cannot estimate gene- and isoform-specific biases as revealed by recent studies. We propose a latent variable model, NLDMseq, to estimate gene and isoform expression. Our method adopts latent variables to model the unknown isoforms, from which reads originate, and the underlying percentage of multiple spliced variants. The isoform- and exon-specific read sequencing biases are modeled to account for the non-uniformity of read distribution, and are identified by utilizing the replicate information of multiple lanes of a single library run. We employ simulation and real data to verify the performance of our method in terms of accuracy in the calculation of gene and isoform expression. Results show that NLDMseq obtains competitive gene and isoform expression compared to popular alternatives. Finally, the proposed method is applied to the detection of differential expression (DE) to show its usefulness in the downstream analysis. The proposed NLDMseq method provides an approach to accurately estimate gene and isoform expression from RNA-Seq data by modeling the isoform- and exon-specific read sequencing biases. It makes use of a latent variable model to discover the hidden pattern of read sequencing. We have shown that it works well in both simulations and real datasets, and has competitive performance compared to popular methods. The method has been implemented as a freely available software which can be found at https://github.com/PUGEA/NLDMseq.

Comparative and Evolutionary Analysis of Grass Pollen Allergens Using Brachypodium distachyon as a Model System.

PubMed

Sharma, Akanksha; Sharma, Niharika; Bhalla, Prem; Singh, Mohan

2017-01-01

Comparative genomics have facilitated the mining of biological information from a genome sequence, through the detection of similarities and differences with genomes of closely or more distantly related species. By using such comparative approaches, knowledge can be transferred from the model to non-model organisms and insights can be gained in the structural and evolutionary patterns of specific genes. In the absence of sequenced genomes for allergenic grasses, this study was aimed at understanding the structure, organisation and expression profiles of grass pollen allergens using the genomic data from Brachypodium distachyon as it is phylogenetically related to the allergenic grasses. Combining genomic data with the anther RNA-Seq dataset revealed 24 pollen allergen genes belonging to eight allergen groups mapping on the five chromosomes in B. distachyon. High levels of anther-specific expression profiles were observed for the 24 identified putative allergen-encoding genes in Brachypodium. The genomic evidence suggests that gene encoding the group 5 allergen, the most potent trigger of hay fever and allergic asthma originated as a pollen specific orphan gene in a common grass ancestor of Brachypodium and Triticiae clades. Gene structure analysis showed that the putative allergen-encoding genes in Brachypodium either lack or contain reduced number of introns. Promoter analysis of the identified Brachypodium genes revealed the presence of specific cis-regulatory sequences likely responsible for high anther/pollen-specific expression. With the identification of putative allergen-encoding genes in Brachypodium, this study has also described some important plant gene families (e.g. expansin superfamily, EF-Hand family, profilins etc) for the first time in the model plant Brachypodium. Altogether, the present study provides new insights into structural characterization and evolution of pollen allergens and will further serve as a base for their functional characterization in related grass species.

Identification of a functional element in the promoter of the silkworm (Bombyx mori) fat body-specific gene Bmlp3.

PubMed

Xu, Hanfu; Deng, Dangjun; Yuan, Lin; Wang, Yuancheng; Wang, Feng; Xia, Qingyou

2014-08-01

30K proteins are a group of structurally related proteins that play important roles in the life cycle of the silkworm Bombyx mori and are largely synthesized and regulated in a time-dependent manner in the fat body. Little is known about the upstream regulatory elements associated with the genes encoding these proteins. In the present study, the promoter of Bmlp3, a fat body-specific gene encoding a 30K protein family member, was characterized by joining sequences containing the Bmlp3 promoter with various amounts of 5' upstream sequences to a luciferase reporter gene. The results indicated that the sequences from -150 to -250bp and -597 to -675bp upstream of the Bmlp3 transcription start site were necessary for high levels of luciferase activity. Further analysis showed that a 21-bp sequence located between -230 and -250 was specifically recognized by nuclear factors from silkworm fat bodies and BmE cells, and could enhance luciferase reporter-gene expression 2.8-fold in BmE cells. This study provides new insights into the Bmlp3 promoter and contributes to the further clarification of the function and developmental regulation of Bmlp3. Copyright © 2014. Published by Elsevier B.V.

Comparison of taxon-specific versus general locus sets for targeted sequence capture in plant phylogenomics.

PubMed

Chau, John H; Rahfeldt, Wolfgang A; Olmstead, Richard G

2018-03-01

Targeted sequence capture can be used to efficiently gather sequence data for large numbers of loci, such as single-copy nuclear loci. Most published studies in plants have used taxon-specific locus sets developed individually for a clade using multiple genomic and transcriptomic resources. General locus sets can also be developed from loci that have been identified as single-copy and have orthologs in large clades of plants. We identify and compare a taxon-specific locus set and three general locus sets (conserved ortholog set [COSII], shared single-copy nuclear [APVO SSC] genes, and pentatricopeptide repeat [PPR] genes) for targeted sequence capture in Buddleja (Scrophulariaceae) and outgroups. We evaluate their performance in terms of assembly success, sequence variability, and resolution and support of inferred phylogenetic trees. The taxon-specific locus set had the most target loci. Assembly success was high for all locus sets in Buddleja samples. For outgroups, general locus sets had greater assembly success. Taxon-specific and PPR loci had the highest average variability. The taxon-specific data set produced the best-supported tree, but all data sets showed improved resolution over previous non-sequence capture data sets. General locus sets can be a useful source of sequence capture targets, especially if multiple genomic resources are not available for a taxon.

Sequence variation at the rice blast resistance gene Pi-km locus: Implications for the development of allele specific markers

USDA-ARS?s Scientific Manuscript database

The recently cloned blast resistance (R) gene Pi-km protects rice crops against specific races of the fungal pathogen Magnaporthe oryzae in a gene-for-gene manner. The use of blast R genes remains the most cost-effective method for an integrated disease management strategy. To facilitate rice breed...

Individual sequences in large sets of gene sequences may be distinguished efficiently by combinations of shared sub-sequences

PubMed Central

Gibbs, Mark J; Armstrong, John S; Gibbs, Adrian J

2005-01-01

Background Most current DNA diagnostic tests for identifying organisms use specific oligonucleotide probes that are complementary in sequence to, and hence only hybridise with the DNA of one target species. By contrast, in traditional taxonomy, specimens are usually identified by 'dichotomous keys' that use combinations of characters shared by different members of the target set. Using one specific character for each target is the least efficient strategy for identification. Using combinations of shared bisectionally-distributed characters is much more efficient, and this strategy is most efficient when they separate the targets in a progressively binary way. Results We have developed a practical method for finding minimal sets of sub-sequences that identify individual sequences, and could be targeted by combinations of probes, so that the efficient strategy of traditional taxonomic identification could be used in DNA diagnosis. The sizes of minimal sub-sequence sets depended mostly on sequence diversity and sub-sequence length and interactions between these parameters. We found that 201 distinct cytochrome oxidase subunit-1 (CO1) genes from moths (Lepidoptera) were distinguished using only 15 sub-sequences 20 nucleotides long, whereas only 8–10 sub-sequences 6–10 nucleotides long were required to distinguish the CO1 genes of 92 species from the 9 largest orders of insects. Conclusion The presence/absence of sub-sequences in a set of gene sequences can be used like the questions in a traditional dichotomous taxonomic key; hybridisation probes complementary to such sub-sequences should provide a very efficient means for identifying individual species, subtypes or genotypes. Sequence diversity and sub-sequence length are the major factors that determine the numbers of distinguishing sub-sequences in any set of sequences. PMID:15817134

Gene replacements and insertions in rice by intron targeting using CRISPR-Cas9.

PubMed

Li, Jun; Meng, Xiangbing; Zong, Yuan; Chen, Kunling; Zhang, Huawei; Liu, Jinxing; Li, Jiayang; Gao, Caixia

2016-09-12

Sequence-specific nucleases have been exploited to create targeted gene knockouts in various plants(1), but replacing a fragment and even obtaining gene insertions at specific loci in plant genomes remain a serious challenge. Here, we report efficient intron-mediated site-specific gene replacement and insertion approaches that generate mutations using the non-homologous end joining (NHEJ) pathway using the clustered regularly interspaced short palindromic repeats (CRISPR)-CRISPR-associated protein 9 (Cas9) system. Using a pair of single guide RNAs (sgRNAs) targeting adjacent introns and a donor DNA template including the same pair of sgRNA sites, we achieved gene replacements in the rice endogenous gene 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) at a frequency of 2.0%. We also obtained targeted gene insertions at a frequency of 2.2% using a sgRNA targeting one intron and a donor DNA template including the same sgRNA site. Rice plants harbouring the OsEPSPS gene with the intended substitutions were glyphosate-resistant. Furthermore, the site-specific gene replacements and insertions were faithfully transmitted to the next generation. These newly developed approaches can be generally used to replace targeted gene fragments and to insert exogenous DNA sequences into specific genomic sites in rice and other plants.

Islander: A database of precisely mapped genomic islands in tRNA and tmRNA genes

DOE PAGES

Hudson, Corey M.; Lau, Britney Y.; Williams, Kelly P.

2014-11-05

Genomic islands are mobile DNAs that are major agents of bacterial and archaeal evolution. Integration into prokaryotic chromosomes usually occurs site-specifically at tRNA or tmRNA gene (together, tDNA) targets, catalyzed by tyrosine integrases. This splits the target gene, yet sequences within the island restore the disrupted gene; the regenerated target and its displaced fragment precisely mark the endpoints of the island. We applied this principle to search for islands in genomic DNA sequences. Our algorithm identifies tDNAs, finds fragments of those tDNAs in the same replicon and removes unlikely candidate islands through a series of filters. A search for islandsmore » in 2168 whole prokaryotic genomes produced 3919 candidates. The website Islander (recently moved to http://bioinformatics.sandia.gov/islander/) presents these precisely mapped candidate islands, the gene content and the island sequence. The algorithm further insists that each island encode an integrase, and attachment site sequence identity is carefully noted; therefore, the database also serves in the study of integrase site-specificity and its evolution.« less

The Genome Sequence of Taurine Cattle: A window to ruminant biology and evolution

PubMed Central

Elsik, Christine G.; Tellam, Ross L.; Worley, Kim C.

2010-01-01

To understand the biology and evolution of ruminants, the cattle genome was sequenced to ∼7× coverage. The cattle genome contains a minimum of 22,000 genes, with a core set of 14,345 orthologs shared among seven mammalian species of which 1,217 are absent or undetected in non-eutherian (marsupial or monotreme) genomes. Cattle-specific evolutionary breakpoint regions in chromosomes have a higher density of segmental duplications, enrichment of repetitive elements, and species-specific variations in genes associated with lactation and immune responsiveness. Genes involved in metabolism are generally highly conserved, although five metabolic genes are deleted or extensively diverged from their human orthologs. The cattle genome sequence thus provides an enabling resource for understanding mammalian evolution and accelerating livestock genetic improvement for milk and meat production. PMID:19390049

Lineage-Specific Biology Revealed by a Finished Genome Assembly of the Mouse

PubMed Central

Hillier, LaDeana W.; Zody, Michael C.; Goldstein, Steve; She, Xinwe; Bult, Carol J.; Agarwala, Richa; Cherry, Joshua L.; DiCuccio, Michael; Hlavina, Wratko; Kapustin, Yuri; Meric, Peter; Maglott, Donna; Birtle, Zoë; Marques, Ana C.; Graves, Tina; Zhou, Shiguo; Teague, Brian; Potamousis, Konstantinos; Churas, Christopher; Place, Michael; Herschleb, Jill; Runnheim, Ron; Forrest, Daniel; Amos-Landgraf, James; Schwartz, David C.; Cheng, Ze; Lindblad-Toh, Kerstin; Eichler, Evan E.; Ponting, Chris P.

2009-01-01

The mouse (Mus musculus) is the premier animal model for understanding human disease and development. Here we show that a comprehensive understanding of mouse biology is only possible with the availability of a finished, high-quality genome assembly. The finished clone-based assembly of the mouse strain C57BL/6J reported here has over 175,000 fewer gaps and over 139 Mb more of novel sequence, compared with the earlier MGSCv3 draft genome assembly. In a comprehensive analysis of this revised genome sequence, we are now able to define 20,210 protein-coding genes, over a thousand more than predicted in the human genome (19,042 genes). In addition, we identified 439 long, non–protein-coding RNAs with evidence for transcribed orthologs in human. We analyzed the complex and repetitive landscape of 267 Mb of sequence that was missing or misassembled in the previously published assembly, and we provide insights into the reasons for its resistance to sequencing and assembly by whole-genome shotgun approaches. Duplicated regions within newly assembled sequence tend to be of more recent ancestry than duplicates in the published draft, correcting our initial understanding of recent evolution on the mouse lineage. These duplicates appear to be largely composed of sequence regions containing transposable elements and duplicated protein-coding genes; of these, some may be fixed in the mouse population, but at least 40% of segmentally duplicated sequences are copy number variable even among laboratory mouse strains. Mouse lineage-specific regions contain 3,767 genes drawn mainly from rapidly-changing gene families associated with reproductive functions. The finished mouse genome assembly, therefore, greatly improves our understanding of rodent-specific biology and allows the delineation of ancestral biological functions that are shared with human from derived functions that are not. PMID:19468303

Partial sequencing of sodA gene and its application to identification of Streptococcus dysgalactiae subsp. dysgalactiae isolated from farmed fish.

PubMed

Nomoto, R; Kagawa, H; Yoshida, T

2008-01-01

To investigate the difference between Lancefield group C Streptococcus dysgalactiae (GCSD) strains isolated from diseased fish and animals by sequencing and phylogenetic analysis of the sodA gene. The sodA gene of Strep. dysgalactiae strains isolated from fish and animals were amplified and its nucleotide sequences were determined. Although 100% sequence identity was observed among fish GCSD strains, the determined sequences from animal isolates showed variations against fish isolate sequences. Thus, all fish GCSD strains were clearly separated from the GCSD strains of other origin by using phylogenetic tree analysis. In addition, the original primer set was designed based on the determined sequences for specifically amplify the sodA gene of fish GCSD strains. The primer set yield amplification products from only fish GCSD strains. By sequencing analysis of the sodA gene, the genetic divergence between Strep. dysgalactiae strains isolated from fish and mammals was demonstrated. Moreover, an original oligonucletide primer set, which could simply detect the genotype of fish GCSD strains was designed. This study shows that Strep. dysgalactiae isolated from diseased fish could be distinguished from conventional GCSD strains by the difference in the sequence of the sodA gene.

Suppression of prolactin gene expression in GH cells correlates with site-specific DNA methylation.

PubMed

Zhang, Z X; Kumar, V; Rivera, R T; Pasion, S G; Chisholm, J; Biswas, D K

1989-10-01

Prolactin- (PRL) producing and nonproducing subclones of the GH line of (rat) pituitary tumor cells have been compared to elucidate the regulatory mechanisms of PRL gene expression. Particular emphasis was placed on delineating the molecular basis of the suppressed state of the PRL gene in the prolactin-nonproducing (PRL-) GH subclone (GH(1)2C1). We examined six methylatable cytosine residues (5, -CCGG- and 1, -GCGC-) within the 30-kb region of the PRL gene in these subclones. This analysis revealed that -CCGG-sequences of the transcribed region, and specifically, one in the fourth exon of the PRL gene, were heavily methylated in the PRL-, GH(1)2C1 cells. Furthermore, the inhibition of PRL gene expression in GH(1)2C1 was reversed by short-term treatment of the cells with a sublethal concentration of azacytidine (AzaC), an inhibitor of DNA methylation. The reversion of PRL gene expression by AzaC was correlated with the concurrent demethylation of the same -CCGG- sequences in the transcribed region of PRL gene. An inverse correlation between PRL gene expression and the level of methylation of the internal -C- residues in the specific -CCGG-sequence of the transcribed region of the PRL gene was demonstrated. The DNase I sensitivity of these regions of the PRL gene in PRL+, PRL-, and AzaC-treated cells was also consistent with an inverse relationship between methylation state, a higher order of structural modification, and gene expression.(ABSTRACT TRUNCATED AT 250 WORDS)

Phylogenomic analysis of UDP glycosyltransferase 1 multigene family in Linum usitatissimum identified genes with varied expression patterns.

PubMed

Barvkar, Vitthal T; Pardeshi, Varsha C; Kale, Sandip M; Kadoo, Narendra Y; Gupta, Vidya S

2012-05-08

The glycosylation process, catalyzed by ubiquitous glycosyltransferase (GT) family enzymes, is a prevalent modification of plant secondary metabolites that regulates various functions such as hormone homeostasis, detoxification of xenobiotics and biosynthesis and storage of secondary metabolites. Flax (Linum usitatissimum L.) is a commercially grown oilseed crop, important because of its essential fatty acids and health promoting lignans. Identification and characterization of UDP glycosyltransferase (UGT) genes from flax could provide valuable basic information about this important gene family and help to explain the seed specific glycosylated metabolite accumulation and other processes in plants. Plant genome sequencing projects are useful to discover complexity within this gene family and also pave way for the development of functional genomics approaches. Taking advantage of the newly assembled draft genome sequence of flax, we identified 137 UDP glycosyltransferase (UGT) genes from flax using a conserved signature motif. Phylogenetic analysis of these protein sequences clustered them into 14 major groups (A-N). Expression patterns of these genes were investigated using publicly available expressed sequence tag (EST), microarray data and reverse transcription quantitative real time PCR (RT-qPCR). Seventy-three per cent of these genes (100 out of 137) showed expression evidence in 15 tissues examined and indicated varied expression profiles. The RT-qPCR results of 10 selected genes were also coherent with the digital expression analysis. Interestingly, five duplicated UGT genes were identified, which showed differential expression in various tissues. Of the seven intron loss/gain positions detected, two intron positions were conserved among most of the UGTs, although a clear relationship about the evolution of these genes could not be established. Comparison of the flax UGTs with orthologs from four other sequenced dicot genomes indicated that seven UGTs were flax diverged. Flax has a large number of UGT genes including few flax diverged ones. Phylogenetic analysis and expression profiles of these genes identified tissue and condition specific repertoire of UGT genes from this crop. This study would facilitate precise selection of candidate genes and their further characterization of substrate specificities and in planta functions.

Phylogenomic analysis of UDP glycosyltransferase 1 multigene family in Linum usitatissimum identified genes with varied expression patterns

PubMed Central

2012-01-01

Background The glycosylation process, catalyzed by ubiquitous glycosyltransferase (GT) family enzymes, is a prevalent modification of plant secondary metabolites that regulates various functions such as hormone homeostasis, detoxification of xenobiotics and biosynthesis and storage of secondary metabolites. Flax (Linum usitatissimum L.) is a commercially grown oilseed crop, important because of its essential fatty acids and health promoting lignans. Identification and characterization of UDP glycosyltransferase (UGT) genes from flax could provide valuable basic information about this important gene family and help to explain the seed specific glycosylated metabolite accumulation and other processes in plants. Plant genome sequencing projects are useful to discover complexity within this gene family and also pave way for the development of functional genomics approaches. Results Taking advantage of the newly assembled draft genome sequence of flax, we identified 137 UDP glycosyltransferase (UGT) genes from flax using a conserved signature motif. Phylogenetic analysis of these protein sequences clustered them into 14 major groups (A-N). Expression patterns of these genes were investigated using publicly available expressed sequence tag (EST), microarray data and reverse transcription quantitative real time PCR (RT-qPCR). Seventy-three per cent of these genes (100 out of 137) showed expression evidence in 15 tissues examined and indicated varied expression profiles. The RT-qPCR results of 10 selected genes were also coherent with the digital expression analysis. Interestingly, five duplicated UGT genes were identified, which showed differential expression in various tissues. Of the seven intron loss/gain positions detected, two intron positions were conserved among most of the UGTs, although a clear relationship about the evolution of these genes could not be established. Comparison of the flax UGTs with orthologs from four other sequenced dicot genomes indicated that seven UGTs were flax diverged. Conclusions Flax has a large number of UGT genes including few flax diverged ones. Phylogenetic analysis and expression profiles of these genes identified tissue and condition specific repertoire of UGT genes from this crop. This study would facilitate precise selection of candidate genes and their further characterization of substrate specificities and in planta functions. PMID:22568875

CLINICAL PROGRESS IN INHERITED RETINAL DEGENERATIONS: GENE THERAPY CLINICAL TRIALS AND ADVANCES IN GENETIC SEQUENCING.

PubMed

Hafler, Brian P

2017-03-01

Inherited retinal dystrophies are a significant cause of vision loss and are characterized by the loss of photoreceptors and the retinal pigment epithelium (RPE). Mutations in approximately 250 genes cause inherited retinal degenerations with a high degree of genetic heterogeneity. New techniques in next-generation sequencing are allowing the comprehensive analysis of all retinal disease genes thus changing the approach to the molecular diagnosis of inherited retinal dystrophies. This review serves to analyze clinical progress in genetic diagnostic testing and implications for retinal gene therapy. A literature search of PubMed and OMIM was conducted to relevant articles in inherited retinal dystrophies. Next-generation genetic sequencing allows the simultaneous analysis of all the approximately 250 genes that cause inherited retinal dystrophies. Reported diagnostic rates range are high and range from 51% to 57%. These new sequencing tools are highly accurate with sensitivities of 97.9% and specificities of 100%. Retinal gene therapy clinical trials are underway for multiple genes including RPE65, ABCA4, CHM, RS1, MYO7A, CNGA3, CNGB3, ND4, and MERTK for which a molecular diagnosis may be beneficial for patients. Comprehensive next-generation genetic sequencing of all retinal dystrophy genes is changing the paradigm for how retinal specialists perform genetic testing for inherited retinal degenerations. Not only are high diagnostic yields obtained, but mutations in genes with novel clinical phenotypes are also identified. In the era of retinal gene therapy clinical trials, identifying specific genetic defects will increasingly be of use to identify patients who may enroll in clinical studies and benefit from novel therapies.

Molecular basis of length polymorphism in the human zeta-globin gene complex.

PubMed Central

Goodbourn, S E; Higgs, D R; Clegg, J B; Weatherall, D J

1983-01-01

The length polymorphism between the human zeta-globin gene and its pseudogene is caused by an allele-specific variation in the copy number of a tandemly repeating 36-base-pair sequence. This sequence is related to a tandemly repeated 14-base-pair sequence in the 5' flanking region of the human insulin gene, which is known to cause length polymorphism, and to a repetitive sequence in intervening sequence (IVS) 1 of the pseudo-zeta-globin gene. Evidence is presented that the latter is also of variable length, probably because of differences in the copy number of the tandem repeat. The homology between the three length polymorphisms may be an indication of the presence of a more widespread group of related sequences in the human genome, which might be useful for generalized linkage studies. PMID:6308667

The 193-base pair Gsg2 (haspin) promoter region regulates germ cell-specific expression bidirectionally and synchronously.

PubMed

Tokuhiro, Keizo; Miyagawa, Yasushi; Yamada, Shuichi; Hirose, Mika; Ohta, Hiroshi; Nishimune, Yoshitake; Tanaka, Hiromitsu

2007-03-01

Haspin is a unique protein kinase expressed predominantly in haploid male germ cells. The genomic structure of haspin (Gsg2) has revealed it to be intronless, and the entire transcription unit is in an intron of the integrin alphaE (Itgae) gene. Transcription occurs from a bidirectional promoter that also generates an alternatively spliced integrin alphaE-derived mRNA (Aed). In mice, the testis-specific alternative splicing of Aed is expressed bidirectionally downstream from the Gsg2 transcription initiation site, and a segment consisting of 26 bp transcribes both genomic DNA strands between Gsg2 and the Aed transcription initiation sites. To investigate the mechanisms for this unique gene regulation, we cloned and characterized the Gsg2 promoter region. The 193-bp genomic fragment from the 5' end of the Gsg2 and Aed genes, fused with EGFP and DsRed genes, drove the expression of both proteins in haploid germ cells of transgenic mice. This promoter element contained only a GC-rich sequence, and not the previously reported DNA sequences known to bind various transcription factors--with the exception of E2F1, TCFAP2A1 (AP2), and SP1. Here, we show that the 193-bp DNA sequence is sufficient for the specific, bidirectional, and synchronous expression in germ cells in the testis. We also demonstrate the existence of germ cell nuclear factors specifically bound to the promoter sequence. This activity may be regulated by binding to the promoter sequence with germ cell-specific nuclear complex(es) without regulation via DNA methylation.

Using complementary DNA from MyoD-transduced fibroblasts to sequence large muscle genes.

PubMed

Waddell, Leigh B; Monnier, Nicole; Cooper, Sandra T; North, Kathryn N; Clarke, Nigel F

2011-08-01

Large muscle genes are often sequenced using complementary DNA (cDNA) made from muscle messenger RNA (mRNA) to reduce the cost and workload associated with sequencing from genomic DNA. Two potential barriers are the availability of a frozen muscle biopsy, and difficulties in detecting nonsense mutations due to nonsense-mediated mRNA decay (NMD). We present patient examples showing that use of MyoD-transduced fibroblasts as a source of muscle-specific mRNA overcomes these potential difficulties in sequencing large muscle-related genes. Copyright © 2011 Wiley Periodicals, Inc.

Reverse Genetics and High Throughput Sequencing Methodologies for Plant Functional Genomics

PubMed Central

Ben-Amar, Anis; Daldoul, Samia; Reustle, Götz M.; Krczal, Gabriele; Mliki, Ahmed

2016-01-01

In the post-genomic era, increasingly sophisticated genetic tools are being developed with the long-term goal of understanding how the coordinated activity of genes gives rise to a complex organism. With the advent of the next generation sequencing associated with effective computational approaches, wide variety of plant species have been fully sequenced giving a wealth of data sequence information on structure and organization of plant genomes. Since thousands of gene sequences are already known, recently developed functional genomics approaches provide powerful tools to analyze plant gene functions through various gene manipulation technologies. Integration of different omics platforms along with gene annotation and computational analysis may elucidate a complete view in a system biology level. Extensive investigations on reverse genetics methodologies were deployed for assigning biological function to a specific gene or gene product. We provide here an updated overview of these high throughout strategies highlighting recent advances in the knowledge of functional genomics in plants. PMID:28217003

Enhancer activity of Helitron in sericin-1 gene promoter from Bombyx mori.

PubMed

Huang, Ke; Li, Chun-Feng; Wu, Jie; Wei, Jun-Hong; Zou, Yong; Han, Min-Jin; Zhou, Ze-Yang

2016-06-01

Sericin is a kind of water-soluble protein expressed specifically in the middle silk gland of Bombyx mori. When the sericin-1 gene promoter was cloned and a transgenic vector was constructed to express a foreign protein, a specific Helitron, Bmhel-8, was identified in the sericin-1 gene promoter sequence in some genotypes of Bombyx mori and Bombyx mandarina. Given that the Bmhel-8 Helitron transposon was present only in some genotypes, it could be the source of allelic variation in the sericin-1 promoter. The length of the sericin-1 promoter sequence is approximately 1063 or 643 bp. The larger size of the sequence or allele is ascribed to the presence of Bmhel-8. Silkworm genotypes can be homozygous for either the shorter or larger promoter sequence or heterozygous, containing both alleles. Bmhel-8 in the sericin-1 promoter exhibits enhancer activity, as demonstrated by a dual-luciferase reporter system in BmE cell lines. Furthermore, Bmhel-8 displays enhancer activity in a sericin-1 promoter-driven gene expression system but does not regulate the tissue-specific expression of sericin-1. © 2016 Institute of Zoology, Chinese Academy of Sciences.

Typing of artiodactyl MHC-DRB genes with the help of intronic simple repeated DNA sequences.

PubMed

Schwaiger, F W; Buitkamp, J; Weyers, E; Epplen, J T

1993-02-01

An efficient oligonucleotide typing method for the highly polymorphic MHC-DRB genes is described for artiodactyls like cattle, sheep and goat. By means of the polymerase chain reaction, the second exon of MHC-DRB is amplified as well as part of the adjacent intron containing a mixed simple repeat sequence. Using this primer combination we were able to amplify the MHC-DRB exons 2 and adjacent introns from all of the investigated 10 species of the family of Bovidae and giraffes. Therefore, the DRB genes of novel artiodactyl species can also be readily studied. Oligonucleotide probes specific for the polymorphisms of ungulate DRB genes are used with which sequences differing in at least one single base can be distinguished. Exonic polymorphism was found to be correlated with the allele lengths and the patterns of the repeat structures. Hence oligonucleotide probes specific for different simple repeats and polymorphic positions serve also for typing across species barriers. The strict correlation of sequence length and exonic polymorphism permits a preselection of specific oligonucleotides for hybridization. Thus more than 20 alleles can already be differentiated from each of the three species.

Isolation of laccase gene-specific sequences from white rot and brown rot fungi by PCR.

PubMed Central

D'Souza, T M; Boominathan, K; Reddy, C A

1996-01-01

Degenerate primers corresponding to the consensus sequences of the copper-binding regions in the N-terminal domains of known basidiomycete laccases were used to isolate laccase gene-specific sequences from strains representing nine genera of wood rot fungi. All except three gave the expected PCR product of about 200 bp. Computer searches of the databases identified the sequence of each of the PCR products analyzed as a laccase gene sequence, suggesting the specificity of the primers. PCR products of the white rot fungi Ganoderma lucidum, Phlebia brevispora, and Trametes versicolor showed 65 to 74% nucleotide sequence similarity to each other; the similarity in deduced amino acid sequences was 83 to 91%. The PCR products of Lentinula edodes and Lentinus tigrinus, on the other hand, showed relatively low nucleotide and amino acid similarities (58 to 64 and 62 to 81%, respectively); however, these similarities were still much higher than when compared with the corresponding regions in the laccases of the ascomycete fungi Aspergillus nidulans and Neurospora crassa. A few of the white rot fungi, as well as Gloeophyllum trabeum, a brown rot fungus, gave a 144-bp PCR fragment which had a nucleotide sequence similarity of 60 to 71%. Demonstration of laccase activity in G. trabeum and several other brown rot fungi was of particular interest because these organisms were not previously shown to produce laccases. PMID:8837429

Mouse mammary tumor virus-like gene sequences are present in lung patient specimens

PubMed Central

2011-01-01

Background Previous studies have reported on the presence of Murine Mammary Tumor Virus (MMTV)-like gene sequences in human cancer tissue specimens. Here, we search for MMTV-like gene sequences in lung diseases including carcinomas specimens from a Mexican population. This study was based on our previous study reporting that the INER51 lung cancer cell line, from a pleural effusion of a Mexican patient, contains MMTV-like env gene sequences. Results The MMTV-like env gene sequences have been detected in three out of 18 specimens studied, by PCR using a specific set of MMTV-like primers. The three identified MMTV-like gene sequences, which were assigned as INER6, HZ101, and HZ14, were 99%, 98%, and 97% homologous, respectively, as compared to GenBank sequence accession number AY161347. The INER6 and HZ-101 samples were isolated from lung cancer specimens, and the HZ-14 was isolated from an acute inflammatory lung infiltrate sample. Two of the env sequences exhibited disruption of the reading frame due to mutations. Conclusion In summary, we identified the presence of MMTV-like gene sequences in 2 out of 11 (18%) of the lung carcinomas and 1 out of 7 (14%) of acute inflamatory lung infiltrate specimens studied of a Mexican Population. PMID:21943279

Short interspersed nuclear elements (SINEs) are abundant in Solanaceae and have a family-specific impact on gene structure and genome organization.

PubMed

Seibt, Kathrin M; Wenke, Torsten; Muders, Katja; Truberg, Bernd; Schmidt, Thomas

2016-05-01

Short interspersed nuclear elements (SINEs) are highly abundant non-autonomous retrotransposons that are widespread in plants. They are short in size, non-coding, show high sequence diversity, and are therefore mostly not or not correctly annotated in plant genome sequences. Hence, comparative studies on genomic SINE populations are rare. To explore the structural organization and impact of SINEs, we comparatively investigated the genome sequences of the Solanaceae species potato (Solanum tuberosum), tomato (Solanum lycopersicum), wild tomato (Solanum pennellii), and two pepper cultivars (Capsicum annuum). Based on 8.5 Gbp sequence data, we annotated 82 983 SINE copies belonging to 10 families and subfamilies on a base pair level. Solanaceae SINEs are dispersed over all chromosomes with enrichments in distal regions. Depending on the genome assemblies and gene predictions, 30% of all SINE copies are associated with genes, particularly frequent in introns and untranslated regions (UTRs). The close association with genes is family specific. More than 10% of all genes annotated in the Solanaceae species investigated contain at least one SINE insertion, and we found genes harbouring up to 16 SINE copies. We demonstrate the involvement of SINEs in gene and genome evolution including the donation of splice sites, start and stop codons and exons to genes, enlargement of introns and UTRs, generation of tandem-like duplications and transduction of adjacent sequence regions. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

Genotyping of Chromobacterium violaceum isolates by recA PCR-RFLP analysis.

PubMed

Scholz, Holger Christian; Witte, Angela; Tomaso, Herbert; Al Dahouk, Sascha; Neubauer, Heinrich

2005-03-15

Intraspecies variation of Chromobacterium violaceum was examined by comparative sequence - and by restriction fragment length polymorphism analysis of the recombinase A gene (recA-PCR-RFLP). Primers deduced from the known recA gene sequence of the type strain C. violaceum ATCC 12472(T) allowed the specific amplification of a 1040bp recA fragment from each of the 13 C. violaceum strains investigated, whereas other closely related organisms tested negative. HindII-PstI-recA RFLP analysis generated from 13 representative C. violaceum strains enabled us to identify at least three different genospecies. In conclusion, analysis of the recA gene provides a rapid and robust nucleotide sequence-based approach to specifically identify and classify C. violaceum on genospecies level.

Subgenome-specific assembly of vitamin E biosynthesis genes and expression patterns during seed development provide insight into the evolution of oat genome.

PubMed

Gutierrez-Gonzalez, Juan J; Garvin, David F

2016-11-01

Vitamin E is essential for humans and thus must be a component of a healthy diet. Among the cereal grains, hexaploid oats (Avena sativa L.) have high vitamin E content. To date, no gene sequences in the vitamin E biosynthesis pathway have been reported for oats. Using deep sequencing and orthology-guided assembly, coding sequences of genes for each step in vitamin E synthesis in oats were reconstructed, including resolution of the sequences of homeologs. Three homeologs, presumably representing each of the three oat subgenomes, were identified for the main steps of the pathway. Partial sequences, likely representing pseudogenes, were recovered in some instances as well. Pairwise comparisons among homeologs revealed that two of the three putative subgenome-specific homeologs are almost identical for each gene. Synonymous substitution rates indicate the time of divergence of the two more similar subgenomes from the distinct one at 7.9-8.7 MYA, and a divergence between the similar subgenomes from a common ancestor 1.1 MYA. A new proposed evolutionary model for hexaploid oat formation is discussed. Homeolog-specific gene expression was quantified during oat seed development and compared with vitamin E accumulation. Homeolog expression largely appears to be similar for most of genes; however, for some genes, homoeolog-specific transcriptional bias was observed. The expression of HPPD, as well as certain homoeologs of VTE2 and VTE4, is highly correlated with seed vitamin E accumulation. Our findings expand our understanding of oat genome evolution and will assist efforts to modify vitamin E content and composition in oats. Published 2016. This article is a U.S. Government work and is in the public domain in the USA. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Development and application of a PCR assay to detect chicken and turkey parvoviruses in commercial poultry flocks in the United States.

USDA-ARS?s Scientific Manuscript database

Comparative sequence analysis of six independent chicken and turkey parvovirus nonstructural (NS) genes revealed specific genomic regions with 100% nucleotide sequence identity. A PCR assay with primers targeting these conserved genome sequences proved to be highly specific and sensitive to detect p...

Direct protein interaction underlies gene-for-gene specificity and coevolution of the flax resistance genes and flax rust avirulence genes

PubMed Central

Dodds, Peter N.; Lawrence, Gregory J.; Catanzariti, Ann-Maree; Teh, Trazel; Wang, Ching-I. A.; Ayliffe, Michael A.; Kobe, Bostjan; Ellis, Jeffrey G.

2006-01-01

Plant resistance proteins (R proteins) recognize corresponding pathogen avirulence (Avr) proteins either indirectly through detection of changes in their host protein targets or through direct R–Avr protein interaction. Although indirect recognition imposes selection against Avr effector function, pathogen effector molecules recognized through direct interaction may overcome resistance through sequence diversification rather than loss of function. Here we show that the flax rust fungus AvrL567 genes, whose products are recognized by the L5, L6, and L7 R proteins of flax, are highly diverse, with 12 sequence variants identified from six rust strains. Seven AvrL567 variants derived from Avr alleles induce necrotic responses when expressed in flax plants containing corresponding resistance genes (R genes), whereas five variants from avr alleles do not. Differences in recognition specificity between AvrL567 variants and evidence for diversifying selection acting on these genes suggest they have been involved in a gene-specific arms race with the corresponding flax R genes. Yeast two-hybrid assays indicate that recognition is based on direct R–Avr protein interaction and recapitulate the interaction specificity observed in planta. Biochemical analysis of Escherichia coli-produced AvrL567 proteins shows that variants that escape recognition nevertheless maintain a conserved structure and stability, suggesting that the amino acid sequence differences directly affect the R–Avr protein interaction. We suggest that direct recognition associated with high genetic diversity at corresponding R and Avr gene loci represents an alternative outcome of plant–pathogen coevolution to indirect recognition associated with simple balanced polymorphisms for functional and nonfunctional R and Avr genes. PMID:16731621

Identification and positional distribution analysis of transcription factor binding sites for genes from the wheat fl-cDNA sequences.

PubMed

Chen, Zhen-Yong; Guo, Xiao-Jiang; Chen, Zhong-Xu; Chen, Wei-Ying; Wang, Ji-Rui

2017-06-01

The binding sites of transcription factors (TFs) in upstream DNA regions are called transcription factor binding sites (TFBSs). TFBSs are important elements for regulating gene expression. To date, there have been few studies on the profiles of TFBSs in plants. In total, 4,873 sequences with 5' upstream regions from 8530 wheat fl-cDNA sequences were used to predict TFBSs. We found 4572 TFBSs for the MADS TF family, which was twice as many as for bHLH (1951), B3 (1951), HB superfamily (1914), ERF (1820), and AP2/ERF (1725) TFs, and was approximately four times higher than the remaining TFBS types. The percentage of TFBSs and TF members showed a distinct distribution in different tissues. Overall, the distribution of TFBSs in the upstream regions of wheat fl-cDNA sequences had significant difference. Meanwhile, high frequencies of some types of TFBSs were found in specific regions in the upstream sequences. Both TFs and fl-cDNA with TFBSs predicted in the same tissues exhibited specific distribution preferences for regulating gene expression. The tissue-specific analysis of TFs and fl-cDNA with TFBSs provides useful information for functional research, and can be used to identify relationships between tissue-specific TFs and fl-cDNA with TFBSs. Moreover, the positional distribution of TFBSs indicates that some types of wheat TFBS have different positional distribution preferences in the upstream regions of genes.

Human Lineage-Specific Transcriptional Regulation through GA-Binding Protein Transcription Factor Alpha (GABPa)

PubMed Central

Perdomo-Sabogal, Alvaro; Nowick, Katja; Piccini, Ilaria; Sudbrak, Ralf; Lehrach, Hans; Yaspo, Marie-Laure; Warnatz, Hans-Jörg; Querfurth, Robert

2016-01-01

A substantial fraction of phenotypic differences between closely related species are likely caused by differences in gene regulation. While this has already been postulated over 30 years ago, only few examples of evolutionary changes in gene regulation have been verified. Here, we identified and investigated binding sites of the transcription factor GA-binding protein alpha (GABPa) aiming to discover cis-regulatory adaptations on the human lineage. By performing chromatin immunoprecipitation-sequencing experiments in a human cell line, we found 11,619 putative GABPa binding sites. Through sequence comparisons of the human GABPa binding regions with orthologous sequences from 34 mammals, we identified substitutions that have resulted in 224 putative human-specific GABPa binding sites. To experimentally assess the transcriptional impact of those substitutions, we selected four promoters for promoter-reporter gene assays using human and African green monkey cells. We compared the activities of wild-type promoters to mutated forms, where we have introduced one or more substitutions to mimic the ancestral state devoid of the GABPa consensus binding sequence. Similarly, we introduced the human-specific substitutions into chimpanzee and macaque promoter backgrounds. Our results demonstrate that the identified substitutions are functional, both in human and nonhuman promoters. In addition, we performed GABPa knock-down experiments and found 1,215 genes as strong candidates for primary targets. Further analyses of our data sets link GABPa to cognitive disorders, diabetes, KRAB zinc finger (KRAB-ZNF), and human-specific genes. Thus, we propose that differences in GABPa binding sites played important roles in the evolution of human-specific phenotypes. PMID:26814189

Traffic at the tmRNA Gene

PubMed Central

Williams, Kelly P.

2003-01-01

A partial screen for genetic elements integrated into completely sequenced bacterial genomes shows more significant bias in specificity for the tmRNA gene (ssrA) than for any type of tRNA gene. Horizontal gene transfer, a major avenue of bacterial evolution, was assessed by focusing on elements using this single attachment locus. Diverse elements use ssrA; among enterobacteria alone, at least four different integrase subfamilies have independently evolved specificity for ssrA, and almost every strain analyzed presents a unique set of integrated elements. Even elements using essentially the same integrase can be very diverse, as is a group with an ssrA-specific integrase of the P4 subfamily. This same integrase appears to promote damage routinely at attachment sites, which may be adaptive. Elements in arrays can recombine; one such event mediated by invertible DNA segments within neighboring elements likely explains the monophasic nature of Salmonella enterica serovar Typhi. One of a limited set of conserved sequences occurs at the attachment site of each enterobacterial element, apparently serving as a transcriptional terminator for ssrA. Elements were usually found integrated into tRNA-like sequence at the 3′ end of ssrA, at subsites corresponding to those used in tRNA genes; an exception was found at the non-tRNA-like 3′ end produced by ssrA gene permutation in cyanobacteria, suggesting that, during the evolution of new site specificity by integrases, tropism toward a conserved 3′ end of an RNA gene may be as strong as toward a tRNA-like sequence. The proximity of ssrA and smpB, which act in concert, was also surveyed. PMID:12533482

Transcriptome response to elevated CO2, water deficit, and thermal stress in peanut

USDA-ARS?s Scientific Manuscript database

Previously, our laboratories have performed gene expression studies using EST sequencing and spotted microarrays to investigate tissue-specific gene expression and response to abiotic stress. While these studies have provided valuable insight into these processes, they are constrained by sequencer t...

Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

PubMed

Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

2016-01-01

In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

Horizontal gene transfer from Bacteria to rumen Ciliates indicates adaptation to their anaerobic, carbohydrates-rich environment

PubMed Central

Ricard, Guénola; McEwan, Neil R; Dutilh, Bas E; Jouany, Jean-Pierre; Macheboeuf, Didier; Mitsumori, Makoto; McIntosh, Freda M; Michalowski, Tadeusz; Nagamine, Takafumi; Nelson, Nancy; Newbold, Charles J; Nsabimana, Eli; Takenaka, Akio; Thomas, Nadine A; Ushida, Kazunari; Hackstein, Johannes HP; Huynen, Martijn A

2006-01-01

Background The horizontal transfer of expressed genes from Bacteria into Ciliates which live in close contact with each other in the rumen (the foregut of ruminants) was studied using ciliate Expressed Sequence Tags (ESTs). More than 4000 ESTs were sequenced from representatives of the two major groups of rumen Cilates: the order Entodiniomorphida (Entodinium simplex, Entodinium caudatum, Eudiplodinium maggii, Metadinium medium, Diploplastron affine, Polyplastron multivesiculatum and Epidinium ecaudatum) and the order Vestibuliferida, previously called Holotricha (Isotricha prostoma, Isotricha intestinalis and Dasytricha ruminantium). Results A comparison of the sequences with the completely sequenced genomes of Eukaryotes and Prokaryotes, followed by large-scale construction and analysis of phylogenies, identified 148 ciliate genes that specifically cluster with genes from the Bacteria and Archaea. The phylogenetic clustering with bacterial genes, coupled with the absence of close relatives of these genes in the Ciliate Tetrahymena thermophila, indicates that they have been acquired via Horizontal Gene Transfer (HGT) after the colonization of the gut by the rumen Ciliates. Conclusion Among the HGT candidates, we found an over-representation (>75%) of genes involved in metabolism, specifically in the catabolism of complex carbohydrates, a rich food source in the rumen. We propose that the acquisition of these genes has greatly facilitated the Ciliates' colonization of the rumen providing evidence for the role of HGT in the adaptation to new niches. PMID:16472398

Horizontal gene transfer from Bacteria to rumen Ciliates indicates adaptation to their anaerobic, carbohydrates-rich environment.

PubMed

Ricard, Guénola; McEwan, Neil R; Dutilh, Bas E; Jouany, Jean-Pierre; Macheboeuf, Didier; Mitsumori, Makoto; McIntosh, Freda M; Michalowski, Tadeusz; Nagamine, Takafumi; Nelson, Nancy; Newbold, Charles J; Nsabimana, Eli; Takenaka, Akio; Thomas, Nadine A; Ushida, Kazunari; Hackstein, Johannes H P; Huynen, Martijn A

2006-02-10

The horizontal transfer of expressed genes from Bacteria into Ciliates which live in close contact with each other in the rumen (the foregut of ruminants) was studied using ciliate Expressed Sequence Tags (ESTs). More than 4000 ESTs were sequenced from representatives of the two major groups of rumen Cilates: the order Entodiniomorphida (Entodinium simplex, Entodinium caudatum, Eudiplodinium maggii, Metadinium medium, Diploplastron affine, Polyplastron multivesiculatum and Epidinium ecaudatum) and the order Vestibuliferida, previously called Holotricha (Isotricha prostoma, Isotricha intestinalis and Dasytricha ruminantium). A comparison of the sequences with the completely sequenced genomes of Eukaryotes and Prokaryotes, followed by large-scale construction and analysis of phylogenies, identified 148 ciliate genes that specifically cluster with genes from the Bacteria and Archaea. The phylogenetic clustering with bacterial genes, coupled with the absence of close relatives of these genes in the Ciliate Tetrahymena thermophila, indicates that they have been acquired via Horizontal Gene Transfer (HGT) after the colonization of the gut by the rumen Ciliates. Among the HGT candidates, we found an over-representation (>75%) of genes involved in metabolism, specifically in the catabolism of complex carbohydrates, a rich food source in the rumen. We propose that the acquisition of these genes has greatly facilitated the Ciliates' colonization of the rumen providing evidence for the role of HGT in the adaptation to new niches.

Jail fever (epidemic typhus) outbreak in Burundi.

PubMed

Raoult, D; Roux, V; Ndihokubwayo, J B; Bise, G; Baudon, D; Marte, G; Birtles, R

1997-01-01

We recently investigated a suspected outbreak of epidemic typhus in a jail in Burundi. We tested sera of nine patients by microimmunofluorescence for antibodies to Rickettsia prowazekii and Rickettsia typhi. We also amplified and sequenced from lice gene portions specific for two R. prowazekii proteins: the gene encoding for citrate synthase and the gene encoding for the rickettsial outer membrane protein. All patients exhibited antibodies specific for R. prowazekii. Specific gene sequences were amplified in two lice from one patient. The patients had typical clinical manifestations, and two died. Molecular techniques provided a convenient and reliable means of examining lice and confirming this outbreak. The jail-associated outbreak predates an extensive ongoing outbreak of louse-borne typhus in central eastern Africa after civil war and in refugee camps in Rwanda, Burundi (1), and Zaire.

Jail fever (epidemic typhus) outbreak in Burundi.

PubMed Central

Raoult, D.; Roux, V.; Ndihokubwayo, J. B.; Bise, G.; Baudon, D.; Marte, G.; Birtles, R.

1997-01-01

We recently investigated a suspected outbreak of epidemic typhus in a jail in Burundi. We tested sera of nine patients by microimmunofluorescence for antibodies to Rickettsia prowazekii and Rickettsia typhi. We also amplified and sequenced from lice gene portions specific for two R. prowazekii proteins: the gene encoding for citrate synthase and the gene encoding for the rickettsial outer membrane protein. All patients exhibited antibodies specific for R. prowazekii. Specific gene sequences were amplified in two lice from one patient. The patients had typical clinical manifestations, and two died. Molecular techniques provided a convenient and reliable means of examining lice and confirming this outbreak. The jail-associated outbreak predates an extensive ongoing outbreak of louse-borne typhus in central eastern Africa after civil war and in refugee camps in Rwanda, Burundi (1), and Zaire. PMID:9284381

Molecular cloning of chitinase 33 (chit33) gene from Trichoderma atroviride

PubMed Central

Matroudi, S.; Zamani, M.R.; Motallebi, M.

2008-01-01

In this study Trichoderma atroviride was selected as over producer of chitinase enzyme among 30 different isolates of Trichoderma sp. on the basis of chitinase specific activity. From this isolate the genomic and cDNA clones encoding chit33 have been isolated and sequenced. Comparison of genomic and cDNA sequences for defining gene structure indicates that this gene contains three short introns and also an open reading frame coding for a protein of 321 amino acids. The deduced amino acid sequence includes a 19 aa putative signal peptide. Homology between this sequence and other reported Trichoderma Chit33 proteins are discussed. The coding sequence of chit33 gene was cloned in pEt26b(+) expression vector and expressed in E. coli. PMID:24031242

Comparative analysis of expressed sequence tags of conifers and angiosperms reveals sequences specifically conserved in conifers.

PubMed

Ujino-Ihara, Tokuko; Kanamori, Hiroyuki; Yamane, Hiroko; Taguchi, Yuriko; Namiki, Nobukazu; Mukai, Yuzuru; Yoshimura, Kensuke; Tsumura, Yoshihiko

2005-12-01

To identify and characterize lineage-specific genes of conifers, two sets of ESTs (with 12791 and 5902 ESTs, representing 5373 and 3018 gene transcripts, respectively) were generated from the Cupressaceae species Cryptomeria japonica and Chamaecyparis obtusa. These transcripts were compared with non-redundant sets of genes generated from Pinaceae species, other gymnosperms and angiosperms. About 6% of tentative unique genes (Unigenes) of C. japonica and C. obtusa had homologs in other conifers but not angiosperms, and about 70% had apparent homologs in angiosperms. The calculated GC contents of orthologous genes showed that GC contents of coniferous genes are likely to be lower than those of angiosperms. Comparisons of the numbers of homologous genes in each species suggest that copy numbers of genes may be correlated between diverse seed plants. This correlation suggests that the multiplicity of such genes may have arisen before the divergence of gymnosperms and angiosperms.

Construction of a Lotus japonicus late nodulin expressed sequence tag library and identification of novel nodule-specific genes.

PubMed Central

Szczyglowski, K; Hamburger, D; Kapranov, P; de Bruijn, F J

1997-01-01

A range of novel expressed sequence tags (ESTs) associated with late developmental events during nodule organogenesis in the legume Lotus japonicus were identified using mRNA differential display; 110 differentially displayed polymerase chain reaction products were cloned and analyzed. Of 88 unique cDNAs obtained, 22 shared significant homology to DNA/protein sequences in the respective databases. This group comprises, among others, a nodule-specific homolog of protein phosphatase 2C, a peptide transporter protein, and a nodule-specific form of cytochrome P450. RNA gel-blot analysis of 16 differentially displayed ESTs confirmed their nodule-specific expression pattern. The kinetics of mRNA accumulation of the majority of the ESTs analyzed were found to resemble the expression pattern observed for the L. japonicus leghemoglobin gene. These results indicate that the newly isolated molecular markers correspond to genes induced during late developmental stages of L. japonicus nodule organogenesis and provide important, novel tools for the study of nodulation. PMID:9276951

Emergence and Evolution of Hominidae-Specific Coding and Noncoding Genomic Sequences

PubMed Central

Saber, Morteza Mahmoudi; Adeyemi Babarinde, Isaac; Hettiarachchi, Nilmini; Saitou, Naruya

2016-01-01

Family Hominidae, which includes humans and great apes, is recognized for unique complex social behavior and intellectual abilities. Despite the increasing genome data, however, the genomic origin of its phenotypic uniqueness has remained elusive. Clade-specific genes and highly conserved noncoding sequences (HCNSs) are among the high-potential evolutionary candidates involved in driving clade-specific characters and phenotypes. On this premise, we analyzed whole genome sequences along with gene orthology data retrieved from major DNA databases to find Hominidae-specific (HS) genes and HCNSs. We discovered that Down syndrome critical region 4 (DSCR4) is the only experimentally verified gene uniquely present in Hominidae. DSCR4 has no structural homology to any known protein and was inferred to have emerged in several steps through LTR/ERV1, LTR/ERVL retrotransposition, and transversion. Using the genomic distance as neutral evolution threshold, we identified 1,658 HS HCNSs. Polymorphism coverage and derived allele frequency analysis of HS HCNSs showed that these HCNSs are under purifying selection, indicating that they may harbor important functions. They are overrepresented in promoters/untranslated regions, in close proximity of genes involved in sensory perception of sound and developmental process, and also showed a significantly lower nucleosome occupancy probability. Interestingly, many ancestral sequences of the HS HCNSs showed very high evolutionary rates. This suggests that new functions emerged through some kind of positive selection, and then purifying selection started to operate to keep these functions. PMID:27289096

Ancient Origin of the U2 Small Nuclear RNA Gene-Targeting Non-LTR Retrotransposons Utopia

PubMed Central

Kojima, Kenji K.

2015-01-01

Most non-long terminal repeat (non-LTR) retrotransposons encoding a restriction-like endonuclease show target-specific integration into repetitive sequences such as ribosomal RNA genes and microsatellites. However, only a few target-specific lineages of non-LTR retrotransposons are distributed widely and no lineage is found across the eukaryotic kingdoms. Here we report the most widely distributed lineage of target sequence-specific non-LTR retrotransposons, designated Utopia. Utopia is found in three supergroups of eukaryotes: Amoebozoa, SAR, and Opisthokonta. Utopia is inserted into a specific site of U2 small nuclear RNA genes with different strength of specificity for each family. Utopia families from oomycetes and wasps show strong target specificity while only a small number of Utopia copies from reptiles are flanked with U2 snRNA genes. Oomycete Utopia families contain an “archaeal” RNase H domain upstream of reverse transcriptase (RT), which likely originated from a plant RNase H gene. Analysis of Utopia from oomycetes indicates that multiple lineages of Utopia have been maintained inside of U2 genes with few copy numbers. Phylogenetic analysis of RT suggests the monophyly of Utopia, and it likely dates back to the early evolution of eukaryotes. PMID:26556480

Dissemination of IMP-6 metallo-β-lactamase-producing Pseudomonas aeruginosa sequence type 235 in Korea.

PubMed

Seok, Yoonmi; Bae, Il Kwon; Jeong, Seok Hoon; Kim, Soo Hyun; Lee, Hyukmin; Lee, Kyungwon

2011-12-01

To investigate the epidemiological traits of Pseudomonas aeruginosa clinical isolates producing metallo-β-lactamases (MBLs) in Korea. A total of 386 non-duplicate P. aeruginosa clinical isolates were collected from Korea in 2009. Detection of MBL genes was performed by PCR. The genetic organization of class 1 integrons carrying the MBL gene cassette was investigated by PCR mapping and sequencing. The epidemiological relationships of the isolates were investigated by multilocus sequence typing and PFGE. Of 386 P. aeruginosa isolates, 30 (7.8%) isolates carried the bla(IMP-6) gene and 1 (0.3%) isolate carried the bla(VIM-2) gene. A probe specific for the bla(IMP-6) gene was hybridized to an ∼950 kbp I-CeuI-macrorestriction fragment from all 30 isolates and a probe specific for the bla(VIM-2) gene also hybridized to an ∼500 kbp I-CeuI-macrorestriction fragment from 1 isolate (BDC10). All 31 MBL-producing isolates shared an identical sequence type (ST), ST235, and they carried the same bla(OXA-50) allelic type, bla(OXA-50g). All MBL-producing isolates showed similar XbaI-macrorestriction patterns (similarity >85%), irrespective of MBL genotype. P. aeruginosa ST235 carrying the chromosomally located bla(IMP-6) gene is widely disseminated in Korea.

Gene discovery in the hamster: a comparative genomics approach for gene annotation by sequencing of hamster testis cDNAs

PubMed Central

Oduru, Sreedhar; Campbell, Janee L; Karri, SriTulasi; Hendry, William J; Khan, Shafiq A; Williams, Simon C

2003-01-01

Background Complete genome annotation will likely be achieved through a combination of computer-based analysis of available genome sequences combined with direct experimental characterization of expressed regions of individual genomes. We have utilized a comparative genomics approach involving the sequencing of randomly selected hamster testis cDNAs to begin to identify genes not previously annotated on the human, mouse, rat and Fugu (pufferfish) genomes. Results 735 distinct sequences were analyzed for their relatedness to known sequences in public databases. Eight of these sequences were derived from previously unidentified genes and expression of these genes in testis was confirmed by Northern blotting. The genomic locations of each sequence were mapped in human, mouse, rat and pufferfish, where applicable, and the structure of their cognate genes was derived using computer-based predictions, genomic comparisons and analysis of uncharacterized cDNA sequences from human and macaque. Conclusion The use of a comparative genomics approach resulted in the identification of eight cDNAs that correspond to previously uncharacterized genes in the human genome. The proteins encoded by these genes included a new member of the kinesin superfamily, a SET/MYND-domain protein, and six proteins for which no specific function could be predicted. Each gene was expressed primarily in testis, suggesting that they may play roles in the development and/or function of testicular cells. PMID:12783626

Gene silencing in the therapy of influenza and other respiratory diseases: Targeting to RNase P by use of External Guide Sequences (EGS)

PubMed Central

Dreyfus, David H; Tompkins, S Mark; Fuleihan, Ramsay; Ghoda, Lucy Y

2007-01-01

Respiratory diseases provide an attractive target for gene silencing using small nucleic acids since the respiratory epithelium can be reached by inhalation therapy. Natural surfactant appears to facilitate the uptake and distribution of these types of molecules making aerosolized nucleic acids a possible new class of therapeutics. This article will review the rationale for the use of External Guide Sequence (EGS) in targeting specific mRNA molecules for RNase P-mediated intracellular destruction. Specific destruction of target mRNA results in gene-specific silencing similar to that instigated by siRNA via the RISC complex. The application of EGS molecules specific for influenza genes are discussed as well as the potential for synergy with siRNA. Furthermore, EGS could be adapted to target other respiratory diseases of viral etiology as well as conditions such as asthma. PMID:19707312

Establishing gene models from the Pinus pinaster genome using gene capture and BAC sequencing.

PubMed

Seoane-Zonjic, Pedro; Cañas, Rafael A; Bautista, Rocío; Gómez-Maldonado, Josefa; Arrillaga, Isabel; Fernández-Pozo, Noé; Claros, M Gonzalo; Cánovas, Francisco M; Ávila, Concepción

2016-02-27

In the era of DNA throughput sequencing, assembling and understanding gymnosperm mega-genomes remains a challenge. Although drafts of three conifer genomes have recently been published, this number is too low to understand the full complexity of conifer genomes. Using techniques focused on specific genes, gene models can be established that can aid in the assembly of gene-rich regions, and this information can be used to compare genomes and understand functional evolution. In this study, gene capture technology combined with BAC isolation and sequencing was used as an experimental approach to establish de novo gene structures without a reference genome. Probes were designed for 866 maritime pine transcripts to sequence genes captured from genomic DNA. The gene models were constructed using GeneAssembler, a new bioinformatic pipeline, which reconstructed over 82% of the gene structures, and a high proportion (85%) of the captured gene models contained sequences from the promoter regulatory region. In a parallel experiment, the P. pinaster BAC library was screened to isolate clones containing genes whose cDNA sequence were already available. BAC clones containing the asparagine synthetase, sucrose synthase and xyloglucan endotransglycosylase gene sequences were isolated and used in this study. The gene models derived from the gene capture approach were compared with the genomic sequences derived from the BAC clones. This combined approach is a particularly efficient way to capture the genomic structures of gene families with a small number of members. The experimental approach used in this study is a valuable combined technique to study genomic gene structures in species for which a reference genome is unavailable. It can be used to establish exon/intron boundaries in unknown gene structures, to reconstruct incomplete genes and to obtain promoter sequences that can be used for transcriptional studies. A bioinformatics algorithm (GeneAssembler) is also provided as a Ruby gem for this class of analyses.

Validation and application of quantitative PCR assays using host-specific Bacteroidales genetic markers for swine fecal pollution tracking.

PubMed

Fan, Lihua; Shuai, Jiangbing; Zeng, Ruoxue; Mo, Hongfei; Wang, Suhua; Zhang, Xiaofeng; He, Yongqiang

2017-12-01

Genome fragment enrichment (GFE) method was applied to identify host-specific bacterial genetic markers that differ among different fecal metagenomes. To enrich for swine-specific DNA fragments, swine fecal DNA composite (n = 34) was challenged against a DNA composite consisting of cow, human, goat, sheep, chicken, duck and goose fecal DNA extracts (n = 83). Bioinformatic analyses of 384 non-redundant swine enriched metagenomic sequences indicated a preponderance of Bacteroidales-like regions predicted to encode metabolism-associated, cellular processes and information storage and processing. After challenged against fecal DNA extracted from different animal sources, four sequences from the clone libraries targeting two Bacteroidales- (genes 1-38 and 3-53), a Clostridia- (gene 2-109) as well as a Bacilli-like sequence (gene 2-95), respectively, showed high specificity to swine feces based on PCR analysis. Host-specificity and host-sensitivity analysis confirmed that oligonucleotide primers and probes capable of annealing to select Bacteroidales-like sequences (1-38 and 3-53) exhibited high specificity (>90%) in quantitative PCR assays with 71 fecal DNAs from non-target animal sources. The two assays also demonstrated broad distributions of corresponding genetic markers (>94% positive) among 72 swine feces. After evaluation with environmental water samples from different areas, swine-targeted assays based on two Bacteroidales-like GFE sequences appear to be suitable quantitative tracing tools for swine fecal pollution. Copyright © 2017 Elsevier Ltd. All rights reserved.

Large-scale transcriptome sequencing and gene analyses in the crab-eating macaque (Macaca fascicularis) for biomedical research

PubMed Central

2012-01-01

Background As a human replacement, the crab-eating macaque (Macaca fascicularis) is an invaluable non-human primate model for biomedical research, but the lack of genetic information on this primate has represented a significant obstacle for its broader use. Results Here, we sequenced the transcriptome of 16 tissues originated from two individuals of crab-eating macaque (male and female), and identified genes to resolve the main obstacles for understanding the biological response of the crab-eating macaque. From 4 million reads with 1.4 billion base sequences, 31,786 isotigs containing genes similar to those of humans, 12,672 novel isotigs, and 348,160 singletons were identified using the GS FLX sequencing method. Approximately 86% of human genes were represented among the genes sequenced in this study. Additionally, 175 tissue-specific transcripts were identified, 81 of which were experimentally validated. In total, 4,314 alternative splicing (AS) events were identified and analyzed. Intriguingly, 10.4% of AS events were associated with transposable element (TE) insertions. Finally, investigation of TE exonization events and evolutionary analysis were conducted, revealing interesting phenomena of human-specific amplified trends in TE exonization events. Conclusions This report represents the first large-scale transcriptome sequencing and genetic analyses of M. fascicularis and could contribute to its utility for biomedical research and basic biology. PMID:22554259

High-throughput identification of antigen-specific TCRs by TCR gene capture.

PubMed

Linnemann, Carsten; Heemskerk, Bianca; Kvistborg, Pia; Kluin, Roelof J C; Bolotin, Dmitriy A; Chen, Xiaojing; Bresser, Kaspar; Nieuwland, Marja; Schotte, Remko; Michels, Samira; Gomez-Eerland, Raquel; Jahn, Lorenz; Hombrink, Pleun; Legrand, Nicolas; Shu, Chengyi Jenny; Mamedov, Ilgar Z; Velds, Arno; Blank, Christian U; Haanen, John B A G; Turchaninova, Maria A; Kerkhoven, Ron M; Spits, Hergen; Hadrup, Sine Reker; Heemskerk, Mirjam H M; Blankenstein, Thomas; Chudakov, Dmitriy M; Bendle, Gavin M; Schumacher, Ton N M

2013-11-01

The transfer of T cell receptor (TCR) genes into patient T cells is a promising approach for the treatment of both viral infections and cancer. Although efficient methods exist to identify antibodies for the treatment of these diseases, comparable strategies to identify TCRs have been lacking. We have developed a high-throughput DNA-based strategy to identify TCR sequences by the capture and sequencing of genomic DNA fragments encoding the TCR genes. We establish the value of this approach by assembling a large library of cancer germline tumor antigen-reactive TCRs. Furthermore, by exploiting the quantitative nature of TCR gene capture, we show the feasibility of identifying antigen-specific TCRs in oligoclonal T cell populations from either human material or TCR-humanized mice. Finally, we demonstrate the ability to identify tumor-reactive TCRs within intratumoral T cell subsets without knowledge of antigen specificities, which may be the first step toward the development of autologous TCR gene therapy to target patient-specific neoantigens in human cancer.

Expressed Sequence Reference Standards for Evaluating Stage-specific Gene Expression in Southern Green Lacewings, Chrysoperla rufilabris

USDA-ARS?s Scientific Manuscript database

Five developmental stages of Chrysoperla rufilabris were tested using nine primer pairs. Three sequences were highly expressed at all life stages and six were differentially expressed. These primer pairs may be used as standards to quantitate functional gene expression associated with physiological ...

RNAi triggered by symmetrically transcribed transgenes in Drosophila melanogaster.

PubMed Central

Giordano, Ennio; Rendina, Rosaria; Peluso, Ivana; Furia, Maria

2002-01-01

Specific silencing of target genes can be induced in a variety of organisms by providing homologous double-stranded RNA molecules. In vivo, these molecules can be generated either by transcription of sequences having an inverted-repeat (IR) configuration or by simultaneous transcription of sense-antisense strands. Since IR constructs are difficult to prepare and can stimulate genomic rearrangements, we investigated the silencing potential of symmetrically transcribed sequences. We report that Drosophila transgenes whose sense-antisense transcription was driven by two convergent arrays of Gal4-dependent UAS sequences can induce specific, dominant, and heritable repression of target genes. This effect is not dependent on a mechanism based on homology-dependent DNA/DNA interactions, but is directly triggered by transcriptional activation and is accompanied by specific depletion of the endogenous target RNA. Tissue-specific induction of these transgenes restricts the target gene silencing to selected body domains, and spreading phenomena described in other cases of post-transcriptional gene silencing (PTGS) were not observed. In addition to providing an additional tool useful for Drosophila functional genomic analysis, these results add further strength to the view that events of sense-antisense transcription may readily account for some, if not all, PTGS-cosuppression phenomena and can potentially play a relevant role in gene regulation. PMID:11861567

Identification of Type A, B, E, and F Botulinum Neurotoxin Genes and of Botulinum Neurotoxigenic Clostridia by Denaturing High-Performance Liquid Chromatography

PubMed Central

Franciosa, Giovanna; Pourshaban, Manoocheher; De Luca, Alessandro; Buccino, Anna; Dallapiccola, Bruno; Aureli, Paolo

2004-01-01

Denaturing high-performance liquid chromatography (DHPLC) is a recently developed technique for rapid screening of nucleotide polymorphisms in PCR products. We used this technique for the identification of type A, B, E, and F botulinum neurotoxin genes. PCR products amplified from a conserved region of the type A, B, E, and F botulinum toxin genes from Clostridium botulinum, neurotoxigenic C. butyricum type E, and C. baratii type F strains were subjected to both DHPLC analysis and sequencing. Unique DHPLC peak profiles were obtained with each different type of botulinum toxin gene fragment, consistent with nucleotide differences observed in the related sequences. We then evaluated the ability of this technique to identify botulinal neurotoxigenic organisms at the genus and species level. A specific short region of the 16S rRNA gene which contains genus-specific and in some cases species-specific heterogeneity was amplified from botulinum neurotoxigenic clostridia and from different food-borne pathogens and subjected to DHPLC analysis. Different peak profiles were obtained for each genus and species, demonstrating that the technique could be a reliable alternative to sequencing for the rapid identification of food-borne pathogens, specifically of botulinal neurotoxigenic clostridia most frequently implicated in human botulism. PMID:15240298

Mutations on the DNA Binding Surface of TBP Discriminate between Yeast TATA and TATA-Less Gene Transcription

PubMed Central

Kamenova, Ivanka; Warfield, Linda

2014-01-01

Most RNA polymerase (Pol) II promoters lack a TATA element, yet nearly all Pol II transcription requires TATA binding protein (TBP). While the TBP-TATA interaction is critical for transcription at TATA-containing promoters, it has been unclear whether TBP sequence-specific DNA contacts are required for transcription at TATA-less genes. Transcription factor IID (TFIID), the TBP-containing coactivator that functions at most TATA-less genes, recognizes short sequence-specific promoter elements in metazoans, but analogous promoter elements have not been identified in Saccharomyces cerevisiae. We generated a set of mutations in the yeast TBP DNA binding surface and found that most support growth of yeast. Both in vivo and in vitro, many of these mutations are specifically defective for transcription of two TATA-containing genes with only minor defects in transcription of two TATA-less, TFIID-dependent genes. TBP binds several TATA-less promoters with apparent high affinity, but our results suggest that this binding is not important for transcription activity. Our results are consistent with the model that sequence-specific TBP-DNA contacts are not important at yeast TATA-less genes and suggest that other general transcription factors or coactivator subunits are responsible for recognition of TATA-less promoters. Our results also explain why yeast TBP derivatives defective for TATA binding appear defective in activated transcription. PMID:24865972

Mutations on the DNA binding surface of TBP discriminate between yeast TATA and TATA-less gene transcription.

PubMed

Kamenova, Ivanka; Warfield, Linda; Hahn, Steven

2014-08-01

Most RNA polymerase (Pol) II promoters lack a TATA element, yet nearly all Pol II transcription requires TATA binding protein (TBP). While the TBP-TATA interaction is critical for transcription at TATA-containing promoters, it has been unclear whether TBP sequence-specific DNA contacts are required for transcription at TATA-less genes. Transcription factor IID (TFIID), the TBP-containing coactivator that functions at most TATA-less genes, recognizes short sequence-specific promoter elements in metazoans, but analogous promoter elements have not been identified in Saccharomyces cerevisiae. We generated a set of mutations in the yeast TBP DNA binding surface and found that most support growth of yeast. Both in vivo and in vitro, many of these mutations are specifically defective for transcription of two TATA-containing genes with only minor defects in transcription of two TATA-less, TFIID-dependent genes. TBP binds several TATA-less promoters with apparent high affinity, but our results suggest that this binding is not important for transcription activity. Our results are consistent with the model that sequence-specific TBP-DNA contacts are not important at yeast TATA-less genes and suggest that other general transcription factors or coactivator subunits are responsible for recognition of TATA-less promoters. Our results also explain why yeast TBP derivatives defective for TATA binding appear defective in activated transcription. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

A New Way to Introduce Microarray Technology in a Lecture/Laboratory Setting by Studying the Evolution of This Modern Technology

ERIC Educational Resources Information Center

Rowland-Goldsmith, Melissa

2009-01-01

DNA microarray is an ordered grid containing known sequences of DNA, which represent many of the genes in a particular organism. Each DNA sequence is unique to a specific gene. This technology enables the researcher to screen many genes from cells or tissue grown in different conditions. We developed an undergraduate lecture and laboratory…

Sequence-specific "gene signatures" can be obtained by PCR with single specific primers at low stringency.

PubMed Central

Pena, S D; Barreto, G; Vago, A R; De Marco, L; Reinach, F C; Dias Neto, E; Simpson, A J

1994-01-01

Low-stringency single specific primer PCR (LSSP-PCR) is an extremely simple PCR-based technique that detects single or multiple mutations in gene-sized DNA fragments. A purified DNA fragment is subjected to PCR using high concentrations of a single specific oligonucleotide primer, large amounts of Taq polymerase, and a very low annealing temperature. Under these conditions the primer hybridizes specifically to its complementary region and nonspecifically to multiple sites within the fragment, in a sequence-dependent manner, producing a heterogeneous set of reaction products resolvable by electrophoresis. The complex banding pattern obtained is significantly altered by even a single-base change and thus constitutes a unique "gene signature." Therefore LSSP-PCR will have almost unlimited application in all fields of genetics and molecular medicine where rapid and sensitive detection of mutations and sequence variations is important. The usefulness of LSSP-PCR is illustrated by applications in the study of mutants of smooth muscle myosin light chain, analysis of a family with X-linked nephrogenic diabetes insipidus, and identity testing using human mitochondrial DNA. Images PMID:8127912

Sequence-specific DNA binding Pyrrole-imidazole polyamides and their applications.

PubMed

Kawamoto, Yusuke; Bando, Toshikazu; Sugiyama, Hiroshi

2018-05-01

Pyrrole-imidazole polyamides (Py-Im polyamides) are cell-permeable compounds that bind to the minor groove of double-stranded DNA in a sequence-specific manner without causing denaturation of the DNA. These compounds can be used to control gene expression and to stain specific sequences in cells. Here, we review the history, structural variations, and functional investigations of Py-Im polyamides. Copyright © 2018 Elsevier Ltd. All rights reserved.

Cloning and sequencing of a laccase gene from the lignin-degrading basidiomycete Pleurotus ostreatus.

PubMed Central

Giardina, P; Cannio, R; Martirani, L; Marzullo, L; Palmieri, G; Sannia, G

1995-01-01

The gene (pox1) encoding a phenol oxidase from Pleurotus ostreatus, a lignin-degrading basidiomycete, was cloned and sequenced, and the corresponding pox1 cDNA was also synthesized and sequenced. The isolated gene consists of 2,592 bp, with the coding sequence being interrupted by 19 introns and flanked by an upstream region in which putative CAAT and TATA consensus sequences could be identified at positions -174 and -84, respectively. The isolation of a second cDNA (pox2 cDNA), showing 84% similarity, and of the corresponding truncated genomic clones demonstrated the existence of a multigene family coding for isoforms of laccase in P. ostreatus. PCR amplifications of specific regions on the DNA of isolated monokaryons proved that the two genes are not allelic forms. The POX1 amino acid sequence deduced was compared with those of other known laccases from different fungi. PMID:7793961

Elephant Transcriptome Provides Insights into the Evolution of Eutherian Placentation

PubMed Central

Hou, Zhuo-Cheng; Sterner, Kirstin N.; Romero, Roberto; Than, Nandor Gabor; Gonzalez, Juan M.; Weckle, Amy; Xing, Jun; Benirschke, Kurt; Goodman, Morris; Wildman, Derek E.

2012-01-01

The chorioallantoic placenta connects mother and fetus in eutherian pregnancies. In order to understand the evolution of the placenta and provide further understanding of placenta biology, we sequenced the transcriptome of a term placenta of an African elephant (Loxodonta africana) and compared these data with RNA sequence and microarray data from other eutherian placentas including human, mouse, and cow. We characterized the composition of 55,910 expressed sequence tag (i.e., cDNA) contigs using our custom annotation pipeline. A Markov algorithm was used to cluster orthologs of human, mouse, cow, and elephant placenta transcripts. We found 2,963 genes are commonly expressed in the placentas of these eutherian mammals. Gene ontology categories previously suggested to be important for placenta function (e.g., estrogen receptor signaling pathway, cell motion and migration, and adherens junctions) were significantly enriched in these eutherian placenta–expressed genes. Genes duplicated in different lineages and also specifically expressed in the placenta contribute to the great diversity observed in mammalian placenta anatomy. We identified 1,365 human lineage–specific, 1,235 mouse lineage–specific, 436 cow lineage–specific, and 904 elephant-specific placenta-expressed (PE) genes. The most enriched clusters of human-specific PE genes are signal/glycoprotein and immunoglobulin, and humans possess a deeply invasive human hemochorial placenta that comes into direct contact with maternal immune cells. Inference of phylogenetically conserved and derived transcripts demonstrates the power of comparative transcriptomics to trace placenta evolution and variation across mammals and identified candidate genes that may be important in the normal function of the human placenta, and their dysfunction may be related to human pregnancy complications. PMID:22546564

Genomic organization, complete sequence, and chromosomal location of the gene for human eotaxin (SCYA11), an eosinophil-specific CC chemokine

DOE Office of Scientific and Technical Information (OSTI.GOV)

Garcia-Zepeda, E.A.; Sarafi, M.N.; Luster, A.D.

1997-05-01

Eotaxin is a CC chemokine that is a specific chemoattractant for eosinophils and is implicated in the pathogenesis of eosinophilic inflammatory diseases, such as asthma. We describe the genomic organization, complete sequence, including 1354 bp 5{prime} of the RNA initiation site, and chromosomal localization of the human eotaxin gene. Fluorescence in situ hybridization analysis localized eotaxin to human chromosome 17, in the region q21.1-q21.2, and the human gene name SCYA11 was assigned. We also present the 5{prime} flanking sequence of the mouse eotaxin gene and have identified several regulatory elements that are conserved between the murine and the human promoters.more » In particular, the presence of elements such as NF-{Kappa}B, interferon-{gamma} response element, and glucocorticoid response element may explain the observed regulation of the eotaxin gene by cytokines and glucocorticoids. 17 refs., 4 figs., 1 tab.« less

Comparative Analysis of Genome Sequences Covering the Seven Cronobacter Species

PubMed Central

Cummings, Craig A.; Shih, Rita; Degoricija, Lovorka; Rico, Alain; Brzoska, Pius; Hamby, Stephen E.; Masood, Naqash; Hariri, Sumyya; Sonbol, Hana; Chuzhanova, Nadia; McClelland, Michael; Furtado, Manohar R.; Forsythe, Stephen J.

2012-01-01

Background Species of Cronobacter are widespread in the environment and are occasional food-borne pathogens associated with serious neonatal diseases, including bacteraemia, meningitis, and necrotising enterocolitis. The genus is composed of seven species: C. sakazakii, C. malonaticus, C. turicensis, C. dublinensis, C. muytjensii, C. universalis, and C. condimenti. Clinical cases are associated with three species, C. malonaticus, C. turicensis and, in particular, with C. sakazakii multilocus sequence type 4. Thus, it is plausible that virulence determinants have evolved in certain lineages. Methodology/Principal Findings We generated high quality sequence drafts for eleven Cronobacter genomes representing the seven Cronobacter species, including an ST4 strain of C. sakazakii. Comparative analysis of these genomes together with the two publicly available genomes revealed Cronobacter has over 6,000 genes in one or more strains and over 2,000 genes shared by all Cronobacter. Considerable variation in the presence of traits such as type six secretion systems, metal resistance (tellurite, copper and silver), and adhesins were found. C. sakazakii is unique in the Cronobacter genus in encoding genes enabling the utilization of exogenous sialic acid which may have clinical significance. The C. sakazakii ST4 strain 701 contained additional genes as compared to other C. sakazakii but none of them were known specific virulence-related genes. Conclusions/Significance Genome comparison revealed that pair-wise DNA sequence identity varies between 89 and 97% in the seven Cronobacter species, and also suggested various degrees of divergence. Sets of universal core genes and accessory genes unique to each strain were identified. These gene sequences can be used for designing genus/species specific detection assays. Genes encoding adhesins, T6SS, and metal resistance genes as well as prophages are found in only subsets of genomes and have contributed considerably to the variation of genomic content. Differences in gene content likely contribute to differences in the clinical and environmental distribution of species and sequence types. PMID:23166675

Biodiversity of mannose-specific adhesion in Lactobacillus plantarum revisited: strain-specific domain composition of the mannose-adhesin.

PubMed

Gross, G; Snel, J; Boekhorst, J; Smits, M A; Kleerebezem, M

2010-03-01

Recently, we have identified the mannose-specific adhesin encoding gene (msa) of Lactobacillus plantarum. In the current study, structure and function of this potentially probiotic effector gene were further investigated, exploring genetic diversity of msa in L. plantarum in relation to mannose adhesion capacity. The results demonstrate that there is considerable variation in quantitative in vitro mannose adhesion capacity, which is paralleled by msa gene sequence variation. The msa genes of different L. plantarum strains encode proteins with variable domain composition. Construction of L. plantarum 299v mutant strains revealed that the msa gene product is the key-protein for mannose adhesion, also in a strain with high mannose adhering capacity. However, no straightforward correlation between adhesion capacity and domain composition of Msa in L. plantarum could be identified. Nevertheless, differences in Msa sequences in combination with variable genetic background of specific bacterial strains appears to determine mannose adhesion capacity and potentially affects probiotic properties. These findings exemplify the strain-specificity of probiotic characteristics and illustrate the need for careful and molecular selection of new candidate probiotics.

CLINICAL PROGRESS IN INHERITED RETINAL DEGENERATIONS: GENE THERAPY CLINICAL TRIALS AND ADVANCES IN GENETIC SEQUENCING

PubMed Central

HAFLER, BRIAN P.

2017-01-01

Purpose Inherited retinal dystrophies are a significant cause of vision loss and are characterized by the loss of photoreceptors and the retinal pigment epithelium (RPE). Mutations in approximately 250 genes cause inherited retinal degenerations with a high degree of genetic heterogeneity. New techniques in next-generation sequencing are allowing the comprehensive analysis of all retinal disease genes thus changing the approach to the molecular diagnosis of inherited retinal dystrophies. This review serves to analyze clinical progress in genetic diagnostic testing and implications for retinal gene therapy. Methods A literature search of PubMed and OMIM was conducted to relevant articles in inherited retinal dystrophies. Results Next-generation genetic sequencing allows the simultaneous analysis of all the approximately 250 genes that cause inherited retinal dystrophies. Reported diagnostic rates range are high and range from 51% to 57%. These new sequencing tools are highly accurate with sensitivities of 97.9% and specificities of 100%. Retinal gene therapy clinical trials are underway for multiple genes including RPE65, ABCA4, CHM, RS1, MYO7A, CNGA3, CNGB3, ND4, and MERTK for which a molecular diagnosis may be beneficial for patients. Conclusion Comprehensive next-generation genetic sequencing of all retinal dystrophy genes is changing the paradigm for how retinal specialists perform genetic testing for inherited retinal degenerations. Not only are high diagnostic yields obtained, but mutations in genes with novel clinical phenotypes are also identified. In the era of retinal gene therapy clinical trials, identifying specific genetic defects will increasingly be of use to identify patients who may enroll in clinical studies and benefit from novel therapies. PMID:27753762

PreCisIon: PREdiction of CIS-regulatory elements improved by gene's positION.

PubMed

Elati, Mohamed; Nicolle, Rémy; Junier, Ivan; Fernández, David; Fekih, Rim; Font, Julio; Képès, François

2013-02-01

Conventional approaches to predict transcriptional regulatory interactions usually rely on the definition of a shared motif sequence on the target genes of a transcription factor (TF). These efforts have been frustrated by the limited availability and accuracy of TF binding site motifs, usually represented as position-specific scoring matrices, which may match large numbers of sites and produce an unreliable list of target genes. To improve the prediction of binding sites, we propose to additionally use the unrelated knowledge of the genome layout. Indeed, it has been shown that co-regulated genes tend to be either neighbors or periodically spaced along the whole chromosome. This study demonstrates that respective gene positioning carries significant information. This novel type of information is combined with traditional sequence information by a machine learning algorithm called PreCisIon. To optimize this combination, PreCisIon builds a strong gene target classifier by adaptively combining weak classifiers based on either local binding sequence or global gene position. This strategy generically paves the way to the optimized incorporation of any future advances in gene target prediction based on local sequence, genome layout or on novel criteria. With the current state of the art, PreCisIon consistently improves methods based on sequence information only. This is shown by implementing a cross-validation analysis of the 20 major TFs from two phylogenetically remote model organisms. For Bacillus subtilis and Escherichia coli, respectively, PreCisIon achieves on average an area under the receiver operating characteristic curve of 70 and 60%, a sensitivity of 80 and 70% and a specificity of 60 and 56%. The newly predicted gene targets are demonstrated to be functionally consistent with previously known targets, as assessed by analysis of Gene Ontology enrichment or of the relevant literature and databases.

Bellerophon: A program to detect chimeric sequences in multiple sequence alignments

DOE Office of Scientific and Technical Information (OSTI.GOV)

Huber, Thomas; Faulkner, Geoffrey; Hugenholtz, Philip

2003-12-23

Bellerophon is a program for detecting chimeric sequences in multiple sequence datasets by an adaption of partial treeing analysis. Bellerophon was specifically developed to detect 16S rRNA gene chimeras in PCR-clone libraries of environmental samples but can be applied to other nucleotide sequence alignments.

Comparative genome sequencing of Drosophila pseudoobscura: Chromosomal, gene, and cis-element evolution

PubMed Central

Richards, Stephen; Liu, Yue; Bettencourt, Brian R.; Hradecky, Pavel; Letovsky, Stan; Nielsen, Rasmus; Thornton, Kevin; Hubisz, Melissa J.; Chen, Rui; Meisel, Richard P.; Couronne, Olivier; Hua, Sujun; Smith, Mark A.; Zhang, Peili; Liu, Jing; Bussemaker, Harmen J.; van Batenburg, Marinus F.; Howells, Sally L.; Scherer, Steven E.; Sodergren, Erica; Matthews, Beverly B.; Crosby, Madeline A.; Schroeder, Andrew J.; Ortiz-Barrientos, Daniel; Rives, Catharine M.; Metzker, Michael L.; Muzny, Donna M.; Scott, Graham; Steffen, David; Wheeler, David A.; Worley, Kim C.; Havlak, Paul; Durbin, K. James; Egan, Amy; Gill, Rachel; Hume, Jennifer; Morgan, Margaret B.; Miner, George; Hamilton, Cerissa; Huang, Yanmei; Waldron, Lenée; Verduzco, Daniel; Clerc-Blankenburg, Kerstin P.; Dubchak, Inna; Noor, Mohamed A.F.; Anderson, Wyatt; White, Kevin P.; Clark, Andrew G.; Schaeffer, Stephen W.; Gelbart, William; Weinstock, George M.; Gibbs, Richard A.

2005-01-01

We have sequenced the genome of a second Drosophila species, Drosophila pseudoobscura, and compared this to the genome sequence of Drosophila melanogaster, a primary model organism. Throughout evolution the vast majority of Drosophila genes have remained on the same chromosome arm, but within each arm gene order has been extensively reshuffled, leading to a minimum of 921 syntenic blocks shared between the species. A repetitive sequence is found in the D. pseudoobscura genome at many junctions between adjacent syntenic blocks. Analysis of this novel repetitive element family suggests that recombination between offset elements may have given rise to many paracentric inversions, thereby contributing to the shuffling of gene order in the D. pseudoobscura lineage. Based on sequence similarity and synteny, 10,516 putative orthologs have been identified as a core gene set conserved over 25–55 million years (Myr) since the pseudoobscura/melanogaster divergence. Genes expressed in the testes had higher amino acid sequence divergence than the genome-wide average, consistent with the rapid evolution of sex-specific proteins. Cis-regulatory sequences are more conserved than random and nearby sequences between the species—but the difference is slight, suggesting that the evolution of cis-regulatory elements is flexible. Overall, a pattern of repeat-mediated chromosomal rearrangement, and high coadaptation of both male genes and cis-regulatory sequences emerges as important themes of genome divergence between these species of Drosophila. PMID:15632085

Two cis elements collaborate to spatially repress transcription from a sea urchin promoter

NASA Technical Reports Server (NTRS)

Frudakis, T. N.; Wilt, F.

1995-01-01

The expression pattern of many territory-specific genes in metazoan embryos is maintained by an active process of negative spatial regulation. However, the mechanism of this strategy of gene regulation is not well understood in any system. Here we show that reporter constructs containing regulatory sequence for the SM30-alpha gene of Stronglyocentrotus purpuratus are expressed in a pattern congruent with that of the endogenous SM30 gene(s), largely as a result of active transcriptional repression in cell lineages in which the gene is not normally expressed. Chloramphenicol acetyl transferase assays of deletion constructs from the 2600-bp upstream region showed that repressive elements were present in the region from -1628 to -300. In situ hybridization analysis showed that the spatial fidelity of expression was severely compromised when the region from -1628 to -300 was deleted. Two highly repetitive sequence motifs, (G/A/C)CCCCT and (T/C)(T/A/C)CTTTT(T/A/C), are present in the -1628 to -300 region. Representatives of these elements were analyzed by gel mobility shift experiments and were found to interact specifically with protein in crude nuclear extracts. When oligonucleotides containing either sequence element were co-injected with a correctly regulated reporter as potential competitors, the reporter was expressed in inappropriate cells. When composite oligonucleotides, containing both sequence elements, were fused to a misregulated reporter, the expression of the reporter in inappropriate cells was suppressed. Comparison of composite oligonucleotides with oligonucleotides containing single constituent elements show that both sequence elements are required for effective spatial regulation. Thus, both individual elements are required, but only a composite element containing both elements is sufficient to function as a tissue-specific repressive element.

Molecular coevolution of mammalian ribosomal gene terminator sequences and the transcription termination factor TTF-I.

PubMed Central

Evers, R; Grummt, I

1995-01-01

Both the DNA elements and the nuclear factors that direct termination of ribosomal gene transcription exhibit species-specific differences. Even between mammals--e.g., human and mouse--the termination signals are not identical and the respective transcription termination factors (TTFs) which bind to the terminator sequence are not fully interchangeable. To elucidate the molecular basis for this species-specificity, we have cloned TTF-I from human and mouse cells and compared their structural and functional properties. Recombinant TTF-I exhibits species-specific DNA binding and terminates transcription both in cell-free transcription assays and in transfection experiments. Chimeric constructs of mouse TTF-I and human TTF-I reveal that the major determinant for species-specific DNA binding resides within the C terminus of TTF-I. Replacing 31 C-terminal amino acids of mouse TTF-I with the homologous human sequences relaxes the DNA-binding specificity and, as a consequence, allows the chimeric factor to bind the human terminator sequence and to specifically stop rDNA transcription. Images Fig. 2 Fig. 3 Fig. 4 PMID:7597036

Genomic organization of human fetal specific P-450IIIA7 (cytochrome P-450HFLa)-related gene(s) and interaction of transcriptional regulatory factor with its DNA element in the 5' flanking region.

PubMed

Itoh, S; Yanagimoto, T; Tagawa, S; Hashimoto, H; Kitamura, R; Nakajima, Y; Okochi, T; Fujimoto, S; Uchino, J; Kamataki, T

1992-03-24

P-450IIIA7 is a form of cytochrome P-450 which was isolated from human fetal livers and termed P-450HFLa. This form has been clarified to be expressed during fetal life specifically (Komori, M., Nishio, K., Kitada, M., Shiramatsu, K., Muroya, K., Soma, M., Nagashima, K. and Kamataki, T. (1990) Biochemistry 29, 4430-4433). In the present study, we isolated five independent clones which probably corresponded to the human P-450IIIA7 gene. These clones were completely sequenced, all exons, exon-intron junctions and the 5' flanking region from the cap site to-869. Although the sequences in the coding region were completely identical to P-450IIIA7, it is possible that genomic fragments sequenced in this study encode portions of other P-450IIIA7-related genes since we could not obtain a complete overlapping set of genomic clones. Within its 5' flanking sequence, the putative binding sites of several transcriptional regulatory factors existed. Among them, it was shown that a basic transcription element binding factor (BTEB) actually interacted with the 5' flanking region of this gene.

Novel primer specific false terminations during DNA sequencing reactions: danger of inaccuracy of mutation analysis in molecular diagnostics

PubMed Central

Anwar, R; Booth, A; Churchill, A J; Markham, A F

1996-01-01

The determination of nucleotide sequence is fundamental to the identification and molecular analysis of genes. Direct sequencing of PCR products is now becoming a commonplace procedure for haplotype analysis, and for defining mutations and polymorphism within genes, particularly for diagnostic purposes. A previously unrecognised phenomenon, primer related variability, observed in sequence data generated using Taq cycle sequencing and T7 Sequenase sequencing, is reported. This suggests that caution is necessary when interpreting DNA sequence data. This is particularly important in situations where treatment may be dependent on the accuracy of the molecular diagnosis. Images PMID:16696096

Sequence variation identified in the 18S rRNA gene of Theileria mutans and Theileria velifera from the African buffalo (Syncerus caffer).

PubMed

Chaisi, Mamohale E; Collins, Nicola E; Potgieter, Fred T; Oosthuizen, Marinda C

2013-01-16

The African buffalo (Syncerus caffer) is a natural reservoir host for both pathogenic and non-pathogenic Theileria species. These often occur naturally as mixed infections in buffalo. Although the benign and mildly pathogenic forms do not have any significant economic importance, their presence could complicate the interpretation of diagnostic test results aimed at the specific diagnosis of the pathogenic Theileria parva in cattle and buffalo in South Africa. The 18S rRNA gene has been used as the target in a quantitative real-time PCR (qPCR) assay for the detection of T. parva infections. However, the extent of sequence variation within this gene in the non-pathogenic Theileria spp. of the Africa buffalo is not well known. The aim of this study was, therefore, to characterise the full-length 18S rRNA genes of Theileria mutans, Theileria sp. (strain MSD) and T. velifera and to determine the possible influence of any sequence variation on the specific detection of T. parva using the 18S rRNA qPCR. The reverse line blot (RLB) hybridization assay was used to select samples which either tested positive for several different Theileria spp., or which hybridised only with the Babesia/Theileria genus-specific probe and not with any of the Babesia or Theileria species-specific probes. The full-length 18S rRNA genes from 14 samples, originating from 13 buffalo and one bovine from different localities in South Africa, were amplified, cloned and the resulting recombinants sequenced. Variations in the 18S rRNA gene sequences were identified in T. mutans, Theileria sp. (strain MSD) and T. velifera, with the greatest diversity observed amongst the T. mutans variants. This variation possibly explained why the RLB hybridization assay failed to detect T. mutans and T. velifera in some of the analysed samples. Copyright © 2012 Elsevier B.V. All rights reserved.

ΔN-P63α and TA-P63α exhibit intrinsic differences in transactivation specificities that depend on distinct features of DNA target sites

PubMed Central

Foggetti, Giorgia; Raimondi, Ivan; Campomenosi, Paola; Menichini, Paola

2014-01-01

TP63 is a member of the TP53 gene family that encodes for up to ten different TA and ΔN isoforms through alternative promoter usage and alternative splicing. Besides being a master regulator of gene expression for squamous epithelial proliferation, differentiation and maintenance, P63, through differential expression of its isoforms, plays important roles in tumorigenesis. All P63 isoforms share an immunoglobulin-like folded DNA binding domain responsible for binding to sequence-specific response elements (REs), whose overall consensus sequence is similar to that of the canonical p53 RE. Using a defined assay in yeast, where P63 isoforms and RE sequences are the only variables, and gene expression assays in human cell lines, we demonstrated that human TA- and ΔN-P63α proteins exhibited differences in transactivation specificity not observed with the corresponding P73 or P53 protein isoforms. These differences 1) were dependent on specific features of the RE sequence, 2) could be related to intrinsic differences in their oligomeric state and cooperative DNA binding, and 3) appeared to be conserved in evolution. Since genotoxic stress can change relative ratio of TA- and ΔN-P63α protein levels, the different transactivation specificity of each P63 isoform could potentially influence cellular responses to specific stresses. PMID:24926492

Molecular characterization of nucleopolyhedrovirus of three lepidopteran pests using late expression factor-8 gene.

PubMed

Jose, Jency; Jalali, S K; Shivalingaswamy, T M; Kumar, N K Krishna; Bhatnagar, R; Bandyopadhyay, A

2013-06-01

A PCR based method for detection of viral DNA in nucleopolyhedrovirus of three lepidopterans, Spodoptera litura, Amsacta albistriga and Helicoverpa armigera, was developed by employing the late expression factor-8 (lef-8) gene of three NPV using specific primers. The amplicons of 689, 699 and 665 bp were amplified, respectively, and the nucleotide sequences were submitted to GenBank and the accession numbers were obtained. The sequences of lef-8 gene of S. litura NPV and H. armigera NPV matched with those of their respective references in the GenBank database, thereby confirming their identity, however, the sequence of A. albistriga NPV was the first sequence submitted to the GenBank database. The sequence similarity analysis between the three lef-8 gene of NPV sequenced in the present study revealed that there was no significant similarity between them, however A. albistriga NPV and S. litura NPV were found to be closely related. CLUSTAL alignment of the sequences generated revealed general relatedness among NPVs lef-8 gene. The study confirmed that lef-8 gene can be used for quick and correct discriminatory identification of insect viruses.

Interactions between the R2R3-MYB Transcription Factor, AtMYB61, and Target DNA Binding Sites

PubMed Central

Prouse, Michael B.; Campbell, Malcolm M.

2013-01-01

Despite the prominent roles played by R2R3-MYB transcription factors in the regulation of plant gene expression, little is known about the details of how these proteins interact with their DNA targets. For example, while Arabidopsis thaliana R2R3-MYB protein AtMYB61 is known to alter transcript abundance of a specific set of target genes, little is known about the specific DNA sequences to which AtMYB61 binds. To address this gap in knowledge, DNA sequences bound by AtMYB61 were identified using cyclic amplification and selection of targets (CASTing). The DNA targets identified using this approach corresponded to AC elements, sequences enriched in adenosine and cytosine nucleotides. The preferred target sequence that bound with the greatest affinity to AtMYB61 recombinant protein was ACCTAC, the AC-I element. Mutational analyses based on the AC-I element showed that ACC nucleotides in the AC-I element served as the core recognition motif, critical for AtMYB61 binding. Molecular modelling predicted interactions between AtMYB61 amino acid residues and corresponding nucleotides in the DNA targets. The affinity between AtMYB61 and specific target DNA sequences did not correlate with AtMYB61-driven transcriptional activation with each of the target sequences. CASTing-selected motifs were found in the regulatory regions of genes previously shown to be regulated by AtMYB61. Taken together, these findings are consistent with the hypothesis that AtMYB61 regulates transcription from specific cis-acting AC elements in vivo. The results shed light on the specifics of DNA binding by an important family of plant-specific transcriptional regulators. PMID:23741471

Adeno-associated virus inverted terminal repeats stimulate gene editing.

PubMed

Hirsch, M L

2015-02-01

Advancements in genome editing have relied on technologies to specifically damage DNA which, in turn, stimulates DNA repair including homologous recombination (HR). As off-target concerns complicate the therapeutic translation of site-specific DNA endonucleases, an alternative strategy to stimulate gene editing based on fragile DNA was investigated. To do this, an episomal gene-editing reporter was generated by a disruptive insertion of the adeno-associated virus (AAV) inverted terminal repeat (ITR) into the egfp gene. Compared with a non-structured DNA control sequence, the ITR induced DNA damage as evidenced by increased gamma-H2AX and Mre11 foci formation. As local DNA damage stimulates HR, ITR-mediated gene editing was investigated using DNA oligonucleotides as repair substrates. The AAV ITR stimulated gene editing >1000-fold in a replication-independent manner and was not biased by the polarity of the repair oligonucleotide. Analysis of additional human DNA sequences demonstrated stimulation of gene editing to varying degrees. In particular, inverted yet not direct, Alu repeats induced gene editing, suggesting a role for DNA structure in the repair event. Collectively, the results demonstrate that inverted DNA repeats stimulate gene editing via double-strand break repair in an episomal context and allude to efficient gene editing of the human chromosome using fragile DNA sequences.

Host-Specific and Segment-Specific Evolutionary Dynamics of Avian and Human Influenza A Viruses: A Systematic Review.

PubMed

Kim, Kiyeon; Omori, Ryosuke; Ueno, Keisuke; Iida, Sayaka; Ito, Kimihito

2016-01-01

Understanding the evolutionary dynamics of influenza viruses is essential to control both avian and human influenza. Here, we analyze host-specific and segment-specific Tajima's D trends of influenza A virus through a systematic review using viral sequences registered in the National Center for Biotechnology Information. To avoid bias from viral population subdivision, viral sequences were stratified according to their sampling locations and sampling years. As a result, we obtained a total of 580 datasets each of which consists of nucleotide sequences of influenza A viruses isolated from a single population of hosts at a single sampling site within a single year. By analyzing nucleotide sequences in the datasets, we found that Tajima's D values of viral sequences were different depending on hosts and gene segments. Tajima's D values of viruses isolated from chicken and human samples showed negative, suggesting purifying selection or a rapid population growth of the viruses. The negative Tajima's D values in rapidly growing viral population were also observed in computer simulations. Tajima's D values of PB2, PB1, PA, NP, and M genes of the viruses circulating in wild mallards were close to zero, suggesting that these genes have undergone neutral selection in constant-sized population. On the other hand, Tajima's D values of HA and NA genes of these viruses were positive, indicating HA and NA have undergone balancing selection in wild mallards. Taken together, these results indicated the existence of unknown factors that maintain viral subtypes in wild mallards.

Molecular diagnosis of glycogen storage disease and disorders with overlapping clinical symptoms by massive parallel sequencing.

PubMed

Vega, Ana I; Medrano, Celia; Navarrete, Rosa; Desviat, Lourdes R; Merinero, Begoña; Rodríguez-Pombo, Pilar; Vitoria, Isidro; Ugarte, Magdalena; Pérez-Cerdá, Celia; Pérez, Belen

2016-10-01

Glycogen storage disease (GSD) is an umbrella term for a group of genetic disorders that involve the abnormal metabolism of glycogen; to date, 23 types of GSD have been identified. The nonspecific clinical presentation of GSD and the lack of specific biomarkers mean that Sanger sequencing is now widely relied on for making a diagnosis. However, this gene-by-gene sequencing technique is both laborious and costly, which is a consequence of the number of genes to be sequenced and the large size of some genes. This work reports the use of massive parallel sequencing to diagnose patients at our laboratory in Spain using either a customized gene panel (targeted exome sequencing) or the Illumina Clinical-Exome TruSight One Gene Panel (clinical exome sequencing (CES)). Sequence variants were matched against biochemical and clinical hallmarks. Pathogenic mutations were detected in 23 patients. Twenty-two mutations were recognized (mostly loss-of-function mutations), including 11 that were novel in GSD-associated genes. In addition, CES detected five patients with mutations in ALDOB, LIPA, NKX2-5, CPT2, or ANO5. Although these genes are not involved in GSD, they are associated with overlapping phenotypic characteristics such as hepatic, muscular, and cardiac dysfunction. These results show that next-generation sequencing, in combination with the detection of biochemical and clinical hallmarks, provides an accurate, high-throughput means of making genetic diagnoses of GSD and related diseases.Genet Med 18 10, 1037-1043.

Multi-Platform Next-Generation Sequencing of the Domestic Turkey (Meleagris gallopavo): Genome Assembly and Analysis

PubMed Central

Aslam, Luqman; Beal, Kathryn; Ann Blomberg, Le; Bouffard, Pascal; Burt, David W.; Crasta, Oswald; Crooijmans, Richard P. M. A.; Cooper, Kristal; Coulombe, Roger A.; De, Supriyo; Delany, Mary E.; Dodgson, Jerry B.; Dong, Jennifer J.; Evans, Clive; Frederickson, Karin M.; Flicek, Paul; Florea, Liliana; Folkerts, Otto; Groenen, Martien A. M.; Harkins, Tim T.; Herrero, Javier; Hoffmann, Steve; Megens, Hendrik-Jan; Jiang, Andrew; de Jong, Pieter; Kaiser, Pete; Kim, Heebal; Kim, Kyu-Won; Kim, Sungwon; Langenberger, David; Lee, Mi-Kyung; Lee, Taeheon; Mane, Shrinivasrao; Marcais, Guillaume; Marz, Manja; McElroy, Audrey P.; Modise, Thero; Nefedov, Mikhail; Notredame, Cédric; Paton, Ian R.; Payne, William S.; Pertea, Geo; Prickett, Dennis; Puiu, Daniela; Qioa, Dan; Raineri, Emanuele; Ruffier, Magali; Salzberg, Steven L.; Schatz, Michael C.; Scheuring, Chantel; Schmidt, Carl J.; Schroeder, Steven; Searle, Stephen M. J.; Smith, Edward J.; Smith, Jacqueline; Sonstegard, Tad S.; Stadler, Peter F.; Tafer, Hakim; Tu, Zhijian (Jake); Van Tassell, Curtis P.; Vilella, Albert J.; Williams, Kelly P.; Yorke, James A.; Zhang, Liqing; Zhang, Hong-Bin; Zhang, Xiaojun; Zhang, Yang; Reed, Kent M.

2010-01-01

A synergistic combination of two next-generation sequencing platforms with a detailed comparative BAC physical contig map provided a cost-effective assembly of the genome sequence of the domestic turkey (Meleagris gallopavo). Heterozygosity of the sequenced source genome allowed discovery of more than 600,000 high quality single nucleotide variants. Despite this heterozygosity, the current genome assembly (∼1.1 Gb) includes 917 Mb of sequence assigned to specific turkey chromosomes. Annotation identified nearly 16,000 genes, with 15,093 recognized as protein coding and 611 as non-coding RNA genes. Comparative analysis of the turkey, chicken, and zebra finch genomes, and comparing avian to mammalian species, supports the characteristic stability of avian genomes and identifies genes unique to the avian lineage. Clear differences are seen in number and variety of genes of the avian immune system where expansions and novel genes are less frequent than examples of gene loss. The turkey genome sequence provides resources to further understand the evolution of vertebrate genomes and genetic variation underlying economically important quantitative traits in poultry. This integrated approach may be a model for providing both gene and chromosome level assemblies of other species with agricultural, ecological, and evolutionary interest. PMID:20838655

Phylogenetic shadowing of primate sequences to find functional regions of the human genome.

PubMed

Boffelli, Dario; McAuliffe, Jon; Ovcharenko, Dmitriy; Lewis, Keith D; Ovcharenko, Ivan; Pachter, Lior; Rubin, Edward M

2003-02-28

Nonhuman primates represent the most relevant model organisms to understand the biology of Homo sapiens. The recent divergence and associated overall sequence conservation between individual members of this taxon have nonetheless largely precluded the use of primates in comparative sequence studies. We used sequence comparisons of an extensive set of Old World and New World monkeys and hominoids to identify functional regions in the human genome. Analysis of these data enabled the discovery of primate-specific gene regulatory elements and the demarcation of the exons of multiple genes. Much of the information content of the comprehensive primate sequence comparisons could be captured with a small subset of phylogenetically close primates. These results demonstrate the utility of intraprimate sequence comparisons to discover common mammalian as well as primate-specific functional elements in the human genome, which are unattainable through the evaluation of more evolutionarily distant species.

PCR Primers to Study the Diversity of Expressed Fungal Genes Encoding Lignocellulolytic Enzymes in Soils Using High-Throughput Sequencing

PubMed Central

Barbi, Florian; Bragalini, Claudia; Vallon, Laurent; Prudent, Elsa; Dubost, Audrey; Fraissinet-Tachet, Laurence; Marmeisse, Roland; Luis, Patricia

2014-01-01

Plant biomass degradation in soil is one of the key steps of carbon cycling in terrestrial ecosystems. Fungal saprotrophic communities play an essential role in this process by producing hydrolytic enzymes active on the main components of plant organic matter. Open questions in this field regard the diversity of the species involved, the major biochemical pathways implicated and how these are affected by external factors such as litter quality or climate changes. This can be tackled by environmental genomic approaches involving the systematic sequencing of key enzyme-coding gene families using soil-extracted RNA as material. Such an approach necessitates the design and evaluation of gene family-specific PCR primers producing sequence fragments compatible with high-throughput sequencing approaches. In the present study, we developed and evaluated PCR primers for the specific amplification of fungal CAZy Glycoside Hydrolase gene families GH5 (subfamily 5) and GH11 encoding endo-β-1,4-glucanases and endo-β-1,4-xylanases respectively as well as Basidiomycota class II peroxidases, corresponding to the CAZy Auxiliary Activity family 2 (AA2), active on lignin. These primers were experimentally validated using DNA extracted from a wide range of Ascomycota and Basidiomycota species including 27 with sequenced genomes. Along with the published primers for Glycoside Hydrolase GH7 encoding enzymes active on cellulose, the newly design primers were shown to be compatible with the Illumina MiSeq sequencing technology. Sequences obtained from RNA extracted from beech or spruce forest soils showed a high diversity and were uniformly distributed in gene trees featuring the global diversity of these gene families. This high-throughput sequencing approach using several degenerate primers constitutes a robust method, which allows the simultaneous characterization of the diversity of different fungal transcripts involved in plant organic matter degradation and may lead to the discovery of complex patterns in gene expression of soil fungal communities. PMID:25545363

Identification of ecotype-specific marker genes for categorization of beer-spoiling Lactobacillus brevis.

PubMed

Behr, Jürgen; Geissler, Andreas J; Preissler, Patrick; Ehrenreich, Armin; Angelov, Angel; Vogel, Rudi F

2015-10-01

The tolerance to hop compounds, which is mainly associated with inhibition of bacterial growth in beer, is a multi-factorial trait. Any approaches to predict the physiological differences between beer-spoiling and non-spoiling strains on the basis of a single marker gene are limited. We identified ecotype-specific genes related to the ability to grow in Pilsner beer via comparative genome sequencing. The genome sequences of four different strains of Lactobacillus brevis were compared, including newly established genomes of two highly hop tolerant beer isolates, one strain isolated from faeces and one published genome of a silage isolate. Gene fragments exclusively occurring in beer-spoiling strains as well as sequences only occurring in non-spoiling strains were identified. Comparative genomic arrays were established and hybridized with a set of L. brevis strains, which are characterized by their ability to spoil beer. As result, a set of 33 and 4 oligonucleotide probes could be established specifically detecting beer-spoilers and non-spoilers, respectively. The detection of more than one of these marker sequences according to a genetic barcode enables scoring of L. brevis for their beer-spoiling potential and can thus assist in risk evaluation in brewing industry. Copyright © 2015 Elsevier Ltd. All rights reserved.

Investigating the diversity of the 18S SSU rRNA hyper-variable region of Theileria in cattle and Cape buffalo (Syncerus caffer) from southern Africa using a next generation sequencing approach.

PubMed

Mans, Ben J; Pienaar, Ronel; Ratabane, John; Pule, Boitumelo; Latif, Abdalla A

2016-07-01

Molecular classification and systematics of the Theileria is based on the analysis of the 18S rRNA gene. Reverse line blot or conventional sequencing approaches have disadvantages in the study of 18S rRNA diversity and a next-generation 454 sequencing approach was investigated. The 18S rRNA gene was amplified using RLB primers coupled to 96 unique sequence identifiers (MIDs). Theileria positive samples from African buffalo (672) and cattle (480) from southern Africa were combined in batches of 96 and sequenced using the GS Junior 454 sequencer to produce 825711 informative sequences. Sequences were extracted based on MIDs and analysed to identify Theileria genotypes. Genotypes observed in buffalo and cattle were confirmed in the current study, while no new genotypes were discovered. Genotypes showed specific geographic distributions, most probably linked with vector distributions. Host specificity of buffalo and cattle specific genotypes were confirmed and prevalence data as well as relative parasitemia trends indicate preference for different hosts. Mixed infections are common with African buffalo carrying more genotypes compared to cattle. Associative or exclusion co-infection profiles were observed between genotypes that may have implications for speciation and systematics: specifically that more Theileria species may exist in cattle and buffalo than currently recognized. Analysis of primers used for Theileria parva diagnostics indicate that no new genotypes will be amplified by the current primer sets confirming their specificity. T. parva SNP variants that occur in the 18S rRNA hypervariable region were confirmed. A next generation sequencing approach is useful in obtaining comprehensive knowledge regarding 18S rRNA diversity and prevalence for the Theileria, allowing for the assessment of systematics and diagnostic assays based on the 18S gene. Copyright © 2016 Elsevier GmbH. All rights reserved.

Triplex technology in studies of DNA damage, DNA repair, and mutagenesis.

PubMed

Mukherjee, Anirban; Vasquez, Karen M

2011-08-01

Triplex-forming oligonucleotides (TFOs) can bind to the major groove of homopurine-homopyrimidine stretches of double-stranded DNA in a sequence-specific manner through Hoogsteen hydrogen bonding to form DNA triplexes. TFOs by themselves or conjugated to reactive molecules can be used to direct sequence-specific DNA damage, which in turn results in the induction of several DNA metabolic activities. Triplex technology is highly utilized as a tool to study gene regulation, molecular mechanisms of DNA repair, recombination, and mutagenesis. In addition, TFO targeting of specific genes has been exploited in the development of therapeutic strategies to modulate DNA structure and function. In this review, we discuss advances made in studies of DNA damage, DNA repair, recombination, and mutagenesis by using triplex technology to target specific DNA sequences. Copyright © 2011 Elsevier Masson SAS. All rights reserved.

A comprehensive catalog of human KRAB-associated zinc finger genes: Insights into the evolutionary history of a large family of transcriptional repressors

PubMed Central

Huntley, Stuart; Baggott, Daniel M.; Hamilton, Aaron T.; Tran-Gyamfi, Mary; Yang, Shan; Kim, Joomyeong; Gordon, Laurie; Branscomb, Elbert; Stubbs, Lisa

2006-01-01

Krüppel-type zinc finger (ZNF) motifs are prevalent components of transcription factor proteins in all eukaryotes. KRAB-ZNF proteins, in which a potent repressor domain is attached to a tandem array of DNA-binding zinc-finger motifs, are specific to tetrapod vertebrates and represent the largest class of ZNF proteins in mammals. To define the full repertoire of human KRAB-ZNF proteins, we searched the genome sequence for key motifs and then constructed and manually curated gene models incorporating those sequences. The resulting gene catalog contains 423 KRAB-ZNF protein-coding loci, yielding alternative transcripts that altogether predict at least 742 structurally distinct proteins. Active rounds of segmental duplication, involving single genes or larger regions and including both tandem and distributed duplication events, have driven the expansion of this mammalian gene family. Comparisons between the human genes and ZNF loci mined from the draft mouse, dog, and chimpanzee genomes not only identified 103 KRAB-ZNF genes that are conserved in mammals but also highlighted a substantial level of lineage-specific change; at least 136 KRAB-ZNF coding genes are primate specific, including many recent duplicates. KRAB-ZNF genes are widely expressed and clustered genes are typically not coregulated, indicating that paralogs have evolved to fill roles in many different biological processes. To facilitate further study, we have developed a Web-based public resource with access to gene models, sequences, and other data, including visualization tools to provide genomic context and interaction with other public data sets. PMID:16606702

Floral gene resources from basal angiosperms for comparative genomics research

PubMed Central

Albert, Victor A; Soltis, Douglas E; Carlson, John E; Farmerie, William G; Wall, P Kerr; Ilut, Daniel C; Solow, Teri M; Mueller, Lukas A; Landherr, Lena L; Hu, Yi; Buzgo, Matyas; Kim, Sangtae; Yoo, Mi-Jeong; Frohlich, Michael W; Perl-Treves, Rafael; Schlarbaum, Scott E; Bliss, Barbara J; Zhang, Xiaohong; Tanksley, Steven D; Oppenheimer, David G; Soltis, Pamela S; Ma, Hong; dePamphilis, Claude W; Leebens-Mack, James H

2005-01-01

Background The Floral Genome Project was initiated to bridge the genomic gap between the most broadly studied plant model systems. Arabidopsis and rice, although now completely sequenced and under intensive comparative genomic investigation, are separated by at least 125 million years of evolutionary time, and cannot in isolation provide a comprehensive perspective on structural and functional aspects of flowering plant genome dynamics. Here we discuss new genomic resources available to the scientific community, comprising cDNA libraries and Expressed Sequence Tag (EST) sequences for a suite of phylogenetically basal angiosperms specifically selected to bridge the evolutionary gaps between model plants and provide insights into gene content and genome structure in the earliest flowering plants. Results Random sequencing of cDNAs from representatives of phylogenetically important eudicot, non-grass monocot, and gymnosperm lineages has so far (as of 12/1/04) generated 70,514 ESTs and 48,170 assembled unigenes. Efficient sorting of EST sequences into putative gene families based on whole Arabidopsis/rice proteome comparison has permitted ready identification of cDNA clones for finished sequencing. Preliminarily, (i) proportions of functional categories among sequenced floral genes seem representative of the entire Arabidopsis transcriptome, (ii) many known floral gene homologues have been captured, and (iii) phylogenetic analyses of ESTs are providing new insights into the process of gene family evolution in relation to the origin and diversification of the angiosperms. Conclusion Initial comparisons illustrate the utility of the EST data sets toward discovery of the basic floral transcriptome. These first findings also afford the opportunity to address a number of conspicuous evolutionary genomic questions, including reproductive organ transcriptome overlap between angiosperms and gymnosperms, genome-wide duplication history, lineage-specific gene duplication and functional divergence, and analyses of adaptive molecular evolution. Since not all genes in the floral transcriptome will be associated with flowering, these EST resources will also be of interest to plant scientists working on other functions, such as photosynthesis, signal transduction, and metabolic pathways. PMID:15799777

Many human accelerated regions are developmental enhancers

PubMed Central

Capra, John A.; Erwin, Genevieve D.; McKinsey, Gabriel; Rubenstein, John L. R.; Pollard, Katherine S.

2013-01-01

The genetic changes underlying the dramatic differences in form and function between humans and other primates are largely unknown, although it is clear that gene regulatory changes play an important role. To identify regulatory sequences with potentially human-specific functions, we and others used comparative genomics to find non-coding regions conserved across mammals that have acquired many sequence changes in humans since divergence from chimpanzees. These regions are good candidates for performing human-specific regulatory functions. Here, we analysed the DNA sequence, evolutionary history, histone modifications, chromatin state and transcription factor (TF) binding sites of a combined set of 2649 non-coding human accelerated regions (ncHARs) and predicted that at least 30% of them function as developmental enhancers. We prioritized the predicted ncHAR enhancers using analysis of TF binding site gain and loss, along with the functional annotations and expression patterns of nearby genes. We then tested both the human and chimpanzee sequence for 29 ncHARs in transgenic mice, and found 24 novel developmental enhancers active in both species, 17 of which had very consistent patterns of activity in specific embryonic tissues. Of these ncHAR enhancers, five drove expression patterns suggestive of different activity for the human and chimpanzee sequence at embryonic day 11.5. The changes to human non-coding DNA in these ncHAR enhancers may modify the complex patterns of gene expression necessary for proper development in a human-specific manner and are thus promising candidates for understanding the genetic basis of human-specific biology. PMID:24218637

Variation of clinical expression in patients with Stargardt dystrophy and sequence variations in the ABCR gene.

PubMed

Fishman, G A; Stone, E M; Grover, S; Derlacki, D J; Haines, H L; Hockey, R R

1999-04-01

To report the spectrum of ophthalmic findings in patients with Stargardt dystrophy or fundus flavimaculatus who have a specific sequence variation in the ABCR gene. Twenty-nine patients with Stargardt dystrophy or fundus flavimaculatus from different pedigrees were identified with possible disease-causing sequence variations in the ABCR gene from a group of 66 patients who were screened for sequence variations in this gene. Patients underwent a routine ocular examination, including slitlamp biomicroscopy and a dilated fundus examination. Fluorescein angiography was performed on 22 patients, and electroretinographic measurements were obtained on 24 of 29 patients. Kinetic visual fields were measured with a Goldmann perimeter in 26 patients. Single-strand conformation polymorphism analysis and DNA sequencing were used to identify variations in coding sequences of the ABCR gene. Three clinical phenotypes were observed among these 29 patients. In phenotype I, 9 of 12 patients had a sequence change in exon 42 of the ABCR gene in which the amino acid glutamic acid was substituted for glycine (Gly1961Glu). In only 4 of these 9 patients was a second possible disease-causing mutation found on the other ABCR allele. In addition to an atrophic-appearing macular lesion, phenotype I was characterized by localized perifoveal yellowish white flecks, the absence of a dark choroid, and normal electroretinographic amplitudes. Phenotype II consisted of 10 patients who showed a dark choroid and more diffuse yellowish white flecks in the fundus. None exhibited the Gly1961Glu change. Phenotype III consisted of 7 patients who showed extensive atrophic-appearing changes of the retinal pigment epithelium. Electroretinographic cone and rod amplitudes were reduced. One patient showed the Gly1961Glu change. A wide variation in clinical phenotype can occur in patients with sequence changes in the ABCR gene. In individual patients, a certain phenotype seems to be associated with the presence of a Gly1961Glu change in exon 42 of the ABCR gene. The identification of correlations between specific mutations in the ABCR gene and clinical phenotypes will better facilitate the counseling of patients on their visual prognosis. This information will also likely be important for future therapeutic trials in patients with Stargardt dystrophy.

Emergence and Evolution of Hominidae-Specific Coding and Noncoding Genomic Sequences.

PubMed

Saber, Morteza Mahmoudi; Adeyemi Babarinde, Isaac; Hettiarachchi, Nilmini; Saitou, Naruya

2016-07-12

Family Hominidae, which includes humans and great apes, is recognized for unique complex social behavior and intellectual abilities. Despite the increasing genome data, however, the genomic origin of its phenotypic uniqueness has remained elusive. Clade-specific genes and highly conserved noncoding sequences (HCNSs) are among the high-potential evolutionary candidates involved in driving clade-specific characters and phenotypes. On this premise, we analyzed whole genome sequences along with gene orthology data retrieved from major DNA databases to find Hominidae-specific (HS) genes and HCNSs. We discovered that Down syndrome critical region 4 (DSCR4) is the only experimentally verified gene uniquely present in Hominidae. DSCR4 has no structural homology to any known protein and was inferred to have emerged in several steps through LTR/ERV1, LTR/ERVL retrotransposition, and transversion. Using the genomic distance as neutral evolution threshold, we identified 1,658 HS HCNSs. Polymorphism coverage and derived allele frequency analysis of HS HCNSs showed that these HCNSs are under purifying selection, indicating that they may harbor important functions. They are overrepresented in promoters/untranslated regions, in close proximity of genes involved in sensory perception of sound and developmental process, and also showed a significantly lower nucleosome occupancy probability. Interestingly, many ancestral sequences of the HS HCNSs showed very high evolutionary rates. This suggests that new functions emerged through some kind of positive selection, and then purifying selection started to operate to keep these functions. © The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

RNA degradation and models for post-transcriptional gene-silencing.

PubMed

Meins, F

2000-06-01

Post-transcriptional gene silencing (PTGS) is a form of stable but potentially reversible epigenetic modification, which frequently occurs in transgenic plants. The interaction in trans of genes with similar transcribed sequences results in sequence-specific degradation of RNAs derived from the genes involved. Highly expressed single-copy loci, transcribed inverted repeats, and poorly transcribed complex loci can act as sources of signals that trigger PTGS. In some cases, mobile, sequence-specific silencing signals can move from cell to cell or even over long distances in the plant. Several current models hold that silencing signals are 'aberrant' RNAs (aRNA), which differ in some way from normal mRNAs. The most likely candidates are small antisense RNAs (asRNA) and double-stranded RNAs (dsRNA). Direct evidence that these or other aRNAs found in silent tissues can induce PTGS is still lacking. Most current models assume that silencing signals interact with target RNAs in a sequence-specific fashion. This results in degradation, usually in the cytoplasm, by exonucleolytic as well as endonucleolytic pathways, which are not necessarily PTGS-specific. Biochemical-switch models hold that the silent state is maintained by a positive auto-regulatory loop. One possibility is that concentrations of hypothetical silencing signals above a critical threshold trigger their own production by self-replication, by degradation of target RNAs, or by a combination of both mechanisms. These models can account for the stability, reversibility and multiplicity of silent states; the strong influence of transcription rate of target genes on the incidence and stability of silencing, and the amplification and systemic propagation of motile silencing signals.

Genes involved in convergent evolution of eusociality in bees

PubMed Central

Woodard, S. Hollis; Fischman, Brielle J.; Venkat, Aarti; Hudson, Matt E.; Varala, Kranthi; Cameron, Sydney A.; Clark, Andrew G.; Robinson, Gene E.

2011-01-01

Eusociality has arisen independently at least 11 times in insects. Despite this convergence, there are striking differences among eusocial lifestyles, ranging from species living in small colonies with overt conflict over reproduction to species in which colonies contain hundreds of thousands of highly specialized sterile workers produced by one or a few queens. Although the evolution of eusociality has been intensively studied, the genetic changes involved in the evolution of eusociality are relatively unknown. We examined patterns of molecular evolution across three independent origins of eusociality by sequencing transcriptomes of nine socially diverse bee species and combining these data with genome sequence from the honey bee Apis mellifera to generate orthologous sequence alignments for 3,647 genes. We found a shared set of 212 genes with a molecular signature of accelerated evolution across all eusocial lineages studied, as well as unique sets of 173 and 218 genes with a signature of accelerated evolution specific to either highly or primitively eusocial lineages, respectively. These results demonstrate that convergent evolution can involve a mosaic pattern of molecular changes in both shared and lineage-specific sets of genes. Genes involved in signal transduction, gland development, and carbohydrate metabolism are among the most prominent rapidly evolving genes in eusocial lineages. These findings provide a starting point for linking specific genetic changes to the evolution of eusociality. PMID:21482769

DNA sequence requirements for the accurate transcription of a protein-coding plastid gene in a plastid in vitro system from mustard (Sinapis alba L.)

PubMed Central

Link, Gerhard

1984-01-01

A nuclease-treated plastid extract from mustard (Sinapis alba L.) allows efficient transcription of cloned plastid DNA templates. In this in vitro system, the major runoff transcript of the truncated gene for the 32 000 mol. wt. photosystem II protein was accurately initiated from a site close to or identical with the in vivo start site. By using plasmids with deletions in the 5'-flanking region of this gene as templates, a DNA region required for efficient and selective initiation was detected ˜28-35 nucleotides upstream of the transcription start site. This region contains the sequence element TTGACA, which matches the consensus sequence for prokaryotic `−35' promoter elements. In the absence of this region, a region ˜13-27 nucleotides upstream of the start site still enables a basic level of specific transcription. This second region contains the sequence element TATATAA, which matches the consensus sequence for the `TATA' box of genes transcribed by RNA polymerase II (or B). The region between the `TATA'-like element and the transcription start site is not sufficient but may be required for specific transcription of the plastid gene. This latter region contains the sequence element TATACT, which resembles the prokaryotic `−10' (Pribnow) box. Based on the structural and transcriptional features of the 5' upstream region, a `promoter switch' mechanism is proposed, which may account for the developmentally regulated expression of this plastid gene. ImagesFig. 1.Fig. 2.Fig. 3.Fig. 4.Figure 5. PMID:16453540

Unique core genomes of the bacterial family vibrionaceae: insights into niche adaptation and speciation.

PubMed

Kahlke, Tim; Goesmann, Alexander; Hjerde, Erik; Willassen, Nils Peder; Haugen, Peik

2012-05-10

The criteria for defining bacterial species and even the concept of bacterial species itself are under debate, and the discussion is apparently intensifying as more genome sequence data is becoming available. However, it is still unclear how the new advances in genomics should be used most efficiently to address this question. In this study we identify genes that are common to any group of genomes in our dataset, to determine whether genes specific to a particular taxon exist and to investigate their potential role in adaptation of bacteria to their specific niche. These genes were named unique core genes. Additionally, we investigate the existence and importance of unique core genes that are found in isolates of phylogenetically non-coherent groups. These groups of isolates, that share a genetic feature without sharing a closest common ancestor, are termed genophyletic groups. The bacterial family Vibrionaceae was used as the model, and we compiled and compared genome sequences of 64 different isolates. Using the software orthoMCL we determined clusters of homologous genes among the investigated genome sequences. We used multilocus sequence analysis to build a host phylogeny and mapped the numbers of unique core genes of all distinct groups of isolates onto the tree. The results show that unique core genes are more likely to be found in monophyletic groups of isolates. Genophyletic groups of isolates, in contrast, are less common especially for large groups of isolate. The subsequent annotation of unique core genes that are present in genophyletic groups indicate a high degree of horizontally transferred genes. Finally, the annotation of the unique core genes of Vibrio cholerae revealed genes involved in aerotaxis and biosynthesis of the iron-chelator vibriobactin. The presented work indicates that genes specific for any taxon inside the bacterial family Vibrionaceae exist. These unique core genes encode conserved metabolic functions that can shed light on the adaptation of a species to its ecological niche. Additionally, our study suggests that unique core genes can be used to aid classification of bacteria and contribute to a bacterial species definition on a genomic level. Furthermore, these genes may be of importance in clinical diagnostics and drug development.

Isolation of laccase gene-specific sequences from white rot and brown rot fungi by PCR

DOE Office of Scientific and Technical Information (OSTI.GOV)

D`Souza, T.M.; Boominathan, K.; Reddy, C.A.

1996-10-01

Degenerate primers corresponding to the consensus sequences of the copper-binding regions in the N-terminal domains of known basidiomycete laccases were used to isolate laccase gene-specific sequences from strains representing nine genera of wood rot fungi. All except three gave the expected PCR product of about 200 bp. Computer searches of the databases identified the sequences of each of the PCR product of about 200 bp. Computer searches of the databases identified the sequence of each of the PCR products analyzed as a laccase gene sequence, suggesting the specificity of the primers. PCR products of the white rot fungi Ganoderma lucidum,more » Phlebia brevispora, and Trametes versicolor showed 65 to 74% nucleotide sequence similarity to each other; the similarity in deduced amino acid sequences was 83 to 91%. The PCR products of Lentinula edodes and Lentinus tigrinus, on the other hand, showed relatively low nucleotide and amino acid similarities (58 to 64 and 62 to 81%, respectively); however, these similarities were still much higher than when compared with the corresponding regions in the laccases of the ascomycete fungi Aspergillus nidulans and Neurospora crassa. A few of the white rot fungi, as well as Gloeophyllum trabeum, a brown rot fungus, gave a 144-bp PCR fragment which had a nucleotide sequence similarity of 60 to 71%. Demonstration of laccase activity in G. trabeum and several other brown rot fungi was of particular interest because these organisms were not previously shown to produce laccases. 36 refs., 6 figs., 2 tabs.« less

Comparative and Evolutionary Analysis of Grass Pollen Allergens Using Brachypodium distachyon as a Model System

PubMed Central

Sharma, Akanksha; Sharma, Niharika; Bhalla, Prem; Singh, Mohan

2017-01-01

Comparative genomics have facilitated the mining of biological information from a genome sequence, through the detection of similarities and differences with genomes of closely or more distantly related species. By using such comparative approaches, knowledge can be transferred from the model to non-model organisms and insights can be gained in the structural and evolutionary patterns of specific genes. In the absence of sequenced genomes for allergenic grasses, this study was aimed at understanding the structure, organisation and expression profiles of grass pollen allergens using the genomic data from Brachypodium distachyon as it is phylogenetically related to the allergenic grasses. Combining genomic data with the anther RNA-Seq dataset revealed 24 pollen allergen genes belonging to eight allergen groups mapping on the five chromosomes in B. distachyon. High levels of anther-specific expression profiles were observed for the 24 identified putative allergen-encoding genes in Brachypodium. The genomic evidence suggests that gene encoding the group 5 allergen, the most potent trigger of hay fever and allergic asthma originated as a pollen specific orphan gene in a common grass ancestor of Brachypodium and Triticiae clades. Gene structure analysis showed that the putative allergen-encoding genes in Brachypodium either lack or contain reduced number of introns. Promoter analysis of the identified Brachypodium genes revealed the presence of specific cis-regulatory sequences likely responsible for high anther/pollen-specific expression. With the identification of putative allergen-encoding genes in Brachypodium, this study has also described some important plant gene families (e.g. expansin superfamily, EF-Hand family, profilins etc) for the first time in the model plant Brachypodium. Altogether, the present study provides new insights into structural characterization and evolution of pollen allergens and will further serve as a base for their functional characterization in related grass species. PMID:28103252

Mitochondrial gene sequences alone or combined with ITS region sequences provide firm molecular criteria for the classification of Lecanicillium species.

PubMed

Kouvelis, Vassili N; Sialakouma, Aphrodite; Typas, Milton A

2008-07-01

The recent revision of Verticillium sect. Prostrata led to the introduction of the genus Lecanicillium, which comprises the majority of the entomopathogenic strains. Sixty-five strains previously classified as Verticillium lecanii or Verticillium sp. from different geographical regions and hosts were examined and their phylogenetic relationships were determined using sequences from three mitochondrial (mt) genes [the small rRNA subunit (rns), the NADH dehydrogenase subunits 1 (nad1) and 3 (nad3)] and the ITS region. In general, single gene phylogenetic trees differentiated and placed the strains examined in well-supported (by BS analysis) groups of L. lecanii, L. longisporum, L. muscarium, and L. nodulosum, although in some cases a few uncertainties still remained. nad1 was the most informative single gene in phylogenetic analyses and was also found to contain group I introns with putative open reading frames (ORFs) encoding for GIY-YIG endonucleases. The combined use of mt gene sequences resolved taxonomic uncertainties arisen from ITS analysis and, alone or in combination with ITS sequences, helped in placing uncharacterised Verticillium lecanii and Verticillium sp. firmly into Lecanicillium species. Combined gene data from all the mt genes and all the mt genes and the ITS region together, were very similar. Furthermore, a relaxed correlation with host specificity -- at least for Homoptera -- was indicated for the rns and the combined mt gene sequences. Thus, the usefulness of mt gene sequences as a convenient molecular tool in phylogenetic studies of entomopathogenic fungi was demonstrated.

Absence of mutation at the 5'-upstream promoter region of the TPM4 gene from cardiac mutant axolotl (Ambystoma mexicanum).

PubMed

Denz, Christopher R; Zhang, Chi; Jia, Pingping; Du, Jianfeng; Huang, Xupei; Dube, Syamalima; Thomas, Anish; Poiesz, Bernard J; Dube, Dipak K

2011-09-01

Tropomyosins are a family of actin-binding proteins that show cell-specific diversity by a combination of multiple genes and alternative RNA splicing. Of the 4 different tropomyosin genes, TPM4 plays a pivotal role in myofibrillogenesis as well as cardiac contractility in amphibians. In this study, we amplified and sequenced the upstream regulatory region of the TPM4 gene from both normal and mutant axolotl hearts. To identify the cis-elements that are essential for the expression of the TPM4, we created various deletion mutants of the TPM4 promoter DNA, inserted the deleted segments into PGL3 vector, and performed promoter-reporter assay using luciferase as the reporter gene. Comparison of sequences of the promoter region of the TPM4 gene from normal and mutant axolotl revealed no mutations in the promoter sequence of the mutant TPM4 gene. CArG box elements that are generally involved in controlling the expression of several other muscle-specific gene promoters were not found in the upstream regulatory region of the TPM4 gene. In deletion experiments, loss of activity of the reporter gene was noted upon deletion which was then restored upon further deletion suggesting the presence of both positive and negative cis-elements in the upstream regulatory region of the TPM4 gene. We believe that this is the first axolotl promoter that has ever been cloned and studied with clear evidence that it functions in mammalian cell lines. Although striated muscle-specific cis-acting elements are absent from the promoter region of TPM4 gene, our results suggest the presence of positive and negative cis-elements in the promoter region, which in conjunction with positive and negative trans-elements may be involved in regulating the expression of TPM4 gene in a tissue-specific manner.

Real-Time PCR-Based Quantitation Method for the Genetically Modified Soybean Line GTS 40-3-2.

PubMed

Kitta, Kazumi; Takabatake, Reona; Mano, Junichi

2016-01-01

This chapter describes a real-time PCR-based method for quantitation of the relative amount of genetically modified (GM) soybean line GTS 40-3-2 [Roundup Ready(®) soybean (RRS)] contained in a batch. The method targets a taxon-specific soybean gene (lectin gene, Le1) and the specific DNA construct junction region between the Petunia hybrida chloroplast transit peptide sequence and the Agrobacterium 5-enolpyruvylshikimate-3-phosphate synthase gene (epsps) sequence present in GTS 40-3-2. The method employs plasmid pMulSL2 as a reference material in order to quantify the relative amount of GTS 40-3-2 in soybean samples using a conversion factor (Cf) equal to the ratio of the RRS-specific DNA to the taxon-specific DNA in representative genuine GTS 40-3-2 seeds.

Genome sequence of an Australian kangaroo, Macropus eugenii, provides insight into the evolution of mammalian reproduction and development

PubMed Central

2011-01-01

Background We present the genome sequence of the tammar wallaby, Macropus eugenii, which is a member of the kangaroo family and the first representative of the iconic hopping mammals that symbolize Australia to be sequenced. The tammar has many unusual biological characteristics, including the longest period of embryonic diapause of any mammal, extremely synchronized seasonal breeding and prolonged and sophisticated lactation within a well-defined pouch. Like other marsupials, it gives birth to highly altricial young, and has a small number of very large chromosomes, making it a valuable model for genomics, reproduction and development. Results The genome has been sequenced to 2 × coverage using Sanger sequencing, enhanced with additional next generation sequencing and the integration of extensive physical and linkage maps to build the genome assembly. We also sequenced the tammar transcriptome across many tissues and developmental time points. Our analyses of these data shed light on mammalian reproduction, development and genome evolution: there is innovation in reproductive and lactational genes, rapid evolution of germ cell genes, and incomplete, locus-specific X inactivation. We also observe novel retrotransposons and a highly rearranged major histocompatibility complex, with many class I genes located outside the complex. Novel microRNAs in the tammar HOX clusters uncover new potential mammalian HOX regulatory elements. Conclusions Analyses of these resources enhance our understanding of marsupial gene evolution, identify marsupial-specific conserved non-coding elements and critical genes across a range of biological systems, including reproduction, development and immunity, and provide new insight into marsupial and mammalian biology and genome evolution. PMID:21854559

An ethylene-responsive enhancer element is involved in the senescence-related expression of the carnation glutathione-S-transferase (GST1) gene.

PubMed

Itzhaki, H; Maxson, J M; Woodson, W R

1994-09-13

The increased production of ethylene during carnation petal senescence regulates the transcription of the GST1 gene encoding a subunit of glutathione-S-transferase. We have investigated the molecular basis for this ethylene-responsive transcription by examining the cis elements and trans-acting factors involved in the expression of the GST1 gene. Transient expression assays following delivery of GST1 5' flanking DNA fused to a beta-glucuronidase receptor gene were used to functionally define sequences responsible for ethylene-responsive expression. Deletion analysis of the 5' flanking sequences of GST1 identified a single positive regulatory element of 197 bp between -667 and -470 necessary for ethylene-responsive expression. The sequences within this ethylene-responsive region were further localized to 126 bp between -596 and -470. The ethylene-responsive element (ERE) within this region conferred ethylene-regulated expression upon a minimal cauliflower mosaic virus-35S TATA-box promoter in an orientation-independent manner. Gel electrophoresis mobility-shift assays and DNase I footprinting were used to identify proteins that bind to sequences within the ERE. Nuclear proteins from carnation petals were shown to specifically interact with the 126-bp ERE and the presence and binding of these proteins were independent of ethylene or petal senescence. DNase I footprinting defined DNA sequences between -510 and -488 within the ERE specifically protected by bound protein. An 8-bp sequence (ATTTCAAA) within the protected region shares significant homology with promoter sequences required for ethylene responsiveness from the tomato fruit-ripening E4 gene.

Genome sequence of an Australian kangaroo, Macropus eugenii, provides insight into the evolution of mammalian reproduction and development.

PubMed

Renfree, Marilyn B; Papenfuss, Anthony T; Deakin, Janine E; Lindsay, James; Heider, Thomas; Belov, Katherine; Rens, Willem; Waters, Paul D; Pharo, Elizabeth A; Shaw, Geoff; Wong, Emily S W; Lefèvre, Christophe M; Nicholas, Kevin R; Kuroki, Yoko; Wakefield, Matthew J; Zenger, Kyall R; Wang, Chenwei; Ferguson-Smith, Malcolm; Nicholas, Frank W; Hickford, Danielle; Yu, Hongshi; Short, Kirsty R; Siddle, Hannah V; Frankenberg, Stephen R; Chew, Keng Yih; Menzies, Brandon R; Stringer, Jessica M; Suzuki, Shunsuke; Hore, Timothy A; Delbridge, Margaret L; Patel, Hardip R; Mohammadi, Amir; Schneider, Nanette Y; Hu, Yanqiu; O'Hara, William; Al Nadaf, Shafagh; Wu, Chen; Feng, Zhi-Ping; Cocks, Benjamin G; Wang, Jianghui; Flicek, Paul; Searle, Stephen M J; Fairley, Susan; Beal, Kathryn; Herrero, Javier; Carone, Dawn M; Suzuki, Yutaka; Sugano, Sumio; Toyoda, Atsushi; Sakaki, Yoshiyuki; Kondo, Shinji; Nishida, Yuichiro; Tatsumoto, Shoji; Mandiou, Ion; Hsu, Arthur; McColl, Kaighin A; Lansdell, Benjamin; Weinstock, George; Kuczek, Elizabeth; McGrath, Annette; Wilson, Peter; Men, Artem; Hazar-Rethinam, Mehlika; Hall, Allison; Davis, John; Wood, David; Williams, Sarah; Sundaravadanam, Yogi; Muzny, Donna M; Jhangiani, Shalini N; Lewis, Lora R; Morgan, Margaret B; Okwuonu, Geoffrey O; Ruiz, San Juana; Santibanez, Jireh; Nazareth, Lynne; Cree, Andrew; Fowler, Gerald; Kovar, Christie L; Dinh, Huyen H; Joshi, Vandita; Jing, Chyn; Lara, Fremiet; Thornton, Rebecca; Chen, Lei; Deng, Jixin; Liu, Yue; Shen, Joshua Y; Song, Xing-Zhi; Edson, Janette; Troon, Carmen; Thomas, Daniel; Stephens, Amber; Yapa, Lankesha; Levchenko, Tanya; Gibbs, Richard A; Cooper, Desmond W; Speed, Terence P; Fujiyama, Asao; Graves, Jennifer A M; O'Neill, Rachel J; Pask, Andrew J; Forrest, Susan M; Worley, Kim C

2011-08-29

We present the genome sequence of the tammar wallaby, Macropus eugenii, which is a member of the kangaroo family and the first representative of the iconic hopping mammals that symbolize Australia to be sequenced. The tammar has many unusual biological characteristics, including the longest period of embryonic diapause of any mammal, extremely synchronized seasonal breeding and prolonged and sophisticated lactation within a well-defined pouch. Like other marsupials, it gives birth to highly altricial young, and has a small number of very large chromosomes, making it a valuable model for genomics, reproduction and development. The genome has been sequenced to 2 × coverage using Sanger sequencing, enhanced with additional next generation sequencing and the integration of extensive physical and linkage maps to build the genome assembly. We also sequenced the tammar transcriptome across many tissues and developmental time points. Our analyses of these data shed light on mammalian reproduction, development and genome evolution: there is innovation in reproductive and lactational genes, rapid evolution of germ cell genes, and incomplete, locus-specific X inactivation. We also observe novel retrotransposons and a highly rearranged major histocompatibility complex, with many class I genes located outside the complex. Novel microRNAs in the tammar HOX clusters uncover new potential mammalian HOX regulatory elements. Analyses of these resources enhance our understanding of marsupial gene evolution, identify marsupial-specific conserved non-coding elements and critical genes across a range of biological systems, including reproduction, development and immunity, and provide new insight into marsupial and mammalian biology and genome evolution.

Extensive structural variations between mitochondrial genomes of CMS and normal peppers (Capsicum annuum L.) revealed by complete nucleotide sequencing.

PubMed

Jo, Yeong Deuk; Choi, Yoomi; Kim, Dong-Hwan; Kim, Byung-Dong; Kang, Byoung-Cheorl

2014-07-04

Cytoplasmic male sterility (CMS) is an inability to produce functional pollen that is caused by mutation of the mitochondrial genome. Comparative analyses of mitochondrial genomes of lines with and without CMS in several species have revealed structural differences between genomes, including extensive rearrangements caused by recombination. However, the mitochondrial genome structure and the DNA rearrangements that may be related to CMS have not been characterized in Capsicum spp. We obtained the complete mitochondrial genome sequences of the pepper CMS line FS4401 (507,452 bp) and the fertile line Jeju (511,530 bp). Comparative analysis between mitochondrial genomes of peppers and tobacco that are included in Solanaceae revealed extensive DNA rearrangements and poor conservation in non-coding DNA. In comparison between pepper lines, FS4401 and Jeju mitochondrial DNAs contained the same complement of protein coding genes except for one additional copy of an atp6 gene (ψatp6-2) in FS4401. In terms of genome structure, we found eighteen syntenic blocks in the two mitochondrial genomes, which have been rearranged in each genome. By contrast, sequences between syntenic blocks, which were specific to each line, accounted for 30,380 and 17,847 bp in FS4401 and Jeju, respectively. The previously-reported CMS candidate genes, orf507 and ψatp6-2, were located on the edges of the largest sequence segments that were specific to FS4401. In this region, large number of small sequence segments which were absent or found on different locations in Jeju mitochondrial genome were combined together. The incorporation of repeats and overlapping of connected sequence segments by a few nucleotides implied that extensive rearrangements by homologous recombination might be involved in evolution of this region. Further analysis using mtDNA pairs from other plant species revealed common features of DNA regions around CMS-associated genes. Although large portion of sequence context was shared by mitochondrial genomes of CMS and male-fertile pepper lines, extensive genome rearrangements were detected. CMS candidate genes located on the edges of highly-rearranged CMS-specific DNA regions and near to repeat sequences. These characteristics were detected among CMS-associated genes in other species, implying a common mechanism might be involved in the evolution of CMS-associated genes.

Phylogenetic relatedness determined between antibiotic resistance and 16S rRNA genes in actinobacteria.

PubMed

Sagova-Mareckova, Marketa; Ulanova, Dana; Sanderova, Petra; Omelka, Marek; Kamenik, Zdenek; Olsovska, Jana; Kopecky, Jan

2015-04-01

Distribution and evolutionary history of resistance genes in environmental actinobacteria provide information on intensity of antibiosis and evolution of specific secondary metabolic pathways at a given site. To this day, actinobacteria producing biologically active compounds were isolated mostly from soil but only a limited range of soil environments were commonly sampled. Consequently, soil remains an unexplored environment in search for novel producers and related evolutionary questions. Ninety actinobacteria strains isolated at contrasting soil sites were characterized phylogenetically by 16S rRNA gene, for presence of erm and ABC transporter resistance genes and antibiotic production. An analogous analysis was performed in silico with 246 and 31 strains from Integrated Microbial Genomes (JGI_IMG) database selected by the presence of ABC transporter genes and erm genes, respectively. In the isolates, distances of erm gene sequences were significantly correlated to phylogenetic distances based on 16S rRNA genes, while ABC transporter gene distances were not. The phylogenetic distance of isolates was significantly correlated to soil pH and organic matter content of isolation sites. In the analysis of JGI_IMG datasets the correlation between phylogeny of resistance genes and the strain phylogeny based on 16S rRNA genes or five housekeeping genes was observed for both the erm genes and ABC transporter genes in both actinobacteria and streptomycetes. However, in the analysis of sequences from genomes where both resistance genes occurred together the correlation was observed for both ABC transporter and erm genes in actinobacteria but in streptomycetes only in the erm gene. The type of erm resistance gene sequences was influenced by linkage to 16S rRNA gene sequences and site characteristics. The phylogeny of ABC transporter gene was correlated to 16S rRNA genes mainly above the genus level. The results support the concept of new specific secondary metabolite scaffolds occurring more likely in taxonomically distant producers but suggest that the antibiotic selection of gene pools is also influenced by site conditions.

Species-specific identification of Dekkera/Brettanomyces yeasts by fluorescently labeled DNA probes targeting the 26S rRNA.

PubMed

Röder, Christoph; König, Helmut; Fröhlich, Jürgen

2007-09-01

Sequencing of the complete 26S rRNA genes of all Dekkera/Brettanomyces species colonizing different beverages revealed the potential for a specific primer and probe design to support diagnostic PCR approaches and FISH. By analysis of the complete 26S rRNA genes of all five currently known Dekkera/Brettanomyces species (Dekkera bruxellensis, D. anomala, Brettanomyces custersianus, B. nanus and B. naardenensis), several regions with high nucleotide sequence variability yet distinct from the D1/D2 domains were identified. FISH species-specific probes targeting the 26S rRNA gene's most variable regions were designed. Accessibility of probe targets for hybridization was facilitated by the construction of partially complementary 'side'-labeled probes, based on secondary structure models of the rRNA sequences. The specificity and routine applicability of the FISH-based method for yeast identification were tested by analyzing different wine isolates. Investigation of the prevalence of Dekkera/Brettanomyces yeasts in the German viticultural regions Wonnegau, Nierstein and Bingen (Rhinehesse, Rhineland-Palatinate) resulted in the isolation of 37 D. bruxellensis strains from 291 wine samples.

Simultaneous mutation detection of three homoeologous genes in wheat by High Resolution Melting analysis and Mutation Surveyor.

PubMed

Dong, Chongmei; Vincent, Kate; Sharp, Peter

2009-12-04

TILLING (Targeting Induced Local Lesions IN Genomes) is a powerful tool for reverse genetics, combining traditional chemical mutagenesis with high-throughput PCR-based mutation detection to discover induced mutations that alter protein function. The most popular mutation detection method for TILLING is a mismatch cleavage assay using the endonuclease CelI. For this method, locus-specific PCR is essential. Most wheat genes are present as three similar sequences with high homology in exons and low homology in introns. Locus-specific primers can usually be designed in introns. However, it is sometimes difficult to design locus-specific PCR primers in a conserved region with high homology among the three homoeologous genes, or in a gene lacking introns, or if information on introns is not available. Here we describe a mutation detection method which combines High Resolution Melting (HRM) analysis of mixed PCR amplicons containing three homoeologous gene fragments and sequence analysis using Mutation Surveyor software, aimed at simultaneous detection of mutations in three homoeologous genes. We demonstrate that High Resolution Melting (HRM) analysis can be used in mutation scans in mixed PCR amplicons containing three homoeologous gene fragments. Combining HRM scanning with sequence analysis using Mutation Surveyor is sensitive enough to detect a single nucleotide mutation in the heterozygous state in a mixed PCR amplicon containing three homoeoloci. The method was tested and validated in an EMS (ethylmethane sulfonate)-treated wheat TILLING population, screening mutations in the carboxyl terminal domain of the Starch Synthase II (SSII) gene. Selected identified mutations of interest can be further analysed by cloning to confirm the mutation and determine the genomic origin of the mutation. Polyploidy is common in plants. Conserved regions of a gene often represent functional domains and have high sequence similarity between homoeologous loci. The method described here is a useful alternative to locus-specific based methods for screening mutations in conserved functional domains of homoeologous genes. This method can also be used for SNP (single nucleotide polymorphism) marker development and eco-TILLING in polyploid species.

Deep sequencing reveals cell-type-specific patterns of single-cell transcriptome variation.

PubMed

Dueck, Hannah; Khaladkar, Mugdha; Kim, Tae Kyung; Spaethling, Jennifer M; Francis, Chantal; Suresh, Sangita; Fisher, Stephen A; Seale, Patrick; Beck, Sheryl G; Bartfai, Tamas; Kuhn, Bernhard; Eberwine, James; Kim, Junhyong

2015-06-09

Differentiation of metazoan cells requires execution of different gene expression programs but recent single-cell transcriptome profiling has revealed considerable variation within cells of seeming identical phenotype. This brings into question the relationship between transcriptome states and cell phenotypes. Additionally, single-cell transcriptomics presents unique analysis challenges that need to be addressed to answer this question. We present high quality deep read-depth single-cell RNA sequencing for 91 cells from five mouse tissues and 18 cells from two rat tissues, along with 30 control samples of bulk RNA diluted to single-cell levels. We find that transcriptomes differ globally across tissues with regard to the number of genes expressed, the average expression patterns, and within-cell-type variation patterns. We develop methods to filter genes for reliable quantification and to calibrate biological variation. All cell types include genes with high variability in expression, in a tissue-specific manner. We also find evidence that single-cell variability of neuronal genes in mice is correlated with that in rats consistent with the hypothesis that levels of variation may be conserved. Single-cell RNA-sequencing data provide a unique view of transcriptome function; however, careful analysis is required in order to use single-cell RNA-sequencing measurements for this purpose. Technical variation must be considered in single-cell RNA-sequencing studies of expression variation. For a subset of genes, biological variability within each cell type appears to be regulated in order to perform dynamic functions, rather than solely molecular noise.

Organization of nif gene cluster in Frankia sp. EuIK1 strain, a symbiont of Elaeagnus umbellata.

PubMed

Oh, Chang Jae; Kim, Ho Bang; Kim, Jitae; Kim, Won Jin; Lee, Hyoungseok; An, Chung Sun

2012-01-01

The nucleotide sequence of a 20.5-kb genomic region harboring nif genes was determined and analyzed. The fragment was obtained from Frankia sp. EuIK1 strain, an indigenous symbiont of Elaeagnus umbellata. A total of 20 ORFs including 12 nif genes were identified and subjected to comparative analysis with the genome sequences of 3 Frankia strains representing diverse host plant specificities. The nucleotide and deduced amino acid sequences showed highest levels of identity with orthologous genes from an Elaeagnus-infecting strain. The gene organization patterns around the nif gene clusters were well conserved among all 4 Frankia strains. However, characteristic features appeared in the location of the nifV gene for each Frankia strain, depending on the type of host plant. Sequence analysis was performed to determine the transcription units and suggested that there could be an independent operon starting from the nifW gene in the EuIK strain. Considering the organization patterns and their total extensions on the genome, we propose that the nif gene clusters remained stable despite genetic variations occurring in the Frankia genomes.

Mining new crystal protein genes from Bacillus thuringiensis on the basis of mixed plasmid-enriched genome sequencing and a computational pipeline.

PubMed

Ye, Weixing; Zhu, Lei; Liu, Yingying; Crickmore, Neil; Peng, Donghai; Ruan, Lifang; Sun, Ming

2012-07-01

We have designed a high-throughput system for the identification of novel crystal protein genes (cry) from Bacillus thuringiensis strains. The system was developed with two goals: (i) to acquire the mixed plasmid-enriched genomic sequence of B. thuringiensis using next-generation sequencing biotechnology, and (ii) to identify cry genes with a computational pipeline (using BtToxin_scanner). In our pipeline method, we employed three different kinds of well-developed prediction methods, BLAST, hidden Markov model (HMM), and support vector machine (SVM), to predict the presence of Cry toxin genes. The pipeline proved to be fast (average speed, 1.02 Mb/min for proteins and open reading frames [ORFs] and 1.80 Mb/min for nucleotide sequences), sensitive (it detected 40% more protein toxin genes than a keyword extraction method using genomic sequences downloaded from GenBank), and highly specific. Twenty-one strains from our laboratory's collection were selected based on their plasmid pattern and/or crystal morphology. The plasmid-enriched genomic DNA was extracted from these strains and mixed for Illumina sequencing. The sequencing data were de novo assembled, and a total of 113 candidate cry sequences were identified using the computational pipeline. Twenty-seven candidate sequences were selected on the basis of their low level of sequence identity to known cry genes, and eight full-length genes were obtained with PCR. Finally, three new cry-type genes (primary ranks) and five cry holotypes, which were designated cry8Ac1, cry7Ha1, cry21Ca1, cry32Fa1, and cry21Da1 by the B. thuringiensis Toxin Nomenclature Committee, were identified. The system described here is both efficient and cost-effective and can greatly accelerate the discovery of novel cry genes.

Inferring gene expression from ribosomal promoter sequences, a crowdsourcing approach

PubMed Central

Meyer, Pablo; Siwo, Geoffrey; Zeevi, Danny; Sharon, Eilon; Norel, Raquel; Segal, Eran; Stolovitzky, Gustavo; Siwo, Geoffrey; Rider, Andrew K.; Tan, Asako; Pinapati, Richard S.; Emrich, Scott; Chawla, Nitesh; Ferdig, Michael T.; Tung, Yi-An; Chen, Yong-Syuan; Chen, Mei-Ju May; Chen, Chien-Yu; Knight, Jason M.; Sahraeian, Sayed Mohammad Ebrahim; Esfahani, Mohammad Shahrokh; Dreos, Rene; Bucher, Philipp; Maier, Ezekiel; Saeys, Yvan; Szczurek, Ewa; Myšičková, Alena; Vingron, Martin; Klein, Holger; Kiełbasa, Szymon M.; Knisley, Jeff; Bonnell, Jeff; Knisley, Debra; Kursa, Miron B.; Rudnicki, Witold R.; Bhattacharjee, Madhuchhanda; Sillanpää, Mikko J.; Yeung, James; Meysman, Pieter; Rodríguez, Aminael Sánchez; Engelen, Kristof; Marchal, Kathleen; Huang, Yezhou; Mordelet, Fantine; Hartemink, Alexander; Pinello, Luca; Yuan, Guo-Cheng

2013-01-01

The Gene Promoter Expression Prediction challenge consisted of predicting gene expression from promoter sequences in a previously unknown experimentally generated data set. The challenge was presented to the community in the framework of the sixth Dialogue for Reverse Engineering Assessments and Methods (DREAM6), a community effort to evaluate the status of systems biology modeling methodologies. Nucleotide-specific promoter activity was obtained by measuring fluorescence from promoter sequences fused upstream of a gene for yellow fluorescence protein and inserted in the same genomic site of yeast Saccharomyces cerevisiae. Twenty-one teams submitted results predicting the expression levels of 53 different promoters from yeast ribosomal protein genes. Analysis of participant predictions shows that accurate values for low-expressed and mutated promoters were difficult to obtain, although in the latter case, only when the mutation induced a large change in promoter activity compared to the wild-type sequence. As in previous DREAM challenges, we found that aggregation of participant predictions provided robust results, but did not fare better than the three best algorithms. Finally, this study not only provides a benchmark for the assessment of methods predicting activity of a specific set of promoters from their sequence, but it also shows that the top performing algorithm, which used machine-learning approaches, can be improved by the addition of biological features such as transcription factor binding sites. PMID:23950146

Sex chromosome differentiation and the W- and Z-specific loci in Xenopus laevis.

PubMed

Mawaribuchi, Shuuji; Takahashi, Shuji; Wada, Mikako; Uno, Yoshinobu; Matsuda, Yoichi; Kondo, Mariko; Fukui, Akimasa; Takamatsu, Nobuhiko; Taira, Masanori; Ito, Michihiko

2017-06-15

Genetic sex-determining systems in vertebrates include two basic types of heterogamety; XX (female)/XY (male) and ZZ (male)/ZW (female) types. The African clawed frog Xenopus laevis has a ZZ/ZW-type sex-determining system. In this species, we previously identified a W-specific sex (female)-determining gene dmw, and specified W and Z chromosomes, which could be morphologically indistinguishable (homomorphic). In addition to dmw, we most recently discovered two genes, named scanw and ccdc69w, and one gene, named capn5z in the W- and Z-specific regions, respectively. In this study, we revealed the detail structures of the W/Z-specific loci and genes. Sequence analysis indicated that there is almost no sequence similarity between 278kb W-specific and 83kb Z-specific sequences on chromosome 2Lq32-33, where both the transposable elements are abundant. Synteny and phylogenic analyses indicated that all the W/Z-specific genes might have emerged independently. Expression analysis demonstrated that scanw and ccdc69w or capn5z are expressed in early differentiating ZW gonads or testes, thereby suggesting possible roles in female or male development, respectively. Importantly, the sex-determining gene (SDG) dmw might have been generated after allotetraploidization, thereby indicating the construction of the new sex-determining system by dmw after species hybridization. Furthermore, by direct genotyping, we confirmed that diploid WW embryos developed into normal female frogs, which indicate that the Z-specific region is not essential for female development. Overall, these findings indicate that sex chromosome differentiation has started, although no heteromorphic sex chromosomes are evident yet, in X. laevis. Homologous recombination suppression might have promoted the accumulation of mutations and transposable elements, and enlarged the W/Z-specific regions, thereby resulting in differentiation of the W/Z chromosomes. Copyright © 2016 Elsevier Inc. All rights reserved.

Sites of instability in the human TCF3 (E2A) gene adopt G-quadruplex DNA structures in vitro

PubMed Central

Williams, Jonathan D.; Fleetwood, Sara; Berroyer, Alexandra; Kim, Nayun; Larson, Erik D.

2015-01-01

The formation of highly stable four-stranded DNA, called G-quadruplex (G4), promotes site-specific genome instability. G4 DNA structures fold from repetitive guanine sequences, and increasing experimental evidence connects G4 sequence motifs with specific gene rearrangements. The human transcription factor 3 (TCF3) gene (also termed E2A) is subject to genetic instability associated with severe disease, most notably a common translocation event t(1;19) associated with acute lymphoblastic leukemia. The sites of instability in TCF3 are not randomly distributed, but focused to certain sequences. We asked if G4 DNA formation could explain why TCF3 is prone to recombination and mutagenesis. Here we demonstrate that sequences surrounding the major t(1;19) break site and a region associated with copy number variations both contain G4 sequence motifs. The motifs identified readily adopt G4 DNA structures that are stable enough to interfere with DNA synthesis in physiological salt conditions in vitro. When introduced into the yeast genome, TCF3 G4 motifs promoted gross chromosomal rearrangements in a transcription-dependent manner. Our results provide a molecular rationale for the site-specific instability of human TCF3, suggesting that G4 DNA structures contribute to oncogenic DNA breaks and recombination. PMID:26029241

New FeFe-hydrogenase genes identified in a metagenomic fosmid library from a municipal wastewater treatment plant as revealed by high-throughput sequencing.

PubMed

Tomazetto, Geizecler; Wibberg, Daniel; Schlüter, Andreas; Oliveira, Valéria M

2015-01-01

A fosmid metagenomic library was constructed with total community DNA obtained from a municipal wastewater treatment plant (MWWTP), with the aim of identifying new FeFe-hydrogenase genes encoding the enzymes most important for hydrogen metabolism. The dataset generated by pyrosequencing of a fosmid library was mined to identify environmental gene tags (EGTs) assigned to FeFe-hydrogenase. The majority of EGTs representing FeFe-hydrogenase genes were affiliated with the class Clostridia, suggesting that this group is the main hydrogen producer in the MWWTP analyzed. Based on assembled sequences, three FeFe-hydrogenase genes were predicted based on detection of the L2 motif (MPCxxKxxE) in the encoded gene product, confirming true FeFe-hydrogenase sequences. These sequences were used to design specific primers to detect fosmids encoding FeFe-hydrogenase genes predicted from the dataset. Three identified fosmids were completely sequenced. The cloned genomic fragments within these fosmids are closely related to members of the Spirochaetaceae, Bacteroidales and Firmicutes, and their FeFe-hydrogenase sequences are characterized by the structure type M3, which is common to clostridial enzymes. FeFe-hydrogenase sequences found in this study represent hitherto undetected sequences, indicating the high genetic diversity regarding these enzymes in MWWTP. Results suggest that MWWTP have to be considered as reservoirs for new FeFe-hydrogenase genes. Copyright © 2014 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

Salient Features of Endonuclease Platforms for Therapeutic Genome Editing.

PubMed

Certo, Michael T; Morgan, Richard A

2016-03-01

Emerging gene-editing technologies are nearing a revolutionary phase in genetic medicine: precisely modifying or repairing causal genetic defects. This may include any number of DNA sequence manipulations, such as knocking out a deleterious gene, introducing a particular mutation, or directly repairing a defective sequence by site-specific recombination. All of these edits can currently be achieved via programmable rare-cutting endonucleases to create targeted DNA breaks that can engage and exploit endogenous DNA repair pathways to impart site-specific genetic changes. Over the past decade, several distinct technologies for introducing site-specific DNA breaks have been developed, yet the different biological origins of these gene-editing technologies bring along inherent differences in parameters that impact clinical implementation. This review aims to provide an accessible overview of the various endonuclease-based gene-editing platforms, highlighting the strengths and weakness of each with respect to therapeutic applications.

Salient Features of Endonuclease Platforms for Therapeutic Genome Editing

PubMed Central

Certo, Michael T; Morgan, Richard A

2016-01-01

Emerging gene-editing technologies are nearing a revolutionary phase in genetic medicine: precisely modifying or repairing causal genetic defects. This may include any number of DNA sequence manipulations, such as knocking out a deleterious gene, introducing a particular mutation, or directly repairing a defective sequence by site-specific recombination. All of these edits can currently be achieved via programmable rare-cutting endonucleases to create targeted DNA breaks that can engage and exploit endogenous DNA repair pathways to impart site-specific genetic changes. Over the past decade, several distinct technologies for introducing site-specific DNA breaks have been developed, yet the different biological origins of these gene-editing technologies bring along inherent differences in parameters that impact clinical implementation. This review aims to provide an accessible overview of the various endonuclease-based gene-editing platforms, highlighting the strengths and weakness of each with respect to therapeutic applications. PMID:26796671

Fluorescent in situ sequencing (FISSEQ) of RNA for gene expression profiling in intact cells and tissues

PubMed Central

Lee, Je Hyuk; Daugharthy, Evan R.; Scheiman, Jonathan; Kalhor, Reza; Ferrante, Thomas C.; Terry, Richard; Turczyk, Brian M.; Yang, Joyce L.; Lee, Ho Suk; Aach, John; Zhang, Kun; Church, George M.

2014-01-01

RNA sequencing measures the quantitative change in gene expression over the whole transcriptome, but it lacks spatial context. On the other hand, in situ hybridization provides the location of gene expression, but only for a small number of genes. Here we detail a protocol for genome-wide profiling of gene expression in situ in fixed cells and tissues, in which RNA is converted into cross-linked cDNA amplicons and sequenced manually on a confocal microscope. Unlike traditional RNA-seq our method enriches for context-specific transcripts over house-keeping and/or structural RNA, and it preserves the tissue architecture for RNA localization studies. Our protocol is written for researchers experienced in cell microscopy with minimal computing skills. Library construction and sequencing can be completed within 14 d, with image analysis requiring an additional 2 d. PMID:25675209

Pooled Resequencing of 122 Ulcerative Colitis Genes in a Large Dutch Cohort Suggests Population-Specific Associations of Rare Variants in MUC2.

PubMed

Visschedijk, Marijn C; Alberts, Rudi; Mucha, Soren; Deelen, Patrick; de Jong, Dirk J; Pierik, Marieke; Spekhorst, Lieke M; Imhann, Floris; van der Meulen-de Jong, Andrea E; van der Woude, C Janneke; van Bodegraven, Adriaan A; Oldenburg, Bas; Löwenberg, Mark; Dijkstra, Gerard; Ellinghaus, David; Schreiber, Stefan; Wijmenga, Cisca; Rivas, Manuel A; Franke, Andre; van Diemen, Cleo C; Weersma, Rinse K

2016-01-01

Genome-wide association studies have revealed several common genetic risk variants for ulcerative colitis (UC). However, little is known about the contribution of rare, large effect genetic variants to UC susceptibility. In this study, we performed a deep targeted re-sequencing of 122 genes in Dutch UC patients in order to investigate the contribution of rare variants to the genetic susceptibility to UC. The selection of genes consists of 111 established human UC susceptibility genes and 11 genes that lead to spontaneous colitis when knocked-out in mice. In addition, we sequenced the promoter regions of 45 genes where known variants exert cis-eQTL-effects. Targeted pooled re-sequencing was performed on DNA of 790 Dutch UC cases. The Genome of the Netherlands project provided sequence data of 500 healthy controls. After quality control and prioritization based on allele frequency and pathogenicity probability, follow-up genotyping of 171 rare variants was performed on 1021 Dutch UC cases and 1166 Dutch controls. Single-variant association and gene-based analyses identified an association of rare variants in the MUC2 gene with UC. The associated variants in the Dutch population could not be replicated in a German replication cohort (1026 UC cases, 3532 controls). In conclusion, this study has identified a putative role for MUC2 on UC susceptibility in the Dutch population and suggests a population-specific contribution of rare variants to UC.

Minimum information about a marker gene sequence (MIMARKS) and minimum information about any (x) sequence (MIxS) specifications

PubMed Central

Yilmaz, Pelin; Kottmann, Renzo; Field, Dawn; Knight, Rob; Cole, James R; Amaral-Zettler, Linda; Gilbert, Jack A; Karsch-Mizrachi, Ilene; Johnston, Anjanette; Cochrane, Guy; Vaughan, Robert; Hunter, Christopher; Park, Joonhong; Morrison, Norman; Rocca-Serra, Philippe; Sterk, Peter; Arumugam, Manimozhiyan; Bailey, Mark; Baumgartner, Laura; Birren, Bruce W; Blaser, Martin J; Bonazzi, Vivien; Booth, Tim; Bork, Peer; Bushman, Frederic D; Buttigieg, Pier Luigi; Chain, Patrick S G; Charlson, Emily; Costello, Elizabeth K; Huot-Creasy, Heather; Dawyndt, Peter; DeSantis, Todd; Fierer, Noah; Fuhrman, Jed A; Gallery, Rachel E; Gevers, Dirk; Gibbs, Richard A; Gil, Inigo San; Gonzalez, Antonio; Gordon, Jeffrey I; Guralnick, Robert; Hankeln, Wolfgang; Highlander, Sarah; Hugenholtz, Philip; Jansson, Janet; Kau, Andrew L; Kelley, Scott T; Kennedy, Jerry; Knights, Dan; Koren, Omry; Kuczynski, Justin; Kyrpides, Nikos; Larsen, Robert; Lauber, Christian L; Legg, Teresa; Ley, Ruth E; Lozupone, Catherine A; Ludwig, Wolfgang; Lyons, Donna; Maguire, Eamonn; Methé, Barbara A; Meyer, Folker; Muegge, Brian; Nakielny, Sara; Nelson, Karen E; Nemergut, Diana; Neufeld, Josh D; Newbold, Lindsay K; Oliver, Anna E; Pace, Norman R; Palanisamy, Giriprakash; Peplies, Jörg; Petrosino, Joseph; Proctor, Lita; Pruesse, Elmar; Quast, Christian; Raes, Jeroen; Ratnasingham, Sujeevan; Ravel, Jacques; Relman, David A; Assunta-Sansone, Susanna; Schloss, Patrick D; Schriml, Lynn; Sinha, Rohini; Smith, Michelle I; Sodergren, Erica; Spor, Aymé; Stombaugh, Jesse; Tiedje, James M; Ward, Doyle V; Weinstock, George M; Wendel, Doug; White, Owen; Whiteley, Andrew; Wilke, Andreas; Wortman, Jennifer R; Yatsunenko, Tanya; Glöckner, Frank Oliver

2012-01-01

Here we present a standard developed by the Genomic Standards Consortium (GSC) for reporting marker gene sequences—the minimum information about a marker gene sequence (MIMARKS). We also introduce a system for describing the environment from which a biological sample originates. The ‘environmental packages’ apply to any genome sequence of known origin and can be used in combination with MIMARKS and other GSC checklists. Finally, to establish a unified standard for describing sequence data and to provide a single point of entry for the scientific community to access and learn about GSC checklists, we present the minimum information about any (x) sequence (MIxS). Adoption of MIxS will enhance our ability to analyze natural genetic diversity documented by massive DNA sequencing efforts from myriad ecosystems in our ever-changing biosphere. PMID:21552244

Construction of a high-density genetic map by specific locus amplified fragment sequencing (SLAF-seq) and its application to Quantitative Trait Loci (QTL) analysis for boll weight in upland cotton (Gossypium hirsutum.).

PubMed

Zhang, Zhen; Shang, Haihong; Shi, Yuzhen; Huang, Long; Li, Junwen; Ge, Qun; Gong, Juwu; Liu, Aiying; Chen, Tingting; Wang, Dan; Wang, Yanling; Palanga, Koffi Kibalou; Muhammad, Jamshed; Li, Weijie; Lu, Quanwei; Deng, Xiaoying; Tan, Yunna; Song, Weiwu; Cai, Juan; Li, Pengtao; Rashid, Harun or; Gong, Wankui; Yuan, Youlu

2016-04-11

Upland Cotton (Gossypium hirsutum) is one of the most important worldwide crops it provides natural high-quality fiber for the industrial production and everyday use. Next-generation sequencing is a powerful method to identify single nucleotide polymorphism markers on a large scale for the construction of a high-density genetic map for quantitative trait loci mapping. In this research, a recombinant inbred lines population developed from two upland cotton cultivars 0-153 and sGK9708 was used to construct a high-density genetic map through the specific locus amplified fragment sequencing method. The high-density genetic map harbored 5521 single nucleotide polymorphism markers which covered a total distance of 3259.37 cM with an average marker interval of 0.78 cM without gaps larger than 10 cM. In total 18 quantitative trait loci of boll weight were identified as stable quantitative trait loci and were detected in at least three out of 11 environments and explained 4.15-16.70 % of the observed phenotypic variation. In total, 344 candidate genes were identified within the confidence intervals of these stable quantitative trait loci based on the cotton genome sequence. These genes were categorized based on their function through gene ontology analysis, Kyoto Encyclopedia of Genes and Genomes analysis and eukaryotic orthologous groups analysis. This research reported the first high-density genetic map for Upland Cotton (Gossypium hirsutum) with a recombinant inbred line population using single nucleotide polymorphism markers developed by specific locus amplified fragment sequencing. We also identified quantitative trait loci of boll weight across 11 environments and identified candidate genes within the quantitative trait loci confidence intervals. The results of this research would provide useful information for the next-step work including fine mapping, gene functional analysis, pyramiding breeding of functional genes as well as marker-assisted selection.

Characterization of wood decay enzymes by MALDI-MS for post-translational modification and gene identification.

Treesearch

Theodorus H. de Koker; Philip J. Kersten

2002-01-01

The recent sequencing of the Phanerochaete chrysosporium genome presents many opportunities, including the possibility of rapidly correlating specific wood decay proteins of the fungus with the corresponding gene sequences. Here we compare mass fragments of trypsin digests, determined by MALDI-MS (Matrix Assisted Laser Desorption Ionization-Mass Spectrometry), with...

Genome of Epinotia aporema granulovirus (EpapGV), a polyorganotropic fast killing betabaculovirus with a novel thymidylate kinase gene

PubMed Central

2012-01-01

Background Epinotia aporema (Lepidoptera: Tortricidae) is an important pest of legume crops in South America. Epinotia aporema granulovirus (EpapGV) is a baculovirus that causes a polyorganotropic infection in the host larva. Its high pathogenicity and host specificity make EpapGV an excellent candidate to be used as a biological control agent. Results The genome of Epinotia aporema granulovirus (EpapGV) was sequenced and analyzed. Its circular double-stranded DNA genome is 119,082 bp in length and codes for 133 putative genes. It contains the 31 baculovirus core genes and a set of 19 genes that are GV exclusive. Seventeen ORFs were unique to EpapGV in comparison with other baculoviruses. Of these, 16 found no homologues in GenBank, and one encoded a thymidylate kinase. Analysis of nucleotide sequence repeats revealed the presence of 16 homologous regions (hrs) interspersed throughout the genome. Each hr was characterized by the presence of 1 to 3 clustered imperfect palindromes which are similar to previously described palindromes of tortricid-specific GVs. Also, one of the hrs (hr4) has flanking sequences suggestive of a putative non-hr ori. Interestingly, two more complex hrs were found in opposite loci, dividing the circular dsDNA genome in two halves. Gene synteny maps showed the great colinearity of sequenced GVs, being EpapGV the most dissimilar as it has a 20 kb-long gene block inversion. Phylogenetic study performed with 31 core genes of 58 baculoviral genomes suggests that EpapGV is the baculovirus isolate closest to the putative common ancestor of tortricid specific betabaculoviruses. Conclusions This study, along with previous characterization of EpapGV infection, is useful for the better understanding of the pathology caused by this virus and its potential utilization as a bioinsecticide. PMID:23051685

Genomic sequences of murine gamma B- and gamma C-crystallin-encoding genes: promoter analysis and complete evolutionary pattern of mouse, rat and human gamma-crystallins.

PubMed

Graw, J; Liebstein, A; Pietrowski, D; Schmitt-John, T; Werner, T

1993-12-22

The murine genes, gamma B-cry and gamma C-cry, encoding the gamma B- and gamma C-crystallins, were isolated from a genomic DNA library. The complete nucleotide (nt) sequences of both genes were determined from 661 and 711 bp, respectively, upstream from the first exon to the corresponding polyadenylation sites, comprising more than 2650 and 2890 bp, respectively. The new sequences were compared to the partial cDNA sequences available for the murine gamma B-cry and gamma C-cry, as well as to the corresponding genomic sequences from rat and man, at both the nt and predicted amino acid (aa) sequence levels. In the gamma B-cry promoter region, a canonical CCAAT-box, a TATA-box, putative NF-I and C/EBP sites were detected. An R-repeat is inserted 366 bp upstream from the transcription start point. In contrast, the gamma C-cry promoter does not contain a CCAAT-box, but some other putative binding sites for transcription factors (AP-2, UBP-1, LBP-1) were located by computer analysis. The promoter regions of all six gamma-cry from mouse, rat and human, except human psi gamma F-cry, were analyzed for common sequence elements. A complex sequence element of about 70-80 bp was found in the proximal promoter, which contains a gamma-cry-specific and almost invariant sequence (crygpel) of 14 nt, and ends with the also invariant TATA-box. Within the complex sequence element, a minimum of three further features specific for the gamma A-, gamma B- and gamma D/E/F-cry genes can be defined, at least two of which were recently shown to be functional. In addition to these four sequence elements, a subtype-specific structure of inverted repeats with different-sized spacers can be deduced from the multiple sequence alignment. A phylogenetic analysis based on the promoter region, as well as the complete exon 3 of all gamma-cry from mouse, rat and man, suggests separation of only five gamma-cry subtypes (gamma A-, gamma B-, gamma C-, gamma D- and gamma E/F-cry) prior to species separation.

Gene calling and bacterial genome annotation with BG7.

PubMed

Tobes, Raquel; Pareja-Tobes, Pablo; Manrique, Marina; Pareja-Tobes, Eduardo; Kovach, Evdokim; Alekhin, Alexey; Pareja, Eduardo

2015-01-01

New massive sequencing technologies are providing many bacterial genome sequences from diverse taxa but a refined annotation of these genomes is crucial for obtaining scientific findings and new knowledge. Thus, bacterial genome annotation has emerged as a key point to investigate in bacteria. Any efficient tool designed specifically to annotate bacterial genomes sequenced with massively parallel technologies has to consider the specific features of bacterial genomes (absence of introns and scarcity of nonprotein-coding sequence) and of next-generation sequencing (NGS) technologies (presence of errors and not perfectly assembled genomes). These features make it convenient to focus on coding regions and, hence, on protein sequences that are the elements directly related with biological functions. In this chapter we describe how to annotate bacterial genomes with BG7, an open-source tool based on a protein-centered gene calling/annotation paradigm. BG7 is specifically designed for the annotation of bacterial genomes sequenced with NGS. This tool is sequence error tolerant maintaining their capabilities for the annotation of highly fragmented genomes or for annotating mixed sequences coming from several genomes (as those obtained through metagenomics samples). BG7 has been designed with scalability as a requirement, with a computing infrastructure completely based on cloud computing (Amazon Web Services).

Onco-Regulon: an integrated database and software suite for site specific targeting of transcription factors of cancer genes

PubMed Central

Tomar, Navneet; Mishra, Akhilesh; Mrinal, Nirotpal; Jayaram, B.

2016-01-01

Transcription factors (TFs) bind at multiple sites in the genome and regulate expression of many genes. Regulating TF binding in a gene specific manner remains a formidable challenge in drug discovery because the same binding motif may be present at multiple locations in the genome. Here, we present Onco-Regulon (http://www.scfbio-iitd.res.in/software/onco/NavSite/index.htm), an integrated database of regulatory motifs of cancer genes clubbed with Unique Sequence-Predictor (USP) a software suite that identifies unique sequences for each of these regulatory DNA motifs at the specified position in the genome. USP works by extending a given DNA motif, in 5′→3′, 3′ →5′ or both directions by adding one nucleotide at each step, and calculates the frequency of each extended motif in the genome by Frequency Counter programme. This step is iterated till the frequency of the extended motif becomes unity in the genome. Thus, for each given motif, we get three possible unique sequences. Closest Sequence Finder program predicts off-target drug binding in the genome. Inclusion of DNA-Protein structural information further makes Onco-Regulon a highly informative repository for gene specific drug development. We believe that Onco-Regulon will help researchers to design drugs which will bind to an exclusive site in the genome with no off-target effects, theoretically. Database URL: http://www.scfbio-iitd.res.in/software/onco/NavSite/index.htm PMID:27515825

Cloning and sequencing of the pheP gene, which encodes the phenylalanine-specific transport system of Escherichia coli.

PubMed Central

Pi, J; Wookey, P J; Pittard, A J

1991-01-01

The phenylalanine-specific permease gene (pheP) of Escherichia coli has been cloned and sequenced. The gene was isolated on a 6-kb Sau3AI fragment from a chromosomal library, and its presence was verified by complementation of a mutant lacking the functional phenylalanine-specific permease. Subcloning from this fragment localized the pheP gene on a 2.7-kb HindIII-HindII fragment. The nucleotide sequence of this 2.7-kb region was determined. An open reading frame was identified which extends from a putative start point of translation (GTG at position 636) to a termination signal (TAA at position 2010). The assignment of the GTG as the initiation codon was verified by site-directed mutagenesis of the initiation codon and by introducing a chain termination mutation into the pheP-lacZ fusion construct. A single initiation site of transcription 30 bp upstream of the start point of translation was identified by the primer extension analysis. The pheP structural gene consists of 1,374 nucleotides specifying a protein of 458 amino acid residues. The PheP protein is very hydrophobic (71% nonpolar residues). A topological model predicted from the sequence analysis defines 12 transmembrane segments. This protein is highly homologous with the AroP (general aromatic transport) system of E. coli (59.6% identity) and to a lesser extent with the yeast permeases CAN1 (arginine), PUT4 (proline), and HIP1 (histidine) of Saccharomyces cerevisiae. Images PMID:1711024

Genomic Sequence and Experimental Tractability of a New Decapod Shrimp Model, Neocaridina denticulata

PubMed Central

Kenny, Nathan J.; Sin, Yung Wa; Shen, Xin; Zhe, Qu; Wang, Wei; Chan, Ting Fung; Tobe, Stephen S.; Shimeld, Sebastian M.; Chu, Ka Hou; Hui, Jerome H. L.

2014-01-01

The speciose Crustacea is the largest subphylum of arthropods on the planet after the Insecta. To date, however, the only publically available sequenced crustacean genome is that of the water flea, Daphnia pulex, a member of the Branchiopoda. While Daphnia is a well-established ecotoxicological model, previous study showed that one-third of genes contained in its genome are lineage-specific and could not be identified in any other metazoan genomes. To better understand the genomic evolution of crustaceans and arthropods, we have sequenced the genome of a novel shrimp model, Neocaridina denticulata, and tested its experimental malleability. A library of 170-bp nominal fragment size was constructed from DNA of a starved single adult and sequenced using the Illumina HiSeq2000 platform. Core eukaryotic genes, the mitochondrial genome, developmental patterning genes (such as Hox) and microRNA processing pathway genes are all present in this animal, suggesting it has not undergone massive genomic loss. Comparison with the published genome of Daphnia pulex has allowed us to reveal 3750 genes that are indeed specific to the lineage containing malacostracans and branchiopods, rather than Daphnia-specific (E-value: 10−6). We also show the experimental tractability of N. denticulata, which, together with the genomic resources presented here, make it an ideal model for a wide range of further aquacultural, developmental, ecotoxicological, food safety, genetic, hormonal, physiological and reproductive research, allowing better understanding of the evolution of crustaceans and other arthropods. PMID:24619275

Novel insertion mutation of ABCB1 gene in an ivermectin-sensitive Border Collie.

PubMed

Han, Jae-Ik; Son, Hyoung-Won; Park, Seung-Cheol; Na, Ki-Jeong

2010-12-01

P-glycoprotein (P-gp) is encoded by the ABCB1 gene and acts as an efflux pump for xenobiotics. In the Border Collie, a nonsense mutation caused by a 4-base pair deletion in the ABCB1 gene is associated with a premature stop to P-gp synthesis. In this study, we examined the full-length coding sequence of the ABCB1 gene in an ivermectin-sensitive Border Collie that lacked the aforementioned deletion mutation. The sequence was compared to the corresponding sequences of a wild-type Beagle and seven ivermectin-tolerant family members of the Border Collie. When compared to the wild-type Beagle sequence, that of the ivermectin-sensitive Border Collie was found to have one insertion mutation and eight single nucleotide polymorphisms (SNPs) in the coding sequence of the ABCB1 gene. While the eight SNPs were also found in the family members' sequences, the insertion mutation was found only in the ivermectin-sensitive dog. These results suggest the possibility that the SNPs are species-specific features of the ABCB1 gene in Border Collies, and that the insertion mutation may be related to ivermectin intolerance.

Novel insertion mutation of ABCB1 gene in an ivermectin-sensitive Border Collie

PubMed Central

Han, Jae-Ik; Son, Hyoung-Won; Park, Seung-Cheol

2010-01-01

P-glycoprotein (P-gp) is encoded by the ABCB1 gene and acts as an efflux pump for xenobiotics. In the Border Collie, a nonsense mutation caused by a 4-base pair deletion in the ABCB1 gene is associated with a premature stop to P-gp synthesis. In this study, we examined the full-length coding sequence of the ABCB1 gene in an ivermectin-sensitive Border Collie that lacked the aforementioned deletion mutation. The sequence was compared to the corresponding sequences of a wild-type Beagle and seven ivermectin-tolerant family members of the Border Collie. When compared to the wild-type Beagle sequence, that of the ivermectin-sensitive Border Collie was found to have one insertion mutation and eight single nucleotide polymorphisms (SNPs) in the coding sequence of the ABCB1 gene. While the eight SNPs were also found in the family members' sequences, the insertion mutation was found only in the ivermectin-sensitive dog. These results suggest the possibility that the SNPs are species-specific features of the ABCB1 gene in Border Collies, and that the insertion mutation may be related to ivermectin intolerance. PMID:21113104

GeneChip{sup {trademark}} screening assay for cystic fibrosis mutations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cronn, M.T.; Miyada, C.G.; Fucini, R.V.

1994-09-01

GeneChip{sup {trademark}} assays are based on high density, carefully designed arrays of short oligonucleotide probes (13-16 bases) built directly on derivatized silica substrates. DNA target sequence analysis is achieved by hybridizing fluorescently labeled amplification products to these arrays. Fluorescent hybridization signals located within the probe array are translated into target sequence information using the known probe sequence at each array feature. The mutation screening assay for cystic fibrosis includes sets of oligonucleotide probes designed to detect numerous different mutations that have been described in 14 exons and one intron of the CFTR gene. Each mutation site is addressed by amore » sub-array of at least 40 probe sequences, half designed to detect the wild type gene sequence and half designed to detect the reported mutant sequence. Hybridization with homozygous mutant, homozygous wild type or heterozygous targets results in distinctive hybridization patterns within a sub-array, permitting specific discrimination of each mutation. The GeneChip probe arrays are very small (approximately 1 cm{sup 2}). There miniature size coupled with their high information content make GeneChip probe arrays a useful and practical means for providing CF mutation analysis in a clinical setting.« less

Sequence analysis of 497 mouse brain ESTs expressed in the substantia nigra

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stewart, G.J.; Savioz, A.; Davies, R.W.

1997-01-15

The use of subtracted, region-specific cDNA libraries combined with single-pass cDNA sequencing allows the discovery of novel genes and facilitates molecular description of the tissue or region involved. We report the sequence of 497 mouse expressed sequence tags (ESTs) from two subtracted libraries enriched for cDNAs expressed in the substantia nigra, a brain region with important roles in movement control and Parkinson disease. Of these, 238 ESTs give no database matches and therefore derive from novel genes. A further 115 ESTs show sequence similarity to ESTs from other organisms, which themselves do not yield any significant database matches to genesmore » of known function. Fifty-six ESTs show sequence similarity to previously identified genes whose mouse homologues have not been reported. The total number of ESTs reported that are new for the mouse is 407, which, together with the 90 ESTs corresponding to known mouse genes or cDNAs, contributes to the molecular description of the substantia nigra. 21 refs., 4 tabs.« less

Using variable rate models to identify genes under selection in sequence pairs: their validity and limitations for EST sequences.

PubMed

Church, Sheri A; Livingstone, Kevin; Lai, Zhao; Kozik, Alexander; Knapp, Steven J; Michelmore, Richard W; Rieseberg, Loren H

2007-02-01

Using likelihood-based variable selection models, we determined if positive selection was acting on 523 EST sequence pairs from two lineages of sunflower and lettuce. Variable rate models are generally not used for comparisons of sequence pairs due to the limited information and the inaccuracy of estimates of specific substitution rates. However, previous studies have shown that the likelihood ratio test (LRT) is reliable for detecting positive selection, even with low numbers of sequences. These analyses identified 56 genes that show a signature of selection, of which 75% were not identified by simpler models that average selection across codons. Subsequent mapping studies in sunflower show four of five of the positively selected genes identified by these methods mapped to domestication QTLs. We discuss the validity and limitations of using variable rate models for comparisons of sequence pairs, as well as the limitations of using ESTs for identification of positively selected genes.

S locus-linked F-box genes expressed in anthers of Hordeum bulbosum.

PubMed

Kakeda, Katsuyuki

2009-09-01

Diploid Hordeum bulbosum (a wild relative of cultivated barley) exhibits a two-locus self-incompatibility (SI) system gametophytically controlled by the unlinked multiallelic loci S and Z. This unique SI system is observed in the grasses (Poaceae) including the tribe Triticeae. This paper describes the identification and characterization of two F-box genes cosegregating with the S locus in H. bulbosum, named Hordeum S locus-linked F-box 1 (HSLF1) and HSLF2, which were derived from an S (3) haplotype-specific clone (HAS175) obtained by previous AMF (AFLP-based mRNA fingerprinting) analysis. Sequence analysis showed that both genes encode similar F-box proteins with a C-terminal leucine-rich repeat (LRR) domain, which are distinct from S locus (or S haplotype-specific) F-box protein (SLF/SFB), a class of F-box proteins identified as the pollen S determinant in S-RNase-based gametophytic SI systems. A number of homologous F-box genes with an LRR domain were found in the rice genome, although the functions of the gene family are unknown. One allele of the HSLF1 gene (HSLF1-S (3)) was expressed specifically in mature anthers, whereas no expression was detected from the other two alleles examined. Although the degree of sequence polymorphism among the three HSLF1 alleles was low, a frameshift mutation was found in one of the unexpressed alleles. The HSLF2 gene showed a low level of expression with no tissue specificity as well as little sequence polymorphism among the three alleles. The multiplicity of S locus-linked F-box genes is discussed in comparison with those found in the S-RNase-based SI system.

Gene: a gene-centered information resource at NCBI.

PubMed

Brown, Garth R; Hem, Vichet; Katz, Kenneth S; Ovetsky, Michael; Wallin, Craig; Ermolaeva, Olga; Tolstoy, Igor; Tatusova, Tatiana; Pruitt, Kim D; Maglott, Donna R; Murphy, Terence D

2015-01-01

The National Center for Biotechnology Information's (NCBI) Gene database (www.ncbi.nlm.nih.gov/gene) integrates gene-specific information from multiple data sources. NCBI Reference Sequence (RefSeq) genomes for viruses, prokaryotes and eukaryotes are the primary foundation for Gene records in that they form the critical association between sequence and a tracked gene upon which additional functional and descriptive content is anchored. Additional content is integrated based on the genomic location and RefSeq transcript and protein sequence data. The content of a Gene record represents the integration of curation and automated processing from RefSeq, collaborating model organism databases, consortia such as Gene Ontology, and other databases within NCBI. Records in Gene are assigned unique, tracked integers as identifiers. The content (citations, nomenclature, genomic location, gene products and their attributes, phenotypes, sequences, interactions, variation details, maps, expression, homologs, protein domains and external databases) is available via interactive browsing through NCBI's Entrez system, via NCBI's Entrez programming utilities (E-Utilities and Entrez Direct) and for bulk transfer by FTP. Published by Oxford University Press on behalf of Nucleic Acids Research 2014. This work is written by (a) US Government employee(s) and is in the public domain in the US.

Regulatory sequence of cupin family gene

DOEpatents

Hood, Elizabeth; Teoh, Thomas

2017-07-25

This invention is in the field of plant biology and agriculture and relates to novel seed specific promoter regions. The present invention further provide methods of producing proteins and other products of interest and methods of controlling expression of nucleic acid sequences of interest using the seed specific promoter regions.

Role of the chromatin landscape and sequence in determining cell type-specific genomic glucocorticoid receptor binding and gene regulation

PubMed Central

Huska, Matthew R.; Jurk, Marcel; Schöpflin, Robert; Starick, Stephan R.; Schwahn, Kevin; Cooper, Samantha B.; Yamamoto, Keith R.; Thomas-Chollier, Morgane; Vingron, Martin

2017-01-01

Abstract The genomic loci bound by the glucocorticoid receptor (GR), a hormone-activated transcription factor, show little overlap between cell types. To study the role of chromatin and sequence in specifying where GR binds, we used Bayesian modeling within the universe of accessible chromatin. Taken together, our results uncovered that although GR preferentially binds accessible chromatin, its binding is biased against accessible chromatin located at promoter regions. This bias can only be explained partially by the presence of fewer GR recognition sequences, arguing for the existence of additional mechanisms that interfere with GR binding at promoters. Therefore, we tested the role of H3K9ac, the chromatin feature with the strongest negative association with GR binding, but found that this correlation does not reflect a causative link. Finally, we find a higher percentage of promoter–proximal GR binding for genes regulated by GR across cell types than for cell type-specific target genes. Given that GR almost exclusively binds accessible chromatin, we propose that cell type-specific regulation by GR preferentially occurs via distal enhancers, whose chromatin accessibility is typically cell type-specific, whereas ubiquitous target gene regulation is more likely to result from binding to promoter regions, which are often accessible regardless of cell type examined. PMID:27903902

Persistence and evolution of allergen-specific IgE repertoires during subcutaneous specific immunotherapy

PubMed Central

Levin, Mattias; King, Jasmine J.; Glanville, Jacob; Jackson, Katherine J. L.; Looney, Timothy J.; Hoh, Ramona A.; Mari, Adriano; Andersson, Morgan; Greiff, Lennart; Fire, Andrew Z.; Boyd, Scott D.; Ohlin, Mats

2016-01-01

Background Specific immunotherapy (SIT) is the only treatment with proven long-term curative potential in allergic disease. Allergen-specific IgE is the causative agent of allergic disease, and antibodies contribute to SIT, but the effects of SIT on aeroallergen-specific B cell repertoires are not well understood. Objective To characterize the IgE sequences expressed by allergen-specific B cells, and track the fate of these B cell clones during SIT. Methods We have used high-throughput antibody gene sequencing and identification of allergen-specific IgE using combinatorial antibody fragment library technology to analyze immunoglobulin repertoires of blood and nasal mucosa of aeroallergen-sensitized individuals before and during the first year of subcutaneous SIT. Results Of 52 distinct allergen-specific IgE heavy chains from eight allergic donors, 37 were also detected by high-throughput antibody gene sequencing of blood, nasal mucosa, or both sample types. The allergen-specific clones had increased persistence, higher likelihood of belonging to clones expressing other switched isotypes, and possibly larger clone size than the rest of the IgE repertoire. Clone members in nasal tissue showed close mutational relationships. Conclusion Combining functional binding studies, deep antibody repertoire sequencing, and information on clinical outcomes in larger studies may in the future aid assessment of SIT mechanisms and efficacy. PMID:26559321

Single-Stranded γPNAs for In Vivo Site-Specific Genome Editing via Watson-Crick Recognition

PubMed Central

Bahal, Raman; Quijano, Elias; McNeer, Nicole Ali; Liu, Yanfeng; Bhunia, Dinesh C.; López-Giráldez, Francesco; Fields, Rachel J.; Saltzman, W. Mark; Ly, Danith H.; Glazer, Peter M.

2014-01-01

Triplex-forming peptide nucleic acids (PNAs) facilitate gene editing by stimulating recombination of donor DNAs within genomic DNA via site-specific formation of altered helical structures that further stimulate DNA repair. However, PNAs designed for triplex formation are sequence restricted to homopurine sites. Herein we describe a novel strategy where next generation single-stranded gamma PNAs (γPNAs) containing miniPEG substitutions at the gamma position can target genomic DNA in mouse bone marrow at mixed-sequence sites to induce targeted gene editing. In addition to enhanced binding, γPNAs confer increased solubility and improved formulation into poly(lactic-co-glycolic acid) (PLGA) nanoparticles for efficient intracellular delivery. Single-stranded γPNAs induce targeted gene editing at frequencies of 0.8% in mouse bone marrow cells treated ex vivo and 0.1% in vivo via IV injection, without detectable toxicity. These results suggest that γPNAs may provide a new tool for induced gene editing based on Watson-Crick recognition without sequence restriction. PMID:25174576

Single-stranded γPNAs for in vivo site-specific genome editing via Watson-Crick recognition.

PubMed

Bahal, Raman; Quijano, Elias; McNeer, Nicole A; Liu, Yanfeng; Bhunia, Dinesh C; Lopez-Giraldez, Francesco; Fields, Rachel J; Saltzman, William M; Ly, Danith H; Glazer, Peter M

2014-01-01

Triplex-forming peptide nucleic acids (PNAs) facilitate gene editing by stimulating recombination of donor DNAs within genomic DNA via site-specific formation of altered helical structures that further stimulate DNA repair. However, PNAs designed for triplex formation are sequence restricted to homopurine sites. Herein we describe a novel strategy where next generation single-stranded gamma PNAs (γPNAs) containing miniPEG substitutions at the gamma position can target genomic DNA in mouse bone marrow at mixed-sequence sites to induce targeted gene editing. In addition to enhanced binding, γPNAs confer increased solubility and improved formulation into poly(lactic-co-glycolic acid) (PLGA) nanoparticles for efficient intracellular delivery. Single-stranded γPNAs induce targeted gene editing at frequencies of 0.8% in mouse bone marrow cells treated ex vivo and 0.1% in vivo via IV injection, without detectable toxicity. These results suggest that γPNAs may provide a new tool for induced gene editing based on Watson-Crick recognition without sequence restriction.

Repressor-mediated tissue-specific gene expression in plants

DOEpatents

Meagher, Richard B [Athens, GA; Balish, Rebecca S [Oxford, OH; Tehryung, Kim [Athens, GA; McKinney, Elizabeth C [Athens, GA

2009-02-17

Plant tissue specific gene expression by way of repressor-operator complexes, has enabled outcomes including, without limitation, male sterility and engineered plants having root-specific gene expression of relevant proteins to clean environmental pollutants from soil and water. A mercury hyperaccumulation strategy requires that mercuric ion reductase coding sequence is strongly expressed. The actin promoter vector, A2pot, engineered to contain bacterial lac operator sequences, directed strong expression in all plant vegetative organs and tissues. In contrast, the expression from the A2pot construct was restricted primarily to root tissues when a modified bacterial repressor (LacIn) was coexpressed from the light-regulated rubisco small subunit promoter in above-ground tissues. Also provided are analogous repressor operator complexes for selective expression in other plant tissues, for example, to produce male sterile plants.

Detection and Tracking of NY-ESO-1-Specific CD8+ T Cells by High-Throughput T Cell Receptor β (TCRB) Gene Rearrangements Sequencing in a Peptide-Vaccinated Patient.

PubMed

Miyai, Manami; Eikawa, Shingo; Hosoi, Akihiro; Iino, Tamaki; Matsushita, Hirokazu; Isobe, Midori; Uenaka, Akiko; Udono, Heiichiro; Nakajima, Jun; Nakayama, Eiichi; Kakimi, Kazuhiro

2015-01-01

Comprehensive immunological evaluation is crucial for monitoring patients undergoing antigen-specific cancer immunotherapy. The identification and quantification of T cell responses is most important for the further development of such therapies. Using well-characterized clinical samples from a high responder patient (TK-f01) in an NY-ESO-1f peptide vaccine study, we performed high-throughput T cell receptor β-chain (TCRB) gene next generation sequencing (NGS) to monitor the frequency of NY-ESO-1-specific CD8+ T cells. We compared these results with those of conventional immunological assays, such as IFN-γ capture, tetramer binding and limiting dilution clonality assays. We sequenced human TCRB complementarity-determining region 3 (CDR3) rearrangements of two NY-ESO-1f-specific CD8+ T cell clones, 6-8L and 2F6, as well as PBMCs over the course of peptide vaccination. Clone 6-8L possessed the TCRB CDR3 gene TCRBV11-03*01 and BJ02-01*01 with amino acid sequence CASSLRGNEQFF, whereas 2F6 possessed TCRBV05-08*01 and BJ02-04*01 (CASSLVGTNIQYF). Using these two sequences as models, we evaluated the frequency of NY-ESO-1-specific CD8+ T cells in PBMCs ex vivo. The 6-8L CDR3 sequence was the second most frequent in PBMC and was present at high frequency (0.7133%) even prior to vaccination, and sustained over the course of vaccination. Despite a marked expansion of NY-ESO-1-specific CD8+ T cells detected from the first through 6th vaccination by tetramer staining and IFN-γ capture assays, as evaluated by CDR3 sequencing the frequency did not increase with increasing rounds of peptide vaccination. By clonal analysis using 12 day in vitro stimulation, the frequency of B*52:01-restricted NY-ESO-1f peptide-specific CD8+ T cells in PBMCs was estimated as only 0.0023%, far below the 0.7133% by NGS sequencing. Thus, assays requiring in vitro stimulation might be underestimating the frequency of clones with lower proliferation potential. High-throughput TCRB sequencing using NGS can potentially better estimate the actual frequency of antigen-specific T cells and thus provide more accurate patient monitoring.

Detection and Tracking of NY-ESO-1-Specific CD8+ T Cells by High-Throughput T Cell Receptor β (TCRB) Gene Rearrangements Sequencing in a Peptide-Vaccinated Patient

PubMed Central

Miyai, Manami; Eikawa, Shingo; Hosoi, Akihiro; Iino, Tamaki; Matsushita, Hirokazu; Isobe, Midori; Uenaka, Akiko; Udono, Heiichiro; Nakajima, Jun; Nakayama, Eiichi; Kakimi, Kazuhiro

2015-01-01

Comprehensive immunological evaluation is crucial for monitoring patients undergoing antigen-specific cancer immunotherapy. The identification and quantification of T cell responses is most important for the further development of such therapies. Using well-characterized clinical samples from a high responder patient (TK-f01) in an NY-ESO-1f peptide vaccine study, we performed high-throughput T cell receptor β-chain (TCRB) gene next generation sequencing (NGS) to monitor the frequency of NY-ESO-1-specific CD8+ T cells. We compared these results with those of conventional immunological assays, such as IFN-γ capture, tetramer binding and limiting dilution clonality assays. We sequenced human TCRB complementarity-determining region 3 (CDR3) rearrangements of two NY-ESO-1f-specific CD8+ T cell clones, 6-8L and 2F6, as well as PBMCs over the course of peptide vaccination. Clone 6-8L possessed the TCRB CDR3 gene TCRBV11-03*01 and BJ02-01*01 with amino acid sequence CASSLRGNEQFF, whereas 2F6 possessed TCRBV05-08*01 and BJ02-04*01 (CASSLVGTNIQYF). Using these two sequences as models, we evaluated the frequency of NY-ESO-1-specific CD8+ T cells in PBMCs ex vivo. The 6-8L CDR3 sequence was the second most frequent in PBMC and was present at high frequency (0.7133%) even prior to vaccination, and sustained over the course of vaccination. Despite a marked expansion of NY-ESO-1-specific CD8+ T cells detected from the first through 6th vaccination by tetramer staining and IFN-γ capture assays, as evaluated by CDR3 sequencing the frequency did not increase with increasing rounds of peptide vaccination. By clonal analysis using 12 day in vitro stimulation, the frequency of B*52:01-restricted NY-ESO-1f peptide-specific CD8+ T cells in PBMCs was estimated as only 0.0023%, far below the 0.7133% by NGS sequencing. Thus, assays requiring in vitro stimulation might be underestimating the frequency of clones with lower proliferation potential. High-throughput TCRB sequencing using NGS can potentially better estimate the actual frequency of antigen-specific T cells and thus provide more accurate patient monitoring. PMID:26291626

PMS2 gene mutational analysis: direct cDNA sequencing to circumvent pseudogene interference.

PubMed

Wimmer, Katharina; Wernstedt, Annekatrin

2014-01-01

The presence of highly homologous pseudocopies can compromise the mutation analysis of a gene of interest. In particular, when using PCR-based strategies, pseudogene co-amplification has to be effectively prevented. This is often achieved by using primers designed to be parental gene specific according to the reference sequence and by applying stringent PCR conditions. However, there are cases in which this approach is of limited utility. For example, it has been shown that the PMS2 gene exchanges sequences with one of its pseudogenes, named PMS2CL. This results in functional PMS2 alleles containing pseudogene-derived sequences at their 3'-end and in nonfunctional PMS2CL pseudogene alleles that contain gene-derived sequences. Hence, the paralogues cannot be distinguished according to the reference sequence. This shortcoming can be effectively circumvented by using direct cDNA sequencing. This approach is based on the selective amplification of PMS2 transcripts in two overlapping 1.6-kb RT-PCR products. In addition to avoiding pseudogene co-amplification and allele dropout, this method has also the advantage that it allows to effectively identify deletions, splice mutations, and de novo retrotransposon insertions that escape the detection of most DNA-based mutation analysis protocols.

Epitopes of human testis-specific lactate dehydrogenase deduced from a cDNA sequence

DOE Office of Scientific and Technical Information (OSTI.GOV)

Millan, J.L.; Driscoll, C.E.; LeVan, K.M.

The sequence and structure of human testis-specific L-lactate dehydrogenase (LDHC/sub 4/, LDHX; (L)-lactate:NAD/sup +/ oxidoreductase, EC 1.1.1.27) has been derived from analysis of a complementary DNA (cDNA) clone comprising the complete protein coding region of the enzyme. From the deduced amino acid sequence, human LDHC/sub 4/ is as different from rodent LDHC/sub 4/ (73% homology) as it is from human LDHA/sub 4/ (76% homology) and porcine LDHB/sub 4/ (68% homology). Subunit homologies are consistent with the conclusion that the LDHC gene arose by at least two independent duplication events. Furthermore, the lower degree of homology between mouse and human LDHC/submore » 4/ and the appearance of this isozyme late in evolution suggests a higher rate of mutation in the mammalian LDHC genes than in the LDHA and -B genes. Comparison of exposed amino acid residues of discrete anti-genic determinants of mouse and human LDHC/sub 4/ reveals significant differences. Knowledge of the human LDHC/sub 4/ sequence will help design human-specific peptides useful in the development of a contraceptive vaccine.« less

Position-specific binding of FUS to nascent RNA regulates mRNA length

PubMed Central

Masuda, Akio; Takeda, Jun-ichi; Okuno, Tatsuya; Okamoto, Takaaki; Ohkawara, Bisei; Ito, Mikako; Ishigaki, Shinsuke; Sobue, Gen

2015-01-01

More than half of all human genes produce prematurely terminated polyadenylated short mRNAs. However, the underlying mechanisms remain largely elusive. CLIP-seq (cross-linking immunoprecipitation [CLIP] combined with deep sequencing) of FUS (fused in sarcoma) in neuronal cells showed that FUS is frequently clustered around an alternative polyadenylation (APA) site of nascent RNA. ChIP-seq (chromatin immunoprecipitation [ChIP] combined with deep sequencing) of RNA polymerase II (RNAP II) demonstrated that FUS stalls RNAP II and prematurely terminates transcription. When an APA site is located upstream of an FUS cluster, FUS enhances polyadenylation by recruiting CPSF160 and up-regulates the alternative short transcript. In contrast, when an APA site is located downstream from an FUS cluster, polyadenylation is not activated, and the RNAP II-suppressing effect of FUS leads to down-regulation of the alternative short transcript. CAGE-seq (cap analysis of gene expression [CAGE] combined with deep sequencing) and PolyA-seq (a strand-specific and quantitative method for high-throughput sequencing of 3' ends of polyadenylated transcripts) revealed that position-specific regulation of mRNA lengths by FUS is operational in two-thirds of transcripts in neuronal cells, with enrichment in genes involved in synaptic activities. PMID:25995189

Clustering, haplotype diversity and locations of MIC-3: a unique root-specific defense-related gene family in upland cotton (Gossypium hirsutum L.)

USDA-ARS?s Scientific Manuscript database

MIC-3-related genes of cotton (Gossypium spp.) were identified and shown to have root-specific expression, associated with pathogen defense-related function and specifically increased expression in root-knot nematode (RKN) resistant plants after nematode infection. Here we cloned and sequenced MIC-...

Genetic and Molecular Characterization of the Caenorhabditis Elegans Spermatogenesis-Defective Gene Spe-17

PubMed Central

L'Hernault, S. W.; Benian, G. M.; Emmons, R. B.

1993-01-01

Two self-sterile mutations that define the spermatogenesis-defective gene spe-17 have been analyzed. These mutations affect unc-22 and fail to complement each other for both Unc-22 and spermatogenesis defects. Both of these mutations are deficiencies (hcDf1 and hDf13) that affect more than one transcription unit. Genomic DNA adjacent to and including the region deleted by the smaller deficiency (hcDf1) has been sequenced and four mRNAs (including unc-22) have been localized to this sequenced region. The three non unc-22 mRNAs are shown to be sex-specific: a 1.2-kb mRNA that can be detected in sperm-free hermaphrodites and 1.2- and 0.56-kb mRNAs found in males. hDf13 deletes at least 55 kb of chromosome IV, including all of unc-22, both male-specific mRNAs and at least part of the female-specific mRNA. hcDf1, which is approximately 15.6 kb, deletes only the 5' end of unc-22 and the gene that encodes the 0.56-kb male-specific mRNA. The common defect that apparently accounts for the defective sperm in hcDf1 and hDf13 homozygotes is deletion of the spe-17 gene, which encodes the 0.56-kb mRNA. Strains carrying two copies of either deletion are self-fertile when they are transgenic for any of four extrachromosomal array that include spe-17. We have sequenced two spe-17 cDNAs, and the deduced 142 amino acid protein sequence is highly charged and rich in serine and threonine, but shows no significant homology to any previously determined protein sequence. PMID:8349108

Identification of Bacillus Probiotics Isolated from Soil Rhizosphere Using 16S rRNA, recA, rpoB Gene Sequencing and RAPD-PCR.

PubMed

Mohkam, Milad; Nezafat, Navid; Berenjian, Aydin; Mobasher, Mohammad Ali; Ghasemi, Younes

2016-03-01

Some Bacillus species, especially Bacillus subtilis and Bacillus pumilus groups, have highly similar 16S rRNA gene sequences, which are hard to identify based on 16S rDNA sequence analysis. To conquer this drawback, rpoB, recA sequence analysis along with randomly amplified polymorphic (RAPD) fingerprinting was examined as an alternative method for differentiating Bacillus species. The 16S rRNA, rpoB and recA genes were amplified via a polymerase chain reaction using their specific primers. The resulted PCR amplicons were sequenced, and phylogenetic analysis was employed by MEGA 6 software. Identification based on 16S rRNA gene sequencing was underpinned by rpoB and recA gene sequencing as well as RAPD-PCR technique. Subsequently, concatenation and phylogenetic analysis showed that extent of diversity and similarity were better obtained by rpoB and recA primers, which are also reinforced by RAPD-PCR methods. However, in one case, these approaches failed to identify one isolate, which in combination with the phenotypical method offsets this issue. Overall, RAPD fingerprinting, rpoB and recA along with concatenated genes sequence analysis discriminated closely related Bacillus species, which highlights the significance of the multigenic method in more precisely distinguishing Bacillus strains. This research emphasizes the benefit of RAPD fingerprinting, rpoB and recA sequence analysis superior to 16S rRNA gene sequence analysis for suitable and effective identification of Bacillus species as recommended for probiotic products.

Deciphering the Resistome of the Widespread Pseudomonas aeruginosa Sequence Type 175 International High-Risk Clone through Whole-Genome Sequencing

PubMed Central

López-Causapé, Carla; Ocampo-Sosa, Alain A.; Sommer, Lea M.; Domínguez, María Ángeles; Zamorano, Laura; Juan, Carlos; Tubau, Fe; Rodríguez, Cristina; Moyà, Bartolomé; Martínez-Martínez, Luis; Plesiat, Patrick

2016-01-01

Whole-genome sequencing (WGS) was used for the characterization of the frequently extensively drug resistant (XDR) Pseudomonas aeruginosa sequence type 175 (ST175) high-risk clone. A total of 18 ST175 isolates recovered from 8 different Spanish hospitals were analyzed; 4 isolates from 4 different French hospitals were included for comparison. The typical resistance profile of ST175 included penicillins, cephalosporins, monobactams, carbapenems, aminoglycosides, and fluoroquinolones. In the phylogenetic analysis, the four French isolates clustered together with two isolates from one of the Spanish regions. Sequence variation was analyzed for 146 chromosomal genes related to antimicrobial resistance, and horizontally acquired genes were explored using online databases. The resistome of ST175 was determined mainly by mutational events; resistance traits common to all or nearly all of the strains included specific ampR mutations leading to ampC overexpression, specific mutations in oprD conferring carbapenem resistance, or a mexZ mutation leading to MexXY overexpression. All isolates additionally harbored an aadB gene conferring gentamicin and tobramycin resistance. Several other resistance traits were specific to certain geographic areas, such as a streptomycin resistance gene, aadA13, detected in all four isolates from France and in the two isolates from the Cantabria region and a glpT mutation conferring fosfomycin resistance, detected in all but these six isolates. Finally, several unique resistance mutations were detected in single isolates; particularly interesting were those in genes encoding penicillin-binding proteins (PBP1A, PBP3, and PBP4). Thus, these results provide information valuable for understanding the genetic basis of resistance and the dynamics of the dissemination and evolution of high-risk clones. PMID:27736752

Deciphering the Resistome of the Widespread Pseudomonas aeruginosa Sequence Type 175 International High-Risk Clone through Whole-Genome Sequencing.

PubMed

Cabot, Gabriel; López-Causapé, Carla; Ocampo-Sosa, Alain A; Sommer, Lea M; Domínguez, María Ángeles; Zamorano, Laura; Juan, Carlos; Tubau, Fe; Rodríguez, Cristina; Moyà, Bartolomé; Peña, Carmen; Martínez-Martínez, Luis; Plesiat, Patrick; Oliver, Antonio

2016-12-01

Whole-genome sequencing (WGS) was used for the characterization of the frequently extensively drug resistant (XDR) Pseudomonas aeruginosa sequence type 175 (ST175) high-risk clone. A total of 18 ST175 isolates recovered from 8 different Spanish hospitals were analyzed; 4 isolates from 4 different French hospitals were included for comparison. The typical resistance profile of ST175 included penicillins, cephalosporins, monobactams, carbapenems, aminoglycosides, and fluoroquinolones. In the phylogenetic analysis, the four French isolates clustered together with two isolates from one of the Spanish regions. Sequence variation was analyzed for 146 chromosomal genes related to antimicrobial resistance, and horizontally acquired genes were explored using online databases. The resistome of ST175 was determined mainly by mutational events; resistance traits common to all or nearly all of the strains included specific ampR mutations leading to ampC overexpression, specific mutations in oprD conferring carbapenem resistance, or a mexZ mutation leading to MexXY overexpression. All isolates additionally harbored an aadB gene conferring gentamicin and tobramycin resistance. Several other resistance traits were specific to certain geographic areas, such as a streptomycin resistance gene, aadA13, detected in all four isolates from France and in the two isolates from the Cantabria region and a glpT mutation conferring fosfomycin resistance, detected in all but these six isolates. Finally, several unique resistance mutations were detected in single isolates; particularly interesting were those in genes encoding penicillin-binding proteins (PBP1A, PBP3, and PBP4). Thus, these results provide information valuable for understanding the genetic basis of resistance and the dynamics of the dissemination and evolution of high-risk clones. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Escherichia coli O-Antigen Gene Clusters of Serogroups O62, O68, O131, O140, O142, and O163: DNA Sequences and Similarity between O62 and O68, and PCR-Based Serogrouping

PubMed Central

Liu, Yanhong; Yan, Xianghe; DebRoy, Chitrita; Fratamico, Pina M.; Needleman, David S.; Li, Robert W.; Wang, Wei; Losada, Liliana; Brinkac, Lauren; Radune, Diana; Toro, Magaly; Hegde, Narasimha; Meng, Jianghong

2015-01-01

The DNA sequence of the O-antigen gene clusters of Escherichia coli serogroups O62, O68, O131, O140, O142, and O163 was determined, and primers based on the wzx (O-antigen flippase) and/or wzy (O-antigen polymerase) genes within the O-antigen gene clusters were designed and used in PCR assays to identify each serogroup. Specificity was tested with E. coli reference strains, field isolates belonging to the target serogroups, and non-E. coli bacteria. The PCR assays were highly specific for the respective serogroups; however, the PCR assay targeting the O62 wzx gene reacted positively with strains belonging to E. coli O68, which was determined by serotyping. Analysis of the O-antigen gene cluster sequences of serogroups O62 and O68 reference strains showed that they were 94% identical at the nucleotide level, although O62 contained an insertion sequence (IS) element located between the rmlA and rmlC genes within the O-antigen gene cluster. A PCR assay targeting the rmlA and rmlC genes flanking the IS element was used to differentiate O62 and O68 serogroups. The PCR assays developed in this study can be used for the detection and identification of E. coli O62/O68, O131, O140, O142, and O163 strains isolated from different sources. PMID:25664526

Sequences 5' to translation start regulate expression of petunia rbcS genes.

PubMed Central

Dean, C; Favreau, M; Bedbrook, J; Dunsmuir, P

1989-01-01

The promoter sequences that contribute to quantitative differences in expression of the petunia genes (rbcS) encoding the small subunit of ribulose bisphosphate carboxylase have been characterized. The promoter regions of the two most abundantly expressed petunia rbcS genes, SSU301 and SSU611, show sequence similarity not present in other rbcS genes. We investigated the significance of these and other sequences by adding specific regions from the SSU301 promoter (the most strongly expressed gene) to equivalent regions in the SSU911 promoter (the least strongly expressed gene) and assaying the expression of the fusions in transgenic tobacco plants. In this way, we characterized an SSU301 promoter region (either from -285 to -178 or -291 to -204) which, when added to SSU911, in either orientation, increased SSU911 expression 25-fold. This increase was equivalent to that caused by addition of the entire SSU301 5'-flanking region. Replacement of SSU911 promoter sequences between -198 and the start codon with sequences from the equivalent region of SSU301 did not increase SSU911 expression significantly. The -291 to -204 SSU301 promoter fragment contributes significantly to quantitative differences in expression between the petunia rbcS genes. PMID:2535543

Generation of TALE-Based Designer Epigenome Modifiers.

PubMed

Nitsch, Sandra; Mussolino, Claudio

2018-01-01

Manipulation of gene expression can be facilitated by editing the genome or the epigenome. Precise genome editing is traditionally achieved by using designer nucleases which are generally exploited to eliminate a specific gene product. Upon the introduction of a site-specific DNA double-strand break (DSB) by the nuclease, endogenous DSB repair mechanisms are in turn harnessed to induce DNA sequence changes that can result in target gene inactivation. Minimal off-target effects can be obtained by endowing designer nucleases with the highly specific DNA-binding domain (DBD) derived from transcription activator-like effectors (TALEs). In contrast, epigenome editing allows gene expression control without inducing changes in the DNA sequence by specifically altering epigenetic marks, as histone tails modifications or DNA methylation patterns within promoter or enhancer regions. Importantly, this approach allows both up- and downregulation of the target gene expression, and the effect is generally reversible. TALE-based designer epigenome modifiers combine the high specificity of TALE-derived DBDs with the power of epigenetic modifier domains to induce fast and long-lasting changes in the epigenetic landscape of a target gene and control its expression. Here we provide a detailed description for the generation of TALE-based designer epigenome modifiers and of a suitable reporter cell line to easily monitor their activity.

Comparison of immunohistochemistry, DNA sequencing and allele-specific PCR for the detection of IDH1 mutations in gliomas.

PubMed

Loussouarn, Delphine; Le Loupp, Anne-Gaëlle; Frenel, Jean-Sébastien; Leclair, François; Von Deimling, Andreas; Aumont, Maud; Martin, Stéphane; Campone, Mario; Denis, Marc G

2012-06-01

Previous studies have identified mutations of the isocitrate dehydrogenase 1 (IDH1) gene in more than 70% of World Health Organization (WHO) grade II and III gliomas. The most frequent mutation leads to a specific amino acid change from arginine to histidine at codon 132 (c.395G>A, p.R132H). IDH1 mutated tumors have a better prognosis than IDH1 non-mutated tumors. The aim of our study was to evaluate and compare the methods of mIDH1 R132H immunohistochemistry, allele-specific PCR and DNA sequencing for determination of IDH1 status. We performed a retrospective study of 91 patients with WHO grade II (n=43) and III (n=48) oligodendrogliomas. A fragment of exon 4 spanning the sequence encoding the catalytic domain of IDH1, including codon 132, was amplified and sequenced using standard conditions. Allele-specific amplification was performed using two forward primers with variations in their 3' nucleotides such that each was specific for the wild-type or the mutated variant, and one reverse primer. Immunohistochemistry was performed with mouse monoclonal mIDH1 R132H. DNA was extracted from FFPE sections following macrodissection. IDH1 mutations were found in 55/90 patients (61.1%) by direct sequencing. R132H mutations were found in 47/55 patients (85.4%). The results of the allele-specific PCR positively correlated with those from DNA sequencing. Other mutations (p.R132C, p.R132S and pR132G) were found by DNA sequencing in 3, 3 and 2 tumors, respectively (8/55 patients, 14.6%). mIDH1 R132H immunostaining was found in the 47 patients presenting the R132H mutation (sensitivity 47/47, 100% for this mutation). None of the tumors presenting a wild-type IDH1 gene were stained (specificity 35/35, 100%). Our results demonstrate that immunohistochemistry using the mIDH1 R132H antibody and allele-specific amplification are highly sensitive techniques to detect the most frequent mutation of the IDH1 gene.

Histidine-rich stabilized polyplexes for cMet-directed tumor-targeted gene transfer

NASA Astrophysics Data System (ADS)

Kos, Petra; Lächelt, Ulrich; Herrmann, Annika; Mickler, Frauke Martina; Döblinger, Markus; He, Dongsheng; Krhač Levačić, Ana; Morys, Stephan; Bräuchle, Christoph; Wagner, Ernst

2015-03-01

Overexpression of the hepatocyte growth factor receptor/c-Met proto oncogene on the surface of a variety of tumor cells gives an opportunity to specifically target cancerous tissues. Herein, we report the first use of c-Met as receptor for non-viral tumor-targeted gene delivery. Sequence-defined oligomers comprising the c-Met binding peptide ligand cMBP2 for targeting, a monodisperse polyethylene glycol (PEG) for polyplex surface shielding, and various cationic (oligoethanamino) amide cores containing terminal cysteines for redox-sensitive polyplex stabilization, were assembled by solid-phase supported syntheses. The resulting oligomers exhibited a greatly enhanced cellular uptake and gene transfer over non-targeted control sequences, confirming the efficacy and target-specificity of the formed polyplexes. Implementation of endosomal escape-promoting histidines in the cationic core was required for gene expression without additional endosomolytic agent. The histidine-enriched polyplexes demonstrated stability in serum as well as receptor-specific gene transfer in vivo upon intratumoral injection. The co-formulation with an analogous PEG-free cationic oligomer led to a further compaction of pDNA polyplexes with an obvious change of shape as demonstrated by transmission electron microscopy. Such compaction was critically required for efficient intravenous gene delivery which resulted in greatly enhanced, cMBP2 ligand-dependent gene expression in the distant tumor.Overexpression of the hepatocyte growth factor receptor/c-Met proto oncogene on the surface of a variety of tumor cells gives an opportunity to specifically target cancerous tissues. Herein, we report the first use of c-Met as receptor for non-viral tumor-targeted gene delivery. Sequence-defined oligomers comprising the c-Met binding peptide ligand cMBP2 for targeting, a monodisperse polyethylene glycol (PEG) for polyplex surface shielding, and various cationic (oligoethanamino) amide cores containing terminal cysteines for redox-sensitive polyplex stabilization, were assembled by solid-phase supported syntheses. The resulting oligomers exhibited a greatly enhanced cellular uptake and gene transfer over non-targeted control sequences, confirming the efficacy and target-specificity of the formed polyplexes. Implementation of endosomal escape-promoting histidines in the cationic core was required for gene expression without additional endosomolytic agent. The histidine-enriched polyplexes demonstrated stability in serum as well as receptor-specific gene transfer in vivo upon intratumoral injection. The co-formulation with an analogous PEG-free cationic oligomer led to a further compaction of pDNA polyplexes with an obvious change of shape as demonstrated by transmission electron microscopy. Such compaction was critically required for efficient intravenous gene delivery which resulted in greatly enhanced, cMBP2 ligand-dependent gene expression in the distant tumor. Electronic supplementary information (ESI) available. See DOI: 10.1039/c4nr06556e

Targeted gene panel sequencing in children with very early onset inflammatory bowel disease--evaluation and prospective analysis.

PubMed

Kammermeier, Jochen; Drury, Suzanne; James, Chela T; Dziubak, Robert; Ocaka, Louise; Elawad, Mamoun; Beales, Philip; Lench, Nicholas; Uhlig, Holm H; Bacchelli, Chiara; Shah, Neil

2014-11-01

Multiple monogenetic conditions with partially overlapping phenotypes can present with inflammatory bowel disease (IBD)-like intestinal inflammation. With novel genotype-specific therapies emerging, establishing a molecular diagnosis is becoming increasingly important. We have introduced targeted next-generation sequencing (NGS) technology as a prospective screening tool in children with very early onset IBD (VEOIBD). We evaluated the coverage of 40 VEOIBD genes in two separate cohorts undergoing targeted gene panel sequencing (TGPS) (n=25) and whole exome sequencing (WES) (n=20). TGPS revealed causative mutations in four genes (IL10RA, EPCAM, TTC37 and SKIV2L) discovered unexpected phenotypes and directly influenced clinical decision making by supporting as well as avoiding haematopoietic stem cell transplantation. TGPS resulted in significantly higher median coverage when compared with WES, fewer coverage deficiencies and improved variant detection across established VEOIBD genes. Excluding or confirming known VEOIBD genotypes should be considered early in the disease course in all cases of therapy-refractory VEOIBD, as it can have a direct impact on patient management. To combine both described NGS technologies would compensate for the limitations of WES for disease-specific application while offering the opportunity for novel gene discovery in the research setting. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

Benchmarking of Methods for Genomic Taxonomy

DOE PAGES

Larsen, Mette V.; Cosentino, Salvatore; Lukjancenko, Oksana; ...

2014-02-26

One of the first issues that emerges when a prokaryotic organism of interest is encountered is the question of what it is—that is, which species it is. The 16S rRNA gene formed the basis of the first method for sequence-based taxonomy and has had a tremendous impact on the field of microbiology. Nevertheless, the method has been found to have a number of shortcomings. In this paper, we trained and benchmarked five methods for whole-genome sequence-based prokaryotic species identification on a common data set of complete genomes: (i) SpeciesFinder, which is based on the complete 16S rRNA gene; (ii) Reads2Typemore » that searches for species-specific 50-mers in either the 16S rRNA gene or the gyrB gene (for the Enterobacteraceae family); (iii) the ribosomal multilocus sequence typing (rMLST) method that samples up to 53 ribosomal genes; (iv) TaxonomyFinder, which is based on species-specific functional protein domain profiles; and finally (v) KmerFinder, which examines the number of cooccurring k-mers (substrings of k nucleotides in DNA sequence data). The performances of the methods were subsequently evaluated on three data sets of short sequence reads or draft genomes from public databases. In total, the evaluation sets constituted sequence data from more than 11,000 isolates covering 159 genera and 243 species. Our results indicate that methods that sample only chromosomal, core genes have difficulties in distinguishing closely related species which only recently diverged. Finally, the KmerFinder method had the overall highest accuracy and correctly identified from 93% to 97% of the isolates in the evaluations sets.« less

Hypoxia-inducible tumour-specific promoters as a dual-targeting transcriptional regulation system for cancer gene therapy

PubMed Central

Javan, Bita; Shahbazi, Majid

2017-01-01

Transcriptional targeting is the best approach for specific gene therapy. Hypoxia is a common feature of the tumour microenvironment. Therefore, targeting gene expression in hypoxic cells by placing transgene under the control of a hypoxia-responsive promoter can be a good strategy for cancer-specific gene therapy. The hypoxia-inducible gene expression system has been investigated more in suicide gene therapy and it can also be of great help in knocking down cancer gene therapy with siRNAs. However, this system needs to be optimised to have maximum efficacy with minimum side effects in normal tissues. The combination of tissue-/tumour-specific promoters with HRE core sequences has been found to enhance the specificity and efficacy of this system. In this review, hypoxia-inducible gene expression system as well as gene therapy strategies targeting tumour hypoxia will be discussed. This review will also focus on hypoxia-inducible tumour-specific promoters as a dual-targeting transcriptional regulation systems developed for cancer-specific gene therapy. PMID:28798809

A flexible and economical barcoding approach for highly multiplexed amplicon sequencing of diverse target genes

PubMed Central

Herbold, Craig W.; Pelikan, Claus; Kuzyk, Orest; Hausmann, Bela; Angel, Roey; Berry, David; Loy, Alexander

2015-01-01

High throughput sequencing of phylogenetic and functional gene amplicons provides tremendous insight into the structure and functional potential of complex microbial communities. Here, we introduce a highly adaptable and economical PCR approach to barcoding and pooling libraries of numerous target genes. In this approach, we replace gene- and sequencing platform-specific fusion primers with general, interchangeable barcoding primers, enabling nearly limitless customized barcode-primer combinations. Compared to barcoding with long fusion primers, our multiple-target gene approach is more economical because it overall requires lower number of primers and is based on short primers with generally lower synthesis and purification costs. To highlight our approach, we pooled over 900 different small-subunit rRNA and functional gene amplicon libraries obtained from various environmental or host-associated microbial community samples into a single, paired-end Illumina MiSeq run. Although the amplicon regions ranged in size from approximately 290 to 720 bp, we found no significant systematic sequencing bias related to amplicon length or gene target. Our results indicate that this flexible multiplexing approach produces large, diverse, and high quality sets of amplicon sequence data for modern studies in microbial ecology. PMID:26236305

Linking maternal and somatic 5S rRNA types with different sequence-specific non-LTR retrotransposons

PubMed Central

Pagano, Johanna F.B.; Ensink, Wim A.; van Olst, Marina; van Leeuwen, Selina; Nehrdich, Ulrike; Zhu, Kongju; Spaink, Herman P.; Girard, Geneviève; Rauwerda, Han; Jonker, Martijs J.; Dekker, Rob J.

2017-01-01

5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo, and adult tissue identified maternal-type 5S rRNA that is exclusively accumulated during oogenesis, replaced throughout the embryogenesis by a somatic-type, and thus virtually absent in adult somatic tissue. The maternal-type 5S rDNA contains several thousands of gene copies on chromosome 4 in tandem repeats with small intergenic regions, whereas the somatic-type is present in only 12 gene copies on chromosome 18 with large intergenic regions. The nine-nucleotide variation between the two 5S rRNA types likely affects TFIII binding and riboprotein L5 binding, probably leading to storage of maternal-type rRNA. Remarkably, these sequence differences are located exactly at the sequence-specific target site for genome integration by the 5S rRNA-specific Mutsu retrotransposon family. Thus, we could define maternal- and somatic-type MutsuDr subfamilies. Furthermore, we identified four additional maternal-type and two new somatic-type MutsuDr subfamilies, each with their own target sequence. This target-site specificity, frequently intact maternal-type retrotransposon elements, plus specific presence of Mutsu retrotransposon RNA and piRNA in egg and adult tissue, suggest an involvement of retrotransposons in achieving the differential copy number of the two types of 5S rDNA loci. PMID:28003516

Nuclease-mediated double-strand break (DSB) enhancement of small fragment homologous recombination (SFHR) gene modification in human-induced pluripotent stem cells (hiPSCs).

PubMed

Sargent, R Geoffrey; Suzuki, Shingo; Gruenert, Dieter C

2014-01-01

Recent developments in methods to specifically modify genomic DNA using sequence-specific endonucleases and donor DNA have opened the door to a new therapeutic paradigm for cell and gene therapy of inherited diseases. Sequence-specific endonucleases, in particular transcription activator-like (TAL) effector nucleases (TALENs), have been coupled with polynucleotide small/short DNA fragments (SDFs) to correct the most common mutation in the cystic fibrosis (CF) transmembrane conductance regulator (CFTR) gene, a 3-base-pair deletion at codon 508 (delF508), in induced pluripotent stem (iPS) cells. The studies presented here describe the generation of candidate TALENs and their co-transfection with wild-type (wt) CFTR-SDFs into CF-iPS cells homozygous for the delF508 mutation. Using an allele-specific PCR (AS-PCR)-based cyclic enrichment protocol, clonal populations of corrected CF-iPS cells were isolated and expanded.

Subtractive cloning of cDNA from Aspergillus oryzae differentially regulated between solid-state culture and liquid (submerged) culture.

PubMed

Akao, Takeshi; Gomi, Katsuya; Goto, Kuniyasu; Okazaki, Naoto; Akita, Osamu

2002-07-01

In solid-state cultures (SC), Aspergillus oryzae shows characteristics such as high-level production and secretion of enzymes and hyphal differentiation with asexual development which are absent in liquid (submerged) culture (LC). It was predicted that many of the genes involved in the characteristics of A. oryzae in SC are differentially expressed between SC and LC. We generated two subtracted cDNA libraries with bi-directional cDNA subtractive hybridizations to isolate and identify such genes. Among them, we identified genes upregulated in or specific to SC, such as the AOS ( A. oryzae SC-specific gene) series, and those downregulated or not expressed in SC, such as the AOL ( A. oryzae LC-specific) series. Sequencing analyses revealed that the AOS series and the AOL series contain genes encoding extra- and intracellular enzymes and transport proteins. However, half were functionally unclassified by nucleotide sequences. Also, by expression profile, the AOS series comprised two groups. These gene products' molecular functions and physiological roles in SC await further investigation.

Development and evaluation of a 28S rRNA gene-based nested PCR assay for P. falciparum and P. vivax

PubMed Central

Pakalapati, Deepak; Garg, Shilpi; Middha, Sheetal; Acharya, Jyoti; Subudhi, Amit K; Boopathi, Arunachalam P; Saxena, Vishal; Kochar, Sanjay K; Kochar, Dhanpat K; Das, Ashis

2013-01-01

The 28S rRNA gene was amplified and sequenced from P. falciparum and P. vivax isolates collected from northwest India. Based upon the sequence diversity of the Plasmodium 28SrRNA gene in comparison with its human counterpart, various nested polymerase chain reaction (PCR) primers were designed from the 3R region of the 28SrRNA gene and evaluated on field isolates. This is the first report demonstrating the utility of this gene for species-specific diagnosis of malaria for these two species, prevalent in India. The initial evaluation on 363 clinical isolates indicated that, in comparison with microscopy, which showed sensitivity and specificity of 85.39% and 100% respectively, the sensitivity and specificity of the nested PCR assay was found to be 99.08% and 100% respectively. This assay was also successful in detecting mixed infections that are undetected by microscopy. Our results demonstrate the utility of the 28S rRNA gene as a diagnostic target for the detection of the major plasmodial species infecting humans. PMID:23816509

Effector profiles distinguish formae speciales of Fusarium oxysporum.

PubMed

van Dam, Peter; Fokkens, Like; Schmidt, Sarah M; Linmans, Jasper H J; Kistler, H Corby; Ma, Li-Jun; Rep, Martijn

2016-11-01

Formae speciales (ff.spp.) of the fungus Fusarium oxysporum are often polyphyletic within the species complex, making it impossible to identify them on the basis of conserved genes. However, sequences that determine host-specific pathogenicity may be expected to be similar between strains within the same forma specialis. Whole genome sequencing was performed on strains from five different ff.spp. (cucumerinum, niveum, melonis, radicis-cucumerinum and lycopersici). In each genome, genes for putative effectors were identified based on small size, secretion signal, and vicinity to a "miniature impala" transposable element. The candidate effector genes of all genomes were collected and the presence/absence patterns in each individual genome were clustered. Members of the same forma specialis turned out to group together, with cucurbit-infecting strains forming a supercluster separate from other ff.spp. Moreover, strains from different clonal lineages within the same forma specialis harbour identical effector gene sequences, supporting horizontal transfer of genetic material. These data offer new insight into the genetic basis of host specificity in the F. oxysporum species complex and show that (putative) effectors can be used to predict host specificity in F. oxysporum. © 2016 Society for Applied Microbiology and John Wiley & Sons Ltd.

Conserved noncoding sequences (CNSs) in higher plants.

PubMed

Freeling, Michael; Subramaniam, Shabarinath

2009-04-01

Plant conserved noncoding sequences (CNSs)--a specific category of phylogenetic footprint--have been shown experimentally to function. No plant CNS is conserved to the extent that ultraconserved noncoding sequences are conserved in vertebrates. Plant CNSs are enriched in known transcription factor or other cis-acting binding sites, and are usually clustered around genes. Genes that encode transcription factors and/or those that respond to stimuli are particularly CNS-rich. Only rarely could this function involve small RNA binding. Some transcribed CNSs encode short translation products as a form of negative control. Approximately 4% of Arabidopsis gene content is estimated to be both CNS-rich and occupies a relatively long stretch of chromosome: Bigfoot genes (long phylogenetic footprints). We discuss a 'DNA-templated protein assembly' idea that might help explain Bigfoot gene CNSs.

Metatranscriptomics of Soil Eukaryotic Communities.

PubMed

Yadav, Rajiv K; Bragalini, Claudia; Fraissinet-Tachet, Laurence; Marmeisse, Roland; Luis, Patricia

2016-01-01

Functions expressed by eukaryotic organisms in soil can be specifically studied by analyzing the pool of eukaryotic-specific polyadenylated mRNA directly extracted from environmental samples. In this chapter, we describe two alternative protocols for the extraction of high-quality RNA from soil samples. Total soil RNA or mRNA can be converted to cDNA for direct high-throughput sequencing. Polyadenylated mRNA-derived full-length cDNAs can also be cloned in expression plasmid vectors to constitute soil cDNA libraries, which can be subsequently screened for functional gene categories. Alternatively, the diversity of specific gene families can also be explored following cDNA sequence capture using exploratory oligonucleotide probes.

Origin-of-transfer sequences facilitate mobilisation of non-conjugative antimicrobial-resistance plasmids in Staphylococcus aureus

PubMed Central

O'Brien, Frances G.; Yui Eto, Karina; Murphy, Riley J. T.; Fairhurst, Heather M.; Coombs, Geoffrey W.; Grubb, Warren B.; Ramsay, Joshua P.

2015-01-01

Staphylococcus aureus is a common cause of hospital, community and livestock-associated infections and is increasingly resistant to multiple antimicrobials. A significant proportion of antimicrobial-resistance genes are plasmid-borne, but only a minority of S. aureus plasmids encode proteins required for conjugative transfer or Mob relaxase proteins required for mobilisation. The pWBG749 family of S. aureus conjugative plasmids can facilitate the horizontal transfer of diverse antimicrobial-resistance plasmids that lack Mob genes. Here we reveal that these mobilisable plasmids carry copies of the pWBG749 origin-of-transfer (oriT) sequence and that these oriT sequences facilitate mobilisation by pWBG749. Sequences resembling the pWBG749 oriT were identified on half of all sequenced S. aureus plasmids, including the most prevalent large antimicrobial-resistance/virulence-gene plasmids, pIB485, pMW2 and pUSA300HOUMR. oriT sequences formed five subfamilies with distinct inverted-repeat-2 (IR2) sequences. pWBG749-family plasmids encoding each IR2 were identified and pWBG749 mobilisation was found to be specific for plasmids carrying matching IR2 sequences. Specificity of mobilisation was conferred by a putative ribbon-helix-helix-protein gene smpO. Several plasmids carried 2–3 oriT variants and pWBG749-mediated recombination occurred between distinct oriT sites during mobilisation. These observations suggest this relaxase-in trans mechanism of mobilisation by pWBG749-family plasmids is a common mechanism of plasmid dissemination in S. aureus. PMID:26243776

Gene conversion as a secondary mechanism of short interspersed element (SINE) evolution

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kass, D.H.; Batzer, M.A.; Deininger, P.L.

The Alu repetitive family of short interspersed elements (SINEs) in primates can be subdivided into distinct subfamilies by specific diagnostic nucleotide changes. The older subfamilies are generally very abundant, while the younger subfamilies have fewer copies. Some of the youngest Alu elements are absent in the orthologous loci of nonhuman primates, indicative of recent retroposition events, the primary mode of SINE evolutions. PCR analysis of one young Alu subfamily (Sb2) member found in the low-density lipoprotein receptor gene apparently revealed the presence of this element in the green monkey, orangutan, gorilla, and chimpanzee genomes, as well as the human genome.more » However, sequence analysis of these genomes revealed a highly mutated, older, primate-specific Alu element was present at this position in the nonhuman primates. Comparison of the flanking DNA sequences upstream of this Alu insertion corresponded to evolution expected for standard primate phylogeny, but comparison of the Alu repeat sequences revealed that the human element departed from this phylogeny. The change in the human sequence apparently occurred by a gene conversion event only within the Alu element itself, converting it from one of the oldest to one of the youngest Alu subfamilies. Although gene conversions of Alu elements are clearly very rare, this finding shows that such events can occur and contribute to specific cases of SINE subfamily evolution.« less

Characterizing partial AZFc deletions of the Y chromosome with amplicon-specific sequence markers

PubMed Central

Navarro-Costa, Paulo; Pereira, Luísa; Alves, Cíntia; Gusmão, Leonor; Proença, Carmen; Marques-Vidal, Pedro; Rocha, Tiago; Correia, Sónia C; Jorge, Sónia; Neves, António; Soares, Ana P; Nunes, Joaquim; Calhaz-Jorge, Carlos; Amorim, António; Plancha, Carlos E; Gonçalves, João

2007-01-01

Background The AZFc region of the human Y chromosome is a highly recombinogenic locus containing multi-copy male fertility genes located in repeated DNA blocks (amplicons). These AZFc gene families exhibit slight sequence variations between copies which are considered to have functional relevance. Yet, partial AZFc deletions yield phenotypes ranging from normospermia to azoospermia, thwarting definite conclusions on their real impact on fertility. Results The amplicon content of partial AZFc deletion products was characterized with novel amplicon-specific sequence markers. Data indicate that partial AZFc deletions are a male infertility risk [odds ratio: 5.6 (95% CI: 1.6–30.1)] and although high diversity of partial deletion products and sequence conversion profiles were recorded, the AZFc marker profiles detected in fertile men were also observed in infertile men. Additionally, the assessment of rearrangement recurrence by Y-lineage analysis indicated that while partial AZFc deletions occurred in highly diverse samples, haplotype diversity was minimal in fertile men sharing identical marker profiles. Conclusion Although partial AZFc deletion products are highly heterogeneous in terms of amplicon content, this plasticity is not sufficient to account for the observed phenotypical variance. The lack of causative association between the deletion of specific gene copies and infertility suggests that AZFc gene content might be part of a multifactorial network, with Y-lineage evolution emerging as a possible phenotype modulator. PMID:17903263

Comparison of the complete genome sequences of four γ-hexachlorocyclohexane-degrading bacterial strains: insights into the evolution of bacteria able to degrade a recalcitrant man-made pesticide.

PubMed

Tabata, Michiro; Ohhata, Satoshi; Nikawadori, Yuki; Kishida, Kouhei; Sato, Takuya; Kawasumi, Toru; Kato, Hiromi; Ohtsubo, Yoshiyuki; Tsuda, Masataka; Nagata, Yuji

2016-12-01

γ-Hexachlorocyclohexane (γ-HCH) is a recalcitrant man-made chlorinated pesticide. Here, the complete genome sequences of four γ-HCH-degrading sphingomonad strains, which are most unlikely to have been derived from one ancestral γ-HCH degrader, were compared. Together with several experimental data, we showed that (i) all the four strains carry almost identical linA to linE genes for the conversion of γ-HCH to maleylacetate (designated "specific" lin genes), (ii) considerably different genes are used for the metabolism of maleylacetate in one of the four strains, and (iii) the linKLMN genes for the putative ABC transporter necessary for γ-HCH utilization exhibit structural divergence, which reflects the phylogenetic relationship of their hosts. Replicon organization and location of the lin genes in the four genomes are significantly different with one another, and that most of the specific lin genes are located on multiple sphingomonad-unique plasmids. Copies of IS6100, the most abundant insertion sequence in the four strains, are often located in close proximity to the specific lin genes. Analysis of the footprints of target duplication upon IS6100 transposition and the experimental detection of IS6100 transposition strongly suggested that the IS6100 transposition has caused dynamic genome rearrangements and the diversification of lin-flanking regions in the four strains. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

Localization of migraine susceptibility genes in human brain by single-cell RNA sequencing.

PubMed

Renthal, William

2018-01-01

Background Migraine is a debilitating disorder characterized by severe headaches and associated neurological symptoms. A key challenge to understanding migraine has been the cellular complexity of the human brain and the multiple cell types implicated in its pathophysiology. The present study leverages recent advances in single-cell transcriptomics to localize the specific human brain cell types in which putative migraine susceptibility genes are expressed. Methods The cell-type specific expression of both familial and common migraine-associated genes was determined bioinformatically using data from 2,039 individual human brain cells across two published single-cell RNA sequencing datasets. Enrichment of migraine-associated genes was determined for each brain cell type. Results Analysis of single-brain cell RNA sequencing data from five major subtypes of cells in the human cortex (neurons, oligodendrocytes, astrocytes, microglia, and endothelial cells) indicates that over 40% of known migraine-associated genes are enriched in the expression profiles of a specific brain cell type. Further analysis of neuronal migraine-associated genes demonstrated that approximately 70% were significantly enriched in inhibitory neurons and 30% in excitatory neurons. Conclusions This study takes the next step in understanding the human brain cell types in which putative migraine susceptibility genes are expressed. Both familial and common migraine may arise from dysfunction of discrete cell types within the neurovascular unit, and localization of the affected cell type(s) in an individual patient may provide insight into to their susceptibility to migraine.

Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites.

PubMed

Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying

2012-10-01

To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi'an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was successful only in three D. canis isolates and one D. brevis isolate out of the nine Demodex isolates. The obtained fragments were sequenced to be 339 bp for D. canis and 338 bp for D. brevis. The CHS gene sequence similarities between the three Xi'an D. canis isolates and one Japanese D. canis isolate ranged from 99.7% to 100.0%, and those between four D. canis isolates and one D. brevis isolate were 99.1%-99.4%. Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters, according with the traditional classification. Two open reading frames (ORFs) were identified in each CHS gene sequenced, and their corresponding amino acid sequences were located at the catalytic domain. The relatively conserved sequences could be deduced to be a CHS class A gene, which is associated with chitin synthesis in the integument of Demodex mites.

Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites*

PubMed Central

Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying

2012-01-01

To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi’an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was successful only in three D. canis isolates and one D. brevis isolate out of the nine Demodex isolates. The obtained fragments were sequenced to be 339 bp for D. canis and 338 bp for D. brevis. The CHS gene sequence similarities between the three Xi’an D. canis isolates and one Japanese D. canis isolate ranged from 99.7% to 100.0%, and those between four D. canis isolates and one D. brevis isolate were 99.1%–99.4%. Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters, according with the traditional classification. Two open reading frames (ORFs) were identified in each CHS gene sequenced, and their corresponding amino acid sequences were located at the catalytic domain. The relatively conserved sequences could be deduced to be a CHS class A gene, which is associated with chitin synthesis in the integument of Demodex mites. PMID:23024043

Canine olfactory receptor gene polymorphism and its relation to odor detection performance by sniffer dogs.

PubMed

Lesniak, Anna; Walczak, Marta; Jezierski, Tadeusz; Sacharczuk, Mariusz; Gawkowski, Maciej; Jaszczak, Kazimierz

2008-01-01

The outstanding sensitivity of the canine olfactory system has been acknowledged by using sniffer dogs in military and civilian service for detection of a variety of odors. It is hypothesized that the canine olfactory ability is determined by polymorphisms in olfactory receptor (OR) genes. We investigated 5 OR genes for polymorphic sites which might affect the olfactory ability of service dogs in different fields of specific substance detection. All investigated OR DNA sequences proved to have allelic variants, the majority of which lead to protein sequence alteration. Homozygous individuals at 2 gene loci significantly differed in their detection skills from other genotypes. This suggests a role of specific alleles in odor detection and a linkage between single-nucleotide polymorphism and odor recognition efficiency.

Sequence-specific epigenetic effects of the maternal somatic genome on developmental rearrangements of the zygotic genome in Paramecium primaurelia.

PubMed Central

Meyer, E; Butler, A; Dubrana, K; Duharcourt, S; Caron, F

1997-01-01

In ciliates, the germ line genome is extensively rearranged during the development of the somatic macronucleus from a mitotic product of the zygotic nucleus. Germ line chromosomes are fragmented in specific regions, and a large number of internal sequence elements are eliminated. It was previously shown that transformation of the vegetative macronucleus of Paramecium primaurelia with a plasmid containing a subtelomeric surface antigen gene can affect the processing of the homologous germ line genomic region during development of a new macronucleus in sexual progeny of transformed clones. The gene and telomere-proximal flanking sequences are deleted from the new macronuclear genome, although the germ line genome remains wild type. Here we show that plasmids containing nonoverlapping segments of the same genomic region are able to induce similar terminal deletions; the locations of deletion end points depend on the particular sequence used. Transformation of the maternal macronucleus with a sequence internal to a macronuclear chromosome also causes the occurrence of internal deletions between short direct repeats composed of alternating thymines and adenines. The epigenetic influence of maternal macronuclear sequences on developmental rearrangements of the zygotic genome thus appears to be both sequence specific and general, suggesting that this trans-nucleus effect is mediated by pairing of homologous sequences. PMID:9199294

Applications of CRISPR/Cas9 technology for targeted mutagenesis, gene replacement and stacking of genes in higher plants.

PubMed

Luo, Ming; Gilbert, Brian; Ayliffe, Michael

2016-07-01

Mutagenesis continues to play an essential role for understanding plant gene function and, in some instances, provides an opportunity for plant improvement. The development of gene editing technologies such as TALENs and zinc fingers has revolutionised the targeted mutation specificity that can now be achieved. The CRISPR/Cas9 system is the most recent addition to gene editing technologies and arguably the simplest requiring only two components; a small guide RNA molecule (sgRNA) and Cas9 endonuclease protein which complex to recognise and cleave a specific 20 bp target site present in a genome. Target specificity is determined by complementary base pairing between the sgRNA and target site sequence enabling highly specific, targeted mutation to be readily engineered. Upon target site cleavage, error-prone endogenous repair mechanisms produce small insertion/deletions at the target site usually resulting in loss of gene function. CRISPR/Cas9 gene editing has been rapidly adopted in plants and successfully undertaken in numerous species including major crop species. Its applications are not restricted to mutagenesis and target site cleavage can be exploited to promote sequence insertion or replacement by recombination. The multiple applications of this technology in plants are described.

Mammalian transcriptional hotspots are enriched for tissue specific enhancers near cell type specific highly expressed genes and are predicted to act as transcriptional activator hubs.

PubMed

Joshi, Anagha

2014-12-30

Transcriptional hotspots are defined as genomic regions bound by multiple factors. They have been identified recently as cell type specific enhancers regulating developmentally essential genes in many species such as worm, fly and humans. The in-depth analysis of hotspots across multiple cell types in same species still remains to be explored and can bring new biological insights. We therefore collected 108 transcription-related factor (TF) ChIP sequencing data sets in ten murine cell types and classified the peaks in each cell type in three groups according to binding occupancy as singletons (low-occupancy), combinatorials (mid-occupancy) and hotspots (high-occupancy). The peaks in the three groups clustered largely according to the occupancy, suggesting priming of genomic loci for mid occupancy irrespective of cell type. We then characterized hotspots for diverse structural functional properties. The genes neighbouring hotspots had a small overlap with hotspot genes in other cell types and were highly enriched for cell type specific function. Hotspots were enriched for sequence motifs of key TFs in that cell type and more than 90% of hotspots were occupied by pioneering factors. Though we did not find any sequence signature in the three groups, the H3K4me1 binding profile had bimodal peaks at hotspots, distinguishing hotspots from mono-modal H3K4me1 singletons. In ES cells, differentially expressed genes after perturbation of activators were enriched for hotspot genes suggesting hotspots primarily act as transcriptional activator hubs. Finally, we proposed that ES hotspots might be under control of SetDB1 and not DNMT for silencing. Transcriptional hotspots are enriched for tissue specific enhancers near cell type specific highly expressed genes. In ES cells, they are predicted to act as transcriptional activator hubs and might be under SetDB1 control for silencing.

Microaspiration of esophageal gland cells and cDNA library construction for identifying parasitism genes of plant-parasitic nematodes.

PubMed

Hussey, Richard S; Huang, Guozhong; Allen, Rex

2011-01-01

Identifying parasitism genes encoding proteins secreted from a plant-parasitic nematode's esophageal gland cells and injected through its stylet into plant tissue is the key to understanding the molecular basis of nematode parasitism of plants. Parasitism genes have been cloned by directly microaspirating the cytoplasm from the esophageal gland cells of different parasitic stages of cyst or root-knot nematodes to provide mRNA to create a gland cell-specific cDNA library by long-distance reverse-transcriptase polymerase chain reaction. cDNA clones are sequenced and deduced protein sequences with a signal peptide for secretion are identified for high-throughput in situ hybridization to confirm gland-specific expression.

T box riboswitches in Actinobacteria: Translational regulation via novel tRNA interactions

PubMed Central

Sherwood, Anna V.; Grundy, Frank J.; Henkin, Tina M.

2015-01-01

The T box riboswitch regulates many amino acid-related genes in Gram-positive bacteria. T box riboswitch-mediated gene regulation was shown previously to occur at the level of transcription attenuation via structural rearrangements in the 5′ untranslated (leader) region of the mRNA in response to binding of a specific uncharged tRNA. In this study, a novel group of isoleucyl-tRNA synthetase gene (ileS) T box leader sequences found in organisms of the phylum Actinobacteria was investigated. The Stem I domains of these RNAs lack several highly conserved elements that are essential for interaction with the tRNA ligand in other T box RNAs. Many of these RNAs were predicted to regulate gene expression at the level of translation initiation through tRNA-dependent stabilization of a helix that sequesters a sequence complementary to the Shine–Dalgarno (SD) sequence, thus freeing the SD sequence for ribosome binding and translation initiation. We demonstrated specific binding to the cognate tRNAIle and tRNAIle-dependent structural rearrangements consistent with regulation at the level of translation initiation, providing the first biochemical demonstration, to our knowledge, of translational regulation in a T box riboswitch. PMID:25583497

Transcription Factor Information System (TFIS): A Tool for Detection of Transcription Factor Binding Sites.

PubMed

Narad, Priyanka; Kumar, Abhishek; Chakraborty, Amlan; Patni, Pranav; Sengupta, Abhishek; Wadhwa, Gulshan; Upadhyaya, K C

2017-09-01

Transcription factors are trans-acting proteins that interact with specific nucleotide sequences known as transcription factor binding site (TFBS), and these interactions are implicated in regulation of the gene expression. Regulation of transcriptional activation of a gene often involves multiple interactions of transcription factors with various sequence elements. Identification of these sequence elements is the first step in understanding the underlying molecular mechanism(s) that regulate the gene expression. For in silico identification of these sequence elements, we have developed an online computational tool named transcription factor information system (TFIS) for detecting TFBS for the first time using a collection of JAVA programs and is mainly based on TFBS detection using position weight matrix (PWM). The database used for obtaining position frequency matrices (PFM) is JASPAR and HOCOMOCO, which is an open-access database of transcription factor binding profiles. Pseudo-counts are used while converting PFM to PWM, and TFBS detection is carried out on the basis of percent score taken as threshold value. TFIS is equipped with advanced features such as direct sequence retrieving from NCBI database using gene identification number and accession number, detecting binding site for common TF in a batch of gene sequences, and TFBS detection after generating PWM from known raw binding sequences in addition to general detection methods. TFIS can detect the presence of potential TFBSs in both the directions at the same time. This feature increases its efficiency. And the results for this dual detection are presented in different colors specific to the orientation of the binding site. Results obtained by the TFIS are more detailed and specific to the detected TFs as integration of more informative links from various related web servers are added in the result pages like Gene Ontology, PAZAR database and Transcription Factor Encyclopedia in addition to NCBI and UniProt. Common TFs like SP1, AP1 and NF-KB of the Amyloid beta precursor gene is easily detected using TFIS along with multiple binding sites. In another scenario of embryonic developmental process, TFs of the FOX family (FOXL1 and FOXC1) were also identified. TFIS is platform-independent which is publicly available along with its support and documentation at http://tfistool.appspot.com and http://www.bioinfoplus.com/tfis/ . TFIS is licensed under the GNU General Public License, version 3 (GPL-3.0).

AnnoTALE: bioinformatics tools for identification, annotation, and nomenclature of TALEs from Xanthomonas genomic sequences

PubMed Central

Grau, Jan; Reschke, Maik; Erkes, Annett; Streubel, Jana; Morgan, Richard D.; Wilson, Geoffrey G.; Koebnik, Ralf; Boch, Jens

2016-01-01

Transcription activator-like effectors (TALEs) are virulence factors, produced by the bacterial plant-pathogen Xanthomonas, that function as gene activators inside plant cells. Although the contribution of individual TALEs to infectivity has been shown, the specific roles of most TALEs, and the overall TALE diversity in Xanthomonas spp. is not known. TALEs possess a highly repetitive DNA-binding domain, which is notoriously difficult to sequence. Here, we describe an improved method for characterizing TALE genes by the use of PacBio sequencing. We present ‘AnnoTALE’, a suite of applications for the analysis and annotation of TALE genes from Xanthomonas genomes, and for grouping similar TALEs into classes. Based on these classes, we propose a unified nomenclature for Xanthomonas TALEs that reveals similarities pointing to related functionalities. This new classification enables us to compare related TALEs and to identify base substitutions responsible for the evolution of TALE specificities. PMID:26876161

Improved Annotation of 3′ Untranslated Regions and Complex Loci by Combination of Strand-Specific Direct RNA Sequencing, RNA-Seq and ESTs

PubMed Central

Song, Junfang; Duc, Céline; Storey, Kate G.; McLean, W. H. Irwin; Brown, Sara J.; Simpson, Gordon G.; Barton, Geoffrey J.

2014-01-01

The reference annotations made for a genome sequence provide the framework for all subsequent analyses of the genome. Correct and complete annotation in addition to the underlying genomic sequence is particularly important when interpreting the results of RNA-seq experiments where short sequence reads are mapped against the genome and assigned to genes according to the annotation. Inconsistencies in annotations between the reference and the experimental system can lead to incorrect interpretation of the effect on RNA expression of an experimental treatment or mutation in the system under study. Until recently, the genome-wide annotation of 3′ untranslated regions received less attention than coding regions and the delineation of intron/exon boundaries. In this paper, data produced for samples in Human, Chicken and A. thaliana by the novel single-molecule, strand-specific, Direct RNA Sequencing technology from Helicos Biosciences which locates 3′ polyadenylation sites to within +/− 2 nt, were combined with archival EST and RNA-Seq data. Nine examples are illustrated where this combination of data allowed: (1) gene and 3′ UTR re-annotation (including extension of one 3′ UTR by 5.9 kb); (2) disentangling of gene expression in complex regions; (3) clearer interpretation of small RNA expression and (4) identification of novel genes. While the specific examples displayed here may become obsolete as genome sequences and their annotations are refined, the principles laid out in this paper will be of general use both to those annotating genomes and those seeking to interpret existing publically available annotations in the context of their own experimental data. PMID:24722185

Differential effects of simple repeating DNA sequences on gene expression from the SV40 early promoter.

PubMed

Amirhaeri, S; Wohlrab, F; Wells, R D

1995-02-17

The influence of simple repeat sequences, cloned into different positions relative to the SV40 early promoter/enhancer, on the transient expression of the chloramphenicol acetyltransferase (CAT) gene was investigated. Insertion of (G)29.(C)29 in either orientation into the 5'-untranslated region of the CAT gene reduced expression in CV-1 cells 50-100 fold when compared with controls with random sequence inserts. Analysis of CAT-specific mRNA levels demonstrated that the effect was due to a reduction of CAT mRNA production rather than to posttranscriptional events. In contrast, insertion of the same insert in either orientation upstream of the promoter-enhancer or downstream of the gene stimulated gene expression 2-3-fold. These effects could be reversed by cotransfection of a competitor plasmid carrying (G)25.(C)25 sequences. The results suggest that a G.C-binding transcription factor modulates gene expression in this system and that promoter strength can be regulated by providing protein-binding sites in trans. Although constructs containing longer tracts of alternating (C-G), (T-G), or (A-T) sequences inhibited CAT expression when inserted in the 5'-untranslated region of the CAT gene, the amount of CAT mRNA was unaffected. Hence, these inhibitions must be due to posttranscriptional events, presumably at the level of translation. These effects of microsatellite sequences on gene expression are discussed with respect to recent data on related simple repeat sequences which cause several human genetic diseases.

Expressed sequence tags from Atta laevigata and identification of candidate genes for the control of pest leaf-cutting ants.

PubMed

Rodovalho, Cynara M; Ferro, Milene; Fonseca, Fernando Pp; Antonio, Erik A; Guilherme, Ivan R; Henrique-Silva, Flávio; Bacci, Maurício

2011-06-17

Leafcutters are the highest evolved within Neotropical ants in the tribe Attini and model systems for studying caste formation, labor division and symbiosis with microorganisms. Some species of leafcutters are agricultural pests controlled by chemicals which affect other animals and accumulate in the environment. Aiming to provide genetic basis for the study of leafcutters and for the development of more specific and environmentally friendly methods for the control of pest leafcutters, we generated expressed sequence tag data from Atta laevigata, one of the pest ants with broad geographic distribution in South America. The analysis of the expressed sequence tags allowed us to characterize 2,006 unique sequences in Atta laevigata. Sixteen of these genes had a high number of transcripts and are likely positively selected for high level of gene expression, being responsible for three basic biological functions: energy conservation through redox reactions in mitochondria; cytoskeleton and muscle structuring; regulation of gene expression and metabolism. Based on leafcutters lifestyle and reports of genes involved in key processes of other social insects, we identified 146 sequences potential targets for controlling pest leafcutters. The targets are responsible for antixenobiosis, development and longevity, immunity, resistance to pathogens, pheromone function, cell signaling, behavior, polysaccharide metabolism and arginine kynase activity. The generation and analysis of expressed sequence tags from Atta laevigata have provided important genetic basis for future studies on the biology of leaf-cutting ants and may contribute to the development of a more specific and environmentally friendly method for the control of agricultural pest leafcutters.

Expressed sequence tags from Atta laevigata and identification of candidate genes for the control of pest leaf-cutting ants

PubMed Central

2011-01-01

Background Leafcutters are the highest evolved within Neotropical ants in the tribe Attini and model systems for studying caste formation, labor division and symbiosis with microorganisms. Some species of leafcutters are agricultural pests controlled by chemicals which affect other animals and accumulate in the environment. Aiming to provide genetic basis for the study of leafcutters and for the development of more specific and environmentally friendly methods for the control of pest leafcutters, we generated expressed sequence tag data from Atta laevigata, one of the pest ants with broad geographic distribution in South America. Results The analysis of the expressed sequence tags allowed us to characterize 2,006 unique sequences in Atta laevigata. Sixteen of these genes had a high number of transcripts and are likely positively selected for high level of gene expression, being responsible for three basic biological functions: energy conservation through redox reactions in mitochondria; cytoskeleton and muscle structuring; regulation of gene expression and metabolism. Based on leafcutters lifestyle and reports of genes involved in key processes of other social insects, we identified 146 sequences potential targets for controlling pest leafcutters. The targets are responsible for antixenobiosis, development and longevity, immunity, resistance to pathogens, pheromone function, cell signaling, behavior, polysaccharide metabolism and arginine kynase activity. Conclusion The generation and analysis of expressed sequence tags from Atta laevigata have provided important genetic basis for future studies on the biology of leaf-cutting ants and may contribute to the development of a more specific and environmentally friendly method for the control of agricultural pest leafcutters. PMID:21682882

Strong early seed-specific gene regulatory region

DOEpatents

Broun, Pierre; Somerville, Chris

1999-01-01

Nucleic acid sequences and methods for their use are described which provide for early seed-specific transcription, in order to modulate or modify expression of foreign or endogenous genes in seeds, particularly embryo cells. The method finds particular use in conjunction with modifying fatty acid production in seed tissue.

Strong early seed-specific gene regulatory region

DOEpatents

Broun, Pierre; Somerville, Chris

2002-01-01

Nucleic acid sequences and methods for their use are described which provide for early seed-specific transcription, in order to modulate or modify expression of foreign or endogenous genes in seeds, particularly embryo cells. The method finds particular use in conjunction with modifying fatty acid production in seed tissue.

Identification of verotoxin type 2 variant B subunit genes in Escherichia coli by the polymerase chain reaction and restriction fragment length polymorphism analysis.

PubMed Central

Tyler, S D; Johnson, W M; Lior, H; Wang, G; Rozee, K R

1991-01-01

A set of synthetic oligonucleotide primers was designed for use in a polymerase chain reaction protocol to specifically detect the B subunit genes in vtx2ha and vtx2hb, which code for the production of the VT2 (Shiga-like toxin II) variant cytotoxins VT2v-a and VT2v-b, respectively. An additional set of primers amplified a fragment common to the B subunits of the VT2 and the VT2 variant genes. Subsequent restriction endonuclease digestion of this amplicon permitted prediction of specific VT2 and variant genotypes on the basis of predetermined restriction fragment length polymorphisms. Genotypes of 21 VT2-producing strains of Escherichia coli were determined using this polymerase chain reaction-restriction fragment length polymorphism procedure. Four strains contained B subunit target sequences only for VT2 genes, 9 strains contained sequences only for VT2v-a genes, and 3 strains contained sequences only for VT2v-b. For genes in combination, one strain contained B subunit genes for both VT2 and VT2v-a and two strains contained B subunit genes for VT2 and VT2v-b. Two strains of E. coli O91:H21 contained both VT2v-a and VT2v-b B subunit genes. The VT2 reference strain of E. coli, E32511, was found to contain the targeted sequences from both VT2 and VT2v-a genes, whereas the recombinant E. coli, pEB1, possessed only that of the VT2 gene. The specific activities of extracellular VT2 determined in HeLa cells ranged from 0.3 to 41.7 TCD50 per microgram of protein in strains carrying the VT2 gene target and from 0 to 50.0 TCD50 per microgram of protein in strains carrying only the VT2 variant target (TCD50 is the tissue culture dose by which 50% of the cells were affected), suggesting that phenotypic expression does not correlate with genotype. Images PMID:1679436

High time for a roll call: gene duplication and phylogenetic relationships of TCP-like genes in monocots

PubMed Central

Mondragón-Palomino, Mariana; Trontin, Charlotte

2011-01-01

Background and Aims The TCP family is an ancient group of plant developmental transcription factors that regulate cell division in vegetative and reproductive structures and are essential in the establishment of flower zygomorphy. In-depth research on eudicot TCPs has documented their evolutionary and developmental role. This has not happened to the same extent in monocots, although zygomorphy has been critical for the diversification of Orchidaceae and Poaceae, the largest families of this group. Investigating the evolution and function of TCP-like genes in a wider group of monocots requires a detailed phylogenetic analysis of all available sequence information and a system that facilitates comparing genetic and functional information. Methods The phylogenetic relationships of TCP-like genes in monocots were investigated by analysing sequences from the genomes of Zea mays, Brachypodium distachyon, Oryza sativa and Sorghum bicolor, as well as EST data from several other monocot species. Key Results All available monocot TCP-like sequences are associated in 20 major groups with an average identity ≥64 % and most correspond to well-supported clades of the phylogeny. Their sequence motifs and relationships of orthology were documented and it was found that 67 % of the TCP-like genes of Sorghum, Oryza, Zea and Brachypodium are in microsyntenic regions. This analysis suggests that two rounds of whole genome duplication drove the expansion of TCP-like genes in these species. Conclusions A system of classification is proposed where putative or recognized monocot TCP-like genes are assigned to a specific clade of PCF-, CIN- or CYC/tb1-like genes. Specific biases in sequence data of this family that must be tackled when studying its molecular evolution and phylogeny are documented. Finally, the significant retention of duplicated TCP genes from Zea mays is considered in the context of balanced gene drive. PMID:21444336

Extraordinary Sequence Divergence at Tsga8, an X-linked Gene Involved in Mouse Spermiogenesis

PubMed Central

Good, Jeffrey M.; Vanderpool, Dan; Smith, Kimberly L.; Nachman, Michael W.

2011-01-01

The X chromosome plays an important role in both adaptive evolution and speciation. We used a molecular evolutionary screen of X-linked genes potentially involved in reproductive isolation in mice to identify putative targets of recurrent positive selection. We then sequenced five very rapidly evolving genes within and between several closely related species of mice in the genus Mus. All five genes were involved in male reproduction and four of the genes showed evidence of recurrent positive selection. The most remarkable evolutionary patterns were found at Testis-specific gene a8 (Tsga8), a spermatogenesis-specific gene expressed during postmeiotic chromatin condensation and nuclear transformation. Tsga8 was characterized by extremely high levels of insertion–deletion variation of an alanine-rich repetitive motif in natural populations of Mus domesticus and M. musculus, differing in length from the reference mouse genome by up to 89 amino acids (27% of the total protein length). This population-level variation was coupled with striking divergence in protein sequence and length between closely related mouse species. Although no clear orthologs had previously been described for Tsga8 in other mammalian species, we have identified a highly divergent hypothetical gene on the rat X chromosome that shares clear orthology with the 5′ and 3′ ends of Tsga8. Further inspection of this ortholog verified that it is expressed in rat testis and shares remarkable similarity with mouse Tsga8 across several general features of the protein sequence despite no conservation of nucleotide sequence across over 60% of the rat-coding domain. Overall, Tsga8 appears to be one of the most rapidly evolving genes to have been described in rodents. We discuss the potential evolutionary causes and functional implications of this extraordinary divergence and the possible contribution of Tsga8 and the other four genes we examined to reproductive isolation in mice. PMID:21186189

Nitrogen Cycle Evaluation (NiCE) Chip for the Simultaneous Analysis of Multiple N-Cycle Associated Genes.

PubMed

Oshiki, Mamoru; Segawa, Takahiro; Ishii, Satoshi

2018-02-02

Various microorganisms play key roles in the Nitrogen (N) cycle. Quantitative PCR (qPCR) and PCR-amplicon sequencing of the N cycle functional genes allow us to analyze the abundance and diversity of microbes responsible in the N transforming reactions in various environmental samples. However, analysis of multiple target genes can be cumbersome and expensive. PCR-independent analysis, such as metagenomics and metatranscriptomics, is useful but expensive especially when we analyze multiple samples and try to detect N cycle functional genes present at relatively low abundance. Here, we present the application of microfluidic qPCR chip technology to simultaneously quantify and prepare amplicon sequence libraries for multiple N cycle functional genes as well as taxon-specific 16S rRNA gene markers for many samples. This approach, named as N cycle evaluation (NiCE) chip, was evaluated by using DNA from pure and artificially mixed bacterial cultures and by comparing the results with those obtained by conventional qPCR and amplicon sequencing methods. Quantitative results obtained by the NiCE chip were comparable to those obtained by conventional qPCR. In addition, the NiCE chip was successfully applied to examine abundance and diversity of N cycle functional genes in wastewater samples. Although non-specific amplification was detected on the NiCE chip, this could be overcome by optimizing the primer sequences in the future. As the NiCE chip can provide high-throughput format to quantify and prepare sequence libraries for multiple N cycle functional genes, this tool should advance our ability to explore N cycling in various samples. Importance. We report a novel approach, namely Nitrogen Cycle Evaluation (NiCE) chip by using microfluidic qPCR chip technology. By sequencing the amplicons recovered from the NiCE chip, we can assess diversities of the N cycle functional genes. The NiCE chip technology is applicable to analyze the temporal dynamics of the N cycle gene transcriptions in wastewater treatment bioreactors. The NiCE chip can provide high-throughput format to quantify and prepare sequence libraries for multiple N cycle functional genes. While there is a room for future improvement, this tool should significantly advance our ability to explore the N cycle in various environmental samples. Copyright © 2018 American Society for Microbiology.

Regulation of ecmF gene expression and genetic hierarchy among STATa, CudA, and MybC on several prestalk A-specific gene expressions in Dictyostelium.

PubMed

Saga, Yukika; Inamura, Tomoka; Shimada, Nao; Kawata, Takefumi

2016-05-01

STATa, a Dictyostelium homologue of metazoan signal transducer and activator of transcription, is important for the organizer function in the tip region of the migrating Dictyostelium slug. We previously showed that ecmF gene expression depends on STATa in prestalk A (pstA) cells, where STATa is activated. Deletion and site-directed mutagenesis analysis of the ecmF/lacZ fusion gene in wild-type and STATa null strains identified an imperfect inverted repeat sequence, ACAAATANTATTTGT, as a STATa-responsive element. An upstream sequence element was required for efficient expression in the rear region of pstA zone; an element downstream of the inverted repeat was necessary for sufficient prestalk expression during culmination. Band shift analyses using purified STATa protein detected no sequence-specific binding to those ecmF elements. The only verified upregulated target gene of STATa is cudA gene; CudA directly activates expL7 gene expression in prestalk cells. However, ecmF gene expression was almost unaffected in a cudA null mutant. Several previously reported putative STATa target genes were also expressed in cudA null mutant but were downregulated in STATa null mutant. Moreover, mybC, which encodes another transcription factor, belonged to this category, and ecmF expression was downregulated in a mybC null mutant. These findings demonstrate the existence of a genetic hierarchy for pstA-specific genes, which can be classified into two distinct STATa downstream pathways, CudA dependent and independent. The ecmF expression is indirectly upregulated by STATa in a CudA-independent activation manner but dependent on MybC, whose expression is positively regulated by STATa. © 2016 Japanese Society of Developmental Biologists.

Genotypic, Phenotypic and Clinical Validation of GeneXpert in Extra-Pulmonary and Pulmonary Tuberculosis in India

PubMed Central

Singh, Urvashi B.; Pandey, Pooja; Mehta, Girija; Bhatnagar, Anuj K.; Mohan, Anant; Goyal, Vinay; Ahuja, Vineet; Ramachandran, Ranjani; Sachdeva, Kuldeep S.; Samantaray, Jyotish C.

2016-01-01

Background Newer molecular diagnostics have brought paradigm shift in early diagnosis of tuberculosis [TB]. WHO recommended use of GeneXpert MTB/RIF [Xpert] for Extra-pulmonary [EP] TB; critics have since questioned its efficiency. Methods The present study was designed to assess the performance of GeneXpert in 761 extra-pulmonary and 384 pulmonary specimens from patients clinically suspected of TB and compare with Phenotypic, Genotypic and Composite reference standards [CRS]. Results Comparison of GeneXpert results to CRS, demonstrated sensitivity of 100% and 90.68%, specificity of 100% and 99.62% for pulmonary and extra-pulmonary samples. On comparison with culture, sensitivity for Rifampicin [Rif] resistance detection was 87.5% and 81.82% respectively, while specificity was 100% for both pulmonary and extra-pulmonary TB. On comparison to sequencing of rpoB gene [Rif resistance determining region, RRDR], sensitivity was respectively 93.33% and 90% while specificity was 100% in both pulmonary and extra-pulmonary TB. GeneXpert assay missed 533CCG mutation in one sputum and dual mutation [517 & 519] in one pus sample, detected by sequencing. Sequencing picked dual mutation [529, 530] in a sputum sample sensitive to Rif, demonstrating, not all RRDR mutations lead to resistance. Conclusions Current study reports observations in a patient care setting in a high burden region, from a large collection of pulmonary and extra-pulmonary samples and puts to rest questions regarding sensitivity, specificity, detection of infrequent mutations and mutations responsible for low-level Rif resistance by GeneXpert. Improvements in the assay could offer further improvement in sensitivity of detection in different patient samples; nevertheless it may be difficult to improve sensitivity of Rif resistance detection if only one gene is targeted. Assay specificity was high both for TB detection and Rif resistance detection. Despite a few misses, the assay offers major boost to early diagnosis of TB and MDR-TB, in difficult to diagnose pauci-bacillary TB. PMID:26894283

Molecular characterization of dihydroneopterin aldolase and aminodeoxychorismate synthase in common bean-genes coding for enzymes in the folate synthesis pathway.

PubMed

Xie, Weilong; Perry, Gregory; Martin, C Joe; Shim, Youn-Seb; Navabi, Alireza; Pauls, K Peter

2017-07-01

Common beans (Phaseolus vulgaris) are excellent sources of dietary folates, but different varieties contain different amounts of these compounds. Genes coding for dihydroneopterin aldolase (DHNA) and aminodeoxychorismate synthase (ADCS) of the folate synthesis pathway were characterized by PCR amplification, BAC clone sequencing, and whole genome sequencing. All DHNA and ADCS genes in the Mesoamerican cultivar OAC Rex were isolated and compared with those genes in the genome of Andean genotype G19833. Both genotypes have two functional DHNA genes and one pseudo gene. PvDHNA1 and PvDHNA2 proteins have similar secondary structures and conserved residues as DHNA homologs in Staphylococcus aureus and Arabidopsis. Sequence analysis and synteny mapping indicated that PvDHNA1 might be a duplicated and transposed copy of PvDHNA2. There is only one ADCS gene (PvADCS) identified in the bean genome and it is identical in OAC Rex and G19833. PvADCS has the conserved motifs required for catalytic activity similar to other plant ADCS homologs. DHNA and ADCS gene-specific markers were developed, mapped, and compared to their physical locations on chromosomes 1 and 7, respectively. The gene-specific markers developed in this study should be useful for detection and selection of varieties with enhanced folate contents in bean breeding programs.

An operon encoding three glycolytic enzymes in Lactobacillus delbrueckii subsp. bulgaricus: glyceraldehyde-3-phosphate dehydrogenase, phosphoglycerate kinase and triosephosphate isomerase.

PubMed

Branny, P; de la Torre, F; Garel, J R

1998-04-01

The structural genes gap, pgk and tpi encoding three glycolytic enzymes, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), 3-phosphoglycerate kinase (PGK) and triosephosphate isomerase (TPI), respectively, have been cloned and sequenced from Lactobacillus delbrueckii subsp. bulgaricus (L. bulgaricus). The genes were isolated after screening genomic sublibraries with specific gap and pgk probes obtained by PCR amplification of chromosomal DNA with degenerate primers corresponding to amino acid sequences highly conserved in GAPDHs and PGKs. Nucleotide sequencing revealed that the three genes were organized in the order gap-pgk-tpi. The translation start codons of the three genes were identified by alignment of the N-terminal sequences. These genes predicted polypeptide chains of 338, 403 and 252 amino acids for GAPDH, PGK and TPI, respectively, and they were separated by 96 bp between gap and pgk, and by only 18 bp between pgk and tpi. The codon usage in gap, pgk, tpi and three other glycolytic genes from L. bulgaricus differed, noticeably from that in other chromosomal genes. The site of transcriptional initiation was located by primer extension, and a probable promoter was identified for the gap-pgk-tpi operon. Northern hybridization of total RNA with specific probes showed two transcripts, an mRNA of 1.4 kb corresponding to the gap gene, and a less abundant mRNA of 3.4 kb corresponding to the gap-pgk-tpi cluster. The absence of a visible terminator in the 3'-end of the shorter transcript and the location of this 3'-end inside the pgk gene indicated that this shorter transcript was produced by degradation of the longer one, rather than by an early termination of transcription after the gap gene.

Two DNA-binding factors recognize specific sequences at silencers, upstream activating sequences, autonomously replicating sequences, and telomeres in Saccharomyces cerevisiae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Buchman, A.R.; Kimmerly, W.J.; Rine, J.

1988-01-01

Two DNA-binding factors from Saccharomyces cerevisiae have been characterized, GRFI (general regulatory factor I) and ABFI (ARS-binding factor I), that recognize specific sequences within diverse genetic elements. GRFI bound to sequences at the negative regulatory elements (silencers) of the silent mating type loci HML E and HMR E and to the upstream activating sequence (UAS) required for transcription of the MAT ..cap alpha.. genes. A putative conserved UAS located at genes involved in translation (RPG box) was also recognized by GRFI. In addition, GRFI bound with high affinity to sequences within the (C/sub 1-3/A)-repeat region at yeast telomeres. Binding sitesmore » for GRFI with the highest affinity appeared to be of the form 5'-(A/G)(A/C)ACCCAN NCA(T/C)(T/C)-3', where N is any nucleotide. ABFI-binding sites were located next to autonomously replicating sequences (ARSs) at controlling elements of the silent mating type loci HMR E, HMR I, and HML I and were associated with ARS1, ARS2, and the 2..mu..m plasmid ARS. Two tandem ABFI binding sites were found between the HIS3 and DED1 genes, several kilobase pairs from any ARS, indicating that ABFI-binding sites are not restricted to ARSs. The sequences recognized by AFBI showed partial dyad-symmetry and appeared to be variations of the consensus 5'-TATCATTNNNNACGA-3'. GRFI and ABFI were both abundant DNA-binding factors and did not appear to be encoded by the SIR genes, whose product are required for repression of the silent mating type loci. Together, these results indicate that both GRFI and ABFI play multiple roles within the cell.« less

Identification of novel and known oocyte-specific genes using complementary DNA subtraction and microarray analysis in three different species.

PubMed

Vallée, Maud; Gravel, Catherine; Palin, Marie-France; Reghenas, Hélène; Stothard, Paul; Wishart, David S; Sirard, Marc-André

2005-07-01

The main objective of the present study was to identify novel oocyte-specific genes in three different species: bovine, mouse, and Xenopus laevis. To achieve this goal, two powerful technologies were combined: a polymerase chain reaction (PCR)-based cDNA subtraction, and cDNA microarrays. Three subtractive libraries consisting of 3456 clones were established and enriched for oocyte-specific transcripts. Sequencing analysis of the positive insert-containing clones resulted in the following classification: 53% of the clones corresponded to known cDNAs, 26% were classified as uncharacterized cDNAs, and a final 9% were classified as novel sequences. All these clones were used for cDNA microarray preparation. Results from these microarray analyses revealed that in addition to already known oocyte-specific genes, such as GDF9, BMP15, and ZP, known genes with unknown function in the oocyte were identified, such as a MLF1-interacting protein (MLF1IP), B-cell translocation gene 4 (BTG4), and phosphotyrosine-binding protein (xPTB). Furthermore, 15 novel oocyte-specific genes were validated by reverse transcription-PCR to confirm their preferential expression in the oocyte compared to somatic tissues. The results obtained in the present study confirmed that microarray analysis is a robust technique to identify true positives from the suppressive subtractive hybridization experiment. Furthermore, obtaining oocyte-specific genes from three species simultaneously allowed us to look at important genes that are conserved across species. Further characterization of these novel oocyte-specific genes will lead to a better understanding of the molecular mechanisms related to the unique functions found in the oocyte.

Design and verification of a pangenome microarray oligonucleotide probe set for Dehalococcoides spp.

PubMed

Hug, Laura A; Salehi, Maryam; Nuin, Paulo; Tillier, Elisabeth R; Edwards, Elizabeth A

2011-08-01

Dehalococcoides spp. are an industrially relevant group of Chloroflexi bacteria capable of reductively dechlorinating contaminants in groundwater environments. Existing Dehalococcoides genomes revealed a high level of sequence identity within this group, including 98 to 100% 16S rRNA sequence identity between strains with diverse substrate specificities. Common molecular techniques for identification of microbial populations are often not applicable for distinguishing Dehalococcoides strains. Here we describe an oligonucleotide microarray probe set designed based on clustered Dehalococcoides genes from five different sources (strain DET195, CBDB1, BAV1, and VS genomes and the KB-1 metagenome). This "pangenome" probe set provides coverage of core Dehalococcoides genes as well as strain-specific genes while optimizing the potential for hybridization to closely related, previously unknown Dehalococcoides strains. The pangenome probe set was compared to probe sets designed independently for each of the five Dehalococcoides strains. The pangenome probe set demonstrated better predictability and higher detection of Dehalococcoides genes than strain-specific probe sets on nontarget strains with <99% average nucleotide identity. An in silico analysis of the expected probe hybridization against the recently released Dehalococcoides strain GT genome and additional KB-1 metagenome sequence data indicated that the pangenome probe set performs more robustly than the combined strain-specific probe sets in the detection of genes not included in the original design. The pangenome probe set represents a highly specific, universal tool for the detection and characterization of Dehalococcoides from contaminated sites. It has the potential to become a common platform for Dehalococcoides-focused research, allowing meaningful comparisons between microarray experiments regardless of the strain examined.

Characterization of the glutathione S-transferase gene family through ESTs and expression analyses within common and pigmented cultivars of Citrus sinensis (L.) Osbeck.

PubMed

Licciardello, Concetta; D'Agostino, Nunzio; Traini, Alessandra; Recupero, Giuseppe Reforgiato; Frusciante, Luigi; Chiusano, Maria Luisa

2014-02-03

Glutathione S-transferases (GSTs) represent a ubiquitous gene family encoding detoxification enzymes able to recognize reactive electrophilic xenobiotic molecules as well as compounds of endogenous origin. Anthocyanin pigments require GSTs for their transport into the vacuole since their cytoplasmic retention is toxic to the cell. Anthocyanin accumulation in Citrus sinensis (L.) Osbeck fruit flesh determines different phenotypes affecting the typical pigmentation of Sicilian blood oranges. In this paper we describe: i) the characterization of the GST gene family in C. sinensis through a systematic EST analysis; ii) the validation of the EST assembly by exploiting the genome sequences of C. sinensis and C. clementina and their genome annotations; iii) GST gene expression profiling in six tissues/organs and in two different sweet orange cultivars, Cadenera (common) and Moro (pigmented). We identified 61 GST transcripts, described the full- or partial-length nature of the sequences and assigned to each sequence the GST class membership exploiting a comparative approach and the classification scheme proposed for plant species. A total of 23 full-length sequences were defined. Fifty-four of the 61 transcripts were successfully aligned to the C. sinensis and C. clementina genomes. Tissue specific expression profiling demonstrated that the expression of some GST transcripts was 'tissue-affected' and cultivar specific. A comparative analysis of C. sinensis GSTs with those from other plant species was also considered. Data from the current analysis are accessible at http://biosrv.cab.unina.it/citrusGST/, with the aim to provide a reference resource for C. sinensis GSTs. This study aimed at the characterization of the GST gene family in C. sinensis. Based on expression patterns from two different cultivars and on sequence-comparative analyses, we also highlighted that two sequences, a Phi class GST and a Mapeg class GST, could be involved in the conjugation of anthocyanin pigments and in their transport into the vacuole, specifically in fruit flesh of the pigmented cultivar.

Characterization of the genomic organization of the region bordering the centromere of chromosome V of Podospora anserina by direct sequencing.

PubMed

Silar, Philippe; Barreau, Christian; Debuchy, Robert; Kicka, Sébastien; Turcq, Béatrice; Sainsard-Chanet, Annie; Sellem, Carole H; Billault, Alain; Cattolico, Laurence; Duprat, Simone; Weissenbach, Jean

2003-08-01

A Podospora anserina BAC library of 4800 clones has been constructed in the vector pBHYG allowing direct selection in fungi. Screening of the BAC collection for centromeric sequences of chromosome V allowed the recovery of clones localized on either sides of the centromere, but no BAC clone was found to contain the centromere. Seven BAC clones containing 322,195 and 156,244bp from either sides of the centromeric region were sequenced and annotated. One 5S rRNA gene, 5 tRNA genes, and 163 putative coding sequences (CDS) were identified. Among these, only six CDS seem specific to P. anserina. The gene density in the centromeric region is approximately one gene every 2.8kb. Extrapolation of this gene density to the whole genome of P. anserina suggests that the genome contains about 11,000 genes. Synteny analyses between P. anserina and Neurospora crassa show that co-linearity extends at the most to a few genes, suggesting rapid genome rearrangements between these two species.

Identification of Human Lineage-Specific Transcriptional Coregulators Enabled by a Glossary of Binding Modules and Tunable Genomic Backgrounds.

PubMed

Mariani, Luca; Weinand, Kathryn; Vedenko, Anastasia; Barrera, Luis A; Bulyk, Martha L

2017-09-27

Transcription factors (TFs) control cellular processes by binding specific DNA motifs to modulate gene expression. Motif enrichment analysis of regulatory regions can identify direct and indirect TF binding sites. Here, we created a glossary of 108 non-redundant TF-8mer "modules" of shared specificity for 671 metazoan TFs from publicly available and new universal protein binding microarray data. Analysis of 239 ENCODE TF chromatin immunoprecipitation sequencing datasets and associated RNA sequencing profiles suggest the 8mer modules are more precise than position weight matrices in identifying indirect binding motifs and their associated tethering TFs. We also developed GENRE (genomically equivalent negative regions), a tunable tool for construction of matched genomic background sequences for analysis of regulatory regions. GENRE outperformed four state-of-the-art approaches to background sequence construction. We used our TF-8mer glossary and GENRE in the analysis of the indirect binding motifs for the co-occurrence of tethering factors, suggesting novel TF-TF interactions. We anticipate that these tools will aid in elucidating tissue-specific gene-regulatory programs. Copyright © 2017 Elsevier Inc. All rights reserved.

[Polymorphism of KPI-A genes from plants of the subgenus Potatoe (sect. Petota, Estolonifera and Lycopersicum) and subgenus Solanum].

PubMed

Krinitsyna, A A; Mel'nikova, N V; Belenikin, M S; Poltronieri, P; Santino, A; Kudriavtseva, A V; Savilova, A M; Speranskaia, A S

2013-01-01

Kunitz-type proteinase inhibitor proteins of group A (KPI-A) are involved in the protection of potato plants from pathogens and pests. Although sequences of large number of the KPI-A genes from different species of cultivated potato (Solanum tuberosum subsp. tuberosum) and a few genes from tomato (Solanum lycopersicum) are known to date, information about the allelic diversity of these genes in other species of the genus Solanum is lacking. In our work, the consensus sequences of the KPI-A genes were established in two species of subgenus Potatoe sect. Petota (Solanum tuberosum subsp. andigenum--5 genes and Solanum stoloniferum--2 genes) and in the subgenus Solanum (Solanum nigrum--5 genes) by amplification, cloning, sequencing and subsequent analysis. The determined sequences of KPI-A genes were 97-100% identical to known sequences of the cultivated potato of sect. Petota (cultivated potato Solanum tuberosum subsp. tuberosum) and sect. Etuberosum (S. palustre). The interspecific variability of these genes did not exceed the intraspecific variability for all studied species except Solanum lycopersicum. The distribution of highly variable and conserved sequences in the mature protein-encoding regions was uniform for all investigated KPI-A genes. However, our attempts to amplify the homologous genes using the same primers and the genomes of Solanum dulcamarum, Solanum lycopersicum and Mandragora officinarum resulted in no product formation. Phylogenetic analysis of KPI-A diversity showed that the sequences of the S. lycopersicum form independent cluster, whereas KPI-A of S. nigrum and species of sect. Etuberosum and sect. Petota are closely related and do not form species-specific subclasters. Although Solanum nigrum is resistant to all known races of economically one of the most important diseases of solanaceous plants oomycete Phytophthora infestans aminoacid sequences encoding by KPI-A genes from its genome have nearly or absolutely no differences to the same from genomes of cultivated potatoes involved by P. infestans.

Identification and characterization of the ecdysteroid UDPglucosyltransferase gene of the Lymantria dispar multinucleocapsid nuclear polyhedrosis virus

Treesearch

Christopher I. Riegel; Carita Lanner-Herrera; James M. Slavicek

1994-01-01

We have located, cloned, sequenced and characterized the ecdysteroid UDP-glucosyltransferase gene (egt) gene from the baculovirus Lymantria dispar multinucleocapsid nuclear polyhedrosis virus,(LdMNPV), which is specific for the gypsy moth (L. dispar). The egt gene from the related baculovirus Autographa californica...

Expressed sequence tag analysis of guinea pig (Cavia porcellus) eye tissues for NEIBank

PubMed Central

Simpanya, Mukoma F.; Wistow, Graeme; Gao, James; David, Larry L.; Giblin, Frank J.

2008-01-01

Purpose To characterize gene expression patterns in guinea pig ocular tissues and identify orthologs of human genes from NEIBank expressed sequence tags. Methods RNA was extracted from dissected eye tissues of 2.5-month-old guinea pigs to make three unamplified and unnormalized cDNA libraries in the pCMVSport-6 vector for the lens, retina, and eye minus lens and retina. Over 4,000 clones were sequenced from each library and were analyzed using GRIST for clustering and gene identification. Lens crystallin EST data were validated using two-dimensional electrophoresis (2-DE), matrix assisted laser desorption (MALDI), and electrospray ionization mass spectrometry (ESIMS). Results Combined data from the three libraries generated a total of 6,694 distinctive gene clusters, with each library having between 1,000 and 3,000 clusters. Approximately 60% of the total gene clusters were novel cDNA sequences and had significant homologies to other mammalian sequences in GenBank. Complete cDNA sequences were obtained for many guinea pig lens proteins, including αA/αAinsert-, γN-, and γS-crystallins, lengsin and GRIFIN. The ratio of αA- to αB-crystallin on 2-DE gels was 8: 1 in the lens nucleus and 6.5: 1 in the cortex. Analysis of ESTs, genome sequence, and proteins (by MALDI), did not reveal any evidence for the presence of γD-, γE-, and γF-crystallin in the guinea pig. Predicted masses of many guinea pig lens crystallins were confirmed by ESIMS analysis. For the retina, orthologs of human phototransduction genes were found, such as Rhodopsin, S-antigen (Sag, Arrestin), and Transducin. The guinea-pig ortholog of NRL, a key rod photoreceptor-specific transcription factor, was also represented in EST data. In the ‘rest-of-eye’ library, the most abundant transcripts included decorin and keratin 12, representative of the cornea. Conclusions Genomic analysis of guinea pig eye tissues provides sequence-verified clones for future studies. Guinea pig orthologs of many human eye specific genes were identified. Guinea pig gene structures were similar to their human and rodent gene counterparts. Surprisingly, no orthologs of γD-, γE-, and γF-crystallin were found in EST, proteomic, or the current guinea pig genome data. PMID:19104676

Identification and characterization of plant-specific NAC gene family in canola (Brassica napus L.) reveal novel members involved in cell death.

PubMed

Wang, Boya; Guo, Xiaohua; Wang, Chen; Ma, Jieyu; Niu, Fangfang; Zhang, Hanfeng; Yang, Bo; Liang, Wanwan; Han, Feng; Jiang, Yuan-Qing

2015-03-01

NAC transcription factors are plant-specific and play important roles in plant development processes, response to biotic and abiotic cues and hormone signaling. However, to date, little is known about the NAC genes in canola (or oilseed rape, Brassica napus L.). In this study, a total of 60 NAC genes were identified from canola through a systematical analysis and mining of expressed sequence tags. Among these, the cDNA sequences of 41 NAC genes were successfully cloned. The translated protein sequences of canola NAC genes with the NAC genes from representative species were phylogenetically clustered into three major groups and multiple subgroups. The transcriptional activities of these BnaNAC proteins were assayed in yeast. In addition, by quantitative real-time RT-PCR, we further observed that some of these BnaNACs were regulated by different hormone stimuli or abiotic stresses. Interestingly, we successfully identified two novel BnaNACs, BnaNAC19 and BnaNAC82, which could elicit hypersensitive response-like cell death when expressed in Nicotiana benthamiana leaves, which was mediated by accumulation of reactive oxygen species. Overall, our work has laid a solid foundation for further characterization of this important NAC gene family in canola.

Visualization and Enumeration of Bacteria Carrying a Specific Gene Sequence by In Situ Rolling Circle Amplification

PubMed Central

Maruyama, Fumito; Kenzaka, Takehiko; Yamaguchi, Nobuyasu; Tani, Katsuji; Nasu, Masao

2005-01-01

Rolling circle amplification (RCA) generates large single-stranded and tandem repeats of target DNA as amplicons. This technique was applied to in situ nucleic acid amplification (in situ RCA) to visualize and count single Escherichia coli cells carrying a specific gene sequence. The method features (i) one short target sequence (35 to 39 bp) that allows specific detection; (ii) maintaining constant fluorescent intensity of positive cells permeabilized extensively after amplicon detection by fluorescence in situ hybridization, which facilitates the detection of target bacteria in various physiological states; and (iii) reliable enumeration of target bacteria by concentration on a gelatin-coated membrane filter. To test our approach, the presence of the following genes were visualized by in situ RCA: green fluorescent protein gene, the ampicillin resistance gene and the replication origin region on multicopy pUC19 plasmid, as well as the single-copy Shiga-like toxin gene on chromosomes inside E. coli cells. Fluorescent antibody staining after in situ RCA also simultaneously identified cells harboring target genes and determined the specificity of in situ RCA. E. coli cells in a nonculturable state from a prolonged incubation were periodically sampled and used for plasmid uptake study. The numbers of cells taking up plasmids determined by in situ RCA was up to 106-fold higher than that measured by selective plating. In addition, in situ RCA allowed the detection of cells taking up plasmids even when colony-forming cells were not detected during the incubation period. By optimizing the cell permeabilization condition for in situ RCA, this method can become a valuable tool for studying free DNA uptake, especially in nonculturable bacteria. PMID:16332770

Allelic barley MLA immune receptors recognize sequence-unrelated avirulence effectors of the powdery mildew pathogen

PubMed Central

Lu, Xunli; Kracher, Barbara; Saur, Isabel M. L.; Bauer, Saskia; Ellwood, Simon R.; Wise, Roger; Yaeno, Takashi; Maekawa, Takaki; Schulze-Lefert, Paul

2016-01-01

Disease-resistance genes encoding intracellular nucleotide-binding domain and leucine-rich repeat proteins (NLRs) are key components of the plant innate immune system and typically detect the presence of isolate-specific avirulence (AVR) effectors from pathogens. NLR genes define the fastest-evolving gene family of flowering plants and are often arranged in gene clusters containing multiple paralogs, contributing to copy number and allele-specific NLR variation within a host species. Barley mildew resistance locus a (Mla) has been subject to extensive functional diversification, resulting in allelic resistance specificities each recognizing a cognate, but largely unidentified, AVRa gene of the powdery mildew fungus, Blumeria graminis f. sp. hordei (Bgh). We applied a transcriptome-wide association study among 17 Bgh isolates containing different AVRa genes and identified AVRa1 and AVRa13, encoding candidate-secreted effectors recognized by Mla1 and Mla13 alleles, respectively. Transient expression of the effector genes in barley leaves or protoplasts was sufficient to trigger Mla1 or Mla13 allele-specific cell death, a hallmark of NLR receptor-mediated immunity. AVRa1 and AVRa13 are phylogenetically unrelated, demonstrating that certain allelic MLA receptors evolved to recognize sequence-unrelated effectors. They are ancient effectors because corresponding loci are present in wheat powdery mildew. AVRA1 recognition by barley MLA1 is retained in transgenic Arabidopsis, indicating that AVRA1 directly binds MLA1 or that its recognition involves an evolutionarily conserved host target of AVRA1. Furthermore, analysis of transcriptome-wide sequence variation among the Bgh isolates provides evidence for Bgh population structure that is partially linked to geographic isolation. PMID:27702901

Allelic barley MLA immune receptors recognize sequence-unrelated avirulence effectors of the powdery mildew pathogen.

PubMed

Lu, Xunli; Kracher, Barbara; Saur, Isabel M L; Bauer, Saskia; Ellwood, Simon R; Wise, Roger; Yaeno, Takashi; Maekawa, Takaki; Schulze-Lefert, Paul

2016-10-18

Disease-resistance genes encoding intracellular nucleotide-binding domain and leucine-rich repeat proteins (NLRs) are key components of the plant innate immune system and typically detect the presence of isolate-specific avirulence (AVR) effectors from pathogens. NLR genes define the fastest-evolving gene family of flowering plants and are often arranged in gene clusters containing multiple paralogs, contributing to copy number and allele-specific NLR variation within a host species. Barley mildew resistance locus a (Mla) has been subject to extensive functional diversification, resulting in allelic resistance specificities each recognizing a cognate, but largely unidentified, AVR a gene of the powdery mildew fungus, Blumeria graminis f. sp. hordei (Bgh). We applied a transcriptome-wide association study among 17 Bgh isolates containing different AVR a genes and identified AVR a1 and AVR a13 , encoding candidate-secreted effectors recognized by Mla1 and Mla13 alleles, respectively. Transient expression of the effector genes in barley leaves or protoplasts was sufficient to trigger Mla1 or Mla13 allele-specific cell death, a hallmark of NLR receptor-mediated immunity. AVR a1 and AVR a13 are phylogenetically unrelated, demonstrating that certain allelic MLA receptors evolved to recognize sequence-unrelated effectors. They are ancient effectors because corresponding loci are present in wheat powdery mildew. AVR A1 recognition by barley MLA1 is retained in transgenic Arabidopsis, indicating that AVR A1 directly binds MLA1 or that its recognition involves an evolutionarily conserved host target of AVR A1 Furthermore, analysis of transcriptome-wide sequence variation among the Bgh isolates provides evidence for Bgh population structure that is partially linked to geographic isolation.

Capturing novel mouse genes encoding chromosomal and other nuclear proteins.

PubMed

Tate, P; Lee, M; Tweedie, S; Skarnes, W C; Bickmore, W A

1998-09-01

The burgeoning wealth of gene sequences contrasts with our ignorance of gene function. One route to assigning function is by determining the sub-cellular location of proteins. We describe the identification of mouse genes encoding proteins that are confined to nuclear compartments by splicing endogeneous gene sequences to a promoterless betageo reporter, using a gene trap approach. Mouse ES (embryonic stem) cell lines were identified that express betageo fusions located within sub-nuclear compartments, including chromosomes, the nucleolus and foci containing splicing factors. The sequences of 11 trapped genes were ascertained, and characterisation of endogenous protein distribution in two cases confirmed the validity of the approach. Three novel proteins concentrated within distinct chromosomal domains were identified, one of which appears to be a serine/threonine kinase. The sequence of a gene whose product co-localises with splicesome components suggests that this protein may be an E3 ubiquitin-protein ligase. The majority of the other genes isolated represent novel genes. This approach is shown to be a powerful tool for identifying genes encoding novel proteins with specific sub-nuclear localisations and exposes our ignorance of the protein composition of the nucleus. Motifs in two of the isolated genes suggest new links between cellular regulatory mechanisms (ubiquitination and phosphorylation) and mRNA splicing and chromosome structure/function.

Sequencing of the variable region of rpsB to discriminate between Streptococcus pneumoniae and other streptococcal species.

PubMed

Wyllie, Anne L; Pannekoek, Yvonne; Bovenkerk, Sandra; van Engelsdorp Gastelaars, Jody; Ferwerda, Bart; van de Beek, Diederik; Sanders, Elisabeth A M; Trzciński, Krzysztof; van der Ende, Arie

2017-09-01

The vast majority of streptococci colonizing the human upper respiratory tract are commensals, only sporadically implicated in disease. Of these, the most pathogenic is Mitis group member, Streptococcus pneumoniae Phenotypic and genetic similarities between streptococci can cause difficulties in species identification. Using ribosomal S2-gene sequences extracted from whole-genome sequences published from 501 streptococci, we developed a method to identify streptococcal species. We validated this method on non-pneumococcal isolates cultured from cases of severe streptococcal disease ( n = 101) and from carriage ( n = 103), and on non-typeable pneumococci from asymptomatic individuals ( n = 17) and on whole-genome sequences of 1157 pneumococcal isolates from meningitis in the Netherlands. Following this, we tested 221 streptococcal isolates in molecular assays originally assumed specific for S. pneumoniae , targeting cpsA , lytA , piaB , ply , Spn9802, zmpC and capsule-type-specific genes. Cluster analysis of S2-sequences showed grouping according to species in line with published phylogenies of streptococcal core genomes. S2-typing convincingly distinguished pneumococci from non-pneumococcal species (99.2% sensitivity, 100% specificity). Molecular assays targeting regions of lytA and piaB were 100% specific for S. pneumoniae , whereas assays targeting cpsA , ply , Spn9802, zmpC and selected serotype-specific assays (but not capsular sequence typing) showed a lack of specificity. False positive results were over-represented in species associated with carriage, although no particular confounding signal was unique for carriage isolates. © 2017 The Authors.

Sequencing of the variable region of rpsB to discriminate between Streptococcus pneumoniae and other streptococcal species

PubMed Central

Pannekoek, Yvonne; Bovenkerk, Sandra; van Engelsdorp Gastelaars, Jody; Ferwerda, Bart; van de Beek, Diederik; Sanders, Elisabeth A. M.; Trzciński, Krzysztof; van der Ende, Arie

2017-01-01

The vast majority of streptococci colonizing the human upper respiratory tract are commensals, only sporadically implicated in disease. Of these, the most pathogenic is Mitis group member, Streptococcus pneumoniae. Phenotypic and genetic similarities between streptococci can cause difficulties in species identification. Using ribosomal S2-gene sequences extracted from whole-genome sequences published from 501 streptococci, we developed a method to identify streptococcal species. We validated this method on non-pneumococcal isolates cultured from cases of severe streptococcal disease (n = 101) and from carriage (n = 103), and on non-typeable pneumococci from asymptomatic individuals (n = 17) and on whole-genome sequences of 1157 pneumococcal isolates from meningitis in the Netherlands. Following this, we tested 221 streptococcal isolates in molecular assays originally assumed specific for S. pneumoniae, targeting cpsA, lytA, piaB, ply, Spn9802, zmpC and capsule-type-specific genes. Cluster analysis of S2-sequences showed grouping according to species in line with published phylogenies of streptococcal core genomes. S2-typing convincingly distinguished pneumococci from non-pneumococcal species (99.2% sensitivity, 100% specificity). Molecular assays targeting regions of lytA and piaB were 100% specific for S. pneumoniae, whereas assays targeting cpsA, ply, Spn9802, zmpC and selected serotype-specific assays (but not capsular sequence typing) showed a lack of specificity. False positive results were over-represented in species associated with carriage, although no particular confounding signal was unique for carriage isolates. PMID:28931649

Development of an oligonucleotide probe for Aureobasidium pullulans based on the small-subunit rRNA gene.

PubMed Central

Li, S; Cullen, D; Hjort, M; Spear, R; Andrews, J H

1996-01-01

Aureobasidium pullulans, a cosmopolitan yeast-like fungus, colonizes leaf surfaces and has potential as a biocontrol agent of pathogens. To assess the feasibility of rRNA as a target for A. pullulans-specific oligonucleotide probes, we compared the nucleotide sequences of the small-subunit rRNA (18S) genes of 12 geographically diverse A. pullulans strains. Extreme sequence conservation was observed. The consensus A. pullulans sequence was compared with other fungal sequences to identify potential probes. A 21-mer probe which hybridized to the 12 A. pullulans strains but not to 98 other fungi, including 82 isolates from the phylloplane, was identified. A 17-mer highly specific for Cladosporium herbarum was also identified. These probes have potential in monitoring and quantifying fungi in leaf surface and other microbial communities. PMID:8633850

Avian W and mammalian Y chromosomes convergently retained dosage-sensitive regulators

PubMed Central

Bellott, Daniel W.; Skaletsky, Helen; Cho, Ting-Jan; Brown, Laura; Locke, Devin; Chen, Nancy; Galkina, Svetlana; Pyntikova, Tatyana; Koutseva, Natalia; Graves, Tina; Kremitzki, Colin; Warren, Wesley C.; Clark, Andrew G.; Gaginskaya, Elena; Wilson, Richard K.; Page, David C.

2017-01-01

After birds diverged from mammals, different ancestral autosomes evolved into sex chromosomes in each lineage. In birds, females are ZW and males ZZ, but in mammals females are XX and males XY. We sequenced the chicken W chromosome, compared its gene content with our reconstruction of the ancestral autosomes, and followed the evolutionary trajectory of ancestral W-linked genes across birds. Avian W chromosomes evolved in parallel with mammalian Y chromosomes, preserving ancestral genes through selection to maintain the dosage of broadly-expressed regulators of key cellular processes. We propose that, like the human Y chromosome, the chicken W chromosome is essential for embryonic viability of the heterogametic sex. Unlike other sequenced sex chromosomes, the chicken W did not acquire and amplify genes specifically expressed in reproductive tissues. We speculate that the pressures that drive the acquisition of reproduction related genes on sex chromosomes may be specific to the male germ line. PMID:28135246

Improving the genome annotation of the acarbose producer Actinoplanes sp. SE50/110 by sequencing enriched 5'-ends of primary transcripts.

PubMed

Schwientek, Patrick; Neshat, Armin; Kalinowski, Jörn; Klein, Andreas; Rückert, Christian; Schneiker-Bekel, Susanne; Wendler, Sergej; Stoye, Jens; Pühler, Alfred

2014-11-20

Actinoplanes sp. SE50/110 is the producer of the alpha-glucosidase inhibitor acarbose, which is an economically relevant and potent drug in the treatment of type-2 diabetes mellitus. In this study, we present the detection of transcription start sites on this genome by sequencing enriched 5'-ends of primary transcripts. Altogether, 1427 putative transcription start sites were initially identified. With help of the annotated genome sequence, 661 transcription start sites were found to belong to the leader region of protein-coding genes with the surprising result that roughly 20% of these genes rank among the class of leaderless transcripts. Next, conserved promoter motifs were identified for protein-coding genes with and without leader sequences. The mapped transcription start sites were finally used to improve the annotation of the Actinoplanes sp. SE50/110 genome sequence. Concerning protein-coding genes, 41 translation start sites were corrected and 9 novel protein-coding genes could be identified. In addition to this, 122 previously undetermined non-coding RNA (ncRNA) genes of Actinoplanes sp. SE50/110 were defined. Focusing on antisense transcription start sites located within coding genes or their leader sequences, it was discovered that 96 of those ncRNA genes belong to the class of antisense RNA (asRNA) genes. The remaining 26 ncRNA genes were found outside of known protein-coding genes. Four chosen examples of prominent ncRNA genes, namely the transfer messenger RNA gene ssrA, the ribonuclease P class A RNA gene rnpB, the cobalamin riboswitch RNA gene cobRS, and the selenocysteine-specific tRNA gene selC, are presented in more detail. This study demonstrates that sequencing of enriched 5'-ends of primary transcripts and the identification of transcription start sites are valuable tools for advanced genome annotation of Actinoplanes sp. SE50/110 and most probably also for other bacteria. Copyright © 2014 Elsevier B.V. All rights reserved.

Novel Molecular Method for Identification of Streptococcus pneumoniae Applicable to Clinical Microbiology and 16S rRNA Sequence-Based Microbiome Studies

PubMed Central

Scholz, Christian F. P.; Poulsen, Knud

2012-01-01

The close phylogenetic relationship of the important pathogen Streptococcus pneumoniae and several species of commensal streptococci, particularly Streptococcus mitis and Streptococcus pseudopneumoniae, and the recently demonstrated sharing of genes and phenotypic traits previously considered specific for S. pneumoniae hamper the exact identification of S. pneumoniae. Based on sequence analysis of 16S rRNA genes of a collection of 634 streptococcal strains, identified by multilocus sequence analysis, we detected a cytosine at position 203 present in all 440 strains of S. pneumoniae but replaced by an adenosine residue in all strains representing other species of mitis group streptococci. The S. pneumoniae-specific sequence signature could be demonstrated by sequence analysis or indirectly by restriction endonuclease digestion of a PCR amplicon covering the site. The S. pneumoniae-specific signature offers an inexpensive means for validation of the identity of clinical isolates and should be used as an integrated marker in the annotation procedure employed in 16S rRNA-based molecular studies of complex human microbiotas. This may avoid frequent misidentifications such as those we demonstrate to have occurred in previous reports and in reference sequence databases. PMID:22442329

Sequence and expression variations suggest an adaptive role for the DA1-like gene family in the evolution of soybeans.

PubMed

Zhao, Man; Gu, Yongzhe; He, Lingli; Chen, Qingshan; He, Chaoying

2015-05-15

The DA1 gene family is plant-specific and Arabidopsis DA1 regulates seed and organ size, but the functions in soybeans are unknown. The cultivated soybean (Glycine max) is believed to be domesticated from the annual wild soybeans (Glycine soja). To evaluate whether DA1-like genes were involved in the evolution of soybeans, we compared variation at both sequence and expression levels of DA1-like genes from G. max (GmaDA1) and G. soja (GsoDA1). Sequence identities were extremely high between the orthologous pairs between soybeans, while the paralogous copies in a soybean species showed a relatively high divergence. Moreover, the expression variation of DA1-like paralogous genes in soybean was much greater than the orthologous gene pairs between the wild and cultivated soybeans during development and challenging abiotic stresses such as salinity. We further found that overexpressing GsoDA1 genes did not affect seed size. Nevertheless, overexpressing them reduced transgenic Arabidopsis seed germination sensitivity to salt stress. Moreover, most of these genes could improve salt tolerance of the transgenic Arabidopsis plants, corroborated by a detection of expression variation of several key genes in the salt-tolerance pathways. Our work suggested that expression diversification of DA1-like genes is functionally associated with adaptive radiation of soybeans, reinforcing that the plant-specific DA1 gene family might have contributed to the successful adaption to complex environments and radiation of the plants.

Development of a real-time PCR method for the differential detection and quantification of four solanaceae in GMO analysis: potato (Solanum tuberosum), tomato (Solanum lycopersicum), eggplant (Solanum melongena), and pepper (Capsicum annuum).

PubMed

Chaouachi, Maher; El Malki, Redouane; Berard, Aurélie; Romaniuk, Marcel; Laval, Valérie; Brunel, Dominique; Bertheau, Yves

2008-03-26

The labeling of products containing genetically modified organisms (GMO) is linked to their quantification since a threshold for the presence of fortuitous GMOs in food has been established. This threshold is calculated from a combination of two absolute quantification values: one for the specific GMO target and the second for an endogenous reference gene specific to the taxon. Thus, the development of reliable methods to quantify GMOs using endogenous reference genes in complex matrixes such as food and feed is needed. Plant identification can be difficult in the case of closely related taxa, which moreover are subject to introgression events. Based on the homology of beta-fructosidase sequences obtained from public databases, two couples of consensus primers were designed for the detection, quantification, and differentiation of four Solanaceae: potato (Solanum tuberosum), tomato (Solanum lycopersicum), pepper (Capsicum annuum), and eggplant (Solanum melongena). Sequence variability was studied first using lines and cultivars (intraspecies sequence variability), then using taxa involved in gene introgressions, and finally, using taxonomically close taxa (interspecies sequence variability). This study allowed us to design four highly specific TaqMan-MGB probes. A duplex real time PCR assay was developed for simultaneous quantification of tomato and potato. For eggplant and pepper, only simplex real time PCR tests were developed. The results demonstrated the high specificity and sensitivity of the assays. We therefore conclude that beta-fructosidase can be used as an endogenous reference gene for GMO analysis.

Microbial metatranscriptomics in a permanent marine oxygen minimum zone.

PubMed

Stewart, Frank J; Ulloa, Osvaldo; DeLong, Edward F

2012-01-01

Simultaneous characterization of taxonomic composition, metabolic gene content and gene expression in marine oxygen minimum zones (OMZs) has potential to broaden perspectives on the microbial and biogeochemical dynamics in these environments. Here, we present a metatranscriptomic survey of microbial community metabolism in the Eastern Tropical South Pacific OMZ off northern Chile. Community RNA was sampled in late austral autumn from four depths (50, 85, 110, 200 m) extending across the oxycline and into the upper OMZ. Shotgun pyrosequencing of cDNA yielded 180,000 to 550,000 transcript sequences per depth. Based on functional gene representation, transcriptome samples clustered apart from corresponding metagenome samples from the same depth, highlighting the discrepancies between metabolic potential and actual transcription. BLAST-based characterizations of non-ribosomal RNA sequences revealed a dominance of genes involved with both oxidative (nitrification) and reductive (anammox, denitrification) components of the marine nitrogen cycle. Using annotations of protein-coding genes as proxies for taxonomic affiliation, we observed depth-specific changes in gene expression by key functional taxonomic groups. Notably, transcripts most closely matching the genome of the ammonia-oxidizing archaeon Nitrosopumilus maritimus dominated the transcriptome in the upper three depths, representing one in five protein-coding transcripts at 85 m. In contrast, transcripts matching the anammox bacterium Kuenenia stuttgartiensis dominated at the core of the OMZ (200 m; 1 in 12 protein-coding transcripts). The distribution of N. maritimus-like transcripts paralleled that of transcripts matching ammonia monooxygenase genes, which, despite being represented by both bacterial and archaeal sequences in the community DNA, were dominated (> 99%) by archaeal sequences in the RNA, suggesting a substantial role for archaeal nitrification in the upper OMZ. These data, as well as those describing other key OMZ metabolic processes (e.g. sulfur oxidation), highlight gene-specific expression patterns in the context of the entire community transcriptome, as well as identify key functional groups for taxon-specific genomic profiling. © 2011 Society for Applied Microbiology and Blackwell Publishing Ltd.

Targeted amplicon sequencing (TAS): a scalable next-gen approach to multilocus, multitaxa phylogenetics.

PubMed

Bybee, Seth M; Bracken-Grissom, Heather; Haynes, Benjamin D; Hermansen, Russell A; Byers, Robert L; Clement, Mark J; Udall, Joshua A; Wilcox, Edward R; Crandall, Keith A

2011-01-01

Next-gen sequencing technologies have revolutionized data collection in genetic studies and advanced genome biology to novel frontiers. However, to date, next-gen technologies have been used principally for whole genome sequencing and transcriptome sequencing. Yet many questions in population genetics and systematics rely on sequencing specific genes of known function or diversity levels. Here, we describe a targeted amplicon sequencing (TAS) approach capitalizing on next-gen capacity to sequence large numbers of targeted gene regions from a large number of samples. Our TAS approach is easily scalable, simple in execution, neither time-nor labor-intensive, relatively inexpensive, and can be applied to a broad diversity of organisms and/or genes. Our TAS approach includes a bioinformatic application, BarcodeCrucher, to take raw next-gen sequence reads and perform quality control checks and convert the data into FASTA format organized by gene and sample, ready for phylogenetic analyses. We demonstrate our approach by sequencing targeted genes of known phylogenetic utility to estimate a phylogeny for the Pancrustacea. We generated data from 44 taxa using 68 different 10-bp multiplexing identifiers. The overall quality of data produced was robust and was informative for phylogeny estimation. The potential for this method to produce copious amounts of data from a single 454 plate (e.g., 325 taxa for 24 loci) significantly reduces sequencing expenses incurred from traditional Sanger sequencing. We further discuss the advantages and disadvantages of this method, while offering suggestions to enhance the approach.

Targeted Amplicon Sequencing (TAS): A Scalable Next-Gen Approach to Multilocus, Multitaxa Phylogenetics

PubMed Central

Bybee, Seth M.; Bracken-Grissom, Heather; Haynes, Benjamin D.; Hermansen, Russell A.; Byers, Robert L.; Clement, Mark J.; Udall, Joshua A.; Wilcox, Edward R.; Crandall, Keith A.

2011-01-01

Next-gen sequencing technologies have revolutionized data collection in genetic studies and advanced genome biology to novel frontiers. However, to date, next-gen technologies have been used principally for whole genome sequencing and transcriptome sequencing. Yet many questions in population genetics and systematics rely on sequencing specific genes of known function or diversity levels. Here, we describe a targeted amplicon sequencing (TAS) approach capitalizing on next-gen capacity to sequence large numbers of targeted gene regions from a large number of samples. Our TAS approach is easily scalable, simple in execution, neither time-nor labor-intensive, relatively inexpensive, and can be applied to a broad diversity of organisms and/or genes. Our TAS approach includes a bioinformatic application, BarcodeCrucher, to take raw next-gen sequence reads and perform quality control checks and convert the data into FASTA format organized by gene and sample, ready for phylogenetic analyses. We demonstrate our approach by sequencing targeted genes of known phylogenetic utility to estimate a phylogeny for the Pancrustacea. We generated data from 44 taxa using 68 different 10-bp multiplexing identifiers. The overall quality of data produced was robust and was informative for phylogeny estimation. The potential for this method to produce copious amounts of data from a single 454 plate (e.g., 325 taxa for 24 loci) significantly reduces sequencing expenses incurred from traditional Sanger sequencing. We further discuss the advantages and disadvantages of this method, while offering suggestions to enhance the approach. PMID:22002916

The Goddard and Saturn Genes Are Essential for Drosophila Male Fertility and May Have Arisen De Novo

PubMed Central

Gubala, Anna M.; Schmitz, Jonathan F.; Kearns, Michael J.; Vinh, Tery T.; Bornberg-Bauer, Erich; Wolfner, Mariana F.

2017-01-01

New genes arise through a variety of mechanisms, including the duplication of existing genes and the de novo birth of genes from noncoding DNA sequences. While there are numerous examples of duplicated genes with important functional roles, the functions of de novo genes remain largely unexplored. Many newly evolved genes are expressed in the male reproductive tract, suggesting that these evolutionary innovations may provide advantages to males experiencing sexual selection. Using testis-specific RNA interference, we screened 11 putative de novo genes in Drosophila melanogaster for effects on male fertility and identified two, goddard and saturn, that are essential for spermatogenesis and sperm function. Goddard knockdown (KD) males fail to produce mature sperm, while saturn KD males produce few sperm, and these function inefficiently once transferred to females. Consistent with a de novo origin, both genes are identifiable only in Drosophila and are predicted to encode proteins with no sequence similarity to any annotated protein. However, since high levels of divergence prevented the unambiguous identification of the noncoding sequences from which each gene arose, we consider goddard and saturn to be putative de novo genes. Within Drosophila, both genes have been lost in certain lineages, but show conserved, male-specific patterns of expression in the species in which they are found. Goddard is consistently found in single-copy and evolves under purifying selection. In contrast, saturn has diversified through gene duplication and positive selection. These data suggest that de novo genes can acquire essential roles in male reproduction. PMID:28104747

Design and Evaluation of Illumina MiSeq-Compatible, 18S rRNA Gene-Specific Primers for Improved Characterization of Mixed Phototrophic Communities.

PubMed

Bradley, Ian M; Pinto, Ameet J; Guest, Jeremy S

2016-10-01

The use of high-throughput sequencing technologies with the 16S rRNA gene for characterization of bacterial and archaeal communities has become routine. However, the adoption of sequencing methods for eukaryotes has been slow, despite their significance to natural and engineered systems. There are large variations among the target genes used for amplicon sequencing, and for the 18S rRNA gene, there is no consensus on which hypervariable region provides the most suitable representation of diversity. Additionally, it is unclear how much PCR/sequencing bias affects the depiction of community structure using current primers. The present study amplified the V4 and V8-V9 regions from seven microalgal mock communities as well as eukaryotic communities from freshwater, coastal, and wastewater samples to examine the effect of PCR/sequencing bias on community structure and membership. We found that degeneracies on the 3' end of the current V4-specific primers impact read length and mean relative abundance. Furthermore, the PCR/sequencing error is markedly higher for GC-rich members than for communities with balanced GC content. Importantly, the V4 region failed to reliably capture 2 of the 12 mock community members, and the V8-V9 hypervariable region more accurately represents mean relative abundance and alpha and beta diversity. Overall, the V4 and V8-V9 regions show similar community representations over freshwater, coastal, and wastewater environments, but specific samples show markedly different communities. These results indicate that multiple primer sets may be advantageous for gaining a more complete understanding of community structure and highlight the importance of including mock communities composed of species of interest. The quantification of error associated with community representation by amplicon sequencing is a critical challenge that is often ignored. When target genes are amplified using currently available primers, differential amplification efficiencies result in inaccurate estimates of community structure. The extent to which amplification bias affects community representation and the accuracy with which different gene targets represent community structure are not known. As a result, there is no consensus on which region provides the most suitable representation of diversity for eukaryotes. This study determined the accuracy with which commonly used 18S rRNA gene primer sets represent community structure and identified particular biases related to PCR amplification and Illumina MiSeq sequencing in order to more accurately study eukaryotic microbial communities. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Characterization of rpoB mutations in rifampin-resistant clinical Mycobacterium tuberculosis isolates from Kuwait and Dubai.

PubMed

Ahmad, Suhail; Mokaddas, Eiman; Fares, Esther

2002-11-01

Mutations conferring resistance to rifampin in rifampin-resistant clinical Mycobacterium tuberculosis isolates occur mostly in the 81 bp rifampin-resistance-determining region (RRDR) of the rpoB gene. In this study, 29 rifampin-resistant and 12 -susceptible clinical M. tuberculosis isolates were tested for characterization of mutations in the rpoB gene by line probe (INNO-LiPA Rif. TB) assay and the results were confirmed and extended by DNA sequencing of the PCR amplified target DNA. The line probe assay identified all 12 susceptible strains as rifampin-sensitive and the DNA sequence of RRDR in the amplified rpoB gene from two isolates matched perfectly with the wild-type sequence. The line probe assay identified 28 resistant isolates as rifampin-resistant with specific detection of mutation in 22 isolates including one isolate that exhibited hetro-resistance containing both the wild-type pattern as well as a specific mutation within RRDR while one of the rifampin-resistant strain was identified as rifampin-susceptible. DNA sequencing confirmed these results and, in addition, led to the specific detection of mutations in 5 rifampin-resistant isolates in which specific base changes within RRDR could not be determined by the line probe assay. These analyses identified 8 different mutations within RRDR of the rpoB gene including one novel mutation (S522W) that has not been reported so far. The genotyping performed on the isolates carrying similar mutations showed that majority of these isolates were unique as they exhibited varying DNA banding patterns. Correlating the ethnic origin of the infected TB patients with the occurrence of specific mutations at three main codon positions (516, 526 and 531) in the rpoB gene showed that most patients (11 of 15) from South Asian region contained mutations at codon 526 while majority of isolates from patients (6 of 11) of Middle Eastern origin contained mutations at codon 531.

Characterization of full-length sequenced cDNA inserts (FLIcs) from Atlantic salmon (Salmo salar)

PubMed Central

Andreassen, Rune; Lunner, Sigbjørn; Høyheim, Bjørn

2009-01-01

Background Sequencing of the Atlantic salmon genome is now being planned by an international research consortium. Full-length sequenced inserts from cDNAs (FLIcs) are an important tool for correct annotation and clustering of the genomic sequence in any species. The large amount of highly similar duplicate sequences caused by the relatively recent genome duplication in the salmonid ancestor represents a particular challenge for the genome project. FLIcs will therefore be an extremely useful resource for the Atlantic salmon sequencing project. In addition to be helpful in order to distinguish between duplicate genome regions and in determining correct gene structures, FLIcs are an important resource for functional genomic studies and for investigation of regulatory elements controlling gene expression. In contrast to the large number of ESTs available, including the ESTs from 23 developmental and tissue specific cDNA libraries contributed by the Salmon Genome Project (SGP), the number of sequences where the full-length of the cDNA insert has been determined has been small. Results High quality full-length insert sequences from 560 pre-smolt white muscle tissue specific cDNAs were generated, accession numbers [GenBank: BT043497 - BT044056]. Five hundred and ten (91%) of the transcripts were annotated using Gene Ontology (GO) terms and 440 of the FLIcs are likely to contain a complete coding sequence (cCDS). The sequence information was used to identify putative paralogs, characterize salmon Kozak motifs, polyadenylation signal variation and to identify motifs likely to be involved in the regulation of particular genes. Finally, conserved 7-mers in the 3'UTRs were identified, of which some were identical to miRNA target sequences. Conclusion This paper describes the first Atlantic salmon FLIcs from a tissue and developmental stage specific cDNA library. We have demonstrated that many FLIcs contained a complete coding sequence (cCDS). This suggests that the remaining cDNA libraries generated by SGP represent a valuable cCDS FLIc source. The conservation of 7-mers in 3'UTRs indicates that these motifs are functionally important. Identity between some of these 7-mers and miRNA target sequences suggests that they are miRNA targets in Salmo salar transcripts as well. PMID:19878547

Phylogenetic analysis reveals conservation and diversification of micro RNA166 genes among diverse plant species.

PubMed

Barik, Suvakanta; SarkarDas, Shabari; Singh, Archita; Gautam, Vibhav; Kumar, Pramod; Majee, Manoj; Sarkar, Ananda K

2014-01-01

Similar to the majority of the microRNAs, mature miR166s are derived from multiple members of MIR166 genes (precursors) and regulate various aspects of plant development by negatively regulating their target genes (Class III HD-ZIP). The evolutionary conservation or functional diversification of miRNA166 family members remains elusive. Here, we show the phylogenetic relationships among MIR166 precursor and mature sequences from three diverse model plant species. Despite strong conservation, some mature miR166 sequences, such as ppt-miR166m, have undergone sequence variation. Critical sequence variation in ppt-miR166m has led to functional diversification, as it targets non-HD-ZIPIII gene transcript (s). MIR166 precursor sequences have diverged in a lineage specific manner, and both precursors and mature osa-miR166i/j are highly conserved. Interestingly, polycistronic MIR166s were present in Physcomitrella and Oryza but not in Arabidopsis. The nature of cis-regulatory motifs on the upstream promoter sequences of MIR166 genes indicates their possible contribution to the functional variation observed among miR166 species. Copyright © 2013 Elsevier Inc. All rights reserved.

Mollusk genes encoding lysine tRNA (UUU) contain introns.

PubMed

Matsuo, M; Abe, Y; Saruta, Y; Okada, N

1995-11-20

New intron-containing genes encoding tRNAs were discovered when genomic DNA isolated from various animal species was amplified by the polymerase chain reaction (PCR) with primers based on sequences of rabbit tRNA(Lys). From sequencing analysis of the products of PCR, we found that introns are present in several genes encoding tRNA(Lys) in mollusks, such as Loligo bleekeri (squid) and Octopus vulgaris (octopus). These introns were specific to genes encoding tRNA(Lys)(CUU) and were not present in genes encoding tRNA(Lys)(CUU). In addition, the sequences of the introns were different from one another. To confirm the results of our initial experiments, we isolated and sequenced genes encoding tRNA(Lys)(CUU) and tRNA(Lys)(UUU). The gene for tRNA(Lys)(UUU) from squid contained an intron, whose sequence was the same as that identified by PCR, and the gene formed a cluster with a corresponding pseudogene. Several DNA regions of 2.1 kb containing this cluster appeared to be tandemly arrayed in the squid genome. By contrast, the gene encoding tRNA(Lys)(CUU) did not contain an intron, as shown also by PCR. The tRNA(Lys)(UUU) that corresponded to the analyzed gene was isolated and characterized. The present study provides the first example of an intron-containing gene encoding a tRNA in mollusks and suggests the universality of introns in such genes in higher eukaryotes.

Generation of a total of 6483 expressed sequence tags from 60 day-old bovine whole fetus and fetal placenta.

PubMed

Oishi, M; Gohma, H; Lejukole, H Y; Taniguchi, Y; Yamada, T; Suzuki, K; Shinkai, H; Uenishi, H; Yasue, H; Sasaki, Y

2004-05-01

Expressed sequence tags (ESTs) generated based on characterization of clones isolated randomly from cDNA libraries are used to study gene expression profiles in specific tissues and to provide useful information for characterizing tissue physiology. In this study, two directionally cloned cDNA libraries were constructed from 60 day-old bovine whole fetus and fetal placenta. We have characterized 5357 and 1126 clones, and then identified 3464 and 795 unique sequences for the fetus and placenta cDNA libraries: 1851 and 504 showed homology to already identified genes, and 1613 and 291 showed no significant matches to any of the sequences in DNA databases, respectively. Further, we found 94 unique sequences overlapping in both the fetus and the placenta, leading to a catalog of 4165 genes expressed in 60 day-old fetus and placenta. The catalog is used to examine expression profile of genes in 60 day-old bovine fetus and placenta.

Deep sequencing of the viral phoH gene reveals temporal variation, depth-specific composition, and persistent dominance of the same viral phoH genes in the Sargasso Sea

PubMed Central

Goldsmith, Dawn B.; Parsons, Rachel J.; Beyene, Damitu; Salamon, Peter

2015-01-01

Deep sequencing of the viral phoH gene, a host-derived auxiliary metabolic gene, was used to track viral diversity throughout the water column at the Bermuda Atlantic Time-series Study (BATS) site in the summer (September) and winter (March) of three years. Viral phoH sequences reveal differences in the viral communities throughout a depth profile and between seasons in the same year. Variation was also detected between the same seasons in subsequent years, though these differences were not as great as the summer/winter distinctions. Over 3,600 phoH operational taxonomic units (OTUs; 97% sequence identity) were identified. Despite high richness, most phoH sequences belong to a few large, common OTUs whereas the majority of the OTUs are small and rare. While many OTUs make sporadic appearances at just a few times or depths, a small number of OTUs dominate the community throughout the seasons, depths, and years. PMID:26157645

IMNGS: A comprehensive open resource of processed 16S rRNA microbial profiles for ecology and diversity studies.

PubMed

Lagkouvardos, Ilias; Joseph, Divya; Kapfhammer, Martin; Giritli, Sabahattin; Horn, Matthias; Haller, Dirk; Clavel, Thomas

2016-09-23

The SRA (Sequence Read Archive) serves as primary depository for massive amounts of Next Generation Sequencing data, and currently host over 100,000 16S rRNA gene amplicon-based microbial profiles from various host habitats and environments. This number is increasing rapidly and there is a dire need for approaches to utilize this pool of knowledge. Here we created IMNGS (Integrated Microbial Next Generation Sequencing), an innovative platform that uniformly and systematically screens for and processes all prokaryotic 16S rRNA gene amplicon datasets available in SRA and uses them to build sample-specific sequence databases and OTU-based profiles. Via a web interface, this integrative sequence resource can easily be queried by users. We show examples of how the approach allows testing the ecological importance of specific microorganisms in different hosts or ecosystems, and performing targeted diversity studies for selected taxonomic groups. The platform also offers a complete workflow for de novo analysis of users' own raw 16S rRNA gene amplicon datasets for the sake of comparison with existing data. IMNGS can be accessed at www.imngs.org.

LOVD: easy creation of a locus-specific sequence variation database using an "LSDB-in-a-box" approach.

PubMed

Fokkema, Ivo F A C; den Dunnen, Johan T; Taschner, Peter E M

2005-08-01

The completion of the human genome project has initiated, as well as provided the basis for, the collection and study of all sequence variation between individuals. Direct access to up-to-date information on sequence variation is currently provided most efficiently through web-based, gene-centered, locus-specific databases (LSDBs). We have developed the Leiden Open (source) Variation Database (LOVD) software approaching the "LSDB-in-a-Box" idea for the easy creation and maintenance of a fully web-based gene sequence variation database. LOVD is platform-independent and uses PHP and MySQL open source software only. The basic gene-centered and modular design of the database follows the recommendations of the Human Genome Variation Society (HGVS) and focuses on the collection and display of DNA sequence variations. With minimal effort, the LOVD platform is extendable with clinical data. The open set-up should both facilitate and promote functional extension with scripts written by the community. The LOVD software is freely available from the Leiden Muscular Dystrophy pages (www.DMD.nl/LOVD/). To promote the use of LOVD, we currently offer curators the possibility to set up an LSDB on our Leiden server. (c) 2005 Wiley-Liss, Inc.

Computational annotation of genes differentially expressed along olive fruit development

PubMed Central

Galla, Giulio; Barcaccia, Gianni; Ramina, Angelo; Collani, Silvio; Alagna, Fiammetta; Baldoni, Luciana; Cultrera, Nicolò GM; Martinelli, Federico; Sebastiani, Luca; Tonutti, Pietro

2009-01-01

Background Olea europaea L. is a traditional tree crop of the Mediterranean basin with a worldwide economical high impact. Differently from other fruit tree species, little is known about the physiological and molecular basis of the olive fruit development and a few sequences of genes and gene products are available for olive in public databases. This study deals with the identification of large sets of differentially expressed genes in developing olive fruits and the subsequent computational annotation by means of different software. Results mRNA from fruits of the cv. Leccino sampled at three different stages [i.e., initial fruit set (stage 1), completed pit hardening (stage 2) and veraison (stage 3)] was used for the identification of differentially expressed genes putatively involved in main processes along fruit development. Four subtractive hybridization libraries were constructed: forward and reverse between stage 1 and 2 (libraries A and B), and 2 and 3 (libraries C and D). All sequenced clones (1,132 in total) were analyzed through BlastX against non-redundant NCBI databases and about 60% of them showed similarity to known proteins. A total of 89 out of 642 differentially expressed unique sequences was further investigated by Real-Time PCR, showing a validation of the SSH results as high as 69%. Library-specific cDNA repertories were annotated according to the three main vocabularies of the gene ontology (GO): cellular component, biological process and molecular function. BlastX analysis, GO terms mapping and annotation analysis were performed using the Blast2GO software, a research tool designed with the main purpose of enabling GO based data mining on sequence sets for which no GO annotation is yet available. Bioinformatic analysis pointed out a significantly different distribution of the annotated sequences for each GO category, when comparing the three fruit developmental stages. The olive fruit-specific transcriptome dataset was used to query all known KEGG (Kyoto Encyclopaedia of Genes and Genomes) metabolic pathways for characterizing and positioning retrieved EST records. The integration of the olive sequence datasets within the MapMan platform for microarray analysis allowed the identification of specific biosynthetic pathways useful for the definition of key functional categories in time course analyses for gene groups. Conclusion The bioinformatic annotation of all gene sequences was useful to shed light on metabolic pathways and transcriptional aspects related to carbohydrates, fatty acids, secondary metabolites, transcription factors and hormones as well as response to biotic and abiotic stresses throughout olive drupe development. These results represent a first step toward both functional genomics and systems biology research for understanding the gene functions and regulatory networks in olive fruit growth and ripening. PMID:19852839

Development of PCR protocols for specific identification of Clostridium spiroforme and detection of sas and sbs genes.

PubMed

Drigo, Ilenia; Bacchin, Cosetta; Cocchi, Monia; Bano, Luca; Agnoletti, Fabrizio

2008-10-15

Rabbit diarrhoea caused by toxigenic Clostridium spiroforme is responsible for significant losses in commercial rabbitries but the accurate identification of this micro-organism is difficult due to the absence of both a commercial biochemical panel and biomolecular methods. The aim of this study was therefore to develop PCR protocols for specific detection of C. spiroforme and its binary toxin encoding genes. The C. spiroforme specie-specific primers were designed based on its 16S rDNA published sequences and the specificity of these primers was tested with DNA extracted from closely related Clostridium species. The sa/bs_F and sa/bs _R C. spiroforme binary toxin specific primers were designed to be complementary, respectively, to a sequence of 21 bases on the 3' and of sas gene and on the 5' of the sbs gene. The detection limits of in house developed PCR protocols were 25CFU/ml of bacterial suspension and 1.38x10(4)CFU/g of caecal content for specie-specific primers and 80CFU/ml of bacterial suspension and 2.8x10(4)CFU/g of caecal content in case of sa/bs primers. These results indicated that the described PCR assays enable specific identification of C. spiroforme and its binary toxin genes and can therefore be considered a rapid, reliable tool for the diagnosis of C. spiroforme-related enterotoxaemia.

Genome sequence of the model medicinal mushroom Ganoderma lucidum

PubMed Central

Chen, Shilin; Xu, Jiang; Liu, Chang; Zhu, Yingjie; Nelson, David R.; Zhou, Shiguo; Li, Chunfang; Wang, Lizhi; Guo, Xu; Sun, Yongzhen; Luo, Hongmei; Li, Ying; Song, Jingyuan; Henrissat, Bernard; Levasseur, Anthony; Qian, Jun; Li, Jianqin; Luo, Xiang; Shi, Linchun; He, Liu; Xiang, Li; Xu, Xiaolan; Niu, Yunyun; Li, Qiushi; Han, Mira V.; Yan, Haixia; Zhang, Jin; Chen, Haimei; Lv, Aiping; Wang, Zhen; Liu, Mingzhu; Schwartz, David C.; Sun, Chao

2012-01-01

Ganoderma lucidum is a widely used medicinal macrofungus in traditional Chinese medicine that creates a diverse set of bioactive compounds. Here we report its 43.3-Mb genome, encoding 16,113 predicted genes, obtained using next-generation sequencing and optical mapping approaches. The sequence analysis reveals an impressive array of genes encoding cytochrome P450s (CYPs), transporters and regulatory proteins that cooperate in secondary metabolism. The genome also encodes one of the richest sets of wood degradation enzymes among all of the sequenced basidiomycetes. In all, 24 physical CYP gene clusters are identified. Moreover, 78 CYP genes are coexpressed with lanosterol synthase, and 16 of these show high similarity to fungal CYPs that specifically hydroxylate testosterone, suggesting their possible roles in triterpenoid biosynthesis. The elucidation of the G. lucidum genome makes this organism a potential model system for the study of secondary metabolic pathways and their regulation in medicinal fungi. PMID:22735441

The ergot alkaloid gene cluster in Claviceps purpurea: extension of the cluster sequence and intra species evolution.

PubMed

Haarmann, Thomas; Machado, Caroline; Lübbe, Yvonne; Correia, Telmo; Schardl, Christopher L; Panaccione, Daniel G; Tudzynski, Paul

2005-06-01

The genomic region of Claviceps purpurea strain P1 containing the ergot alkaloid gene cluster [Tudzynski, P., Hölter, K., Correia, T., Arntz, C., Grammel, N., Keller, U., 1999. Evidence for an ergot alkaloid gene cluster in Claviceps purpurea. Mol. Gen. Genet. 261, 133-141] was explored by chromosome walking, and additional genes probably involved in the ergot alkaloid biosynthesis have been identified. The putative cluster sequence (extending over 68.5kb) contains 4 different nonribosomal peptide synthetase (NRPS) genes and several putative oxidases. Northern analysis showed that most of the genes were co-regulated (repressed by high phosphate), and identified probable flanking genes by lack of co-regulation. Comparison of the cluster sequences of strain P1, an ergotamine producer, with that of strain ECC93, an ergocristine producer, showed high conservation of most of the cluster genes, but significant variation in the NRPS modules, strongly suggesting that evolution of these chemical races of C. purpurea is determined by evolution of NRPS module specificity.

Overdispersion of the Molecular Clock: Temporal Variation of Gene-Specific Substitution Rates in Drosophila

PubMed Central

Hartl, Daniel L.

2008-01-01

Simple models of molecular evolution assume that sequences evolve by a Poisson process in which nucleotide or amino acid substitutions occur as rare independent events. In these models, the expected ratio of the variance to the mean of substitution counts equals 1, and substitution processes with a ratio greater than 1 are called overdispersed. Comparing the genomes of 10 closely related species of Drosophila, we extend earlier evidence for overdispersion in amino acid replacements as well as in four-fold synonymous substitutions. The observed deviation from the Poisson expectation can be described as a linear function of the rate at which substitutions occur on a phylogeny, which implies that deviations from the Poisson expectation arise from gene-specific temporal variation in substitution rates. Amino acid sequences show greater temporal variation in substitution rates than do four-fold synonymous sequences. Our findings provide a general phenomenological framework for understanding overdispersion in the molecular clock. Also, the presence of substantial variation in gene-specific substitution rates has broad implications for work in phylogeny reconstruction and evolutionary rate estimation. PMID:18480070

A "signal on" protection-displacement-hybridization-based electrochemical hepatitis B virus gene sequence sensor with high sensitivity and peculiar adjustable specificity.

PubMed

Li, Fengqin; Xu, Yanmei; Yu, Xiang; Yu, Zhigang; He, Xunjun; Ji, Hongrui; Dong, Jinghao; Song, Yongbin; Yan, Hong; Zhang, Guiling

2016-08-15

One "signal on" electrochemical sensing strategy was constructed for the detection of a specific hepatitis B virus (HBV) gene sequence based on the protection-displacement-hybridization-based (PDHB) signaling mechanism. This sensing system is composed of three probes, one capturing probe (CP) and one assistant probe (AP) which are co-immobilized on the Au electrode surface, and one 3-methylene blue (MB) modified signaling probe (SP) free in the detection solution. One duplex are formed between AP and SP with the target, a specific HBV gene sequence, hybridizing with CP. This structure can drive the MB labels close to the electrode surface, thereby producing a large detection current. Two electrochemical testing techniques, alternating current voltammetry (ACV) and cyclic voltammetry (CV), were used for characterizing the sensor. Under the optimized conditions, the proposed sensor exhibits a high sensitivity with the detection limit of ∼5fM for the target. When used for the discrimination of point mutation, the sensor also features an outstanding ability and its peculiar high adjustability. Copyright © 2016 Elsevier B.V. All rights reserved.

The expanding universe of p53 targets.

PubMed

Menendez, Daniel; Inga, Alberto; Resnick, Michael A

2009-10-01

The p53 tumour suppressor is modified through mutation or changes in expression in most cancers, leading to the altered regulation of hundreds of genes that are directly influenced by this sequence-specific transcription factor. Central to the p53 master regulatory network are the target response element (RE) sequences. The extent of p53 transactivation and transcriptional repression is influenced by many factors, including p53 levels, cofactors and the specific RE sequences, all of which contribute to the role that p53 has in the aetiology of cancer. This Review describes the identification and functionality of REs and highlights the inclusion of non-canonical REs that expand the universe of genes and regulation mechanisms in the p53 tumour suppressor network.

Effects of Cr(III) and CR(VI) on nitrification inhibition as determined by SOUR, function-specific gene expression and 16S rRNA sequence analysis of wastewater nitrifying enrichments

EPA Science Inventory

The effect of Cr(III) and Cr(VI) on ammonia oxidation, the transcriptional responses of functional genes involved in nitrification and changes in 16S rRNA level sequences were examined in nitrifying enrichment cultures. The nitrifying bioreactor was operated as a continuous react...

Subgenome-specific assembly of vitamin E biosynthesis genes and expression patterns during seed development provide insight into the evolution of the oat genome

USDA-ARS?s Scientific Manuscript database

Vitamin E is essential for humans and thus must be a component of a healthy diet. Among the cereal grains, hexaploid oats (Avena sativa L.) have high vitamin E content. To date, no gene sequences in the vitamin E biosynthesis pathway have been reported for oats. Using deep sequencing and orthology-g...

First Pass Annotation of Promoters on Human Chromosome 22

PubMed Central

Scherf, Matthias; Klingenhoff, Andreas; Frech, Kornelie; Quandt, Kerstin; Schneider, Ralf; Grote, Korbinian; Frisch, Matthias; Gailus-Durner, Valérie; Seidel, Alexander; Brack-Werner, Ruth; Werner, Thomas

2001-01-01

The publication of the first almost complete sequence of a human chromosome (chromosome 22) is a major milestone in human genomics. Together with the sequence, an excellent annotation of genes was published which certainly will serve as an information resource for numerous future projects. We noted that the annotation did not cover regulatory regions; in particular, no promoter annotation has been provided. Here we present an analysis of the complete published chromosome 22 sequence for promoters. A recent breakthrough in specific in silico prediction of promoter regions enabled us to attempt large-scale prediction of promoter regions on chromosome 22. Scanning of sequence databases revealed only 20 experimentally verified promoters, of which 10 were correctly predicted by our approach. Nearly 40% of our 465 predicted promoter regions are supported by the currently available gene annotation. Promoter finding also provides a biologically meaningful method for “chromosomal scaffolding”, by which long genomic sequences can be divided into segments starting with a gene. As one example, the combination of promoter region prediction with exon/intron structure predictions greatly enhances the specificity of de novo gene finding. The present study demonstrates that it is possible to identify promoters in silico on the chromosomal level with sufficient reliability for experimental planning and indicates that a wealth of information about regulatory regions can be extracted from current large-scale (megabase) sequencing projects. Results are available on-line at http://genomatix.gsf.de/chr22/. PMID:11230158

Single-Cell Sequencing of the Healthy and Diseased Heart Reveals Ckap4 as a New Modulator of Fibroblasts Activation.

PubMed

Gladka, Monika M; Molenaar, Bas; de Ruiter, Hesther; van der Elst, Stefan; Tsui, Hoyee; Versteeg, Danielle; Lacraz, Grègory P A; Huibers, Manon M H; van Oudenaarden, Alexander; van Rooij, Eva

2018-01-31

Background -Genome-wide transcriptome analysis has greatly advanced our understanding of the regulatory networks underlying basic cardiac biology and mechanisms driving disease. However, so far, the resolution of studying gene expression patterns in the adult heart has been limited to the level of extracts from whole tissues. The use of tissue homogenates inherently causes the loss of any information on cellular origin or cell type-specific changes in gene expression. Recent developments in RNA amplification strategies provide a unique opportunity to use small amounts of input RNA for genome-wide sequencing of single cells. Methods -Here, we present a method to obtain high quality RNA from digested cardiac tissue from adult mice for automated single-cell sequencing of both the healthy and diseased heart. Results -After optimization, we were able to perform single-cell sequencing on adult cardiac tissue under both homeostatic conditions and after ischemic injury. Clustering analysis based on differential gene expression unveiled known and novel markers of all main cardiac cell types. Based on differential gene expression we were also able to identify multiple subpopulations within a certain cell type. Furthermore, applying single-cell sequencing on both the healthy and the injured heart indicated the presence of disease-specific cell subpopulations. As such, we identified cytoskeleton associated protein 4 ( Ckap4 ) as a novel marker for activated fibroblasts that positively correlates with known myofibroblast markers in both mouse and human cardiac tissue. Ckap4 inhibition in activated fibroblasts treated with TGFβ triggered a greater increase in the expression of genes related to activated fibroblasts compared to control, suggesting a role of Ckap4 in modulating fibroblast activation in the injured heart. Conclusions -Single-cell sequencing on both the healthy and diseased adult heart allows us to study transcriptomic differences between cardiac cells, as well as cell type-specific changes in gene expression during cardiac disease. This new approach provides a wealth of novel insights into molecular changes that underlie the cellular processes relevant for cardiac biology and pathophysiology. Applying this technology could lead to the discovery of new therapeutic targets relevant for heart disease.

The genome of Theobroma cacao.

PubMed

Argout, Xavier; Salse, Jerome; Aury, Jean-Marc; Guiltinan, Mark J; Droc, Gaetan; Gouzy, Jerome; Allegre, Mathilde; Chaparro, Cristian; Legavre, Thierry; Maximova, Siela N; Abrouk, Michael; Murat, Florent; Fouet, Olivier; Poulain, Julie; Ruiz, Manuel; Roguet, Yolande; Rodier-Goud, Maguy; Barbosa-Neto, Jose Fernandes; Sabot, Francois; Kudrna, Dave; Ammiraju, Jetty Siva S; Schuster, Stephan C; Carlson, John E; Sallet, Erika; Schiex, Thomas; Dievart, Anne; Kramer, Melissa; Gelley, Laura; Shi, Zi; Bérard, Aurélie; Viot, Christopher; Boccara, Michel; Risterucci, Ange Marie; Guignon, Valentin; Sabau, Xavier; Axtell, Michael J; Ma, Zhaorong; Zhang, Yufan; Brown, Spencer; Bourge, Mickael; Golser, Wolfgang; Song, Xiang; Clement, Didier; Rivallan, Ronan; Tahi, Mathias; Akaza, Joseph Moroh; Pitollat, Bertrand; Gramacho, Karina; D'Hont, Angélique; Brunel, Dominique; Infante, Diogenes; Kebe, Ismael; Costet, Pierre; Wing, Rod; McCombie, W Richard; Guiderdoni, Emmanuel; Quetier, Francis; Panaud, Olivier; Wincker, Patrick; Bocs, Stephanie; Lanaud, Claire

2011-02-01

We sequenced and assembled the draft genome of Theobroma cacao, an economically important tropical-fruit tree crop that is the source of chocolate. This assembly corresponds to 76% of the estimated genome size and contains almost all previously described genes, with 82% of these genes anchored on the 10 T. cacao chromosomes. Analysis of this sequence information highlighted specific expansion of some gene families during evolution, for example, flavonoid-related genes. It also provides a major source of candidate genes for T. cacao improvement. Based on the inferred paleohistory of the T. cacao genome, we propose an evolutionary scenario whereby the ten T. cacao chromosomes were shaped from an ancestor through eleven chromosome fusions.

Biosynthesis of riboflavin: an unusual riboflavin synthase of Methanobacterium thermoautotrophicum.

PubMed Central

Eberhardt, S; Korn, S; Lottspeich, F; Bacher, A

1997-01-01

Riboflavin synthase was purified by a factor of about 1,500 from cell extract of Methanobacterium thermoautotrophicum. The enzyme had a specific activity of about 2,700 nmol mg(-1) h(-1) at 65 degrees C, which is relatively low compared to those of riboflavin synthases of eubacteria and yeast. Amino acid sequences obtained after proteolytic cleavage had no similarity with known riboflavin synthases. The gene coding for riboflavin synthase (designated ribC) was subsequently cloned by marker rescue with a ribC mutant of Escherichia coli. The ribC gene of M. thermoautotrophicum specifies a protein of 153 amino acid residues. The predicted amino acid sequence agrees with the information gleaned from Edman degradation of the isolated protein and shows 67% identity with the sequence predicted for the unannotated reading frame MJ1184 of Methanococcus jannaschii. The ribC gene is adjacent to a cluster of four genes with similarity to the genes cbiMNQO of Salmonella typhimurium, which form part of the cob operon (this operon contains most of the genes involved in the biosynthesis of vitamin B12). The amino acid sequence predicted by the ribC gene of M. thermoautotrophicum shows no similarity whatsoever to the sequences of riboflavin synthases of eubacteria and yeast. Most notably, the M. thermoautotrophicum protein does not show the internal sequence homology characteristic of eubacterial and yeast riboflavin synthases. The protein of M. thermoautotrophicum can be expressed efficiently in a recombinant E. coli strain. The specific activity of the purified, recombinant protein is 1,900 nmol mg(-1) h(-1) at 65 degrees C. In contrast to riboflavin synthases from eubacteria and fungi, the methanobacterial enzyme has an absolute requirement for magnesium ions. The 5' phosphate of 6,7-dimethyl-8-ribityllumazine does not act as a substrate. The findings suggest that riboflavin synthase has evolved independently in eubacteria and methanobacteria. PMID:9139911

Isolation and partial characterization of a root-specific promoter for stacking multiple traits into cassava (Manihot esculenta CRANTZ).

PubMed

Gbadegesin, M A; Beeching, J R

2011-06-07

Cassava can be cultivated on impoverished soils with minimum inputs, and its storage roots are a staple food for millions in Africa. However, these roots are low in bioavailable nutrients and in protein content, contain cyanogenic glycosides, and suffer from a very short post-harvest shelf-life, and the plant is susceptible to viral and bacterial diseases prevalent in Africa. The demand for improvement of cassava with respect to these traits comes from both farmers and national agricultural institutions. Genetic improvement of cassava cultivars by molecular biology techniques requires the availability of appropriate genes, a system to introduce these genes into cassava, and the use of suitable gene promoters. Cassava root-specific promoter for auxin-repressed protein was isolated using the gene walking approach, starting with a cDNA sequence. In silico analysis of promoter sequences revealed putative cis-acting regulatory elements, including root-specific elements, which may be required for gene expression in vascular tissues. Research on the activities of this promoter is continuing, with the development of plant expression cassettes for transformation into major African elite lines and farmers' preferred cassava cultivars to enable testing of tissue-specific expression patterns in the field.

Exome sequencing in amyotrophic lateral sclerosis identifies risk genes and pathways.

PubMed

Cirulli, Elizabeth T; Lasseigne, Brittany N; Petrovski, Slavé; Sapp, Peter C; Dion, Patrick A; Leblond, Claire S; Couthouis, Julien; Lu, Yi-Fan; Wang, Quanli; Krueger, Brian J; Ren, Zhong; Keebler, Jonathan; Han, Yujun; Levy, Shawn E; Boone, Braden E; Wimbish, Jack R; Waite, Lindsay L; Jones, Angela L; Carulli, John P; Day-Williams, Aaron G; Staropoli, John F; Xin, Winnie W; Chesi, Alessandra; Raphael, Alya R; McKenna-Yasek, Diane; Cady, Janet; Vianney de Jong, J M B; Kenna, Kevin P; Smith, Bradley N; Topp, Simon; Miller, Jack; Gkazi, Athina; Al-Chalabi, Ammar; van den Berg, Leonard H; Veldink, Jan; Silani, Vincenzo; Ticozzi, Nicola; Shaw, Christopher E; Baloh, Robert H; Appel, Stanley; Simpson, Ericka; Lagier-Tourenne, Clotilde; Pulst, Stefan M; Gibson, Summer; Trojanowski, John Q; Elman, Lauren; McCluskey, Leo; Grossman, Murray; Shneider, Neil A; Chung, Wendy K; Ravits, John M; Glass, Jonathan D; Sims, Katherine B; Van Deerlin, Vivianna M; Maniatis, Tom; Hayes, Sebastian D; Ordureau, Alban; Swarup, Sharan; Landers, John; Baas, Frank; Allen, Andrew S; Bedlack, Richard S; Harper, J Wade; Gitler, Aaron D; Rouleau, Guy A; Brown, Robert; Harms, Matthew B; Cooper, Gregory M; Harris, Tim; Myers, Richard M; Goldstein, David B

2015-03-27

Amyotrophic lateral sclerosis (ALS) is a devastating neurological disease with no effective treatment. We report the results of a moderate-scale sequencing study aimed at increasing the number of genes known to contribute to predisposition for ALS. We performed whole-exome sequencing of 2869 ALS patients and 6405 controls. Several known ALS genes were found to be associated, and TBK1 (the gene encoding TANK-binding kinase 1) was identified as an ALS gene. TBK1 is known to bind to and phosphorylate a number of proteins involved in innate immunity and autophagy, including optineurin (OPTN) and p62 (SQSTM1/sequestosome), both of which have also been implicated in ALS. These observations reveal a key role of the autophagic pathway in ALS and suggest specific targets for therapeutic intervention. Copyright © 2015, American Association for the Advancement of Science.

[Characterization of Black and Dichothrix Cyanobacteria Based on the 16S Ribosomal RNA Gene Sequence

NASA Technical Reports Server (NTRS)

Ortega, Maya

2010-01-01

My project focuses on characterizing different cyanobacteria in thrombolitic mats found on the island of Highborn Cay, Bahamas. Thrombolites are interesting ecosystems because of the ability of bacteria in these mats to remove carbon dioxide from the atmosphere and mineralize it as calcium carbonate. In the future they may be used as models to develop carbon sequestration technologies, which could be used as part of regenerative life systems in space. These thrombolitic communities are also significant because of their similarities to early communities of life on Earth. I targeted two cyanobacteria in my research, Dichothrix spp. and whatever black is, since they are believed to be important to carbon sequestration in these thrombolitic mats. The goal of my summer research project was to molecularly identify these two cyanobacteria. DNA was isolated from each organism through mat dissections and DNA extractions. I ran Polymerase Chain Reactions (PCR) to amplify the 16S ribosomal RNA (rRNA) gene in each cyanobacteria. This specific gene is found in almost all bacteria and is highly conserved, meaning any changes in the sequence are most likely due to evolution. As a result, the 16S rRNA gene can be used for bacterial identification of different species based on the sequence of their 16S rRNA gene. Since the exact sequence of the Dichothrix gene was unknown, I designed different primers that flanked the gene based on the known sequences from other taxonomically similar cyanobacteria. Once the 16S rRNA gene was amplified, I cloned the gene into specialized Escherichia coli cells and sent the gene products for sequencing. Once the sequence is obtained, it will be added to a genetic database for future reference to and classification of other Dichothrix sp.

Gene trap and gene inversion methods for conditional gene inactivation in the mouse

PubMed Central

Xin, Hong-Bo; Deng, Ke-Yu; Shui, Bo; Qu, Shimian; Sun, Qi; Lee, Jane; Greene, Kai Su; Wilson, Jason; Yu, Ying; Feldman, Morris; Kotlikoff, Michael I.

2005-01-01

Conditional inactivation of individual genes in mice using site-specific recombinases is an extremely powerful method for determining the complex roles of mammalian genes in developmental and tissue-specific contexts, a major goal of post-genomic research. However, the process of generating mice with recombinase recognition sequences placed at specific locations within a gene, while maintaining a functional allele, is time consuming, expensive and technically challenging. We describe a system that combines gene trap and site-specific DNA inversion to generate mouse embryonic stem (ES) cell clones for the rapid production of conditional knockout mice, and the use of this system in an initial gene trap screen. Gene trapping should allow the selection of thousands of ES cell clones with defined insertions that can be used to generate conditional knockout mice, thereby providing extensive parallelism that eliminates the time-consuming steps of targeting vector construction and homologous recombination for each gene. PMID:15659575

Application of Stochastic Labeling with Random-Sequence Barcodes for Simultaneous Quantification and Sequencing of Environmental 16S rRNA Genes.

PubMed

Hoshino, Tatsuhiko; Inagaki, Fumio

2017-01-01

Next-generation sequencing (NGS) is a powerful tool for analyzing environmental DNA and provides the comprehensive molecular view of microbial communities. For obtaining the copy number of particular sequences in the NGS library, however, additional quantitative analysis as quantitative PCR (qPCR) or digital PCR (dPCR) is required. Furthermore, number of sequences in a sequence library does not always reflect the original copy number of a target gene because of biases caused by PCR amplification, making it difficult to convert the proportion of particular sequences in the NGS library to the copy number using the mass of input DNA. To address this issue, we applied stochastic labeling approach with random-tag sequences and developed a NGS-based quantification protocol, which enables simultaneous sequencing and quantification of the targeted DNA. This quantitative sequencing (qSeq) is initiated from single-primer extension (SPE) using a primer with random tag adjacent to the 5' end of target-specific sequence. During SPE, each DNA molecule is stochastically labeled with the random tag. Subsequently, first-round PCR is conducted, specifically targeting the SPE product, followed by second-round PCR to index for NGS. The number of random tags is only determined during the SPE step and is therefore not affected by the two rounds of PCR that may introduce amplification biases. In the case of 16S rRNA genes, after NGS sequencing and taxonomic classification, the absolute number of target phylotypes 16S rRNA gene can be estimated by Poisson statistics by counting random tags incorporated at the end of sequence. To test the feasibility of this approach, the 16S rRNA gene of Sulfolobus tokodaii was subjected to qSeq, which resulted in accurate quantification of 5.0 × 103 to 5.0 × 104 copies of the 16S rRNA gene. Furthermore, qSeq was applied to mock microbial communities and environmental samples, and the results were comparable to those obtained using digital PCR and relative abundance based on a standard sequence library. We demonstrated that the qSeq protocol proposed here is advantageous for providing less-biased absolute copy numbers of each target DNA with NGS sequencing at one time. By this new experiment scheme in microbial ecology, microbial community compositions can be explored in more quantitative manner, thus expanding our knowledge of microbial ecosystems in natural environments.

Methods for the isolation of genes encoding novel PHB cycle enzymes from complex microbial communities.

PubMed

Nordeste, Ricardo F; Trainer, Maria A; Charles, Trevor C

2010-01-01

Development of different PHAs as alternatives to petrochemically derived plastics can be facilitated by mining metagenomic libraries for diverse PHA cycle genes that might be useful for synthesis of bioplastics. The specific phenotypes associated with mutations of the PHA synthesis pathway genes in Sinorhizobium meliloti allows for the use of powerful selection and screening tools to identify complementing novel PHA synthesis genes. Identification of novel genes through their function rather than sequence facilitates finding functional proteins that may otherwise have been excluded through sequence-only screening methodology. We present here methods that we have developed for the isolation of clones expressing novel PHA metabolism genes from metagenomic libraries.

Methods for the Isolation of Genes Encoding Novel PHA Metabolism Enzymes from Complex Microbial Communities.

PubMed

Cheng, Jiujun; Nordeste, Ricardo; Trainer, Maria A; Charles, Trevor C

2017-01-01

Development of different PHAs as alternatives to petrochemically derived plastics can be facilitated by mining metagenomic libraries for diverse PHA cycle genes that might be useful for synthesis of bio-plastics. The specific phenotypes associated with mutations of the PHA synthesis pathway genes in Sinorhizobium meliloti and Pseudomonas putida, allows the use of powerful selection and screening tools to identify complementing novel PHA synthesis genes. Identification of novel genes through their function rather than sequence facilitates the functional proteins that may otherwise have been excluded through sequence-only screening methodology. We present here methods that we have developed for the isolation of clones expressing novel PHA metabolism genes from metagenomic libraries.

The RNA polymerase III-dependent family of genes in hemiascomycetes: comparative RNomics, decoding strategies, transcription and evolutionary implications

PubMed Central

Marck, Christian; Kachouri-Lafond, Rym; Lafontaine, Ingrid; Westhof, Eric; Dujon, Bernard; Grosjean, Henri

2006-01-01

We present the first comprehensive analysis of RNA polymerase III (Pol III) transcribed genes in ten yeast genomes. This set includes all tRNA genes (tDNA) and genes coding for SNR6 (U6), SNR52, SCR1 and RPR1 RNA in the nine hemiascomycetes Saccharomyces cerevisiae, Saccharomyces castellii, Candida glabrata, Kluyveromyces waltii, Kluyveromyces lactis, Eremothecium gossypii, Debaryomyces hansenii, Candida albicans, Yarrowia lipolytica and the archiascomycete Schizosaccharomyces pombe. We systematically analysed sequence specificities of tRNA genes, polymorphism, variability of introns, gene redundancy and gene clustering. Analysis of decoding strategies showed that yeasts close to S.cerevisiae use bacterial decoding rules to read the Leu CUN and Arg CGN codons, in contrast to all other known Eukaryotes. In D.hansenii and C.albicans, we identified a novel tDNA-Leu (AAG), reading the Leu CUU/CUC/CUA codons with an unusual G at position 32. A systematic ‘p-distance tree’ using the 60 variable positions of the tRNA molecule revealed that most tDNAs cluster into amino acid-specific sub-trees, suggesting that, within hemiascomycetes, orthologous tDNAs are more closely related than paralogs. We finally determined the bipartite A- and B-box sequences recognized by TFIIIC. These minimal sequences are nearly conserved throughout hemiascomycetes and were satisfactorily retrieved at appropriate locations in other Pol III genes. PMID:16600899

Limited number of immunoglobulin VH regions expressed in the mutant rabbit "Alicia".

PubMed

DiPietro, L A; Short, J A; Zhai, S K; Kelus, A S; Meier, D; Knight, K L

1990-06-01

A unique feature of rabbit Ig is the presence of VH region allotypic specificities. In normal rabbits, more than 80% of circulating immunoglobulin molecules bear the VHa allotypic specificities, al, a2 or a3; the remaining 10% to 20% of immunoglobulin molecules lack VHa allotypic specificities and are designated VHa-. A mutant rabbit designated Alicia, in contrast, has predominantly serum immunoglobulin molecules that lack the VHa allotypic specificities (Kelus and Weiss, Proc. Natl. Acad. Sci. USA 1986. 83: 4883). To study the nature and molecular complexity of VHa- molecules, we cloned and determined the nucleotide sequence of seven cDNA prepared from splenic RNA of an Alicia rabbit. Six of the clones appeared to encode VHa- molecules; the framework regions encoded by these clones were remarkably similar to each other, each having an unusual insertion of four amino acids at position 10. This insertion of four amino acids has been seen in only 2 of 54 sequenced rabbit VH genes. The similarity of the sequences of the six VHa- clones to each other and their dissimilarity to most other VH genes leads us to suggest that the VHa- molecules in Alicia rabbits are derived predominantly from one or a small number of very similar VH genes. Such preferential utilization of a small number of VH genes may explain the allelic inheritance of VH allotypes.

Role of the chromatin landscape and sequence in determining cell type-specific genomic glucocorticoid receptor binding and gene regulation.

PubMed

Love, Michael I; Huska, Matthew R; Jurk, Marcel; Schöpflin, Robert; Starick, Stephan R; Schwahn, Kevin; Cooper, Samantha B; Yamamoto, Keith R; Thomas-Chollier, Morgane; Vingron, Martin; Meijsing, Sebastiaan H

2017-02-28

The genomic loci bound by the glucocorticoid receptor (GR), a hormone-activated transcription factor, show little overlap between cell types. To study the role of chromatin and sequence in specifying where GR binds, we used Bayesian modeling within the universe of accessible chromatin. Taken together, our results uncovered that although GR preferentially binds accessible chromatin, its binding is biased against accessible chromatin located at promoter regions. This bias can only be explained partially by the presence of fewer GR recognition sequences, arguing for the existence of additional mechanisms that interfere with GR binding at promoters. Therefore, we tested the role of H3K9ac, the chromatin feature with the strongest negative association with GR binding, but found that this correlation does not reflect a causative link. Finally, we find a higher percentage of promoter-proximal GR binding for genes regulated by GR across cell types than for cell type-specific target genes. Given that GR almost exclusively binds accessible chromatin, we propose that cell type-specific regulation by GR preferentially occurs via distal enhancers, whose chromatin accessibility is typically cell type-specific, whereas ubiquitous target gene regulation is more likely to result from binding to promoter regions, which are often accessible regardless of cell type examined. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Impact of sequencing depth and read length on single cell RNA sequencing data of T cells.

PubMed

Rizzetto, Simone; Eltahla, Auda A; Lin, Peijie; Bull, Rowena; Lloyd, Andrew R; Ho, Joshua W K; Venturi, Vanessa; Luciani, Fabio

2017-10-06

Single cell RNA sequencing (scRNA-seq) provides great potential in measuring the gene expression profiles of heterogeneous cell populations. In immunology, scRNA-seq allowed the characterisation of transcript sequence diversity of functionally relevant T cell subsets, and the identification of the full length T cell receptor (TCRαβ), which defines the specificity against cognate antigens. Several factors, e.g. RNA library capture, cell quality, and sequencing output affect the quality of scRNA-seq data. We studied the effects of read length and sequencing depth on the quality of gene expression profiles, cell type identification, and TCRαβ reconstruction, utilising 1,305 single cells from 8 publically available scRNA-seq datasets, and simulation-based analyses. Gene expression was characterised by an increased number of unique genes identified with short read lengths (<50 bp), but these featured higher technical variability compared to profiles from longer reads. Successful TCRαβ reconstruction was achieved for 6 datasets (81% - 100%) with at least 0.25 millions (PE) reads of length >50 bp, while it failed for datasets with <30 bp reads. Sufficient read length and sequencing depth can control technical noise to enable accurate identification of TCRαβ and gene expression profiles from scRNA-seq data of T cells.

Presence and Expression of Microbial Genes Regulating Soil Nitrogen Dynamics Along the Tanana River Successional Sequence

NASA Astrophysics Data System (ADS)

Boone, R. D.; Rogers, S. L.

2004-12-01

We report on work to assess the functional gene sequences for soil microbiota that control nitrogen cycle pathways along the successional sequence (willow, alder, poplar, white spruce, black spruce) on the Tanana River floodplain, Interior Alaska. Microbial DNA and mRNA were extracted from soils (0-10 cm depth) for amoA (ammonium monooxygenase), nifH (nitrogenase reductase), napA (nitrate reductase), and nirS and nirK (nitrite reductase) genes. Gene presence was determined by amplification of a conserved sequence of each gene employing sequence specific oligonucleotide primers and Polymerase Chain Reaction (PCR). Expression of the genes was measured via nested reverse transcriptase PCR amplification of the extracted mRNA. Amplified PCR products were visualized on agarose electrophoresis gels. All five successional stages show evidence for the presence and expression of microbial genes that regulate N fixation (free-living), nitrification, and nitrate reduction. We detected (1) nifH, napA, and nirK presence and amoA expression (mRNA production) for all five successional stages and (2) nirS and amoA presence and nifH, nirK, and napA expression for early successional stages (willow, alder, poplar). The results highlight that the existing body of previous process-level work has not sufficiently considered the microbial potential for a nitrate economy and free-living N fixation along the complete floodplain successional sequence.

Adaptable gene-specific dye bias correction for two-channel DNA microarrays.

PubMed

Margaritis, Thanasis; Lijnzaad, Philip; van Leenen, Dik; Bouwmeester, Diane; Kemmeren, Patrick; van Hooff, Sander R; Holstege, Frank C P

2009-01-01

DNA microarray technology is a powerful tool for monitoring gene expression or for finding the location of DNA-bound proteins. DNA microarrays can suffer from gene-specific dye bias (GSDB), causing some probes to be affected more by the dye than by the sample. This results in large measurement errors, which vary considerably for different probes and also across different hybridizations. GSDB is not corrected by conventional normalization and has been difficult to address systematically because of its variance. We show that GSDB is influenced by label incorporation efficiency, explaining the variation of GSDB across different hybridizations. A correction method (Gene- And Slide-Specific Correction, GASSCO) is presented, whereby sequence-specific corrections are modulated by the overall bias of individual hybridizations. GASSCO outperforms earlier methods and works well on a variety of publically available datasets covering a range of platforms, organisms and applications, including ChIP on chip. A sequence-based model is also presented, which predicts which probes will suffer most from GSDB, useful for microarray probe design and correction of individual hybridizations. Software implementing the method is publicly available.

Adaptable gene-specific dye bias correction for two-channel DNA microarrays

PubMed Central

Margaritis, Thanasis; Lijnzaad, Philip; van Leenen, Dik; Bouwmeester, Diane; Kemmeren, Patrick; van Hooff, Sander R; Holstege, Frank CP

2009-01-01

DNA microarray technology is a powerful tool for monitoring gene expression or for finding the location of DNA-bound proteins. DNA microarrays can suffer from gene-specific dye bias (GSDB), causing some probes to be affected more by the dye than by the sample. This results in large measurement errors, which vary considerably for different probes and also across different hybridizations. GSDB is not corrected by conventional normalization and has been difficult to address systematically because of its variance. We show that GSDB is influenced by label incorporation efficiency, explaining the variation of GSDB across different hybridizations. A correction method (Gene- And Slide-Specific Correction, GASSCO) is presented, whereby sequence-specific corrections are modulated by the overall bias of individual hybridizations. GASSCO outperforms earlier methods and works well on a variety of publically available datasets covering a range of platforms, organisms and applications, including ChIP on chip. A sequence-based model is also presented, which predicts which probes will suffer most from GSDB, useful for microarray probe design and correction of individual hybridizations. Software implementing the method is publicly available. PMID:19401678

Phylogenetic analysis of Fusobacterium prausnitzii based upon the 16S rRNA gene sequence and PCR confirmation.

PubMed

Wang, R F; Cao, W W; Cerniglia, C E

1996-01-01

In order to develop a PCR method to detect Fusobacterium prausnitzii in human feces and to clarify the phylogenetic position of this species, its 16S rRNA gene sequence was determined. The sequence described in this paper is different from the 16S rRNA gene sequence is specific for F. prausnitzii, and the results of this assay confirmed that F. prausnitzii is the most common species in human feces. However, a PCR assay based on the original GenBank sequence was negative when it was performed with two strains of F. prausnitzii obtained from the American Type Culture Collection. A phylogenetic tree based on the new 16S rRNA gene sequence was constructed. On this tree F. prausnitzii was not a member of the Fusobacterium group but was closer to some Eubacterium spp. and located between Clostridium "clusters III and IV" (M.D. Collins, P.A. Lawson, A. Willems, J.J. Cordoba, J. Fernandez-Garayzabal, P. Garcia, J. Cai, H. Hippe, and J.A.E. Farrow, Int. J. Syst. Bacteriol. 44:812-826, 1994).

The C. elegans CSR-1 argonaute pathway counteracts epigenetic silencing to promote germline gene expression.

PubMed

Seth, Meetu; Shirayama, Masaki; Gu, Weifeng; Ishidate, Takao; Conte, Darryl; Mello, Craig C

2013-12-23

Organisms can develop adaptive sequence-specific immunity by reexpressing pathogen-specific small RNAs that guide gene silencing. For example, the C. elegans PIWI-Argonaute/piwi-interacting RNA (piRNA) pathway recruits RNA-dependent RNA polymerase (RdRP) to foreign sequences to amplify a transgenerational small-RNA-induced epigenetic silencing signal (termed RNAe). Here, we provide evidence that, in addition to an adaptive memory of silenced sequences, C. elegans can also develop an opposing adaptive memory of expressed/self-mRNAs. We refer to this mechanism, which can prevent or reverse RNAe, as RNA-induced epigenetic gene activation (RNAa). We show that CSR-1, which engages RdRP-amplified small RNAs complementary to germline-expressed mRNAs, is required for RNAa. We show that a transgene with RNAa activity also exhibits accumulation of cognate CSR-1 small RNAs. Our findings suggest that C. elegans adaptively acquires and maintains a transgenerational CSR-1 memory that recognizes and protects self-mRNAs, allowing piRNAs to recognize foreign sequences innately, without the need for prior exposure

The design of strain-specific polymerase chain reactions for discrimination of the racoon rabies virus strain from indigenous rabies viruses of Ontario.

PubMed

Nadin-Davis, S A; Huang, W; Wandeler, A I

1996-03-01

Since its recognition as a discrete epizootic in Florida in the early 1950s, the raccoon strain of rabies virus (RV) has spread over almost the entire eastern seaboard of the US and now threatens to enter the southernmost regions of Canada. To characterise this RV strain in more detail, nucleotide sequencing of the N and G genes, encoding the nucleoprotein and glycoprotein, respectively, of representative isolates has been undertaken. This sequence information generated a conserved restriction map of the N gene, thereby permitting unequivocal identification of this strain by molecular techniques. Comparisons of the predicted nucleoprotein and glycoprotein products with those of other RV strains identified a number of amino acid sequence variations conserved only in the raccoon strain. This information was used to design strain-specific primers targeted to the N gene sequences encoding these residues. The incorporation of these primers into a multiplex polymerase chain reaction (PCR) protocol permitted easy and rapid discrimination between the raccoon RV strain and indigenous Ontario RVs.

The C. elegans CSR-1 Argonaute pathway counteracts epigenetic silencing to promote germline gene expression

PubMed Central

Seth, Meetu; Shirayama, Masaki; Gu, Weifeng; Ishidate, Takao; Conte, Darryl; Mello, Craig C.

2014-01-01

SUMMARY Organisms can develop adaptive sequence-specific immunity by re-expressing pathogen-specific small RNAs that guide gene silencing. For example, the C. elegans PIWI-Argonaute/piRNA pathway recruits RNA-dependent RNA polymerase RdRP to foreign sequences to amplify a trans-generational small RNA-induced epigenetic silencing signal (termed RNAe). Here we provide evidence that in addition to an adaptive memory of silenced sequences, C. elegans can also develop an opposing adaptive memory of expressed/self mRNAs. We refer to this mechanism, which can prevent or reverse RNAe as RNA-induced epigenetic gene activation (RNAa). We show that CSR-1, which engages RdRP-amplified small RNAs complementary to germline-expressed mRNAs, is required for RNAa. We show that a transgene with RNAa activity also exhibits accumulation of cognate CSR-1 small RNAs. Our findings suggest that C. elegans adaptively acquires and maintains a trans-generational CSR-1 memory that recognizes and protects self mRNAs, allowing piRNAs to recognize foreign sequences innately, without need for prior exposure. PMID:24360782

The Methanol Dehydrogenase Gene, mxaF, as a Functional and Phylogenetic Marker for Proteobacterial Methanotrophs in Natural Environments

PubMed Central

Lau, Evan; Fisher, Meredith C.; Steudler, Paul A.; Cavanaugh, Colleen M.

2013-01-01

The mxaF gene, coding for the large (α) subunit of methanol dehydrogenase, is highly conserved among distantly related methylotrophic species in the Alpha-, Beta- and Gammaproteobacteria. It is ubiquitous in methanotrophs, in contrast to other methanotroph-specific genes such as the pmoA and mmoX genes, which are absent in some methanotrophic proteobacterial genera. This study examined the potential for using the mxaF gene as a functional and phylogenetic marker for methanotrophs. mxaF and 16S rRNA gene phylogenies were constructed based on over 100 database sequences of known proteobacterial methanotrophs and other methylotrophs to assess their evolutionary histories. Topology tests revealed that mxaF and 16S rDNA genes of methanotrophs do not show congruent evolutionary histories, with incongruencies in methanotrophic taxa in the Methylococcaceae, Methylocystaceae, and Beijerinckiacea. However, known methanotrophs generally formed coherent clades based on mxaF gene sequences, allowing for phylogenetic discrimination of major taxa. This feature highlights the mxaF gene’s usefulness as a biomarker in studying the molecular diversity of proteobacterial methanotrophs in nature. To verify this, PCR-directed assays targeting this gene were used to detect novel methanotrophs from diverse environments including soil, peatland, hydrothermal vent mussel tissues, and methanotroph isolates. The placement of the majority of environmental mxaF gene sequences in distinct methanotroph-specific clades (Methylocystaceae and Methylococcaceae) detected in this study supports the use of mxaF as a biomarker for methanotrophic proteobacteria. PMID:23451130

Recommendations for Accurate Resolution of Gene and Isoform Allele-Specific Expression in RNA-Seq Data

PubMed Central

Wood, David L. A.; Nones, Katia; Steptoe, Anita; Christ, Angelika; Harliwong, Ivon; Newell, Felicity; Bruxner, Timothy J. C.; Miller, David; Cloonan, Nicole; Grimmond, Sean M.

2015-01-01

Genetic variation modulates gene expression transcriptionally or post-transcriptionally, and can profoundly alter an individual’s phenotype. Measuring allelic differential expression at heterozygous loci within an individual, a phenomenon called allele-specific expression (ASE), can assist in identifying such factors. Massively parallel DNA and RNA sequencing and advances in bioinformatic methodologies provide an outstanding opportunity to measure ASE genome-wide. In this study, matched DNA and RNA sequencing, genotyping arrays and computationally phased haplotypes were integrated to comprehensively and conservatively quantify ASE in a single human brain and liver tissue sample. We describe a methodological evaluation and assessment of common bioinformatic steps for ASE quantification, and recommend a robust approach to accurately measure SNP, gene and isoform ASE through the use of personalized haplotype genome alignment, strict alignment quality control and intragenic SNP aggregation. Our results indicate that accurate ASE quantification requires careful bioinformatic analyses and is adversely affected by sample specific alignment confounders and random sampling even at moderate sequence depths. We identified multiple known and several novel ASE genes in liver, including WDR72, DSP and UBD, as well as genes that contained ASE SNPs with imbalance direction discordant with haplotype phase, explainable by annotated transcript structure, suggesting isoform derived ASE. The methods evaluated in this study will be of use to researchers performing highly conservative quantification of ASE, and the genes and isoforms identified as ASE of interest to researchers studying those loci. PMID:25965996

Identification of an Amino Acid Domain Encoded by the Capsid Protein Gene of Porcine Circovirus Type 2 that Modulates Viral Protein Distribution During Replication

USDA-ARS?s Scientific Manuscript database

Previous work showed that distinct amino acid motifs are encoded by the Rep, Cap and ORF3 genes of two subgroups of porcine circoviruses (PCV), PCV2a and PCV2b. At a specific location of the gene, a certain amino acid residue or sequence is preferred. Specifically, two amino acid domains located in ...

Sequence Similarity of Clostridium difficile Strains by Analysis of Conserved Genes and Genome Content Is Reflected by Their Ribotype Affiliation

PubMed Central

Kurka, Hedwig; Ehrenreich, Armin; Ludwig, Wolfgang; Monot, Marc; Rupnik, Maja; Barbut, Frederic; Indra, Alexander; Dupuy, Bruno; Liebl, Wolfgang

2014-01-01

PCR-ribotyping is a broadly used method for the classification of isolates of Clostridium difficile, an emerging intestinal pathogen, causing infections with increased disease severity and incidence in several European and North American countries. We have now carried out clustering analysis with selected genes of numerous C. difficile strains as well as gene content comparisons of their genomes in order to broaden our view of the relatedness of strains assigned to different ribotypes. We analyzed the genomic content of 48 C. difficile strains representing 21 different ribotypes. The calculation of distance matrix-based dendrograms using the neighbor joining method for 14 conserved genes (standard phylogenetic marker genes) from the genomes of the C. difficile strains demonstrated that the genes from strains with the same ribotype generally clustered together. Further, certain ribotypes always clustered together and formed ribotype groups, i.e. ribotypes 078, 033 and 126, as well as ribotypes 002 and 017, indicating their relatedness. Comparisons of the gene contents of the genomes of ribotypes that clustered according to the conserved gene analysis revealed that the number of common genes of the ribotypes belonging to each of these three ribotype groups were very similar for the 078/033/126 group (at most 69 specific genes between the different strains with the same ribotype) but less similar for the 002/017 group (86 genes difference). It appears that the ribotype is indicative not only of a specific pattern of the amplified 16S–23S rRNA intergenic spacer but also reflects specific differences in the nucleotide sequences of the conserved genes studied here. It can be anticipated that the sequence deviations of more genes of C. difficile strains are correlated with their PCR-ribotype. In conclusion, the results of this study corroborate and extend the concept of clonal C. difficile lineages, which correlate with ribotypes affiliation. PMID:24482682

A genome-wide SNP scan accelerates trait-regulatory genomic loci identification in chickpea

PubMed Central

Kujur, Alice; Bajaj, Deepak; Upadhyaya, Hari D.; Das, Shouvik; Ranjan, Rajeev; Shree, Tanima; Saxena, Maneesha S.; Badoni, Saurabh; Kumar, Vinod; Tripathi, Shailesh; Gowda, C.L.L.; Sharma, Shivali; Singh, Sube; Tyagi, Akhilesh K.; Parida, Swarup K.

2015-01-01

We identified 44844 high-quality SNPs by sequencing 92 diverse chickpea accessions belonging to a seed and pod trait-specific association panel using reference genome- and de novo-based GBS (genotyping-by-sequencing) assays. A GWAS (genome-wide association study) in an association panel of 211, including the 92 sequenced accessions, identified 22 major genomic loci showing significant association (explaining 23–47% phenotypic variation) with pod and seed number/plant and 100-seed weight. Eighteen trait-regulatory major genomic loci underlying 13 robust QTLs were validated and mapped on an intra-specific genetic linkage map by QTL mapping. A combinatorial approach of GWAS, QTL mapping and gene haplotype-specific LD mapping and transcript profiling uncovered one superior haplotype and favourable natural allelic variants in the upstream regulatory region of a CesA-type cellulose synthase (Ca_Kabuli_CesA3) gene regulating high pod and seed number/plant (explaining 47% phenotypic variation) in chickpea. The up-regulation of this superior gene haplotype correlated with increased transcript expression of Ca_Kabuli_CesA3 gene in the pollen and pod of high pod/seed number accession, resulting in higher cellulose accumulation for normal pollen and pollen tube growth. A rapid combinatorial genome-wide SNP genotyping-based approach has potential to dissect complex quantitative agronomic traits and delineate trait-regulatory genomic loci (candidate genes) for genetic enhancement in crop plants, including chickpea. PMID:26058368

Dog leukocyte antigen class II-associated genetic risk testing for immune disorders of dogs: simplified approaches using Pug dog necrotizing meningoencephalitis as a model.

PubMed

Pedersen, Niels; Liu, Hongwei; Millon, Lee; Greer, Kimberly

2011-01-01

A significantly increased risk for a number of autoimmune and infectious diseases in purebred and mixed-breed dogs has been associated with certain alleles or allele combinations of the dog leukocyte antigen (DLA) class II complex containing the DRB1, DQA1, and DQB1 genes. The exact level of risk depends on the specific disease, the alleles in question, and whether alleles exist in a homozygous or heterozygous state. The gold standard for identifying high-risk alleles and their zygosity has involved direct sequencing of the exon 2 regions of each of the 3 genes. However, sequencing and identification of specific alleles at each of the 3 loci are relatively expensive and sequencing techniques are not ideal for additional parentage or identity determination. However, it is often possible to get the same information from sequencing only 1 gene given the small number of possible alleles at each locus in purebred dogs, extensive homozygosity, and tendency for disease-causing alleles at each of the 3 loci to be strongly linked to each other into haplotypes. Therefore, genetic testing in purebred dogs with immune diseases can be often simplified by sequencing alleles at 1 rather than 3 loci. Further simplification of genetic tests for canine immune diseases can be achieved by the use of alternative genetic markers in the DLA class II region that are also strongly linked with the disease genotype. These markers consist of either simple tandem repeats or single nucleotide polymorphisms that are also in strong linkage with specific DLA class II genotypes and/or haplotypes. The current study uses necrotizing meningoencephalitis of Pug dogs as a paradigm to assess simple alternative genetic tests for disease risk. It was possible to attain identical necrotizing meningoencephalitis risk assessments to 3-locus DLA class II sequencing by sequencing only the DQB1 gene, using 3 DLA class II-linked simple tandem repeat markers, or with a small single nucleotide polymorphism array designed to identify breed-specific DQB1 alleles.

Linking maternal and somatic 5S rRNA types with different sequence-specific non-LTR retrotransposons.

PubMed

Locati, Mauro D; Pagano, Johanna F B; Ensink, Wim A; van Olst, Marina; van Leeuwen, Selina; Nehrdich, Ulrike; Zhu, Kongju; Spaink, Herman P; Girard, Geneviève; Rauwerda, Han; Jonker, Martijs J; Dekker, Rob J; Breit, Timo M

2017-04-01

5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo, and adult tissue identified maternal-type 5S rRNA that is exclusively accumulated during oogenesis, replaced throughout the embryogenesis by a somatic-type, and thus virtually absent in adult somatic tissue. The maternal-type 5S rDNA contains several thousands of gene copies on chromosome 4 in tandem repeats with small intergenic regions, whereas the somatic-type is present in only 12 gene copies on chromosome 18 with large intergenic regions. The nine-nucleotide variation between the two 5S rRNA types likely affects TFIII binding and riboprotein L5 binding, probably leading to storage of maternal-type rRNA. Remarkably, these sequence differences are located exactly at the sequence-specific target site for genome integration by the 5S rRNA-specific Mutsu retrotransposon family. Thus, we could define maternal- and somatic-type MutsuDr subfamilies. Furthermore, we identified four additional maternal-type and two new somatic-type MutsuDr subfamilies, each with their own target sequence. This target-site specificity, frequently intact maternal-type retrotransposon elements, plus specific presence of Mutsu retrotransposon RNA and piRNA in egg and adult tissue, suggest an involvement of retrotransposons in achieving the differential copy number of the two types of 5S rDNA loci. © 2017 Locati et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

Molecular Characterization of Transgene Integration by Next-Generation Sequencing in Transgenic Cattle

PubMed Central

Zhang, Ran; Yin, Yinliang; Zhang, Yujun; Li, Kexin; Zhu, Hongxia; Gong, Qin; Wang, Jianwu; Hu, Xiaoxiang; Li, Ning

2012-01-01

As the number of transgenic livestock increases, reliable detection and molecular characterization of transgene integration sites and copy number are crucial not only for interpreting the relationship between the integration site and the specific phenotype but also for commercial and economic demands. However, the ability of conventional PCR techniques to detect incomplete and multiple integration events is limited, making it technically challenging to characterize transgenes. Next-generation sequencing has enabled cost-effective, routine and widespread high-throughput genomic analysis. Here, we demonstrate the use of next-generation sequencing to extensively characterize cattle harboring a 150-kb human lactoferrin transgene that was initially analyzed by chromosome walking without success. Using this approach, the sites upstream and downstream of the target gene integration site in the host genome were identified at the single nucleotide level. The sequencing result was verified by event-specific PCR for the integration sites and FISH for the chromosomal location. Sequencing depth analysis revealed that multiple copies of the incomplete target gene and the vector backbone were present in the host genome. Upon integration, complex recombination was also observed between the target gene and the vector backbone. These findings indicate that next-generation sequencing is a reliable and accurate approach for the molecular characterization of the transgene sequence, integration sites and copy number in transgenic species. PMID:23185606

Analysis of MHC class I genes across horse MHC haplotypes

PubMed Central

Tallmadge, Rebecca L.; Campbell, Julie A.; Miller, Donald C.; Antczak, Douglas F.

2010-01-01

The genomic sequences of 15 horse Major Histocompatibility Complex (MHC) class I genes and a collection of MHC class I homozygous horses of five different haplotypes were used to investigate the genomic structure and polymorphism of the equine MHC. A combination of conserved and locus-specific primers was used to amplify horse MHC class I genes with classical and non-classical characteristics. Multiple clones from each haplotype identified three to five classical sequences per homozygous animal, and two to three non-classical sequences. Phylogenetic analysis was applied to these sequences and groups were identified which appear to be allelic series, but some sequences were left ungrouped. Sequences determined from MHC class I heterozygous horses and previously described MHC class I sequences were then added, representing a total of ten horse MHC haplotypes. These results were consistent with those obtained from the MHC homozygous horses alone, and 30 classical sequences were assigned to four previously confirmed loci and three new provisional loci. The non-classical genes had few alleles and the classical genes had higher levels of allelic polymorphism. Alleles for two classical loci with the expected pattern of polymorphism were found in the majority of haplotypes tested, but alleles at two other commonly detected loci had more variation outside of the hypervariable region than within. Our data indicate that the equine Major Histocompatibility Complex is characterized by variation in the complement of class I genes expressed in different haplotypes in addition to the expected allelic polymorphism within loci. PMID:20099063

Human population-specific gene expression and transcriptional network modification with polymorphic transposable elements

PubMed Central

Wang, Lu; Mariño-Ramírez, Leonardo

2017-01-01

Abstract Transposable element (TE) derived sequences are known to contribute to the regulation of the human genome. The majority of known TE-derived regulatory sequences correspond to relatively ancient insertions, which are fixed across human populations. The extent to which human genetic variation caused by recent TE activity leads to regulatory polymorphisms among populations has yet to be thoroughly explored. In this study, we searched for associations between polymorphic TE (polyTE) loci and human gene expression levels using an expression quantitative trait loci (eQTL) approach. We compared locus-specific polyTE insertion genotypes to B cell gene expression levels among 445 individuals from 5 human populations. Numerous human polyTE loci correspond to both cis and trans eQTL, and their regulatory effects are directly related to cell type-specific function in the immune system. PolyTE loci are associated with differences in expression between European and African population groups, and a single polyTE loci is indirectly associated with the expression of numerous genes via the regulation of the B cell-specific transcription factor PAX5. The polyTE-gene expression associations we found indicate that human TE genetic variation can have important phenotypic consequences. Our results reveal that TE-eQTL are involved in population-specific gene regulation as well as transcriptional network modification. PMID:27998931

The presence of both negative and positive elements in the 5'-flanking sequence of the rat Na,K-ATPase alpha 3 subunit gene are required for brain expression in transgenic mice.

PubMed Central

Pathak, B G; Neumann, J C; Croyle, M L; Lingrel, J B

1994-01-01

The Na,K-ATPase is an integral plasma membrane protein consisting of alpha and beta subunits, each of which has discrete isoforms expressed in a tissue-specific manner. Of the three functional alpha isoform genes, the one encoding the alpha 3 isoform is the most tissue-restricted in its expression, being found primarily in the brain. To identify regions of the alpha 3 isoform gene that are involved in directing expression in the brain, a 1.6 kb 5'-flanking sequence was attached to a reporter gene, chloramphenicol acetyltransferase (CAT). The alpha 3-CAT chimeric gene construct was microinjected into fertilized mouse eggs, and transgenic mice were produced. Analysis of adult transgenic mice from different lines revealed that the transgene is expressed primarily in the brain. To further delineate regions that are needed for conferring expression in this tissue, systematic deletions of the 5'-flanking sequence of the alpha 3-CAT fusion constructs were made and analyzed, again using transgenic mice. The results from these analyses indicate that DNA sequences required for mediating brain-specific expression of the alpha 3 isoform gene are present within 210 bp upstream of the transcription initiation site. alpha 3-CAT promoter constructs containing scanning mutations in this region were also assayed in transgenic mice. These studies have identified both a functional neural-restrictive silencer element as well as a positively acting cis element. Images PMID:7984427

A new genome of Acidithiobacillus thiooxidans provides insights into adaptation to a bioleaching environment.

PubMed

Travisany, Dante; Cortés, María Paz; Latorre, Mauricio; Di Genova, Alex; Budinich, Marko; Bobadilla-Fazzini, Roberto A; Parada, Pilar; González, Mauricio; Maass, Alejandro

2014-11-01

Acidithiobacillus thiooxidans is a sulfur oxidizing acidophilic bacterium found in many sulfur-rich environments. It is particularly interesting due to its role in bioleaching of sulphide minerals. In this work, we report the genome sequence of At. thiooxidans Licanantay, the first strain from a copper mine to be sequenced and currently used in bioleaching industrial processes. Through comparative genomic analysis with two other At. thiooxidans non-metal mining strains (ATCC 19377 and A01) we determined that these strains share a large core genome of 2109 coding sequences and a high average nucleotide identity over 98%. Nevertheless, the presence of 841 strain-specific genes (absent in other At. thiooxidans strains) suggests a particular adaptation of Licanantay to its specific biomining environment. Among this group, we highlight genes encoding for proteins involved in heavy metal tolerance, mineral cell attachment and cysteine biosynthesis. Several of these genes were located near genetic motility genes (e.g. transposases and integrases) in genomic regions of over 10 kbp absent in the other strains, suggesting the presence of genomic islands in the Licanantay genome probably produced by horizontal gene transfer in mining environments. Copyright © 2014 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

Divergent evolution of multiple virus-resistance genes from a progenitor in Capsicum spp.

PubMed

Kim, Saet-Byul; Kang, Won-Hee; Huy, Hoang Ngoc; Yeom, Seon-In; An, Jeong-Tak; Kim, Seungill; Kang, Min-Young; Kim, Hyun Jung; Jo, Yeong Deuk; Ha, Yeaseong; Choi, Doil; Kang, Byoung-Cheorl

2017-01-01

Plants have evolved hundreds of nucleotide-binding and leucine-rich domain proteins (NLRs) as potential intracellular immune receptors, but the evolutionary mechanism leading to the ability to recognize specific pathogen effectors is elusive. Here, we cloned Pvr4 (a Potyvirus resistance gene in Capsicum annuum) and Tsw (a Tomato spotted wilt virus resistance gene in Capsicum chinense) via a genome-based approach using independent segregating populations. The genes both encode typical NLRs and are located at the same locus on pepper chromosome 10. Despite the fact that these two genes recognize completely different viral effectors, the genomic structures and coding sequences of the two genes are strikingly similar. Phylogenetic studies revealed that these two immune receptors diverged from a progenitor gene of a common ancestor. Our results suggest that sequence variations caused by gene duplication and neofunctionalization may underlie the evolution of the ability to specifically recognize different effectors. These findings thereby provide insight into the divergent evolution of plant immune receptors. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.

A-WINGS: an integrated genome database for Pleurocybella porrigens (Angel's wing oyster mushroom, Sugihiratake).

PubMed

Yamamoto, Naoki; Suzuki, Tomohiro; Kobayashi, Masaaki; Dohra, Hideo; Sasaki, Yohei; Hirai, Hirofumi; Yokoyama, Koji; Kawagishi, Hirokazu; Yano, Kentaro

2014-12-03

The angel's wing oyster mushroom (Pleurocybella porrigens, Sugihiratake) is a well-known delicacy. However, its potential risk in acute encephalopathy was recently revealed by a food poisoning incident. To disclose the genes underlying the accident and provide mechanistic insight, we seek to develop an information infrastructure containing omics data. In our previous work, we sequenced the genome and transcriptome using next-generation sequencing techniques. The next step in achieving our goal is to develop a web database to facilitate the efficient mining of large-scale omics data and identification of genes specifically expressed in the mushroom. This paper introduces a web database A-WINGS (http://bioinf.mind.meiji.ac.jp/a-wings/) that provides integrated genomic and transcriptomic information for the angel's wing oyster mushroom. The database contains structure and functional annotations of transcripts and gene expressions. Functional annotations contain information on homologous sequences from NCBI nr and UniProt, Gene Ontology, and KEGG Orthology. Digital gene expression profiles were derived from RNA sequencing (RNA-seq) analysis in the fruiting bodies and mycelia. The omics information stored in the database is freely accessible through interactive and graphical interfaces by search functions that include 'GO TREE VIEW' browsing, keyword searches, and BLAST searches. The A-WINGS database will accelerate omics studies on specific aspects of the angel's wing oyster mushroom and the family Tricholomataceae.

Structural and functional partitioning of bread wheat chromosome 3B.

PubMed

Choulet, Frédéric; Alberti, Adriana; Theil, Sébastien; Glover, Natasha; Barbe, Valérie; Daron, Josquin; Pingault, Lise; Sourdille, Pierre; Couloux, Arnaud; Paux, Etienne; Leroy, Philippe; Mangenot, Sophie; Guilhot, Nicolas; Le Gouis, Jacques; Balfourier, Francois; Alaux, Michael; Jamilloux, Véronique; Poulain, Julie; Durand, Céline; Bellec, Arnaud; Gaspin, Christine; Safar, Jan; Dolezel, Jaroslav; Rogers, Jane; Vandepoele, Klaas; Aury, Jean-Marc; Mayer, Klaus; Berges, Hélène; Quesneville, Hadi; Wincker, Patrick; Feuillet, Catherine

2014-07-18

We produced a reference sequence of the 1-gigabase chromosome 3B of hexaploid bread wheat. By sequencing 8452 bacterial artificial chromosomes in pools, we assembled a sequence of 774 megabases carrying 5326 protein-coding genes, 1938 pseudogenes, and 85% of transposable elements. The distribution of structural and functional features along the chromosome revealed partitioning correlated with meiotic recombination. Comparative analyses indicated high wheat-specific inter- and intrachromosomal gene duplication activities that are potential sources of variability for adaption. In addition to providing a better understanding of the organization, function, and evolution of a large and polyploid genome, the availability of a high-quality sequence anchored to genetic maps will accelerate the identification of genes underlying important agronomic traits. Copyright © 2014, American Association for the Advancement of Science.

New approach for the study of mite reproduction: The first transcriptome analysis of a mite, Phytoseiulus persimilis (Acari: Phytoseiidae).

PubMed

Cabrera, Ana R; Donohue, Kevin V; Khalil, Sayed M S; Scholl, Elizabeth; Opperman, Charles; Sonenshine, Daniel E; Roe, R Michael

2011-01-01

Many species of mites and ticks are of agricultural and medical importance. Much can be learned from the study of transcriptomes of acarines which can generate DNA-sequence information of potential target genes for the control of acarine pests. High throughput transcriptome sequencing can also yield sequences of genes critical during physiological processes poorly understood in acarines, i.e., the regulation of female reproduction in mites. The predatory mite, Phytoseiulus persimilis, was selected to conduct a transcriptome analysis using 454 pyrosequencing. The objective of this project was to obtain DNA-sequence information of expressed genes from P. persimilis with special interest in sequences corresponding to vitellogenin (Vg) and the vitellogenin receptor (VgR). These genes are critical to the understanding of vitellogenesis, and they will facilitate the study of the regulation of mite female reproduction. A total of 12,556 contiguous sequences (contigs) were assembled with an average size of 935bp. From these sequences, the putative translated peptides of 11 contigs were similar in amino acid sequences to other arthropod Vgs, while 6 were similar to VgRs. We selected some of these sequences to conduct stage-specific expression studies to further determine their function. 2010 Elsevier Ltd. All rights reserved.

Analysis of the genome-wide variations among multiple strains of the plant pathogenic bacterium Xylella fastidiosa

PubMed Central

Doddapaneni, Harshavardhan; Yao, Jiqiang; Lin, Hong; Walker, M Andrew; Civerolo, Edwin L

2006-01-01

Background The Gram-negative, xylem-limited phytopathogenic bacterium Xylella fastidiosa is responsible for causing economically important diseases in grapevine, citrus and many other plant species. Despite its economic impact, relatively little is known about the genomic variations among strains isolated from different hosts and their influence on the population genetics of this pathogen. With the availability of genome sequence information for four strains, it is now possible to perform genome-wide analyses to identify and categorize such DNA variations and to understand their influence on strain functional divergence. Results There are 1,579 genes and 194 non-coding homologous sequences present in the genomes of all four strains, representing a 76. 2% conservation of the sequenced genome. About 60% of the X. fastidiosa unique sequences exist as tandem gene clusters of 6 or more genes. Multiple alignments identified 12,754 SNPs and 14,449 INDELs in the 1528 common genes and 20,779 SNPs and 10,075 INDELs in the 194 non-coding sequences. The average SNP frequency was 1.08 × 10-2 per base pair of DNA and the average INDEL frequency was 2.06 × 10-2 per base pair of DNA. On an average, 60.33% of the SNPs were synonymous type while 39.67% were non-synonymous type. The mutation frequency, primarily in the form of external INDELs was the main type of sequence variation. The relative similarity between the strains was discussed according to the INDEL and SNP differences. The number of genes unique to each strain were 60 (9a5c), 54 (Dixon), 83 (Ann1) and 9 (Temecula-1). A sub-set of the strain specific genes showed significant differences in terms of their codon usage and GC composition from the native genes suggesting their xenologous origin. Tandem repeat analysis of the genomic sequences of the four strains identified associations of repeat sequences with hypothetical and phage related functions. Conclusion INDELs and strain specific genes have been identified as the main source of variations among strains, with individual strains showing different rates of genome evolution. Based on these genome comparisons, it appears that the Pierce's disease strain Temecula-1 genome represents the ancestral genome of the X. fastidiosa. Results of this analysis are publicly available in the form of a web database. PMID:16948851

The zebrafish reference genome sequence and its relationship to the human genome.

PubMed

Howe, Kerstin; Clark, Matthew D; Torroja, Carlos F; Torrance, James; Berthelot, Camille; Muffato, Matthieu; Collins, John E; Humphray, Sean; McLaren, Karen; Matthews, Lucy; McLaren, Stuart; Sealy, Ian; Caccamo, Mario; Churcher, Carol; Scott, Carol; Barrett, Jeffrey C; Koch, Romke; Rauch, Gerd-Jörg; White, Simon; Chow, William; Kilian, Britt; Quintais, Leonor T; Guerra-Assunção, José A; Zhou, Yi; Gu, Yong; Yen, Jennifer; Vogel, Jan-Hinnerk; Eyre, Tina; Redmond, Seth; Banerjee, Ruby; Chi, Jianxiang; Fu, Beiyuan; Langley, Elizabeth; Maguire, Sean F; Laird, Gavin K; Lloyd, David; Kenyon, Emma; Donaldson, Sarah; Sehra, Harminder; Almeida-King, Jeff; Loveland, Jane; Trevanion, Stephen; Jones, Matt; Quail, Mike; Willey, Dave; Hunt, Adrienne; Burton, John; Sims, Sarah; McLay, Kirsten; Plumb, Bob; Davis, Joy; Clee, Chris; Oliver, Karen; Clark, Richard; Riddle, Clare; Elliot, David; Eliott, David; Threadgold, Glen; Harden, Glenn; Ware, Darren; Begum, Sharmin; Mortimore, Beverley; Mortimer, Beverly; Kerry, Giselle; Heath, Paul; Phillimore, Benjamin; Tracey, Alan; Corby, Nicole; Dunn, Matthew; Johnson, Christopher; Wood, Jonathan; Clark, Susan; Pelan, Sarah; Griffiths, Guy; Smith, Michelle; Glithero, Rebecca; Howden, Philip; Barker, Nicholas; Lloyd, Christine; Stevens, Christopher; Harley, Joanna; Holt, Karen; Panagiotidis, Georgios; Lovell, Jamieson; Beasley, Helen; Henderson, Carl; Gordon, Daria; Auger, Katherine; Wright, Deborah; Collins, Joanna; Raisen, Claire; Dyer, Lauren; Leung, Kenric; Robertson, Lauren; Ambridge, Kirsty; Leongamornlert, Daniel; McGuire, Sarah; Gilderthorp, Ruth; Griffiths, Coline; Manthravadi, Deepa; Nichol, Sarah; Barker, Gary; Whitehead, Siobhan; Kay, Michael; Brown, Jacqueline; Murnane, Clare; Gray, Emma; Humphries, Matthew; Sycamore, Neil; Barker, Darren; Saunders, David; Wallis, Justene; Babbage, Anne; Hammond, Sian; Mashreghi-Mohammadi, Maryam; Barr, Lucy; Martin, Sancha; Wray, Paul; Ellington, Andrew; Matthews, Nicholas; Ellwood, Matthew; Woodmansey, Rebecca; Clark, Graham; Cooper, James D; Cooper, James; Tromans, Anthony; Grafham, Darren; Skuce, Carl; Pandian, Richard; Andrews, Robert; Harrison, Elliot; Kimberley, Andrew; Garnett, Jane; Fosker, Nigel; Hall, Rebekah; Garner, Patrick; Kelly, Daniel; Bird, Christine; Palmer, Sophie; Gehring, Ines; Berger, Andrea; Dooley, Christopher M; Ersan-Ürün, Zübeyde; Eser, Cigdem; Geiger, Horst; Geisler, Maria; Karotki, Lena; Kirn, Anette; Konantz, Judith; Konantz, Martina; Oberländer, Martina; Rudolph-Geiger, Silke; Teucke, Mathias; Lanz, Christa; Raddatz, Günter; Osoegawa, Kazutoyo; Zhu, Baoli; Rapp, Amanda; Widaa, Sara; Langford, Cordelia; Yang, Fengtang; Schuster, Stephan C; Carter, Nigel P; Harrow, Jennifer; Ning, Zemin; Herrero, Javier; Searle, Steve M J; Enright, Anton; Geisler, Robert; Plasterk, Ronald H A; Lee, Charles; Westerfield, Monte; de Jong, Pieter J; Zon, Leonard I; Postlethwait, John H; Nüsslein-Volhard, Christiane; Hubbard, Tim J P; Roest Crollius, Hugues; Rogers, Jane; Stemple, Derek L

2013-04-25

Zebrafish have become a popular organism for the study of vertebrate gene function. The virtually transparent embryos of this species, and the ability to accelerate genetic studies by gene knockdown or overexpression, have led to the widespread use of zebrafish in the detailed investigation of vertebrate gene function and increasingly, the study of human genetic disease. However, for effective modelling of human genetic disease it is important to understand the extent to which zebrafish genes and gene structures are related to orthologous human genes. To examine this, we generated a high-quality sequence assembly of the zebrafish genome, made up of an overlapping set of completely sequenced large-insert clones that were ordered and oriented using a high-resolution high-density meiotic map. Detailed automatic and manual annotation provides evidence of more than 26,000 protein-coding genes, the largest gene set of any vertebrate so far sequenced. Comparison to the human reference genome shows that approximately 70% of human genes have at least one obvious zebrafish orthologue. In addition, the high quality of this genome assembly provides a clearer understanding of key genomic features such as a unique repeat content, a scarcity of pseudogenes, an enrichment of zebrafish-specific genes on chromosome 4 and chromosomal regions that influence sex determination.

The zebrafish reference genome sequence and its relationship to the human genome

PubMed Central

Howe, Kerstin; Clark, Matthew D.; Torroja, Carlos F.; Torrance, James; Berthelot, Camille; Muffato, Matthieu; Collins, John E.; Humphray, Sean; McLaren, Karen; Matthews, Lucy; McLaren, Stuart; Sealy, Ian; Caccamo, Mario; Churcher, Carol; Scott, Carol; Barrett, Jeffrey C.; Koch, Romke; Rauch, Gerd-Jörg; White, Simon; Chow, William; Kilian, Britt; Quintais, Leonor T.; Guerra-Assunção, José A.; Zhou, Yi; Gu, Yong; Yen, Jennifer; Vogel, Jan-Hinnerk; Eyre, Tina; Redmond, Seth; Banerjee, Ruby; Chi, Jianxiang; Fu, Beiyuan; Langley, Elizabeth; Maguire, Sean F.; Laird, Gavin K.; Lloyd, David; Kenyon, Emma; Donaldson, Sarah; Sehra, Harminder; Almeida-King, Jeff; Loveland, Jane; Trevanion, Stephen; Jones, Matt; Quail, Mike; Willey, Dave; Hunt, Adrienne; Burton, John; Sims, Sarah; McLay, Kirsten; Plumb, Bob; Davis, Joy; Clee, Chris; Oliver, Karen; Clark, Richard; Riddle, Clare; Eliott, David; Threadgold, Glen; Harden, Glenn; Ware, Darren; Mortimer, Beverly; Kerry, Giselle; Heath, Paul; Phillimore, Benjamin; Tracey, Alan; Corby, Nicole; Dunn, Matthew; Johnson, Christopher; Wood, Jonathan; Clark, Susan; Pelan, Sarah; Griffiths, Guy; Smith, Michelle; Glithero, Rebecca; Howden, Philip; Barker, Nicholas; Stevens, Christopher; Harley, Joanna; Holt, Karen; Panagiotidis, Georgios; Lovell, Jamieson; Beasley, Helen; Henderson, Carl; Gordon, Daria; Auger, Katherine; Wright, Deborah; Collins, Joanna; Raisen, Claire; Dyer, Lauren; Leung, Kenric; Robertson, Lauren; Ambridge, Kirsty; Leongamornlert, Daniel; McGuire, Sarah; Gilderthorp, Ruth; Griffiths, Coline; Manthravadi, Deepa; Nichol, Sarah; Barker, Gary; Whitehead, Siobhan; Kay, Michael; Brown, Jacqueline; Murnane, Clare; Gray, Emma; Humphries, Matthew; Sycamore, Neil; Barker, Darren; Saunders, David; Wallis, Justene; Babbage, Anne; Hammond, Sian; Mashreghi-Mohammadi, Maryam; Barr, Lucy; Martin, Sancha; Wray, Paul; Ellington, Andrew; Matthews, Nicholas; Ellwood, Matthew; Woodmansey, Rebecca; Clark, Graham; Cooper, James; Tromans, Anthony; Grafham, Darren; Skuce, Carl; Pandian, Richard; Andrews, Robert; Harrison, Elliot; Kimberley, Andrew; Garnett, Jane; Fosker, Nigel; Hall, Rebekah; Garner, Patrick; Kelly, Daniel; Bird, Christine; Palmer, Sophie; Gehring, Ines; Berger, Andrea; Dooley, Christopher M.; Ersan-Ürün, Zübeyde; Eser, Cigdem; Geiger, Horst; Geisler, Maria; Karotki, Lena; Kirn, Anette; Konantz, Judith; Konantz, Martina; Oberländer, Martina; Rudolph-Geiger, Silke; Teucke, Mathias; Osoegawa, Kazutoyo; Zhu, Baoli; Rapp, Amanda; Widaa, Sara; Langford, Cordelia; Yang, Fengtang; Carter, Nigel P.; Harrow, Jennifer; Ning, Zemin; Herrero, Javier; Searle, Steve M. J.; Enright, Anton; Geisler, Robert; Plasterk, Ronald H. A.; Lee, Charles; Westerfield, Monte; de Jong, Pieter J.; Zon, Leonard I.; Postlethwait, John H.; Nüsslein-Volhard, Christiane; Hubbard, Tim J. P.; Crollius, Hugues Roest; Rogers, Jane; Stemple, Derek L.

2013-01-01

Zebrafish have become a popular organism for the study of vertebrate gene function1,2. The virtually transparent embryos of this species, and the ability to accelerate genetic studies by gene knockdown or overexpression, have led to the widespread use of zebrafish in the detailed investigation of vertebrate gene function and increasingly, the study of human genetic disease3–5. However, for effective modelling of human genetic disease it is important to understand the extent to which zebrafish genes and gene structures are related to orthologous human genes. To examine this, we generated a high-quality sequence assembly of the zebrafish genome, made up of an overlapping set of completely sequenced large-insert clones that were ordered and oriented using a high-resolution high-density meiotic map. Detailed automatic and manual annotation provides evidence of more than 26,000 protein-coding genes6, the largest gene set of any vertebrate so far sequenced. Comparison to the human reference genome shows that approximately 70% of human genes have at least one obvious zebrafish orthologue. In addition, the high quality of this genome assembly provides a clearer understanding of key genomic features such as a unique repeat content, a scarcity of pseudogenes, an enrichment of zebrafish-specific genes on chromosome 4 and chromosomal regions that influence sex determination. PMID:23594743

The legumin gene family: structure of a B type gene of Vicia faba and a possible legumin gene specific regulatory element.

PubMed Central

Bäumlein, H; Wobus, U; Pustell, J; Kafatos, F C

1986-01-01

The field bean, Vicia faba L. var. minor, possesses two sub-families of 11 S legumin genes named A and B. We isolated from a genomic library a B-type gene (LeB4) and determined its primary DNA sequence. Gene LeB4 codes for a 484 amino acid residue prepropolypeptide, encompassing a signal peptide of 22 amino acid residues, an acidic, very hydrophilic alpha-chain of 281 residues and a basic, somewhat hydrophobic beta-chain of 181 residues. The latter two coding regions are immediately contiguous, but each is interrupted by a short intron. Type A legumin genes from soybean and pea are known to have introns in the same two positions, in addition to an extra intron (within the alpha-coding sequence). Sequence comparisons of legumin genes from these three plants revealed a highly conserved sequence element of at least 28 bp, centered at approximately 100 bp upstream of each cap site. The element is absent from the equivalent position of all non-legumin and other plant and fungal genes examined. We tentatively name this element "legumin box" and suggest that it may have a function in the regulation of legumin gene expression. PMID:3960730

snoSeeker: an advanced computational package for screening of guide and orphan snoRNA genes in the human genome.

PubMed

Yang, Jian-Hua; Zhang, Xiao-Chen; Huang, Zhan-Peng; Zhou, Hui; Huang, Mian-Bo; Zhang, Shu; Chen, Yue-Qin; Qu, Liang-Hu

2006-01-01

Small nucleolar RNAs (snoRNAs) represent an abundant group of non-coding RNAs in eukaryotes. They can be divided into guide and orphan snoRNAs according to the presence or absence of antisense sequence to rRNAs or snRNAs. Current snoRNA-searching programs, which are essentially based on sequence complementarity to rRNAs or snRNAs, exist only for the screening of guide snoRNAs. In this study, we have developed an advanced computational package, snoSeeker, which includes CDseeker and ACAseeker programs, for the highly efficient and specific screening of both guide and orphan snoRNA genes in mammalian genomes. By using these programs, we have systematically scanned four human-mammal whole-genome alignment (WGA) sequences and identified 54 novel candidates including 26 orphan candidates as well as 266 known snoRNA genes. Eighteen novel snoRNAs were further experimentally confirmed with four snoRNAs exhibiting a tissue-specific or restricted expression pattern. The results of this study provide the most comprehensive listing of two families of snoRNA genes in the human genome till date.

Molecular approach to annelid regeneration: cDNA subtraction cloning reveals various novel genes that are upregulated during the large-scale regeneration of the oligochaete, Enchytraeus japonensis.

PubMed

Myohara, Maroko; Niva, Cintia Carla; Lee, Jae Min

2006-08-01

To identify genes specifically activated during annelid regeneration, suppression subtractive hybridization was performed with cDNAs from regenerating and intact Enchytraeus japonensis, a terrestrial oligochaete that can regenerate a complete organism from small body fragments within 4-5 days. Filter array screening subsequently revealed that about 38% of the forward-subtracted cDNA clones contained genes that were upregulated during regeneration. Two hundred seventy-nine of these clones were sequenced and found to contain 165 different sequences (79 known and 86 unknown). Nine clones were fully sequenced and four of these sequences were matched to known genes for glutamine synthetase, glucosidase 1, retinal protein 4, and phosphoribosylaminoimidazole carboxylase, respectively. The remaining five clones encoded an unknown open-reading frame. The expression levels of these genes were highest during blastema formation. Our present results, therefore, demonstrate the great potential of annelids as a new experimental subject for the exploration of unknown genes that play critical roles in animal regeneration.

Evaluation of highly conserved hsp65-specific nested PCR primers for diagnosing Mycobacterium tuberculosis.

PubMed

Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G

2017-02-01

To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.

Genomic structure of the human D-site binding protein (DBP) gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shutler, G.; Glassco, T.; Kang, Xiaolin

1996-06-15

The human gene for the D-Site Binding Protein (DBP) has been sequenced and characterized. This gene is a member of the b/ZIP family of transcription factors and is one of three genes forming the PAR sub-family. DBP has been implicated in the diurnal regulation of a variety of liver-specific genes. Examination of the genomic structure of DBP reveals that the gene is divided into four exons and is contained within a relatively compact region of approximately 6 kb. These exons appear to correspond to functional divisions the DBP protein. Exon 1 contains a long 5{prime} UTR, and conservation between themore » rat and the human genes of the presence of small open reading frames within this region suggests that is may play a role in translational control. Exon 2 contains a limited region of similarity to the other PAR domain genes, which may be part of a potential activation domain. Exon 3 contains the PAR domain and differs by only 1 of 71 amino acids between rat and human. Exon 4, containing both the basic and the leucine zipper domains, is likewise highly conserved. The overall degree of homology between the rat and the human cDNA sequences is 82% for the nucleic acid sequence and 92% for the protein sequence. comparison of the rat and human proximal promoters reveals extensive sequence conservation, with two previously characterized DNA binding sites being conserved at the functional and sequence levels. 31 refs., 4 figs.« less

Uncovering the novel characteristics of Asian honey bee, Apis cerana, by whole genome sequencing.

PubMed

Park, Doori; Jung, Je Won; Choi, Beom-Soon; Jayakodi, Murukarthick; Lee, Jeongsoo; Lim, Jongsung; Yu, Yeisoo; Choi, Yong-Soo; Lee, Myeong-Lyeol; Park, Yoonseong; Choi, Ik-Young; Yang, Tae-Jin; Edwards, Owain R; Nah, Gyoungju; Kwon, Hyung Wook

2015-01-02

The honey bee is an important model system for increasing understanding of molecular and neural mechanisms underlying social behaviors relevant to the agricultural industry and basic science. The western honey bee, Apis mellifera, has served as a model species, and its genome sequence has been published. In contrast, the genome of the Asian honey bee, Apis cerana, has not yet been sequenced. A. cerana has been raised in Asian countries for thousands of years and has brought considerable economic benefits to the apicultural industry. A cerana has divergent biological traits compared to A. mellifera and it has played a key role in maintaining biodiversity in eastern and southern Asia. Here we report the first whole genome sequence of A. cerana. Using de novo assembly methods, we produced a 238 Mbp draft of the A. cerana genome and generated 10,651 genes. A.cerana-specific genes were analyzed to better understand the novel characteristics of this honey bee species. Seventy-two percent of the A. cerana-specific genes had more than one GO term, and 1,696 enzymes were categorized into 125 pathways. Genes involved in chemoreception and immunity were carefully identified and compared to those from other sequenced insect models. These included 10 gustatory receptors, 119 odorant receptors, 10 ionotropic receptors, and 160 immune-related genes. This first report of the whole genome sequence of A. cerana provides resources for comparative sociogenomics, especially in the field of social insect communication. These important tools will contribute to a better understanding of the complex behaviors and natural biology of the Asian honey bee and to anticipate its future evolutionary trajectory.

Expressed sequence tag (EST) analysis of two subspecies of Metarhizium anisopliae reveals a plethora of secreted proteins with potential activity in insect hosts.

PubMed

Freimoser, Florian M; Screen, Steven; Bagga, Savita; Hu, Gang; St Leger, Raymond J

2003-01-01

Expressed sequence tag (EST) libraries for Metarhizium anisopliae, the causative agent of green muscardine disease, were developed from the broad host-range pathogen Metarhizium anisopliae sf. anisopliae and the specific grasshopper pathogen, M. anisopliae sf. acridum. Approximately 1,700 5' end sequences from each subspecies were generated from cDNA libraries representing fungi grown under conditions that maximize secretion of cuticle-degrading enzymes. Both subspecies had ESTs for virtually all pathogenicity-related genes cloned to date from M. anisopliae, but many novel genes encoding potential virulence factors were also tagged. Enzymes with potential targets in the insect host included proteases, chitinases, phospholipases, lipases, esterases, phosphatases and enzymes producing toxic secondary metabolites. A diverse array of proteases composed 36 % of all M. anisopliae sf. anisopliae ESTs. Eighty percent of the ESTs that could be clustered into functional groups had significant matches (E<10(-5)) in other ascomycete fungi. These included genes reported to have specific roles in pathogens with plant or vertebrate hosts. Many of the remaining ESTs had their best BLAST match among animal, plant and bacterial sequences. These include genes with plant and microbial counterparts that produce potent antimicrobials. The abundance of transcripts discovered for different functional groups varied between the two subspecies of M. anisopliae in a manner consistent with ecological adaptations of the two pathogens. By hastening gene discovery this project has enhanced development of improved mycoinsecticides. In addition, the M. anisopliae ESTs represent a significant contribution to the extensive database of sequences from ascomycetes that are saprophytes or plant and vertebrate pathogens. Comparative analyses of these sequences is providing important information about the biology and evolutionary history of this clade.

The human homolog of S. cerevisiae CDC27, CDC27 Hs, is encoded by a highly conserved intronless gene present in multiple copies in the human genome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Devor, E.J.; Dill-Devor, R.M.

1994-09-01

We have obtained a number of unique sequences via PCR amplification of human genomic DNA using degenerate primers under low stringency (42{degrees}C). One of these, an 853 bp product, has been identified as a partial genomic sequence of the human homolog of the S. cerevisiae CDC27 gene, CDC27Hs (GenBank No. U00001). This gene, reported by Turgendreich et al. is also designated EST00556 from Adams et al. We have undertaken a more detailed examination of our sequence, MCP34N, and have found that: 1. the genomic sequence is nearly identical to CDC27Hs over its entire 853 bp length; 2. an MCP34N-specific PCRmore » assay of several non-human primate species reveals amplification products in chimpanzee and gorilla genomes having greater than 90% sequence identity with CDC27Hs; and 3. an MCP34N-specific PCR assay of the BIOS hybrid cell line panel gives a discordancy pattern suggesting multiple loci. Based upon these data, we present the following initial characterization: 1. the complete MCP34N sequence identity with CDC27Hs indicates that the latter is encoded by an intronless gene; 2. CDC27Hs is highly conserved among higher primates; and 3. CDC27Hs is present in multiple copies in the human genome. These characteristics, taken together with those initially reported for CDC27Hs, suggest that this is an old gene that carries out an important but, as yet, unknown function in the human brain.« less

Analysis, Characterization, and Loci of the tuf Genes in Lactobacillus and Bifidobacterium Species and Their Direct Application for Species Identification

PubMed Central

Ventura, Marco; Canchaya, Carlos; Meylan, Valèrie; Klaenhammer, Todd R.; Zink, Ralf

2003-01-01

We analyzed the tuf gene, encoding elongation factor Tu, from 33 strains representing 17 Lactobacillus species and 8 Bifidobacterium species. The tuf sequences were aligned and used to infer phylogenesis among species of lactobacilli and bifidobacteria. We demonstrated that the synonymous substitution affecting this gene renders elongation factor Tu a reliable molecular clock for investigating evolutionary distances of lactobacilli and bifidobacteria. In fact, the phylogeny generated by these tuf sequences is consistent with that derived from 16S rRNA analysis. The investigation of a multiple alignment of tuf sequences revealed regions conserved among strains belonging to the same species but distinct from those of other species. PCR primers complementary to these regions allowed species-specific identification of closely related species, such as Lactobacillus casei group members. These tuf gene-based assays developed in this study provide an alternative to present methods for the identification for lactic acid bacterial species. Since a variable number of tuf genes have been described for bacteria, the presence of multiple genes was examined. Southern analysis revealed one tuf gene in the genomes of lactobacilli and bifidobacteria, but the tuf gene was arranged differently in the genomes of these two taxa. Our results revealed that the tuf gene in bifidobacteria is flanked by the same gene constellation as the str operon, as originally reported for Escherichia coli. In contrast, bioinformatic and transcriptional analyses of the DNA region flanking the tuf gene in four Lactobacillus species indicated the same four-gene unit and suggested a novel tuf operon specific for the genus Lactobacillus. PMID:14602655

SIBIS: a Bayesian model for inconsistent protein sequence estimation.

PubMed

Khenoussi, Walyd; Vanhoutrève, Renaud; Poch, Olivier; Thompson, Julie D

2014-09-01

The prediction of protein coding genes is a major challenge that depends on the quality of genome sequencing, the accuracy of the model used to elucidate the exonic structure of the genes and the complexity of the gene splicing process leading to different protein variants. As a consequence, today's protein databases contain a huge amount of inconsistency, due to both natural variants and sequence prediction errors. We have developed a new method, called SIBIS, to detect such inconsistencies based on the evolutionary information in multiple sequence alignments. A Bayesian framework, combined with Dirichlet mixture models, is used to estimate the probability of observing specific amino acids and to detect inconsistent or erroneous sequence segments. We evaluated the performance of SIBIS on a reference set of protein sequences with experimentally validated errors and showed that the sensitivity is significantly higher than previous methods, with only a small loss of specificity. We also assessed a large set of human sequences from the UniProt database and found evidence of inconsistency in 48% of the previously uncharacterized sequences. We conclude that the integration of quality control methods like SIBIS in automatic analysis pipelines will be critical for the robust inference of structural, functional and phylogenetic information from these sequences. Source code, implemented in C on a linux system, and the datasets of protein sequences are freely available for download at http://www.lbgi.fr/∼julie/SIBIS. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

The Complete Mitochondrial Genome of Gossypium hirsutum and Evolutionary Analysis of Higher Plant Mitochondrial Genomes

PubMed Central

Su, Aiguo; Geng, Jianing; Grover, Corrinne E.; Hu, Songnian; Hua, Jinping

2013-01-01

Background Mitochondria are the main manufacturers of cellular ATP in eukaryotes. The plant mitochondrial genome contains large number of foreign DNA and repeated sequences undergone frequently intramolecular recombination. Upland Cotton (Gossypium hirsutum L.) is one of the main natural fiber crops and also an important oil-producing plant in the world. Sequencing of the cotton mitochondrial (mt) genome could be helpful for the evolution research of plant mt genomes. Methodology/Principal Findings We utilized 454 technology for sequencing and combined with Fosmid library of the Gossypium hirsutum mt genome screening and positive clones sequencing and conducted a series of evolutionary analysis on Cycas taitungensis and 24 angiosperms mt genomes. After data assembling and contigs joining, the complete mitochondrial genome sequence of G. hirsutum was obtained. The completed G.hirsutum mt genome is 621,884 bp in length, and contained 68 genes, including 35 protein genes, four rRNA genes and 29 tRNA genes. Five gene clusters are found conserved in all plant mt genomes; one and four clusters are specifically conserved in monocots and dicots, respectively. Homologous sequences are distributed along the plant mt genomes and species closely related share the most homologous sequences. For species that have both mt and chloroplast genome sequences available, we checked the location of cp-like migration and found several fragments closely linked with mitochondrial genes. Conclusion The G. hirsutum mt genome possesses most of the common characters of higher plant mt genomes. The existence of syntenic gene clusters, as well as the conservation of some intergenic sequences and genic content among the plant mt genomes suggest that evolution of mt genomes is consistent with plant taxonomy but independent among different species. PMID:23940520

The complete mitochondrial genome of Gossypium hirsutum and evolutionary analysis of higher plant mitochondrial genomes.

PubMed

Liu, Guozheng; Cao, Dandan; Li, Shuangshuang; Su, Aiguo; Geng, Jianing; Grover, Corrinne E; Hu, Songnian; Hua, Jinping

2013-01-01

Mitochondria are the main manufacturers of cellular ATP in eukaryotes. The plant mitochondrial genome contains large number of foreign DNA and repeated sequences undergone frequently intramolecular recombination. Upland Cotton (Gossypium hirsutum L.) is one of the main natural fiber crops and also an important oil-producing plant in the world. Sequencing of the cotton mitochondrial (mt) genome could be helpful for the evolution research of plant mt genomes. We utilized 454 technology for sequencing and combined with Fosmid library of the Gossypium hirsutum mt genome screening and positive clones sequencing and conducted a series of evolutionary analysis on Cycas taitungensis and 24 angiosperms mt genomes. After data assembling and contigs joining, the complete mitochondrial genome sequence of G. hirsutum was obtained. The completed G.hirsutum mt genome is 621,884 bp in length, and contained 68 genes, including 35 protein genes, four rRNA genes and 29 tRNA genes. Five gene clusters are found conserved in all plant mt genomes; one and four clusters are specifically conserved in monocots and dicots, respectively. Homologous sequences are distributed along the plant mt genomes and species closely related share the most homologous sequences. For species that have both mt and chloroplast genome sequences available, we checked the location of cp-like migration and found several fragments closely linked with mitochondrial genes. The G. hirsutum mt genome possesses most of the common characters of higher plant mt genomes. The existence of syntenic gene clusters, as well as the conservation of some intergenic sequences and genic content among the plant mt genomes suggest that evolution of mt genomes is consistent with plant taxonomy but independent among different species.

HIT'nDRIVE: patient-specific multidriver gene prioritization for precision oncology

PubMed Central

Hodzic, Ermin; Sauerwald, Thomas; Dao, Phuong; Wang, Kendric; Yeung, Jake; Anderson, Shawn; Vandin, Fabio; Haffari, Gholamreza; Collins, Colin C.; Sahinalp, S. Cenk

2017-01-01

Prioritizing molecular alterations that act as drivers of cancer remains a crucial bottleneck in therapeutic development. Here we introduce HIT'nDRIVE, a computational method that integrates genomic and transcriptomic data to identify a set of patient-specific, sequence-altered genes, with sufficient collective influence over dysregulated transcripts. HIT'nDRIVE aims to solve the “random walk facility location” (RWFL) problem in a gene (or protein) interaction network, which differs from the standard facility location problem by its use of an alternative distance measure: “multihitting time,” the expected length of the shortest random walk from any one of the set of sequence-altered genes to an expression-altered target gene. When applied to 2200 tumors from four major cancer types, HIT'nDRIVE revealed many potentially clinically actionable driver genes. We also demonstrated that it is possible to perform accurate phenotype prediction for tumor samples by only using HIT'nDRIVE-seeded driver gene modules from gene interaction networks. In addition, we identified a number of breast cancer subtype-specific driver modules that are associated with patients’ survival outcome. Furthermore, HIT'nDRIVE, when applied to a large panel of pan-cancer cell lines, accurately predicted drug efficacy using the driver genes and their seeded gene modules. Overall, HIT'nDRIVE may help clinicians contextualize massive multiomics data in therapeutic decision making, enabling widespread implementation of precision oncology. PMID:28768687

Sequence analysis of a few species of termites (Order: Isoptera) on the basis of partial characterization of COII gene.

PubMed

Sobti, Ranbir Chander; Kumari, Mamtesh; Sharma, Vijay Lakshmi; Sodhi, Monika; Mukesh, Manishi; Shouche, Yogesh

2009-11-01

The present study was aimed to get the nucleotide sequences of a part of COII mitochondrial gene amplified from individuals of five species of Termites (Isoptera: Termitidae: Macrotermitinae). Four of them belonged to the genus Odontotermes (O. obesus, O. horni, O. bhagwatii and Odontotermes sp.) and one to Microtermes (M. obesi). Partial COII gene fragments were amplified by using specific primers. The sequences so obtained were characterized to calculate the frequencies of each nucleotide bases and a high A + T content was observed. The interspecific pairwise sequence divergence in Odontotermes species ranged from 6.5% to 17.1% across COII fragment. M. obesi sequence diversity ranged from 2.5 with Odontotermes sp. to 19.0% with O. bhagwatii. Phylogenetic trees drawn on the basis of distance neighbour-joining method revealed three main clades clustering all the individuals according to their genera and families.

Chromosomal location and genetic mapping of the mismatch repair gene homologs MSH2, MSH3, and MSH6 in rye and wheat

PubMed

Korzun; Borner; Siebert; Malyshev; Hilpert; Kunze; Puchta

1999-12-01

The efficiency of homeologous recombination is influenced by mismatch repair genes in bacteria, yeast, and mammals. To elucidate a possible role of these genes in homeologous pairing and cross-compatibility in plants, gene probes of wheat (Triticum aestivum) specific for the mismatch repair gene homologues MSH2, MSH3, and MSH6 were used to map them to their genomic positions in rye (Secale cereale). Whereas MSH2 was mapped to the short arm of chromosome 1R, MSH3 was mapped to the long arm of chromosome 2R and MSH6 to the long arm of chromosome 5R. Southern blots with nullisomic-tetrasomic (NT) lines of wheat indicated the presence of the sequences on the respective homeologous group of wheat chromosomes. Additionally, an MSH6-specific homologue could also be detected on homoeologous group 3 of wheat. However, in the well-known, highly homoeologous pairing wheat mutant ph1b the MSH6-specific sequence is not within the deleted part of chromosome 5BL, indicating that the pairing phenotype is not due to a loss of one of the mismatch repair genes tested.

Next-generation sequencing to identify candidate genes and develop diagnostic markers for a novel Phytophthora resistance gene, RpsHC18, in soybean.

PubMed

Zhong, Chao; Sun, Suli; Li, Yinping; Duan, Canxing; Zhu, Zhendong

2018-03-01

A novel Phytophthora sojae resistance gene RpsHC18 was identified and finely mapped on soybean chromosome 3. Two NBS-LRR candidate genes were identified and two diagnostic markers of RpsHC18 were developed. Phytophthora root rot caused by Phytophthora sojae is a destructive disease of soybean. The most effective disease-control strategy is to deploy resistant cultivars carrying Phytophthora-resistant Rps genes. The soybean cultivar Huachun 18 has a broad and distinct resistance spectrum to 12 P. sojae isolates. Quantitative trait loci sequencing (QTL-seq), based on the whole-genome resequencing (WGRS) of two extreme resistant and susceptible phenotype bulks from an F 2:3 population, was performed, and one 767-kb genomic region with ΔSNP-index ≥ 0.9 on chromosome 3 was identified as the RpsHC18 candidate region in Huachun 18. The candidate region was reduced to a 146-kb region by fine mapping. Nonsynonymous SNP and haplotype analyses were carried out in the 146-kb region among ten soybean genotypes using WGRS. Four specific nonsynonymous SNPs were identified in two nucleotide-binding sites-leucine-rich repeat (NBS-LRR) genes, RpsHC18-NBL1 and RpsHC18-NBL2, which were considered to be the candidate genes. Finally, one specific SNP marker in each candidate gene was successfully developed using a tetra-primer ARMS-PCR assay, and the two markers were verified to be specific for RpsHC18 and to effectively distinguish other known Rps genes. In this study, we applied an integrated genomic-based strategy combining WGRS with traditional genetic mapping to identify RpsHC18 candidate genes and develop diagnostic markers. These results suggest that next-generation sequencing is a precise, rapid and cost-effective way to identify candidate genes and develop diagnostic markers, and it can accelerate Rps gene cloning and marker-assisted selection for breeding of P. sojae-resistant soybean cultivars.

In-depth resistome analysis by targeted metagenomics.

PubMed

Lanza, Val F; Baquero, Fernando; Martínez, José Luís; Ramos-Ruíz, Ricardo; González-Zorn, Bruno; Andremont, Antoine; Sánchez-Valenzuela, Antonio; Ehrlich, Stanislav Dusko; Kennedy, Sean; Ruppé, Etienne; van Schaik, Willem; Willems, Rob J; de la Cruz, Fernando; Coque, Teresa M

2018-01-15

Antimicrobial resistance is a major global health challenge. Metagenomics allows analyzing the presence and dynamics of "resistomes" (the ensemble of genes encoding antimicrobial resistance in a given microbiome) in disparate microbial ecosystems. However, the low sensitivity and specificity of available metagenomic methods preclude the detection of minority populations (often present below their detection threshold) and/or the identification of allelic variants that differ in the resulting phenotype. Here, we describe a novel strategy that combines targeted metagenomics using last generation in-solution capture platforms, with novel bioinformatics tools to establish a standardized framework that allows both quantitative and qualitative analyses of resistomes. We developed ResCap, a targeted sequence capture platform based on SeqCapEZ (NimbleGene) technology, which includes probes for 8667 canonical resistance genes (7963 antibiotic resistance genes and 704 genes conferring resistance to metals or biocides), and 2517 relaxase genes (plasmid markers) and 78,600 genes homologous to the previous identified targets (47,806 for antibiotics and 30,794 for biocides or metals). Its performance was compared with metagenomic shotgun sequencing (MSS) for 17 fecal samples (9 humans, 8 swine). ResCap significantly improves MSS to detect "gene abundance" (from 2.0 to 83.2%) and "gene diversity" (26 versus 14.9 genes unequivocally detected per sample per million of reads; the number of reads unequivocally mapped increasing up to 300-fold by using ResCap), which were calculated using novel bioinformatic tools. ResCap also facilitated the analysis of novel genes potentially involved in the resistance to antibiotics, metals, biocides, or any combination thereof. ResCap, the first targeted sequence capture, specifically developed to analyze resistomes, greatly enhances the sensitivity and specificity of available metagenomic methods and offers the possibility to analyze genes related to the selection and transfer of antimicrobial resistance (biocides, heavy metals, plasmids). The model opens the possibility to study other complex microbial systems in which minority populations play a relevant role.

Genetic heterogeneity of the dnaK gene locus including transcription terminator region (TTR) in Campylobacter lari.

PubMed

Shitara, M; Tsuboi, Y; Sekizuka, T; Tazumi, A; Moorei, J E; Millar, B C; Taneike, I; Matsuda, M

2008-01-01

Nucleotide sequences of approximately 3.1 kbp consisting of the full-length open reading frame (ORF) for grpE, a non-coding (NC) region and a putative ORF for the full-length dnaK gene (1860 bp) were identified from a urease-positive thermophilic Campylobacter (UPTC) CF89-12 isolate. Then, following the construction of a new degenerate polymerase chain reaction (PCR) primer pair for amplification of the dnaK structural gene, including the transcription terminator region of C. lari isolates, the dnaK region was amplified successfully, TA-cloned and sequenced in nine C. lari isolates. The dnaK gene sequences commenced with an ATG and terminated with a TAA in all 10 isolates, including CF89-12. In addition, the putative ORFs for the dnaK gene locus from seven UPTC isolates consisted of 1860 bases, and the four urease-negative (UN) C. lari isolates included C. lari RM2100 reference strain 1866. Interestingly, different probable ribosome binding sites and hypothetically intrinsic p-independent terminator structures were identified between the seven UPTC and four UN C. lari isolates, respectively. Moreover, it is interesting to note that 20 out of a total of 28 polymorphic sites occurred among amino acid sequences of the dnaK ORF from 11 C. lari isolates, identified to be alternatively UPTC-specific or UN C. lari-specific. In the neighbour-joining tree based on the nucleotide sequence information of the dnaK gene, C. lari forms two major distinct clusters consisting of UPTC and UN C. lari isolates, respectively, with UN C. lari being more closely related to other thermophilic campylobacters than to UPTC.

Identification of the genomic locus for the human Rieske Fe-S Protein gene on Chromosome 19q12

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pennacchio, L.A.

1994-05-06

We have identified the chromosomal location of the human Rieske Iron-Sulfur Protein (UQCRFS1) gene. Mapping by hybridization to a panel of monochromosomal hybrid cell lines indicated that the gene was either on chromosome 19 or 22. By screening a human chromosome 19 specific genomic cosmid library with an oligonucleotide probe made from the published Rieske cDNA sequence, we identified a corresponding cosmid. Portions of this cosmid were sequenced directly. The exon, exon:intron junction, and flanking sequences verified that this cosmid contains the genomic locus. Fluorescent in situ hybridization (FISH) was performed to localize this cosmid to chromosome band 19q12.

Sequence Analysis and Initial Characterization of Two Isozymes of Hydroxylaminobenzene Mutase from Pseudomonas pseudoalcaligenes JS45

PubMed Central

Davis, John K.; Paoli, George C.; He, Zhongqi; Nadeau, Lloyd J.; Somerville, Charles C.; Spain, Jim C.

2000-01-01

Pseudomonas pseudoalcaligenes JS45 grows on nitrobenzene by a partially reductive pathway in which the intermediate hydroxylaminobenzene is enzymatically rearranged to 2-aminophenol by hydroxylaminobenzene mutase (HAB mutase). The properties of the enzyme, the reaction mechanism, and the evolutionary origin of the gene(s) encoding the enzyme are unknown. In this study, two open reading frames (habA and habB), each encoding an HAB mutase enzyme, were cloned from a P. pseudoalcaligenes JS45 genomic library and sequenced. The open reading frames encoding HabA and HabB are separated by 2.5 kb and are divergently transcribed. The deduced amino acid sequences of HabA and HabB are 44% identical. The HAB mutase specific activities in crude extracts of Escherichia coli clones synthesizing either HabA or HabB were similar to the specific activities of extracts of strain JS45 grown on nitrobenzene. HAB mutase activity in E. coli extracts containing HabB withstood heating at 85°C for 10 min, but extracts containing HabA were inactivated when they were heated at temperatures above 60°C. HAB mutase activity in extracts of P. pseudoalcaligenes JS45 grown on nitrobenzene exhibited intermediate temperature stability. Although both the habA gene and the habB gene conferred HAB mutase activity when they were separately cloned and expressed in E. coli, reverse transcriptase PCR analysis indicated that only habA is transcribed in P. pseudoalcaligenes JS45. A mutant strain derived from strain JS45 in which the habA gene was disrupted was unable to grow on nitrobenzene, which provided physiological evidence that HabA is involved in the degradation of nitrobenzene. A strain in which habB was disrupted grew on nitrobenzene. Gene Rv3078 of Mycobacterium tuberculosis H37Rv encodes a protein whose deduced amino acid sequence is 52% identical to the HabB amino acid sequence. E. coli containing M. tuberculosis gene Rv3078 cloned into pUC18 exhibited low levels of HAB mutase activity. Sequences that exhibit similarity to transposable element sequences are present between habA and habB, as well as downstream of habB, which suggests that horizontal gene transfer resulted in acquisition of one or both of the hab genes. PMID:10877793

Identification of a DNA sequence motif required for expression of iron-regulated genes in pseudomonads.

PubMed

Rombel, I T; McMorran, B J; Lamont, I L

1995-02-20

Many bacteria respond to a lack of iron in the environment by synthesizing siderophores, which act as iron-scavenging compounds. Fluorescent pseudomonads synthesize strain-specific but chemically related siderophores called pyoverdines or pseudobactins. We have investigated the mechanisms by which iron controls expression of genes involved in pyoverdine metabolism in Pseudomonas aeruginosa. Transcription of these genes is repressed by the presence of iron in the growth medium. Three promoters from these genes were cloned and the activities of the promoters were dependent on the amounts of iron in the growth media. Two of the promoters were sequenced and the transcriptional start site were identified by S1 nuclease analysis. Sequences similar to the consensus binding site for the Fur repressor protein, which controls expression of iron-repressible genes in several gram-negative species, were not present in the promoters, suggesting that they are unlikely to have a high affinity for Fur. However, comparison of the promoter sequences with those of iron-regulated genes from other Pseudomonas species and also the iron-regulated exotoxin gene of P. aeruginosa allowed identification of a shared sequence element, with the consensus sequence (G/C)CTAAAT-CCC, which is likely to act as a binding site for a transcriptional activator protein. Mutations in this sequence greatly reduced the activities of the promoters characterized here as well as those of other iron-regulated promoters. The requirement for this motif in the promoters of iron-regulated genes of different Pseudomonas species indicates that similar mechanisms are likely to be involved in controlling expression of a range of iron-regulated genes in pseudomonads.

Phylogenetic and comparative gene expression analysis of barley (Hordeum vulgare)WRKY transcription factor family reveals putatively retained functions betweenmonocots and dicots

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mangelsen, Elke; Kilian, Joachim; Berendzen, Kenneth W.

2008-02-01

WRKY proteins belong to the WRKY-GCM1 superfamily of zinc finger transcription factors that have been subject to a large plant-specific diversification. For the cereal crop barley (Hordeum vulgare), three different WRKY proteins have been characterized so far, as regulators in sucrose signaling, in pathogen defense, and in response to cold and drought, respectively. However, their phylogenetic relationship remained unresolved. In this study, we used the available sequence information to identify a minimum number of 45 barley WRKY transcription factor (HvWRKY) genes. According to their structural features the HvWRKY factors were classified into the previously defined polyphyletic WRKY subgroups 1 tomore » 3. Furthermore, we could assign putative orthologs of the HvWRKY proteins in Arabidopsis and rice. While in most cases clades of orthologous proteins were formed within each group or subgroup, other clades were composed of paralogous proteins for the grasses and Arabidopsis only, which is indicative of specific gene radiation events. To gain insight into their putative functions, we examined expression profiles of WRKY genes from publicly available microarray data resources and found group specific expression patterns. While putative orthologs of the HvWRKY transcription factors have been inferred from phylogenetic sequence analysis, we performed a comparative expression analysis of WRKY genes in Arabidopsis and barley. Indeed, highly correlative expression profiles were found between some of the putative orthologs. HvWRKY genes have not only undergone radiation in monocot or dicot species, but exhibit evolutionary traits specific to grasses. HvWRKY proteins exhibited not only sequence similarities between orthologs with Arabidopsis, but also relatedness in their expression patterns. This correlative expression is indicative for a putative conserved function of related WRKY proteins in mono- and dicot species.« less

Mapping of a Novel Race Specific Resistance Gene to Phytophthora Root Rot of Pepper (Capsicum annuum) Using Bulked Segregant Analysis Combined with Specific Length Amplified Fragment Sequencing Strategy.

PubMed

Xu, Xiaomei; Chao, Juan; Cheng, Xueli; Wang, Rui; Sun, Baojuan; Wang, Hengming; Luo, Shaobo; Xu, Xiaowan; Wu, Tingquan; Li, Ying

2016-01-01

Phytophthora root rot caused by Phytophthora capsici (P. capsici) is a serious limitation to pepper production in Southern China, with high temperature and humidity. Mapping PRR resistance genes can provide linked DNA markers for breeding PRR resistant varieties by molecular marker-assisted selection (MAS). Two BC1 populations and an F2 population derived from a cross between P. capsici-resistant accession, Criollo de Morelos 334 (CM334) and P. capsici-susceptible accession, New Mexico Capsicum Accession 10399 (NMCA10399) were used to investigate the genetic characteristics of PRR resistance. PRR resistance to isolate Byl4 (race 3) was controlled by a single dominant gene, PhR10, that was mapped to an interval of 16.39Mb at the end of the long arm of chromosome 10. Integration of bulked segregant analysis (BSA) and Specific Length Amplified Fragment sequencing (SLAF-seq) provided an efficient genetic mapping strategy. Ten polymorphic Simple Sequence Repeat (SSR) markers were found within this region and used to screen the genotypes of 636 BC1 plants, delimiting PhR10 to a 2.57 Mb interval between markers P52-11-21 (1.5 cM away) and P52-11-41 (1.1 cM). A total of 163 genes were annotated within this region and 31 were predicted to be associated with disease resistance. PhR10 is a novel race specific gene for PRR, and this paper describes linked SSR markers suitable for marker-assisted selection of PRR resistant varieties, also laying a foundation for cloning the resistance gene.

Zooanthroponotic transmission of rotavirus in Haryana State of Northern India.

PubMed

Choudhary, P; Minakshi, P; Ranjan, K; Basanti, B

Rotaviruses are the major cause of severe gastroenteritis and mortality in young children and animals. Due to segmented nature of dsRNA genome and wide host range, vast genetic and antigenic diversity exists amongst different isolates of rotaviruses. A total of 230 fecal ovine and caprine samples collected from organized farms and villages in Haryana were screened for rotavirus detection. Samples were screened by latex agglutination test and RNA-PAGE followed by RT-PCR and nucleic acid sequencing. The latex agglutination test showed 25 newborn lamb and 4 kid fecal samples positive for rotavirus. However, RNA-PAGE showed only 9 lamb fecal samples positive for rotavirus. All the samples were subjected to RT-PCR employing vp4 and vp7 gene specific primers of group A rotavirus of ovine, bovine and human origin. Only two samples from lamb (Sheep18/Hisar/2013 and Sheep22/Hisar/2013) showed vp4 and vp7 gene specific amplification with human group A rotavirus (GAR) specific primer. However, they did not show any amplification with ovine and bovine rotavirus specific primers. The nucleotide as well as deduced amino acid sequence analysis of vp4 gene of these isolates showed >98/97% and vp7 gene >95/94% nt/aa identity with human GAR from different regions of the world. Based on nucleotide similarity search, Sheep18/Hisar/2013 and Sheep22/Hisar/2013 isolates were genotyped as G1P[8] and G1P[4]. Phylogenetic analysis also confirmed that these isolates were clustered closely with human rotaviruses from different regions of the world. Earlier, higher prevalence of human rotaviruses was reported from the sample collecting area. The amplification of ovine samples with human rotavirus gene specific primers, sequence identity and phylogenetic analysis strongly suggests the zoonotic transmission of human GAR to sheep.

Integrative View of α2,3-Sialyltransferases (ST3Gal) Molecular and Functional Evolution in Deuterostomes: Significance of Lineage-Specific Losses

PubMed Central

Petit, Daniel; Teppa, Elin; Mir, Anne-Marie; Vicogne, Dorothée; Thisse, Christine; Thisse, Bernard; Filloux, Cyril; Harduin-Lepers, Anne

2015-01-01

Sialyltransferases are responsible for the synthesis of a diverse range of sialoglycoconjugates predicted to be pivotal to deuterostomes’ evolution. In this work, we reconstructed the evolutionary history of the metazoan α2,3-sialyltransferases family (ST3Gal), a subset of sialyltransferases encompassing six subfamilies (ST3Gal I–ST3Gal VI) functionally characterized in mammals. Exploration of genomic and expressed sequence tag databases and search of conserved sialylmotifs led to the identification of a large data set of st3gal-related gene sequences. Molecular phylogeny and large scale sequence similarity network analysis identified four new vertebrate subfamilies called ST3Gal III-r, ST3Gal VII, ST3Gal VIII, and ST3Gal IX. To address the issue of the origin and evolutionary relationships of the st3gal-related genes, we performed comparative syntenic mapping of st3gal gene loci combined to ancestral genome reconstruction. The ten vertebrate ST3Gal subfamilies originated from genome duplication events at the base of vertebrates and are organized in three distinct and ancient groups of genes predating the early deuterostomes. Inferring st3gal gene family history identified also several lineage-specific gene losses, the significance of which was explored in a functional context. Toward this aim, spatiotemporal distribution of st3gal genes was analyzed in zebrafish and bovine tissues. In addition, molecular evolutionary analyses using specificity determining position and coevolved amino acid predictions led to the identification of amino acid residues with potential implication in functional divergence of vertebrate ST3Gal. We propose a detailed scenario of the evolutionary relationships of st3gal genes coupled to a conceptual framework of the evolution of ST3Gal functions. PMID:25534026

Discovery of genes related to insecticide resistance in Bactrocera dorsalis by functional genomic analysis of a de novo assembled transcriptome.

PubMed

Hsu, Ju-Chun; Chien, Ting-Ying; Hu, Chia-Cheng; Chen, Mei-Ju May; Wu, Wen-Jer; Feng, Hai-Tung; Haymer, David S; Chen, Chien-Yu

2012-01-01

Insecticide resistance has recently become a critical concern for control of many insect pest species. Genome sequencing and global quantization of gene expression through analysis of the transcriptome can provide useful information relevant to this challenging problem. The oriental fruit fly, Bactrocera dorsalis, is one of the world's most destructive agricultural pests, and recently it has been used as a target for studies of genetic mechanisms related to insecticide resistance. However, prior to this study, the molecular data available for this species was largely limited to genes identified through homology. To provide a broader pool of gene sequences of potential interest with regard to insecticide resistance, this study uses whole transcriptome analysis developed through de novo assembly of short reads generated by next-generation sequencing (NGS). The transcriptome of B. dorsalis was initially constructed using Illumina's Solexa sequencing technology. Qualified reads were assembled into contigs and potential splicing variants (isotigs). A total of 29,067 isotigs have putative homologues in the non-redundant (nr) protein database from NCBI, and 11,073 of these correspond to distinct D. melanogaster proteins in the RefSeq database. Approximately 5,546 isotigs contain coding sequences that are at least 80% complete and appear to represent B. dorsalis genes. We observed a strong correlation between the completeness of the assembled sequences and the expression intensity of the transcripts. The assembled sequences were also used to identify large numbers of genes potentially belonging to families related to insecticide resistance. A total of 90 P450-, 42 GST-and 37 COE-related genes, representing three major enzyme families involved in insecticide metabolism and resistance, were identified. In addition, 36 isotigs were discovered to contain target site sequences related to four classes of resistance genes. Identified sequence motifs were also analyzed to characterize putative polypeptide translational products and associate them with specific genes and protein functions.

Distinguishing the genotype 1 genes and proteins of human Wa-like rotaviruses vs. porcine rotaviruses

PubMed Central

Silva, Fernanda D.F.; Gregori, F.; McDonald, Sarah M.

2016-01-01

Group A rotaviruses (RVAs) are 11-segmented, double-stranded RNA viruses and important causes of gastroenteritis in the young of many animal species. Previous studies have suggested that human Wa-like RVAs share a close evolutionary relationship with porcine RVAs. Specifically, the VP1-VP3 and NSP2-5/6 genes of these viruses are usually classified as genotype 1 with >81% nucleotide sequence identity. Yet, it remains unknown whether the genotype 1 genes and proteins of human Wa-like strains are distinguishable from those of porcine strains. To investigate this, we performed comprehensive bioinformatic analyses using all known genotype 1 gene sequences. The RVAs analyzed represent wildtype strains isolated from humans or pigs at various geographical locations during the years of 2004–2013, including 11 newly-sequenced porcine RVAs from Brazil. We also analyzed archival strains that were isolated during the years of 1977–1992 as well as atypical strains involved in inter-species transmission between humans and pigs. We found that, in general, the genotype 1 genes of typical modern human Wa-like RVAs clustered together in phylogenetic trees and were separate from those of typical modern porcine RVAs. The only exception was for the NSP5/6 gene, which showed no host-specific phylogenetic clustering. Using amino acid sequence alignments, we identified 34 positions that differentiated the VP1-VP3, NSP2, and NSP3 genotype 1 proteins of typical modern human Wa-like RVAs versus typical modern porcine RVAs and documented how these positions vary in the archival/unusual isolates. No host-specific amino acid positions were identified for NSP4, NSP5, or NSP6. Altogether, the results of this study support the notion that human Wa-like RVAs and porcine RVAs are evolutionarily related, but indicate that some of their genotype 1 genes and proteins have diverged over time possibly as a reflection of sequestered replication and protein co-adaptation in their respective hosts. PMID:27180895

Human AZU-1 gene, variants thereof and expressed gene products

DOEpatents

Chen, Huei-Mei; Bissell, Mina

2004-06-22

A human AZU-1 gene, mutants, variants and fragments thereof. Protein products encoded by the AZU-1 gene and homologs encoded by the variants of AZU-1 gene acting as tumor suppressors or markers of malignancy progression and tumorigenicity reversion. Identification, isolation and characterization of AZU-1 and AZU-2 genes localized to a tumor suppressive locus at chromosome 10q26, highly expressed in nonmalignant and premalignant cells derived from a human breast tumor progression model. A recombinant full length protein sequences encoded by the AZU-1 gene and nucleotide sequences of AZU-1 and AZU-2 genes and variant and fragments thereof. Monoclonal or polyclonal antibodies specific to AZU-1, AZU-2 encoded protein and to AZU-1, or AZU-2 encoded protein homologs.

The Eucalyptus terpene synthase gene family.

PubMed

Külheim, Carsten; Padovan, Amanda; Hefer, Charles; Krause, Sandra T; Köllner, Tobias G; Myburg, Alexander A; Degenhardt, Jörg; Foley, William J

2015-06-11

Terpenoids are abundant in the foliage of Eucalyptus, providing the characteristic smell as well as being valuable economically and influencing ecological interactions. Quantitative and qualitative inter- and intra- specific variation of terpenes is common in eucalypts. The genome sequences of Eucalyptus grandis and E. globulus were mined for terpene synthase genes (TPS) and compared to other plant species. We investigated the relative expression of TPS in seven plant tissues and functionally characterized five TPS genes from E. grandis. Compared to other sequenced plant genomes, Eucalyptus grandis has the largest number of putative functional TPS genes of any sequenced plant. We discovered 113 and 106 putative functional TPS genes in E. grandis and E. globulus, respectively. All but one TPS from E. grandis were expressed in at least one of seven plant tissues examined. Genomic clusters of up to 20 genes were identified. Many TPS are expressed in tissues other than leaves which invites a re-evaluation of the function of terpenes in Eucalyptus. Our data indicate that terpenes in Eucalyptus may play a wider role in biotic and abiotic interactions than previously thought. Tissue specific expression is common and the possibility of stress induction needs further investigation. Phylogenetic comparison of the two investigated Eucalyptus species gives insight about recent evolution of different clades within the TPS gene family. While the majority of TPS genes occur in orthologous pairs some clades show evidence of recent gene duplication, as well as loss of function.

The largest subunit of RNA polymerase II as a new marker gene to study assemblages of arbuscular mycorrhizal fungi in the field.

PubMed

Stockinger, Herbert; Peyret-Guzzon, Marine; Koegel, Sally; Bouffaud, Marie-Lara; Redecker, Dirk

2014-01-01

Due to the potential of arbuscular mycorrhizal fungi (AMF, Glomeromycota) to improve plant growth and soil quality, the influence of agricultural practice on their diversity continues to be an important research question. Up to now studies of community diversity in AMF have exclusively been based on nuclear ribosomal gene regions, which in AMF show high intra-organism polymorphism, seriously complicating interpretation of these data. We designed specific PCR primers for 454 sequencing of a region of the largest subunit of RNA polymerase II gene, and established a new reference dataset comprising all major AMF lineages. This gene is known to be monomorphic within fungal isolates but shows an excellent barcode gap between species. We designed a primer set to amplify all known lineages of AMF and demonstrated its applicability in combination with high-throughput sequencing in a long-term tillage experiment. The PCR primers showed a specificity of 99.94% for glomeromycotan sequences. We found evidence of significant shifts of the AMF communities caused by soil management and showed that tillage effects on different AMF taxa are clearly more complex than previously thought. The high resolving power of high-throughput sequencing highlights the need for quantitative measurements to efficiently detect these effects.

Comparison of Five Major Trichome Regulatory Genes in Brassica villosa with Orthologues within the Brassicaceae

PubMed Central

Nayidu, Naghabushana K.; Kagale, Sateesh; Taheri, Ali; Withana-Gamage, Thushan S.; Parkin, Isobel A. P.; Sharpe, Andrew G.; Gruber, Margaret Y.

2014-01-01

Coding sequences for major trichome regulatory genes, including the positive regulators GLABRA 1(GL1), GLABRA 2 (GL2), ENHANCER OF GLABRA 3 (EGL3), and TRANSPARENT TESTA GLABRA 1 (TTG1) and the negative regulator TRIPTYCHON (TRY), were cloned from wild Brassica villosa, which is characterized by dense trichome coverage over most of the plant. Transcript (FPKM) levels from RNA sequencing indicated much higher expression of the GL2 and TTG1 regulatory genes in B. villosa leaves compared with expression levels of GL1 and EGL3 genes in either B. villosa or the reference genome species, glabrous B. oleracea; however, cotyledon TTG1 expression was high in both species. RNA sequencing and Q-PCR also revealed an unusual expression pattern for the negative regulators TRY and CPC, which were much more highly expressed in trichome-rich B. villosa leaves than in glabrous B. oleracea leaves and in glabrous cotyledons from both species. The B. villosa TRY expression pattern also contrasted with TRY expression patterns in two diploid Brassica species, and with the Arabidopsis model for expression of negative regulators of trichome development. Further unique sequence polymorphisms, protein characteristics, and gene evolution studies highlighted specific amino acids in GL1 and GL2 coding sequences that distinguished glabrous species from hairy species and several variants that were specific for each B. villosa gene. Positive selection was observed for GL1 between hairy and non-hairy plants, and as expected the origin of the four expressed positive trichome regulatory genes in B. villosa was predicted to be from B. oleracea. In particular the unpredicted expression patterns for TRY and CPC in B. villosa suggest additional characterization is needed to determine the function of the expanded families of trichome regulatory genes in more complex polyploid species within the Brassicaceae. PMID:24755905

Transcriptome analysis of Cymbidium sinense and its application to the identification of genes associated with floral development

PubMed Central

2013-01-01

Background Cymbidium sinense belongs to the Orchidaceae, which is one of the most abundant angiosperm families. C. sinense, a high-grade traditional potted flower, is most prevalent in China and some Southeast Asian countries. The control of flowering time is a major bottleneck in the industrialized development of C. sinense. Little is known about the mechanisms responsible for floral development in this orchid. Moreover, genome references for entire transcriptome sequences do not currently exist for C. sinense. Thus, transcriptome and expression profiling data for this species are needed as an important resource to identify genes and to better understand the biological mechanisms of floral development in C. sinense. Results In this study, de novo transcriptome assembly and gene expression analysis using Illumina sequencing technology were performed. Transcriptome analysis assembles gene-related information related to vegetative and reproductive growth of C. sinense. Illumina sequencing generated 54,248,006 high quality reads that were assembled into 83,580 unigenes with an average sequence length of 612 base pairs, including 13,315 clusters and 70,265 singletons. A total of 41,687 (49.88%) unique sequences were annotated, 23,092 of which were assigned to specific metabolic pathways by the Kyoto Encyclopedia of Genes and Genomes (KEGG). Gene Ontology (GO) analysis of the annotated unigenes revealed that the majority of sequenced genes were associated with metabolic and cellular processes, cell and cell parts, catalytic activity and binding. Furthermore, 120 flowering-associated unigenes, 73 MADS-box unigenes and 28 CONSTANS-LIKE (COL) unigenes were identified from our collection. In addition, three digital gene expression (DGE) libraries were constructed for the vegetative phase (VP), floral differentiation phase (FDP) and reproductive phase (RP). The specific expression of many genes in the three development phases was also identified. 32 genes among three sub-libraries with high differential expression were selected as candidates connected with flower development. Conclusion RNA-seq and DGE profiling data provided comprehensive gene expression information at the transcriptional level that could facilitate our understanding of the molecular mechanisms of floral development at three development phases of C. sinense. This data could be used as an important resource for investigating the genetics of the flowering pathway and various biological mechanisms in this orchid. PMID:23617896

Transcriptome analysis of Cymbidium sinense and its application to the identification of genes associated with floral development.

PubMed

Zhang, Jianxia; Wu, Kunlin; Zeng, Songjun; Teixeira da Silva, Jaime A; Zhao, Xiaolan; Tian, Chang-En; Xia, Haoqiang; Duan, Jun

2013-04-24

Cymbidium sinense belongs to the Orchidaceae, which is one of the most abundant angiosperm families. C. sinense, a high-grade traditional potted flower, is most prevalent in China and some Southeast Asian countries. The control of flowering time is a major bottleneck in the industrialized development of C. sinense. Little is known about the mechanisms responsible for floral development in this orchid. Moreover, genome references for entire transcriptome sequences do not currently exist for C. sinense. Thus, transcriptome and expression profiling data for this species are needed as an important resource to identify genes and to better understand the biological mechanisms of floral development in C. sinense. In this study, de novo transcriptome assembly and gene expression analysis using Illumina sequencing technology were performed. Transcriptome analysis assembles gene-related information related to vegetative and reproductive growth of C. sinense. Illumina sequencing generated 54,248,006 high quality reads that were assembled into 83,580 unigenes with an average sequence length of 612 base pairs, including 13,315 clusters and 70,265 singletons. A total of 41,687 (49.88%) unique sequences were annotated, 23,092 of which were assigned to specific metabolic pathways by the Kyoto Encyclopedia of Genes and Genomes (KEGG). Gene Ontology (GO) analysis of the annotated unigenes revealed that the majority of sequenced genes were associated with metabolic and cellular processes, cell and cell parts, catalytic activity and binding. Furthermore, 120 flowering-associated unigenes, 73 MADS-box unigenes and 28 CONSTANS-LIKE (COL) unigenes were identified from our collection. In addition, three digital gene expression (DGE) libraries were constructed for the vegetative phase (VP), floral differentiation phase (FDP) and reproductive phase (RP). The specific expression of many genes in the three development phases was also identified. 32 genes among three sub-libraries with high differential expression were selected as candidates connected with flower development. RNA-seq and DGE profiling data provided comprehensive gene expression information at the transcriptional level that could facilitate our understanding of the molecular mechanisms of floral development at three development phases of C. sinense. This data could be used as an important resource for investigating the genetics of the flowering pathway and various biological mechanisms in this orchid.

Analysis of Cytoskeletal and Motility Proteins in the Sea Urchin Genome Assembly

PubMed Central

RL, Morris; MP, Hoffman; RA, Obar; SS, McCafferty; IR, Gibbons; AD, Leone; J, Cool; EL, Allgood; AM, Musante; KM, Judkins; BJ, Rossetti; AP, Rawson; DR, Burgess

2007-01-01

The sea urchin embryo is a classical model system for studying the role of the cytoskeleton in such events as fertilization, mitosis, cleavage, cell migration and gastrulation. We have conducted an analysis of gene models derived from the Strongylocentrotus purpuratus genome assembly and have gathered strong evidence for the existence of multiple gene families encoding cytoskeletal proteins and their regulators in sea urchin. While many cytoskeletal genes have been cloned from sea urchin with sequences already existing in public databases, genome analysis reveals a significantly higher degree of diversity within certain gene families. Furthermore, genes are described corresponding to homologs of cytoskeletal proteins not previously documented in sea urchins. To illustrate the varying degree of sequence diversity that exists within cytoskeletal gene families, we conducted an analysis of genes encoding actins, specific actin-binding proteins, myosins, tubulins, kinesins, dyneins, specific microtubule-associated proteins, and intermediate filaments. We conducted ontological analysis of select genes to better understand the relatedness of urchin cytoskeletal genes to those of other deuterostomes. We analyzed developmental expression (EST) data to confirm the existence of select gene models and to understand their differential expression during various stages of early development. PMID:17027957

Positive Selection Underlies Faster-Z Evolution of Gene Expression in Birds

PubMed Central

Dean, Rebecca; Harrison, Peter W.; Wright, Alison E.; Zimmer, Fabian; Mank, Judith E.

2015-01-01

The elevated rate of evolution for genes on sex chromosomes compared with autosomes (Fast-X or Fast-Z evolution) can result either from positive selection in the heterogametic sex or from nonadaptive consequences of reduced relative effective population size. Recent work in birds suggests that Fast-Z of coding sequence is primarily due to relaxed purifying selection resulting from reduced relative effective population size. However, gene sequence and gene expression are often subject to distinct evolutionary pressures; therefore, we tested for Fast-Z in gene expression using next-generation RNA-sequencing data from multiple avian species. Similar to studies of Fast-Z in coding sequence, we recover clear signatures of Fast-Z in gene expression; however, in contrast to coding sequence, our data indicate that Fast-Z in expression is due to positive selection acting primarily in females. In the soma, where gene expression is highly correlated between the sexes, we detected Fast-Z in both sexes, although at a higher rate in females, suggesting that many positively selected expression changes in females are also expressed in males. In the gonad, where intersexual correlations in expression are much lower, we detected Fast-Z for female gene expression, but crucially, not males. This suggests that a large amount of expression variation is sex-specific in its effects within the gonad. Taken together, our results indicate that Fast-Z evolution of gene expression is the product of positive selection acting on recessive beneficial alleles in the heterogametic sex. More broadly, our analysis suggests that the adaptive potential of Z chromosome gene expression may be much greater than that of gene sequence, results which have important implications for the role of sex chromosomes in speciation and sexual selection. PMID:26067773

Analysis of a native whitefly transcriptome and its sequence divergence with two invasive whitefly species.

PubMed

Wang, Xiao-Wei; Zhao, Qiong-Yi; Luan, Jun-Bo; Wang, Yu-Jun; Yan, Gen-Hong; Liu, Shu-Sheng

2012-10-04

Genomic divergence between invasive and native species may provide insight into the molecular basis underlying specific characteristics that drive the invasion and displacement of closely related species. In this study, we sequenced the transcriptome of an indigenous species, Asia II 3, of the Bemisia tabaci complex and compared its genetic divergence with the transcriptomes of two invasive whiteflies species, Middle East Asia Minor 1 (MEAM1) and Mediterranean (MED), respectively. More than 16 million reads of 74 base pairs in length were obtained for the Asia II 3 species using the Illumina sequencing platform. These reads were assembled into 52,535 distinct sequences (mean size: 466 bp) and 16,596 sequences were annotated with an E-value above 10-5. Protein family comparisons revealed obvious diversification among the transcriptomes of these species suggesting species-specific adaptations during whitefly evolution. On the contrary, substantial conservation of the whitefly transcriptomes was also evident, despite their differences. The overall divergence of coding sequences between the orthologous gene pairs of Asia II 3 and MEAM1 is 1.73%, which is comparable to the average divergence of Asia II 3 and MED transcriptomes (1.84%) and much higher than that of MEAM1 and MED (0.83%). This is consistent with the previous phylogenetic analyses and crossing experiments suggesting these are distinct species. We also identified hundreds of highly diverged genes and compiled sequence identify data into gene functional groups and found the most divergent gene classes are Cytochrome P450, Glutathione metabolism and Oxidative phosphorylation. These results strongly suggest that the divergence of genes related to metabolism might be the driving force of the MEAM1 and Asia II 3 differentiation. We also analyzed single nucleotide polymorphisms within the orthologous gene pairs of indigenous and invasive whiteflies which are helpful for the investigation of association between allelic and phenotypes. Our data present the most comprehensive sequences for the indigenous whitefly species Asia II 3. The extensive comparisons of Asia II 3, MEAM1 and MED transcriptomes will serve as an invaluable resource for revealing the genetic basis of whitefly invasion and the molecular mechanisms underlying their biological differences.

Analysis of a native whitefly transcriptome and its sequence divergence with two invasive whitefly species

PubMed Central

2012-01-01

Background Genomic divergence between invasive and native species may provide insight into the molecular basis underlying specific characteristics that drive the invasion and displacement of closely related species. In this study, we sequenced the transcriptome of an indigenous species, Asia II 3, of the Bemisia tabaci complex and compared its genetic divergence with the transcriptomes of two invasive whiteflies species, Middle East Asia Minor 1 (MEAM1) and Mediterranean (MED), respectively. Results More than 16 million reads of 74 base pairs in length were obtained for the Asia II 3 species using the Illumina sequencing platform. These reads were assembled into 52,535 distinct sequences (mean size: 466 bp) and 16,596 sequences were annotated with an E-value above 10-5. Protein family comparisons revealed obvious diversification among the transcriptomes of these species suggesting species-specific adaptations during whitefly evolution. On the contrary, substantial conservation of the whitefly transcriptomes was also evident, despite their differences. The overall divergence of coding sequences between the orthologous gene pairs of Asia II 3 and MEAM1 is 1.73%, which is comparable to the average divergence of Asia II 3 and MED transcriptomes (1.84%) and much higher than that of MEAM1 and MED (0.83%). This is consistent with the previous phylogenetic analyses and crossing experiments suggesting these are distinct species. We also identified hundreds of highly diverged genes and compiled sequence identify data into gene functional groups and found the most divergent gene classes are Cytochrome P450, Glutathione metabolism and Oxidative phosphorylation. These results strongly suggest that the divergence of genes related to metabolism might be the driving force of the MEAM1 and Asia II 3 differentiation. We also analyzed single nucleotide polymorphisms within the orthologous gene pairs of indigenous and invasive whiteflies which are helpful for the investigation of association between allelic and phenotypes. Conclusions Our data present the most comprehensive sequences for the indigenous whitefly species Asia II 3. The extensive comparisons of Asia II 3, MEAM1 and MED transcriptomes will serve as an invaluable resource for revealing the genetic basis of whitefly invasion and the molecular mechanisms underlying their biological differences. PMID:23036081

High-quality draft genome sequence of Ensifer meliloti Mlalz-1, a microsymbiont of Medicago laciniata (L.) miller collected in Lanzarote, Canary Islands, Spain

DOE Office of Scientific and Technical Information (OSTI.GOV)

Osman, Wan Adnawani Meor; van Berkum, Peter; León-Barrios, Milagros

Ensifer meliloti Mlalz-1 (INSDC = ATZD00000000) is an aerobic, motile, Gram-negative, non-spore-forming rod that was isolated from an effective nitrogen-fixing nodule of Medicago laciniata (L.) Miller from a soil sample collected near the town of Guatiza on the island of Lanzarote, the Canary Islands, Spain. This strain nodulates and forms an effective symbiosis with the highly specific host M. laciniata. This rhizobial genome was sequenced as part of the DOE Joint Genome Institute 2010 Genomic Encyclopedia for Bacteria and Archaea-Root Nodule Bacteria (GEBA-RNB) sequencing project. Here in this paper, the features of E. meliloti Mlalz-1 are described, together with high-qualitymore » permanent draft genome sequence information and annotation. The 6,664,116 bp high-quality draft genome is arranged in 99 scaffolds of 100 contigs, containing 6314 protein-coding genes and 74 RNA-only encoding genes. Strain Mlalz-1 is closely related to Ensifer meliloti IAM 12611 T, Ensifer medicae A 321T and Ensifer numidicus ORS 1407 T, based on 16S rRNA gene sequences. gANI values of ≥98.1% support the classification of strain Mlalz-1 as E. meliloti . Nodulation of M. laciniata requires a specific nodC allele, and the nodC gene of strain Mlalz-1 shares ≥98% sequence identity with nodC of M. laciniata-nodulating Ensifer strains, but ≤93% with nodC of Ensifer strains that nodulate other Medicago species. Strain Mlalz-1 is unique among sequenced E. meliloti strains in possessing genes encoding components of a T2SS and in having two versions of the adaptive acid tolerance response lpiA-acvB operon. In E. medicae strain WSM419, lpiA is essential for enhancing survival in lethal acid conditions. The second copy of the lpiA-acvB operon of strain Mlalz-1 has highest sequence identity (> 96%) with that of E. medicae strains, which suggests genetic recombination between strain Mlalz-1 and E. medicae and the horizontal gene transfer of lpiA-acvB.« less

High-quality draft genome sequence of Ensifer meliloti Mlalz-1, a microsymbiont of Medicago laciniata (L.) miller collected in Lanzarote, Canary Islands, Spain

DOE PAGES

Osman, Wan Adnawani Meor; van Berkum, Peter; León-Barrios, Milagros; ...

2017-09-25

Ensifer meliloti Mlalz-1 (INSDC = ATZD00000000) is an aerobic, motile, Gram-negative, non-spore-forming rod that was isolated from an effective nitrogen-fixing nodule of Medicago laciniata (L.) Miller from a soil sample collected near the town of Guatiza on the island of Lanzarote, the Canary Islands, Spain. This strain nodulates and forms an effective symbiosis with the highly specific host M. laciniata. This rhizobial genome was sequenced as part of the DOE Joint Genome Institute 2010 Genomic Encyclopedia for Bacteria and Archaea-Root Nodule Bacteria (GEBA-RNB) sequencing project. Here in this paper, the features of E. meliloti Mlalz-1 are described, together with high-qualitymore » permanent draft genome sequence information and annotation. The 6,664,116 bp high-quality draft genome is arranged in 99 scaffolds of 100 contigs, containing 6314 protein-coding genes and 74 RNA-only encoding genes. Strain Mlalz-1 is closely related to Ensifer meliloti IAM 12611 T, Ensifer medicae A 321T and Ensifer numidicus ORS 1407 T, based on 16S rRNA gene sequences. gANI values of ≥98.1% support the classification of strain Mlalz-1 as E. meliloti . Nodulation of M. laciniata requires a specific nodC allele, and the nodC gene of strain Mlalz-1 shares ≥98% sequence identity with nodC of M. laciniata-nodulating Ensifer strains, but ≤93% with nodC of Ensifer strains that nodulate other Medicago species. Strain Mlalz-1 is unique among sequenced E. meliloti strains in possessing genes encoding components of a T2SS and in having two versions of the adaptive acid tolerance response lpiA-acvB operon. In E. medicae strain WSM419, lpiA is essential for enhancing survival in lethal acid conditions. The second copy of the lpiA-acvB operon of strain Mlalz-1 has highest sequence identity (> 96%) with that of E. medicae strains, which suggests genetic recombination between strain Mlalz-1 and E. medicae and the horizontal gene transfer of lpiA-acvB.« less

Chromosome arm-specific BAC end sequences permit comparative analysis of homoeologous chromosomes and genomes of polyploid wheat

PubMed Central

2012-01-01

Background Bread wheat, one of the world’s staple food crops, has the largest, highly repetitive and polyploid genome among the cereal crops. The wheat genome holds the key to crop genetic improvement against challenges such as climate change, environmental degradation, and water scarcity. To unravel the complex wheat genome, the International Wheat Genome Sequencing Consortium (IWGSC) is pursuing a chromosome- and chromosome arm-based approach to physical mapping and sequencing. Here we report on the use of a BAC library made from flow-sorted telosomic chromosome 3A short arm (t3AS) for marker development and analysis of sequence composition and comparative evolution of homoeologous genomes of hexaploid wheat. Results The end-sequencing of 9,984 random BACs from a chromosome arm 3AS-specific library (TaaCsp3AShA) generated 11,014,359 bp of high quality sequence from 17,591 BAC-ends with an average length of 626 bp. The sequence represents 3.2% of t3AS with an average DNA sequence read every 19 kb. Overall, 79% of the sequence consisted of repetitive elements, 1.38% as coding regions (estimated 2,850 genes) and another 19% of unknown origin. Comparative sequence analysis suggested that 70-77% of the genes present in both 3A and 3B were syntenic with model species. Among the transposable elements, gypsy/sabrina (12.4%) was the most abundant repeat and was significantly more frequent in 3A compared to homoeologous chromosome 3B. Twenty novel repetitive sequences were also identified using de novo repeat identification. BESs were screened to identify simple sequence repeats (SSR) and transposable element junctions. A total of 1,057 SSRs were identified with a density of one per 10.4 kb, and 7,928 junctions between transposable elements (TE) and other sequences were identified with a density of one per 1.39 kb. With the objective of enhancing the marker density of chromosome 3AS, oligonucleotide primers were successfully designed from 758 SSRs and 695 Insertion Site Based Polymorphisms (ISBPs). Of the 96 ISBP primer pairs tested, 28 (29%) were 3A-specific and compared to 17 (18%) for 96 SSRs. Conclusion This work reports on the use of wheat chromosome arm 3AS-specific BAC library for the targeted generation of sequence data from a particular region of the huge genome of wheat. A large quantity of sequences were generated from the A genome of hexaploid wheat for comparative genome analysis with homoeologous B and D genomes and other model grass genomes. Hundreds of molecular markers were developed from the 3AS arm-specific sequences; these and other sequences will be useful in gene discovery and physical mapping. PMID:22559868

Identification of Abundantly Expressed Novel and Conserved Genes from the Infective Larval Stage of Toxocara canis by an Expressed Sequence Tag Strategy

PubMed Central

Tetteh, Kevin K. A.; Loukas, Alex; Tripp, Cindy; Maizels, Rick M.

1999-01-01

Larvae of Toxocara canis, a nematode parasite of dogs, infect humans, causing visceral and ocular larva migrans. In noncanid hosts, larvae neither grow nor differentiate but endure in a state of arrested development. Reasoning that parasite protein production is orientated to immune evasion, we undertook a random sequencing project from a larval cDNA library to characterize the most highly expressed transcripts. In all, 266 clones were sequenced, most from both 3′ and 5′ ends, and similarity searches against GenBank protein and dbEST nucleotide databases were conducted. Cluster analyses showed that 128 distinct gene products had been found, all but 3 of which represented newly identified genes. Ninety-five genes were represented by a single clone, but seven transcripts were present at high frequencies, each composing >2% of all clones sequenced. These high-abundance transcripts include a mucin and a C-type lectin, which are both major excretory-secretory antigens released by parasites. Four highly expressed novel gene transcripts, termed ant (abundant novel transcript) genes, were found. Together, these four genes comprised 18% of all cDNA clones isolated, but no similar sequences occur in the Caenorhabditis elegans genome. While the coding regions of the four genes are dissimilar, their 3′ untranslated tracts have significant homology in nucleotide sequence. The discovery of these abundant, parasite-specific genes of newly identified lectins and mucins, as well as a range of conserved and novel proteins, provides defined candidates for future analysis of the molecular basis of immune evasion by T. canis. PMID:10456930

Alu sequence involvement in transcriptional insulation of the keratin 18 gene in transgenic mice.

PubMed Central

Thorey, I S; Ceceña, G; Reynolds, W; Oshima, R G

1993-01-01

The human keratin 18 (K18) gene is expressed in a variety of adult simple epithelial tissues, including liver, intestine, lung, and kidney, but is not normally found in skin, muscle, heart, spleen, or most of the brain. Transgenic animals derived from the cloned K18 gene express the transgene in appropriate tissues at levels directly proportional to the copy number and independently of the sites of integration. We have investigated in transgenic mice the dependence of K18 gene expression on the distal 5' and 3' flanking sequences and upon the RNA polymerase III promoter of an Alu repetitive DNA transcription unit immediately upstream of the K18 promoter. Integration site-independent expression of tandemly duplicated K18 transgenes requires the presence of either an 825-bp fragment of the 5' flanking sequence or the 3.5-kb 3' flanking sequence. Mutation of the RNA polymerase III promoter of the Alu element within the 825-bp fragment abolishes copy number-dependent expression in kidney but does not abolish integration site-independent expression when assayed in the absence of the 3' flanking sequence of the K18 gene. The characteristics of integration site-independent expression and copy number-dependent expression are separable. In addition, the formation of the chromatin state of the K18 gene, which likely restricts the tissue-specific expression of this gene, is not dependent upon the distal flanking sequences of the 10-kb K18 gene but rather may depend on internal regulatory regions of the gene. Images PMID:7692231

Transcriptome dynamics through alternative polyadenylation in developmental and environmental responses in plants revealed by deep sequencing

PubMed Central

Shen, Yingjia; Venu, R.C.; Nobuta, Kan; Wu, Xiaohui; Notibala, Varun; Demirci, Caghan; Meyers, Blake C.; Wang, Guo-Liang; Ji, Guoli; Li, Qingshun Q.

2011-01-01

Polyadenylation sites mark the ends of mRNA transcripts. Alternative polyadenylation (APA) may alter sequence elements and/or the coding capacity of transcripts, a mechanism that has been demonstrated to regulate gene expression and transcriptome diversity. To study the role of APA in transcriptome dynamics, we analyzed a large-scale data set of RNA “tags” that signify poly(A) sites and expression levels of mRNA. These tags were derived from a wide range of tissues and developmental stages that were mutated or exposed to environmental treatments, and generated using digital gene expression (DGE)–based protocols of the massively parallel signature sequencing (MPSS-DGE) and the Illumina sequencing-by-synthesis (SBS-DGE) sequencing platforms. The data offer a global view of APA and how it contributes to transcriptome dynamics. Upon analysis of these data, we found that ∼60% of Arabidopsis genes have multiple poly(A) sites. Likewise, ∼47% and 82% of rice genes use APA, supported by MPSS-DGE and SBS-DGE tags, respectively. In both species, ∼49%–66% of APA events were mapped upstream of annotated stop codons. Interestingly, 10% of the transcriptomes are made up of APA transcripts that are differentially distributed among developmental stages and in tissues responding to environmental stresses, providing an additional level of transcriptome dynamics. Examples of pollen-specific APA switching and salicylic acid treatment-specific APA clearly demonstrated such dynamics. The significance of these APAs is more evident in the 3034 genes that have conserved APA events between rice and Arabidopsis. PMID:21813626

KpnBI is the prototype of a new family (IE) of bacterial type I restriction-modification system

PubMed Central

Chin, V.; Valinluck, V.; Magaki, S.; Ryu, J.

2004-01-01

KpnBI is a restriction-modification (R-M) system recognized in the GM236 strain of Klebsiella pneumoniae. Here, the KpnBI modification genes were cloned into a plasmid using a modification expression screening method. The modification genes that consist of both hsdM (2631 bp) and hsdS (1344 bp) genes were identified on an 8.2 kb EcoRI chromosomal fragment. These two genes overlap by one base and share the same promoter located upstream of the hsdM gene. Using recently developed plasmid R-M tests and a computer program RM Search, the DNA recognition sequence for the KpnBI enzymes was identified as a new 8 nt sequence containing one degenerate base with a 6 nt spacer, CAAANNNNNNRTCA. From Dam methylation and HindIII sensitivity tests, the methylation loci were predicted to be the italicized third adenine in the 5′ specific region and the adenine opposite the italicized thymine in the 3′ specific region. Combined with previous sequence data for hsdR, we concluded that the KpnBI system is a typical type I R-M system. The deduced amino acid sequences of the three subunits of the KpnBI system show only limited homologies (25 to 33% identity) at best, to the four previously categorized type I families (IA, IB, IC, and ID). Furthermore, their identity scores to other uncharacterized putative genome type I sequences were 53% at maximum. Therefore, we propose that KpnBI is the prototype of a new ‘type IE’ family. PMID:15475385

The structural role of high molecular weight tropomyosins in dipteran indirect flight muscle and the effect of phosphorylation.

PubMed

Mateos, Jesús; Herranz, Raúl; Domingo, Alberto; Sparrow, John; Marco, Roberto

2006-01-01

In Drosophila melanogaster two high molecular weight tropomyosin isoforms, historically named heavy troponins (TnH-33 and TnH-34), are encoded by the Tm1 tropomyosin gene. They are specifically expressed in the indirect flight muscles (IFM). Their N-termini are conventional and complete tropomyosin sequences, but their C-termini consist of different IFM-specific domains that are rich in proline, alanine, glycine and glutamate. The evidence indicates that in Diptera these IFM-specific isoforms are conserved and are not troponins, but heavy tropomyosins (TmH). We report here that they are post-translationally modified by several phosphorylations in their C-termini in mature flies, but not in recently emerged flies that are incapable of flight. From stoichiometric measurements of thin filament proteins and interactions of the TmH isoforms with the standard Drosophila IFM tropomyosin isoform (protein 129), we propose that the TmH N-termini are integrated into the thin filament structural unit as tropomyosin dimers. The phosphorylated C-termini remain unlocated and may be important in IFM stretch-activation. Comparison of the Tm1 and Tm2 gene sequences shows a complete conservation of gene organisation in other Drosophilidae, such as Drosophila pseudoobscura, while in Anopheles gambiae only one exon encodes a single C-terminal domain, though overall gene organization is maintained. Interestingly, in Apis mellifera (hymenopteran), while most of the Tm1 and Tm2 gene features are conserved, the gene lacks any C-terminal exons. Instead these sequences are found at the 3' end of the troponin I gene. In this insect order, as in Lethocerus (hemipteran), the original designation of troponin H (TnH) should be retained. We discuss whether the insertion of the IFM-specific pro-ala-gly-glu-rich domain into the tropomyosin or troponin I genes in different insect orders may be related to proposals that the IFM stretch activation mechanism has evolved independently several times in higher insects.

Highly specific gene silencing in a monocot species by artificial microRNAs derived from chimeric miRNA precursors

DOE PAGES

Carbonell, Alberto; Fahlgren, Noah; Mitchell, Skyler; ...

2015-05-20

Artificial microRNAs (amiRNAs) are used for selective gene silencing in plants. However, current methods to produce amiRNA constructs for silencing transcripts in monocot species are not suitable for simple, cost-effective and large-scale synthesis. Here, a series of expression vectors based on Oryza sativa MIR390 (OsMIR390) precursor was developed for high-throughput cloning and high expression of amiRNAs in monocots. Four different amiRNA sequences designed to target specifically endogenous genes and expressed from OsMIR390-based vectors were validated in transgenic Brachypodium distachyon plants. Surprisingly, amiRNAs accumulated to higher levels and were processed more accurately when expressed from chimeric OsMIR390-based precursors that include distalmore » stem-loop sequences from Arabidopsis thaliana MIR390a (AtMIR390a). In all cases, transgenic plants displayed the predicted phenotypes induced by target gene repression, and accumulated high levels of amiRNAs and low levels of the corresponding target transcripts. Genome-wide transcriptome profiling combined with 5-RLM-RACE analysis in transgenic plants confirmed that amiRNAs were highly specific. Finally, significance Statement A series of amiRNA vectors based on Oryza sativa MIR390 (OsMIR390) precursor were developed for simple, cost-effective and large-scale synthesis of amiRNA constructs to silence genes in monocots. Unexpectedly, amiRNAs produced from chimeric OsMIR390-based precursors including Arabidopsis thaliana MIR390a distal stem-loop sequences accumulated elevated levels of highly effective and specific amiRNAs in transgenic Brachypodium distachyon plants.« less

Detection and analysis of hemolysin genes in Aeromonas hydrophila isolated from Gouramy (Osphronemus gouramy) by polymerase chain reaction (PCR)

NASA Astrophysics Data System (ADS)

Rozi; Rahayu, K.; Daruti, D. N.

2018-04-01

The goal of this study was to detect of Aeromonas hydrophila carrying the hlyA gene in guramy by PCR assay. A total of 5 A. hydrophila strains were isolated from gouramy with different location and furthermore genotypic of all A. hydrophila strains havedetected by PCR assay for 16S rRNA gene. The primers used in the PCR targeted a 592-bp fragment of the hlyA gene coding for the hemolysin gene. Particularly hlyA genes are responsible for haemolysin toxins production in this genus. After gel electrophoresis, the amplicons from representative strains of the A. hydrophila were purified using extraction kit and were subjected to the DNA sequencing analysis. The results showed that: (i) the 592bp amplicon of the hlyA gene was detected in 5/6 of the A. hydrophila; (ii) the nucleotide blast results of hemolysin gene sequences of the strains of A. hydrophila revealed a high homology of 90-97 % with published sequences, and;(iii) the protein blast showed 95-98 % homology when compared to the published sequences. The PCR clearly identified the haemolysin-producing strains of A. hydrophila by detection in hlyA genes and may have application as a rapid species-specific virulence test.

An enhancer-like region regulates hrp3 promoter stage-specific gene expression in the human malaria parasite Plasmodium falciparum

PubMed Central

López-Estraño, Carlos; Gopalakrishnan, Anusha M.; Semblat, Jean-Philippe; Fergus, M. Ross; Mazier, Dominique; Haldar, Kasturi

2008-01-01

The asexual blood stage of Plasmodium falciparum is comprised of morphologically distinct ring, trophozoite and schizont stages. Each of these developmental stages possesses a distinct pattern of gene expression. Regulation of P. falciparum gene expression is thought to occur, at least in part, at the promoter level. Previously, we have found that although the RNA of the P. falciparum hrp3 gene is only seen in ring-stage parasites, deletion of a specific sequensce in the 5’ end of the promoter region decreased ring-stage expression of hrp3 and enabled detection of its transcripts in trophozoite-stage parasites. In order to investigate this stage specific regulation of gene expression, we employed a series of nested deletions of the 1.7-kb hrp3 promoter. Firefly luciferase gene was used as a reporter to evaluate the role of promoter sequences in gene regulation. Using this approach, we identified a ring-stage specific regulatory region on the hrp3 promoter located between -1.7-kb and -1.1-kb from the ATG initiation codon. Small 100–150 bp truncations on this enhancer-like region failed to uncover discrete regulatory sequences, suggesting the multipartite nature of this element. The data presented in this study demonstrates that stage specific promoter activity of the hrp3 gene in P. falciparum blood stage parasites is supported, at least in-part, by a small promoter region that can function in the absence of a larger chromosomal context. PMID:17570541

Conifer R2R3-MYB transcription factors: sequence analyses and gene expression in wood-forming tissues of white spruce (Picea glauca)

PubMed Central

Bedon, Frank; Grima-Pettenati, Jacqueline; Mackay, John

2007-01-01

Background Several members of the R2R3-MYB family of transcription factors act as regulators of lignin and phenylpropanoid metabolism during wood formation in angiosperm and gymnosperm plants. The angiosperm Arabidopsis has over one hundred R2R3-MYBs genes; however, only a few members of this family have been discovered in gymnosperms. Results We isolated and characterised full-length cDNAs encoding R2R3-MYB genes from the gymnosperms white spruce, Picea glauca (13 sequences), and loblolly pine, Pinus taeda L. (five sequences). Sequence similarities and phylogenetic analyses placed the spruce and pine sequences in diverse subgroups of the large R2R3-MYB family, although several of the sequences clustered closely together. We searched the highly variable C-terminal region of diverse plant MYBs for conserved amino acid sequences and identified 20 motifs in the spruce MYBs, nine of which have not previously been reported and three of which are specific to conifers. The number and length of the introns in spruce MYB genes varied significantly, but their positions were well conserved relative to angiosperm MYB genes. Quantitative RTPCR of MYB genes transcript abundance in root and stem tissues revealed diverse expression patterns; three MYB genes were preferentially expressed in secondary xylem, whereas others were preferentially expressed in phloem or were ubiquitous. The MYB genes expressed in xylem, and three others, were up-regulated in the compression wood of leaning trees within 76 hours of induction. Conclusion Our survey of 18 conifer R2R3-MYB genes clearly showed a gene family structure similar to that of Arabidopsis. Three of the sequences are likely to play a role in lignin metabolism and/or wood formation in gymnosperm trees, including a close homolog of the loblolly pine PtMYB4, shown to regulate lignin biosynthesis in transgenic tobacco. PMID:17397551

Evaluation of the norrie disease gene in a family with incontinentia pigmenti.

PubMed

Shastry, B S; Trese, M T

2000-01-01

Incontinentia pigmenti (IP) is an ectodermal multisystem disorder which can affect dental, ocular, cardiac and neurologic structures. The ocular changes of IP can have a very similar appearance to the retinal detachment of X-linked familial exudative vitreoretinopathy, which has been shown to be caused by the mutations in the Norrie disease gene. Therefore, it is of interest to determine whether similar mutations in the gene can account for the retinal pathology in patients with IP. To test our hypothesis, we have analyzed the entire Norrie disease gene for a family with IP, by single strand conformational polymorphism followed by DNA sequencing. The sequencing data revealed no disease-specific sequence alterations. These data suggest that ocular findings of IP are perhaps associated with different genes and there is no direct relationship between the genotype and phenotype. Copyright 2000 S. Karger AG, Basel

The Application of Next-Generation Sequencing for Mutation Detection in Autosomal-Dominant Hereditary Hearing Impairment.

PubMed

Gürtler, Nicolas; Röthlisberger, Benno; Ludin, Katja; Schlegel, Christoph; Lalwani, Anil K

2017-07-01

Identification of the causative mutation using next-generation sequencing in autosomal-dominant hereditary hearing impairment, as mutation analysis in hereditary hearing impairment by classic genetic methods, is hindered by the high heterogeneity of the disease. Two Swiss families with autosomal-dominant hereditary hearing impairment. Amplified DNA libraries for next-generation sequencing were constructed from extracted genomic DNA, derived from peripheral blood, and enriched by a custom-made sequence capture library. Validated, pooled libraries were sequenced on an Illumina MiSeq instrument, 300 cycles and paired-end sequencing. Technical data analysis was performed with SeqMonk, variant analysis with GeneTalk or VariantStudio. The detection of mutations in genes related to hearing loss by next-generation sequencing was subsequently confirmed using specific polymerase-chain-reaction and Sanger sequencing. Mutation detection in hearing-loss-related genes. The first family harbored the mutation c.5383+5delGTGA in the TECTA-gene. In the second family, a novel mutation c.2614-2625delCATGGCGCCGTG in the WFS1-gene and a second mutation TCOF1-c.1028G>A were identified. Next-generation sequencing successfully identified the causative mutation in families with autosomal-dominant hereditary hearing impairment. The results helped to clarify the pathogenic role of a known mutation and led to the detection of a novel one. NGS represents a feasible approach with great potential future in the diagnostics of hereditary hearing impairment, even in smaller labs.

Molecular cloning and characterization of a gene encoding glutaminase from Aspergillus oryzae.

PubMed

Koibuchi, K; Nagasaki, H; Yuasa, A; Kataoka, J; Kitamoto, K

2000-07-01

A glutaminase from Aspergillus oryzae was purified and its molecular weight was determined to be 82,091 by matrix-assisted laser desorption ionization time-of-flight mass spectrometry. Purified glutaminase catalysed the hydrolysis not only of L-glutamine but also of D-glutamine. Both the molecular weight and the substrate specificity of this glutaminase were different from those reported previously [Yano et al. (1998) J Ferment Technol 66: 137-143]. On the basis of its internal amino acid sequences, we have isolated and characterized the glutaminase gene (gtaA) from A. oryzae. The gtaA gene had an open reading frame coding for 690 amino acid residues, including a signal peptide of 20 amino acid residues and a mature protein of 670 amino acid residues. In the 5'-flanking region of the gene, there were three putative CreAp binding sequences and one putative AreAp binding sequence. The gtaA structural gene was introduced into A. oryzae NS4 and a marked increase in activity was detected in comparison with the control strain. The gtaA gene was also isolated from Aspergillus nidulans on the basis of the determined nucleotide sequence of the gtaA gene from A. oryzae.

Cloning and characterization of a novel oocyte-specific gene encoding an F-Box protein in rainbow trout (Oncorhynchus mykiss)

USDA-ARS?s Scientific Manuscript database

Oocyte-specific genes play critical roles in oogenesis, folliculogenesis and early embryonic development. Through analysis of expressed sequence tags (ESTs) from a rainbow trout oocyte cDNA library, we identified a novel transcript which is represented by multiple ESTs derived only from the oocyte c...

Cloning and characterization of a novel oocyte-specific gene encoding an F-Box protein in rainbow trout (Oncorhynchus mykiss)

USDA-ARS?s Scientific Manuscript database

Oocyte-specific genes play critical roles in oogenesis, folliculogenesis and early embryonic development. Through analysis of expressed sequence tags (ESTs) from a rainbow trout oocyte cDNA library, we identified a novel transcript which is represented by ESTs only from the oocyte library. The novel...

Identifying Specific Genes Controlling Complex Traits Through A Genome-Wide Screen For cis-Acting Regulatory Elements - An Example Using Marek's Disease

USDA-ARS?s Scientific Manuscript database

The identification of specific genes underlying phenotypic variation of complex traits remains one of the greatest challenges in biology despite having genome sequences and more powerful tools. Most genome-wide screens lack sufficient resolving power as they typically depend on linkage. One altern...

Phylogenetic Analysis of Bacteroidales 16S rRNA Genes Unveils Sequences Specific to Diverse Swine Fecal Sources

EPA Science Inventory

Two of the currently available methods to assess swine fecal pollution (Bac1 and PF163) target Bacteroidales 16S rRNA genes. However, these assays have been shown to exhibit poor host-specificity and low detection limits in environmental waters, in part due to the limited number...

The Goddard and Saturn Genes Are Essential for Drosophila Male Fertility and May Have Arisen De Novo.

PubMed

Gubala, Anna M; Schmitz, Jonathan F; Kearns, Michael J; Vinh, Tery T; Bornberg-Bauer, Erich; Wolfner, Mariana F; Findlay, Geoffrey D

2017-05-01

New genes arise through a variety of mechanisms, including the duplication of existing genes and the de novo birth of genes from noncoding DNA sequences. While there are numerous examples of duplicated genes with important functional roles, the functions of de novo genes remain largely unexplored. Many newly evolved genes are expressed in the male reproductive tract, suggesting that these evolutionary innovations may provide advantages to males experiencing sexual selection. Using testis-specific RNA interference, we screened 11 putative de novo genes in Drosophila melanogaster for effects on male fertility and identified two, goddard and saturn, that are essential for spermatogenesis and sperm function. Goddard knockdown (KD) males fail to produce mature sperm, while saturn KD males produce few sperm, and these function inefficiently once transferred to females. Consistent with a de novo origin, both genes are identifiable only in Drosophila and are predicted to encode proteins with no sequence similarity to any annotated protein. However, since high levels of divergence prevented the unambiguous identification of the noncoding sequences from which each gene arose, we consider goddard and saturn to be putative de novo genes. Within Drosophila, both genes have been lost in certain lineages, but show conserved, male-specific patterns of expression in the species in which they are found. Goddard is consistently found in single-copy and evolves under purifying selection. In contrast, saturn has diversified through gene duplication and positive selection. These data suggest that de novo genes can acquire essential roles in male reproduction. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Bellerophon: a program to detect chimeric sequences in multiple sequence alignments.

PubMed

Huber, Thomas; Faulkner, Geoffrey; Hugenholtz, Philip

2004-09-22

Bellerophon is a program for detecting chimeric sequences in multiple sequence datasets by an adaption of partial treeing analysis. Bellerophon was specifically developed to detect 16S rRNA gene chimeras in PCR-clone libraries of environmental samples but can be applied to other nucleotide sequence alignments. Bellerophon is available as an interactive web server at http://foo.maths.uq.edu.au/~huber/bellerophon.pl

Therapeutic Gene Editing Safety and Specificity.

PubMed

Lux, Christopher T; Scharenberg, Andrew M

2017-10-01

Therapeutic gene editing is significant for medical advancement. Safety is intricately linked to the specificity of the editing tools used to cut at precise genomic targets. Improvements can be achieved by thoughtful design of nucleases and repair templates, analysis of off-target editing, and careful utilization of viral vectors. Advancements in DNA repair mechanisms and development of new generations of tools improve targeting of specific sequences while minimizing risks. It is important to plot a safe course for future clinical trials. This article reviews safety and specificity for therapeutic gene editing to spur dialogue and advancement. Copyright © 2017 Elsevier Inc. All rights reserved.

Genetic variations in merozoite surface antigen genes of Babesia bovis detected in Vietnamese cattle and water buffaloes.

PubMed

Yokoyama, Naoaki; Sivakumar, Thillaiampalam; Tuvshintulga, Bumduuren; Hayashida, Kyoko; Igarashi, Ikuo; Inoue, Noboru; Long, Phung Thang; Lan, Dinh Thi Bich

2015-03-01

The genes that encode merozoite surface antigens (MSAs) in Babesia bovis are genetically diverse. In this study, we analyzed the genetic diversity of B. bovis MSA-1, MSA-2b, and MSA-2c genes in Vietnamese cattle and water buffaloes. Blood DNA samples from 258 cattle and 49 water buffaloes reared in the Thua Thien Hue province of Vietnam were screened with a B. bovis-specific diagnostic PCR assay. The B. bovis-positive DNA samples (23 cattle and 16 water buffaloes) were then subjected to PCR assays to amplify the MSA-1, MSA-2b, and MSA-2c genes. Sequencing analyses showed that the Vietnamese MSA-1 and MSA-2b sequences are genetically diverse, whereas MSA-2c is relatively conserved. The nucleotide identity values for these MSA gene sequences were similar in the cattle and water buffaloes. Consistent with the sequencing data, the Vietnamese MSA-1 and MSA-2b sequences were dispersed across several clades in the corresponding phylogenetic trees, whereas the MSA-2c sequences occurred in a single clade. Cattle- and water-buffalo-derived sequences also often clustered together on the phylogenetic trees. The Vietnamese MSA-1, MSA-2b, and MSA-2c sequences were then screened for recombination with automated methods. Of the seven recombination events detected, five and two were associated with the MSA-2b and MSA-2c recombinant sequences, respectively, whereas no MSA-1 recombinants were detected among the sequences analyzed. Recombination between the sequences derived from cattle and water buffaloes was very common, and the resultant recombinant sequences were found in both host animals. These data indicate that the genetic diversity of the MSA sequences does not differ between cattle and water buffaloes in Vietnam. They also suggest that recombination between the B. bovis MSA sequences in both cattle and water buffaloes might contribute to the genetic variation in these genes in Vietnam. Copyright © 2015 Elsevier B.V. All rights reserved.

Sequencing and comparative genomic analysis of 1227 Felis catus cDNA sequences enriched for developmental, clinical and nutritional phenotypes

PubMed Central

2012-01-01

Background The feline genome is valuable to the veterinary and model organism genomics communities because the cat is an obligate carnivore and a model for endangered felids. The initial public release of the Felis catus genome assembly provided a framework for investigating the genomic basis of feline biology. However, the entire set of protein coding genes has not been elucidated. Results We identified and characterized 1227 protein coding feline sequences, of which 913 map to public sequences and 314 are novel. These sequences have been deposited into NCBI's genbank database and complement public genomic resources by providing additional protein coding sequences that fill in some of the gaps in the feline genome assembly. Through functional and comparative genomic analyses, we gained an understanding of the role of these sequences in feline development, nutrition and health. Specifically, we identified 104 orthologs of human genes associated with Mendelian disorders. We detected negative selection within sequences with gene ontology annotations associated with intracellular trafficking, cytoskeleton and muscle functions. We detected relatively less negative selection on protein sequences encoding extracellular networks, apoptotic pathways and mitochondrial gene ontology annotations. Additionally, we characterized feline cDNA sequences that have mouse orthologs associated with clinical, nutritional and developmental phenotypes. Together, this analysis provides an overview of the value of our cDNA sequences and enhances our understanding of how the feline genome is similar to, and different from other mammalian genomes. Conclusions The cDNA sequences reported here expand existing feline genomic resources by providing high-quality sequences annotated with comparative genomic information providing functional, clinical, nutritional and orthologous gene information. PMID:22257742

Isolation and characterization of the promoter sequence of a cassava gene coding for Pt2L4, a glutamic acid-rich protein differentially expressed in storage roots.

PubMed

de Souza, C R; Aragão, F J; Moreira, E C O; Costa, C N M; Nascimento, S B; Carvalho, L J

2009-03-24

Cassava is one of the most important tropical food crops for more than 600 million people worldwide. Transgenic technologies can be useful for increasing its nutritional value and its resistance to viral diseases and insect pests. However, tissue-specific promoters that guarantee correct expression of transgenes would be necessary. We used inverse polymerase chain reaction to isolate a promoter sequence of the Mec1 gene coding for Pt2L4, a glutamic acid-rich protein differentially expressed in cassava storage roots. In silico analysis revealed putative cis-acting regulatory elements within this promoter sequence, including root-specific elements that may be required for its expression in vascular tissues. Transient expression experiments showed that the Mec1 promoter is functional, since this sequence was able to drive GUS expression in bean embryonic axes. Results from our computational analysis can serve as a guide for functional experiments to identify regions with tissue-specific Mec1 promoter activity. The DNA sequence that we identified is a new promoter that could be a candidate for genetic engineering of cassava roots.

How Changes in Anti-SD Sequences Would Affect SD Sequences in Escherichia coli and Bacillus subtilis.

PubMed

Abolbaghaei, Akram; Silke, Jordan R; Xia, Xuhua

2017-05-05

The 3' end of the small ribosomal RNAs (ssu rRNA) in bacteria is directly involved in the selection and binding of mRNA transcripts during translation initiation via well-documented interactions between a Shine-Dalgarno (SD) sequence located upstream of the initiation codon and an anti-SD (aSD) sequence at the 3' end of the ssu rRNA. Consequently, the 3' end of ssu rRNA (3'TAIL) is strongly conserved among bacterial species because a change in the region may impact the translation of many protein-coding genes. Escherichia coli and Bacillus subtilis differ in their 3' ends of ssu rRNA, being GAUC ACCUCCUUA 3' in E. coli and GAUC ACCUCCUU UCU3' or GAUC ACCUCCUU UCUA3' in B. subtilis Such differences in 3'TAIL lead to species-specific SDs (designated SD Ec for E. coli and SD Bs for B. subtilis ) that can form strong and well-positioned SD/aSD pairing in one species but not in the other. Selection mediated by the species-specific 3'TAIL is expected to favor SD Bs against SD Ec in B. subtilis , but favor SD Ec against SD Bs in E. coli Among well-positioned SDs, SD Ec is used more in E. coli than in B. subtilis , and SD Bs more in B. subtilis than in E. coli Highly expressed genes and genes of high translation efficiency tend to have longer SDs than lowly expressed genes and genes with low translation efficiency in both species, but more so in B. subtilis than in E. coli Both species overuse SDs matching the bolded part of the 3'TAIL shown above. The 3'TAIL difference contributes to the host specificity of phages. Copyright © 2017 Abolbaghaei et al.

Identification of an expressed gene in Dipylidium caninum.

PubMed

Miranda, Rodrigo R C; Costa-Júnior, Livio M; Campos, Artur K; Santos, Hudson A; Rabelo, Elida M L

2004-10-01

Recombinant DNA studies have been focused on developing vaccines to different cestodes. But few studies involving Dipylidium caninum molecular biology and genes have been done. Only partial sequences of mitochondrial DNA and ribosomal RNA gene are available in databases. Any molecular work with this parasite, including epidemiology, study of drug-resistant strains, and vaccine development, is hampered by the lack of knowledge of its genome. Thus, the knowledge of specific genes of different developmental stages of D. caninum is crucial to locate potential targets to be used as candidates to develop a vaccine and/or new drugs against this parasite. Here we report, for the first time, the sequencing of a fragment of a D. caninum expressed gene.

Rapid transcriptome sequencing of an invasive pest, the brown marmorated stink bug Halyomorpha halys.

PubMed

Ioannidis, Panagiotis; Lu, Yong; Kumar, Nikhil; Creasy, Todd; Daugherty, Sean; Chibucos, Marcus C; Orvis, Joshua; Shetty, Amol; Ott, Sandra; Flowers, Melissa; Sengamalay, Naomi; Tallon, Luke J; Pick, Leslie; Dunning Hotopp, Julie C

2014-08-29

Halyomorpha halys (Stål) (Insecta:Hemiptera;Pentatomidae), commonly known as the Brown Marmorated Stink Bug (BMSB), is an invasive pest of the mid-Atlantic region of the United States, causing economically important damage to a wide range of crops. Native to Asia, BMSB was first observed in Allentown, PA, USA, in 1996, and this pest is now well-established throughout the US mid-Atlantic region and beyond. In addition to the serious threat BMSB poses to agriculture, BMSB has become a nuisance to homeowners, invading home gardens and congregating in large numbers in human-made structures, including homes, to overwinter. Despite its significance as an agricultural pest with limited control options, only 100 bp of BMSB sequence data was available in public databases when this project began. Transcriptome sequencing was undertaken to provide a molecular resource to the research community to inform the development of pest control strategies and to provide molecular data for population genetics studies of BMSB. Using normalized, strand-specific libraries, we sequenced pools of all BMSB life stages on the Illumina HiSeq. Trinity was used to assemble 200,000 putative transcripts in >100,000 components. A novel bioinformatic method that analyzed the strand-specificity of the data reduced this to 53,071 putative transcripts from 18,573 components. By integrating multiple other data types, we narrowed this further to 13,211 representative transcripts. Bacterial endosymbiont genes were identified in this dataset, some of which have a copy number consistent with being lateral gene transfers between endosymbiont genomes and Hemiptera, including ankyrin-repeat related proteins, lysozyme, and mannanase. Such genes and endosymbionts may provide novel targets for BMSB-specific biocontrol. This study demonstrates the utility of strand-specific sequencing in generating shotgun transcriptomes and that rapid sequencing shotgun transcriptomes is possible without the need for extensive inbreeding to generate homozygous lines. Such sequencing can provide a rapid response to pest invasions similar to that already described for disease epidemiology.

Development of chromosome-specific markers with high polymorphism for allotetraploid cotton based on genome-wide characterization of simple sequence repeats in diploid cottons (Gossypium arboreum L. and Gossypium raimondii Ulbrich).

PubMed

Lu, Cairui; Zou, Changsong; Zhang, Youping; Yu, Daoqian; Cheng, Hailiang; Jiang, Pengfei; Yang, Wencui; Wang, Qiaolian; Feng, Xiaoxu; Prosper, Mtawa Andrew; Guo, Xiaoping; Song, Guoli

2015-02-06

Tetraploid cotton contains two sets of homologous chromosomes, the At- and Dt-subgenomes. Consequently, many markers in cotton were mapped to multiple positions during linkage genetic map construction, posing a challenge to anchoring linkage groups and mapping economically-important genes to particular chromosomes. Chromosome-specific markers could solve this problem. Recently, the genomes of two diploid species were sequenced whose progenitors were putative contributors of the At- and Dt-subgenomes to tetraploid cotton. These sequences provide a powerful tool for developing chromosome-specific markers given the high level of synteny among tetraploid and diploid cotton genomes. In this study, simple sequence repeats (SSRs) on each chromosome in the two diploid genomes were characterized. Chromosome-specific SSRs were developed by comparative analysis and proved to distinguish chromosomes. A total of 200,744 and 142,409 SSRs were detected on the 13 chromosomes of Gossypium arboreum L. and Gossypium raimondii Ulbrich, respectively. Chromosome-specific SSRs were obtained by comparing SSR flanking sequences from each chromosome with those from the other 25 chromosomes. The average was 7,996 per chromosome. To confirm their chromosome specificity, these SSRs were used to distinguish two homologous chromosomes in tetraploid cotton through linkage group construction. The chromosome-specific SSRs and previously-reported chromosome markers were grouped together, and no marker mapped to another homologous chromosome, proving that the chromosome-specific SSRs were unique and could distinguish homologous chromosomes in tetraploid cotton. Because longer dinucleotide AT-rich repeats were the most polymorphic in previous reports, the SSRs on each chromosome were sorted by motif type and repeat length for convenient selection. The primer sequences of all chromosome-specific SSRs were also made publicly available. Chromosome-specific SSRs are efficient tools for chromosome identification by anchoring linkage groups to particular chromosomes during genetic mapping and are especially useful in mapping of qualitative-trait genes or quantitative trait loci with just a few markers. The SSRs reported here will facilitate a number of genetic and genomic studies in cotton, including construction of high-density genetic maps, positional gene cloning, fingerprinting, and genetic diversity and comparative evolutionary analyses among Gossypium species.

Sequencing of a QTL-rich region of the Theobroma cacao genome using pooled BACs and the identification of trait specific candidate genes

USDA-ARS?s Scientific Manuscript database

Background: BAC-based physical maps provide for sequencing across an entire genome or selected sub-genome regions of biological interest. Using the minimum tiling path as a guide, it is possible to select specific BAC clones from prioritized genome sections such as a genetically defined QTL interv...

The pea END1 promoter drives anther-specific gene expression in different plant species.

PubMed

Gómez, María D; Beltrán, José-Pío; Cañas, Luis A

2004-10-01

END1 was isolated by an immunosubtractive approach intended to identify specific proteins present in the different pea (Pisum sativum L.) floral organs and the genes encoding them. Following this strategy we obtained a monoclonal antibody (mAbA1) that specifically recognized a 26-kDa protein (END1) only detected in anther tissues. Northern blot assays showed that END1 is expressed specifically in the anther. In situ hybridization and immunolocalization assays corroborated the specific expression of END1 in the epidermis, connective, endothecium and middle layer cells during the different stages of anther development. END1 is the first anther-specific gene isolated from pea. The absence of a practicable pea transformation method together with the fact that no END1 homologue gene exists in Arabidopsis prevented us from carrying out END1 functional studies. However, we designed functional studies with the END1 promoter in different dicot species, as the specific spatial and temporal expression pattern of END1 suggested, among other things, the possibility of using its promoter region for biotechnological applications. Using different constructs to drive the uidA (beta-glucuronidase) gene controlled by the 2.7-kb isolated promoter sequence we have proven that the END1 promoter is fully functional in the anthers of transgenic Arabidopsis thaliana (L.) Heynh., Nicotiana tabacum L. (tobacco) and Lycopersicon esculentum Mill. (tomato) plants. The presence in the -330-bp region of the promoter sequence of three putative CArG boxes also suggests that END1 could be a target gene of MADS-box proteins and that, subsequently, it would be activated by genes controlling floral organ identity.

Genome sequence comparison reveals a candidate gene involved in male-hermaphrodite differentiation in papaya (Carica papaya) trees.

PubMed

Ueno, Hiroki; Urasaki, Naoya; Natsume, Satoshi; Yoshida, Kentaro; Tarora, Kazuhiko; Shudo, Ayano; Terauchi, Ryohei; Matsumura, Hideo

2015-04-01

The sex type of papaya (Carica papaya) is determined by the pair of sex chromosomes (XX, female; XY, male; and XY(h), hermaphrodite), in which there is a non-recombining genomic region in the Y and Y(h) chromosomes. This region is presumed to be involved in determination of males and hermaphrodites; it is designated as the male-specific region in the Y chromosome (MSY) and the hermaphrodite-specific region in the Y(h) chromosome (HSY). Here, we identified the genes determining male and hermaphrodite sex types by comparing MSY and HSY genomic sequences. In the MSY and HSY genomic regions, we identified 14,528 nucleotide substitutions and 965 short indels with a large gap and two highly diverged regions. In the predicted genes expressed in flower buds, we found no nucleotide differences leading to amino acid changes between the MSY and HSY. However, we found an HSY-specific transposon insertion in a gene (SVP like) showing a similarity to the Short Vegetative Phase (SVP) gene. Study of SVP-like transcripts revealed that the MSY allele encoded an intact protein, while the HSY allele encoded a truncated protein. Our findings demonstrated that the SVP-like gene is a candidate gene for male-hermaphrodite determination in papaya.

Direct identification of antibiotic resistance genes on single plasmid molecules using CRISPR/Cas9 in combination with optical DNA mapping

NASA Astrophysics Data System (ADS)

Müller, Vilhelm; Rajer, Fredrika; Frykholm, Karolin; Nyberg, Lena K.; Quaderi, Saair; Fritzsche, Joachim; Kristiansson, Erik; Ambjörnsson, Tobias; Sandegren, Linus; Westerlund, Fredrik

2016-12-01

Bacterial plasmids are extensively involved in the rapid global spread of antibiotic resistance. We here present an assay, based on optical DNA mapping of single plasmids in nanofluidic channels, which provides detailed information about the plasmids present in a bacterial isolate. In a single experiment, we obtain the number of different plasmids in the sample, the size of each plasmid, an optical barcode that can be used to identify and trace the plasmid of interest and information about which plasmid that carries a specific resistance gene. Gene identification is done using CRISPR/Cas9 loaded with a guide-RNA (gRNA) complementary to the gene of interest that linearizes the circular plasmids at a specific location that is identified using the optical DNA maps. We demonstrate the principle on clinically relevant extended spectrum beta-lactamase (ESBL) producing isolates. We discuss how the gRNA sequence can be varied to obtain the desired information. The gRNA can either be very specific to identify a homogeneous group of genes or general to detect several groups of genes at the same time. Finally, we demonstrate an example where we use a combination of two gRNA sequences to identify carbapenemase-encoding genes in two previously not characterized clinical bacterial samples.

Peregrine and saker falcon genome sequences provide insights into evolution of a predatory lifestyle.

PubMed

Zhan, Xiangjiang; Pan, Shengkai; Wang, Junyi; Dixon, Andrew; He, Jing; Muller, Margit G; Ni, Peixiang; Hu, Li; Liu, Yuan; Hou, Haolong; Chen, Yuanping; Xia, Jinquan; Luo, Qiong; Xu, Pengwei; Chen, Ying; Liao, Shengguang; Cao, Changchang; Gao, Shukun; Wang, Zhaobao; Yue, Zhen; Li, Guoqing; Yin, Ye; Fox, Nick C; Wang, Jun; Bruford, Michael W

2013-05-01

As top predators, falcons possess unique morphological, physiological and behavioral adaptations that allow them to be successful hunters: for example, the peregrine is renowned as the world's fastest animal. To examine the evolutionary basis of predatory adaptations, we sequenced the genomes of both the peregrine (Falco peregrinus) and saker falcon (Falco cherrug), and we present parallel, genome-wide evidence for evolutionary innovation and selection for a predatory lifestyle. The genomes, assembled using Illumina deep sequencing with greater than 100-fold coverage, are both approximately 1.2 Gb in length, with transcriptome-assisted prediction of approximately 16,200 genes for both species. Analysis of 8,424 orthologs in both falcons, chicken, zebra finch and turkey identified consistent evidence for genome-wide rapid evolution in these raptors. SNP-based inference showed contrasting recent demographic trajectories for the two falcons, and gene-based analysis highlighted falcon-specific evolutionary novelties for beak development and olfaction and specifically for homeostasis-related genes in the arid environment-adapted saker.

A report on extensive lateral genetic reciprocation between arsenic resistant Bacillus subtilis and Bacillus pumilus strains analyzed using RAPD-PCR.

PubMed

Khowal, Sapna; Siddiqui, Md Zulquarnain; Ali, Shadab; Khan, Mohd Taha; Khan, Mather Ali; Naqvi, Samar Husain; Wajid, Saima

2017-02-01

The study involves isolation of arsenic resistant bacteria from soil samples. The characterization of bacteria isolates was based on 16S rRNA gene sequences. The phylogenetic consanguinity among isolates was studied employing rpoB and gltX gene sequence. RAPD-PCR technique was used to analyze genetic similarity between arsenic resistant isolates. In accordance with the results Bacillus subtilis and Bacillus pumilus strains may exhibit extensive horizontal gene transfer. Arsenic resistant potency in Bacillus sonorensis and high arsenite tolerance in Bacillus pumilus strains was identified. The RAPD-PCR primer OPO-02 amplified a 0.5kb DNA band specific to B. pumilus 3ZZZ strain and 0.75kb DNA band specific to B. subtilis 3PP. These unique DNA bands may have potential use as SCAR (Sequenced Characterized Amplified Region) molecular markers for identification of arsenic resistant B. pumilus and B. subtilis strains. Copyright © 2016 Elsevier Inc. All rights reserved.

Dcode.org anthology of comparative genomic tools.

PubMed

Loots, Gabriela G; Ovcharenko, Ivan

2005-07-01

Comparative genomics provides the means to demarcate functional regions in anonymous DNA sequences. The successful application of this method to identifying novel genes is currently shifting to deciphering the non-coding encryption of gene regulation across genomes. To facilitate the practical application of comparative sequence analysis to genetics and genomics, we have developed several analytical and visualization tools for the analysis of arbitrary sequences and whole genomes. These tools include two alignment tools, zPicture and Mulan; a phylogenetic shadowing tool, eShadow for identifying lineage- and species-specific functional elements; two evolutionary conserved transcription factor analysis tools, rVista and multiTF; a tool for extracting cis-regulatory modules governing the expression of co-regulated genes, Creme 2.0; and a dynamic portal to multiple vertebrate and invertebrate genome alignments, the ECR Browser. Here, we briefly describe each one of these tools and provide specific examples on their practical applications. All the tools are publicly available at the http://www.dcode.org/ website.

Functional comparison of three transformer gene introns regulating conditional female lethality

USDA-ARS?s Scientific Manuscript database

The trasformer gene plays a critical role in the sex determination pathways of many insects. We cloned two transformer gene introns from Anastrepha suspensa, the Caribbean fruit fly. These introns have sequences that putatively have a role in sex-specific splicing patterns that affect sex determinat...

Improved PCR assay for the specific detection and quantitation of Escherichia coli serotype O157 in water.

PubMed

Cho, Min Seok; Joh, Kiseong; Ahn, Tae-Young; Park, Dong Suk

2014-09-01

Escherichia coli serotype O157 is still a major global healthcare problem. However, only limited information is now available on the molecular and serological detection of pathogenic bacteria. Therefore, the development of appropriate strategies for their rapid identification and monitoring is still needed. In general, the sequence analysis based on stx, slt, eae, hlyA, rfb, and fliCh7 genes is widely employed for the identification of E. coli serotype O157; but there have been critical defects in the diagnosis and identification of E. coli serotype O157, in that they are also present in other E. coli serogroups. In this study, NCBI-BLAST searches using the nucleotide sequences of the putative regulatory protein gene from E. coli O157:H7 str. Sakai found sequence difference at the serotype level. The specific primers from the putative regulatory protein gene were designed and investigated for their sensitivity and specificity for detecting the pathogen in environment water samples. The specificity of the primer set was evaluated using genomic DNA from 8 isolates of E. coli serotype O157 and 32 other reference strains. In addition, the sensitivity and specificity of this assay were confirmed by successful identification of E. coli serotype O157 in environmental water samples. In conclusion, this study showed that the newly developed quantitative serotype-specific PCR method is a highly specific and efficient tool for the surveillance and rapid detection of high-risk E. coli serotype O157.

Genomic structure and chromosomal localization of GML (GPI-anchored molecule-like protein), a gene induced by p53

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kimura, Yasutoshi; Furuhata, Tomohisa; Nakamura, Yusuke

1997-05-01

Among its known functions, tumor suppressor gene p53 serves as a transcriptional regulator and mediates various signals through activation of downstream genes. We recently identified a novel gene, GML (glycosylphosphatidylinositol (GPI)-anchored molecule-like protein), whose expression is specifically induced by wildtype p53. To characterize the GML gene further, we determined 35.8 kb of DNA sequence that included a consensus binding sequence for p53 and the entire GML gene. The GML gene consists of four exons, and the p53-binding sequence is present in the 5{prime}-flanking region. In genomic organization this gene resembles genes encoding murine Ly-6 glycoproteins, a human homologue of themore » Ly-6 family called RIG-E, and CD59; products of these genes, known as GPI-anchored proteins, are variously involved in signal transduction, cell-cell adhesion, and cell-matrix attachment. FISH analysis revealed that the GML gene is located on human chromosome 8q24.3. Genes encoding at least two other GPI-anchored molecules, E48 and RIG-E, are also located in this region. 20 refs., 2 figs., 1 tab.« less

miRNA-embedded shRNAs for Lineage-specific BCL11A Knockdown and Hemoglobin F Induction

PubMed Central

Guda, Swaroopa; Brendel, Christian; Renella, Raffaele; Du, Peng; Bauer, Daniel E; Canver, Matthew C; Grenier, Jennifer K; Grimson, Andrew W; Kamran, Sophia C; Thornton, James; de Boer, Helen; Root, David E; Milsom, Michael D; Orkin, Stuart H; Gregory, Richard I; Williams, David A

2015-01-01

RNA interference (RNAi) technology using short hairpin RNAs (shRNAs) expressed via RNA polymerase (pol) III promoters has been widely exploited to modulate gene expression in a variety of mammalian cell types. For certain applications, such as lineage-specific knockdown, embedding targeting sequences into pol II-driven microRNA (miRNA) architecture is required. Here, using the potential therapeutic target BCL11A, we demonstrate that pol III-driven shRNAs lead to significantly increased knockdown but also increased cytotoxcity in comparison to pol II-driven miRNA adapted shRNAs (shRNAmiR) in multiple hematopoietic cell lines. We show that the two expression systems yield mature guide strand sequences that differ by a 4 bp shift. This results in alternate seed sequences and consequently influences the efficacy of target gene knockdown. Incorporating a corresponding 4 bp shift into the guide strand of shRNAmiRs resulted in improved knockdown efficiency of BCL11A. This was associated with a significant de-repression of the hemoglobin target of BCL11A, human γ-globin or the murine homolog Hbb-y. Our results suggest the requirement for optimization of shRNA sequences upon incorporation into a miRNA backbone. These findings have important implications in future design of shRNAmiRs for RNAi-based therapy in hemoglobinopathies and other diseases requiring lineage-specific expression of gene silencing sequences. PMID:26080908

Investigation of the mechanism of meiotic DNA cleavage by VMA1-derived endonuclease uncovers a meiotic alteration in chromatin structure around the target site.

PubMed

Fukuda, Tomoyuki; Ohta, Kunihiro; Ohya, Yoshikazu

2006-06-01

VMA1-derived endonuclease (VDE), a homing endonuclease in Saccharomyces cerevisiae, is encoded by the mobile intein-coding sequence within the nuclear VMA1 gene. VDE recognizes and cleaves DNA at the 31-bp VDE recognition sequence (VRS) in the VMA1 gene lacking the intein-coding sequence during meiosis to insert a copy of the intein-coding sequence at the cleaved site. The mechanism underlying the meiosis specificity of VMA1 intein-coding sequence homing remains unclear. We studied various factors that might influence the cleavage activity in vivo and found that VDE binding to the VRS can be detected only when DNA cleavage by VDE takes place, implying that meiosis-specific DNA cleavage is regulated by the accessibility of VDE to its target site. As a possible candidate for the determinant of this accessibility, we analyzed chromatin structure around the VRS and revealed that local chromatin structure near the VRS is altered during meiosis. Although the meiotic chromatin alteration exhibits correlations with DNA binding and cleavage by VDE at the VMA1 locus, such a chromatin alteration is not necessarily observed when the VRS is embedded in ectopic gene loci. This suggests that nucleosome positioning or occupancy around the VRS by itself is not the sole mechanism for the regulation of meiosis-specific DNA cleavage by VDE and that other mechanisms are involved in the regulation.

Investigation of the Mechanism of Meiotic DNA Cleavage by VMA1-Derived Endonuclease Uncovers a Meiotic Alteration in Chromatin Structure around the Target Site

PubMed Central

Fukuda, Tomoyuki; Ohta, Kunihiro; Ohya, Yoshikazu

2006-01-01

VMA1-derived endonuclease (VDE), a homing endonuclease in Saccharomyces cerevisiae, is encoded by the mobile intein-coding sequence within the nuclear VMA1 gene. VDE recognizes and cleaves DNA at the 31-bp VDE recognition sequence (VRS) in the VMA1 gene lacking the intein-coding sequence during meiosis to insert a copy of the intein-coding sequence at the cleaved site. The mechanism underlying the meiosis specificity of VMA1 intein-coding sequence homing remains unclear. We studied various factors that might influence the cleavage activity in vivo and found that VDE binding to the VRS can be detected only when DNA cleavage by VDE takes place, implying that meiosis-specific DNA cleavage is regulated by the accessibility of VDE to its target site. As a possible candidate for the determinant of this accessibility, we analyzed chromatin structure around the VRS and revealed that local chromatin structure near the VRS is altered during meiosis. Although the meiotic chromatin alteration exhibits correlations with DNA binding and cleavage by VDE at the VMA1 locus, such a chromatin alteration is not necessarily observed when the VRS is embedded in ectopic gene loci. This suggests that nucleosome positioning or occupancy around the VRS by itself is not the sole mechanism for the regulation of meiosis-specific DNA cleavage by VDE and that other mechanisms are involved in the regulation. PMID:16757746

The genome sequence of the model ascomycete fungus Podospora anserina.

PubMed

Espagne, Eric; Lespinet, Olivier; Malagnac, Fabienne; Da Silva, Corinne; Jaillon, Olivier; Porcel, Betina M; Couloux, Arnaud; Aury, Jean-Marc; Ségurens, Béatrice; Poulain, Julie; Anthouard, Véronique; Grossetete, Sandrine; Khalili, Hamid; Coppin, Evelyne; Déquard-Chablat, Michelle; Picard, Marguerite; Contamine, Véronique; Arnaise, Sylvie; Bourdais, Anne; Berteaux-Lecellier, Véronique; Gautheret, Daniel; de Vries, Ronald P; Battaglia, Evy; Coutinho, Pedro M; Danchin, Etienne Gj; Henrissat, Bernard; Khoury, Riyad El; Sainsard-Chanet, Annie; Boivin, Antoine; Pinan-Lucarré, Bérangère; Sellem, Carole H; Debuchy, Robert; Wincker, Patrick; Weissenbach, Jean; Silar, Philippe

2008-01-01

The dung-inhabiting ascomycete fungus Podospora anserina is a model used to study various aspects of eukaryotic and fungal biology, such as ageing, prions and sexual development. We present a 10X draft sequence of P. anserina genome, linked to the sequences of a large expressed sequence tag collection. Similar to higher eukaryotes, the P. anserina transcription/splicing machinery generates numerous non-conventional transcripts. Comparison of the P. anserina genome and orthologous gene set with the one of its close relatives, Neurospora crassa, shows that synteny is poorly conserved, the main result of evolution being gene shuffling in the same chromosome. The P. anserina genome contains fewer repeated sequences and has evolved new genes by duplication since its separation from N. crassa, despite the presence of the repeat induced point mutation mechanism that mutates duplicated sequences. We also provide evidence that frequent gene loss took place in the lineages leading to P. anserina and N. crassa. P. anserina contains a large and highly specialized set of genes involved in utilization of natural carbon sources commonly found in its natural biotope. It includes genes potentially involved in lignin degradation and efficient cellulose breakdown. The features of the P. anserina genome indicate a highly dynamic evolution since the divergence of P. anserina and N. crassa, leading to the ability of the former to use specific complex carbon sources that match its needs in its natural biotope.

Analysis of the Type IV Fimbrial-Subunit Gene fimA of Xanthomonas hyacinthi: Application in PCR-Mediated Detection of Yellow Disease in Hyacinths

PubMed Central

van Doorn, J.; Hollinger, T. C.; Oudega, B.

2001-01-01

A sensitive and specific detection method was developed for Xanthomonas hyacinthi; this method was based on amplification of a subsequence of the type IV fimbrial-subunit gene fimA from strain S148. The fimA gene was amplified by PCR with degenerate DNA primers designed by using the N-terminal and C-terminal amino acid sequences of trypsin fragments of FimA. The nucleotide sequence of fimA was determined and compared with the nucleotide sequences coding for the fimbrial subunits in other type IV fimbria-producing bacteria, such as Xanthomonas campestris pv. vesicatoria, Neisseria gonorrhoeae, and Moraxella bovis. In a PCR internal primers JAAN and JARA, designed by using the nucleotide sequences of the variable central and C-terminal region of fimA, amplified a 226-bp DNA fragment in all X. hyacinthi isolates. This PCR was shown to be pathovar specific, as assessed by testing 71 Xanthomonas pathovars and bacterial isolates belonging to other genera, such as Erwinia and Pseudomonas. Southern hybridization experiments performed with the labelled 226-bp DNA amplicon as a probe suggested that there is only one structural type IV fimbrial-gene cluster in X. hyacinthi. Only two Xanthomonas translucens pathovars cross-reacted weakly in PCR. Primers amplifying a subsequence of the fimA gene of X. campestris pv. vesicatoria (T. Ojanen-Reuhs, N. Kalkkinen, B. Westerlund-Wikström, J. van Doorn, K. Haahtela, E.-L. Nurmiaho-Lassila, K. Wengelink, U. Bonas, and T. K. Korhonen, J. Bacteriol. 179: 1280–1290, 1997) were shown to be pathovar specific, indicating that the fimbrial-subunit sequences are more generally applicable in xanthomonads for detection purposes. Under laboratory conditions, approximately 1,000 CFU of X. hyacinthi per ml could be detected. In inoculated leaves of hyacinths the threshold was 5,000 CFU/ml. The results indicated that infected hyacinths with early symptoms could be successfully screened for X. hyacinthi with PCR. PMID:11157222

Diversity and function in microbial mats from the Lucky Strike hydrothermal vent field.

PubMed

Crépeau, Valentin; Cambon Bonavita, Marie-Anne; Lesongeur, Françoise; Randrianalivelo, Henintsoa; Sarradin, Pierre-Marie; Sarrazin, Jozée; Godfroy, Anne

2011-06-01

Diversity and function in microbial mats from the Lucky Strike hydrothermal vent field (Mid-Atlantic Ridge) were investigated using molecular approaches. DNA and RNA were extracted from mat samples overlaying hydrothermal deposits and Bathymodiolus azoricus mussel assemblages. We constructed and analyzed libraries of 16S rRNA gene sequences and sequences of functional genes involved in autotrophic carbon fixation [forms I and II RuBisCO (cbbL/M), ATP-citrate lyase B (aclB)]; methane oxidation [particulate methane monooxygenase (pmoA)] and sulfur oxidation [adenosine-5'-phosphosulfate reductase (aprA) and soxB]. To gain new insights into the relationships between mats and mussels, we also used new domain-specific 16S rRNA gene primers targeting Bathymodiolus sp. symbionts. All identified archaeal sequences were affiliated with a single group: the marine group 1 Thaumarchaeota. In contrast, analyses of bacterial sequences revealed much higher diversity, although two phyla Proteobacteria and Bacteroidetes were largely dominant. The 16S rRNA gene sequence library revealed that species affiliated to Beggiatoa Gammaproteobacteria were the dominant active population. Analyses of DNA and RNA functional gene libraries revealed a diverse and active chemolithoautotrophic population. Most of these sequences were affiliated with Gammaproteobacteria, including hydrothermal fauna symbionts, Thiotrichales and Methylococcales. PCR and reverse transcription-PCR using 16S rRNA gene primers targeted to Bathymodiolus sp. symbionts revealed sequences affiliated with both methanotrophic and thiotrophic endosymbionts. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

The Sequences of 1504 Mutants in the Model Rice Variety Kitaake Facilitate Rapid Functional Genomic Studies

PubMed Central

Pham, Nikki T.; Wei, Tong; Schackwitz, Wendy S.; Lipzen, Anna M.; Duong, Phat Q.; Jones, Kyle C.; Ruan, Deling; Bauer, Diane; Peng, Yi; Schmutz, Jeremy

2017-01-01

The availability of a whole-genome sequenced mutant population and the cataloging of mutations of each line at a single-nucleotide resolution facilitate functional genomic analysis. To this end, we generated and sequenced a fast-neutron-induced mutant population in the model rice cultivar Kitaake (Oryza sativa ssp japonica), which completes its life cycle in 9 weeks. We sequenced 1504 mutant lines at 45-fold coverage and identified 91,513 mutations affecting 32,307 genes, i.e., 58% of all rice genes. We detected an average of 61 mutations per line. Mutation types include single-base substitutions, deletions, insertions, inversions, translocations, and tandem duplications. We observed a high proportion of loss-of-function mutations. We identified an inversion affecting a single gene as the causative mutation for the short-grain phenotype in one mutant line. This result reveals the usefulness of the resource for efficient, cost-effective identification of genes conferring specific phenotypes. To facilitate public access to this genetic resource, we established an open access database called KitBase that provides access to sequence data and seed stocks. This population complements other available mutant collections and gene-editing technologies. This work demonstrates how inexpensive next-generation sequencing can be applied to generate a high-density catalog of mutations. PMID:28576844

The alternative oxidase family of Vitis vinifera reveals an attractive model to study the importance of genomic design.

PubMed

Costa, José Hélio; de Melo, Dirce Fernandes; Gouveia, Zélia; Cardoso, Hélia Guerra; Peixe, Augusto; Arnholdt-Schmitt, Birgit

2009-12-01

'Genomic design' refers to the structural organization of gene sequences. Recently, the role of intron sequences for gene regulation is being better understood. Further, introns possess high rates of polymorphism that are considered as the major source for speciation. In molecular breeding, the length of gene-specific introns is recognized as a tool to discriminate genotypes with diverse traits of agronomic interest. 'Economy selection' and 'time-economy selection' have been proposed as models for explaining why highly expressed genes typically contain small introns. However, in contrast to these theories, plant-specific selection reveals that highly expressed genes contain introns that are large. In the presented research, 'wet'Aox gene identification from grapevine is advanced by a bioinformatics approach to study the species-specific organization of Aox gene structures in relation to available expressed sequence tag (EST) data. Two Aox1 and one Aox2 gene sequences have been identified in Vitis vinifera using grapevine cultivars from Portugal and Germany. Searching the complete genome sequence data of two grapevine cultivars confirmed that V. vinifera alternative oxidase (Aox) is encoded by a small multigene family composed of Aox1a, Aox1b and Aox2. An analysis of EST distribution revealed high expression of the VvAox2 gene. A relationship between the atypical long primary transcript of VvAox2 (in comparison to other plant Aox genes) and its expression level is suggested. V. vinifera Aox genes contain four exons interrupted by three introns except for Aox1a which contains an additional intron in the 3'-UTR. The lengths of primary Aox transcripts were estimated for each gene in two V. vinifera varieties: PN40024 and Pinot Noir. In both varieties, Aox1a and Aox1b contained small introns that corresponded to primary transcript lengths ranging from 1501 to 1810 bp. The Aox2 of PN40024 (12 329 bp) was longer than that from Pinot Noir (7279 bp) because of selection against a transposable-element insertion that is 5028 bp in size. An EST database basic local alignment search tool (BLAST) search of GenBank revealed the following ESTs percentages for each gene: Aox1a (26.2%), Aox1b (11.9%) and Aox2 (61.9%). Aox1a was expressed in fruits and roots, Aox1b expression was confined to flowers and Aox2 was ubiquitously expressed. These data for V. vinifera show that atypically long Aox intron lengths are related to high levels of gene expression. Furthermore, it is shown for the first time that two grapevine cultivars can be distinguished by Aox intron length polymorphism.

A Segment of the Apospory-Specific Genomic Region Is Highly Microsyntenic Not Only between the Apomicts Pennisetum squamulatum and Buffelgrass, But Also with a Rice Chromosome 11 Centromeric-Proximal Genomic Region1[W

PubMed Central

Gualtieri, Gustavo; Conner, Joann A.; Morishige, Daryl T.; Moore, L. David; Mullet, John E.; Ozias-Akins, Peggy

2006-01-01

Bacterial artificial chromosome (BAC) clones from apomicts Pennisetum squamulatum and buffelgrass (Cenchrus ciliaris), isolated with the apospory-specific genomic region (ASGR) marker ugt197, were assembled into contigs that were extended by chromosome walking. Gene-like sequences from contigs were identified by shotgun sequencing and BLAST searches, and used to isolate orthologous rice contigs. Additional gene-like sequences in the apomicts' contigs were identified by bioinformatics using fully sequenced BACs from orthologous rice contigs as templates, as well as by interspecies, whole-contig cross-hybridizations. Hierarchical contig orthology was rapidly assessed by constructing detailed long-range contig molecular maps showing the distribution of gene-like sequences and markers, and searching for microsyntenic patterns of sequence identity and spatial distribution within and across species contigs. We found microsynteny between P. squamulatum and buffelgrass contigs. Importantly, this approach also enabled us to isolate from within the rice (Oryza sativa) genome contig Rice A, which shows the highest microsynteny and is most orthologous to the ugt197-containing C1C buffelgrass contig. Contig Rice A belongs to the rice genome database contig 77 (according to the current September 12, 2003, rice fingerprint contig build) that maps proximal to the chromosome 11 centromere, a feature that interestingly correlates with the mapping of ASGR-linked BACs proximal to the centromere or centromere-like sequences. Thus, relatedness between these two orthologous contigs is supported both by their molecular microstructure and by their centromeric-proximal location. Our discoveries promote the use of a microsynteny-based positional-cloning approach using the rice genome as a template to aid in constructing the ASGR toward the isolation of genes underlying apospory. PMID:16415213

A segment of the apospory-specific genomic region is highly microsyntenic not only between the apomicts Pennisetum squamulatum and buffelgrass, but also with a rice chromosome 11 centromeric-proximal genomic region.

PubMed

Gualtieri, Gustavo; Conner, Joann A; Morishige, Daryl T; Moore, L David; Mullet, John E; Ozias-Akins, Peggy

2006-03-01

Bacterial artificial chromosome (BAC) clones from apomicts Pennisetum squamulatum and buffelgrass (Cenchrus ciliaris), isolated with the apospory-specific genomic region (ASGR) marker ugt197, were assembled into contigs that were extended by chromosome walking. Gene-like sequences from contigs were identified by shotgun sequencing and BLAST searches, and used to isolate orthologous rice contigs. Additional gene-like sequences in the apomicts' contigs were identified by bioinformatics using fully sequenced BACs from orthologous rice contigs as templates, as well as by interspecies, whole-contig cross-hybridizations. Hierarchical contig orthology was rapidly assessed by constructing detailed long-range contig molecular maps showing the distribution of gene-like sequences and markers, and searching for microsyntenic patterns of sequence identity and spatial distribution within and across species contigs. We found microsynteny between P. squamulatum and buffelgrass contigs. Importantly, this approach also enabled us to isolate from within the rice (Oryza sativa) genome contig Rice A, which shows the highest microsynteny and is most orthologous to the ugt197-containing C1C buffelgrass contig. Contig Rice A belongs to the rice genome database contig 77 (according to the current September 12, 2003, rice fingerprint contig build) that maps proximal to the chromosome 11 centromere, a feature that interestingly correlates with the mapping of ASGR-linked BACs proximal to the centromere or centromere-like sequences. Thus, relatedness between these two orthologous contigs is supported both by their molecular microstructure and by their centromeric-proximal location. Our discoveries promote the use of a microsynteny-based positional-cloning approach using the rice genome as a template to aid in constructing the ASGR toward the isolation of genes underlying apospory.

[Cloning and sequencing of KIR2DL1 framework gene cDNA and identification of a novel allele].

PubMed

Sun, Ge; Wang, Chang; Zhen, Jianxin; Zhang, Guobin; Xu, Yunping; Deng, Zhihui

2016-10-01

To develop an assay for cDNA cloning and haplotype sequencing of KIR2DL1 framework gene and determine the genotype of an ethnic Han from southern China. Total RNA was isolated from peripheral blood sample, and complementary DNA (cDNA) transcript was synthesized by RT-PCR. The entire coding sequence of the KIR2DL1 framework gene was amplified with a pair of KIR2DL1-specific PCR primers. The PCR products with a length of approximately 1.2 kb were then subjected to cloning and haplotype sequencing. A specific target fragment of the KIR2DL1 framework gene was obtained. Following allele separation, a wild-type KIR2DL1*00302 allele and a novel variant allele, KIR2DL1*031, were identified. Sequence alignment with KIR2DL1 alleles from the IPD-KIR Database showed that the novel allele KIR2DL1*031 has differed from the closest allele KIR2DL1*00302 by a non-synonymous mutation at CDS nt 188A>G (codon 42 GAG>GGG) in exon 4, which has caused an amino acid change Glu42Gly. The sequence of the novel allele KIR2DL1*031 was submitted to GenBank under the accession number KP025960 and to the IPD-KIR Database under the submission number IWS40001982. A name KIR2DL1*031 has been officially assigned by the World Health Organization (WHO) Nomenclature Committee. An assay for cDNA cloning and haplotype sequencing of KIR2DL1 has been established, which has a broad applications in KIR studies at allelic level.

The development and mapping of functional markers in Fragaria and their transferability and potential for mapping in other genera.

PubMed

Sargent, D J; Rys, A; Nier, S; Simpson, D W; Tobutt, K R

2007-01-01

We have developed 46 primer pairs from exon sequences flanking polymorphic introns of 23 Fragaria gene sequences and one Malus sequence deposited in the EMBL database. Sequencing of a set of the PCR products amplified with the novel primer pairs in diploid Fragaria showed the products to be homologous to the sequences from which the primers were originally designed. By scoring the segregation of the 24 genes in two diploid Fragaria progenies FV x FN (F. vesca x F. nubicola F(2)) and 815 x 903BC (F. vesca x F. viridis BC(1)) 29 genetic loci at discrete positions on the seven linkage groups previously characterised could be mapped, bringing to 35 the total number of known function genes mapped in Fragaria. Twenty primer pairs, representing 14 genes, amplified a product of the expected size in both Malus and Prunus. To demonstrate the applicability of these gene-specific loci to comparative mapping in Rosaceae, five markers that displayed clear polymorphism between the parents of a Malus and a Prunus mapping population were selected. The markers were then scored and mapped in at least one of the two additional progenies.

Plants transformed with a tobacco mosaic virus nonstructural gene sequence are resistant to the virus.

PubMed Central

Golemboski, D B; Lomonossoff, G P; Zaitlin, M

1990-01-01

Nicotiana tabacum cv. Xanthi nn plants were transformed with nucleotides 3472-4916 of tobacco mosaic virus (TMV) strain U1. This sequence contains all but the three 3 terminal nucleotides of the TMV 54-kDa gene, which encodes a putative component of the replicase complex. These plants were resistant to infection when challenged with either TMV U1 virions or TMV U1 RNA at concentrations of up to 500 micrograms/ml or 300 micrograms/ml, respectively, the highest concentrations tested. Resistance was also exhibited when plants were inoculated at 100 micrograms/ml with the closely related TMV mutant YSI/1 but was not shown in plants challenged at the same concentrations with the more distantly related TMV strains U2 or L or cucumber mosaic virus. Although the copy number of the 54-kDa gene sequence varied in individual transformants from 1 to approximately 5, the level of resistance in plants was not dependent on the number of copies of the 54-kDa gene sequence integrated. The transformed plants accumulated a 54-kDa gene sequence-specific RNA transcript of the expected size, but no protein product was detected. Images PMID:2385595

Molecular characterization of a phloem-specific gene encoding the filament protein, phloem protein 1 (PP1), from Cucurbita maxima.

PubMed

Clark, A M; Jacobsen, K R; Bostwick, D E; Dannenhoffer, J M; Skaggs, M I; Thompson, G A

1997-07-01

Sieve elements in the phloem of most angiosperms contain proteinaceous filaments and aggregates called P-protein. In the genus Cucurbita, these filaments are composed of two major proteins: PP1, the phloem filament protein, and PP2, the phloem lactin. The gene encoding the phloem filament protein in pumpkin (Cucurbita maxima Duch.) has been isolated and characterized. Nucleotide sequence analysis of the reconstructed gene gPP1 revealed a continuous 2430 bp protein coding sequence, with no introns, encoding an 809 amino acid polypeptide. The deduced polypeptide had characteristics of PP1 and contained a 15 amino acid sequence determined by N-terminal peptide sequence analysis of PP1. The sequence of PP1 was highly repetitive with four 200 amino acid sequence domains containing structural motifs in common with cysteine proteinase inhibitors. Expression of the PP1 gene was detected in roots, hypocotyls, cotyledons, stems, and leaves of pumpkin plants. PP1 and its mRNA accumulated in pumpkin hypocotyls during the period of rapid hypocotyl elongation after which mRNA levels declined, while protein levels remained elevated. PP1 was immunolocalized in slime plugs and P-protein bodies in sieve elements of the phloem. Occasionally, PP1 was detected in companion cells. PP1 mRNA was localized by in situ hybridization in companion cells at early stages of vascular differentiation. The developmental accumulation and localization of PP1 and its mRNA paralleled the phloem lactin, further suggesting an interaction between these phloem-specific proteins.

Genomic resources for songbird research and their use in characterizing gene expression during brain development

PubMed Central

Li, XiaoChing; Wang, Xiu-Jie; Tannenhauser, Jonathan; Podell, Sheila; Mukherjee, Piali; Hertel, Moritz; Biane, Jeremy; Masuda, Shoko; Nottebohm, Fernando; Gaasterland, Terry

2007-01-01

Vocal learning and neuronal replacement have been studied extensively in songbirds, but until recently, few molecular and genomic tools for songbird research existed. Here we describe new molecular/genomic resources developed in our laboratory. We made cDNA libraries from zebra finch (Taeniopygia guttata) brains at different developmental stages. A total of 11,000 cDNA clones from these libraries, representing 5,866 unique gene transcripts, were randomly picked and sequenced from the 3′ ends. A web-based database was established for clone tracking, sequence analysis, and functional annotations. Our cDNA libraries were not normalized. Sequencing ESTs without normalization produced many developmental stage-specific sequences, yielding insights into patterns of gene expression at different stages of brain development. In particular, the cDNA library made from brains at posthatching day 30–50, corresponding to the period of rapid song system development and song learning, has the most diverse and richest set of genes expressed. We also identified five microRNAs whose sequences are highly conserved between zebra finch and other species. We printed cDNA microarrays and profiled gene expression in the high vocal center of both adult male zebra finches and canaries (Serinus canaria). Genes differentially expressed in the high vocal center were identified from the microarray hybridization results. Selected genes were validated by in situ hybridization. Networks among the regulated genes were also identified. These resources provide songbird biologists with tools for genome annotation, comparative genomics, and microarray gene expression analysis. PMID:17426146

SELMAP - SELEX affinity landscape MAPping of transcription factor binding sites using integrated microfluidics

PubMed Central

Chen, Dana; Orenstein, Yaron; Golodnitsky, Rada; Pellach, Michal; Avrahami, Dorit; Wachtel, Chaim; Ovadia-Shochat, Avital; Shir-Shapira, Hila; Kedmi, Adi; Juven-Gershon, Tamar; Shamir, Ron; Gerber, Doron

2016-01-01

Transcription factors (TFs) alter gene expression in response to changes in the environment through sequence-specific interactions with the DNA. These interactions are best portrayed as a landscape of TF binding affinities. Current methods to study sequence-specific binding preferences suffer from limited dynamic range, sequence bias, lack of specificity and limited throughput. We have developed a microfluidic-based device for SELEX Affinity Landscape MAPping (SELMAP) of TF binding, which allows high-throughput measurement of 16 proteins in parallel. We used it to measure the relative affinities of Pho4, AtERF2 and Btd full-length proteins to millions of different DNA binding sites, and detected both high and low-affinity interactions in equilibrium conditions, generating a comprehensive landscape of the relative TF affinities to all possible DNA 6-mers, and even DNA10-mers with increased sequencing depth. Low quantities of both the TFs and DNA oligomers were sufficient for obtaining high-quality results, significantly reducing experimental costs. SELMAP allows in-depth screening of hundreds of TFs, and provides a means for better understanding of the regulatory processes that govern gene expression. PMID:27628341

DNA methylation assessment from human slow- and fast-twitch skeletal muscle fibers

PubMed Central

Begue, Gwénaëlle; Raue, Ulrika; Jemiolo, Bozena

2017-01-01

A new application of the reduced representation bisulfite sequencing method was developed using low-DNA input to investigate the epigenetic profile of human slow- and fast-twitch skeletal muscle fibers. Successful library construction was completed with as little as 15 ng of DNA, and high-quality sequencing data were obtained with 32 ng of DNA. Analysis identified 143,160 differentially methylated CpG sites across 14,046 genes. In both fiber types, selected genes predominantly expressed in slow or fast fibers were hypomethylated, which was supported by the RNA-sequencing analysis. These are the first fiber type-specific methylation data from human skeletal muscle and provide a unique platform for future research. NEW & NOTEWORTHY This study validates a low-DNA input reduced representation bisulfite sequencing method for human muscle biopsy samples to investigate the methylation patterns at a fiber type-specific level. These are the first fiber type-specific methylation data reported from human skeletal muscle and thus provide initial insight into basal state differences in myosin heavy chain I and IIa muscle fibers among young, healthy men. PMID:28057818

Novel numerical and graphical representation of DNA sequences and proteins.

PubMed

Randić, M; Novic, M; Vikić-Topić, D; Plavsić, D

2006-12-01

We have introduced novel numerical and graphical representations of DNA, which offer a simple and unique characterization of DNA sequences. The numerical representation of a DNA sequence is given as a sequence of real numbers derived from a unique graphical representation of the standard genetic code. There is no loss of information on the primary structure of a DNA sequence associated with this numerical representation. The novel representations are illustrated with the coding sequences of the first exon of beta-globin gene of half a dozen species in addition to human. The method can be extended to proteins as is exemplified by humanin, a 24-aa peptide that has recently been identified as a specific inhibitor of neuronal cell death induced by familial Alzheimer's disease mutant genes.

Flow cytometric purification of Colletotrichum higginsianum biotrophic hyphae from Arabidopsis leaves for stage-specific transcriptome analysis.

PubMed

Takahara, Hiroyuki; Dolf, Andreas; Endl, Elmar; O'Connell, Richard

2009-08-01

Generation of stage-specific cDNA libraries is a powerful approach to identify pathogen genes that are differentially expressed during plant infection. Biotrophic pathogens develop specialized infection structures inside living plant cells, but sampling the transcriptome of these structures is problematic due to the low ratio of fungal to plant RNA, and the lack of efficient methods to isolate them from infected plants. Here we established a method, based on fluorescence-activated cell sorting (FACS), to purify the intracellular biotrophic hyphae of Colletotrichum higginsianum from homogenates of infected Arabidopsis leaves. Specific selection of viable hyphae using a fluorescent vital marker provided intact RNA for cDNA library construction. Pilot-scale sequencing showed that the library was enriched with plant-induced and pathogenicity-related fungal genes, including some encoding small, soluble secreted proteins that represent candidate fungal effectors. The high purity of the hyphae (94%) prevented contamination of the library by sequences derived from host cells or other fungal cell types. RT-PCR confirmed that genes identified in the FACS-purified hyphae were also expressed in planta. The method has wide applicability for isolating the infection structures of other plant pathogens, and will facilitate cell-specific transcriptome analysis via deep sequencing and microarray hybridization, as well as proteomic analyses.

A cDNA from a mouse pancreatic beta cell encoding a putative transcription factor of the insulin gene.

PubMed Central

Walker, M D; Park, C W; Rosen, A; Aronheim, A

1990-01-01

Cell specific expression of the insulin gene is achieved through transcriptional mechanisms operating on multiple DNA sequence elements located in the 5' flanking region of the gene. Of particular importance in the rat insulin I gene are two closely similar 9 bp sequences (IEB1 and IEB2): mutation of either of these leads to 5-10 fold reduction in transcriptional activity. We have screened an expression cDNA library derived from mouse pancreatic endocrine beta cells with a radioactive DNA probe containing multiple copies of the IEB1 sequence. A cDNA clone (A1) isolated by this procedure encodes a protein which shows efficient binding to the IEB1 probe, but much weaker binding to either an unrelated DNA probe or to a probe bearing a single base pair insertion within the recognition sequence. DNA sequence analysis indicates a protein belonging to the helix-loop-helix family of DNA-binding proteins. The ability of the protein encoded by clone A1 to recognize a number of wild type and mutant DNA sequences correlates closely with the ability of each sequence element to support transcription in vivo in the context of the insulin 5' flanking DNA. We conclude that the isolated cDNA may encode a transcription factor that participates in control of insulin gene expression. Images PMID:2181401

Rapid divergence and expansion of the X chromosome in papaya

PubMed Central

Gschwend, Andrea R.; Yu, Qingyi; Tong, Eric J.; Zeng, Fanchang; Han, Jennifer; VanBuren, Robert; Aryal, Rishi; Charlesworth, Deborah; Moore, Paul H.; Paterson, Andrew H.; Ming, Ray

2012-01-01

X chromosomes have long been thought to conserve the structure and gene content of the ancestral autosome from which the sex chromosomes evolved. We compared the recently evolved papaya sex chromosomes with a homologous autosome of a close relative, the monoecious Vasconcellea monoica, to infer changes since recombination stopped between the papaya sex chromosomes. We sequenced 12 V. monoica bacterial artificial chromosomes, 11 corresponding to the papaya X-specific region, and 1 to a papaya autosomal region. The combined V. monoica X-orthologous sequences are much shorter (1.10 Mb) than the corresponding papaya region (2.56 Mb). Given that the V. monoica genome is 41% larger than that of papaya, this finding suggests considerable expansion of the papaya X; expansion is supported by a higher repetitive sequence content of the X compared with the papaya autosomal sequence. The alignable regions include 27 transcript-encoding sequences, only 6 of which are functional X/V. monoica gene pairs. Sequence divergence from the V. monoica orthologs is almost identical for papaya X and Y alleles; the Carica-Vasconcellea split therefore occurred before the papaya sex chromosomes stopped recombining, making V. monoica a suitable outgroup for inferring changes in papaya sex chromosomes. The papaya X and the hermaphrodite-specific region of the Yh chromosome and V. monoica have all gained and lost genes, including a surprising amount of changes in the X. PMID:22869742

Quantification of sequence exchange events between PMS2 and PMS2CL provides a basis for improved mutation scanning of Lynch syndrome patients.

PubMed

van der Klift, Heleen M; Tops, Carli M J; Bik, Elsa C; Boogaard, Merel W; Borgstein, Anne-Marijke; Hansson, Kerstin B M; Ausems, Margreet G E M; Gomez Garcia, Encarna; Green, Andrew; Hes, Frederik J; Izatt, Louise; van Hest, Liselotte P; Alonso, Angel M; Vriends, Annette H J T; Wagner, Anja; van Zelst-Stams, Wendy A G; Vasen, Hans F A; Morreau, Hans; Devilee, Peter; Wijnen, Juul T

2010-05-01

Heterozygous mutations in PMS2 are involved in Lynch syndrome, whereas biallelic mutations are found in Constitutional mismatch repair-deficiency syndrome patients. Mutation detection is complicated by the occurrence of sequence exchange events between the duplicated regions of PMS2 and PMS2CL. We investigated the frequency of such events with a nonspecific polymerase chain reaction (PCR) strategy, co-amplifying both PMS2 and PMS2CL sequences. This allowed us to score ratios between gene and pseudogene-specific nucleotides at 29 PSV sites from exon 11 to the end of the gene. We found sequence transfer at all investigated PSVs from intron 12 to the 3' end of the gene in 4 to 52% of DNA samples. Overall, sequence exchange between PMS2 and PMS2CL was observed in 69% (83/120) of individuals. We demonstrate that mutation scanning with PMS2-specific PCR primers and MLPA probes, designed on PSVs, in the 3' duplicated region is unreliable, and present an RNA-based mutation detection strategy to improve reliability. Using this strategy, we found 19 different putative pathogenic PMS2 mutations. Four of these (21%) are lying in the region with frequent sequence transfer and are missed or called incorrectly as homozygous with several PSV-based mutation detection methods. (c) 2010 Wiley-Liss, Inc.

Specific DNA binding of the two chicken Deformed family homeodomain proteins, Chox-1.4 and Chox-a.

PubMed Central

Sasaki, H; Yokoyama, E; Kuroiwa, A

1990-01-01

The cDNA clones encoding two chicken Deformed (Dfd) family homeobox containing genes Chox-1.4 and Chox-a were isolated. Comparison of their amino acid sequences with another chicken Dfd family homeodomain protein and with those of mouse homologues revealed that strong homologies are located in the amino terminal regions and around the homeodomains. Although homologies in other regions were relatively low, some short conserved sequences were also identified. E. coli-made full length proteins were purified and used for the production of specific antibodies and for DNA binding studies. The binding profiles of these proteins to the 5'-leader and 5'-upstream sequences of Chox-1.4 and Chox-a coding regions were analyzed by immunoprecipitation and DNase I footprint assays. These two Chox proteins bound to the same sites in the 5'-flanking sequences of their coding regions with various affinities and their binding affinities to each site were nearly the same. The consensus sequences of the high and low affinity binding sites were TAATGA(C/G) and CTAATTTT, respectively. A clustered binding site was identified in the 5'-upstream of the Chox-a gene, suggesting that this clustered binding site works as a cis-regulatory element for auto- and/or cross-regulation of Chox-a gene expression. Images PMID:1970866

Detection and Identification of Gastrointestinal Lactobacillus Species by Using Denaturing Gradient Gel Electrophoresis and Species-Specific PCR Primers

PubMed Central

Walter, J.; Tannock, G. W.; Tilsala-Timisjarvi, A.; Rodtong, S.; Loach, D. M.; Munro, K.; Alatossava, T.

2000-01-01

Denaturing gradient gel electrophoresis (DGGE) of DNA fragments obtained by PCR amplification of the V2-V3 region of the 16S rRNA gene was used to detect the presence of Lactobacillus species in the stomach contents of mice. Lactobacillus isolates cultured from human and porcine gastrointestinal samples were identified to the species level by using a combination of DGGE and species-specific PCR primers that targeted 16S-23S rRNA intergenic spacer region or 16S rRNA gene sequences. The identifications obtained by this approach were confirmed by sequencing the V2-V3 region of the 16S rRNA gene and by a BLAST search of the GenBank database. PMID:10618239

[Efficient genome editing in human pluripotent stem cells through CRISPR/Cas9].

PubMed

Liu, Gai-gai; Li, Shuang; Wei, Yu-da; Zhang, Yong-xian; Ding, Qiu-rong

2015-11-01

The RNA-guided CRISPR (clustered regularly interspaced short palindromic repeat)-associated Cas9 nuclease has offered a new platform for genome editing with high efficiency. Here, we report the use of CRISPR/Cas9 technology to target a specific genomic region in human pluripotent stem cells. We show that CRISPR/Cas9 can be used to disrupt a gene by introducing frameshift mutations to gene coding region; to knock in specific sequences (e.g. FLAG tag DNA sequence) to targeted genomic locus via homology directed repair; to induce large genomic deletion through dual-guide multiplex. Our results demonstrate the versatile application of CRISPR/Cas9 in stem cell genome editing, which can be widely utilized for functional studies of genes or genome loci in human pluripotent stem cells.

RFLP and sequence analysis of the cytochrome b gene of selected animals and man: methodology and forensic application.

PubMed

Zehner, R; Zimmermann, S; Mebs, D

1998-01-01

To identify common animal species by analysis of the cytochrome b gene a method has been developed to obtain PCR products of a large domain of the cytochrome b gene (981 bp out of 1140 bp) in humans, selected mammals and birds using the same specifically designed primers. Species-specific RFLP patterns are generated by co-restriction with the restriction endonucleases ALU I and NCO I. The RFLP patterns obtained are conclusive even in mixtures of two or more species. The results were confirmed by sequence analysis which in addition explained intraspecies variations in the RFLP patterns. The method has been applied to forensic casework studies where the origin of roasted meat, stomach contents and a bone sample has been successfully identified.

Structure and Sequence Search on Aptamer-Protein Docking

NASA Astrophysics Data System (ADS)

Xiao, Jiajie; Bonin, Keith; Guthold, Martin; Salsbury, Freddie

2015-03-01

Interactions between proteins and deoxyribonucleic acid (DNA) play a significant role in the living systems, especially through gene regulation. However, short nucleic acids sequences (aptamers) with specific binding affinity to specific proteins exhibit clinical potential as therapeutics. Our capillary and gel electrophoresis selection experiments show that specific sequences of aptamers can be selected that bind specific proteins. Computationally, given the experimentally-determined structure and sequence of a thrombin-binding aptamer, we can successfully dock the aptamer onto thrombin in agreement with experimental structures of the complex. In order to further study the conformational flexibility of this thrombin-binding aptamer and to potentially develop a predictive computational model of aptamer-binding, we use GPU-enabled molecular dynamics simulations to both examine the conformational flexibility of the aptamer in the absence of binding to thrombin, and to determine our ability to fold an aptamer. This study should help further de-novo predictions of aptamer sequences by enabling the study of structural and sequence-dependent effects on aptamer-protein docking specificity.

SigEMD: A powerful method for differential gene expression analysis in single-cell RNA sequencing data.

PubMed

Wang, Tianyu; Nabavi, Sheida

2018-04-24

Differential gene expression analysis is one of the significant efforts in single cell RNA sequencing (scRNAseq) analysis to discover the specific changes in expression levels of individual cell types. Since scRNAseq exhibits multimodality, large amounts of zero counts, and sparsity, it is different from the traditional bulk RNA sequencing (RNAseq) data. The new challenges of scRNAseq data promote the development of new methods for identifying differentially expressed (DE) genes. In this study, we proposed a new method, SigEMD, that combines a data imputation approach, a logistic regression model and a nonparametric method based on the Earth Mover's Distance, to precisely and efficiently identify DE genes in scRNAseq data. The regression model and data imputation are used to reduce the impact of large amounts of zero counts, and the nonparametric method is used to improve the sensitivity of detecting DE genes from multimodal scRNAseq data. By additionally employing gene interaction network information to adjust the final states of DE genes, we further reduce the false positives of calling DE genes. We used simulated datasets and real datasets to evaluate the detection accuracy of the proposed method and to compare its performance with those of other differential expression analysis methods. Results indicate that the proposed method has an overall powerful performance in terms of precision in detection, sensitivity, and specificity. Copyright © 2018 Elsevier Inc. All rights reserved.