Cardiogenic Genes Expressed in Cardiac Fibroblasts Contribute to Heart Development and Repair

PubMed Central

Furtado, Milena B.; Costa, Mauro W.; Pranoto, Edward Adi; Salimova, Ekaterina; Pinto, Alex; Lam, Nicholas T.; Park, Anthony; Snider, Paige; Chandran, Anjana; Harvey, Richard P.; Boyd, Richard; Conway, Simon J.; Pearson, James; Kaye, David M.; Rosenthal, Nadia A.

2014-01-01

Rationale Cardiac fibroblasts are critical to proper heart function through multiple interactions with the myocardial compartment but appreciation of their contribution has suffered from incomplete characterization and lack of cell-specific markers. Objective To generate an unbiased comparative gene expression profile of the cardiac fibroblast pool, identify and characterize the role of key genes in cardiac fibroblast function, and determine their contribution to myocardial development and regeneration. Methods and Results High-throughput cell surface and intracellular profiling of cardiac and tail fibroblasts identified canonical MSC and a surprising number of cardiogenic genes, some expressed at higher levels than in whole heart. Whilst genetically marked fibroblasts contributed heterogeneously to interstitial but not cardiomyocyte compartments in infarcted hearts, fibroblast-restricted depletion of one highly expressed cardiogenic marker, Tbx20, caused marked myocardial dysmorphology and perturbations in scar formation upon myocardial infarction. Conclusions The surprising transcriptional identity of cardiac fibroblasts, the adoption of cardiogenic gene programs and direct contribution to cardiac development and repair provokes alternative interpretations for studies on more specialized cardiac progenitors, offering a novel perspective for reinterpreting cardiac regenerative therapies. PMID:24650916

Pooled Resequencing of 122 Ulcerative Colitis Genes in a Large Dutch Cohort Suggests Population-Specific Associations of Rare Variants in MUC2.

PubMed

Visschedijk, Marijn C; Alberts, Rudi; Mucha, Soren; Deelen, Patrick; de Jong, Dirk J; Pierik, Marieke; Spekhorst, Lieke M; Imhann, Floris; van der Meulen-de Jong, Andrea E; van der Woude, C Janneke; van Bodegraven, Adriaan A; Oldenburg, Bas; Löwenberg, Mark; Dijkstra, Gerard; Ellinghaus, David; Schreiber, Stefan; Wijmenga, Cisca; Rivas, Manuel A; Franke, Andre; van Diemen, Cleo C; Weersma, Rinse K

2016-01-01

Genome-wide association studies have revealed several common genetic risk variants for ulcerative colitis (UC). However, little is known about the contribution of rare, large effect genetic variants to UC susceptibility. In this study, we performed a deep targeted re-sequencing of 122 genes in Dutch UC patients in order to investigate the contribution of rare variants to the genetic susceptibility to UC. The selection of genes consists of 111 established human UC susceptibility genes and 11 genes that lead to spontaneous colitis when knocked-out in mice. In addition, we sequenced the promoter regions of 45 genes where known variants exert cis-eQTL-effects. Targeted pooled re-sequencing was performed on DNA of 790 Dutch UC cases. The Genome of the Netherlands project provided sequence data of 500 healthy controls. After quality control and prioritization based on allele frequency and pathogenicity probability, follow-up genotyping of 171 rare variants was performed on 1021 Dutch UC cases and 1166 Dutch controls. Single-variant association and gene-based analyses identified an association of rare variants in the MUC2 gene with UC. The associated variants in the Dutch population could not be replicated in a German replication cohort (1026 UC cases, 3532 controls). In conclusion, this study has identified a putative role for MUC2 on UC susceptibility in the Dutch population and suggests a population-specific contribution of rare variants to UC.

Forager bees (Apis mellifera) highly express immune and detoxification genes in tissues associated with nectar processing.

PubMed

Vannette, Rachel L; Mohamed, Abbas; Johnson, Brian R

2015-11-09

Pollinators, including honey bees, routinely encounter potentially harmful microorganisms and phytochemicals during foraging. However, the mechanisms by which honey bees manage these potential threats are poorly understood. In this study, we examine the expression of antimicrobial, immune and detoxification genes in Apis mellifera and compare between forager and nurse bees using tissue-specific RNA-seq and qPCR. Our analysis revealed extensive tissue-specific expression of antimicrobial, immune signaling, and detoxification genes. Variation in gene expression between worker stages was pronounced in the mandibular and hypopharyngeal gland (HPG), where foragers were enriched in transcripts that encode antimicrobial peptides (AMPs) and immune response. Additionally, forager HPGs and mandibular glands were enriched in transcripts encoding detoxification enzymes, including some associated with xenobiotic metabolism. Using qPCR on an independent dataset, we verified differential expression of three AMP and three P450 genes between foragers and nurses. High expression of AMP genes in nectar-processing tissues suggests that these peptides may contribute to antimicrobial properties of honey or to honey bee defense against environmentally-acquired microorganisms. Together, these results suggest that worker role and tissue-specific expression of AMPs, and immune and detoxification enzymes may contribute to defense against microorganisms and xenobiotic compounds acquired while foraging.

Forager bees (Apis mellifera) highly express immune and detoxification genes in tissues associated with nectar processing

PubMed Central

Vannette, Rachel L.; Mohamed, Abbas; Johnson, Brian R.

2015-01-01

Pollinators, including honey bees, routinely encounter potentially harmful microorganisms and phytochemicals during foraging. However, the mechanisms by which honey bees manage these potential threats are poorly understood. In this study, we examine the expression of antimicrobial, immune and detoxification genes in Apis mellifera and compare between forager and nurse bees using tissue-specific RNA-seq and qPCR. Our analysis revealed extensive tissue-specific expression of antimicrobial, immune signaling, and detoxification genes. Variation in gene expression between worker stages was pronounced in the mandibular and hypopharyngeal gland (HPG), where foragers were enriched in transcripts that encode antimicrobial peptides (AMPs) and immune response. Additionally, forager HPGs and mandibular glands were enriched in transcripts encoding detoxification enzymes, including some associated with xenobiotic metabolism. Using qPCR on an independent dataset, we verified differential expression of three AMP and three P450 genes between foragers and nurses. High expression of AMP genes in nectar-processing tissues suggests that these peptides may contribute to antimicrobial properties of honey or to honey bee defense against environmentally-acquired microorganisms. Together, these results suggest that worker role and tissue-specific expression of AMPs, and immune and detoxification enzymes may contribute to defense against microorganisms and xenobiotic compounds acquired while foraging. PMID:26549293

Transcription factor trapping by RNA in gene regulatory elements.

PubMed

Sigova, Alla A; Abraham, Brian J; Ji, Xiong; Molinie, Benoit; Hannett, Nancy M; Guo, Yang Eric; Jangi, Mohini; Giallourakis, Cosmas C; Sharp, Phillip A; Young, Richard A

2015-11-20

Transcription factors (TFs) bind specific sequences in promoter-proximal and -distal DNA elements to regulate gene transcription. RNA is transcribed from both of these DNA elements, and some DNA binding TFs bind RNA. Hence, RNA transcribed from regulatory elements may contribute to stable TF occupancy at these sites. We show that the ubiquitously expressed TF Yin-Yang 1 (YY1) binds to both gene regulatory elements and their associated RNA species across the entire genome. Reduced transcription of regulatory elements diminishes YY1 occupancy, whereas artificial tethering of RNA enhances YY1 occupancy at these elements. We propose that RNA makes a modest but important contribution to the maintenance of certain TFs at gene regulatory elements and suggest that transcription of regulatory elements produces a positive-feedback loop that contributes to the stability of gene expression programs. Copyright © 2015, American Association for the Advancement of Science.

An alternative splicing program promotes adipose tissue thermogenesis

PubMed Central

Vernia, Santiago; Edwards, Yvonne JK; Han, Myoung Sook; Cavanagh-Kyros, Julie; Barrett, Tamera; Kim, Jason K; Davis, Roger J

2016-01-01

Alternative pre-mRNA splicing expands the complexity of the transcriptome and controls isoform-specific gene expression. Whether alternative splicing contributes to metabolic regulation is largely unknown. Here we investigated the contribution of alternative splicing to the development of diet-induced obesity. We found that obesity-induced changes in adipocyte gene expression include alternative pre-mRNA splicing. Bioinformatics analysis associated part of this alternative splicing program with sequence specific NOVA splicing factors. This conclusion was confirmed by studies of mice with NOVA deficiency in adipocytes. Phenotypic analysis of the NOVA-deficient mice demonstrated increased adipose tissue thermogenesis and improved glycemia. We show that NOVA proteins mediate a splicing program that suppresses adipose tissue thermogenesis. Together, these data provide quantitative analysis of gene expression at exon-level resolution in obesity and identify a novel mechanism that contributes to the regulation of adipose tissue function and the maintenance of normal glycemia. DOI: http://dx.doi.org/10.7554/eLife.17672.001 PMID:27635635

Unifying measures of gene function and evolution.

PubMed

Wolf, Yuri I; Carmel, Liran; Koonin, Eugene V

2006-06-22

Recent genome analyses revealed intriguing correlations between variables characterizing the functioning of a gene, such as expression level (EL), connectivity of genetic and protein-protein interaction networks, and knockout effect, and variables describing gene evolution, such as sequence evolution rate (ER) and propensity for gene loss. Typically, variables within each of these classes are positively correlated, e.g. products of highly expressed genes also have a propensity to be involved in many protein-protein interactions, whereas variables between classes are negatively correlated, e.g. highly expressed genes, on average, evolve slower than weakly expressed genes. Here, we describe principal component (PC) analysis of seven genome-related variables and propose biological interpretations for the first three PCs. The first PC reflects a gene's 'importance', or the 'status' of a gene in the genomic community, with positive contributions from knockout lethality, EL, number of protein-protein interaction partners and the number of paralogues, and negative contributions from sequence ER and gene loss propensity. The next two PCs define a plane that seems to reflect the functional and evolutionary plasticity of a gene. Specifically, PC2 can be interpreted as a gene's 'adaptability' whereby genes with high adaptability readily duplicate, have many genetic interaction partners and tend to be non-essential. PC3 also might reflect the role of a gene in organismal adaptation albeit with a negative rather than a positive contribution of genetic interactions; we provisionally designate this PC 'reactivity'. The interpretation of PC2 and PC3 as measures of a gene's plasticity is compatible with the observation that genes with high values of these PCs tend to be expressed in a condition- or tissue-specific manner. Functional classes of genes substantially vary in status, adaptability and reactivity, with the highest status characteristic of the translation system and cytoskeletal proteins, highest adaptability seen in cellular processes and signalling genes, and top reactivity characteristic of metabolic enzymes.

F-box genes: Genome-wide expansion, evolution and their contribution to pollen growth in pear (Pyrus bretschneideri).

PubMed

Wang, Guo-Ming; Yin, Hao; Qiao, Xin; Tan, Xu; Gu, Chao; Wang, Bao-Hua; Cheng, Rui; Wang, Ying-Zhen; Zhang, Shao-Ling

2016-12-01

F-box gene family, as one of the largest gene families in plants, plays crucial roles in regulating plant development, reproduction, cellular protein degradation and responses to biotic and abiotic stresses. However, comprehensive analysis of the F-box gene family in pear (Pyrus bretschneideri Rehd.) and other Rosaceae species has not been reported yet. Herein, we identified a total of 226 full-length F-box genes in pear for the first time. And these genes were further divided into various subgroups based on specific domains and phylogenetic analysis. Intriguingly, we observed that whole-genome duplication and dispersed duplication have a major contribution to F-box family expansion. Furthermore, the dynamic evolution for different modes of gene duplication was dissected. Interestingly, we found that dispersed and tandem duplicate have been evolving at a high rate. In addition, we found that F-box genes exhibited functional specificity based on GO analysis, and most of the F-box genes were significantly enriched in the protein binding (GO: 0005515) term, supporting that F-box genes might play a critical role for gene regulation in pear. Transcriptome and digital expression profiles revealed that F-box genes are involved in the development of multiple pear tissues. Overall, these results will set stage for elaborating the biological role of F-box genes in pear and other plants. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

How Does the Scientific Community Contribute to Gene Ontology?

PubMed

Lovering, Ruth C

2017-01-01

Collaborations between the scientific community and members of the Gene Ontology (GO) Consortium have led to an increase in the number and specificity of GO terms, as well as increasing the number of GO annotations. A variety of approaches have been taken to encourage research scientists to contribute to the GO, but the success of these approaches has been variable. This chapter reviews both the successes and failures of engaging the scientific community in GO development and annotation, as well as, providing motivation and advice to encourage individual researchers to contribute to GO.

African-specific variability in the acetylcholine muscarinic receptor M4: association with cocaine and heroin addiction.

PubMed

Levran, Orna; Randesi, Matthew; Peles, Einat; Correa da Rosa, Joel; Ott, Jurg; Rotrosen, John; Adelson, Miriam; Kreek, Mary Jeanne

2016-06-01

This study was designed to determine whether polymorphisms in acetylcholine receptors contribute to opioid dependence and/or cocaine dependence. The sample (n = 1860) was divided by drug and ancestry, and 55 polymorphisms (nine genes) were analyzed. Of the 20 SNPs that showed nominally significant associations, the association of the African-specific CHRM4 SNP rs2229163 (Asn417=) with cocaine dependence survived correction for multiple testing (Pcorrected = 0.047). CHRM4 is located in a region of strong linkage disequilibrium on chromosome 11 that includes genes associated with schizophrenia. CHRM4 SNP rs2229163 is in strong linkage disequilibrium with several African-specific SNPs in DGKZ and AMBRA1. Cholinergic receptors' variants may contribute to drug addiction and have a potential role as pharmacogenetic markers.

Epigenetic regulation of BDNF gene transcription in the consolidation of fear memory.

PubMed

Lubin, Farah D; Roth, Tania L; Sweatt, J David

2008-10-15

Long-term memory formation requires selective changes in gene expression. Here, we determined the contribution of chromatin remodeling to learning-induced changes in brain-derived neurotrophic factor (bdnf) gene expression in the adult hippocampus. Contextual fear learning induced differential regulation of exon-specific bdnf mRNAs (I, IV, VI, IX) that was associated with changes in bdnf DNA methylation and altered local chromatin structure. Infusions of zebularine (a DNA methyltransferase inhibitor) significantly altered bdnf DNA methylation and triggered changes in exon-specific bdnf mRNA levels, indicating that altered DNA methylation is sufficient to drive differential bdnf transcript regulation in the hippocampus. In addition, NMDA receptor blockade prevented memory-associated alterations in bdnf DNA methylation, resulting in a block of altered bdnf gene expression in hippocampus and a deficit in memory formation. These results suggest epigenetic modification of the bdnf gene as a mechanism for isoform-specific gene readout during memory consolidation.

Variants at serotonin transporter and 2A receptor genes predict cooperative behavior differentially according to presence of punishment.

PubMed

Schroeder, Kari B; McElreath, Richard; Nettle, Daniel

2013-03-05

Punishment of free-riding has been implicated in the evolution of cooperation in humans, and yet mechanisms for punishment avoidance remain largely uninvestigated. Individual variation in these mechanisms may stem from variation in the serotonergic system, which modulates processing of aversive stimuli. Functional serotonin gene variants have been associated with variation in the processing of aversive stimuli and widely studied as risk factors for psychiatric disorders. We show that variants at the serotonin transporter gene (SLC6A4) and serotonin 2A receptor gene (HTR2A) predict contributions to the public good in economic games, dependent upon whether contribution behavior can be punished. Participants with a variant at the serotonin transporter gene contribute more, leading to group-level differences in cooperation, but this effect dissipates in the presence of punishment. When contribution behavior can be punished, those with a variant at the serotonin 2A receptor gene contribute more than those without it. This variant also predicts a more stressful experience of the games. The diversity of institutions (including norms) that govern cooperation and punishment may create selective pressures for punishment avoidance that change rapidly across time and space. Variant-specific epigenetic regulation of these genes, as well as population-level variation in the frequencies of these variants, may facilitate adaptation to local norms of cooperation and punishment.

Variants at serotonin transporter and 2A receptor genes predict cooperative behavior differentially according to presence of punishment

PubMed Central

Schroeder, Kari B.; McElreath, Richard; Nettle, Daniel

2013-01-01

Punishment of free-riding has been implicated in the evolution of cooperation in humans, and yet mechanisms for punishment avoidance remain largely uninvestigated. Individual variation in these mechanisms may stem from variation in the serotonergic system, which modulates processing of aversive stimuli. Functional serotonin gene variants have been associated with variation in the processing of aversive stimuli and widely studied as risk factors for psychiatric disorders. We show that variants at the serotonin transporter gene (SLC6A4) and serotonin 2A receptor gene (HTR2A) predict contributions to the public good in economic games, dependent upon whether contribution behavior can be punished. Participants with a variant at the serotonin transporter gene contribute more, leading to group-level differences in cooperation, but this effect dissipates in the presence of punishment. When contribution behavior can be punished, those with a variant at the serotonin 2A receptor gene contribute more than those without it. This variant also predicts a more stressful experience of the games. The diversity of institutions (including norms) that govern cooperation and punishment may create selective pressures for punishment avoidance that change rapidly across time and space. Variant-specific epigenetic regulation of these genes, as well as population-level variation in the frequencies of these variants, may facilitate adaptation to local norms of cooperation and punishment. PMID:23431136

A versatile Multisite Gateway-compatible promoter and transgenic line collection for cell type-specific functional genomics in Arabidopsis

PubMed Central

Platre, Matthieu Pierre; Barberon, Marie; Caillieux, Erwann; Colot, Vincent

2016-01-01

Summary Multicellular organisms are composed of many cell types that acquire their specific fate through a precisely controlled pattern of gene expression in time and space dictated in part by cell type-specific promoter activity. Understanding the contribution of highly specialized cell types in the development of a whole organism requires the ability to isolate or analyze different cell types separately. We have characterized and validated a large collection of root cell type-specific promoters and have generated cell type-specific marker lines. These benchmarked promoters can be readily used to evaluate cell type-specific complementation of mutant phenotypes, or to knockdown gene expression using targeted expression of artificial miRNA. We also generated vectors and characterized transgenic lines for cell type-specific induction of gene expression and cell type-specific isolation of nuclei for RNA and chromatin profiling. Vectors and seeds from transgenic Arabidopsis plants will be freely available, and will promote rapid progress in cell type-specific functional genomics. We demonstrate the power of this promoter set for analysis of complex biological processes by investigating the contribution of root cell types in the IRT1-dependent root iron uptake. Our findings revealed the complex spatial expression pattern of IRT1 in both root epidermis and phloem companion cells and the requirement for IRT1 to be expressed in both cell types for proper iron homeostasis. PMID:26662936

A Stratified Transcriptomics Analysis of Polygenic Fat and Lean Mouse Adipose Tissues Identifies Novel Candidate Obesity Genes

PubMed Central

Morton, Nicholas M.; Nelson, Yvonne B.; Michailidou, Zoi; Di Rollo, Emma M.; Ramage, Lynne; Hadoke, Patrick W. F.; Seckl, Jonathan R.; Bunger, Lutz; Horvat, Simon; Kenyon, Christopher J.; Dunbar, Donald R.

2011-01-01

Background Obesity and metabolic syndrome results from a complex interaction between genetic and environmental factors. In addition to brain-regulated processes, recent genome wide association studies have indicated that genes highly expressed in adipose tissue affect the distribution and function of fat and thus contribute to obesity. Using a stratified transcriptome gene enrichment approach we attempted to identify adipose tissue-specific obesity genes in the unique polygenic Fat (F) mouse strain generated by selective breeding over 60 generations for divergent adiposity from a comparator Lean (L) strain. Results To enrich for adipose tissue obesity genes a ‘snap-shot’ pooled-sample transcriptome comparison of key fat depots and non adipose tissues (muscle, liver, kidney) was performed. Known obesity quantitative trait loci (QTL) information for the model allowed us to further filter genes for increased likelihood of being causal or secondary for obesity. This successfully identified several genes previously linked to obesity (C1qr1, and Np3r) as positional QTL candidate genes elevated specifically in F line adipose tissue. A number of novel obesity candidate genes were also identified (Thbs1, Ppp1r3d, Tmepai, Trp53inp2, Ttc7b, Tuba1a, Fgf13, Fmr) that have inferred roles in fat cell function. Quantitative microarray analysis was then applied to the most phenotypically divergent adipose depot after exaggerating F and L strain differences with chronic high fat feeding which revealed a distinct gene expression profile of line, fat depot and diet-responsive inflammatory, angiogenic and metabolic pathways. Selected candidate genes Npr3 and Thbs1, as well as Gys2, a non-QTL gene that otherwise passed our enrichment criteria were characterised, revealing novel functional effects consistent with a contribution to obesity. Conclusions A focussed candidate gene enrichment strategy in the unique F and L model has identified novel adipose tissue-enriched genes contributing to obesity. PMID:21915269

A stratified transcriptomics analysis of polygenic fat and lean mouse adipose tissues identifies novel candidate obesity genes.

PubMed

Morton, Nicholas M; Nelson, Yvonne B; Michailidou, Zoi; Di Rollo, Emma M; Ramage, Lynne; Hadoke, Patrick W F; Seckl, Jonathan R; Bunger, Lutz; Horvat, Simon; Kenyon, Christopher J; Dunbar, Donald R

2011-01-01

Obesity and metabolic syndrome results from a complex interaction between genetic and environmental factors. In addition to brain-regulated processes, recent genome wide association studies have indicated that genes highly expressed in adipose tissue affect the distribution and function of fat and thus contribute to obesity. Using a stratified transcriptome gene enrichment approach we attempted to identify adipose tissue-specific obesity genes in the unique polygenic Fat (F) mouse strain generated by selective breeding over 60 generations for divergent adiposity from a comparator Lean (L) strain. To enrich for adipose tissue obesity genes a 'snap-shot' pooled-sample transcriptome comparison of key fat depots and non adipose tissues (muscle, liver, kidney) was performed. Known obesity quantitative trait loci (QTL) information for the model allowed us to further filter genes for increased likelihood of being causal or secondary for obesity. This successfully identified several genes previously linked to obesity (C1qr1, and Np3r) as positional QTL candidate genes elevated specifically in F line adipose tissue. A number of novel obesity candidate genes were also identified (Thbs1, Ppp1r3d, Tmepai, Trp53inp2, Ttc7b, Tuba1a, Fgf13, Fmr) that have inferred roles in fat cell function. Quantitative microarray analysis was then applied to the most phenotypically divergent adipose depot after exaggerating F and L strain differences with chronic high fat feeding which revealed a distinct gene expression profile of line, fat depot and diet-responsive inflammatory, angiogenic and metabolic pathways. Selected candidate genes Npr3 and Thbs1, as well as Gys2, a non-QTL gene that otherwise passed our enrichment criteria were characterised, revealing novel functional effects consistent with a contribution to obesity. A focussed candidate gene enrichment strategy in the unique F and L model has identified novel adipose tissue-enriched genes contributing to obesity.

The Functional Genetics of Handedness and Language Lateralization: Insights from Gene Ontology, Pathway and Disease Association Analyses.

PubMed

Schmitz, Judith; Lor, Stephanie; Klose, Rena; Güntürkün, Onur; Ocklenburg, Sebastian

2017-01-01

Handedness and language lateralization are partially determined by genetic influences. It has been estimated that at least 40 (and potentially more) possibly interacting genes may influence the ontogenesis of hemispheric asymmetries. Recently, it has been suggested that analyzing the genetics of hemispheric asymmetries on the level of gene ontology sets, rather than at the level of individual genes, might be more informative for understanding the underlying functional cascades. Here, we performed gene ontology, pathway and disease association analyses on genes that have previously been associated with handedness and language lateralization. Significant gene ontology sets for handedness were anatomical structure development, pattern specification (especially asymmetry formation) and biological regulation. Pathway analysis highlighted the importance of the TGF-beta signaling pathway for handedness ontogenesis. Significant gene ontology sets for language lateralization were responses to different stimuli, nervous system development, transport, signaling, and biological regulation. Despite the fact that some authors assume that handedness and language lateralization share a common ontogenetic basis, gene ontology sets barely overlap between phenotypes. Compared to genes involved in handedness, which mostly contribute to structural development, genes involved in language lateralization rather contribute to activity-dependent cognitive processes. Disease association analysis revealed associations of genes involved in handedness with diseases affecting the whole body, while genes involved in language lateralization were specifically engaged in mental and neurological diseases. These findings further support the idea that handedness and language lateralization are ontogenetically independent, complex phenotypes.

The Functional Genetics of Handedness and Language Lateralization: Insights from Gene Ontology, Pathway and Disease Association Analyses

PubMed Central

Schmitz, Judith; Lor, Stephanie; Klose, Rena; Güntürkün, Onur; Ocklenburg, Sebastian

2017-01-01

Handedness and language lateralization are partially determined by genetic influences. It has been estimated that at least 40 (and potentially more) possibly interacting genes may influence the ontogenesis of hemispheric asymmetries. Recently, it has been suggested that analyzing the genetics of hemispheric asymmetries on the level of gene ontology sets, rather than at the level of individual genes, might be more informative for understanding the underlying functional cascades. Here, we performed gene ontology, pathway and disease association analyses on genes that have previously been associated with handedness and language lateralization. Significant gene ontology sets for handedness were anatomical structure development, pattern specification (especially asymmetry formation) and biological regulation. Pathway analysis highlighted the importance of the TGF-beta signaling pathway for handedness ontogenesis. Significant gene ontology sets for language lateralization were responses to different stimuli, nervous system development, transport, signaling, and biological regulation. Despite the fact that some authors assume that handedness and language lateralization share a common ontogenetic basis, gene ontology sets barely overlap between phenotypes. Compared to genes involved in handedness, which mostly contribute to structural development, genes involved in language lateralization rather contribute to activity-dependent cognitive processes. Disease association analysis revealed associations of genes involved in handedness with diseases affecting the whole body, while genes involved in language lateralization were specifically engaged in mental and neurological diseases. These findings further support the idea that handedness and language lateralization are ontogenetically independent, complex phenotypes. PMID:28729848

Multilevel regulation of gene expression by microRNAs.

PubMed

Makeyev, Eugene V; Maniatis, Tom

2008-03-28

MicroRNAs (miRNAs) are approximately 22-nucleotide-long noncoding RNAs that normally function by suppressing translation and destabilizing messenger RNAs bearing complementary target sequences. Some miRNAs are expressed in a cell- or tissue-specific manner and may contribute to the establishment and/or maintenance of cellular identity. Recent studies indicate that tissue-specific miRNAs may function at multiple hierarchical levels of gene regulatory networks, from targeting hundreds of effector genes incompatible with the differentiated state to controlling the levels of global regulators of transcription and alternative pre-mRNA splicing. This multilevel regulation may allow individual miRNAs to profoundly affect the gene expression program of differentiated cells.

Cross-Species Transcriptome Profiling Identifies New Alveolar Epithelial Type I Cell–Specific Genes

PubMed Central

Sunohara, Mitsuhiro; Pouldar, Tiffany M.; Wang, Hongjun; Liu, Yixin; Rieger, Megan E.; Tran, Evelyn; Flodby, Per; Siegmund, Kimberly D.; Crandall, Edward D.; Laird-Offringa, Ite A.

2017-01-01

Diseases involving the distal lung alveolar epithelium include chronic obstructive pulmonary disease, idiopathic pulmonary fibrosis, and lung adenocarcinoma. Accurate labeling of specific cell types is critical for determining the contribution of each to the pathogenesis of these diseases. The distal lung alveolar epithelium is composed of two cell types, alveolar epithelial type 1 (AT1) and type 2 (AT2) cells. Although cell type–specific markers, most prominently surfactant protein C, have allowed detailed lineage tracing studies of AT2 cell differentiation and the cells’ roles in disease, studies of AT1 cells have been hampered by a lack of genes with expression unique to AT1 cells. In this study, we performed genome-wide expression profiling of multiple rat organs together with purified rat AT2, AT1, and in vitro differentiated AT1-like cells, resulting in the identification of 54 candidate AT1 cell markers. Cross-referencing with genes up-regulated in human in vitro differentiated AT1-like cells narrowed the potential list to 18 candidate genes. Testing the top four candidate genes at RNA and protein levels revealed GRAM domain 2 (GRAMD2), a protein of unknown function, as highly specific to AT1 cells. RNA sequencing (RNAseq) confirmed that GRAMD2 is transcriptionally silent in human AT2 cells. Immunofluorescence verified that GRAMD2 expression is restricted to the plasma membrane of AT1 cells and is not expressed in bronchial epithelial cells, whereas reverse transcription–polymerase chain reaction confirmed that it is not expressed in endothelial cells. Using GRAMD2 as a new AT1 cell–specific gene will enhance AT1 cell isolation, the investigation of alveolar epithelial cell differentiation potential, and the contribution of AT1 cells to distal lung diseases. PMID:27749084

Identification of Regulatory DNA Elements Using Genome-wide Mapping of DNase I Hypersensitive Sites during Tomato Fruit Development.

PubMed

Qiu, Zhengkun; Li, Ren; Zhang, Shuaibin; Wang, Ketao; Xu, Meng; Li, Jiayang; Du, Yongchen; Yu, Hong; Cui, Xia

2016-08-01

Development and ripening of tomato fruit are precisely controlled by transcriptional regulation, which depends on the orchestrated accessibility of regulatory proteins to promoters and other cis-regulatory DNA elements. This accessibility and its effect on gene expression play a major role in defining the developmental process. To understand the regulatory mechanism and functional elements modulating morphological and anatomical changes during fruit development, we generated genome-wide high-resolution maps of DNase I hypersensitive sites (DHSs) from the fruit tissues of the tomato cultivar "Moneymaker" at 20 days post anthesis as well as break stage. By exploring variation of DHSs across fruit development stages, we pinpointed the most likely hypersensitive sites related to development-specific genes. By detecting binding motifs on DHSs of these development-specific genes or genes in the ascorbic acid biosynthetic pathway, we revealed the common regulatory elements contributing to coordinating gene transcription of plant ripening and specialized metabolic pathways. Our results contribute to a better understanding of the regulatory dynamics of genes involved in tomato fruit development and ripening. Copyright © 2016 The Author. Published by Elsevier Inc. All rights reserved.

The evolution of resistance genes in multi-protein plant resistance systems.

PubMed

Friedman, Aaron R; Baker, Barbara J

2007-12-01

The genomic perspective aids in integrating the analysis of single resistance (R-) genes into a higher order model of complex plant resistance systems. The majority of R-genes encode a class of proteins with nucleotide binding (NB) and leucine-rich repeat (LRR) domains. Several R-proteins act in multi-protein R-complexes that mediate interaction with pathogen effectors to induce resistance signaling. The complexity of these systems seems to have resulted from multiple rounds of plant-pathogen co-evolution. R-gene evolution is thought to be facilitated by the formation of R-gene clusters, which permit sequence exchanges via recombinatorial mispairing and generate high haplotypic diversity. This pattern of evolution may also generate diversity at other loci that contribute to the R-complex. The rate of recombination at R-clusters is not necessarily homogeneous or consistent over evolutionary time: recent evidence suggests that recombination at R-clusters is increased following pathogen infection, suggesting a mechanism that induces temporary genome instability in response to extreme stress. DNA methylation and chromatin modifications may allow this instability to be conditionally regulated and targeted to specific genome regions. Knowledge of natural R-gene evolution may contribute to strategies for artificial evolution of novel resistance specificities.

Variants in the dopamine-4-receptor gene promoter are not associated with sensation seeking in skiers.

PubMed

Thomson, Cynthia J; Rajala, Amelia K; Carlson, Scott R; Rupert, Jim L

2014-01-01

Sensation seeking is a personality trait that has been associated with disinhibited behaviours including substance use and gambling, but also with high-risk sport practices including skydiving, paragliding, and downhill skiing. Twin studies have shown that sensation seeking is moderately heritable, and candidate genes encoding components involved in dopaminergic transmission have been investigated as contributing to this type of behaviour. To determine whether variants in the regulatory regions of the dopamine-4-receptor gene (DRD4) influenced sport-specific sensation seeking, we analyzed five polymorphisms (-1106T/C, -906T/C, -809G/A, -291C/T, 120-bp duplication) in the promoter region of the gene in a cohort of skiers and snowboarders (n = 599) that represented a broad range of sensation seeking behaviours. We grouped subjects by genotype at each of the five loci and compared impulsive sensation seeking and domain-specific (skiing) sensation seeking between groups. There were no significant associations between genotype(s) and general or domain-specific sensation seeking in the skiers and snowboarders, suggesting that while DRD4 has previously been implicated in sensation seeking, the promoter variants investigated in this study do not contribute to sensation seeking in this athlete population.

Inheritance of partial resistance against Colletotrichum lindemuthianum in Phaseolus vulgaris and co-localization of quantitative trait loci with genes involved in specific resistance.

PubMed

Geffroy, V; Sévignac, M; De Oliveira, J C; Fouilloux, G; Skroch, P; Thoquet, P; Gepts, P; Langin, T; Dron, M

2000-03-01

Anthracnose, one of the most important diseases of common bean (Phaseolus vulgaris), is caused by the fungus Colletotrichum lindemuthianum. A "candidate gene" approach was used to map anthracnose resistance quantitative trait loci (QTL). Candidate genes included genes for both pathogen recognition (resistance genes and resistance gene analogs [RGAs]) and general plant defense (defense response genes). Two strains of C. lindemuthianum, identified in a world collection of 177 strains, displayed a reproducible and differential aggressiveness toward BAT93 and JaloEEP558, two parental lines of P. vulgaris representing the two major gene pools of this crop. A reliable test was developed to score partial resistance in aerial organs of the plant (stem, leaf, petiole) under controlled growth chamber conditions. BAT93 was more resistant than JaloEEP558 regardless of the organ or strain tested. With a recombinant inbred line (RIL) population derived from a cross between these two parental lines, 10 QTL were located on a genetic map harboring 143 markers, including known defense response genes, anthracnose-specific resistance genes, and RGAs. Eight of the QTL displayed isolate specificity. Two were co-localized with known defense genes (phenylalanine ammonia-lyase and hydroxyproline-rich glycoprotein) and three with anthracnose-specific resistance genes and/or RGAs. Interestingly, two QTL, with different allelic contribution, mapped on linkage group B4 in a 5.0 cM interval containing Andean and Mesoamerican specific resistance genes against C. lindemuthianum and 11 polymorphic fragments revealed with a RGA probe. The possible relationship between genes underlying specific and partial resistance is discussed.

Toxoplasmosis and Polygenic Disease Susceptibility Genes: Extensive Toxoplasma gondii Host/Pathogen Interactome Enrichment in Nine Psychiatric or Neurological Disorders.

PubMed

Carter, C J

2013-01-01

Toxoplasma gondii is not only implicated in schizophrenia and related disorders, but also in Alzheimer's or Parkinson's disease, cancer, cardiac myopathies, and autoimmune disorders. During its life cycle, the pathogen interacts with ~3000 host genes or proteins. Susceptibility genes for multiple sclerosis, Alzheimer's disease, schizophrenia, bipolar disorder, depression, childhood obesity, Parkinson's disease, attention deficit hyperactivity disorder (P  from  8.01E - 05  (ADHD)  to  1.22E - 71) (multiple sclerosis), and autism (P = 0.013), but not anorexia or chronic fatigue are highly enriched in the human arm of this interactome and 18 (ADHD) to 33% (MS) of the susceptibility genes relate to it. The signalling pathways involved in the susceptibility gene/interactome overlaps are relatively specific and relevant to each disease suggesting a means whereby susceptibility genes could orient the attentions of a single pathogen towards disruption of the specific pathways that together contribute (positively or negatively) to the endophenotypes of different diseases. Conditional protein knockdown, orchestrated by T. gondii proteins or antibodies binding to those of the host (pathogen derived autoimmunity) and metabolite exchange, may contribute to this disruption. Susceptibility genes may thus be related to the causes and influencers of disease, rather than (and as well as) to the disease itself.

Epigenetics of the myotonic dystrophy-associated DMPK gene neighborhood

PubMed Central

Buckley, Lauren; Lacey, Michelle; Ehrlich, Melanie

2016-01-01

Aim: Identify epigenetic marks in the vicinity of DMPK (linked to myotonic dystrophy, DM1) that help explain tissue-specific differences in its expression. Materials & methods: At DMPK and its flanking genes (DMWD, SIX5, BHMG1 and RSPH6A), we analyzed many epigenetic and transcription profiles from myoblasts, myotubes, skeletal muscle, heart and 30 nonmuscle samples. Results: In the DMPK gene neighborhood, muscle-associated DNA hypermethylation and hypomethylation, enhancer chromatin, and CTCF binding were seen. Myogenic DMPK hypermethylation correlated with high expression and decreased alternative promoter usage. Testis/sperm hypomethylation of BHMG1 and RSPH6A was associated with testis-specific expression. G-quadruplex (G4) motifs and sperm-specific hypomethylation were found near the DM1-linked CTG repeats within DMPK. Conclusion: Tissue-specific epigenetic features in DMPK and neighboring genes help regulate its expression. G4 motifs in DMPK DNA and RNA might contribute to DM1 pathology. PMID:26756355

Sex-specific mouse liver gene expression: genome-wide analysis of developmental changes from pre-pubertal period to young adulthood

PubMed Central

2012-01-01

Background Early liver development and the transcriptional transitions during hepatogenesis are well characterized. However, gene expression changes during the late postnatal/pre-pubertal to young adulthood period are less well understood, especially with regards to sex-specific gene expression. Methods Microarray analysis of male and female mouse liver was carried out at 3, 4, and 8 wk of age to elucidate developmental changes in gene expression from the late postnatal/pre-pubertal period to young adulthood. Results A large number of sex-biased and sex-independent genes showed significant changes during this developmental period. Notably, sex-independent genes involved in cell cycle, chromosome condensation, and DNA replication were down regulated from 3 wk to 8 wk, while genes associated with metal ion binding, ion transport and kinase activity were up regulated. A majority of genes showing sex differential expression in adult liver did not display sex differences prior to puberty, at which time extensive changes in sex-specific gene expression were seen, primarily in males. Thus, in male liver, 76% of male-specific genes were up regulated and 47% of female-specific genes were down regulated from 3 to 8 wk of age, whereas in female liver 67% of sex-specific genes showed no significant change in expression. In both sexes, genes up regulated from 3 to 8 wk were significantly enriched (p < E-76) in the set of genes positively regulated by the liver transcription factor HNF4α, as determined in a liver-specific HNF4α knockout mouse model, while genes down regulated during this developmental period showed significant enrichment (p < E-65) for negative regulation by HNF4α. Significant enrichment of the developmentally regulated genes in the set of genes subject to positive and negative regulation by pituitary hormone was also observed. Five sex-specific transcriptional regulators showed sex-specific expression at 4 wk (male-specific Ihh; female-specific Cdx4, Cux2, Tox, and Trim24) and may contribute to the developmental changes that lead to global acquisition of liver sex-specificity by 8 wk of age. Conclusions Overall, the observed changes in gene expression during postnatal liver development reflect the deceleration of liver growth and the induction of specialized liver functions, with widespread changes in sex-specific gene expression primarily occurring in male liver. PMID:22475005

Osmotic regulation of gene action.

PubMed

Douzou, P

1994-03-01

Most reactions involved in gene translation systems are ionic-dependent and may be explained in electrostatic terms. However, a number of observations of equilibria and rate processes making up the overall reactions clearly indicate that there is still an enormous gap between the rough picture of the mechanism of ionic regulation and the detailed behavior of reactions at the molecular level that hold the key to specific mechanisms. The present paper deals with possible osmotic contributions arising from the gel state of gene systems that are complementary to, and interdependent of, electrostatic contributions. This treatment, although still oversimplified, explains many previous observations by relating them to a general osmotic mechanism and suggests experimental approaches to studying the mechanisms of gene regulation in organelle-free and intact systems.

What Can We Learn from Studying Twins?: Exploring Genetic and Environmental Contributions to Human Development

ERIC Educational Resources Information Center

Powers, Stefanie

2006-01-01

Twin research has a long history and plays a central role in the ongoing exploration of the influence of genes and the environment on human development. Recent advances in molecular biology and the ability to identify the role of specific genes in human development raise new questions about how genes and the environment influence behavior. At the…

Identification of a novel Gig2 gene family specific to non-amniote vertebrates.

PubMed

Zhang, Yi-Bing; Liu, Ting-Kai; Jiang, Jun; Shi, Jun; Liu, Ying; Li, Shun; Gui, Jian-Fang

2013-01-01

Gig2 (grass carp reovirus (GCRV)-induced gene 2) is first identified as a novel fish interferon (IFN)-stimulated gene (ISG). Overexpression of a zebrafish Gig2 gene can protect cultured fish cells from virus infection. In the present study, we identify a novel gene family that is comprised of genes homologous to the previously characterized Gig2. EST/GSS search and in silico cloning identify 190 Gig2 homologous genes in 51 vertebrate species ranged from lampreys to amphibians. Further large-scale search of vertebrate and invertebrate genome databases indicate that Gig2 gene family is specific to non-amniotes including lampreys, sharks/rays, ray-finned fishes and amphibians. Phylogenetic analysis and synteny analysis reveal lineage-specific expansion of Gig2 gene family and also provide valuable evidence for the fish-specific genome duplication (FSGD) hypothesis. Although Gig2 family proteins exhibit no significant sequence similarity to any known proteins, a typical Gig2 protein appears to consist of two conserved parts: an N-terminus that bears very low homology to the catalytic domains of poly(ADP-ribose) polymerases (PARPs), and a novel C-terminal domain that is unique to this gene family. Expression profiling of zebrafish Gig2 family genes shows that some duplicate pairs have diverged in function via acquisition of novel spatial and/or temporal expression under stresses. The specificity of this gene family to non-amniotes might contribute to a large extent to distinct physiology in non-amniote vertebrates.

Drosophila CLOCK target gene characterization: implications for circadian tissue-specific gene expression

PubMed Central

Abruzzi, Katharine Compton; Rodriguez, Joseph; Menet, Jerome S.; Desrochers, Jennifer; Zadina, Abigail; Luo, Weifei; Tkachev, Sasha; Rosbash, Michael

2011-01-01

CLOCK (CLK) is a master transcriptional regulator of the circadian clock in Drosophila. To identify CLK direct target genes and address circadian transcriptional regulation in Drosophila, we performed chromatin immunoprecipitation (ChIP) tiling array assays (ChIP–chip) with a number of circadian proteins. CLK binding cycles on at least 800 sites with maximal binding in the early night. The CLK partner protein CYCLE (CYC) is on most of these sites. The CLK/CYC heterodimer is joined 4–6 h later by the transcriptional repressor PERIOD (PER), indicating that the majority of CLK targets are regulated similarly to core circadian genes. About 30% of target genes also show cycling RNA polymerase II (Pol II) binding. Many of these generate cycling RNAs despite not being documented in prior RNA cycling studies. This is due in part to different RNA isoforms and to fly head tissue heterogeneity. CLK has specific targets in different tissues, implying that important CLK partner proteins and/or mechanisms contribute to gene-specific and tissue-specific regulation. PMID:22085964

Molecular evolution of candidate male reproductive genes in the brown algal model Ectocarpus.

PubMed

Lipinska, Agnieszka P; Van Damme, Els J M; De Clerck, Olivier

2016-01-05

Evolutionary studies of genes that mediate recognition between sperm and egg contribute to our understanding of reproductive isolation and speciation. Surface receptors involved in fertilization are targets of sexual selection, reinforcement, and other evolutionary forces including positive selection. This observation was made across different lineages of the eukaryotic tree from land plants to mammals, and is particularly evident in free-spawning animals. Here we use the brown algal model species Ectocarpus (Phaeophyceae) to investigate the evolution of candidate gamete recognition proteins in a distant major phylogenetic group of eukaryotes. Male gamete specific genes were identified by comparing transcriptome data covering different stages of the Ectocarpus life cycle and screened for characteristics expected from gamete recognition receptors. Selected genes were sequenced in a representative number of strains from distant geographical locations and varying stages of reproductive isolation, to search for signatures of adaptive evolution. One of the genes (Esi0130_0068) showed evidence of selective pressure. Interestingly, that gene displayed domain similarities to the receptor for egg jelly (REJ) protein involved in sperm-egg recognition in sea urchins. We have identified a male gamete specific gene with similarity to known gamete recognition receptors and signatures of adaptation. Altogether, this gene could contribute to gamete interaction during reproduction as well as reproductive isolation in Ectocarpus and is therefore a good candidate for further functional evaluation.

Genetics of Vitiligo

PubMed Central

Spritz, Richard; Andersen, Genevieve

2016-01-01

Synopsis Vitiligo is “complex disorder” (also termed polygenic and multifactorial), reflecting simultaneous contributions of multiple genetic risk factors and environmental triggers. Large-scale genome-wide association studies, principally in European-derived whites and in Chinese, have discovered approximately 50 different genetic loci that contribute to vitiligo risk, some of which also contribute to other autoimmune diseases that are epidemiologically associated with vitiligo. At many of these vitiligo susceptibility loci the corresponding relevant genes have now been identified, and for some of these genes the specific DNA sequence variants that contribute to vitiligo risk are also now known. A large fraction of these genes encode proteins involved in immune regulation, a number of others play roles in cellular apoptosis, and still others are involved in regulating functions of melanocytes. For this last group, there appears to be an opposite relationship between susceptibility to vitiligo and susceptibility to melanoma, suggesting that vitiligo may engage a normal mechanism of immune surveillance for melanoma. While many of the specific biologic mechanisms through which these genetic factors operate to cause vitiligo remain to be elucidated, it is now clear that vitiligo is an autoimmune disease involving a complex relationship between programming and function of the immune system, aspects of the melanocyte autoimmune target, and dysregulation of the immune response. PMID:28317533

Scientific Goals of the Human Genome Project.

ERIC Educational Resources Information Center

Wills, Christopher

1993-01-01

The Human Genome Project, an effort to sequence all the DNA of a human cell, is needed to better understand the behavior of chromosomes during cell division, with the ultimate goal of understanding the specific genes contributing to specific diseases and disabilities. (MSE)

Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children.

PubMed

Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A

2015-10-01

The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.

Association of sequence variations in vitamin K epoxide reductase and gamma-glutamyl carboxylas genes with biochemical measures of vitamin K status

USDA-ARS?s Scientific Manuscript database

Genetic factors, specifically the VKORC1 and GGCX genes, have been shown to contribute to the interindividual variability in response to the vitamin K-antagonist, warfarin, which influences the dose required to achieve the desired anticoagulation response. These differences in warfarin sensitivity ...

Restricted VH gene usage and generation of antibody diversity in rabbit.

PubMed

Knight, K L

1992-01-01

The presence of VHa allotypic specificities on nearly all rabbit Ig molecules has perplexed immunologists for many years. How could these allotypic specificities be inherited as if controlled by alleles if the germline has hundreds of VHa allotype-encoding genes and if most of these genes are used in VDJ gene rearrangements. I review recent data indicating that the allelic inheritance of the VHa allotypes can be explained by preferential utilization of the D-proximal VH gene VH1 in VDJ gene rearrangements. The preferential usage of one VH gene, however, limits the contribution of combinatorial joining of multiple VH, D and JH gene segments to the generation of antibody diversity. The roles of somatic gene conversion and somatic mutation in generating antibody diversity are discussed. Further, the limited usage of germline VH genes in normal, allotype-suppressed and the mutant Alicia rabbit as well as the molecular basis of latent allotypes and VH/CH recombinants is reviewed.

The evolution of Homo sapiens denisova and Homo sapiens neanderthalensis miRNA targeting genes in the prenatal and postnatal brain.

PubMed

Gunbin, Konstantin V; Afonnikov, Dmitry A; Kolchanov, Nikolay A; Derevianko, Anatoly P; Rogaev, Eugeny I

2015-01-01

As the evolution of miRNA genes has been found to be one of the important factors in formation of the modern type of man, we performed a comparative analysis of the evolution of miRNA genes in two archaic hominines, Homo sapiens neanderthalensis and Homo sapiens denisova, and elucidated the expression of their target mRNAs in bain. A comparative analysis of the genomes of primates, including species in the genus Homo, identified a group of miRNA genes having fixed substitutions with important implications for the evolution of Homo sapiens neanderthalensis and Homo sapiens denisova. The mRNAs targeted by miRNAs with mutations specific for Homo sapiens denisova exhibited enhanced expression during postnatal brain development in modern humans. By contrast, the expression of mRNAs targeted by miRNAs bearing variations specific for Homo sapiens neanderthalensis was shown to be enhanced in prenatal brain development. Our results highlight the importance of changes in miRNA gene sequences in the course of Homo sapiens denisova and Homo sapiens neanderthalensis evolution. The genetic alterations of miRNAs regulating the spatiotemporal expression of multiple genes in the prenatal and postnatal brain may contribute to the progressive evolution of brain function, which is consistent with the observations of fine technical and typological properties of tools and decorative items reported from archaeological Denisovan sites. The data also suggest that differential spatial-temporal regulation of gene products promoted by the subspecies-specific mutations in the miRNA genes might have occurred in the brains of Homo sapiens denisova and Homo sapiens neanderthalensis, potentially contributing to the cultural differences between these two archaic hominines.

The evolution of Homo sapiens denisova and Homo sapiens neanderthalensis miRNA targeting genes in the prenatal and postnatal brain

PubMed Central

2015-01-01

Background As the evolution of miRNA genes has been found to be one of the important factors in formation of the modern type of man, we performed a comparative analysis of the evolution of miRNA genes in two archaic hominines, Homo sapiens neanderthalensis and Homo sapiens denisova, and elucidated the expression of their target mRNAs in bain. Results A comparative analysis of the genomes of primates, including species in the genus Homo, identified a group of miRNA genes having fixed substitutions with important implications for the evolution of Homo sapiens neanderthalensis and Homo sapiens denisova. The mRNAs targeted by miRNAs with mutations specific for Homo sapiens denisova exhibited enhanced expression during postnatal brain development in modern humans. By contrast, the expression of mRNAs targeted by miRNAs bearing variations specific for Homo sapiens neanderthalensis was shown to be enhanced in prenatal brain development. Conclusions Our results highlight the importance of changes in miRNA gene sequences in the course of Homo sapiens denisova and Homo sapiens neanderthalensis evolution. The genetic alterations of miRNAs regulating the spatiotemporal expression of multiple genes in the prenatal and postnatal brain may contribute to the progressive evolution of brain function, which is consistent with the observations of fine technical and typological properties of tools and decorative items reported from archaeological Denisovan sites. The data also suggest that differential spatial-temporal regulation of gene products promoted by the subspecies-specific mutations in the miRNA genes might have occurred in the brains of Homo sapiens denisova and Homo sapiens neanderthalensis, potentially contributing to the cultural differences between these two archaic hominines. PMID:26693966

Muscle-specific gene expression is underscored by differential stressor responses and coexpression changes.

PubMed

Moreno-Sánchez, Natalia; Rueda, Julia; Reverter, Antonio; Carabaño, María Jesús; Díaz, Clara

2012-03-01

Variations on the transcriptome from one skeletal muscle type to another still remain unknown. The reliable identification of stable gene coexpression networks is essential to unravel gene functions and define biological processes. The differential expression of two distinct muscles, M. flexor digitorum (FD) and M. psoas major (PM), was studied using microarrays in cattle to illustrate muscle-specific transcription patterns and to quantify changes in connectivity regarding the expected gene coexpression pattern. A total of 206 genes were differentially expressed (DE), 94 upregulated in PM and 112 in FD. The distribution of DE genes in pathways and biological functions was explored in the context of system biology. Global interactomes for genes of interest were predicted. Fast/slow twitch genes, genes coding for extracellular matrix, ribosomal and heat shock proteins, and fatty acid uptake centred the specific gene expression patterns per muscle. Genes involved in repairing mechanisms, such as ribosomal and heat shock proteins, suggested a differential ability of muscles to react to similar stressing factors, acting preferentially in slow twitch muscles. Muscle attributes do not seem to be completely explained by the muscle fibre composition. Changes in connectivity accounted for 24% of significant correlations between DE genes. Genes changing their connectivity mostly seem to contribute to the main differential attributes that characterize each specific muscle type. These results underscore the unique flexibility of skeletal muscle where a substantial set of genes are able to change their behavior depending on the circumstances.

Variants in the Dopamine-4-Receptor Gene Promoter Are Not Associated with Sensation Seeking in Skiers

PubMed Central

Thomson, Cynthia J.; Rajala, Amelia K.; Carlson, Scott R.; Rupert, Jim L.

2014-01-01

Sensation seeking is a personality trait that has been associated with disinhibited behaviours including substance use and gambling, but also with high-risk sport practices including skydiving, paragliding, and downhill skiing. Twin studies have shown that sensation seeking is moderately heritable, and candidate genes encoding components involved in dopaminergic transmission have been investigated as contributing to this type of behaviour. To determine whether variants in the regulatory regions of the dopamine-4-receptor gene (DRD4) influenced sport-specific sensation seeking, we analyzed five polymorphisms (−1106T/C, −906T/C, −809G/A, −291C/T, 120-bp duplication) in the promoter region of the gene in a cohort of skiers and snowboarders (n = 599) that represented a broad range of sensation seeking behaviours. We grouped subjects by genotype at each of the five loci and compared impulsive sensation seeking and domain-specific (skiing) sensation seeking between groups. There were no significant associations between genotype(s) and general or domain-specific sensation seeking in the skiers and snowboarders, suggesting that while DRD4 has previously been implicated in sensation seeking, the promoter variants investigated in this study do not contribute to sensation seeking in this athlete population. PMID:24691022

A High-Throughput Data Mining of Single Nucleotide Polymorphisms in Coffea Species Expressed Sequence Tags Suggests Differential Homeologous Gene Expression in the Allotetraploid Coffea arabica1[W

PubMed Central

Vidal, Ramon Oliveira; Mondego, Jorge Maurício Costa; Pot, David; Ambrósio, Alinne Batista; Andrade, Alan Carvalho; Pereira, Luiz Filipe Protasio; Colombo, Carlos Augusto; Vieira, Luiz Gonzaga Esteves; Carazzolle, Marcelo Falsarella; Pereira, Gonçalo Amarante Guimarães

2010-01-01

Polyploidization constitutes a common mode of evolution in flowering plants. This event provides the raw material for the divergence of function in homeologous genes, leading to phenotypic novelty that can contribute to the success of polyploids in nature or their selection for use in agriculture. Mounting evidence underlined the existence of homeologous expression biases in polyploid genomes; however, strategies to analyze such transcriptome regulation remained scarce. Important factors regarding homeologous expression biases remain to be explored, such as whether this phenomenon influences specific genes, how paralogs are affected by genome doubling, and what is the importance of the variability of homeologous expression bias to genotype differences. This study reports the expressed sequence tag assembly of the allopolyploid Coffea arabica and one of its direct ancestors, Coffea canephora. The assembly was used for the discovery of single nucleotide polymorphisms through the identification of high-quality discrepancies in overlapped expressed sequence tags and for gene expression information indirectly estimated by the transcript redundancy. Sequence diversity profiles were evaluated within C. arabica (Ca) and C. canephora (Cc) and used to deduce the transcript contribution of the Coffea eugenioides (Ce) ancestor. The assignment of the C. arabica haplotypes to the C. canephora (CaCc) or C. eugenioides (CaCe) ancestral genomes allowed us to analyze gene expression contributions of each subgenome in C. arabica. In silico data were validated by the quantitative polymerase chain reaction and allele-specific combination TaqMAMA-based method. The presence of differential expression of C. arabica homeologous genes and its implications in coffee gene expression, ontology, and physiology are discussed. PMID:20864545

Diverse Cis-Regulatory Mechanisms Contribute to Expression Evolution of Tandem Gene Duplicates

PubMed Central

Baudouin-Gonzalez, Luís; Santos, Marília A; Tempesta, Camille; Sucena, Élio; Roch, Fernando; Tanaka, Kohtaro

2017-01-01

Abstract Pairs of duplicated genes generally display a combination of conserved expression patterns inherited from their unduplicated ancestor and newly acquired domains. However, how the cis-regulatory architecture of duplicated loci evolves to produce these expression patterns is poorly understood. We have directly examined the gene-regulatory evolution of two tandem duplicates, the Drosophila Ly6 genes CG9336 and CG9338, which arose at the base of the drosophilids between 40 and 60 Ma. Comparing the expression patterns of the two paralogs in four Drosophila species with that of the unduplicated ortholog in the tephritid Ceratitis capitata, we show that they diverged from each other as well as from the unduplicated ortholog. Moreover, the expression divergence appears to have occurred close to the duplication event and also more recently in a lineage-specific manner. The comparison of the tissue-specific cis-regulatory modules (CRMs) controlling the paralog expression in the four Drosophila species indicates that diverse cis-regulatory mechanisms, including the novel tissue-specific enhancers, differential inactivation, and enhancer sharing, contributed to the expression evolution. Our analysis also reveals a surprisingly variable cis-regulatory architecture, in which the CRMs driving conserved expression domains change in number, location, and specificity. Altogether, this study provides a detailed historical account that uncovers a highly dynamic picture of how the paralog expression patterns and their underlying cis-regulatory landscape evolve. We argue that our findings will encourage studying cis-regulatory evolution at the whole-locus level to understand how interactions between enhancers and other regulatory levels shape the evolution of gene expression. PMID:28961967

Extensive female-mediated gene flow and low phylogeography among seventeen goat breeds in southwest China.

PubMed

Zhao, Wei; Zhong, Tao; Wang, Lin Jie; Li, Li; Zhang, Hong Ping

2014-08-01

Indigenous Chinese goat mtDNA is highly diverse but lacks geographic specificity; however, whether gene flow or gene exchange contributed to this remains unknown. We reanalyzed a consensus fragment of 481 bp in the D-loop region from 339 individuals. The network and neighbor-joining tree revealed three divergent maternal haplogroups (A, B1, and B2) in 17 local breeds. Although high polymorphism resulting in 198 different haplotypes was observed (h = 0.984 ± 0.002; π = 0.0336 ± 0.0008), neither the distribution of haplotypes nor PCA analysis revealed any obvious geographic structure in the local breeds. Extensive gene flow was widely detected among breeds from southwest China. High levels of gene exchange were detected between Qianbei Brown goats and the other breeds, indicating either more contribution or introgression to their gene pools. This study will be helpful in understanding the phylogeography and gene flow among the goat breeds of southwest China.

Partial least squares based identification of Duchenne muscular dystrophy specific genes.

PubMed

An, Hui-bo; Zheng, Hua-cheng; Zhang, Li; Ma, Lin; Liu, Zheng-yan

2013-11-01

Large-scale parallel gene expression analysis has provided a greater ease for investigating the underlying mechanisms of Duchenne muscular dystrophy (DMD). Previous studies typically implemented variance/regression analysis, which would be fundamentally flawed when unaccounted sources of variability in the arrays existed. Here we aim to identify genes that contribute to the pathology of DMD using partial least squares (PLS) based analysis. We carried out PLS-based analysis with two datasets downloaded from the Gene Expression Omnibus (GEO) database to identify genes contributing to the pathology of DMD. Except for the genes related to inflammation, muscle regeneration and extracellular matrix (ECM) modeling, we found some genes with high fold change, which have not been identified by previous studies, such as SRPX, GPNMB, SAT1, and LYZ. In addition, downregulation of the fatty acid metabolism pathway was found, which may be related to the progressive muscle wasting process. Our results provide a better understanding for the downstream mechanisms of DMD.

Wild tobacco genomes reveal the evolution of nicotine biosynthesis.

PubMed

Xu, Shuqing; Brockmöller, Thomas; Navarro-Quezada, Aura; Kuhl, Heiner; Gase, Klaus; Ling, Zhihao; Zhou, Wenwu; Kreitzer, Christoph; Stanke, Mario; Tang, Haibao; Lyons, Eric; Pandey, Priyanka; Pandey, Shree P; Timmermann, Bernd; Gaquerel, Emmanuel; Baldwin, Ian T

2017-06-06

Nicotine, the signature alkaloid of Nicotiana species responsible for the addictive properties of human tobacco smoking, functions as a defensive neurotoxin against attacking herbivores. However, the evolution of the genetic features that contributed to the assembly of the nicotine biosynthetic pathway remains unknown. We sequenced and assembled genomes of two wild tobaccos, Nicotiana attenuata (2.5 Gb) and Nicotiana obtusifolia (1.5 Gb), two ecological models for investigating adaptive traits in nature. We show that after the Solanaceae whole-genome triplication event, a repertoire of rapidly expanding transposable elements (TEs) bloated these Nicotiana genomes, promoted expression divergences among duplicated genes, and contributed to the evolution of herbivory-induced signaling and defenses, including nicotine biosynthesis. The biosynthetic machinery that allows for nicotine synthesis in the roots evolved from the stepwise duplications of two ancient primary metabolic pathways: the polyamine and nicotinamide adenine dinucleotide (NAD) pathways. In contrast to the duplication of the polyamine pathway that is shared among several solanaceous genera producing polyamine-derived tropane alkaloids, we found that lineage-specific duplications within the NAD pathway and the evolution of root-specific expression of the duplicated Solanaceae-specific ethylene response factor that activates the expression of all nicotine biosynthetic genes resulted in the innovative and efficient production of nicotine in the genus Nicotiana Transcription factor binding motifs derived from TEs may have contributed to the coexpression of nicotine biosynthetic pathway genes and coordinated the metabolic flux. Together, these results provide evidence that TEs and gene duplications facilitated the emergence of a key metabolic innovation relevant to plant fitness.

Genome-wide analysis of the Dof transcription factor gene family reveals soybean-specific duplicable and functional characteristics.

PubMed

Guo, Yong; Qiu, Li-Juan

2013-01-01

The Dof domain protein family is a classic plant-specific zinc-finger transcription factor family involved in a variety of biological processes. There is great diversity in the number of Dof genes in different plants. However, there are only very limited reports on the characterization of Dof transcription factors in soybean (Glycine max). In the present study, 78 putative Dof genes were identified from the whole-genome sequence of soybean. The predicted GmDof genes were non-randomly distributed within and across 19 out of 20 chromosomes and 97.4% (38 pairs) were preferentially retained duplicate paralogous genes located in duplicated regions of the genome. Soybean-specific segmental duplications contributed significantly to the expansion of the soybean Dof gene family. These Dof proteins were phylogenetically clustered into nine distinct subgroups among which the gene structure and motif compositions were considerably conserved. Comparative phylogenetic analysis of these Dof proteins revealed four major groups, similar to those reported for Arabidopsis and rice. Most of the GmDofs showed specific expression patterns based on RNA-seq data analyses. The expression patterns of some duplicate genes were partially redundant while others showed functional diversity, suggesting the occurrence of sub-functionalization during subsequent evolution. Comprehensive expression profile analysis also provided insights into the soybean-specific functional divergence among members of the Dof gene family. Cis-regulatory element analysis of these GmDof genes suggested diverse functions associated with different processes. Taken together, our results provide useful information for the functional characterization of soybean Dof genes by combining phylogenetic analysis with global gene-expression profiling.

Transcriptional repression of epithelial cell adhesion molecule (EpCAM) contributes to p53 control of breast cancer invasion

PubMed Central

Sankpal, NV; Willman, MW; Fleming, TP; Mayfield, J; Gillanders, WE

2014-01-01

p53 is a tumor suppressor gene with well-characterized roles in cell cycle regulation, apoptosis and the maintenance of genome stability. Recent evidence suggests that p53 may also contribute to the regulation of migration and invasion. Epithelial cell adhesion molecule (EpCAM) is a transmembrane glycoprotein that is overexpressed in the majority of human epithelial carcinomas, including breast and colorectal carcinomas. We demonstrate by chromatin immunoprecipitation assays that p53 interacts with a candidate p53 binding site within the EpCAM gene. p53-mediated transcriptional repression of EpCAM was confirmed in gain-of-function, and loss-of-function experimental systems. Induction of wildtype p53 was associated with a significant dose-dependent decrease in EpCAM expression; conversely, specific ablation of p53 was associated with a significant increase in EpCAM expression. At the functional level, specific ablation of p53 expression is associated with increased breast cancer invasion, and this effect is abrogated by concomitant specific ablation of EpCAM expression. Taken together, these biochemical and functional data are the first demonstration that (1) wildtype p53 protein binds to a response element within the EpCAM gene and negatively regulates EpCAM expression, and (2) transcriptional repression of EpCAM contributes to p53 control of breast cancer invasion. PMID:19141643

Comparison of gene expression profiles between pansensitive and multidrug-resistant strains of Mycobacterium tuberculosis.

PubMed

Peñuelas-Urquides, K; González-Escalante, L; Villarreal-Treviño, L; Silva-Ramírez, B; Gutiérrez-Fuentes, D J; Mojica-Espinosa, R; Rangel-Escareño, C; Uribe-Figueroa, L; Molina-Salinas, G M; Dávila-Velderrain, J; Castorena-Torres, F; Bermúdez de León, M; Said-Fernández, S

2013-09-01

Mycobacterium tuberculosis has developed resistance to anti-tuberculosis first-line drugs. Multidrug-resistant strains complicate the control of tuberculosis and have converted it into a worldwide public health problem. Mutational studies of target genes have tried to envisage the resistance in clinical isolates; however, detection of these mutations in some cases is not sufficient to identify drug resistance, suggesting that other mechanisms are involved. Therefore, the identification of new markers of susceptibility or resistance to first-line drugs could contribute (1) to specifically diagnose the type of M. tuberculosis strain and prescribe an appropriate therapy, and (2) to elucidate the mechanisms of resistance in multidrug-resistant strains. In order to identify specific genes related to resistance in M. tuberculosis, we compared the gene expression profiles between the pansensitive H37Rv strain and a clinical CIBIN:UMF:15:99 multidrug-resistant isolate using microarray analysis. Quantitative real-time PCR confirmed that in the clinical multidrug-resistant isolate, the esxG, esxH, rpsA, esxI, and rpmI genes were upregulated, while the lipF, groES, and narG genes were downregulated. The modified genes could be involved in the mechanisms of resistance to first-line drugs in M. tuberculosis and could contribute to increased efficiency in molecular diagnosis approaches of infections with drug-resistant strains.

Dissociable contribution of prefrontal and striatal dopaminergic genes to learning in economic games

PubMed Central

Set, Eric; Saez, Ignacio; Zhu, Lusha; Houser, Daniel E.; Myung, Noah; Zhong, Songfa; Ebstein, Richard P.; Chew, Soo Hong; Hsu, Ming

2014-01-01

Game theory describes strategic interactions where success of players’ actions depends on those of coplayers. In humans, substantial progress has been made at the neural level in characterizing the dopaminergic and frontostriatal mechanisms mediating such behavior. Here we combined computational modeling of strategic learning with a pathway approach to characterize association of strategic behavior with variations in the dopamine pathway. Specifically, using gene-set analysis, we systematically examined contribution of different dopamine genes to variation in a multistrategy competitive game captured by (i) the degree players anticipate and respond to actions of others (belief learning) and (ii) the speed with which such adaptations take place (learning rate). We found that variation in genes that primarily regulate prefrontal dopamine clearance—catechol-O-methyl transferase (COMT) and two isoforms of monoamine oxidase—modulated degree of belief learning across individuals. In contrast, we did not find significant association for other genes in the dopamine pathway. Furthermore, variation in genes that primarily regulate striatal dopamine function—dopamine transporter and D2 receptors—was significantly associated with the learning rate. We found that this was also the case with COMT, but not for other dopaminergic genes. Together, these findings highlight dissociable roles of frontostriatal systems in strategic learning and support the notion that genetic variation, organized along specific pathways, forms an important source of variation in complex phenotypes such as strategic behavior. PMID:24979760

Dissociable contribution of prefrontal and striatal dopaminergic genes to learning in economic games.

PubMed

Set, Eric; Saez, Ignacio; Zhu, Lusha; Houser, Daniel E; Myung, Noah; Zhong, Songfa; Ebstein, Richard P; Chew, Soo Hong; Hsu, Ming

2014-07-01

Game theory describes strategic interactions where success of players' actions depends on those of coplayers. In humans, substantial progress has been made at the neural level in characterizing the dopaminergic and frontostriatal mechanisms mediating such behavior. Here we combined computational modeling of strategic learning with a pathway approach to characterize association of strategic behavior with variations in the dopamine pathway. Specifically, using gene-set analysis, we systematically examined contribution of different dopamine genes to variation in a multistrategy competitive game captured by (i) the degree players anticipate and respond to actions of others (belief learning) and (ii) the speed with which such adaptations take place (learning rate). We found that variation in genes that primarily regulate prefrontal dopamine clearance--catechol-O-methyl transferase (COMT) and two isoforms of monoamine oxidase--modulated degree of belief learning across individuals. In contrast, we did not find significant association for other genes in the dopamine pathway. Furthermore, variation in genes that primarily regulate striatal dopamine function--dopamine transporter and D2 receptors--was significantly associated with the learning rate. We found that this was also the case with COMT, but not for other dopaminergic genes. Together, these findings highlight dissociable roles of frontostriatal systems in strategic learning and support the notion that genetic variation, organized along specific pathways, forms an important source of variation in complex phenotypes such as strategic behavior.

Toxoplasmosis and Polygenic Disease Susceptibility Genes: Extensive Toxoplasma gondii Host/Pathogen Interactome Enrichment in Nine Psychiatric or Neurological Disorders

PubMed Central

Carter, C. J.

2013-01-01

Toxoplasma gondii is not only implicated in schizophrenia and related disorders, but also in Alzheimer's or Parkinson's disease, cancer, cardiac myopathies, and autoimmune disorders. During its life cycle, the pathogen interacts with ~3000 host genes or proteins. Susceptibility genes for multiple sclerosis, Alzheimer's disease, schizophrenia, bipolar disorder, depression, childhood obesity, Parkinson's disease, attention deficit hyperactivity disorder (P  from  8.01E − 05  (ADHD)  to  1.22E − 71) (multiple sclerosis), and autism (P = 0.013), but not anorexia or chronic fatigue are highly enriched in the human arm of this interactome and 18 (ADHD) to 33% (MS) of the susceptibility genes relate to it. The signalling pathways involved in the susceptibility gene/interactome overlaps are relatively specific and relevant to each disease suggesting a means whereby susceptibility genes could orient the attentions of a single pathogen towards disruption of the specific pathways that together contribute (positively or negatively) to the endophenotypes of different diseases. Conditional protein knockdown, orchestrated by T. gondii proteins or antibodies binding to those of the host (pathogen derived autoimmunity) and metabolite exchange, may contribute to this disruption. Susceptibility genes may thus be related to the causes and influencers of disease, rather than (and as well as) to the disease itself. PMID:23533776

Genetic mechanisms involved in the evolution of the cephalopod camera eye revealed by transcriptomic and developmental studies

PubMed Central

2011-01-01

Background Coleoid cephalopods (squids and octopuses) have evolved a camera eye, the structure of which is very similar to that found in vertebrates and which is considered a classic example of convergent evolution. Other molluscs, however, possess mirror, pin-hole, or compound eyes, all of which differ from the camera eye in the degree of complexity of the eye structures and neurons participating in the visual circuit. Therefore, genes expressed in the cephalopod eye after divergence from the common molluscan ancestor could be involved in eye evolution through association with the acquisition of new structural components. To clarify the genetic mechanisms that contributed to the evolution of the cephalopod camera eye, we applied comprehensive transcriptomic analysis and conducted developmental validation of candidate genes involved in coleoid cephalopod eye evolution. Results We compared gene expression in the eyes of 6 molluscan (3 cephalopod and 3 non-cephalopod) species and selected 5,707 genes as cephalopod camera eye-specific candidate genes on the basis of homology searches against 3 molluscan species without camera eyes. First, we confirmed the expression of these 5,707 genes in the cephalopod camera eye formation processes by developmental array analysis. Second, using molecular evolutionary (dN/dS) analysis to detect positive selection in the cephalopod lineage, we identified 156 of these genes in which functions appeared to have changed after the divergence of cephalopods from the molluscan ancestor and which contributed to structural and functional diversification. Third, we selected 1,571 genes, expressed in the camera eyes of both cephalopods and vertebrates, which could have independently acquired a function related to eye development at the expression level. Finally, as experimental validation, we identified three functionally novel cephalopod camera eye genes related to optic lobe formation in cephalopods by in situ hybridization analysis of embryonic pygmy squid. Conclusion We identified 156 genes positively selected in the cephalopod lineage and 1,571 genes commonly found in the cephalopod and vertebrate camera eyes from the analysis of cephalopod camera eye specificity at the expression level. Experimental validation showed that the cephalopod camera eye-specific candidate genes include those expressed in the outer part of the optic lobes, which unique to coleoid cephalopods. The results of this study suggest that changes in gene expression and in the primary structure of proteins (through positive selection) from those in the common molluscan ancestor could have contributed, at least in part, to cephalopod camera eye acquisition. PMID:21702923

Strong motion deficits in dyslexia associated with DCDC2 gene alteration.

PubMed

Cicchini, Guido Marco; Marino, Cecilia; Mascheretti, Sara; Perani, Daniela; Morrone, Maria Concetta

2015-05-27

Dyslexia is a specific impairment in reading that affects 1 in 10 people. Previous studies have failed to isolate a single cause of the disorder, but several candidate genes have been reported. We measured motion perception in two groups of dyslexics, with and without a deletion within the DCDC2 gene, a risk gene for dyslexia. We found impairment for motion particularly strong at high spatial frequencies in the population carrying the deletion. The data suggest that deficits in motion processing occur in a specific genotype, rather than the entire dyslexia population, contributing to the large variability in impairment of motion thresholds in dyslexia reported in the literature. Copyright © 2015 the authors 0270-6474/15/358059-06$15.00/0.

Common phenotype and different non-HLA genes in Graves' disease and alopecia areata.

PubMed

Taketomo, Yasunori; Noso, Shinsuke; Babaya, Naru; Hiromine, Yoshihisa; Ito, Hiroyuki; Kanto, Kousei; Niwano, Fumimaru; Oiso, Naoki; Kawada, Akira; Kawabata, Yumiko; Ikegami, Hiroshi

2017-02-01

Our previous observations clarified that Graves' disease (GD) is the most frequent autoimmune disease in patients with alopecia areata (AA), and 42.7% of patients with AA were positive for thyrotropin receptor antibody (TRAb). A class II HLA haplotype DRB1 ∗ 15:01-DQB1 ∗ 06:02 was suggested to contribute to autoimmunity against the thyroid gland in AA. To further clarify the genetic factors contributing to organ specificity in autoimmune diseases, we studied the contribution of non-HLA genes to organ specificity in GD and AA. A high frequency of AA (13.4%) was observed in patients with GD, indicating strong phenotypic association between GD and AA. CTLA4 and TSHR were significantly associated with GD (Pc=0.007 and Pc<0.002, respectively), but not with AA, even in TRAb-positive patients. The difference in the association between GD and AA suggests that the CTLA4 and TSHR are not main factors contributing to determining common genetic basis among GD and AA. Copyright © 2016 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

Functional and topological characteristics of mammalian regulatory domains

PubMed Central

Symmons, Orsolya; Uslu, Veli Vural; Tsujimura, Taro; Ruf, Sandra; Nassari, Sonya; Schwarzer, Wibke; Ettwiller, Laurence; Spitz, François

2014-01-01

Long-range regulatory interactions play an important role in shaping gene-expression programs. However, the genomic features that organize these activities are still poorly characterized. We conducted a large operational analysis to chart the distribution of gene regulatory activities along the mouse genome, using hundreds of insertions of a regulatory sensor. We found that enhancers distribute their activities along broad regions and not in a gene-centric manner, defining large regulatory domains. Remarkably, these domains correlate strongly with the recently described TADs, which partition the genome into distinct self-interacting blocks. Different features, including specific repeats and CTCF-binding sites, correlate with the transition zones separating regulatory domains, and may help to further organize promiscuously distributed regulatory influences within large domains. These findings support a model of genomic organization where TADs confine regulatory activities to specific but large regulatory domains, contributing to the establishment of specific gene expression profiles. PMID:24398455

Familial cancer syndromes and clusters.

PubMed

Birch, J M

1994-07-01

The study of rare families in which a variety of cancers occur, usually at an early age and with patterns consistent with a common hereditary mechanism, has contributed much to our understanding of the process of carcinogenesis. So far, genes identified as having a role in cancer predisposition in these families have also been important in the histogenesis of sporadic cancers. In the two most clearly defined cancer family syndromes, the Li-Fraumeni syndrome and Lynch syndrome II, the genes involved predispose to diverse but specific constellations of cancers. Genes associated with site-specific familial cancer clusters may also give rise to increased susceptibility to other cancers, and site-specific clusters may represent one end of a spectrum. A consistent feature of familial cancer syndromes is the variable expression within and between families. A challenge for the future will be to determine other factors which may interact with the principal genes involved, giving rise to this variability.

Evidence for a hierarchical transcriptional circuit in Drosophila male germline involving testis-specific TAF and two gene-specific transcription factors, Mod and Acj6.

PubMed

Jiang, Mei; Gao, Zhengliang; Wang, Jian; Nurminsky, Dmitry I

2018-01-01

To analyze transcription factors involved in gene regulation by testis-specific TAF (tTAF), tTAF-dependent promoters were mapped and analyzed in silico. Core promoters show decreased AT content, paucity of classical promoter motifs, and enrichment with translation control element CAAAATTY. Scanning of putative regulatory regions for known position frequency matrices identified 19 transcription regulators possibly contributing to tTAF-driven gene expression. Decreased male fertility associated with mutation in one of the regulators, Acj6, indicates its involvement in male reproduction. Transcriptome study of testes from male mutants for tTAF, Acj6, and previously characterized tTAF-interacting factor Modulo implies the existence of a regulatory hierarchy of tTAF, Modulo and Acj6, in which Modulo and/or Acj6 regulate one-third of tTAF-dependent genes. © 2017 Federation of European Biochemical Societies.

Of Pesticides and Men: A California Story of Genes and Environment in Parkinson’s Disease

PubMed Central

Ritz, BR; Paul, KC; Bronstein, JM

2018-01-01

At the start of the post-genomics era, most Parkinson’s disease (PD) etiology cannot be explained by our knowledge of genetic or environmental factors alone. For more than a decade, we have explored gene-environment (GxE) interactions possibly responsible for the heterogeneity of genetic as well as environmental results across populations. We developed three pesticide exposure measures (ambient due to agricultural applications, home and garden use, occupational use) in a large population-based case-control study of incident PD in central California. Specifically, we assessed interactions with genes responsible for pesticide metabolism (PON1); transport across the blood brain barrier (ABCB1); pesticides interfering with or depending on dopamine transporter activity (DAT) and dopamine metabolism (ALDH2); impacting mitochondrial function via oxidative/nitrosative stress (NOS1) or proteasome inhibition (SKP1); and contributing to immune dysregulation (HLA-DR). These studies established some specificity for pesticides’ neurodegenerative actions, contributed biologic plausibility to epidemiologic findings, and identified genetically susceptible populations. PMID:26857251

Genome-wide patterns of genetic distances reveal candidate Loci contributing to human population-specific traits.

PubMed

de Magalhães, João Pedro; Matsuda, Alex

2012-03-01

Modern humans originated in Africa before migrating across the world with founder effects and adaptations to new environments contributing to their present phenotypic diversity. Determining the genetic basis of differences between populations may provide clues about our evolutionary history and may have clinical implications. Herein, we develop a method to detect genes and biological processes in which populations most differ by calculating the genetic distance between modern populations and a hypothetical ancestral population. We apply our method to large-scale single nucleotide polymorphism (SNP) data from human populations of African, European and Asian origin. As expected, ancestral alleles were more conserved in the African populations and we found evidence of high divergence in genes previously suggested as targets of selection related to skin pigmentation, immune response, senses and dietary adaptations. Our genome-wide scan also reveals novel candidates for contributing to population-specific traits. These include genes related to neuronal development and behavior that may have been influenced by cultural processes. Moreover, in the African populations, we found a high divergence in genes related to UV protection and to the male reproductive system. Taken together, these results confirm and expand previous findings, providing new clues about the evolution and genetics of human phenotypic diversity. © 2011 The Authors Annals of Human Genetics © 2011 Blackwell Publishing Ltd/University College London.

Are Endophenotypes Based on Measures of Executive Functions Useful for Molecular Genetic Studies of ADHD?

ERIC Educational Resources Information Center

Doyle, Alysa E.; Faraone, Stephen V.; Seidman, Larry J.; Willcutt, Erik G.; Nigg, Joel T.; Waldman, Irwin D.; Pennington, Bruce F.; Peart, Joanne; Biederman, Joseph

2005-01-01

Background: Behavioral genetic studies provide strong evidence that attention-deficit/hyperactivity disorder (ADHD) has a substantial genetic component. Yet, due to the complexity of the ADHD phenotype, questions remain as to the specific genes that contribute to this condition as well as the pathways from genes to behavior. Endophenotypes, or…

Tissue-specific NETs alter genome organization and regulation even in a heterologous system.

PubMed

de Las Heras, Jose I; Zuleger, Nikolaj; Batrakou, Dzmitry G; Czapiewski, Rafal; Kerr, Alastair R W; Schirmer, Eric C

2017-01-02

Different cell types exhibit distinct patterns of 3D genome organization that correlate with changes in gene expression in tissue and differentiation systems. Several tissue-specific nuclear envelope transmembrane proteins (NETs) have been found to influence the spatial positioning of genes and chromosomes that normally occurs during tissue differentiation. Here we study 3 such NETs: NET29, NET39, and NET47, which are expressed preferentially in fat, muscle and liver, respectively. We found that even when exogenously expressed in a heterologous system they can specify particular genome organization patterns and alter gene expression. Each NET affected largely different subsets of genes. Notably, the liver-specific NET47 upregulated many genes in HT1080 fibroblast cells that are normally upregulated in hepatogenesis, showing that tissue-specific NETs can favor expression patterns associated with the tissue where the NET is normally expressed. Similarly, global profiling of peripheral chromatin after exogenous expression of these NETs using lamin B1 DamID revealed that each NET affected the nuclear positioning of distinct sets of genomic regions with a significant tissue-specific component. Thus NET influences on genome organization can contribute to gene expression changes associated with differentiation even in the absence of other factors and overt cellular differentiation changes.

Sexual Dimorphism of Body Size Is Controlled by Dosage of the X-Chromosomal Gene Myc and by the Sex-Determining Gene tra in Drosophila.

PubMed

Mathews, Kristina Wehr; Cavegn, Margrith; Zwicky, Monica

2017-03-01

Drosophila females are larger than males. In this article, we describe how X -chromosome dosage drives sexual dimorphism of body size through two means: first, through unbalanced expression of a key X -linked growth-regulating gene, and second, through female-specific activation of the sex-determination pathway. X -chromosome dosage determines phenotypic sex by regulating the genes of the sex-determining pathway. In the presence of two sets of X -chromosome signal elements (XSEs), Sex-lethal ( Sxl ) is activated in female ( XX ) but not male ( XY ) animals. Sxl activates transformer ( tra ), a gene that encodes a splicing factor essential for female-specific development. It has previously been shown that null mutations in the tra gene result in only a partial reduction of body size of XX animals, which shows that other factors must contribute to size determination. We tested whether X dosage directly affects animal size by analyzing males with duplications of X -chromosomal segments. Upon tiling across the X chromosome, we found four duplications that increase male size by >9%. Within these, we identified several genes that promote growth as a result of duplication. Only one of these, Myc , was found not to be dosage compensated. Together, our results indicate that both Myc dosage and tra expression play crucial roles in determining sex-specific size in Drosophila larvae and adult tissue. Since Myc also acts as an XSE that contributes to tra activation in early development, a double dose of Myc in females serves at least twice in development to promote sexual size dimorphism. Copyright © 2017 by the Genetics Society of America.

Direct interplay between two candidate genes in FSHD muscular dystrophy

PubMed Central

Ferri, Giulia; Huichalaf, Claudia H.; Caccia, Roberta; Gabellini, Davide

2015-01-01

Facioscapulohumeral muscular dystrophy (FSHD) is one of the most common neuromuscular disorders. The major form of the disease (FSHD1) is linked to decrease in copy number of a 3.3-kb tandem repeated macrosatellite (D4Z4), located on chromosome 4q35. D4Z4 deletion alters chromatin structure of the locus leading to aberrant expression of nearby 4q35 genes. Given the high variability in disease onset and progression, multiple factors could contribute to the pathogenesis of FSHD. Among the FSHD candidate genes are double homeobox 4 (DUX4), encoded by the most telomeric D4Z4 unit, and FSHD region gene 1 (FRG1). DUX4 is a sequence-specific transcription factor. Here, we located putative DUX4 binding sites in the human FRG1 genomic area and we show specific DUX4 association to these regions. We found also that ectopically expressed DUX4 up-regulates the endogenous human FRG1 gene in healthy muscle cells, while DUX4 knockdown leads to a decrease in FRG1 expression in FSHD muscle cells. Moreover, DUX4 binds directly and specifically to its binding site located in the human FRG1 gene and transactivates constructs containing FRG1 genomic regions. Intriguingly, the mouse Frg1 genomic area lacks DUX4 binding sites and DUX4 is unable to activate the endogenous mouse Frg1 gene providing a possible explanation for the lack of muscle phenotype in DUX4 transgenic mice. Altogether, our results demonstrate that FRG1 is a direct DUX4 transcriptional target uncovering a novel regulatory circuit contributing to FSHD. PMID:25326393

Profile of the genes expressed in the human peripheral retina, macula, and retinal pigment epithelium determined through serial analysis of gene expression (SAGE)

PubMed Central

Sharon, Dror; Blackshaw, Seth; Cepko, Constance L.; Dryja, Thaddeus P.

2002-01-01

We used the serial analysis of gene expression (SAGE) technique to catalogue and measure the relative levels of expression of the genes expressed in the human peripheral retina, macula, and retinal pigment epithelium (RPE) from one or both of two humans, aged 88 and 44 years. The cone photoreceptor contribution to all transcription in the retina was found to be similar in the macula versus the retinal periphery, whereas the rod contribution was greater in the periphery versus the macula. Genes encoding structural proteins for axons were found to be expressed at higher levels in the macula versus the retinal periphery, probably reflecting the large proportion of ganglion cells in the central retina. In comparison with the younger eye, the peripheral retina of the older eye had a substantially higher proportion of mRNAs from genes encoding proteins involved in iron metabolism or protection against oxidative damage and a substantially lower proportion of mRNAs from genes encoding proteins involved in rod phototransduction. These differences may reflect the difference in age between the two donors or merely interindividual variation. The RPE library had numerous previously unencountered tags, suggesting that this cell type has a large, idiosyncratic repertoire of expressed genes. Comparison of these libraries with 100 reported nonocular SAGE libraries revealed 89 retina-specific or enriched genes expressed at substantial levels, of which 14 are known to cause a retinal disease and 53 are RPE-specific genes. We expect that these libraries will serve as a resource for understanding the relative expression levels of genes in the retina and the RPE and for identifying additional disease genes. PMID:11756676

An active role for endogenous beta-1,3-glucanase genes in transgene-mediated co-suppression in tobacco.

PubMed

Sanders, Matthew; Maddelein, Wendy; Depicker, Anna; Van Montagu, Marc; Cornelissen, Marc; Jacobs, John

2002-11-01

Post-transcriptional gene silencing (PTGS) is characterized by the accumulation of short interfering RNAs that are proposed to mediate sequence-specific degradation of cognate and secondary target mRNAs. In plants, it is unclear to what extent endogenous genes contribute to this process. Here, we address the role of the endogenous target genes in transgene-mediated PTGS of beta-1,3-glucanases in tobacco. We found that mRNA sequences of the endogenous glucanase glb gene with varying degrees of homology to the Nicotiana plumbaginifolia gn1 transgene are targeted by the silencing machinery, although less efficiently than corresponding transgene regions. Importantly, we show that endogene-specific nucleotides in the glb sequence provide specificity to the silencing process. Consistent with this finding, small sense and antisense 21- to 23-nucleotide RNAs homologous to the endogenous glb gene were detected. Combined, these data demonstrate that a co-suppressed endogenous glucan ase gene is involved in signal amplification and selection of homologous targets, and show that endogenous genes can actively participate in PTGS in plants. The findings are introduced as a further sophistication of the post-transciptional silencing model.

The contribution of the mitochondrial genome to sex-specific fitness variance.

PubMed

Smith, Shane R T; Connallon, Tim

2017-05-01

Maternal inheritance of mitochondrial DNA (mtDNA) facilitates the evolutionary accumulation of mutations with sex-biased fitness effects. Whereas maternal inheritance closely aligns mtDNA evolution with natural selection in females, it makes it indifferent to evolutionary changes that exclusively benefit males. The constrained response of mtDNA to selection in males can lead to asymmetries in the relative contributions of mitochondrial genes to female versus male fitness variation. Here, we examine the impact of genetic drift and the distribution of fitness effects (DFE) among mutations-including the correlation of mutant fitness effects between the sexes-on mitochondrial genetic variation for fitness. We show how drift, genetic correlations, and skewness of the DFE determine the relative contributions of mitochondrial genes to male versus female fitness variance. When mutant fitness effects are weakly correlated between the sexes, and the effective population size is large, mitochondrial genes should contribute much more to male than to female fitness variance. In contrast, high fitness correlations and small population sizes tend to equalize the contributions of mitochondrial genes to female versus male variance. We discuss implications of these results for the evolution of mitochondrial genome diversity and the genetic architecture of female and male fitness. © 2017 The Author(s). Evolution © 2017 The Society for the Study of Evolution.

A meta-analysis of public microarray data identifies biological regulatory networks in Parkinson's disease.

PubMed

Su, Lining; Wang, Chunjie; Zheng, Chenqing; Wei, Huiping; Song, Xiaoqing

2018-04-13

Parkinson's disease (PD) is a long-term degenerative disease that is caused by environmental and genetic factors. The networks of genes and their regulators that control the progression and development of PD require further elucidation. We examine common differentially expressed genes (DEGs) from several PD blood and substantia nigra (SN) microarray datasets by meta-analysis. Further we screen the PD-specific genes from common DEGs using GCBI. Next, we used a series of bioinformatics software to analyze the miRNAs, lncRNAs and SNPs associated with the common PD-specific genes, and then identify the mTF-miRNA-gene-gTF network. Our results identified 36 common DEGs in PD blood studies and 17 common DEGs in PD SN studies, and five of the genes were previously known to be associated with PD. Further study of the regulatory miRNAs associated with the common PD-specific genes revealed 14 PD-specific miRNAs in our study. Analysis of the mTF-miRNA-gene-gTF network about PD-specific genes revealed two feed-forward loops: one involving the SPRK2 gene, hsa-miR-19a-3p and SPI1, and the second involving the SPRK2 gene, hsa-miR-17-3p and SPI. The long non-coding RNA (lncRNA)-mediated regulatory network identified lncRNAs associated with PD-specific genes and PD-specific miRNAs. Moreover, single nucleotide polymorphism (SNP) analysis of the PD-specific genes identified two significant SNPs, and SNP analysis of the neurodegenerative disease-specific genes identified seven significant SNPs. Most of these SNPs are present in the 3'-untranslated region of genes and are controlled by several miRNAs. Our study identified a total of 53 common DEGs in PD patients compared with healthy controls in blood and brain datasets and five of these genes were previously linked with PD. Regulatory network analysis identified PD-specific miRNAs, associated long non-coding RNA and feed-forward loops, which contribute to our understanding of the mechanisms underlying PD. The SNPs identified in our study can determine whether a genetic variant is associated with PD. Overall, these findings will help guide our study of the complex molecular mechanism of PD.

Distinct contributions of replication and transcription to mutation rate variation of human genomes.

PubMed

Cui, Peng; Ding, Feng; Lin, Qiang; Zhang, Lingfang; Li, Ang; Zhang, Zhang; Hu, Songnian; Yu, Jun

2012-02-01

Here, we evaluate the contribution of two major biological processes--DNA replication and transcription--to mutation rate variation in human genomes. Based on analysis of the public human tissue transcriptomics data, high-resolution replicating map of Hela cells and dbSNP data, we present significant correlations between expression breadth, replication time in local regions and SNP density. SNP density of tissue-specific (TS) genes is significantly higher than that of housekeeping (HK) genes. TS genes tend to locate in late-replicating genomic regions and genes in such regions have a higher SNP density compared to those in early-replication regions. In addition, SNP density is found to be positively correlated with expression level among HK genes. We conclude that the process of DNA replication generates stronger mutational pressure than transcription-associated biological processes do, resulting in an increase of mutation rate in TS genes while having weaker effects on HK genes. In contrast, transcription-associated processes are mainly responsible for the accumulation of mutations in highly-expressed HK genes. Copyright © 2012 Beijing Genomics Institute. Published by Elsevier Ltd. All rights reserved.

Cloning of novel rice blast resistance genes from two rapidly evolving NBS-LRR gene families in rice.

PubMed

Guo, Changjiang; Sun, Xiaoguang; Chen, Xiao; Yang, Sihai; Li, Jing; Wang, Long; Zhang, Xiaohui

2016-01-01

Most rice blast resistance genes (R-genes) encode proteins with nucleotide-binding site (NBS) and leucine-rich repeat (LRR) domains. Our previous study has shown that more rice blast R-genes can be cloned in rapidly evolving NBS-LRR gene families. In the present study, two rapidly evolving R-gene families in rice were selected for cloning a subset of genes from their paralogs in three resistant rice lines. A total of eight functional blast R-genes were identified among nine NBS-LRR genes, and some of these showed resistance to three or more blast strains. Evolutionary analysis indicated that high nucleotide diversity of coding regions served as important parameters in the determination of gene resistance. We also observed that amino-acid variants (nonsynonymous mutations, insertions, or deletions) in essential motifs of the NBS domain contribute to the blast resistance capacity of NBS-LRR genes. These results suggested that the NBS regions might also play an important role in resistance specificity determination. On the other hand, different splicing patterns of introns were commonly observed in R-genes. The results of the present study contribute to improving the effectiveness of R-gene identification by using evolutionary analysis method and acquisition of novel blast resistance genes.

Identification of rhizome-specific genes by genome-wide differential expression analysis in Oryza longistaminata.

PubMed

Hu, Fengyi; Wang, Di; Zhao, Xiuqin; Zhang, Ting; Sun, Haixi; Zhu, Linghua; Zhang, Fan; Li, Lijuan; Li, Qiong; Tao, Dayun; Fu, Binying; Li, Zhikang

2011-01-24

Rhizomatousness is a key component of perenniality of many grasses that contribute to competitiveness and invasiveness of many noxious grass weeds, but can potentially be used to develop perennial cereal crops for sustainable farmers in hilly areas of tropical Asia. Oryza longistaminata, a perennial wild rice with strong rhizomes, has been used as the model species for genetic and molecular dissection of rhizome development and in breeding efforts to transfer rhizome-related traits into annual rice species. In this study, an effort was taken to get insights into the genes and molecular mechanisms underlying the rhizomatous trait in O. longistaminata by comparative analysis of the genome-wide tissue-specific gene expression patterns of five different tissues of O. longistaminata using the Affymetrix GeneChip Rice Genome Array. A total of 2,566 tissue-specific genes were identified in five different tissues of O. longistaminata, including 58 and 61 unique genes that were specifically expressed in the rhizome tips (RT) and internodes (RI), respectively. In addition, 162 genes were up-regulated and 261 genes were down-regulated in RT compared to the shoot tips. Six distinct cis-regulatory elements (CGACG, GCCGCC, GAGAC, AACGG, CATGCA, and TAAAG) were found to be significantly more abundant in the promoter regions of genes differentially expressed in RT than in the promoter regions of genes uniformly expressed in all other tissues. Many of the RT and/or RI specifically or differentially expressed genes were located in the QTL regions associated with rhizome expression, rhizome abundance and rhizome growth-related traits in O. longistaminata and thus are good candidate genes for these QTLs. The initiation and development of the rhizomatous trait in O. longistaminata are controlled by very complex gene networks involving several plant hormones and regulatory genes, different members of gene families showing tissue specificity and their regulated pathways. Auxin/IAA appears to act as a negative regulator in rhizome development, while GA acts as the activator in rhizome development. Co-localization of the genes specifically expressed in rhizome tips and rhizome internodes with the QTLs for rhizome traits identified a large set of candidate genes for rhizome initiation and development in rice for further confirmation.

The Role of Retrotransposons in Gene Family Expansions in the Human and Mouse Genomes

PubMed Central

Janoušek, Václav; Laukaitis, Christina M.; Yanchukov, Alexey

2016-01-01

Abstract Retrotransposons comprise a large portion of mammalian genomes. They contribute to structural changes and more importantly to gene regulation. The expansion and diversification of gene families have been implicated as sources of evolutionary novelties. Given the roles retrotransposons play in genomes, their contribution to the evolution of gene families warrants further exploration. In this study, we found a significant association between two major retrotransposon classes, LINEs and LTRs, and lineage-specific gene family expansions in both the human and mouse genomes. The distribution and diversity differ between LINEs and LTRs, suggesting that each has a distinct involvement in gene family expansion. LTRs are associated with open chromatin sites surrounding the gene families, supporting their involvement in gene regulation, whereas LINEs may play a structural role promoting gene duplication. Our findings also suggest that gene family expansions, especially in the mouse genome, undergo two phases. The first phase is characterized by elevated deposition of LTRs and their utilization in reshaping gene regulatory networks. The second phase is characterized by rapid gene family expansion due to continuous accumulation of LINEs and it appears that, in some instances at least, this could become a runaway process. We provide an example in which this has happened and we present a simulation supporting the possibility of the runaway process. Altogether we provide evidence of the contribution of retrotransposons to the expansion and evolution of gene families. Our findings emphasize the putative importance of these elements in diversification and adaptation in the human and mouse lineages. PMID:27503295

Mof-associated complexes have overlapping and unique roles in regulating pluripotency in embryonic stem cells and during differentiation

PubMed Central

Ravens, Sarina; Fournier, Marjorie; Ye, Tao; Stierle, Matthieu; Dembele, Doulaye; Chavant, Virginie; Tora, Làszlò

2014-01-01

The histone acetyltransferase (HAT) Mof is essential for mouse embryonic stem cell (mESC) pluripotency and early development. Mof is the enzymatic subunit of two different HAT complexes, MSL and NSL. The individual contribution of MSL and NSL to transcription regulation in mESCs is not well understood. Our genome-wide analysis show that i) MSL and NSL bind to specific and common sets of expressed genes, ii) NSL binds exclusively at promoters, iii) while MSL binds in gene bodies. Nsl1 regulates proliferation and cellular homeostasis of mESCs. MSL is the main HAT acetylating H4K16 in mESCs, is enriched at many mESC-specific and bivalent genes. MSL is important to keep a subset of bivalent genes silent in mESCs, while developmental genes require MSL for expression during differentiation. Thus, NSL and MSL HAT complexes differentially regulate specific sets of expressed genes in mESCs and during differentiation. DOI: http://dx.doi.org/10.7554/eLife.02104.001 PMID:24898753

Amh and Dmrta2 genes map to tilapia (Oreochromis spp.) linkage group 23 within quantitative trait locus regions for sex determination.

PubMed

Shirak, Andrey; Seroussi, Eyal; Cnaani, Avner; Howe, Aimee E; Domokhovsky, Raisa; Zilberman, Noam; Kocher, Thomas D; Hulata, Gideon; Ron, Micha

2006-11-01

Recent studies have revealed that the major genes of the mammalian sex determination pathway are also involved in sex determination of fish. Several studies have reported QTL in various species and strains of tilapia, regions contributing to sex determination have been identified on linkage groups 1, 3, and 23. Genes contributing to sex-specific mortality have been detected on linkage groups 2, 6, and 23. To test whether the same genes might control sex determination in mammals and fishes, we mapped 11 genes that are considered putative master key regulators of sex determination: Amh, Cyp19, Dax1, Dmrt2, Dmrta2, Fhl3l, Foxl2, Ixl, Lhx9, Sf1, and Sox8. We identified polymorphisms in noncoding regions of these genes and genotyped these sites for 90 individuals of an F2 mapping family. Mapping of Dax1 joined LG16 and LG21 into a single linkage group. The Amh and Dmrta2 genes were mapped to two distinct regions of LG23. The Amh gene was mapped 5 cM from UNH879 within a QTL region for sex determination and 2 cM from UNH216 within a QTL region for sex-specific mortality. Dmrta2 was mapped 4 cM from UNH848 within another QTL region for sex determination. Cyp19 was mapped to LG1 far from a previously reported QTL region for sex determination on this chromosome. Seven other candidate genes mapped to LG4, -11, -12, -14, and -17.

Site-Specific Expression of Polycomb-Group Genes Encoding the HPC-HPH/PRC1 Complex in Clinically Defined Primary Nodal and Cutaneous Large B-Cell Lymphomas

PubMed Central

Raaphorst, Frank M.; Vermeer, Maarten; Fieret, Elly; Blokzijl, Tjasso; Dukers, Danny; Sewalt, Richard G.A.B.; Otte, Arie P.; Willemze, Rein; Meijer, Chris J.L.M.

2004-01-01

Polycomb-group (PcG) genes preserve cell identity by gene silencing, and contribute to regulation of lymphopoiesis and malignant transformation. We show that primary nodal large B-cell lymphomas (LBCLs), and secondary cutaneous deposits from such lymphomas, abnormally express the BMI-1, RING1, and HPH1 PcG genes in cycling neoplastic cells. By contrast, tumor cells in primary cutaneous LBCLs lacked BMI-1 expression, whereas RING1 was variably detected. Lack of BMI-1 expression was characteristic for primary cutaneous LBCLs, because other primary extranodal LBCLs originating from brain, testes, and stomach were BMI-1-positive. Expression of HPH1 was rarely detected in primary cutaneous LBCLs of the head or trunk and abundant in primary cutaneous LBCLs of the legs, which fits well with its earlier recognition as a distinct clinical pathological entity with different clinical behavior. We conclude that clinically defined subclasses of primary LBCLs display site-specific abnormal expression patterns of PcG genes of the HPC-HPH/PRC1 PcG complex. Some of these patterns (such as the expression profile of BMI-1) may be diagnostically relevant. We propose that distinct expression profiles of PcG genes results in abnormal formation of HPC-HPH/PRC1 PcG complexes, and that this contributes to lymphomagenesis and different clinical behavior of clinically defined LBCLs. PMID:14742259

The dopamine transporter gene may not contribute to susceptibility and the specific personality traits of amphetamine dependence.

PubMed

Tzeng, Nian-Sheng; Lu, Ru-Band; Yeh, Hui-Wen; Yeh, Yi-Wei; Huang, Chang-Chih; Yen, Che-Hung; Kuo, Shin-Chang; Chen, Chun-Yen; Chang, Hsin-An; Ho, Pei-Shen; Cheng, Serena; Shih, Mei-Chen; Huang, San-Yuan

2015-04-01

A substantial amount of evidence suggests that dysfunction of the dopamine transporter may be involved in the pathophysiology of amphetamine dependence (AD). The aim of this study was to examine whether the dopamine transporter gene (DAT1, SLC6A3) is associated with development of AD and whether this gene influences personality traits in patients with AD. Eighteen polymorphisms of the DAT1 gene were analyzed in a case-control study that included 909 Han Chinese men (568 patients with AD and 341 control subjects). The patients fulfilled the DSM-IV-TR criteria for AD. The Tridimensional Personality Questionnaire (TPQ) was used to assess personality traits and to examine the association between these traits and DAT1 gene variants. A weak association was found between the rs27072 polymorphism and development of AD, but these borderline associations were unconfirmed by logistic regression and haplotype analysis. Although harm avoidance and novelty seeking scores were significantly higher in patients than in controls, DAT1 polymorphisms did not influence these scores. This study suggests that high harm avoidance and novelty seeking personality traits may be a risk factor for the development of AD. However, the DAT1 gene may not contribute to AD susceptibility and specific personality traits observed in AD among Han Chinese men. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

HIV-1-negative female sex workers sustain high cervical IFNɛ, low immune activation, and low expression of HIV-1-required host genes.

PubMed

Abdulhaqq, S A; Zorrilla, C; Kang, G; Yin, X; Tamayo, V; Seaton, K E; Joseph, J; Garced, S; Tomaras, G D; Linn, K A; Foulkes, A S; Azzoni, L; VerMilyea, M; Coutifaris, C; Kossenkov, A V; Showe, L; Kraiselburd, E N; Li, Q; Montaner, L J

2016-07-01

Sex workers practicing in high HIV endemic areas have been extensively targeted to test anti-HIV prophylactic strategies. We hypothesize that in women with high levels of genital exposure to semen changes in cervico-vaginal mucosal and/or systemic immune activation will contribute to a decreased susceptibility to HIV-1 infection. To address this question, we assessed sexual activity and immune activation status (in peripheral blood), as well as cellular infiltrates and gene expression in ectocervical mucosa biopsies in female sex workers (FSWs; n=50), as compared with control women (CG; n=32). FSWs had low-to-absent HIV-1-specific immune responses with significantly lower CD38 expression on circulating CD4(+) or CD8(+) T-cells (both: P<0.001) together with lower cervical gene expression of genes associated with leukocyte homing and chemotaxis. FSWs also had increased levels of interferon-ɛ (IFNɛ) gene and protein expression in the cervical epithelium together with reduced expression of genes associated with HIV-1 integration and replication. A correlative relationship between semen exposure and elevated type-1 IFN expression in FSWs was also established. Overall, our data suggest that long-term condomless sex work can result in multiple changes within the cervico-vaginal compartment that would contribute to sustaining a lower susceptibility for HIV-1 infection in the absence of HIV-specific responses.

STAT3 or USF2 Contributes to HIF Target Gene Specificity

PubMed Central

Pawlus, Matthew R.; Wang, Liyi; Murakami, Aya; Dai, Guanhai; Hu, Cheng-Jun

2013-01-01

The HIF1- and HIF2-mediated transcriptional responses play critical roles in solid tumor progression. Despite significant similarities, including their binding to promoters of both HIF1 and HIF2 target genes, HIF1 and HIF2 proteins activate unique subsets of target genes under hypoxia. The mechanism for HIF target gene specificity has remained unclear. Using siRNA or inhibitor, we previously reported that STAT3 or USF2 is specifically required for activation of endogenous HIF1 or HIF2 target genes. In this study, using reporter gene assays and chromatin immuno-precipitation, we find that STAT3 or USF2 exhibits specific binding to the promoters of HIF1 or HIF2 target genes respectively even when over-expressed. Functionally, HIF1α interacts with STAT3 to activate HIF1 target gene promoters in a HIF1α HLH/PAS and N-TAD dependent manner while HIF2α interacts with USF2 to activate HIF2 target gene promoters in a HIF2α N-TAD dependent manner. Physically, HIF1α HLH and PAS domains are required for its interaction with STAT3 while both N- and C-TADs of HIF2α are involved in physical interaction with USF2. Importantly, addition of functional USF2 binding sites into a HIF1 target gene promoter increases the basal activity of the promoter as well as its response to HIF2+USF2 activation while replacing HIF binding site with HBS from a HIF2 target gene does not change the specificity of the reporter gene. Importantly, RNA Pol II on HIF1 or HIF2 target genes is primarily associated with HIF1α or HIF2α in a STAT3 or USF2 dependent manner. Thus, we demonstrate here for the first time that HIF target gene specificity is achieved by HIF transcription partners that are required for HIF target gene activation, exhibit specific binding to the promoters of HIF1 or HIF2 target genes and selectively interact with HIF1α or HIF2α protein. PMID:23991099

Natural genetic variation profoundly regulates gene expression in immune cells and dictates susceptibility to CNS autoimmunity

PubMed Central

Bearoff, Frank; del Rio, Roxana; Case, Laure K.; Dragon, Julie A.; Nguyen-Vu, Trang; Lin, Chin-Yo; Blankenhorn, Elizabeth P.; Teuscher, Cory; Krementsov, Dimitry N.

2016-01-01

Regulation of gene expression in immune cells is known to be under genetic control, and likely contributes to susceptibility to autoimmune diseases, such as multiple sclerosis (MS). How this occurs in concert across multiple immune cell types is poorly understood. Using a mouse model that harnesses the genetic diversity of wild-derived mice, more accurately reflecting genetically diverse human populations, we provide an extensive characterization of the genetic regulation of gene expression in five different naïve immune cell types relevant to MS. The immune cell transcriptome is shown to be under profound genetic control, exhibiting diverse patterns: global, cell-specific, and sex-specific. Bioinformatic analysis of the genetically-controlled transcript networks reveals reduced cell type-specificity and inflammatory activity in wild-derived PWD/PhJ mice, compared with the conventional laboratory strain C57BL/6J. Additionally, candidate MS-GWAS genes were significantly enriched among transcripts overrepresented in C57BL/6J cells compared to PWD. These expression level differences correlate with robust differences in susceptibility to experimental autoimmune encephalomyelitis, the principal model of MS, and skewing of the encephalitogenic T cell responses. Taken together, our results provide functional insights into the genetic regulation of the immune transcriptome, and shed light on how this in turn contributes to susceptibility to autoimmune disease. PMID:27653816

YY1 Regulates Melanocyte Development and Function by Cooperating with MITF

PubMed Central

Bell, Robert J. A.; Tran, Thanh-Nga T.; Haq, Rizwan; Liu, Huifei; Love, Kevin T.; Langer, Robert; Anderson, Daniel G.; Larue, Lionel; Fisher, David E.

2012-01-01

Studies of coat color mutants have greatly contributed to the discovery of genes that regulate melanocyte development and function. Here, we generated Yy1 conditional knockout mice in the melanocyte-lineage and observed profound melanocyte deficiency and premature gray hair, similar to the loss of melanocytes in human piebaldism and Waardenburg syndrome. Although YY1 is a ubiquitous transcription factor, YY1 interacts with M-MITF, the Waardenburg Syndrome IIA gene and a master transcriptional regulator of melanocytes. YY1 cooperates with M-MITF in regulating the expression of piebaldism gene KIT and multiple additional pigmentation genes. Moreover, ChIP–seq identified genome-wide YY1 targets in the melanocyte lineage. These studies mechanistically link genes implicated in human conditions of melanocyte deficiency and reveal how a ubiquitous factor (YY1) gains lineage-specific functions by co-regulating gene expression with a lineage-restricted factor (M-MITF)—a general mechanism which may confer tissue-specific gene expression in multiple lineages. PMID:22570637

Differentially-Expressed Pseudogenes in HIV-1 Infection.

PubMed

Gupta, Aditi; Brown, C Titus; Zheng, Yong-Hui; Adami, Christoph

2015-09-29

Not all pseudogenes are transcriptionally silent as previously thought. Pseudogene transcripts, although not translated, contribute to the non-coding RNA pool of the cell that regulates the expression of other genes. Pseudogene transcripts can also directly compete with the parent gene transcripts for mRNA stability and other cell factors, modulating their expression levels. Tissue-specific and cancer-specific differential expression of these "functional" pseudogenes has been reported. To ascertain potential pseudogene:gene interactions in HIV-1 infection, we analyzed transcriptomes from infected and uninfected T-cells and found that 21 pseudogenes are differentially expressed in HIV-1 infection. This is interesting because parent genes of one-third of these differentially-expressed pseudogenes are implicated in HIV-1 life cycle, and parent genes of half of these pseudogenes are involved in different viral infections. Our bioinformatics analysis identifies candidate pseudogene:gene interactions that may be of significance in HIV-1 infection. Experimental validation of these interactions would establish that retroviruses exploit this newly-discovered layer of host gene expression regulation for their own benefit.

Global study of holistic morphological effectors in the budding yeast Saccharomyces cerevisiae.

PubMed

Suzuki, Godai; Wang, Yang; Kubo, Karen; Hirata, Eri; Ohnuki, Shinsuke; Ohya, Yoshikazu

2018-02-20

The size of the phenotypic effect of a gene has been thoroughly investigated in terms of fitness and specific morphological traits in the budding yeast Saccharomyces cerevisiae, but little is known about gross morphological abnormalities. We identified 1126 holistic morphological effectors that cause severe gross morphological abnormality when deleted, and 2241 specific morphological effectors with weak holistic effects but distinctive effects on yeast morphology. Holistic effectors fell into many gene function categories and acted as network hubs, affecting a large number of morphological traits, interacting with a large number of genes, and facilitating high protein expression. Holistic morphological abnormality was useful for estimating the importance of a gene to morphology. The contribution of gene importance to fitness and morphology could be used to efficiently classify genes into functional groups. Holistic morphological abnormality can be used as a reproducible and reliable gene feature for high-dimensional morphological phenotyping. It can be used in many functional genomic applications.

Pharmacogenetics of cystic fibrosis treatment.

PubMed

Carter, Suzanne C; McKone, Edward F

2016-08-01

Cystic fibrosis (CF) is genetic autosomal recessive disease caused by reduced or absent function of CFTR protein. Treatments for patients with CF have primarily focused on the downstream end-organ consequences of defective CFTR. Since the discovery of the CFTR gene that causes CF in 1989 there have been tremendous advances in our understanding of the genetics and pathophysiology of CF. This has recently led to the development of new CFTR mutation-specific targeted therapies for select patients with CF. This review will discuss the characteristics of the CFTR gene, the CFTR mutations that cause CF and the new mutation specific pharmacological treatments including gene therapy that are contributing to the dawning of a new era in cystic fibrosis care.

Identifying Candidate Reprogramming Genes in Mouse Induced Pluripotent Stem Cells.

PubMed

Gao, Fang; Li, Jingyu; Zhang, Heng; Yang, Xu; An, Tiezhu

2017-08-01

Factor-based induced reprogramming approaches have tremendous potential for human regenerative medicine, but the efficiencies of these approaches are still low. In this study, we analyzed the global transcriptional profiles of mouse induced pluripotent stem cells (miPSCs) and mouse embryonic stem cells (mESCs) from seven different labs and present here the first successful clustering according to cell type, not by lab of origin. We identified 2131 different expression genes (DEs) as candidate pluripotency-associated genes by comparing mESCs/miPSCs with somatic cells and 720 DEs between miPSCs and mESCs. Interestingly, there was a significant overlap between the two DE sets. Therefore, we defined the overlap DEs as "consensus DEs" including 313 miPSC-specific genes expressed at a higher level in miPSCs versus mESCs and 184 mESC-specific genes in total and reasoned that these may contribute to the differences in pluripotency between mESCs and miPSCs. A classification of "consensus DEs" according to their different expression levels between somatic cells and mESCs/miPSCs shows that 86% of the miPSC-specific genes are more highly expressed in somatic cells, while 73% of mESC-specific genes are highly expressed in mESCs/miPSCs, indicating that the miPSCs have not efficiently silenced the expression pattern of the somatic cells from which they are derived and failed to completely induce the genes with high expression levels in mESCs. We further revealed a strong correlation between oocyte-enriched factors and insufficiently induced mESC-specific genes and identified 11 hub genes via network analysis. In light of these findings, we postulated that these key hub genes might not only drive somatic cell nuclear transfer (SCNT) reprogramming but also augment the efficiency and quality of miPSC reprogramming.

Allelic variation contributes to bacterial host specificity

DOE PAGES

Yue, Min; Han, Xiangan; Masi, Leon De; ...

2015-10-30

Understanding the molecular parameters that regulate cross-species transmission and host adaptation of potential pathogens is crucial to control emerging infectious disease. Although microbial pathotype diversity is conventionally associated with gene gain or loss, the role of pathoadaptive nonsynonymous single-nucleotide polymorphisms (nsSNPs) has not been systematically evaluated. Here, our genome-wide analysis of core genes within Salmonella enterica serovar Typhimurium genomes reveals a high degree of allelic variation in surface-exposed molecules, including adhesins that promote host colonization. Subsequent multinomial logistic regression, MultiPhen and Random Forest analyses of known/suspected adhesins from 580 independent Typhimurium isolates identifies distinct host-specific nsSNP signatures. Moreover, population andmore » functional analyses of host-associated nsSNPs for FimH, the type 1 fimbrial adhesin, highlights the role of key allelic residues in host-specific adherence in vitro. In conclusion, together, our data provide the first concrete evidence that functional differences between allelic variants of bacterial proteins likely contribute to pathoadaption to diverse hosts.« less

Analysis of experience-regulated transcriptome and imprintome during critical periods of mouse visual system development reveals spatiotemporal dynamics.

PubMed

Hsu, Chi-Lin; Chou, Chih-Hsuan; Huang, Shih-Chuan; Lin, Chia-Yi; Lin, Meng-Ying; Tung, Chun-Che; Lin, Chun-Yen; Lai, Ivan Pochou; Zou, Yan-Fang; Youngson, Neil A; Lin, Shau-Ping; Yang, Chang-Hao; Chen, Shih-Kuo; Gau, Susan Shur-Fen; Huang, Hsien-Sung

2018-03-15

Visual system development is light-experience dependent, which strongly implicates epigenetic mechanisms in light-regulated maturation. Among many epigenetic processes, genomic imprinting is an epigenetic mechanism through which monoallelic gene expression occurs in a parent-of-origin-specific manner. It is unknown if genomic imprinting contributes to visual system development. We profiled the transcriptome and imprintome during critical periods of mouse visual system development under normal- and dark-rearing conditions using B6/CAST F1 hybrid mice. We identified experience-regulated, isoform-specific and brain-region-specific imprinted genes. We also found imprinted microRNAs were predominantly clustered into the Dlk1-Dio3 imprinted locus with light experience affecting some imprinted miRNA expression. Our findings provide the first comprehensive analysis of light-experience regulation of the transcriptome and imprintome during critical periods of visual system development. Our results may contribute to therapeutic strategies for visual impairments and circadian rhythm disorders resulting from a dysfunctional imprintome.

Accelerated rates of protein evolution in barley grain and pistil biased genes might be legacy of domestication.

PubMed

Shi, Tao; Dimitrov, Ivan; Zhang, Yinling; Tax, Frans E; Yi, Jing; Gou, Xiaoping; Li, Jia

2015-10-01

Traits related to grain and reproductive organs in grass crops have been under continuous directional selection during domestication. Barley is one of the oldest domesticated crops in human history. Thus genes associated with the grain and reproductive organs in barley may show evidence of dramatic evolutionary change. To understand how artificial selection contributes to protein evolution of biased genes in different barley organs, we used Digital Gene Expression analysis of six barley organs (grain, pistil, anther, leaf, stem and root) to identify genes with biased expression in specific organs. Pairwise comparisons of orthologs between barley and Brachypodium distachyon, as well as between highland and lowland barley cultivars mutually indicated that grain and pistil biased genes show relatively higher protein evolutionary rates compared with the median of all orthologs and other organ biased genes. Lineage-specific protein evolutionary rates estimation showed similar patterns with elevated protein evolution in barley grain and pistil biased genes, yet protein sequences generally evolve much faster in the lowland barley cultivar. Further functional annotations revealed that some of these grain and pistil biased genes with rapid protein evolution are related to nutrient biosynthesis and cell cycle/division. Our analyses provide insights into how domestication differentially shaped the evolution of genes specific to different organs of a crop species, and implications for future functional studies of domestication genes.

DNA methylation analysis of the gene CDKN2B in Gallus gallus (chicken).

PubMed

Gryzińska, Magdalena; Andraszek, Katarzyna; Jocek, Grzegorz

2013-01-01

Methylation is an epigenetic modification of DNA affecting gene expression without changing the structure of nucleotides. It plays a crucial role in the embryonic and post-embryonic development of living organisms. Methylation level is tissue and species-specific and changes with age. The study was aimed at identifying the methylation of the CDKN2B gene situated at locus bar in Polbar chickens on the 6th and 18th day of embryonic development using the MSP (methylation-specific PCR) method. Methylation was not detected in the promoter region of gene CDKN2B on the 6th and 18th day of embryonic development. As one of the five genes responsible for melanine activity in melanocytes and highly active, it can contribute to the production of this pigment. The present research broadens the current knowledge of the chicken epigenome and the mechanism of autosexing in birds.

Profiling of gene duplication patterns of sequenced teleost genomes: evidence for rapid lineage-specific genome expansion mediated by recent tandem duplications.

PubMed

Lu, Jianguo; Peatman, Eric; Tang, Haibao; Lewis, Joshua; Liu, Zhanjiang

2012-06-15

Gene duplication has had a major impact on genome evolution. Localized (or tandem) duplication resulting from unequal crossing over and whole genome duplication are believed to be the two dominant mechanisms contributing to vertebrate genome evolution. While much scrutiny has been directed toward discerning patterns indicative of whole-genome duplication events in teleost species, less attention has been paid to the continuous nature of gene duplications and their impact on the size, gene content, functional diversity, and overall architecture of teleost genomes. Here, using a Markov clustering algorithm directed approach we catalogue and analyze patterns of gene duplication in the four model teleost species with chromosomal coordinates: zebrafish, medaka, stickleback, and Tetraodon. Our analyses based on set size, duplication type, synonymous substitution rate (Ks), and gene ontology emphasize shared and lineage-specific patterns of genome evolution via gene duplication. Most strikingly, our analyses highlight the extraordinary duplication and retention rate of recent duplicates in zebrafish and their likely role in the structural and functional expansion of the zebrafish genome. We find that the zebrafish genome is remarkable in its large number of duplicated genes, small duplicate set size, biased Ks distribution toward minimal mutational divergence, and proportion of tandem and intra-chromosomal duplicates when compared with the other teleost model genomes. The observed gene duplication patterns have played significant roles in shaping the architecture of teleost genomes and appear to have contributed to the recent functional diversification and divergence of important physiological processes in zebrafish. We have analyzed gene duplication patterns and duplication types among the available teleost genomes and found that a large number of genes were tandemly and intrachromosomally duplicated, suggesting their origin of independent and continuous duplication. This is particularly true for the zebrafish genome. Further analysis of the duplicated gene sets indicated that a significant portion of duplicated genes in the zebrafish genome were of recent, lineage-specific duplication events. Most strikingly, a subset of duplicated genes is enriched among the recently duplicated genes involved in immune or sensory response pathways. Such findings demonstrated the significance of continuous gene duplication as well as that of whole genome duplication in the course of genome evolution.

From experimental design to functional gene networks: DNA microarray contribution to skin ageing research.

PubMed

Benech, P D; Patatian, A

2014-12-01

There is no doubt that the DNA microarray-based technology contributed to increase our knowledge of a wide range of processes. However, integrating genes into functional networks, rather than terms describing generic characteristics, remains an important challenge. The highly context-dependent function of a given gene and feedback mechanisms complexify greatly the interpretation of the data. Moreover, it is difficult to determine whether changes in gene expression are the result or the cause of pathologies or physiological events. In both cases, the difficulty relies on the involvement of processes that, at an early stage, can be protective and later on, deleterious because of their runaway. Each individual cell has its own transcription profile that determines its behaviour and its relationships with its neighbours. This is particularly true when a mechanism such as cell cycle is concerned. Another issue concerns the analyses from samples of different donors. Whereas the statistical tools lead to determine common features among groups, they tend to smooth the overall data and consequently, the selected values represent the 'tip of the iceberg'. There is a significant overlap in the set of genes identified in the different studies on skin ageing processes described in the present review. The reason of this overlap is because most of these genes belong to the basic machinery controlling cell growth and arrest. To get a more full picture of these processes, a hard work has still to be done to determine the precise mechanisms conferring the cell type specificity of ageing. Integrative biology applied to the huge amount of existing microarray data should fulfil gaps, through the characterization of additional actors accounting for the activation of specific signalling pathways at crossing points. Furthermore, computational tools have to be developed taking into account that expression values among similar groups may not vary 'by chance' but may reflect, along with other subtle changes, specific features of one given donor. Through a better stratification, these tools will allow to recover genes from the 'bottom of the iceberg'. Identifying these genes should contribute to understand how skin ages among individuals, thus paving the way for personalized skin care. © 2014 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

Survey of the Heritability and Sparse Architecture of Gene Expression Traits across Human Tissues.

PubMed

Wheeler, Heather E; Shah, Kaanan P; Brenner, Jonathon; Garcia, Tzintzuni; Aquino-Michaels, Keston; Cox, Nancy J; Nicolae, Dan L; Im, Hae Kyung

2016-11-01

Understanding the genetic architecture of gene expression traits is key to elucidating the underlying mechanisms of complex traits. Here, for the first time, we perform a systematic survey of the heritability and the distribution of effect sizes across all representative tissues in the human body. We find that local h2 can be relatively well characterized with 59% of expressed genes showing significant h2 (FDR < 0.1) in the DGN whole blood cohort. However, current sample sizes (n ≤ 922) do not allow us to compute distal h2. Bayesian Sparse Linear Mixed Model (BSLMM) analysis provides strong evidence that the genetic contribution to local expression traits is dominated by a handful of genetic variants rather than by the collective contribution of a large number of variants each of modest size. In other words, the local architecture of gene expression traits is sparse rather than polygenic across all 40 tissues (from DGN and GTEx) examined. This result is confirmed by the sparsity of optimal performing gene expression predictors via elastic net modeling. To further explore the tissue context specificity, we decompose the expression traits into cross-tissue and tissue-specific components using a novel Orthogonal Tissue Decomposition (OTD) approach. Through a series of simulations we show that the cross-tissue and tissue-specific components are identifiable via OTD. Heritability and sparsity estimates of these derived expression phenotypes show similar characteristics to the original traits. Consistent properties relative to prior GTEx multi-tissue analysis results suggest that these traits reflect the expected biology. Finally, we apply this knowledge to develop prediction models of gene expression traits for all tissues. The prediction models, heritability, and prediction performance R2 for original and decomposed expression phenotypes are made publicly available (https://github.com/hakyimlab/PrediXcan).

Horizontal gene acquisitions contributed to genome expansion in insect-symbiotic Spiroplasma clarkii.

PubMed

Tsai, Yi-Ming; Chang, An; Kuo, Chih-Horng

2018-06-01

Genome reduction is a recurring theme of symbiont evolution. The genus Spiroplasma contains species that are mostly facultative insect symbionts. The typical genome sizes of those species within the Apis clade were estimated to be ∼1.0-1.4 Mb. Intriguingly, Spiroplasma clarkii was found to have a genome size that is > 30% larger than the median of other species within the same clade. To investigate the molecular evolution events that led to the genome expansion of this bacterium, we determined its complete genome sequence and inferred the evolutionary origin of each protein-coding gene based on the phylogenetic distribution of homologs. Among the 1,346 annotated protein-coding genes, 641 were originated from within the Apis clade while 233 were putatively acquired from outside of the clade (including 91 high-confidence candidates). Additionally, 472 were specific to S. clarkii without homologs in the current database (i.e., the origins remained unknown). The acquisition of protein-coding genes, rather than mobile genetic elements, appeared to be a major contributing factor of genome expansion. Notably, >50% of the high-confidence acquired genes are related to carbohydrate transport and metabolism, suggesting that these acquired genes contributed to the expansion of both genome size and metabolic capability. The findings of this work provided an interesting case against the general evolutionary trend observed among symbiotic bacteria and further demonstrated the flexibility of Spiroplasma genomes. For future studies, investigation on the functional integration of these acquired genes, as well as the inference of their contribution to fitness could improve our knowledge of symbiont evolution.

Epigenetic determinants of ovarian clear cell carcinoma biology

PubMed Central

Yamaguchi, Ken; Huang, Zhiqing; Matsumura, Noriomi; Mandai, Masaki; Okamoto, Takako; Baba, Tsukasa; Konishi, Ikuo; Berchuck, Andrew; Murphy, Susan K.

2015-01-01

Targeted approaches have revealed frequent epigenetic alterations in ovarian cancer, but the scope and relation of these changes to histologic subtype of disease is unclear. Genome-wide methylation and expression data for 14 clear cell carcinoma (CCC), 32 non-CCC, and 4 corresponding normal cell lines were generated to determine how methylation profiles differ between cells of different histological derivations of ovarian cancer. Consensus clustering showed that CCC is epigenetically distinct. Inverse relationships between expression and methylation in CCC were identified, suggesting functional regulation by methylation, and included 22 hypomethylated (UM) genes and 276 hypermethylated (HM) genes. Categorical and pathway analyses indicated that the CCC-specific UM genes were involved in response to stress and many contain hepatocyte nuclear factor (HNF) 1 binding sites, while the CCC-specific HM genes included members of the estrogen receptor alpha (ERalpha) network and genes involved in tumor development. We independently validated the methylation status of 17 of these pathway-specific genes, and confirmed increased expression of HNF1 network genes and repression of ERalpha pathway genes in CCC cell lines and primary cancer tissues relative to non-CCC specimens. Treatment of three CCC cell lines with the demethylating agent Decitabine significantly induced expression for all five genes analyzed. Coordinate changes in pathway expression were confirmed using two primary ovarian cancer datasets (p<0.0001 for both). Our results suggest that methylation regulates specific pathways and biological functions in CCC, with hypomethylation influencing the characteristic biology of the disease while hypermethylation contributes to the carcinogenic process. PMID:24382740

Differential Network Analysis Reveals Evolutionary Complexity in Secondary Metabolism of Rauvolfia serpentina over Catharanthus roseus

PubMed Central

Pathania, Shivalika; Bagler, Ganesh; Ahuja, Paramvir S.

2016-01-01

Comparative co-expression analysis of multiple species using high-throughput data is an integrative approach to determine the uniformity as well as diversification in biological processes. Rauvolfia serpentina and Catharanthus roseus, both members of Apocyanacae family, are reported to have remedial properties against multiple diseases. Despite of sharing upstream of terpenoid indole alkaloid pathway, there is significant diversity in tissue-specific synthesis and accumulation of specialized metabolites in these plants. This led us to implement comparative co-expression network analysis to investigate the modules and genes responsible for differential tissue-specific expression as well as species-specific synthesis of metabolites. Toward these goals differential network analysis was implemented to identify candidate genes responsible for diversification of metabolites profile. Three genes were identified with significant difference in connectivity leading to differential regulatory behavior between these plants. These genes may be responsible for diversification of secondary metabolism, and thereby for species-specific metabolite synthesis. The network robustness of R. serpentina, determined based on topological properties, was also complemented by comparison of gene-metabolite networks of both plants, and may have evolved to have complex metabolic mechanisms as compared to C. roseus under the influence of various stimuli. This study reveals evolution of complexity in secondary metabolism of R. serpentina, and key genes that contribute toward diversification of specific metabolites. PMID:27588023

Differential Network Analysis Reveals Evolutionary Complexity in Secondary Metabolism of Rauvolfia serpentina over Catharanthus roseus.

PubMed

Pathania, Shivalika; Bagler, Ganesh; Ahuja, Paramvir S

2016-01-01

Comparative co-expression analysis of multiple species using high-throughput data is an integrative approach to determine the uniformity as well as diversification in biological processes. Rauvolfia serpentina and Catharanthus roseus, both members of Apocyanacae family, are reported to have remedial properties against multiple diseases. Despite of sharing upstream of terpenoid indole alkaloid pathway, there is significant diversity in tissue-specific synthesis and accumulation of specialized metabolites in these plants. This led us to implement comparative co-expression network analysis to investigate the modules and genes responsible for differential tissue-specific expression as well as species-specific synthesis of metabolites. Toward these goals differential network analysis was implemented to identify candidate genes responsible for diversification of metabolites profile. Three genes were identified with significant difference in connectivity leading to differential regulatory behavior between these plants. These genes may be responsible for diversification of secondary metabolism, and thereby for species-specific metabolite synthesis. The network robustness of R. serpentina, determined based on topological properties, was also complemented by comparison of gene-metabolite networks of both plants, and may have evolved to have complex metabolic mechanisms as compared to C. roseus under the influence of various stimuli. This study reveals evolution of complexity in secondary metabolism of R. serpentina, and key genes that contribute toward diversification of specific metabolites.

Human population-specific gene expression and transcriptional network modification with polymorphic transposable elements

PubMed Central

Wang, Lu; Mariño-Ramírez, Leonardo

2017-01-01

Abstract Transposable element (TE) derived sequences are known to contribute to the regulation of the human genome. The majority of known TE-derived regulatory sequences correspond to relatively ancient insertions, which are fixed across human populations. The extent to which human genetic variation caused by recent TE activity leads to regulatory polymorphisms among populations has yet to be thoroughly explored. In this study, we searched for associations between polymorphic TE (polyTE) loci and human gene expression levels using an expression quantitative trait loci (eQTL) approach. We compared locus-specific polyTE insertion genotypes to B cell gene expression levels among 445 individuals from 5 human populations. Numerous human polyTE loci correspond to both cis and trans eQTL, and their regulatory effects are directly related to cell type-specific function in the immune system. PolyTE loci are associated with differences in expression between European and African population groups, and a single polyTE loci is indirectly associated with the expression of numerous genes via the regulation of the B cell-specific transcription factor PAX5. The polyTE-gene expression associations we found indicate that human TE genetic variation can have important phenotypic consequences. Our results reveal that TE-eQTL are involved in population-specific gene regulation as well as transcriptional network modification. PMID:27998931

Meta-analysis of Polyploid Cotton QTL Shows Unequal Contributions of Subgenomes to a Complex Network of Genes and Gene Clusters Implicated in Lint Fiber Development

PubMed Central

Rong, Junkang; Feltus, F. Alex; Waghmare, Vijay N.; Pierce, Gary J.; Chee, Peng W.; Draye, Xavier; Saranga, Yehoshua; Wright, Robert J.; Wilkins, Thea A.; May, O. Lloyd; Smith, C. Wayne; Gannaway, John R.; Wendel, Jonathan F.; Paterson, Andrew H.

2007-01-01

QTL mapping experiments yield heterogeneous results due to the use of different genotypes, environments, and sampling variation. Compilation of QTL mapping results yields a more complete picture of the genetic control of a trait and reveals patterns in organization of trait variation. A total of 432 QTL mapped in one diploid and 10 tetraploid interspecific cotton populations were aligned using a reference map and depicted in a CMap resource. Early demonstrations that genes from the non-fiber-producing diploid ancestor contribute to tetraploid lint fiber genetics gain further support from multiple populations and environments and advanced-generation studies detecting QTL of small phenotypic effect. Both tetraploid subgenomes contribute QTL at largely non-homeologous locations, suggesting divergent selection acting on many corresponding genes before and/or after polyploid formation. QTL correspondence across studies was only modest, suggesting that additional QTL for the target traits remain to be discovered. Crosses between closely-related genotypes differing by single-gene mutants yield profoundly different QTL landscapes, suggesting that fiber variation involves a complex network of interacting genes. Members of the lint fiber development network appear clustered, with cluster members showing heterogeneous phenotypic effects. Meta-analysis linked to synteny-based and expression-based information provides clues about specific genes and families involved in QTL networks. PMID:17565937

Meta-analysis of polyploid cotton QTL shows unequal contributions of subgenomes to a complex network of genes and gene clusters implicated in lint fiber development.

PubMed

Rong, Junkang; Feltus, F Alex; Waghmare, Vijay N; Pierce, Gary J; Chee, Peng W; Draye, Xavier; Saranga, Yehoshua; Wright, Robert J; Wilkins, Thea A; May, O Lloyd; Smith, C Wayne; Gannaway, John R; Wendel, Jonathan F; Paterson, Andrew H

2007-08-01

QTL mapping experiments yield heterogeneous results due to the use of different genotypes, environments, and sampling variation. Compilation of QTL mapping results yields a more complete picture of the genetic control of a trait and reveals patterns in organization of trait variation. A total of 432 QTL mapped in one diploid and 10 tetraploid interspecific cotton populations were aligned using a reference map and depicted in a CMap resource. Early demonstrations that genes from the non-fiber-producing diploid ancestor contribute to tetraploid lint fiber genetics gain further support from multiple populations and environments and advanced-generation studies detecting QTL of small phenotypic effect. Both tetraploid subgenomes contribute QTL at largely non-homeologous locations, suggesting divergent selection acting on many corresponding genes before and/or after polyploid formation. QTL correspondence across studies was only modest, suggesting that additional QTL for the target traits remain to be discovered. Crosses between closely-related genotypes differing by single-gene mutants yield profoundly different QTL landscapes, suggesting that fiber variation involves a complex network of interacting genes. Members of the lint fiber development network appear clustered, with cluster members showing heterogeneous phenotypic effects. Meta-analysis linked to synteny-based and expression-based information provides clues about specific genes and families involved in QTL networks.

DNA hypermethylation profiles in squamous cell carcinoma of the vulva.

PubMed

Stephen, Josena K; Chen, Kang Mei; Raitanen, Misa; Grénman, Seija; Worsham, Maria J

2009-01-01

Gene silencing through promoter hypermethylation is a growing concept in the development of human cancers. In this study, we examined the contribution of aberrant methylation of promoter regions in methylation-prone tumor suppressors to the pathogenesis of vulvar cancer. Thirteen cell lines from 12 patients with squamous cell carcinoma of the vulva were evaluated for aberrant methylation status and gene copy number alterations, concomitantly, using the methylation-specific multiplex ligation-dependent probe amplification assay. Of the 22 tumor suppressor genes examined, aberrant methylation was observed for 9 genes: tumor protein p73 (TP73), fragile histidine triad (FHIT), von Hippel-Lindau (VHL), adenomatosis polyposis coli (APC), estrogen receptor 1 (ESR1), cyclin-dependent kinase inhibitor 2B (CDKN2B), death-associated protein kinase 1 (DAPK1), glutathione S-transferase pi (GSTP1), and immunoglobin superfamily, member 4 (IGSF4). The most frequently methylated genes included TP73 in 9 of 13 cell lines, and IGSF4, DAPK1, and FHIT in 3 of 13 cell lines. Methylation-specific polymerase chain reaction was performed for TP73 and FHIT to confirm aberrant methylation by methylation-specific multiplex ligation-dependent probe amplification. In the context of gene copy number and methylation status, both copies of the TP73 gene were hypermethylated. Loss or decreased mRNA expression of TP73 and IGSF4 by reverse transcription polymerase chain reaction confirmed aberrant methylation. Frequent genetic alterations of loss and gain of gene copy number included gain of GSTP1 and multiple endocrine neoplasia type 1 (MEN1), and loss of malignant fibrous histiocytoma amplified sequence 1 (MFHAS1) and IGSF4 in over 50% of the squamous cell carcinoma of the vulva cell lines. These findings underscore the contribution of both genetic and epigenetic events to the underlying pathogenesis of squamous cell carcinoma of the vulva.

HRP2 determines the efficiency and specificity of HIV-1 integration in LEDGF/p75 knockout cells but does not contribute to the antiviral activity of a potent LEDGF/p75-binding site integrase inhibitor.

PubMed

Wang, Hao; Jurado, Kellie A; Wu, Xiaolin; Shun, Ming-Chieh; Li, Xiang; Ferris, Andrea L; Smith, Steven J; Patel, Pratiq A; Fuchs, James R; Cherepanov, Peter; Kvaratskhelia, Mamuka; Hughes, Stephen H; Engelman, Alan

2012-12-01

The binding of integrase (IN) to lens epithelium-derived growth factor (LEDGF)/p75 in large part determines the efficiency and specificity of HIV-1 integration. However, a significant residual preference for integration into active genes persists in Psip1 (the gene that encodes for LEDGF/p75) knockout (KO) cells. One other cellular protein, HRP2, harbors both the PWWP and IN-binding domains that are important for LEDGF/p75 co-factor function. To assess the role of HRP2 in HIV-1 integration, cells generated from Hdgfrp2 (the gene that encodes for HRP2) and Psip1/Hdgfrp2 KO mice were infected alongside matched control cells. HRP2 depleted cells supported normal infection, while disruption of Hdgfrp2 in Psip1 KO cells yielded additional defects in the efficiency and specificity of integration. These deficits were largely restored by ectopic expression of either LEDGF/p75 or HRP2. The double-KO cells nevertheless supported residual integration into genes, indicating that IN and/or other host factors contribute to integration specificity in the absence of LEDGF/p75 and HRP2. Psip1 KO significantly increased the potency of an allosteric inhibitor that binds the LEDGF/p75 binding site on IN, a result that was not significantly altered by Hdgfrp2 disruption. These findings help to rule out the host factor-IN interactions as the primary antiviral targets of LEDGF/p75-binding site IN inhibitors.

A comprehensive study of the genomic differentiation between temperate Dent and Flint maize.

PubMed

Unterseer, Sandra; Pophaly, Saurabh D; Peis, Regina; Westermeier, Peter; Mayer, Manfred; Seidel, Michael A; Haberer, Georg; Mayer, Klaus F X; Ordas, Bernardo; Pausch, Hubert; Tellier, Aurélien; Bauer, Eva; Schön, Chris-Carolin

2016-07-08

Dent and Flint represent two major germplasm pools exploited in maize breeding. Several traits differentiate the two pools, like cold tolerance, early vigor, and flowering time. A comparative investigation of their genomic architecture relevant for quantitative trait expression has not been reported so far. Understanding the genomic differences between germplasm pools may contribute to a better understanding of the complementarity in heterotic patterns exploited in hybrid breeding and of mechanisms involved in adaptation to different environments. We perform whole-genome screens for signatures of selection specific to temperate Dent and Flint maize by comparing high-density genotyping data of 70 American and European Dent and 66 European Flint inbred lines. We find 2.2 % and 1.4 % of the genes are under selective pressure, respectively, and identify candidate genes associated with agronomic traits known to differ between the two pools. Taking flowering time as an example for the differentiation between Dent and Flint, we investigate candidate genes involved in the flowering network by phenotypic analyses in a Dent-Flint introgression library and find that the Flint haplotypes of the candidates promote earlier flowering. Within the flowering network, the majority of Flint candidates are associated with endogenous pathways in contrast to Dent candidate genes, which are mainly involved in response to environmental factors like light and photoperiod. The diversity patterns of the candidates in a unique panel of more than 900 individuals from 38 European landraces indicate a major contribution of landraces from France, Germany, and Spain to the candidate gene diversity of the Flint elite lines. In this study, we report the investigation of pool-specific differences between temperate Dent and Flint on a genome-wide scale. The identified candidate genes represent a promising source for the functional investigation of pool-specific haplotypes in different genetic backgrounds and for the evaluation of their potential for future crop improvement like the adaptation to specific environments.

Massive contribution of transposable elements to mammalian regulatory sequences.

PubMed

Rayan, Nirmala Arul; Del Rosario, Ricardo C H; Prabhakar, Shyam

2016-09-01

Barbara McClintock discovered the existence of transposable elements (TEs) in the late 1940s and initially proposed that they contributed to the gene regulatory program of higher organisms. This controversial idea gained acceptance only much later in the 1990s, when the first examples of TE-derived promoter sequences were uncovered. It is now known that half of the human genome is recognizably derived from TEs. It is thus important to understand the scope and nature of their contribution to gene regulation. Here, we provide a timeline of major discoveries in this area and discuss how transposons have revolutionized our understanding of mammalian genomes, with a special emphasis on the massive contribution of TEs to primate evolution. Our analysis of primate-specific functional elements supports a simple model for the rate at which new functional elements arise in unique and TE-derived DNA. Finally, we discuss some of the challenges and unresolved questions in the field, which need to be addressed in order to fully characterize the impact of TEs on gene regulation, evolution and disease processes. Copyright © 2016 Elsevier Ltd. All rights reserved.

Nucleus-specific expression in the multinuclear mushroom-forming fungus Agaricus bisporus reveals different nuclear regulatory programs.

PubMed

Gehrmann, Thies; Pelkmans, Jordi F; Ohm, Robin A; Vos, Aurin M; Sonnenberg, Anton S M; Baars, Johan J P; Wösten, Han A B; Reinders, Marcel J T; Abeel, Thomas

2018-04-24

Many fungi are polykaryotic, containing multiple nuclei per cell. In the case of heterokaryons, there are different nuclear types within a single cell. It is unknown what the different nuclear types contribute in terms of mRNA expression levels in fungal heterokaryons. Each cell of the mushroom Agaricus bisporus contains two to 25 nuclei of two nuclear types originating from two parental strains. Using RNA-sequencing data, we assess the differential mRNA contribution of individual nuclear types and its functional impact. We studied differential expression between genes of the two nuclear types, P1 and P2, throughout mushroom development in various tissue types. P1 and P2 produced specific mRNA profiles that changed through mushroom development. Differential regulation occurred at the gene level, rather than at the locus, chromosomal, or nuclear level. P1 dominated mRNA production throughout development, and P2 showed more differentially up-regulated genes in important functional groups. In the vegetative mycelium, P2 up-regulated almost threefold more metabolism genes and carbohydrate active enzymes (cazymes) than P1, suggesting phenotypic differences in growth. We identified widespread transcriptomic variation between the nuclear types of A. bisporus Our method enables studying nucleus-specific expression, which likely influences the phenotype of a fungus in a polykaryotic stage. Our findings have a wider impact to better understand gene regulation in fungi in a heterokaryotic state. This work provides insight into the transcriptomic variation introduced by genomic nuclear separation. Copyright © 2018 the Author(s). Published by PNAS.

Role of T cell receptor delta gene in susceptibility to celiac disease.

PubMed

Roschmann, E; Wienker, T F; Volk, B A

1996-02-01

There is a strong genetic influence on the susceptibility to celiac disease. Although in the vast majority of patients with celiac disease, the HLA-DQ(alpha1*0501, beta1*0201) heterodimer encoded by the alleles HLA-DQA1*0501 and HLA-DQB1*0201 seems to confer the primary disease susceptibility, it cannot be excluded that other genes contribute to disease susceptibility, as indicated by the difference in concordance rates between monozygotic twins and HLA identical siblings (70% vs. 30%). Obviously other genes involved in the genetic control of T cell mediated immune response could potentially influence susceptibility to celiac disease. The density of T cells using the gammadelta T cell receptor (TCR) is considerably increased in the jejunal epithelium of patients with celiac disease, an abnormality considered to be specific for celiac disease. This suggests an involvement of gammadelta T cells in the pathogenesis of the disease. To ascertain whether the TCR delta (TCRD) gene contributes to celiac disease susceptibility we carried out an association study and genetic linkage analysis using a highly polymorphic microsatellite marker at the TCRD locus on chromosome 14q11.2. The association study demonstrated no significant difference in allele frequencies of the TCRD gene marker between celiac disease patients and controls; accordingly, the relative risk estimates did not reach the level of statistical significance. In the linkage analysis, performed in 23 families, the logarithm of the odds (LOD) scores calculated for celiac disease versus the TCRD gene marker excluded linkage, suggesting that there is no determinant contributing to celiac disease status at or 5 cM distant to the analyzed TCRD gene marker. In conclusion, the results of the present study provide no evidence that the analyzed TCRD gene contributes substantially to celiac disease susceptibility.

Seed maturation associated transcriptional programs and regulatory networks underlying genotypic difference in seed dormancy and size/weight in wheat (Triticum aestivum L.).

PubMed

Yamasaki, Yuji; Gao, Feng; Jordan, Mark C; Ayele, Belay T

2017-09-16

Maturation forms one of the critical seed developmental phases and it is characterized mainly by programmed cell death, dormancy and desiccation, however, the transcriptional programs and regulatory networks underlying acquisition of dormancy and deposition of storage reserves during the maturation phase of seed development are poorly understood in wheat. The present study performed comparative spatiotemporal transcriptomic analysis of seed maturation in two wheat genotypes with contrasting seed weight/size and dormancy phenotype. The embryo and endosperm tissues of maturing seeds appeared to exhibit genotype-specific temporal shifts in gene expression profile that might contribute to the seed phenotypic variations. Functional annotations of gene clusters suggest that the two tissues exhibit distinct but genotypically overlapping molecular functions. Motif enrichment predicts genotypically distinct abscisic acid (ABA) and gibberellin (GA) regulated transcriptional networks contribute to the contrasting seed weight/size and dormancy phenotypes between the two genotypes. While other ABA responsive element (ABRE) motifs are enriched in both genotypes, the prevalence of G-box-like motif specifically in tissues of the dormant genotype suggests distinct ABA mediated transcriptional mechanisms control the establishment of dormancy during seed maturation. In agreement with this, the bZIP transcription factors that co-express with ABRE enriched embryonic genes differ with genotype. The enrichment of SITEIIATCYTC motif specifically in embryo clusters of maturing seeds irrespective of genotype predicts a tissue specific role for the respective TCP transcription factors with no or minimal contribution to the variations in seed dormancy. The results of this study advance our understanding of the seed maturation associated molecular mechanisms underlying variation in dormancy and weight/size in wheat seeds, which is a critical step towards the designing of molecular strategies for enhancing seed yield and quality.

Genome-wide identification of bacterial plant colonization genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cole, Benjamin J.; Feltcher, Meghan E.; Waters, Robert J.

Diverse soil-resident bacteria can contribute to plant growth and health, but the molecular mechanisms enabling them to effectively colonize their plant hosts remain poorly understood. We used randomly barcoded transposon mutagenesis sequencing (RB-TnSeq) in Pseudomonas simiae, a model root-colonizing bacterium, to establish a genome-wide map of bacterial genes required for colonization of the Arabidopsis thaliana root system. We identified 115 genes (2% of all P. simiae genes) with functions that are required for maximal competitive colonization of the root system. Among the genes we identified were some with obvious colonization-related roles in motility and carbon metabolism, as well as 44more » other genes that had no or vague functional predictions. Independent validation assays of individual genes confirmed colonization functions for 20 of 22 (91%) cases tested. To further characterize genes identified by our screen, we compared the functional contributions of P. simiae genes to growth in 90 distinct in vitro conditions by RB-TnSeq, highlighting specific metabolic functions associated with root colonization genes. Here, our analysis of bacterial genes by sequence-driven saturation mutagenesis revealed a genome-wide map of the genetic determinants of plant root colonization and offers a starting point for targeted improvement of the colonization capabilities of plant-beneficial microbes.« less

Genome-wide identification of bacterial plant colonization genes

DOE PAGES

Cole, Benjamin J.; Feltcher, Meghan E.; Waters, Robert J.; ...

2017-09-22

Diverse soil-resident bacteria can contribute to plant growth and health, but the molecular mechanisms enabling them to effectively colonize their plant hosts remain poorly understood. We used randomly barcoded transposon mutagenesis sequencing (RB-TnSeq) in Pseudomonas simiae, a model root-colonizing bacterium, to establish a genome-wide map of bacterial genes required for colonization of the Arabidopsis thaliana root system. We identified 115 genes (2% of all P. simiae genes) with functions that are required for maximal competitive colonization of the root system. Among the genes we identified were some with obvious colonization-related roles in motility and carbon metabolism, as well as 44more » other genes that had no or vague functional predictions. Independent validation assays of individual genes confirmed colonization functions for 20 of 22 (91%) cases tested. To further characterize genes identified by our screen, we compared the functional contributions of P. simiae genes to growth in 90 distinct in vitro conditions by RB-TnSeq, highlighting specific metabolic functions associated with root colonization genes. Here, our analysis of bacterial genes by sequence-driven saturation mutagenesis revealed a genome-wide map of the genetic determinants of plant root colonization and offers a starting point for targeted improvement of the colonization capabilities of plant-beneficial microbes.« less

Epigenetic events underlie the pathogenesis of sinonasal papillomas.

PubMed

Stephen, Josena K; Vaught, Lori E; Chen, Kang M; Sethi, Seema; Shah, Veena; Benninger, Michael S; Gardner, Glendon M; Schweitzer, Vanessa G; Khan, Mumtaz; Worsham, Maria J

2007-10-01

Benign inverted papillomas have been reported as monoclonal but lacking common genetic alterations identified in squamous cell carcinoma of the head and neck. Epigenetic changes alter the heritable state of gene expression and chromatin organization without change in DNA sequence. We investigated whether epigenetic events of aberrant promoter hypermethylation in genes known to be involved in squamous head and neck cancer underlie the pathogenesis of sinonasal papillomas. Ten formalin-fixed paraffin DNA samples from three inverted papilloma cases, two exophytic (everted) papilloma cases, and two cases with inverted and exophytic components were studied. DNA was obtained from microdissected areas of normal and papilloma areas and examined using a panel of 41 gene probes, designed to interrogate 35 unique genes for aberrant methylation status (22 genes) using the methylation-specific multiplex-ligation-specific polymerase assay. Methylation-specific PCR was employed to confirm aberrant methylation detected by the methylation-specific multiplex-ligation-specific polymerase assay. All seven cases indicated at least one epigenetic event of aberrant promoter hypermethylation. The CDKN2B gene was a consistent target of aberrant methylation in six of seven cases. Methylation-specific PCR confirmed hypermethylation of CDKN2B. Recurrent biopsies from two inverted papilloma cases had common epigenetic events. Promoter hypermethylation of CDKN2B was a consistent epigenetic event. Common epigenetic alterations in recurrent biopsies underscore a monoclonal origin for these lesions. Epigenetic events contribute to the underlying pathogenesis of benign inverted and exophytic papillomas. As a consistent target of aberrant promoter hypermethylation, CDKN2B may serve as an important epigenetic biomarker for gene reactivation studies.

Tissue-Specific Transcriptomic Profiling of Sorghum propinquum using a Rice Genome Array

PubMed Central

Zhang, Ting; Zhao, Xiuqin; Huang, Liyu; Liu, Xiaoyue; Zong, Ying; Zhu, Linghua; Yang, Daichang; Fu, Binying

2013-01-01

Sorghum (Sorghum bicolor) is one of the world's most important cereal crops. S. propinquum is a perennial wild relative of S. bicolor with well-developed rhizomes. Functional genomics analysis of S. propinquum, especially with respect to molecular mechanisms related to rhizome growth and development, can contribute to the development of more sustainable grain, forage, and bioenergy cropping systems. In this study, we used a whole rice genome oligonucleotide microarray to obtain tissue-specific gene expression profiles of S. propinquum with special emphasis on rhizome development. A total of 548 tissue-enriched genes were detected, including 31 and 114 unique genes that were expressed predominantly in the rhizome tips (RT) and internodes (RI), respectively. Further GO analysis indicated that the functions of these tissue-enriched genes corresponded to their characteristic biological processes. A few distinct cis-elements, including ABA-responsive RY repeat CATGCA, sugar-repressive TTATCC, and GA-responsive TAACAA, were found to be prevalent in RT-enriched genes, implying an important role in rhizome growth and development. Comprehensive comparative analysis of these rhizome-enriched genes and rhizome-specific genes previously identified in Oryza longistaminata and S. propinquum indicated that phytohormones, including ABA, GA, and SA, are key regulators of gene expression during rhizome development. Co-localization of rhizome-enriched genes with rhizome-related QTLs in rice and sorghum generated functional candidates for future cloning of genes associated with rhizome growth and development. PMID:23536906

Topological analysis of metabolic networks integrating co-segregating transcriptomes and metabolomes in type 2 diabetic rat congenic series.

PubMed

Dumas, Marc-Emmanuel; Domange, Céline; Calderari, Sophie; Martínez, Andrea Rodríguez; Ayala, Rafael; Wilder, Steven P; Suárez-Zamorano, Nicolas; Collins, Stephan C; Wallis, Robert H; Gu, Quan; Wang, Yulan; Hue, Christophe; Otto, Georg W; Argoud, Karène; Navratil, Vincent; Mitchell, Steve C; Lindon, John C; Holmes, Elaine; Cazier, Jean-Baptiste; Nicholson, Jeremy K; Gauguier, Dominique

2016-09-30

The genetic regulation of metabolic phenotypes (i.e., metabotypes) in type 2 diabetes mellitus occurs through complex organ-specific cellular mechanisms and networks contributing to impaired insulin secretion and insulin resistance. Genome-wide gene expression profiling systems can dissect the genetic contributions to metabolome and transcriptome regulations. The integrative analysis of multiple gene expression traits and metabolic phenotypes (i.e., metabotypes) together with their underlying genetic regulation remains a challenge. Here, we introduce a systems genetics approach based on the topological analysis of a combined molecular network made of genes and metabolites identified through expression and metabotype quantitative trait locus mapping (i.e., eQTL and mQTL) to prioritise biological characterisation of candidate genes and traits. We used systematic metabotyping by 1 H NMR spectroscopy and genome-wide gene expression in white adipose tissue to map molecular phenotypes to genomic blocks associated with obesity and insulin secretion in a series of rat congenic strains derived from spontaneously diabetic Goto-Kakizaki (GK) and normoglycemic Brown-Norway (BN) rats. We implemented a network biology strategy approach to visualize the shortest paths between metabolites and genes significantly associated with each genomic block. Despite strong genomic similarities (95-99 %) among congenics, each strain exhibited specific patterns of gene expression and metabotypes, reflecting the metabolic consequences of series of linked genetic polymorphisms in the congenic intervals. We subsequently used the congenic panel to map quantitative trait loci underlying specific mQTLs and genome-wide eQTLs. Variation in key metabolites like glucose, succinate, lactate, or 3-hydroxybutyrate and second messenger precursors like inositol was associated with several independent genomic intervals, indicating functional redundancy in these regions. To navigate through the complexity of these association networks we mapped candidate genes and metabolites onto metabolic pathways and implemented a shortest path strategy to highlight potential mechanistic links between metabolites and transcripts at colocalized mQTLs and eQTLs. Minimizing the shortest path length drove prioritization of biological validations by gene silencing. These results underline the importance of network-based integration of multilevel systems genetics datasets to improve understanding of the genetic architecture of metabotype and transcriptomic regulation and to characterize novel functional roles for genes determining tissue-specific metabolism.

NRSF-dependent epigenetic mechanisms contribute to programming of stress-sensitive neurons by neonatal experience, promoting resilience.

PubMed

Singh-Taylor, A; Molet, J; Jiang, S; Korosi, A; Bolton, J L; Noam, Y; Simeone, K; Cope, J; Chen, Y; Mortazavi, A; Baram, T Z

2018-03-01

Resilience to stress-related emotional disorders is governed in part by early-life experiences. Here we demonstrate experience-dependent re-programming of stress-sensitive hypothalamic neurons, which takes place through modification of neuronal gene expression via epigenetic mechanisms. Specifically, we found that augmented maternal care reduced glutamatergic synapses onto stress-sensitive hypothalamic neurons and repressed expression of the stress-responsive gene, Crh. In hypothalamus in vitro, reduced glutamatergic neurotransmission recapitulated the repressive effects of augmented maternal care on Crh, and this required recruitment of the transcriptional repressor repressor element-1 silencing transcription factor/neuron restrictive silencing factor (NRSF). Increased NRSF binding to chromatin was accompanied by sequential repressive epigenetic changes which outlasted NRSF binding. chromatin immunoprecipitation-seq analyses of NRSF targets identified gene networks that, in addition to Crh, likely contributed to the augmented care-induced phenotype, including diminished depression-like and anxiety-like behaviors. Together, we believe these findings provide the first causal link between enriched neonatal experience, synaptic refinement and induction of epigenetic processes within specific neurons. They uncover a novel mechanistic pathway from neonatal environment to emotional resilience.

β-Aminoisobutyric Acid Induces Browning of White Fat and Hepatic β-oxidation and is Inversely Correlated with Cardiometabolic Risk Factors

PubMed Central

Roberts, Lee D.; Boström, Pontus; O’Sullivan, John F.; Schinzel, Robert T.; Lewis, Gregory D.; Dejam, Andre; Lee, Youn-Kyoung; Palma, Melinda J.; Calhoun, Sondra; Georgiadi, Anastasia; Chen, Ming-Huei; Ramachandran, Vasan S.; Larson, Martin G.; Bouchard, Claude; Rankinen, Tuomo; Souza, Amanda L.; Clish, Clary B.; Wang, Thomas J.; Estall, Jennifer L.; Soukas, Alexander A.; Cowan, Chad A.; Spiegelman, Bruce M.; Gerszten, Robert E.

2014-01-01

Summary The transcriptional co-activator peroxisome proliferator-activated receptor-gamma co-activator-1 α (PGC-1α) regulates metabolic genes in skeletal muscle, and contributes substantially to the response of muscle to exercise. Muscle specific PGC-1α transgenic expression and exercise both increase the expression of thermogenic genes within white adipose. How the PGC-1α mediated response to exercise in muscle conveys signals to other tissues remains incompletely defined. We employed a metabolic profiling approach to examine metabolites secreted from myocytes with forced expression of PGC-1α, and identified β-aminoisobutyric acid (BAIBA) as a novel small molecule myokine. BAIBA increases the expression of brown adipocyte-specific genes in white adipose tissue and fatty acid β-oxidation in hepatocytes both in vitro and in vivo through a PPARα mediated mechanism, induces a brown adipose-like phenotype in human pluripotent stem cells, and improves glucose homeostasis in mice. In humans, plasma BAIBA concentrations are increased with exercise and inversely associated with metabolic risk factors. BAIBA may thus contribute to exercise-induced protection from metabolic diseases. PMID:24411942

The Sorghum bicolor genome and the diversification of grasses

DOE Office of Scientific and Technical Information (OSTI.GOV)

Paterson, Andrew H.; Bowers, John E.; Bruggmann, Remy

2008-08-20

Sorghum, an African grass related to sugar cane and maize, is grown for food, feed, fibre and fuel. We present an initial analysis of the approx730-megabase Sorghum bicolor (L.) Moench genome, placing approx98percent of genes in their chromosomal context using whole-genome shotgun sequence validated by genetic, physical and syntenic information. Genetic recombination is largely confined to about one-third of the sorghum genome with gene order and density similar to those of rice. Retrotransposon accumulation in recombinationally recalcitrant heterochromatin explains the approx75percent larger genome size of sorghum compared with rice. Although gene and repetitive DNA distributions have been preserved since palaeopolyploidizationmore » approx70 million years ago, most duplicated gene sets lost one member before the sorghum rice divergence. Concerted evolution makes one duplicated chromosomal segment appear to be only a few million years old. About 24percent of genes are grass-specific and 7percent are sorghum-specific. Recent gene and microRNA duplications may contribute to sorghum's drought tolerance.« less

The Sorghum bicolor genome and the diversification of grasses.

PubMed

Paterson, Andrew H; Bowers, John E; Bruggmann, Rémy; Dubchak, Inna; Grimwood, Jane; Gundlach, Heidrun; Haberer, Georg; Hellsten, Uffe; Mitros, Therese; Poliakov, Alexander; Schmutz, Jeremy; Spannagl, Manuel; Tang, Haibao; Wang, Xiyin; Wicker, Thomas; Bharti, Arvind K; Chapman, Jarrod; Feltus, F Alex; Gowik, Udo; Grigoriev, Igor V; Lyons, Eric; Maher, Christopher A; Martis, Mihaela; Narechania, Apurva; Otillar, Robert P; Penning, Bryan W; Salamov, Asaf A; Wang, Yu; Zhang, Lifang; Carpita, Nicholas C; Freeling, Michael; Gingle, Alan R; Hash, C Thomas; Keller, Beat; Klein, Patricia; Kresovich, Stephen; McCann, Maureen C; Ming, Ray; Peterson, Daniel G; Mehboob-ur-Rahman; Ware, Doreen; Westhoff, Peter; Mayer, Klaus F X; Messing, Joachim; Rokhsar, Daniel S

2009-01-29

Sorghum, an African grass related to sugar cane and maize, is grown for food, feed, fibre and fuel. We present an initial analysis of the approximately 730-megabase Sorghum bicolor (L.) Moench genome, placing approximately 98% of genes in their chromosomal context using whole-genome shotgun sequence validated by genetic, physical and syntenic information. Genetic recombination is largely confined to about one-third of the sorghum genome with gene order and density similar to those of rice. Retrotransposon accumulation in recombinationally recalcitrant heterochromatin explains the approximately 75% larger genome size of sorghum compared with rice. Although gene and repetitive DNA distributions have been preserved since palaeopolyploidization approximately 70 million years ago, most duplicated gene sets lost one member before the sorghum-rice divergence. Concerted evolution makes one duplicated chromosomal segment appear to be only a few million years old. About 24% of genes are grass-specific and 7% are sorghum-specific. Recent gene and microRNA duplications may contribute to sorghum's drought tolerance.

Comprehensive analysis of TCP transcription factors and their expression during cotton (Gossypium arboreum) fiber early development

PubMed Central

Ma, Jun; Liu, Fang; Wang, Qinglian; Wang, Kunbo; Jones, Don C.; Zhang, Baohong

2016-01-01

TCP proteins are plant-specific transcription factors implicated to perform a variety of physiological functions during plant growth and development. In the current study, we performed for the first time the comprehensive analysis of TCP gene family in a diploid cotton species, Gossypium arboreum, including phylogenetic analysis, chromosome location, gene duplication status, gene structure and conserved motif analysis, as well as expression profiles in fiber at different developmental stages. Our results showed that G. arboreum contains 36 TCP genes, distributing across all of the thirteen chromosomes. GaTCPs within the same subclade of the phylogenetic tree shared similar exon/intron organization and motif composition. In addition, both segmental duplication and whole-genome duplication contributed significantly to the expansion of GaTCPs. Many these TCP transcription factor genes are specifically expressed in cotton fiber during different developmental stages, including cotton fiber initiation and early development. This suggests that TCP genes may play important roles in cotton fiber development. PMID:26857372

Comprehensive analysis of TCP transcription factors and their expression during cotton (Gossypium arboreum) fiber early development.

PubMed

Ma, Jun; Liu, Fang; Wang, Qinglian; Wang, Kunbo; Jones, Don C; Zhang, Baohong

2016-02-09

TCP proteins are plant-specific transcription factors implicated to perform a variety of physiological functions during plant growth and development. In the current study, we performed for the first time the comprehensive analysis of TCP gene family in a diploid cotton species, Gossypium arboreum, including phylogenetic analysis, chromosome location, gene duplication status, gene structure and conserved motif analysis, as well as expression profiles in fiber at different developmental stages. Our results showed that G. arboreum contains 36 TCP genes, distributing across all of the thirteen chromosomes. GaTCPs within the same subclade of the phylogenetic tree shared similar exon/intron organization and motif composition. In addition, both segmental duplication and whole-genome duplication contributed significantly to the expansion of GaTCPs. Many these TCP transcription factor genes are specifically expressed in cotton fiber during different developmental stages, including cotton fiber initiation and early development. This suggests that TCP genes may play important roles in cotton fiber development.

Accelerated recruitment of new brain development genes into the human genome.

PubMed

Zhang, Yong E; Landback, Patrick; Vibranovski, Maria D; Long, Manyuan

2011-10-01

How the human brain evolved has attracted tremendous interests for decades. Motivated by case studies of primate-specific genes implicated in brain function, we examined whether or not the young genes, those emerging genome-wide in the lineages specific to the primates or rodents, showed distinct spatial and temporal patterns of transcription compared to old genes, which had existed before primate and rodent split. We found consistent patterns across different sources of expression data: there is a significantly larger proportion of young genes expressed in the fetal or infant brain of humans than in mouse, and more young genes in humans have expression biased toward early developing brains than old genes. Most of these young genes are expressed in the evolutionarily newest part of human brain, the neocortex. Remarkably, we also identified a number of human-specific genes which are expressed in the prefrontal cortex, which is implicated in complex cognitive behaviors. The young genes upregulated in the early developing human brain play diverse functional roles, with a significant enrichment of transcription factors. Genes originating from different mechanisms show a similar expression bias in the developing brain. Moreover, we found that the young genes upregulated in early brain development showed rapid protein evolution compared to old genes also expressed in the fetal brain. Strikingly, genes expressed in the neocortex arose soon after its morphological origin. These four lines of evidence suggest that positive selection for brain function may have contributed to the origination of young genes expressed in the developing brain. These data demonstrate a striking recruitment of new genes into the early development of the human brain.

Visual gene-network analysis reveals the cancer gene co-expression in human endometrial cancer

PubMed Central

2014-01-01

Background Endometrial cancers (ECs) are the most common form of gynecologic malignancy. Recent studies have reported that ECs reveal distinct markers for molecular pathogenesis, which in turn is linked to the various histological types of ECs. To understand further the molecular events contributing to ECs and endometrial tumorigenesis in general, a more precise identification of cancer-associated molecules and signaling networks would be useful for the detection and monitoring of malignancy, improving clinical cancer therapy, and personalization of treatments. Results ECs-specific gene co-expression networks were constructed by differential expression analysis and weighted gene co-expression network analysis (WGCNA). Important pathways and putative cancer hub genes contribution to tumorigenesis of ECs were identified. An elastic-net regularized classification model was built using the cancer hub gene signatures to predict the phenotypic characteristics of ECs. The 19 cancer hub gene signatures had high predictive power to distinguish among three key principal features of ECs: grade, type, and stage. Intriguingly, these hub gene networks seem to contribute to ECs progression and malignancy via cell-cycle regulation, antigen processing and the citric acid (TCA) cycle. Conclusions The results of this study provide a powerful biomarker discovery platform to better understand the progression of ECs and to uncover potential therapeutic targets in the treatment of ECs. This information might lead to improved monitoring of ECs and resulting improvement of treatment of ECs, the 4th most common of cancer in women. PMID:24758163

Identification of rhizome-specific genes by genome-wide differential expression Analysis in Oryza longistaminata

PubMed Central

2011-01-01

Background Rhizomatousness is a key component of perenniality of many grasses that contribute to competitiveness and invasiveness of many noxious grass weeds, but can potentially be used to develop perennial cereal crops for sustainable farmers in hilly areas of tropical Asia. Oryza longistaminata, a perennial wild rice with strong rhizomes, has been used as the model species for genetic and molecular dissection of rhizome development and in breeding efforts to transfer rhizome-related traits into annual rice species. In this study, an effort was taken to get insights into the genes and molecular mechanisms underlying the rhizomatous trait in O. longistaminata by comparative analysis of the genome-wide tissue-specific gene expression patterns of five different tissues of O. longistaminata using the Affymetrix GeneChip Rice Genome Array. Results A total of 2,566 tissue-specific genes were identified in five different tissues of O. longistaminata, including 58 and 61 unique genes that were specifically expressed in the rhizome tips (RT) and internodes (RI), respectively. In addition, 162 genes were up-regulated and 261 genes were down-regulated in RT compared to the shoot tips. Six distinct cis-regulatory elements (CGACG, GCCGCC, GAGAC, AACGG, CATGCA, and TAAAG) were found to be significantly more abundant in the promoter regions of genes differentially expressed in RT than in the promoter regions of genes uniformly expressed in all other tissues. Many of the RT and/or RI specifically or differentially expressed genes were located in the QTL regions associated with rhizome expression, rhizome abundance and rhizome growth-related traits in O. longistaminata and thus are good candidate genes for these QTLs. Conclusion The initiation and development of the rhizomatous trait in O. longistaminata are controlled by very complex gene networks involving several plant hormones and regulatory genes, different members of gene families showing tissue specificity and their regulated pathways. Auxin/IAA appears to act as a negative regulator in rhizome development, while GA acts as the activator in rhizome development. Co-localization of the genes specifically expressed in rhizome tips and rhizome internodes with the QTLs for rhizome traits identified a large set of candidate genes for rhizome initiation and development in rice for further confirmation. PMID:21261937

Dual-species transcriptional profiling during systemic candidiasis reveals organ-specific host-pathogen interactions.

PubMed

Hebecker, Betty; Vlaic, Sebastian; Conrad, Theresia; Bauer, Michael; Brunke, Sascha; Kapitan, Mario; Linde, Jörg; Hube, Bernhard; Jacobsen, Ilse D

2016-11-03

Candida albicans is a common cause of life-threatening fungal bloodstream infections. In the murine model of systemic candidiasis, the kidney is the primary target organ while the fungal load declines over time in liver and spleen. To better understand these organ-specific differences in host-pathogen interaction, we performed gene expression profiling of murine kidney, liver and spleen and determined the fungal transcriptome in liver and kidney. We observed a delayed transcriptional immune response accompanied by late induction of fungal stress response genes in the kidneys. In contrast, early upregulation of the proinflammatory response in the liver was associated with a fungal transcriptome resembling response to phagocytosis, suggesting that phagocytes contribute significantly to fungal control in the liver. Notably, C. albicans hypha-associated genes were upregulated in the absence of visible filamentation in the liver, indicating an uncoupling of gene expression and morphology and a morphology-independent effect by hypha-associated genes in this organ. Consistently, integration of host and pathogen transcriptional data in an inter-species gene regulatory network indicated connections of C. albicans cell wall remodelling and metabolism to the organ-specific immune responses.

Dual-species transcriptional profiling during systemic candidiasis reveals organ-specific host-pathogen interactions

PubMed Central

Hebecker, Betty; Vlaic, Sebastian; Conrad, Theresia; Bauer, Michael; Brunke, Sascha; Kapitan, Mario; Linde, Jörg; Hube, Bernhard; Jacobsen, Ilse D.

2016-01-01

Candida albicans is a common cause of life-threatening fungal bloodstream infections. In the murine model of systemic candidiasis, the kidney is the primary target organ while the fungal load declines over time in liver and spleen. To better understand these organ-specific differences in host-pathogen interaction, we performed gene expression profiling of murine kidney, liver and spleen and determined the fungal transcriptome in liver and kidney. We observed a delayed transcriptional immune response accompanied by late induction of fungal stress response genes in the kidneys. In contrast, early upregulation of the proinflammatory response in the liver was associated with a fungal transcriptome resembling response to phagocytosis, suggesting that phagocytes contribute significantly to fungal control in the liver. Notably, C. albicans hypha-associated genes were upregulated in the absence of visible filamentation in the liver, indicating an uncoupling of gene expression and morphology and a morphology-independent effect by hypha-associated genes in this organ. Consistently, integration of host and pathogen transcriptional data in an inter-species gene regulatory network indicated connections of C. albicans cell wall remodelling and metabolism to the organ-specific immune responses. PMID:27808111

HIV promoter integration site primarily modulates transcriptional burst size rather than frequency.

PubMed

Skupsky, Ron; Burnett, John C; Foley, Jonathan E; Schaffer, David V; Arkin, Adam P

2010-09-30

Mammalian gene expression patterns, and their variability across populations of cells, are regulated by factors specific to each gene in concert with its surrounding cellular and genomic environment. Lentiviruses such as HIV integrate their genomes into semi-random genomic locations in the cells they infect, and the resulting viral gene expression provides a natural system to dissect the contributions of genomic environment to transcriptional regulation. Previously, we showed that expression heterogeneity and its modulation by specific host factors at HIV integration sites are key determinants of infected-cell fate and a possible source of latent infections. Here, we assess the integration context dependence of expression heterogeneity from diverse single integrations of a HIV-promoter/GFP-reporter cassette in Jurkat T-cells. Systematically fitting a stochastic model of gene expression to our data reveals an underlying transcriptional dynamic, by which multiple transcripts are produced during short, infrequent bursts, that quantitatively accounts for the wide, highly skewed protein expression distributions observed in each of our clonal cell populations. Interestingly, we find that the size of transcriptional bursts is the primary systematic covariate over integration sites, varying from a few to tens of transcripts across integration sites, and correlating well with mean expression. In contrast, burst frequencies are scattered about a typical value of several per cell-division time and demonstrate little correlation with the clonal means. This pattern of modulation generates consistently noisy distributions over the sampled integration positions, with large expression variability relative to the mean maintained even for the most productive integrations, and could contribute to specifying heterogeneous, integration-site-dependent viral production patterns in HIV-infected cells. Genomic environment thus emerges as a significant control parameter for gene expression variation that may contribute to structuring mammalian genomes, as well as be exploited for survival by integrating viruses.

Aberrant RNA splicing in cancer; expression changes and driver mutations of splicing factor genes.

PubMed

Sveen, A; Kilpinen, S; Ruusulehto, A; Lothe, R A; Skotheim, R I

2016-05-12

Alternative splicing is a widespread process contributing to structural transcript variation and proteome diversity. In cancer, the splicing process is commonly disrupted, resulting in both functional and non-functional end-products. Cancer-specific splicing events are known to contribute to disease progression; however, the dysregulated splicing patterns found on a genome-wide scale have until recently been less well-studied. In this review, we provide an overview of aberrant RNA splicing and its regulation in cancer. We then focus on the executors of the splicing process. Based on a comprehensive catalog of splicing factor encoding genes and analyses of available gene expression and somatic mutation data, we identify cancer-associated patterns of dysregulation. Splicing factor genes are shown to be significantly differentially expressed between cancer and corresponding normal samples, and to have reduced inter-individual expression variation in cancer. Furthermore, we identify enrichment of predicted cancer-critical genes among the splicing factors. In addition to previously described oncogenic splicing factor genes, we propose 24 novel cancer-critical splicing factors predicted from somatic mutations.

Highly efficient gene transfer using a retroviral vector into murine T cells for preclinical chimeric antigen receptor-expressing T cell therapy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kusabuka, Hotaka; Fujiwara, Kento; Tokunaga, Yusuke

Adoptive immunotherapy using chimeric antigen receptor-expressing T (CAR-T) cells has attracted attention as an efficacious strategy for cancer treatment. To prove the efficacy and safety of CAR-T cell therapy, the elucidation of immunological mechanisms underlying it in mice is required. Although a retroviral vector (Rv) is mainly used for the introduction of CAR to murine T cells, gene transduction efficiency is generally less than 50%. The low transduction efficiency causes poor precision in the functional analysis of CAR-T cells. We attempted to improve the Rv gene transduction protocol to more efficiently generate functional CAR-T cells by optimizing the period ofmore » pre-cultivation and antibody stimulation. In the improved protocol, gene transduction efficiency to murine T cells was more than 90%. In addition, almost all of the prepared murine T cells expressed CAR after puromycin selection. These CAR-T cells had antigen-specific cytotoxic activity and secreted multiple cytokines by antigen stimulation. We believe that our optimized gene transduction protocol for murine T cells contributes to the advancement of T cell biology and development of immunotherapy using genetically engineered T cells. - Highlights: • We established highly efficient gene transduction protocols for murine T cells. • CD8{sup +} CAR-T cells had antigen-specific cytotoxic activity. • CD4{sup +} CAR-T cells secreted multiple cytokines by antigen stimulation. • This finding can contribute to the development of T-cell biology and immunotherapy.« less

Differences and similarities in the serotonergic diathesis for suicide attempts and mood disorders: a 22-year longitudinal gene-environment study.

PubMed

Brezo, J; Bureau, A; Mérette, C; Jomphe, V; Barker, E D; Vitaro, F; Hébert, M; Carbonneau, R; Tremblay, R E; Turecki, G

2010-08-01

To investigate similarities and differences in the serotonergic diathesis for mood disorders and suicide attempts, we conducted a study in a cohort followed longitudinally for 22 years. A total of 1255 members of this cohort, which is representative of the French-speaking population of Quebec, were investigated. Main outcome measures included (1) mood disorders (bipolar disorder and major depression) and suicide attempts by early adulthood; (2) odds ratios and probabilities associated with 143 single nucleotide polymorphisms in 11 serotonergic genes, acting directly or as moderators in gene-environment interactions with childhood sexual or childhood physical abuse (CPA), and in gene-gene interactions; (3) regression coefficients for putative endophenotypes for mood disorders (childhood anxiousness) and suicide attempts (childhood disruptiveness). Five genes showed significant adjusted effects (HTR2A, TPH1, HTR5A, SLC6A4 and HTR1A). Of these, HTR2A variation influenced both suicide attempts and mood disorders, although through different mechanisms. In suicide attempts, HTR2A variants (rs6561333, rs7997012 and rs1885884) were involved through interactions with histories of sexual and physical abuse whereas in mood disorders through one main effect (rs9316235). In terms of phenotype-specific contributions, TPH1 variation (rs10488683) was relevant only in the diathesis for suicide attempts. Three genes contributed exclusively to mood disorders, one through a main effect (HTR5A (rs1657268)) and two through gene-environment interactions with CPA (HTR1A (rs878567) and SLC6A4 (rs3794808)). Childhood anxiousness did not mediate the effects of HTR2A and HTR5A on mood disorders, nor did childhood disruptiveness mediate the effects of TPH1 on suicide attempts. Of the serotonergic genes implicated in mood disorders and suicidal behaviors, four exhibited phenotype-specific effects, suggesting that despite their high concordance and common genetic determinants, suicide attempts and mood disorders may also have partially independent etiological pathways. To identify where these pathways diverge, we need to understand the differential, phenotype-specific gene-environment interactions such as the ones observed in the present study, using suitably powered samples.

Genes encoding cuticular proteins are components of the Nimrod gene cluster in Drosophila.

PubMed

Cinege, Gyöngyi; Zsámboki, János; Vidal-Quadras, Maite; Uv, Anne; Csordás, Gábor; Honti, Viktor; Gábor, Erika; Hegedűs, Zoltán; Varga, Gergely I B; Kovács, Attila L; Juhász, Gábor; Williams, Michael J; Andó, István; Kurucz, Éva

2017-08-01

The Nimrod gene cluster, located on the second chromosome of Drosophila melanogaster, is the largest synthenic unit of the Drosophila genome. Nimrod genes show blood cell specific expression and code for phagocytosis receptors that play a major role in fruit fly innate immune functions. We previously identified three homologous genes (vajk-1, vajk-2 and vajk-3) located within the Nimrod cluster, which are unrelated to the Nimrod genes, but are homologous to a fourth gene (vajk-4) located outside the cluster. Here we show that, unlike the Nimrod candidates, the Vajk proteins are expressed in cuticular structures of the late embryo and the late pupa, indicating that they contribute to cuticular barrier functions. Copyright © 2017 Elsevier Ltd. All rights reserved.

Gender-Specific Gene Expression in Post-Mortem Human Brain: Localization to Sex Chromosomes

PubMed Central

Vawter, Marquis P; Evans, Simon; Choudary, Prabhakara; Tomita, Hiroaki; Meador-Woodruff, Jim; Molnar, Margherita; Li, Jun; Lopez, Juan F; Myers, Rick; Cox, David; Watson, Stanley J; Akil, Huda; Jones, Edward G; Bunney, William E

2011-01-01

Gender differences in brain development and in the prevalence of neuropsychiatric disorders such as depression have been reported. Gender differences in human brain might be related to patterns of gene expression. Microarray technology is one useful method for investigation of gene expression in brain. We investigated gene expression, cell types, and regional expression patterns of differentially expressed sex chromosome genes in brain. We profiled gene expression in male and female dorsolateral prefrontal cortex, anterior cingulate cortex, and cerebellum using the Affymetrix oligonucleotide microarray platform. Differentially expressed genes between males and females on the Y chromosome (DBY, SMCY, UTY, RPS4Y, and USP9Y) and X chromosome (XIST) were confirmed using real-time PCR measurements. In situ hybridization confirmed the differential expression of gender-specific genes and neuronal expression of XIST, RPS4Y, SMCY, and UTY in three brain regions examined. The XIST gene, which silences gene expression on regions of the X chromosome, is expressed in a subset of neurons. Since a subset of neurons express gender-specific genes, neural subpopulations may exhibit a subtle sexual dimorphism at the level of differences in gene regulation and function. The distinctive pattern of neuronal expression of XIST, RPS4Y, SMCY, and UTY and other sex chromosome genes in neuronal subpopulations may possibly contribute to gender differences in prevalence noted for some neuropsychiatric disorders. Studies of the protein expression of these sex- chromosome-linked genes in brain tissue are required to address the functional consequences of the observed gene expression differences. PMID:14583743

Differential patterns of acquired virulence genes distinguish Salmonella strains

PubMed Central

Conner, Christopher P.; Heithoff, Douglas M.; Julio, Steven M.; Sinsheimer, Robert L.; Mahan, Michael J.

1998-01-01

Analysis of several Salmonella typhimurium in vivo-induced genes located in regions of atypical base composition has uncovered acquired genetic elements that cumulatively engender pathogenicity. Many of these regions are associated with mobile elements, encode predicted adhesin and invasin-like functions, and are required for full virulence. Some of these regions distinguish broad host range from host-adapted Salmonella serovars and may contribute to inherent differences in host specificity, tissue tropism, and disease manifestation. Maintenance of this archipelago of acquired sequence by selection in specific hosts reveals a fossil record of the evolution of pathogenic species. PMID:9539791

The HUSH complex cooperates with TRIM28 to repress young retrotransposons and new genes.

PubMed

Robbez-Masson, Luisa; Tie, Christopher H C; Conde, Lucia; Tunbak, Hale; Husovsky, Connor; Tchasovnikarova, Iva A; Timms, Richard T; Herrero, Javier; Lehner, Paul J; Rowe, Helen M

2018-05-04

Retrotransposons encompass half of the human genome and contribute to the formation of heterochromatin, which provides nuclear structure and regulates gene expression. Here, we asked if the human silencing hub (HUSH) complex is necessary to silence retrotransposons and whether it collaborates with TRIM28 and the chromatin remodeler ATRX at specific genomic loci. We show that the HUSH complex contributes to de novo repression and DNA methylation of a SVA retrotransposon reporter. By using naïve vs. primed mouse pluripotent stem cells, we reveal a critical role for the HUSH complex in naïve cells, implicating it in programming epigenetic marks in development. While the HUSH component FAM208A binds to endogenous retroviruses (ERVs) and long interspersed element-1s (LINE-1s or L1s), it is mainly required to repress evolutionarily young L1s (mouse-specific lineages less than 5 million years old). TRIM28, in contrast, is necessary to repress both ERVs and young L1s. Genes co-repressed by TRIM28 and FAM208A are evolutionarily young, or exhibit tissue-specific expression, are enriched in young L1s and display evidence for regulation through LTR promoters. Finally, we demonstrate that the HUSH complex is also required to repress L1 elements in human cells. Overall, these data indicate that the HUSH complex and TRIM28 co-repress young retrotransposons and new genes rewired by retrotransposon non-coding DNA. Published by Cold Spring Harbor Laboratory Press.

Subcutaneous and gonadal adipose tissue transcriptome differences in lean and obese female dogs.

PubMed

Grant, Ryan W; Vester Boler, Brittany M; Ridge, Tonya K; Graves, Thomas K; Swanson, Kelly S

2013-12-01

Canine obesity leads to shortened life span and increased disease incidence. Adipose tissue depots are known to have unique metabolic and gene expression profiles in rodents and humans, but few comparisons of depot gene expression have been performed in the dog. Using microarray technology, our objective was to identify differentially expressed genes and enriched functional pathways between subcutaneous and gonadal adipose of lean and obese dogs to better understand the pathogenesis of obesity in the dog. Because no depot × body weight status interactions were identified in the microarray data, depot differences were the primary focus. A total of 946 and 703 transcripts were differentially expressed (FDR P < 0.05) between gonadal and subcutaneous adipose tissue in obese and lean dogs respectively. Of the adipose depot-specific differences in gene expression, 162 were present in both lean and obese dogs, with the majority (85%) expressed in the same direction. Both lean and obese dog gene lists had enrichment of the complement and coagulation cascade and systemic lupus erythematosus pathways. Obese dogs had enrichment of lysosome, extracellular matrix-receptor interaction, renin-angiotensin system and hematopoietic cell lineage pathways. Lean dogs had enrichment of glutathione metabolism and synthesis and degradation of ketone bodies. We have identified a core set of genes differentially expressed between subcutaneous and gonadal adipose tissue in dogs regardless of body weight. These genes contribute to depot-specific differences in immune function, extracellular matrix remodeling and lysosomal function and may contribute to the physiological differences noted between depots. © 2013 The Authors, Animal Genetics © 2013 Stichting International Foundation for Animal Genetics.

Differences in DNA Binding Specificity of Floral Homeotic Protein Complexes Predict Organ-Specific Target Genes.

PubMed

Smaczniak, Cezary; Muiño, Jose M; Chen, Dijun; Angenent, Gerco C; Kaufmann, Kerstin

2017-08-01

Floral organ identities in plants are specified by the combinatorial action of homeotic master regulatory transcription factors. However, how these factors achieve their regulatory specificities is still largely unclear. Genome-wide in vivo DNA binding data show that homeotic MADS domain proteins recognize partly distinct genomic regions, suggesting that DNA binding specificity contributes to functional differences of homeotic protein complexes. We used in vitro systematic evolution of ligands by exponential enrichment followed by high-throughput DNA sequencing (SELEX-seq) on several floral MADS domain protein homo- and heterodimers to measure their DNA binding specificities. We show that specification of reproductive organs is associated with distinct binding preferences of a complex formed by SEPALLATA3 and AGAMOUS. Binding specificity is further modulated by different binding site spacing preferences. Combination of SELEX-seq and genome-wide DNA binding data allows differentiation between targets in specification of reproductive versus perianth organs in the flower. We validate the importance of DNA binding specificity for organ-specific gene regulation by modulating promoter activity through targeted mutagenesis. Our study shows that intrafamily protein interactions affect DNA binding specificity of floral MADS domain proteins. Differential DNA binding of MADS domain protein complexes plays a role in the specificity of target gene regulation. © 2017 American Society of Plant Biologists. All rights reserved.

Soybean kinome: functional classification and gene expression patterns

PubMed Central

Liu, Jinyi; Chen, Nana; Grant, Joshua N.; Cheng, Zong-Ming (Max); Stewart, C. Neal; Hewezi, Tarek

2015-01-01

The protein kinase (PK) gene family is one of the largest and most highly conserved gene families in plants and plays a role in nearly all biological functions. While a large number of genes have been predicted to encode PKs in soybean, a comprehensive functional classification and global analysis of expression patterns of this large gene family is lacking. In this study, we identified the entire soybean PK repertoire or kinome, which comprised 2166 putative PK genes, representing 4.67% of all soybean protein-coding genes. The soybean kinome was classified into 19 groups, 81 families, and 122 subfamilies. The receptor-like kinase (RLK) group was remarkably large, containing 1418 genes. Collinearity analysis indicated that whole-genome segmental duplication events may have played a key role in the expansion of the soybean kinome, whereas tandem duplications might have contributed to the expansion of specific subfamilies. Gene structure, subcellular localization prediction, and gene expression patterns indicated extensive functional divergence of PK subfamilies. Global gene expression analysis of soybean PK subfamilies revealed tissue- and stress-specific expression patterns, implying regulatory functions over a wide range of developmental and physiological processes. In addition, tissue and stress co-expression network analysis uncovered specific subfamilies with narrow or wide interconnected relationships, indicative of their association with particular or broad signalling pathways, respectively. Taken together, our analyses provide a foundation for further functional studies to reveal the biological and molecular functions of PKs in soybean. PMID:25614662

Discovering Condition-Specific Gene Co-Expression Patterns Using Gaussian Mixture Models: A Cancer Case Study.

PubMed

Ficklin, Stephen P; Dunwoodie, Leland J; Poehlman, William L; Watson, Christopher; Roche, Kimberly E; Feltus, F Alex

2017-08-17

A gene co-expression network (GCN) describes associations between genes and points to genetic coordination of biochemical pathways. However, genetic correlations in a GCN are only detectable if they are present in the sampled conditions. With the increasing quantity of gene expression samples available in public repositories, there is greater potential for discovery of genetic correlations from a variety of biologically interesting conditions. However, even if gene correlations are present, their discovery can be masked by noise. Noise is introduced from natural variation (intrinsic and extrinsic), systematic variation (caused by sample measurement protocols and instruments), and algorithmic and statistical variation created by selection of data processing tools. A variety of published studies, approaches and methods attempt to address each of these contributions of variation to reduce noise. Here we describe an approach using Gaussian Mixture Models (GMMs) to address natural extrinsic (condition-specific) variation during network construction from mixed input conditions. To demonstrate utility, we build and analyze a condition-annotated GCN from a compendium of 2,016 mixed gene expression data sets from five tumor subtypes obtained from The Cancer Genome Atlas. Our results show that GMMs help discover tumor subtype specific gene co-expression patterns (modules) that are significantly enriched for clinical attributes.

Evolutionary Characteristics of Missing Proteins: Insights into the Evolution of Human Chromosomes Related to Missing-Protein-Encoding Genes.

PubMed

Xu, Aishi; Li, Guang; Yang, Dong; Wu, Songfeng; Ouyang, Hongsheng; Xu, Ping; He, Fuchu

2015-12-04

Although the "missing protein" is a temporary concept in C-HPP, the biological information for their "missing" could be an important clue in evolutionary studies. Here we classified missing-protein-encoding genes into two groups, the genes encoding PE2 proteins (with transcript evidence) and the genes encoding PE3/4 proteins (with no transcript evidence). These missing-protein-encoding genes distribute unevenly among different chromosomes, chromosomal regions, or gene clusters. In the view of evolutionary features, PE3/4 genes tend to be young, spreading at the nonhomology chromosomal regions and evolving at higher rates. Interestingly, there is a higher proportion of singletons in PE3/4 genes than the proportion of singletons in all genes (background) and OTCSGs (organ, tissue, cell type-specific genes). More importantly, most of the paralogous PE3/4 genes belong to the newly duplicated members of the paralogous gene groups, which mainly contribute to special biological functions, such as "smell perception". These functions are heavily restricted into specific type of cells, tissues, or specific developmental stages, acting as the new functional requirements that facilitated the emergence of the missing-protein-encoding genes during evolution. In addition, the criteria for the extremely special physical-chemical proteins were first set up based on the properties of PE2 proteins, and the evolutionary characteristics of those proteins were explored. Overall, the evolutionary analyses of missing-protein-encoding genes are expected to be highly instructive for proteomics and functional studies in the future.

The Evolution of the FT/TFL1 Genes in Amaranthaceae and Their Expression Patterns in the Course of Vegetative Growth and Flowering in Chenopodium rubrum.

PubMed

Drabešová, Jana; Černá, Lucie; Mašterová, Helena; Koloušková, Pavla; Potocký, Martin; Štorchová, Helena

2016-10-13

The FT/TFL1 gene family controls important aspects of plant development: MFT-like genes affect germination, TFL1-like genes act as floral inhibitors, and FT-like genes are floral activators. Gene duplications produced paralogs with modified functions required by the specific lifestyles of various angiosperm species. We constructed the transcriptome of the weedy annual plant Chenopodium rubrum and used it for the comprehensive search for the FT/TFL1 genes. We analyzed their phylogenetic relationships across Amaranthaceae and all angiosperms. We discovered a very ancient phylogenetic clade of FT genes represented by the CrFTL3 gene of C. rubrum Another paralog CrFTL2 showed an unusual structural rearrangement which might have contributed to the functional shift. We examined the transcription patterns of the FT/TFL1 genes during the vegetative growth and floral transition in C. rubrum to get clues about their possible functions. All the genes except for the constitutively expressed CrFTL2 gene, and the CrFTL3 gene, which was transcribed only in seeds, exhibited organ-specific expression influenced by the specific light regime. The CrFTL1 gene was confirmed as a single floral activator from the FT/TFL1 family in C. rubrum Its floral promoting activity may be counteracted by CrTFL1 C. rubrum emerges as an easily manipulated model for the study of floral induction in weedy fast-cycling plants lacking a juvenile phase. Copyright © 2016 Drabesova et al.

Aberrant activation of the human sex-determining gene in early embryonic development results in postnatal growth retardation and lethality in mice.

PubMed

Kido, Tatsuo; Sun, Zhaoyu; Lau, Yun-Fai Chris

2017-06-23

Sexual dimorphisms are prevalent in development, physiology and diseases in humans. Currently, the contributions of the genes on the male-specific region of the Y chromosome (MSY) in these processes are uncertain. Using a transgene activation system, the human sex-determining gene hSRY is activated in the single-cell embryos of the mouse. Pups with hSRY activated (hSRY ON ) are born of similar sizes as those of non-activated controls. However, they retard significantly in postnatal growth and development and all die of multi-organ failure before two weeks of age. Pathological and molecular analyses indicate that hSRY ON pups lack innate suckling activities, and develop fatty liver disease, arrested alveologenesis in the lung, impaired neurogenesis in the brain and occasional myocardial fibrosis and minimized thymus development. Transcriptome analysis shows that, in addition to those unique to the respective organs, various cell growth and survival pathways and functions are differentially affected in the transgenic mice. These observations suggest that ectopic activation of a Y-located SRY gene could exert male-specific effects in development and physiology of multiple organs, thereby contributing to sexual dimorphisms in normal biological functions and disease processes in affected individuals.

Differentially-Expressed Pseudogenes in HIV-1 Infection

PubMed Central

Gupta, Aditi; Brown, C. Titus; Zheng, Yong-Hui; Adami, Christoph

2015-01-01

Not all pseudogenes are transcriptionally silent as previously thought. Pseudogene transcripts, although not translated, contribute to the non-coding RNA pool of the cell that regulates the expression of other genes. Pseudogene transcripts can also directly compete with the parent gene transcripts for mRNA stability and other cell factors, modulating their expression levels. Tissue-specific and cancer-specific differential expression of these “functional” pseudogenes has been reported. To ascertain potential pseudogene:gene interactions in HIV-1 infection, we analyzed transcriptomes from infected and uninfected T-cells and found that 21 pseudogenes are differentially expressed in HIV-1 infection. This is interesting because parent genes of one-third of these differentially-expressed pseudogenes are implicated in HIV-1 life cycle, and parent genes of half of these pseudogenes are involved in different viral infections. Our bioinformatics analysis identifies candidate pseudogene:gene interactions that may be of significance in HIV-1 infection. Experimental validation of these interactions would establish that retroviruses exploit this newly-discovered layer of host gene expression regulation for their own benefit. PMID:26426037

Differential enrichment of TTF-I and Tip5 in the T-like promoter structures of the rDNA contribute to the epigenetic response of Cyprinus carpio during environmental adaptation.

PubMed

Nardocci, Gino; Simonet, Nicolas G; Navarro, Cristina; Längst, Gernot; Alvarez, Marco

2016-08-01

To ensure homeostasis, ectothermic organisms adapt to environmental variations through molecular mechanisms. We previously reported that during the seasonal acclimatization of the common carp Cyprinus carpio, molecular and cellular functions are reprogrammed, resulting in distinctive traits. Importantly, the carp undergoes a drastic rearrangement of nucleolar components during adaptation. This ultrastructural feature reflects a fine modulation of rRNA gene transcription. Specifically, we identified the involvement of the transcription termination factor I (TTF-I) and Tip-5 (member of nucleolar remodeling complex, NoRC) in the control of rRNA transcription. Our results suggest that differential Tip5 enrichment is essential for silencing carp ribosomal genes and that the T0 element is key for regulating the ribosomal gene during the acclimatization process. Interestingly, the expression and content of Tip5 were significantly higher in winter than in summer. Since carp ribosomal gene expression is lower in the winter than in summer, and considering that expression concomitantly occurs with nucleolar ultrastructural changes of the acclimatization process, these results indicate that Tip5 importantly contributes to silencing the ribosomal genes. In conclusion, the current study provides novel evidence on the contributions of TTF-I and NoRC in the environmental reprogramming of ribosomal genes during the seasonal adaptation process in carp.

Identification of suitable genes contributes to lung adenocarcinoma clustering by multiple meta-analysis methods.

PubMed

Yang, Ze-Hui; Zheng, Rui; Gao, Yuan; Zhang, Qiang

2016-09-01

With the widespread application of high-throughput technology, numerous meta-analysis methods have been proposed for differential expression profiling across multiple studies. We identified the suitable differentially expressed (DE) genes that contributed to lung adenocarcinoma (ADC) clustering based on seven popular multiple meta-analysis methods. Seven microarray expression profiles of ADC and normal controls were extracted from the ArrayExpress database. The Bioconductor was used to perform the data preliminary preprocessing. Then, DE genes across multiple studies were identified. Hierarchical clustering was applied to compare the classification performance for microarray data samples. The classification efficiency was compared based on accuracy, sensitivity and specificity. Across seven datasets, 573 ADC cases and 222 normal controls were collected. After filtering out unexpressed and noninformative genes, 3688 genes were remained for further analysis. The classification efficiency analysis showed that DE genes identified by sum of ranks method separated ADC from normal controls with the best accuracy, sensitivity and specificity of 0.953, 0.969 and 0.932, respectively. The gene set with the highest classification accuracy mainly participated in the regulation of response to external stimulus (P = 7.97E-04), cyclic nucleotide-mediated signaling (P = 0.01), regulation of cell morphogenesis (P = 0.01) and regulation of cell proliferation (P = 0.01). Evaluation of DE genes identified by different meta-analysis methods in classification efficiency provided a new perspective to the choice of the suitable method in a given application. Varying meta-analysis methods always present varying abilities, so synthetic consideration should be taken when providing meta-analysis methods for particular research. © 2015 John Wiley & Sons Ltd.

Patterns of homoeologous gene expression shown by RNA sequencing in hexaploid bread wheat

PubMed Central

2014-01-01

Background Bread wheat (Triticum aestivum) has a large, complex and hexaploid genome consisting of A, B and D homoeologous chromosome sets. Therefore each wheat gene potentially exists as a trio of A, B and D homoeoloci, each of which may contribute differentially to wheat phenotypes. We describe a novel approach combining wheat cytogenetic resources (chromosome substitution ‘nullisomic-tetrasomic’ lines) with next generation deep sequencing of gene transcripts (RNA-Seq), to directly and accurately identify homoeologue-specific single nucleotide variants and quantify the relative contribution of individual homoeoloci to gene expression. Results We discover, based on a sample comprising ~5-10% of the total wheat gene content, that at least 45% of wheat genes are expressed from all three distinct homoeoloci. Most of these genes show strikingly biased expression patterns in which expression is dominated by a single homoeolocus. The remaining ~55% of wheat genes are expressed from either one or two homoeoloci only, through a combination of extensive transcriptional silencing and homoeolocus loss. Conclusions We conclude that wheat is tending towards functional diploidy, through a variety of mechanisms causing single homoeoloci to become the predominant source of gene transcripts. This discovery has profound consequences for wheat breeding and our understanding of wheat evolution. PMID:24726045

Microarray Data Analysis of Space Grown Arabidopsis Leaves for Genes Important in Vascular Patterning

NASA Technical Reports Server (NTRS)

Weitzeal, A. J.; Wyatt, S. E.; Parsons-Wingerter, P.

2016-01-01

Venation patterning in leaves is a major determinant of photosynthesis efficiency because of its dependency on vascular transport of photoassimilates, water, and minerals. Arabidopsis thaliana grown in microgravity show delayed growth and leaf maturation. Gene expression data from the roots, hypocotyl, and leaves of A. thaliana grown during spaceflight vs. ground control analyzed by Affymetrix microarray are available through NASAs GeneLab (GLDS-7). We analyzed the data for differential expression of genes in leaves resulting from the effects of spaceflight on vascular patterning. Two genes were found by preliminary analysis to be upregulated during spaceflight that may be related to vascular formation. The genes are responsible for coding an ARGOS like protein (potentially affecting cell elongation in the leaves), and an F-boxkelch-repeat protein (possibly contributing to protoxylem specification). Further analysis that will focus on raw data quality assessment and a moderated t-test may further confirm upregulation of the two genes and/or identify other gene candidates. Plants defective in these genes will then be assessed for phenotype by the mapping and quantification of leaf vascular patterning by NASAs VESsel GENeration (VESGEN) software to model specific vascular differences of plants grown in spaceflight.

Microarray Data Analysis of Space Grown Arabidopsis Leaves for Genes Important in Vascular Patterning

NASA Technical Reports Server (NTRS)

Weitzeal, A. J.; Wyatt, S. E.; Parsons-Wingerter, P.

2016-01-01

Venation patterning in leaves is a major determinant of photosynthesis efficiency because of its dependency on vascular transport of photoassimilates, water, and minerals. Arabidopsis thaliana grown in microgravity show delayed growth and leaf maturation. Gene expression data from the roots, hypocotyl, and leaves of A. thaliana grown during spaceflight vs. ground control analyzed by Affymetrix microarray are available through NASA's GeneLab (GLDS-7). We analyzed the data for differential expression of genes in leaves resulting from the effects of spaceflight on vascular patterning. Two genes were found by preliminary analysis to be upregulated during spaceflight that may be related to vascular formation. The genes are responsible for coding an ARGOS like protein (potentially affecting cell elongation in the leaves), and an F-box/kelch-repeat protein (possibly contributing to protoxylem specification). Further analysis that will focus on raw data quality assessment and a moderated t-test may further confirm upregulation of the two genes and/or identify other gene candidates. Plants defective in these genes will then be assessed for phenotype by the mapping and quantification of leaf vascular patterning by NASA's VESsel GENeration (VESGEN) software to model specific vascular differences of plants grown in spaceflight.

Analyses of the NAC transcription factor gene family in Gossypium raimondii Ulbr.: chromosomal location, structure, phylogeny, and expression patterns.

PubMed

Shang, Haihong; Li, Wei; Zou, Changsong; Yuan, Youlu

2013-07-01

NAC domain proteins are plant-specific transcription factors known to play diverse roles in various plant developmental processes. In the present study, we performed the first comprehensive study of the NAC gene family in Gossypium raimondii Ulbr., incorporating phylogenetic, chromosomal location, gene structure, conserved motif, and expression profiling analyses. We identified 145 NAC transcription factor (NAC-TF) genes that were phylogenetically clustered into 18 distinct subfamilies. Of these, 127 NAC-TF genes were distributed across the 13 chromosomes, 80 (55%) were preferentially retained duplicates located in both duplicated regions and six were located in triplicated chromosomal regions. The majority of NAC-TF genes showed temporal-, spatial-, and tissue-specific expression patterns based on transcriptomic and qRT-PCR analyses. However, the expression patterns of several duplicate genes were partially redundant, suggesting the occurrence of sub-functionalization during their evolution. Based on their genomic organization, we concluded that genomic duplications contributed significantly to the expansion of the NAC-TF gene family in G. raimondii. Comprehensive analysis of their expression profiles could provide novel insights into the functional divergence among members of the NAC gene family in G. raimondii. © 2013 Institute of Botany, Chinese Academy of Sciences.

Elephant Transcriptome Provides Insights into the Evolution of Eutherian Placentation

PubMed Central

Hou, Zhuo-Cheng; Sterner, Kirstin N.; Romero, Roberto; Than, Nandor Gabor; Gonzalez, Juan M.; Weckle, Amy; Xing, Jun; Benirschke, Kurt; Goodman, Morris; Wildman, Derek E.

2012-01-01

The chorioallantoic placenta connects mother and fetus in eutherian pregnancies. In order to understand the evolution of the placenta and provide further understanding of placenta biology, we sequenced the transcriptome of a term placenta of an African elephant (Loxodonta africana) and compared these data with RNA sequence and microarray data from other eutherian placentas including human, mouse, and cow. We characterized the composition of 55,910 expressed sequence tag (i.e., cDNA) contigs using our custom annotation pipeline. A Markov algorithm was used to cluster orthologs of human, mouse, cow, and elephant placenta transcripts. We found 2,963 genes are commonly expressed in the placentas of these eutherian mammals. Gene ontology categories previously suggested to be important for placenta function (e.g., estrogen receptor signaling pathway, cell motion and migration, and adherens junctions) were significantly enriched in these eutherian placenta–expressed genes. Genes duplicated in different lineages and also specifically expressed in the placenta contribute to the great diversity observed in mammalian placenta anatomy. We identified 1,365 human lineage–specific, 1,235 mouse lineage–specific, 436 cow lineage–specific, and 904 elephant-specific placenta-expressed (PE) genes. The most enriched clusters of human-specific PE genes are signal/glycoprotein and immunoglobulin, and humans possess a deeply invasive human hemochorial placenta that comes into direct contact with maternal immune cells. Inference of phylogenetically conserved and derived transcripts demonstrates the power of comparative transcriptomics to trace placenta evolution and variation across mammals and identified candidate genes that may be important in the normal function of the human placenta, and their dysfunction may be related to human pregnancy complications. PMID:22546564

Autism risk factors: genes, environment, and gene-environment interactions

PubMed Central

Chaste, Pauline; Leboyer, Marion

2012-01-01

The aim of this review is to summarize the key findings from genetic and epidemiological research, which show that autism is a complex disorder resulting from the combination of genetic and environmental factors. Remarkable advances in the knowledge of genetic causes of autism have resulted from the great efforts made in the field of genetics. The identification of specific alleles contributing to the autism spectrum has supplied important pieces for the autism puzzle. However, many questions remain unanswered, and new questions are raised by recent results. Moreover, given the amount of evidence supporting a significant contribution of environmental factors to autism risk, it is now clear that the search for environmental factors should be reinforced. One aspect of this search that has been neglected so far is the study of interactions between genes and environmental factors. PMID:23226953

Comparative Analysis of Genome Sequences Covering the Seven Cronobacter Species

PubMed Central

Cummings, Craig A.; Shih, Rita; Degoricija, Lovorka; Rico, Alain; Brzoska, Pius; Hamby, Stephen E.; Masood, Naqash; Hariri, Sumyya; Sonbol, Hana; Chuzhanova, Nadia; McClelland, Michael; Furtado, Manohar R.; Forsythe, Stephen J.

2012-01-01

Background Species of Cronobacter are widespread in the environment and are occasional food-borne pathogens associated with serious neonatal diseases, including bacteraemia, meningitis, and necrotising enterocolitis. The genus is composed of seven species: C. sakazakii, C. malonaticus, C. turicensis, C. dublinensis, C. muytjensii, C. universalis, and C. condimenti. Clinical cases are associated with three species, C. malonaticus, C. turicensis and, in particular, with C. sakazakii multilocus sequence type 4. Thus, it is plausible that virulence determinants have evolved in certain lineages. Methodology/Principal Findings We generated high quality sequence drafts for eleven Cronobacter genomes representing the seven Cronobacter species, including an ST4 strain of C. sakazakii. Comparative analysis of these genomes together with the two publicly available genomes revealed Cronobacter has over 6,000 genes in one or more strains and over 2,000 genes shared by all Cronobacter. Considerable variation in the presence of traits such as type six secretion systems, metal resistance (tellurite, copper and silver), and adhesins were found. C. sakazakii is unique in the Cronobacter genus in encoding genes enabling the utilization of exogenous sialic acid which may have clinical significance. The C. sakazakii ST4 strain 701 contained additional genes as compared to other C. sakazakii but none of them were known specific virulence-related genes. Conclusions/Significance Genome comparison revealed that pair-wise DNA sequence identity varies between 89 and 97% in the seven Cronobacter species, and also suggested various degrees of divergence. Sets of universal core genes and accessory genes unique to each strain were identified. These gene sequences can be used for designing genus/species specific detection assays. Genes encoding adhesins, T6SS, and metal resistance genes as well as prophages are found in only subsets of genomes and have contributed considerably to the variation of genomic content. Differences in gene content likely contribute to differences in the clinical and environmental distribution of species and sequence types. PMID:23166675

Evolution of Salmonella-Host Cell Interactions through a Dynamic Bacterial Genome

PubMed Central

Ilyas, Bushra; Tsai, Caressa N.; Coombes, Brian K.

2017-01-01

Salmonella Typhimurium has a broad arsenal of genes that are tightly regulated and coordinated to facilitate adaptation to the various host environments it colonizes. The genome of Salmonella Typhimurium has undergone multiple gene acquisition events and has accrued changes in non-coding DNA that have undergone selection by regulatory evolution. Together, at least 17 horizontally acquired pathogenicity islands (SPIs), prophage-associated genes, and changes in core genome regulation contribute to the virulence program of Salmonella. Here, we review the latest understanding of these elements and their contributions to pathogenesis, emphasizing the regulatory circuitry that controls niche-specific gene expression. In addition to an overview of the importance of SPI-1 and SPI-2 to host invasion and colonization, we describe the recently characterized contributions of other SPIs, including the antibacterial activity of SPI-6 and adhesion and invasion mediated by SPI-4. We further discuss how these fitness traits have been integrated into the regulatory circuitry of the bacterial cell through cis-regulatory evolution and by a careful balance of silencing and counter-silencing by regulatory proteins. Detailed understanding of regulatory evolution within Salmonella is uncovering novel aspects of infection biology that relate to host-pathogen interactions and evasion of host immunity. PMID:29034217

Gene-gene-environment interactions between drugs, transporters, receptors, and metabolizing enzymes: Statins, SLCO1B1, and CYP3A4 as an example.

PubMed

Sadee, Wolfgang

2013-09-01

Pharmacogenetic biomarker tests include mostly specific single gene-drug pairs, capable of accounting for a portion of interindividual variability in drug response and toxicity. However, multiple genes are likely to contribute, either acting independently or epistatically, with the CYP2C9-VKORC1-warfarin test panel, an example of a clinically used gene-gene-dug interaction. I discuss here further instances of gene-gene-drug interactions, including a proposed dynamic effect on statin therapy by genetic variants in both a transporter (SLCO1B1) and a metabolizing enzyme (CYP3A4) in liver cells, the main target site where statins block cholesterol synthesis. These examples set a conceptual framework for developing diagnostic panels involving multiple gene-drug combinations. Copyright © 2013 Wiley Periodicals, Inc.

Expansion by whole genome duplication and evolution of the sox gene family in teleost fish

PubMed Central

Naville, Magali; Volff, Jean-Nicolas

2017-01-01

It is now recognized that several rounds of whole genome duplication (WGD) have occurred during the evolution of vertebrates, but the link between WGDs and phenotypic diversification remains unsolved. We have investigated in this study the impact of the teleost-specific WGD on the evolution of the sox gene family in teleostean fishes. The sox gene family, which encodes for transcription factors, has essential role in morphology, physiology and behavior of vertebrates and teleosts, the current largest group of vertebrates. We have first redrawn the evolution of all sox genes identified in eleven teleost genomes using a comparative genomic approach including phylogenetic and synteny analyses. We noticed, compared to tetrapods, an important expansion of the sox family: 58% (11/19) of sox genes are duplicated in teleost genomes. Furthermore, all duplicated sox genes, except sox17 paralogs, are derived from the teleost-specific WGD. Then, focusing on five sox genes, analyzing the evolution of coding and non-coding sequences, as well as the expression patterns in fish embryos and adult tissues, we demonstrated that these paralogs followed lineage-specific evolutionary trajectories in teleost genomes. This work, based on whole genome data from multiple teleostean species, supports the contribution of WGDs to the expansion of gene families, as well as to the emergence of genomic differences between lineages that might promote genetic and phenotypic diversity in teleosts. PMID:28738066

Convergence of GWA and candidate gene studies for alcoholism

PubMed Central

Olfson, Emily; Bierut, Laura Jean

2012-01-01

Background Genome-wide association (GWA) studies have led to a paradigm shift in how researchers study the genetics underlying disease. Many GWA studies are now publicly available and can be used to examine whether or not previously proposed candidate genes are supported by GWA data. This approach is particularly important for the field of alcoholism because the contribution of many candidate genes remains controversial. Methods Using the Human Genome Epidemiology (HuGE) Navigator, we selected candidate genes for alcoholism that have been frequently examined in scientific articles in the past decade. Specific candidate loci as well as all the reported SNPs in candidate genes were examined in the Study of Alcohol Addiction: Genetics and Addiction (SAGE), a GWA study comparing alcohol dependent and non-dependent subjects. Results Several commonly reported candidate loci, including rs1800497 in DRD2, rs698 in ADH1C, rs1799971 in OPRM1 and rs4680 in COMT, are not replicated in SAGE (p> .05). Among candidate loci available for analysis, only rs279858 in GABRA2 (p=0.0052, OR=1.16) demonstrated a modest association. Examination of all SNPs reported in SAGE in over 50 candidate genes revealed no SNPs with large frequency differences between cases and controls and the lowest p value of any SNP was .0006. Discussion We provide evidence that several extensively studied candidate loci do not have a strong contribution to risk of developing alcohol dependence in European and African Ancestry populations. Due to lack of coverage, we were unable to rule out the contribution of other variants and these genes and particular loci warrant further investigation. Our analysis demonstrates that publicly available GWA results can be used to better understand which if any of previously proposed candidate genes contribute to disease. Furthermore, we illustrate how examining the convergence of candidate gene and GWA studies can help elucidate the genetic architecture of alcoholism and more generally complex diseases. PMID:22978509

β-Catenin–regulated myeloid cell adhesion and migration determine wound healing

PubMed Central

Amini-Nik, Saeid; Cambridge, Elizabeth; Yu, Winston; Guo, Anne; Whetstone, Heather; Nadesan, Puviindran; Poon, Raymond; Hinz, Boris; Alman, Benjamin A.

2014-01-01

A β-catenin/T cell factor–dependent transcriptional program is critical during cutaneous wound repair for the regulation of scar size; however, the relative contribution of β-catenin activity and function in specific cell types in the granulation tissue during the healing process is unknown. Here, cell lineage tracing revealed that cells in which β-catenin is transcriptionally active express a gene profile that is characteristic of the myeloid lineage. Mice harboring a macrophage-specific deletion of the gene encoding β-catenin exhibited insufficient skin wound healing due to macrophage-specific defects in migration, adhesion to fibroblasts, and ability to produce TGF-β1. In irradiated mice, only macrophages expressing β-catenin were able to rescue wound-healing deficiency. Evaluation of scar tissue collected from patients with hypertrophic and normal scars revealed a correlation between the number of macrophages within the wound, β-catenin levels, and cellularity. Our data indicate that β-catenin regulates myeloid cell motility and adhesion and that β-catenin–mediated macrophage motility contributes to the number of mesenchymal cells and ultimate scar size following cutaneous injury. PMID:24837430

A polymorphic region in the human transcription factor AP-2beta gene is associated with specific personality traits.

PubMed

Damberg, M; Garpenstrand, H; Alfredsson, J; Ekblom, J; Forslund, K; Rylander, G; Oreland, L

2000-03-01

Transcription factor AP-2beta is implicated in playing an important role during embryonic development of different parts of the brain, eg, midbrain, hindbrain, spinal cord, dorsal and cranial root ganglia.1,2 The gene encoding AP-2beta contains a polymorphic region which includes a tetranucleotide repeat of [CAAA] four or five times, located in intron 2 between nucleotides 12593 and 12612.3 Since the midbrain contains structures important for variables such as mood and personality, we have investigated if the AP-2beta genotype is associated with personality traits estimated by the Karolinska Scales of Personality (KSP). Identification of transcription factor genes as candidate genes in psychiatric disorders is a novel approach to further elucidate the genetic factors that, together with environmental factors, are involved in the expression of specific psychiatric phenotypes. The AP-2beta genotype and KSP scores were determined for 137 Caucasian volunteers (73 females and 64 males). The personality traits muscular tension, guilt, somatic anxiety, psychastenia and indirect aggression were significantly associated with the specific AP-2beta genotype, albeit with significant difference between genders. Based on this result the human AP-2beta gene seems to be an important candidate gene for personality disorders. Moreover, the present results suggest that the structure of the intron 2 region of the AP-2beta gene is one factor that contributes to development of the constitutional component of specific personality traits.

An extensive requirement for transcription factor IID-specific TAF-1 in Caenorhabditis elegans embryonic transcription.

PubMed

Walker, Amy K; Shi, Yang; Blackwell, T Keith

2004-04-09

The general transcription factor TFIID sets the mRNA start site and consists of TATA-binding protein and associated factors (TAF(II)s), some of which are also present in SPT-ADA-GCN5 (SAGA)-related complexes. In yeast, results of multiple studies indicate that TFIID-specific TAF(II)s are not required for the transcription of most genes, implying that intact TFIID may have a surprisingly specialized role in transcription. Relatively little is known about how TAF(II)s contribute to metazoan transcription in vivo, especially at developmental and tissue-specific genes. Previously, we investigated functions of four shared TFIID/SAGA TAF(II)s in Caenorhabditis elegans. Whereas TAF-4 was required for essentially all embryonic transcription, TAF-5, TAF-9, and TAF-10 were dispensable at multiple developmental and other metazoan-specific promoters. Here we show evidence that in C. elegans embryos transcription of most genes requires TFIID-specific TAF-1. TAF-1 is not as universally required as TAF-4, but it is essential for a greater proportion of transcription than TAF-5, -9, or -10 and is important for transcription of many developmental and other metazoan-specific genes. TAF-2, which binds core promoters with TAF-1, appears to be required for a similarly substantial proportion of transcription. C. elegans TAF-1 overlaps functionally with the coactivator p300/CBP (CBP-1), and at some genes it is required along with the TBP-like protein TLF(TRF2). We conclude that during C. elegans embryogenesis TAF-1 and TFIID have broad roles in transcription and development and that TFIID and TLF may act together at certain promoters. Our findings imply that in metazoans TFIID may be of widespread importance for transcription and for expression of tissue-specific genes.

Selective Constraints on Coding Sequences of Nervous System Genes Are a Major Determinant of Duplicate Gene Retention in Vertebrates

PubMed Central

Roux, Julien; Liu, Jialin; Robinson-Rechavi, Marc

2017-01-01

Abstract The evolutionary history of vertebrates is marked by three ancient whole-genome duplications: two successive rounds in the ancestor of vertebrates, and a third one specific to teleost fishes. Biased loss of most duplicates enriched the genome for specific genes, such as slow evolving genes, but this selective retention process is not well understood. To understand what drives the long-term preservation of duplicate genes, we characterized duplicated genes in terms of their expression patterns. We used a new method of expression enrichment analysis, TopAnat, applied to in situ hybridization data from thousands of genes from zebrafish and mouse. We showed that the presence of expression in the nervous system is a good predictor of a higher rate of retention of duplicate genes after whole-genome duplication. Further analyses suggest that purifying selection against the toxic effects of misfolded or misinteracting proteins, which is particularly strong in nonrenewing neural tissues, likely constrains the evolution of coding sequences of nervous system genes, leading indirectly to the preservation of duplicate genes after whole-genome duplication. Whole-genome duplications thus greatly contributed to the expansion of the toolkit of genes available for the evolution of profound novelties of the nervous system at the base of the vertebrate radiation. PMID:28981708

Genes and Social Behavior

PubMed Central

Robinson, Gene E.; Fernald, Russell D.; Clayton, David F.

2011-01-01

What specific genes and regulatory sequences contribute to the organization and functioning of brain circuits that support social behavior? How does social experience interact with information in the genome to modulate these brain circuits? Here we address these questions by highlighting progress that has been made in identifying and understanding two key “vectors of influence” that link genes, brain, and social behavior: 1) social information alters gene readout in the brain to influence behavior; and 2) genetic variation influences brain function and social behavior. We also briefly discuss how evolutionary changes in genomic elements influence social behavior and outline prospects for a systems biology of social behavior. PMID:18988841

Genome-nuclear lamina interactions and gene regulation.

PubMed

Kind, Jop; van Steensel, Bas

2010-06-01

The nuclear lamina, a filamentous protein network that coats the inner nuclear membrane, has long been thought to interact with specific genomic loci and regulate their expression. Molecular mapping studies have now identified large genomic domains that are in contact with the lamina. Genes in these domains are typically repressed, and artificial tethering experiments indicate that the lamina can actively contribute to this repression. Furthermore, the lamina indirectly controls gene expression in the nuclear interior by sequestration of certain transcription factors. A variety of DNA-binding and chromatin proteins may anchor specific loci to the lamina, while histone-modifying enzymes partly mediate the local repressive effect of the lamina. Experimental tools are now available to begin to unravel the underlying molecular mechanisms. Copyright 2010 Elsevier Ltd. All rights reserved.

Global impact of RNA splicing on transcriptome remodeling in the heart.

PubMed

Gao, Chen; Wang, Yibin

2012-08-01

In the eukaryotic transcriptome, both the numbers of genes and different RNA species produced by each gene contribute to the overall complexity. These RNA species are generated by the utilization of different transcriptional initiation or termination sites, or more commonly, from different messenger RNA (mRNA) splicing events. Among the 30,000+ genes in human genome, it is estimated that more than 95% of them can generate more than one gene product via alternative RNA splicing. The protein products generated from different RNA splicing variants can have different intracellular localization, activity, or tissue-distribution. Therefore, alternative RNA splicing is an important molecular process that contributes to the overall complexity of the genome and the functional specificity and diversity among different cell types. In this review, we will discuss current efforts to unravel the full complexity of the cardiac transcriptome using a deep-sequencing approach, and highlight the potential of this technology to uncover the global impact of RNA splicing on the transcriptome during development and diseases of the heart.

Non-redundant coding of aversive odours in the main olfactory pathway.

PubMed

Dewan, Adam; Pacifico, Rodrigo; Zhan, Ross; Rinberg, Dmitry; Bozza, Thomas

2013-05-23

Many species are critically dependent on olfaction for survival. In the main olfactory system of mammals, odours are detected by sensory neurons that express a large repertoire of canonical odorant receptors and a much smaller repertoire of trace amine-associated receptors (TAARs). Odours are encoded in a combinatorial fashion across glomeruli in the main olfactory bulb, with each glomerulus corresponding to a specific receptor. The degree to which individual receptor genes contribute to odour perception is unclear. Here we show that genetic deletion of the olfactory Taar gene family, or even a single Taar gene (Taar4), eliminates the aversion that mice display to low concentrations of volatile amines and to the odour of predator urine. Our findings identify a role for the TAARs in olfaction, namely, in the high-sensitivity detection of innately aversive odours. In addition, our data reveal that aversive amines are represented in a non-redundant fashion, and that individual main olfactory receptor genes can contribute substantially to odour perception.

Bioinformatics Identification of Modules of Transcription Factor Binding Sites in Alzheimer's Disease-Related Genes by In Silico Promoter Analysis and Microarrays

PubMed Central

Augustin, Regina; Lichtenthaler, Stefan F.; Greeff, Michael; Hansen, Jens; Wurst, Wolfgang; Trümbach, Dietrich

2011-01-01

The molecular mechanisms and genetic risk factors underlying Alzheimer's disease (AD) pathogenesis are only partly understood. To identify new factors, which may contribute to AD, different approaches are taken including proteomics, genetics, and functional genomics. Here, we used a bioinformatics approach and found that distinct AD-related genes share modules of transcription factor binding sites, suggesting a transcriptional coregulation. To detect additional coregulated genes, which may potentially contribute to AD, we established a new bioinformatics workflow with known multivariate methods like support vector machines, biclustering, and predicted transcription factor binding site modules by using in silico analysis and over 400 expression arrays from human and mouse. Two significant modules are composed of three transcription factor families: CTCF, SP1F, and EGRF/ZBPF, which are conserved between human and mouse APP promoter sequences. The specific combination of in silico promoter and multivariate analysis can identify regulation mechanisms of genes involved in multifactorial diseases. PMID:21559189

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sharpe, Laura J.; Brown, Andrew J.

As a key regulator of cholesterol homeostasis, sterol-regulatory element binding protein-2 (SREBP-2) up-regulates expression of genes involved in cholesterol synthesis (e.g., 3-hydroxy-3-methyl-glutaryl-coenzyme A (HMG-CoA) Reductase) and uptake (the low density lipoprotein (LDL)-receptor). Previously, we showed that Akt, a critical kinase in cell growth and proliferation, contributes to SREBP-2 activation. However, the specific Akt target involved is unknown. A potential candidate is the mammalian target of rapamycin, mTOR. Rapamycin can cause hyperlipidaemia clinically, and we hypothesised that this may be mediated via an effect of mTOR on SREBP-2. Herein, we found that SREBP-2 activation and HMG-CoA Reductase gene expression were unaffectedmore » by rapamycin treatment. However, LDL-receptor gene expression was decreased by rapamycin, suggesting that this may contribute to the hyperlipidaemia observed in rapamycin-treated patients. Rapamycin did not affect mRNA stability, so the decrease in LDL-receptor gene expression is likely to be occurring at the transcriptional level, although independently of SREBP-2.« less

EHMT2 directs DNA methylation for efficient gene silencing in mouse embryos

PubMed Central

Auclair, Ghislain; Borgel, Julie; Sanz, Lionel A.; Vallet, Judith; Guibert, Sylvain; Dumas, Michael; Cavelier, Patricia; Girardot, Michael; Forné, Thierry; Feil, Robert; Weber, Michael

2016-01-01

The extent to which histone modifying enzymes contribute to DNA methylation in mammals remains unclear. Previous studies suggested a link between the lysine methyltransferase EHMT2 (also known as G9A and KMT1C) and DNA methylation in the mouse. Here, we used a model of knockout mice to explore the role of EHMT2 in DNA methylation during mouse embryogenesis. The Ehmt2 gene is expressed in epiblast cells but is dispensable for global DNA methylation in embryogenesis. In contrast, EHMT2 regulates DNA methylation at specific sequences that include CpG-rich promoters of germline-specific genes. These loci are bound by EHMT2 in embryonic cells, are marked by H3K9 dimethylation, and have strongly reduced DNA methylation in Ehmt2−/− embryos. EHMT2 also plays a role in the maintenance of germline-derived DNA methylation at one imprinted locus, the Slc38a4 gene. Finally, we show that DNA methylation is instrumental for EHMT2-mediated gene silencing in embryogenesis. Our findings identify EHMT2 as a critical factor that facilitates repressive DNA methylation at specific genomic loci during mammalian development. PMID:26576615

MicroRNAs shape circadian hepatic gene expression on a transcriptome-wide scale

PubMed Central

Du, Ngoc-Hien; Arpat, Alaaddin Bulak; De Matos, Mara; Gatfield, David

2014-01-01

A considerable proportion of mammalian gene expression undergoes circadian oscillations. Post-transcriptional mechanisms likely make important contributions to mRNA abundance rhythms. We have investigated how microRNAs (miRNAs) contribute to core clock and clock-controlled gene expression using mice in which miRNA biogenesis can be inactivated in the liver. While the hepatic core clock was surprisingly resilient to miRNA loss, whole transcriptome sequencing uncovered widespread effects on clock output gene expression. Cyclic transcription paired with miRNA-mediated regulation was thus identified as a frequent phenomenon that affected up to 30% of the rhythmic transcriptome and served to post-transcriptionally adjust the phases and amplitudes of rhythmic mRNA accumulation. However, only few mRNA rhythms were actually generated by miRNAs. Overall, our study suggests that miRNAs function to adapt clock-driven gene expression to tissue-specific requirements. Finally, we pinpoint several miRNAs predicted to act as modulators of rhythmic transcripts, and identify rhythmic pathways particularly prone to miRNA regulation. DOI: http://dx.doi.org/10.7554/eLife.02510.001 PMID:24867642

Redox regulation of genome stability by effects on gene expression, epigenetic pathways and DNA damage/repair

PubMed Central

Mikhed, Yuliya; Görlach, Agnes; Knaus, Ulla G.; Daiber, Andreas

2015-01-01

Reactive oxygen and nitrogen species (e.g. H2O2, nitric oxide) confer redox regulation of essential cellular signaling pathways such as cell differentiation, proliferation, migration and apoptosis. In addition, classical regulation of gene expression or activity, including gene transcription to RNA followed by translation to the protein level, by transcription factors (e.g. NF-κB, HIF-1α) and mRNA binding proteins (e.g. GAPDH, HuR) is subject to redox regulation. This review will give an update of recent discoveries in this field, and specifically highlight the impact of reactive oxygen and nitrogen species on DNA repair systems that contribute to genomic stability. Emphasis will be placed on the emerging role of redox mechanisms regulating epigenetic pathways (e.g. miRNA, DNA methylation and histone modifications). By providing clinical correlations we discuss how oxidative stress can impact on gene regulation/activity and vise versa, how epigenetic processes, other gene regulatory mechanisms and DNA repair can influence the cellular redox state and contribute or prevent development or progression of disease. PMID:26079210

Control of early seed development.

PubMed

Chaudhury, A M; Koltunow, A; Payne, T; Luo, M; Tucker, M R; Dennis, E S; Peacock, W J

2001-01-01

Seed development requires coordinated expression of embryo and endosperm and has contributions from both sporophytic and male and female gametophytic genes. Genetic and molecular analyses in recent years have started to illuminate how products of these multiple genes interact to initiate seed development. Imprinting or differential expression of paternal and maternal genes seems to be involved in controlling seed development, presumably by controlling gene expression in developing endosperm. Epigenetic processes such as chromatin remodeling and DNA methylation affect imprinting of key seed-specific genes; however, the identity of many of these genes remains unknown. The discovery of FIS genes has illuminated control of autonomous endosperm development, a component of apomixis, which is an important developmental and agronomic trait. FIS genes are targets of imprinting, and the genes they control in developing endosperm are also regulated by DNA methylation and chromatin remodeling genes. These results define some exciting future areas of research in seed development.

Inhibition of Apoptosis Overcomes Stage-Related Compatibility Barriers to Chimera Formation in Mouse Embryos.

PubMed

Masaki, Hideki; Kato-Itoh, Megumi; Takahashi, Yusuke; Umino, Ayumi; Sato, Hideyuki; Ito, Keiichi; Yanagida, Ayaka; Nishimura, Toshinobu; Yamaguchi, Tomoyuki; Hirabayashi, Masumi; Era, Takumi; Loh, Kyle M; Wu, Sean M; Weissman, Irving L; Nakauchi, Hiromitsu

2016-11-03

Cell types more advanced in development than embryonic stem cells, such as EpiSCs, fail to contribute to chimeras when injected into pre-implantation-stage blastocysts, apparently because the injected cells undergo apoptosis. Here we show that transient promotion of cell survival through expression of the anti-apoptotic gene BCL2 enables EpiSCs and Sox17 + endoderm progenitors to integrate into blastocysts and contribute to chimeric embryos. Upon injection into blastocyst, BCL2-expressing EpiSCs contributed to all bodily tissues in chimeric animals while Sox17 + endoderm progenitors specifically contributed in a region-specific fashion to endodermal tissues. In addition, BCL2 expression enabled rat EpiSCs to contribute to mouse embryonic chimeras, thereby forming interspecies chimeras that could survive to adulthood. Our system therefore provides a method to overcome cellular compatibility issues that typically restrict chimera formation. Application of this type of approach could broaden the use of embryonic chimeras, including region-specific chimeras, for basic developmental biology research and regenerative medicine. Copyright © 2016 Elsevier Inc. All rights reserved.

Genome-wide identification and expression profiling of the SnRK2 gene family in Malus prunifolia.

PubMed

Shao, Yun; Qin, Yuan; Zou, Yangjun; Ma, Fengwang

2014-11-15

Sucrose non-fermenting-1-related protein kinase 2 (SnRK2) constitutes a small plant-specific serine/threonine kinase family with essential roles in the abscisic acid (ABA) signal pathway and in responses to osmotic stress. Although a genome-wide analysis of this family has been conducted in some species, little is known about SnRK2 genes in apple (Malus domestica). We identified 14 putative sequences encoding 12 deduced SnRK2 proteins within the apple genome. Gene chromosomal location and synteny analysis of the apple SnRK2 genes indicated that tandem and segmental duplications have likely contributed to the expansion and evolution of these genes. All 12 full-length coding sequences were confirmed by cloning from Malus prunifolia. The gene structure and motif compositions of the apple SnRK2 genes were analyzed. Phylogenetic analysis showed that MpSnRK2s could be classified into four groups. Profiling of these genes presented differential patterns of expression in various tissues. Under stress conditions, transcript levels for some family members were up-regulated in the leaves in response to drought, salinity, or ABA treatments. This suggested their possible roles in plant response to abiotic stress. Our findings provide essential information about SnRK2 genes in apple and will contribute to further functional dissection of this gene family. Copyright © 2014 Elsevier B.V. All rights reserved.

Toward Bridging the Mechanistic Gap Between Genes and Traits by Emphasizing the Role of Proteins in a Computational Environment

NASA Astrophysics Data System (ADS)

Haskel-Ittah, Michal; Yarden, Anat

2017-12-01

Previous studies have shown that students often ignore molecular mechanisms when describing genetic phenomena. Specifically, students tend to directly link genes to their encoded traits, ignoring the role of proteins as mediators in this process. We tested the ability of 10th grade students to connect genes to traits through proteins, using concept maps and reasoning questions. The context of this study was a computational learning environment developed specifically to foster this ability. This environment presents proteins as the mechanism-mediating genetic phenomena. We found that students' ability to connect genes, proteins, and traits, or to reason using this connection, was initially poor. However, significant improvement was obtained when using the learning environment. Our results suggest that visual representations of proteins' functions in the context of a specific trait contributed to this improvement. One significant aspect of these results is the indication that 10th graders are capable of accurately describing genetic phenomena and their underlying mechanisms, a task that has been shown to raise difficulties, even in higher grades of high school.

DNA polymorphism analysis of Brucella lipopolysaccharide genes reveals marked differences in O-polysaccharide biosynthetic genes between smooth and rough Brucella species and novel species-specific markers

PubMed Central

2009-01-01

Background The lipopolysaccharide is a major antigen and virulence factor of Brucella, an important bacterial pathogen. In smooth brucellae, lipopolysaccharide is made of lipid A-core oligosaccharide and N-formylperosamine O-polysaccharide. B. ovis and B. canis (rough species) lack the O-polysaccharide. Results The polymorphism of O-polysaccharide genes wbkE, manAO-Ag, manBO-Ag, manCO-Ag, wbkF and wbkD) and wbo (wboA and wboB), and core genes manBcore and wa** was analyzed. Although most genes were highly conserved, species- and biovar-specific restriction patterns were found. There were no significant differences in putative N-formylperosamyl transferase genes, suggesting that Brucella A and M serotypes are not related to specific genes. In B. pinnipedialis and B. ceti (both smooth), manBO-Ag carried an IS711, confirming its dispensability for perosamine synthesis. Significant differences between smooth and rough species were found in wbkF and wbkD, two adjacent genes putatively related to bactoprenol priming for O-polysaccharide polymerization. B. ovis wbkF carried a frame-shift and B. canis had a long deletion partially encompassing both genes. In smooth brucellae, this region contains two direct repeats suggesting the deletion mechanism. Conclusion The results define species and biovar markers, confirm the dispensability of manBO-Ag for O-polysaccharide synthesis and contribute to explain the lipopolysaccharide structure of rough and smooth Brucella species. PMID:19439075

Mouse Models of Genomic Syndromes as Tools for Understanding the Basis of Complex Traits: An Example with the Smith-Magenis and the Potocki-Lupski Syndromes

PubMed Central

Carmona-Mora, P; Molina, J; Encina, C.A; Walz, K

2009-01-01

Each human's genome is distinguished by extra and missing DNA that can be “benign” or powerfully impact everything from development to disease. In the case of genomic disorders DNA rearrangements, such as deletions or duplications, correlate with a clinical specific phenotype. The clinical presentations of genomic disorders were thought to result from altered gene copy number of physically linked dosage sensitive genes. Genomic disorders are frequent diseases (~1 per 1,000 births). Smith-Magenis syndrome (SMS) and Potocki-Lupski syndrome (PTLS) are genomic disorders, associated with a deletion and a duplication, of 3.7 Mb respectively, within chromosome 17 band p11.2. This region includes 23 genes. Both syndromes have complex and distinctive phenotypes including multiple congenital and neurobehavioral abnormalities. Human chromosome 17p11.2 is syntenic to the 32-34 cM region of murine chromosome 11. The number and order of the genes are highly conserved. In this review, we will exemplify how genomic disorders can be modeled in mice and the advantages that such models can give in the study of genomic disorders in particular and gene copy number variation (CNV) in general. The contributions of the SMS and PTLS animal models in several aspects ranging from more specific ones, as the definition of the clinical aspects of the human clinical spectrum, the identification of dosage sensitive genes related to the human syndromes, to the more general contributions as the definition of genetic locus impacting obesity and behavior and the elucidation of general mechanisms related to the pathogenesis of gene CNV are discussed. PMID:19949547

A Protocol for Epigenetic Imprinting Analysis with RNA-Seq Data.

PubMed

Zou, Jinfeng; Xiang, Daoquan; Datla, Raju; Wang, Edwin

2018-01-01

Genomic imprinting is an epigenetic regulatory mechanism that operates through expression of certain genes from maternal or paternal in a parent-of-origin-specific manner. Imprinted genes have been identified in diverse biological systems that are implicated in some human diseases and in embryonic and seed developmental programs in plants. The molecular underpinning programs and mechanisms involved in imprinting are yet to be explored in depth in plants. The recent advances in RNA-Seq-based methods and technologies offer an opportunity to systematically analyze epigenetic imprinting that operates at the whole genome level in the model and crop plants. We are interested using Arabidopsis model system, to investigate gene expression patterns associated with parent of origin and their implications to imprinting during embryo and seed development. Toward this, we have generated early embryo development RNA-Seq-based transcriptome datasets in F1s from a genetic cross between two diverse Arabidopsis thaliana ecotypes Col-0 and Tsu-1. With the data, we developed a protocol for evaluating the maternal and paternal contributions of genes during the early stages of embryo development after fertilization. This protocol is also designed to consider the contamination from other potential seed tissues, sequencing quality, proper processing of sequenced reads and variant calling, and appropriate inference of the parental contributions based on the parent-of-origin-specific single-nucleotide polymorphisms within the expressed genes. The approach, methods and the protocol developed in this study can be used for evaluating the effects of epigenetic imprinting in plants.

A substitution involving the NLGN4 gene associated with autistic behavior in the Greek population.

PubMed

Pampanos, Andreas; Volaki, Konstantina; Kanavakis, Emmanuel; Papandreou, Ourania; Youroukos, Sotiris; Thomaidis, Loretta; Karkelis, Savvas; Tzetis, Maria; Kitsiou-Tzeli, Sophia

2009-10-01

Autism is a neurodevelopmental disorder characterized by clinical, etiologic, and genetic heterogeneity. During the last decade, predisposing genes and genetic loci were under investigation. Recently, mutations in two X-linked neuroligin genes, neuroligin 3 (NLGN3) and neuroligin 4 (NLGN4), have been implicated in the pathogenesis of autism. In our ongoing survey, we screened 169 patients with autism for mutations linked with autism. In the preliminary study of specific exons of NLGN3 and NLGN4 genes, we identified the p.K378R substitution (c.1597 A > G) in exon 5 of the NLGN4 gene in a patient who was found to have mild autism and normal IQ at 3 years of age. The same mutation has previously been found in a patient with autism. It is important that, for the first time, a specific mutation in neuroligins is confirmed in a molecular screen in another homogeneous ethnic population. This finding further contributes to consideration of neuroligins as probable candidate genes for future molecular genetic studies, suggesting that a defect of synaptogenesis may predispose to autism.

DLGP: A database for lineage-conserved and lineage-specific gene pairs in animal and plant genomes.

PubMed

Wang, Dapeng

2016-01-15

The conservation of gene organization in the genome with lineage-specificity is an invaluable resource to decipher their potential functionality with diverse selective constraints, especially in higher animals and plants. Gene pairs appear to be the minimal structure for such kind of gene clusters that tend to reside in their preferred locations, representing the distinctive genomic characteristics in single species or a given lineage. Despite gene families having been investigated in a widespread manner, the definition of gene pair families in various taxa still lacks adequate attention. To address this issue, we report DLGP (http://lcgbase.big.ac.cn/DLGP/) that stores the pre-calculated lineage-based gene pairs in currently available 134 animal and plant genomes and inspect them under the same analytical framework, bringing out a set of innovational features. First, the taxonomy or lineage has been classified into four levels such as Kingdom, Phylum, Class and Order. It adopts all-to-all comparison strategy to identify the possible conserved gene pairs in all species for each gene pair in certain species and reckon those that are conserved in over a significant proportion of species in a given lineage (e.g. Primates, Diptera or Poales) as the lineage-conserved gene pairs. Furthermore, it predicts the lineage-specific gene pairs by retaining the above-mentioned lineage-conserved gene pairs that are not conserved in any other lineages. Second, it carries out pairwise comparison for the gene pairs between two compared species and creates the table including all the conserved gene pairs and the image elucidating the conservation degree of gene pairs in chromosomal level. Third, it supplies gene order browser to extend gene pairs to gene clusters, allowing users to view the evolution dynamics in the gene context in an intuitive manner. This database will be able to facilitate the particular comparison between animals and plants, between vertebrates and arthropods, and between monocots and eudicots, accounting for the significant contribution of gene pairs to speciation and diversification in specific lineages. Copyright © 2015 Elsevier Inc. All rights reserved.

Environmental Adaptation Contributes to Gene Polymorphism across the Arabidopsis thaliana Genome

PubMed Central

Lee, Cheng-Ruei

2012-01-01

The level of within-species polymorphism differs greatly among genes in a genome. Many genomic studies have investigated the relationship between gene polymorphism and factors such as recombination rate or expression pattern. However, the polymorphism of a gene is affected not only by its physical properties or functional constraints but also by natural selection on organisms in their environments. Specifically, if functionally divergent alleles enable adaptation to different environments, locus-specific polymorphism may be maintained by spatially heterogeneous natural selection. To test this hypothesis and estimate the extent to which environmental selection shapes the pattern of genome-wide polymorphism, we define the "environmental relevance" of a gene as the proportion of genetic variation explained by environmental factors, after controlling for population structure. We found substantial effects of environmental relevance on patterns of polymorphism among genes. In addition, the correlation between environmental relevance and gene polymorphism is positive, consistent with the expectation that balancing selection among heterogeneous environments maintains genetic variation at ecologically important genes. Comparison of the gene ontology annotations shows that genes with high environmental relevance are enriched in unknown function categories. These results suggest an important role for environmental factors in shaping genome-wide patterns of polymorphism and indicate another direction of genomic study. PMID:22798389

The Pleiotropic MET Receptor Network: Circuit Development and the Neural-Medical Interface of Autism

PubMed Central

Eagleson, Kathie L.; Xie, Zhihui; Levitt, Pat

2016-01-01

People with autism spectrum disorder (ASD) and other neurodevelopmental disorders (NDDs) are behaviorally and medically heterogeneous. The combination of polygenicity and gene pleiotropy - the influence of one gene on distinct phenotypes - raises questions of how specific genes and their protein products interact to contribute to NDDs. A preponderance of evidence supports developmental and pathophysiological roles for the MET receptor tyrosine kinase, a multi-functional receptor that mediates distinct biological responses depending upon cell context. MET influences neuron architecture and synapse maturation in the forebrain, and regulates homeostasis in gastrointestinal and immune systems, both commonly disrupted in NDDs. Peak expression of synapse-enriched MET is conserved across rodent and primate forebrain, yet regional differences in primate neocortex are pronounced, with enrichment in circuits that participate in social information processing. A functional risk allele in the MET promoter, enriched in subgroups of children with ASD, reduces transcription and disrupts socially-relevant neural circuits structurally and functionally. In mice, circuit-specific deletion of Met causes distinct atypical behaviors. MET activation increases dendritic complexity and nascent synapse number, but synapse maturation requires reductions in MET. MET mediates its specific biological effects through different intracellular signaling pathways, and has a complex protein interactome that is enriched in ASD and other NDD candidates. The interactome is co-regulated in developing human neocortex. We suggest that a gene as pleiotropic and highly regulated as MET, together with its interactome, is biologically relevant in normal and pathophysiological contexts, impacting central and peripheral phenotypes that contribute to NDD risk and clinical symptoms. PMID:27837921

Inability to activate Rac1-dependent forgetting contributes to behavioral inflexibility in mutants of multiple autism-risk genes

PubMed Central

Dong, Tao; He, Jing; Wang, Shiqing; Wang, Lianzhang; Cheng, Yuqi; Zhong, Yi

2016-01-01

The etiology of autism is so complicated because it involves the effects of variants of several hundred risk genes along with the contribution of environmental factors. Therefore, it has been challenging to identify the causal paths that lead to the core autistic symptoms such as social deficit, repetitive behaviors, and behavioral inflexibility. As an alternative approach, extensive efforts have been devoted to identifying the convergence of the targets and functions of the autism-risk genes to facilitate mapping out causal paths. In this study, we used a reversal-learning task to measure behavioral flexibility in Drosophila and determined the effects of loss-of-function mutations in multiple autism-risk gene homologs in flies. Mutations of five autism-risk genes with diversified molecular functions all led to a similar phenotype of behavioral inflexibility indicated by impaired reversal-learning. These reversal-learning defects resulted from the inability to forget or rather, specifically, to activate Rac1 (Ras-related C3 botulinum toxin substrate 1)-dependent forgetting. Thus, behavior-evoked activation of Rac1-dependent forgetting has a converging function for autism-risk genes. PMID:27335463

Replication of 6 obesity genes in a meta-analysis of genome-wide association studies from diverse ancestries.

PubMed

Tan, Li-Jun; Zhu, Hu; He, Hao; Wu, Ke-Hao; Li, Jian; Chen, Xiang-Ding; Zhang, Ji-Gang; Shen, Hui; Tian, Qing; Krousel-Wood, Marie; Papasian, Christopher J; Bouchard, Claude; Pérusse, Louis; Deng, Hong-Wen

2014-01-01

Obesity is a major public health problem with a significant genetic component. Multiple DNA polymorphisms/genes have been shown to be strongly associated with obesity, typically in populations of European descent. The aim of this study was to verify the extent to which 6 confirmed obesity genes (FTO, CTNNBL1, ADRB2, LEPR, PPARG and UCP2 genes) could be replicated in 8 different samples (n = 11,161) and to explore whether the same genes contribute to obesity-susceptibility in populations of different ancestries (five Caucasian, one Chinese, one African-American and one Hispanic population). GWAS-based data sets with 1000 G imputed variants were tested for association with obesity phenotypes individually in each population, and subsequently combined in a meta-analysis. Multiple variants at the FTO locus showed significant associations with BMI, fat mass (FM) and percentage of body fat (PBF) in meta-analysis. The strongest association was detected at rs7185735 (P-value = 1.01×10(-7) for BMI, 1.80×10(-6) for FM, and 5.29×10(-4) for PBF). Variants at the CTNNBL1, LEPR and PPARG loci demonstrated nominal association with obesity phenotypes (meta-analysis P-values ranging from 1.15×10(-3) to 4.94×10(-2)). There was no evidence of association with variants at ADRB2 and UCP2 genes. When stratified by sex and ethnicity, FTO variants showed sex-specific and ethnic-specific effects on obesity traits. Thus, it is likely that FTO has an important role in the sex- and ethnic-specific risk of obesity. Our data confirmed the role of FTO, CTNNBL1, LEPR and PPARG in obesity predisposition. These findings enhanced our knowledge of genetic associations between these genes and obesity-related phenotypes, and provided further justification for pursuing functional studies of these genes in the pathophysiology of obesity. Sex and ethnic differences in genetic susceptibility across populations of diverse ancestries may contribute to a more targeted prevention and customized treatment of obesity.

Elevated transcription factor specificity protein 1 in autistic brains alters the expression of autism candidate genes.

PubMed

Thanseem, Ismail; Anitha, Ayyappan; Nakamura, Kazuhiko; Suda, Shiro; Iwata, Keiko; Matsuzaki, Hideo; Ohtsubo, Masafumi; Ueki, Takatoshi; Katayama, Taiichi; Iwata, Yasuhide; Suzuki, Katsuaki; Minoshima, Shinsei; Mori, Norio

2012-03-01

Profound changes in gene expression can result from abnormalities in the concentrations of sequence-specific transcription factors like specificity protein 1 (Sp1). Specificity protein 1 binding sites have been reported in the promoter regions of several genes implicated in autism. We hypothesize that dysfunction of Sp1 could affect the expression of multiple autism candidate genes, contributing to the heterogeneity of autism. We assessed any alterations in the expression of Sp1 and that of autism candidate genes in the postmortem brain (anterior cingulate gyrus [ACG], motor cortex, and thalamus) of autism patients (n = 8) compared with healthy control subjects (n = 13). Alterations in the expression of candidate genes upon Sp1/DNA binding inhibition with mithramycin and Sp1 silencing by RNAi were studied in SK-N-SH neuronal cells. We observed elevated expression of Sp1 in ACG of autism patients (p = .010). We also observed altered expression of several autism candidate genes. GABRB3, RELN, and HTR2A showed reduced expression, whereas CD38, ITGB3, MAOA, MECP2, OXTR, and PTEN showed elevated expression in autism. In SK-N-SH cells, OXTR, PTEN, and RELN showed reduced expression upon Sp1/DNA binding inhibition and Sp1 silencing. The RNA integrity number was not available for any of the samples. Transcription factor Sp1 is dysfunctional in the ACG of autistic brain. Consequently, the expression of potential autism candidate genes regulated by Sp1, especially OXTR and PTEN, could be affected. The diverse downstream pathways mediated by the Sp1-regulated genes, along with the environmental and intracellular signal-related regulation of Sp1, could explain the complex phenotypes associated with autism.

Evolution of Sex-Specific Traits through Changes in HOX-Dependent doublesex Expression

PubMed Central

Tanaka, Kohtaro; Barmina, Olga; Sanders, Laura E.; Arbeitman, Michelle N.; Kopp, Artyom

2011-01-01

Almost every animal lineage is characterized by unique sex-specific traits, implying that such traits are gained and lost frequently in evolution. However, the genetic mechanisms responsible for these changes are not understood. In Drosophila, the activity of the sex determination pathway is restricted to sexually dimorphic tissues, suggesting that spatial regulation of this pathway may contribute to the evolution of sex-specific traits. We examine the regulation and function of doublesex (dsx), the main transcriptional effector of the sex determination pathway, in the development and evolution of Drosophila sex combs. Sex combs are a recent evolutionary innovation and show dramatic diversity in the relatively few Drosophila species that have them. We show that dsx expression in the presumptive sex comb region is activated by the HOX gene Sex combs reduced (Scr), and that the male isoform of dsx up-regulates Scr so that both genes become expressed at high levels in this region in males but not in females. Precise spatial regulation of dsx is essential for defining sex comb position and morphology. Comparative analysis of Scr and dsx expression reveals a tight correlation between sex comb morphology and the expression patterns of both genes. In species that primitively lack sex combs, no dsx expression is observed in the homologous region, suggesting that the origin and diversification of this structure were linked to the gain of a new dsx expression domain. Two other, distantly related fly lineages that independently evolved novel male-specific structures show evolutionary gains of dsx expression in the corresponding tissues, where dsx may also be controlled by Scr. These findings suggest that changes in the spatial regulation of sex-determining genes are a key mechanism that enables the evolution of new sex-specific traits, contributing to some of the most dramatic examples of phenotypic diversification in nature. PMID:21886483

Integration of ATAC-seq and RNA-seq identifies human alpha cell and beta cell signature genes.

PubMed

Ackermann, Amanda M; Wang, Zhiping; Schug, Jonathan; Naji, Ali; Kaestner, Klaus H

2016-03-01

Although glucagon-secreting α-cells and insulin-secreting β-cells have opposing functions in regulating plasma glucose levels, the two cell types share a common developmental origin and exhibit overlapping transcriptomes and epigenomes. Notably, destruction of β-cells can stimulate repopulation via transdifferentiation of α-cells, at least in mice, suggesting plasticity between these cell fates. Furthermore, dysfunction of both α- and β-cells contributes to the pathophysiology of type 1 and type 2 diabetes, and β-cell de-differentiation has been proposed to contribute to type 2 diabetes. Our objective was to delineate the molecular properties that maintain islet cell type specification yet allow for cellular plasticity. We hypothesized that correlating cell type-specific transcriptomes with an atlas of open chromatin will identify novel genes and transcriptional regulatory elements such as enhancers involved in α- and β-cell specification and plasticity. We sorted human α- and β-cells and performed the "Assay for Transposase-Accessible Chromatin with high throughput sequencing" (ATAC-seq) and mRNA-seq, followed by integrative analysis to identify cell type-selective gene regulatory regions. We identified numerous transcripts with either α-cell- or β-cell-selective expression and discovered the cell type-selective open chromatin regions that correlate with these gene activation patterns. We confirmed cell type-selective expression on the protein level for two of the top hits from our screen. The "group specific protein" (GC; or vitamin D binding protein) was restricted to α-cells, while CHODL (chondrolectin) immunoreactivity was only present in β-cells. Furthermore, α-cell- and β-cell-selective ATAC-seq peaks were identified to overlap with known binding sites for islet transcription factors, as well as with single nucleotide polymorphisms (SNPs) previously identified as risk loci for type 2 diabetes. We have determined the genetic landscape of human α- and β-cells based on chromatin accessibility and transcript levels, which allowed for detection of novel α- and β-cell signature genes not previously known to be expressed in islets. Using fine-mapping of open chromatin, we have identified thousands of potential cis-regulatory elements that operate in an endocrine cell type-specific fashion.

The organ-specific expression of terpene synthase genes contributes to the terpene hydrocarbon composition of chamomile essential oils.

PubMed

Irmisch, Sandra; Krause, Sandra T; Kunert, Grit; Gershenzon, Jonathan; Degenhardt, Jörg; Köllner, Tobias G

2012-06-08

The essential oil of chamomile, one of the oldest and agronomically most important medicinal plant species in Europe, has significant antiphlogistic, spasmolytic and antimicrobial activities. It is rich in chamazulene, a pharmaceutically active compound spontaneously formed during steam distillation from the sesquiterpene lactone matricine. Chamomile oil also contains sesquiterpene alcohols and hydrocarbons which are produced by the action of terpene synthases (TPS), the key enzymes in constructing terpene carbon skeletons. Here, we present the identification and characterization of five TPS enzymes contributing to terpene biosynthesis in chamomile (Matricaria recutita). Four of these enzymes were exclusively expressed in above-ground organs and produced the common terpene hydrocarbons (-)-(E)-β-caryophyllene (MrTPS1), (+)-germacrene A (MrTPS3), (E)-β-ocimene (MrTPS4) and (-)-germacrene D (MrTPS5). A fifth TPS, the multiproduct enzyme MrTPS2, was mainly expressed in roots and formed several Asteraceae-specific tricyclic sesquiterpenes with (-)-α-isocomene being the major product. The TPS transcript accumulation patterns in different organs of chamomile were consistent with the abundance of the corresponding TPS products isolated from these organs suggesting that the spatial regulation of TPS gene expression qualitatively contribute to terpene composition. The terpene synthases characterized in this study are involved in the organ-specific formation of essential oils in chamomile. While the products of MrTPS1, MrTPS2, MrTPS4 and MrTPS5 accumulate in the oils without further chemical alterations, (+)-germacrene A produced by MrTPS3 accumulates only in trace amounts, indicating that it is converted into another compound like matricine. Thus, MrTPS3, but also the other TPS genes, are good markers for further breeding of chamomile cultivars rich in pharmaceutically active essential oils.

Response of Spring Diatoms to CO2 Availability in the Western North Pacific as Determined by Next-Generation Sequencing.

PubMed

Endo, Hisashi; Sugie, Koji; Yoshimura, Takeshi; Suzuki, Koji

2016-01-01

Next-generation sequencing (NGS) technologies have enabled us to determine phytoplankton community compositions at high resolution. However, few studies have adopted this approach to assess the responses of natural phytoplankton communities to environmental change. Here, we report the impact of different CO2 levels on spring diatoms in the Oyashio region of the western North Pacific as estimated by NGS of the diatom-specific rbcL gene (DNA), which encodes the large subunit of RubisCO. We also examined the abundance and composition of rbcL transcripts (cDNA) in diatoms to assess their physiological responses to changing CO2 levels. A short-term (3-day) incubation experiment was carried out on-deck using surface Oyashio waters under different pCO2 levels (180, 350, 750, and 1000 μatm) in May 2011. During the incubation, the transcript abundance of the diatom-specific rbcL gene decreased with an increase in seawater pCO2 levels. These results suggest that CO2 fixation capacity of diatoms decreased rapidly under elevated CO2 levels. In the high CO2 treatments (750 and 1000 μatm), diversity of diatom-specific rbcL gene and its transcripts decreased relative to the control treatment (350 μatm), as well as contributions of Chaetocerataceae, Thalassiosiraceae, and Fragilariaceae to the total population, but the contributions of Bacillariaceae increased. In the low CO2 treatment, contributions of Bacillariaceae also increased together with other eukaryotes. These suggest that changes in CO2 levels can alter the community composition of spring diatoms in the Oyashio region. Overall, the NGS technology provided us a deeper understanding of the response of diatoms to changes in CO2 levels in terms of their community composition, diversity, and photosynthetic physiology.

Repression of Virus-Induced Interferon A Promoters by Homeodomain Transcription Factor Ptx1

PubMed Central

Lopez, Sébastien; Island, Marie-Laure; Drouin, Jacques; Bandu, Marie-Thérese; Christeff, Nicolas; Darracq, Nicole; Barbey, Régine; Doly, Janine; Thomas, Dominique; Navarro, Sébastien

2000-01-01

Interferon A (IFN-A) genes are differentially expressed after virus induction. The differential expression of individual IFN-A genes is modulated by substitutions in the proximal positive virus responsive element A (VRE-A) of their promoters and by the presence or absence of a distal negative regulatory element (DNRE). The functional feature of the DNRE is to specifically act by repression of VRE-A activity. With the use of the yeast one-hybrid system, we describe here the identification of a specific DNRE-binding protein, the pituitary homeobox 1 (Ptx1 or Pitx1). Ptx1 is detectable in different cell types that differentially express IFN-A genes, and the endogenous Ptx1 protein binds specifically to the DNRE. Upon virus induction, Ptx1 negatively regulates the transcription of DNRE-containing IFN-A promoters, and the C-terminal region, as well as the homeodomain of the Ptx1 protein, is required for this repression. After virus induction, the expression of the Ptx1 antisense RNA leads to a significant increase of endogenous IFN-A gene transcription and is able to modify the pattern of differential expression of individual IFN-A genes. These studies suggest that Ptx1 contributes to the differential transcriptional strength of the promoters of different IFN-A genes and that these genes may provide new targets for transcriptional regulation by a homeodomain transcription factor. PMID:11003649

Nematogalectin, a nematocyst protein with GlyXY and galectin domains, demonstrates nematocyte-specific alternative splicing in Hydra

PubMed Central

Hwang, Jung Shan; Takaku, Yasuharu; Momose, Tsuyoshi; Adamczyk, Patrizia; Özbek, Suat; Ikeo, Kazuho; Khalturin, Konstantin; Hemmrich, Georg; Bosch, Thomas C. G.; Holstein, Thomas W.; David, Charles N.; Gojobori, Takashi

2010-01-01

Taxonomically restricted genes or lineage-specific genes contribute to morphological diversification in metazoans and provide unique functions for particular taxa in adapting to specific environments. To understand how such genes arise and participate in morphological evolution, we have investigated a gene called nematogalectin in Hydra, which has a structural role in the formation of nematocysts, stinging organelles that are unique to the phylum Cnidaria. Nematogalectin is a 28-kDa protein with an N-terminal GlyXY domain (glycine followed by two hydrophobic amino acids), which can form a collagen triple helix, followed by a galactose-binding lectin domain. Alternative splicing of the nematogalectin transcript allows the gene to encode two proteins, nematogalectin A and nematogalectin B. We demonstrate that expression of nematogalectin A and B is mutually exclusive in different nematocyst types: Desmonemes express nematogalectin B, whereas stenoteles and isorhizas express nematogalectin B early in differentiation, followed by nematogalectin A. Like Hydra, the marine hydrozoan Clytia also has two nematogalectin transcripts, which are expressed in different nematocyte types. By comparison, anthozoans have only one nematogalectin gene. Gene phylogeny indicates that tandem duplication of nematogalectin B exons gave rise to nematogalectin A before the divergence of Anthozoa and Medusozoa and that nematogalectin A was subsequently lost in Anthozoa. The emergence of nematogalectin A may have played a role in the morphological diversification of nematocysts in the medusozoan lineage. PMID:20937891

Evolutionary forward genomics reveals novel insights into the genes and pathways dysregulated in recurrent early pregnancy loss.

PubMed

Kosova, Gülüm; Stephenson, Mary D; Lynch, Vincent J; Ober, Carole

2015-03-01

Are the genes that gained novel expression in the endometria of Eutherian (placental) mammals more likely to be dysregulated in patients with endometrial-associated recurrent early pregnancy loss (REPL)? There was a significant enrichment of genes dysregulated in REPL patients among the Eutherian-specific endometrial genes. Pregnancy loss is the most common complication of human pregnancy. REPL has multiple etiologies, including dysregulation of endometrial function, leading to 'suboptimal' implantation. Although the implantation process is tightly regulated in Eutherian (placental) mammals, the molecular factors contributing to dysregulated endometrial gene expression patterns in women with REPL are largely unknown. Endometrial biopsies were obtained from 32 REPL patients during the mid-luteal phase, and evaluated for glandular development arrest based on elevated nuclear cyclin E levels in gland cells, and for out-of-phase endometrial development based on histology. Gene expression levels were measured using Illumina Human HT-12v4 BeadChip arrays. Differentially expressed genes were identified between patients with (i) out-of-phase (n = 10) versus normal (n = 22) histological dating and (ii) abnormally elevated (n = 9) versus normal (n = 23) cyclin E levels in the nuclei of endometrial glands, using a likelihood ratio test. Enrichment of dysregulated genes in REPL endometria among Eutherian-specific genes was tested by permutation. Gene ontology and pathway enrichment analyses were carried out for the dysregulated genes. Fifty-eight and eighty-one genes were identified as differentially expressed at P < 0.001 in women with out-of-phase histological dating and abnormally elevated glandular cyclin E levels, respectively. Genes that were recruited into endometrial expression during the evolution of pregnancy in Eutherian mammals were significantly enriched for dysregulated genes (P = 0.002 for histology, P = 0.021 for cyclin E), as well as for genes involved in immune response and signaling pathways with essential roles in implantation and endometrial biology. Small sample size limits the statistical power to detect dysregulated genes, and the lack of non-REPL control women does not allow us to test for the contribution of these genes to overall risk of REPL. Enrichment of functional gene categories, as well as genes gained expression in the Eutherian endometria, help to identify molecular etiologies that contribute to normal functioning of the endometrium. These pathways are also strong candidates for successful pregnancy outcomes. Using the evolutionary history of mammalian gene expression in the endometrial tissue may be a promising approach to discover genes involved in female reproductive disorders. This work is supported by National Institutes of Health (NIH) grant R01 HD21244 to C.O. Authors declare no competing interests. © The Author 2015. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

The aquaglyceroporin AQP9 contributes to the sex-specific effects of in utero arsenic exposure on placental gene expression.

PubMed

Winterbottom, Emily F; Koestler, Devin C; Fei, Dennis Liang; Wika, Eric; Capobianco, Anthony J; Marsit, Carmen J; Karagas, Margaret R; Robbins, David J

2017-06-14

Sex-specific factors play a major role in human health and disease, including responses to environmental stresses such as toxicant exposure. Increasing evidence suggests that such sex differences also exist during fetal development. In a previous report using the resources of the New Hampshire Birth Cohort Study (NHBCS), we found that low-to-moderate in utero exposure to arsenic, a highly toxic and widespread pollutant, was associated with altered expression of several key developmental genes in the fetal portion of the placenta. These associations were sex-dependent, suggesting that in utero arsenic exposure differentially impacts male and female fetuses. In the present study, we investigated the molecular basis for these sex-specific responses to arsenic. Using NanoString technology, we further analyzed the fetal placenta samples from the NHBCS for the expression of genes encoding arsenic transporters and metabolic enzymes. Multivariable linear regression analysis was used to examine their relationship with arsenic exposure and with key developmental genes, after stratification by fetal sex. We found that maternal arsenic exposure was strongly associated with expression of the AQP9 gene, encoding an aquaglyceroporin transporter, in female but not male fetal placenta. Moreover, AQP9 expression associated with that of a subset of female-specific arsenic-responsive genes. Our results suggest that AQP9 is upregulated in response to arsenic exposure in female, but not male, fetal placenta. Based on these results and prior studies, increased AQP9 expression may lead to increased arsenic transport in the female fetal placenta, which in turn may alter the expression patterns of key developmental genes that we have previously shown to be associated with arsenic exposure. Thus, this study suggests that AQP9 may play a role in the sex-specific effects of in utero arsenic exposure.

Epigenetic modification of DRG neuronal gene expression subsequent to nerve injury: etiological contribution to complex regional pain syndromes (Part II).

PubMed

Wang, Fuzhou; Stefano, George B; Kream, Richard M

2014-07-12

Cumulating evidence indicated that nerve injury-associated cellular and molecular changes play an essential role in contributing to the development of pathological pain, and more recent findings implicated the critical role of epigenetic mechanisms in pain-related sensitization in the DRG subsequent to nerve injury. In this part of the dyad review (Part II), we reviewed and paid special attention on the etiological contribution of DGR gene expression modulated by epigenetic mechanisms of CRPS. As essential effectors to different molecular activation, we first discussed the activation of various signaling pathways that subsequently from nerve injury, and in further illustrated the fundamental and functional underpinnings of nerve injury-induced pain, in which we argued for the potential epigenetic mechanisms in response to sensitizing stimuli or injury. Therefore, understanding the specific mediating factors that influence individual epigenetic differences contributing to pain sensitivity and responsiveness to analgesics possesses crucial clinical implications.

Acquisition and evolution of plant pathogenesis-associated gene clusters and candidate determinants of tissue-specificity in xanthomonas.

PubMed

Lu, Hong; Patil, Prabhu; Van Sluys, Marie-Anne; White, Frank F; Ryan, Robert P; Dow, J Maxwell; Rabinowicz, Pablo; Salzberg, Steven L; Leach, Jan E; Sonti, Ramesh; Brendel, Volker; Bogdanove, Adam J

2008-01-01

Xanthomonas is a large genus of plant-associated and plant-pathogenic bacteria. Collectively, members cause diseases on over 392 plant species. Individually, they exhibit marked host- and tissue-specificity. The determinants of this specificity are unknown. To assess potential contributions to host- and tissue-specificity, pathogenesis-associated gene clusters were compared across genomes of eight Xanthomonas strains representing vascular or non-vascular pathogens of rice, brassicas, pepper and tomato, and citrus. The gum cluster for extracellular polysaccharide is conserved except for gumN and sequences downstream. The xcs and xps clusters for type II secretion are conserved, except in the rice pathogens, in which xcs is missing. In the otherwise conserved hrp cluster, sequences flanking the core genes for type III secretion vary with respect to insertion sequence element and putative effector gene content. Variation at the rpf (regulation of pathogenicity factors) cluster is more pronounced, though genes with established functional relevance are conserved. A cluster for synthesis of lipopolysaccharide varies highly, suggesting multiple horizontal gene transfers and reassortments, but this variation does not correlate with host- or tissue-specificity. Phylogenetic trees based on amino acid alignments of gum, xps, xcs, hrp, and rpf cluster products generally reflect strain phylogeny. However, amino acid residues at four positions correlate with tissue specificity, revealing hpaA and xpsD as candidate determinants. Examination of genome sequences of xanthomonads Xylella fastidiosa and Stenotrophomonas maltophilia revealed that the hrp, gum, and xcs clusters are recent acquisitions in the Xanthomonas lineage. Our results provide insight into the ancestral Xanthomonas genome and indicate that differentiation with respect to host- and tissue-specificity involved not major modifications or wholesale exchange of clusters, but subtle changes in a small number of genes or in non-coding sequences, and/or differences outside the clusters, potentially among regulatory targets or secretory substrates.

PD1 as a common candidate susceptibility gene of subacute sclerosing panencephalitis.

PubMed

Ishizaki, Yoshito; Yukaya, Naoko; Kusuhara, Koichi; Kira, Ryutaro; Torisu, Hiroyuki; Ihara, Kenji; Sakai, Yasunari; Sanefuji, Masafumi; Pipo-Deveza, Judy R; Silao, Catherine Lynn T; Sanchez, Benilda C; Lukban, Marissa B; Salonga, Aida M; Hara, Toshiro

2010-04-01

Although the exact pathogenesis of subacute sclerosing panencephalitis (SSPE) remains to be determined, our previous data suggested a genetic contribution to the host susceptibility to SSPE. During chronic viral infection, virus-specific cytotoxic T lymphocytes display poor effector functions. Since co-inhibitory molecules are involved in the suppression of T lymphocytes, we investigated whether single nucleotide polymorphisms (SNPs) of genes encoding co-inhibitory molecules contributed to a susceptibility to SSPE. Association studies on a total of 20 SNPs in 8 genes (CTLA4, CD80, CD86, PD1, PDL1, PDL2, BTLA and HVEM) and subsequent haplotype analysis of 4 SNPs in the PD1 genes were performed in Japanese and Filipino SSPE patients and controls. Then, we investigated a functional difference in promoter activity of two haplotypes and compared the expression levels of PD1 between SSPE and controls. The frequency of GCG(C) haplotype of PD1 containing -606G allele was significantly higher in SSPE patients than in controls both in Japanese and in Filipinos. The promoter activity was significantly higher in the construct with -606G allele than in that with -606A allele. The expression levels of PD1 were significantly higher in SSPE patients than in the controls. Our results suggested that the PD1 gene contributed to a genetic susceptibility to SSPE.

FLOWERING LOCUS C Mediates Natural Variation in the High-Temperature Response of the Arabidopsis Circadian Clock[W

PubMed Central

Edwards, Kieron D.; Anderson, Paul E.; Hall, Anthony; Salathia, Neeraj S.; Locke, James C.W.; Lynn, James R.; Straume, Martin; Smith, James Q.; Millar, Andrew J.

2006-01-01

Temperature compensation contributes to the accuracy of biological timing by preventing circadian rhythms from running more quickly at high than at low temperatures. We previously identified quantitative trait loci (QTL) with temperature-specific effects on the circadian rhythm of leaf movement, including a QTL linked to the transcription factor FLOWERING LOCUS C (FLC). We have now analyzed FLC alleles in near-isogenic lines and induced mutants to eliminate other candidate genes. We showed that FLC lengthened the circadian period specifically at 27°C, contributing to temperature compensation of the circadian clock. Known upstream regulators of FLC expression in flowering time pathways similarly controlled its circadian effect. We sought to identify downstream targets of FLC regulation in the molecular mechanism of the circadian clock using genome-wide analysis to identify FLC-responsive genes and 3503 transcripts controlled by the circadian clock. A Bayesian clustering method based on Fourier coefficients allowed us to discriminate putative regulatory genes. Among rhythmic FLC-responsive genes, transcripts of the transcription factor LUX ARRHYTHMO (LUX) correlated in peak abundance with the circadian period in flc mutants. Mathematical modeling indicated that the modest change in peak LUX RNA abundance was sufficient to cause the period change due to FLC, providing a molecular target for the crosstalk between flowering time pathways and circadian regulation. PMID:16473970

Evolution of the vertebrate claudin gene family: insights from a basal vertebrate, the sea lamprey.

PubMed

Mukendi, Christian; Dean, Nicholas; Lala, Rushil; Smith, Jeramiah; Bronner, Marianne E; Nikitina, Natalya V

2016-01-01

Claudins are major constituents of tight junctions, contributing both to their intercellular sealing and selective permeability properties. While claudins and claudin-like molecules are present in some invertebrates, the association of claudins with tight junctions has been conclusively documented only in vertebrates. Here we report the sequencing, phylogenetic analysis and comprehensive spatiotemporal expression analysis of the entire claudin gene family in the basal extant vertebrate, the sea lamprey. Our results demonstrate that clear orthologues to about half of all mammalian claudins are present in the lamprey, suggesting that at least one round of whole genome duplication contributed to the diversification of this gene family. Expression analysis revealed that claudins are expressed in discrete and specific domains, many of which represent vertebrate-specific innovations, such as in cranial ectodermal placodes and the neural crest; whereas others represent structures characteristic of chordates, e.g. pronephros, notochord, somites, endostyle and pharyngeal arches. By comparing the embryonic expression of claudins in the lamprey to that of other vertebrates, we found that ancestral expression patterns were often preserved in higher vertebrates. Morpholino mediated loss of Cldn3b demonstrated a functional role for this protein in placode and pharyngeal arch morphogenesis. Taken together, our data provide novel insights into the origins and evolution of the claudin gene family and the significance of claudin proteins in the evolution of vertebrates.

Microarray Data Analysis of Space Grown Arabidopsis Leaves for Genes Important in Vascular Patterning. Analysis of Space Grown Arabidopsis with Microarray Data from GeneLab: Identification of Genes Important in Vascular Patterning

NASA Technical Reports Server (NTRS)

Weitzel, A. J.; Wyatt, S. E.; Parsons-Wingerter, P.

2016-01-01

Venation patterning in leaves is a major determinant of photosynthesis efficiency because of its dependency on vascular transport of photo-assimilates, water, and minerals. Arabidopsis thaliana grown in microgravity show delayed growth and leaf maturation. Gene expression data from the roots, hypocotyl, and leaves of A. thaliana grown during spaceflight vs. ground control analyzed by Affymetrix microarray are available through NASA's GeneLab (GLDS-7). We analyzed the data for differential expression of genes in leaves resulting from the effects of spaceflight on vascular patterning. Two genes were found by preliminary analysis to be up-regulated during spaceflight that may be related to vascular formation. The genes are responsible for coding an ARGOS (Auxin-Regulated Gene Involved in Organ Size)-like protein (potentially affecting cell elongation in the leaves), and an F-box/kelch-repeat protein (possibly contributing to protoxylem specification). Further analysis that will focus on raw data quality assessment and a moderated t-test may further confirm up-regulation of the two genes and/or identify other gene candidates. Plants defective in these genes will then be assessed for phenotype by the mapping and quantification of leaf vascular patterning by NASA's VESsel GENeration (VESGEN) software to model specific vascular differences of plants grown in spaceflight.

Targeted Changes of the Cell Wall Proteome Influence Candida albicans Ability to Form Single- and Multi-strain Biofilms

PubMed Central

Walker, Louise A.; Martin-Yken, Hélène; Dague, Etienne; Legrand, Mélanie; Lee, Keunsook; Chauvel, Murielle; Firon, Arnaud; Rossignol, Tristan; Richard, Mathias L.; Munro, Carol A.; Bachellier-Bassi, Sophie; d'Enfert, Christophe

2014-01-01

Biofilm formation is an important virulence trait of the pathogenic yeast Candida albicans. We have combined gene overexpression, strain barcoding and microarray profiling to screen a library of 531 C. albicans conditional overexpression strains (∼10% of the genome) for genes affecting biofilm development in mixed-population experiments. The overexpression of 16 genes increased strain occupancy within a multi-strain biofilm, whereas overexpression of 4 genes decreased it. The set of 16 genes was significantly enriched for those encoding predicted glycosylphosphatidylinositol (GPI)-modified proteins, namely Ihd1/Pga36, Phr2, Pga15, Pga19, Pga22, Pga32, Pga37, Pga42 and Pga59; eight of which have been classified as pathogen-specific. Validation experiments using either individually- or competitively-grown overexpression strains revealed that the contribution of these genes to biofilm formation was variable and stage-specific. Deeper functional analysis of PGA59 and PGA22 at a single-cell resolution using atomic force microscopy showed that overexpression of either gene increased C. albicans ability to adhere to an abiotic substrate. However, unlike PGA59, PGA22 overexpression led to cell cluster formation that resulted in increased sensitivity to shear forces and decreased ability to form a single-strain biofilm. Within the multi-strain environment provided by the PGA22-non overexpressing cells, PGA22-overexpressing cells were protected from shear forces and fitter for biofilm development. Ultrastructural analysis, genome-wide transcript profiling and phenotypic analyses in a heterologous context suggested that PGA22 affects cell adherence through alteration of cell wall structure and/or function. Taken together, our findings reveal that several novel predicted GPI-modified proteins contribute to the cooperative behaviour between biofilm cells and are important participants during C. albicans biofilm formation. Moreover, they illustrate the power of using signature tagging in conjunction with gene overexpression for the identification of novel genes involved in processes pertaining to C. albicans virulence. PMID:25502890

Sexual dimorphism in parental imprint ontogeny and contribution to embryonic development.

PubMed

Bourc'his, Déborah; Proudhon, Charlotte

2008-01-30

Genomic imprinting refers to the functional non-equivalence of parental genomes in mammals that results from the parent-of-origin allelic expression of a subset of genes. Parent-specific expression is dependent on the germ line acquisition of DNA methylation marks at imprinting control regions (ICRs), coordinated by the DNA-methyltransferase homolog DNMT3L. We discuss here how the gender-specific stages of DNMT3L expression may have influenced the various sexually dimorphic aspects of genomic imprinting: (1) the differential developmental timing of methylation establishment at paternally and maternally imprinted genes in each parental germ line, (2) the differential dependence on DNMT3L of parental methylation imprint establishment, (3) the unequal duration of paternal versus maternal methylation imprints during germ cell development, (4) the biased distribution of methylation-dependent ICRs towards the maternal genome, (5) the different genomic organization of paternal versus maternal ICRs, and finally (6) the overwhelming contribution of maternal germ line imprints to development compared to their paternal counterparts.

The SAGA/TREX-2 subunit Sus1 binds widely to transcribed genes and affects mRNA turnover globally.

PubMed

García-Molinero, Varinia; García-Martínez, José; Reja, Rohit; Furió-Tarí, Pedro; Antúnez, Oreto; Vinayachandran, Vinesh; Conesa, Ana; Pugh, B Franklin; Pérez-Ortín, José E; Rodríguez-Navarro, Susana

2018-03-29

Eukaryotic transcription is regulated through two complexes, the general transcription factor IID (TFIID) and the coactivator Spt-Ada-Gcn5 acetyltransferase (SAGA). Recent findings confirm that both TFIID and SAGA contribute to the synthesis of nearly all transcripts and are recruited genome-wide in yeast. However, how this broad recruitment confers selectivity under specific conditions remains an open question. Here we find that the SAGA/TREX-2 subunit Sus1 associates with upstream regulatory regions of many yeast genes and that heat shock drastically changes Sus1 binding. While Sus1 binding to TFIID-dominated genes is not affected by temperature, its recruitment to SAGA-dominated genes and RP genes is significantly disturbed under heat shock, with Sus1 relocated to environmental stress-responsive genes in these conditions. Moreover, in contrast to recent results showing that SAGA deubiquitinating enzyme Ubp8 is dispensable for RNA synthesis, genomic run-on experiments demonstrate that Sus1 contributes to synthesis and stability of a wide range of transcripts. Our study provides support for a model in which SAGA/TREX-2 factor Sus1 acts as a global transcriptional regulator in yeast but has differential activity at yeast genes as a function of their transcription rate or during stress conditions.

Sequences 5' to translation start regulate expression of petunia rbcS genes.

PubMed Central

Dean, C; Favreau, M; Bedbrook, J; Dunsmuir, P

1989-01-01

The promoter sequences that contribute to quantitative differences in expression of the petunia genes (rbcS) encoding the small subunit of ribulose bisphosphate carboxylase have been characterized. The promoter regions of the two most abundantly expressed petunia rbcS genes, SSU301 and SSU611, show sequence similarity not present in other rbcS genes. We investigated the significance of these and other sequences by adding specific regions from the SSU301 promoter (the most strongly expressed gene) to equivalent regions in the SSU911 promoter (the least strongly expressed gene) and assaying the expression of the fusions in transgenic tobacco plants. In this way, we characterized an SSU301 promoter region (either from -285 to -178 or -291 to -204) which, when added to SSU911, in either orientation, increased SSU911 expression 25-fold. This increase was equivalent to that caused by addition of the entire SSU301 5'-flanking region. Replacement of SSU911 promoter sequences between -198 and the start codon with sequences from the equivalent region of SSU301 did not increase SSU911 expression significantly. The -291 to -204 SSU301 promoter fragment contributes significantly to quantitative differences in expression between the petunia rbcS genes. PMID:2535543

Molecular Evolution of Phosphoprotein Phosphatases in Drosophila

PubMed Central

Miskei, Márton; Ádám, Csaba; Kovács, László; Karányi, Zsolt; Dombrádi, Viktor

2011-01-01

Phosphoprotein phosphatases (PPP), these ancient and important regulatory enzymes are present in all eukaryotic organisms. Based on the genome sequences of 12 Drosophila species we traced the evolution of the PPP catalytic subunits and noted a substantial expansion of the gene family. We concluded that the 18–22 PPP genes of Drosophilidae were generated from a core set of 8 indispensable phosphatases that are present in most of the insects. Retropositons followed by tandem gene duplications extended the phosphatase repertoire, and sporadic gene losses contributed to the species specific variations in the PPP complement. During the course of these studies we identified 5, up till now uncharacterized phosphatase retrogenes: PpY+, PpD5+, PpD6+, Pp4+, and Pp6+ which are found only in some ancient Drosophila. We demonstrated that all of these new PPP genes exhibit a distinct male specific expression. In addition to the changes in gene numbers, the intron-exon structure and the chromosomal localization of several PPP genes was also altered during evolution. The G−C content of the coding regions decreased when a gene moved into the heterochromatic region of chromosome Y. Thus the PPP enzymes exemplify the various types of dynamic rearrangements that accompany the molecular evolution of a gene family in Drosophilidae. PMID:21789237

Gene flow and biological conflict systems in the origin and evolution of eukaryotes

PubMed Central

Aravind, L.; Anantharaman, Vivek; Zhang, Dapeng; de Souza, Robson F.; Iyer, Lakshminarayan M.

2012-01-01

The endosymbiotic origin of eukaryotes brought together two disparate genomes in the cell. Additionally, eukaryotic natural history has included other endosymbiotic events, phagotrophic consumption of organisms, and intimate interactions with viruses and endoparasites. These phenomena facilitated large-scale lateral gene transfer and biological conflicts. We synthesize information from nearly two decades of genomics to illustrate how the interplay between lateral gene transfer and biological conflicts has impacted the emergence of new adaptations in eukaryotes. Using apicomplexans as example, we illustrate how lateral transfer from animals has contributed to unique parasite-host interfaces comprised of adhesion- and O-linked glycosylation-related domains. Adaptations, emerging due to intense selection for diversity in the molecular participants in organismal and genomic conflicts, being dispersed by lateral transfer, were subsequently exapted for eukaryote-specific innovations. We illustrate this using examples relating to eukaryotic chromatin, RNAi and RNA-processing systems, signaling pathways, apoptosis and immunity. We highlight the major contributions from catalytic domains of bacterial toxin systems to the origin of signaling enzymes (e.g., ADP-ribosylation and small molecule messenger synthesis), mutagenic enzymes for immune receptor diversification and RNA-processing. Similarly, we discuss contributions of bacterial antibiotic/siderophore synthesis systems and intra-genomic and intra-cellular selfish elements (e.g., restriction-modification, mobile elements and lysogenic phages) in the emergence of chromatin remodeling/modifying enzymes and RNA-based regulation. We develop the concept that biological conflict systems served as evolutionary “nurseries” for innovations in the protein world, which were delivered to eukaryotes via lateral gene flow to spur key evolutionary innovations all the way from nucleogenesis to lineage-specific adaptations. PMID:22919680

Children's 5-HTTLPR genotype moderates the link between maternal criticism and attentional biases specifically for facial displays of anger.

PubMed

Gibb, Brandon E; Johnson, Ashley L; Benas, Jessica S; Uhrlass, Dorothy J; Knopik, Valerie S; McGeary, John E

2011-09-01

Theorists have proposed that negative experiences in childhood may contribute to the development of experience-specific information-processing biases, including attentional biases. There are also clear genetic influences on cognitive processes, with evidence that polymorphisms in specific candidate genes may moderate the impact of environmental stress on attentional biases (e.g., a functional polymorphism in the serotonin transporter gene; 5-HTTLPR). In the current study, we tested a gene×environment (G×E) model of risk for attentional biases. We hypothesised that children whose mothers exhibit high levels of expressed emotion criticism (EE-Crit) would display attentional biases specifically for angry, but not happy or sad, faces, and that this link would be stronger among children carrying one or two copies of the 5-HTTLPR short allele than among those homozygous for the long allele. Results generally supported these hypotheses, though we found that carriers of the 5-HTTLPR short allele who also had a critical mother exhibited attentional avoidance of angry faces rather than preferential attention.

Children’s 5-HTTLPR genotype moderates the link between maternal criticism and attentional biases specifically for facial displays of anger

PubMed Central

Gibb, Brandon E.; Johnson, Ashley L.; Benas, Jessica S.; Uhrlass, Dorothy J.; Knopik, Valerie S.; McGeary, John E.

2011-01-01

Theorists have proposed that negative experiences in childhood may contribute to the development of experience-specific information-processing biases, including attentional biases. There are also clear genetic influences on cognitive processes, with evidence that polymorphisms in specific candidate genes may moderate the impact of environmental stress on attentional biases (e.g., a functional polymorphism in the serotonin transporter gene [5-HTTLPR]). In the current study, we tested a gene × environment (G × E) model of risk for attentional biases. We hypothesized that children whose mothers exhibit high levels of expressed emotion criticism (EE-Crit) would display attentional biases specifically for angry, but not happy or sad, faces, and that this link would be stronger among children carrying one or two copies of the 5-HTTLPR short allele than among those homozygous for the long allele. Results generally supported these hypotheses, though we found that carriers of the 5-HTTLPR short allele who also had a critical mother exhibited attentional avoidance of angry faces rather than preferential attention. PMID:21895572

A gene regulatory network armature for T-lymphocyte specification

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fung, Elizabeth-sharon

Choice of a T-lymphoid fate by hematopoietic progenitor cells depends on sustained Notch-Delta signaling combined with tightly-regulated activities of multiple transcription factors. To dissect the regulatory network connections that mediate this process, we have used high-resolution analysis of regulatory gene expression trajectories from the beginning to the end of specification; tests of the short-term Notchdependence of these gene expression changes; and perturbation analyses of the effects of overexpression of two essential transcription factors, namely PU.l and GATA-3. Quantitative expression measurements of >50 transcription factor and marker genes have been used to derive the principal components of regulatory change through whichmore » T-cell precursors progress from primitive multipotency to T-lineage commitment. Distinct parts of the path reveal separate contributions of Notch signaling, GATA-3 activity, and downregulation of PU.l. Using BioTapestry, the results have been assembled into a draft gene regulatory network for the specification of T-cell precursors and the choice of T as opposed to myeloid dendritic or mast-cell fates. This network also accommodates effects of E proteins and mutual repression circuits of Gfil against Egr-2 and of TCF-l against PU.l as proposed elsewhere, but requires additional functions that remain unidentified. Distinctive features of this network structure include the intense dose-dependence of GATA-3 effects; the gene-specific modulation of PU.l activity based on Notch activity; the lack of direct opposition between PU.l and GATA-3; and the need for a distinct, late-acting repressive function or functions to extinguish stem and progenitor-derived regulatory gene expression.« less

Genetic and epigenetic factors underlying sex differences in the regulation of gene expression in the brain

PubMed Central

Ratnu, Vikram S.; Emami, Michael R.; Bredy, Timothy W.

2016-01-01

There are inherent biological differences between males and females that contribute to sex differences in brain function and to many sex-specific illnesses and disorders. Traditionally, it has been thought that such differences are largely due to hormonal regulation; however, there are also genetic and epigenetic effects caused by the inheritance and unequal dosage of genes located on the X- and Y-chromosomes. Here we discuss the evidence in favor of a genetic and epigenetic basis for sexually dimorphic behavior, as a consequence of underlying differences in the regulation of genes that drive brain function. A better understanding of sex-specific molecular processes in the brain will provide further insight for the development of novel therapeutic approaches for the treatment of neuropsychiatric disorders characterized by gender/sex differences. PMID:27870402

Developmental fate and lineage commitment of singled mouse blastomeres.

PubMed

Lorthongpanich, Chanchao; Doris, Tham Puay Yoke; Limviphuvadh, Vachiranee; Knowles, Barbara B; Solter, Davor

2012-10-01

The inside-outside model has been invoked to explain cell-fate specification of the pre-implantation mammalian embryo. Here, we investigate whether cell-cell interaction can influence the fate specification of embryonic blastomeres by sequentially separating the blastomeres in two-cell stage mouse embryos and continuing separation after each cell division throughout pre-implantation development. This procedure eliminates information provided by cell-cell interaction and cell positioning. Gene expression profiles, polarity protein localization and functional tests of these separated blastomeres reveal that cell interactions, through cell position, influence the fate of the blastomere. Blastomeres, in the absence of cell contact and inner-outer positional information, have a unique pattern of gene expression that is characteristic of neither inner cell mass nor trophectoderm, but overall they have a tendency towards a 'trophectoderm-like' gene expression pattern and preferentially contribute to the trophectoderm lineage.

Teleost Fish-Specific Preferential Retention of Pigmentation Gene-Containing Families After Whole Genome Duplications in Vertebrates

PubMed Central

Lorin, Thibault; Brunet, Frédéric G.; Laudet, Vincent; Volff, Jean-Nicolas

2018-01-01

Vertebrate pigmentation is a highly diverse trait mainly determined by neural crest cell derivatives. It has been suggested that two rounds (1R/2R) of whole-genome duplications (WGDs) at the basis of vertebrates allowed changes in gene regulation associated with neural crest evolution. Subsequently, the teleost fish lineage experienced other WGDs, including the teleost-specific Ts3R before teleost radiation and the more recent Ss4R at the basis of salmonids. As the teleost lineage harbors the highest number of pigment cell types and pigmentation diversity in vertebrates, WGDs might have contributed to the evolution and diversification of the pigmentation gene repertoire in teleosts. We have compared the impact of the basal vertebrate 1R/2R duplications with that of the teleost-specific Ts3R and salmonid-specific Ss4R WGDs on 181 gene families containing genes involved in pigmentation. We show that pigmentation genes (PGs) have been globally more frequently retained as duplicates than other genes after Ts3R and Ss4R but not after the early 1R/2R. This is also true for non-pigmentary paralogs of PGs, suggesting that the function in pigmentation is not the sole key driver of gene retention after WGDs. On the long-term, specific categories of PGs have been repeatedly preferentially retained after ancient 1R/2R and Ts3R WGDs, possibly linked to the molecular nature of their proteins (e.g., DNA binding transcriptional regulators) and their central position in protein-protein interaction networks. Taken together, our results support a major role of WGDs in the diversification of the pigmentation gene repertoire in the teleost lineage, with a possible link with the diversity of pigment cell lineages observed in these animals compared to other vertebrates. PMID:29599177

Development of unidentified dna-specific hif 1α gene of lizard (hemidactylus platyurus) which plays a role in tissue regeneration process

NASA Astrophysics Data System (ADS)

Novianti, T.; Sadikin, M.; Widia, S.; Juniantito, V.; Arida, E. A.

2018-03-01

Development of unidentified specific gene is essential to analyze the availability these genes in biological process. Identification unidentified specific DNA of HIF 1α genes is important to analyze their contribution in tissue regeneration process in lizard tail (Hemidactylus platyurus). Bioinformatics and PCR techniques are relatively an easier method to identify an unidentified gene. The most widely used method is BLAST (Basic Local Alignment Sequence Tools) method for alignment the sequences from the other organism. BLAST technique is online software from website https://blast.ncbi.nlm.nih.gov/Blast.cgi that capable to generate the similar sequences from closest kinship to distant kindship. Gecko japonicus is a species that it has closest kinship with H. platyurus. Comparing HIF 1 α gene sequence of G. japonicus with the other species used multiple alignment methods from Mega7 software. Conserved base areas were identified using Clustal IX method. Primary DNA of HIF 1 α gene was design by Primer3 software. HIF 1α gene of lizard (H. platyurus) was successfully amplified using a real-time PCR machine by primary DNA that we had designed from Gecko japonicus. Identification unidentified gene of HIF 1a lizard has been done successfully with multiple alignment method. The study was conducted by analyzing during the growth of tail on day 1, 3, 5, 7, 10, 13 and 17 of lizard tail after autotomy. Process amplification of HIF 1α gene was described by CT value in real time PCR machine. HIF 1α expression of gene is quantified by Livak formula. Chi-square statistic test is 0.000 which means that there is a different expression of HIF 1 α gene in every growth day treatment.

Pediatric Crohn disease patients exhibit specific ileal transcriptome and microbiome signature.

PubMed

Haberman, Yael; Tickle, Timothy L; Dexheimer, Phillip J; Kim, Mi-Ok; Tang, Dora; Karns, Rebekah; Baldassano, Robert N; Noe, Joshua D; Rosh, Joel; Markowitz, James; Heyman, Melvin B; Griffiths, Anne M; Crandall, Wallace V; Mack, David R; Baker, Susan S; Huttenhower, Curtis; Keljo, David J; Hyams, Jeffrey S; Kugathasan, Subra; Walters, Thomas D; Aronow, Bruce; Xavier, Ramnik J; Gevers, Dirk; Denson, Lee A

2014-08-01

Interactions between the host and gut microbial community likely contribute to Crohn disease (CD) pathogenesis; however, direct evidence for these interactions at the onset of disease is lacking. Here, we characterized the global pattern of ileal gene expression and the ileal microbial community in 359 treatment-naive pediatric patients with CD, patients with ulcerative colitis (UC), and control individuals. We identified core gene expression profiles and microbial communities in the affected CD ilea that are preserved in the unaffected ilea of patients with colon-only CD but not present in those with UC or control individuals; therefore, this signature is specific to CD and independent of clinical inflammation. An abnormal increase of antimicrobial dual oxidase (DUOX2) expression was detected in association with an expansion of Proteobacteria in both UC and CD, while expression of lipoprotein APOA1 gene was downregulated and associated with CD-specific alterations in Firmicutes. The increased DUOX2 and decreased APOA1 gene expression signature favored oxidative stress and Th1 polarization and was maximally altered in patients with more severe mucosal injury. A regression model that included APOA1 gene expression and microbial abundance more accurately predicted month 6 steroid-free remission than a model using clinical factors alone. These CD-specific host and microbe profiles identify the ileum as the primary inductive site for all forms of CD and may direct prognostic and therapeutic approaches.

(Bis)urea and (Bis)thiourea Inhibitors of Lysine-Specific Demethylase 1 as Epigenetic Modulators

PubMed Central

Sharma, Shiv K.; Wu, Yu; Steinbergs, Nora; Crowley, Michael L.; Hanson, Allison S.; Casero, Robert A.; Woster, Patrick M.

2010-01-01

The recently discovered enzyme lysine-specific demethylase 1 (LSD1) plays an important role in the epigenetic control of gene expression, and aberrant gene silencing secondary to LSD1 over expression is thought to contribute to the development of cancer. We recently reported a series of (bis)guanidines and (bis)biguanides that are potent inhibitors of LSD1, and induce the re-expression of aberrantly silenced tumor suppressor genes in tumor cells in vitro. We now report a series of isosteric ureas and thioureas that are also potent inhibitors of LSD1. These compounds induce increases in methylation at the histone 3 lysine 4 (H3K4) chromatin mark, a specific target of LSD1, in Calu-6 lung carcinoma cells. In addition, these analogues increase cellular levels of secreted frizzle-related proteins (SFRP) 2 and 5, and transcription factor GATA4. These compounds represent an important new series of epigenetic modulators with the potential for use as antitumor agents. PMID:20568780

Exome chip meta-analysis identifies novel loci and East Asian-specific coding variants that contribute to lipid levels and coronary artery disease.

PubMed

Lu, Xiangfeng; Peloso, Gina M; Liu, Dajiang J; Wu, Ying; Zhang, He; Zhou, Wei; Li, Jun; Tang, Clara Sze-Man; Dorajoo, Rajkumar; Li, Huaixing; Long, Jirong; Guo, Xiuqing; Xu, Ming; Spracklen, Cassandra N; Chen, Yang; Liu, Xuezhen; Zhang, Yan; Khor, Chiea Chuen; Liu, Jianjun; Sun, Liang; Wang, Laiyuan; Gao, Yu-Tang; Hu, Yao; Yu, Kuai; Wang, Yiqin; Cheung, Chloe Yu Yan; Wang, Feijie; Huang, Jianfeng; Fan, Qiao; Cai, Qiuyin; Chen, Shufeng; Shi, Jinxiu; Yang, Xueli; Zhao, Wanting; Sheu, Wayne H-H; Cherny, Stacey Shawn; He, Meian; Feranil, Alan B; Adair, Linda S; Gordon-Larsen, Penny; Du, Shufa; Varma, Rohit; Chen, Yii-Der Ida; Shu, Xiao-Ou; Lam, Karen Siu Ling; Wong, Tien Yin; Ganesh, Santhi K; Mo, Zengnan; Hveem, Kristian; Fritsche, Lars G; Nielsen, Jonas Bille; Tse, Hung-Fat; Huo, Yong; Cheng, Ching-Yu; Chen, Y Eugene; Zheng, Wei; Tai, E Shyong; Gao, Wei; Lin, Xu; Huang, Wei; Abecasis, Goncalo; Kathiresan, Sekar; Mohlke, Karen L; Wu, Tangchun; Sham, Pak Chung; Gu, Dongfeng; Willer, Cristen J

2017-12-01

Most genome-wide association studies have been of European individuals, even though most genetic variation in humans is seen only in non-European samples. To search for novel loci associated with blood lipid levels and clarify the mechanism of action at previously identified lipid loci, we used an exome array to examine protein-coding genetic variants in 47,532 East Asian individuals. We identified 255 variants at 41 loci that reached chip-wide significance, including 3 novel loci and 14 East Asian-specific coding variant associations. After a meta-analysis including >300,000 European samples, we identified an additional nine novel loci. Sixteen genes were identified by protein-altering variants in both East Asians and Europeans, and thus are likely to be functional genes. Our data demonstrate that most of the low-frequency or rare coding variants associated with lipids are population specific, and that examining genomic data across diverse ancestries may facilitate the identification of functional genes at associated loci.

Exome chip meta-analysis identifies novel loci and East Asian-specific coding variants contributing to lipid levels and coronary artery disease

PubMed Central

Lu, Xiangfeng; Peloso, Gina M; Liu, Dajiang J.; Wu, Ying; Zhang, He; Zhou, Wei; Li, Jun; Tang, Clara Sze-man; Dorajoo, Rajkumar; Li, Huaixing; Long, Jirong; Guo, Xiuqing; Xu, Ming; Spracklen, Cassandra N.; Chen, Yang; Liu, Xuezhen; Zhang, Yan; Khor, Chiea Chuen; Liu, Jianjun; Sun, Liang; Wang, Laiyuan; Gao, Yu-Tang; Hu, Yao; Yu, Kuai; Wang, Yiqin; Cheung, Chloe Yu Yan; Wang, Feijie; Huang, Jianfeng; Fan, Qiao; Cai, Qiuyin; Chen, Shufeng; Shi, Jinxiu; Yang, Xueli; Zhao, Wanting; Sheu, Wayne H.-H.; Cherny, Stacey Shawn; He, Meian; Feranil, Alan B.; Adair, Linda S.; Gordon-Larsen, Penny; Du, Shufa; Varma, Rohit; da Chen, Yii-Der I; Shu, XiaoOu; Lam, Karen Siu Ling; Wong, Tien Yin; Ganesh, Santhi K.; Mo, Zengnan; Hveem, Kristian; Fritsche, Lars; Nielsen, Jonas Bille; Tse, Hung-fat; Huo, Yong; Cheng, Ching-Yu; Chen, Y. Eugene; Zheng, Wei; Tai, E Shyong; Gao, Wei; Lin, Xu; Huang, Wei; Abecasis, Goncalo; Consortium, GLGC; Kathiresan, Sekar; Mohlke, Karen L.; Wu, Tangchun; Sham, Pak Chung; Gu, Dongfeng; Willer, Cristen J

2017-01-01

Most genome-wide association studies have been conducted in European individuals, even though most genetic variation in humans is seen only in non-European samples. To search for novel loci associated with blood lipid levels and clarify the mechanism of action at previously identified lipid loci, we examined protein-coding genetic variants in 47,532 East Asian individuals using an exome array. We identified 255 variants at 41 loci reaching chip-wide significance, including 3 novel loci and 14 East Asian-specific coding variant associations. After meta-analysis with > 300,000 European samples, we identified an additional 9 novel loci. The same 16 genes were identified by the protein-altering variants in both East Asians and Europeans, likely pointing to the functional genes. Our data demonstrate that most of the low-frequency or rare coding variants associated with lipids are population-specific, and that examining genomic data across diverse ancestries may facilitate the identification of functional genes at associated loci. PMID:29083407

Regulation of rice root development by a retrotransposon acting as a microRNA sponge.

PubMed

Cho, Jungnam; Paszkowski, Jerzy

2017-08-26

It is well documented that transposable elements (TEs) can regulate the expression of neighbouring genes. However, their ability to act in trans and influence ectopic loci has been reported rarely. We searched in rice transcriptomes for tissue-specific expression of TEs and found them to be regulated developmentally. They often shared sequence homology with co-expressed genes and contained potential microRNA-binding sites, which suggested possible contributions to gene regulation. In fact, we have identified a retrotransposon that is highly transcribed in roots and whose spliced transcript constitutes a target mimic for miR171. miR171 destabilizes mRNAs encoding the root-specific family of SCARECROW-Like transcription factors. We demonstrate that retrotransposon-derived transcripts act as decoys for miR171, triggering its degradation and thus results in the root-specific accumulation of SCARECROW-Like mRNAs. Such transposon-mediated post-transcriptional control of miR171 levels is conserved in diverse rice species.

Alternative Splicing of Four Trafficking Genes Regulates Myofiber Structure and Skeletal Muscle Physiology.

PubMed

Giudice, Jimena; Loehr, James A; Rodney, George G; Cooper, Thomas A

2016-11-15

During development, transcriptional and post-transcriptional networks are coordinately regulated to drive organ maturation. Alternative splicing contributes by producing temporal-specific protein isoforms. We previously found that genes undergoing splicing transitions during mouse postnatal heart development are enriched for vesicular trafficking and membrane dynamics functions. Here, we show that adult trafficking isoforms are also expressed in adult skeletal muscle and hypothesize that striated muscle utilizes alternative splicing to generate specific isoforms required for function of adult tissue. We deliver morpholinos into flexor digitorum brevis muscles in adult mice to redirect splicing of four trafficking genes to the fetal isoforms. The splicing switch results in multiple structural and functional defects, including transverse tubule (T-tubule) disruption and dihydropyridine receptor alpha (DHPR) and Ryr1 mislocalization, impairing excitation-contraction coupling, calcium handling, and force generation. The results demonstrate a previously unrecognized role for trafficking functions in adult muscle tissue homeostasis and a specific requirement for the adult splice variants. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.

An EG-VEGF-dependent decrease in homeobox gene NKX3.1 contributes to cytotrophoblast dysfunction: a possible mechanism in human fetal growth restriction.

PubMed

Murthi, P; Brouillet, S; Pratt, A; Borg, Aj; Kalionis, B; Goffin, F; Tsatsaris, V; Munaut, C; Feige, Jj; Benharouga, M; Fournier, T; Alfaidy, N

2015-07-21

Idiopathic fetal growth restriction (FGR) is frequently associated with placental insufficiency. Previous reports have provided evidence that EG-VEGF (endocrine gland derived-vascular endothelial growth factor), a placental secreted protein, is expressed during the first trimester of pregnancy, controls both trophoblast proliferation and invasion, and its increased expression is associated with human FGR. In this study, we hypothesise that EG-VEGF-dependent change in placental homeobox gene expressions contribute to trophoblast dysfunction in idiopathic FGR. The changes in EG-VEGF-dependent homeobox gene expressions were determined using a Homeobox gene cDNA array on placental explants of 8-12 weeks' gestation after stimulation with EG-VEGF in vitro for 24 hours. The Homeobox gene array identified a >5-fold increase in HOXA9, HOXC8, HOXC10, HOXD1, HOXD8, HOXD9 and HOXD11, while NKX 3.1 showed a >2 fold-decrease in mRNA expression compared to untreated controls. Homeobox gene NKX3.1 was selected as a candidate because it is a downstream target of EG-VEGF and its expression and functional role are largely unknown in control and idiopathic FGR-affected placentae. Real-time PCR and immunoblotting showed a significant decrease in NKX3.1 mRNA and protein levels, respectively, in placentae from FGR compared to control pregnancies. Gene inactivation in vitro using short-interference RNA specific for NKX3.1 demonstrated an increase in BeWo cell differentiation and a decrease in HTR8-SVneo proliferation. We conclude that the decreased expression of homeobox gene NKX3.1 down-stream of EG-VEGF may contribute to the trophoblast dysfunction associated with idiopathic FGR pregnancies.

Computational deconvolution of genome wide expression data from Parkinson's and Huntington's disease brain tissues using population-specific expression analysis

PubMed Central

Capurro, Alberto; Bodea, Liviu-Gabriel; Schaefer, Patrick; Luthi-Carter, Ruth; Perreau, Victoria M.

2015-01-01

The characterization of molecular changes in diseased tissues gives insight into pathophysiological mechanisms and is important for therapeutic development. Genome-wide gene expression analysis has proven valuable for identifying biological processes in neurodegenerative diseases using post mortem human brain tissue and numerous datasets are publically available. However, many studies utilize heterogeneous tissue samples consisting of multiple cell types, all of which contribute to global gene expression values, confounding biological interpretation of the data. In particular, changes in numbers of neuronal and glial cells occurring in neurodegeneration confound transcriptomic analyses, particularly in human brain tissues where sample availability and controls are limited. To identify cell specific gene expression changes in neurodegenerative disease, we have applied our recently published computational deconvolution method, population specific expression analysis (PSEA). PSEA estimates cell-type-specific expression values using reference expression measures, which in the case of brain tissue comprises mRNAs with cell-type-specific expression in neurons, astrocytes, oligodendrocytes and microglia. As an exercise in PSEA implementation and hypothesis development regarding neurodegenerative diseases, we applied PSEA to Parkinson's and Huntington's disease (PD, HD) datasets. Genes identified as differentially expressed in substantia nigra pars compacta neurons by PSEA were validated using external laser capture microdissection data. Network analysis and Annotation Clustering (DAVID) identified molecular processes implicated by differential gene expression in specific cell types. The results of these analyses provided new insights into the implementation of PSEA in brain tissues and additional refinement of molecular signatures in human HD and PD. PMID:25620908

A powerful score-based test statistic for detecting gene-gene co-association.

PubMed

Xu, Jing; Yuan, Zhongshang; Ji, Jiadong; Zhang, Xiaoshuai; Li, Hongkai; Wu, Xuesen; Xue, Fuzhong; Liu, Yanxun

2016-01-29

The genetic variants identified by Genome-wide association study (GWAS) can only account for a small proportion of the total heritability for complex disease. The existence of gene-gene joint effects which contains the main effects and their co-association is one of the possible explanations for the "missing heritability" problems. Gene-gene co-association refers to the extent to which the joint effects of two genes differ from the main effects, not only due to the traditional interaction under nearly independent condition but the correlation between genes. Generally, genes tend to work collaboratively within specific pathway or network contributing to the disease and the specific disease-associated locus will often be highly correlated (e.g. single nucleotide polymorphisms (SNPs) in linkage disequilibrium). Therefore, we proposed a novel score-based statistic (SBS) as a gene-based method for detecting gene-gene co-association. Various simulations illustrate that, under different sample sizes, marginal effects of causal SNPs and co-association levels, the proposed SBS has the better performance than other existed methods including single SNP-based and principle component analysis (PCA)-based logistic regression model, the statistics based on canonical correlations (CCU), kernel canonical correlation analysis (KCCU), partial least squares path modeling (PLSPM) and delta-square (δ (2)) statistic. The real data analysis of rheumatoid arthritis (RA) further confirmed its advantages in practice. SBS is a powerful and efficient gene-based method for detecting gene-gene co-association.

A role for neurotransmission and neurodevelopment in attention-deficit/hyperactivity disorder

PubMed Central

2009-01-01

Attention-deficit/hyperactivity disorder (ADHD) has a moderate to high genetic component, probably due to many genes with small effects. Several susceptibility genes have been suggested on the basis of hypotheses that catecholaminergic pathways in the brain are responsible for ADHD. However, many negative association findings have been reported, indicating a limited success for investigations using this approach. The results from genome-wide association studies have suggested that genes related to general brain functions rather than specific aspects of the disorder may contribute to its development. Plausible biological hypotheses linked to neurotransmission and neurodevelopment in general and common to different psychiatric conditions need to be considered when defining candidate genes for ADHD association studies. PMID:19930624

Selective Constraints on Coding Sequences of Nervous System Genes Are a Major Determinant of Duplicate Gene Retention in Vertebrates.

PubMed

Roux, Julien; Liu, Jialin; Robinson-Rechavi, Marc

2017-11-01

The evolutionary history of vertebrates is marked by three ancient whole-genome duplications: two successive rounds in the ancestor of vertebrates, and a third one specific to teleost fishes. Biased loss of most duplicates enriched the genome for specific genes, such as slow evolving genes, but this selective retention process is not well understood. To understand what drives the long-term preservation of duplicate genes, we characterized duplicated genes in terms of their expression patterns. We used a new method of expression enrichment analysis, TopAnat, applied to in situ hybridization data from thousands of genes from zebrafish and mouse. We showed that the presence of expression in the nervous system is a good predictor of a higher rate of retention of duplicate genes after whole-genome duplication. Further analyses suggest that purifying selection against the toxic effects of misfolded or misinteracting proteins, which is particularly strong in nonrenewing neural tissues, likely constrains the evolution of coding sequences of nervous system genes, leading indirectly to the preservation of duplicate genes after whole-genome duplication. Whole-genome duplications thus greatly contributed to the expansion of the toolkit of genes available for the evolution of profound novelties of the nervous system at the base of the vertebrate radiation. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Subtle Changes in Motif Positioning Cause Tissue-Specific Effects on Robustness of an Enhancer's Activity

PubMed Central

Erceg, Jelena; Saunders, Timothy E.; Girardot, Charles; Devos, Damien P.; Hufnagel, Lars; Furlong, Eileen E. M.

2014-01-01

Deciphering the specific contribution of individual motifs within cis-regulatory modules (CRMs) is crucial to understanding how gene expression is regulated and how this process is affected by sequence variation. But despite vast improvements in the ability to identify where transcription factors (TFs) bind throughout the genome, we are limited in our ability to relate information on motif occupancy to function from sequence alone. Here, we engineered 63 synthetic CRMs to systematically assess the relationship between variation in the content and spacing of motifs within CRMs to CRM activity during development using Drosophila transgenic embryos. In over half the cases, very simple elements containing only one or two types of TF binding motifs were capable of driving specific spatio-temporal patterns during development. Different motif organizations provide different degrees of robustness to enhancer activity, ranging from binary on-off responses to more subtle effects including embryo-to-embryo and within-embryo variation. By quantifying the effects of subtle changes in motif organization, we were able to model biophysical rules that explain CRM behavior and may contribute to the spatial positioning of CRM activity in vivo. For the same enhancer, the effects of small differences in motif positions varied in developmentally related tissues, suggesting that gene expression may be more susceptible to sequence variation in one tissue compared to another. This result has important implications for human eQTL studies in which many associated mutations are found in cis-regulatory regions, though the mechanism for how they affect tissue-specific gene expression is often not understood. PMID:24391522

Transposable elements generate population-specific insertional patterns and allelic variation in genes of wild emmer wheat (Triticum turgidum ssp. dicoccoides).

PubMed

Domb, Katherine; Keidar, Danielle; Yaakov, Beery; Khasdan, Vadim; Kashkush, Khalil

2017-10-27

Natural populations of the tetraploid wild emmer wheat (genome AABB) were previously shown to demonstrate eco-geographically structured genetic and epigenetic diversity. Transposable elements (TEs) might make up a significant part of the genetic and epigenetic variation between individuals and populations because they comprise over 80% of the wild emmer wheat genome. In this study, we performed detailed analyses to assess the dynamics of transposable elements in 50 accessions of wild emmer wheat collected from 5 geographically isolated sites. The analyses included: the copy number variation of TEs among accessions in the five populations, population-unique insertional patterns, and the impact of population-unique/specific TE insertions on structure and expression of genes. We assessed the copy numbers of 12 TE families using real-time quantitative PCR, and found significant copy number variation (CNV) in the 50 wild emmer wheat accessions, in a population-specific manner. In some cases, the CNV difference reached up to 6-fold. However, the CNV was TE-specific, namely some TE families showed higher copy numbers in one or more populations, and other TE families showed lower copy numbers in the same population(s). Furthermore, we assessed the insertional patterns of 6 TE families using transposon display (TD), and observed significant population-specific insertional patterns. The polymorphism levels of TE-insertional patterns reached 92% among all wild emmer wheat accessions, in some cases. In addition, we observed population-specific/unique TE insertions, some of which were located within or close to protein-coding genes, creating allelic variations in a population-specific manner. We also showed that those genes are differentially expressed in wild emmer wheat. For the first time, this study shows that TEs proliferate in wild emmer wheat in a population-specific manner, creating new alleles of genes, which contribute to the divergent evolution of homeologous genes from the A and B subgenomes.

Hypoxic regulation of the expression of cell proliferation related genes in U87 glioma cells upon inhibition of ire1 signaling enzyme

PubMed

Minchenko, O H; Tsymbal, D O; Minchenko, D O; Riabovol, O O; Ratushna, O O; Karbovskyi, L L

2016-01-01

We have studied the effect of inhibition of IRE1 (inositol requiring enzyme 1), which is a central mediator of endoplasmic reticulum stress and a controller of cell proliferation and tumor growth, on hypoxic regulation of the expression of different proliferation related genes in U87 glioma cells. It was shown that hypoxia leads to up-regulation of the expression of IL13RA2, CD24, ING1, ING2, ENDOG, and POLG genes and to down-regulation – of KRT18, TRAPPC3, TSFM, and MTIF2 genes at the mRNA level in control glioma cells. Changes for ING1 and CD24 genes were more significant. At the same time, inhibition of IRE1 modifies the effect of hypoxia on the expression of all studied genes. In particular, it increases sensitivity to hypoxia of the expression of IL13RA2, TRAPPC3, ENDOG, and PLOG genes and suppresses the effect of hypoxia on the expression of ING1 gene. Additionally, it eliminates hypoxic regulation of KRT18, CD24, ING2, TSFM, and MTIF2 genes expressions and introduces sensitivity to hypoxia of the expression of BET1 gene in glioma cells. The present study demonstrates that hypoxia, which often contributes to tumor growth, affects the expression of almost all studied genes. Additionally, inhibition of IRE1 can both enhance and suppress the hypoxic regulation of these gene expressions in a gene specific manner and thus possibly contributes to slower glioma growth, but several aspects of this regulation must be further clarified.

Hyphae-specific genes HGC1, ALS3, HWP1, and ECE1 and relevant signaling pathways in Candida albicans.

PubMed

Fan, Yan; He, Hong; Dong, Yan; Pan, Hengbiao

2013-12-01

Fungal virulence mechanisms include adhesion to epithelia, morphogenesis, production of secretory hydrolytic enzymes, and phenotype switching, all of which contribute to the process of pathogenesis. A striking feature of the biology of Candida albicans is its ability to grow in yeast, pseudohyphal, and hyphal forms. The hyphal form plays an important role in causing disease, by invading epithelial cells and causing tissue damage. In this review, we illustrate some of the main hyphae-specific genes, namely HGC1, UME6, ALS3, HWP1, and ECE1, and their relevant and reversed signal transduction pathways in reactions stimulated by environmental factors, including pH, CO2, and serum.

Lessons learned from the dog genome.

PubMed

Wayne, Robert K; Ostrander, Elaine A

2007-11-01

Extensive genetic resources and a high-quality genome sequence position the dog as an important model species for understanding genome evolution, population genetics and genes underlying complex phenotypic traits. Newly developed genomic resources have expanded our understanding of canine evolutionary history and dog origins. Domestication involved genetic contributions from multiple populations of gray wolves probably through backcrossing. More recently, the advent of controlled breeding practices has segregated genetic variability into distinct dog breeds that possess specific phenotypic traits. Consequently, genome-wide association and selective sweep scans now allow the discovery of genes underlying breed-specific characteristics. The dog is finally emerging as a novel resource for studying the genetic basis of complex traits, including behavior.

Rapid strain improvement through optimized evolution in the cytostat.

PubMed

Gilbert, Alan; Sangurdekar, Dipen P; Srienc, Friedrich

2009-06-15

Acetate is present in lignocellulosic hydrolysates at growth inhibiting concentrations. Industrial processes based on such feedstock require strains that are tolerant of this and other inhibitors present. We investigated the effect of acetate on Saccharomyces cerevisiae and show that elevated acetate concentrations result in a decreased specific growth rate, an accumulation of cells in the G1 phase of the cell cycle, and an increased cell size. With the cytostat cultivation technology under previously derived optimal operating conditions, several acetate resistant mutants were enriched and isolated in the shortest possible time. In each case, the isolation time was less than 5 days. The independently isolated mutant strains have increased specific growth rates under conditions of high acetate concentrations, high ethanol concentrations, and high temperature. In the presence of high acetate concentrations, the isolated mutants produce ethanol at higher rates and titers than the parental strain and a commercial ethanol producing strain that has been analyzed for comparison. Whole genome microarray analysis revealed gene amplifications in each mutant. In one case, the LPP1 gene, coding for lipid phosphate phosphatase, was amplified. Two mutants contained amplified ENA1, ENA2, and ENA5 genes, which code for P-type ATPase sodium pumps. LPP1 was overexpressed on a plasmid, and the growth data at elevated acetate concentrations suggest that LPP1 likely contributes to the phenotype of acetate tolerance. A diploid cross of the two mutants with the amplified ENA genes grew faster than either individual haploid parent strain when 20 g/L acetate was supplemented to the medium, which suggests that these genes contribute to acetate tolerance in a gene dosage dependent manner. 2009 Wiley Periodicals, Inc.

Transcriptome and Metabolite Profiling of the Infection Cycle of Zymoseptoria tritici on Wheat Reveals a Biphasic Interaction with Plant Immunity Involving Differential Pathogen Chromosomal Contributions and a Variation on the Hemibiotrophic Lifestyle Definition1[OPEN

PubMed Central

Rudd, Jason J.; Kanyuka, Kostya; Hassani-Pak, Keywan; Derbyshire, Mark; Andongabo, Ambrose; Devonshire, Jean; Lysenko, Artem; Saqi, Mansoor; Desai, Nalini M.; Powers, Stephen J.; Hooper, Juliet; Ambroso, Linda; Bharti, Arvind; Farmer, Andrew; Hammond-Kosack, Kim E.; Dietrich, Robert A.; Courbot, Mikael

2015-01-01

The hemibiotrophic fungus Zymoseptoria tritici causes Septoria tritici blotch disease of wheat (Triticum aestivum). Pathogen reproduction on wheat occurs without cell penetration, suggesting that dynamic and intimate intercellular communication occurs between fungus and plant throughout the disease cycle. We used deep RNA sequencing and metabolomics to investigate the physiology of plant and pathogen throughout an asexual reproductive cycle of Z. tritici on wheat leaves. Over 3,000 pathogen genes, more than 7,000 wheat genes, and more than 300 metabolites were differentially regulated. Intriguingly, individual fungal chromosomes contributed unequally to the overall gene expression changes. Early transcriptional down-regulation of putative host defense genes was detected in inoculated leaves. There was little evidence for fungal nutrient acquisition from the plant throughout symptomless colonization by Z. tritici, which may instead be utilizing lipid and fatty acid stores for growth. However, the fungus then subsequently manipulated specific plant carbohydrates, including fructan metabolites, during the switch to necrotrophic growth and reproduction. This switch coincided with increased expression of jasmonic acid biosynthesis genes and large-scale activation of other plant defense responses. Fungal genes encoding putative secondary metabolite clusters and secreted effector proteins were identified with distinct infection phase-specific expression patterns, although functional analysis suggested that many have overlapping/redundant functions in virulence. The pathogenic lifestyle of Z. tritici on wheat revealed through this study, involving initial defense suppression by a slow-growing extracellular and nutritionally limited pathogen followed by defense (hyper) activation during reproduction, reveals a subtle modification of the conceptual definition of hemibiotrophic plant infection. PMID:25596183

Phenotypic Robustness and the Assortativity Signature of Human Transcription Factor Networks

PubMed Central

Pechenick, Dov A.; Payne, Joshua L.; Moore, Jason H.

2014-01-01

Many developmental, physiological, and behavioral processes depend on the precise expression of genes in space and time. Such spatiotemporal gene expression phenotypes arise from the binding of sequence-specific transcription factors (TFs) to DNA, and from the regulation of nearby genes that such binding causes. These nearby genes may themselves encode TFs, giving rise to a transcription factor network (TFN), wherein nodes represent TFs and directed edges denote regulatory interactions between TFs. Computational studies have linked several topological properties of TFNs — such as their degree distribution — with the robustness of a TFN's gene expression phenotype to genetic and environmental perturbation. Another important topological property is assortativity, which measures the tendency of nodes with similar numbers of edges to connect. In directed networks, assortativity comprises four distinct components that collectively form an assortativity signature. We know very little about how a TFN's assortativity signature affects the robustness of its gene expression phenotype to perturbation. While recent theoretical results suggest that increasing one specific component of a TFN's assortativity signature leads to increased phenotypic robustness, the biological context of this finding is currently limited because the assortativity signatures of real-world TFNs have not been characterized. It is therefore unclear whether these earlier theoretical findings are biologically relevant. Moreover, it is not known how the other three components of the assortativity signature contribute to the phenotypic robustness of TFNs. Here, we use publicly available DNaseI-seq data to measure the assortativity signatures of genome-wide TFNs in 41 distinct human cell and tissue types. We find that all TFNs share a common assortativity signature and that this signature confers phenotypic robustness to model TFNs. Lastly, we determine the extent to which each of the four components of the assortativity signature contributes to this robustness. PMID:25121490

Tissue-Specific Venom Composition and Differential Gene Expression in Sea Anemones

PubMed Central

Macrander, Jason; Broe, Michael; Daly, Marymegan

2016-01-01

Cnidarians represent one of the few groups of venomous animals that lack a centralized venom transmission system. Instead, they are equipped with stinging capsules collectively known as nematocysts. Nematocysts vary in abundance and type across different tissues; however, the venom composition in most species remains unknown. Depending on the tissue type, the venom composition in sea anemones may be vital for predation, defense, or digestion. Using a tissue-specific RNA-seq approach, we characterize the venom assemblage in the tentacles, mesenterial filaments, and column for three species of sea anemone (Anemonia sulcata, Heteractis crispa, and Megalactis griffithsi). These taxa vary with regard to inferred venom potency, symbiont abundance, and nematocyst diversity. We show that there is significant variation in abundance of toxin-like genes across tissues and species. Although the cumulative toxin abundance for the column was consistently the lowest, contributions to the overall toxin assemblage varied considerably among tissues for different toxin types. Our gene ontology (GO) analyses also show sharp contrasts between conserved GO groups emerging from whole transcriptome analysis and tissue-specific expression among GO groups in our differential expression analysis. This study provides a framework for future characterization of tissue-specific venom and other functionally important genes in this lineage of simple bodied animals. PMID:27389690

Toward an Integration of Cognitive and Genetic Models of Risk for Depression

PubMed Central

Gibb, Brandon E.; Beevers, Christopher G.; McGeary, John E.

2012-01-01

There is growing interest in integrating cognitive and genetic models of depression risk. We review two ways in which these models can be meaningfully integrated. First, information-processing biases may represent intermediate phenotypes for specific genetic influences. These genetic influences may represent main effects on specific cognitive processes or may moderate the impact of environmental influences on information-processing biases. Second, cognitive and genetic influences may combine to increase reactivity to environmental stressors, increasing risk for depression in a gene × cognition × environment model of risk. There is now growing support for both of these ways of integrating cognitive and genetic models of depression risk. Specifically, there is support for genetic influences on information-processing biases, particularly the link between 5-HTTLPR and attentional biases, from both genetic association and gene × environment (G × E) studies. There is also initial support for gene × cognition × environment models of risk in which specific genetic influences contribute to increased reactivity to environmental influences. We review this research and discuss important areas of future research, particularly the need for larger samples that allow for a broader examination of genetic and epigenetic influences as well as the combined influence of variability across a number of genes. PMID:22920216

Silencing and heterologous expression of ppo-2 indicate a specific function of a single polyphenol oxidase isoform in resistance of dandelion (Taraxacum officinale) against Pseudomonas syringae pv. tomato.

PubMed

Richter, Carolin; Dirks, Mareike E; Gronover, Christian Schulze; Prüfer, Dirk; Moerschbacher, Bruno M

2012-02-01

Dandelion (Taraxacum officinale) possesses an unusually high degree of disease resistance. As this plant exhibits high polyphenol oxidase (PPO) activity and PPO have been implicated in resistance against pests and pathogens, we analyzed the potential involvement of five PPO isoenzymes in the resistance of dandelion against Botrytis cinerea and Pseudomonas syringae pv. tomato. Only one PPO (ppo-2) was induced during infection, and ppo-2 promoter and β-glucuronidase marker gene fusions revealed strong induction of the gene surrounding lesions induced by B. cinerea. Specific RNAi silencing reduced ppo-2 expression only, and concomitantly increased plant susceptibility to P. syringae pv. tomato. At 4 days postinoculation, P. syringae pv. tomato populations were strongly increased in the ppo-2 RNAi lines compared with wild-type plants. When the dandelion ppo-2 gene was expressed in Arabidopsis thaliana, a plant having no PPO gene, active protein was formed and protein extracts of the transgenic plants exhibited substrate-dependent antimicrobial activity against P. syringae pv. tomato. These results clearly indicate a strong contribution of a specific, single PPO isoform to disease resistance. Therefore, we propose that specific PPO isoenzymes be included in a new family of pathogenesis-related (PR) proteins.

The Influence of Major Life Events on Economic Attitudes in a World of Gene-Environment Interplay.

PubMed

Hatemi, Peter K

2013-10-01

The role of "genes" on political attitudes has gained attention across disciplines. However, person-specific experiences have yet to be incorporated into models that consider genetic influences. Relying on a gene-environment interplay approach, this study explicates how life-events, such as losing one's job or suffering a financial loss, influence economic policy attitudes. The results indicate genetic and environmental variance on support for unions, immigration, capitalism, socialism and property tax is moderated by financial risks. Changes in the magnitude of genetic influences, however, are temporary. After two years, the phenotypic effects of the life events remain on most attitudes, but changes in the sources of individual differences do not. Univariate twin models that estimate the independent contributions of genes and environment on the variation of attitudes appear to provide robust baseline indicators of sources of individual differences. These estimates, however, are not event or day specific. In this way, genetic influences add stability, while environment cues change, and this process is continually updated.

Convergent Transcription At Intragenic Super-Enhancers Targets AID-initiated Genomic Instability

PubMed Central

Meng, Fei-Long; Du, Zhou; Federation, Alexander; Hu, Jiazhi; Wang, Qiao; Kieffer-Kwon, Kyong-Rim; Meyers, Robin M.; Amor, Corina; Wasserman, Caitlyn R.; Neuberg, Donna; Casellas, Rafael; Nussenzweig, Michel C.; Bradner, James E.; Liu, X. Shirley; Alt, Frederick W.

2015-01-01

Summary Activation-induced cytidine deaminase (AID) initiates both somatic hypermutation (SHM) for antibody affinity maturation and DNA breakage for antibody class switch recombination (CSR) via transcription-dependent cytidine deamination of single stranded DNA targets. While largely specific for immunoglobulin genes, AID also acts on a limited set of off-targets, generating oncogenic translocations and mutations that contribute to B cell lymphoma. How AID is recruited to off-targets has been a long-standing mystery. Based on deep GRO-Seq studies of mouse and human B lineage cells activated for CSR or SHM, we report that most robust AID off-target translocations occur within highly focal regions of target genes in which sense and antisense transcription converge. Moreover, we found that such AID-targeting “convergent” transcription arises from antisense transcription that emanates from Super-Enhancers within sense transcribed gene bodies. Our findings provide an explanation for AID off-targeting to a small subset of mostly lineage-specific genes in activated B cells. PMID:25483776

Loss of cell invasiveness through PKC-mediated syndecan-1 downregulation in melanoma cells under anchorage independency.

PubMed

Wang, ChiaChen; Tseng, TingTing; Jhang, Yaoyun; Tseng, JenChih; Hsieh, ChiaoHui; Wu, Wen-guey; Lee, ShaoChen

2014-11-01

Anchorage-independent survival is one of the key features for malignant tumor cells. Whether specific gene alterations contributed by anchorage independency would further affect metastatic phenotypes of melanoma cells was unclear. We adapted suspension culture of melanoma cells to establish anchorage independency. The suspended melanoma cells lost their invasive abilities in vitro. Specific loss of laminin-binding ability in suspended melanoma cells was observed, which was correlated with downregulation of syndecan-1 as revealed by microarray and validated by qPCR and Western blot. Modulation of syndecan-1 expression level affected laminin binding, transwell migration and matrix metalloproteinase-2 secretion in melanoma cells. SDC1 expression and transwell migration were correlated with activity or level of protein kinase Cδ as evidence by specific inhibitors and shRNA transfection. In this study, we compared metastatic phenotypes and gene expressions of adherent and suspended melanoma cells. The anchorage independency led to protein kinase Cδ-mediated syndecan-1 downregulation, which contributed to loss of laminin-binding ability, reduced metalloproteinase-2 secretion and loss of invasiveness. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

The long non-coding RNA ROCR contributes to SOX9 expression and chondrogenic differentiation of human mesenchymal stem cells

PubMed Central

Hyatt, Sam; Cheung, Kat; Skelton, Andrew J.; Xu, Yaobo; Clark, Ian M.

2017-01-01

Long non-coding RNAs (lncRNAs) are expressed in a highly tissue-specific manner and function in various aspects of cell biology, often as key regulators of gene expression. In this study, we established a role for lncRNAs in chondrocyte differentiation. Using RNA sequencing we identified a human articular chondrocyte repertoire of lncRNAs from normal hip cartilage donated by neck of femur fracture patients. Of particular interest are lncRNAs upstream of the master chondrocyte transcription factor SOX9 locus. SOX9 is an HMG-box transcription factor that plays an essential role in chondrocyte development by directing the expression of chondrocyte-specific genes. Two of these lncRNAs are upregulated during chondrogenic differentiation of mesenchymal stem cells (MSCs). Depletion of one of these lncRNAs, LOC102723505, which we termed ROCR (regulator of chondrogenesis RNA), by RNA interference disrupted MSC chondrogenesis, concomitant with reduced cartilage-specific gene expression and incomplete matrix component production, indicating an important role in chondrocyte biology. Specifically, SOX9 induction was significantly ablated in the absence of ROCR, and overexpression of SOX9 rescued the differentiation of MSCs into chondrocytes. Our work sheds further light on chondrocyte-specific SOX9 expression and highlights a novel method of chondrocyte gene regulation involving a lncRNA. PMID:29084806

An upstream open reading frame represses expression of Lc, a member of the R/B family of maize transcriptional activators

DOE Office of Scientific and Technical Information (OSTI.GOV)

Damiani, R.D. Jr.; Wessler, S.R.

1993-09-01

The R/B genes of maize encode a family of basic helix-loop-helix proteins that determine where and when the anthocyanin-pigment pathway will be expressed in the plant. Previous studies showed that allelic diversity among family members reflects differences in gene expression, specifically in transcription initiation. The authors present evidence that the R gene Lc is under translational control. They demonstrate that the 235-nt transcript leader of Lc represses expression 25- to 30-fold in an in vivo assay. Repression is mediated by the presence in cis of a 38-codon upstream open reading frame. Furthermore, the coding capacity of the upstream open readingmore » frame influences the magnitude of repression. It is proposed that translational control does not contribute to tissue specificity but prevents overexpression of the Lc protein. The diversity of promoter and 5' untranslated leader sequences among the R/B genes provides an opportunity to study the coevolution of transcriptional and translational mechanisms of gene regulation. 36 refs., 5 figs.« less

Exon Shuffling and Origin of Scorpion Venom Biodiversity

PubMed Central

Wang, Xueli; Gao, Bin; Zhu, Shunyi

2016-01-01

Scorpion venom is a complex combinatorial library of peptides and proteins with multiple biological functions. A combination of transcriptomic and proteomic techniques has revealed its enormous molecular diversity, as identified by the presence of a large number of ion channel-targeted neurotoxins with different folds, membrane-active antimicrobial peptides, proteases, and protease inhibitors. Although the biodiversity of scorpion venom has long been known, how it arises remains unsolved. In this work, we analyzed the exon-intron structures of an array of scorpion venom protein-encoding genes and unexpectedly found that nearly all of these genes possess a phase-1 intron (one intron located between the first and second nucleotides of a codon) near the cleavage site of a signal sequence despite their mature peptides remarkably differ. This observation matches a theory of exon shuffling in the origin of new genes and suggests that recruitment of different folds into scorpion venom might be achieved via shuffling between body protein-coding genes and ancestral venom gland-specific genes that presumably contributed tissue-specific regulatory elements and secretory signal sequences. PMID:28035955

Exon Shuffling and Origin of Scorpion Venom Biodiversity.

PubMed

Wang, Xueli; Gao, Bin; Zhu, Shunyi

2016-12-26

Scorpion venom is a complex combinatorial library of peptides and proteins with multiple biological functions. A combination of transcriptomic and proteomic techniques has revealed its enormous molecular diversity, as identified by the presence of a large number of ion channel-targeted neurotoxins with different folds, membrane-active antimicrobial peptides, proteases, and protease inhibitors. Although the biodiversity of scorpion venom has long been known, how it arises remains unsolved. In this work, we analyzed the exon-intron structures of an array of scorpion venom protein-encoding genes and unexpectedly found that nearly all of these genes possess a phase-1 intron (one intron located between the first and second nucleotides of a codon) near the cleavage site of a signal sequence despite their mature peptides remarkably differ. This observation matches a theory of exon shuffling in the origin of new genes and suggests that recruitment of different folds into scorpion venom might be achieved via shuffling between body protein-coding genes and ancestral venom gland-specific genes that presumably contributed tissue-specific regulatory elements and secretory signal sequences.

Comparative genome sequencing reveals genomic signature of extreme desiccation tolerance in the anhydrobiotic midge

PubMed Central

Gusev, Oleg; Suetsugu, Yoshitaka; Cornette, Richard; Kawashima, Takeshi; Logacheva, Maria D.; Kondrashov, Alexey S.; Penin, Aleksey A.; Hatanaka, Rie; Kikuta, Shingo; Shimura, Sachiko; Kanamori, Hiroyuki; Katayose, Yuichi; Matsumoto, Takashi; Shagimardanova, Elena; Alexeev, Dmitry; Govorun, Vadim; Wisecaver, Jennifer; Mikheyev, Alexander; Koyanagi, Ryo; Fujie, Manabu; Nishiyama, Tomoaki; Shigenobu, Shuji; Shibata, Tomoko F.; Golygina, Veronika; Hasebe, Mitsuyasu; Okuda, Takashi; Satoh, Nori; Kikawada, Takahiro

2014-01-01

Anhydrobiosis represents an extreme example of tolerance adaptation to water loss, where an organism can survive in an ametabolic state until water returns. Here we report the first comparative analysis examining the genomic background of extreme desiccation tolerance, which is exclusively found in larvae of the only anhydrobiotic insect, Polypedilum vanderplanki. We compare the genomes of P. vanderplanki and a congeneric desiccation-sensitive midge P. nubifer. We determine that the genome of the anhydrobiotic species specifically contains clusters of multi-copy genes with products that act as molecular shields. In addition, the genome possesses several groups of genes with high similarity to known protective proteins. However, these genes are located in distinct paralogous clusters in the genome apart from the classical orthologues of the corresponding genes shared by both chironomids and other insects. The transcripts of these clustered paralogues contribute to a large majority of the mRNA pool in the desiccating larvae and most likely define successful anhydrobiosis. Comparison of expression patterns of orthologues between two chironomid species provides evidence for the existence of desiccation-specific gene expression systems in P. vanderplanki. PMID:25216354

Defining the Role of Essential Genes in Human Disease

PubMed Central

Robertson, David L.; Hentges, Kathryn E.

2011-01-01

A greater understanding of the causes of human disease can come from identifying characteristics that are specific to disease genes. However, a full understanding of the contribution of essential genes to human disease is lacking, due to the premise that these genes tend to cause developmental abnormalities rather than adult disease. We tested the hypothesis that human orthologs of mouse essential genes are associated with a variety of human diseases, rather than only those related to miscarriage and birth defects. We segregated human disease genes according to whether the knockout phenotype of their mouse ortholog was lethal or viable, defining those with orthologs producing lethal knockouts as essential disease genes. We show that the human orthologs of mouse essential genes are associated with a wide spectrum of diseases affecting diverse physiological systems. Notably, human disease genes with essential mouse orthologs are over-represented among disease genes associated with cancer, suggesting links between adult cellular abnormalities and developmental functions. The proteins encoded by essential genes are highly connected in protein-protein interaction networks, which we find correlates with an over-representation of nuclear proteins amongst essential disease genes. Disease genes associated with essential orthologs also are more likely than those with non-essential orthologs to contribute to disease through an autosomal dominant inheritance pattern, suggesting that these diseases may actually result from semi-dominant mutant alleles. Overall, we have described attributes found in disease genes according to the essentiality status of their mouse orthologs. These findings demonstrate that disease genes do occupy highly connected positions in protein-protein interaction networks, and that due to the complexity of disease-associated alleles, essential genes cannot be ignored as candidates for causing diverse human diseases. PMID:22096564

Mice with Deficiency of G Protein γ3 Are Lean and Have Seizures

PubMed Central

Schwindinger, William F.; Giger, Kathryn E.; Betz, Kelly S.; Stauffer, Anna M.; Sunderlin, Elaine M.; Sim-Selley, Laura J.; Selley, Dana E.; Bronson, Sarah K.; Robishaw, Janet D.

2004-01-01

Emerging evidence suggests that the γ subunit composition of an individual G protein contributes to the specificity of the hundreds of known receptor signaling pathways. Among the twelve γ subtypes, γ3 is abundantly and widely expressed in the brain. To identify specific functions and associations for γ3, a gene-targeting approach was used to produce mice lacking the Gng3 gene (Gng3−/−). Confirming the efficacy and specificity of gene targeting, Gng3−/− mice show no detectable expression of the Gng3 gene, but expression of the divergently transcribed Bscl2 gene is not affected. Suggesting unique roles for γ3 in the brain, Gng3−/− mice display increased susceptibility to seizures, reduced body weights, and decreased adiposity compared to their wild-type littermates. Predicting possible associations for γ3, these phenotypic changes are associated with significant reductions in β2 and αi3 subunit levels in certain regions of the brain. The finding that the Gng3−/− mice and the previously reported Gng7−/− mice display distinct phenotypes and different αβγ subunit associations supports the notion that even closely related γ subtypes, such as γ3 and γ7, perform unique functions in the context of the organism. PMID:15314181

Identification of a functional element in the promoter of the silkworm (Bombyx mori) fat body-specific gene Bmlp3.

PubMed

Xu, Hanfu; Deng, Dangjun; Yuan, Lin; Wang, Yuancheng; Wang, Feng; Xia, Qingyou

2014-08-01

30K proteins are a group of structurally related proteins that play important roles in the life cycle of the silkworm Bombyx mori and are largely synthesized and regulated in a time-dependent manner in the fat body. Little is known about the upstream regulatory elements associated with the genes encoding these proteins. In the present study, the promoter of Bmlp3, a fat body-specific gene encoding a 30K protein family member, was characterized by joining sequences containing the Bmlp3 promoter with various amounts of 5' upstream sequences to a luciferase reporter gene. The results indicated that the sequences from -150 to -250bp and -597 to -675bp upstream of the Bmlp3 transcription start site were necessary for high levels of luciferase activity. Further analysis showed that a 21-bp sequence located between -230 and -250 was specifically recognized by nuclear factors from silkworm fat bodies and BmE cells, and could enhance luciferase reporter-gene expression 2.8-fold in BmE cells. This study provides new insights into the Bmlp3 promoter and contributes to the further clarification of the function and developmental regulation of Bmlp3. Copyright © 2014. Published by Elsevier B.V.

Correlational analysis for identifying genes whose regulation contributes to chronic neuropathic pain

PubMed Central

Persson, Anna-Karin; Gebauer, Mathias; Jordan, Suzana; Metz-Weidmann, Christiane; Schulte, Anke M; Schneider, Hans-Christoph; Ding-Pfennigdorff, Danping; Thun, Jonas; Xu, Xiao-Jun; Wiesenfeld-Hallin, Zsuzsanna; Darvasi, Ariel; Fried, Kaj; Devor, Marshall

2009-01-01

Background Nerve injury-triggered hyperexcitability in primary sensory neurons is considered a major source of chronic neuropathic pain. The hyperexcitability, in turn, is thought to be related to transcriptional switching in afferent cell somata. Analysis using expression microarrays has revealed that many genes are regulated in the dorsal root ganglion (DRG) following axotomy. But which contribute to pain phenotype versus other nerve injury-evoked processes such as nerve regeneration? Using the L5 spinal nerve ligation model of neuropathy we examined differential changes in gene expression in the L5 (and L4) DRGs in five mouse strains with contrasting susceptibility to neuropathic pain. We sought genes for which the degree of regulation correlates with strain-specific pain phenotype. Results In an initial experiment six candidate genes previously identified as important in pain physiology were selected for in situ hybridization to DRG sections. Among these, regulation of the Na+ channel α subunit Scn11a correlated with levels of spontaneous pain behavior, and regulation of the cool receptor Trpm8 correlated with heat hypersensibility. In a larger scale experiment, mRNA extracted from individual mouse DRGs was processed on Affymetrix whole-genome expression microarrays. Overall, 2552 ± 477 transcripts were significantly regulated in the axotomized L5DRG 3 days postoperatively. However, in only a small fraction of these was the degree of regulation correlated with pain behavior across strains. Very few genes in the "uninjured" L4DRG showed altered expression (24 ± 28). Conclusion Correlational analysis based on in situ hybridization provided evidence that differential regulation of Scn11a and Trpm8 contributes to across-strain variability in pain phenotype. This does not, of course, constitute evidence that the others are unrelated to pain. Correlational analysis based on microarray data yielded a larger "look-up table" of genes whose regulation likely contributes to pain variability. While this list is enriched in genes of potential importance for pain physiology, and is relatively free of the bias inherent in the candidate gene approach, additional steps are required to clarify which transcripts on the list are in fact of functional importance. PMID:19228393

Convergence of genome-wide association and candidate gene studies for alcoholism.

PubMed

Olfson, Emily; Bierut, Laura Jean

2012-12-01

Genome-wide association (GWA) studies have led to a paradigm shift in how researchers study the genetics underlying disease. Many GWA studies are now publicly available and can be used to examine whether or not previously proposed candidate genes are supported by GWA data. This approach is particularly important for the field of alcoholism because the contribution of many candidate genes remains controversial. Using the Human Genome Epidemiology (HuGE) Navigator, we selected candidate genes for alcoholism that have been frequently examined in scientific articles in the past decade. Specific candidate loci as well as all the reported single nucleotide polymorphisms (SNPs) in candidate genes were examined in the Study of Addiction: Genetics and Environment (SAGE), a GWA study comparing alcohol-dependent and nondependent subjects. Several commonly reported candidate loci, including rs1800497 in DRD2, rs698 in ADH1C, rs1799971 in OPRM1, and rs4680 in COMT, are not replicated in SAGE (p > 0.05). Among candidate loci available for analysis, only rs279858 in GABRA2 (p = 0.0052, OR = 1.16) demonstrated a modest association. Examination of all SNPs reported in SAGE in over 50 candidate genes revealed no SNPs with large frequency differences between cases and controls, and the lowest p-value of any SNP was 0.0006. We provide evidence that several extensively studied candidate loci do not have a strong contribution to risk of developing alcohol dependence in European and African ancestry populations. Owing to the lack of coverage, we were unable to rule out the contribution of other variants, and these genes and particular loci warrant further investigation. Our analysis demonstrates that publicly available GWA results can be used to better understand which if any of previously proposed candidate genes contribute to disease. Furthermore, we illustrate how examining the convergence of candidate gene and GWA studies can help elucidate the genetic architecture of alcoholism and more generally complex diseases. Copyright © 2012 by the Research Society on Alcoholism.

Epigenetic Regulation of Placenta-Specific 8 Contributes to Altered Function of Endothelial Colony-Forming Cells Exposed to Intrauterine Gestational Diabetes Mellitus.

PubMed

Blue, Emily K; Sheehan, BreAnn M; Nuss, Zia V; Boyle, Frances A; Hocutt, Caleb M; Gohn, Cassandra R; Varberg, Kaela M; McClintick, Jeanette N; Haneline, Laura S

2015-07-01

Intrauterine exposure to gestational diabetes mellitus (GDM) is linked to development of hypertension, obesity, and type 2 diabetes in children. Our previous studies determined that endothelial colony-forming cells (ECFCs) from neonates exposed to GDM exhibit impaired function. The current goals were to identify aberrantly expressed genes that contribute to impaired function of GDM-exposed ECFCs and to evaluate for evidence of altered epigenetic regulation of gene expression. Genome-wide mRNA expression analysis was conducted on ECFCs from control and GDM pregnancies. Candidate genes were validated by quantitative RT-PCR and Western blotting. Bisulfite sequencing evaluated DNA methylation of placenta-specific 8 (PLAC8). Proliferation and senescence assays of ECFCs transfected with siRNA to knockdown PLAC8 were performed to determine functional impact. Thirty-eight genes were differentially expressed between control and GDM-exposed ECFCs. PLAC8 was highly expressed in GDM-exposed ECFCs, and PLAC8 expression correlated with maternal hyperglycemia. Methylation status of 17 CpG sites in PLAC8 negatively correlated with mRNA expression. Knockdown of PLAC8 in GDM-exposed ECFCs improved proliferation and senescence defects. This study provides strong evidence in neonatal endothelial progenitor cells that GDM exposure in utero leads to altered gene expression and DNA methylation, suggesting the possibility of altered epigenetic regulation. © 2015 by the American Diabetes Association. Readers may use this article as long as the work is properly cited, the use is educational and not for profit, and the work is not altered.

Comparative Genomics of a Plant-Pathogenic Fungus, Pyrenophora tritici-repentis, Reveals Transduplication and the Impact of Repeat Elements on Pathogenicity and Population Divergence

PubMed Central

Manning, Viola A.; Pandelova, Iovanna; Dhillon, Braham; Wilhelm, Larry J.; Goodwin, Stephen B.; Berlin, Aaron M.; Figueroa, Melania; Freitag, Michael; Hane, James K.; Henrissat, Bernard; Holman, Wade H.; Kodira, Chinnappa D.; Martin, Joel; Oliver, Richard P.; Robbertse, Barbara; Schackwitz, Wendy; Schwartz, David C.; Spatafora, Joseph W.; Turgeon, B. Gillian; Yandava, Chandri; Young, Sarah; Zhou, Shiguo; Zeng, Qiandong; Grigoriev, Igor V.; Ma, Li-Jun; Ciuffetti, Lynda M.

2013-01-01

Pyrenophora tritici-repentis is a necrotrophic fungus causal to the disease tan spot of wheat, whose contribution to crop loss has increased significantly during the last few decades. Pathogenicity by this fungus is attributed to the production of host-selective toxins (HST), which are recognized by their host in a genotype-specific manner. To better understand the mechanisms that have led to the increase in disease incidence related to this pathogen, we sequenced the genomes of three P. tritici-repentis isolates. A pathogenic isolate that produces two known HSTs was used to assemble a reference nuclear genome of approximately 40 Mb composed of 11 chromosomes that encode 12,141 predicted genes. Comparison of the reference genome with those of a pathogenic isolate that produces a third HST, and a nonpathogenic isolate, showed the nonpathogen genome to be more diverged than those of the two pathogens. Examination of gene-coding regions has provided candidate pathogen-specific proteins and revealed gene families that may play a role in a necrotrophic lifestyle. Analysis of transposable elements suggests that their presence in the genome of pathogenic isolates contributes to the creation of novel genes, effector diversification, possible horizontal gene transfer events, identified copy number variation, and the first example of transduplication by DNA transposable elements in fungi. Overall, comparative analysis of these genomes provides evidence that pathogenicity in this species arose through an influx of transposable elements, which created a genetically flexible landscape that can easily respond to environmental changes. PMID:23316438

Comparative Genomics of a Plant-Pathogenic Fungus, Pyrenophora tritici-repentis, Reveals Transduplication and the Impact of Repeat Elements on Pathogenicity and Population Divergence

DOE Office of Scientific and Technical Information (OSTI.GOV)

Manning, Viola A.; Pandelova, Iovanna; Dhillon, Braham

2012-08-16

Pyrenophora tritici-repentis is a necrotrophic fungus causal to the disease tan spot of wheat, whose contribution to crop loss has increased significantly during the last few decades. Pathogenicity by this fungus is attributed to the production of host-selective toxins (HST), which are recognized by their host in a genotype-specific manner. To better understand the mechanisms that have led to the increase in disease incidence related to this pathogen, we sequenced the genomes of three P. tritici-repentis isolates. A pathogenic isolate that produces two known HSTs was used to assemble a reference nuclear genome of approximately 40 Mb composed of 11more » chromosomes that encode 12,141 predicted genes. Comparison of the reference genome with those of a pathogenic isolate that produces a third HST, and a nonpathogenic isolate, showed the nonpathogen genome to be more diverged than those of the two pathogens. Examination of gene-coding regions has provided candidate pathogen-specific proteins and revealed gene families that may play a role in a necrotrophic lifestyle. Analysis of transposable elements suggests that their presence in the genome of pathogenic isolates contributes to the creation of novel genes, effector diversification, possible horizontal gene transfer events, identified copy number variation, and the first example of transduplication by DNA transposable elements in fungi. Overall, comparative analysis of these genomes provides evidence that pathogenicity in this species arose through an influx of transposable elements, which created a genetically flexible landscape that can easily respond to environmental changes.« less

Quantifying the Effect of DNA Packaging on Gene Expression Level

NASA Astrophysics Data System (ADS)

Kim, Harold

2010-10-01

Gene expression, the process by which the genetic code comes alive in the form of proteins, is one of the most important biological processes in living cells, and begins when transcription factors bind to specific DNA sequences in the promoter region upstream of a gene. The relationship between gene expression output and transcription factor input which is termed the gene regulation function is specific to each promoter, and predicting this gene regulation function from the locations of transcription factor binding sites is one of the challenges in biology. In eukaryotic organisms (for example, animals, plants, fungi etc), DNA is highly compacted into nucleosomes, 147-bp segments of DNA tightly wrapped around histone protein core, and therefore, the accessibility of transcription factor binding sites depends on their locations with respect to nucleosomes - sites inside nucleosomes are less accessible than those outside nucleosomes. To understand how transcription factor binding sites contribute to gene expression in a quantitative manner, we obtain gene regulation functions of promoters with various configurations of transcription factor binding sites by using fluorescent protein reporters to measure transcription factor input and gene expression output in single yeast cells. In this talk, I will show that the affinity of a transcription factor binding site inside and outside the nucleosome controls different aspects of the gene regulation function, and explain this finding based on a mass-action kinetic model that includes competition between nucleosomes and transcription factors.

The Pleiotropic MET Receptor Network: Circuit Development and the Neural-Medical Interface of Autism.

PubMed

Eagleson, Kathie L; Xie, Zhihui; Levitt, Pat

2017-03-01

People with autism spectrum disorder and other neurodevelopmental disorders (NDDs) are behaviorally and medically heterogeneous. The combination of polygenicity and gene pleiotropy-the influence of one gene on distinct phenotypes-raises questions of how specific genes and their protein products interact to contribute to NDDs. A preponderance of evidence supports developmental and pathophysiological roles for the MET receptor tyrosine kinase, a multifunctional receptor that mediates distinct biological responses depending upon cell context. MET influences neuron architecture and synapse maturation in the forebrain and regulates homeostasis in gastrointestinal and immune systems, both commonly disrupted in NDDs. Peak expression of synapse-enriched MET is conserved across rodent and primate forebrain, yet regional differences in primate neocortex are pronounced, with enrichment in circuits that participate in social information processing. A functional risk allele in the MET promoter, enriched in subgroups of children with autism spectrum disorder, reduces transcription and disrupts socially relevant neural circuits structurally and functionally. In mice, circuit-specific deletion of Met causes distinct atypical behaviors. MET activation increases dendritic complexity and nascent synapse number, but synapse maturation requires reductions in MET. MET mediates its specific biological effects through different intracellular signaling pathways and has a complex protein interactome that is enriched in autism spectrum disorder and other NDD candidates. The interactome is coregulated in developing human neocortex. We suggest that a gene as pleiotropic and highly regulated as MET, together with its interactome, is biologically relevant in normal and pathophysiological contexts, affecting central and peripheral phenotypes that contribute to NDD risk and clinical symptoms. Copyright © 2016 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

What triggers differential DNA methylation of genes and TEs: contribution of body methylation?

PubMed

Inagaki, S; Kakutani, T

2012-01-01

Transposable elements (TEs) are epigenetically silenced with extensive DNA methylation. The silent epigenetic marks should, however, be excluded from active genes. By genetic approaches, we study mechanisms to remove the heterochromatin marks from transcribed genes. Based on our observations on control of TE transcription, we propose a possible trigger for the TE-specific accumulation of DNA methylation. A critical difference between TEs and genes could be their responses to the DNA methylation in the internal part of transcribed regions. When their internal region is methylated, genes are still transcribed, but TEs could be silenced, which may reflect the obligatory position of every critical cis-acting element within the TE itself. This initial difference of TEs and genes will be amplified by positive feedback loops to stabilize active or silent states. Thus, the mechanisms to accumulate heterochromatin marks within transcribed regions could provide a trigger to induce differential DNA methylation between genes and TEs.

Gene family innovation, conservation and loss on the animal stem lineage.

PubMed

Richter, Daniel J; Fozouni, Parinaz; Eisen, Michael; King, Nicole

2018-05-31

Choanoflagellates, the closest living relatives of animals, can provide unique insights into the changes in gene content that preceded the origin of animals. However, only two choanoflagellate genomes are currently available, providing poor coverage of their diversity. We sequenced transcriptomes of 19 additional choanoflagellate species to produce a comprehensive reconstruction of the gains and losses that shaped the ancestral animal gene repertoire. We identified ~1,944 gene families that originated on the animal stem lineage, of which only 39 are conserved across all animals in our study. In addition, ~372 gene families previously thought to be animal-specific, including Notch, Delta, and homologs of the animal Toll-like receptor genes, instead evolved prior to the animal-choanoflagellate divergence. Our findings contribute to an increasingly detailed portrait of the gene families that defined the biology of the Urmetazoan and that may underpin core features of extant animals. © 2018, Richter et al.

Colloquium paper: uniquely human evolution of sialic acid genetics and biology.

PubMed

Varki, Ajit

2010-05-11

Darwinian evolution of humans from our common ancestors with nonhuman primates involved many gene-environment interactions at the population level, and the resulting human-specific genetic changes must contribute to the "Human Condition." Recent data indicate that the biology of sialic acids (which directly involves less than 60 genes) shows more than 10 uniquely human genetic changes in comparison with our closest evolutionary relatives. Known outcomes are tissue-specific changes in abundant cell-surface glycans, changes in specificity and/or expression of multiple proteins that recognize these glycans, and novel pathogen regimes. Specific events include Alu-mediated inactivation of the CMAH gene, resulting in loss of synthesis of the Sia N-glycolylneuraminic acid (Neu5Gc) and increase in expression of the precursor N-acetylneuraminic acid (Neu5Ac); increased expression of alpha2-6-linked Sias (likely because of changed expression of ST6GALI); and multiple changes in SIGLEC genes encoding Sia-recognizing Ig-like lectins (Siglecs). The last includes binding specificity changes (in Siglecs -5, -7, -9, -11, and -12); expression pattern changes (in Siglecs -1, -5, -6, and -11); gene conversion (SIGLEC11); and deletion or pseudogenization (SIGLEC13, SIGLEC14, and SIGLEC16). A nongenetic outcome of the CMAH mutation is human metabolic incorporation of foreign dietary Neu5Gc, in the face of circulating anti-Neu5Gc antibodies, generating a novel "xeno-auto-antigen" situation. Taken together, these data suggest that both the genes associated with Sia biology and the related impacts of the environment comprise a relative "hot spot" of genetic and physiological changes in human evolution, with implications for uniquely human features both in health and disease.

Transcriptional control of the tissue-specific, developmentally regulated osteocalcin gene requires a binding motif for the Msx family of homeodomain proteins.

PubMed

Hoffmann, H M; Catron, K M; van Wijnen, A J; McCabe, L R; Lian, J B; Stein, G S; Stein, J L

1994-12-20

The OC box of the rat osteocalcin promoter (nt -99 to -76) is the principal proximal regulatory element contributing to both tissue-specific and developmental control of osteocalcin gene expression. The central motif of the OC box includes a perfect consensus DNA binding site for certain homeodomain proteins. Homeodomain proteins are transcription factors that direct proper development by regulating specific temporal and spatial patterns of gene expression. We therefore addressed the role of the homeodomain binding motif in the activity of the OC promoter. In this study, by the combined application of mutagenesis and site-specific protein recognition analysis, we examined interactions of ROS 17/2.8 osteosarcoma cell nuclear proteins and purified Msx-1 homeodomain protein with the OC box. We detected a series of related specific protein-DNA interactions, a subset of which were inhibited by antibodies directed against the Msx-1 homeodomain but which also recognize the Msx-2 homeodomain. Our results show that the sequence requirements for binding the Msx-1 or Msx-2 homeodomain closely parallel those necessary for osteocalcin gene promoter activity in vivo. This functional relationship was demonstrated by transient expression in ROS 17/2.8 osteosarcoma cells of a series of osteocalcin promoter (nt -1097 to +24)-reporter gene constructs containing mutations within and flanking the homeodomain binding site of the OC box. Northern blot analysis of several bone-related cell types showed that all of the cells expressed msx-1, whereas msx-2 expression was restricted to cells transcribing osteocalcin. Taken together, our results suggest a role for Msx-1 and -2 or related homeodomain proteins in transcription of the osteocalcin gene.

A Common histone modification code on C4 genes in maize and its conservation in Sorghum and Setaria italica.

PubMed

Heimann, Louisa; Horst, Ina; Perduns, Renke; Dreesen, Björn; Offermann, Sascha; Peterhansel, Christoph

2013-05-01

C4 photosynthesis evolved more than 60 times independently in different plant lineages. Each time, multiple genes were recruited into C4 metabolism. The corresponding promoters acquired new regulatory features such as high expression, light induction, or cell type-specific expression in mesophyll or bundle sheath cells. We have previously shown that histone modifications contribute to the regulation of the model C4 phosphoenolpyruvate carboxylase (C4-Pepc) promoter in maize (Zea mays). We here tested the light- and cell type-specific responses of three selected histone acetylations and two histone methylations on five additional C4 genes (C4-Ca, C4-Ppdk, C4-Me, C4-Pepck, and C4-RbcS2) in maize. Histone acetylation and nucleosome occupancy assays indicated extended promoter regions with regulatory upstream regions more than 1,000 bp from the transcription initiation site for most of these genes. Despite any detectable homology of the promoters on the primary sequence level, histone modification patterns were highly coregulated. Specifically, H3K9ac was regulated by illumination, whereas H3K4me3 was regulated in a cell type-specific manner. We further compared histone modifications on the C4-Pepc and C4-Me genes from maize and the homologous genes from sorghum (Sorghum bicolor) and Setaria italica. Whereas sorghum and maize share a common C4 origin, C4 metabolism evolved independently in S. italica. The distribution of histone modifications over the promoters differed between the species, but differential regulation of light-induced histone acetylation and cell type-specific histone methylation were evident in all three species. We propose that a preexisting histone code was recruited into C4 promoter control during the evolution of C4 metabolism.

Lentiviral-induced high-grade gliomas in rats: the effects of PDGFB, HRAS-G12V, AKT, and IDH1-R132H.

PubMed

Lynes, John; Wibowo, Mia; Koschmann, Carl; Baker, Gregory J; Saxena, Vandana; Muhammad, A K M G; Bondale, Niyati; Klein, Julia; Assi, Hikmat; Lieberman, Andrew P; Castro, Maria G; Lowenstein, Pedro R

2014-07-01

In human gliomas, the RTK/RAS/PI(3)K signaling pathway is nearly always altered. We present a model of experimental gliomagenesis that elucidates the contributions of genes involved in this pathway (PDGF-B ligand, HRAS-G12V, and AKT). We also examine the effect on gliomagenesis by the potential modifier gene, IDH1-R132H. Injections of lentiviral-encoded oncogenes induce de novo gliomas of varying penetrance, tumor progression, and histological grade depending on the specific oncogenes used. Our model mimics hallmark histological structures of high-grade glioma, such as pseudopalisades, glomeruloid microvascular proliferation, and diffuse tumor invasion. We use our model of gliomagenesis to test the efficacy of an experimental brain tumor gene therapy. Our model allowed us to test the contributions of oncogenes in the RTK/RAS/PI(3)K pathway, and their potential modification by over-expression of mutated IDH1, in glioma development and progression in rats. Our model constitutes a clinically relevant system to study gliomagenesis, the effects of modifier genes, and the efficacy of experimental therapeutics.

Divergent Evolutionary Patterns of NAC Transcription Factors Are Associated with Diversification and Gene Duplications in Angiosperm

PubMed Central

Jin, Xiaoli; Ren, Jing; Nevo, Eviatar; Yin, Xuegui; Sun, Dongfa; Peng, Junhua

2017-01-01

NAC (NAM/ATAF/CUC) proteins constitute one of the biggest plant-specific transcription factor (TF) families and have crucial roles in diverse developmental programs during plant growth. Phylogenetic analyses have revealed both conserved and lineage-specific NAC subfamilies, among which various origins and distinct features were observed. It is reasonable to hypothesize that there should be divergent evolutionary patterns of NAC TFs both between dicots and monocots, and among NAC subfamilies. In this study, we compared the gene duplication and loss, evolutionary rate, and selective pattern among non-lineage specific NAC subfamilies, as well as those between dicots and monocots, through genome-wide analyses of sequence and functional data in six dicot and five grass lineages. The number of genes gained in the dicot lineages was much larger than that in the grass lineages, while fewer gene losses were observed in the grass than that in the dicots. We revealed (1) uneven constitution of Clusters of Orthologous Groups (COGs) and contrasting birth/death rates among subfamilies, and (2) two distinct evolutionary scenarios of NAC TFs between dicots and grasses. Our results demonstrated that relaxed selection, resulting from concerted gene duplications, may have permitted substitutions responsible for functional divergence of NAC genes into new lineages. The underlying mechanism of distinct evolutionary fates of NAC TFs shed lights on how evolutionary divergence contributes to differences in establishing NAC gene subfamilies and thus impacts the distinct features between dicots and grasses. PMID:28713414

Influence of molecular weight upon mannosylated bio-synthetic hybrids for targeted antigen presenting cell gene delivery

PubMed Central

Jones, Charles H.; Gollakota, Akhila; Chen, Mingfu; Chung, Tai-Chun; Ravikrishnan, Anitha; Zhang, Guojian; Pfeifer, Blaine A.

2015-01-01

Given the rise of antibiotic resistant microbes, genetic vaccination is a promising prophylactic strategy that enables rapid design and manufacture. Facilitating this process is the choice of vector, which is often situationally-specific and limited in engineering capacity. Furthermore, these shortcomings are usually tied to an incomplete understanding of the structure-function relationships driving vector-mediated gene delivery. Building upon our initial report of a hybrid bacterial-biomaterial gene delivery vector, a comprehensive structure-function assessment was completed using a class of mannosylated poly(beta-amino esters). Through a top-down screening methodology, an ideal polymer was selected on the basis of gene delivery efficacy and then used for the synthesis of a stratified molecular weight polymer library. By eliminating contributions of polymer chemical background, we were able to complete an in-depth assessment of gene delivery as a function of (1) polymer molecular weight, (2) relative mannose content, (3) polymer-membrane biophysical properties, (4) APC uptake specificity, and (5) serum inhibition. In summary, the flexibility and potential of the hybrid design featured in this work highlights the ability to systematically probe vector-associated properties for the development of translational gene delivery candidates. PMID:25941787

High Diversity of Genes for Nonhost Resistance of Barley to Heterologous Rust Fungi

PubMed Central

Jafary, Hossein; Albertazzi, Giorgia; Marcel, Thierry C.; Niks, Rients E.

2008-01-01

Inheritance studies on the nonhost resistance of plants would normally require interspecific crosses that suffer from sterility and abnormal segregation. Therefore, we developed the barley–Puccinia rust model system to study, using forward genetics, the specificity, number, and diversity of genes involved in nonhost resistance. We developed two mapping populations by crossing the line SusPtrit, with exceptional susceptibility to heterologous rust species, with the immune barley cultivars Vada and Cebada Capa. These two mapping populations along with the Oregon Wolfe Barley population, which showed unexpected segregation for resistance to heterologous rusts, were phenotyped with four heterologous rust fungal species. Positions of QTL conferring nonhost resistance in the three mapping populations were compared using an integrated consensus map. The results confirmed that nonhost resistance in barley to heterologous rust species is controlled by QTL with different and overlapping specificities and by an occasional contribution of an R-gene for hypersensitivity. In each population, different sets of loci were implicated in resistance. Few genes were common between the populations, suggesting a high diversity of genes conferring nonhost resistance to heterologous pathogens. These loci were significantly associated with QTL for partial resistance to the pathogen Puccinia hordei and with defense-related genes. PMID:18430953

Stearoyl-acyl carrier protein desaturases are associated with floral isolation in sexually deceptive orchids

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schluter, P.M.; Shanklin, J.; Xu, S.

The orchids Ophrys sphegodes and O. exaltata are reproductively isolated from each other by the attraction of two different, highly specific pollinator species. For pollinator attraction, flowers chemically mimic the pollinators sex pheromones, the key components of which are alkenes with different double-bond positions. This study identifies genes likely involved in alkene biosynthesis, encoding stearoyl-acyl carrier protein (ACP) desaturase (SAD) homologs. The expression of two isoforms, SAD1 and SAD2, is flower-specific and broadly parallels alkene production during flower development. SAD2 shows a significant association with alkene production, and in vitro assays show that O. sphegodes SAD2 has activity both asmore » an 18:0-ACP {Delta}{sup 9} and a 16:0-ACP {Delta}{sup 4} desaturase. Downstream metabolism of the SAD2 reaction products would give rise to alkenes with double-bonds at position 9 or position 12, matching double-bond positions observed in alkenes in the odor bouquet of O. sphegodes. SAD1 and SAD2 show evidence of purifying selection before, and positive or relaxed purifying selection after gene duplication. By contributing to the production of species-specific alkene bouquets, SAD2 is suggested to contribute to differential pollinator attraction and reproductive isolation among these species. Taken together, these data are consistent with the hypothesis that SAD2 is a florally expressed barrier gene of large phenotypic effect and, possibly, a genic target of pollinator-mediated selection.« less

Stearoyl-acyl carrier protein desaturases are associated with floral isolation in sexually deceptive orchids

PubMed Central

Schlüter, Philipp M.; Xu, Shuqing; Gagliardini, Valeria; Whittle, Edward; Shanklin, John; Grossniklaus, Ueli; Schiestl, Florian P.

2011-01-01

The orchids Ophrys sphegodes and O. exaltata are reproductively isolated from each other by the attraction of two different, highly specific pollinator species. For pollinator attraction, flowers chemically mimic the pollinators’ sex pheromones, the key components of which are alkenes with different double-bond positions. This study identifies genes likely involved in alkene biosynthesis, encoding stearoyl-acyl carrier protein (ACP) desaturase (SAD) homologs. The expression of two isoforms, SAD1 and SAD2, is flower-specific and broadly parallels alkene production during flower development. SAD2 shows a significant association with alkene production, and in vitro assays show that O. sphegodes SAD2 has activity both as an 18:0-ACP Δ9 and a 16:0-ACP Δ4 desaturase. Downstream metabolism of the SAD2 reaction products would give rise to alkenes with double-bonds at position 9 or position 12, matching double-bond positions observed in alkenes in the odor bouquet of O. sphegodes. SAD1 and SAD2 show evidence of purifying selection before, and positive or relaxed purifying selection after gene duplication. By contributing to the production of species-specific alkene bouquets, SAD2 is suggested to contribute to differential pollinator attraction and reproductive isolation among these species. Taken together, these data are consistent with the hypothesis that SAD2 is a florally expressed barrier gene of large phenotypic effect and, possibly, a genic target of pollinator-mediated selection. PMID:21436056

Development and validation of real-time PCR screening methods for detection of cry1A.105 and cry2Ab2 genes in genetically modified organisms.

PubMed

Dinon, Andréia Z; Prins, Theo W; van Dijk, Jeroen P; Arisi, Ana Carolina M; Scholtens, Ingrid M J; Kok, Esther J

2011-05-01

Primers and probes were developed for the element-specific detection of cry1A.105 and cry2Ab2 genes, based on their DNA sequence as present in GM maize MON89034. Cry genes are present in many genetically modified (GM) plants and they are important targets for developing GMO element-specific detection methods. Element-specific methods can be of use to screen for the presence of GMOs in food and feed supply chains. Moreover, a combination of GMO elements may indicate the potential presence of unapproved GMOs (UGMs). Primer-probe combinations were evaluated in terms of specificity, efficiency and limit of detection. Except for specificity, the complete experiment was performed in 9 PCR runs, on 9 different days and by testing 8 DNA concentrations. The results showed a high specificity and efficiency for cry1A.105 and cry2Ab2 detection. The limit of detection was between 0.05 and 0.01 ng DNA per PCR reaction for both assays. These data confirm the applicability of these new primer-probe combinations for element detection that can contribute to the screening for GM and UGM crops in food and feed samples.

Gene expression differences between Noccaea caerulescens ecotypes help to identify candidate genes for metal phytoremediation.

PubMed

Halimaa, Pauliina; Lin, Ya-Fen; Ahonen, Viivi H; Blande, Daniel; Clemens, Stephan; Gyenesei, Attila; Häikiö, Elina; Kärenlampi, Sirpa O; Laiho, Asta; Aarts, Mark G M; Pursiheimo, Juha-Pekka; Schat, Henk; Schmidt, Holger; Tuomainen, Marjo H; Tervahauta, Arja I

2014-03-18

Populations of Noccaea caerulescens show tremendous differences in their capacity to hyperaccumulate and hypertolerate metals. To explore the differences that could contribute to these traits, we undertook SOLiD high-throughput sequencing of the root transcriptomes of three phenotypically well-characterized N. caerulescens accessions, i.e., Ganges, La Calamine, and Monte Prinzera. Genes with possible contribution to zinc, cadmium, and nickel hyperaccumulation and hypertolerance were predicted. The most significant differences between the accessions were related to metal ion (di-, trivalent inorganic cation) transmembrane transporter activity, iron and calcium ion binding, (inorganic) anion transmembrane transporter activity, and antioxidant activity. Analysis of correlation between the expression profile of each gene and the metal-related characteristics of the accessions disclosed both previously characterized (HMA4, HMA3) and new candidate genes (e.g., for nickel IRT1, ZIP10, and PDF2.3) as possible contributors to the hyperaccumulation/tolerance phenotype. A number of unknown Noccaea-specific transcripts also showed correlation with Zn(2+), Cd(2+), or Ni(2+) hyperaccumulation/tolerance. This study shows that N. caerulescens populations have evolved great diversity in the expression of metal-related genes, facilitating adaptation to various metalliferous soils. The information will be helpful in the development of improved plants for metal phytoremediation.

AnnoTALE: bioinformatics tools for identification, annotation, and nomenclature of TALEs from Xanthomonas genomic sequences

PubMed Central

Grau, Jan; Reschke, Maik; Erkes, Annett; Streubel, Jana; Morgan, Richard D.; Wilson, Geoffrey G.; Koebnik, Ralf; Boch, Jens

2016-01-01

Transcription activator-like effectors (TALEs) are virulence factors, produced by the bacterial plant-pathogen Xanthomonas, that function as gene activators inside plant cells. Although the contribution of individual TALEs to infectivity has been shown, the specific roles of most TALEs, and the overall TALE diversity in Xanthomonas spp. is not known. TALEs possess a highly repetitive DNA-binding domain, which is notoriously difficult to sequence. Here, we describe an improved method for characterizing TALE genes by the use of PacBio sequencing. We present ‘AnnoTALE’, a suite of applications for the analysis and annotation of TALE genes from Xanthomonas genomes, and for grouping similar TALEs into classes. Based on these classes, we propose a unified nomenclature for Xanthomonas TALEs that reveals similarities pointing to related functionalities. This new classification enables us to compare related TALEs and to identify base substitutions responsible for the evolution of TALE specificities. PMID:26876161

Genome-wide comparison of ferritin family from Archaea, Bacteria, Eukarya, and Viruses: its distribution, characteristic motif, and phylogenetic relationship

NASA Astrophysics Data System (ADS)

Bai, Lina; Xie, Ting; Hu, Qingqing; Deng, Changyan; Zheng, Rong; Chen, Wanping

2015-10-01

Ferritins are highly conserved proteins that are widely distributed in various species from archaea to humans. The ubiquitous characteristic of these proteins reflects the pivotal contribution of ferritins to the safe storage and timely delivery of iron to achieve iron homeostasis. This study investigated the ferritin genes in 248 genomes from various species, including viruses, archaea, bacteria, and eukarya. The distribution comparison suggests that mammals and eudicots possess abundant ferritin genes, whereas fungi contain very few ferritin genes. Archaea and bacteria show considerable numbers of ferritin genes. Generally, prokaryotes possess three types of ferritin (the typical ferritin, bacterioferritin, and DNA-binding protein from starved cell), whereas eukaryotes have various subunit types of ferritin, thereby indicating the individuation of the ferritin family during evolution. The characteristic motif analysis of ferritins suggested that all key residues specifying the unique structural motifs of ferritin are highly conserved across three domains of life. Meanwhile, the characteristic motifs were also distinguishable between ferritin groups, especially phytoferritins, which show a plant-specific motif. The phylogenetic analyses show that ferritins within the same subfamily or subunits are generally clustered together. The phylogenetic relationships among ferritin members suggest that both gene duplication and horizontal transfer contribute to the wide variety of ferritins, and their possible evolutionary scenario was also proposed. The results contribute to a better understanding of the distribution, characteristic motif, and evolutionary relationship of the ferritin family.

Parent-of-origin and trans-generational germline influences on behavioral development: the interacting roles of mothers, fathers, and grandparents.

PubMed

Curley, J P; Mashoodh, R

2010-05-01

Mothers and fathers do not contribute equally to the development of their offspring. In addition to the differential investment of mothers versus fathers in the rearing of offspring, there are also a number of germline factors that are transmitted unequally from one parent or the other that contribute significantly to offspring development. This article shall review four major sources of such parent-of-origin effects. Firstly, there is increasing evidence that genes inherited on the sex chromosomes including the nonpseudoautosomal part of the Y chromosome that is only inherited from fathers to sons, contribute to brain development and behavior independently of the organizing effects of sex hormones. Secondly, recent work has demonstrated that mitochondrial DNA that is primarily inherited only from mothers may play a much greater than anticipated role in neurobehavioral development. Thirdly, there exists a class of genes known as imprinted genes that are epigenetically silenced when passed on in a parent-of-origin specific manner and have been shown to regulate brain development and a variety of behaviors. Finally, there is converging evidence from several disciplines that environmental variations experienced by mothers and fathers may lead to plasticity in the development and behavior of offspring and that this phenotypic inheritance can be solely transmitted through the germline. Mechanistically, this may be achieved through altered programming within germ cells of the epigenetic status of particular genes such as retrotransposons and imprinted genes or potentially through altered expression of RNAs within gametes.

Ectopic expression of miR-126*, an intronic product of the vascular endothelial EGF-like 7 gene, regulates prostein translation and invasiveness of prostate cancer LNCaP cells.

PubMed

Musiyenko, Alla; Bitko, Vira; Barik, Sailen

2008-03-01

MicroRNAs (miRNAs) are endogenous noncoding RNAs that down-regulate gene expression by promoting cleavage or translational arrest of target mRNAs. While most miRNAs are transcribed from their own dedicated genes, some map to introns of 'host' transcripts, the biological significance of which remains unknown. Here, we show that prostate cells are naturally devoid of EGF-like domain 7 (Egfl7) transcripts and hence also deficient in a miRNA, miR-126*, generated from splicing and processing of its ninth intron. Use of recombinant and synthetic miRNAs or a specific antagomir established a role of miR-126* in silencing prostein in non-endothelial cells. We mapped two miR-126*-binding sites in the 3'UTR of the prostein mRNA required for translational repression. Transfection of synthetic miR-126* into prostate cancer LNCaP cells strongly reduced the translation of prostein. Interestingly, loss of prostein correlated with reduction of LNCaP cell migration and invasion. Thus, the robust expression of prostein protein in the prostate cells results from a combination of transcriptional activation of the prostein gene and absence of intronic miRNA-126* due to the prostate-specific repression of the Egfl7 gene. We conclude that intronic miRNAs from tissue-specific transcripts, or their natural absence, make cardinal contributions to cellular gene expression and phenotype. These findings also open the door to tissue-specific miRNA therapy.

Erythroid activator NF-E2, TAL1 and KLF1 play roles in forming the LCR HSs in the human adult β-globin locus.

PubMed

Kim, Yea Woon; Yun, Won Ju; Kim, AeRi

2016-06-01

The β-like globin genes are developmental stage specifically transcribed in erythroid cells. The transcription of the β-like globin genes requires erythroid specific activators such as GATA-1, NF-E2, TAL1 and KLF1. However, the roles of these activators have not fully elucidated in transcription of the human adult β-globin gene. Here we employed hybrid MEL cells (MEL/ch11) where a human chromosome containing the β-globin locus is present and the adult β-globin gene is highly transcribed by induction. The roles of erythroid specific activators were analyzed by inhibiting the expression of NF-E2, TAL1 or KLF1 in MEL/ch11 cells. The loss of each activator decreased the transcription of human β-globin gene, locus wide histone hyperacetylation and the binding of other erythroid specific activators including GATA-1, even though not affecting the expression of other activators. Notably, sensitivity to DNase I was reduced in the locus control region (LCR) hypersensitive sites (HSs) with the depletion of activators. These results indicate that NF-E2, TAL1 and KLF1, all activators play a primary role in HSs formation in the LCR. It might contribute to the transcription of human adult β-globin gene by allowing the access of activators and cofactors. The roles of activators in the adult β-globin locus appear to be different from the roles in the early fetal locus. Copyright © 2016 Elsevier Ltd. All rights reserved.

Combined gene expression analysis of whole-tissue and microdissected pancreatic ductal adenocarcinoma identifies genes specifically overexpressed in tumor epithelia.

PubMed

Badea, Liviu; Herlea, Vlad; Dima, Simona Olimpia; Dumitrascu, Traian; Popescu, Irinel

2008-01-01

The precise details of pancreatic ductal adenocarcinoma (PDAC) pathogenesis are still insufficiently known, requiring the use of high-throughput methods. However, PDAC is especially difficult to study using microarrays due to its strong desmoplastic reaction, which involves a hyperproliferating stroma that effectively "masks" the contribution of the minoritary neoplastic epithelial cells. Thus it is not clear which of the genes that have been found differentially expressed between normal and whole tumor tissues are due to the tumor epithelia and which simply reflect the differences in cellular composition. To address this problem, laser microdissection studies have been performed, but these have to deal with much smaller tissue sample quantities and therefore have significantly higher experimental noise. In this paper we combine our own large sample whole-tissue study with a previously published smaller sample microdissection study by Grützmann et al. to identify the genes that are specifically overexpressed in PDAC tumor epithelia. The overlap of this list of genes with other microarray studies of pancreatic cancer as well as with the published literature is impressive. Moreover, we find a number of genes whose over-expression appears to be inversely correlated with patient survival: keratin 7, laminin gamma 2, stratifin, platelet phosphofructokinase, annexin A2, MAP4K4 and OACT2 (MBOAT2), which are all specifically upregulated in the neoplastic epithelia, rather than the tumor stroma. We improve on other microarray studies of PDAC by putting together the higher statistical power due to a larger number of samples with information about cell-type specific expression and patient survival.

An RNA matchmaker protein regulates the activity of the long noncoding RNA HOTAIR

PubMed Central

Meredith, Emily K.; Balas, Maggie M.; Sindy, Karla; Haislop, Krystal; Johnson, Aaron M.

2016-01-01

The human long noncoding RNA (lncRNA) HOTAIR acts in trans to recruit the Polycomb repressive complex 2 (PRC2) to the HOXD gene cluster and to promote gene silencing during development. In breast cancers, overexpression of HOTAIR increases metastatic potential via the repression of many additional genes. It has remained unclear what factors determine HOTAIR-dependent PRC2 activity at specific genomic loci, particularly when high levels of HOTAIR result in aberrant gene silencing. To identify additional proteins that contribute to the specific action of HOTAIR, we performed a quantitative proteomic analysis of the HOTAIR interactome. We found that the most specific interaction was between HOTAIR and the heterogeneous nuclear ribonucleoprotein (hnRNP) A2/B1, a member of a family of proteins involved in nascent mRNA processing and RNA matchmaking. Our data suggest that A2/B1 are key contributors to HOTAIR-mediated chromatin regulation in breast cancer cells: A2/B1 knockdown reduces HOTAIR-dependent breast cancer cell invasion and decreases PRC2 activity at the majority of HOTAIR-dependent loci. We found that the B1 isoform, which differs from A2 by 12 additional amino acids, binds with highest specificity to HOTAIR. B1 also binds chromatin and associates preferentially with RNA transcripts of HOTAIR gene targets. We furthermore demonstrate a direct RNA–RNA interaction between HOTAIR and a target transcript that is enhanced by B1 binding. Together, these results suggest a model in which B1 matches HOTAIR with transcripts of target genes on chromatin, leading to repression by PRC2. PMID:27146324

Allelic barley MLA immune receptors recognize sequence-unrelated avirulence effectors of the powdery mildew pathogen

PubMed Central

Lu, Xunli; Kracher, Barbara; Saur, Isabel M. L.; Bauer, Saskia; Ellwood, Simon R.; Wise, Roger; Yaeno, Takashi; Maekawa, Takaki; Schulze-Lefert, Paul

2016-01-01

Disease-resistance genes encoding intracellular nucleotide-binding domain and leucine-rich repeat proteins (NLRs) are key components of the plant innate immune system and typically detect the presence of isolate-specific avirulence (AVR) effectors from pathogens. NLR genes define the fastest-evolving gene family of flowering plants and are often arranged in gene clusters containing multiple paralogs, contributing to copy number and allele-specific NLR variation within a host species. Barley mildew resistance locus a (Mla) has been subject to extensive functional diversification, resulting in allelic resistance specificities each recognizing a cognate, but largely unidentified, AVRa gene of the powdery mildew fungus, Blumeria graminis f. sp. hordei (Bgh). We applied a transcriptome-wide association study among 17 Bgh isolates containing different AVRa genes and identified AVRa1 and AVRa13, encoding candidate-secreted effectors recognized by Mla1 and Mla13 alleles, respectively. Transient expression of the effector genes in barley leaves or protoplasts was sufficient to trigger Mla1 or Mla13 allele-specific cell death, a hallmark of NLR receptor-mediated immunity. AVRa1 and AVRa13 are phylogenetically unrelated, demonstrating that certain allelic MLA receptors evolved to recognize sequence-unrelated effectors. They are ancient effectors because corresponding loci are present in wheat powdery mildew. AVRA1 recognition by barley MLA1 is retained in transgenic Arabidopsis, indicating that AVRA1 directly binds MLA1 or that its recognition involves an evolutionarily conserved host target of AVRA1. Furthermore, analysis of transcriptome-wide sequence variation among the Bgh isolates provides evidence for Bgh population structure that is partially linked to geographic isolation. PMID:27702901

Allelic barley MLA immune receptors recognize sequence-unrelated avirulence effectors of the powdery mildew pathogen.

PubMed

Lu, Xunli; Kracher, Barbara; Saur, Isabel M L; Bauer, Saskia; Ellwood, Simon R; Wise, Roger; Yaeno, Takashi; Maekawa, Takaki; Schulze-Lefert, Paul

2016-10-18

Disease-resistance genes encoding intracellular nucleotide-binding domain and leucine-rich repeat proteins (NLRs) are key components of the plant innate immune system and typically detect the presence of isolate-specific avirulence (AVR) effectors from pathogens. NLR genes define the fastest-evolving gene family of flowering plants and are often arranged in gene clusters containing multiple paralogs, contributing to copy number and allele-specific NLR variation within a host species. Barley mildew resistance locus a (Mla) has been subject to extensive functional diversification, resulting in allelic resistance specificities each recognizing a cognate, but largely unidentified, AVR a gene of the powdery mildew fungus, Blumeria graminis f. sp. hordei (Bgh). We applied a transcriptome-wide association study among 17 Bgh isolates containing different AVR a genes and identified AVR a1 and AVR a13 , encoding candidate-secreted effectors recognized by Mla1 and Mla13 alleles, respectively. Transient expression of the effector genes in barley leaves or protoplasts was sufficient to trigger Mla1 or Mla13 allele-specific cell death, a hallmark of NLR receptor-mediated immunity. AVR a1 and AVR a13 are phylogenetically unrelated, demonstrating that certain allelic MLA receptors evolved to recognize sequence-unrelated effectors. They are ancient effectors because corresponding loci are present in wheat powdery mildew. AVR A1 recognition by barley MLA1 is retained in transgenic Arabidopsis, indicating that AVR A1 directly binds MLA1 or that its recognition involves an evolutionarily conserved host target of AVR A1 Furthermore, analysis of transcriptome-wide sequence variation among the Bgh isolates provides evidence for Bgh population structure that is partially linked to geographic isolation.

Genome-wide identification and characterization of polygalacturonase genes in Cucumis sativus and Citrullus lanatus.

PubMed

Yu, Youjian; Liang, Ying; Lv, Meiling; Wu, Jian; Lu, Gang; Cao, Jiashu

2014-01-01

Polygalacturonase (PG, EC3.2.1.15), one of the hydrolytic enzymes associated with the modification of pectin network in plant cell wall, has an important role in various cell-separation processes that are essential for plant development. PGs are encoded by a large gene family in plants. However, information on this gene family in plant development remains limited. In the present study, 53 and 62 putative members of the PG gene family in cucumber and watermelon genomes, respectively, were identified by genome-wide search to explore the composition, structure, and evolution of the PG family in Cucurbitaceae crops. The results showed that tandem duplication could be an important factor that contributes to the expansion of the PG genes in the two crops. The phylogenetic and evolutionary analyses suggested that PGs could be classified into seven clades, and that the exon/intron structures and intron phases were conserved within but divergent between clades. At least 24 ancestral PGs were detected in the common ancestor of Arabidopsis and Cucumis sativus. Expression profile analysis by quantitative real-time polymerase chain reaction demonstrated that most CsPGs exhibit specific or high expression pattern in one of the organs/tissues. The 16 CsPGs associated with fruit development could be divided into three subsets based on their specific expression patterns and the cis-elements of fruit-specific, endosperm/seed-specific, and ethylene-responsive exhibited in their promoter regions. Our comparative analysis provided some basic information on the PG gene family, which would be valuable for further functional analysis of the PG genes during plant development. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

Biomineralization, life-time of odontogenic cells and differential expression of the two homeobox genes MSX-1 and DLX-2 in transgenic mice.

PubMed

Lézot, F; Thomas, B; Hotton, D; Forest, N; Orestes-Cardoso, S; Robert, B; Sharpe, P; Berdal, A

2000-03-01

Msx and Dlx homeobox genes encode for transcription factors that control early morphogenesis. More specifically, Msx-1, Msx-2, and Dlx-2 homeobox genes contribute to the initial patterning of the dentition. The present study is devoted to the potential role of those homeobox genes during the late formation of mineralized tissues, using the rodent incisor as an experimental system. The continuously erupting mandibular incisor allows (1) the coinvestigation of the whole sequences of amelogenesis and dentinogenesis, aligned along the main dental axis in a single sample in situ and (2) the differential characterization of transcripts generated by epithelial and ectomesenchymal odontogenic cells. Northern blot experiments on microdissected cells showed the continuing expression of Msx-2 and Dlx-2 in the later stages of dental biomineralization, differentially in epithelial and ectomesenchymal compartments. Transgenic mice produced with LacZ reporter constructs for Dlx-2 and Msx-1 were used to detect different components of the gene expression patterns with the sensitive beta-galactosidase histoenzymology. The results show a prominent epithelial involvement of Dlx-2, with stage-specific variations in the cells involved in enamel formation. Quantitative analyses identified specific modulations of Dlx-2 expression in ameloblasts depending on the anatomical sites of the incisor, showing more specifically an inverse linear relationship between the Dlx-2 promoter activity level and enamel thickness. This investigation extends the role of homeoproteins to postmitotic stages, which would control secretory cell activity, in a site-specific manner as shown here for Dlx-2.

Cloning of the cDNA for a human homologue of the Drosophila white gene and mapping to chromosome 21q22.3

DOE Office of Scientific and Technical Information (OSTI.GOV)

Haiming Chen; Lalioti, M.D.; Perrin, G.

1996-07-01

In an effort to contribute to the transcript map of human chromosome 21 and the understanding of the pathophysiology of trisomy 21, we have used exon trapping to identify fragments of chromosome 21 genes. Two trapped exons, from pools of chromosome 21-specific cosmids, showed homology to the Drosophila white (w) gene. We subsequently cloned the corresponding cDNA for a human homologue of the Drosophila w gene (hW) from human retina and fetal brain cDNA libraries. The gene belongs to the ATP-binding cassette transporter gene family and is homologous to Drosophila w (and to 2 genes from other species) and tomore » a lesser extent to Drosophila brown (bw) and scarlet (st) genes that are all involved in the transport of eye pigment precursor molecules. A DNA polymorphism with 62% heterozygosity due to variation of a poly (T) region in the 3{prime} UTR of the hW has been identified and used for the incorporation of this gene to the genetic map of chromosome 21. The hW is located at 21q22.3 between DNA markers D21S212 and D21S49 in a P1 clone that also contains marker BCEI. The gene is expressed at various levels in many human tissues. The contributions of this gene to the Down syndrome phenotypes, to human eye color, and to the resulting phenotypes of null or missense mutations are presently unknown. 56 refs., 8 figs., 1 tab.« less

Evolution of the Insect Desaturase Gene Family with an Emphasis on Social Hymenoptera

PubMed Central

Helmkampf, Martin; Cash, Elizabeth; Gadau, Jürgen

2015-01-01

Desaturase genes are essential for biological processes, including lipid metabolism, cell signaling, and membrane fluidity regulation. Insect desaturases are particularly interesting for their role in chemical communication, and potential contribution to speciation, symbioses, and sociality. Here, we describe the acyl-CoA desaturase gene families of 15 insects, with a focus on social Hymenoptera. Phylogenetic reconstruction revealed that the insect desaturases represent an ancient gene family characterized by eight subfamilies that differ strongly in their degree of conservation and frequency of gene gain and loss. Analyses of genomic organization showed that five of these subfamilies are represented in a highly microsyntenic region conserved across holometabolous insect taxa, indicating an ancestral expansion during early insect evolution. In three subfamilies, ants exhibit particularly large expansions of genes. Despite these expansions, however, selection analyses showed that desaturase genes in all insect lineages are predominantly undergoing strong purifying selection. Finally, for three expanded subfamilies, we show that ants exhibit variation in gene expression between species, and more importantly, between sexes and castes within species. This suggests functional differentiation of these genes and a role in the regulation of reproductive division of labor in ants. The dynamic pattern of gene gain and loss of acyl-CoA desaturases in ants may reflect changes in response to ecological diversification and an increased demand for chemical signal variability. This may provide an example of how gene family expansions can contribute to lineage-specific adaptations through structural and regulatory changes acting in concert to produce new adaptive phenotypes. PMID:25425561

Allele-specific gene expression in a wild nonhuman primate population

PubMed Central

Tung, J.; Akinyi, M. Y.; Mutura, S.; Altmann, J.; Wray, G. A.; Alberts, S. C.

2015-01-01

Natural populations hold enormous potential for evolutionary genetic studies, especially when phenotypic, genetic and environmental data are all available on the same individuals. However, untangling the genotype-phenotype relationship in natural populations remains a major challenge. Here, we describe results of an investigation of one class of phenotype, allele-specific gene expression (ASGE), in the well-studied natural population of baboons of the Amboseli basin, Kenya. ASGE measurements identify cases in which one allele of a gene is overexpressed relative to the alternative allele of the same gene, within individuals, thus providing a control for background genetic and environmental effects. Here, we characterize the incidence of ASGE in the Amboseli baboon population, focusing on the genetic and environmental contributions to ASGE in a set of eleven genes involved in immunity and defence. Within this set, we identify evidence for common ASGE in four genes. We also present examples of two relationships between cis-regulatory genetic variants and the ASGE phenotype. Finally, we identify one case in which this relationship is influenced by a novel gene-environment interaction. Specifically, the dominance rank of an individual’s mother during its early life (an aspect of that individual’s social environment) influences the expression of the gene CCL5 via an interaction with cis-regulatory genetic variation. These results illustrate how environmental and ecological data can be integrated into evolutionary genetic studies of functional variation in natural populations. They also highlight the potential importance of early life environmental variation in shaping the genetic architecture of complex traits in wild mammals. PMID:21226779

Meta-Analysis of Multiple Sclerosis Microarray Data Reveals Dysregulation in RNA Splicing Regulatory Genes.

PubMed

Paraboschi, Elvezia Maria; Cardamone, Giulia; Rimoldi, Valeria; Gemmati, Donato; Spreafico, Marta; Duga, Stefano; Soldà, Giulia; Asselta, Rosanna

2015-09-30

Abnormalities in RNA metabolism and alternative splicing (AS) are emerging as important players in complex disease phenotypes. In particular, accumulating evidence suggests the existence of pathogenic links between multiple sclerosis (MS) and altered AS, including functional studies showing that an imbalance in alternatively-spliced isoforms may contribute to disease etiology. Here, we tested whether the altered expression of AS-related genes represents a MS-specific signature. A comprehensive comparative analysis of gene expression profiles of publicly-available microarray datasets (190 MS cases, 182 controls), followed by gene-ontology enrichment analysis, highlighted a significant enrichment for differentially-expressed genes involved in RNA metabolism/AS. In detail, a total of 17 genes were found to be differentially expressed in MS in multiple datasets, with CELF1 being dysregulated in five out of seven studies. We confirmed CELF1 downregulation in MS (p=0.0015) by real-time RT-PCRs on RNA extracted from blood cells of 30 cases and 30 controls. As a proof of concept, we experimentally verified the unbalance in alternatively-spliced isoforms in MS of the NFAT5 gene, a putative CELF1 target. In conclusion, for the first time we provide evidence of a consistent dysregulation of splicing-related genes in MS and we discuss its possible implications in modulating specific AS events in MS susceptibility genes.

The human lexinome: Genes of language and reading

PubMed Central

Gibson, Christopher J.; Gruen, Jeffrey R.

2008-01-01

Within the human genome, genetic mapping studies have identified ten regions of different chromosomes, known as DYX loci, in genetic linkage with dyslexia, and two, known as SLI loci, in genetic linkage with Specific Language Impairment. Further genetic studies have identified four dyslexia genes within the DYX loci: DYX1C1 on 15q, KIAA0319 and DCDC2 on 6p22, and ROBO1on 13q. FOXP2 on 7q has been implicated in the development of Speech-Language Disorder. No genes for Specific Language impairment have yet been identified within the two SLI loci. Functional studies have shown that all four dyslexia genes play roles in brain development, and ongoing molecular studies are attempting to elucidate how these genes exert their effects at a subcellular level. Taken together, these genes and loci likely represent only a fraction of the human lexinome, a term we introduce here to refer to the collection of all the genetic and protein elements involved in the development of human language, expression, and reading. Learning outcomes The reader will become familiar with (i) methods for identifying genes for complex diseases, (ii) the application of these methods in the elucidation of genes underlying disorders of language and reading, and (iii) the cellular pathways through which polymorphisms in these genes may contribute to the development of the disorders. PMID:18466916

Genome-wide classification, evolutionary analysis and gene expression patterns of the kinome in Gossypium

PubMed Central

Yan, Jun; Li, Guilin; Guo, Xingqi; Li, Yang; Cao, Xuecheng

2018-01-01

The protein kinase (PK, kinome) family is one of the largest families in plants and regulates almost all aspects of plant processes, including plant development and stress responses. Despite their important functions, comprehensive functional classification, evolutionary analysis and expression patterns of the cotton PK gene family has yet to be performed on PK genes. In this study, we identified the cotton kinomes in the Gossypium raimondii, Gossypium arboretum, Gossypium hirsutum and Gossypium barbadense genomes and classified them into 7 groups and 122–24 subfamilies using software HMMER v3.0 scanning and neighbor-joining (NJ) phylogenetic analysis. Some conserved exon-intron structures were identified not only in cotton species but also in primitive plants, ferns and moss, suggesting the significant function and ancient origination of these PK genes. Collinearity analysis revealed that 16.6 million years ago (Mya) cotton-specific whole genome duplication (WGD) events may have played a partial role in the expansion of the cotton kinomes, whereas tandem duplication (TD) events mainly contributed to the expansion of the cotton RLK group. Synteny analysis revealed that tetraploidization of G. hirsutum and G. barbadense contributed to the expansion of G. hirsutum and G. barbadense PKs. Global expression analysis of cotton PKs revealed stress-specific and fiber development-related expression patterns, suggesting that many cotton PKs might be involved in the regulation of the stress response and fiber development processes. This study provides foundational information for further studies on the evolution and molecular function of cotton PKs. PMID:29768506

Identification of a specific intronic PEAR1 gene variant associated with greater platelet aggregability and protein expression

PubMed Central

Yanek, Lisa R.; Yang, Xiao Ping; Mathias, Rasika; Herrera-Galeano, J. Enrique; Suktitipat, Bhoom; Qayyum, Rehan; Johnson, Andrew D.; Chen, Ming-Huei; Tofler, Geoffrey H.; Ruczinski, Ingo; Friedman, Alan D.; Gylfason, Arnaldur; Thorsteinsdottir, Unnur; Bray, Paul F.; O'Donnell, Christopher J.; Becker, Diane M.; Becker, Lewis C.

2011-01-01

Genetic variation is thought to contribute to variability in platelet function; however, the specific variants and mechanisms that contribute to altered platelet function are poorly defined. With the use of a combination of fine mapping and sequencing of the platelet endothelial aggregation receptor 1 (PEAR1) gene we identified a common variant (rs12041331) in intron 1 that accounts for ≤ 15% of total phenotypic variation in platelet function. Association findings were robust in 1241 persons of European ancestry (P = 2.22 × 10−8) and were replicated down to the variant and nucleotide level in 835 persons of African ancestry (P = 2.31 × 10−27) and in an independent sample of 2755 persons of European descent (P = 1.64 × 10−5). Sequencing confirmed that variation at rs12041331 accounted most strongly (P = 2.07 × 10−6) for the relation between the PEAR1 gene and platelet function phenotype. A dose-response relation between the number of G alleles at rs12041331 and expression of PEAR1 protein in human platelets was confirmed by Western blotting and ELISA. Similarly, the G allele was associated with greater protein expression in a luciferase reporter assay. These experiments identify the precise genetic variant in PEAR1 associated with altered platelet function and provide a plausible biologic mechanism to explain the association between variation in the PEAR1 gene and platelet function phenotype. PMID:21791418

The involvement of serotonin polymorphisms in autistic spectrum symptomatology.

PubMed

Hervás, Amaia; Toma, Claudio; Romarís, Patricia; Ribasés, Marta; Salgado, Marta; Bayes, Mònica; Balmaña, Noemí; Cormand, Bru; Maristany, Marta; Guijarro, Silvina; Arranz, María J

2014-08-01

Autism spectrum disorders (ASD) are highly inherited developmental syndromes, resulting from a complex interaction between environmental and genetic factors. To date, only a limited number of genetic variants have been discovered with respect to autism, and their contribution to the development of the disorder has not been clearly determined. Investigation of specific autistic symptomatology may improve the chances of identifying related genes and may help to better understand these disorders. We investigated the contribution of 80 genetic variants in 15 serotonin genes to ASD phenotypes [intelligence quotation (IQ), intellectual disability (ID) and language onset delay (LD)] in a cohort of 141 children and young adults (121 male patients and 20 female patients, average age 14.5±5.1 years). Two polymorphisms in the HTR2B gene, rs10194776 and rs16827801, were associated with IQ (P=0.0004 and 0.003, respectively), ID (P=0.02 and 0.03) and LD (P=0.04 and 0.004). Nominal associations were also detected between the ASD phenotypes investigated and 5-HT2A, 5-HT4 and 5-HT6 genetic variants. Our study provides evidence of the contribution of serotonergic variants to IQ, ID and LD in ASD patients.

Variable promoter methylation contributes to differential expression of key genes in human placenta-derived venous and arterial endothelial cells.

PubMed

Joo, Jihoon E; Hiden, Ursula; Lassance, Luciana; Gordon, Lavinia; Martino, David J; Desoye, Gernot; Saffery, Richard

2013-07-15

The endothelial compartment, comprising arterial, venous and lymphatic cell types, is established prenatally in association with rapid phenotypic and functional changes. The molecular mechanisms underpinning this process in utero have yet to be fully elucidated. The aim of this study was to investigate the potential for DNA methylation to act as a driver of the specific gene expression profiles of arterial and venous endothelial cells. Placenta-derived venous and arterial endothelial cells were collected at birth prior to culturing. DNA methylation was measured at >450,000 CpG sites in parallel with expression measurements taken from 25,000 annotated genes. A consistent set of genomic loci was found to show coordinate differential methylation between the arterial and venous cell types. This included many loci previously not investigated in relation to endothelial function. An inverse relationship was observed between gene expression and promoter methylation levels for a limited subset of genes implicated in endothelial function, including NOS3, encoding endothelial Nitric Oxide Synthase. Endothelial cells derived from the placental vasculature at birth contain widespread methylation of key regulatory genes. These are candidates involved in the specification of different endothelial cell types and represent potential target genes for environmentally mediated epigenetic disruption in utero in association with cardiovascular disease risk later in life.

A transcriptome multi-tissue analysis identifies biological pathways and genes associated with variations in feed efficiency of growing pigs.

PubMed

Gondret, Florence; Vincent, Annie; Houée-Bigot, Magalie; Siegel, Anne; Lagarrigue, Sandrine; Causeur, David; Gilbert, Hélène; Louveau, Isabelle

2017-03-21

Animal's efficiency in converting feed into lean gain is a critical issue for the profitability of meat industries. This study aimed to describe shared and specific molecular responses in different tissues of pigs divergently selected over eight generations for residual feed intake (RFI). Pigs from the low RFI line had an improved gain-to-feed ratio during the test period and displayed higher leanness but similar adiposity when compared with pigs from the high RFI line at 132 days of age. Transcriptomics data were generated from longissimus muscle, liver and two adipose tissues using a porcine microarray and analyzed for the line effect (n = 24 pigs per line). The most apparent effect of the line was seen in muscle, whereas subcutaneous adipose tissue was the less affected tissue. Molecular data were analyzed by bioinformatics and subjected to multidimensional statistics to identify common biological processes across tissues and key genes participating to differences in the genetics of feed efficiency. Immune response, response to oxidative stress and protein metabolism were the main biological pathways shared by the four tissues that distinguished pigs from the low or high RFI lines. Many immune genes were under-expressed in the four tissues of the most efficient pigs. The main genes contributing to difference between pigs from the low vs high RFI lines were CD40, CTSC and NTN1. Different genes associated with energy use were modulated in a tissue-specific manner between the two lines. The gene expression program related to glycogen utilization was specifically up-regulated in muscle of pigs from the low RFI line (more efficient). Genes involved in fatty acid oxidation were down-regulated in muscle but were promoted in adipose tissues of the same pigs when compared with pigs from the high RFI line (less efficient). This underlined opposite line-associated strategies for energy use in skeletal muscle and adipose tissue. Genes related to cholesterol synthesis and efflux in liver and perirenal fat were also differentially regulated in pigs from the low vs high RFI lines. Non-productive functions such as immunity, defense against pathogens and oxidative stress contribute likely to inter-individual variations in feed efficiency.

Pathobiology and genetics of neural tube defects.

PubMed

Finnell, Richard H; Gould, Amy; Spiegelstein, Ofer

2003-01-01

Neural tube defects (NTDs), including spina bifida and anencephaly, are common congenital malformations that occur when the neural tube fails to achieve proper closure during early embryogenesis. Based on epidemiological and clinical data obtained over the last few decades, it is apparent that these multifactorial defects have a significant genetic component to their etiology that interacts with specific environmental risk factors. The purpose of this review article is to synthesize the existing literature on the genetic factors contributing to NTD risk. To date, there is evidence that closure of the mammalian neural tube initiates and fuses intermittently at four discrete locations. Disruption of this process at any of these four sites may lead to an NTD, possibly arising through closure site-specific genetic mechanisms. Candidate genes involved in neural tube closure include genes of the folate metabolic pathway, as well as those involved in folate transport. Although extensive efforts have focused on elucidating the genetic risk factors contributing to the etiology of NTDs, the population burden for these malformations remains unknown. One group at high risk for having children with NTDs is epileptic women receiving antiepileptic medications during pregnancy. Efforts to better understand the genetic factors that may contribute to their heightened risk, as well as the pathogenesis of neural tube closure defects, are reviewed herein.

Stenotrophomonas-Like Bacteria Are Widespread Symbionts in Cone Snail Venom Ducts.

PubMed

Torres, Joshua P; Tianero, Maria Diarey; Robes, Jose Miguel D; Kwan, Jason C; Biggs, Jason S; Concepcion, Gisela P; Olivera, Baldomero M; Haygood, Margo G; Schmidt, Eric W

2017-12-01

Cone snails are biomedically important sources of peptide drugs, but it is not known whether snail-associated bacteria affect venom chemistry. To begin to answer this question, we performed 16S rRNA gene amplicon sequencing of eight cone snail species, comparing their microbiomes with each other and with those from a variety of other marine invertebrates. We show that the cone snail microbiome is distinct from those in other marine invertebrates and conserved in specimens from around the world, including the Philippines, Guam, California, and Florida. We found that all venom ducts examined contain diverse 16S rRNA gene sequences bearing closest similarity to Stenotrophomonas bacteria. These sequences represent specific symbionts that live in the lumen of the venom duct, where bioactive venom peptides are synthesized. IMPORTANCE In animals, symbiotic bacteria contribute critically to metabolism. Cone snails are renowned for the production of venoms that are used as medicines and as probes for biological study. In principle, symbiotic bacterial metabolism could either degrade or synthesize active venom components, and previous publications show that bacteria do indeed contribute small molecules to some venoms. Therefore, understanding symbiosis in cone snails will contribute to further drug discovery efforts. Here, we describe an unexpected, specific symbiosis between bacteria and cone snails from around the world. Copyright © 2017 American Society for Microbiology.

Sequence and expression variations suggest an adaptive role for the DA1-like gene family in the evolution of soybeans.

PubMed

Zhao, Man; Gu, Yongzhe; He, Lingli; Chen, Qingshan; He, Chaoying

2015-05-15

The DA1 gene family is plant-specific and Arabidopsis DA1 regulates seed and organ size, but the functions in soybeans are unknown. The cultivated soybean (Glycine max) is believed to be domesticated from the annual wild soybeans (Glycine soja). To evaluate whether DA1-like genes were involved in the evolution of soybeans, we compared variation at both sequence and expression levels of DA1-like genes from G. max (GmaDA1) and G. soja (GsoDA1). Sequence identities were extremely high between the orthologous pairs between soybeans, while the paralogous copies in a soybean species showed a relatively high divergence. Moreover, the expression variation of DA1-like paralogous genes in soybean was much greater than the orthologous gene pairs between the wild and cultivated soybeans during development and challenging abiotic stresses such as salinity. We further found that overexpressing GsoDA1 genes did not affect seed size. Nevertheless, overexpressing them reduced transgenic Arabidopsis seed germination sensitivity to salt stress. Moreover, most of these genes could improve salt tolerance of the transgenic Arabidopsis plants, corroborated by a detection of expression variation of several key genes in the salt-tolerance pathways. Our work suggested that expression diversification of DA1-like genes is functionally associated with adaptive radiation of soybeans, reinforcing that the plant-specific DA1 gene family might have contributed to the successful adaption to complex environments and radiation of the plants.

Genetics and molecular mapping of genes for race-specific all-stage resistance and non-race-specific high-temperature adult-plant resistance to stripe rust in spring wheat cultivar Alpowa.

PubMed

Lin, F; Chen, X M

2007-05-01

Stripe rust, caused by Puccinia striiformis f. sp. tritici, is one of the most widespread and destructive wheat diseases worldwide. Growing resistant cultivars is the preferred control of the disease. The spring wheat cultivar 'Alpowa' has both race-specific, all-stage resistance and non-race-specific, high-temperature adult-plant (HTAP) resistances to stripe rust. To identify genes for the stripe rust resistances, Alpowa was crossed with 'Avocet Susceptible' (AVS). Seedlings of the parents, and F(1), F(2) and F(3) progeny were tested with races PST-1 and PST-21 of P. striiformis f. sp. tritici under controlled greenhouse conditions. Alpowa has a single partially dominant gene, designated as YrAlp, conferring all-stage resistance. Resistance gene analog polymorphism (RGAP) and simple sequence repeat (SSR) techniques were used to identify molecular markers linked to YrAlp. A linkage group of five RGAP markers and two SSR markers was constructed for YrAlp using 136 F(3) lines. Amplification of a set of nulli-tetrasomic Chinese Spring lines with RGAP markers Xwgp47 and Xwgp48 and the two SSR markers indicated that YrAlp is located on the short arm of chromosome 1B. To map quantitative trait loci (QTLs) for the non-race-specific HTAP resistance, the parents and 136 F(3) lines were tested at two sites near Pullman and one site near Mount Vernon, Washington, under naturally infected conditions. A major HTAP QTL was consistently detected across environments and was located on chromosome 7BL. Because of its chromosomal location and the non-race-specific nature of the HTAP resistance, this gene is different from previously described genes for adult-plant resistance, and is therefore designated Yr39. The gene contributed to 64.2% of the total variation of relative area under disease progress curve (AUDPC) data and 59.1% of the total variation of infection type data recorded at the heading-flowering stages. Two RGAP markers, Xwgp36 and Xwgp45 with the highest R (2) values were closely linked to Yr39, should be useful for incorporation of the non-race-specific resistance gene into new cultivars and for combining Yr39 with other genes for durable and high-level resistance.

Genomic Analysis Reveals Contrasting PIFq Contribution to Diurnal Rhythmic Gene Expression in PIF-Induced and -Repressed Genes.

PubMed

Martin, Guiomar; Soy, Judit; Monte, Elena

2016-01-01

Members of the PIF quartet (PIFq; PIF1, PIF3, PIF4, and PIF5) collectively contribute to induce growth in Arabidopsis seedlings under short day (SD) conditions, specifically promoting elongation at dawn. Their action involves the direct regulation of growth-related and hormone-associated genes. However, a comprehensive definition of the PIFq-regulated transcriptome under SD is still lacking. We have recently shown that SD and free-running (LL) conditions correspond to "growth" and "no growth" conditions, respectively, correlating with greater abundance of PIF protein in SD. Here, we present a genomic analysis whereby we first define SD-regulated genes at dawn compared to LL in the wild type, followed by identification of those SD-regulated genes whose expression depends on the presence of PIFq. By using this sequential strategy, we have identified 349 PIF/SD-regulated genes, approximately 55% induced and 42% repressed by both SD and PIFq. Comparison with available databases indicates that PIF/SD-induced and PIF/SD-repressed sets are differently phased at dawn and mid-morning, respectively. In addition, we found that whereas rhythmicity of the PIF/SD-induced gene set is lost in LL, most PIF/SD-repressed genes keep their rhythmicity in LL, suggesting differential regulation of both gene sets by the circadian clock. Moreover, we also uncovered distinct overrepresented functions in the induced and repressed gene sets, in accord with previous studies in other examined PIF-regulated processes. Interestingly, promoter analyses showed that, whereas PIF/SD-induced genes are enriched in direct PIF targets, PIF/SD-repressed genes are mostly indirectly regulated by the PIFs and might be more enriched in ABA-regulated genes.

Cardiac CaM Kinase II genes δ and γ contribute to adverse remodeling but redundantly inhibit calcineurin-induced myocardial hypertrophy.

PubMed

Kreusser, Michael M; Lehmann, Lorenz H; Keranov, Stanislav; Hoting, Marc-Oscar; Oehl, Ulrike; Kohlhaas, Michael; Reil, Jan-Christian; Neumann, Kay; Schneider, Michael D; Hill, Joseph A; Dobrev, Dobromir; Maack, Christoph; Maier, Lars S; Gröne, Hermann-Josef; Katus, Hugo A; Olson, Eric N; Backs, Johannes

2014-10-07

Ca(2+)-dependent signaling through CaM Kinase II (CaMKII) and calcineurin was suggested to contribute to adverse cardiac remodeling. However, the relative importance of CaMKII versus calcineurin for adverse cardiac remodeling remained unclear. We generated double-knockout mice (DKO) lacking the 2 cardiac CaMKII genes δ and γ specifically in cardiomyocytes. We show that both CaMKII isoforms contribute redundantly to phosphorylation not only of phospholamban, ryanodine receptor 2, and histone deacetylase 4, but also calcineurin. Under baseline conditions, DKO mice are viable and display neither abnormal Ca(2+) handling nor functional and structural changes. On pathological pressure overload and β-adrenergic stimulation, DKO mice are protected against cardiac dysfunction and interstitial fibrosis. But surprisingly and paradoxically, DKO mice develop cardiac hypertrophy driven by excessive activation of endogenous calcineurin, which is associated with a lack of phosphorylation at the auto-inhibitory calcineurin A site Ser411. Likewise, calcineurin inhibition prevents cardiac hypertrophy in DKO. On exercise performance, DKO mice show an exaggeration of cardiac hypertrophy with increased expression of the calcineurin target gene RCAN1-4 but no signs of adverse cardiac remodeling. We established a mouse model in which CaMKII's activity is specifically and completely abolished. By the use of this model we show that CaMKII induces maladaptive cardiac remodeling while it inhibits calcineurin-dependent hypertrophy. These data suggest inhibition of CaMKII but not calcineurin as a promising approach to attenuate the progression of heart failure. © 2014 American Heart Association, Inc.

Developmental Regulation of an Adhesin Gene during Cellular Morphogenesis in the Fungal Pathogen Candida albicans▿ †

PubMed Central

Argimón, Silvia; Wishart, Jill A.; Leng, Roger; Macaskill, Susan; Mavor, Abigail; Alexandris, Thomas; Nicholls, Susan; Knight, Andrew W.; Enjalbert, Brice; Walmsley, Richard; Odds, Frank C.; Gow, Neil A. R.; Brown, Alistair J. P.

2007-01-01

Candida albicans expresses specific virulence traits that promote disease establishment and progression. These traits include morphological transitions between yeast and hyphal growth forms that are thought to contribute to dissemination and invasion and cell surface adhesins that promote attachment to the host. Here, we describe the regulation of the adhesin gene ALS3, which is expressed specifically during hyphal development in C. albicans. Using a combination of reporter constructs and regulatory mutants, we show that this regulation is mediated by multiple factors at the transcriptional level. The analysis of ALS3 promoter deletions revealed that this promoter contains two activation regions: one is essential for activation during hyphal development, while the second increases the amplitude of this activation. Further deletion analyses using the Renilla reniformis luciferase reporter delineate the essential activation region between positions −471 and −321 of the promoter. Further 5′ or 3′ deletions block activation. ALS3 transcription is repressed mainly by Nrg1 and Tup1, but Rfg1 contributes to this repression. Efg1, Tec1, and Bcr1 are essential for the transcriptional activation of ALS3, with Tec1 mediating its effects indirectly through Bcr1 rather than through the putative Tec1 sites in the ALS3 promoter. ALS3 transcription is not affected by Cph2, but Cph1 contributes to full ALS3 activation. The data suggest that multiple morphogenetic signaling pathways operate through the promoter of this adhesin gene to mediate its developmental regulation in this major fungal pathogen. PMID:17277173

Genome-wide identification and analysis of the SBP-box family genes in apple (Malus × domestica Borkh.).

PubMed

Li, Jun; Hou, Hongmin; Li, Xiaoqin; Xiang, Jiang; Yin, Xiangjing; Gao, Hua; Zheng, Yi; Bassett, Carole L; Wang, Xiping

2013-09-01

SQUAMOSA promoter binding protein (SBP)-box genes encode a family of plant-specific transcription factors and play many crucial roles in plant development. In this study, 27 SBP-box gene family members were identified in the apple (Malus × domestica Borkh.) genome, 15 of which were suggested to be putative targets of MdmiR156. Plant SBPs were classified into eight groups according to the phylogenetic analysis of SBP-domain proteins. Gene structure, gene chromosomal location and synteny analyses of MdSBP genes within the apple genome demonstrated that tandem and segmental duplications, as well as whole genome duplications, have likely contributed to the expansion and evolution of the SBP-box gene family in apple. Additionally, synteny analysis between apple and Arabidopsis indicated that several paired homologs of MdSBP and AtSPL genes were located in syntenic genomic regions. Tissue-specific expression analysis of MdSBP genes in apple demonstrated their diversified spatiotemporal expression patterns. Most MdmiR156-targeted MdSBP genes, which had relatively high transcript levels in stems, leaves, apical buds and some floral organs, exhibited a more differential expression pattern than most MdmiR156-nontargeted MdSBP genes. Finally, expression analysis of MdSBP genes in leaves upon various plant hormone treatments showed that many MdSBP genes were responsive to different plant hormones, indicating that MdSBP genes may be involved in responses to hormone signaling during stress or in apple development. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

Intramuscular injection of AAV8 in mice and macaques is associated with substantial hepatic targeting and transgene expression.

PubMed

Greig, Jenny A; Peng, Hui; Ohlstein, Jason; Medina-Jaszek, C Angelica; Ahonkhai, Omua; Mentzinger, Anne; Grant, Rebecca L; Roy, Soumitra; Chen, Shu-Jen; Bell, Peter; Tretiakova, Anna P; Wilson, James M

2014-01-01

Intramuscular (IM) administration of adeno-associated viral (AAV) vectors has entered the early stages of clinical development with some success, including the first approved gene therapy product in the West called Glybera. In preparation for broader clinical development of IM AAV vector gene therapy, we conducted detailed pre-clinical studies in mice and macaques evaluating aspects of delivery that could affect performance. We found that following IM administration of AAV8 vectors in mice, a portion of the vector reached the liver and hepatic gene expression contributed significantly to total expression of secreted transgenes. The contribution from liver could be controlled by altering injection volume and by the use of traditional (promoter) and non-traditional (tissue-specific microRNA target sites) expression control elements. Hepatic distribution of vector following IM injection was also noted in rhesus macaques. These pre-clinical data on AAV delivery should inform safe and efficient development of future AAV products.

Male gametophyte development in bread wheat (Triticum aestivum L.): molecular, cellular, and biochemical analyses of a sporophytic contribution to pollen wall ontogeny.

PubMed

Wang, Aiming; Xia, Qun; Xie, Wenshuang; Dumonceaux, Tim; Zou, Jitao; Datla, Raju; Selvaraj, Gopalan

2002-06-01

Bread wheat (hexaploid AABBDD genome; 16 billion basepairs) is a genetically complex, self-pollinating plant with bisexual flowers that produce short-lived pollen. Very little is known about the molecular biology of its gametophyte development despite a longstanding interest in hybrid seeds. We present here a comprehensive characterization of three apparently homeologous genes (TAA1a, TAA1b and TAA1c) and demonstrate their anther-specific biochemical function. These eight-exon genes, found at only one copy per haploid complement in this large genome, express specifically within the sporophytic tapetum cells. The presence of TAA1 mRNA and protein was evident only at specific stages of pollen development as the microspore wall thickened during the progression of free microspores into vacuolated-microspores. This temporal regulation matched the assembly of wall-impregnated sporopollenin, a phenylpropanoid-lipid polymer containing very long chain fatty alcohols (VLCFAlc), described in the literature. Our results establish that sporophytic genes contribute to the production of fatty alcohols: Transgenic expression of TAA1 afforded production of long/VLCFAlc in tobacco seeds (18 : 1; 20 : 1; 22 : 1; 24 : 0; 26 : 0) and in Escherichia coli (14 : 0; 16 : 0; 18 : 1), suggesting biochemical versatility of TAA1 with respect to cellular milieu and substrate spectrum. Pollen walls additionally contain fatty alcohols in the form of wax esters and other lipids, and some of these lipids are known to play a role in the highly specific sexual interactions at the pollen-pistil interface. This study provides a handle to study these and to manipulate pollen traits, and, furthermore, to understand the molecular biology of fatty alcohol metabolism in general.

Homoeolog-specific activation of genes for heat acclimation in the allopolyploid grass Brachypodium hybridum.

PubMed

Takahagi, Kotaro; Inoue, Komaki; Shimizu, Minami; Uehara-Yamaguchi, Yukiko; Onda, Yoshihiko; Mochida, Keiichi

2018-04-01

Allopolyploid plants often show wider environmental tolerances than their ancestors; this is expected to be due to the merger of multiple distinct genomes with a fixed heterozygosity. The complex homoeologous gene expression could have been evolutionarily advantageous for the adaptation of allopolyploid plants. Despite multiple previous studies reporting homoeolog-specific gene expression in allopolyploid species, there are no clear examples of homoeolog-specific function in acclimation to a long-term stress condition. We found that the allopolyploid grass Brachypodium hybridum and its ancestor Brachypodium stacei show long-term heat stress tolerance, unlike its other ancestor, Brachypodium distachyon. To understand the physiological traits of B. hybridum, we compared the transcriptome of the 3 Brachypodium species grown under normal and heat stress conditions. We found that the expression patterns of approximately 26% and approximately 38% of the homoeolog groups in B. hybridum changed toward nonadditive expression and nonancestral expression, respectively, under normal condition. Moreover, we found that B. distachyon showed similar expression patterns between normal and heat stress conditions, whereas B. hybridum and B. stacei significantly altered their transcriptome in response to heat after 3 days of stress exposure, and homoeologs that were inherited from B. stacei may have contributed to the transcriptional stress response to heat in B. hybridum. After 15 days of heat exposure, B. hybridum and B. stacei maintained transcriptional states similar to those under normal conditions. These results suggest that an earlier response to heat that was specific to homoeologs originating from B. stacei contributed to cellular homeostasis under long-term heat stress in B. hybridum. Our results provide insights into different regulatory events of the homoeo-transcriptome that are associated with stress acclimation in allopolyploid plants.

Recombinant Rp1 genes confer necrotic or nonspecific resistance phenotypes.

PubMed

Smith, Shavannor M; Steinau, Martin; Trick, Harold N; Hulbert, Scot H

2010-06-01

Genes at the Rp1 rust resistance locus of maize confer race-specific resistance to the common rust fungus Puccinia sorghi. Three variant genes with nonspecific effects (HRp1 -Kr1N, -D*21 and -MD*19) were found to be generated by intragenic crossing over within the LRR region. The LRR region of most NBS-LRR encoding genes is quite variable and codes for one of the regions in resistance gene proteins that controls specificity. Sequence comparisons demonstrated that the Rp1-Kr1N recombinant gene was identical to the N-terminus of the rp1-kp2 gene and C-terminus of another gene from its HRp1-K grandparent. The Rp1-D*21 recombinant gene consists of the N-terminus of the rp1-dp2 gene and C-terminus of the Rp1-D gene from the parental haplotype. Similarly, a recombinant gene from the Rp1-MD*19 haplotype has the N-terminus of an rp1 gene from the HRp1-M parent and C-terminus of the rp1-D19 gene from the HRp1-D parent. The recombinant Rp1 -Kr1N, -D*21 and -MD*19 genes activated defense responses in the absence of their AVR proteins triggering HR (hypersensitive response) in the absence of the pathogen. The results indicate that the frequent intragenic recombination events that occur in the Rp1 gene cluster not only recombine the genes into novel haplotypes, but also create genes with nonspecific effects. Some of these may contribute to nonspecific quantitative resistance but others have severe consequences for the fitness of the plant.

MCScanX: a toolkit for detection and evolutionary analysis of gene synteny and collinearity

PubMed Central

Wang, Yupeng; Tang, Haibao; DeBarry, Jeremy D.; Tan, Xu; Li, Jingping; Wang, Xiyin; Lee, Tae-ho; Jin, Huizhe; Marler, Barry; Guo, Hui; Kissinger, Jessica C.; Paterson, Andrew H.

2012-01-01

MCScan is an algorithm able to scan multiple genomes or subgenomes in order to identify putative homologous chromosomal regions, and align these regions using genes as anchors. The MCScanX toolkit implements an adjusted MCScan algorithm for detection of synteny and collinearity that extends the original software by incorporating 14 utility programs for visualization of results and additional downstream analyses. Applications of MCScanX to several sequenced plant genomes and gene families are shown as examples. MCScanX can be used to effectively analyze chromosome structural changes, and reveal the history of gene family expansions that might contribute to the adaptation of lineages and taxa. An integrated view of various modes of gene duplication can supplement the traditional gene tree analysis in specific families. The source code and documentation of MCScanX are freely available at http://chibba.pgml.uga.edu/mcscan2/. PMID:22217600

Retinal determination genes coordinate neuroepithelial specification and neurogenesis modes in the Drosophila optic lobe

PubMed Central

Apitz, Holger

2016-01-01

Differences in neuroepithelial patterning and neurogenesis modes contribute to area-specific diversifications of neural circuits. In the Drosophila visual system, two neuroepithelia, the outer (OPC) and inner (IPC) proliferation centers, generate neuron subtypes for four ganglia in several ways. Whereas neuroepithelial cells in the medial OPC directly convert into neuroblasts, in an IPC subdomain they generate migratory progenitors by epithelial-mesenchymal transition that mature into neuroblasts in a second proliferative zone. The molecular mechanisms that regulate the identity of these neuroepithelia, including their neurogenesis modes, remain poorly understood. Analysis of Polycomblike revealed that loss of Polycomb group-mediated repression of the Hox gene Abdominal-B (Abd-B) caused the transformation of OPC to IPC neuroepithelial identity. This suggests that the neuroepithelial default state is IPC-like, whereas OPC identity is derived. Ectopic Abd-B blocks expression of the highly conserved retinal determination gene network members Eyes absent (Eya), Sine oculis (So) and Homothorax (Hth). These factors are essential for OPC specification and neurogenesis control. Finally, eya and so are also sufficient to confer OPC-like identity, and, in parallel with hth, the OPC-specific neurogenesis mode on the IPC. PMID:27381228

Framework for reanalysis of publicly available Affymetrix® GeneChip® data sets based on functional regions of interest.

PubMed

Saka, Ernur; Harrison, Benjamin J; West, Kirk; Petruska, Jeffrey C; Rouchka, Eric C

2017-12-06

Since the introduction of microarrays in 1995, researchers world-wide have used both commercial and custom-designed microarrays for understanding differential expression of transcribed genes. Public databases such as ArrayExpress and the Gene Expression Omnibus (GEO) have made millions of samples readily available. One main drawback to microarray data analysis involves the selection of probes to represent a specific transcript of interest, particularly in light of the fact that transcript-specific knowledge (notably alternative splicing) is dynamic in nature. We therefore developed a framework for reannotating and reassigning probe groups for Affymetrix® GeneChip® technology based on functional regions of interest. This framework addresses three issues of Affymetrix® GeneChip® data analyses: removing nonspecific probes, updating probe target mapping based on the latest genome knowledge and grouping probes into gene, transcript and region-based (UTR, individual exon, CDS) probe sets. Updated gene and transcript probe sets provide more specific analysis results based on current genomic and transcriptomic knowledge. The framework selects unique probes, aligns them to gene annotations and generates a custom Chip Description File (CDF). The analysis reveals only 87% of the Affymetrix® GeneChip® HG-U133 Plus 2 probes uniquely align to the current hg38 human assembly without mismatches. We also tested new mappings on the publicly available data series using rat and human data from GSE48611 and GSE72551 obtained from GEO, and illustrate that functional grouping allows for the subtle detection of regions of interest likely to have phenotypical consequences. Through reanalysis of the publicly available data series GSE48611 and GSE72551, we profiled the contribution of UTR and CDS regions to the gene expression levels globally. The comparison between region and gene based results indicated that the detected expressed genes by gene-based and region-based CDFs show high consistency and regions based results allows us to detection of changes in transcript formation.

The expanding universe of p53 targets.

PubMed

Menendez, Daniel; Inga, Alberto; Resnick, Michael A

2009-10-01

The p53 tumour suppressor is modified through mutation or changes in expression in most cancers, leading to the altered regulation of hundreds of genes that are directly influenced by this sequence-specific transcription factor. Central to the p53 master regulatory network are the target response element (RE) sequences. The extent of p53 transactivation and transcriptional repression is influenced by many factors, including p53 levels, cofactors and the specific RE sequences, all of which contribute to the role that p53 has in the aetiology of cancer. This Review describes the identification and functionality of REs and highlights the inclusion of non-canonical REs that expand the universe of genes and regulation mechanisms in the p53 tumour suppressor network.

Analysis of RNA-Seq datasets reveals enrichment of tissue-specific splice variants for nuclear envelope proteins.

PubMed

Capitanchik, Charlotte; Dixon, Charles; Swanson, Selene K; Florens, Laurence; Kerr, Alastair R W; Schirmer, Eric C

2018-06-18

Nuclear envelopathies/laminopathies yield tissue-specific pathologies, yet arise from mutation of ubiquitously-expressed genes. One possible explanation of this tissue specificity is that tissue-specific partners become disrupted from larger complexes, but a little investigated alternate hypothesis is that the mutated proteins themselves have tissue-specific splice variants. Here, we analyze RNA-Seq datasets to identify muscle-specific splice variants of nuclear envelope genes that could be relevant to the study of laminopathies, particularly muscular dystrophies, that are not currently annotated in sequence databases. Notably, we found novel isoforms or tissue-specificity of isoforms for: Lap2, linked to cardiomyopathy; Nesprin 2, linked to Emery-Dreifuss muscular dystrophy and Lmo7, a regulator of the emerin gene that is linked to Emery-Dreifuss muscular dystrophy. Interestingly, the muscle-specific exon in Lmo7 is rich in serine phosphorylation motifs, suggesting an important regulatory function. Evidence for muscle-specific splice variants in non-nuclear envelope proteins linked to other muscular dystrophies was also found. Tissue-specific variants were also indicated for several nucleoporins including Nup54, Nup133, Nup153 and Nup358/RanBP2. We confirmed expression of novel Lmo7 and RanBP2 variants with RT-PCR and found that specific knockdown of the Lmo7 variant caused a reduction in myogenic index during mouse C2C12 myogenesis. Global analysis revealed an enrichment of tissue-specific splice variants for nuclear envelope proteins in general compared to the rest of the genome, suggesting that splice variants contribute to regulating its tissue-specific functions.

Comparative genomic analysis identified a mutation related to enhanced heterologous protein production in the filamentous fungus Aspergillus oryzae.

PubMed

Jin, Feng-Jie; Katayama, Takuya; Maruyama, Jun-Ichi; Kitamoto, Katsuhiko

2016-11-01

Genomic mapping of mutations using next-generation sequencing technologies has facilitated the identification of genes contributing to fundamental biological processes, including human diseases. However, few studies have used this approach to identify mutations contributing to heterologous protein production in industrial strains of filamentous fungi, such as Aspergillus oryzae. In a screening of A. oryzae strains that hyper-produce human lysozyme (HLY), we previously isolated an AUT1 mutant that showed higher production of various heterologous proteins; however, the underlying factors contributing to the increased heterologous protein production remained unclear. Here, using a comparative genomic approach performed with whole-genome sequences, we attempted to identify the genes responsible for the high-level production of heterologous proteins in the AUT1 mutant. The comparative sequence analysis led to the detection of a gene (AO090120000003), designated autA, which was predicted to encode an unknown cytoplasmic protein containing an alpha/beta-hydrolase fold domain. Mutation or deletion of autA was associated with higher production levels of HLY. Specifically, the HLY yields of the autA mutant and deletion strains were twofold higher than that of the control strain during the early stages of cultivation. Taken together, these results indicate that combining classical mutagenesis approaches with comparative genomic analysis facilitates the identification of novel genes involved in heterologous protein production in filamentous fungi.

Genetic and Environmental Overlap between Chinese and English Reading-Related Skills in Chinese Children

ERIC Educational Resources Information Center

Wong, Simpson W. L.; Chow, Bonnie Wing-Yin; Ho, Connie Suk-Han; Waye, Mary M. Y.; Bishop, Dorothy V. M.

2014-01-01

This twin study examined the relative contributions of genes and environment on 2nd language reading acquisition of Chinese-speaking children learning English. We examined whether specific skills-visual word recognition, receptive vocabulary, phonological awareness, phonological memory, and speech discrimination-in the 1st and 2nd languages have…

Identification of a methyltransferase catalyzing the final step of methyl anthranilate synthesis in cultivated strawberry

USDA-ARS?s Scientific Manuscript database

Methyl anthranilate (MA) contributes an attractive fruity note to the complex flavor and aroma of strawberry (Fragaria spp.), yet it is rarely found in modern cultivars. The genetic basis for its biosynthesis has not been elucidated. Understanding the specific genes required for its synthesis could ...

Exome sequencing in amyotrophic lateral sclerosis identifies risk genes and pathways.

PubMed

Cirulli, Elizabeth T; Lasseigne, Brittany N; Petrovski, Slavé; Sapp, Peter C; Dion, Patrick A; Leblond, Claire S; Couthouis, Julien; Lu, Yi-Fan; Wang, Quanli; Krueger, Brian J; Ren, Zhong; Keebler, Jonathan; Han, Yujun; Levy, Shawn E; Boone, Braden E; Wimbish, Jack R; Waite, Lindsay L; Jones, Angela L; Carulli, John P; Day-Williams, Aaron G; Staropoli, John F; Xin, Winnie W; Chesi, Alessandra; Raphael, Alya R; McKenna-Yasek, Diane; Cady, Janet; Vianney de Jong, J M B; Kenna, Kevin P; Smith, Bradley N; Topp, Simon; Miller, Jack; Gkazi, Athina; Al-Chalabi, Ammar; van den Berg, Leonard H; Veldink, Jan; Silani, Vincenzo; Ticozzi, Nicola; Shaw, Christopher E; Baloh, Robert H; Appel, Stanley; Simpson, Ericka; Lagier-Tourenne, Clotilde; Pulst, Stefan M; Gibson, Summer; Trojanowski, John Q; Elman, Lauren; McCluskey, Leo; Grossman, Murray; Shneider, Neil A; Chung, Wendy K; Ravits, John M; Glass, Jonathan D; Sims, Katherine B; Van Deerlin, Vivianna M; Maniatis, Tom; Hayes, Sebastian D; Ordureau, Alban; Swarup, Sharan; Landers, John; Baas, Frank; Allen, Andrew S; Bedlack, Richard S; Harper, J Wade; Gitler, Aaron D; Rouleau, Guy A; Brown, Robert; Harms, Matthew B; Cooper, Gregory M; Harris, Tim; Myers, Richard M; Goldstein, David B

2015-03-27

Amyotrophic lateral sclerosis (ALS) is a devastating neurological disease with no effective treatment. We report the results of a moderate-scale sequencing study aimed at increasing the number of genes known to contribute to predisposition for ALS. We performed whole-exome sequencing of 2869 ALS patients and 6405 controls. Several known ALS genes were found to be associated, and TBK1 (the gene encoding TANK-binding kinase 1) was identified as an ALS gene. TBK1 is known to bind to and phosphorylate a number of proteins involved in innate immunity and autophagy, including optineurin (OPTN) and p62 (SQSTM1/sequestosome), both of which have also been implicated in ALS. These observations reveal a key role of the autophagic pathway in ALS and suggest specific targets for therapeutic intervention. Copyright © 2015, American Association for the Advancement of Science.

Complex chromosomal neighborhood effects determine the adaptive potential of a gene under selection.

PubMed

Steinrueck, Magdalena; Guet, Călin C

2017-07-25

How the organization of genes on a chromosome shapes adaptation is essential for understanding evolutionary paths. Here, we investigate how adaptation to rapidly increasing levels of antibiotic depends on the chromosomal neighborhood of a drug-resistance gene inserted at different positions of the Escherichia coli chromosome. Using a dual-fluorescence reporter that allows us to distinguish gene amplifications from other up-mutations, we track in real-time adaptive changes in expression of the drug-resistance gene. We find that the relative contribution of several mutation types differs systematically between loci due to properties of neighboring genes: essentiality, expression, orientation, termination, and presence of duplicates. These properties determine rate and fitness effects of gene amplification, deletions, and mutations compromising transcriptional termination. Thus, the adaptive potential of a gene under selection is a system-property with a complex genetic basis that is specific for each chromosomal locus, and it can be inferred from detailed functional and genomic data.

More than a bystander: the contributions of intrinsic skeletal muscle defects in motor neuron diseases

PubMed Central

Boyer, Justin G.; Ferrier, Andrew; Kothary, Rashmi

2013-01-01

Spinal muscular atrophy (SMA), amyotrophic lateral sclerosis (ALS), and spinal-bulbar muscular atrophy (SBMA) are devastating diseases characterized by the degeneration of motor neurons. Although the molecular causes underlying these diseases differ, recent findings have highlighted the contribution of intrinsic skeletal muscle defects in motor neuron diseases. The use of cell culture and animal models has led to the important finding that muscle defects occur prior to and independently of motor neuron degeneration in motor neuron diseases. In SMA for instance, the muscle specific requirements of the SMA disease-causing gene have been demonstrated by a series of genetic rescue experiments in SMA models. Conditional ALS mouse models expressing a muscle specific mutant SOD1 gene develop atrophy and muscle degeneration in the absence of motor neuron pathology. Treating SBMA mice by over-expressing IGF-1 in a skeletal muscle-specific manner attenuates disease severity and improves motor neuron pathology. In the present review, we provide an in depth description of muscle intrinsic defects, and discuss how they impact muscle function in these diseases. Furthermore, we discuss muscle-specific therapeutic strategies used to treat animal models of SMA, ALS, and SBMA. The study of intrinsic skeletal muscle defects is crucial for the understanding of the pathophysiology of these diseases and will open new therapeutic options for the treatment of motor neuron diseases. PMID:24391590

Tissue-enriched expression profiles in Aedes aegypti identify hemocyte-specific transcriptome responses to infection

PubMed Central

Choi, Young-Jun; Fuchs, Jeremy F.; Mayhew, George F.; Yu, Helen E.; Christensen, Bruce M.

2012-01-01

Hemocytes are integral components of mosquito immune mechanisms such as phagocytosis, melanization, and production of antimicrobial peptides. However, our understanding of hemocyte-specific molecular processes and their contribution to shaping the host immune response remains limited. To better understand the immunophysiological features distinctive of hemocytes, we conducted genome-wide analysis of hemocyte-enriched transcripts, and examined how tissue-enriched expression patterns change with the immune status of the host. Our microarray data indicate that the hemocyte-enriched trascriptome is dynamic and context-dependent. Analysis of transcripts enriched after bacterial challenge in circulating hemocytes with respect to carcass added a dimension to evaluating infection-responsive genes and immune-related gene families. We resolved patterns of transcriptional change unique to hemocytes from those that are likely shared by other immune responsive tissues, and identified clusters of genes preferentially induced in hemocytes, likely reflecting their involvement in cell type specific functions. In addition, the study revealed conserved hemocyte-enriched molecular repertoires which might be implicated in core hemocyte function by cross-species meta-analysis of microarray expression data from Anopheles gambiae and Drosophila melanogaster. PMID:22796331

The low density lipoprotein receptor-related protein 1: Unique tissue-specific functions revealed by selective gene knockout studies

PubMed Central

Lillis, Anna P.; Van Duyn, Lauren B.; Murphy-Ullrich, Joanne E.; Strickland, Dudley K.

2008-01-01

The low-density lipoprotein (LDL) receptor-related protein (originally called LRP, but now referred to as LRP1) is a large endocytic receptor that is widely expressed in several tissues. LRP1 is a member of the LDL receptor family that plays diverse roles in various biological processes including lipoprotein metabolism, degradation of proteases, activation of lysosomal enzymes and cellular entry of bacterial toxins and viruses. Deletion of the LRP1 gene leads to lethality in mice, revealing a critical, but as of yet, undefined role in development. Tissue-specific gene deletion studies reveal an important contribution of LRP1 in the vasculature, central nervous system, in macrophages and in adipocytes. Three important properties of LRP1 dictate its diverse role in physiology: first, its ability to recognize more than thirty distinct ligands; second, its ability to bind a large number of cytoplasmic adaptor proteins via determinants located on its cytoplasmic domain in a phosphorylation-specific manner; and third, its ability to associate with and modulate the activity of other transmembrane receptors such as integrins and receptor tyrosine kinases. PMID:18626063

Human-Specific NOTCH2NL Genes Affect Notch Signaling and Cortical Neurogenesis.

PubMed

Fiddes, Ian T; Lodewijk, Gerrald A; Mooring, Meghan; Bosworth, Colleen M; Ewing, Adam D; Mantalas, Gary L; Novak, Adam M; van den Bout, Anouk; Bishara, Alex; Rosenkrantz, Jimi L; Lorig-Roach, Ryan; Field, Andrew R; Haeussler, Maximilian; Russo, Lotte; Bhaduri, Aparna; Nowakowski, Tomasz J; Pollen, Alex A; Dougherty, Max L; Nuttle, Xander; Addor, Marie-Claude; Zwolinski, Simon; Katzman, Sol; Kriegstein, Arnold; Eichler, Evan E; Salama, Sofie R; Jacobs, Frank M J; Haussler, David

2018-05-31

Genetic changes causing brain size expansion in human evolution have remained elusive. Notch signaling is essential for radial glia stem cell proliferation and is a determinant of neuronal number in the mammalian cortex. We find that three paralogs of human-specific NOTCH2NL are highly expressed in radial glia. Functional analysis reveals that different alleles of NOTCH2NL have varying potencies to enhance Notch signaling by interacting directly with NOTCH receptors. Consistent with a role in Notch signaling, NOTCH2NL ectopic expression delays differentiation of neuronal progenitors, while deletion accelerates differentiation into cortical neurons. Furthermore, NOTCH2NL genes provide the breakpoints in 1q21.1 distal deletion/duplication syndrome, where duplications are associated with macrocephaly and autism and deletions with microcephaly and schizophrenia. Thus, the emergence of human-specific NOTCH2NL genes may have contributed to the rapid evolution of the larger human neocortex, accompanied by loss of genomic stability at the 1q21.1 locus and resulting recurrent neurodevelopmental disorders. Copyright © 2018 Elsevier Inc. All rights reserved.

Pseudotyped Lentiviral Vectors for Retrograde Gene Delivery into Target Brain Regions

PubMed Central

Kobayashi, Kenta; Inoue, Ken-ichi; Tanabe, Soshi; Kato, Shigeki; Takada, Masahiko; Kobayashi, Kazuto

2017-01-01

Gene transfer through retrograde axonal transport of viral vectors offers a substantial advantage for analyzing roles of specific neuronal pathways or cell types forming complex neural networks. This genetic approach may also be useful in gene therapy trials by enabling delivery of transgenes into a target brain region distant from the injection site of the vectors. Pseudotyping of a lentiviral vector based on human immunodeficiency virus type 1 (HIV-1) with various fusion envelope glycoproteins composed of different combinations of rabies virus glycoprotein (RV-G) and vesicular stomatitis virus glycoprotein (VSV-G) enhances the efficiency of retrograde gene transfer in both rodent and nonhuman primate brains. The most recently developed lentiviral vector is a pseudotype with fusion glycoprotein type E (FuG-E), which demonstrates highly efficient retrograde gene transfer in the brain. The FuG-E–pseudotyped vector permits powerful experimental strategies for more precisely investigating the mechanisms underlying various brain functions. It also contributes to the development of new gene therapy approaches for neurodegenerative disorders, such as Parkinson’s disease, by delivering genes required for survival and protection into specific neuronal populations. In this review article, we report the properties of the FuG-E–pseudotyped vector, and we describe the application of the vector to neural circuit analysis and the potential use of the FuG-E vector in gene therapy for Parkinson’s disease. PMID:28824385

Tbx2/3 is an essential mediator within the Brachyury gene network during Ciona notochord development

PubMed Central

José-Edwards, Diana S.; Oda-Ishii, Izumi; Nibu, Yutaka; Di Gregorio, Anna

2013-01-01

T-box genes are potent regulators of mesoderm development in many metazoans. In chordate embryos, the T-box transcription factor Brachyury (Bra) is required for specification and differentiation of the notochord. In some chordates, including the ascidian Ciona, members of the Tbx2 subfamily of T-box genes are also expressed in this tissue; however, their regulatory relationships with Bra and their contributions to the development of the notochord remain uncharacterized. We determined that the notochord expression of Ciona Tbx2/3 (Ci-Tbx2/3) requires Ci-Bra, and identified a Ci-Tbx2/3 notochord CRM that necessitates multiple Ci-Bra binding sites for its activity. Expression of mutant forms of Ci-Tbx2/3 in the developing notochord revealed a role for this transcription factor primarily in convergent extension. Through microarray screens, we uncovered numerous Ci-Tbx2/3 targets, some of which overlap with known Ci-Bra-downstream notochord genes. Among the Ci-Tbx2/3 notochord targets are evolutionarily conserved genes, including caspases, lineage-specific genes, such as Noto4, and newly identified genes, such as MLKL. This work sheds light on a large section of the notochord regulatory circuitry controlled by T-box factors, and reveals new components of the complement of genes required for the proper formation of this structure. PMID:23674602

Tbx2/3 is an essential mediator within the Brachyury gene network during Ciona notochord development.

PubMed

José-Edwards, Diana S; Oda-Ishii, Izumi; Nibu, Yutaka; Di Gregorio, Anna

2013-06-01

T-box genes are potent regulators of mesoderm development in many metazoans. In chordate embryos, the T-box transcription factor Brachyury (Bra) is required for specification and differentiation of the notochord. In some chordates, including the ascidian Ciona, members of the Tbx2 subfamily of T-box genes are also expressed in this tissue; however, their regulatory relationships with Bra and their contributions to the development of the notochord remain uncharacterized. We determined that the notochord expression of Ciona Tbx2/3 (Ci-Tbx2/3) requires Ci-Bra, and identified a Ci-Tbx2/3 notochord CRM that necessitates multiple Ci-Bra binding sites for its activity. Expression of mutant forms of Ci-Tbx2/3 in the developing notochord revealed a role for this transcription factor primarily in convergent extension. Through microarray screens, we uncovered numerous Ci-Tbx2/3 targets, some of which overlap with known Ci-Bra-downstream notochord genes. Among the Ci-Tbx2/3 notochord targets are evolutionarily conserved genes, including caspases, lineage-specific genes, such as Noto4, and newly identified genes, such as MLKL. This work sheds light on a large section of the notochord regulatory circuitry controlled by T-box factors, and reveals new components of the complement of genes required for the proper formation of this structure.

FOXM1 promotes the progression of prostate cancer by regulating PSA gene transcription.

PubMed

Liu, Youhong; Liu, Yijun; Yuan, Bowen; Yin, Linglong; Peng, Yuchong; Yu, Xiaohui; Zhou, Weibing; Gong, Zhicheng; Liu, Jianye; He, Leye; Li, Xiong

2017-03-07

Androgen/AR is the primary contributor to prostate cancer (PCa) progression by regulating Prostate Specific Antigen (PSA) gene transcription. The disease inevitably evolves to androgen-independent (AI) status. Other mechanisms by which PSA is regulated and develops to AI have not yet been fully determined. FOXM1 is a cell proliferation-specific transcription factor highly expressed in PCa cells compared to non-malignant prostate epithelial cells, suggesting that the aberrant overexpression of FOXM1 contributes to PCa development. In addition to regulating AR gene transcription and cell cycle-regulatory genes, FOXM1 selectively regulates the gene transcription of KLK2 and PSA, typical androgen responsive genes. Screening the potential FOXM1-binding sites by ChIP-PCR, we found that FOXM1 directly binds to the FHK binding motifs in the PSA promoter/enhancer regions. AI C4-2 cells have more FOXM1 binding sites than androgen dependent LNCaP cells. The depletion of FOXM1 by small molecular inhibitors significantly improves the suppression of PSA gene transcription by the anti-AR agent Cadosax. This is the first report showing that FOXM1 promotes PCa progression by regulating PSA gene transcription, particularly in AI PCa cells. The combination of anti-AR agents and FOXM1 inhibitors has the potential to greatly improve therapy for late-stage PCa patients by suppressing PSA levels.

The recurrent SET-NUP214 fusion as a new HOXA activation mechanism in pediatric T-cell acute lymphoblastic leukemia

PubMed Central

Van Vlierberghe, Pieter; van Grotel, Martine; Tchinda, Joëlle; Lee, Charles; Beverloo, H. Berna; van der Spek, Peter J.; Stubbs, Andrew; Cools, Jan; Nagata, Kyosuke; Fornerod, Maarten; Buijs-Gladdines, Jessica; Horstmann, Martin; van Wering, Elisabeth R.; Soulier, Jean; Pieters, Rob

2008-01-01

T-cell acute lymphoblastic leukemia (T-ALL) is mostly characterized by specific chromosomal abnormalities, some occurring in a mutually exclusive manner that possibly delineate specific T-ALL subgroups. One subgroup, including MLL-rearranged, CALM-AF10 or inv (7)(p15q34) patients, is characterized by elevated expression of HOXA genes. Using a gene expression–based clustering analysis of 67 T-ALL cases with recurrent molecular genetic abnormalities and 25 samples lacking apparent aberrations, we identified 5 new patients with elevated HOXA levels. Using microarray-based comparative genomic hybridization (array-CGH), a cryptic and recurrent deletion, del (9)(q34.11q34.13), was exclusively identified in 3 of these 5 patients. This deletion results in a conserved SET-NUP214 fusion product, which was also identified in the T-ALL cell line LOUCY. SET-NUP214 binds in the promoter regions of specific HOXA genes, where it interacts with CRM1 and DOT1L, which may transcriptionally activate specific members of the HOXA cluster. Targeted inhibition of SET-NUP214 by siRNA abolished expression of HOXA genes, inhibited proliferation, and induced differentiation in LOUCY but not in other T-ALL lines. We conclude that SET-NUP214 may contribute to the pathogenesis of T-ALL by enforcing T-cell differentiation arrest. PMID:18299449

Epigenetic changes in solid and hematopoietic tumors.

PubMed

Toyota, Minoru; Issa, Jean-Pierre J

2005-10-01

There are three connected molecular mechanisms of epigenetic cellular memory in mammalian cells: DNA methylation, histone modifications, and RNA interference. The first two have now been firmly linked to neoplastic transformation. Hypermethylation of CpG-rich promoters triggers local histone code modifications resulting in a cellular camouflage mechanism that sequesters gene promoters away from transcription factors and results in stable silencing. This normally restricted mechanism is ubiquitously used in cancer to silence hundreds of genes, among which some critically contribute to the neoplastic phenotype. Virtually every pathway important to cancer formation is affected by this process. Methylation profiling of human cancers reveals tissue-specific epigenetic signatures, as well as tumor-specific signatures, reflecting in particular the presence of epigenetic instability in a subset of cancers affected by the CpG island methylator phenotype. Generally, methylation patterns can be traced to a tissue-specific, proliferation-dependent accumulation of aberrant promoter methylation in aging tissues, a process that can be accelerated by chronic inflammation and less well-defined mechanisms including, possibly, diet and genetic predisposition. The epigenetic machinery can also be altered in cancer by specific lesions in epigenetic effector genes, or by aberrant recruitment of these genes by mutant transcription factors and coactivators. Epigenetic patterns are proving clinically useful in human oncology via risk assessment, early detection, and prognostic classification. Pharmacologic manipulation of these patterns-epigenetic therapy-is also poised to change the way we treat cancer in the clinic.

Effects of Gene Duplication, Positive Selection, and Shifts in Gene Expression on the Evolution of the Venom Gland Transcriptome in Widow Spiders

PubMed Central

Haney, Robert A.; Clarke, Thomas H.; Gadgil, Rujuta; Fitzpatrick, Ryan; Hayashi, Cheryl Y.; Ayoub, Nadia A.; Garb, Jessica E.

2016-01-01

Gene duplication and positive selection can be important determinants of the evolution of venom, a protein-rich secretion used in prey capture and defense. In a typical model of venom evolution, gene duplicates switch to venom gland expression and change function under the action of positive selection, which together with further duplication produces large gene families encoding diverse toxins. Although these processes have been demonstrated for individual toxin families, high-throughput multitissue sequencing of closely related venomous species can provide insights into evolutionary dynamics at the scale of the entire venom gland transcriptome. By assembling and analyzing multitissue transcriptomes from the Western black widow spider and two closely related species with distinct venom toxicity phenotypes, we do not find that gene duplication and duplicate retention is greater in gene families with venom gland biased expression in comparison with broadly expressed families. Positive selection has acted on some venom toxin families, but does not appear to be in excess for families with venom gland biased expression. Moreover, we find 309 distinct gene families that have single transcripts with venom gland biased expression, suggesting that the switching of genes to venom gland expression in numerous unrelated gene families has been a dominant mode of evolution. We also find ample variation in protein sequences of venom gland–specific transcripts, lineage-specific family sizes, and ortholog expression among species. This variation might contribute to the variable venom toxicity of these species. PMID:26733576

Differences in candidate gene association between European ancestry and African American asthmatic children.

PubMed

Baye, Tesfaye M; Butsch Kovacic, Melinda; Biagini Myers, Jocelyn M; Martin, Lisa J; Lindsey, Mark; Patterson, Tia L; He, Hua; Ericksen, Mark B; Gupta, Jayanta; Tsoras, Anna M; Lindsley, Andrew; Rothenberg, Marc E; Wills-Karp, Marsha; Eissa, N Tony; Borish, Larry; Khurana Hershey, Gurjit K

2011-02-28

Candidate gene case-control studies have identified several single nucleotide polymorphisms (SNPs) that are associated with asthma susceptibility. Most of these studies have been restricted to evaluations of specific SNPs within a single gene and within populations from European ancestry. Recently, there is increasing interest in understanding racial differences in genetic risk associated with childhood asthma. Our aim was to compare association patterns of asthma candidate genes between children of European and African ancestry. Using a custom-designed Illumina SNP array, we genotyped 1,485 children within the Greater Cincinnati Pediatric Clinic Repository and Cincinnati Genomic Control Cohort for 259 SNPs in 28 genes and evaluated their associations with asthma. We identified 14 SNPs located in 6 genes that were significantly associated (p-values <0.05) with childhood asthma in African Americans. Among Caucasians, 13 SNPs in 5 genes were associated with childhood asthma. Two SNPs in IL4 were associated with asthma in both races (p-values <0.05). Gene-gene interaction studies identified race specific sets of genes that best discriminate between asthmatic children and non-allergic controls. We identified IL4 as having a role in asthma susceptibility in both African American and Caucasian children. However, while IL4 SNPs were associated with asthma in asthmatic children with European and African ancestry, the relative contributions of the most replicated asthma-associated SNPs varied by ancestry. These data provides valuable insights into the pathways that may predispose to asthma in individuals with European vs. African ancestry.

Differential expression of thymic DNA repair genes in low-dose-rate irradiated AKR/J mice

PubMed Central

Bong, Jin Jong; Kang, Yu Mi; Shin, Suk Chul; Choi, Seung Jin

2013-01-01

We previously determined that AKR/J mice housed in a low-dose-rate (LDR) (137Cs, 0.7 mGy/h, 2.1 Gy) γ-irradiation facility developed less spontaneous thymic lymphoma and survived longer than those receiving sham or high-dose-rate (HDR) (137Cs, 0.8 Gy/min, 4.5 Gy) radiation. Interestingly, histopathological analysis showed a mild lymphomagenesis in the thymus of LDR-irradiated mice. Therefore, in this study, we investigated whether LDR irradiation could trigger the expression of thymic genes involved in the DNA repair process of AKR/J mice. The enrichment analysis of Gene Ontology terms and Kyoto Encyclopedia of Genes and Genomes pathways showed immune response, nucleosome organization, and the peroxisome proliferator-activated receptors signaling pathway in LDR-irradiated mice. Our microarray analysis and quantitative polymerase chain reaction data demonstrated that mRNA levels of Lig4 and RRM2 were specifically elevated in AKR/J mice at 130 days after the start of LDR irradiation. Furthermore, transcriptional levels of H2AX and ATM, proteins known to recruit DNA repair factors, were also shown to be upregulated. These data suggest that LDR irradiation could trigger specific induction of DNA repair-associated genes in an attempt to repair damaged DNA during tumor progression, which in turn contributed to the decreased incidence of lymphoma and increased survival. Overall, we identified specific DNA repair genes in LDR-irradiated AKR/J mice. PMID:23820165

Genomic islands link secondary metabolism to functional adaptation in marine Actinobacteria

PubMed Central

Penn, Kevin; Jenkins, Caroline; Nett, Markus; Udwary, Daniel W.; Gontang, Erin A.; McGlinchey, Ryan P.; Foster, Brian; Lapidus, Alla; Podell, Sheila; Allen, Eric E.; Moore, Bradley S.; Jensen, Paul R.

2009-01-01

Genomic islands have been shown to harbor functional traits that differentiate ecologically distinct populations of environmental bacteria. A comparative analysis of the complete genome sequences of the marine Actinobacteria Salinispora tropica and S. arenicola reveals that 75% of the species-specific genes are located in 21 genomic islands. These islands are enriched in genes associated with secondary metabolite biosynthesis providing evidence that secondary metabolism is linked to functional adaptation. Secondary metabolism accounts for 8.8% and 10.9% of the genes in the S. tropica and S. arenicola genomes, respectively, and represents the major functional category of annotated genes that differentiates the two species. Genomic islands harbor all 25 of the species-specific biosynthetic pathways, the majority of which occur in S. arenicola and may contribute to the cosmopolitan distribution of this species. Genome evolution is dominated by gene duplication and acquisition, which in the case of secondary metabolism provide immediate opportunities for the production of new bioactive products. Evidence that secondary metabolic pathways are exchanged horizontally, coupled with prior evidence for fixation among globally distributed populations, supports a functional role and suggests that the acquisition of natural product biosynthetic gene clusters represents a previously unrecognized force driving bacterial diversification. Species-specific differences observed in CRISPR (clustered regularly interspaced short palindromic repeat) sequences suggest that S. arenicola may possess a higher level of phage immunity, while a highly duplicated family of polymorphic membrane proteins provides evidence of a new mechanism of marine adaptation in Gram-positive bacteria. PMID:19474814

Drosophila innate immunity: regional and functional specialization of prophenoloxidases.

PubMed

Dudzic, Jan P; Kondo, Shu; Ueda, Ryu; Bergman, Casey M; Lemaitre, Bruno

2015-10-01

The diversification of immune systems during evolution involves the expansion of particular gene families in given phyla. A better understanding of the metazoan immune system requires an analysis of the logic underlying such immune gene amplification. This analysis is now within reach due to the ease with which we can generate multiple mutations in an organism. In this paper, we analyze the contribution of the three Drosophila prophenoloxidases (PPOs) to host defense by generating single, double and triple mutants. PPOs are enzymes that catalyze the production of melanin at the site of infection and around parasites. They are the rate-limiting enzymes that contribute to the melanization reaction, a major immune mechanism of arthropods. The number of PPO-encoding genes is variable among insects, ranging from one in the bee to ten in the mosquito. By analyzing mutations alone and in combination, we ascribe a specific function to each of the three PPOs of Drosophila. Our study confirms that two PPOs produced by crystal cells, PPO1 and PPO2, contribute to the bulk of melanization in the hemolymph, upon septic or clean injury. In contrast, PPO3, a PPO restricted to the D. melanogaster group, is expressed in lamellocytes and contributes to melanization during the encapsulation process. Interestingly, another overlapping set of PPOs, PPO2 and PPO3, achieve melanization of the capsule upon parasitoid wasp infection. The use of single or combined mutations allowed us to show that each PPO mutant has a specific phenotype, and that knocking out two of three genes is required to abolish fully a particular function. Thus, Drosophila PPOs have partially overlapping functions to optimize melanization in at least two conditions: following injury or during encapsulation. Since PPO3 is restricted to the D. melanogaster group, this suggests that production of PPO by lamellocytes emerged as a recent defense mechanism against parasitoid wasps. We conclude that differences in spatial localization, immediate or late availability, and mode of activation underlie the functional diversification of the three Drosophila PPOs, with each of them having non-redundant but overlapping functions.

Genetics of Dementia

PubMed Central

Paulson, Henry L.; Igo, Indu

2012-01-01

Genetic factors are now recognized to play an important role in most age-related dementias. While other factors, including aging itself, contribute to dementia, in this review we focus on the role of specific disease-causing genes and genetic factors in the most common age-related dementias. We review each dementia within the context of a genes/environment continuum, with varying levels of genetic versus environmental influence. All major classes of dementia will be discussed but greatest attention will be given to the most common dementia, Alzheimer’s disease, for which several new genetic factors were recently identified. PMID:22266883

New Tricks for “Old” Domains: How Novel Architectures and Promiscuous Hubs Contributed to the Organization and Evolution of the ECM

PubMed Central

Cromar, Graham; Wong, Ka-Chun; Loughran, Noeleen; On, Tuan; Song, Hongyan; Xiong, Xuejian; Zhang, Zhaolei; Parkinson, John

2014-01-01

The extracellular matrix (ECM) is a defining characteristic of metazoans and consists of a meshwork of self-assembling, fibrous proteins, and their functionally related neighbours. Previous studies, focusing on a limited number of gene families, suggest that vertebrate complexity predominantly arose through the duplication and subsequent modification of retained, preexisting ECM genes. These genes provided the structural underpinnings to support a variety of specialized tissues, as well as a platform for the organization of spatio-temporal signaling and cell migration. However, the relative contributions of ancient versus novel domains to ECM evolution have not been quantified across the full range of ECM proteins. Here, utilizing a high quality list comprising 324 ECM genes, we reveal general and clade-specific domain combinations, identifying domains of eukaryotic and metazoan origin recruited into new roles in approximately two-third of the ECM proteins in humans representing novel vertebrate proteins. We show that, rather than acquiring new domains, sampling of new domain combinations has been key to the innovation of paralogous ECM genes during vertebrate evolution. Applying a novel framework for identifying potentially important, noncontiguous, conserved arrangements of domains, we find that the distinct biological characteristics of the ECM have arisen through unique evolutionary processes. These include the preferential recruitment of novel domains to existing architectures and the utilization of high promiscuity domains in organizing the ECM network around a connected array of structural hubs. Our focus on ECM proteins reveals that distinct types of proteins and/or the biological systems in which they operate have influenced the types of evolutionary forces that drive protein innovation. This emphasizes the need for rigorously defined systems to address questions of evolution that focus on specific systems of interacting proteins. PMID:25323955

Estrogen Signaling Contributes to Sex Differences in Macrophage Polarization during Asthma.

PubMed

Keselman, Aleksander; Fang, Xi; White, Preston B; Heller, Nicola M

2017-09-01

Allergic asthma is a chronic Th2 inflammation in the lungs that constricts the airways and presents as coughing and wheezing. Asthma mostly affects boys in childhood and women in adulthood, suggesting that shifts in sex hormones alter the course of the disease. Alveolar macrophages have emerged as major mediators of allergic lung inflammation in animal models as well as humans. Whether sex differences exist in macrophage polarization and the molecular mechanism(s) that drive differential responses are not well understood. We found that IL-4-stimulated bone marrow-derived and alveolar macrophages from female mice exhibited greater expression of M2 genes in vitro and after allergen challenge in vivo. Alveolar macrophages from female mice exhibited greater expression of the IL-4Rα and estrogen receptor (ER) α compared with macrophages from male mice following allergen challenge. An ERα-specific agonist enhanced IL-4-induced M2 gene expression in macrophages from both sexes, but more so in macrophages from female mice. Furthermore, IL-4-stimulated macrophages from female mice exhibited more transcriptionally active histone modifications at M2 gene promoters than did macrophages from male mice. We found that supplementation of estrogen into ovariectomized female mice enhanced M2 polarization in vivo upon challenge with allergen and that macrophage-specific deletion of ERα impaired this M2 polarization. The effects of estrogen are long-lasting; bone marrow-derived macrophages from ovariectomized mice implanted with estrogen exhibited enhanced IL-4-induced M2 gene expression compared with macrophages from placebo-implanted littermates. Taken together, our findings suggest that estrogen enhances IL-4-induced M2 gene expression and thereby contributes to sex differences observed in asthma. Copyright © 2017 by The American Association of Immunologists, Inc.

Multi-step aberrant CpG island hyper-methylation is associated with the progression of adult T-cell leukemia/lymphoma.

PubMed

Sato, Hiaki; Oka, Takashi; Shinnou, Yoko; Kondo, Takami; Washio, Kana; Takano, Masayuki; Takata, Katsuyoshi; Morito, Toshiaki; Huang, Xingang; Tamura, Maiko; Kitamura, Yuta; Ohara, Nobuya; Ouchida, Mamoru; Ohshima, Koichi; Shimizu, Kenji; Tanimoto, Mitsune; Takahashi, Kiyoshi; Matsuoka, Masao; Utsunomiya, Atae; Yoshino, Tadashi

2010-01-01

Aberrant CpG island methylation contributes to the pathogenesis of various malignancies. However, little is known about the association of epigenetic abnormalities with multistep tumorigenic events in adult T cell leukemia/lymphoma (ATLL). To determine whether epigenetic abnormalities induce the progression of ATLL, we analyzed the methylation profiles of the SHP1, p15, p16, p73, HCAD, DAPK, hMLH-1, and MGMT genes by methylation specific PCR assay in 65 cases with ATLL patients. The number of CpG island methylated genes increased with disease progression and aberrant hypermethylation in specific genes was detected even in HTLV-1 carriers and correlated with progression to ATLL. The CpG island methylator phenotype (CIMP) was observed most frequently in lymphoma type ATLL and was also closely associated with the progression and crisis of ATLL. The high number of methylated genes and increase of CIMP incidence were shown to be unfavorable prognostic factors and correlated with a shorter overall survival by Kaplan-Meyer analysis. The present findings strongly suggest that the multistep accumulation of aberrant CpG methylation in specific target genes and the presence of CIMP are deeply involved in the crisis, progression, and prognosis of ATLL, as well as indicate the value of CpG methylation and CIMP for new diagnostic and prognostic biomarkers.

Multi-Step Aberrant CpG Island Hyper-Methylation Is Associated with the Progression of Adult T–Cell Leukemia/Lymphoma

PubMed Central

Sato, Hiaki; Oka, Takashi; Shinnou, Yoko; Kondo, Takami; Washio, Kana; Takano, Masayuki; Takata, Katsuyoshi; Morito, Toshiaki; Huang, Xingang; Tamura, Maiko; Kitamura, Yuta; Ohara, Nobuya; Ouchida, Mamoru; Ohshima, Koichi; Shimizu, Kenji; Tanimoto, Mitsune; Takahashi, Kiyoshi; Matsuoka, Masao; Utsunomiya, Atae; Yoshino, Tadashi

2010-01-01

Aberrant CpG island methylation contributes to the pathogenesis of various malignancies. However, little is known about the association of epigenetic abnormalities with multistep tumorigenic events in adult T cell leukemia/lymphoma (ATLL). To determine whether epigenetic abnormalities induce the progression of ATLL, we analyzed the methylation profiles of the SHP1, p15, p16, p73, HCAD, DAPK, hMLH-1, and MGMT genes by methylation specific PCR assay in 65 cases with ATLL patients. The number of CpG island methylated genes increased with disease progression and aberrant hypermethylation in specific genes was detected even in HTLV-1 carriers and correlated with progression to ATLL. The CpG island methylator phenotype (CIMP) was observed most frequently in lymphoma type ATLL and was also closely associated with the progression and crisis of ATLL. The high number of methylated genes and increase of CIMP incidence were shown to be unfavorable prognostic factors and correlated with a shorter overall survival by Kaplan-Meyer analysis. The present findings strongly suggest that the multistep accumulation of aberrant CpG methylation in specific target genes and the presence of CIMP are deeply involved in the crisis, progression, and prognosis of ATLL, as well as indicate the value of CpG methylation and CIMP for new diagnostic and prognostic biomarkers. PMID:20019193

Set regulation in asexual and sexual Plasmodium parasites reveals a novel mechanism of stage-specific expression.

PubMed

Pace, Tomasino; Olivieri, Anna; Sanchez, Massimo; Albanesi, Veronica; Picci, Leonardo; Siden Kiamos, Inga; Janse, Chris J; Waters, Andrew P; Pizzi, Elisabetta; Ponzi, Marta

2006-05-01

Transmission of the malaria parasite depends on specialized gamete precursors (gametocytes) that develop in the bloodstream of a vertebrate host. Gametocyte/gamete differentiation requires controlled patterns of gene expression and regulation not only of stage and gender-specific genes but also of genes associated with DNA replication and mitosis. Once taken up by mosquito, male gametocytes undergo three mitotic cycles within few minutes to produce eight motile gametes. Here we analysed, in two Plasmodium species, the expression of SET, a conserved nuclear protein involved in chromatin dynamics. SET is expressed in both asexual and sexual blood stages but strongly accumulates in male gametocytes. We demonstrated functionally the presence of two distinct promoters upstream of the set open reading frame, the one active in all blood stage parasites while the other active only in gametocytes and in a fraction of schizonts possibly committed to sexual differentiation. In ookinetes both promoters exhibit a basal activity, while in the oocysts the gametocyte-specific promoter is silent and the reporter gene is only transcribed from the constitutive promoter. This transcriptional control, described for the first time in Plasmodium, provides a mechanism by which single-copy genes can be differently modulated during parasite development. In male gametocytes an overexpression of SET might contribute to a prompt entry and execution of S/M phases within mosquito vector.

Integrated analysis of gene expression and methylation profiles of 48 candidate genes in breast cancer patients.

PubMed

Li, Zibo; Heng, Jianfu; Yan, Jinhua; Guo, Xinwu; Tang, Lili; Chen, Ming; Peng, Limin; Wu, Yepeng; Wang, Shouman; Xiao, Zhi; Deng, Zhongping; Dai, Lizhong; Wang, Jun

2016-11-01

Gene-specific methylation and expression have shown biological and clinical importance for breast cancer diagnosis and prognosis. Integrated analysis of gene methylation and gene expression may identify genes associated with biology mechanism and clinical outcome of breast cancer and aid in clinical management. Using high-throughput microfluidic quantitative PCR, we analyzed the expression profiles of 48 candidate genes in 96 Chinese breast cancer patients and investigated their correlation with gene methylation and associations with breast cancer clinical parameters. Breast cancer-specific gene expression alternation was found in 25 genes with significant expression difference between paired tumor and normal tissues. A total of 9 genes (CCND2, EGFR, GSTP1, PGR, PTGS2, RECK, SOX17, TNFRSF10D, and WIF1) showed significant negative correlation between methylation and gene expression, which were validated in the TCGA database. Total 23 genes (ACADL, APC, BRCA2, CADM1, CAV1, CCND2, CST6, EGFR, ESR2, GSTP1, ICAM5, NPY, PGR, PTGS2, RECK, RUNX3, SFRP1, SOX17, SYK, TGFBR2, TNFRSF10D, WIF1, and WRN) annotated with potential TFBSs in the promoter regions showed negative correlation between methylation and expression. In logistics regression analysis, 31 of the 48 genes showed improved performance in disease prediction with combination of methylation and expression coefficient. Our results demonstrated the complex correlation and the possible regulatory mechanisms between DNA methylation and gene expression. Integration analysis of methylation and expression of candidate genes could improve performance in breast cancer prediction. These findings would contribute to molecular characterization and identification of biomarkers for potential clinical applications.

Regulation of Plasmodium yoelii oocyst development by strain- and stage-specific small-subunit rRNA.

PubMed

Qi, Yanwei; Zhu, Feng; Eastman, Richard T; Fu, Young; Zilversmit, Martine; Pattaradilokrat, Sittiporn; Hong, Lingxian; Liu, Shengfa; McCutchan, Thomas F; Pan, Weiqing; Xu, Wenyue; Li, Jian; Huang, Fusheng; Su, Xin-zhuan

2015-03-10

One unique feature of malaria parasites is the differential transcription of structurally distinct rRNA (rRNA) genes at different developmental stages: the A-type genes are transcribed mainly in asexual stages, whereas the S-type genes are expressed mostly in sexual or mosquito stages. Conclusive functional evidence of different rRNAs in regulating stage-specific parasite development, however, is still absent. Here we performed genetic crosses of Plasmodium yoelii parasites with one parent having an oocyst development defect (ODD) phenotype and another producing normal oocysts to identify the gene(s) contributing to the ODD. The parent with ODD--characterized as having small oocysts and lacking infective sporozoites--was obtained after introduction of a plasmid with a green fluorescent protein gene into the parasite genome and subsequent passages in mice. Quantitative trait locus analysis of genome-wide microsatellite genotypes of 48 progeny from the crosses linked an ~200-kb segment on chromosome 6 containing one of the S-type genes (D-type small subunit rRNA gene [D-ssu]) to the ODD. Fine mapping of the plasmid integration site, gene expression pattern, and gene knockout experiments demonstrated that disruption of the D-ssu gene caused the ODD phenotype. Interestingly, introduction of the D-ssu gene into the same parasite strain (self), but not into a different subspecies, significantly affected or completely ablated oocyst development, suggesting a stage- and subspecies (strain)-specific regulation of oocyst development by D-ssu. This study demonstrates that P. yoelii D-ssu is essential for normal oocyst and sporozoite development and that variation in the D-ssu sequence can have dramatic effects on parasite development. Malaria parasites are the only known organisms that express structurally distinct rRNA genes at different developmental stages. The differential expression of these genes suggests that they play unique roles during the complex life cycle of the parasites. Conclusive functional proof of different rRNAs in regulating parasite development, however, is still absent or controversial. Here we functionally demonstrate for the first time that a stage-specifically expressed D-type small-subunit rRNA gene (D-ssu) is essential for oocyst development of the malaria parasite Plasmodium yoelii in the mosquito. This study also shows that variations in D-ssu sequence and/or the timing of transcription may have profound effects on parasite oocyst development. The results show that in addition to protein translation, rRNAs of malaria parasites also regulate parasite development and differentiation in a strain-specific manner, which can be explored for controlling parasite transmission. Copyright © 2015 Qi et al.

The impact of endurance exercise on global and AMPK gene-specific DNA methylation

DOE Office of Scientific and Technical Information (OSTI.GOV)

King-Himmelreich, Tanya S.; Schramm, Stefanie; Wolters, Miriam C.

Alterations in gene expression as a consequence of physical exercise are frequently described. The mechanism of these regulations might depend on epigenetic changes in global or gene-specific DNA methylation levels. The AMP-activated protein kinase (AMPK) plays a key role in maintenance of energy homeostasis and is activated by increases in the AMP/ATP ratio as occurring in skeletal muscles after sporting activity. To analyze whether exercise has an impact on the methylation status of the AMPK promoter, we determined the AMPK methylation status in human blood samples from patients before and after sporting activity in the context of rehabilitation as wellmore » as in skeletal muscles of trained and untrained mice. Further, we examined long interspersed nuclear element 1 (LINE-1) as indicator of global DNA methylation changes. Our results revealed that light sporting activity in mice and humans does not alter global DNA methylation but has an effect on methylation of specific CpG sites in the AMPKα2 gene. These regulations were associated with a reduced AMPKα2 mRNA and protein expression in muscle tissue, pointing at a contribution of the methylation status to AMPK expression. Taken together, these results suggest that exercise influences AMPKα2 gene methylation in human blood and eminently in the skeletal muscle of mice and therefore might repress AMPKα2 gene expression. -- Highlights: •AMPK gene methylation increases after moderate endurance exercise in humans and mice. •AMPKα mRNA and protein decrease after moderate endurance exercise in mice. •Global DNA methylation is not affected under the same conditions.« less

COX inhibitors directly alter gene expression: role in cancer prevention?

PubMed Central

Wang, Xingya; Baek, Seung Joon; Eling, Thomas

2016-01-01

Inflammation is an important contributor to the development and progression of human cancers. Inflammatory lipid metabolites, prostaglandins, formed from arachidonic acid by prostaglandin H synthases commonly called cyclooxygenases (COXs) bind to specific receptors that activate signaling pathways driving the development and progression of tumors. Inhibitors of prostaglandin formation, COX inhibitors, or nonsteroidal anti-inflammatory drugs (NSAIDs) are well documented as agents that inhibit tumor growth and with long-term use prevent tumor development. NSAIDs also alter gene expression independent of COX inhibition and these changes in gene expression also appear to contribute to the anti-tumorigenic activity of these drugs. Many NSAIDs, as illustrated by sulindac sulfide, alter gene expressions by altering the expression or phosphorylation status of the transcription factors specificity protein 1 and early growth response-1 with the balance between these two events resulting in increases or decreases in specific target genes. In this review, we have summarized and discussed the various genes altered by this mechanism after NSAID treatment and how these changes in expression relate to the anti-tumorigenic activity. A major focus of the review is on NSAID-activated gene (NAG-1) or growth differentiation factor 15. This unique member of the TGF-β superfamily is highly induced by NSAIDs and numerous drugs and chemicals with anti-tumorigenic activities. Investigations with a transgenic mouse expressing the human NAG-1 suggest it acts to suppress tumor development in several mouse models of cancer. The biochemistry and biology of NAG-1 were discussed as potential contributor to cancer prevention by COX inhibitors. PMID:22020924

Loci under selection during multiple range expansions of an invasive plant are mostly population specific, but patterns are associated with climate.

PubMed

Zenni, Rafael D; Hoban, Sean M

2015-07-01

Identifying the genes underlying rapid evolutionary changes, describing their function and ascertaining the environmental pressures that determine fitness are the central elements needed for understanding of evolutionary processes and phenotypic changes that improve the fitness of populations. It has been hypothesized that rapid adaptive changes in new environments may contribute to the rapid spread and success of invasive plants and animals. As yet, studies of adaptation during invasion are scarce, as is knowledge of the genes underlying adaptation, especially in multiple replicated invasions. Here, we quantified how genotype frequencies change during invasions, resulting in rapid evolution of naturalized populations. We used six fully replicated common garden experiments in Brazil where Pinus taeda (loblolly pine) was introduced at the same time, in the same numbers, from the same seed sources, and has formed naturalized populations expanding outward from the plantations. We used a combination of nonparametric, population genetics and multivariate statistics to detect changes in genotype frequencies along each of the six naturalization gradients and their association with climate as well as shifts in allele frequencies compared to the source populations. Results show 25 genes with significant shifts in genotype frequencies. Six genes had shifts in more than one population. Climate explained 25% of the variation in the groups of genes under selection across all locations, but specific genes under strong selection during invasions did not show climate-related convergence. In conclusion, we detected rapid evolutionary changes during invasive range expansions, but the particular gene-level patterns of evolution may be population specific. © 2015 John Wiley & Sons Ltd.

A systems-wide comparison of red rice (Oryza longistaminata) tissues identifies rhizome specific genes and proteins that are targets for cultivated rice improvement

PubMed Central

2014-01-01

Background The rhizome, the original stem of land plants, enables species to invade new territory and is a critical component of perenniality, especially in grasses. Red rice (Oryza longistaminata) is a perennial wild rice species with many valuable traits that could be used to improve cultivated rice cultivars, including rhizomatousness, disease resistance and drought tolerance. Despite these features, little is known about the molecular mechanisms that contribute to rhizome growth, development and function in this plant. Results We used an integrated approach to compare the transcriptome, proteome and metabolome of the rhizome to other tissues of red rice. 116 Gb of transcriptome sequence was obtained from various tissues and used to identify rhizome-specific and preferentially expressed genes, including transcription factors and hormone metabolism and stress response-related genes. Proteomics and metabolomics approaches identified 41 proteins and more than 100 primary metabolites and plant hormones with rhizome preferential accumulation. Of particular interest was the identification of a large number of gene transcripts from Magnaportha oryzae, the fungus that causes rice blast disease in cultivated rice, even though the red rice plants showed no sign of disease. Conclusions A significant set of genes, proteins and metabolites appear to be specifically or preferentially expressed in the rhizome of O. longistaminata. The presence of M. oryzae gene transcripts at a high level in apparently healthy plants suggests that red rice is resistant to this pathogen, and may be able to provide genes to cultivated rice that will enable resistance to rice blast disease. PMID:24521476

The organ-specific expression of terpene synthase genes contributes to the terpene hydrocarbon composition of chamomile essential oils

PubMed Central

2012-01-01

Background The essential oil of chamomile, one of the oldest and agronomically most important medicinal plant species in Europe, has significant antiphlogistic, spasmolytic and antimicrobial activities. It is rich in chamazulene, a pharmaceutically active compound spontaneously formed during steam distillation from the sesquiterpene lactone matricine. Chamomile oil also contains sesquiterpene alcohols and hydrocarbons which are produced by the action of terpene synthases (TPS), the key enzymes in constructing terpene carbon skeletons. Results Here, we present the identification and characterization of five TPS enzymes contributing to terpene biosynthesis in chamomile (Matricaria recutita). Four of these enzymes were exclusively expressed in above-ground organs and produced the common terpene hydrocarbons (−)-(E)-β-caryophyllene (MrTPS1), (+)-germacrene A (MrTPS3), (E)-β-ocimene (MrTPS4) and (−)-germacrene D (MrTPS5). A fifth TPS, the multiproduct enzyme MrTPS2, was mainly expressed in roots and formed several Asteraceae-specific tricyclic sesquiterpenes with (−)-α-isocomene being the major product. The TPS transcript accumulation patterns in different organs of chamomile were consistent with the abundance of the corresponding TPS products isolated from these organs suggesting that the spatial regulation of TPS gene expression qualitatively contribute to terpene composition. Conclusions The terpene synthases characterized in this study are involved in the organ-specific formation of essential oils in chamomile. While the products of MrTPS1, MrTPS2, MrTPS4 and MrTPS5 accumulate in the oils without further chemical alterations, (+)-germacrene A produced by MrTPS3 accumulates only in trace amounts, indicating that it is converted into another compound like matricine. Thus, MrTPS3, but also the other TPS genes, are good markers for further breeding of chamomile cultivars rich in pharmaceutically active essential oils. PMID:22682202

Transcript Isoform Variation Associated with Cytosine Modification in Human Lymphoblastoid Cell Lines.

PubMed

Zhang, Xu; Zhang, Wei

2016-06-01

Cytosine modification on DNA is variable among individuals, which could correlate with gene expression variation. The effect of cytosine modification on interindividual transcript isoform variation (TIV), however, remains unclear. In this study, we assessed the extent of cytosine modification-specific TIV in lymphoblastoid cell lines (LCLs) derived from unrelated individuals of European and African descent. Our study detected cytosine modification-specific TIVs for 17% of the analyzed genes at a 5% false discovery rate. Forty-five percent of the TIV-associated cytosine modifications correlated with the overall gene expression levels as well, with the corresponding CpG sites overrepresented in transcript initiation sites, transcription factor binding sites, and distinct histone modification peaks, suggesting that alternative isoform transcription underlies the TIVs. Our analysis also revealed 33% of the TIV-associated cytosine modifications that affected specific exons, with the corresponding CpG sites overrepresented in exon/intron junctions, splicing branching points, and transcript termination sites, implying that the TIVs are attributable to alternative splicing or transcription termination. Genetic and epigenetic regulation of TIV shared target preference but exerted independent effects on 61% of the common exon targets. Cytosine modification-specific TIVs detected from LCLs were differentially enriched in those detected from various tissues in The Cancer Genome Atlas, indicating their developmental dependency. Genes containing cytosine modification-specific TIVs were enriched in pathways of cancers and metabolic disorders. Our study demonstrated a prominent effect of cytosine modification variation on the transcript isoform spectrum over gross transcript abundance and revealed epigenetic contributions to diseases that were mediated through cytosine modification-specific TIV. Copyright © 2016 by the Genetics Society of America.

Relative Contribution of Genetic and Non-genetic Modifiers to Intestinal Obstruction in Cystic Fibrosis

PubMed Central

Blackman, Scott M.; Deering-Brose, Rebecca; McWilliams, Rita; Naughton, Kathleen; Coleman, Barbara; Lai, Teresa; Algire, Marilyn; Beck, Suzanne; Hoover-Fong, Julie; Hamosh, Ada; Fallin, M. Daniele; West, Kristen; Arking, Dan E.; Chakravarti, Aravinda; Cutler, David J.; Cutting, Garry R

2006-01-01

Background & Aims Neonatal intestinal obstruction (meconium ileus or MI) occurs in 15% of patients with cystic fibrosis (CF). Our aim was to determine the relative contribution of genetic and non-genetic modifiers to the development of this major complication of CF. Methods Using clinical data and DNA collected by the CF Twin and Sibling Study, 65 monozygous twin pairs, 23 dizygous twin/triplet sets, and 349 sets of siblings with CF were analyzed for MI status, significant covariates, and genome-wide linkage. Results Specific mutations in CFTR, the gene responsible for CF, correlated with MI indicating a role for CFTR genotype. Monozygous twins showed substantially greater concordance for MI than dizygous twins and siblings (p=1×10−5) demonstrating that modifier genes independent of CFTR contribute substantially to this trait. Regression analysis revealed that MI was correlated with distal intestinal obstruction syndrome (DIOS; p=8×10−4). Unlike MI, concordance analysis indicated that the risk for development of DIOS in CF patients is primarily due to non-genetic factors. Regions of suggestive linkage (logarithm of the odds of linkage >2.0) for modifier genes that cause MI (chromosomes 4q35.1, 8p23.1, and 11q25) or protect from MI (chromosomes 20p11.22 and 21q22.3) were identified by genome-wide analyses. These analyses did not support the existence of a major modifier gene within the CFM1 region on chromosome 19 that had previously been linked to MI. Conclusions The CFTR gene along with two or more modifier genes are the major determinants of intestinal obstruction in newborn CF patients, while intestinal obstruction in older CF patients is primarily due to non-genetic factors. PMID:17030173

Genetic and phenotypic dissection of 1q43q44 microdeletion syndrome and neurodevelopmental phenotypes associated with mutations in ZBTB18 and HNRNPU.

PubMed

Depienne, Christel; Nava, Caroline; Keren, Boris; Heide, Solveig; Rastetter, Agnès; Passemard, Sandrine; Chantot-Bastaraud, Sandra; Moutard, Marie-Laure; Agrawal, Pankaj B; VanNoy, Grace; Stoler, Joan M; Amor, David J; Billette de Villemeur, Thierry; Doummar, Diane; Alby, Caroline; Cormier-Daire, Valérie; Garel, Catherine; Marzin, Pauline; Scheidecker, Sophie; de Saint-Martin, Anne; Hirsch, Edouard; Korff, Christian; Bottani, Armand; Faivre, Laurence; Verloes, Alain; Orzechowski, Christine; Burglen, Lydie; Leheup, Bruno; Roume, Joelle; Andrieux, Joris; Sheth, Frenny; Datar, Chaitanya; Parker, Michael J; Pasquier, Laurent; Odent, Sylvie; Naudion, Sophie; Delrue, Marie-Ange; Le Caignec, Cédric; Vincent, Marie; Isidor, Bertrand; Renaldo, Florence; Stewart, Fiona; Toutain, Annick; Koehler, Udo; Häckl, Birgit; von Stülpnagel, Celina; Kluger, Gerhard; Møller, Rikke S; Pal, Deb; Jonson, Tord; Soller, Maria; Verbeek, Nienke E; van Haelst, Mieke M; de Kovel, Carolien; Koeleman, Bobby; Monroe, Glen; van Haaften, Gijs; Attié-Bitach, Tania; Boutaud, Lucile; Héron, Delphine; Mignot, Cyril

2017-04-01

Subtelomeric 1q43q44 microdeletions cause a syndrome associating intellectual disability, microcephaly, seizures and anomalies of the corpus callosum. Despite several previous studies assessing genotype-phenotype correlations, the contribution of genes located in this region to the specific features of this syndrome remains uncertain. Among those, three genes, AKT3, HNRNPU and ZBTB18 are highly expressed in the brain and point mutations in these genes have been recently identified in children with neurodevelopmental phenotypes. In this study, we report the clinical and molecular data from 17 patients with 1q43q44 microdeletions, four with ZBTB18 mutations and seven with HNRNPU mutations, and review additional data from 37 previously published patients with 1q43q44 microdeletions. We compare clinical data of patients with 1q43q44 microdeletions with those of patients with point mutations in HNRNPU and ZBTB18 to assess the contribution of each gene as well as the possibility of epistasis between genes. Our study demonstrates that AKT3 haploinsufficiency is the main driver for microcephaly, whereas HNRNPU alteration mostly drives epilepsy and determines the degree of intellectual disability. ZBTB18 deletions or mutations are associated with variable corpus callosum anomalies with an incomplete penetrance. ZBTB18 may also contribute to microcephaly and HNRNPU to thin corpus callosum, but with a lower penetrance. Co-deletion of contiguous genes has additive effects. Our results confirm and refine the complex genotype-phenotype correlations existing in the 1qter microdeletion syndrome and define more precisely the neurodevelopmental phenotypes associated with genetic alterations of AKT3, ZBTB18 and HNRNPU in humans.

Post-transcriptional regulation mediated by specific neurofilament introns in vivo.

PubMed

Wang, Chen; Szaro, Ben G

2016-04-01

Neurons regulate genes post-transcriptionally to coordinate the supply of cytoskeletal proteins, such as the medium neurofilament (NEFM), with demand for structural materials in response to extracellular cues encountered by developing axons. By using a method for evaluating functionality of cis-regulatory gene elements in vivo through plasmid injection into Xenopus embryos, we discovered that splicing of a specific nefm intron was required for robust transgene expression, regardless of promoter or cell type. Transgenes utilizing the nefm 3'-UTR but substituting other nefm introns expressed little or no protein owing to defects in handling of the messenger (m)RNA as opposed to transcription or splicing. Post-transcriptional events at multiple steps, but mainly during nucleocytoplasmic export, contributed to these varied levels of protein expression. An intron of the β-globin gene was also able to promote expression in a manner identical to that of the nefm intron, implying a more general preference for certain introns in controlling nefm expression. These results expand our knowledge of intron-mediated gene expression to encompass neurofilaments, indicating an additional layer of complexity in the control of a cytoskeletal gene needed for developing and maintaining healthy axons. © 2016. Published by The Company of Biologists Ltd.

Genome-Wide Prediction of the Polymorphic Ser Gene Family in Tetrahymena thermophila Based on Motif Analysis

PubMed Central

Ponsuwanna, Patrath; Kümpornsin, Krittikorn; Chookajorn, Thanat

2014-01-01

Even though antigenic variation is employed among parasitic protozoa for host immune evasion, Tetrahymena thermophila, a free-living ciliate, can also change its surface protein antigens. These cysteine-rich glycosylphosphatidylinositol (GPI)-linked surface proteins are encoded by a family of polymorphic Ser genes. Despite the availability of T. thermophila genome, a comprehensive analysis of the Ser family is limited by its high degree of polymorphism. In order to overcome this problem, a new approach was adopted by searching for Ser candidates with common motif sequences, namely length-specific repetitive cysteine pattern and GPI anchor site. The candidate genes were phylogenetically compared with the previously identified Ser genes and classified into subtypes. Ser candidates were often found to be located as tandem arrays of the same subtypes on several chromosomal scaffolds. Certain Ser candidates located in the same chromosomal arrays were transcriptionally expressed at specific T. thermophila developmental stages. These Ser candidates selected by the motif analysis approach can form the foundation for a systematic identification of the entire Ser gene family, which will contribute to the understanding of their function and the basis of T. thermophila antigenic variation. PMID:25133747

Friendships Moderate an Association Between a Dopamine Gene Variant and Political Ideology.

PubMed

Settle, Jaime E; Dawes, Christopher T; Christakis, Nicholas A; Fowler, James H

2010-01-01

Scholars in many fields have long noted the importance of social context in the development of political ideology. Recent work suggests that political ideology also has a heritable component, but no specific gene variant or combination of variants associated with political ideology have so far been identified. Here, we hypothesize that individuals with a genetic predisposition toward seeking out new experiences will tend to be more liberal, but only if they are embedded in a social context that provides them with multiple points of view. Using data from the National Longitudinal Study of Adolescent Health, we test this hypothesis by investigating an association between self-reported political ideology and the 7R variant of the dopamine receptor D4 gene (DRD4), which has previously been associated with novelty seeking. Among those with DRD4-7R, we find that the number of friendships a person has in adolescence is significantly associated with liberal political ideology. Among those without the gene variant, there is no association. This is the first study to elaborate a specific gene-environment interaction that contributes to ideological self-identification, and it highlights the importance of incorporating both nature and nurture into the study of political preferences.

Friendships Moderate an Association Between a Dopamine Gene Variant and Political Ideology

PubMed Central

Settle, Jaime E.; Dawes, Christopher T.; Christakis, Nicholas A.; Fowler, James H.

2012-01-01

Scholars in many fields have long noted the importance of social context in the development of political ideology. Recent work suggests that political ideology also has a heritable component, but no specific gene variant or combination of variants associated with political ideology have so far been identified. Here, we hypothesize that individuals with a genetic predisposition toward seeking out new experiences will tend to be more liberal, but only if they are embedded in a social context that provides them with multiple points of view. Using data from the National Longitudinal Study of Adolescent Health, we test this hypothesis by investigating an association between self-reported political ideology and the 7R variant of the dopamine receptor D4 gene (DRD4), which has previously been associated with novelty seeking. Among those with DRD4-7R, we find that the number of friendships a person has in adolescence is significantly associated with liberal political ideology. Among those without the gene variant, there is no association. This is the first study to elaborate a specific gene-environment interaction that contributes to ideological self-identification, and it highlights the importance of incorporating both nature and nurture into the study of political preferences. PMID:22282583

T-Box Genes in Drosophila Mesoderm Development.

PubMed

Reim, I; Frasch, M; Schaub, C

2017-01-01

In Drosophila there are eight genes encoding transcription factors of the T-box family, which are known to exert a variety of crucial developmental functions during ectodermal patterning processes, neuronal cell specification, mesodermal tissue development, and the development of extraembryonic tissues. In this review, we focus on the prominent roles of Drosophila T-box genes in mesodermal tissues. First, we describe the contributions of brachyenteron (byn) and optomotor-blind-related-gene-1 (org-1) to the development of the visceral mesoderm. Second, we provide an overview on the functions of the three Dorsocross paralogs (Doc1-3) and the two Tbx20-related paralogs (midline and H15) during Drosophila heart development. Third, we portray the roles of org-1 and midline/H15 in the specification of individual body wall and organ-attached muscles, including the function of org-1 in the transdifferentiation of certain heart-attached muscles during metamorphosis. The functional analysis of these evolutionarily conserved T-box genes, along with their interactions with other types of transcription factors and various signaling pathways, has provided key insights into the regulation of Drosophila visceral mesoderm, muscle, and heart development. © 2017 Elsevier Inc. All rights reserved.

StPOTHR1, a NDR1/HIN1-like gene in Solanum tuberosum, enhances resistance against Phytophthora infestans.

PubMed

Chen, Qiansi; Tian, Zhendong; Jiang, Rui; Zheng, Xueao; Xie, Conghua; Liu, Jun

2018-02-19

A family of NDR1/HIN1-like (NHL) genes that shows homology to the nonrace-specific disease resistance (NDR1) and the tobacco (Nicotiana tabacum) harpin-induced (HIN1) genes is reported to be involved in defense. However, little information about NHL genes is available for the potato (Solanum tuberosum). Here, we report that the expression of StPOTHR1, a member of the NHL gene family, is associated with resistance in potato against Phytophthora infestans, and is specifically induced in inoculation sites. Overexpression of StPOTHR1 enhances resistance against P. infestans via restricting rapid pathogen proliferation. Further, suppression of StPOTHR1 does not compromise R-mediated cell death. Subcellular localization and posttranscription modifications (PTMs) analysis reveals that StPOTHR1 is localized in plasma membrane (PM) and undergoes multiple PTMs. Moreover, StPOTHR1 interacts with NbMKK5L, a component of the MAP kinase signaling cascade. Taken together, our results suggest that the PM-localized StPOTHR1 contributes to potato immunity against P. infestans and may be associated with the MAP kinase signaling cascade. Copyright © 2018 Elsevier Inc. All rights reserved.

Functional Study of Genes Essential for Autogamy and Nuclear Reorganization in Paramecium▿§

PubMed Central

Nowak, Jacek K.; Gromadka, Robert; Juszczuk, Marek; Jerka-Dziadosz, Maria; Maliszewska, Kamila; Mucchielli, Marie-Hélène; Gout, Jean-François; Arnaiz, Olivier; Agier, Nicolas; Tang, Thomas; Aggerbeck, Lawrence P.; Cohen, Jean; Delacroix, Hervé; Sperling, Linda; Herbert, Christopher J.; Zagulski, Marek; Bétermier, Mireille

2011-01-01

Like all ciliates, Paramecium tetraurelia is a unicellular eukaryote that harbors two kinds of nuclei within its cytoplasm. At each sexual cycle, a new somatic macronucleus (MAC) develops from the germ line micronucleus (MIC) through a sequence of complex events, which includes meiosis, karyogamy, and assembly of the MAC genome from MIC sequences. The latter process involves developmentally programmed genome rearrangements controlled by noncoding RNAs and a specialized RNA interference machinery. We describe our first attempts to identify genes and biological processes that contribute to the progression of the sexual cycle. Given the high percentage of unknown genes annotated in the P. tetraurelia genome, we applied a global strategy to monitor gene expression profiles during autogamy, a self-fertilization process. We focused this pilot study on the genes carried by the largest somatic chromosome and designed dedicated DNA arrays covering 484 genes from this chromosome (1.2% of all genes annotated in the genome). Transcriptome analysis revealed four major patterns of gene expression, including two successive waves of gene induction. Functional analysis of 15 upregulated genes revealed four that are essential for vegetative growth, one of which is involved in the maintenance of MAC integrity and another in cell division or membrane trafficking. Two additional genes, encoding a MIC-specific protein and a putative RNA helicase localizing to the old and then to the new MAC, are specifically required during sexual processes. Our work provides a proof of principle that genes essential for meiosis and nuclear reorganization can be uncovered following genome-wide transcriptome analysis. PMID:21257794

Muscle-specific deletion of Prkaa1 enhances skeletal muscle lipid accumulation in mice fed a high-fat diet.

PubMed

Wu, Weiche; Xu, Ziye; Zhang, Ling; Liu, Jiaqi; Feng, Jie; Wang, Xinxia; Shan, Tizhong; Wang, Yizhen

2018-05-01

Excessive intramyocellular triacylglycerols (IMTGs, muscle lipids) are associated with the abnormal energy metabolism and insulin resistance of skeletal muscle. AMP-activated protein kinase (AMPK), a crucial cellular energy sensor, consists of α, β and γ subunits. Researchers have not clearly determined whether Prkaa1 (also known as AMPKα1) affects IMTG accumulation in skeletal muscle. Here, we show an important role of Prkaa1 in skeletal muscle lipid metabolism. Deletion of muscle Prkaa1 leads to the delayed development of skeletal muscles but does not affect glucose tolerance or insulin sensitivity in animals fed a normal diet. Notably, when animals are fed a high-fat diet, the skeletal muscle of muscle-specific Prkaa1 knockout mice accumulates more lipids than the skeletal muscle of wild-type (WT) mice, with concomitant upregulation of adipogenic gene expressions and downregulation of the expression of genes associated with mitochondrial oxidation. Muscle-specific Prkaa1 ablation also results in hyperlipidemia, which may contribute to the increased IMTG levels. Furthermore, Prkaa1 deletion activates skeletal muscle mTOR signalling, which has a central role in lipid metabolism and mitochondrial oxidation. Collectively, our study provides new insights into the role of Prkaa1 in skeletal muscle. This knowledge may contribute to the treatment of related metabolic diseases.

Measuring, Reversing, and Modeling the Mechanical Changes Due to the Absence of Fibulin-4 in Mouse Arteries

PubMed Central

Le, Victoria P.; Yamashiro, Yoshito; Yanagisawa, Hiromi; Wagenseil, Jessica E.

2014-01-01

Mice with a smooth muscle cell (SMC) specific deletion of fibulin-4 (SMKO) show decreased expression of SMC contractile genes, decreased circumferential compliance, and develop aneurysms in the ascending aorta. Neonatal administration of drugs that inhibit the angiotensin II pathway encourage expression of contractile genes and prevent aneurysm development, but do not increase compliance in SMKO aorta. We hypothesized that multidimensional mechanical changes in the aorta and/or other elastic arteries may contribute to aneurysm pathophysiology. We found that the SMKO ascending aorta and carotid artery showed mechanical changes in the axial direction. These changes were not reversed by angiotensin II inhibitors, hence reversing the axial changes is not required for aneurysm prevention. Mechanical changes in the circumferential direction were specific to the ascending aorta, therefore mechanical changes in the carotid do not contribute to aortic aneurysm development. We also hypothesized that a published model of postnatal aortic growth and remodeling could be used to investigate mechanisms behind the changes in SMKO aorta and aneurysm development over time. Dimensions and mechanical behavior of adult SMKO aorta were reproduced by the model after modifying the initial component material constants and the aortic dilation with each postnatal time step. The model links biological observations to specific mechanical responses in aneurysm development and treatment. PMID:24526456

Measuring, reversing, and modeling the mechanical changes due to the absence of Fibulin-4 in mouse arteries.

PubMed

Le, Victoria P; Yamashiro, Yoshito; Yanagisawa, Hiromi; Wagenseil, Jessica E

2014-10-01

Mice with a smooth muscle cell (SMC)-specific deletion of Fibulin-4 (SMKO) show decreased expression of SMC contractile genes, decreased circumferential compliance, and develop aneurysms in the ascending aorta. Neonatal administration of drugs that inhibit the angiotensin II pathway encourages the expression of contractile genes and prevents aneurysm development, but does not increase compliance in SMKO aorta. We hypothesized that multidimensional mechanical changes in the aorta and/or other elastic arteries may contribute to aneurysm pathophysiology. We found that the SMKO ascending aorta and carotid artery showed mechanical changes in the axial direction. These changes were not reversed by angiotensin II inhibitors, hence reversing the axial changes is not required for aneurysm prevention. Mechanical changes in the circumferential direction were specific to the ascending aorta; therefore, mechanical changes in the carotid do not contribute to aortic aneurysm development. We also hypothesized that a published model of postnatal aortic growth and remodeling could be used to investigate mechanisms behind the changes in SMKO aorta and aneurysm development over time. Dimensions and mechanical behavior of adult SMKO aorta were reproduced by the model after modifying the initial component material constants and the aortic dilation with each postnatal time step. The model links biological observations to specific mechanical responses in aneurysm development and treatment.

The large soybean (Glycine max) WRKY TF family expanded by segmental duplication events and subsequent divergent selection among subgroups.

PubMed

Yin, Guangjun; Xu, Hongliang; Xiao, Shuyang; Qin, Yajuan; Li, Yaxuan; Yan, Yueming; Hu, Yingkao

2013-10-03

WRKY genes encode one of the most abundant groups of transcription factors in higher plants, and its members regulate important biological process such as growth, development, and responses to biotic and abiotic stresses. Although the soybean genome sequence has been published, functional studies on soybean genes still lag behind those of other species. We identified a total of 133 WRKY members in the soybean genome. According to structural features of their encoded proteins and to the phylogenetic tree, the soybean WRKY family could be classified into three groups (groups I, II, and III). A majority of WRKY genes (76.7%; 102 of 133) were segmentally duplicated and 13.5% (18 of 133) of the genes were tandemly duplicated. This pattern was not apparent in Arabidopsis or rice. The transcriptome atlas revealed notable differential expression in either transcript abundance or in expression patterns under normal growth conditions, which indicated wide functional divergence in this family. Furthermore, some critical amino acids were detected using DIVERGE v2.0 in specific comparisons, suggesting that these sites have contributed to functional divergence among groups or subgroups. In addition, site model and branch-site model analyses of positive Darwinian selection (PDS) showed that different selection regimes could have affected the evolution of these groups. Sites with high probabilities of having been under PDS were found in groups I, II c, II e, and III. Together, these results contribute to a detailed understanding of the molecular evolution of the WRKY gene family in soybean. In this work, all the WRKY genes, which were generated mainly through segmental duplication, were identified in the soybean genome. Moreover, differential expression and functional divergence of the duplicated WRKY genes were two major features of this family throughout their evolutionary history. Positive selection analysis revealed that the different groups have different evolutionary rates. Together, these results contribute to a detailed understanding of the molecular evolution of the WRKY gene family in soybean.

Identification of Putative Transmembrane Proteins Involved in Salinity Tolerance in Chenopodium quinoa by Integrating Physiological Data, RNAseq, and SNP Analyses

PubMed Central

Schmöckel, Sandra M.; Lightfoot, Damien J.; Razali, Rozaimi; Tester, Mark; Jarvis, David E.

2017-01-01

Chenopodium quinoa (quinoa) is an emerging crop that produces nutritious grains with the potential to contribute to global food security. Quinoa can also grow on marginal lands, such as soils affected by high salinity. To identify candidate salt tolerance genes in the recently sequenced quinoa genome, we used a multifaceted approach integrating RNAseq analyses with comparative genomics and topology prediction. We identified 219 candidate genes by selecting those that were differentially expressed in response to salinity, were specific to or overrepresented in quinoa relative to other Amaranthaceae species, and had more than one predicted transmembrane domain. To determine whether these genes might underlie variation in salinity tolerance in quinoa and its close relatives, we compared the response to salinity stress in a panel of 21 Chenopodium accessions (14 C. quinoa, 5 C. berlandieri, and 2 C. hircinum). We found large variation in salinity tolerance, with one C. hircinum displaying the highest salinity tolerance. Using genome re-sequencing data from these accessions, we investigated single nucleotide polymorphisms and copy number variation (CNV) in the 219 candidate genes in accessions of contrasting salinity tolerance, and identified 15 genes that could contribute to the differences in salinity tolerance of these Chenopodium accessions. PMID:28680429

Characterization of Arabidopsis Transcriptional Responses to Different Aphid Species Reveals Genes that Contribute to Host Susceptibility and Non-host Resistance

PubMed Central

Jaouannet, Maëlle; Morris, Jenny A.; Hedley, Peter E.; Bos, Jorunn I. B.

2015-01-01

Aphids are economically important pests that display exceptional variation in host range. The determinants of diverse aphid host ranges are not well understood, but it is likely that molecular interactions are involved. With significant progress being made towards understanding host responses upon aphid attack, the mechanisms underlying non-host resistance remain to be elucidated. Here, we investigated and compared Arabidopsis thaliana host and non-host responses to aphids at the transcriptional level using three different aphid species, Myzus persicae, Myzus cerasi and Rhopalosiphum pisum. Gene expression analyses revealed a high level of overlap in the overall gene expression changes during the host and non-host interactions with regards to the sets of genes differentially expressed and the direction of expression changes. Despite this overlap in transcriptional responses across interactions, there was a stronger repression of genes involved in metabolism and oxidative responses specifically during the host interaction with M. persicae. In addition, we identified a set of genes with opposite gene expression patterns during the host versus non-host interactions. Aphid performance assays on Arabidopsis mutants that were selected based on our transcriptome analyses identified novel genes contributing to host susceptibility, host defences during interactions with M. persicae as well to non-host resistance against R. padi. Understanding how plants respond to aphid species that differ in their ability to infest plant species, and identifying the genes and signaling pathways involved, is essential for the development of novel and durable aphid control in crop plants. PMID:25993686

Preliminary molecular detection of the somatic embryogenesis receptor-like kinase (VpSERK) and knotted-like homeobox (VpKNOX1) genes during in vitro morphogenesis of Vanilla planifolia Jacks.

PubMed

Ramírez-Mosqueda, Marco A; Iglesias-Andreu, Lourdes G; Sáenz, Luis; Córdova, Iván

2018-02-01

This work aimed to evaluate the embryogenic competence of different tissues from different stages (friable callus, bud-regenerating callus, and whole buds) of Vanilla planifolia , through the molecular detection of the somatic embryogenesis receptor-like kinase ( VpSERK ) and knotted-like homeobox ( VpKNOX1 ) genes. RNA was extracted with Trizol ® , cDNA was obtained, and the studied transcripts were amplified. Using non-specific primers, VpSERK and VpSTM gene expression was detected in the three stages evaluated. This study might contribute to providing an explanation for the recalcitrance of this Vanilla species to somatic embryogenesis.

Expression of Terminal Effector Genes in Mammalian Neurons Is Maintained by a Dynamic Relay of Transient Enhancers.

PubMed

Rhee, Ho Sung; Closser, Michael; Guo, Yuchun; Bashkirova, Elizaveta V; Tan, G Christopher; Gifford, David K; Wichterle, Hynek

2016-12-21

Generic spinal motor neuron identity is established by cooperative binding of programming transcription factors (TFs), Isl1 and Lhx3, to motor-neuron-specific enhancers. How expression of effector genes is maintained following downregulation of programming TFs in maturing neurons remains unknown. High-resolution exonuclease (ChIP-exo) mapping revealed that the majority of enhancers established by programming TFs are rapidly deactivated following Lhx3 downregulation in stem-cell-derived hypaxial motor neurons. Isl1 is released from nascent motor neuron enhancers and recruited to new enhancers bound by clusters of Onecut1 in maturing neurons. Synthetic enhancer reporter assays revealed that Isl1 operates as an integrator factor, translating the density of Lhx3 or Onecut1 binding sites into transient enhancer activity. Importantly, independent Isl1/Lhx3- and Isl1/Onecut1-bound enhancers contribute to sustained expression of motor neuron effector genes, demonstrating that outwardly stable expression of terminal effector genes in postmitotic neurons is controlled by a dynamic relay of stage-specific enhancers. Copyright © 2016 Elsevier Inc. All rights reserved.

SR proteins in Vertical Integration of Gene Expression from Transcription to RNA Processing to Translation

PubMed Central

Zhong, Xiang-Yang; Wang, Pingping; Han, Joonhee; Rosenfeld, Michael G.; Fu, Xiang-Dong

2009-01-01

Summary SR proteins have been studied extensively as a family of RNA binding proteins that participate in both constitutive and regulated pre-mRNA splicing in mammalian cells. However, SR proteins were first discovered as factors that interact with transcriptionally active chromatin. Recent studies have now uncovered properties that connect these once apparently disparate functions, showing that a subset of SR proteins seem to bind directly to the histone 3 tail, play an active role in transcriptional elongation, and co-localize with genes that are engaged in specific intra- and inter-chromosome interactions for coordinated regulation of gene expression in the nucleus. These transcription-related activities are also coupled with a further expansion of putative functions of specific SR protein family members in RNA metabolism downstream of mRNA splicing, from RNA export to stability control to translation. These findings therefore highlight the broader roles of SR proteins in vertical integration of gene expression and provide mechanistic insights into their contributions to genome stability and proper cell cycle progression in higher eukaryotic cells. PMID:19595711

SR proteins in vertical integration of gene expression from transcription to RNA processing to translation.

PubMed

Zhong, Xiang-Yang; Wang, Pingping; Han, Joonhee; Rosenfeld, Michael G; Fu, Xiang-Dong

2009-07-10

SR proteins have been studied extensively as a family of RNA-binding proteins that participate in both constitutive and regulated pre-mRNA splicing in mammalian cells. However, SR proteins were first discovered as factors that interact with transcriptionally active chromatin. Recent studies have now uncovered properties that connect these once apparently disparate functions, showing that a subset of SR proteins seem to bind directly to the histone 3 tail, play an active role in transcriptional elongation, and colocalize with genes that are engaged in specific intra- and interchromosome interactions for coordinated regulation of gene expression in the nucleus. These transcription-related activities are also coupled with a further expansion of putative functions of specific SR protein family members in RNA metabolism downstream of mRNA splicing, from RNA export to stability control to translation. These findings, therefore, highlight the broader roles of SR proteins in vertical integration of gene expression and provide mechanistic insights into their contributions to genome stability and proper cell-cycle progression in higher eukaryotic cells.

Transcriptional Regulation of Pattern-Triggered Immunity in Plants.

PubMed

Li, Bo; Meng, Xiangzong; Shan, Libo; He, Ping

2016-05-11

Perception of microbe-associated molecular patterns (MAMPs) by cell-surface-resident pattern recognition receptors (PRRs) induces rapid, robust, and selective transcriptional reprogramming, which is central for launching effective pattern-triggered immunity (PTI) in plants. Signal relay from PRR complexes to the nuclear transcriptional machinery via intracellular kinase cascades rapidly activates primary immune response genes. The coordinated action of gene-specific transcription factors and the general transcriptional machinery contribute to the selectivity of immune gene activation. In addition, PRR complexes and signaling components are often transcriptionally upregulated upon MAMP perception to ensure the robustness and sustainability of PTI outputs. In this review, we discuss recent advances in deciphering the signaling pathways and regulatory mechanisms that coordinately lead to timely and accurate MAMP-induced gene expression in plants. Copyright © 2016 Elsevier Inc. All rights reserved.

Differential Retention of Gene Functions in a Secondary Metabolite Cluster.

PubMed

Reynolds, Hannah T; Slot, Jason C; Divon, Hege H; Lysøe, Erik; Proctor, Robert H; Brown, Daren W

2017-08-01

In fungi, distribution of secondary metabolite (SM) gene clusters is often associated with host- or environment-specific benefits provided by SMs. In the plant pathogen Alternaria brassicicola (Dothideomycetes), the DEP cluster confers an ability to synthesize the SM depudecin, a histone deacetylase inhibitor that contributes weakly to virulence. The DEP cluster includes genes encoding enzymes, a transporter, and a transcription regulator. We investigated the distribution and evolution of the DEP cluster in 585 fungal genomes and found a wide but sporadic distribution among Dothideomycetes, Sordariomycetes, and Eurotiomycetes. We confirmed DEP gene expression and depudecin production in one fungus, Fusarium langsethiae. Phylogenetic analyses suggested 6-10 horizontal gene transfers (HGTs) of the cluster, including a transfer that led to the presence of closely related cluster homologs in Alternaria and Fusarium. The analyses also indicated that HGTs were frequently followed by loss/pseudogenization of one or more DEP genes. Independent cluster inactivation was inferred in at least four fungal classes. Analyses of transitions among functional, pseudogenized, and absent states of DEP genes among Fusarium species suggest enzyme-encoding genes are lost at higher rates than the transporter (DEP3) and regulatory (DEP6) genes. The phenotype of an experimentally-induced DEP3 mutant of Fusarium did not support the hypothesis that selective retention of DEP3 and DEP6 protects fungi from exogenous depudecin. Together, the results suggest that HGT and gene loss have contributed significantly to DEP cluster distribution, and that some DEP genes provide a greater fitness benefit possibly due to a differential tendency to form network connections. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution 2017. This work is written by US Government employees and is in the public domain in the US.

Metabolic Coevolution in the Bacterial Symbiosis of Whiteflies and Related Plant Sap-Feeding Insects.

PubMed

Luan, Jun-Bo; Chen, Wenbo; Hasegawa, Daniel K; Simmons, Alvin M; Wintermantel, William M; Ling, Kai-Shu; Fei, Zhangjun; Liu, Shu-Sheng; Douglas, Angela E

2015-09-15

Genomic decay is a common feature of intracellular bacteria that have entered into symbiosis with plant sap-feeding insects. This study of the whitefly Bemisia tabaci and two bacteria (Portiera aleyrodidarum and Hamiltonella defensa) cohoused in each host cell investigated whether the decay of Portiera metabolism genes is complemented by host and Hamiltonella genes, and compared the metabolic traits of the whitefly symbiosis with other sap-feeding insects (aphids, psyllids, and mealybugs). Parallel genomic and transcriptomic analysis revealed that the host genome contributes multiple metabolic reactions that complement or duplicate Portiera function, and that Hamiltonella may contribute multiple cofactors and one essential amino acid, lysine. Homologs of the Bemisia metabolism genes of insect origin have also been implicated in essential amino acid synthesis in other sap-feeding insect hosts, indicative of parallel coevolution of shared metabolic pathways across multiple symbioses. Further metabolism genes coded in the Bemisia genome are of bacterial origin, but phylogenetically distinct from Portiera, Hamiltonella and horizontally transferred genes identified in other sap-feeding insects. Overall, 75% of the metabolism genes of bacterial origin are functionally unique to one symbiosis, indicating that the evolutionary history of metabolic integration in these symbioses is strongly contingent on the pattern of horizontally acquired genes. Our analysis, further, shows that bacteria with genomic decay enable host acquisition of complex metabolic pathways by multiple independent horizontal gene transfers from exogenous bacteria. Specifically, each horizontally acquired gene can function with other genes in the pathway coded by the symbiont, while facilitating the decay of the symbiont gene coding the same reaction. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Memory retrieval after contextual fear conditioning induces c-Fos and JunB expression in CA1 hippocampus.

PubMed

Strekalova, T; Zörner, B; Zacher, C; Sadovska, G; Herdegen, T; Gass, P

2003-02-01

Using specific polyclonal antisera against c-Fos, JunB, c-Jun and JunD, we tried to identify the candidate transcription factors of the immediate early gene family which may contribute to the molecular processes during contextual memory reconsolidation. For that purpose we analyzed the expression of these proteins in the hippocampus after contextual memory retrieval in a mouse model of fear conditioning. A single exposure to a foot shock of 0.8 mA was sufficient to induce robust contextual fear conditioning in C57BI/6N mice. In these mice context dependent memory retrieval evoked a marked induction of c-Fos and JunB, but not of c-Jun and JunD, in pyramidal CA1 neurons of the dorsal hippocampus. In contrast, mice exposed and re-exposed only to the context, without foot shock, did not show behavioral signs of contextual fear conditioning and exhibited significantly less expression of c-Fos and JunB in CA1 neurons. Mice which received a foot shock but were not re-exposed to the context revealed no immediate early gene induction. These results demonstrate that contextual memory retrieval is associated with de novo synthesis of specific members of the Fos/Jun transcription factor family. Therefore we suggest that these genes may contribute to plasticity and reconsolidation accompanying the retrieval process. The specific activation of CA1 neurons during the retrieval of contextual fear associations supports the postulated concept of a mnemonic role of this hippocampal subsector during the retrieval of contextual informations.

Positive transcriptional regulation of the human micro opioid receptor gene by poly(ADP-ribose) polymerase-1 and increase of its DNA binding affinity based on polymorphism of G-172 -> T.

PubMed

Ono, Takeshi; Kaneda, Toshio; Muto, Akihiro; Yoshida, Tadashi

2009-07-24

Micro opioid receptor (MOR) agonists such as morphine are applied widely in clinical practice as pain therapy. The effects of morphine through MOR, such as analgesia and development of tolerance and dependence, are influenced by individual specificity. Recently, we analyzed single nucleotide polymorphisms on the human MOR gene to investigate the factors that contribute to individual specificity. In process of single nucleotide polymorphisms analysis, we found that specific nuclear proteins bound to G(-172) --> T region in exon 1 in MOR gene, and its affinity to DNA was increased by base substitution from G(-172) to T(-172). The isolated protein was identified by mass spectrometry and was confirmed by Western blotting to be poly(ADP-ribose) polymerase-1 (PARP-1). The overexpressed PARP-1 bound to G(-172) --> T and enhanced the transcription of reporter vectors containing G(-172) and T(-172). Furthermore, PARP-1 inhibitor (benzamide) decreased PARP-1 binding to G(-172) --> T without affecting mRNA or protein expression level of PARP-1 and down-regulated the subsequent MOR gene expression in SH-SY5Y cells. Moreover, we found that tumor necrosis factor-alpha enhanced MOR gene expression as well as increased PARP-1 binding to the G(-172) --> T region and G(-172) --> T-dependent transcription in SH-SY5Y cells. These effects were also inhibited by benzamide. In this study, our data suggest that PARP-1 positively regulates MOR gene transcription via G(-172) --> T, which might influence individual specificity in therapeutic opioid effects.

Profound Tissue Specificity in Proliferation Control Underlies Cancer Drivers and Aneuploidy Patterns.

PubMed

Sack, Laura Magill; Davoli, Teresa; Li, Mamie Z; Li, Yuyang; Xu, Qikai; Naxerova, Kamila; Wooten, Eric C; Bernardi, Ronald J; Martin, Timothy D; Chen, Ting; Leng, Yumei; Liang, Anthony C; Scorsone, Kathleen A; Westbrook, Thomas F; Wong, Kwok-Kin; Elledge, Stephen J

2018-04-05

Genomics has provided a detailed structural description of the cancer genome. Identifying oncogenic drivers that work primarily through dosage changes is a current challenge. Unrestrained proliferation is a critical hallmark of cancer. We constructed modular, barcoded libraries of human open reading frames (ORFs) and performed screens for proliferation regulators in multiple cell types. Approximately 10% of genes regulate proliferation, with most performing in an unexpectedly highly tissue-specific manner. Proliferation drivers in a given cell type showed specific enrichment in somatic copy number changes (SCNAs) from cognate tumors and helped predict aneuploidy patterns in those tumors, implying that tissue-type-specific genetic network architectures underlie SCNA and driver selection in different cancers. In vivo screening confirmed these results. We report a substantial contribution to the catalog of SCNA-associated cancer drivers, identifying 147 amplified and 107 deleted genes as potential drivers, and derive insights about the genetic network architecture of aneuploidy in tumors. Copyright © 2018 Elsevier Inc. All rights reserved.

An Integrated Genomic Approach for Rapid Delineation of Candidate Genes Regulating Agro-Morphological Traits in Chickpea

PubMed Central

Saxena, Maneesha S.; Bajaj, Deepak; Das, Shouvik; Kujur, Alice; Kumar, Vinod; Singh, Mohar; Bansal, Kailash C.; Tyagi, Akhilesh K.; Parida, Swarup K.

2014-01-01

The identification and fine mapping of robust quantitative trait loci (QTLs)/genes governing important agro-morphological traits in chickpea still lacks systematic efforts at a genome-wide scale involving wild Cicer accessions. In this context, an 834 simple sequence repeat and single-nucleotide polymorphism marker-based high-density genetic linkage map between cultivated and wild parental accessions (Cicer arietinum desi cv. ICC 4958 and Cicer reticulatum wild cv. ICC 17160) was constructed. This inter-specific genetic map comprising eight linkage groups spanned a map length of 949.4 cM with an average inter-marker distance of 1.14 cM. Eleven novel major genomic regions harbouring 15 robust QTLs (15.6–39.8% R2 at 4.2–15.7 logarithm of odds) associated with four agro-morphological traits (100-seed weight, pod and branch number/plant and plant hairiness) were identified and mapped on chickpea chromosomes. Most of these QTLs showed positive additive gene effects with effective allelic contribution from ICC 4958, particularly for increasing seed weight (SW) and pod and branch number. One robust SW-influencing major QTL region (qSW4.2) has been narrowed down by combining QTL mapping with high-resolution QTL region-specific association analysis, differential expression profiling and gene haplotype-based association/LD mapping. This enabled to delineate a strong SW-regulating ABI3VP1 transcription factor (TF) gene at trait-specific QTL interval and consequently identified favourable natural allelic variants and superior high seed weight-specific haplotypes in the upstream regulatory region of this gene showing increased transcript expression during seed development. The genes (TFs) harbouring diverse trait-regulating QTLs, once validated and fine-mapped by our developed rapid integrated genomic approach and through gene/QTL map-based cloning, can be utilized as potential candidates for marker-assisted genetic enhancement of chickpea. PMID:25335477

Specific down-regulation of spermatogenesis genes targeted by 22G RNAs in hybrid sterile males associated with an X-Chromosome introgression.

PubMed

Li, Runsheng; Ren, Xiaoliang; Bi, Yu; Ho, Vincy Wing Sze; Hsieh, Chia-Ling; Young, Amanda; Zhang, Zhihong; Lin, Tingting; Zhao, Yanmei; Miao, Long; Sarkies, Peter; Zhao, Zhongying

2016-09-01

Hybrid incompatibility (HI) prevents gene flow between species, thus lying at the heart of speciation genetics. One of the most common HIs is male sterility. Two superficially contradictory observations exist for hybrid male sterility. First, an introgression on the X Chromosome is more likely to produce male sterility than on autosome (so-called large-X theory); second, spermatogenesis genes are enriched on the autosomes but depleted on the X Chromosome (demasculinization of X Chromosome). Analysis of gene expression in Drosophila hybrids suggests a genetic interaction between the X Chromosome and autosomes that is essential for male fertility. However, the prevalence of such an interaction and its underlying mechanism remain largely unknown. Here we examine the interaction in nematode species by contrasting the expression of both coding genes and transposable elements (TEs) between hybrid sterile males and its parental nematode males. We use two lines of hybrid sterile males, each carrying an independent introgression fragment from Caenorhabditis briggsae X Chromosome in an otherwise Caenorhabditis nigoni background, which demonstrate similar defects in spermatogenesis. We observe a similar pattern of down-regulated genes that are specific for spermatogenesis between the two hybrids. Importantly, the down-regulated genes caused by the X Chromosome introgressions show a significant enrichment on the autosomes, supporting an epistatic interaction between the X Chromosome and autosomes. We investigate the underlying mechanism of the interaction by measuring small RNAs and find that a subset of 22G RNAs specifically targeting the down-regulated spermatogenesis genes is significantly up-regulated in hybrids, suggesting that perturbation of small RNA-mediated regulation may contribute to the X-autosome interaction. © 2016 Li et al.; Published by Cold Spring Harbor Laboratory Press.

Genome-Wide Identification, Evolution and Expression Analysis of mTERF Gene Family in Maize

PubMed Central

Zhao, Yanxin; Cai, Manjun; Zhang, Xiaobo; Li, Yurong; Zhang, Jianhua; Zhao, Hailiang; Kong, Fei; Zheng, Yonglian; Qiu, Fazhan

2014-01-01

Plant mitochondrial transcription termination factor (mTERF) genes comprise a large family with important roles in regulating organelle gene expression. In this study, a comprehensive database search yielded 31 potential mTERF genes in maize (Zea mays L.) and most of them were targeted to mitochondria or chloroplasts. Maize mTERF were divided into nine main groups based on phylogenetic analysis, and group IX represented the mitochondria and species-specific clade that diverged from other groups. Tandem and segmental duplication both contributed to the expansion of the mTERF gene family in the maize genome. Comprehensive expression analysis of these genes, using microarray data and RNA-seq data, revealed that these genes exhibit a variety of expression patterns. Environmental stimulus experiments revealed differential up or down-regulation expression of maize mTERF genes in seedlings exposed to light/dark, salts and plant hormones, respectively, suggesting various important roles of maize mTERF genes in light acclimation and stress-related responses. These results will be useful for elucidating the roles of mTERF genes in the growth, development and stress response of maize. PMID:24718683

Tissue-specific mRNA expression profiling in grape berry tissues

PubMed Central

Grimplet, Jerome; Deluc, Laurent G; Tillett, Richard L; Wheatley, Matthew D; Schlauch, Karen A; Cramer, Grant R; Cushman, John C

2007-01-01

Background Berries of grape (Vitis vinifera) contain three major tissue types (skin, pulp and seed) all of which contribute to the aroma, color, and flavor characters of wine. The pericarp, which is composed of the exocarp (skin) and mesocarp (pulp), not only functions to protect and feed the developing seed, but also to assist in the dispersal of the mature seed by avian and mammalian vectors. The skin provides volatile and nonvolatile aroma and color compounds, the pulp contributes organic acids and sugars, and the seeds provide condensed tannins, all of which are important to the formation of organoleptic characteristics of wine. In order to understand the transcriptional network responsible for controlling tissue-specific mRNA expression patterns, mRNA expression profiling was conducted on each tissue of mature berries of V. vinifera Cabernet Sauvignon using the Affymetrix GeneChip® Vitis oligonucleotide microarray ver. 1.0. In order to monitor the influence of water-deficit stress on tissue-specific expression patterns, mRNA expression profiles were also compared from mature berries harvested from vines subjected to well-watered or water-deficit conditions. Results Overall, berry tissues were found to express approximately 76% of genes represented on the Vitis microarray. Approximately 60% of these genes exhibited significant differential expression in one or more of the three major tissue types with more than 28% of genes showing pronounced (2-fold or greater) differences in mRNA expression. The largest difference in tissue-specific expression was observed between the seed and pulp/skin. Exocarp tissue, which is involved in pathogen defense and pigment production, showed higher mRNA abundance relative to other berry tissues for genes involved with flavonoid biosynthesis, pathogen resistance, and cell wall modification. Mesocarp tissue, which is considered a nutritive tissue, exhibited a higher mRNA abundance of genes involved in cell wall function and transport processes. Seeds, which supply essential resources for embryo development, showed higher mRNA abundance of genes encoding phenylpropanoid biosynthetic enzymes, seed storage proteins, and late embryogenesis abundant proteins. Water-deficit stress affected the mRNA abundance of 13% of the genes with differential expression patterns occurring mainly in the pulp and skin. In pulp and seed tissues transcript abundance in most functional categories declined in water-deficit stressed vines relative to well-watered vines with transcripts for storage proteins and novel (no-hit) functional assignments being over represented. In the skin of berries from water-deficit stressed vines, however, transcripts from several functional categories including general phenypropanoid and ethylene metabolism, pathogenesis-related responses, energy, and interaction with the environment were significantly over-represented. Conclusion These results revealed novel insights into the tissue-specific expression mRNA expression patterns of an extensive repertoire of genes expressed in berry tissues. This work also establishes an extensive catalogue of gene expression patterns for future investigations aimed at the dissection of the transcriptional regulatory hierarchies that govern tissue-specific expression patterns associated with tissue differentiation within berries. These results also confirmed that water-deficit stress has a profound effect on mRNA expression patterns particularly associated with the biosynthesis of aroma and color metabolites within skin and pulp tissues that ultimately impact wine quality. PMID:17584945

Differential gene expression in Daphnia magna suggests distinct modes of action and bioavailability for ZnO nanoparticles and Zn ions.

PubMed

Poynton, Helen C; Lazorchak, James M; Impellitteri, Christopher A; Smith, Mark E; Rogers, Kim; Patra, Manomita; Hammer, Katherine A; Allen, H Joel; Vulpe, Chris D

2011-01-15

Zinc oxide nanoparticles (ZnO NPs) are being rapidly developed for use in consumer products, wastewater treatment, and chemotherapy providing several possible routes for ZnO NP exposure to humans and aquatic organisms. Recent studies have shown that ZnO NPs undergo rapid dissolution to Zn(2+), but the relative contribution of Zn(2+) to ZnO NP bioavailability and toxicity is not clear. We show that a fraction of the ZnO NPs in suspension dissolves, and this fraction cannot account for the toxicity of the ZnO NP suspensions to Daphnia magna. Gene expression profiling of D. magna exposed to ZnO NPs or ZnSO(4) at sublethal concentrations revealed distinct modes of toxicity. There was also little overlap in gene expression between ZnO NPs and SiO(x) NPs, suggesting specificity for the ZnO NP expression profile. ZnO NPs effected expression of genes involved in cytoskeletal transport, cellular respiration, and reproduction. A specific pattern of differential expression of three biomarker genes including a multicystatin, ferritin, and C1q containing gene were confirmed for ZnO NP exposure and provide a suite of biomarkers for identifying environmental exposure to ZnO NPs and differentiating between NP and ionic exposure.

Influence of molecular weight upon mannosylated bio-synthetic hybrids for targeted antigen presenting cell gene delivery.

PubMed

Jones, Charles H; Gollakota, Akhila; Chen, Mingfu; Chung, Tai-Chun; Ravikrishnan, Anitha; Zhang, Guojian; Pfeifer, Blaine A

2015-07-01

Given the rise of antibiotic resistant microbes, genetic vaccination is a promising prophylactic strategy that enables rapid design and manufacture. Facilitating this process is the choice of vector, which is often situationally-specific and limited in engineering capacity. Furthermore, these shortcomings are usually tied to an incomplete understanding of the structure-function relationships driving vector-mediated gene delivery. Building upon our initial report of a hybrid bacterial-biomaterial gene delivery vector, a comprehensive structure-function assessment was completed using a class of mannosylated poly(beta-amino esters). Through a top-down screening methodology, an ideal polymer was selected on the basis of gene delivery efficacy and then used for the synthesis of a stratified molecular weight polymer library. By eliminating contributions of polymer chemical background, we were able to complete an in-depth assessment of gene delivery as a function of (1) polymer molecular weight, (2) relative mannose content, (3) polymer-membrane biophysical properties, (4) APC uptake specificity, and (5) serum inhibition. In summary, the flexibility and potential of the hybrid design featured in this work highlights the ability to systematically probe vector-associated properties for the development of translational gene delivery candidates. Copyright © 2015 Elsevier Ltd. All rights reserved.

"Orphan" retrogenes in the human genome.

PubMed

Ciomborowska, Joanna; Rosikiewicz, Wojciech; Szklarczyk, Damian; Makałowski, Wojciech; Makałowska, Izabela

2013-02-01

Gene duplicates generated via retroposition were long thought to be pseudogenized and consequently decayed. However, a significant number of these genes escaped their evolutionary destiny and evolved into functional genes. Despite multiple studies, the number of functional retrogenes in human and other genomes remains unclear. We performed a comparative analysis of human, chicken, and worm genomes to identify "orphan" retrogenes, that is, retrogenes that have replaced their progenitors. We located 25 such candidates in the human genome. All of these genes were previously known, and the majority has been intensively studied. Despite this, they have never been recognized as retrogenes. Analysis revealed that the phenomenon of replacing parental genes with their retrocopies has been taking place over the entire span of animal evolution. This process was often species specific and contributed to interspecies differences. Surprisingly, these retrogenes, which should evolve in a more relaxed mode, are subject to a very strong purifying selection, which is, on average, two and a half times stronger than other human genes. Also, for retrogenes, they do not show a typical overall tendency for a testis-specific expression. Notably, seven of them are associated with human diseases. Recognizing them as "orphan" retrocopies, which have different regulatory machinery than their parents, is important for any disease studies in model organisms, especially when discoveries made in one species are transferred to humans.

Contribution of Salmonella Enteritidis virulence factors to intestinal colonization and systemic dissemination in 1-day-old chickens.

PubMed

Addwebi, Tarek M; Call, Douglas R; Shah, Devendra H

2014-04-01

Salmonella enterica serovar Enteritidis is one of the most common serovars associated with poultry and poultry product contamination in the United States. We previously identified 14 mutant strains of Salmonella Enteritidis phage type 4 (PT4) with significantly reduced invasiveness in human intestinal epithelial cells (Caco-2), chicken macrophages (HD-11), and chicken hepatocellular epithelial cells (LMH). These included Salmonella Enteritidis mutants with transposon insertions in 6 newly identified Salmonella Enteritidis-specific genes (pegD and SEN1393), and genes or genomic islands common to most other Salmonella serovars (SEN0803, SEN0034, SEN2278, and SEN3503) along with 8 genes previously known to contribute to enteric infection (hilA, pipA, fliH, fljB, csgB, spvR, and rfbMN). We hypothesized that Salmonella Enteritidis employs both common Salmonella enterica colonization factors and Salmonella Enteritidis-specific traits to establish infection in chickens. Four Salmonella Enteritidis mutants (SEN0034::Tn5, fliH::Tn5, SEN1393::Tn5, and spvR::Tn5) were indistinguishable from the isogenic wild-type strain when orally inoculated in 1-d-old chickens, whereas 2 mutants (CsgB::Tn5 and PegD::Tn5) were defective for intestinal colonization (P < 0.05) and 8 mutants (hilA::Tn5, SEN3503::Tn5, SEN0803::Tn5, SEN2278::Tn5, fljB::Tn5, rfbM::Tn5, rfbN::Tn5, and pipA::Tn5) showed significant in vivo attenuation in more than one organ (P < 0.05). Complementation studies confirmed the role of rfbN and SEN3503 during infection. This study should contribute to a better understanding of the mechanisms involved in Salmonella Enteritidis pathogenesis, and the target genes identified here could potentially serve as targets for the development of live-attenuated or subunit vaccine.

Gene networks underlying convergent and pleiotropic phenotypes in a large and systematically-phenotyped cohort with heterogeneous developmental disorders.

PubMed

Andrews, Tallulah; Meader, Stephen; Vulto-van Silfhout, Anneke; Taylor, Avigail; Steinberg, Julia; Hehir-Kwa, Jayne; Pfundt, Rolph; de Leeuw, Nicole; de Vries, Bert B A; Webber, Caleb

2015-03-01

Readily-accessible and standardised capture of genotypic variation has revolutionised our understanding of the genetic contribution to disease. Unfortunately, the corresponding systematic capture of patient phenotypic variation needed to fully interpret the impact of genetic variation has lagged far behind. Exploiting deep and systematic phenotyping of a cohort of 197 patients presenting with heterogeneous developmental disorders and whose genomes harbour de novo CNVs, we systematically applied a range of commonly-used functional genomics approaches to identify the underlying molecular perturbations and their phenotypic impact. Grouping patients into 408 non-exclusive patient-phenotype groups, we identified a functional association amongst the genes disrupted in 209 (51%) groups. We find evidence for a significant number of molecular interactions amongst the association-contributing genes, including a single highly-interconnected network disrupted in 20% of patients with intellectual disability, and show using microcephaly how these molecular networks can be used as baits to identify additional members whose genes are variant in other patients with the same phenotype. Exploiting the systematic phenotyping of this cohort, we observe phenotypic concordance amongst patients whose variant genes contribute to the same functional association but note that (i) this relationship shows significant variation across the different approaches used to infer a commonly perturbed molecular pathway, and (ii) that the phenotypic similarities detected amongst patients who share the same inferred pathway perturbation result from these patients sharing many distinct phenotypes, rather than sharing a more specific phenotype, inferring that these pathways are best characterized by their pleiotropic effects.

Computational dissection of human episodic memory reveals mental process-specific genetic profiles

PubMed Central

Luksys, Gediminas; Fastenrath, Matthias; Coynel, David; Freytag, Virginie; Gschwind, Leo; Heck, Angela; Jessen, Frank; Maier, Wolfgang; Milnik, Annette; Riedel-Heller, Steffi G.; Scherer, Martin; Spalek, Klara; Vogler, Christian; Wagner, Michael; Wolfsgruber, Steffen; Papassotiropoulos, Andreas; de Quervain, Dominique J.-F.

2015-01-01

Episodic memory performance is the result of distinct mental processes, such as learning, memory maintenance, and emotional modulation of memory strength. Such processes can be effectively dissociated using computational models. Here we performed gene set enrichment analyses of model parameters estimated from the episodic memory performance of 1,765 healthy young adults. We report robust and replicated associations of the amine compound SLC (solute-carrier) transporters gene set with the learning rate, of the collagen formation and transmembrane receptor protein tyrosine kinase activity gene sets with the modulation of memory strength by negative emotional arousal, and of the L1 cell adhesion molecule (L1CAM) interactions gene set with the repetition-based memory improvement. Furthermore, in a large functional MRI sample of 795 subjects we found that the association between L1CAM interactions and memory maintenance revealed large clusters of differences in brain activity in frontal cortical areas. Our findings provide converging evidence that distinct genetic profiles underlie specific mental processes of human episodic memory. They also provide empirical support to previous theoretical and neurobiological studies linking specific neuromodulators to the learning rate and linking neural cell adhesion molecules to memory maintenance. Furthermore, our study suggests additional memory-related genetic pathways, which may contribute to a better understanding of the neurobiology of human memory. PMID:26261317

Computational dissection of human episodic memory reveals mental process-specific genetic profiles.

PubMed

Luksys, Gediminas; Fastenrath, Matthias; Coynel, David; Freytag, Virginie; Gschwind, Leo; Heck, Angela; Jessen, Frank; Maier, Wolfgang; Milnik, Annette; Riedel-Heller, Steffi G; Scherer, Martin; Spalek, Klara; Vogler, Christian; Wagner, Michael; Wolfsgruber, Steffen; Papassotiropoulos, Andreas; de Quervain, Dominique J-F

2015-09-01

Episodic memory performance is the result of distinct mental processes, such as learning, memory maintenance, and emotional modulation of memory strength. Such processes can be effectively dissociated using computational models. Here we performed gene set enrichment analyses of model parameters estimated from the episodic memory performance of 1,765 healthy young adults. We report robust and replicated associations of the amine compound SLC (solute-carrier) transporters gene set with the learning rate, of the collagen formation and transmembrane receptor protein tyrosine kinase activity gene sets with the modulation of memory strength by negative emotional arousal, and of the L1 cell adhesion molecule (L1CAM) interactions gene set with the repetition-based memory improvement. Furthermore, in a large functional MRI sample of 795 subjects we found that the association between L1CAM interactions and memory maintenance revealed large clusters of differences in brain activity in frontal cortical areas. Our findings provide converging evidence that distinct genetic profiles underlie specific mental processes of human episodic memory. They also provide empirical support to previous theoretical and neurobiological studies linking specific neuromodulators to the learning rate and linking neural cell adhesion molecules to memory maintenance. Furthermore, our study suggests additional memory-related genetic pathways, which may contribute to a better understanding of the neurobiology of human memory.

Identification of Homeotic Target Genes in Drosophila Melanogaster Including Nervy, a Proto-Oncogene Homologue

PubMed Central

Feinstein, P. G.; Kornfeld, K.; Hogness, D. S.; Mann, R. S.

1995-01-01

In Drosophila, the specific morphological characteristics of each segment are determined by the homeotic genes that regulate the expression of downstream target genes. We used a subtractive hybridization procedure to isolate activated target genes of the homeotic gene Ultrabithorax (Ubx). In addition, we constructed a set of mutant genotypes that measures the regulatory contribution of individual homeotic genes to a complex target gene expression pattern. Using these mutants, we demonstrate that homeotic genes can regulate target gene expression at the start of gastrulation, suggesting a previously unknown role for the homeotic genes at this early stage. We also show that, in abdominal segments, the levels of expression for two target genes increase in response to high levels of Ubx, demonstrating that the normal down-regulation of Ubx in these segments is functional. Finally, the DNA sequence of cDNAs for one of these genes predicts a protein that is similar to a human proto-oncogene involved in acute myeloid leukemias. These results illustrate potentially general rules about the homeotic control of target gene expression and suggest that subtractive hybridization can be used to isolate interesting homeotic target genes. PMID:7498738

Comparative transcriptomics reveals similarities and differences between astrocytoma grades.

PubMed

Seifert, Michael; Garbe, Martin; Friedrich, Betty; Mittelbronn, Michel; Klink, Barbara

2015-12-16

Astrocytomas are the most common primary brain tumors distinguished into four histological grades. Molecular analyses of individual astrocytoma grades have revealed detailed insights into genetic, transcriptomic and epigenetic alterations. This provides an excellent basis to identify similarities and differences between astrocytoma grades. We utilized public omics data of all four astrocytoma grades focusing on pilocytic astrocytomas (PA I), diffuse astrocytomas (AS II), anaplastic astrocytomas (AS III) and glioblastomas (GBM IV) to identify similarities and differences using well-established bioinformatics and systems biology approaches. We further validated the expression and localization of Ang2 involved in angiogenesis using immunohistochemistry. Our analyses show similarities and differences between astrocytoma grades at the level of individual genes, signaling pathways and regulatory networks. We identified many differentially expressed genes that were either exclusively observed in a specific astrocytoma grade or commonly affected in specific subsets of astrocytoma grades in comparison to normal brain. Further, the number of differentially expressed genes generally increased with the astrocytoma grade with one major exception. The cytokine receptor pathway showed nearly the same number of differentially expressed genes in PA I and GBM IV and was further characterized by a significant overlap of commonly altered genes and an exclusive enrichment of overexpressed cancer genes in GBM IV. Additional analyses revealed a strong exclusive overexpression of CX3CL1 (fractalkine) and its receptor CX3CR1 in PA I possibly contributing to the absence of invasive growth. We further found that PA I was significantly associated with the mesenchymal subtype typically observed for very aggressive GBM IV. Expression of endothelial and mesenchymal markers (ANGPT2, CHI3L1) indicated a stronger contribution of the micro-environment to the manifestation of the mesenchymal subtype than the tumor biology itself. We further inferred a transcriptional regulatory network associated with specific expression differences distinguishing PA I from AS II, AS III and GBM IV. Major central transcriptional regulators were involved in brain development, cell cycle control, proliferation, apoptosis, chromatin remodeling or DNA methylation. Many of these regulators showed directly underlying DNA methylation changes in PA I or gene copy number mutations in AS II, AS III and GBM IV. This computational study characterizes similarities and differences between all four astrocytoma grades confirming known and revealing novel insights into astrocytoma biology. Our findings represent a valuable resource for future computational and experimental studies.

Unique core genomes of the bacterial family vibrionaceae: insights into niche adaptation and speciation.

PubMed

Kahlke, Tim; Goesmann, Alexander; Hjerde, Erik; Willassen, Nils Peder; Haugen, Peik

2012-05-10

The criteria for defining bacterial species and even the concept of bacterial species itself are under debate, and the discussion is apparently intensifying as more genome sequence data is becoming available. However, it is still unclear how the new advances in genomics should be used most efficiently to address this question. In this study we identify genes that are common to any group of genomes in our dataset, to determine whether genes specific to a particular taxon exist and to investigate their potential role in adaptation of bacteria to their specific niche. These genes were named unique core genes. Additionally, we investigate the existence and importance of unique core genes that are found in isolates of phylogenetically non-coherent groups. These groups of isolates, that share a genetic feature without sharing a closest common ancestor, are termed genophyletic groups. The bacterial family Vibrionaceae was used as the model, and we compiled and compared genome sequences of 64 different isolates. Using the software orthoMCL we determined clusters of homologous genes among the investigated genome sequences. We used multilocus sequence analysis to build a host phylogeny and mapped the numbers of unique core genes of all distinct groups of isolates onto the tree. The results show that unique core genes are more likely to be found in monophyletic groups of isolates. Genophyletic groups of isolates, in contrast, are less common especially for large groups of isolate. The subsequent annotation of unique core genes that are present in genophyletic groups indicate a high degree of horizontally transferred genes. Finally, the annotation of the unique core genes of Vibrio cholerae revealed genes involved in aerotaxis and biosynthesis of the iron-chelator vibriobactin. The presented work indicates that genes specific for any taxon inside the bacterial family Vibrionaceae exist. These unique core genes encode conserved metabolic functions that can shed light on the adaptation of a species to its ecological niche. Additionally, our study suggests that unique core genes can be used to aid classification of bacteria and contribute to a bacterial species definition on a genomic level. Furthermore, these genes may be of importance in clinical diagnostics and drug development.

Genetic influences on insight problem solving: the role of catechol-O-methyltransferase (COMT) gene polymorphisms

PubMed Central

Jiang, Weili; Shang, Siyuan; Su, Yanjie

2015-01-01

People may experience an “aha” moment, when suddenly realizing a solution of a puzzling problem. This experience is called insight problem solving. Several findings suggest that catecholamine-related genes may contribute to insight problem solving, among which the catechol-O-methyltransferase (COMT) gene is the most promising candidate. The current study examined 753 healthy individuals to determine the associations between 7 candidate single nucleotide polymorphisms on the COMT gene and insight problem-solving performance, while considering gender differences. The results showed that individuals carrying A allele of rs4680 or T allele of rs4633 scored significantly higher on insight problem-solving tasks, and the COMT gene rs5993883 combined with gender interacted with correct solutions of insight problems, specifically showing that this gene only influenced insight problem-solving performance in males. This study presents the first investigation of the genetic impact on insight problem solving and provides evidence that highlights the role that the COMT gene plays in insight problem solving. PMID:26528222

Genetic influences on insight problem solving: the role of catechol-O-methyltransferase (COMT) gene polymorphisms.

PubMed

Jiang, Weili; Shang, Siyuan; Su, Yanjie

2015-01-01

People may experience an "aha" moment, when suddenly realizing a solution of a puzzling problem. This experience is called insight problem solving. Several findings suggest that catecholamine-related genes may contribute to insight problem solving, among which the catechol-O-methyltransferase (COMT) gene is the most promising candidate. The current study examined 753 healthy individuals to determine the associations between 7 candidate single nucleotide polymorphisms on the COMT gene and insight problem-solving performance, while considering gender differences. The results showed that individuals carrying A allele of rs4680 or T allele of rs4633 scored significantly higher on insight problem-solving tasks, and the COMT gene rs5993883 combined with gender interacted with correct solutions of insight problems, specifically showing that this gene only influenced insight problem-solving performance in males. This study presents the first investigation of the genetic impact on insight problem solving and provides evidence that highlights the role that the COMT gene plays in insight problem solving.

The Genetics of Asthma and Allergic Disease: A 21st Century Perspective

PubMed Central

Ober, Carole; Yao, Tsung-Chieh

2011-01-01

Summary Asthma and allergy are common conditions with complex etiologies involving both genetic and environmental contributions. Recent genome-wide association studies (GWAS) and meta-analyses of GWAS have begun to shed light on both common and distinct pathways that contribute to asthma and allergic diseases. Associations with variation in genes encoding the epithelial cell-derived cytokines, interleukin-33 (IL-33) and thymic stromal lymphopoietin (TSLP), and the IL1RL1 gene encoding the IL-33 receptor, ST2, highlight the central roles for innate immune response pathways that promote the activation and differentiation of T-helper 2 (Th2) cells in the pathogenesis of both asthma and allergic diseases. In contrast, variation at the 17q21 asthma locus, encoding the ORMDL3 and GSDML genes, is specifically associated with risk for childhood onset asthma. These and other genetic findings are providing a list of well-validated asthma and allergy susceptibility genes that are expanding our understanding of the common and unique biological pathways that are dysregulated in these related conditions. Ongoing studies will continue to broaden our understanding of asthma and allergy and unravel the mechanisms for the development of these complex traits. PMID:21682736

Molecular and Functional Characterization of Odorant-Binding Protein Genes in an Invasive Vector Mosquito, Aedes albopictus

PubMed Central

Deng, Yuhua; Yan, Hui; Gu, Jinbao; Xu, Jiabao; Wu, Kun; Tu, Zhijian; James, Anthony A.; Chen, Xiaoguang

2013-01-01

Aedes albopictus is a major vector of dengue and Chikungunya viruses. Olfaction plays a vital role in guiding mosquito behaviors and contributes to their ability to transmit pathogens. Odorant-binding proteins (OBPs) are abundant in insect olfactory tissues and involved in the first step of odorant reception. While comprehensive descriptions are available of OBPs from Aedes aegypti, Culex quinquefasciatus and Anopheles gambiae, only a few genes from Ae. albopictus have been reported. In this study, twenty-one putative AalbOBP genes were cloned using their homologues in Ae. aegypti to query an Ae. albopictus partial genome sequence. Two antenna-specific OBPs, AalbOBP37 and AalbOBP39, display a remarkable similarity in their overall folding and binding pockets, according to molecular modeling. Binding affinity assays indicated that AalbOBP37 and AalbOBP39 had overlapping ligand affinities and are affected in different pH condition. Electroantennagrams (EAG) and behavioral tests show that these two genes were involved in olfactory reception. An improved understanding of the Ae. albopictus OBPs is expected to contribute to the development of more efficient and environmentally-friendly mosquito control strategies. PMID:23935894

Genome-wide analysis and expression profile of the bZIP transcription factor gene family in grapevine (Vitis vinifera)

PubMed Central

2014-01-01

Background Basic leucine zipper (bZIP) transcription factor gene family is one of the largest and most diverse families in plants. Current studies have shown that the bZIP proteins regulate numerous growth and developmental processes and biotic and abiotic stress responses. Nonetheless, knowledge concerning the specific expression patterns and evolutionary history of plant bZIP family members remains very limited. Results We identified 55 bZIP transcription factor-encoding genes in the grapevine (Vitis vinifera) genome, and divided them into 10 groups according to the phylogenetic relationship with those in Arabidopsis. The chromosome distribution and the collinearity analyses suggest that expansion of the grapevine bZIP (VvbZIP) transcription factor family was greatly contributed by the segment/chromosomal duplications, which may be associated with the grapevine genome fusion events. Nine intron/exon structural patterns within the bZIP domain and the additional conserved motifs were identified among all VvbZIP proteins, and showed a high group-specificity. The predicted specificities on DNA-binding domains indicated that some highly conserved amino acid residues exist across each major group in the tree of land plant life. The expression patterns of VvbZIP genes across the grapevine gene expression atlas, based on microarray technology, suggest that VvbZIP genes are involved in grapevine organ development, especially seed development. Expression analysis based on qRT-PCR indicated that VvbZIP genes are extensively involved in drought- and heat-responses, with possibly different mechanisms. Conclusions The genome-wide identification, chromosome organization, gene structures, evolutionary and expression analyses of grapevine bZIP genes provide an overall insight of this gene family and their potential involvement in growth, development and stress responses. This will facilitate further research on the bZIP gene family regarding their evolutionary history and biological functions. PMID:24725365

Draft Assembly of Elite Inbred Line PH207 Provides Insights into Genomic and Transcriptome Diversity in Maize

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hirsch, Candice N.; Hirsch, Cory D.; Brohammer, Alex B.

Intense artificial selection over the last 100 years has produced elite maize (Zea mays) inbred lines that combine to produce high-yielding hybrids. To further our understanding of how genome and transcriptome variation contribute to the production of high-yielding hybrids, we generated a draft genome assembly of the inbred line PH207 to complement and compare with the existing B73 reference sequence. B73 is a founder of the Stiff Stalk germplasm pool, while PH207 is a founder of Iodent germplasm, both of which have contributed substantially to the production of temperate commercial maize and are combined to make heterotic hybrids. Comparison ofmore » these two assemblies revealed over 2500 genes present in only one of the two genotypes and 136 gene families that have undergone extensive expansion or contraction. Transcriptome profiling revealed extensive expression variation, with as many as 10,564 differentially expressed transcripts and 7128 transcripts expressed in only one of the two genotypes in a single tissue. Genotype-specific genes were more likely to have tissue/condition-specific expression and lower transcript abundance. The availability of a high-quality genome assembly for the elite maize inbred PH207 expands our knowledge of the breadth of natural genome and transcriptome variation in elite maize inbred lines across heterotic pools.« less

Ancestry, admixture and fitness in Colombian genomes

PubMed Central

Rishishwar, Lavanya; Conley, Andrew B.; Wigington, Charles H.; Wang, Lu; Valderrama-Aguirre, Augusto; King Jordan, I.

2015-01-01

The human dimension of the Columbian Exchange entailed substantial genetic admixture between ancestral source populations from Africa, the Americas and Europe, which had evolved separately for many thousands of years. We sought to address the implications of the creation of admixed American genomes, containing novel allelic combinations, for human health and fitness via analysis of an admixed Colombian population from Medellin. Colombian genomes from Medellin show a wide range of three-way admixture contributions from ancestral source populations. The primary ancestry component for the population is European (average = 74.6%, range = 45.0%–96.7%), followed by Native American (average = 18.1%, range = 2.1%–33.3%) and African (average = 7.3%, range = 0.2%–38.6%). Locus-specific patterns of ancestry were evaluated to search for genomic regions that are enriched across the population for particular ancestry contributions. Adaptive and innate immune system related genes and pathways are particularly over-represented among ancestry-enriched segments, including genes (HLA-B and MAPK10) that are involved in defense against endemic pathogens such as malaria. Genes that encode functions related to skin pigmentation (SCL4A5) and cutaneous glands (EDAR) are also found in regions with anomalous ancestry patterns. These results suggest the possibility that ancestry-specific loci were differentially retained in the modern admixed Colombian population based on their utility in the New World environment. PMID:26197429

Draft Assembly of Elite Inbred Line PH207 Provides Insights into Genomic and Transcriptome Diversity in Maize

DOE PAGES

Hirsch, Candice N.; Hirsch, Cory D.; Brohammer, Alex B.; ...

2016-11-01

Intense artificial selection over the last 100 years has produced elite maize (Zea mays) inbred lines that combine to produce high-yielding hybrids. To further our understanding of how genome and transcriptome variation contribute to the production of high-yielding hybrids, we generated a draft genome assembly of the inbred line PH207 to complement and compare with the existing B73 reference sequence. B73 is a founder of the Stiff Stalk germplasm pool, while PH207 is a founder of Iodent germplasm, both of which have contributed substantially to the production of temperate commercial maize and are combined to make heterotic hybrids. Comparison ofmore » these two assemblies revealed over 2500 genes present in only one of the two genotypes and 136 gene families that have undergone extensive expansion or contraction. Transcriptome profiling revealed extensive expression variation, with as many as 10,564 differentially expressed transcripts and 7128 transcripts expressed in only one of the two genotypes in a single tissue. Genotype-specific genes were more likely to have tissue/condition-specific expression and lower transcript abundance. The availability of a high-quality genome assembly for the elite maize inbred PH207 expands our knowledge of the breadth of natural genome and transcriptome variation in elite maize inbred lines across heterotic pools.« less

Draft Assembly of Elite Inbred Line PH207 Provides Insights into Genomic and Transcriptome Diversity in Maize[OPEN

PubMed Central

Soifer, Ilya; Barad, Omer; Shem-Tov, Doron; Baruch, Kobi; Lu, Fei; Hernandez, Alvaro G.; Wright, Chris L.; Koehler, Klaus; Buell, C. Robin; de Leon, Natalia

2016-01-01

Intense artificial selection over the last 100 years has produced elite maize (Zea mays) inbred lines that combine to produce high-yielding hybrids. To further our understanding of how genome and transcriptome variation contribute to the production of high-yielding hybrids, we generated a draft genome assembly of the inbred line PH207 to complement and compare with the existing B73 reference sequence. B73 is a founder of the Stiff Stalk germplasm pool, while PH207 is a founder of Iodent germplasm, both of which have contributed substantially to the production of temperate commercial maize and are combined to make heterotic hybrids. Comparison of these two assemblies revealed over 2500 genes present in only one of the two genotypes and 136 gene families that have undergone extensive expansion or contraction. Transcriptome profiling revealed extensive expression variation, with as many as 10,564 differentially expressed transcripts and 7128 transcripts expressed in only one of the two genotypes in a single tissue. Genotype-specific genes were more likely to have tissue/condition-specific expression and lower transcript abundance. The availability of a high-quality genome assembly for the elite maize inbred PH207 expands our knowledge of the breadth of natural genome and transcriptome variation in elite maize inbred lines across heterotic pools. PMID:27803309

Distribution and quantification of antibiotic resistant genes and bacteria across agricultural and non-agricultural metagenomes.

PubMed

Durso, Lisa M; Miller, Daniel N; Wienhold, Brian J

2012-01-01

There is concern that antibiotic resistance can potentially be transferred from animals to humans through the food chain. The relationship between specific antibiotic resistant bacteria and the genes they carry remains to be described. Few details are known about the ecology of antibiotic resistant genes and bacteria in food production systems, or how antibiotic resistance genes in food animals compare to antibiotic resistance genes in other ecosystems. Here we report the distribution of antibiotic resistant genes in publicly available agricultural and non-agricultural metagenomic samples and identify which bacteria are likely to be carrying those genes. Antibiotic resistance, as coded for in the genes used in this study, is a process that was associated with all natural, agricultural, and human-impacted ecosystems examined, with between 0.7 to 4.4% of all classified genes in each habitat coding for resistance to antibiotic and toxic compounds (RATC). Agricultural, human, and coastal-marine metagenomes have characteristic distributions of antibiotic resistance genes, and different bacteria that carry the genes. There is a larger percentage of the total genome associated with antibiotic resistance in gastrointestinal-associated and agricultural metagenomes compared to marine and Antarctic samples. Since antibiotic resistance genes are a natural part of both human-impacted and pristine habitats, presence of these resistance genes in any specific habitat is therefore not sufficient to indicate or determine impact of anthropogenic antibiotic use. We recommend that baseline studies and control samples be taken in order to determine natural background levels of antibiotic resistant bacteria and/or antibiotic resistance genes when investigating the impacts of veterinary use of antibiotics on human health. We raise questions regarding whether the underlying biology of each type of bacteria contributes to the likelihood of transfer via the food chain.

RNA interference as a key to knockdown overexpressed cyclooxygenase-2 gene in tumour cells

PubMed Central

Strillacci, A; Griffoni, C; Spisni, E; Manara, M C; Tomasi, V

2006-01-01

Silencing those genes that are overexpressed in cancer and contribute to the survival and progression of tumour cells is the aim of several researches. Cyclooxygenase-2 (COX-2) is one of the most intensively studied genes since it is overexpressed in most tumours, mainly in colon cancer. The use of specific COX-2 inhibitors to treat colon cancer has generated great enthusiasm. Yet, the side effects of some inhibitors emerging during long-term treatment have caused much concern. Genes silencing by RNA interference (RNAi) has led to new directions in the field of experimental oncology. In this study, we detected sequences directed against COX-2 mRNA, that potently downregulate COX-2 gene expression and inhibit phorbol 12-myristate 13-acetate-induced angiogenesis in vitro in a specific, nontoxic manner. Moreover, we found that the insertion of a specific cassette carrying anti-COX-2 short hairpin RNA sequence into a viral vector (pSUPER.retro) greatly increased silencing potency in a colon cancer cell line (HT29) without activating any interferon response. Phenotypically, COX-2 deficient HT29 cells showed a significant impairment of their in vitro malignant behaviour. Thus, the retroviral approach enhancing COX-2 knockdown, mediated by RNAi, proved to be an useful tool to better understand the role of COX-2 in colon cancer. Furthermore, the higher infection efficiency we observed in tumour cells, if compared to normal endothelial cells, may disclose the possibility to specifically treat tumour cells without impairing endothelial COX-2 activity. PMID:16622456

Bromovirus movement protein genes play a crucial role in host specificity.

PubMed Central

Mise, K; Allison, R F; Janda, M; Ahlquist, P

1993-01-01

Monocot-adapted brome mosaic virus (BMV) and dicot-adapted cowpea chlorotic mottle virus (CCMV) are closely related bromoviruses with tripartite RNA genomes. Although RNAs 1 and 2 together are sufficient for RNA replication in protoplasts, systemic infection also requires RNA3, which encodes the coat protein and the nonstructural 3a movement protein. We have previously shown with bromoviral reassortants that host specificity determinants in both viruses are encoded by RNA3 as well as by RNA1 and/or RNA2. Here, to test their possible role in host specificity, the 3a movement protein genes were precisely exchanged between BMV and CCMV. The hybrid viruses, but not 3a deletion mutants, systemically infected Nicotiana benthamiana, a permissive host for both parental viruses. The hybrids thus retain basic competence for replication, packaging, cell-to-cell spread, and long-distance (vascular) spread. However, the hybrids failed to systemically infect either barley or cowpea, selective hosts for parental viruses. Thus, the 3a gene and/or its encoded 3a protein contributes to host specificity of both monocot- and dicot-adapted bromoviruses. Tests of inoculated cowpea leaves showed that the spread of the CCMV hybrid containing the BMV 3a gene was blocked at a very early stage of infection. Moreover, the BMV hybrid containing the CCMV 3a gene appeared to spread farther than wt BMV in inoculated cowpea leaves. Several pseudorevertants directing systemic infection in cowpea leaves were obtained from plants inoculated with the CCMV(BMV 3a) hybrid, suggesting that the number of mutations required to adapt the hybrid to dicots is small. Images PMID:7682628

Whole-genome analyses of speciation events in pathogenic Brucellae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chain, Patrick S. G.; Comerci, Diego J.; Tolmasky, Marcelo E.

Despite their high DNA identity and a proposal to group classical Brucella species as biovars of Brucella melitensis, the commonly recognized Brucella species can be distinguished by distinct biochemical and fatty acid characters, as well as by a marked host range (e.g., Brucella suis for swine, B. melitensis for sheep and goats, and Brucella abortus for cattle). Here we present the genome of B. abortus 2308, the virulent prototype biovar 1 strain, and its comparison to the two other human pathogenic Brucella species and to B. abortus field isolate 9-941. The global distribution of pseudogenes, deletions, and insertions supports previousmore » indications that B. abortus and B. melitensis share a common ancestor that diverged from B. suis. With the exception of a dozen genes, the genetic complements of both B. abortus strains are identical, whereas the three species differ in gene content and pseudogenes. The pattern of species-specific gene inactivations affecting transcriptional regulators and outer membrane proteins suggests that these inactivations may play an important role in the establishment of host specificity and may have been a primary driver of speciation in the genus Brucella. Despite being nonmotile, the brucellae contain flagellum gene clusters and display species-specific flagellar gene inactivations, which lead to the putative generation of different versions of flagellum-derived structures and may contribute to differences in host specificity and virulence. Metabolic changes such as the lack of complete metabolic pathways for the synthesis of numerous compounds (e.g., glycogen, biotin, NAD, and choline) are consistent with adaptation of brucellae to an intracellular life-style.« less

Whole-genome analyses of the speciation events in the pathogenic Brucellae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chain, P; Comerci, D; Tolmasky, M

Despite their high DNA identity and a proposal to group classical Brucella species as biovars of B. melitensis, the commonly recognized Brucella species can be distinguished by distinct biochemical and fatty acid characters as well as by a marked host range (e.g. B. suis for swine, B. melitensis for sheep and goats, B. abortus for cattle). Here we present the genome of B. abortus 2308, the virulent prototype biovar 1 strain, and its comparison to the two other human pathogenic Brucellae species and to the B. abortus field isolate 9-941. The global distribution of pseudogenes, deletions and insertions support previousmore » indications that B. abortus and B. melitensis share a common ancestor that diverged from B. suis. With the exception of a dozen genes, the genetic complement of both B. abortus strains is identical, whereas the three species differ in gene content and pseudogenes. The pattern of species-specific gene inactivations affecting transcriptional regulators and outer membrane proteins suggest that these inactivations may play an important role in the establishment of host-specificity and may have been a primary driver of speciation in the Brucellae. Despite being non-motile, the Brucellae contain flagellum gene clusters and display species-specific flagellar gene inactivations, which lead to the putative generation of different versions of flagellum-derived structures, and may contribute to differences in host-specificity and virulence. Metabolic changes such as the lack of complete metabolic pathways for the synthesis of numerous compounds (e.g. glycogen, biotin, NAD, and choline) are consistent with adaptation of Brucellae to an intracellular lifestyle.« less

Genome-wide analysis of WRKY transcription factors in wheat (Triticum aestivum L.) and differential expression under water deficit condition.

PubMed

Ning, Pan; Liu, Congcong; Kang, Jingquan; Lv, Jinyin

2017-01-01

WRKY proteins, which comprise one of the largest transcription factor (TF) families in the plant kingdom, play crucial roles in plant development and stress responses. Despite several studies on WRKYs in wheat ( Triticum aestivum L.), functional annotation information about wheat WRKYs is limited. Here, 171 TaWRKY TFs were identified from the whole wheat genome and compared with proteins from 19 other species representing nine major plant lineages. A phylogenetic analysis, coupled with gene structure analysis and motif determination, divided these TaWRKYs into seven subgroups (Group I, IIa-e, and III). Chromosomal location showed that most TaWRKY genes were enriched on four chromosomes, especially on chromosome 3B. In addition, 85 (49.7%) genes were either tandem (5) or segmental duplication (80), which suggested that though tandem duplication has contributed to the expansion of TaWRKY family, segmental duplication probably played a more pivotal role. Analysis of cis -acting elements revealed putative functions of WRKYs in wheat during development as well as under numerous biotic and abiotic stresses. Finally, the expression of TaWRKY genes in flag leaves, glumes, and lemmas under water-deficit condition were analyzed. Results showed that different TaWRKY genes preferentially express in specific tissue during the grain-filling stage. Our results provide a more extensive insight on WRKY gene family in wheat, and also contribute to the screening of more candidate genes for further investigation on function characterization of WRKYs under various stresses.

Evolution of Chemical Diversity in Echinocandin Lipopeptide Antifungal Metabolites

PubMed Central

Yue, Qun; Chen, Li; Zhang, Xiaoling; Li, Kuan; Sun, Jingzu; Liu, Xingzhong

2015-01-01

The echinocandins are a class of antifungal drugs that includes caspofungin, micafungin, and anidulafungin. Gene clusters encoding most of the structural complexity of the echinocandins provided a framework for hypotheses about the evolutionary history and chemical logic of echinocandin biosynthesis. Gene orthologs among echinocandin-producing fungi were identified. Pathway genes, including the nonribosomal peptide synthetases (NRPSs), were analyzed phylogenetically to address the hypothesis that these pathways represent descent from a common ancestor. The clusters share cooperative gene contents and linkages among the different strains. Individual pathway genes analyzed in the context of similar genes formed unique echinocandin-exclusive phylogenetic lineages. The echinocandin NRPSs, along with the NRPS from the inp gene cluster in Aspergillus nidulans and its orthologs, comprise a novel lineage among fungal NRPSs. NRPS adenylation domains from different species exhibited a one-to-one correspondence between modules and amino acid specificity that is consistent with models of tandem duplication and subfunctionalization. Pathway gene trees and Ascomycota phylogenies are congruent and consistent with the hypothesis that the echinocandin gene clusters have a common origin. The disjunct Eurotiomycete-Leotiomycete distribution appears to be consistent with a scenario of vertical descent accompanied by incomplete lineage sorting and loss of the clusters from most lineages of the Ascomycota. We present evidence for a single evolutionary origin of the echinocandin family of gene clusters and a progression of structural diversification in two fungal classes that diverged approximately 290 to 390 million years ago. Lineage-specific gene cluster evolution driven by selection of new chemotypes contributed to diversification of the molecular functionalities. PMID:26024901

Variation in Orthologous Shell-Forming Proteins Contribute to Molluscan Shell Diversity

PubMed Central

Jackson, Daniel J.; Reim, Laurin; Randow, Clemens; Cerveau, Nicolas; Degnan, Bernard M.; Fleck, Claudia

2017-01-01

Abstract Despite the evolutionary success and ancient heritage of the molluscan shell, little is known about the molecular details of its formation, evolutionary origins, or the interactions between the material properties of the shell and its organic constituents. In contrast to this dearth of information, a growing collection of molluscan shell-forming proteomes and transcriptomes suggest they are comprised of both deeply conserved, and lineage specific elements. Analyses of these sequence data sets have suggested that mechanisms such as exon shuffling, gene co-option, and gene family expansion facilitated the rapid evolution of shell-forming proteomes and supported the diversification of this phylum specific structure. In order to further investigate and test these ideas we have examined the molecular features and spatial expression patterns of two shell-forming genes (Lustrin and ML1A2) and coupled these observations with materials properties measurements of shells from a group of closely related gastropods (abalone). We find that the prominent “GS” domain of Lustrin, a domain believed to confer elastomeric properties to the shell, varies significantly in length between the species we investigated. Furthermore, the spatial expression patterns of Lustrin and ML1A2 also vary significantly between species, suggesting that both protein architecture, and the regulation of spatial gene expression patterns, are important drivers of molluscan shell evolution. Variation in these molecular features might relate to certain materials properties of the shells of these species. These insights reveal an important and underappreciated source of variation within shell-forming proteomes that must contribute to the diversity of molluscan shell phenotypes. PMID:28961798

Defining the Diverse Cell Populations Contributing to Lignification in Arabidopsis Stems.

PubMed

Smith, Rebecca A; Schuetz, Mathias; Karlen, Steven D; Bird, David; Tokunaga, Naohito; Sato, Yasushi; Mansfield, Shawn D; Ralph, John; Samuels, A Lacey

2017-06-01

Many land plants evolved tall and sturdy growth habits due to specialized cells with thick lignified cell walls: tracheary elements that function in water transport and fibers that function in structural support. The objective of this study was to define how and when diverse cell populations contribute lignin precursors, monolignols, to secondary cell walls during lignification of the Arabidopsis ( Arabidopsis thaliana ) inflorescence stem. Previous work demonstrated that, when lignin biosynthesis is suppressed in fiber and tracheary element cells with thickened walls, fibers become lignin-depleted while vascular bundles still lignify, suggesting that nonlignifying neighboring xylem cells are contributing to lignification. In this work, we dissect the contributions of different cell types, specifically xylary parenchyma and fiber cells, to lignification of the stem using cell-type-specific promoters to either knock down an essential monolignol biosynthetic gene or to introduce novel monolignol conjugates. Analysis of either reductions in lignin in knockdown lines, or the addition of novel monolignol conjugates, directly identifies the xylary parenchyma and fiber cell populations that contribute to the stem lignification and the developmental timing at which each contribution is most important. © 2017 American Society of Plant Biologists. All Rights Reserved.

The molecular basis for stability of heterochromatin-mediated silencing in mammals.

PubMed

Hiragami-Hamada, Kyoko; Xie, Sheila Q; Saveliev, Alexander; Uribe-Lewis, Santiago; Pombo, Ana; Festenstein, Richard

2009-11-04

The archetypal epigenetic phenomenon of position effect variegation (PEV) in Drosophila occurs when a gene is brought abnormally close to heterochromatin, resulting in stochastic silencing of the affected gene in a proportion of cells that would normally express it. PEV has been instrumental in unraveling epigenetic mechanisms. Using an in vivo mammalian model for PEV we have extensively investigated the molecular basis for heterochromatin-mediated gene silencing. Here we distinguish 'epigenetic effects' from other cellular differences by studying ex vivo cells that are identical, apart from the expression of the variegating gene which is silenced in a proportion of the cells. By separating cells according to transgene expression we show here that silencing appears to be associated with histone H3 lysine 9 trimethylation (H3K9me3), DNA methylation and the localization of the silenced gene to a specific nuclear compartment enriched in these modifications. In contrast, histone H3 acetylation (H3Ac) and lysine 4 di or tri methylation (H3K4me2/3) are the predominant modifications associated with expression where we see the gene in a euchromatic compartment. Interestingly, DNA methylation and inaccessibility, rather than H3K9me3, correlated most strongly with resistance to de-repression by cellular activation. These results have important implications for understanding the contribution of specific factors involved in the establishment and maintenance of gene silencing and activation in vivo.

A global view of the nonprotein-coding transcriptome in Plasmodium falciparum

PubMed Central

Raabe, Carsten A.; Sanchez, Cecilia P.; Randau, Gerrit; Robeck, Thomas; Skryabin, Boris V.; Chinni, Suresh V.; Kube, Michael; Reinhardt, Richard; Ng, Guey Hooi; Manickam, Ravichandran; Kuryshev, Vladimir Y.; Lanzer, Michael; Brosius, Juergen; Tang, Thean Hock; Rozhdestvensky, Timofey S.

2010-01-01

Nonprotein-coding RNAs (npcRNAs) represent an important class of regulatory molecules that act in many cellular pathways. Here, we describe the experimental identification and validation of the small npcRNA transcriptome of the human malaria parasite Plasmodium falciparum. We identified 630 novel npcRNA candidates. Based on sequence and structural motifs, 43 of them belong to the C/D and H/ACA-box subclasses of small nucleolar RNAs (snoRNAs) and small Cajal body-specific RNAs (scaRNAs). We further observed the exonization of a functional H/ACA snoRNA gene, which might contribute to the regulation of ribosomal protein L7a gene expression. Some of the small npcRNA candidates are from telomeric and subtelomeric repetitive regions, suggesting their potential involvement in maintaining telomeric integrity and subtelomeric gene silencing. We also detected 328 cis-encoded antisense npcRNAs (asRNAs) complementary to P. falciparum protein-coding genes of a wide range of biochemical pathways, including determinants of virulence and pathology. All cis-encoded asRNA genes tested exhibit lifecycle-specific expression profiles. For all but one of the respective sense–antisense pairs, we deduced concordant patterns of expression. Our findings have important implications for a better understanding of gene regulatory mechanisms in P. falciparum, revealing an extended and sophisticated npcRNA network that may control the expression of housekeeping genes and virulence factors. PMID:19864253

A global view of the nonprotein-coding transcriptome in Plasmodium falciparum.

PubMed

Raabe, Carsten A; Sanchez, Cecilia P; Randau, Gerrit; Robeck, Thomas; Skryabin, Boris V; Chinni, Suresh V; Kube, Michael; Reinhardt, Richard; Ng, Guey Hooi; Manickam, Ravichandran; Kuryshev, Vladimir Y; Lanzer, Michael; Brosius, Juergen; Tang, Thean Hock; Rozhdestvensky, Timofey S

2010-01-01

Nonprotein-coding RNAs (npcRNAs) represent an important class of regulatory molecules that act in many cellular pathways. Here, we describe the experimental identification and validation of the small npcRNA transcriptome of the human malaria parasite Plasmodium falciparum. We identified 630 novel npcRNA candidates. Based on sequence and structural motifs, 43 of them belong to the C/D and H/ACA-box subclasses of small nucleolar RNAs (snoRNAs) and small Cajal body-specific RNAs (scaRNAs). We further observed the exonization of a functional H/ACA snoRNA gene, which might contribute to the regulation of ribosomal protein L7a gene expression. Some of the small npcRNA candidates are from telomeric and subtelomeric repetitive regions, suggesting their potential involvement in maintaining telomeric integrity and subtelomeric gene silencing. We also detected 328 cis-encoded antisense npcRNAs (asRNAs) complementary to P. falciparum protein-coding genes of a wide range of biochemical pathways, including determinants of virulence and pathology. All cis-encoded asRNA genes tested exhibit lifecycle-specific expression profiles. For all but one of the respective sense-antisense pairs, we deduced concordant patterns of expression. Our findings have important implications for a better understanding of gene regulatory mechanisms in P. falciparum, revealing an extended and sophisticated npcRNA network that may control the expression of housekeeping genes and virulence factors.

A cryptic translocation leading to NUP98-PHF23 fusion in AML.

PubMed

Ning, Yi

2016-12-01

Chromosome translocations leading to gene fusions have emerged as important oncogenic drivers of various types of malignancies. Detection and characterization of these fusion genes not only help diagnosis and management of specific malignancies, but also contribute to our understanding of the genetic basis and pathogenesis of these diseases. NUP98 gene encodes a 98 kDa nucleoporin, which is a component of the nuclear pore complex that mediates transport of mRNA and proteins between the nucleus and the cytoplasm. Due to its participation in translocations leading to the formation of fusion with at least 29 different partner genes, NUP98 is considered one of the most promiscuous fusion genes in hematologic malignancies. We discuss our identification and characterization of a NUP98-PHF23 fusion from a cryptic translocation in patients with acute myeloid leukemia (AML). Copyright © 2016 Elsevier Ltd. All rights reserved.

Examination of the genetic basis for sexual dimorphism in the Aedes aegypti (dengue vector mosquito) pupal brain

PubMed Central

2014-01-01

Background Most animal species exhibit sexually dimorphic behaviors, many of which are linked to reproduction. A number of these behaviors, including blood feeding in female mosquitoes, contribute to the global spread of vector-borne illnesses. However, knowledge concerning the genetic basis of sexually dimorphic traits is limited in any organism, including mosquitoes, especially with respect to differences in the developing nervous system. Methods Custom microarrays were used to examine global differences in female vs. male gene expression in the developing pupal head of the dengue vector mosquito, Aedes aegypti. The spatial expression patterns of a subset of differentially expressed transcripts were examined in the developing female vs. male pupal brain through in situ hybridization experiments. Small interfering RNA (siRNA)-mediated knockdown studies were used to assess the putative role of Doublesex, a terminal component of the sex determination pathway, in the regulation of sex-specific gene expression observed in the developing pupal brain. Results Transcripts (2,527), many of which were linked to proteolysis, the proteasome, metabolism, catabolic, and biosynthetic processes, ion transport, cell growth, and proliferation, were found to be differentially expressed in A. aegypti female vs. male pupal heads. Analysis of the spatial expression patterns for a subset of dimorphically expressed genes in the pupal brain validated the data set and also facilitated the identification of brain regions with dimorphic gene expression. In many cases, dimorphic gene expression localized to the optic lobe. Sex-specific differences in gene expression were also detected in the antennal lobe and mushroom body. siRNA-mediated gene targeting experiments demonstrated that Doublesex, a transcription factor with consensus binding sites located adjacent to many dimorphically expressed transcripts that function in neural development, is required for regulation of sex-specific gene expression in the developing A. aegypti brain. Conclusions These studies revealed sex-specific gene expression profiles in the developing A. aegypti pupal head and identified Doublesex as a key regulator of sexually dimorphic gene expression during mosquito neural development. PMID:25729562

Integrative Analysis of Brain Region-specific Shank3 Interactomes for Understanding the Heterogeneity of Neuronal Pathophysiology Related to SHANK3 Mutations

PubMed Central

Lee, Yeunkum; Kang, Hyojin; Lee, Bokyoung; Zhang, Yinhua; Kim, Yoonhee; Kim, Shinhyun; Kim, Won-Ki; Han, Kihoon

2017-01-01

Recent molecular genetic studies have identified 100s of risk genes for various neurodevelopmental and neuropsychiatric disorders. As the number of risk genes increases, it is becoming clear that different mutations of a single gene could cause different types of disorders. One of the best examples of such a gene is SHANK3, which encodes a core scaffold protein of the neuronal excitatory post-synapse. Deletions, duplications, and point mutations of SHANK3 are associated with autism spectrum disorders, intellectual disability, schizophrenia, bipolar disorder, and attention deficit hyperactivity disorder. Nevertheless, how the different mutations of SHANK3 can lead to such phenotypic diversity remains largely unknown. In this study, we investigated whether Shank3 could form protein complexes in a brain region-specific manner, which might contribute to the heterogeneity of neuronal pathophysiology caused by SHANK3 mutations. To test this, we generated a medial prefrontal cortex (mPFC) Shank3 in vivo interactome consisting of 211 proteins, and compared this protein list with a Shank3 interactome previously generated from mixed hippocampal and striatal (HP+STR) tissues. Unexpectedly, we found that only 47 proteins (about 20%) were common between the two interactomes, while 164 and 208 proteins were specifically identified in the mPFC and HP+STR interactomes, respectively. Each of the mPFC- and HP+STR-specific Shank3 interactomes represents a highly interconnected network. Upon comparing the brain region-enriched proteomes, we found that the large difference between the mPFC and HP+STR Shank3 interactomes could not be explained by differential protein expression profiles among the brain regions. Importantly, bioinformatic pathway analysis revealed that the representative biological functions of the mPFC- and HP+STR-specific Shank3 interactomes were different, suggesting that these interactors could mediate the brain region-specific functions of Shank3. Meanwhile, the same analysis on the common Shank3 interactors, including Homer and GKAP/SAPAP proteins, suggested that they could mainly function as scaffolding proteins at the post-synaptic density. Lastly, we found that the mPFC- and HP+STR-specific Shank3 interactomes contained a significant number of proteins associated with neurodevelopmental and neuropsychiatric disorders. These results suggest that Shank3 can form protein complexes in a brain region-specific manner, which might contribute to the pathophysiological and phenotypic diversity of disorders related to SHANK3 mutations. PMID:28469556

Drought responsive gene expression regulatory divergence between upland and lowland ecotypes of a perennial C4 grass.

PubMed

Lovell, John T; Schwartz, Scott; Lowry, David B; Shakirov, Eugene V; Bonnette, Jason E; Weng, Xiaoyu; Wang, Mei; Johnson, Jenifer; Sreedasyam, Avinash; Plott, Christopher; Jenkins, Jerry; Schmutz, Jeremy; Juenger, Thomas E

2016-04-01

Climatic adaptation is an example of a genotype-by-environment interaction (G×E) of fitness. Selection upon gene expression regulatory variation can contribute to adaptive phenotypic diversity; however, surprisingly few studies have examined how genome-wide patterns of gene expression G×E are manifested in response to environmental stress and other selective agents that cause climatic adaptation. Here, we characterize drought-responsive expression divergence between upland (drought-adapted) and lowland (mesic) ecotypes of the perennial C4 grass,Panicum hallii, in natural field conditions. Overall, we find that cis-regulatory elements contributed to gene expression divergence across 47% of genes, 7.2% of which exhibit drought-responsive G×E. While less well-represented, we observe 1294 genes (7.8%) with transeffects.Trans-by-environment interactions are weaker and much less common than cis G×E, occurring in only 0.7% oft rans-regulated genes. Finally, gene expression heterosis is highly enriched in expression phenotypes with significant G×E. As such, modes of inheritance that drive heterosis, such as dominance or overdominance, may be common among G×E genes. Interestingly, motifs specific to drought-responsive transcription factors are highly enriched in the promoters of genes exhibiting G×E and transregulation, indicating that expression G×E and heterosis may result from the evolution of transcription factors or their binding sites.P. hallii serves as the genomic model for its close relative and emerging biofuel crop, switchgrass (Panicum virgatum). Accordingly, the results here not only aid in the discovery of the genetic mechanisms that underlie local adaptation but also provide a foundation to improve switchgrass yield under water-limited conditions. © 2016 Lovell et al.; Published by Cold Spring Harbor Laboratory Press.

Drought responsive gene expression regulatory divergence between upland and lowland ecotypes of a perennial C4 grass

PubMed Central

Lovell, John T.; Schwartz, Scott; Lowry, David B.; Shakirov, Eugene V.; Bonnette, Jason E.; Weng, Xiaoyu; Wang, Mei; Johnson, Jenifer; Sreedasyam, Avinash; Plott, Christopher; Jenkins, Jerry; Schmutz, Jeremy; Juenger, Thomas E.

2016-01-01

Climatic adaptation is an example of a genotype-by-environment interaction (G×E) of fitness. Selection upon gene expression regulatory variation can contribute to adaptive phenotypic diversity; however, surprisingly few studies have examined how genome-wide patterns of gene expression G×E are manifested in response to environmental stress and other selective agents that cause climatic adaptation. Here, we characterize drought-responsive expression divergence between upland (drought-adapted) and lowland (mesic) ecotypes of the perennial C4 grass, Panicum hallii, in natural field conditions. Overall, we find that cis-regulatory elements contributed to gene expression divergence across 47% of genes, 7.2% of which exhibit drought-responsive G×E. While less well-represented, we observe 1294 genes (7.8%) with trans effects. Trans-by-environment interactions are weaker and much less common than cis G×E, occurring in only 0.7% of trans-regulated genes. Finally, gene expression heterosis is highly enriched in expression phenotypes with significant G×E. As such, modes of inheritance that drive heterosis, such as dominance or overdominance, may be common among G×E genes. Interestingly, motifs specific to drought-responsive transcription factors are highly enriched in the promoters of genes exhibiting G×E and trans regulation, indicating that expression G×E and heterosis may result from the evolution of transcription factors or their binding sites. P. hallii serves as the genomic model for its close relative and emerging biofuel crop, switchgrass (Panicum virgatum). Accordingly, the results here not only aid in the discovery of the genetic mechanisms that underlie local adaptation but also provide a foundation to improve switchgrass yield under water-limited conditions. PMID:26953271

Heterogeneous contribution of microdeletions in the development of common generalised and focal epilepsies

PubMed Central

Pérez-Palma, Eduardo; Helbig, Ingo; Klein, Karl Martin; Anttila, Verneri; Horn, Heiko; Reinthaler, Eva Maria; Gormley, Padhraig; Ganna, Andrea; Byrnes, Andrea; Pernhorst, Katharina; Toliat, Mohammad R; Saarentaus, Elmo; Howrigan, Daniel P; Hoffman, Per; Miquel, Juan Francisco; De Ferrari, Giancarlo V; Nürnberg, Peter; Lerche, Holger; Zimprich, Fritz; Neubauer, Bern A; Becker, Albert J; Rosenow, Felix; Perucca, Emilio; Zara, Federico; Weber, Yvonne G; Lal, Dennis

2017-01-01

Background Microdeletions are known to confer risk to epilepsy, particularly at genomic rearrangement ‘hotspot’ loci. However, microdeletion burden not overlapping these regions or within different epilepsy subtypes has not been ascertained. Objective To decipher the role of microdeletions outside hotspots loci and risk assessment by epilepsy subtype. Methods We assessed the burden, frequency and genomic content of rare, large microdeletions found in a previously published cohort of 1366 patients with genetic generalised epilepsy (GGE) in addition to two sets of additional unpublished genome-wide microdeletions found in 281 patients with rolandic epilepsy (RE) and 807 patients with adult focal epilepsy (AFE), totalling 2454 cases. Microdeletions were assessed in a combined and subtype-specific approaches against 6746 controls. Results When hotspots are considered, we detected an enrichment of microdeletions in the combined epilepsy analysis (adjusted p=1.06×10−6,OR 1.89, 95% CI 1.51 to 2.35). Epilepsy subtype-specific analyses showed that hotspot microdeletions in the GGE subgroup contribute most of the overall signal (adjusted p=9.79×10−12, OR 7.45, 95% CI 4.20–13.5). Outside hotspots , microdeletions were enriched in the GGE cohort for neurodevelopmental genes (adjusted p=9.13×10−3,OR 2.85, 95% CI 1.62–4.94). No additional signal was observed for RE and AFE. Still, gene-content analysis identified known (NRXN1, RBFOX1 and PCDH7) and novel (LOC102723362) candidate genes across epilepsy subtypes that were not deleted in controls. Conclusions Our results show a heterogeneous effect of recurrent and non-recurrent microdeletions as part of the genetic architecture of GGE and a minor contribution in the aetiology of RE and AFE. PMID:28756411

A Distinctive Cytoplasmic Tail Contributes to Low Surface Expression and Intracellular Retention of the Patr-AL MHC class I molecule1

PubMed Central

Goyos, Ana; Guethlein, Lisbeth A.; Horowitz, Amir; Hilton, Hugo G.; Gleimer, Michael; Brodsky, Frances M.; Parham, Peter

2015-01-01

Chimpanzees have orthologs of the six, fixed, functional human MHC class I genes. But in addition, the chimpanzee has a seventh functional gene, Patr-AL, which is not polymorphic but contributes substantially to population diversity by its presence on only 50% of MHC haplotypes. The ancestral AL gene emerged long before the separation of human and chimpanzee ancestors and then subsequently and specifically lost function during human evolution, but was maintained in chimpanzees. Patr-AL is an alloantigen that participates in negative and positive selection of the T-cell repertoire. The three-dimensional structure and the peptide-binding repertoire of Patr-AL and HLA-A*02 are surprisingly similar. In contrast, the expression of these two molecules is very different as shown using specific monoclonal and polyclonal antibodies made against Patr-AL. Peripheral blood cells and B cell lines express low levels of Patr-AL at the cell surface. Higher levels are seen for 221-cell transfectants expressing Patr-AL, but in these cells a large majority of Patr-AL molecules are retained in the early compartments of the secretory pathway: mainly the endoplasmic reticulum but also cis-Golgi. Replacing the cytoplasmic tail of Patr-AL with that of HLA-A*02 increased the cell-surface expression of Patr-AL substantially. Four substitutions distinguish the Patr-AL and HLA-A*02 cytoplasmic tails. Systematic mutagenesis showed that each substitution contributes changes in cell-surface expression. The combination of residues present in Patr-AL appears unique, but each individual residue is present in other primate MHC class I molecules, notably MHC-E, the most ancient of the functional human MHC class I molecules. PMID:26371256

Genetic heterogeneity and Alzheimer`s disease

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schellenberg, G.D.; Wijsman, E.M.; Bird, T.D.

1994-09-01

In some early-onset Alzheimer`s disease (AD) families, inheritance is autosomal dominant. (Early-onset AD is arbitarily defined as onset at {le} 60 years.) Two loci have been identified which are causative for early-onset familial AD (FAD). One is the amyloid precursor protein gene in which specific mutation have been identified. The second is a locus at 14q24.3 (AD3) which has been localized by linkage analysis; the gene and specific mutations have not been identified. Linkage studies place this locus between D14S61 and D14S63. These 2 loci, however, do not account for all early-onset FAD. The Volga German (VG) kindreds are descendantsmore » of families which emigrated from Germany to the Volga river region of Russia and subsequently to the US; AD in these families is hypothesized to be the result of a common genetic founder. The average age-at-onset in these families is 57 years. Linkage analysis for this group has been negative for the APP gene and for chromosome 14 markers. Thus, there is at least 1 other early-onset FAD locus. Recently, the {epsilon}4 allele of apolipoprotein E (ApoE) was identified as a risk-factor for late-onset AD. In a series of 53 late-onset kindreds, a strong genetic association was observed between the ApoE {epsilon}4 allele and AD. However, when linkage analysis was performed using a highly polymorphic locus at the ApoCII gene, which is within 30 kb of ApoE, significant evidence for co-segregation was not observed. This and other data suggests that while ApoE is an age-at-onset modifying locus, another gene(s), located elsewhere, contribute(s) to late-onset AD. Thus, there is probably at least 1 other late-onset locus. Once the VG locus is identified, it will be possible to determine whether an allelic variant of this locus is responsible for late-onset FAD.« less

Mapping the Tail Fiber as the Receptor Binding Protein Responsible for Differential Host Specificity of Pseudomonas aeruginosa Bacteriophages PaP1 and JG004

PubMed Central

Le, Shuai; He, Xuesong; Tan, Yinling; Huang, Guangtao; Zhang, Lin; Lux, Renate; Shi, Wenyuan; Hu, Fuquan

2013-01-01

The first step in bacteriophage infection is recognition and binding to the host receptor, which is mediated by the phage receptor binding protein (RBP). Different RBPs can lead to differential host specificity. In many bacteriophages, such as Escherichia coli and Lactococcal phages, RBPs have been identified as the tail fiber or protruding baseplate proteins. However, the tail fiber-dependent host specificity in Pseudomonas aeruginosa phages has not been well studied. This study aimed to identify and investigate the binding specificity of the RBP of P. aeruginosa phages PaP1 and JG004. These two phages share high DNA sequence homology but exhibit different host specificities. A spontaneous mutant phage was isolated and exhibited broader host range compared with the parental phage JG004. Sequencing of its putative tail fiber and baseplate region indicated a single point mutation in ORF84 (a putative tail fiber gene), which resulted in the replacement of a positively charged lysine (K) by an uncharged asparagine (N). We further demonstrated that the replacement of the tail fiber gene (ORF69) of PaP1 with the corresponding gene from phage JG004 resulted in a recombinant phage that displayed altered host specificity. Our study revealed the tail fiber-dependent host specificity in P. aeruginosa phages and provided an effective tool for its alteration. These contributions may have potential value in phage therapy. PMID:23874674

Molecular genetic evidence for the involvement of a specific polygalacturonase, P2c, in the invasion and spread of Aspergillus flavus in cotton bolls.

PubMed Central

Shieh, M T; Brown, R L; Whitehead, M P; Cary, J W; Cotty, P J; Cleveland, T E; Dean, R A

1997-01-01

Isolates of Aspergillus flavus can be differentiated based on production of the polygalacturonase P2c. One group of isolates produces P2c, whereas the other group does not. In general, the group that produces P2c causes more damage and spreads to a greater extent in cotton bolls than those isolates that do not produce P2c. To determine whether P2c contributes to disease, the expression of pecA, the gene previously determined to encode P2c, was genetically altered. Adding the pecA gene to a strain previously lacking the gene resulted in the ability to cause significantly more damage to the intercarpellary membrane and the ability spread to a greater extent within the adjacent locule compared to the abilities of a control transformant. Conversely, eliminating the expression of pecA by targeted disruption caused a significant reduction in aggressiveness compared to that of a nondisrupted control transformant. These results provide direct evidence that P2c contributes to the invasion and spread of A. flavus during infection of cotton bolls. However, other factors not evaluated in this study also contribute to aggressiveness. PMID:9293005

Moving Speciation Genetics Forward: Modern Techniques Build on Foundational Studies in Drosophila.

PubMed

Castillo, Dean M; Barbash, Daniel A

2017-11-01

The question of how new species evolve has been examined at every level, from macroevolutionary patterns of diversification to molecular population genetic analyses of specific genomic regions between species pairs. Drosophila has been at the center of many of these research efforts. Though our understanding of the speciation process has grown considerably over the past few decades, very few genes have been identified that contribute to barriers to reproduction. The development of advanced molecular genetic and genomic methods provides promising avenues for the rapid discovery of more genes that contribute to speciation, particularly those involving prezygotic isolation. The continued expansion of tools and resources, especially for species other than Drosophila melanogaster , will be most effective when coupled with comparative approaches that reveal the genetic basis of reproductive isolation across a range of divergence times. Future research programs in Drosophila have high potential to answer long-standing questions in speciation. These include identifying the selective forces that contribute to divergence between populations and the genetic basis of traits that cause reproductive isolation. The latter can be expanded upon to understand how the genetic basis of reproductive isolation changes over time and whether certain pathways and genes are more commonly involved. Copyright © 2017 by the Genetics Society of America.

Evolution and Expression Patterns of TCP Genes in Asparagales

PubMed Central

Madrigal, Yesenia; Alzate, Juan F.; Pabón-Mora, Natalia

2017-01-01

CYCLOIDEA-like genes are involved in the symmetry gene network, limiting cell proliferation in the dorsal regions of bilateral flowers in core eudicots. CYC-like and closely related TCP genes (acronym for TEOSINTE BRANCHED1, CYCLOIDEA, and PROLIFERATION CELL FACTOR) have been poorly studied in Asparagales, the largest order of monocots that includes both bilateral flowers in Orchidaceae (ca. 25.000 spp) and radially symmetrical flowers in Hypoxidaceae (ca. 200 spp). With the aim of assessing TCP gene evolution in the Asparagales, we isolated TCP-like genes from publicly available databases and our own transcriptomes of Cattleya trianae (Orchidaceae) and Hypoxis decumbens (Hypoxidaceae). Our matrix contains 452 sequences representing the three major clades of TCP genes. Besides the previously identified CYC specific core eudicot duplications, our ML phylogenetic analyses recovered an early CIN-like duplication predating all angiosperms, two CIN-like Asparagales-specific duplications and a duplication prior to the diversification of Orchidoideae and Epidendroideae. In addition, we provide evidence of at least three duplications of PCF-like genes in Asparagales. While CIN-like and PCF-like genes have multiplied in Asparagales, likely enhancing the genetic network for cell proliferation, CYC-like genes remain as single, shorter copies with low expression. Homogeneous expression of CYC-like genes in the labellum as well as the lateral petals suggests little contribution to the bilateral perianth in C. trianae. CIN-like and PCF-like gene expression suggests conserved roles in cell proliferation in leaves, sepals and petals, carpels, ovules and fruits in Asparagales by comparison with previously reported functions in core eudicots and monocots. This is the first large scale analysis of TCP-like genes in Asparagales that will serve as a platform for in-depth functional studies in emerging model monocots. PMID:28144250

Identification of amino acid substitutions with compensational effects in the attachment protein of canine distemper virus.

PubMed

Sattler, Ursula; Khosravi, Mojtaba; Avila, Mislay; Pilo, Paola; Langedijk, Johannes P; Ader-Ebert, Nadine; Alves, Lisa A; Plattet, Philippe; Origgi, Francesco C

2014-07-01

The hemagglutinin (H) gene of canine distemper virus (CDV) encodes the receptor-binding protein. This protein, together with the fusion (F) protein, is pivotal for infectivity since it contributes to the fusion of the viral envelope with the host cell membrane. Of the two receptors currently known for CDV (nectin-4 and the signaling lymphocyte activation molecule [SLAM]), SLAM is considered the most relevant for host susceptibility. To investigate how evolution might have impacted the host-CDV interaction, we examined the functional properties of a series of missense single nucleotide polymorphisms (SNPs) naturally accumulating within the H-gene sequences during the transition between two distinct but related strains. The two strains, a wild-type strain and a consensus strain, were part of a single continental outbreak in European wildlife and occurred in distinct geographical areas 2 years apart. The deduced amino acid sequence of the two H genes differed at 5 residues. A panel of mutants carrying all the combinations of the SNPs was obtained by site-directed mutagenesis. The selected mutant, wild type, and consensus H proteins were functionally evaluated according to their surface expression, SLAM binding, fusion protein interaction, and cell fusion efficiencies. The results highlight that the most detrimental functional effects are associated with specific sets of SNPs. Strikingly, an efficient compensational system driven by additional SNPs appears to come into play, virtually neutralizing the negative functional effects. This system seems to contribute to the maintenance of the tightly regulated function of the H-gene-encoded attachment protein. Importance: To investigate how evolution might have impacted the host-canine distemper virus (CDV) interaction, we examined the functional properties of naturally occurring single nucleotide polymorphisms (SNPs) in the hemagglutinin gene of two related but distinct strains of CDV. The hemagglutinin gene encodes the attachment protein, which is pivotal for infection. Our results show that few SNPs have a relevant detrimental impact and they generally appear in specific combinations (molecular signatures). These drastic negative changes are neutralized by compensatory mutations, which contribute to maintenance of an overall constant bioactivity of the attachment protein. This compensational mechanism might reflect the reaction of the CDV machinery to the changes occurring in the virus following antigenic variations critical for virulence. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Accurate and sensitive quantification of protein-DNA binding affinity.

PubMed

Rastogi, Chaitanya; Rube, H Tomas; Kribelbauer, Judith F; Crocker, Justin; Loker, Ryan E; Martini, Gabriella D; Laptenko, Oleg; Freed-Pastor, William A; Prives, Carol; Stern, David L; Mann, Richard S; Bussemaker, Harmen J

2018-04-17

Transcription factors (TFs) control gene expression by binding to genomic DNA in a sequence-specific manner. Mutations in TF binding sites are increasingly found to be associated with human disease, yet we currently lack robust methods to predict these sites. Here, we developed a versatile maximum likelihood framework named No Read Left Behind (NRLB) that infers a biophysical model of protein-DNA recognition across the full affinity range from a library of in vitro selected DNA binding sites. NRLB predicts human Max homodimer binding in near-perfect agreement with existing low-throughput measurements. It can capture the specificity of the p53 tetramer and distinguish multiple binding modes within a single sample. Additionally, we confirm that newly identified low-affinity enhancer binding sites are functional in vivo, and that their contribution to gene expression matches their predicted affinity. Our results establish a powerful paradigm for identifying protein binding sites and interpreting gene regulatory sequences in eukaryotic genomes. Copyright © 2018 the Author(s). Published by PNAS.

Accurate and sensitive quantification of protein-DNA binding affinity

PubMed Central

Rastogi, Chaitanya; Rube, H. Tomas; Kribelbauer, Judith F.; Crocker, Justin; Loker, Ryan E.; Martini, Gabriella D.; Laptenko, Oleg; Freed-Pastor, William A.; Prives, Carol; Stern, David L.; Mann, Richard S.; Bussemaker, Harmen J.

2018-01-01

Transcription factors (TFs) control gene expression by binding to genomic DNA in a sequence-specific manner. Mutations in TF binding sites are increasingly found to be associated with human disease, yet we currently lack robust methods to predict these sites. Here, we developed a versatile maximum likelihood framework named No Read Left Behind (NRLB) that infers a biophysical model of protein-DNA recognition across the full affinity range from a library of in vitro selected DNA binding sites. NRLB predicts human Max homodimer binding in near-perfect agreement with existing low-throughput measurements. It can capture the specificity of the p53 tetramer and distinguish multiple binding modes within a single sample. Additionally, we confirm that newly identified low-affinity enhancer binding sites are functional in vivo, and that their contribution to gene expression matches their predicted affinity. Our results establish a powerful paradigm for identifying protein binding sites and interpreting gene regulatory sequences in eukaryotic genomes. PMID:29610332

Dimerization-induced corepressor binding and relaxed DNA-binding specificity are critical for PML/RARA-induced immortalization

PubMed Central

Zhou, Jun; Pérès, Laurent; Honoré, Nicole; Nasr, Rihab; Zhu, Jun; de Thé, Hugues

2006-01-01

The pathogenesis of acute promyelocytic leukemia involves the transcriptional repression of master genes of myeloid differentiation by the promyelocytic leukemia–retinoic acid receptor α (PML/RARA) oncogene. PML-enforced RARA homodimerization allows the tighter binding of corepressors, silencing RARA target genes. In addition, homodimerization dramatically extends the spectrum of DNA-binding sites of the fusion protein compared with those of normal RARA. Yet, any contribution of these two properties of PML/RARA to differentiation arrest and immortalization of primary mouse hematopoietic progenitors was unknown. We demonstrate that dimerization-induced silencing mediator of retinoid and thyroid receptors (SMRT)-enhanced binding and relaxed DNA-binding site specificity are both required for efficient immortalization. Thus, enforced RARA dimerization is critical not only for triggering transcriptional repression but also for extending the repertoire of target genes. Our studies exemplify how dimerization-induced gain of functions converts an unessential transcription factor into a dominant oncogenic protein. PMID:16757557

Germline Mutations and Polymorphisms in the Origins of Cancers in Women

PubMed Central

Hirshfield, Kim M.; Rebbeck, Timothy R.; Levine, Arnold J.

2010-01-01

Several female malignancies including breast, ovarian, and endometrial cancers can be characterized based on known somatic and germline mutations. Initiation and propagation of tumors reflect underlying genomic alterations such as mutations, polymorphisms, and copy number variations found in genes of multiple cellular pathways. The contributions of any single genetic variation or mutation in a population depend on its frequency and penetrance as well as tissue-specific functionality. Genome wide association studies, fluorescence in situ hybridization, comparative genomic hybridization, and candidate gene studies have enumerated genetic contributors to cancers in women. These include p53, BRCA1, BRCA2, STK11, PTEN, CHEK2, ATM, BRIP1, PALB2, FGFR2, TGFB1, MDM2, MDM4 as well as several other chromosomal loci. Based on the heterogeneity within a specific tumor type, a combination of genomic alterations defines the cancer subtype, biologic behavior, and in some cases, response to therapeutics. Consideration of tumor heterogeneity is therefore important in the critical analysis of gene associations in cancer. PMID:20111735

Genome-wide identification, phylogeny and expressional profiles of mitogen activated protein kinase kinase kinase (MAPKKK) gene family in bread wheat (Triticum aestivum L.).

PubMed

Wang, Meng; Yue, Hong; Feng, Kewei; Deng, Pingchuan; Song, Weining; Nie, Xiaojun

2016-08-22

Mitogen-activated protein kinase kinase kinases (MAPKKKs) are the important components of MAPK cascades, which play the crucial role in plant growth and development as well as in response to diverse stresses. Although this family has been systematically studied in many plant species, little is known about MAPKKK genes in wheat (Triticum aestivum L.), especially those involved in the regulatory network of stress processes. In this study, we identified 155 wheat MAPKKK genes through a genome-wide search method based on the latest available wheat genome information, of which 29 belonged to MEKK, 11 to ZIK and 115 to Raf subfamily, respectively. Then, chromosome localization, gene structure and conserved protein motifs and phylogenetic relationship as well as regulatory network of these TaMAPKKKs were systematically investigated and results supported the prediction. Furthermore, a total of 11 homologous groups between A, B and D sub-genome and 24 duplication pairs among them were detected, which contributed to the expansion of wheat MAPKKK gene family. Finally, the expression profiles of these MAPKKKs during development and under different abiotic stresses were investigated using the RNA-seq data. Additionally, 10 tissue-specific and 4 salt-responsive TaMAPKKK genes were selected to validate their expression level through qRT-PCR analysis. This study for the first time reported the genome organization, evolutionary features and expression profiles of the wheat MAPKKK gene family, which laid the foundation for further functional analysis of wheat MAPKKK genes, and contributed to better understanding the roles and regulatory mechanism of MAPKKKs in wheat.

Highly conserved proximal promoter element harbouring paired Sox9-binding sites contributes to the tissue- and developmental stage-specific activity of the matrilin-1 gene.

PubMed

Rentsendorj, Otgonchimeg; Nagy, Andrea; Sinkó, Ildikó; Daraba, Andreea; Barta, Endre; Kiss, Ibolya

2005-08-01

The matrilin-1 gene has the unique feature that it is expressed in chondrocytes in a developmental stage-specific manner. Previously, we found that the chicken matrilin-1 long promoter with or without the intronic enhancer and the short promoter with the intronic enhancer restricted the transgene expression to the columnar proliferative chondroblasts and prehypertrophic chondrocytes of growth-plate cartilage in transgenic mice. To study whether the short promoter shared by these transgenes harbours cartilage-specific control elements, we generated transgenic mice expressing the LacZ reporter gene under the control of the matrilin-1 promoter between -338 and +67. Histological analysis of the founder embryos demonstrated relatively weak transgene activity in the developing chondrocranium, axial and appendicular skeleton with highest level of expression in the columnar proliferating chondroblasts and prehypertrophic chondrocytes. Computer analysis of the matrilin-1 genes of amniotes revealed a highly conserved Pe1 (proximal promoter element 1) and two less-conserved sequence blocks in the distal promoter region. The inverted Sox motifs of the Pe1 element interacted with chondrogenic transcription factors Sox9, L-Sox5 and Sox6 in vitro and another factor bound to the spacer region. Point mutations in the Sox motifs or in the spacer region interfered with or altered the formation of nucleoprotein complexes in vitro and significantly decreased the reporter gene activity in transient expression assays in chondrocytes. In vivo occupancy of the Sox motifs in genomic footprinting in the expressing cell type, but not in fibroblasts, also supported the involvement of Pe1 in the tissue-specific regulation of the gene. Our results indicate that interaction of Pe1 with distal DNA elements is required for the high level, cartilage- and developmental stage-specific transgene expression.

A Common Histone Modification Code on C4 Genes in Maize and Its Conservation in Sorghum and Setaria italica1[W][OA

PubMed Central

Heimann, Louisa; Horst, Ina; Perduns, Renke; Dreesen, Björn; Offermann, Sascha; Peterhansel, Christoph

2013-01-01

C4 photosynthesis evolved more than 60 times independently in different plant lineages. Each time, multiple genes were recruited into C4 metabolism. The corresponding promoters acquired new regulatory features such as high expression, light induction, or cell type-specific expression in mesophyll or bundle sheath cells. We have previously shown that histone modifications contribute to the regulation of the model C4 phosphoenolpyruvate carboxylase (C4-Pepc) promoter in maize (Zea mays). We here tested the light- and cell type-specific responses of three selected histone acetylations and two histone methylations on five additional C4 genes (C4-Ca, C4-Ppdk, C4-Me, C4-Pepck, and C4-RbcS2) in maize. Histone acetylation and nucleosome occupancy assays indicated extended promoter regions with regulatory upstream regions more than 1,000 bp from the transcription initiation site for most of these genes. Despite any detectable homology of the promoters on the primary sequence level, histone modification patterns were highly coregulated. Specifically, H3K9ac was regulated by illumination, whereas H3K4me3 was regulated in a cell type-specific manner. We further compared histone modifications on the C4-Pepc and C4-Me genes from maize and the homologous genes from sorghum (Sorghum bicolor) and Setaria italica. Whereas sorghum and maize share a common C4 origin, C4 metabolism evolved independently in S. italica. The distribution of histone modifications over the promoters differed between the species, but differential regulation of light-induced histone acetylation and cell type-specific histone methylation were evident in all three species. We propose that a preexisting histone code was recruited into C4 promoter control during the evolution of C4 metabolism. PMID:23564230

In Silico Assigned Resistance Genes Confer Bifidobacterium with Partial Resistance to Aminoglycosides but Not to Β-Lactams

PubMed Central

Fouhy, Fiona; O’Connell Motherway, Mary; Fitzgerald, Gerald F.; Ross, R. Paul; Stanton, Catherine; van Sinderen, Douwe; Cotter, Paul D.

2013-01-01

Bifidobacteria have received significant attention due to their contribution to human gut health and the use of specific strains as probiotics. It is thus not surprising that there has also been significant interest with respect to their antibiotic resistance profile. Numerous culture-based studies have demonstrated that bifidobacteria are resistant to the majority of aminoglycosides, but are sensitive to β-lactams. However, limited research exists with respect to the genetic basis for the resistance of bifidobacteria to aminoglycosides. Here we performed an in-depth in silico analysis of putative Bifidobacterium-encoded aminoglycoside resistance proteins and β-lactamases and assess the contribution of these proteins to antibiotic resistance. The in silico-based screen detected putative aminoglycoside and β-lactam resistance proteins across the Bifidobacterium genus. Laboratory-based investigations of a number of representative bifidobacteria strains confirmed that despite containing putative β-lactamases, these strains were sensitive to β-lactams. In contrast, all strains were resistant to the aminoglycosides tested. To assess the contribution of genes encoding putative aminoglycoside resistance proteins in Bifidobacterium sp. two genes, namely Bbr_0651 and Bbr_1586, were targeted for insertional inactivation in B. breve UCC2003. As compared to the wild-type, the UCC2003 insertion mutant strains exhibited decreased resistance to gentamycin, kanamycin and streptomycin. This study highlights the associated risks of relying on the in silico assignment of gene function. Although several putative β-lactam resistance proteins are located in bifidobacteria, their presence does not coincide with resistance to these antibiotics. In contrast however, this approach has resulted in the identification of two loci that contribute to the aminoglycoside resistance of B. breve UCC2003 and, potentially, many other bifidobacteria. PMID:24324818

Genetic Mechanisms Leading to Sex Differences Across Common Diseases and Anthropometric Traits.

PubMed

Traglia, Michela; Bseiso, Dina; Gusev, Alexander; Adviento, Brigid; Park, Daniel S; Mefford, Joel A; Zaitlen, Noah; Weiss, Lauren A

2017-02-01

Common diseases often show sex differences in prevalence, onset, symptomology, treatment, or prognosis. Although studies have been performed to evaluate sex differences at specific SNP associations, this work aims to comprehensively survey a number of complex heritable diseases and anthropometric traits. Potential genetically encoded sex differences we investigated include differential genetic liability thresholds or distributions, gene-sex interaction at autosomal loci, major contribution of the X-chromosome, or gene-environment interactions reflected in genes responsive to androgens or estrogens. Finally, we tested the overlap between sex-differential association with anthropometric traits and disease risk. We utilized complementary approaches of assessing GWAS association enrichment and SNP-based heritability estimation to explore explicit sex differences, as well as enrichment in sex-implicated functional categories. We do not find consistent increased genetic load in the lower-prevalence sex, or a disproportionate role for the X-chromosome in disease risk, despite sex-heterogeneity on the X for several traits. We find that all anthropometric traits show less than complete correlation between the genetic contribution to males and females, and find a convincing example of autosome-wide genome-sex interaction in multiple sclerosis (P = 1 × 10 -9 ). We also find some evidence for hormone-responsive gene enrichment, and striking evidence of the contribution of sex-differential anthropometric associations to common disease risk, implying that general mechanisms of sexual dimorphism determining secondary sex characteristics have shared effects on disease risk. Copyright © 2017 by the Genetics Society of America.

Female-specific gene expression in dioecious liverwort Pellia endiviifolia is developmentally regulated and connected to archegonia production.

PubMed

Sierocka, Izabela; Kozlowski, Lukasz P; Bujnicki, Janusz M; Jarmolowski, Artur; Szweykowska-Kulinska, Zofia

2014-06-17

In flowering plants a number of genes have been identified which control the transition from a vegetative to generative phase of life cycle. In bryophytes representing basal lineage of land plants, there is little data regarding the mechanisms that control this transition. Two species from bryophytes - moss Physcomitrella patens and liverwort Marchantia polymorpha are under advanced molecular and genetic research. The goal of our study was to identify genes connected to female gametophyte development and archegonia production in the dioecious liverwort Pellia endiviifolia species B, which is representative of the most basal lineage of the simple thalloid liverworts. The utility of the RDA-cDNA technique allowed us to identify three genes specifically expressed in the female individuals of P.endiviifolia: PenB_CYSP coding for cysteine protease, PenB_MT2 and PenB_MT3 coding for Mysterious Transcripts1 and 2 containing ORFs of 143 and 177 amino acid residues in length, respectively. The exon-intron structure of all three genes has been characterized and pre-mRNA processing was investigated. Interestingly, five mRNA isoforms are produced from the PenB_MT2 gene, which result from alternative splicing within the second and third exon. All observed splicing events take place within the 5'UTR and do not interfere with the coding sequence. All three genes are exclusively expressed in the female individuals, regardless of whether they were cultured in vitro or were collected from a natural habitat. Moreover we observed ten-fold increased transcripts level for all three genes in the archegonial tissue in comparison to the vegetative parts of the same female thalli grown in natural habitat suggesting their connection to archegonia development. We have identified three genes which are specifically expressed in P.endiviifolia sp B female gametophytes. Moreover, their expression is connected to the female sex-organ differentiation and is developmentally regulated. The contribution of the identified genes may be crucial for successful liverwort sexual reproduction.

The muscle creatine kinase gene is regulated by multiple upstream elements, including a muscle-specific enhancer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jaynes, J.B.; Johnson, J.E.; Buskin, J.N.

1988-01-01

Muscle creatine kinase (MCK) is induced to high levels during skeletal muscle differentiation. The authors examined the upstream regulatory elements of the mouse MCK gene which specify its activation during myogenesis in culture. Fusion genes containing up to 3,300 nucleotides (nt) of MCK 5' flanking DNA in various positions and orientations relative to the bacterial chloramphenicol acetyltransferase (CAT) structural gene were transfected into cultured cells. Transient expression of CAT was compared between proliferating and differentiated MM14 mouse myoblasts and with nonmyogenic mouse L cells. The major effector of high-level expression was found to have the properties of a transcriptional enhancer.more » This element, located between 1,050 and 1,256 nt upstream of the transcription start site, was also found to have a major influence on the tissue and differentiation specificity of MCK expression; it activated either the MCK promoter or heterologous promoters only in differentiated muscle cells. Comparisons of viral and cellular enhancer sequences with the MCK enhancer revealed some similarities to essential regions of the simian virus 40 enhancer as well as to a region of the immunoglobulin heavy-chain enhancer, which has been implicated in tissue-specific protein binding. Even in the absence of the enhancer, low-level expression from a 776-nt MCK promoter retained differentiation specificity. In addition to positive regulatory elements, our data provide some evidence for negative regulatory elements with activity in myoblasts. These may contribute to the cell type and differentiation specificity of MCK expression.« less

Site-specific programming of the host epithelial transcriptome by the gut microbiota.

PubMed

Sommer, Felix; Nookaew, Intawat; Sommer, Nina; Fogelstrand, Per; Bäckhed, Fredrik

2015-03-28

The intestinal epithelium separates us from the microbiota but also interacts with it and thus affects host immune status and physiology. Previous studies investigated microbiota-induced responses in the gut using intact tissues or unfractionated epithelial cells, thereby limiting conclusions about regional differences in the epithelium. Here, we sought to investigate microbiota-induced transcriptional responses in specific fractions of intestinal epithelial cells. To this end, we used microarray analysis of laser capture microdissection (LCM)-harvested ileal and colonic tip and crypt epithelial fractions from germ-free and conventionally raised mice and from mice during the time course of colonization. We found that about 10% of the host's transcriptome was microbially regulated, mainly including genes annotated with functions in immunity, cell proliferation, and metabolism. The microbial impact on host gene expression was highly site specific, as epithelial responses to the microbiota differed between cell fractions. Specific transcriptional regulators were enriched in each fraction. In general, the gut microbiota induced a more rapid response in the colon than in the ileum. Our study indicates that the microbiota engage different regulatory networks to alter host gene expression in a particular niche. Understanding host-microbiota interactions on a cellular level may facilitate signaling pathways that contribute to health and disease and thus provide new therapeutic strategies.

Dominance and Sexual Dimorphism Pervade the Salix purpurea L. Transcriptome

DOE PAGES

Carlson, Craig H.; Choi, Yongwook; Chan, Agnes P.; ...

2017-09-01

The heritability of gene expression is critical in understanding heterosis and is dependent on allele-specific regulation by local and remote factors in the genome. We used RNA-Seq to test whether variation in gene expression among F 1 and F 2 intraspecific Salix purpurea progeny is attributable to cis- and trans-regulatory divergence. We assessed the mode of inheritance based on gene expression levels and allele-specific expression for F1 and F2 intraspecific progeny in two distinct tissue types: shoot tip and stem internode. In addition, we explored sexually dimorphic patterns of inheritance and regulatory divergence among F 1 progeny individuals. We showmore » that in S. purpurea intraspecific crosses, gene expression inheritance largely exhibits a maternal dominant pattern, regardless of tissue type or pedigree. A significantly greater number of cis- and trans-regulated genes coincided with upregulation of the maternal parent allele in the progeny, irrespective of the magnitude, whereas the paternal allele was higher expressed for genes showing cis × trans or compensatory regulation. Importantly, consistent with previous genetic mapping results for sex in shrub willow, we have delimited sex-biased gene expression to a 2 Mb pericentromeric region on S. purpurea chr15 and further refined the sex determination region. Lastly, altogether, our results offer insight into the inheritance of gene expression in S. purpurea as well as evidence of sexually dimorphic expression which may have contributed to the evolution of dioecy in Salix.« less

Dominance and Sexual Dimorphism Pervade the Salix purpurea L. Transcriptome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Carlson, Craig H.; Choi, Yongwook; Chan, Agnes P.

The heritability of gene expression is critical in understanding heterosis and is dependent on allele-specific regulation by local and remote factors in the genome. We used RNA-Seq to test whether variation in gene expression among F 1 and F 2 intraspecific Salix purpurea progeny is attributable to cis- and trans-regulatory divergence. We assessed the mode of inheritance based on gene expression levels and allele-specific expression for F1 and F2 intraspecific progeny in two distinct tissue types: shoot tip and stem internode. In addition, we explored sexually dimorphic patterns of inheritance and regulatory divergence among F 1 progeny individuals. We showmore » that in S. purpurea intraspecific crosses, gene expression inheritance largely exhibits a maternal dominant pattern, regardless of tissue type or pedigree. A significantly greater number of cis- and trans-regulated genes coincided with upregulation of the maternal parent allele in the progeny, irrespective of the magnitude, whereas the paternal allele was higher expressed for genes showing cis × trans or compensatory regulation. Importantly, consistent with previous genetic mapping results for sex in shrub willow, we have delimited sex-biased gene expression to a 2 Mb pericentromeric region on S. purpurea chr15 and further refined the sex determination region. Lastly, altogether, our results offer insight into the inheritance of gene expression in S. purpurea as well as evidence of sexually dimorphic expression which may have contributed to the evolution of dioecy in Salix.« less

Complete genome sequence of Corynebacterium variabile DSM 44702 isolated from the surface of smear-ripened cheeses and insights into cheese ripening and flavor generation

PubMed Central

2011-01-01

Background Corynebacterium variabile is part of the complex microflora on the surface of smear-ripened cheeses and contributes to the development of flavor and textural properties during cheese ripening. Still little is known about the metabolic processes and microbial interactions during the production of smear-ripened cheeses. Therefore, the gene repertoire contributing to the lifestyle of the cheese isolate C. variabile DSM 44702 was deduced from the complete genome sequence to get a better understanding of this industrial process. Results The chromosome of C. variabile DSM 44702 is composed of 3, 433, 007 bp and contains 3, 071 protein-coding regions. A comparative analysis of this gene repertoire with that of other corynebacteria detected 1, 534 predicted genes to be specific for the cheese isolate. These genes might contribute to distinct metabolic capabilities of C. variabile, as several of them are associated with metabolic functions in cheese habitats by playing roles in the utilization of alternative carbon and sulphur sources, in amino acid metabolism, and fatty acid degradation. Relevant C. variabile genes confer the capability to catabolize gluconate, lactate, propionate, taurine, and gamma-aminobutyric acid and to utilize external caseins. In addition, C. variabile is equipped with several siderophore biosynthesis gene clusters for iron acquisition and an exceptional repertoire of AraC-regulated iron uptake systems. Moreover, C. variabile can produce acetoin, butanediol, and methanethiol, which are important flavor compounds in smear-ripened cheeses. Conclusions The genome sequence of C. variabile provides detailed insights into the distinct metabolic features of this bacterium, implying a strong adaption to the iron-depleted cheese surface habitat. By combining in silico data obtained from the genome annotation with previous experimental knowledge, occasional observations on genes that are involved in the complex metabolic capacity of C. variabile were integrated into a global view on the lifestyle of this species. PMID:22053731

Distinct tissue-specific transcriptional regulation revealed by gene regulatory networks in maize.

PubMed

Huang, Ji; Zheng, Juefei; Yuan, Hui; McGinnis, Karen

2018-06-07

Transcription factors (TFs) are proteins that can bind to DNA sequences and regulate gene expression. Many TFs are master regulators in cells that contribute to tissue-specific and cell-type-specific gene expression patterns in eukaryotes. Maize has been a model organism for over one hundred years, but little is known about its tissue-specific gene regulation through TFs. In this study, we used a network approach to elucidate gene regulatory networks (GRNs) in four tissues (leaf, root, SAM and seed) in maize. We utilized GENIE3, a machine-learning algorithm combined with large quantity of RNA-Seq expression data to construct four tissue-specific GRNs. Unlike some other techniques, this approach is not limited by high-quality Position Weighed Matrix (PWM), and can therefore predict GRNs for over 2000 TFs in maize. Although many TFs were expressed across multiple tissues, a multi-tiered analysis predicted tissue-specific regulatory functions for many transcription factors. Some well-studied TFs emerged within the four tissue-specific GRNs, and the GRN predictions matched expectations based upon published results for many of these examples. Our GRNs were also validated by ChIP-Seq datasets (KN1, FEA4 and O2). Key TFs were identified for each tissue and matched expectations for key regulators in each tissue, including GO enrichment and identity with known regulatory factors for that tissue. We also found functional modules in each network by clustering analysis with the MCL algorithm. By combining publicly available genome-wide expression data and network analysis, we can uncover GRNs at tissue-level resolution in maize. Since ChIP-Seq and PWMs are still limited in several model organisms, our study provides a uniform platform that can be adapted to any species with genome-wide expression data to construct GRNs. We also present a publicly available database, maize tissue-specific GRN (mGRN, https://www.bio.fsu.edu/mcginnislab/mgrn/ ), for easy querying. All source code and data are available at Github ( https://github.com/timedreamer/maize_tissue-specific_GRN ).

Valine-glutamine (VQ) motif coding genes are ancient and non-plant-specific with comprehensive expression regulation by various biotic and abiotic stresses.

PubMed

Jiang, Shu-Ye; Sevugan, Mayalagu; Ramachandran, Srinivasan

2018-05-09

Valine-glutamine (VQ) motif containing proteins play important roles in abiotic and biotic stress responses in plants. However, little is known about the origin and evolution as well as comprehensive expression regulation of the VQ gene family. In this study, we systematically surveyed this gene family in 50 plant genomes from algae, moss, gymnosperm and angiosperm and explored their presence in other species from animals, bacteria, fungi and viruses. No VQs were detected in all tested algae genomes and all genomes from moss, gymnosperm and angiosperm encode varying numbers of VQs. Interestingly, some of fungi, lower animals and bacteria also encode single to a few VQs. Thus, they are not plant-specific and should be regarded as an ancient family. Their family expansion was mainly due to segmental duplication followed by tandem duplication and mobile elements. Limited contribution of gene conversion was detected to the family evolution. Generally, VQs were very much conserved in their motif coding region and were under purifying selection. However, positive selection was also observed during species divergence. Many VQs were up- or down-regulated by various abiotic / biotic stresses and phytohormones in rice and Arabidopsis. They were also co-expressed with some of other stress-related genes. All of the expression data suggest a comprehensive expression regulation of the VQ gene family. We provide new insights into gene expansion, divergence, evolution and their expression regulation of this VQ family. VQs were detectable not only in plants but also in some of fungi, lower animals and bacteria, suggesting the evolutionary conservation and the ancient origin. Overall, VQs are non-plant-specific and play roles in abiotic / biotic responses or other biological processes through comprehensive expression regulation.

Comprehensive analysis of the mutation spectrum in 301 German ALS families.

PubMed

Müller, Kathrin; Brenner, David; Weydt, Patrick; Meyer, Thomas; Grehl, Torsten; Petri, Susanne; Grosskreutz, Julian; Schuster, Joachim; Volk, Alexander E; Borck, Guntram; Kubisch, Christian; Klopstock, Thomas; Zeller, Daniel; Jablonka, Sibylle; Sendtner, Michael; Klebe, Stephan; Knehr, Antje; Günther, Kornelia; Weis, Joachim; Claeys, Kristl G; Schrank, Berthold; Sperfeld, Anne-Dorte; Hübers, Annemarie; Otto, Markus; Dorst, Johannes; Meitinger, Thomas; Strom, Tim M; Andersen, Peter M; Ludolph, Albert C; Weishaupt, Jochen H

2018-04-12

Recent advances in amyotrophic lateral sclerosis (ALS) genetics have revealed that mutations in any of more than 25 genes can cause ALS, mostly as an autosomal-dominant Mendelian trait. Detailed knowledge about the genetic architecture of ALS in a specific population will be important for genetic counselling but also for genotype-specific therapeutic interventions. Here we combined fragment length analysis, repeat-primed PCR, Southern blotting, Sanger sequencing and whole exome sequencing to obtain a comprehensive profile of genetic variants in ALS disease genes in 301 German pedigrees with familial ALS. We report C9orf72 mutations as well as variants in consensus splice sites and non-synonymous variants in protein-coding regions of ALS genes. We furthermore estimate their pathogenicity by taking into account type and frequency of the respective variant as well as segregation within the families. 49% of our German ALS families carried a likely pathogenic variant in at least one of the earlier identified ALS genes. In 45% of the ALS families, likely pathogenic variants were detected in C9orf72, SOD1, FUS, TARDBP or TBK1 , whereas the relative contribution of the other ALS genes in this familial ALS cohort was 4%. We identified several previously unreported rare variants and demonstrated the absence of likely pathogenic variants in some of the recently described ALS disease genes. We here present a comprehensive genetic characterisation of German familial ALS. The present findings are of importance for genetic counselling in clinical practice, for molecular research and for the design of diagnostic gene panels or genotype-specific therapeutic interventions in Europe. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

Network-Based Identification and Prioritization of Key Regulators of Coronary Artery Disease Loci

PubMed Central

Zhao, Yuqi; Chen, Jing; Freudenberg, Johannes M.; Meng, Qingying; Rajpal, Deepak K.; Yang, Xia

2017-01-01

Objective Recent genome-wide association studies of coronary artery disease (CAD) have revealed 58 genome-wide significant and 148 suggestive genetic loci. However, the molecular mechanisms through which they contribute to CAD and the clinical implications of these findings remain largely unknown. We aim to retrieve gene subnetworks of the 206 CAD loci and identify and prioritize candidate regulators to better understand the biological mechanisms underlying the genetic associations. Approach and Results We devised a new integrative genomics approach that incorporated (1) candidate genes from the top CAD loci, (2) the complete genetic association results from the 1000 genomes-based CAD genome-wide association studies from the Coronary Artery Disease Genome Wide Replication and Meta-Analysis Plus the Coronary Artery Disease consortium, (3) tissue-specific gene regulatory networks that depict the potential relationship and interactions between genes, and (4) tissue-specific gene expression patterns between CAD patients and controls. The networks and top-ranked regulators according to these data-driven criteria were further queried against literature, experimental evidence, and drug information to evaluate their disease relevance and potential as drug targets. Our analysis uncovered several potential novel regulators of CAD such as LUM and STAT3, which possess properties suitable as drug targets. We also revealed molecular relations and potential mechanisms through which the top CAD loci operate. Furthermore, we found that multiple CAD-relevant biological processes such as extracellular matrix, inflammatory and immune pathways, complement and coagulation cascades, and lipid metabolism interact in the CAD networks. Conclusions Our data-driven integrative genomics framework unraveled tissue-specific relations among the candidate genes of the CAD genome-wide association studies loci and prioritized novel network regulatory genes orchestrating biological processes relevant to CAD. PMID:26966275

Genetic and molecular characterization of a gene encoding a wide specificity purine permease of Aspergillus nidulans reveals a novel family of transporters conserved in prokaryotes and eukaryotes.

PubMed

Diallinas, G; Gorfinkiel, L; Arst, H N; Cecchetto, G; Scazzocchio, C

1995-04-14

In Aspergillus nidulans, loss-of-function mutations in the uapA and azgA genes, encoding the major uric acid-xanthine and hypoxanthine-adenine-guanine permeases, respectively, result in impaired utilization of these purines as sole nitrogen sources. The residual growth of the mutant strains is due to the activity of a broad specificity purine permease. We have identified uapC, the gene coding for this third permease through the isolation of both gain-of-function and loss-of-function mutations. Uptake studies with wild-type and mutant strains confirmed the genetic analysis and showed that the UapC protein contributes 30% and 8-10% to uric acid and hypoxanthine transport rates, respectively. The uapC gene was cloned, its expression studied, its sequence and transcript map established, and the sequence of its putative product analyzed. uapC message accumulation is: (i) weakly induced by 2-thiouric acid; (ii) repressed by ammonium; (iii) dependent on functional uaY and areA regulatory gene products (mediating uric acid induction and nitrogen metabolite repression, respectively); (iv) increased by uapC gain-of-function mutations which specifically, but partially, suppress a leucine to valine mutation in the zinc finger of the protein coded by the areA gene. The putative uapC gene product is a highly hydrophobic protein of 580 amino acids (M(r) = 61,251) including 12-14 putative transmembrane segments. The UapC protein is highly similar (58% identity) to the UapA permease and significantly similar (23-34% identity) to a number of bacterial transporters. Comparisons of the sequences and hydropathy profiles of members of this novel family of transporters yield insights into their structure, functionally important residues, and possible evolutionary relationships.

Aldehyde Dehydrogenase Gene Superfamily in Populus: Organization and Expression Divergence between Paralogous Gene Pairs.

PubMed

Tian, Feng-Xia; Zang, Jian-Lei; Wang, Tan; Xie, Yu-Li; Zhang, Jin; Hu, Jian-Jun

2015-01-01

Aldehyde dehydrogenases (ALDHs) constitute a superfamily of NAD(P)+-dependent enzymes that catalyze the irreversible oxidation of a wide range of reactive aldehydes to their corresponding nontoxic carboxylic acids. ALDHs have been studied in many organisms from bacteria to mammals; however, no systematic analyses incorporating genome organization, gene structure, expression profiles, and cis-acting elements have been conducted in the model tree species Populus trichocarpa thus far. In this study, a comprehensive analysis of the Populus ALDH gene superfamily was performed. A total of 26 Populus ALDH genes were found to be distributed across 12 chromosomes. Genomic organization analysis indicated that purifying selection may have played a pivotal role in the retention and maintenance of PtALDH gene families. The exon-intron organizations of PtALDHs were highly conserved within the same family, suggesting that the members of the same family also may have conserved functionalities. Microarray data and qRT-PCR analysis indicated that most PtALDHs had distinct tissue-specific expression patterns. The specificity of cis-acting elements in the promoter regions of the PtALDHs and the divergence of expression patterns between nine paralogous PtALDH gene pairs suggested that gene duplications may have freed the duplicate genes from the functional constraints. The expression levels of some ALDHs were up- or down-regulated by various abiotic stresses, implying that the products of these genes may be involved in the adaptation of Populus to abiotic stresses. Overall, the data obtained from our investigation contribute to a better understanding of the complexity of the Populus ALDH gene superfamily and provide insights into the function and evolution of ALDH gene families in vascular plants.

Coalitional game theory as a promising approach to identify candidate autism genes.

PubMed

Gupta, Anika; Sun, Min Woo; Paskov, Kelley Marie; Stockham, Nate Tyler; Jung, Jae-Yoon; Wall, Dennis Paul

2018-01-01

Despite mounting evidence for the strong role of genetics in the phenotypic manifestation of Autism Spectrum Disorder (ASD), the specific genes responsible for the variable forms of ASD remain undefined. ASD may be best explained by a combinatorial genetic model with varying epistatic interactions across many small effect mutations. Coalitional or cooperative game theory is a technique that studies the combined effects of groups of players, known as coalitions, seeking to identify players who tend to improve the performance--the relationship to a specific disease phenotype--of any coalition they join. This method has been previously shown to boost biologically informative signal in gene expression data but to-date has not been applied to the search for cooperative mutations among putative ASD genes. We describe our approach to highlight genes relevant to ASD using coalitional game theory on alteration data of 1,965 fully sequenced genomes from 756 multiplex families. Alterations were encoded into binary matrices for ASD (case) and unaffected (control) samples, indicating likely gene-disrupting, inherited mutations in altered genes. To determine individual gene contributions given an ASD phenotype, a "player" metric, referred to as the Shapley value, was calculated for each gene in the case and control cohorts. Sixty seven genes were found to have significantly elevated player scores and likely represent significant contributors to the genetic coordination underlying ASD. Using network and cross-study analysis, we found that these genes are involved in biological pathways known to be affected in the autism cases and that a subset directly interact with several genes known to have strong associations to autism. These findings suggest that coalitional game theory can be applied to large-scale genomic data to identify hidden yet influential players in complex polygenic disorders such as autism.

Modes of gene duplication contribute differently to genetic novelty and redundancy, but show parallels across divergent angiosperms.

PubMed

Wang, Yupeng; Wang, Xiyin; Tang, Haibao; Tan, Xu; Ficklin, Stephen P; Feltus, F Alex; Paterson, Andrew H

2011-01-01

Both single gene and whole genome duplications (WGD) have recurred in angiosperm evolution. However, the evolutionary effects of different modes of gene duplication, especially regarding their contributions to genetic novelty or redundancy, have been inadequately explored. In Arabidopsis thaliana and Oryza sativa (rice), species that deeply sample botanical diversity and for which expression data are available from a wide range of tissues and physiological conditions, we have compared expression divergence between genes duplicated by six different mechanisms (WGD, tandem, proximal, DNA based transposed, retrotransposed and dispersed), and between positional orthologs. Both neo-functionalization and genetic redundancy appear to contribute to retention of duplicate genes. Genes resulting from WGD and tandem duplications diverge slowest in both coding sequences and gene expression, and contribute most to genetic redundancy, while other duplication modes contribute more to evolutionary novelty. WGD duplicates may more frequently be retained due to dosage amplification, while inferred transposon mediated gene duplications tend to reduce gene expression levels. The extent of expression divergence between duplicates is discernibly related to duplication modes, different WGD events, amino acid divergence, and putatively neutral divergence (time), but the contribution of each factor is heterogeneous among duplication modes. Gene loss may retard inter-species expression divergence. Members of different gene families may have non-random patterns of origin that are similar in Arabidopsis and rice, suggesting the action of pan-taxon principles of molecular evolution. Gene duplication modes differ in contribution to genetic novelty and redundancy, but show some parallels in taxa separated by hundreds of millions of years of evolution.

Modes of Gene Duplication Contribute Differently to Genetic Novelty and Redundancy, but Show Parallels across Divergent Angiosperms

PubMed Central

Wang, Yupeng; Wang, Xiyin; Tang, Haibao; Tan, Xu; Ficklin, Stephen P.; Feltus, F. Alex; Paterson, Andrew H.

2011-01-01

Background Both single gene and whole genome duplications (WGD) have recurred in angiosperm evolution. However, the evolutionary effects of different modes of gene duplication, especially regarding their contributions to genetic novelty or redundancy, have been inadequately explored. Results In Arabidopsis thaliana and Oryza sativa (rice), species that deeply sample botanical diversity and for which expression data are available from a wide range of tissues and physiological conditions, we have compared expression divergence between genes duplicated by six different mechanisms (WGD, tandem, proximal, DNA based transposed, retrotransposed and dispersed), and between positional orthologs. Both neo-functionalization and genetic redundancy appear to contribute to retention of duplicate genes. Genes resulting from WGD and tandem duplications diverge slowest in both coding sequences and gene expression, and contribute most to genetic redundancy, while other duplication modes contribute more to evolutionary novelty. WGD duplicates may more frequently be retained due to dosage amplification, while inferred transposon mediated gene duplications tend to reduce gene expression levels. The extent of expression divergence between duplicates is discernibly related to duplication modes, different WGD events, amino acid divergence, and putatively neutral divergence (time), but the contribution of each factor is heterogeneous among duplication modes. Gene loss may retard inter-species expression divergence. Members of different gene families may have non-random patterns of origin that are similar in Arabidopsis and rice, suggesting the action of pan-taxon principles of molecular evolution. Conclusion Gene duplication modes differ in contribution to genetic novelty and redundancy, but show some parallels in taxa separated by hundreds of millions of years of evolution. PMID:22164235

Overlapping Yet Response-Specific Transcriptome Alterations Characterize the Nature of Tobacco-Pseudomonas syringae Interactions.

PubMed

Bozsó, Zoltán; Ott, Péter G; Kámán-Tóth, Evelin; Bognár, Gábor F; Pogány, Miklós; Szatmári, Ágnes

2016-01-01

In this study transcriptomic alterations of bacterially induced pattern triggered immunity (PTI) were compared with other types of tobacco-Pseudomonas interactions. In addition, using pharmacological agents we blocked some signal transduction pathways (Ca(2+) influx, kinases, phospholipases, proteasomic protein degradation) to find out how they contribute to gene expression during PTI. PTI is the first defense response of plant cells to microbes, elicited by their widely conserved molecular patterns. Tobacco is an important model of Solanaceae to study resistance responses, including defense mechanisms against bacteria. In spite of these facts the transcription regulation of tobacco genes during different types of plant bacterial interactions is not well-described. In this paper we compared the tobacco transcriptomic alterations in microarray experiments induced by (i) PTI inducer Pseudomonas syringae pv. syringae type III secretion mutant (hrcC) at earlier (6 h post inoculation) and later (48 hpi) stages of defense, (ii) wild type P. syringae (6 hpi) that causes effector triggered immunity (ETI) and cell death (HR), and (iii) disease-causing P. syringae pv. tabaci (6 hpi). Among the different treatments the highest overlap was between the PTI and ETI at 6 hpi, however, there were groups of genes with specifically altered activity for either type of defenses. Instead of quantitative effects of the virulent P. tabaci on PTI-related genes it influenced transcription qualitatively and blocked the expression changes of a special set of genes including ones involved in signal transduction and transcription regulation. P. tabaci specifically activated or repressed other groups of genes seemingly not related to either PTI or ETI. Kinase and phospholipase A inhibitors had highest impacts on the PTI response and effects of these signal inhibitors on transcription greatly overlapped. Remarkable interactions of phospholipase C-related pathways with the proteasomal system were also observable. Genes specifically affected by virulent P. tabaci belonged to various previously identified signaling routes, suggesting that compatible pathogens may modulate diverse signaling pathways of PTI to overcome plant defense.

Identification of a lineage specific zinc responsive genomic island in Mycobacterium avium ssp. paratuberculosis.

PubMed

Eckelt, Elke; Jarek, Michael; Frömke, Cornelia; Meens, Jochen; Goethe, Ralph

2014-12-06

Maintenance of metal homeostasis is crucial in bacterial pathogenicity as metal starvation is the most important mechanism in the nutritional immunity strategy of host cells. Thus, pathogenic bacteria have evolved sensitive metal scavenging systems to overcome this particular host defence mechanism. The ruminant pathogen Mycobacterium avium ssp. paratuberculosis (MAP) displays a unique gut tropism and causes a chronic progressive intestinal inflammation. MAP possesses eight conserved lineage specific large sequence polymorphisms (LSP), which distinguish MAP from its ancestral M. avium ssp. hominissuis or other M. avium subspecies. LSP14 and LSP15 harbour many genes proposed to be involved in metal homeostasis and have been suggested to substitute for a MAP specific, impaired mycobactin synthesis. In the present study, we found that a LSP14 located putative IrtAB-like iron transporter encoded by mptABC was induced by zinc but not by iron starvation. Heterologous reporter gene assays with the lacZ gene under control of the mptABC promoter in M. smegmatis (MSMEG) and in a MSMEG∆furB deletion mutant revealed a zinc dependent, metalloregulator FurB mediated expression of mptABC via a conserved mycobacterial FurB recognition site. Deep sequencing of RNA from MAP cultures treated with the zinc chelator TPEN revealed that 70 genes responded to zinc limitation. Remarkably, 45 of these genes were located on a large genomic island of approximately 90 kb which harboured LSP14 and LSP15. Thirty-five of these genes were predicted to be controlled by FurB, due to the presence of putative binding sites. This clustering of zinc responsive genes was exclusively found in MAP and not in other mycobacteria. Our data revealed a particular genomic signature for MAP given by a unique zinc specific locus, thereby suggesting an exceptional relevance of zinc for the metabolism of MAP. MAP seems to be well adapted to maintain zinc homeostasis which might contribute to the peculiarity of MAP pathogenicity.

The role of KIR2DS1 in multiple sclerosis--KIR in Portuguese MS patients.

PubMed

Bettencourt, Andreia; Silva, Ana Martins; Carvalho, Cláudia; Leal, Bárbara; Santos, Ernestina; Costa, Paulo P; Silva, Berta M

2014-04-15

Killer Immunoglobulin-like Receptor (KIR) genes may influence both resistance and susceptibility to different autoimmune diseases, but their role in the pathogenesis of Multiple Sclerosis (MS) is still unclear. We investigated the influence of KIR genes on MS susceptibility in 447 MS Portuguese patients, and also whether genetic interactions between specific KIR genes and their HLA class I ligands could contribute to the pathogenesis of MS. We observed a negative association between the activating KIR2DS1 gene and MS (adjusted OR=0.450, p=0.030) independently from the presence of HLA-DRB1*15 allele. The activating KIR2DS1 receptor seems to confer protection against MS most probably through modulation of autoreactive T cells by Natural Killer cells. Copyright © 2014 Elsevier B.V. All rights reserved.

Deciphering the Code of the Cancer Genome: Mechanisms of Chromosome Rearrangement

PubMed Central

Willis, Nicholas A.; Rass, Emilie; Scully, Ralph

2015-01-01

Chromosome rearrangement plays a causal role in tumorigenesis by contributing to the inactivation of tumor suppressor genes, the dysregulated expression or amplification of oncogenes and the generation of novel gene fusions. Chromosome breaks are important intermediates in this process. How, when and where these breaks arise and the specific mechanisms engaged in their repair strongly influence the resulting patterns of chromosome rearrangement. Here, we review recent progress in understanding how certain distinctive features of the cancer genome, including clustered mutagenesis, tandem segmental duplications, complex breakpoints, chromothripsis, chromoplexy and chromoanasynthesis may arise. PMID:26726318

[Hypertension, catecholamine hypersecretion and potential for metastasis: recent progress in the pathophysiology and genetics of pheochromocytoma and paraganglioma].

PubMed

Plouin, Pierre-François; Amar, Laurence; Gimenez-Roqueplo, Anne-paule

2015-01-01

Pheochromocytomas and paragangliomas are catecholamine-secreting tumors usually associated with arterial hypertension. They can contribute to acute cardiovascular events. Ten to 15 percent of tumors are metastatic. Autosomal dominant gene alterations are present in more than a third of cases. The secretory phenotype and the risk of malignancy are driven by the presence of gene mutations, specifically in the subunits of succinate dehydrogenase. Recent advances in genomics have clinical implications for family screening, biological follow-up, prediction of the risk of recurrence, and therapeutic options in cases with malignant recurrence.

Genetics of Human Cardiovascular Disease

PubMed Central

Kathiresan, Sekar; Srivastava, Deepak

2012-01-01

Cardiovascular disease encompasses a range of conditions extending from myocardial infarction to congenital heart disease most of which are heritable. Enormous effort has been invested in understanding the genes and specific DNA sequence variants responsible for this heritability. Here, we review the lessons learned for monogenic and common, complex forms of cardiovascular disease. We also discuss key challenges that remain for gene discovery and for moving from genomic localization to mechanistic insights with an emphasis on the impact of next generation sequencing and the use of pluripotent human cells to understand the mechanism by which genetic variation contributes to disease. PMID:22424232

S187. SEARCHING FOR BRAIN CO-EXPRESSION MODULES THAT CONTRIBUTE DISPROPORTIONATELY TO THE COMMON POLYGENIC RISK FOR SCHIZOPHRENIA

PubMed Central

Costas, Javier; Paramo, Mario; Arrojo, Manuel

2018-01-01

Abstract Background Genomic research has revealed that schizophrenia is a highly polygenic disease. Recent estimates indicate that at least 71% of genomic segments of 1 Mb include one or more risk loci for schizophrenia (Loh et al., Nature Genet 2015). This extremely high polygenicity represents a challenge to decipher the biological basis of schizophrenia, as it is expected that any set of SNPs with enough size will be associated with the disorder. Among the different gene sets available for study (such as those from Gene Ontology, KEGG pathway, Reactome pathways or protein protein interaction datasets), those based on brain co-expression networks represent putative functional relationships in the relevant tissue. The aim of this work was to identify brain co-expression networks that contribute disproportionately to the common polygenic risk for schizophrenia to get more insight on schizophrenia etiopathology. Methods We analyzed a case -control dataset consisting of 582 schizophrenia patients from Galicia, NW Spain, and 591 ancestrally matched controls, genotyped with the Illumina PsychArray. Using as discovery sample the summary results from the largest GWAS of schizophrenia to date (Psychiatric Genomics Consortium, SCZ2), we generated polygenic risk scores (PRS) in our sample based on SNPs located at genes belonging to brain co-expression modules determined by the CommonMind Consortium (Fromer et al., Nature Neurosci 2016). PRS were generated using the clumping procedure of PLINK, considering several different thresholds to select SNPs from the discovery sample. In order to test if any specific module increased risk to schizophrenia more than expected by their size, we generated up to 10,000 random permutations of the same number of SNPs, matched by frequency, distance to nearest gene, number of SNPs in LD and gene density, using SNPsnap. Results As expected, most modules with enough number of independent SNPs belonging to them showed a significant increase in Nagelkerke’s R2 in our case-control sample after the addition of the module-specific PRS in a logistic regression model. Our permutation strategy revealed that most modules did not show an excess of risk, measured by increase in Nagelkerke’s R2, in comparison to equal number of SNPs with similar characteristics. But one module, M2c from Fromer et al., remained highly significant after multiple tests’ correction. Reactome pathways analysis revealed an over-representation of genes involved in “Neuronal System” and “Axon guidance” among genes from this module. Using the same protocol, we detected that the 84 genes from the neuronal system pathway at this module, representing less than 6% of the genes from the module, explained a higher level of risk than expected. “Voltage-gated Potassium channels” and “Neurexins and neuroligins” are overrepresented among the Neuronal System genes from module M2c. Discussion Here, we show that, in spite of the high polygenicity of schizophrenia, it is possible to identify gene sets contributing disproportionately to total risk, as it was the case for the M2c module from Fromer et al. These authors have previously reported that the M2c module was enriched in GWAS signals, as well as CNVs and rare variants associated with schizophrenia. Therefore, this module shows a disproportionately contribution to schizophrenia risk. Study supported by Grant PI14/01020 from Instituto de Salud Carlos III, Ministry of Health, Spanish Government.

Stress inducible proteinase inhibitor diversity in Capsicum annuum

PubMed Central

2012-01-01

Background Wound-inducible Pin-II Proteinase inhibitors (PIs) are one of the important plant serine PIs which have been studied extensively for their structural and functional diversity and relevance in plant defense against insect pests. To explore the functional specialization of an array of Capsicum annuum (L.) proteinase inhibitor (CanPIs) genes, we studied their expression, processing and tissue-specific distribution under steady-state and induced conditions. Inductions were performed by subjecting C. annuum leaves to various treatments, namely aphid infestation or mechanical wounding followed by treatment with either oral secretion (OS) of Helicoverpa armigera or water. Results The elicitation treatments regulated the accumulation of CanPIs corresponding to 4-, 3-, and 2-inhibitory repeat domains (IRDs). Fourty seven different CanPI genes composed of 28 unique IRDs were identified in total along with those reported earlier. The CanPI gene pool either from uninduced or induced leaves was dominated by 3-IRD PIs and trypsin inhibitory domains. Also a major contribution by 4-IRD CanPI genes possessing trypsin and chymotrypsin inhibitor domains was specifically revealed in wounded leaves treated with OS. Wounding displayed the highest number of unique CanPIs while wounding with OS treatment resulted in the high accumulation of specifically CanPI-4, -7 and −10. Characterization of the PI protein activity through two dimensional gel electrophoresis revealed tissue and induction specific patterns. Consistent with transcript abundance, wound plus OS or water treated C. annuum leaves exhibited significantly higher PI activity and isoform diversity contributed by 3- and 4-IRD CanPIs. CanPI accumulation and activity was weakly elicited by aphid infestation yet resulted in the higher expression of CanPI-26, -41 and −43. Conclusions Plants can differentially perceive various kinds of insect attacks and respond appropriately through activating plant defenses including regulation of PIs at transcriptional and post-translational levels. Based on the differentially elicited CanPI accumulation patterns, it is intriguing to speculate that generating sequence diversity in the form of multi-IRD PIs is a part of elaborative plant defense strategy to obtain a diverse pool of functional units to confine insect attack. PMID:23153298

Oxytocin, vasopressin and pair bonding: implications for autism.

PubMed

Hammock, Elizabeth A D; Young, Larry J

2006-12-29

Understanding the neurobiological substrates regulating normal social behaviours may provide valuable insights in human behaviour, including developmental disorders such as autism that are characterized by pervasive deficits in social behaviour. Here, we review the literature which suggests that the neuropeptides oxytocin and vasopressin play critical roles in modulating social behaviours, with a focus on their role in the regulation of social bonding in monogamous rodents. Oxytocin and vasopressin contribute to a wide variety of social behaviours, including social recognition, communication, parental care, territorial aggression and social bonding. The effects of these two neuropeptides are species-specific and depend on species-specific receptor distributions in the brain. Comparative studies in voles with divergent social structures have revealed some of the neural and genetic mechanisms of social-bonding behaviour. Prairie voles are socially monogamous; males and females form long-term pair bonds, establish a nest site and rear their offspring together. In contrast, montane and meadow voles do not form a bond with a mate and only the females take part in rearing the young. Species differences in the density of receptors for oxytocin and vasopressin in ventral forebrain reward circuitry differentially reinforce social-bonding behaviour in the two species. High levels of oxytocin receptor (OTR) in the nucleus accumbens and high levels of vasopressin 1a receptor (V1aR) in the ventral pallidum contribute to monogamous social structure in the prairie vole. While little is known about the genetic factors contributing to species-differences in OTR distribution, the species-specific distribution pattern of the V1aR is determined in part by a species-specific repetitive element, or 'microsatellite', in the 5' regulatory region of the gene encoding V1aR (avpr1a). This microsatellite is highly expanded in the prairie vole (as well as the monogamous pine vole) compared to a very short version in the promiscuous montane and meadow voles. These species differences in microsatellite sequence are sufficient to change gene expression in cell culture. Within the prairie vole species, intraspecific variation in the microsatellite also modulates gene expression in vitro as well as receptor distribution patterns in vivo and influences the probability of social approach and bonding behaviour. Similar genetic variation in the human AVPR1A may contribute to variations in human social behaviour, including extremes outside the normal range of behaviour and those found in autism spectrum disorders. In sum, comparative studies in pair-bonding rodents have revealed neural and genetic mechanisms contributing to social-bonding behaviour. These studies have generated testable hypotheses regarding the motivational systems and underlying molecular neurobiology involved in social engagement and social bond formation that may have important implications for the core social deficits characterizing autism spectrum disorders.

Oxytocin, vasopressin and pair bonding: implications for autism

PubMed Central

Hammock, Elizabeth A.D; Young, Larry J

2006-01-01

Understanding the neurobiological substrates regulating normal social behaviours may provide valuable insights in human behaviour, including developmental disorders such as autism that are characterized by pervasive deficits in social behaviour. Here, we review the literature which suggests that the neuropeptides oxytocin and vasopressin play critical roles in modulating social behaviours, with a focus on their role in the regulation of social bonding in monogamous rodents. Oxytocin and vasopressin contribute to a wide variety of social behaviours, including social recognition, communication, parental care, territorial aggression and social bonding. The effects of these two neuropeptides are species-specific and depend on species-specific receptor distributions in the brain. Comparative studies in voles with divergent social structures have revealed some of the neural and genetic mechanisms of social-bonding behaviour. Prairie voles are socially monogamous; males and females form long-term pair bonds, establish a nest site and rear their offspring together. In contrast, montane and meadow voles do not form a bond with a mate and only the females take part in rearing the young. Species differences in the density of receptors for oxytocin and vasopressin in ventral forebrain reward circuitry differentially reinforce social-bonding behaviour in the two species. High levels of oxytocin receptor (OTR) in the nucleus accumbens and high levels of vasopressin 1a receptor (V1aR) in the ventral pallidum contribute to monogamous social structure in the prairie vole. While little is known about the genetic factors contributing to species-differences in OTR distribution, the species-specific distribution pattern of the V1aR is determined in part by a species-specific repetitive element, or ‘microsatellite’, in the 5′ regulatory region of the gene encoding V1aR (avpr1a). This microsatellite is highly expanded in the prairie vole (as well as the monogamous pine vole) compared to a very short version in the promiscuous montane and meadow voles. These species differences in microsatellite sequence are sufficient to change gene expression in cell culture. Within the prairie vole species, intraspecific variation in the microsatellite also modulates gene expression in vitro as well as receptor distribution patterns in vivo and influences the probability of social approach and bonding behaviour. Similar genetic variation in the human AVPR1A may contribute to variations in human social behaviour, including extremes outside the normal range of behaviour and those found in autism spectrum disorders. In sum, comparative studies in pair-bonding rodents have revealed neural and genetic mechanisms contributing to social-bonding behaviour. These studies have generated testable hypotheses regarding the motivational systems and underlying molecular neurobiology involved in social engagement and social bond formation that may have important implications for the core social deficits characterizing autism spectrum disorders. PMID:17118932

Decoding critical long non-coding RNA in ovarian cancer epithelial-to-mesenchymal transition.

PubMed

Mitra, Ramkrishna; Chen, Xi; Greenawalt, Evan J; Maulik, Ujjwal; Jiang, Wei; Zhao, Zhongming; Eischen, Christine M

2017-11-17

Long non-coding RNA (lncRNA) are emerging as contributors to malignancies. Little is understood about the contribution of lncRNA to epithelial-to-mesenchymal transition (EMT), which correlates with metastasis. Ovarian cancer is usually diagnosed after metastasis. Here we report an integrated analysis of >700 ovarian cancer molecular profiles, including genomic data sets, from four patient cohorts identifying lncRNA DNM3OS, MEG3, and MIAT overexpression and their reproducible gene regulation in ovarian cancer EMT. Genome-wide mapping shows 73% of MEG3-regulated EMT-linked pathway genes contain MEG3 binding sites. DNM3OS overexpression, but not MEG3 or MIAT, significantly correlates to worse overall patient survival. DNM3OS knockdown results in altered EMT-linked genes/pathways, mesenchymal-to-epithelial transition, and reduced cell migration and invasion. Proteotranscriptomic characterization further supports the DNM3OS and ovarian cancer EMT connection. TWIST1 overexpression and DNM3OS amplification provides an explanation for increased DNM3OS levels. Therefore, our results elucidate lncRNA that regulate EMT and demonstrate DNM3OS specifically contributes to EMT in ovarian cancer.

Coexpression networks implicate human midfetal deep cortical projection neurons in the pathogenesis of autism

PubMed Central

Willsey, A. Jeremy; Sanders, Stephan J.; Li, Mingfeng; Dong, Shan; Tebbenkamp, Andrew T.; Muhle, Rebecca A.; Reilly, Steven K.; Lin, Leon; Fertuzinhos, Sofia; Miller, Jeremy A.; Murtha, Michael T.; Bichsel, Candace; Niu, Wei; Cotney, Justin; Ercan-Sencicek, A. Gulhan; Gockley, Jake; Gupta, Abha; Han, Wenqi; He, Xin; Hoffman, Ellen; Klei, Lambertus; Lei, Jing; Liu, Wenzhong; Liu, Li; Lu, Cong; Xu, Xuming; Zhu, Ying; Mane, Shrikant M.; Lein, Edward S.; Wei, Liping; Noonan, James P.; Roeder, Kathryn; Devlin, Bernie; Šestan, Nenad; State, Matthew W.

2013-01-01

SUMMARY Autism spectrum disorder (ASD) is a complex developmental syndrome of unknown etiology. Recent studies employing exome- and genome-wide sequencing have identified nine high-confidence ASD (hcASD) genes. Working from the hypothesis that ASD-associated mutations in these biologically pleiotropic genes will disrupt intersecting developmental processes to contribute to a common phenotype, we have attempted to identify time periods, brain regions, and cell types in which these genes converge. We have constructed coexpression networks based on the hcASD “seed” genes, leveraging a rich expression data set encompassing multiple human brain regions across human development and into adulthood. By assessing enrichment of an independent set of probable ASD (pASD) genes, derived from the same sequencing studies, we demonstrate a key point of convergence in midfetal layer 5/6 cortical projection neurons. This approach informs when, where, and in what cell types mutations in these specific genes may be productively studied to clarify ASD pathophysiology. PMID:24267886

Contribution of transposable elements and distal enhancers to evolution of human-specific features of interphase chromatin architecture in embryonic stem cells.

PubMed

Glinsky, Gennadi V

2018-03-01

Transposable elements have made major evolutionary impacts on creation of primate-specific and human-specific genomic regulatory loci and species-specific genomic regulatory networks (GRNs). Molecular and genetic definitions of human-specific changes to GRNs contributing to development of unique to human phenotypes remain a highly significant challenge. Genome-wide proximity placement analysis of diverse families of human-specific genomic regulatory loci (HSGRL) identified topologically associating domains (TADs) that are significantly enriched for HSGRL and designated rapidly evolving in human TADs. Here, the analysis of HSGRL, hESC-enriched enhancers, super-enhancers (SEs), and specific sub-TAD structures termed super-enhancer domains (SEDs) has been performed. In the hESC genome, 331 of 504 (66%) of SED-harboring TADs contain HSGRL and 68% of SEDs co-localize with HSGRL, suggesting that emergence of HSGRL may have rewired SED-associated GRNs within specific TADs by inserting novel and/or erasing existing non-coding regulatory sequences. Consequently, markedly distinct features of the principal regulatory structures of interphase chromatin evolved in the hESC genome compared to mouse: the SED quantity is 3-fold higher and the median SED size is significantly larger. Concomitantly, the overall TAD quantity is increased by 42% while the median TAD size is significantly decreased (p = 9.11E-37) in the hESC genome. Present analyses illustrate a putative global role for transposable elements and HSGRL in shaping the human-specific features of the interphase chromatin organization and functions, which are facilitated by accelerated creation of novel transcription factor binding sites and new enhancers driven by targeted placement of HSGRL at defined genomic coordinates. A trend toward the convergence of TAD and SED architectures of interphase chromatin in the hESC genome may reflect changes of 3D-folding patterns of linear chromatin fibers designed to enhance both regulatory complexity and functional precision of GRNs by creating predominantly a single gene (or a set of functionally linked genes) per regulatory domain structures. Collectively, present analyses reveal critical evolutionary contributions of transposable elements and distal enhancers to creation of thousands primate- and human-specific elements of a chromatin folding code, which defines the 3D context of interphase chromatin both restricting and facilitating biological functions of GRNs.

Identification of transcription coactivator OCA-B-dependent genes involved in antigen-dependent B cell differentiation by cDNA array analyses.

PubMed

Kim, Unkyu; Siegel, Rachael; Ren, Xiaodi; Gunther, Cary S; Gaasterland, Terry; Roeder, Robert G

2003-07-22

The tissue-specific transcriptional coactivator OCA-B is required for antigen-dependent B cell differentiation events, including germinal center formation. However, the identity of OCA-B target genes involved in this process is unknown. This study has used large-scale cDNA arrays to monitor changes in gene expression patterns that accompany mature B cell differentiation. B cell receptor ligation alone induces many genes involved in B cell expansion, whereas B cell receptor and helper T cell costimulation induce genes associated with B cell effector function. OCA-B expression is induced by both B cell receptor ligation alone and helper T cell costimulation, suggesting that OCA-B is involved in B cell expansion as well as B cell function. Accordingly, several genes involved in cell proliferation and signaling, such as Lck, Kcnn4, Cdc37, cyclin D3, B4galt1, and Ms4a11, have been identified as OCA-B-dependent genes. Further studies on the roles played by these genes in B cells will contribute to an understanding of B cell differentiation.

microRNA-mediated R gene regulation: molecular scabbards for double-edged swords.

PubMed

Deng, Yingtian; Liu, Minglei; Li, Xiaofei; Li, Feng

2018-02-01

Plant resistance (R) proteins are immune receptors that recognize pathogen effectors and trigger rapid defense responses, namely effector-triggered immunity. R protein-mediated pathogen resistance is usually race specific. During plant-pathogen coevolution, plant genomes accumulated large numbers of R genes. Even though plant R genes provide important natural resources for breeding disease-resistant crops, their presence in the plant genome comes at a cost. Misregulation of R genes leads to developmental defects, such as stunted growth and reduced fertility. In the past decade, many microRNAs (miRNAs) have been identified to target various R genes in plant genomes. miRNAs reduce R gene levels under normal conditions and allow induction of R gene expression under various stresses. For these reasons, we consider R genes to be double-edged "swords" and miRNAs as molecular "scabbards". In the present review, we summarize the contributions and potential problems of these "swords" and discuss the features and production of the "scabbards", as well as the mechanisms used to pull the "sword" from the "scabbard" when needed.

NIMEFI: gene regulatory network inference using multiple ensemble feature importance algorithms.

PubMed

Ruyssinck, Joeri; Huynh-Thu, Vân Anh; Geurts, Pierre; Dhaene, Tom; Demeester, Piet; Saeys, Yvan

2014-01-01

One of the long-standing open challenges in computational systems biology is the topology inference of gene regulatory networks from high-throughput omics data. Recently, two community-wide efforts, DREAM4 and DREAM5, have been established to benchmark network inference techniques using gene expression measurements. In these challenges the overall top performer was the GENIE3 algorithm. This method decomposes the network inference task into separate regression problems for each gene in the network in which the expression values of a particular target gene are predicted using all other genes as possible predictors. Next, using tree-based ensemble methods, an importance measure for each predictor gene is calculated with respect to the target gene and a high feature importance is considered as putative evidence of a regulatory link existing between both genes. The contribution of this work is twofold. First, we generalize the regression decomposition strategy of GENIE3 to other feature importance methods. We compare the performance of support vector regression, the elastic net, random forest regression, symbolic regression and their ensemble variants in this setting to the original GENIE3 algorithm. To create the ensemble variants, we propose a subsampling approach which allows us to cast any feature selection algorithm that produces a feature ranking into an ensemble feature importance algorithm. We demonstrate that the ensemble setting is key to the network inference task, as only ensemble variants achieve top performance. As second contribution, we explore the effect of using rankwise averaged predictions of multiple ensemble algorithms as opposed to only one. We name this approach NIMEFI (Network Inference using Multiple Ensemble Feature Importance algorithms) and show that this approach outperforms all individual methods in general, although on a specific network a single method can perform better. An implementation of NIMEFI has been made publicly available.

Population genomics of Fusarium graminearum reveals signatures of divergent evolution within a major cereal pathogen

PubMed Central

2018-01-01

The cereal pathogen Fusarium graminearum is the primary cause of Fusarium head blight (FHB) and a significant threat to food safety and crop production. To elucidate population structure and identify genomic targets of selection within major FHB pathogen populations in North America we sequenced the genomes of 60 diverse F. graminearum isolates. We also assembled the first pan-genome for F. graminearum to clarify population-level differences in gene content potentially contributing to pathogen diversity. Bayesian and phylogenomic analyses revealed genetic structure associated with isolates that produce the novel NX-2 mycotoxin, suggesting a North American population that has remained genetically distinct from other endemic and introduced cereal-infecting populations. Genome scans uncovered distinct signatures of selection within populations, focused in high diversity, frequently recombining regions. These patterns suggested selection for genomic divergence at the trichothecene toxin gene cluster and thirteen additional regions containing genes potentially involved in pathogen specialization. Gene content differences further distinguished populations, in that 121 genes showed population-specific patterns of conservation. Genes that differentiated populations had predicted functions related to pathogenesis, secondary metabolism and antagonistic interactions, though a subset had unique roles in temperature and light sensitivity. Our results indicated that F. graminearum populations are distinguished by dozens of genes with signatures of selection and an array of dispensable accessory genes, suggesting that FHB pathogen populations may be equipped with different traits to exploit the agroecosystem. These findings provide insights into the evolutionary processes and genomic features contributing to population divergence in plant pathogens, and highlight candidate genes for future functional studies of pathogen specialization across evolutionarily and ecologically diverse fungi. PMID:29584736

Specific and quantitative detection of human polyomaviruses BKV, JCV, and SV40 by real time PCR.

PubMed

McNees, Adrienne L; White, Zoe S; Zanwar, Preeti; Vilchez, Regis A; Butel, Janet S

2005-09-01

The polyomaviruses that infect humans, BK virus (BKV), JC virus (JCV), and simian virus 40 (SV40), typically establish subclinical persistent infections. However, reactivation of these viruses in immunocompromised hosts is associated with renal nephropathy and hemorrhagic cystitis (HC) caused by BKV and with progressive multifocal leukoencephalopathy (PML) caused by JCV. Additionally, SV40 is associated with several types of human cancers including primary brain and bone cancers, mesotheliomas, and non-Hodgkin's lymphoma. Advancements in detection of these viruses may contribute to improved diagnosis and treatment of affected patients. To develop sensitive and specific real time quantitative polymerase chain reaction (RQ-PCR) assays for the detection of T-antigen DNA sequences of the human polyomaviruses BKV, JCV, and SV40 using the ABI Prism 7000 Sequence Detection System. Assays for absolute quantification of the viral T-ag sequences were designed and the sensitivity and specificity were evaluated. A quantitative assay to measure the single copy human RNAse P gene was also developed and evaluated in order to normalize viral gene copy numbers to cell numbers. Quantification of the target genes is sensitive and specific over a 7 log dynamic range. Ten copies each of the viral and cellular genes are reproducibly and accurately detected. The sensitivity of detection of the RQ-PCR assays is increased 10- to 100-fold compared to conventional PCR and agarose gel protocols. The primers and probes used to detect the viral genes are specific for each virus and there is no cross reactivity within the dynamic range of the standard dilutions. The sensitivity of detection for these assays is not reduced in human cellular extracts; however, different DNA extraction protocols may affect quantification. These assays provide a technique for rapid and specific quantification of polyomavirus genomes per cell in human samples.

Persistence and evolution of allergen-specific IgE repertoires during subcutaneous specific immunotherapy

PubMed Central

Levin, Mattias; King, Jasmine J.; Glanville, Jacob; Jackson, Katherine J. L.; Looney, Timothy J.; Hoh, Ramona A.; Mari, Adriano; Andersson, Morgan; Greiff, Lennart; Fire, Andrew Z.; Boyd, Scott D.; Ohlin, Mats

2016-01-01

Background Specific immunotherapy (SIT) is the only treatment with proven long-term curative potential in allergic disease. Allergen-specific IgE is the causative agent of allergic disease, and antibodies contribute to SIT, but the effects of SIT on aeroallergen-specific B cell repertoires are not well understood. Objective To characterize the IgE sequences expressed by allergen-specific B cells, and track the fate of these B cell clones during SIT. Methods We have used high-throughput antibody gene sequencing and identification of allergen-specific IgE using combinatorial antibody fragment library technology to analyze immunoglobulin repertoires of blood and nasal mucosa of aeroallergen-sensitized individuals before and during the first year of subcutaneous SIT. Results Of 52 distinct allergen-specific IgE heavy chains from eight allergic donors, 37 were also detected by high-throughput antibody gene sequencing of blood, nasal mucosa, or both sample types. The allergen-specific clones had increased persistence, higher likelihood of belonging to clones expressing other switched isotypes, and possibly larger clone size than the rest of the IgE repertoire. Clone members in nasal tissue showed close mutational relationships. Conclusion Combining functional binding studies, deep antibody repertoire sequencing, and information on clinical outcomes in larger studies may in the future aid assessment of SIT mechanisms and efficacy. PMID:26559321

The phosphatidylinositol synthase gene (GhPIS) contributes to longer, stronger, and finer fibers in cotton.

PubMed

Long, Qin; Yue, Fang; Liu, Ruochen; Song, Shuiqing; Li, Xianbi; Ding, Bo; Yan, Xingying; Pei, Yan

2018-05-11

Cotton fibers are the most important natural raw material used in textile industries world-wide. Fiber length, strength, and fineness are the three major traits which determine the quality and economic value of cotton. It is known that exogenous application of phosphatidylinositols (PtdIns), important structural phospholipids, can promote cotton fiber elongation. Here, we sought to increase the in planta production of PtdIns to improve fiber traits. Transgenic cotton plants were generated in which the expression of a cotton phosphatidylinositol synthase gene (i.e., GhPIS) was controlled by the fiber-specific SCFP promoter element, resulting in the specific up-regulation of GhPIS during cotton fiber development. We demonstrate that PtdIns content was significantly enhanced in transgenic cotton fibers and the elevated level of PtdIns stimulated the expression of genes involved in PtdIns phosphorylation as well as promoting lignin/lignin-like phenolic biosynthesis. Fiber length, strength and fineness were also improved in the transgenic plants as compared to the wild-type cotton, with no loss in overall fiber yield. Our data indicate that fiber-specific up-regulation of PtdIns synthesis is a promising strategy for cotton fiber quality improvement.

Identification of diagnostic markers in colorectal cancer via integrative epigenomics and genomics data

PubMed Central

KOK-SIN, TEOW; MOKHTAR, NORFILZA MOHD; HASSAN, NUR ZARINA ALI; SAGAP, ISMAIL; ROSE, ISA MOHAMED; HARUN, ROSLAN; JAMAL, RAHMAN

2015-01-01

Apart from genetic mutations, epigenetic alteration is a common phenomenon that contributes to neoplastic transformation in colorectal cancer. Transcriptional silencing of tumor-suppressor genes without changes in the DNA sequence is explained by the existence of promoter hypermethylation. To test this hypothesis, we integrated the epigenome and transcriptome data from a similar set of colorectal tissue samples. Methylation profiling was performed using the Illumina InfiniumHumanMethylation27 BeadChip on 55 paired cancer and adjacent normal epithelial cells. Fifteen of the 55 paired tissues were used for gene expression profiling using the Affymetrix GeneChip Human Gene 1.0 ST array. Validation was carried out on 150 colorectal tissues using the methylation-specific multiplex ligation-dependent probe amplification (MS-MLPA) technique. PCA and supervised hierarchical clustering in the two microarray datasets showed good separation between cancer and normal samples. Significant genes from the two analyses were obtained based on a ≥2-fold change and a false discovery rate (FDR) P-value of <0.05. We identified 1,081 differentially hypermethylated CpG sites and 36 hypomethylated CpG sites. We also found 709 upregulated and 699 downregulated genes from the gene expression profiling. A comparison of the two datasets revealed 32 overlapping genes with 27 being hypermethylated with downregulated expression and 4 hypermethylated with upregulated expression. One gene was found to be hypomethylated and downregulated. The most enriched molecular pathway identified was cell adhesion molecules that involved 4 overlapped genes, JAM2, NCAM1, ITGA8 and CNTN1. In the present study, we successfully identified a group of genes that showed methylation and gene expression changes in well-defined colorectal cancer tissues with high purity. The integrated analysis gives additional insight regarding the regulation of colorectal cancer-associated genes and their underlying mechanisms that contribute to colorectal carcinogenesis. PMID:25997610

Human Microbiome Acquisition and Bioinformatic Challenges in Metagenomic Studies

PubMed Central

2018-01-01

The study of the human microbiome has become a very popular topic. Our microbial counterpart, in fact, appears to play an important role in human physiology and health maintenance. Accordingly, microbiome alterations have been reported in an increasing number of human diseases. Despite the huge amount of data produced to date, less is known on how a microbial dysbiosis effectively contributes to a specific pathology. To fill in this gap, other approaches for microbiome study, more comprehensive than 16S rRNA gene sequencing, i.e., shotgun metagenomics and metatranscriptomics, are becoming more widely used. Methods standardization and the development of specific pipelines for data analysis are required to contribute to and increase our understanding of the human microbiome relationship with health and disease status. PMID:29382070

Systematic Analysis of the Transcriptional Switch Inducing Migration of Border Cells

PubMed Central

Borghese, Lodovica; Fletcher, Georgina; Mathieu, Juliette; Atzberger, Ann; Eades, William C.; Cagan, Ross L.; Rørth, Pernille

2010-01-01

Summary Cell migration within a natural context is tightly controlled, often by specific transcription factors. However, the switch from stationary to migratory behavior is poorly understood. Border cells perform a spatially and temporally controlled invasive migration during Drosophila oogenesis. Slbo, a C/EBP family transcriptional activator, is required for them to become migratory. We purified wild-type and slbo mutant border cells as well as nonmigratory follicle cells and performed comparative whole-genome expression profiling, followed by functional tests of the contributions of identified targets to migration. About 300 genes were significantly upregulated in border cells, many dependent on Slbo. Among these, the microtubule regulator Stathmin was strongly upregulated and was required for normal migration. Actin cytoskeleton regulators were also induced, including, surprisingly, a large cluster of “muscle-specific” genes. We conclude that Slbo induces multiple cytoskeletal effectors, and that each contributes to the behavioral changes in border cells. PMID:16580994

Developmental-Genetic Effects on Level and Change in Childhood Fears of Twins during Adolescence

ERIC Educational Resources Information Center

Eaves, Lindon J.; Silberg, Judy L.

2008-01-01

Background: If the adaptive significance of specific fears changes with age, the genetic contribution to individual differences may be lowest at the age of greatest salience. The roles of genes and environment in the developmental-genetic trajectory of five common childhood fears are explored in 1094 like-sex pairs of male and female monozygotic…

Variant ribosomal RNA alleles are conserved and exhibit tissue-specific expression

PubMed Central

Parks, Matthew M.; Kurylo, Chad M.; Dass, Randall A.; Bojmar, Linda; Lyden, David; Vincent, C. Theresa; Blanchard, Scott C.

2018-01-01

The ribosome, the integration point for protein synthesis in the cell, is conventionally considered a homogeneous molecular assembly that only passively contributes to gene expression. Yet, epigenetic features of the ribosomal DNA (rDNA) operon and changes in the ribosome’s molecular composition have been associated with disease phenotypes, suggesting that the ribosome itself may possess inherent regulatory capacity. Analyzing whole-genome sequencing data from the 1000 Genomes Project and the Mouse Genomes Project, we find that rDNA copy number varies widely across individuals, and we identify pervasive intra- and interindividual nucleotide variation in the 5S, 5.8S, 18S, and 28S ribosomal RNA (rRNA) genes of both human and mouse. Conserved rRNA sequence heterogeneities map to functional centers of the assembled ribosome, variant rRNA alleles exhibit tissue-specific expression, and ribosomes bearing variant rRNA alleles are present in the actively translating ribosome pool. These findings provide a critical framework for exploring the possibility that the expression of genomically encoded variant rRNA alleles gives rise to physically and functionally heterogeneous ribosomes that contribute to mammalian physiology and human disease. PMID:29503865

Epigenetic Silencing of TAP1 in Aldefluor+ Breast Cancer Stem Cells Contributes to Their Enhanced Immune Evasion.

PubMed

Sultan, Mohammad; Vidovic, Dejan; Paine, Arianne S; Huynh, Thomas T; Coyle, Krysta M; Thomas, Margaret L; Cruickshank, Brianne M; Dean, Cheryl A; Clements, Derek R; Kim, Youra; Lee, Kristen; Gujar, Shashi A; Weaver, Ian C G; Marcato, Paola

2018-05-01

Avoiding detection and destruction by immune cells is key for tumor initiation and progression. The important role of cancer stem cells (CSCs) in tumor initiation has been well established, yet their ability to evade immune detection and targeting is only partly understood. To investigate the ability of breast CSCs to evade immune detection, we identified a highly tumorigenic population in a spontaneous murine mammary tumor based on increased aldehyde dehydrogenase activity. We performed tumor growth studies in immunocompetent and immunocompromised mice. In immunocompetent mice, growth of the spontaneous mammary tumor was restricted; however, the Aldefluor + population was expanded, suggesting inherent resistance mechanisms. Gene expression analysis of the sorted tumor cells revealed that the Aldefluor + tumor cells has decreased expression of transporter associated with antigen processing (TAP) genes and co-stimulatory molecule CD80, which would decrease susceptibility to T cells. Similarly, the Aldefluor + population of patient tumors and 4T1 murine mammary cells had decreased expression of TAP and co-stimulatory molecule genes. In contrast, breast CSCs identified by CD44 + CD24 - do not have decreased expression of these genes, but do have increased expression of C-X-C chemokine receptor type 4. Decitabine treatment and bisulfite pyrosequencing suggests that DNA hypermethylation contributes to decreased TAP gene expression in Aldefluor + CSCs. TAP1 knockdown resulted in increased tumor growth of 4T1 cells in immunocompetent mice. Together, this suggests immune evasion mechanisms in breast CSCs are marker specific and epigenetic silencing of TAP1 in Aldefluor + breast CSCs contributes to their enhanced survival under immune pressure. Stem Cells 2018;36:641-654. © AlphaMed Press 2018.

RNAi pathways contribute to developmental history-dependent phenotypic plasticity in C. elegans

PubMed Central

Hall, Sarah E.; Chirn, Gung-Wei; Lau, Nelson C.; Sengupta, Piali

2013-01-01

Early environmental experiences profoundly influence adult phenotypes through complex mechanisms that are poorly understood. We previously showed that adult Caenorhabditis elegans that transiently passed through the stress-induced dauer larval stage (post-dauer adults) exhibit significant changes in gene expression profiles, chromatin states, and life history traits when compared with adults that bypassed the dauer stage (control adults). These wild-type, isogenic animals of equivalent developmental stages exhibit different signatures of molecular marks that reflect their distinct developmental trajectories. To gain insight into the mechanisms that contribute to these developmental history-dependent phenotypes, we profiled small RNAs from post-dauer and control adults by deep sequencing. RNA interference (RNAi) pathways are known to regulate genome-wide gene expression both at the chromatin and post-transcriptional level. By quantifying changes in endogenous small interfering RNA (endo-siRNA) levels in post-dauer as compared with control animals, our analyses identified a subset of genes that are likely targets of developmental history-dependent reprogramming through a complex RNAi-mediated mechanism. Mutations in specific endo-siRNA pathways affect expected gene expression and chromatin state changes for a subset of genes in post-dauer animals, as well as disrupt their increased brood size phenotype. We also find that both chromatin state and endo-siRNA distribution in dauers are unique, and suggest that remodeling in dauers provides a template for the subsequent establishment of adult post-dauer profiles. Our results indicate a role for endo-siRNA pathways as a contributing mechanism to early experience-dependent phenotypic plasticity in adults, and describe how developmental history can program adult physiology and behavior via epigenetic mechanisms. PMID:23329696

ABCF2, an Nrf2 target gene, contributes to cisplatin resistance in ovarian cancer cells.

PubMed

Bao, Lingjie; Wu, Jianfa; Dodson, Matthew; Rojo de la Vega, Elisa Montserrat; Ning, Yan; Zhang, Zhenbo; Yao, Ming; Zhang, Donna D; Xu, Congjian; Yi, Xiaofang

2017-06-01

Previously, we have demonstrated that NRF2 plays a key role in mediating cisplatin resistance in ovarian cancer. To further explore the mechanism underlying NRF2-dependent cisplatin resistance, we stably overexpressed or knocked down NRF2 in parental and cisplatin-resistant human ovarian cancer cells, respectively. These two pairs of stable cell lines were then subjected to microarray analysis, where we identified 18 putative NRF2 target genes. Among these genes, ABCF2, a cytosolic member of the ABC superfamily of transporters, has previously been reported to contribute to chemoresistance in clear cell ovarian cancer. A detailed analysis on ABCF2 revealed a functional antioxidant response element (ARE) in its promoter region, establishing ABCF2 as an NRF2 target gene. Next, we investigated the contribution of ABCF2 in NRF2-mediated cisplatin resistance using our stable ovarian cancer cell lines. The NRF2-overexpressing cell line, containing high levels of ABCF2, was more resistant to cisplatin-induced apoptosis compared to its control cell line; whereas the NRF2 knockdown cell line with low levels of ABCF2, was more sensitive to cisplatin treatment than its control cell line. Furthermore, transient overexpression of ABCF2 in the parental cells decreased apoptosis and increased cell viability following cisplatin treatment. Conversely, knockdown of ABCF2 using specific siRNA notably increased apoptosis and decreased cell viability in cisplatin-resistant cells treated with cisplatin. This data indicate that the novel NRF2 target gene, ABCF2, plays a critical role in cisplatin resistance in ovarian cancer, and that targeting ABCF2 may be a new strategy to improve chemotherapeutic efficiency. © 2017 Wiley Periodicals, Inc.

Hepatocyte-specific PPARA expression exclusively promotes agonist-induced cell proliferation without influence from nonparenchymal cells

PubMed Central

Brocker, Chad N.; Yue, Jiang; Kim, Donghwan; Qu, Aijuan; Bonzo, Jessica A.

2017-01-01

Peroxisome proliferator-activated receptor-α (PPARA) is a nuclear transcription factor and key mediator of systemic lipid metabolism. Prolonged activation in rodents causes hepatocyte proliferation and hepatocellular carcinoma. Little is known about the contribution of nonparenchymal cells (NPCs) to PPARA-mediated cell proliferation. NPC contribution to PPARA agonist-induced hepatomegaly was assessed in hepatocyte (Ppara△Hep)- and macrophage (Ppara△Mac)-specific Ppara null mice. Mice were treated with the agonist Wy-14643 for 14 days, and response of conditional null mice was compared with conventional knockout mice (Ppara−/−). Wy-14643 treatment caused weight loss and severe hepatomegaly in wild-type and Ppara△Mac mice, and histological analysis revealed characteristic hepatocyte swelling; Ppara△Hep and Ppara−/− mice were protected from these effects. Ppara△Mac serum chemistries, as well as aspartate aminotransferase and alanine aminotransferase levels, matched wild-type mice. Agonist-treated Ppara△Hep mice had elevated serum cholesterol, phospholipids, and triglycerides when compared with Ppara−/− mice, indicating a possible role for extrahepatic PPARA in regulating circulating lipid levels. BrdU labeling confirmed increased cell proliferation only in wild-type and Ppara△Mac mice. Macrophage PPARA disruption did not impact agonist-induced upregulation of lipid metabolism, cell proliferation, or DNA damage and repair-related gene expression, whereas gene expression was repressed in Ppara△Hep mice. Interestingly, downregulation of inflammatory cytokines IL-15 and IL-18 was dependent on macrophage PPARA. Cell type-specific regulation of target genes was confirmed in primary hepatocytes and Kupffer cells. These studies conclusively show that cell proliferation is mediated exclusively by PPARA activation in hepatocytes and that Kupffer cell PPARA has an important role in mediating the anti-inflammatory effects of PPARA agonists. PMID:28082284

IGHV1-69-Encoded Antibodies Expressed in Chronic Lymphocytic Leukemia React with Malondialdehyde–Acetaldehyde Adduct, an Immunodominant Oxidation-Specific Epitope

PubMed Central

Amir, Shahzada; Hartvigsen, Karsten; Hansen, Lotte F.; Woelkers, Douglas; Tsimikas, Sotirios; Binder, Christoph J.; Kipps, Thomas J.; Witztum, Joseph L.

2013-01-01

The immunoglobulins expressed by chronic lymphocytic leukemia (CLL) B cells are highly restricted, suggesting they are selected for binding either self or foreign antigen. Of the immunoglobulin heavy-chain variable (IGHV) genes expressed in CLL, IGHV1-69 is the most common, and often is expressed with little or no somatic mutation, and restricted IGHD and IGHJ gene usage. We found that antibodies encoded by one particular IGHV1-69 subset, designated CLL69C, with the HCDR3 encoded by the IGHD3-3 gene in reading frame 2 and IGHJ6, specifically bound to oxidation-specific epitopes (OSE), which are products of enhanced lipid peroxidation and a major target of innate natural antibodies. Specifically, CLL69C bound immunodominant OSE adducts termed MAA (malondialdehyde–acetaldehyde-adducts), which are found on apoptotic cells, inflammatory tissues, and atherosclerotic lesions. It also reacted specifically with MAA-specific peptide mimotopes. Light chain shuffling indicated that non-stochastically paired L chain of IGLV3-9 contributes to the antigen binding of CLL69C. A nearly identical CLL69C Ig heavy chain was identified from an MAA-enriched umbilical cord phage displayed Fab library, and a derived Fab with the same HCDR3 rearrangement displayed identical MAA-binding properties. These data support the concept that OSE (MAA-epitopes), which are ubiquitous products of inflammation, may play a role in clonal selection and expansion of CLL B cells. PMID:23840319

Dopaminergic Neuron-Specific Deletion of p53 Gene Attenuates Methamphetamine Neurotoxicity.

PubMed

Lu, Tao; Kim, Paul P; Greig, Nigel H; Luo, Yu

2017-08-01

p53 plays an essential role in the regulation of cell death in dopaminergic (DA) neurons and its activation has been implicated in the neurotoxic effects of methamphetamine (MA). However, how p53 mediates MA neurotoxicity remains largely unknown. In this study, we examined the effect of DA-specific p53 gene deletion in DAT-p53KO mice. Whereas in vivo MA binge exposure reduced locomotor activity in wild-type (WT) mice, this was significantly attenuated in DAT-p53KO mice and associated with significant differences in the levels of the p53 target genes BAX and p21 between WT and DAT-p53KO. Notably, DA-specific deletion of p53 provided protection of substantia nigra pars reticulata (SNpr) tyrosine hydroxylase (TH) positive fibers following binge MA, with DAT-p53KO mice having less decline of TH protein levels in striatum versus WT mice. Whereas DAT-p53KO mice demonstrated a consistently higher density of TH fibers in striatum compared to WT mice at 10 days after MA exposure, DA neuron counts within the substantia nigra pars compacta (SNpc) were similar. Finally, supportive of these results, administration of a p53-specific inhibitor (PFT-α) provided a similarly protective effect on MA binge-induced behavioral deficits. Neither DA specific p53 deletion nor p53 pharmacological inhibition affected hyperthermia induced by MA binge. These findings demonstrate a specific contribution of p53 activation in behavioral deficits and DA neuronal terminal loss by MA binge exposure.

Current concepts on primary open-angle glaucoma genetics: a contribution to disease pathophysiology and future treatment

PubMed Central

Gemenetzi, M; Yang, Y; Lotery, A J

2012-01-01

Glaucoma is a common, complex, heterogenous disease and it constitutes the major cause of irreversible blindness worldwide. Primary open-angle glaucoma (POAG) is the most common type of glaucoma in all populations. Most of the molecular mechanisms leading to POAG development are still unknown. Gene mutations in various populations have been identified by genetic studies and a genetic basis for glaucoma pathogenesis has been established. Linkage analysis and association studies are genetic approaches in the investigation of the genetic basis of POAG. Genome-wide association studies (GWAS) are more powerful compared with linkage analysis in discovering genes of small effect that might contribute to the development of the disease. POAG links to at least 20 genetic loci, but only 2 genes identified in these loci, myocilin and optineurin, are considered as well-established glaucoma-causing genes, whereas the role of other loci, genes, and variants implicated in the development of POAG remains controversial. Gene mutations associated with POAG result in retinal ganglion cell death, which is the common outcome of pathogenetic mechanisms in glaucoma. In future, if the sensitivity and specificity of genotyping increases, it may be possible to screen individuals routinely for disease susceptibility. This review is an update on the latest progress of genetic studies associated with POAG. It emphasizes the correlation of recent achievements in genetics with glaucoma pathophysiology, glaucoma treatment perspectives, and the possibility of future prevention of irreversible visual loss caused by the disease. PMID:22173078

Gossypium barbadense genome sequence provides insight into the evolution of extra-long staple fiber and specialized metabolites.

PubMed

Liu, Xia; Zhao, Bo; Zheng, Hua-Jun; Hu, Yan; Lu, Gang; Yang, Chang-Qing; Chen, Jie-Dan; Chen, Jun-Jian; Chen, Dian-Yang; Zhang, Liang; Zhou, Yan; Wang, Ling-Jian; Guo, Wang-Zhen; Bai, Yu-Lin; Ruan, Ju-Xin; Shangguan, Xiao-Xia; Mao, Ying-Bo; Shan, Chun-Min; Jiang, Jian-Ping; Zhu, Yong-Qiang; Jin, Lei; Kang, Hui; Chen, Shu-Ting; He, Xu-Lin; Wang, Rui; Wang, Yue-Zhu; Chen, Jie; Wang, Li-Jun; Yu, Shu-Ting; Wang, Bi-Yun; Wei, Jia; Song, Si-Chao; Lu, Xin-Yan; Gao, Zheng-Chao; Gu, Wen-Yi; Deng, Xiao; Ma, Dan; Wang, Sen; Liang, Wen-Hua; Fang, Lei; Cai, Cai-Ping; Zhu, Xie-Fei; Zhou, Bao-Liang; Jeffrey Chen, Z; Xu, Shu-Hua; Zhang, Yu-Gao; Wang, Sheng-Yue; Zhang, Tian-Zhen; Zhao, Guo-Ping; Chen, Xiao-Ya

2015-09-30

Of the two cultivated species of allopolyploid cotton, Gossypium barbadense produces extra-long fibers for the production of superior textiles. We sequenced its genome (AD)2 and performed a comparative analysis. We identified three bursts of retrotransposons from 20 million years ago (Mya) and a genome-wide uneven pseudogenization peak at 11-20 Mya, which likely contributed to genomic divergences. Among the 2,483 genes preferentially expressed in fiber, a cell elongation regulator, PRE1, is strikingly At biased and fiber specific, echoing the A-genome origin of spinnable fiber. The expansion of the PRE members implies a genetic factor that underlies fiber elongation. Mature cotton fiber consists of nearly pure cellulose. G. barbadense and G. hirsutum contain 29 and 30 cellulose synthase (CesA) genes, respectively; whereas most of these genes (>25) are expressed in fiber, genes for secondary cell wall biosynthesis exhibited a delayed and higher degree of up-regulation in G. barbadense compared with G. hirsutum, conferring an extended elongation stage and highly active secondary wall deposition during extra-long fiber development. The rapid diversification of sesquiterpene synthase genes in the gossypol pathway exemplifies the chemical diversity of lineage-specific secondary metabolites. The G. barbadense genome advances our understanding of allopolyploidy, which will help improve cotton fiber quality.

Neurotransmitter-based strategies for the treatment of cognitive dysfunction in Down syndrome.

PubMed

Das, Devsmita; Phillips, Cristy; Hsieh, Wayne; Sumanth, Krithika; Dang, Van; Salehi, Ahmad

2014-10-03

Down syndrome (DS) is a multisystem disorder affecting the cardiovascular, respiratory, gastrointestinal, neurological, hematopoietic, and musculoskeletal systems and is characterized by significant cognitive disability and a possible common pathogenic mechanism with Alzheimer's disease. During the last decade, numerous studies have supported the notion that the triplication of specific genes on human chromosome 21 plays a significant role in cognitive dysfunction in DS. Here we reviewed studies in trisomic mouse models and humans, including children and adults with DS. In order to identify groups of genes that contribute to cognitive disability in DS, multiple mouse models of DS with segmental trisomy have been generated. Over-expression of these particular genes in DS can lead to dysfunction of several neurotransmitter systems. Therapeutic strategies for DS have either focused on normalizing the expression of triplicated genes with important roles in DS or restoring the function of these systems. Indeed, our extensive review of studies on the pathogenesis of DS suggests that one plausible strategy for the treatment of cognitive dysfunction is to target the cholinergic, serotonergic, GABA-ergic, glutamatergic, and norepinephrinergic system. However, a fundamental strategy for treatment of cognitive dysfunction in DS would include reducing to normal levels the expression of specific triplicated genes in affected systems before the onset of neurodegeneration. Published by Elsevier Inc.

Detection of human fecal contamination by nifH gene quantification of marine waters in the coastal beaches of Rio de Janeiro, Brazil.

PubMed

Oliveira, Samara Sant'Anna; Sorgine, Marcos Henrique Ferreira; Bianco, Kayo; Pinto, Leonardo Henriques; Barreto, Camila; Albano, Rodolpho Mattos; Cardoso, Alexander Machado; Clementino, Maysa Mandetta

2016-12-01

The identification of fecal pollution in aquatic ecosystems is one of the requirements to assess the possible risks to human health. In this report, physicochemical parameters, Escherichia coli enumeration and Methanobrevibacter smithii nifH gene quantification were conducted at 13 marine waters in the coastal beaches of Rio de Janeiro, Brazil. The pH, turbidity, dissolved oxygen, temperature, and conductivity, carried out by mobile equipment, revealed varied levels due to specific conditions of the beaches. The bioindicators' enumerations were done by defined substrate method, conventional, and real-time PCR. Six marine beach sites (46 %) presenting E. coli levels in compliance with Brazilian water quality guidelines (<2500 MPN/100 mL) showed nifH gene between 5.7 × 10 9 to 9.5 × 10 11 copies. L -1 revealing poor correlation between the two approaches. To our knowledge, this is the first inquiry in qPCR using nifH gene as a biomarker of human-specific sources of sewage pollution in marine waters in Brazil. In addition, our data suggests that alternative indicator nifH gene could be used, in combination with other markers, for source tracking studies to measure the quality of marine ecosystems thereby contributing to improved microbial risk assessment.

Integrated metagenomic analysis of the rumen microbiome of cattle reveals key biological mechanisms associated with methane traits.

PubMed

Wang, Haiying; Zheng, Huiru; Browne, Fiona; Roehe, Rainer; Dewhurst, Richard J; Engel, Felix; Hemmje, Matthias; Lu, Xiangwu; Walsh, Paul

2017-07-15

Methane is one of the major contributors to global warming. The rumen microbiota is directly involved in methane production in cattle. The link between variation in rumen microbial communities and host genetics has important applications and implications in bioscience. Having the potential to reveal the full extent of microbial gene diversity and complex microbial interactions, integrated metagenomics and network analysis holds great promise in this endeavour. This study investigates the rumen microbial community in cattle through the integration of metagenomic and network-based approaches. Based on the relative abundance of 1570 microbial genes identified in a metagenomics analysis, the co-abundance network was constructed and functional modules of microbial genes were identified. One of the main contributions is to develop a random matrix theory-based approach to automatically determining the correlation threshold used to construct the co-abundance network. The resulting network, consisting of 549 microbial genes and 3349 connections, exhibits a clear modular structure with certain trait-specific genes highly over-represented in modules. More specifically, all the 20 genes previously identified to be associated with methane emissions are found in a module (hypergeometric test, p<10 -11 ). One third of genes are involved in methane metabolism pathways. The further examination of abundance profiles across 8 samples of genes highlights that the revealed pattern of metagenomics abundance has a strong association with methane emissions. Furthermore, the module is significantly enriched with microbial genes encoding enzymes that are directly involved in methanogenesis (hypergeometric test, p<10 -9 ). Copyright © 2017 Elsevier Inc. All rights reserved.

Hypervariable and highly divergent intron-exon organizations in the chordate Oikopleura dioica.

PubMed

Edvardsen, Rolf B; Lerat, Emmanuelle; Maeland, Anne Dorthea; Flåt, Mette; Tewari, Rita; Jensen, Marit F; Lehrach, Hans; Reinhardt, Richard; Seo, Hee-Chan; Chourrout, Daniel

2004-10-01

Oikopleura dioica is a pelagic tunicate with a very small genome and a very short life cycle. In order to investigate the intron-exon organizations in Oikopleura, we have isolated and characterized ribosomal protein EF-1alpha, Hox, and alpha-tubulin genes. Their intron positions have been compared with those of the same genes from various invertebrates and vertebrates, including four species with entirely sequenced genomes. Oikopleura genes, like Caenorhabditis genes, have introns at a large number of nonconserved positions, which must originate from late insertions or intron sliding of ancient insertions. Both species exhibit hypervariable intron-exon organization within their alpha-tubulin gene family. This is due to localization of most nonconserved intron positions in single members of this gene family. The hypervariability and divergence of intron positions in Oikopleura and Caenorhabditis may be related to the predominance of short introns, the processing of which is not very dependent upon the exonic environment compared to large introns. Also, both species have an undermethylated genome, and the control of methylation-induced point mutations imposes a control on exon size, at least in vertebrate genes. That introns placed at such variable positions in Oikopleura or C. elegans may serve a specific purpose is not easy to infer from our current knowledge and hypotheses on intron functions. We propose that new introns are retained in species with very short life cycles, because illegitimate exchanges including gene conversion are repressed. We also speculate that introns placed at gene-specific positions may contribute to suppressing these exchanges and thereby favor their own persistence.

Implication of common and disease specific variants in CLU, CR1, and PICALM.

PubMed

Ferrari, Raffaele; Moreno, Jorge H; Minhajuddin, Abu T; O'Bryant, Sid E; Reisch, Joan S; Barber, Robert C; Momeni, Parastoo

2012-08-01

Two recent genome-wide association studies (GWAS) for late onset Alzheimer's disease (LOAD) revealed 3 new genes: clusterin (CLU), phosphatidylinositol binding clathrin assembly protein (PICALM), and complement receptor 1 (CR1). In order to evaluate association with these genome-wide association study-identified genes and to isolate the variants contributing to the pathogenesis of LOAD, we genotyped the top single nucleotide polymorphisms (SNPs), rs11136000 (CLU), rs3818361 (CR1), and rs3851179 (PICALM), and sequenced the entire coding regions of these genes in our cohort of 342 LOAD patients and 277 control subjects. We confirmed the association of rs3851179 (PICALM) (p = 7.4 × 10(-3)) with the disease status. Through sequencing we identified 18 variants in CLU, 3 of which were found exclusively in patients; 8 variants (out of 65) in CR1 gene were only found in patients and the 16 variants identified in PICALM gene were present in both patients and controls. In silico analysis of the variants in PICALM did not predict any damaging effect on the protein. The haplotype analysis of the variants in each gene predicted a common haplotype when the 3 single nucleotide polymorphisms rs11136000 (CLU), rs3818361 (CR1), and rs3851179 (PICALM), respectively, were included. For each gene the haplotype structure and size differed between patients and controls. In conclusion, we confirmed association of CLU, CR1, and PICALM genes with the disease status in our cohort through identification of a number of disease-specific variants among patients through the sequencing of the coding region of these genes. Published by Elsevier Inc.

Comparative transcriptional analysis provides new insights into the molecular basis of adventitious rooting recalcitrance in Eucalyptus.

PubMed

de Almeida, Márcia Rodrigues; de Bastiani, Daniela; Gaeta, Marcos Letaif; de Araújo Mariath, Jorge Ernesto; de Costa, Fernanda; Retallick, Jeffrey; Nolan, Lana; Tai, Helen H; Strömvik, Martina V; Fett-Neto, Arthur Germano

2015-10-01

Adventitious rooting (AR) is essential in clonal propagation. Eucalyptus globulus is relevant for the cellulose industry due to its low lignin content. However, several useful clones are recalcitrant to AR, often requiring exogenous auxin, adding cost to clonal garden operations. In contrast, E. grandis is an easy-to-root species widely used in clonal forestry. Aiming at contributing to the elucidation of recalcitrance causes in E. globulus, we conducted a comparative analysis with these two species differing in rooting competence, combining gene expression and anatomical techniques. Recalcitrance in E. globulus is reversed by exposure to exogenous indole-3-acetic acid (IAA), which promotes important gene expression modifications in both species. The endogenous content of IAA was significantly higher in E. grandis than in E. globulus. The cambium zone was identified as an active area during AR, concentrating the first cell divisions. Immunolocalization assay showed auxin accumulation in cambium cells, further indicating the importance of this region for rooting. We then performed a cambium zone-specific gene expression analysis during AR using laser microdissection. The results indicated that the auxin-related genes TOPLESS and IAA12/BODENLOS and the cytokinin-related gene ARR1may act as negative regulators of AR, possibly contributing to the hard-to-root phenotype of E. globulus. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Cross-species functional analysis of cancer-associated fibroblasts identifies a critical role for CLCF1 and IL6 in non-small cell lung cancer in vivo

PubMed Central

Vicent, Silvestre; Sayles, Leanne C.; Vaka, Dedeepya; Khatri, Purvesh; Gevaert, Olivier; Chen, Ron; Zheng, Yanyan; Gillespie, Anna K.; Clarke, Nicole; Xu, Yue; Shrager, Joseph; Hoang, Chuong D.; Plevritis, Sylvia; Butte, Atul J.; Sweet-Cordero, E. Alejandro

2013-01-01

Cancer-associated fibroblasts (CAFs) have been reported to support tumor progression by a variety of mechanisms. However, their role in the progression of non-small cell lung cancer (NSCLC) remains poorly defined. In addition, the extent to which specific proteins secreted by CAFs contribute directly to tumor growth is unclear. To study the role of CAFs in NSCLC, a cross-species functional characterization of mouse and human lung CAFs was performed. CAFs supported the growth of lung cancer cells in vivo by secretion of soluble factors that directly stimulate the growth of tumor cells. Gene expression analysis comparing normal mouse lung fibroblasts (NFs) and mouse lung CAFs identified multiple genes that correlate with the CAF phenotype. A gene signature of secreted genes upregulated in CAFs was an independent marker of poor survival in NSCLC patients. This secreted gene signature was upregulated in NFs after long-term exposure to tumor cells, demonstrating that NFs are “educated” by tumor cells to acquire a CAF-like phenotype. Functional studies identified important roles for CLCF1-CNTFR and IL6-IL6R signaling, in promoting growth of NSCLC cells. This study identifies novel soluble factors contributing to the CAF protumorigenic phenotype in NSCLC and suggests new avenues for the development of therapeutic strategies. PMID:22962265

Environmental and genetic modulation of the phenotypic expression of antibiotic resistance

PubMed Central

Andersson, Dan I

2017-01-01

Abstract Antibiotic resistance can be acquired by mutation or horizontal transfer of a resistance gene, and generally an acquired mechanism results in a predictable increase in phenotypic resistance. However, recent findings suggest that the environment and/or the genetic context can modify the phenotypic expression of specific resistance genes/mutations. An important implication from these findings is that a given genotype does not always result in the expected phenotype. This dissociation of genotype and phenotype has important consequences for clinical bacteriology and for our ability to predict resistance phenotypes from genetics and DNA sequences. A related problem concerns the degree to which the genes/mutations currently identified in vitro can fully explain the in vivo resistance phenotype, or whether there is a significant additional amount of presently unknown mutations/genes (genetic ‘dark matter’) that could contribute to resistance in clinical isolates. Finally, a very important question is whether/how we can identify the genetic features that contribute to making a successful pathogen, and predict why some resistant clones are very successful and spread globally? In this review, we describe different environmental and genetic factors that influence phenotypic expression of antibiotic resistance genes/mutations and how this information is needed to understand why particular resistant clones spread worldwide and to what extent we can use DNA sequences to predict evolutionary success. PMID:28333270

Revealing New Mouse Epicardial Cell Markers through Transcriptomics

PubMed Central

Bochmann, Lars; Sarathchandra, Padmini; Mori, Federica; Lara-Pezzi, Enrique; Lazzaro, Domenico; Rosenthal, Nadia

2010-01-01

Background The epicardium has key functions during myocardial development, by contributing to the formation of coronary endothelial and smooth muscle cells, cardiac fibroblasts, and potentially cardiomyocytes. The epicardium plays a morphogenetic role by emitting signals to promote and maintain cardiomyocyte proliferation. In a regenerative context, the adult epicardium might comprise a progenitor cell population that can be induced to contribute to cardiac repair. Although some genes involved in epicardial function have been identified, a detailed molecular profile of epicardial gene expression has not been available. Methodology Using laser capture microscopy, we isolated the epicardial layer from the adult murine heart before or after cardiac infarction in wildtype mice and mice expressing a transgenic IGF-1 propeptide (mIGF-1) that enhances cardiac repair, and analyzed the transcription profile using DNA microarrays. Principal Findings Expression of epithelial genes such as basonuclin, dermokine, and glycoprotein M6A are highly enriched in the epicardial layer, which maintains expression of selected embryonic genes involved in epicardial development in mIGF-1 transgenic hearts. After myocardial infarct, a subset of differentially expressed genes are down-regulated in the epicardium representing an epicardium-specific signature that responds to injury. Conclusion This study presents the description of the murine epicardial transcriptome obtained from snap frozen tissues, providing essential information for further analysis of this important cardiac cell layer. PMID:20596535

Flower development and sex specification in wild grapevine.

PubMed

Ramos, Miguel Jesus Nunes; Coito, João Lucas; Silva, Helena Gomes; Cunha, Jorge; Costa, Maria Manuela Ribeiro; Rocheta, Margarida

2014-12-12

Wild plants of Vitis closely related to the cultivated grapevine (V. v. vinifera) are believed to have been first domesticated 10,000 years BC around the Caspian Sea. V. v. vinifera is hermaphrodite whereas V. v. sylvestris is a dioecious species. Male flowers show a reduced pistil without style or stigma and female flowers present reflexed stamens with infertile pollen. V. vinifera produce perfect flowers with all functional structures. The mechanism for flower sex determination and specification in grapevine is still unknown. To understand which genes are involved during the establishment of male, female and complete flowers, we analysed and compared the transcription profiles of four developmental stages of the three genders. We showed that sex determination is a late event during flower development and that the expression of genes from the ABCDE model is not directly correlated with the establishment of sexual dimorphism. We propose a temporal comprehensive model in which two mutations in two linked genes could be players in sex determination and indirectly establish the Vitis domestication process. Additionally, we also found clusters of genes differentially expressed between genders and between developmental stages that suggest a role involved in sex differentiation. Also, the detection of differentially transcribed regions that extended existing gene models (intergenic regions) between sexes suggests that they may account for some of the variation between the subspecies. There is no evidence of differences of expression levels in genes from the ABCDE model that could explain the shift from hermaphroditism to dioecy. We propose that sex specification occurs after floral organ identity has been established and therefore, sex determination genes might be having an effect downstream of the ABCDE model genes.For the first time a full transcriptomic analysis was performed in different flower developmental stages in the same individual. Our experimental approach enabled us to create a comprehensive catalogue of transcribed genes across developmental stages and genders that will contribute for future work in sex determination in seed plants.

Gene expression profiling following NRF2 and KEAP1 siRNA knockdown in human lung fibroblasts identifies CCL11/Eotaxin-1 as a novel NRF2 regulated gene

PubMed Central

2012-01-01

Background Oxidative Stress contributes to the pathogenesis of many diseases. The NRF2/KEAP1 axis is a key transcriptional regulator of the anti-oxidant response in cells. Nrf2 knockout mice have implicated this pathway in regulating inflammatory airway diseases such as asthma and COPD. To better understand the role the NRF2 pathway has on respiratory disease we have taken a novel approach to define NRF2 dependent gene expression in a relevant lung system. Methods Normal human lung fibroblasts were transfected with siRNA specific for NRF2 or KEAP1. Gene expression changes were measured at 30 and 48 hours using a custom Affymetrix Gene array. Changes in Eotaxin-1 gene expression and protein secretion were further measured under various inflammatory conditions with siRNAs and pharmacological tools. Results An anti-correlated gene set (inversely regulated by NRF2 and KEAP1 RNAi) that reflects specific NRF2 regulated genes was identified. Gene annotations show that NRF2-mediated oxidative stress response is the most significantly regulated pathway, followed by heme metabolism, metabolism of xenobiotics by Cytochrome P450 and O-glycan biosynthesis. Unexpectedly the key eosinophil chemokine Eotaxin-1/CCL11 was found to be up-regulated when NRF2 was inhibited and down-regulated when KEAP1 was inhibited. This transcriptional regulation leads to modulation of Eotaxin-1 secretion from human lung fibroblasts under basal and inflammatory conditions, and is specific to Eotaxin-1 as NRF2 or KEAP1 knockdown had no effect on the secretion of a set of other chemokines and cytokines. Furthermore, the known NRF2 small molecule activators CDDO and Sulphoraphane can also dose dependently inhibit Eotaxin-1 release from human lung fibroblasts. Conclusions These data uncover a previously unknown role for NRF2 in regulating Eotaxin-1 expression and further the mechanistic understanding of this pathway in modulating inflammatory lung disease. PMID:23061798

Gene expression profiling following NRF2 and KEAP1 siRNA knockdown in human lung fibroblasts identifies CCL11/Eotaxin-1 as a novel NRF2 regulated gene.

PubMed

Fourtounis, Jimmy; Wang, I-Ming; Mathieu, Marie-Claude; Claveau, David; Loo, Tenneille; Jackson, Aimee L; Peters, Mette A; Therien, Alex G; Boie, Yves; Crackower, Michael A

2012-10-12

Oxidative Stress contributes to the pathogenesis of many diseases. The NRF2/KEAP1 axis is a key transcriptional regulator of the anti-oxidant response in cells. Nrf2 knockout mice have implicated this pathway in regulating inflammatory airway diseases such as asthma and COPD. To better understand the role the NRF2 pathway has on respiratory disease we have taken a novel approach to define NRF2 dependent gene expression in a relevant lung system. Normal human lung fibroblasts were transfected with siRNA specific for NRF2 or KEAP1. Gene expression changes were measured at 30 and 48 hours using a custom Affymetrix Gene array. Changes in Eotaxin-1 gene expression and protein secretion were further measured under various inflammatory conditions with siRNAs and pharmacological tools. An anti-correlated gene set (inversely regulated by NRF2 and KEAP1 RNAi) that reflects specific NRF2 regulated genes was identified. Gene annotations show that NRF2-mediated oxidative stress response is the most significantly regulated pathway, followed by heme metabolism, metabolism of xenobiotics by Cytochrome P450 and O-glycan biosynthesis. Unexpectedly the key eosinophil chemokine Eotaxin-1/CCL11 was found to be up-regulated when NRF2 was inhibited and down-regulated when KEAP1 was inhibited. This transcriptional regulation leads to modulation of Eotaxin-1 secretion from human lung fibroblasts under basal and inflammatory conditions, and is specific to Eotaxin-1 as NRF2 or KEAP1 knockdown had no effect on the secretion of a set of other chemokines and cytokines. Furthermore, the known NRF2 small molecule activators CDDO and Sulphoraphane can also dose dependently inhibit Eotaxin-1 release from human lung fibroblasts. These data uncover a previously unknown role for NRF2 in regulating Eotaxin-1 expression and further the mechanistic understanding of this pathway in modulating inflammatory lung disease.

A whole blood gene expression-based signature for smoking status

PubMed Central

2012-01-01

Background Smoking is the leading cause of preventable death worldwide and has been shown to increase the risk of multiple diseases including coronary artery disease (CAD). We sought to identify genes whose levels of expression in whole blood correlate with self-reported smoking status. Methods Microarrays were used to identify gene expression changes in whole blood which correlated with self-reported smoking status; a set of significant genes from the microarray analysis were validated by qRT-PCR in an independent set of subjects. Stepwise forward logistic regression was performed using the qRT-PCR data to create a predictive model whose performance was validated in an independent set of subjects and compared to cotinine, a nicotine metabolite. Results Microarray analysis of whole blood RNA from 209 PREDICT subjects (41 current smokers, 4 quit ≤ 2 months, 64 quit > 2 months, 100 never smoked; NCT00500617) identified 4214 genes significantly correlated with self-reported smoking status. qRT-PCR was performed on 1,071 PREDICT subjects across 256 microarray genes significantly correlated with smoking or CAD. A five gene (CLDND1, LRRN3, MUC1, GOPC, LEF1) predictive model, derived from the qRT-PCR data using stepwise forward logistic regression, had a cross-validated mean AUC of 0.93 (sensitivity=0.78; specificity=0.95), and was validated using 180 independent PREDICT subjects (AUC=0.82, CI 0.69-0.94; sensitivity=0.63; specificity=0.94). Plasma from the 180 validation subjects was used to assess levels of cotinine; a model using a threshold of 10 ng/ml cotinine resulted in an AUC of 0.89 (CI 0.81-0.97; sensitivity=0.81; specificity=0.97; kappa with expression model = 0.53). Conclusion We have constructed and validated a whole blood gene expression score for the evaluation of smoking status, demonstrating that clinical and environmental factors contributing to cardiovascular disease risk can be assessed by gene expression. PMID:23210427

Gene trapping in differentiating cell lines: regulation of the lysosomal protease cathepsin B in skeletal myoblast growth and fusion.

PubMed

Gogos, J A; Thompson, R; Lowry, W; Sloane, B F; Weintraub, H; Horwitz, M

1996-08-01

To identify genes regulated during skeletal muscle differentiation, we have infected mouse C2C12 myoblasts with retroviral gene trap vectors, containing a promoterless marker gene with a 5' splice acceptor signal. Integration of the vector adjacent to an actively transcribed gene places the marker under the transcriptional control of the endogenous gene, while the adjacent vector sequences facilitate cloning. The vector insertionally mutates the trapped locus and may also form fusion proteins with the endogenous gene product. We have screened several hundred clones, each containing a trapping vector integrated into a different endogenous gene. In agreement with previous estimates based on hybridization kinetics, we find that a large proportion of all genes expressed in myoblasts are regulated during differentiation. Many of these genes undergo unique temporal patterns of activation or repression during cell growth and myotube formation, and some show specific patterns of subcellular localization. The first gene we have identified with this strategy is the lysosomal cysteine protease cathepsin B. Expression from the trapped allele is upregulated during early myoblast fusion and downregulated in myotubes. A direct role for cathepsin B in myoblast growth and fusion is suggested by the observation that the trapped cells deficient in cathepsin B activity have an unusual morphology and reduced survival in low-serum media and undergo differentiation with impaired cellular fusion. The phenotype is reproduced by antisense cathepsin B expression in parental C2C12 myoblasts. The cellular phenotype is similar to that observed in cultured myoblasts from patients with I cell disease, in which there is diminished accumulation of lysosomal enzymes. This suggests that a specific deficiency of cathepsin B could contribute to the myopathic component of this illness.

tRNAomics: tRNA gene copy number variation and codon use provide bioinformatic evidence of a new anticodon:codon wobble pair in a eukaryote

PubMed Central

Iben, James R.; Maraia, Richard J.

2012-01-01

tRNA genes are interspersed throughout eukaryotic DNA, contributing to genome architecture and evolution in addition to translation of the transcriptome. Codon use correlates with tRNA gene copy number in noncomplex organisms including yeasts. Synonymous codons impact translation with various outcomes, dependent on relative tRNA abundances. Availability of whole-genome sequences allowed us to examine tRNA gene copy number variation (tgCNV) and codon use in four Schizosaccharomyces species and Saccharomyces cerevisiae. tRNA gene numbers vary from 171 to 322 in the four Schizosaccharomyces despite very high similarity in other features of their genomes. In addition, we performed whole-genome sequencing of several related laboratory strains of Schizosaccharomyces pombe and found tgCNV at a cluster of tRNA genes. We examined for the first time effects of wobble rules on correlation of tRNA gene number and codon use and showed improvement for S. cerevisiae and three of the Schizosaccharomyces species. In contrast, correlation in Schizosaccharomyces japonicus is poor due to markedly divergent tRNA gene content, and much worsened by the wobble rules. In japonicus, some tRNA iso-acceptor genes are absent and others are greatly reduced relative to the other yeasts, while genes for synonymous wobble iso-acceptors are amplified, indicating wobble use not apparent in any other eukaryote. We identified a subset of japonicus-specific wobbles that improves correlation of codon use and tRNA gene content in japonicus. We conclude that tgCNV is high among Schizo species and occurs in related laboratory strains of S. pombe (and expectedly other species), and tRNAome-codon analyses can provide insight into species-specific wobble decoding. PMID:22586155

Exome sequencing and arrayCGH detection of gene sequence and copy number variation between ILS and ISS mouse strains.

PubMed

Dumas, Laura; Dickens, C Michael; Anderson, Nathan; Davis, Jonathan; Bennett, Beth; Radcliffe, Richard A; Sikela, James M

2014-06-01

It has been well documented that genetic factors can influence predisposition to develop alcoholism. While the underlying genomic changes may be of several types, two of the most common and disease associated are copy number variations (CNVs) and sequence alterations of protein coding regions. The goal of this study was to identify CNVs and single-nucleotide polymorphisms that occur in gene coding regions that may play a role in influencing the risk of an individual developing alcoholism. Toward this end, two mouse strains were used that have been selectively bred based on their differential sensitivity to alcohol: the Inbred long sleep (ILS) and Inbred short sleep (ISS) mouse strains. Differences in initial response to alcohol have been linked to risk for alcoholism, and the ILS/ISS strains are used to investigate the genetics of initial sensitivity to alcohol. Array comparative genomic hybridization (arrayCGH) and exome sequencing were conducted to identify CNVs and gene coding sequence differences, respectively, between ILS and ISS mice. Mouse arrayCGH was performed using catalog Agilent 1 × 244 k mouse arrays. Subsequently, exome sequencing was carried out using an Illumina HiSeq 2000 instrument. ArrayCGH detected 74 CNVs that were strain-specific (38 ILS/36 ISS), including several ISS-specific deletions that contained genes implicated in brain function and neurotransmitter release. Among several interesting coding variations detected by exome sequencing was the gain of a premature stop codon in the alpha-amylase 2B (AMY2B) gene specifically in the ILS strain. In total, exome sequencing detected 2,597 and 1,768 strain-specific exonic gene variants in the ILS and ISS mice, respectively. This study represents the most comprehensive and detailed genomic comparison of ILS and ISS mouse strains to date. The two complementary genome-wide approaches identified strain-specific CNVs and gene coding sequence variations that should provide strong candidates to contribute to the alcohol-related phenotypic differences associated with these strains.

Characterization of Heterobasidion occidentale transcriptomes reveals candidate genes and DNA polymorphisms for virulence variations.

PubMed

Liu, Jun-Jun; Shamoun, Simon Francis; Leal, Isabel; Kowbel, Robert; Sumampong, Grace; Zamany, Arezoo

2018-05-01

Characterization of genes involved in differentiation of pathogen species and isolates with variations of virulence traits provides valuable information to control tree diseases for meeting the challenges of sustainable forest health and phytosanitary trade issues. Lack of genetic knowledge and genomic resources hinders novel gene discovery, molecular mechanism studies and development of diagnostic tools in the management of forest pathogens. Here, we report on transcriptome profiling of Heterobasidion occidentale isolates with contrasting virulence levels. Comparative transcriptomic analysis identified orthologous groups exclusive to H. occidentale and its isolates, revealing biological processes involved in the differentiation of isolates. Further bioinformatics analyses identified an H. occidentale secretome, CYPome and other candidate effectors, from which genes with species- and isolate-specific expression were characterized. A large proportion of differentially expressed genes were revealed to have putative activities as cell wall modification enzymes and transcription factors, suggesting their potential roles in virulence and fungal pathogenesis. Next, large numbers of simple sequence repeats (SSRs) and single nucleotide polymorphisms (SNPs) were detected, including more than 14 000 interisolate non-synonymous SNPs. These polymorphic loci and species/isolate-specific genes may contribute to virulence variations and provide ideal DNA markers for development of diagnostic tools and investigation of genetic diversity. © 2018 The Authors. Microbial Biotechnology published by John Wiley & Sons Ltd and Society for Applied Microbiology.

Bombyx mori E26 transformation-specific 2 (BmEts2), an Ets family protein, represses Bombyx mori Rels (BmRels)-mediated promoter activation of antimicrobial peptide genes in the silkworm Bombyx mori.

PubMed

Tanaka, H; Sagisaka, A; Suzuki, N; Yamakawa, M

2016-10-01

E26 transformation-specific (Ets) family transcription factors are known to play roles in various biological phenomena, including immunity, in vertebrates. However, the mechanisms by which Ets proteins contribute to immunity in invertebrates remain poorly understood. In this study, we identified a cDNA encoding BmEts2, which is a putative orthologue of Drosophila Yan and human translocation-ets-leukemia/Ets-variant gene 6, from the silkworm Bombyx mori. Expression of the BmEts2 gene was significantly increased in the fat bodies of silkworm larvae in response to injection with Escherichia coli and Staphylococcus aureus. BmEts2 overexpression dramatically repressed B. mori Rels (BmRels)-mediated promoter activation of antimicrobial peptide genes in silkworm cells. Conversely, gene knockdown of BmEts2 significantly enhanced BmRels activity. In addition, two κB sites located on the 5' upstream region of cecropin B1 were found to be involved in the repression of BmRels-mediated promoter activation. Protein-competition analysis further demonstrated that BmEts2 competitively inhibited binding of BmRels to κB sites. Overall, BmEts2 acts as a repressor of BmRels-mediated transactivation of antimicrobial protein genes by inhibiting the binding of BmRels to κB sites. © 2016 The Royal Entomological Society.

The Tarenaya hassleriana Genome Provides Insight into Reproductive Trait and Genome Evolution of Crucifers[W][OPEN

PubMed Central

Cheng, Shifeng; van den Bergh, Erik; Zeng, Peng; Zhong, Xiao; Xu, Jiajia; Liu, Xin; Hofberger, Johannes; de Bruijn, Suzanne; Bhide, Amey S.; Kuelahoglu, Canan; Bian, Chao; Chen, Jing; Fan, Guangyi; Kaufmann, Kerstin; Hall, Jocelyn C.; Becker, Annette; Bräutigam, Andrea; Weber, Andreas P.M.; Shi, Chengcheng; Zheng, Zhijun; Li, Wujiao; Lv, Mingju; Tao, Yimin; Wang, Junyi; Zou, Hongfeng; Quan, Zhiwu; Hibberd, Julian M.; Zhang, Gengyun; Zhu, Xin-Guang; Xu, Xun; Schranz, M. Eric

2013-01-01

The Brassicaceae, including Arabidopsis thaliana and Brassica crops, is unmatched among plants in its wealth of genomic and functional molecular data and has long served as a model for understanding gene, genome, and trait evolution. However, genome information from a phylogenetic outgroup that is essential for inferring directionality of evolutionary change has been lacking. We therefore sequenced the genome of the spider flower (Tarenaya hassleriana) from the Brassicaceae sister family, the Cleomaceae. By comparative analysis of the two lineages, we show that genome evolution following ancient polyploidy and gene duplication events affect reproductively important traits. We found an ancient genome triplication in Tarenaya (Th-α) that is independent of the Brassicaceae-specific duplication (At-α) and nested Brassica (Br-α) triplication. To showcase the potential of sister lineage genome analysis, we investigated the state of floral developmental genes and show Brassica retains twice as many floral MADS (for MINICHROMOSOME MAINTENANCE1, AGAMOUS, DEFICIENS and SERUM RESPONSE FACTOR) genes as Tarenaya that likely contribute to morphological diversity in Brassica. We also performed synteny analysis of gene families that confer self-incompatibility in Brassicaceae and found that the critical SERINE RECEPTOR KINASE receptor gene is derived from a lineage-specific tandem duplication. The T. hassleriana genome will facilitate future research toward elucidating the evolutionary history of Brassicaceae genomes. PMID:23983221

B-BOX genes: genome-wide identification, evolution and their contribution to pollen growth in pear (Pyrus bretschneideri Rehd.).

PubMed

Cao, Yunpeng; Han, Yahui; Meng, Dandan; Li, Dahui; Jiao, Chunyan; Jin, Qing; Lin, Yi; Cai, Yongping

2017-09-19

The B-BOX (BBX) proteins have important functions in regulating plant growth and development. In plants, the BBX gene family has been identified in several plants, such as rice, Arabidopsis and tomato. However, there still lack a genome-wide survey of BBX genes in pear. In the present study, a total of 25 BBX genes were identified in pear (Pyrus bretschneideri Rehd.). Subsequently, phylogenetic relationship, gene structure, gene duplication, transcriptome data and qRT-PCR were conducted on these BBX gene members. The transcript analysis revealed that twelve PbBBX genes (48%) were specifically expressed in pear pollen tubes. Furthermore, qRT-PCR analysis indicated that both PbBBX4 and PbBBX13 have potential role in pear fruit development, while PbBBX5 should be involved in the senescence of pear pollen tube. This study provided a genome-wide survey of BBX gene family in pear, and highlighted its roles in both pear fruits and pollen tubes. The results will be useful in improving our understanding of the complexity of BBX gene family and functional characteristics of its members in future study.

Genetic and epigenetic contributions to the cortical phenotype in mammals☆

PubMed Central

Larsen, DeLaine D.; Krubitzer, Leah

2008-01-01

One aspect of cortical organization, cortical field size, is variable both within and across species. The observed variability arises from a variety of sources, including genes intrinsic to the neocortex and a number of extrinsic and epigenetic factors. Genes intrinsic to the cortex are directly involved in the development and specification of cortical fields and are regulated from both signaling centers located outside of the neocortex, which secrete diffusible molecules, and the expression of transcription factors within the neocortex. In addition, extrinsic factors such as the type, location and density of sensory receptor arrays and how these receptor arrays are utilized, are also strongly related to cortical field size. Epigenetic factors including the relative activity patterns generated by the different types of physical stimuli in a given environment also contribute to differences in cortical organization, including cortical field size. Since both genetic and epigenetic factors contribute to cortical organization, some aspects of the cortical phenotype evolve, while other aspects of the cortical phenotype persist only if the environment in which an individual develops is relatively stable. PMID:18331904